International Nuclear Information System (INIS)
Low, M.G.; Prasad, A.R.S.
1988-01-01
An enzyme activity capable of degrading the glycosyl-phosphatidylinositol membrane anchor of cell-surface proteins has previously been reported in a number of mammalian tissues. The experiments reported here demonstrate that this anchor-degrading activity is also abundant in mammalian plasma. The activity was inhibited by EGTA or 1,10-phenanthroline. It was capable of removing the anchor from alkaline phosphatase, 5'-nucleotidase, and variant surface glycoprotein but had little or no activity toward phosphatidylinositol or phosphatidylcholine. Phosphatidic acid was the only 3 H-labeled product when this enzyme hydrolyzed [ 3 H]myristate-labeled variant surface glycoprotein. It could be distinguished from the Ca 2 =-dependent inositol phospholipid-specific phospholipase C activity in several rat tissues on the basis of its molecular size and its sensitivity to 1,10-phenanthroline. The data therefore suggest that this activity is due to a phospholipase D with specificity for glycosylphosphatidylinositol structures. Although the precise physiological function of this anchor-specific phospholipase D remains to be determined, these findings indicate that it could play an important role in regulating the expression and release of cell-surface proteins in vivo
Abd-El-Haliem, Ahmed; Vossen, J.H.; Zeijl, van Arjan; Dezhsetan, Sara; Testerink, Christa; Seidl, M.F.; Beck, Martina; Strutt, James; Robatzek, Silke; Joosten, M.H.A.J.
2016-01-01
Plants possess effective mechanisms to quickly respond to biotic and abiotic stresses. The rapid activation of phosphatidylinositol-specific phospholipase C (PLC) enzymes occurs early after the stimulation of plant immune-receptors. Genomes of different plant species encode multiple PLC homologs
Energy Technology Data Exchange (ETDEWEB)
Shi, X.; Shao, C; Zhang, X; Zambonelli, C; Redfield, A; Head, J; Seaton, B; Roberts, M
2009-01-01
Cleavage of phosphatidylinositol (PI) to inositol 1,2-(cyclic)-phosphate (cIP) and cIP hydrolysis to inositol 1-phosphate by Bacillus thuringiensis phosphatidylinositol-specific phospholipase C are activated by the enzyme binding to phosphatidylcholine (PC) surfaces. Part of this reflects improved binding of the protein to interfaces. However, crystallographic analysis of an interfacially impaired phosphatidylinositol-specific phospholipase (W47A/W242A) suggested protein dimerization might occur on the membrane. In the W47A/W242A dimer, four tyrosine residues from one monomer interact with the same tyrosine cluster of the other, forming a tight dimer interface close to the membrane binding regions. We have constructed mutant proteins in which two or more of these tyrosine residues have been replaced with serine. Phospholipid binding and enzymatic activity of these mutants have been examined to assess the importance of these residues to enzyme function. Replacing two tyrosines had small effects on enzyme activity. However, removal of three or four tyrosine residues weakened PC binding and reduced PI cleavage by the enzyme as well as PC activation of cIP hydrolysis. Crystal structures of Y247S/Y251S in the absence and presence of myo-inositol as well as Y246S/Y247S/Y248S/Y251S indicate that both mutant proteins crystallized as monomers, were very similar to one another, and had no change in the active site region. Kinetic assays, lipid binding, and structural results indicate that either (i) a specific PC binding site, critical for vesicle activities and cIP activation, has been impaired, or (ii) the reduced dimerization potential for Y246S/Y247S/Y248S and Y246S/Y247S/Y248S/Y251S is responsible for their reduced catalytic activity in all assay systems.
Rodriguez, A V; Baigorí, M D; Alvarez, S; Castro, G R; Oliver, G
2001-10-16
Phosphatidylinositol-specific phospholipase C (PI-PLC) activity was investigated in 25 different lactic acid bacteria (LAB) strains belonging to the genera Lactobacillus, Weisella, and Enterococcus. PI-PLC activity was detected in 44% of the strains studied in culture medium without carbon source. From the PI-PLC positive strains, Lactobacillus rhamnosus ATCC 7469 was selected for translocation studies. Healthy mice were orally administered with a daily dose of 2.0 x 10(9) of viable L. rhamnosus suspension. Viable bacteria were detected in liver and spleen of mice fed with LAB for 7 days. Bacterial colonies isolated from liver were biochemically characterized, and further subjected to randomly amplified polymorphic DNA. Amplification patterns of five strains displayed identical profiles to L. rhamnosus. PI-PLC activity was determined in the strains recovered from liver.
Stalling autophagy: a new function for Listeria phospholipases
Directory of Open Access Journals (Sweden)
Ivan Tattoli
2014-01-01
Full Text Available Listeria monocytogenes is a Gram-positive bacterial pathogen that induces its own uptake in non-phagocytic cells. Following invasion, Listeria escapes from the entry vacuole through the secretion of a pore-forming toxin, listeriolysin O (LLO that acts to damage and disrupt the vacuole membrane. Listeria then replicates in the cytosol and is able to spread from cell-to-cell using actin-based motility. In addition to LLO, Listeria produces two phospholipase toxins, a phosphatidylinositol-specific phospholipase C (PI-PLC, encoded by plcB and a broad-range phospholipase C (PC-PLC, encoded by plcA, which contribute to bacterial virulence. It has long been recognized that secretion of PI- and PC-PLC enables the disruption of the double membrane vacuole during cell-to-cell spread, and those phospholipases have also been shown to augment LLO-dependent escape from the entry endosome. However, a specific role for Listeria phospholipases during the cytosolic stage of infection has not been previously reported. In a recent study, we demonstrated that Listeria PI-PLC and PC-PLC contribute to the bacterial escape from autophagy through a mechanism that involves direct inhibition of the autophagic flux in the infected cells [Tattoli et al. EMBO J (2013, 32, 3066-3078].
Phospholipase D function in Saccharomyces cerevisiae.
Mendonsa, Rima; Engebrecht, JoAnne
2009-09-01
Phosphatidylinositol 4,5-bisphosphate-regulated phosphatidylcholine-specific phospholipase D is conserved from yeast to man. The essential role of this enzyme in yeast is to mediate the fusion of Golgi and endosome-derived vesicles to generate the prospore membrane during the developmental program of sporulation, through the production of the fusogenic lipid phosphatidic acid. In addition to recruiting proteins required for fusion, phosphatidic acid is believed to lower the energy barrier to stimulate membrane curvature. During mitotic growth, phospholipase D activity is dispensable unless the major phosphatidylinositol/phosphatidylcholine transfer protein is absent; it also appears to play a nonessential role in the mating signal transduction pathway. The regulation of phospholipase D activity during both sporulation and mitotic growth is still not fully understood and awaits further characterization.
Gonorazky, Gabriela; Guzzo, María Carla; Abd-El-Haliem, Ahmed M.; Joosten, Matthieu H.A.J.; Laxalt, Ana María
2016-01-01
The tomato [Solanum lycopersicum (Sl)] phosphatidylinositol-phospholipase C (PI-PLC) gene family is composed of six members, named SlPLC1 to SlPLC6, differentially regulated on pathogen attack. We have previously shown that the fungal elicitor xylanase induces a raise of SlPLC2 and SlPLC5
Listeria monocytogenes: Overview and Targeting Advances
Directory of Open Access Journals (Sweden)
Mostafa F.N. Abushahba
2016-04-01
Full Text Available Listeria monocytogenes is a serious foodborne zoonotic pathogen capable of causing gastroenteritis and severe systemic infections such as septicemia, meningitis or abortion in the infected individuals what is called listeriosis. The bacterium is reported as the third leading cause of death among the foodborne pathogens preceded by nontyphoidal Salmonella spp. and Toxoplasma gondii. The power to tolerate a wide range of temperatures is considered the most prominent trait distinguishing it from the other foodborne pathogens. Within the infected host, the bacteria harbor inside macrophages and jump from cell to another without leaving the safeguarding milieu of the host's cells utilizing a set of genes including hly (listeriolysin O, plcA (phosphatidylinositol-specific phospholipase c, plcB (phosphatidylcholine-phospholipase C and actA (actin-assembly inducing protein. In addition to the health concerns associated with antibiotics, treatment failure likely occurs among listeriosis-infected persons especially with the inability of most antibiotics to access intracellular replicative niches and achieve the optimum therapeutic concentrations within the infected cells. Recently, one novel choice, peptide nucleic acid (PNA, has been emerged to target this bacterium as a model of targeting intracellular pathogens with anti-sense agents. PNA is a one of the DNA analogues which works via specific inhibition of bacterial gene expression.
Han, Xuelin; Yu, Rentao; Ji, Lei; Zhen, Dongyu; Tao, Sha; Li, Shuai; Sun, Yansong; Huang, Liuyu; Feng, Zhe; Li, Xianping; Han, Gaige; Schmidt, Martina; Han, Li
Internalization of Listeria monocytogenes into non-phagocytic cells is tightly controlled by host cell actin dynamics and cell membrane alterations. However, knowledge about the impact of phosphatidylcholine cleavage driven by host cell phospholipase D (PLD) on Listeria internalization into
Isolation and biochemical and molecular characterization of Listeria monocytogenes in food
International Nuclear Information System (INIS)
Helel, Salma
2008-01-01
monocytogenes is a Gram-positive bacteria, saprophytic, non-spore. This is an extremely resistant seeds to environmental conditions outside, especially since the cold psychrotrophic. It can contaminate raw vegetables, cooked meals ready for consumption or foods to be stored in the refrigerator, such as cheese or meat. It is the bacteria responsible for listeriosis. It threatens first unborn children, infants, pregnant women, the elderly and people whose immune system is weakened. Strains of Listeria spp isolated from foods (seafood, meat, meat) were first identified at the stage of the genus by classical tests (Gram staining, catalase test, oxidase test and mobility) and stage of the test case by hemolysis, CAMP test and the gallery Api Listeria. Biochemical characterization allowed after a numerical analysis, to assign 100% of isolates to the genus Listeria. Molecular characterization was performed by PCR amplification of genes coding for protein p60 (iap), the listeriolysine O (hly), the Phosphatidylinositol Phospholipase C (PI-PLC plca) Phosphatidylcholine Phospholipase C (plcB). The result showed an amplification of the iap gene of 100% of the hly gene, plca, plcB of 31.81%. This characterization represents an identification of the collection on the genetic level and shows that 31.81% of isolates, is likely to express the genes responsible for virulence factors of L. monocytogenes, to produce listeriolysine O, phospholipase C and Lecithinase. The molecular identification was performed by microarray technique and identified isolates L. September monocytogenes (five original clinical isolates and two food-borne), fourteen L. innocua (of food) and a strain not identified by DNA chip.. (Author)
International Nuclear Information System (INIS)
Baldassare, J.J.; Henderson, P.A.; Fisher, G.J.
1989-01-01
The effects of thrombin and GTPγS on the hydrolysis of phosphoinositides by membrane-associated phospholipase C (PLC) from human platelets were examined with endogenous [ 3 H]inositol-labeled membranes or with lipid vesicles containing either [ 3 H]phosphatidylinositol or [ 3 H]phosphatidylinositol 4,5-bisphosphate. GTPγS (1 μM) or thrombin (1 unit/mL) did not stimulate release of inositol trisphosphate (IP 3 ), inositol bisphosphate (IP 2 ), or inositol phosphate (IP) from [ 3 H]inositol-labeled membranes. IP 2 and IP 3 , but not IP, from [ 3 H]inositol-labeled membranes were, however, stimulated 3-fold by GTPγS (1 μM) plus thrombin (1 unit/mL). A higher concentration of GTPγS (100 μM) alone also stimulated IP 2 and IP 3 , but not IP, release. In the presence of 1 mM calcium, release of IP 2 and IP 3 was increased 6-fold over basal levels; however, formation of IP was not observed. At submicromolar calcium concentration, hydrolysis of exogenous phosphatidylinositol 4,5-bisphosphate (PIP 2 ) by platelet membrane associated PLC was also markedly enhanced by GTPγS (100 μM) or GTPγS (1 μM) plus thrombin (1 unit/mL). Under identical conditions, exogenous phosphatidylinositol (PI) was not hydrolyzed. The same substrate specificity was observed when the membrane-associated PLC was activated with 1 mM calcium. Thrombin-induced hydrolysis of PIP 2 was inhibited by treatment of the membranes with pertussis toxin or pretreatment of intact platelets with 12-O-tetradecanoyl-13-acetate (TPA) prior to preparation of membranes. Pertussis toxin did not inhibit GTPγS (100 μM) or calcium (1 mM) dependent PIP 2 breakdown, while TPA inhibited GTPγS-dependent but not calcium-dependent phospholipase C activity
International Nuclear Information System (INIS)
Jett, M.; Alving, C.R.
1986-01-01
Plant phosphatidylinositol (PI) has been shown by us to have a direct cytotoxic effect on cultured tumor cells but not on normal cells. Synthetic PI containing 14 C-linoleic acid in the sn-2 position, also showed the same pattern of selective cytotoxicity. When the metabolic fate of synthetic PI was examined with tumor cells, the radioactivity which no longer occurred as PI, was found as either products of phospholipase A 2 (93%, free fatty acids and phosphatidylcholine) or phospholipase C (7%, diglycerides). Uptake of liposomal PI was directly correlated with cytotoxicity. They tested a variety of inhibitors to see the effect on uptake and/or cytotoxicity of plant PI. General metabolic inhibitors such as metrizamide or sodium azide did not alter cellular uptake of the plant PI liposomes. Inhibitors of lipoxygenase formation, such as indomethacin, also did not alter the uptake or cytotoxicity induced by plant PI. Quinacrine, an inhibitor of phospholipase A 2 , decreased the uptake of the PI containing liposomes to 50% of that seen in the presence or absence of any other inhibitor. Although quinacrine is itself toxic to cells, at low concentrations of quinacrine, plant PI did not show the same degree of cytotoxicity as in the absence of quinacrine. These data are compatible with the hypothesis that plant PI exerts cytotoxicity by serving as a substrate for phospholipase A 2
International Nuclear Information System (INIS)
Babson, J.R.; Dougherty, J.M.
1991-01-01
Exposure of cultured rat cardiomyocytes to ionomycin and extracellular Ca 2+ leads to a rapid, sustained increase in intracellular free Ca 2+ as monitored by Ca 2+ -dependent phosphorylase a activation and to a subsequent loss of cardiomyocyte viability as determined by lactate dehydrogenase (LDH) leakage. The intracellular free Ca 2+ increase coincided with a rapid hydrolysis of phosphatidylinositol that preceded cell death. Phosphatidylinositol hydrolysis was monitored by the release of radiolabeled phosphoinositides from cardiomyocytes prelabeled with [2- 3 H]-myo-inositol. Neomycin, a known inhibitor of phospholipase C, inhibited the phosphatidylinositol hydrolysis and markedly reduced the extent of cell injury. Inhibitors of other Ca 2+ -activated processes, including intracellular proteases and phospholipase A 2 , had no effect on ionomycin-mediated cell injury. These data suggest that ionomycin-induced Ca 2+ -dependent cell injury in cultured cardiomyocytes may be due in part to the stimulation of phosphatidylinositol hydrolysis, presumably catalyzed by a Ca 2+ -dependent phospholipase C
International Nuclear Information System (INIS)
Mayor, S.; Menon, A.K.; Cross, G.A.
1990-01-01
A common diagnostic feature of glycosylinositol phospholipid (GPI)-anchored proteins is their release from the membrane by a phosphatidylinositol-specific phospholipase C (PI-PLC). However, some GPI-anchored proteins are resistant to this enzyme. The best characterized example of this subclass is the human erythrocyte acetylcholinesterase, where the structural basis of PI-PLC resistance has been shown to be the acylation of an inositol hydroxyl group(s). Both PI-PLC-sensitive and resistant GPI-anchor precursors (P2 and P3, respectively) have been found in Trypanosoma brucei, where the major surface glycoprotein is anchored by a PI-PLC-sensitive glycolipid anchor. The accompanying paper shows that P2 and P3 have identical glycans, indistinguishable from the common core glycan found on all the characterized GPI protein anchors. This paper shows that the single difference between P2 and P3, and the basis for the PI-PLC insusceptibility of P3, is a fatty acid, ester-linked to the inositol residue in P3. The inositol-linked fatty acid can be removed by treatment with mild base to restore PI-PLC sensitivity. Biosynthetic labeling experiments with [3H]palmitic acid and [3H]myristic acid show that [3H]palmitic acid specifically labels the inositol residue in P3 while [3H]myristic acid labels the diacylglycerol portion. Possible models to account for the simultaneous presence of PI-PLC-resistant and sensitive glycolipids are discussed in the context of available information on the biosynthesis of GPI-anchors
Directory of Open Access Journals (Sweden)
Abdelkafi Slim
2011-11-01
Full Text Available Abstract Background Phospholipase D (PLD belongs to a lipolytic enzyme subclass which catalyzes the hydrolysis and transesterification of glycerophospholipids at the terminal phosphodiester bond. Results In this work, we have studied the substrate specificity of PLDs from germinating sunflower seeds and cultured-soybean cells, using their capacity of transphosphatidylation. In the presence of a nucleophilic acceptor, such as [14C]ethanol, PLD catalyzes the production of phosphatidyl-[14C]-ethanol. The resulting product is easily identified since it is well separated from the other lipids by thin-layer chromatography. The main advantage of this assay is that the phospholipid used as substrate does not need to be radiolabelled and thus allow us a large choice of polar heads and fatty acids. In vitro, we observed that sunflower and soybean cell PLD show the following decreasing order of specificity: phosphatidylcholine, phosphatidylethanolamine and phosphatidylglycerol; while phosphatidylserine and phosphatidylinositol are utilized much less efficiently. Conclusions The substrate specificity is modulated by the fatty acid composition of the phosphatidylcholine used as well as by the presence of other charged phospholipids.
International Nuclear Information System (INIS)
Slivka, S.R.; Insel, P.A.
1987-01-01
alpha 1-Adrenergic receptors mediate two effects on phospholipid metabolism in Madin-Darby canine kidney (MDCK-D1) cells: hydrolysis of phosphoinositides and arachidonic acid release with generation of prostaglandin E2 (PGE2). The similarity in concentration dependence for the agonist (-)-epinephrine in eliciting these two responses implies that they are mediated by a single population of alpha 1-adrenergic receptors. However, we find that the kinetics of the two responses are quite different, PGE2 production occurring more rapidly and transiently than the hydrolysis of phosphoinositides. The antibiotic neomycin selectively decreases alpha 1-receptor-mediated phosphatidylinositol 4,5-bisphosphate hydrolysis without decreasing alpha 1-receptor-mediated arachidonic acid release and PGE2 generation. In addition, receptor-mediated inositol trisphosphate formation is independent of extracellular calcium, whereas release of labeled arachidonic acid is largely calcium-dependent. Moreover, based on studies obtained with labeled arachidonic acid, receptor-mediated generation of arachidonic acid cannot be accounted for by breakdown of phosphatidylinositol monophosphate, phosphatidylinositol bisphosphate, or phosphatidic acid. Further studies indicate that epinephrine produces changes in formation or turnover of several classes of membrane phospholipids in MDCK cells. We conclude that alpha 1-adrenergic receptors in MDCK cells appear to regulate phospholipid metabolism by the parallel activation of phospholipase C and phospholipase A2. This parallel activation of phospholipases contrasts with models described in other systems which imply sequential activation of phospholipase C and diacylglycerol lipase or phospholipase A2
Sharma, Sanjita; Sharma, Vishnu; Dahiya, Dinesh Kumar; Khan, Aarif; Mathur, Manisha; Sharma, Amit
2017-03-01
Listeriosis is a serious foodborne disease of a global concern, and can effectively be controlled by a continuous surveillance of the virulent and multidrug-resistant strains of Listeria monocytogenes. This study was planned to investigate prevalence of L. monocytogenes in bovine raw milk samples. A total of 457 raw milk samples collected from 15 major cities in Rajasthan, India, were analyzed for the presence of L. monocytogenes by using standard microbiological and molecular methods. Five of the 457 samples screen tested positive for L. monocytogenes. Multiplex serotyping showed that 3/5 strains belonged to serotype 4b followed by one strain each to 1/2a and to 1/2c. Further virulence potential assessment indicated that all strains possessed inlA and inlC internalins, and, in addition, two strains also possessed the gene for inlB. All strains were positive for Listeriolysin O (LLO) and showed phosphatidylinositol-specific phospholipase C (PI-PLC) activity on an in vitro agar medium with variations in production levels among the strains. A good correlation between the in vitro pathogenicity test and the chick embryo test was observed, as the strains showing higher LLO and PI-PLC activity were found to be lethal to fertilized chick embryos. All strains were resistant to the majority of antibiotics and were designated as multidrug-resistant strains. However, these strains were susceptible to 9 of the 22 tested antibiotics. The maximum zone of inhibition (mm) and acceptable minimum inhibitory concentration were observed with azithromycin, and thus it could be the first choice of a treatment. Overall, the presence of multidrug-resistant L. monocytogenes strains in the raw milk of Rajasthan region is an indicator of public health hazard and highlighting the need of consumer awareness in place and implementation of stricter food safety regulations at all levels of milk production.
Evidence for glycosyl-phosphatidylinositol anchoring of Toxoplasma gondii major surface antigens
International Nuclear Information System (INIS)
Tomavo, S.; Schwarz, R.T.; Dubremetz, J.F.
1989-01-01
The four major surface antigens of Toxoplasma gondii tachyzoites (P43, P35, P30, and P22) were made water soluble by phosphatidylinositol-specific phospholipase C (PI-PLC). These antigens were biosynthetically labeled with 3 H-fatty acids, [ 3 H]ethanolamine, and [ 3 H]carbohydrates. Treatment of 3 H-fatty-acid-labeled parasite lysates with PI-PLC removed the radioactive label from these antigens. A cross-reacting determinant was exposed on these antigens after PI-PLC treatment
Chen, Jianshun; Jiang, Lingli; Chen, Xueyan; Luo, Xiaokai; Chen, Yang; Yu, Ying; Tian, Guoming; Liu, Dongyou; Fang, Weihuan
2009-03-01
The genus Listeria consists of six closely related species and forms three phylogenetic groups: L. monocytogenes- L. innocua, L. ivanovii-L. seeligeri-L. welshimeri, and L. grayi. In this report, we attempted to examine the evolutionary relationship in the L. monocytogenes-L. innocua group by probing the nucleotide sequences of 23S rRNA and 16S rRNA, and the gene clusters lmo0029-lmo0042, ascBdapE, rplS-infC, and prs-ldh in L. monocytogenes serovars 1/2a, 4a, and 4b, and L. innocua. Additionally, we assessed the status of L. monocytogenes-specific inlA and inlB genes and 10 L. innocua-specific genes in these species/serovars, together with phenotypic characterization by using in vivo and in vitro procedures. The results indicate that L. monocytogenes serovar 4a strains are genetically similar to L. innocua in the lmo0035-lmo0042, ascB-dapE, and rplS-infC regions and also possess L. innocua-specific genes lin0372 and lin1073. Furthermore, both L. monocytogenes serovar 4a and L. innocua exhibit impaired intercellular spread ability and negligible pathogenicity in mouse model. On the other hand, despite resembling L. monocytogenes serovars 1/2a and 4b in having a nearly identical virulence gene cluster, and inlA and inlB genes, these serovar 4a strains differ from serovars 1/2a and 4b by harboring notably altered actA and plcB genes, displaying strong phospholipase activity and subdued in vivo and in vitro virulence. Thus, by possessing many genes common to L. monocytogenes serovars 1/2a and 4b, and sharing many similar gene deletions with L. innocua, L. monocytogenes serovar 4a represents a possible evolutionary intermediate between L. monocytogenes serovars 1/2a and 4b and L. innocua.
DEFF Research Database (Denmark)
Rönnstrand, L; Siegbahn, A; Rorsman, C
1999-01-01
., Siegbahn, A. , Rorsman, C., Engström, U., Wernstedt, C., Heldin, C.-H., and Rönnstrand, L. (1996) EMBO J. 15, 5299-5313). Here we show that the increased chemotaxis correlates with increased activation of phospholipase C-gamma1 (PLC-gamma1), measured as inositol-1,4, 5-trisphosphate release. By two......-dimensional phosphopeptide mapping, the increase in phosphorylation of PLC-gamma1 was shown not to be selective for any site, rather a general increase in phosphorylation of PLC-gamma1 was seen. Specific inhibitors of protein kinase C, bisindolylmaleimide (GF109203X), and phosphatidylinositol 3-kinase (PI3-kinase), LY294002......, did not affect the activation of PLC-gamma1. To assess whether increased activation of PLC-gamma1 is the cause of the hyperchemotactic behavior of the Y934F mutant cell line, we constructed cell lines expressing either wild-type or a catalytically compromised version of PLC-gamma1 under a tetracycline...
Phosphatidylinositol-glycan-phospholipase D is involved in neurodegeneration in prion disease.
Directory of Open Access Journals (Sweden)
Jae-Kwang Jin
Full Text Available PrPSc is formed from a normal glycosylphosphatidylinositol (GPI-anchored prion protein (PrPC by a posttranslational modification. Most GPI-anchored proteins have been shown to be cleaved by GPI phospholipases. Recently, GPI-phospholipase D (GPI-PLD was shown to be a strictly specific enzyme for GPI anchors. To investigate the involvement of GPI-PLD in the processes of neurodegeneration in prion diseases, we examined the mRNA and protein expression levels of GPI-PLD in the brains of a prion animal model (scrapie, and in both the brains and cerebrospinal fluids (CSF of sporadic and familial Creutzfeldt-Jakob disease (CJD patients. We found that compared with controls, the expression of GPI-PLD was dramatically down-regulated in the brains of scrapie-infected mice, especially in the caveolin-enriched membrane fractions. Interestingly, the observed decrease in GPI-PLD expression levels began at the same time that PrPSc began to accumulate in the infected brains and this decrease was also observed in both the brain and CSF of CJD patients; however, no differences in expression were observed in either the brains or CSF specimens from Alzheimer's disease patients. Taken together, these results suggest that the down-regulation of GPI-PLD protein may be involved in prion propagation in the brains of prion diseases.
Mohammadi, M; Dionne, C A; Li, W; Li, N; Spivak, T; Honegger, A M; Jaye, M; Schlessinger, J
1992-08-20
Stimulation of growth factor receptors with tyrosine kinase activity is followed by rapid receptor dimerization, tyrosine autophosphorylation and phosphorylation of signalling molecules such as phospholipase C gamma (PLC gamma) and the ras GTPase-activating protein. PLC gamma and GTPase-activating protein bind to specific tyrosine-phosphorylated regions in growth factor receptors through their src-homologous SH2 domains. Growth factor-induced tyrosine phosphorylation of PLC gamma is essential for stimulation of phosphatidylinositol hydrolysis in vitro and in vivo. We have shown that a short phosphorylated peptide containing tyrosine at position 766 from a conserved region of the fibroblast growth factor (FGF) receptor is a binding site for the SH2 domain of PLC gamma (ref. 8). Here we show that an FGF receptor point mutant in which Tyr 766 is replaced by a phenylalanine residue (Y766F) is unable to associate with and tyrosine-phosphorylate PLC gamma or to stimulate hydrolysis of phosphatidylinositol. Nevertheless, the Y766F FGF receptor mutant can be autophosphorylated, and can phosphorylate several cellular proteins and stimulate DNA synthesis. Our data show that phosphorylation of the conserved Tyr 766 of the FGF receptor is essential for phosphorylation of PLC gamma and for hydrolysis of phosphatidylinositol, but that elimination of this hydrolysis does not affect FGF-induced mitogenesis.
Directory of Open Access Journals (Sweden)
Neale Harrison
Full Text Available N-acylethanolamines are an important class of lipid signaling molecules found in many species, including the nematode Caenorhabditis elegans (C. elegans where they are involved in development and adult lifespan. In mammals, the relative activity of the biosynthetic enzyme N-acyl phosphatidylethanolamine-specific phospholipase-D and the hydrolytic enzyme fatty acid amide hydrolase determine N-acylethanolamine levels. C. elegans has two N-acyl phosphatidylethanolamine-specific phospholipase-D orthologs, nape-1 and nape-2, that are likely to have arisen from a gene duplication event. Here, we find that recombinant C. elegans NAPE-1 and NAPE-2 are capable of generating N-acylethanolamines in vitro, confirming their functional conservation. In vivo, they exhibit overlapping expression in the pharynx and the nervous system, but are also expressed discretely in these and other tissues, suggesting divergent roles. Indeed, nape-1 over-expression results in delayed growth and shortened lifespan only at 25°C, while nape-2 over-expression results in significant larval arrest and increased adult lifespan at 15°C. Interestingly, deletion of the N-acylethanolamine degradation enzyme faah-1 exacerbates nape-1 over-expression phenotypes, but suppresses the larval arrest phenotype of nape-2 over-expression, suggesting that faah-1 is coupled to nape-2, but not nape-1, in a negative feedback loop. We also find that over-expression of either nape-1 or nape-2 significantly enhances recovery from the dauer larval stage in the insulin signaling mutant daf-2(e1368, but only nape-1 over-expression reduces daf-2 adult lifespan, consistent with increased levels of the N-acylethanolamine eicosapentaenoyl ethanolamine. These results provide evidence that N-acylethanolamine biosynthetic enzymes in C. elegans have conserved function and suggest a temperature-dependent, functional divergence between the two isoforms.
Standaert, M L; Avignon, A; Yamada, K; Bandyopadhyay, G; Farese, R V
1996-01-01
We questioned whether phosphatidylinositol 3-kinase (PI 3-kinase) and protein kinase C (PKC) function as interrelated signalling mechanisms during insulin action in rat adipocytes. Insulin rapidly activated a phospholipase D that hydrolyses phosphatidylcholine (PC), and this activation was accompanied by increases in diacylglycerol and translocative activation of PKC-alpha and PKC-beta in the plasma membrane. Wortmannin, an apparently specific PI 3-kinase inhibitor, inhibited insulin-stimulat...
Lev, Shaya; Katz, Ben; Tzarfaty, Vered; Minke, Baruch
2012-01-01
In Drosophila, a phospholipase C (PLC)-mediated signaling cascade, couples photo-excitation of rhodopsin to the opening of the transient receptor potential (TRP) and TRP-like (TRPL) channels. A lipid product of PLC, diacylglycerol (DAG), and its metabolites, polyunsaturated fatty acids (PUFAs) may function as second messengers of channel activation. However, how can one separate between the increase in putative second messengers, change in pH, and phosphatidylinositol 4,5-bisphosphate (PI(4,5)P2) depletion when exploring the TRPL gating mechanism? To answer this question we co-expressed the TRPL channels together with the muscarinic (M1) receptor, enabling the openings of TRPL channels via G-protein activation of PLC. To dissect PLC activation of TRPL into its molecular components, we used a powerful method that reduced plasma membrane-associated PI(4,5)P2 in HEK cells within seconds without activating PLC. Upon the addition of a dimerizing drug, PI(4,5)P2 was selectively hydrolyzed in the cell membrane without producing DAG, inositol trisphosphate, or calcium signals. We show that PI(4,5)P2 is not an inhibitor of TRPL channel activation. PI(4,5)P2 hydrolysis combined with either acidification or application of DAG analogs failed to activate the channels, whereas PUFA did activate the channels. Moreover, a reduction in PI(4,5)P2 levels or inhibition of DAG lipase during PLC activity suppressed the PLC-activated TRPL current. This suggests that PI(4,5)P2 is a crucial substrate for PLC-mediated activation of the channels, whereas PUFA may function as the channel activator. Together, this study defines a narrow range of possible mechanisms for TRPL gating. PMID:22065576
Standaert, M L; Avignon, A; Yamada, K; Bandyopadhyay, G; Farese, R V
1996-02-01
We questioned whether phosphatidylinositol 3-kinase (PI 3-kinase) and protein kinase C (PKC) function as interrelated signalling mechanisms during insulin action in rat adipocytes. Insulin rapidly activated a phospholipase D that hydrolyses phosphatidylcholine (PC), and this activation was accompanied by increases in diacylglycerol and translocative activation of PKC-alpha and PKC-beta in the plasma membrane. Wortmannin, an apparently specific PI 3-kinase inhibitor, inhibited insulin-stimulated, phospholipase D-dependent PC hydrolysis and subsequent translocation of PKC-alpha and PKC-beta to the plasma membrane. Wortmannin did not inhibit PKC directly in vitro, or the PKC-dependent effects of phorbol esters on glucose transport in intact adipocytes. The PKC inhibitor RO 31-8220 did not inhibit PI 3-kinase directly or its activation in situ by insulin, but inhibited both insulin-stimulated and phorbol ester-stimulated glucose transport. Our findings suggest that insulin acts through PI 3-kinase to activate a PC-specific phospholipase D and causes the translocative activation of PKC-alpha and PKC-beta in plasma membranes of rat adipocytes.
Coffey, A; van den Burg, B; Veltman, R; Abee, T
Listeria monocytogenes, a facultative intracellular pathogen, synthesizes an extracellular protease which is responsible for the maturation of phosphatidylcholine phospholipase C (lecithinase), a virulence factor involved in cell-to-cell spread. This work describes the environmental parameters
The plant non-specific phospholipase C gene family. Novel competitors in lipid signalling
Czech Academy of Sciences Publication Activity Database
Pokotylo, Igor; Pejchar, Přemysl; Potocký, Martin; Kocourková, Daniela; Krčková, Zuzana; Ruelland, E.; Kravets, V.; Martinec, Jan
2013-01-01
Roč. 52, č. 1 (2013), s. 62-79 ISSN 0163-7827 R&D Projects: GA ČR(CZ) GAP501/12/1942; GA ČR(CZ) GPP501/12/P950; GA MŠk ME09108; GA AV ČR IAA601110916 Institutional research plan: CEZ:AV0Z50380511 Keywords : Plant nonspecific phospholipase C * Phosphatidylcholine-specific phospholipase C * Diacylglycerol Subject RIV: ED - Physiology Impact factor: 12.963, year: 2013
International Nuclear Information System (INIS)
Falo, L.D. Jr.; Haber, S.I.; Herrmann, S.; Benacerraf, B.; Rock, K.L.
1987-01-01
To characterize the basis for the cell surface association of processed antigen with the antigen-presenting cell (APC) the authors analyzed its sensitivity to enzymatic digestion. Antigen-exposed APC that are treated with phospholipase and then immediately fixed lose their ability to stimulate antigen-plus-Ia-specific T-T hybridomas. This effect is seen with highly purified phospholipase A 2 and phospholipase C. In addition it is observed with three distinct antigens - ovalbumin, bovine insulin, and poly(LGlu 56 LLys 35 LPhe 9 )[(GluLysPhe)/sub n/]. The effect of phospholipases is highly specific. Identically treated APC are equivalent to control in their ability to stimulate alloreactive hybridomas specific for precisely the same Ia molecule that is corecognized by antigen-plus-Ia-specific hybrids. Furthermore, the antigen-presenting function of enzyme-treated, fixed APC can be reconstituted by the addition of exogenous in vitro processed or processing independent antigens. In parallel studies 125 I-labeled avidin was shown to specifically bind to APC that were previously exposed and allowed to process biotin-insulin. Biotin-insulin-exposed APC that are pretreated with phospholipase bind significantly less 125 I-labeled avidin than do untreated, exposed APC. Identical enzyme treatment does not reduce the binding of avidin to a biotinylated antibody already bound to class II major histocompatibility complex molecules of APC. These studies demonstrate that phospholipase effectively removes processed cell surface antigen
Leeuwen, van W.; Vermeer, J.E.M.; Gadella, T.W.J.; Munnik, T.
2007-01-01
Phosphatidylinositol 4,5-bisphosphate [PtdIns(4,5)P-2] is an important signalling lipid in mammalian cells, where it functions as a second-messenger precursor in response to agonist-dependent activation of phospholipase C (PLC) but also operates as a signalling molecule on its own. Much of the
Harada, T; Koyama, I; Sato, K; Komoda, T
2000-10-01
Serum alkaline phosphatase (ALP) is detected in soluble-form as a result of translocation from the membrane site by cleavage at the glycosyl-phosphatidylinositol moiety (GPI anchor). It is known that membrane-bound ALP (mALP) can be detected in serum in certain pathological and physiological conditions, and that it can be solubilized in vitro to soluble-ALP (sALP) by phosphatidylinositol-specific phospholipase C (PIPLC), phospholipase D, bile salt, detergent, etc. We observed a marked increase in ALP activity in the serum of rats given a benzimidazole derivative by gavage, and detected it as slow-migrating ALPs (SM-ALPs), which were mALP-like but resistant to PIPLC and n-butanol treatment on disc PAGE. On the other hand, ficin treatment made SM-ALPs shift to the sALP position. The molecular size of the SM-ALPs was smaller than that of sALP on sodium dodecyl sulphide-polyacrylamide slab-gel electrophoresis (SDS-PAGE), and immunoreactivity revealed the intestinal type. SM-ALPs were also detected in the duodenum and jejunum. The main sugar chain structure of SM-ALPs was the biantennary complex-type, which was coincided with intestinal sALP sugar chain. These results suggest that intestinal ALPs induced by the benzimidazole derivative were modified in their C-terminus or GPI anchor region and modification of this region may also participate in translocation into the bloodstream.
Czech Academy of Sciences Publication Activity Database
Krčková, Zuzana; Kocourková, Daniela; Daněk, Michal; Brouzdová, Jitka; Pejchar, Přemysl; Janda, Martin; Pokotylo, I.; Ott, P.G.; Valentová, O.; Martinec, Jan
2018-01-01
Roč. 121, č. 2 (2018), s. 297-310 ISSN 0305-7364 R&D Projects: GA ČR(CZ) GAP501/12/1942 Institutional support: RVO:61389030 Keywords : Arabidopsis thaliana * effector-triggered immunity * flagellin * MAMP-triggered immunity * non-specific phospholipase C * phosphatidylcholine-specific phospholipase C * Pseudomonas syringae * reactive oxygen species Subject RIV: ED - Physiology OBOR OECD: Plant sciences, botany Impact factor: 4.041, year: 2016
Directory of Open Access Journals (Sweden)
V. López
2006-12-01
Full Text Available Listeria monocytogenes es un patógeno humano que se transmite a través de los alimentos y que causa infecciones graves, con una alta tasa de mortalidad. A pesar de la ubicuidad del microorganismo, la tasa real de la enfermedad es bastante baja y se asocia casi siempre a condiciones predisponentes. Tradicionalmente se consideraba que los aislamientos presentes en los alimentos y en el ambiente tenían la misma capacidad patogénica que los aislamientos de origen clínico. Pero el análisis de mutaciones en los genes de determinados factores de virulencia (internalina, hemolisina, fosfolipasas, proteína de superficie ActA y proteína reguladora PrfA, los estudios cuantitativos realizados con cultivos celulares y la genética de poblaciones, están replanteando la discusión sobre la variabilidad de la virulencia de L. monocytogenes. A pesar de todos estos avances, no existe un único marcador que permita comprobar la virulencia de los aislamientos naturales de esta especie. Probablemente en el futuro, la combinación de diferentes marcadores moleculares permitirá detectar los alimentos contaminados sólo por los clones virulentos de L. monocytogenes, con lo que se mejorará la prevención de la listeriosis humana transmitida por alimentos.Listeria monocytogenes is a foodborne human pathogen responsible for invasive infections presenting overall a high mortality. Despite the ubiquity of the microorganism, the actual disease rate is quite low and the disease is most often associated with an underlying predisposition. Foodborne and environmental isolates were traditionally considered of similar pathogenicity compared to clinical isolates. But the analysis of mutations in the genes encoding specific virulence factors (internalin, hemolysin, phospholipases, surface protein ActA and regulator protein PrfA, quantitative studies with cell cultures and population genetics have raised considerable concerns about virulence differences among L
The mechanism of phospholipase Cγ1 activation
Directory of Open Access Journals (Sweden)
Paweł Krawczyk
2011-08-01
Full Text Available Phospholipase C is an enzyme which catalyzes the hydrolysis of phosphatidylinositol-4,5-bisphosphate (PI(4,5P2 into second messengers inositol-1,4,5-triphosphate (Ins(1,4,5P3 and diacylglycerol (DAG. These messengers then promote the activation of protein kinase C and release of Ca2 from intracellular stores, initiating numerous cellular events including proliferation, differentiation, signal transduction, endocytosis, cytoskeletal reorganization or activation of ion channels. There have been identified 14 isozymes of PLC among which PLCγ1 and PLCγ2 are of particular interest. PLC contains catalytic region XY and a few regulatory domains: PH, EF and C2. The most unique features of these two enzymes are the Src homology domains (SH2, SH3 and split PH domain within the catalytic barrel. PLC1 and PLCγ2 have an identical domain structure, but they differ in their function and occurrence. Phospholipase Cγ1 is expressed ubiquitously, especially in the brain, thymus and lungs.PLCγ1 can be activated by receptor tyrosine kinases (i.e.: PDGFR, EGFR, FGFR, Trk, as well as non-receptor protein kinases (Src, Syk, Tec or phosphatidic acid, tau protein and its analogue.The molecular mechanism of PLCγ1 activation includes membrane recruitment, phosphorylation, rearrangements and activation in the presence of growth factors.In reference to PLCγ1 regulation, a number of positive and negative modulators have been considered. The most important positive modulator is phosphatidylinositol-3,4,5-trisphosphate (PI(3,4,5P2. Protein kinase A and C, tyrosine phosphatases (SHP-1, PTP-1B and Cbl, Grb2, Jak2/PTP-1B complex proteins have been described as negative regulators of PLCγ1 activation.
Wachiralurpan, Sirirat; Sriyapai, Thayat; Areekit, Supatra; Sriyapai, Pichapak; Augkarawaritsawong, Suphitcha; Santiwatanakul, Somchai; Chansiri, Kosum
2018-04-01
ABSTRACT Listeria monocytogenes is a major foodborne pathogen of global health concern. Herein, the rapid diagnosis of L. monocytogenes has been achieved using loop-mediated isothermal amplification (LAMP) based on the phosphatidylcholine-phospholipase C gene (plcB). Colorimetric detection was then performed through the formation of DNA concatemers and a gold nanoparticle/DNA probe complex (GNP/DNA probe). The overall detection process was accomplished within approximately 1 h with no need for complicated equipment. The limits of detection for L. monocytogenes in the forms of purified genomic DNA and pure culture were 800 fg and 2.82 CFU mL-1, respectively. No cross reactions were observed from closely related bacteria species. The LAMP-GNP/DNA probe assay was applied to the detection of 200 raw chicken meat samples and compared to routine standard methods. The data revealed that the specificity, sensitivity and accuracy were 100%, 90.20% and 97.50%, respectively. The present assay was 100% in conformity with LAMP-agarose gel electrophoresis assay. Five samples that were negative by both assays appeared to have the pathogen at below the level of detection. The assay can be applied as a rapid direct screening method for L. monocytogenes.
Identification of the Elusive Mammalian Enzyme Phosphatidylcholine-Specific Phospholipase C
2015-09-01
Summary of Results. Task 1. To identify mammalian PC- PLC . Based on results published by other groups, we proposed to identify candidate PC- PLC mRNAs by...establishing the role of the elusive mammalian protein, phosphatidycholine- specific phospholipase C (PC- PLC ) in the inflammatory processes involved in...progression of rheumatoid arthritis (RA). Thus, the main scopes of this proposal are: 1. to identify the PC- PLC gene and protein; and 2. to test PC- PLC
The Metalloprotease of Listeria monocytogenes Is Activated by Intramolecular Autocatalysis▿ †
Bitar, Alan Pavinski; Cao, Min; Marquis, Hélène
2007-01-01
The metalloprotease (Mpl) of Listeria monocytogenes is a thermolysin-like protease that mediates the maturation of a broad-range phospholipase C, whose function contributes to the ability of this food-borne bacterial pathogen to survive intracellularly. Mpl is made as a proprotein that undergoes maturation by proteolytic cleavage of a large N-terminal prodomain. In this study, we identified the N terminus of mature Mpl and generated Mpl catalytic mutants to investigate the mechanism of Mpl ma...
Structural basis for phosphatidylinositol-phosphate biosynthesis
Clarke, Oliver B.; Tomasek, David; Jorge, Carla D.; Dufrisne, Meagan Belcher; Kim, Minah; Banerjee, Surajit; Rajashankar, Kanagalaghatta R.; Shapiro, Lawrence; Hendrickson, Wayne A.; Santos, Helena; Mancia, Filippo
2015-10-01
Phosphatidylinositol is critical for intracellular signalling and anchoring of carbohydrates and proteins to outer cellular membranes. The defining step in phosphatidylinositol biosynthesis is catalysed by CDP-alcohol phosphotransferases, transmembrane enzymes that use CDP-diacylglycerol as donor substrate for this reaction, and either inositol in eukaryotes or inositol phosphate in prokaryotes as the acceptor alcohol. Here we report the structures of a related enzyme, the phosphatidylinositol-phosphate synthase from Renibacterium salmoninarum, with and without bound CDP-diacylglycerol to 3.6 and 2.5 Å resolution, respectively. These structures reveal the location of the acceptor site, and the molecular determinants of substrate specificity and catalysis. Functional characterization of the 40%-identical ortholog from Mycobacterium tuberculosis, a potential target for the development of novel anti-tuberculosis drugs, supports the proposed mechanism of substrate binding and catalysis. This work therefore provides a structural and functional framework to understand the mechanism of phosphatidylinositol-phosphate biosynthesis.
Directory of Open Access Journals (Sweden)
Jan Matysiak
2016-06-01
Full Text Available Introduction: Beekeepers are a group of people with high exposure to honeybee stings and with a very high risk of allergy to bee venom. Therefore, they are a proper population to study the correlations between clinical symptoms and results of diagnostic tests. Aim: The primary aim of our study was to assess the correlations between total IgE, venom- and phospholipase A 2 -specific IgE and clinical symptoms after a bee sting in beekeepers. The secondary aim was to compare the results of diagnostic tests in beekeepers and in individuals with standard exposure to bees. Material and methods: Fifty-four individuals were divided into two groups: beekeepers and control group. The levels of total IgE (tIgE, venom-specific IgE (venom sIgE, and phospholipase A 2 -specific IgE (phospholipase A 2 sIgE were analyzed. Results: Our study showed no statistically significant correlation between the clinical symptoms after a sting and tIgE in the entire analyzed group. There was also no correlation between venom sIgE level and clinical symptoms either in beekeepers or in the group with standard exposure to bees. We observed a statistically significant correlation between phospholipase A 2 sIgE level and clinical signs after a sting in the group of beekeepers, whereas no such correlation was detected in the control group. Significantly higher venom-specific IgE levels in the beekeepers, as compared to control individuals were shown. Conclusions : In beekeepers, the severity of clinical symptoms after a bee sting correlated better with phospholipase A 2 sIgE than with venom sIgE levels.
Kim, Young-Hwan; Jeong, Ji-Hyun; Ahn, Duck-Sun; Chung, Seungsoo
2017-03-04
Agmatine suppresses peripheral sympathetic tone by modulating Cav2.2 channels in peripheral sympathetic neurons. However, the detailed cellular signaling mechanism underlying the agmatine-induced Cav2.2 inhibition remains unclear. Therefore, in the present study, we investigated the electrophysiological mechanism for the agmatine-induced inhibition of Cav2.2 current (I Cav2.2 ) in rat celiac ganglion (CG) neurons. Consistent with previous reports, agmatine inhibited I Cav2.2 in a VI manner. The agmatine-induced inhibition of the I Cav2.2 current was also almost completely hindered by the blockade of the imidazoline I 2 receptor (IR 2 ), and an IR 2 agonist mimicked the inhibitory effect of agmatine on I Cav2.2 , implying involvement of IR 2 . The agmatine-induced I Cav2.2 inhibition was significantly hampered by the blockade of G protein or phospholipase C (PLC), but not by the pretreatment with pertussis toxin. In addition, diC8-phosphatidylinositol 4,5-bisphosphate (PIP 2 ) dialysis nearly completely hampered agmatine-induced inhibition, which became irreversible when PIP 2 resynthesis was blocked. These results suggest that in rat peripheral sympathetic neurons, agmatine-induced IR 2 activation suppresses Cav2.2 channel voltage-independently, and that the PLC-dependent PIP 2 hydrolysis is responsible for the agmatine-induced suppression of the Cav2.2 channel. Copyright © 2017 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Ryan Chong
Full Text Available Intracellular bacterial pathogens, such as Listeria monocytogenes and Rickettsia conorii display actin-based motility in the cytosol of infected cells and spread from cell to cell through the formation of membrane protrusions at the cell cortex. Whereas the mechanisms supporting cytosolic actin-based motility are fairly well understood, it is unclear whether specific host factors may be required for supporting the formation and resolution of membrane protrusions. To address this gap in knowledge, we have developed high-throughput fluorescence microscopy and computer-assisted image analysis procedures to quantify pathogen spread in human epithelial cells. We used the approach to screen a siRNA library covering the human kinome and identified 7 candidate kinases whose depletion led to severe spreading defects in cells infected with L. monocytogenes. We conducted systematic validation procedures with redundant silencing reagents and confirmed the involvement of the serine/threonine kinases, CSNK1A1 and CSNK2B. We conducted secondary assays showing that, in contrast with the situation observed in CSNK2B-depleted cells, L. monocytogenes formed wild-type cytosolic tails and displayed wild-type actin-based motility in the cytosol of CSNK1A1-depleted cells. Furthermore, we developed a protrusion formation assay and showed that the spreading defect observed in CSNK1A1-depleted cells correlated with the formation of protrusion that did not resolve into double-membrane vacuoles. Moreover, we developed sending and receiving cell-specific RNAi procedures and showed that CSNK1A was required in the sending cells, but was dispensable in the receiving cells, for protrusion resolution. Finally, we showed that the observed defects were specific to Listeria monocytogenes, as Rickettsia conorii displayed wild-type cell-to-cell spread in CSNK1A1- and CSNK2B-depleted cells. We conclude that, in addition to the specific host factors supporting cytosolic actin
2012-01-01
Background Immunomagnetic separation (IMS) and immunoassays are widely used for pathogen detection. However, novel technology platforms with highly selective antibodies are essential to improve detection sensitivity, specificity and performance. In this study, monoclonal antibodies (MAbs) against Internalin A (InlA) and p30 were generated and used on paramagnetic beads of varying diameters for concentration, as well as on fiber-optic sensor for detection. Results Anti-InlA MAb-2D12 (IgG2a subclass) was specific for Listeria monocytogenes and L. ivanovii, and p30-specific MAb-3F8 (IgM) was specific for the genus Listeria. At all bacterial concentrations (103–108 CFU/mL) tested in the IMS assay; the 1-μm diameter MyOne beads had significantly higher capture efficiency (P Listeria antibody (9 %). Furthermore, capture efficiency for MyOne-2D12 was highly specific for L. monocytogenes and L. ivanovii. Subsequently, we captured L. monocytogenes by MyOne-2D12 and MyOne-3F8 from hotdogs inoculated with mono- or co-cultures of L. monocytogenes and L. innocua (10–40 CFU/g), enriched for 18 h and detected by fiber-optic sensor and confirmed by plating, light-scattering, and qPCR assays. The detection limit for L. monocytogenes and L. ivanovii by the fiber-optic immunosensor was 3 × 102 CFU/mL using MAb-2D12 as capture and reporter antibody. Selective media plating, light-scattering, and qPCR assays confirmed the IMS and fiber-optic results. Conclusions IMS coupled with a fiber-optic sensor using anti-InlA MAb is highly specific for L. monocytogenes and L. ivanovii and enabled detection of these pathogens at low levels from buffer or food. PMID:23176167
O'Neil, Heather S.; Forster, Brian M.; Roberts, Kari L.; Chambers, Andrew J.; Bitar, Alan Pavinski; Marquis, Hélène
2009-01-01
Integral to the virulence of the intracellular bacterial pathogen Listeria monocytogenes is its metalloprotease (Mpl). Mpl regulates the activity and compartmentalization of the bacterial broad-range phospholipase C (PC-PLC). Mpl is secreted as a proprotein that undergoes intramolecular autocatalysis to release its catalytic domain. In related proteases, the propeptide serves as a folding catalyst and can act either in cis or in trans. Propeptides can also influence protein compartmentalizati...
Superantigen and HLA-DR ligation induce phospholipase-C gamma 1 activation in class II+ T cells
DEFF Research Database (Denmark)
Kanner, S B; Odum, Niels; Grosmaire, L
1992-01-01
Bacterial enterotoxin superantigens bind directly to HLA class II molecules (HLA-DR) expressed on both APC and activated human T cells, and simultaneously bind to certain V beta chains of the TCR. In this report, we compared early T cell signaling events in human alloantigen-stimulated T cells when...... activated by HLA-DR ligation through antibody cross-linking or by direct enterotoxin superantigen binding. Both types of stimuli induced tyrosine phosphorylation of phosphatidylinositol-specific phospholipase C gamma 1 (PLC gamma 1) and an increase in intracellular calcium concentration; however......, superantigen-induced signaling was stronger than class II ligation alone. Antibody-mediated ligation of HLA-DR with CD3 resulted in augmented PLC gamma 1 activation and increased calcium mobilization, consistent with a mechanism of superantigen activity through a combination of class II and CD3/Ti signals...
Activation of oocyte phosphatidylinositol kinase by polyamines
International Nuclear Information System (INIS)
Allende, J.E.; Carrasco, D.; Allende, C.C.
1987-01-01
Membrane bound phosphatidylinositol is phosphorylated by a specific membrane enzyme to form phosphatidylinositol 4 phosphate (PIP) which in turn is again phosphorylated to generate phosphatidylinositol 4,5 biphosphate (PIPP). The regulation of phosphatidylinositol phosphorylation and hydrolysis is relevant to the possible role of inositol phosphates as second messengers of hormone action. The membranes of Xenopus laevis oocytes contain a phosphatidylinositol kinase that can generate radioactive PIP after incubation with [ 32 ATP]. The radioactive product is extracted with methanol-chloroform and isolated by thin layer chromatography. The oocyte enzyme has an app Km for ATP of 80 μM and cannot use GTP as a phosphate donor. The formation of PIP is greatly stimulated by the addition of synthetic peptides containing clusters of polylysine at concentrations 0.5 mM. A similar effect is observed with a lysine rich peptide that corresponds to the 14 amino acids of the carboxyl terminus of the Kirstein ras 2 protein and also by polyornithine. Polyarginine and histone H 1 have much lower effects. Peptides containing polylysine clusters have also been found to affect the activity of other key membrane enzymes such as protein kinases and adenylate cyclase
Wooten, D K; Teague, T K; McIntyre, B W
1999-01-01
In normal lymphocytes an inside-out signal up-regulating integrin adhesion is followed by a ligand-mediated outside-in cell spreading signal. Protein kinase C (PKC) inhibition blocks lymphocyte adherence to and spreading on fibronectin. In contrast, putative PLC inhibitors yield distinct differences with respect to adhesion and morphology. The phosphatidylinositol-specific phospholipase C (PLC) inhibitor neomycin blocked spreading of CD3/CD28-activated T cells on fibronectin by disrupting adhesion. Furthermore, when an additional inside-out signal for fibronectin adhesion is unnecessary such as with HPB-ALL T leukemic or phorbol-myristate-acetate-treated normal T cells, neomycin treatment does not alter adhesion or morphology. However, the phosphatidylcholine-specific PLC inhibitor D609 abrogates cell spreading without affecting adhesion to fibronectin in these cells as well as the CD3/CD28-activated T cells. These results strongly suggest that inside-out signaling for the integrin alpha4beta1 in lymphocytes proceeds through phosphatidylinositol-specific PLC and PKC, whereas the outside-in signal utilizes phosphatidylcholine-specific PLC and PKC.
Enhanced Activity and Altered Specificity of Phospholipase A2 by Deletion of a Surface Loop
Kuipers, Oscar P.; Thunnissen, Marjolein M.G.M.; Geus, Pieter de; Dijkstra, Bauke W.; Drenth, Jan; Verheij, Hubertus M.; Haas, Gerard H. de
1989-01-01
Protein engineering and x-ray crystallography have been used to study the role of a surface loop that is present in pancreatic phospholipases but is absent in snake venom phospholipases. Removal of residues 62 to 66 from porcine pancreatic phospholipase A2 does not change the binding constant for
Lineage specific recombination rates and microevolution in Listeria monocytogenes
Directory of Open Access Journals (Sweden)
Nightingale Kendra K
2008-10-01
Full Text Available Abstract Background The bacterium Listeria monocytogenes is a saprotroph as well as an opportunistic human foodborne pathogen, which has previously been shown to consist of at least two widespread lineages (termed lineages I and II and an uncommon lineage (lineage III. While some L. monocytogenes strains show evidence for considerable diversification by homologous recombination, our understanding of the contribution of recombination to L. monocytogenes evolution is still limited. We therefore used STRUCTURE and ClonalFrame, two programs that model the effect of recombination, to make inferences about the population structure and different aspects of the recombination process in L. monocytogenes. Analyses were performed using sequences for seven loci (including the house-keeping genes gap, prs, purM and ribC, the stress response gene sigB, and the virulence genes actA and inlA for 195 L. monocytogenes isolates. Results Sequence analyses with ClonalFrame and the Sawyer's test showed that recombination is more prevalent in lineage II than lineage I and is most frequent in two house-keeping genes (ribC and purM and the two virulence genes (actA and inlA. The relative occurrence of recombination versus point mutation is about six times higher in lineage II than in lineage I, which causes a higher genetic variability in lineage II. Unlike lineage I, lineage II represents a genetically heterogeneous population with a relatively high proportion (30% average of genetic material imported from external sources. Phylograms, constructed with correcting for recombination, as well as Tajima's D data suggest that both lineages I and II have suffered a population bottleneck. Conclusion Our study shows that evolutionary lineages within a single bacterial species can differ considerably in the relative contributions of recombination to genetic diversification. Accounting for recombination in phylogenetic studies is critical, and new evolutionary models that
Energy Technology Data Exchange (ETDEWEB)
Bielmann, Regula; Habann, Matthias; Eugster, Marcel R. [Institute of Food, Nutrition and Health, ETH Zurich, Schmelzbergstrasse 7, 8092 Zurich (Switzerland); Lurz, Rudi [Max-Planck Institute for Molecular Genetics, 14195 Berlin (Germany); Calendar, Richard [Department of Molecular and Cell Biology, University of California, Berkeley, CA 94720-3202 (United States); Klumpp, Jochen, E-mail: jochen.klumpp@hest.ethz.ch [Institute of Food, Nutrition and Health, ETH Zurich, Schmelzbergstrasse 7, 8092 Zurich (Switzerland); Loessner, Martin J. [Institute of Food, Nutrition and Health, ETH Zurich, Schmelzbergstrasse 7, 8092 Zurich (Switzerland)
2015-03-15
Adsorption of a bacteriophage to the host requires recognition of a cell wall-associated receptor by a receptor binding protein (RBP). This recognition is specific, and high affinity binding is essential for efficient virus attachment. The molecular details of phage adsorption to the Gram-positive cell are poorly understood. We present the first description of receptor binding proteins and a tail tip structure for the siphovirus group infecting Listeria monocytogenes. The host-range determining factors in two phages, A118 and P35 specific for L. monocytogenes serovar 1/2 have been determined. Two proteins were identified as RBPs in phage A118. Rhamnose residues in wall teichoic acids represent the binding ligands for both proteins. In phage P35, protein gp16 could be identified as RBP and the role of both rhamnose and N-acetylglucosamine in phage adsorption was confirmed. Immunogold-labeling and transmission electron microscopy allowed the creation of a topological model of the A118 phage tail. - Highlights: • We present the first description of receptor binding proteins and a tail tip structure for the Siphovirus group infecting Listeria monocytogenes. • The host-range determining factors in two phages, A118 and P35 specific for L. monocytogenes serovar 1/2 have been determined. • Rhamnose residues in wall teichoic acids represent the binding ligands for both receptor binding proteins in phage A118. • Rhamnose and N-acetylglucosamine are required for adsorption of phage P35. • We preset a topological model of the A118 phage tail.
Endo, Toshiaki; Yanagawa, Yuchio; Komatsu, Yukio
2016-02-01
To understand the functions of the neocortex, it is essential to characterize the properties of neurons constituting cortical circuits. Here, we focused on a distinct group of GABAergic neurons that are defined by a specific colocalization of intense labeling for both neuronal nitric oxide synthase (nNOS) and substance P (SP) receptor [neurokinin 1 (NK1) receptors]. We investigated the mechanisms of the SP actions on these neurons in visual cortical slices obtained from young glutamate decarboxylase 67-green fluorescent protein knock-in mice. Bath application of SP induced a nonselective cation current leading to depolarization that was inhibited by the NK1 antagonists in nNOS-immunopositive neurons. Ruthenium red and La(3+), transient receptor potential (TRP) channel blockers, suppressed the SP-induced current. The SP-induced current was mediated by G proteins and suppressed by D609, an inhibitor of phosphatidylcholine-specific phospholipase C (PC-PLC), but not by inhibitors of phosphatidylinositol-specific PLC, adenylate cyclase or Src tyrosine kinases. Ca(2+) imaging experiments under voltage clamp showed that SP induced a rise in intracellular Ca(2+) that was abolished by removal of extracellular Ca(2+) but not by depletion of intracellular Ca(2+) stores. These results suggest that SP regulates nNOS neurons by activating TRP-like Ca(2+)-permeable nonselective cation channels through a PC-PLC-dependent signaling pathway. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Van der Wiele, F C; Atsma, W; Roelofsen, B; van Linde, M; Van Binsbergen, J; Radvanyi, F; Raykova, D; Slotboom, A J; De Haas, G H
1988-03-08
Long-chain lecithins present in bilayer structures like vesicles or membranes are only very poor substrates for pancreatic phospholipases A2. This is probably due to the fact that pancreatic phospholipases A2 cannot penetrate into the densely packed bilayer structures. To improve the weak penetrating properties of pancreatic phospholipases A2, we prepared and characterized a number of pancreatic phospholipase A2 mutants that have various long acyl chains linked covalently to Lys116 in porcine and to Lys10 in bovine phospholipase A2 [Van der Wiele, F.C., Atsma, W., Dijkman, R., Schreurs, A.M.M., Slotboom, A.J., & De Haas, G.H. (1988) Biochemistry (preceding paper in this issue)]. When monomolecular surface layers of L- and D-didecanoyllecithin were used, it was found that the introduction of caprinic, lauric, palmitic, and oleic acid at Lys116 in the porcine enzyme increases its penetrating power from 13 to about 17, 20, 32, and 22 dyn/cm, respectively, before long lag periods were obtained. Incorporation of a palmitoyl moiety at Lys10 in the bovine enzyme shifted the penetrating power from 11 to about 25 dyn/cm. Only the best penetrating mutant, viz., porcine phospholipase A2 having a palmitoyl moiety at Lys116, was able to cause complete leakage of 6-carboxyfluorescein entrapped in small unilamellar vesicles of egg lecithin under nonhydrolytic conditions. Similarly, only this latter palmitoylphospholipase A2 completely hydrolyzed all lecithin in the outer monolayer of the human erythrocyte at a rate much faster than Naja naja phospholipase A2, the most powerful penetrating snake venom enzyme presently known.
Non-specific phospholipase C4 mediates response to aluminum toxicity in Arabidopsis thaliana
Directory of Open Access Journals (Sweden)
Přemysl ePejchar
2015-02-01
Full Text Available Aluminum ions (Al have been recognized as a major toxic factor for crop production in acidic soils. The first indication of the Al toxicity in plants is the cessation of root growth, but the mechanism of root growth inhibition is largely unknown. Here we examined the impact of Al on the expression, activity and function of the non-specific phospholipase C4 (NPC4, a plasma membrane-bound isoform of NPC, a member of the plant phospholipase family, in Arabidopsis thaliana.We observed a lower expression of NPC4 using GUS assay and a decreased formation of labeled diacylglycerol, product of NPC activity, using fluorescently labeled phosphatidylcholine as a phospholipase substrate in Arabidopsis WT seedlings treated with AlCl3 for 2 h. The effect on in situ NPC activity persisted for longer Al treatment periods (8, 14 h. Interestingly, in seedlings overexpressing NPC4, the Al-mediated NPC-inhibiting effect was alleviated at 14 h. However, in vitro activity and localization of NPC4 were not affected by Al, thus excluding direct inhibition by Al ions or possible translocation of NPC4 as the mechanisms involved in NPC-inhibiting effect. Furthermore, the growth of tobacco pollen tubes rapidly arrested by Al was partially rescued by the overexpression of AtNPC4 while Arabidopsis npc4 knockout lines were found to be more sensitive to Al stress during long-term exposure of Al at low phosphate conditions.Our observations suggest that NPC4 plays a role in both early and long-term responses to Al stress.
Directory of Open Access Journals (Sweden)
Cronin Michael
2008-06-01
Full Text Available Abstract Background The foodborne, gram-positive pathogen, Listeria monocytogenes, is capable of causing lethal infections in compromised individuals. In the post genomic era of L. monocytogenes research, techniques are required to identify and validate genes involved in the pathogenicity and environmental biology of the organism. The aim here was to develop a widely applicable method to tag L. monocytogenes strains, with a particular emphasis on the development of multiple strain competitive index assays. Results We have constructed a new site-specific integrative vector, pIMC, based on pPL2, for the selection of L. monocytogenes from complex samples. The pIMC vector was further modified through the incorporation of IPTG inducible markers (antibiotic and phenotypic to produce a suite of four vectors which allowed the discrimination of multiple strains from a single sample. We were able to perform murine infection studies with up to four EGDe isolates within a single mouse and showed that the tags did not impact upon growth rate or virulence. The system also allowed the identification of subtle differences in virulence between strains of L. monocytogenes commonly used in laboratory studies. Conclusion This study has developed a competitive index assay that can be broadly applied to all L. monocytogenes strains. Improved statistical robustness of the data was observed, resulting in fewer mice being required for virulence assays. The competitive index assays provide a powerful method to analyse the virulence or fitness of L. monocytogenes in complex biological samples.
Listeria monocytogenes as a vector for anti-cancer therapies.
LENUS (Irish Health Repository)
Tangney, Mark
2012-01-31
The intracellular pathogen Listeria monocytogenes represents a promising therapeutic vector for the delivery of DNA, RNA or protein to cancer cells or to prime immune responses against tumour-specific antigens. A number of biological properties make L. monocytogenes a promising platform for development as a vector for either gene therapy or as an anti-cancer vaccine vector. L. monocytogenes is particularly efficient in mediating internalization into host cells. Once inside cells, the bacterium produces specific virulence factors which lyse the vaculolar membrane and allow escape into the cytoplasm. Once in the cytosol, L. monocytogenes is capable of actin-based motility and cell-to-cell spread without an extracellular phase. The cytoplasmic location of L. monocytogenes is significant as this potentiates entry of antigens into the MHC Class I antigen processing pathway leading to priming of specific CD8(+) T cell responses. The cytoplasmic location is also beneficial for the delivery of DNA (bactofection) by L. monocytogenes whilst cell-to-cell spread may facilitate access of the vector to cells throughout the tumour. Several preclinical studies have demonstrated the ability of L. monocytogenes for intracellular gene or protein delivery in vitro and in vivo, and this vector has also displayed safety and efficacy in clinical trial. Here, we review the features of the L. monocytogenes host-pathogen interaction that make this bacterium such an attractive candidate with which to induce appropriate therapeutic responses. We focus primarily upon work that has led to attenuation of the pathogen, demonstrated DNA, RNA or protein delivery to tumour cells as well as research that shows the efficacy of L. monocytogenes as a vector for tumour-specific vaccine delivery.
Lev, Shaya; Katz, Ben; Tzarfaty, Vered; Minke, Baruch
2012-01-06
In Drosophila, a phospholipase C (PLC)-mediated signaling cascade, couples photo-excitation of rhodopsin to the opening of the transient receptor potential (TRP) and TRP-like (TRPL) channels. A lipid product of PLC, diacylglycerol (DAG), and its metabolites, polyunsaturated fatty acids (PUFAs) may function as second messengers of channel activation. However, how can one separate between the increase in putative second messengers, change in pH, and phosphatidylinositol 4,5-bisphosphate (PI(4,5)P(2)) depletion when exploring the TRPL gating mechanism? To answer this question we co-expressed the TRPL channels together with the muscarinic (M1) receptor, enabling the openings of TRPL channels via G-protein activation of PLC. To dissect PLC activation of TRPL into its molecular components, we used a powerful method that reduced plasma membrane-associated PI(4,5)P(2) in HEK cells within seconds without activating PLC. Upon the addition of a dimerizing drug, PI(4,5)P(2) was selectively hydrolyzed in the cell membrane without producing DAG, inositol trisphosphate, or calcium signals. We show that PI(4,5)P(2) is not an inhibitor of TRPL channel activation. PI(4,5)P(2) hydrolysis combined with either acidification or application of DAG analogs failed to activate the channels, whereas PUFA did activate the channels. Moreover, a reduction in PI(4,5)P(2) levels or inhibition of DAG lipase during PLC activity suppressed the PLC-activated TRPL current. This suggests that PI(4,5)P(2) is a crucial substrate for PLC-mediated activation of the channels, whereas PUFA may function as the channel activator. Together, this study defines a narrow range of possible mechanisms for TRPL gating.
Directory of Open Access Journals (Sweden)
Anne-Sophie eLeprince
2015-01-01
Full Text Available Plant adaptation to abiotic stresses such as drought and salinity involves complex regulatory processes. Deciphering the signalling components that are involved in stress signal transduction and cellular responses is of importance to understand how plants cope with salt stress. Accumulation of osmolytes such as proline is considered to participate in the osmotic adjustment of plant cells to salinity. Proline accumulation results from a tight regulation between its biosynthesis and catabolism. Lipid signal components such as phospholipases C and D have previously been shown to be involved in the regulation of proline metabolism in Arabidopsis thaliana. In this study, we demonstrate that proline metabolism is also regulated by class-III Phosphatidylinositol 3-kinase (PI3K, VPS34, which catalyses the formation of phosphatidylinositol 3-phosphate (PI3P from phosphatidylinositol. Using pharmacological and biochemical approaches, we show that the PI3K inhibitor, LY294002, affects PI3P levels in vivo and that it triggers a decrease in proline accumulation in response to salt treatment of A. thaliana seedlings. The lower proline accumulation is correlated with a lower transcript level of Pyrroline-5-carboxylate synthetase 1 biosynthetic enzyme and higher transcript and protein levels of Proline dehydrogenase 1 (ProDH1, a key-enzyme in proline catabolism. We also found that the ProDH1 expression is induced in a pi3k-hemizygous mutant, further demonstrating that PI3K is involved in the regulation of proline catabolism through transcriptional regulation of ProDH1. A broader metabolomic analysis indicates that LY294002 also reduced other metabolites, such as hydrophobic and aromatic amino acids and sugars like raffinose.
International Nuclear Information System (INIS)
Burch, R.M.; Axelrod, J.
1987-01-01
In Swiss 3T3 fibroblasts bradykinin stimulated inositol phosphate (InsP) formation and prostaglandin E 2 (PGE 2 ) synthesis. The EC 50 values for stimulation of PGE 2 synthesis and InsP formation by bradykinin were similar, 200 pM and 275 pM, respectively. Guanosine-5'-[γ-thio]triphosphate stimulated PGE 2 synthesis and InsP formation, and guanosine-5'-[β-thio]diphosphate inhibited both PGE 2 synthesis and InsP formation stimulated by bradykinin. Neither bradykinin-stimulated PGE 2 synthesis nor InsP formation was sensitive to pertussis toxin. Phorbol ester, dexamethasone, and cycloheximide distinguished between bradykinin-stimulated PGE 2 synthesis and InsP formation. Phorbol 12-myristate 13-acetate enhanced bradykinin-stimulated PGE 2 synthesis but inhibited bradykinin-stimulated InsP formation. Pretreatment of cells with dexamethasone for 24 hr inhibited bradykinin-stimulated PGE 2 synthesis but was without effect on bradykinin-stimulated InsP formation. Cycloheximide inhibited on bradykinin-stimulated InsP formation. When bradykinin was added to cells prelabeled with [ 3 H] choline, the phospholipase A 2 products lysophosphatidylcholine and glycerophosphocholine were generated. The data suggest that bradykinin receptors are coupled by GTP-binding proteins to both phospholipase C and phospholipase A 2 and that phospholipase A 2 is the enzyme that catalyzes release of arachidonate for prostaglandin synthesis
Isotype-specific inhibition of the phosphatidylinositol-3-kinase pathway in hematologic malignancies
Directory of Open Access Journals (Sweden)
Castillo JJ
2014-02-01
Full Text Available Jorge J Castillo,1 Meera Iyengar,2 Benjamin Kuritzky,2 Kenneth D Bishop2 1Division of Hematologic Malignancies, Dana-Farber Cancer Institute, Boston, MA, 2Division of Hematology and Oncology, Rhode Island Hospital, Providence, RI, USA Abstract: In the last decade, the advent of biological targeted therapies has revolutionized the management of several types of cancer, especially in the realm of hematologic malignancies. One of these pathways, and the center of this review, is the phosphatidylinositol-3-kinase (PI3K pathway. The PI3K pathway seems to play an important role in the pathogenesis and survival advantage in hematologic malignancies, such as leukemia, lymphoma, and myeloma. The objectives of the present review, hence, are to describe the current knowledge on the PI3K pathway and its isoforms, and to summarize preclinical and clinical studies using PI3K inhibitors, focusing on the advances made in hematologic malignancies. Keywords: phosphatidylinositol-3-kinase pathway, inhibitors, leukemia, lymphoma, myeloma
Plant phospholipase C family: Regulation and functional role in lipid signaling.
Singh, Amarjeet; Bhatnagar, Nikita; Pandey, Amita; Pandey, Girdhar K
2015-08-01
Phospholipase C (PLC), a major membrane phospholipid hydrolyzing enzyme generates signaling messengers such as diacylglycerol (DAG) and inositol 1,4,5-trisphosphate (IP3) in animals, and their phosphorylated forms such as phosphatidic acid (PA) and inositol hexakisphosphate (IP6) are thought to regulate various cellular processes in plants. Based on substrate specificity, plant PLC family is sub-divided into phosphatidylinositol-PLC (PI-PLC) and phosphatidylcholine-PLC (PC-PLC) groups. The activity of plant PLCs is regulated by various factors and the major ones include, Ca(2+) concentration, phospholipid substrate, post-translational modifications and interacting proteins. Most of the PLC members have been localized at the plasma membrane, suited for their function of membrane lipid hydrolysis. Several PLC members have been implicated in various cellular processes and signaling networks, triggered in response to a number of environmental cues and developmental events in different plant species, which makes them potential candidates for genetically engineering the crop plants for stress tolerance and enhancing the crop productivity. In this review article, we are focusing mainly on the plant PLC signaling and regulation, potential cellular and physiological role in different abiotic and biotic stresses, nutrient deficiency, growth and development. Copyright © 2015 Elsevier Ltd. All rights reserved.
Wasp venom proteins: phospholipase A1 and B.
King, T P; Kochoumian, L; Joslyn, A
1984-04-01
Three major venom proteins from different species of wasps have been isolated and characterized. They are hyaluronidase, phospholipase, and antigen 5 of as yet unknown biochemical function. These three proteins are allergens in wasp venom-sensitive persons. The species of wasps studied, of the genus Polistes, were annularis, carolina, exclamans, fuscatus, and instabilis. Antigen 5 and phospholipase from wasp venoms were shown to be antigenically distinct from homologous proteins of yellowjacket venoms. The venom phospholipase from wasp, as well as that from yellowjacket (Vespula germanica), appears to have dual enzymatic specificities of the A1 and B types. That is, hydrolysis takes place at the 1-acyl residue of phosphatidylcholine and at the 1- or 2-acyl residue of lysophosphatidylcholine.
International Nuclear Information System (INIS)
Baer, K.M.; Saibil, H.R.
1988-01-01
Light stimulates the hydrolysis of exogenous, [ 3 H]inositol-labeled phosphatidylinositol bisphosphate (PtdInsP2) added to squid photoreceptor membranes, releasing inositol trisphosphate (InsP3). At free calcium levels of 0.05 microM or greater, hydrolysis of the labeled lipid is stimulated up to 4-fold by GTP and light together, but not separately. This activity is the biochemical counterpart of observations on intact retina showing that a rhodopsin-activated GTP-binding protein is involved in visual transduction in invertebrates, and that InsP3 release is correlated with visual excitation and adaptation. Using an in vitro assay, we investigated the calcium and GTP dependence of the phospholipase activity. At calcium concentrations between 0.1 and 0.5 microM, some hydrolysis occurs independently of GTP and light, with a light- and GTP-activated component superimposed. At 1 microM calcium there is no background activity, and hydrolysis absolutely requires both GTP and light. Ion exchange chromatography on Dowex 1 (formate form) of the water-soluble products released at 1 microM calcium reveals that the product is almost entirely InsP3. Invertebrate rhodopsin is homologous in sequence and function to vertebrate visual pigment, which modulates the concentration of cyclic GMP through the mediation of the GTP-binding protein transducin. While there is some evidence that light also modulates PtdInsP2 content in vertebrate photoreceptors, the case for its involvement in phototransduction is stronger for the invertebrate systems. The results reported here support the scheme of rhodopsin----GTP-binding protein----phospholipase C activation in invertebrate photoreceptors
International Nuclear Information System (INIS)
Navidi, M.; MacQuarrie, R.A.; Sun, G.Y.
1990-01-01
The metabolism of phosphatidylinositols (PI) labeled with [14C]arachidonic acid within plasma membranes or synaptosomes was compared to the metabolism of PI prelabeled with [14C]arachidonic acid and added exogenously to the same membranes. Incubation of membranes containing the endogenously-labeled PI pool in the presence of Ca2+ resulted in the release of labeled arachidonic acid, as well as a small amount of labeled diacylglycerol. Labeled arachidonic acid was effectively reutilized and returned to the membrane phospholipids in the presence of adenosine triphosphate (ATP), CoA, and lysoPI. Although Ca2+ promoted the release of labeled diacylglycerol from prelabeled plasma membranes, this amount was only 17% of the maximal release, i.e., release in the presence of deoxycholate and Ca2+. This latter condition is known to fully activate the PI-phospholipase C, and incubation of prelabeled plasma membranes resulted in a six-fold increase in labeled diacylglycerols. On the other hand, when exogenously labeled PI were incubated with plasma membranes in the presence of Ca2+, the labeled diacylglycerols released were 59% of that compared to the fully activated condition. The phospholipase C action was calcium-dependent, regardless of whether exogenous or endogenous substrates were used in the incubation. In contrast to plasma membranes, intact synaptosomes had limited ability to metabolize exogenous PI even in the presence of Ca2+, although the activity of phospholipase C was similar to that in the plasma membranes when assayed in the presence of deoxycholate and Ca2+. These results suggest that discrete pools of PI are present in plasma membranes, and that the pool associated with the acyltransferase is apparently not readily accessible to hydrolysis by phospholipase C
Phospholipase B activity of a purified phospholipase A from Vipera palestinae venom.
Shiloah, J; Klibansky, C; de Vries, A; Berger, A
1973-05-01
Phospholipase was isolated (in two fractions) from Vipera palestinae venom and it was shown to possess phospholipase A activity (hydrolyzing diacyl-sn-glycerophosphorylcholines, e.g., lecithin, in the 2-position) as well as lysophospholipase (phospholipase B) activity (hydrolyzing 1-monoacyl-sn-glycerophosphorylcholines, e.g., lysolecithin, yielding free fatty acid and glycerophosphorylcholine). Each of the two purified enzyme fractions was homogeneous as judged by electrophoresis on acrylamide gel and by immunodiffusion and immunoelectrophoresis, and both had essentially equal activities. The ratio of the specific activity, at various purification stages, to the specific activity of the whole venom was the same for A activity (substrate lecithin) as for B activity (substrate lysolecithin). The enzyme has a molecular weight of 16,000, six S-S bridges, and no free thiol groups. At pH 7, dimerization was observed in the ultracentrifuge. A dissociation constant of about 10(-5) m was estimated. The amino acid composition for both fractions (140 amino acid residues) was found to be essentially the same. The A activity had a pH optimum at 9; B activity was low at this pH but increased steadily beyond pH 10.5. For the hydrolysis of lysolecithin the Lineweaver-Burk plot was found to be linear, giving K(m) = 1.1 mm and k(cat) = 0.55 sec(-1) at 37 degrees C and pH 10. 2-Deoxylysolecithin was also hydrolyzed by the enzyme at pH 10, with k(cat) = 0.01 sec(-1) (zero-order kinetics in the range 0.5-2.5 mm). For lecithin these constants could not be determined, but at 0.25 mm substrate the hydrolysis rate (at pH 9) of lecithin was about 1000 times the hydrolysis rate of lysolecithin (at pH 10).
Forster, Brian M; Bitar, Alan Pavinski; Marquis, Hélène
2014-01-01
Mpl, a thermolysin-like metalloprotease, and PC-PLC, a phospholipase C, are synthesized as proenzymes by the intracellular bacterial pathogen Listeria monocytogenes. During intracellular growth, L. monocytogenes is temporarily confined in a membrane-bound vacuole whose acidification leads to Mpl autolysis and Mpl-mediated cleavage of the PC-PLC N-terminal propeptide. Mpl maturation also leads to the secretion of both Mpl and PC-PLC across the bacterial cell wall. Previously, we identified negatively charged and uncharged amino acid residues within the N terminus of the PC-PLC propeptide that influence the ability of Mpl to mediate the maturation of PC-PLC, suggesting that these residues promote the interaction of the PC-PLC propeptide with Mpl. In the present study, we identified a non-catalytic histidine residue (H226) that influences Mpl secretion across the cell wall and its ability to process PC-PLC. Our results suggest that a positive charge at position 226 is required for Mpl functions other than autolysis. Based on the charge requirement at this position, we hypothesize that this residue contributes to the interaction of Mpl with the PC-PLC propeptide.
Recombinant phage probes for Listeria monocytogenes
Carnazza, S.; Gioffrè, G.; Felici, F.; Guglielmino, S.
2007-10-01
Monitoring of food and environmental samples for biological threats, such as Listeria monocytogenes, requires probes that specifically bind biological agents and ensure their immediate and efficient detection. There is a need for robust and inexpensive affinity probes as an alternative to antibodies. These probes may be recruited from random peptide libraries displayed on filamentous phage. In this study, we selected from two phage peptide libraries phage clones displaying peptides capable of specific and strong binding to the L. monocytogenes cell surface. The ability of isolated phage clones to interact specifically with L. monocytogenes was demonstrated using enzyme-linked immunosorbent assay (ELISA) and confirmed by co-precipitation assay. We also assessed the sensitivity of phage-bacteria binding by PCR on phage-captured Listeria cells, which could be detected at a concentration of 104 cells ml-1. In addition, as proof-of-concept, we tested the possibility of immobilizing the affinity-selected phages to a putative biosensor surface. The quality of phage deposition was monitored by ELISA and fluorescent microscopy. Phage-bacterial binding was confirmed by high power optical phase contrast microscopy. Overall, the results of this work validate the concept of affinity-selected recombinant filamentous phages as probes for detecting and monitoring bacterial agents under any conditions that warrant their recognition, including in food products.
Alpha 1-adrenergic stimulation of phosphatidylinositol turnover and respiration of brown fat cells
International Nuclear Information System (INIS)
Mohell, N.; Wallace, M.; Fain, J.N.
1984-01-01
The alpha-adrenergic agonist phenylephrine (in the presence of the beta-adrenergic antagonist alprenolol) stimulated respiration and incorporation of [ 3 H]glycerol and [ 32 P] P/sub i/ into phosphatidylinositol of hamster brown fat cells in a concentration-dependent manner. Both responses were preferentially inhibited by prazosin as compared with yohimbine, indicating alpha 1 specificity. Uniquely, prazosin inhibition of phenylephrine-stimulated phosphatidylinositol metabolism had two components, since 30% of the response was inhibited by less than 1 nM prazosin, 10 nM gave no further inhibition, and 100 nM prazosin completely inhibited the response. The phosphatidylinositol response was still present in Ca 2 +-free buffer, although reduced in magnitude. The concentration relationships of the effects of agonists and antagonists were compared with those of previous results of [ 3 H]prazosin binding and with phenylephrine potency to compete for binding. On the basis of these comparisons, it is suggested that the highly prazosin-sensitive part of the phosphatidylinositol response may be closely associated with receptor occupation
Incorporation of Listeria monocytogenes strains in raw milk biofilms.
Weiler, Christiane; Ifland, Andrea; Naumann, Annette; Kleta, Sylvia; Noll, Matthias
2013-02-01
Biofilms develop successively on devices of milk production without sufficient cleaning and originate from the microbial community of raw milk. The established biofilm matrices enable incorporation of pathogens like Listeria monocytogenes, which can cause a continuous contamination of food processing plants. L. monocytogenes is frequently found in raw milk and non-pasteurized raw milk products and as part of a biofilm community in milk meters and bulk milk tanks. The aim of this study was to analyze whether different L. monocytogenes strains are interacting with the microbial community of raw milk in terms of biofilm formation in the same manner, and to identify at which stage of biofilm formation a selected L. monocytogenes strain settles best. Bacterial community structure and composition of biofilms were analyzed by a cloning and sequencing approach and terminal restriction fragment length polymorphism analysis (T-RFLP) based on the bacterial 16S rRNA gene. The chemical composition of biofilms was analyzed by Fourier transform infrared spectroscopy (FTIR), while settled L. monocytogenes cells were quantified by fluorescence in situ hybridization (FISH). Addition of individual L. monocytogenes strains to raw milk caused significant shifts in the biofilm biomass, in the chemical as well as in the bacterial community composition. Biofilm formation and attachment of L. monocytogenes cells were not serotype but strain specific. However, the added L. monocytogenes strains were not abundant since mainly members of the genera Citrobacter and Lactococcus dominated the bacterial biofilm community. Overall, added L. monocytogenes strains led to a highly competitive interaction with the raw milk community and triggered alterations in biofilm formation. Copyright © 2012 Elsevier B.V. All rights reserved.
Klippel, A; Escobedo, J A; Fantl, W J; Williams, L T
1992-01-01
Upon stimulation by its ligand, the platelet-derived growth factor (PDGF) receptor associates with the 85-kDa subunit of phosphatidylinositol (PI) 3-kinase. The 85-kDa protein (p85) contains two Src homology 2 (SH2) domains and one SH3 domain. To define the part of p85 that interacts with the PDGF receptor, a series of truncated p85 mutants was analyzed for association with immobilized PDGF receptor in vitro. We found that a fragment of p85 that contains a single Src homology domain, the C-terminal SH2 domain (SH2-C), was sufficient for directing the high-affinity interaction with the receptor. Half-maximal binding of SH2-C to the receptor was observed at an SH2-C concentration of 0.06 nM. SH2-C, like full-length p85, was able to distinguish between wild-type PDGF receptor and a mutant receptor lacking the PI 3-kinase binding site. An excess of SH2-C blocked binding of full-length p85 and PI 3-kinase to the receptor but did not interfere with the binding of two other SH2-containing proteins, phospholipase C-gamma and GTPase-activating protein. These results demonstrate that a region of p85 containing a single SH2 domain accounts both for the high affinity and specificity of binding of PI 3-kinase to the PDGF receptor. Images PMID:1312663
Recombinant phage probes for Listeria monocytogenes
Energy Technology Data Exchange (ETDEWEB)
Carnazza, S; Gioffre, G; Felici, F; Guglielmino, S [Department of Microbiological, Genetic and Molecular Sciences, University of Messina, Messina (Italy)
2007-10-03
Monitoring of food and environmental samples for biological threats, such as Listeria monocytogenes, requires probes that specifically bind biological agents and ensure their immediate and efficient detection. There is a need for robust and inexpensive affinity probes as an alternative to antibodies. These probes may be recruited from random peptide libraries displayed on filamentous phage. In this study, we selected from two phage peptide libraries phage clones displaying peptides capable of specific and strong binding to the L. monocytogenes cell surface. The ability of isolated phage clones to interact specifically with L. monocytogenes was demonstrated using enzyme-linked immunosorbent assay (ELISA) and confirmed by co-precipitation assay. We also assessed the sensitivity of phage-bacteria binding by PCR on phage-captured Listeria cells, which could be detected at a concentration of 10{sup 4} cells ml{sup -1}. In addition, as proof-of-concept, we tested the possibility of immobilizing the affinity-selected phages to a putative biosensor surface. The quality of phage deposition was monitored by ELISA and fluorescent microscopy. Phage-bacterial binding was confirmed by high power optical phase contrast microscopy. Overall, the results of this work validate the concept of affinity-selected recombinant filamentous phages as probes for detecting and monitoring bacterial agents under any conditions that warrant their recognition, including in food products.
International Nuclear Information System (INIS)
Morrison, W.J.
1988-01-01
The major objectives of this study were two-fold. The first was to establish whether binding of platelet activating factor (PAF) to its receptor was integral to the stimulation of polyphosphoinositide-specific phospholipase C (PLC) in rabbit platelets. The second was to determine regulatory features of this receptor-coupled mechanism. [ 3 H]PAF binding demonstrated two binding sites, a high affinity site with a inhibitory constant (Ki) of 2.65 nM and a low affinity site with a Ki of 0.80 μM. PAF receptor coupled activation of phosphoinositide-specific PLC was studied in platelets which were made refractory, by short term pretreatments, to either PAF or thrombin. Saponin-permeabilized rabbit platelets continue to regulate the mechanism(s) coupling PAF receptors to PLC stimulation. However, TRPγS and GDPβS, which affect guanine nucleotide regulatory protein functions, were unable to modulate the PLC activity to any appreciable extent as compared to PAF. The possible involvement of protein kinase C (PKC) activation in regulating PAF-stimulated PLC activity was studied in rabbit platelets pretreated with staurosporine followed by pretreatments with PAF or phorbol 12-myristate 13-acetate (PMA)
[Risk assessment of Listeria monocytogenes in deli meats and vegetable salads].
Tian, Jing; Liu, Xiu-mei
2009-09-01
To analysis risk from Listeria monocytogenes in deli meats and vegetable salads. Use Risk Ranger which is a software programme developed by the University of Hobart, Australia and answer 11 questions on affecting the risk from hazards in the specific foods by combining data from national foodborne diseases surveillance network and some references to make semi-quantitative risk assessment for the specific food. Relative risk from Listeria monocytogenes in deli meats and vegetable salads is 61 and 52, respectively. Incidence of listeriosis caused by deli meats-Listeria monocytogenes pairs and vegetable salads-Listeria monocytogenes pairs is 5.4 and 0.2 cases per million people, respectively. Risk from the former is 32 times than that from the latter. By changing the selection for some risk factors in the model, it was known that the risks from two food-hazard combinations could decrease 10 times, if taking necessary actions after processing. Deli meats is a kind of high risk food for listeriosis.
Hsu, Po-Yuan; Lee, Kuo-Kau; Hu, Chih-Chuang; Liu, Ping-Chung
2014-09-01
Toxicity of the extracellular products (ECPs) and the lethal attributes of phospholipase secreted by pathogenic Photobacterium damselae subsp. piscicida from cobia Rachycentron canadum was studied. An extracellular lethal toxin in the ECPs was partially purified by using Fast Protein Liquid Chromatography system. A protein band (27 kDa) exhibited phospholipase activity on Native-PAGE (by 0.3% egg yolk agar-overlay), was excised and eluted. The pI value of the purified phospholipase was determined as 3.65 and was determined as a phospholipase C by using the Amplex™ Red phosphatidylcholine -Specific phospholipase C Assay kit. The phospholipase showed maximum activity at temperature around 4-40 °C and maximal activity at pH between 8 and 9. The enzyme was inhibited by ethylenediamine-tetraacetic acid (EDTA) and sodium dodecyl sulfate (SDS); but was activated by Ca(2+) and Mg(2+) and inactivated by Zn(2+) and Cu(2+) . Both the ECPs and phospholipase were hemolytic against erythrocytes of cobia and lethal to the fish with LD50 values of 3.25 and 0.91 µg protein g(-1) fish, respectively. In toxicity neutralization test, the rabbit antisera against the phospholipase could neutralize the toxicity of ECPs, indicating that the phospholipase is a major extracellular toxin produced by the bacterium. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Chayakulkeeree, Methee; Johnston, Simon Andrew; Oei, Johanes Bijosono; Lev, Sophie; Williamson, Peter Richard; Wilson, Christabel Frewen; Zuo, Xiaoming; Leal, Ana Lusia; Vainstein, Marilene Henning; Meyer, Wieland; Sorrell, Tania Christine; May, Robin Charles; Djordjevic, Julianne Teresa
2011-01-01
Summary Secreted phospholipase B1 (CnPlb1) is essential for dissemination of Cryptococcus neoformans to the central nervous system (CNS) yet essential components of its secretion machinery remain to be elucidated. Using gene deletion analysis we demonstrate that CnPlb1 secretion is dependent on the CnSEC14 product, CnSec14-1p. CnSec14-1p is a homologue of the phosphatidylinositol transfer protein (PITP) ScSec14p, which is essential for secretion and viability in Saccharomyces cerevisiae. In contrast to CnPlb1, neither laccase 1 (Lac1)-induced melanization within the cell wall nor capsule induction were negatively impacted in CnSEC14-1 deletion mutants (CnΔsec14-1 and CnΔsec14-1CnΔsfh5). Similar to the CnPLB1 deletion mutant (CnΔplb1), CnΔsec14-1 was hypo-virulent in mice and did not disseminate to the CNS by day 14 post infection. Furthermore, macrophage expulsion of live CnΔsec14-1 and CnΔplb1 (vomocytosis) was reduced. Individual deletion of CnSEC14-2, a closely-related CnSEC14-1 homologue, and CnSFH5, a distantly-related SEC fourteen-like homologue, did not abrogate CnPlb1 secretion or virulence. However, reconstitution of CnΔsec14-1 with CnSEC14-1 or CnSEC14-2 restored both phenotypes, consistent with functional genetic redundancy. We conclude that CnPlb1 secretion is SEC14-dependent and that C. neoformans preferentially exports virulence determinants to the cell periphery via distinct pathways. We also demonstrate that CnPlb1 secretion is essential for vomocytosis. PMID:21453402
Fødevarebetinget listeria monocytogenes endokarditis
DEFF Research Database (Denmark)
Frydland, Martin; Bundgaard, Henning; Moser, Claus
2014-01-01
Infection with Listeria monocytogenes is rare and mainly seen in immunosuppressed patients. Infection with L. monocytogenes has a mortality rate of 30%. We present a case report of L. monocytogenes bacteraemia and endocarditis in a 70-year-old man with several co-morbidities and following four...... major surgical procedures. This illustrates the findings and characteristics in one of the 16 patients who died in 2013 and 2014 this summer due to sausage-related L. monocytogenes infection....
Assay strategies and methods for phospholipases
International Nuclear Information System (INIS)
Reynolds, L.J.; Washburn, W.N.; Deems, R.A.; Dennis, E.A.
1991-01-01
Of the general considerations discussed, the two issues which are most important in choosing an assay are (1) what sensitivity is required to assay a particular enzyme and (2) whether the assay must be continuous. One can narrow the options further by considering substrate availability, enzyme specificity, assay convenience, or the presence of incompatible side reactions. In addition, the specific preference of a particular phospholipase for polar head group, micellar versus vesicular substrates, and anionic versus nonionic detergents may further restrict the options. Of the many assays described in this chapter, several have limited applicability or serious drawbacks and are not commonly employed. The most commonly used phospholipase assays are the radioactive TLC assay and the pH-stat assay. The TLC assay is probably the most accurate, sensitive assay available. These aspects often outweigh the disadvantages of being discontinuous, tedious, and expensive. The radioactive E. coli assay has become popular recently as an alternative to the TLC assay for the purification of the mammalian nonpancreatic phospholipases. The assay is less time consuming and less expensive than the TLC assay, but it is not appropriate when careful kinetics are required. Where less sensitivity is needed, or when a continuous assay is necessary, the pH-stat assay is often employed. With purified enzymes, when free thiol groups are not present, a spectrophotometric thiol assay can be used. This assay is ∼ as sensitive as the pH-stat assay but is more convenient and more reproducible, although the substrate is not available commercially. Despite the many assay choices available, the search continues for a convenient, generally applicable assay that is both sensitive and continuous
Drayer, A. Lyndsay; Kaay, Jeroen van der; Mayr, Georg W.; Haastert, Peter J.M. van
1994-01-01
The micro-organism Dictyostelium uses extracellular cAMP to induce chemotaxis and cell differentiation. Signals are transduced via surface receptors, which activate G proteins, to effector enzymes. The deduced protein sequence of Dictyostelium discoideum phosphabidylinositol-specific phospholipase C
Listeria monocytogenes in Fresh Produce: Outbreaks, Prevalence and Contamination Levels
Directory of Open Access Journals (Sweden)
Qi Zhu
2017-03-01
Full Text Available Listeria monocytogenes, a member of the genus Listeria, is widely distributed in agricultural environments, such as soil, manure and water. This organism is a recognized foodborne pathogenic bacterium that causes many diseases, from mild gastroenteritis to severe blood and/or central nervous system infections, as well as abortion in pregnant women. Generally, processed ready-to-eat and cold-stored meat and dairy products are considered high-risk foods for L. monocytogenes infections that cause human illness (listeriosis. However, recently, several listeriosis outbreaks have been linked to fresh produce contamination around the world. Additionally, many studies have detected L. monocytogenes in fresh produce samples and even in some minimally processed vegetables. Thus L. monocytogenes may contaminate fresh produce if present in the growing environment (soil and water. Prevention of biofilm formation is an important control measure to reduce the prevalence and survival of L. monocytogenes in growing environments and on fresh produce. This article specifically focuses on fresh produce–associated listeriosis outbreaks, prevalence in growing environments, contamination levels of fresh produce, and associated fresh produce safety challenges.
Effects of dexamethasone on palate mesenchymal cell phospholipase activity
International Nuclear Information System (INIS)
Bulleit, R.F.; Zimmerman, E.F.
1984-01-01
Corticosteroids will induce cleft palate in mice. One suggested mechanism for this effect is through inhibition of phospholipase activity. This hypothesis was tested by measuring the effects of dexamethasone, a synthetic corticosteroid, on phospholipase activity in cultures of palate mesenchymal cells. Palate mesenchymal cells were prelabeled with [3H]arachidonic acid. The cells were subsequently treated with various concentrations of dexamethasone. Concurrently, cultures of M-MSV-transformed 3T3 cells were prepared identically. After treatment, phospholipase activity was stimulated by the addition of serum or epidermal growth factor (EGF), and radioactivity released into the medium was taken as a measure of phospholipase activity. Dexamethasone (1 X 10(-5) or 1 X 10(-4) M) could inhibit serum-stimulated phospholipase activity in transformed 3T3 cells after 1 to 24 hr of treatment. However, no inhibition of activity was measured in palate mesenchymal cells following this period of treatment. Not until 120 hr of treatment with dexamethasone (1 X 10(-4) M) was any significant inhibition of serum-stimulated phospholipase activity observed in palate mesenchymal cells. When EGF was used to stimulate phospholipase activity, dexamethasone (1 X 10(-5) M) caused an increase in phospholipase activity in palate mesenchymal cells. These observations suggested that phospholipase in transformed 3T3 cells was sensitive to inhibition by dexamethasone. However, palate mesenchymal cell phospholipase is only minimally sensitive to dexamethasone, and in certain instances can be enhanced. These results cannot support the hypothesis that corticosteroids mediate their teratogenic effect via inhibition of phospholipase activity
Horrevoets, A J; Hackeng, T M; Verheij, H M; Dijkman, R; de Haas, G H
1989-02-07
The substrate specificity of Escherichia coli outer membrane phospholipase A was analyzed in mixed micelles of lipid with deoxycholate or Triton X-100. Diglycerides, monoglycerides, and Tweens 40 and 85 in Triton X-100 are hydrolyzed at rates comparable to those of phospholipids and lysophospholipids. p-Nitrophenyl esters of fatty acids with different chain lengths and triglycerides are not hydrolyzed. The minimal substrate characteristics consist of a long acyl chain esterified to a more or less hydrophilic headgroup as is the case for the substrate monopalmitoylglycol. Binding occurs via the hydrocarbon chain of the substrate; diacyl compounds are bound three to five times better than monoacyl compounds. When acting on lecithins, phospholipase A1 activity is six times higher than phospholipase A2 activity or 1-acyl lysophospholipase activity. Activity on the 2-acyl lyso compound is about two times less than that on the 1-acyl lysophospholipid. The enzyme therefore has a clear preference for the primary ester bond of phospholipids. In contrast to phospholipase A1 activity, phospholipase A2 activity is stereospecific. Only the L isomer of a lecithin analogue in which the primary acyl chain was replaced by an alkyl ether group is hydrolyzed. The D isomer of this analogue is a competitive inhibitor, bound with the same affinity as the L isomer. On these ether analogues the enzyme shows the same preference for the primary acyl chain as with the natural diester phospholipids. Despite its broad specificity, the enzyme will initially act as a phospholipase A1 in the E. coli envelope where it is embedded in phospholipids.
Cysteine Biosynthesis Controls Serratia marcescens Phospholipase Activity.
Anderson, Mark T; Mitchell, Lindsay A; Mobley, Harry L T
2017-08-15
Serratia marcescens causes health care-associated opportunistic infections that can be difficult to treat due to a high incidence of antibiotic resistance. One of the many secreted proteins of S. marcescens is the PhlA phospholipase enzyme. Genes involved in the production and secretion of PhlA were identified by screening a transposon insertion library for phospholipase-deficient mutants on phosphatidylcholine-containing medium. Mutations were identified in four genes ( cyaA , crp , fliJ , and fliP ) that are involved in the flagellum-dependent PhlA secretion pathway. An additional phospholipase-deficient isolate harbored a transposon insertion in the cysE gene encoding a predicted serine O -acetyltransferase required for cysteine biosynthesis. The cysE requirement for extracellular phospholipase activity was confirmed using a fluorogenic phospholipase substrate. Phospholipase activity was restored to the cysE mutant by the addition of exogenous l-cysteine or O -acetylserine to the culture medium and by genetic complementation. Additionally, phlA transcript levels were decreased 6-fold in bacteria lacking cysE and were restored with added cysteine, indicating a role for cysteine-dependent transcriptional regulation of S. marcescens phospholipase activity. S. marcescens cysE mutants also exhibited a defect in swarming motility that was correlated with reduced levels of flhD and fliA flagellar regulator gene transcription. Together, these findings suggest a model in which cysteine is required for the regulation of both extracellular phospholipase activity and surface motility in S. marcescens IMPORTANCE Serratia marcescens is known to secrete multiple extracellular enzymes, but PhlA is unusual in that this protein is thought to be exported by the flagellar transport apparatus. In this study, we demonstrate that both extracellular phospholipase activity and flagellar function are dependent on the cysteine biosynthesis pathway. Furthermore, a disruption of cysteine
International Nuclear Information System (INIS)
Bonetti, A.C.; Canonico, P.L.; MacLeod, R.M.
1985-01-01
The in vitro effect of bovine brain cortex phosphatidylserine on 32 Pi incorporation into phosphatidylinositol, phosphatidylcholine, and phosphatidylethanolamine of rat anterior pituitary glands was studied. Phosphatidylserine (0.1 to 66.6 microM) decreased the incorporation of 32 Pi into phosphatidylinositol, but not phosphatidylcholine or phosphatidylethanolamine, in a concentration-related manner. The inhibitory effect of phosphatidylinositol was similar to that of dopamine in the same experimental conditions. The combined effects of submaximal concentrations of dopamine and phosphatidylserine elicited an apparently additive inhibitory effect on phosphatidylinositol synthesis. The inhibitory effect of phosphatidylserine was completely reversed by haloperidol and sulpiride and only partially by pimozide, antidopaminergic agents which per se do not affect phosphatidylinositol synthesis. The stimulatory effect of TRH to increase 32 Pi incorporation into phosphatidylinositol was decreased by phosphatidylserine. These observations suggest that the decrease in prolactin release in the presence of phosphatidylserine may be evoked through a dopaminergic mechanism
The binding of activated Gαq to phospholipase C-β exhibits anomalous affinity.
Navaratnarajah, Punya; Gershenson, Anne; Ross, Elliott M
2017-10-06
Upon activation by the G q family of Gα subunits, Gβγ subunits, and some Rho family GTPases, phospholipase C-β (PLC-β) isoforms hydrolyze phosphatidylinositol 4,5-bisphosphate to the second messengers inositol 1,4,5-trisphosphate and diacylglycerol. PLC-β isoforms also function as GTPase-activating proteins, potentiating G q deactivation. To elucidate the mechanism of this mutual regulation, we measured the thermodynamics and kinetics of PLC-β3 binding to Gα q FRET and fluorescence correlation spectroscopy, two physically distinct methods, both yielded K d values of about 200 nm for PLC-β3-Gα q binding. This K d is 50-100 times greater than the EC 50 for Gα q -mediated PLC-β3 activation and for the Gα q GTPase-activating protein activity of PLC-β. The measured K d was not altered either by the presence of phospholipid vesicles, phosphatidylinositol 4,5-bisphosphate and Ca 2+ , or by the identity of the fluorescent labels. FRET-based kinetic measurements were also consistent with a K d of 200 nm We determined that PLC-β3 hysteresis, whereby PLC-β3 remains active for some time following either Gα q -PLC-β3 dissociation or PLC-β3-potentiated Gα q deactivation, is not sufficient to explain the observed discrepancy between EC 50 and K d These results indicate that the mechanism by which Gα q and PLC-β3 mutually regulate each other is far more complex than a simple, two-state allosteric model and instead is probably kinetically determined. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
Radiochromatographic assay of N-acyl-phosphatidylethanolamine-specific phospholipase D activity.
Fezza, Filomena; Gasperi, Valeria; Mazzei, Cinzia; Maccarrone, Mauro
2005-04-01
A radiochromatographic method has been set up to assay the activity of N-acyl-phosphatidylethanolamine-specific phospholipase D (NAPE-PLD), based on reversed-phase high-performance liquid chromatography (HPLC) and online scintillation counting. The anandamide (N-arachidonoylethanolamine, AEA), product released by NAPE-PLD from the N-arachidonoyl-phosphatidylethanolamine (NArPE) substrate, was separated using a C18 column eluted with methanol-water-acetic acid and was quantified with an external standard method. Baseline separation of AEA and NArPE was completed in less than 15 min, with a detection limit of 0.5 fmol AEA at a signal-to-noise ratio of 4:1. The sensitivity and accuracy of the radiochromatographic procedure allowed detection and characterization of NAPE-PLD activity in very tiny tissue samples or in samples where the enzymatic activity is very low. With this method, we could determine the kinetic constants (i.e., apparent Michaelis-Menten constant (Km) of 40.0+/-5.6 microM and maximum velocity (Vmax) of 22.2+/-3.5 pmol/min per milligram protein toward NArPE) and the distribution of NAPE-PLD activity in brain areas and peripheral tissues of mouse. In addition, we could collect unprecedented evidence that compounds widely used in studies of the endocannabinoid system (e.g., AEA and congeners, receptor a(nta)gonists and inhibitors of AEA degradation) can also affect NAPE-PLD activity.
International Nuclear Information System (INIS)
Hostetler, K.Y.; Gardner, M.F.; Giordano, J.R.
1986-01-01
Phospholipase A has been isolated from a crude lysosomal fraction from rat kidney cortex and purified 7600-fold with a recovery of 9.8% of the starting activity. The purified enzyme is a glycoprotein having an isoelectric point of pH 5.4 and an apparent molecular weight of 30,000 by high-pressure liquid chromatography gel permeation. Naturally occurring inhibitors of lysosomal phospholipase A are present in two of the lysosomal-soluble protein fractions obtained in the purification. They inhibit hydrolysis of 1,2-di[1- 14 C]oleoylphosphatidylcholine by purified phospholipase A 1 with IC 50 values of 7-11 μg. The inhibition is abolished by preincubation with trypsin at 37 0 C, but preincubation with trypsin at 4 0 C has no effect, providing evidence that the inhibitors are proteins. The results suggest that the activity of lysosomal phospholipase A may be regulated in part by inhibitory proteins. Lysosomal phospholipase A from rat kidney hydrolyzes the sn-1 acyl group of phosphatidylcholine, does not require divalent cations for full activity, and is not inhibited by ethylenediaminetetraacetic acid. It has an acid pH optimum of 3.6-3.8. Neither rho-bromophenacyl bromide, diisopropyl fluorophosphate, nor mercuric ion inhibits phospholipase A 1 . In contrast to rat liver, which has two major isoenzymes of acid phospholipase A 1 , kidney cortex has only one isoenzyme of lysosomal phospholipase A 1
Energy Technology Data Exchange (ETDEWEB)
Hostetler, K.Y.; Gardner, M.F.; Giordano, J.R.
1986-10-21
Phospholipase A has been isolated from a crude lysosomal fraction from rat kidney cortex and purified 7600-fold with a recovery of 9.8% of the starting activity. The purified enzyme is a glycoprotein having an isoelectric point of pH 5.4 and an apparent molecular weight of 30,000 by high-pressure liquid chromatography gel permeation. Naturally occurring inhibitors of lysosomal phospholipase A are present in two of the lysosomal-soluble protein fractions obtained in the purification. They inhibit hydrolysis of 1,2-di(1-/sup 14/C)oleoylphosphatidylcholine by purified phospholipase A/sub 1/ with IC/sub 50/ values of 7-11 ..mu..g. The inhibition is abolished by preincubation with trypsin at 37/sup 0/C, but preincubation with trypsin at 4/sup 0/C has no effect, providing evidence that the inhibitors are proteins. The results suggest that the activity of lysosomal phospholipase A may be regulated in part by inhibitory proteins. Lysosomal phospholipase A from rat kidney hydrolyzes the sn-1 acyl group of phosphatidylcholine, does not require divalent cations for full activity, and is not inhibited by ethylenediaminetetraacetic acid. It has an acid pH optimum of 3.6-3.8. Neither rho-bromophenacyl bromide, diisopropyl fluorophosphate, nor mercuric ion inhibits phospholipase A/sub 1/. In contrast to rat liver, which has two major isoenzymes of acid phospholipase A/sub 1/, kidney cortex has only one isoenzyme of lysosomal phospholipase A/sub 1/.
Chen, Bang-Yuan; Pyla, Rajkumar; Kim, Tae-Jo; Silva, Juan L; Jung, Yean-Sung
2010-08-01
Catfish skins, intestines, fresh fillets, processing surfaces at different production stages, chiller water and non-food contact surfaces were sampled for Listeria monocytogenes and other Listeria species. Among 315 samples, prevalence of L. monocytogenes, Listeria innocua and a group of Listeria seeligeri-Listeria welshimeri-Listeria ivanovii was 21.6, 13.0 and 29.5%, respectively. No Listeria grayi was detected in this survey. While no L. monocytogenes strains were isolated from catfish skins and intestines, the strains were found with a frequency of 76.7% in chilled fresh catfish fillets and 43.3% in unchilled fillets. L. monocytogenes and Listeria spp. were also detected in fish contact surfaces such as deheading machine, trimming board, chiller water, conveyor belts at different stages, and fillet weighing table. Among L. monocytogenes, 1/2b (47.0%), 3b (16.0%) and 4c (14%) were the predominant serotypes isolated, whereas 4b, 4e, 1/2c and 1/2a were detected at much lower frequencies. Genotype analyses of L. monocytogenes isolates using serotyping, pulsed-field gel electrophoresis (PFGE) and enterobacterial repetitive intergenic consensus (ERIC)-PCR revealed that chiller water represented an important contamination source of L. monocytogenes in the chilled catfish fillets of two processing facilities, whereas fillet weighing table significantly contributed to the catfish fillet contamination of the third facility. This study suggests that L. monocytogenes contamination in the processed catfish fillets originates from the processing environment, rather than directly from catfish. Results from this study can aid the catfish industry to develop a plant-specific proper cleaning and sanitation procedure for equipment and the processing environment designed to specifically target L. monocytogenes contamination. Copyright 2010 Elsevier Ltd. All rights reserved.
International Nuclear Information System (INIS)
Kouchi, Zen; Fujiwara, Yuki; Yamaguchi, Hideki; Nakamura, Yoshikazu; Fukami, Kiyoko
2011-01-01
Highlights: → We analyzed Phosphatidylinositol 5-phosphate kinase IIβ (PIPKIIβ) function in cancer. → PIPKIIβ is required for vitamin D receptor-mediated E-cadherin upregulation in SW480. → PIPKIIβ suppresses cellular motility through E-cadherin induction in SW480 cells. → Nuclear PIP 2 but not plasma membrane-localized PIP 2 mediates E-cadherin upregulation. -- Abstract: Numerous epidemiological data indicate that vitamin D receptor (VDR) signaling induced by its ligand or active metabolite 1α,25-dihydroxyvitamin D 3 (1α,25(OH) 2 D 3 ) has anti-cancer activity in several colon cancers. 1α,25(OH) 2 D 3 induces the epithelial differentiation of SW480 colon cancer cells expressing VDR (SW480-ADH) by upregulating E-cadherin expression; however, its precise mechanism remains unknown. We found that phosphatidylinositol-5-phosphate 4-kinase type II beta (PIPKIIβ) but not PIPKIIα is required for VDR-mediated E-cadherin induction in SW480-ADH cells. The syntenin-2 postsynaptic density protein/disc large/zona occludens (PDZ) domain and pleckstrin homology domain of phospholipase C-delta1 (PLCδ1 PHD) possess high affinity for phosphatidylinositol-4,5-bisphosphate (PI(4,5)P 2 ) mainly localized to the nucleus and plasma membrane, respectively. The expression of syntenin-2 PDZ but not PLCδ1 PHD inhibited 1α,25(OH) 2 D 3 -induced E-cadherin upregulation, suggesting that nuclear PI(4,5)P 2 production mediates E-cadherin expression through PIPKIIβ in a VDR-dependent manner. PIPKIIβ is also involved in the suppression of the cell motility induced by 1α,25(OH) 2 D 3 . These results indicate that PIPKIIβ-mediated PI(4,5)P 2 signaling is important for E-cadherin upregulation and inhibition of cellular motility induced by VDR activation.
Recombinant Lipases and Phospholipases and Their Use as Biocatalysts for Industrial Applications.
Borrelli, Grazia M; Trono, Daniela
2015-09-01
Lipases and phospholipases are interfacial enzymes that hydrolyze hydrophobic ester linkages of triacylglycerols and phospholipids, respectively. In addition to their role as esterases, these enzymes catalyze a plethora of other reactions; indeed, lipases also catalyze esterification, transesterification and interesterification reactions, and phospholipases also show acyltransferase, transacylase and transphosphatidylation activities. Thus, lipases and phospholipases represent versatile biocatalysts that are widely used in various industrial applications, such as for biodiesels, food, nutraceuticals, oil degumming and detergents; minor applications also include bioremediation, agriculture, cosmetics, leather and paper industries. These enzymes are ubiquitous in most living organisms, across animals, plants, yeasts, fungi and bacteria. For their greater availability and their ease of production, microbial lipases and phospholipases are preferred to those derived from animals and plants. Nevertheless, traditional purification strategies from microbe cultures have a number of disadvantages, which include non-reproducibility and low yields. Moreover, native microbial enzymes are not always suitable for biocatalytic processes. The development of molecular techniques for the production of recombinant heterologous proteins in a host system has overcome these constraints, as this allows high-level protein expression and production of new redesigned enzymes with improved catalytic properties. These can meet the requirements of specific industrial process better than the native enzymes. The purpose of this review is to give an overview of the structural and functional features of lipases and phospholipases, to describe the recent advances in optimization of the production of recombinant lipases and phospholipases, and to summarize the information available relating to their major applications in industrial processes.
Recombinant Lipases and Phospholipases and Their Use as Biocatalysts for Industrial Applications
Directory of Open Access Journals (Sweden)
Grazia M. Borrelli
2015-09-01
Full Text Available Lipases and phospholipases are interfacial enzymes that hydrolyze hydrophobic ester linkages of triacylglycerols and phospholipids, respectively. In addition to their role as esterases, these enzymes catalyze a plethora of other reactions; indeed, lipases also catalyze esterification, transesterification and interesterification reactions, and phospholipases also show acyltransferase, transacylase and transphosphatidylation activities. Thus, lipases and phospholipases represent versatile biocatalysts that are widely used in various industrial applications, such as for biodiesels, food, nutraceuticals, oil degumming and detergents; minor applications also include bioremediation, agriculture, cosmetics, leather and paper industries. These enzymes are ubiquitous in most living organisms, across animals, plants, yeasts, fungi and bacteria. For their greater availability and their ease of production, microbial lipases and phospholipases are preferred to those derived from animals and plants. Nevertheless, traditional purification strategies from microbe cultures have a number of disadvantages, which include non-reproducibility and low yields. Moreover, native microbial enzymes are not always suitable for biocatalytic processes. The development of molecular techniques for the production of recombinant heterologous proteins in a host system has overcome these constraints, as this allows high-level protein expression and production of new redesigned enzymes with improved catalytic properties. These can meet the requirements of specific industrial process better than the native enzymes. The purpose of this review is to give an overview of the structural and functional features of lipases and phospholipases, to describe the recent advances in optimization of the production of recombinant lipases and phospholipases, and to summarize the information available relating to their major applications in industrial processes.
Prevalence and serotypes of Listeria monocytogenes contamination in Chinese beef processing plants.
Zhu, Lixian; Feng, Xiaohui; Zhang, Lihua; Zhu, Ruiliang; Luo, Xin
2012-06-01
The aim of this work was to study the epidemiology of Listeria spp., particularly Listeria monocytogenes, and to identify the serotypes present in contaminated samples from beef processing plants in China. A total of 439 samples were obtained from bovine feces, hides, and carcasses at three commercial processing plants. A standard protocol (ISO 11290-1) was followed to detect Listeria spp. and L. monocytogenes, and multiplex polymerase chain reaction was used to identify the various L. monocytogenes serotypes. The overall prevalences of Listeria spp. and L. monocytogenes were 65.6% and 26.4%, respectively, and the contamination was highest in the hide samples. The identified L. monocytogenes serotypes were 1/2c and 1/2a. The results of the current study indicate that Listeria spp. contamination is common in Chinese beef processing plants; specific measures should be taken to prevent and/or treat L. monocytogenes contamination of feces and hides in beef slaughter plants. Furthermore, because Listeria spp. contamination was found to be prevalent, it should, therefore, be studied further. The prevention of cases of sporadic listeriosis in China should also be addressed.
Sakaridis, Ioannis; Ganopoulos, Ioannis; Madesis, Panagiotis; Tsaftaris, Athanasios; Argiriou, Anagnostis
2014-01-02
An outbreak situation of human listeriosis requires a fast and accurate protocol for typing Listeria monocytogenes . Existing techniques are either characterized by low discriminatory power or are laborious and require several days to give a final result. Polymerase chain reaction (PCR) coupled with high resolution melting (HRM) analysis was investigated in this study as an alternative tool for a rapid and precise genotyping of L. monocytogenes isolates. Fifty-five isolates of L. monocytogenes isolated from poultry carcasses and the environment of four slaughterhouses were typed by HRM analysis using two specific markers, internalin B and ssrA genes. The analysis of genotype confidence percentage of L. monocytogenes isolates produced by HRM analysis generated dendrograms with two major groups and several subgroups. Furthermore, the analysis of the HRM curves revealed that all L. monocytogenes isolates could easily be distinguished. In conclusion, HRM was proven to be a fast and powerful tool for genotyping isolates of L. monocytogenes .
DEFF Research Database (Denmark)
Grabon, Aby; Orłowski, Adam; Tripathi, Ashutosh
2017-01-01
. However, the details of the PITP-mediated lipid exchange cycle remain entirely obscure. Here, all-atom molecular dynamics simulations of the mammalian StART-like PtdIns/phosphatidylcholine (PtdCho) transfer protein PITPα, both on membrane bilayers and in solvated systems, informed downstream biochemical...... analyses that tested key aspects of the hypotheses generated by the molecular dynamics simulations. These studies provided five key insights into the PITPα lipid exchange cycle: (i) interaction of PITPα with the membrane is spontaneous and mediated by four specific protein substructures; (ii) the ability......Phosphatidylinositol-transfer proteins (PITPs) regulate phosphoinositide signaling in eukaryotic cells. The defining feature of PITPs is their ability to exchange phosphatidylinositol (PtdIns) molecules between membranes, and this property is central to PITP-mediated regulation of lipid signaling...
Sun, Chunhui; Wang, Nan; Huang, Jie; Xin, Jie; Peng, Fen; Ren, Yinshi; Zhang, Shangli; Miao, Junying
2009-10-01
Bone marrow stromal cells (BMSCs) can proliferate in vitro and can be transplanted for treating many kinds of diseases. However, BMSCs become senescent with long-term culture, which inhibits their application. To understand the mechanism underlying the senescence, we investigated the activity of phosphatidylcholine-specific phospholipase C (PC-PLC) and levels of integrin beta4, caveolin-1 and ROS with BMSC senescence. The activity of PC-PLC and levels of integrin beta4, caveolin-1 and ROS increased greatly during cell senescence. Selective inhibition of increased PC-PLC activity with D609 significantly decreased the number of senescence-associated beta galactosidase positive cells in BMSCs. Furthermore, D609 restored proliferation of BMSCs and their differentiation into adipocytes. Moreover, D609 suppressed the elevated levels of integrin beta4, caveolin-1 and ROS. The data suggest that PC-PLC is involved in senescence of BMSCs, and its function is associated with integrin beta4, caveolin-1 and ROS. (c) 2009 Wiley-Liss, Inc.
Gabriel, N E; Agman, N V; Roberts, M F
1987-11-17
Short-chain lecithin/long-chain phospholipid unilamellar vesicles (SLUVs), unlike pure long-chain lecithin vesicles, are excellent substrates for water-soluble phospholipases. Hemolysis assays show that greater than 99.5% of the short-chain lecithin is partitioned in the bilayer. In these binary component vesicles, the short-chain species is the preferred substrate, while the long-chain phospholipid can be treated as an inhibitor (phospholipase C) or poor substrate (phospholipase A2). For phospholipase C Bacillus cereus, apparent Km and Vmax values show that bilayer-solubilized diheptanoylphosphatidylcholine (diheptanoyl-PC) is nearly as good a substrate as pure micellar diheptanoyl-PC, although the extent of short-chain lecithin hydrolysis depends on the phase state of the long-chain lipid. For phospholipase A2 Naja naja naja, both Km and Vmax values show a greater range: in a gel-state matrix, diheptanoyl-PC is hydrolyzed with micellelike kinetic parameters; in a liquid-crystalline matrix, the short-chain lecithin becomes comparable to the long-chain component. Both enzymes also show an anomalous increase in specific activity toward diheptanoyl-PC around the phase transition temperature of the long-chain phospholipid. Since the short-chain lecithin does not exhibit a phase transition, this must reflect fluctuations in head-group area or vertical motions of the short-chain lecithin caused by surrounding long-chain lecithin molecules. These results are discussed in terms of a specific model for SLUV hydrolysis and a general explanation for the "interfacial activation" observed with water-soluble phospholipases.
Inhibition of [3H]nitrendipine binding by phospholipase A2
International Nuclear Information System (INIS)
Goldman, M.E.; Pisano, J.J.
1985-01-01
Phospholipase A 2 from several sources inhibited [ 3 H]nitrendipine binding to membranes from brain, heart and ileal longitudinal muscle. The enzymes from bee venom and Russell's viper venom were most potent, having IC 50 values of approximately 5 and 14 ng/ml, respectively, in all three membrane preparations. Inhibition of binding by bee venom phospholipase A 2 was time- and dose-dependent. Mastoparan, a known facilitator of phospholipase A 2 enzymatic activity, shifted the bee venom phospholipase A 2 dose-response curve to the left. Pretreatment of brain membranes with bee venom phospholipase A 2 (10 ng/ml) for 15 min caused a 2-fold increase in the K/sub d/ without changing the B/sub max/ compared with untreated membranes. Extension of the preincubation period to 30 min caused no further increase in the K/sub d/ but significantly decreased the B/sub max/ to 71% the value for untreated membranes. [ 3 H]Nitrendipine, preincubated with bee venom phospholipase A 2 , was recovered and found to be fully active, indicating that the phospholipase A 2 did not modify the ligand. It is concluded that phospholipase A 2 acts on the membrane at or near the [ 3 H]nitrendipine binding site and that phospholipids play a key role in the interactions of 1,4 dihydropyridine calcium channel antagonists with the dihydropyridine binding site. 33 references, 3 figures, 1 table
International Nuclear Information System (INIS)
Kang, Mi Sun; Jeong, Ju Yeon; Seo, Ji Heui; Jeon, Hyung Jun; Jung, Kwang Mook; Chin, Mi-Reyoung; Moon, Chang-Kiu; Bonventre, Joseph V.; Jung, Sung Yun; Kim, Dae Kyong
2006-01-01
Methylmercury (MeHg) is a ubiquitous environmental toxicant to which humans can be exposed by ingestion of contaminated food. MeHg has been suggested to exert its toxicity through its high reactivity to thiols, generation of arachidonic acid and reactive oxygen species (ROS), and elevation of free intracellular Ca 2+ levels ([Ca 2+ ] i ). However, the precise mechanism has not been fully defined. Here we show that phosphatidylcholine-specific phospholipase C (PC-PLC) is a critical pathway for MeHg-induced toxicity in MDCK cells. D609, an inhibitor of PC-PLC, significantly reversed the toxicity in a time- and dose-dependent manner with concomitant inhibition of the diacylglycerol (DAG) generation and the phosphatidylcholine (PC)-breakdown. MeHg activated the group IV cytosolic phospholipase A 2 (cPLA 2 ) and acidic form of sphingomyelinase (A-SMase) downstream of PC-PLC, but these enzymes as well as protein kinase C (PKC) were not linked to the toxicity by MeHg. Furthermore, MeHg produced ROS, which did not affect the toxicity. Addition of EGTA to culture media resulted in partial decrease of [Ca 2+ ] i and partially blocked the toxicity. In contrast, when the cells were treated with MeHg in the presence of Ca 2+ in the culture media, D609 completely prevented cell death with parallel decrease in [Ca 2+ ] i . Our results demonstrated that MeHg-induced toxicity was linked to elevation of [Ca 2+ ] i through activation of PC-PLC, but not attributable to the signaling pathways such as cPLA 2 , A-SMase, and PKC, or to the generation of ROS
COMPARISON OF TWO METHODS FOR THE DETECTION OF LISTERIA MONOCYTOGENES
Directory of Open Access Journals (Sweden)
G. Tantillo
2013-02-01
Full Text Available The aim of this study was to compare the performance of the conventional methods for detection of Listeria monocytogenes in food using media Oxford and ALOA (Agar Listeria acc. to Ottaviani & Agosti in according to the ISO 11290-1 to a new chromogenic medium “CHROMagar Listeria” standardized in 2005 AFNOR ( CHR – 21/1-12/01. A total of 40 pre-packed ready-to-eat food samples were examined. Using two methods six samples were found positive for Listeria monocytogenes but the medium “CHROMagar Listeria” was more selective in comparison with the others. In conclusion this study has demonstrated that isolation medium able to target specifically the detection of L. monocytogenes such as “CHROMagar Listeria” is highly recommendable because of that detection time is significantly reduced and the analysis cost is less expensive.
Role of Extracellular DNA during Biofilm Formation by Listeria monocytogenes
DEFF Research Database (Denmark)
Harmsen, Morten; Lappann, Martin; Knøchel, S
2010-01-01
(eDNA) may be the only central component of the biofilm matrix and that it is necessary for both initial attachment and early biofilm formation for 41 L. monocytogenes strains that were tested. DNase I treatment resulted in dispersal of biofilms, not only in microtiter tray assays but also in flow......Listeria monocytogenes is a food-borne pathogen that is capable of living in harsh environments. It is believed to do this by forming biofilms, which are surface-associated multicellular structures encased in a self-produced matrix. In this paper we show that in L. monocytogenes extracellular DNA...... cell biofilm assays. However, it was also demonstrated that in a culture without eDNA, neither Listeria genomic DNA nor salmon sperm DNA by itself could restore the capacity to adhere. A search for additional necessary components revealed that peptidoglycan (PG), specifically N-acetylglucosamine (NAG...
RAPID DNA EXTRACTION AND PCR VALIDATION FOR DIRECT DETECTION OF Listeria monocytogenes IN RAW MILK
Directory of Open Access Journals (Sweden)
Edith Burbano
2006-05-01
Full Text Available Objective. The aim of this study was to validate a method for detecting L. monocytogenes in raw milk.Materials and methods. The extraction procedure carried out using a chaotropic agent like NaI, toreduce fat in the sample to 0.2% w/v, which is the lowest limit for detection in the Gerber method, toavoid the polymerization. The raw milk samples were analyzed by using the traditional gold standardmethod for L. monocytogenes. Detection PCR was done on the specificity of primers that recognize theListeria genus by amplifying a specific fragment of about 938bp of the 16S rDNA. Several primer setswere use: L1 (CTCCATAAAGGTGACCCT, U1 (CAGCMGCCGCGGTAATWC, LF (CAAACGTTAACAACGCAGTAand LR (TCCAGAGTGATCGATGTTAA that recognize the hlyA gene of L. monocytogenes, amplifying a 750bpfragment. Results. The DNA of 39 strains evidenced high specificity of the technique since all the strainsof L. monocytogenes amplified the fragments 938bp and 750bp, specifically for genus and species,respectively. The detection limit of the PCR was 101 CFU/ml. T he PCR reproducibility showed a Kappa of0.85; the specificity and sensitivity of 100% were found, predictive positive and negative values were of100% respectively. Conclusions. These results demonstrate that is possible to detect of Listeria spp. byusing any of the three methods since they share the same sensitivity and specificity. One hundred percentof the predictive value for PCR (alternative method provides high reliability, and allows the detection ofthe positive samples. The extraction procedure combined with a PCR method can reduce in 15 days thetime of identification of L. monocytogenes in raw milk. This PCR technique could be adapted and validatedto be use for other types of food such as poultry, meat products and cheeses
Expression of enzymatically inactive wasp venom phospholipase A1 in Pichia pastoris.
Directory of Open Access Journals (Sweden)
Irina Borodina
Full Text Available Wasp venom allergy is the most common insect venom allergy in Europe. It is manifested by large local reaction or anaphylactic shock occurring after a wasp sting. The allergy can be treated by specific immunotherapy with whole venom extracts. Wasp venom is difficult and costly to obtain and is a subject to composition variation, therefore it can be advantageous to substitute it with a cocktail of recombinant allergens. One of the major venom allergens is phospholipase A1, which so far has been expressed in Escherichia coli and in insect cells. Our aim was to produce the protein in secreted form in yeast Pichia pastoris, which can give high yields of correctly folded protein on defined minimal medium and secretes relatively few native proteins simplifying purification.Residual amounts of enzymatically active phospholipase A1 could be expressed, but the venom protein had a deleterious effect on growth of the yeast cells. To overcome the problem we introduced three different point mutations at the critical points of the active site, where serine137, aspartate165 or histidine229 were replaced by alanine (S137A, D165A and H229A. All the three mutated forms could be expressed in P. pastoris. The H229A mutant did not have any detectable phospholipase A1 activity and was secreted at the level of several mg/L in shake flask culture. The protein was purified by nickel-affinity chromatography and its identity was confirmed by MALDI-TOF mass spectrometry. The protein could bind IgE antibodies from wasp venom allergic patients and could inhibit the binding of wasp venom to IgE antibodies specific for phospholipase A1 as shown by Enzyme Allergo-Sorbent Test (EAST. Moreover, the recombinant protein was allergenic in a biological assay as demonstrated by its capability to induce histamine release of wasp venom-sensitive basophils.The recombinant phospholipase A1 presents a good candidate for wasp venom immunotherapy.
First Trimester Listeria monocytogenes Septicemia
Goddijn, M.; Schipper, H. G.; Spanjaard, L.; Wolf, H.
1997-01-01
Background: Little is known about fetal outcome after Listeria monocytogenes septicemia in the first trimester of pregnancy.Case: A primigravida with L. monocytogenes septicemia at 9 weeks gestation was treated with amoxicillin. At 40 weeks gestation a healthy female infant was born.Conclusion: This
Secretory Phospholipase A2-IIA and Cardiovascular Disease
DEFF Research Database (Denmark)
Holmes, Michael V; Simon, Tabassome; Exeter, Holly J
2013-01-01
This study sought to investigate the role of secretory phospholipase A2 (sPLA2)-IIA in cardiovascular disease.......This study sought to investigate the role of secretory phospholipase A2 (sPLA2)-IIA in cardiovascular disease....
Pejchar, Přemysl; Martinec, Jan
2015-01-01
The first indication of the aluminum (Al) toxicity in plants growing in acidic soils is the cessation of root growth, but the detailed mechanism of Al effect is unknown. Here we examined the impact of Al stress on the activity of non-specific phospholipase C (NPC) in the connection with the processes related to the plasma membrane using fluorescently labeled phosphatidylcholine. We observed a rapid and significant decrease of labeled diacylglycerol (DAG), product of NPC activity, in Arabidopsis seedlings treated with AlCl₃. Interestingly, an application of the membrane fluidizer, benzyl alcohol, restored the level of DAG during Al treatment. Our observations suggest that the activity of NPC is affected by Al-induced changes in plasma membrane physical properties.
Listeria monocytogenes, a down-to-earth pathogen.
Vivant, Anne-Laure; Garmyn, Dominique; Piveteau, Pascal
2013-01-01
Listeria monocytogenes is the causative agent of the food-borne life threatening disease listeriosis. This pathogenic bacterium received much attention in the endeavor of deciphering the cellular mechanisms that underlie the onset of infection and its ability to adapt to the food processing environment. Although information is available on the presence of L. monocytogenes in many environmental niches including soil, water, plants, foodstuff and animals, understanding the ecology of L. monocytogenes in outdoor environments has received less attention. Soil is an environmental niche of pivotal importance in the transmission of this bacterium to plants and animals. Soil composition, microbial communities and macrofauna are extrinsic edaphic factors that direct the fate of L. monocytogenes in the soil environment. Moreover, farming practices may further affect its incidence. The genome of L. monocytogenes presents an extensive repertoire of genes encoding transport proteins and regulators, a characteristic of the genome of ubiquitous bacteria. Postgenomic analyses bring new insights in the process of soil adaptation. In the present paper focussing on soil, we review these extrinsic and intrinsic factors that drive environmental adaptation of L. monocytogenes.
Energy Technology Data Exchange (ETDEWEB)
Du, Yijun [Department of Pathobiology, University of Illinois at Urbana-Champaign, 2001 South Lincoln Ave, Urbana, IL 61802 (United States); Shandong Key Laboratory of Animal Disease Control and Breeding, Institute of Animal Science and Veterinary Medicine, Shandong Academy of Agricultural Sciences, Jinan (China); Pattnaik, Asit K. [School of Veterinary Medicine and Biomedical Sciences and the Nebraska Center for Virology, University of Nebraska-Lincoln, Lincoln, NE 68583-0900 (United States); Song, Cheng [Department of Pathobiology, University of Illinois at Urbana-Champaign, 2001 South Lincoln Ave, Urbana, IL 61802 (United States); Yoo, Dongwan, E-mail: dyoo@illinois.edu [Department of Pathobiology, University of Illinois at Urbana-Champaign, 2001 South Lincoln Ave, Urbana, IL 61802 (United States); Li, Gang, E-mail: dyoo@illinois.edu [Department of Pathobiology, University of Illinois at Urbana-Champaign, 2001 South Lincoln Ave, Urbana, IL 61802 (United States); Institute of Animal Science and Veterinary Medicine, Chinese Academy of Agricultural Sciences, Beijing (China)
2012-03-01
The porcine reproductive and respiratory syndrome virus (PRRSV) glycoprotein 4 (GP4) resembles a typical type I membrane protein in its structure but lacks a hydrophilic tail at the C-terminus, suggesting that GP4 may be a lipid-anchored membrane protein. Using the human decay-accelerating factor (DAF; CD55), a known glycosyl-phosphatidylinositol (GPI) lipid-anchored protein, chimeric constructs were made to substitute the GPI-anchor domain of DAF with the putative lipid-anchor domain of GP4, and their membrane association and lipase cleavage were determined in cells. The DAF-GP4 fusion protein was transported to the plasma membrane and was cleaved by phosphatidylinositol-specific phospholipase C (PI-PLC), indicating that the C-terminal domain of GP4 functions as a GPI anchor. Mutational studies for residues adjacent to the GPI modification site and characterization of respective mutant viruses generated from infectious cDNA clones show that the ability of GP4 for membrane association corresponded to virus viability and growth characteristics. The residues T158 ({omega} - 2, where {omega} is the GPI moiety at E160), P159 ({omega} - 1), and M162 ({omega} + 2) of GP4 were determined to be important for virus replication, with M162 being of particular importance for virus infectivity. The complete removal of the peptide-anchor domain in GP4 resulted in a complete loss of virus infectivity. The depletion of cholesterol from the plasma membrane of cells reduced the virus production, suggesting a role of lipid rafts in PRRSV infection. Remarkably, GP4 was found to co-localize with CD163 in the lipid rafts on the plasma membrane. Since CD163 has been reported as a cellular receptor for PRRSV and GP4 has been shown to interact with this receptor, our data implicates an important role of lipid rafts during entry of the virus.
International Nuclear Information System (INIS)
Du, Yijun; Pattnaik, Asit K.; Song, Cheng; Yoo, Dongwan; Li, Gang
2012-01-01
The porcine reproductive and respiratory syndrome virus (PRRSV) glycoprotein 4 (GP4) resembles a typical type I membrane protein in its structure but lacks a hydrophilic tail at the C-terminus, suggesting that GP4 may be a lipid-anchored membrane protein. Using the human decay-accelerating factor (DAF; CD55), a known glycosyl-phosphatidylinositol (GPI) lipid-anchored protein, chimeric constructs were made to substitute the GPI-anchor domain of DAF with the putative lipid-anchor domain of GP4, and their membrane association and lipase cleavage were determined in cells. The DAF-GP4 fusion protein was transported to the plasma membrane and was cleaved by phosphatidylinositol-specific phospholipase C (PI-PLC), indicating that the C-terminal domain of GP4 functions as a GPI anchor. Mutational studies for residues adjacent to the GPI modification site and characterization of respective mutant viruses generated from infectious cDNA clones show that the ability of GP4 for membrane association corresponded to virus viability and growth characteristics. The residues T158 (ω − 2, where ω is the GPI moiety at E160), P159 (ω − 1), and M162 (ω + 2) of GP4 were determined to be important for virus replication, with M162 being of particular importance for virus infectivity. The complete removal of the peptide–anchor domain in GP4 resulted in a complete loss of virus infectivity. The depletion of cholesterol from the plasma membrane of cells reduced the virus production, suggesting a role of lipid rafts in PRRSV infection. Remarkably, GP4 was found to co-localize with CD163 in the lipid rafts on the plasma membrane. Since CD163 has been reported as a cellular receptor for PRRSV and GP4 has been shown to interact with this receptor, our data implicates an important role of lipid rafts during entry of the virus.
Schenning, Martijn; Goedhart, Joachim; Gadella, Theodorus W J; Avram, Diana; Wirtz, Karel W A; Snoek, Gerry T
2008-10-01
The conditioned medium (CM) from mouse NIH3T3 fibroblast cells overexpressing phosphatidylinositol transfer protein alpha (PI-TPalpha; SPIalpha cells) demonstrates an increased anti-apoptotic activity compared with CM from wild type NIH3T3 (wtNIH3T3) cells. As previously shown, the anti-apoptotic activity acts by activating a G protein-coupled receptor, most probably a cannabinoid 1 (CB1)-like receptor as the activity was blocked by both pertussis toxin and rimonabant [M. Schenning, C.M. van Tiel, D. Van Manen, J.C. Stam, B.M. Gadella, K.W. Wirtz and G.T. Snoek, Phosphatidylinositol transfer protein alpha regulates growth and apoptosis of NIH3T3 cells: involvement of a cannabinoid 1-like receptor, J. Lipid Res. 45 (2004) 1555-1564]. The CB1 receptor appears to be expressed in mouse fibroblast cells, at levels in the order SPIalpha>wtNIH3T3>SPIbeta cells (i.e. wild type cells overexpressing PI-TPbeta). Upon incubation of SPIbeta cells with the PI-TPalpha-dependent anti-apoptotic factors, both the ERK/MAP kinase and the Akt/PKB pathway are activated in a CB1 receptor dependent manner as shown by Western blotting. In addition, activation of ERK2 was also shown by EYFP-ERK2 translocation to the nucleus, as visualized by confocal laser scanning microscopy. The subsequent activation of the anti-apoptotic transcription factor NF-kappaB is in line with the increased resistance towards UV-induced apoptosis. On the other hand, receptor activation by CM from SPIalpha cells was not linked to phospholipase C activation as the YFP-labelled C2-domain of protein kinase C was not translocated to the plasma membrane of SPIbeta cells as visualized by confocal laser scanning microscopy.
Xia, Keke; Wang, Bo; Zhang, Jiewei; Li, Yuan; Yang, Hailian; Ren, Dongtao
2017-08-01
Previous physiological and pharmacological studies have suggested that the activity of phosphoinositide-specific phospholipase C (PI-PLC) plays an important role in regulating plant salt stress responses by altering the intracellular Ca 2+ concentration. However, the individual members of plant PLCs involved in this process need to be identified. Here, the function of AtPLC4 in the salt stress response of Arabidopsis seedlings was analysed. plc4 mutant seedlings showed hyposensitivity to salt stress compared with Col-0 wild-type seedlings, and the salt hyposensitive phenotype could be complemented by the expression of native promoter-controlled AtPLC4. Transgenic seedlings with AtPLC4 overexpression (AtPLC4 OE) exhibited a salt-hypersensitive phenotype, while transgenic seedlings with its inactive mutant expression (AtPLC4m OE) did not exhibit this phenotype. Using aequorin as a Ca 2+ indicator in plc4 mutant and AtPLC4 OE seedlings, AtPLC4 was shown to positively regulate the salt-induced Ca 2+ increase. The salt-hypersensitive phenotype of AtPLC4 OE seedlings was partially rescued by EGTA. An analysis of salt-responsive genes revealed that the transcription of RD29B, MYB15 and ZAT10 was inversely regulated in plc4 mutant and AtPLC4 OE seedlings. Our findings suggest that AtPLC4 negatively regulates the salt tolerance of Arabidopsis seedlings, and Ca 2+ may be involved in regulating this process. © 2017 John Wiley & Sons Ltd.
An ecological perspective of Listeria monocytogenes biofilms in food processing facilities.
Valderrama, Wladir B; Cutter, Catherine N
2013-01-01
Listeria monocytogenes can enter the food chain at virtually any point. However, food processing environments seem to be of particular importance. From an ecological point of view, food processing facilities are microbial habitats that are constantly disturbed by cleaning and sanitizing procedures. Although L. monocytogenes is considered ubiquitous in nature, it is important to recognize that not all L. monocytogenes strains appear to be equally distributed; the distribution of the organism seems to be related to certain habitats. Currently, no direct evidence exists that L. monocytogenes-associated biofilms have played a role in food contamination or foodborne outbreaks, likely because biofilm isolation and identification are not part of an outbreak investigation, or the definition of biofilm is unclear. Because L. monocytogenes is known to colonize surfaces, we suggest that contamination patterns may be studied in the context of how biofilm formation is influenced by the environment within food processing facilities. In this review, direct and indirect epidemiological and phenotypic evidence of lineage-related biofilm formation capacity to specific ecological niches will be discussed. A critical view on the development of the biofilm concept, focused on the practical implications, strengths, and weaknesses of the current definitions also is discussed. The idea that biofilm formation may be an alternative surrogate for microbial fitness is proposed. Furthermore, current research on the influence of environmental factors on biofilm formation is discussed.
Zhang, Cathy X. Y.; Brooks, Brian W.; Huang, Hongsheng; Pagotto, Franco
2016-01-01
ABSTRACT The Gram-positive bacterium Listeria monocytogenes causes a significant percentage of the fatalities among foodborne illnesses in humans. Surface proteins specifically expressed in a wide range of L. monocytogenes serotypes under selective enrichment culture conditions could serve as potential biomarkers for detection and isolation of this pathogen via antibody-based methods. Our study aimed to identify such biomarkers. Interrogation of the L. monocytogenes serotype 4b strain F2365 genome identified 130 putative or known surface proteins. The homologues of four surface proteins, LMOf2365_0578, LMOf2365_0581, LMOf2365_0639, and LMOf2365_2117, were assessed as biomarkers due to the presence of conserved regions among strains of L. monocytogenes which are variable among other Listeria species. Rabbit polyclonal antibodies against the four recombinant proteins revealed the expression of only LMOf2365_0639 on the surface of serotype 4b strain LI0521 cells despite PCR detection of mRNA transcripts for all four proteins in the organism. Three of 35 monoclonal antibodies (MAbs) to LMOf2365_0639, MAbs M3643, M3644, and M3651, specifically recognized 42 (91.3%) of 46 L. monocytogenes lineage I and II isolates grown in nonselective brain heart infusion medium. While M3644 and M3651 reacted with 14 to 15 (82.4 to 88.2%) of 17 L. monocytogenes lineage I and II isolates, M3643 reacted with 22 (91.7%) of 24 lineage I, II, and III isolates grown in selective enrichment media (UVM1, modified Fraser, Palcam, and UVM2 media). The three MAbs exhibited only weak reactivities (the optical densities at 414 nm were close to the cutoff value) to some other Listeria species grown in selective enrichment media. Collectively, the data indicate the potential of LMOf2365_0639 as a surface biomarker of L. monocytogenes, with the aid of specific MAbs, for pathogen detection, identification, and isolation in clinical, environmental, and food samples. IMPORTANCE L. monocytogenes is
Chen, Bang-Yuan; Wang, Chung-Yi; Wang, Chia-Lan; Fan, Yang-Chi; Weng, I-Ting; Chou, Chung-Hsi
2016-11-01
A 2-year study was performed at two ready-to-eat tilapia sashimi processing plants (A and B) to identify possible routes of contamination with Listeria monocytogenes during processing. Samples were collected from the aquaculture environments, transportation tanks, processing plants, and final products. Seventy-nine L. monocytogenes isolates were found in the processing environments and final products; 3.96% (50 of 1,264 samples) and 3.86% (29 of 752 samples) of the samples from plants A and B, respectively, were positive for L. monocytogenes . No L. monocytogenes was detected in the aquaculture environments or transportation tanks. The predominant L. monocytogenes serotypes were 1/2b (55.70%) and 4b (37.97%); serotypes 3b and 4e were detected at much lower percentages. At both plants, most processing sections were contaminated with L. monocytogenes before the start of processing, which indicated that the cleaning and sanitizing methods did not achieve adequate pathogen removal. Eleven seropulsotypes were revealed by pulsed-field gel electrophoresis and serotyping. Analysis of seropulsotype distribution revealed that the contamination was disseminated by the processing work; the same seropulsotypes were repeatedly found along the work flow line and in the final products. Specific seropulsotypes were persistently found during different sampling periods, which suggests that the sanitation procedures or equipment used at these plants were inadequate. Plant staff should improve the sanitation procedures and equipment to reduce the risk of L. monocytogenes cross-contamination and ensure the safety of ready-to-eat tilapia products.
Directory of Open Access Journals (Sweden)
Moutong eChen
2015-09-01
Full Text Available Listeria monocytogenes is an important foodborne pathogen that can cause serious illness in immunocompromised individuals, pregnant women, the elderly, and newborns. The aim of this study was to: (i evaluate the prevalence and contamination level (most probable number, MPN of L. monocytogenes in 567 retail raw foods (fishery products, n=154; raw/fresh meat, n=123; frozen foods, n=110; edible fungi, n=108; vegetables, n=72 collected from South China and (ii to gain further knowledge on the phenotype and genotype distributions of this important foodborne pathogen. Approximately 22% of the samples were positive for L. monocytogenes. The contamination levels were between 0.3 and 10 MPN/g in 75.0%, between 10 and 100 MPN/g in 11.0% and less than 100 MPN/g in 14.0% of the countable samples. Five serogroups were identified among the177 foodborne L. monocytogenes isolates, with1/2a-3a (42.4% and1/2b-3b (26.0% serogroups being the most dominant. Serogroup I.1 and II.2 were only found in the edible mushrooms, while serogroup III was dominant in the fishery products, suggesting that specific serogroups of L. monocytogenes may have distinct ecological niches. Ten (5.6% L. monocytogenes isolates exhibited multidrug resistance. Genetic relatedness analysis revealed the absence of distinct associations between specific food types, antibiotic resistance, serogroups, and genetic diversity. The present study provided the first baseline data on the prevalence, contamination level, and characteristics of L. monocytogenes isolated from raw foods in South China. Some multidrug resistant strains belonged to the epidemiologically important serogroups (I.1 and II.1, implying a potential public health risk. In addition, these findings also provide basic information for the Chinese food safety associated authorities to draft appropriate standards to control L. monocytogenes contamination and improve microbiological safety of raw foods.
An insight into the isolation, enumeration and molecular detection of Listeria monocytogenes in food
Directory of Open Access Journals (Sweden)
Jodi Woan-Fei Law
2015-11-01
Full Text Available Listeria monocytogenes, a foodborne pathogen that can cause listeriosis through the consumption of food contaminated with this pathogen. The ability of L. monocytogenes to survive in extreme conditions and cause food contaminations have become a major concern. Hence, routine microbiological food testing is necessary to prevent food contamination and outbreaks of foodborne illness. This review provides insight into the methods for cultural detection, enumeration and molecular identification of L. monocytogenes in various food samples. There are a number of enrichment and plating media that can be used for the isolation of L. monocytogenes from food samples. Enrichment media such as buffered Listeria Enrichment Broth (BLEB, Fraser broth and University of Vermont Medium (UVM Listeria enrichment broth are recommended by regulatory agencies such as FDA-BAM, USDA-FSIS and ISO. Many plating media are available for the isolation of L. monocytogenes, for instance, PALCAM, Oxford and other chromogenic media. Besides, reference methods like FDA-BAM, ISO 11290 method and USDA-FSIS method are usually applied for the cultural detection or enumeration of L. monocytogenes. MPN technique is applied for the enumeration of L. monocytogenes in the case of low level contamination. Molecular methods including polymerase chain reaction (PCR, multiplex polymerase chain reaction (mPCR, real-time/quantitative polymerase chain reaction (qPCR, nucleic acid sequence-based amplification (NASBA, loop-mediated isothermal amplification (LAMP, DNA microarray and Next Generation Sequencing (NGS technology for the detection and identification of L. monocytogenes are discussed in this review. Overall, molecular methods are rapid, sensitive, specific, time- and labour-saving. In future, there are chances for the development of new techniques for the detection and identification of foodborne with improved features.
DEFF Research Database (Denmark)
Kastbjerg, Vicky Gaedt; Hein-Kristensen, Line; Gram, Lone
2014-01-01
Exposure of the human food-borne pathogen Listeria monocytogenes to sublethal concentrations of triclosan can cause resistance to several aminoglycosides. Aminoglycoside-resistant isolates exhibit two colony morphologies: normal-size and pinpoint colonies. The purposes of the present study were...... to characterize the small colonies of L. monocytogenes and to determine if specific genetic changes could explain the triclosan-induced aminoglycoside resistance in both pinpoint and normal-size isolates. Isolates from the pinpoint colonies grew poorly under aerated conditions, but growth was restored by addition......I and that exposure to triclosan can cause resistance to antibiotics that enters the cell via active transport. Further studies are needed to elucidate if L. monocytogenes pinpoint isolates could have any clinical impact, e.g., in persistent infections....
Occurrence of Listeria monocytogenes in smoked fish in Sokoto ...
African Journals Online (AJOL)
STORAGESEVER
2008-09-03
Sep 3, 2008 ... monocytogenes and other Listeria species are common contaminant of smoked fish, and this may pose serious public health implications. Key words: Smoked fish, Listeria monocytogenes, contamination, public health. INTRODUCTION ... L. monocytogenes belong to the recently emerging psychrotrophic ...
An outbreak of an unusual strain of Listeria monocytogenes infection in North-East Scotland
Directory of Open Access Journals (Sweden)
Emmanuel Okpo
2015-11-01
Full Text Available Summary: Listeria monocytogenes infection is an important cause of illness and hospitalization in vulnerable individuals. In the present study, we describe a community outbreak of Listeria monocytogenes in the North-East region of Scotland, which was epidemiologically, environmentally and microbiologically linked to a local meat product and ready-to-eat product manufacturer. Infected individuals were interviewed, and an environmental investigation was conducted. Clinical and environmental samples were tested by culture, and isolates were typed by fluorescent amplified fragment length polymorphism (fAFLP. Three cases of Listeria monocytogenes were linked geographically, had the same serotype (1/2a and were indistinguishable by fAFLP type XII.6. The human, food and environmental isolates were of the same serotype and were indistinguishable by molecular typing.This is the first community outbreak of L. monocytogenes reported in Scotland since the current outbreak surveillance was established in 1996. Epidemiological and laboratory evidence indicated poor hand hygiene, unhygienic practices and cross-contamination throughout the manufacturing process of ready-to-eat foods as a possible cause of the outbreak. More stringent control of commercial food establishments that provide ready-to-eat food and the need to advise specifically vulnerable groups, e.g., pregnant women, of the risk of L. monocytogenes in ready-to-eat food is urgently needed. Keywords: Listeria monocytogenes, Outbreak, Foodborne, Community acquired infection, Listeriosis
Novel Biocontrol Methods for Listeria monocytogenes Biofilms in Food Production Facilities.
Gray, Jessica A; Chandry, P Scott; Kaur, Mandeep; Kocharunchitt, Chawalit; Bowman, John P; Fox, Edward M
2018-01-01
High mortality and hospitalization rates have seen Listeria monocytogenes as a foodborne pathogen of public health importance for many years and of particular concern for high-risk population groups. Food manufactures face an ongoing challenge in preventing the entry of L. monocytogenes into food production environments (FPEs) due to its ubiquitous nature. In addition to this, the capacity of L. monocytogenes strains to colonize FPEs can lead to repeated identification of L. monocytogenes in FPE surveillance. The contamination of food products requiring product recall presents large economic burden to industry and is further exacerbated by damage to the brand. Poor equipment design, facility layout, and worn or damaged equipment can result in Listeria hotspots and biofilms where traditional cleaning and disinfecting procedures may be inadequate. Novel biocontrol methods may offer FPEs effective means to help improve control of L. monocytogenes and decrease cross contamination of food. Bacteriophages have been used as a medical treatment for many years for their ability to infect and lyse specific bacteria. Endolysins, the hydrolytic enzymes of bacteriophages responsible for breaking the cell wall of Gram-positive bacteria, are being explored as a biocontrol method for food preservation and in nanotechnology and medical applications. Antibacterial proteins known as bacteriocins have been used as alternatives to antibiotics for biopreservation and food product shelf life extension. Essential oils are natural antimicrobials formed by plants and have been used as food additives and preservatives for many years and more recently as a method to prevent food spoilage by microorganisms. Competitive exclusion occurs naturally among bacteria in the environment. However, intentionally selecting and applying bacteria to effect competitive exclusion of food borne pathogens has potential as a biocontrol application. This review discusses these novel biocontrol methods and their
Listeria monocytogenes infection in pregnancy and neonatal sepsis
Directory of Open Access Journals (Sweden)
Francesca Pascale
2008-06-01
Full Text Available Authors report a fatal neonatal sepsis caused by Listeria monocytogenes. While the diagnostic procedure aimed to identify the microrganism is described, it is emphasized the importance to recover Streptococcus agalactiae (GBS and L. monocytogenes by means of vaginal-rectal swab culture. The intrapartum screening for L. monocytogenes, by Polymerase Chain Reaction (PCR providing results in 75 minutes is also evaluated.
Vongkamjan, Kitiya; Benjakul, Soottawat; Kim Vu, Hue Thi; Vuddhakul, Varaporn
2017-09-01
Listeria monocytogenes is a foodborne pathogen commonly found in environments of seafood processing, thus presenting a challenge for eradication from seafood processing facilities. Monitoring the prevalence and subtype diversity of L. monocytogenes together with phages that are specific to Listeria spp. ("Listeria phages") will provide knowledge on the bacteria-phage ecology in food processing plants. In this work, a total of 595 samples were collected from raw material, finished seafood products and environmental samples from different sites of a seafood processing plant during 17 sampling visits in 1.5 years of study. L. monocytogenes and Listeria spp. (non-monocytogenes) were found in 22 (3.7%) and 43 (7.2%) samples, respectively, whereas 29 Listeria phages were isolated from 9 (1.5%) phage-positive samples. DNA fingerprint analysis of L. monocytogenes isolates revealed 11 Random Amplified Polymorphic DNA (RAPD) profiles, with two subtypes were frequently observed over time. Our data reveal a presence of Listeria phages within the same seafood processing environments where a diverse set of L. monocytogenes subtypes was also found. Although serotype 4b was observed at lower frequency, data indicate that isolates from this seafood processing plant belonged to both epidemiologically important serotypes 1/2a and 4b, which may suggest a potential public health risk. Phages (all showed a unique genome size of 65 ± 2 kb) were classified into 9 host range groups, representing both broad- and narrow-host range. While most L. monocytogenes isolates from this facility were susceptible to phages, five isolates showed resistance to 12-20 phages. Variations in phage host range among Listeria phages isolated from food processing plant may affect a presence of a diverse set of L. monocytogenes isolates derived from the same processing environment in Thailand. Copyright © 2017 Elsevier Ltd. All rights reserved.
Law, Jodi Woan-Fei; Ab Mutalib, Nurul-Syakima; Chan, Kok-Gan; Lee, Learn-Han
2015-01-01
Listeria monocytogenes, a foodborne pathogen that can cause listeriosis through the consumption of food contaminated with this pathogen. The ability of L. monocytogenes to survive in extreme conditions and cause food contaminations have become a major concern. Hence, routine microbiological food testing is necessary to prevent food contamination and outbreaks of foodborne illness. This review provides insight into the methods for cultural detection, enumeration, and molecular identification of L. monocytogenes in various food samples. There are a number of enrichment and plating media that can be used for the isolation of L. monocytogenes from food samples. Enrichment media such as buffered Listeria enrichment broth, Fraser broth, and University of Vermont Medium (UVM) Listeria enrichment broth are recommended by regulatory agencies such as Food and Drug Administration-bacteriological and analytical method (FDA-BAM), US Department of Agriculture-Food and Safety (USDA-FSIS), and International Organization for Standardization (ISO). Many plating media are available for the isolation of L. monocytogenes, for instance, polymyxin acriflavin lithium-chloride ceftazidime aesculin mannitol, Oxford, and other chromogenic media. Besides, reference methods like FDA-BAM, ISO 11290 method, and USDA-FSIS method are usually applied for the cultural detection or enumeration of L. monocytogenes. most probable number technique is applied for the enumeration of L. monocytogenes in the case of low level contamination. Molecular methods including polymerase chain reaction, multiplex polymerase chain reaction, real-time/quantitative polymerase chain reaction, nucleic acid sequence-based amplification, loop-mediated isothermal amplification, DNA microarray, and next generation sequencing technology for the detection and identification of L. monocytogenes are discussed in this review. Overall, molecular methods are rapid, sensitive, specific, time- and labor-saving. In future, there are
Expression of phosphoinositide-specific phospholipase C isoforms in native endothelial cells.
Béziau, Delphine M; Toussaint, Fanny; Blanchette, Alexandre; Dayeh, Nour R; Charbel, Chimène; Tardif, Jean-Claude; Dupuis, Jocelyn; Ledoux, Jonathan
2015-01-01
Phospholipase C (PLC) comprises a superfamily of enzymes that play a key role in a wide array of intracellular signalling pathways, including protein kinase C and intracellular calcium. Thirteen different mammalian PLC isoforms have been identified and classified into 6 families (PLC-β, γ, δ, ε, ζ and η) based on their biochemical properties. Although the expression of PLC isoforms is tissue-specific, concomitant expression of different PLC has been reported, suggesting that PLC family is involved in multiple cellular functions. Despite their critical role, the PLC isoforms expressed in native endothelial cells (ECs) remains undetermined. A conventional PCR approach was initially used to elucidate the mRNA expression pattern of PLC isoforms in 3 distinct murine vascular beds: mesenteric (MA), pulmonary (PA) and middle cerebral arteries (MCA). mRNA encoding for most PLC isoforms was detected in MA, MCA and PA with the exception of η2 and β2 (only expressed in PA), δ4 (only expressed in MCA), η1 (expressed in all but MA) and ζ (not detected in any vascular beds tested). The endothelial-specific PLC expression was then sought in freshly isolated ECs. Interestingly, the PLC expression profile appears to differ across the investigated arterial beds. While mRNA for 8 of the 13 PLC isoforms was detected in ECs from MA, two additional PLC isoforms were detected in ECs from PA and MCA. Co-expression of multiple PLC isoforms in ECs suggests an elaborate network of signalling pathways: PLC isoforms may contribute to the complexity or diversity of signalling by their selective localization in cellular microdomains. However in situ immunofluorescence revealed a homogeneous distribution for all PLC isoforms probed (β3, γ2 and δ1) in intact endothelium. Although PLC isoforms play a crucial role in endothelial signal transduction, subcellular localization alone does not appear to be sufficient to determine the role of PLC in the signalling microdomains found in the
Expression of phosphoinositide-specific phospholipase C isoforms in native endothelial cells.
Directory of Open Access Journals (Sweden)
Delphine M Béziau
Full Text Available Phospholipase C (PLC comprises a superfamily of enzymes that play a key role in a wide array of intracellular signalling pathways, including protein kinase C and intracellular calcium. Thirteen different mammalian PLC isoforms have been identified and classified into 6 families (PLC-β, γ, δ, ε, ζ and η based on their biochemical properties. Although the expression of PLC isoforms is tissue-specific, concomitant expression of different PLC has been reported, suggesting that PLC family is involved in multiple cellular functions. Despite their critical role, the PLC isoforms expressed in native endothelial cells (ECs remains undetermined. A conventional PCR approach was initially used to elucidate the mRNA expression pattern of PLC isoforms in 3 distinct murine vascular beds: mesenteric (MA, pulmonary (PA and middle cerebral arteries (MCA. mRNA encoding for most PLC isoforms was detected in MA, MCA and PA with the exception of η2 and β2 (only expressed in PA, δ4 (only expressed in MCA, η1 (expressed in all but MA and ζ (not detected in any vascular beds tested. The endothelial-specific PLC expression was then sought in freshly isolated ECs. Interestingly, the PLC expression profile appears to differ across the investigated arterial beds. While mRNA for 8 of the 13 PLC isoforms was detected in ECs from MA, two additional PLC isoforms were detected in ECs from PA and MCA. Co-expression of multiple PLC isoforms in ECs suggests an elaborate network of signalling pathways: PLC isoforms may contribute to the complexity or diversity of signalling by their selective localization in cellular microdomains. However in situ immunofluorescence revealed a homogeneous distribution for all PLC isoforms probed (β3, γ2 and δ1 in intact endothelium. Although PLC isoforms play a crucial role in endothelial signal transduction, subcellular localization alone does not appear to be sufficient to determine the role of PLC in the signalling microdomains found
Listeria monocytogenes - Danger for health safety vegetable production.
Kljujev, Igor; Raicevic, Vera; Jovicic-Petrovic, Jelena; Vujovic, Bojana; Mirkovic, Milica; Rothballer, Michael
2018-04-22
The microbiologically contaminated vegetables represent a risk for consumers, especially vegetables without thermal processing. It is known that human pathogen bacteria, such as Listeria monocytogenes, could exist on fresh vegetables. The fresh vegetables could become Listeria-contaminated if they come in touch with contaminated soil, manure, irrigation water. The aim of this work was to investigate the presence of Listeria spp. and L. monocytogenes in different kind of vegetables grown in field and greenhouse condition as well as surface and endophytic colonization plant roots of different vegetables species by L. monocytogenes in laboratory conditions. The detection of Listeria spp. and L. monocytogenes in vegetable samples was done using ISO and PCR methods. The investigation of colonization vegetable roots and detection Listeria-cells inside plant root tissue was done using Fluorescence in situ hybridization (FISH) method in combination with confocal laser scanning microscopy (CLSM). The results showed that 25.58% vegetable samples were positive for Listeria spp. and only one sample (carrot) was positive for L. monocytogenes out of 43 samples in total collected from field and greenhouse. The strain L. monocytogenes EGD-E surface and endophytic colonized carrot root in highest degree while strain L. monocytogenes SV4B was the most represented at leafy vegetable plants, such at lettuce (1.68 × 10 6 cells/mm 3 absolutely dry root) and spinach (1.39 × 10 6 cells/mm 3 absolutely dry root) root surface. The cells of L. monocytogenes SV4B were visible as single cells in interior tissue of plant roots (celery and sweet corn roots) as well as in the interior of the plant root cell at sweet corn root. The cells of L. monocytogenes EGD-E bind to the surface of the plant root and they were less commonly found out on root hair. In the inner layers of the root, those bacterial cells were inhabited intercellular spaces mainly as single cells very close to the
REAL-TIME PCR DETECTION OF LISTERIA MONOCYTOGENES IN FOOD SAMPLES OF ANIMAL ORIGIN
Directory of Open Access Journals (Sweden)
Jaroslav Pochop
2013-02-01
Full Text Available The aim of this study was to follow the contamination of food with Listeria monocytogenes by using Step One real time polymerase chain reaction (PCR. We used the PrepSEQ Rapid Spin Sample Preparation Kit for isolation of DNA and SensiFAST SYBR Hi-ROX Kit for the real-time PCR performance. In 24 samples of food of animal origin without incubation were detected strains of Listeria monocytogenes in 15 samples (swabs. Nine samples were negative. Our results indicated that the real-time PCR assay developed in this study could sensitively detect Listeria monocytogenes in food of animal origin without incubation. This could prevent infection caused by Listeria monocytogenes, and also could benefit food manufacturing companies by extending their product’s shelf-life as well as saving the cost of warehousing their food products while awaiting pathogen testing results. The rapid real-time PCR-based method performed very well compared to the conventional method. It is a fast, simple, specific and sensitive way to detect nucleic acids, which could be used in clinical diagnostic tests in the future.
Listeria monocytogenes Identification in Food of Animal Origin Used with Real Time PCR
Directory of Open Access Journals (Sweden)
Jaroslav Pochop
2013-10-01
Full Text Available The aim of this study was to follow the contamination of food with Listeria monocytogenes by using Step One real time polymerase chain reaction (RT PCR. We used the PrepSEQ Rapid Spin Sample Preparation Kit for isolation of DNA and SensiFAST SYBR Hi-ROX Kit for the real-time PCR performance. In 20 samples of food of animal origin with incubation were detected strains of Listeria monocytogenes in 9 samples (swabs. Eleven samples were negative. Our results indicated that the real-time PCR assay developed in this study could sensitively detect Listeria monocytogenes in food of animal origin without incubation. This could prevent infection caused by Listeria monocytogenes, and also could benefit food manufacturing companies by extending their product’s shelf-life as well as saving the cost of warehousing their food products while awaiting pathogen testing results. The rapid real-time PCR-based method performed very well compared to the conventional method. It is a fast, simple, specific and sensitive way to detect nucleic acids, which could be used in clinical diagnostic tests in the future.
40 CFR 721.4585 - Lecithins, phospholipase A2-hydrolyzed.
2010-07-01
... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Lecithins, phospholipase A2-hydrolyzed... Substances § 721.4585 Lecithins, phospholipase A2-hydrolyzed. (a) Chemical substances and significant new uses subject to reporting. (1) The chemical substances identified generically as lecithins...
Biofilm Formation of Listeria monocytogenes on Various Surfaces
Directory of Open Access Journals (Sweden)
M Mahdavi
2007-10-01
Full Text Available Introduction & Objective: Listeria monocytogenes is considered as a ubiquitous foodborne pathogen which can lead to serious infections, especially in newborns, elderly, pregnant, and immunocompromised people. The organism has been isolated from many foods and may cause meningitis, septicemia and abortion in pregnant women. Also L. monocytogenes forms biofilms on many food contact surface materials and medical devices. Development of biofilms on many surfaces is a potential source of contamination of foods that may lead to spoilage or transmission of foodborne pathogens. Materials & Methods: Biofilm formation of L. monocytogenes (RITCC 1293 serotype 4a was investigated. Hydrophobicity of L. monocytogenes was measured by MATH method. Then biofilm formation of the organism was assessed at 2, 4, 8, 16 and 20 hours on stainless steel (type 304 no 2B, polyethylene and glass by drop plate method. Results: Results indicated that L. monocytogenes with 85% of hydrophobicity formed biofilm on each of three surfaces. Biofilm formation on stainless steel surfaces was significantly more than other surfaces (p<0.05. Conclusion: The ability of biofilm formation of L. monocytogenes on medical devices and food containers is very important as far as hygiene and disease outbreaks are concerned.
Vojkovska, H; Kubikova, I; Kralik, P
2015-03-01
Epidemiological data indicate that raw vegetables are associated with outbreaks of Listeria monocytogenes. Therefore, there is a demand for the availability of rapid and sensitive methods, such as PCR assays, for the detection and accurate discrimination of L. monocytogenes. However, the efficiency of PCR methods can be negatively affected by inhibitory compounds commonly found in vegetable matrices that may cause false-negative results. Therefore, the sample processing and DNA isolation steps must be carefully evaluated prior to the introduction of such methods into routine practice. In this study, we compared the ability of three column-based and four magnetic bead-based commercial DNA isolation kits to extract DNA of the model micro-organism L. monocytogenes from raw vegetables. The DNA isolation efficiency of all isolation kits was determined using a triplex real-time qPCR assay designed to specifically detect L. monocytogenes. The kit with best performance, the PowerSoil(™) Microbial DNA Isolation Kit, is suitable for the extraction of amplifiable DNA from L. monocytogenes cells in vegetable with efficiencies ranging between 29.6 and 70.3%. Coupled with the triplex real-time qPCR assay, this DNA isolation kit is applicable to the samples with bacterial loads of 10(3) bacterial cells per gram of L. monocytogenes. Several recent outbreaks of Listeria monocytogenes have been associated with the consumption of fruits and vegetables. Real-time PCR assays allow fast detection and accurate quantification of microbes. However, the success of real-time PCR is dependent on the success with which template DNA can be extracted. The results of this study suggest that the PowerSoil(™) Microbial DNA Isolation Kit can be used for the extraction of amplifiable DNA from L. monocytogenes cells in vegetable with efficiencies ranging between 29.6 and 70.3%. This method is applicable to samples with bacterial loads of 10(3) bacterial cells per gram of L. monocytogenes. © 2014
A conserved function in phosphatidylinositol metabolism for mammalian Vps13 family proteins.
Directory of Open Access Journals (Sweden)
Jae-Sook Park
Full Text Available The Vps13 protein family is highly conserved in eukaryotic cells. In humans, mutations in the gene encoding the family member VPS13A lead to the neurodegenerative disorder chorea-acanthocytosis. In the yeast Saccharomyces cerevisiae, there is just a single version of VPS13, thereby simplifying the task of unraveling its molecular function(s. While VPS13 was originally identified in yeast by its role in vacuolar sorting, recent studies have revealed a completely different function for VPS13 in sporulation, where VPS13 regulates phosphatidylinositol-4-phosphate (PtdIns(4P levels in the prospore membrane. This discovery raises the possibility that the disease phenotype associated with vps13A mutants in humans is due to misregulation of PtdIns(4P in membranes. To determine whether VPS13A affects PtdIns(4P in membranes from mammalian neuronal cells, phosphatidylinositol phosphate pools were compared in PC12 tissue culture cells in the absence or presence of VPS13A. Consistent with the yeast results, the localization of PtdIns(4P is specifically altered in VPS13A knockdown cells while other phosphatidylinositol phosphates appear unaffected. In addition, VPS13A is necessary to prevent the premature degeneration of neurites that develop in response to Nerve Growth Factor. The regulation of PtdIns(4P is therefore a conserved function of the Vps13 family and may play a role in the maintenance of neuronal processes in mammals.
78 FR 27939 - Draft Interagency Risk Assessment-Listeria monocytogenes
2013-05-13
... Listeria (L.) monocytogenes contamination of certain ready-to-eat (RTE) foods, for example cheese, deli... Scott, V.N., Survey of Listeria monocytogenes in ready-to-eat foods. Journal of Food Protection, 2003... monocytogenes in ready-to-eat processed meat and poultry collected in four FoodNet states in International...
Presence of Listeria monocytogenes in Mediterranean-Style Dry Fermented Sausages
Directory of Open Access Journals (Sweden)
Domenico Meloni
2015-03-01
Full Text Available The morphological, physiological and epidemiological features of L. monocytogenes, together with the severity of human listeriosis infections, make L. monocytogenes of particular concern for manufacturers of cold-stored “ready to eat” (RTE foods. L. monocytogenes has been isolated from a wide variety of RTE foods and is responsible for several outbreaks associated with the consumption of RTE meat, poultry, dairy, fish and vegetable products. Although L. monocytogenes is among the most frequently-detected pathogens in dry fermented sausages, these products could be included in the category of RTE products in which the growth of L. monocytogenes is not favored and have rarely been implicated in listeriosis outbreaks. However, L. monocytogenes is highly difficult to control in fermented sausage processing environments due to its high tolerance to low pH and high salt concentration. In many Mediterranean-style dry fermented sausages, an empirical application of the hurdle technology often occurs and the frequent detection of L. monocytogenes in these products at the end of ripening highlights the need for food business operators to properly apply hurdle technology and to control the contamination routes of L. monocytogenes in the processing plants. In the following, through an up-to-date review of (personal and un- published data, the main aspects of the presence of L. monocytogenes in Mediterranean-style dry fermented sausages will be discussed.
Presence of Listeria monocytogenes in Mediterranean-Style Dry Fermented Sausages.
Meloni, Domenico
2015-03-12
The morphological, physiological and epidemiological features of L. monocytogenes , together with the severity of human listeriosis infections, make L. monocytogenes of particular concern for manufacturers of cold-stored "ready to eat" (RTE) foods. L. monocytogenes has been isolated from a wide variety of RTE foods and is responsible for several outbreaks associated with the consumption of RTE meat, poultry, dairy, fish and vegetable products. Although L. monocytogenes is among the most frequently-detected pathogens in dry fermented sausages, these products could be included in the category of RTE products in which the growth of L. monocytogenes is not favored and have rarely been implicated in listeriosis outbreaks. However, L. monocytogenes is highly difficult to control in fermented sausage processing environments due to its high tolerance to low pH and high salt concentration. In many Mediterranean-style dry fermented sausages, an empirical application of the hurdle technology often occurs and the frequent detection of L. monocytogenes in these products at the end of ripening highlights the need for food business operators to properly apply hurdle technology and to control the contamination routes of L. monocytogenes in the processing plants. In the following, through an up-to-date review of (personal and un-) published data, the main aspects of the presence of L. monocytogenes in Mediterranean-style dry fermented sausages will be discussed.
Guariglia-Oropeza, Veronica; Orsi, Renato H.; Guldimann, Claudia; Wiedmann, Martin; Boor, Kathryn J.
2018-01-01
Listeria monocytogenes uses a variety of transcriptional regulation strategies to adapt to the extra-host environment, the gastrointestinal tract, and the intracellular host environment. While the alternative sigma factor SigB has been proposed to be a key transcriptional regulator that facilitates L. monocytogenes adaptation to the gastrointestinal environment, the L. monocytogenes' transcriptional response to bile exposure is not well-understood. RNA-seq characterization of the bile stimulon was performed in two L. monocytogenes strains representing lineages I and II. Exposure to bile at pH 5.5 elicited a large transcriptomic response with ~16 and 23% of genes showing differential transcription in 10403S and H7858, respectively. The bile stimulon includes genes involved in motility and cell wall modification mechanisms, as well as genes in the PrfA regulon, which likely facilitate survival during the gastrointestinal stages of infection that follow bile exposure. The fact that bile exposure induced the PrfA regulon, but did not induce further upregulation of the SigB regulon (beyond that expected by exposure to pH 5.5), suggests a model where at the earlier stages of gastrointestinal infection (e.g., acid exposure in the stomach), SigB-dependent gene expression plays an important role. Subsequent exposure to bile induces the PrfA regulon, potentially priming L. monocytogenes for subsequent intracellular infection stages. Some members of the bile stimulon showed lineage- or strain-specific distribution when 27 Listeria genomes were analyzed. Even though sigB null mutants showed increased sensitivity to bile, the SigB regulon was not found to be upregulated in response to bile beyond levels expected by exposure to pH 5.5. Comparison of wildtype and corresponding ΔsigB strains newly identified 26 SigB-dependent genes, all with upstream putative SigB-dependent promoters. PMID:29467736
Ma, Xiaohong; Shor, Oded; Diminshtein, Sofia; Yu, Ling; Im, Yang Ju; Perera, Imara; Lomax, Aaron; Boss, Wendy F; Moran, Nava
2009-02-01
In the animal world, the regulation of ion channels by phosphoinositides (PIs) has been investigated extensively, demonstrating a wide range of channels controlled by phosphatidylinositol (4,5)bisphosphate (PtdInsP2). To understand PI regulation of plant ion channels, we examined the in planta effect of PtdInsP2 on the K+-efflux channel of tobacco (Nicotiana tabacum), NtORK (outward-rectifying K channel). We applied a patch clamp in the whole-cell configuration (with fixed "cytosolic" Ca2+ concentration and pH) to protoplasts isolated from cultured tobacco cells with genetically manipulated plasma membrane levels of PtdInsP2 and cellular inositol (1,4,5)trisphosphate: "Low PIs" had depressed levels of these PIs, and "High PIs" had elevated levels relative to controls. In all of these cells, K channel activity, reflected in the net, steady-state outward K+ currents (IK), was inversely related to the plasma membrane PtdInsP2 level. Consistent with this, short-term manipulations decreasing PtdInsP2 levels in the High PIs, such as pretreatment with the phytohormone abscisic acid (25 microM) or neutralizing the bath solution from pH 5.6 to pH 7, increased IK (i.e. NtORK activity). Moreover, increasing PtdInsP2 levels in controls or in abscisic acid-treated high-PI cells, using the specific PI-phospholipase C inhibitor U73122 (2.5-4 microM), decreased NtORK activity. In all cases, IK decreases stemmed largely from decreased maximum attainable NtORK channel conductance and partly from shifted voltage dependence of channel gating to more positive potentials, making it more difficult to activate the channels. These results are consistent with NtORK inhibition by the negatively charged PtdInsP2 in the internal plasma membrane leaflet. Such effects are likely to underlie PI signaling in intact plant cells.
Inhibition of (/sup 3/H)nitrendipine binding by phospholipase A/sub 2/
Energy Technology Data Exchange (ETDEWEB)
Goldman, M.E.; Pisano, J.J.
1985-10-07
Phospholipase A/sub 2/ from several sources inhibited (/sup 3/H)nitrendipine binding to membranes from brain, heart and ileal longitudinal muscle. The enzymes from bee venom and Russell's viper venom were most potent, having IC/sub 50/ values of approximately 5 and 14 ng/ml, respectively, in all three membrane preparations. Inhibition of binding by bee venom phospholipase A/sub 2/ was time- and dose-dependent. Mastoparan, a known facilitator of phospholipase A/sub 2/ enzymatic activity, shifted the bee venom phospholipase A/sub 2/ dose-response curve to the left. Pretreatment of brain membranes with bee venom phospholipase A/sub 2/ (10 ng/ml) for 15 min caused a 2-fold increase in the K/sub d/ without changing the B/sub max/ compared with untreated membranes. Extension of the preincubation period to 30 min caused no further increase in the K/sub d/ but significantly decreased the B/sub max/ to 71% the value for untreated membranes. (/sup 3/H)Nitrendipine, preincubated with bee venom phospholipase A/sub 2/, was recovered and found to be fully active, indicating that the phospholipase A/sub 2/ did not modify the ligand. It is concluded that phospholipase A/sub 2/ acts on the membrane at or near the (/sup 3/H)nitrendipine binding site and that phospholipids play a key role in the interactions of 1,4 dihydropyridine calcium channel antagonists with the dihydropyridine binding site. 33 references, 3 figures, 1 table.
Prevalence and growth of Listeria monocytogenes in naturally contaminated seafood
DEFF Research Database (Denmark)
Jørgensen, Lasse Vigel; Huss, Hans Henrik
1998-01-01
Listeria monocytogenes contamination of seafood varies with product category. The highest prevalence was found in cold- smoked fish (34-60%), while the lowest was found in heat- treated and cured seafood (4-12%). The prevalence of L. monocytogenes differed greatly in cold-smoked salmon between...... production sites, ranging from monocytogenes. The organism showed moderate growth...... in naturally contaminated cold-smoked, and 'gravad', fish while the growth appeared faster in hot smoked fish. Thus L. monocytogenes is not under control in these products. Finally, the prevalence and growth of L. monocytogenes in naturally contaminated cold-smoked salmon are discussed in relation...
Listeria monocytogenes endophthalmitis following keratoconjunctivitis
Directory of Open Access Journals (Sweden)
Shoughy SS
2014-01-01
Full Text Available Samir S Shoughy,1 Khalid F Tabbara1–31The Eye Center and The Eye Foundation for Research in Ophthalmology, Riyadh, Saudi Arabia; 2Department of Ophthalmology, College of Medicine, King Saud University, Riyadh, Saudi Arabia; 3The Wilmer Ophthalmological Institute of The Johns Hopkins University School of Medicine, Baltimore, MD, USAAbstract: Endophthalmitis due to endogenous or exogenous bacteria is a rare infection of the eye. We report a case of endophthalmitis following Listeria monocytogenes keratoconjunctivitis in a 27-year-old healthy white male presenting with hand motion visual acuity, right eye mucopurulent conjunctivitis, elevated intraocular pressure, and pigmented hypopyon 6 months post-keratectomy. The conjunctivitis was unresponsive to a 5-day course of topical tobramycin eye drops, and the patient developed keratitis with pain that progressed to endophthalmitis after 21 days. Diagnostic B-scan revealed vitreous exudates. Intraocular fluid specimen showed Gram-positive organisms and the aqueous culture grew penicillin-/aminoglycoside-sensitive L. monocytogenes. The patient was given intravitreal and systemic vancomycin and ceftazidime. The eye was unresponsive to intravenous penicillin and gentamicin; the anterior chamber progressively flattened and developed phthisis bulbi. L. monocytogenes keratoconjunctivitis may lead to bacterial endophthalmitis. Prompt culture and early antibiotic therapy are recommended.Keywords: conjunctivitis, L. monocytogenes, endophthalmitis
Directory of Open Access Journals (Sweden)
Jin-Qiang Chen
2017-09-01
Full Text Available Listeria monocytogenes, one of the most important foodborne pathogens, can cause listeriosis, a lethal disease for humans. L. ivanovii, which is closely related to L. monocytogenes, is also widely distributed in nature and infects mainly warm-blooded ruminants, causing economic loss. Thus, there are high priority needs for methodologies for rapid, specific, cost-effective and accurate detection, characterization and subtyping of L. monocytogenes and L. ivanovii in foods and environmental sources. In this review, we (A described L. monocytogenes and L. ivanovii, world-wide incidence of listeriosis, and prevalence of various L. monocytogenes strains in food and environmental sources; (B comprehensively reviewed different types of traditional and newly developed methodologies, including culture-based, antigen/antibody-based, LOOP-mediated isothermal amplification, matrix-assisted laser desorption ionization-time of flight-mass spectrometry, DNA microarray, and genomic sequencing for detection and characterization of L. monocytogenes in foods and environmental sources; (C comprehensively summarized different subtyping methodologies, including pulsed-field gel electrophoresis, multi-locus sequence typing, ribotyping, and phage-typing, and whole genomic sequencing etc. for subtyping of L. monocytogenes strains from food and environmental sources; and (D described the applications of these methodologies in detection and subtyping of L. monocytogenes in foods and food processing facilities.
Glycerol metabolism induces Listeria monocytogenes biofilm formation at the air-liquid interface.
Crespo Tapia, Natalia; den Besten, Heidy M W; Abee, Tjakko
2018-05-20
Listeria monocytogenes is a food-borne pathogen that can grow as a biofilm on surfaces. Biofilm formation in food-processing environments is a big concern for food safety, as it can cause product contamination through the food-processing line. Although motile aerobic bacteria have been described to form biofilms at the air-liquid interface of cell cultures, to our knowledge, this type of biofilm has not been described in L. monocytogenes before. In this study we report L. monocytogenes biofilm formation at the air-liquid interface of aerobically grown cultures, and that this phenotype is specifically induced when the media is supplemented with glycerol as a carbon and energy source. Planktonic growth, metabolic activity assays and HPLC measurements of glycerol consumption over time showed that glycerol utilization in L. monocytogenes is restricted to growth under aerobic conditions. Gene expression analysis showed that genes encoding the glycerol transporter GlpF, the glycerol kinase GlpK and the glycerol 3-phosphate dehydrogenase GlpD were upregulated in the presence of oxygen, and downregulated in absence of oxygen. Additionally, motility assays revealed the induction of aerotaxis in the presence of glycerol. Our results demonstrate that the formation of biofilms at the air-liquid interface is dependent on glycerol-induced aerotaxis towards the surface of the culture, where L. monocytogenes has access to higher concentrations of oxygen, and is therefore able to utilize this compound as a carbon source. Copyright © 2018 Elsevier B.V. All rights reserved.
Hemolytic potency and phospholipase activity of some bee and wasp venoms.
Watala, C; Kowalczyk, J K
1990-01-01
1. The action of crude venoms of four aculeate species: Apis mellifera, Vespa crabro, Vespula germanica and Vespula vulgaris on human erythrocytes was investigated in order to determine the lytic and phospholipase activity of different aculeate venoms and their ability to induce red blood cell hemolysis. 2. Bee venom was the only extract to completely lyse red blood cells at the concentration of 2-3 micrograms/ml. 3. Phospholipase activity in all of the examined vespid venoms was similar and the highest value was recorded in V. germanica. 4. Vespid venoms exhibited phospholipase B activity, which is lacking in honeybee venom. 5. In all membrane phospholipids but lecithin, lysophospholipase activity of vespid venoms was 2-6 times lower than the relevant phospholipase activity. 6. The incubation of red blood cells with purified bee venom phospholipase A2 was not accompanied by lysis and, when supplemented with purified melittin, the increase of red blood cell lysis was approximately 30%.
International Nuclear Information System (INIS)
Lambeau, G.; Barhanin, J.; Schweitz, H.; Qar, J.; Lazdunski, M.
1989-01-01
Four new monochain phospholipases were purified from the Oxyuranus scutellatus (taipan) venom. Three of them were highly toxic when injected into mice brain. One of these neurotoxic phospholipases, OS2, was iodinated and used in binding experiments to demonstrate the presence of two families of specific binding sites in rat brain synaptic membranes. The affinities were exceptionally high, Kd1 = 1.5 +/- 0.5 pM and Kd2 = 45 +/- 10 pM, and the maximal binding capacities were Bmax 1 = 1 +/- 0.4 and Bmax 2 = 3 +/- 0.5 pmol/mg of protein. Both binding sites were sensitive to proteolysis and demonstrated to be located on proteins of Mr 85,000-88,000 and 36,000-51,000 by cross-linking and photoaffinity labeling techniques. The binding of 125 I-OS2 to synaptic membranes was dependent on Ca2+ ions and enhanced by Zn2+ ions which inhibit phospholipase activity. Competition experiments have shown that, except for beta-bungarotoxin, a number of known toxic snake or bee phospholipases have very high affinities for the newly identified binding sites. A good correlation (r = 0.80) was observed between toxicity and affinity but not between phospholipase activity and affinity
Directory of Open Access Journals (Sweden)
Michela Ibba
2013-09-01
Full Text Available Listeria monocytogenes harbouring niches established in the processing plant support post-process contamination of dairy products made from pasteurised or thermised milk. The present study investigated L. monocytogenes environmental contamination in two sheep’s milk cheese-making plants. Persistence of contamination in the area at higher risk was also investigated. During a one-year survey 7 samplings were carried out in each dairy plant, along the production lines of Pecorino Romano and ricotta salata cheese. A total of 613 environmental samples collected from food contact and non-food contact surfaces were analysed according to ISO 11290-1:2005 standard method. Identification of the isolated strains was carried out by polymerase chain reaction. L. monocytogenes prevalence was 23.2% in dairy A and 13.1% in dairy B, respectively. The higher prevalence rate was found in the following areas: salting, products washing, packaging, ricotta salata storage and Pecorino Romano ripening rooms. L. monocytogenes was never found in the cheese-making area. The probability of observing samples positive for the presence of L. monocytogenes was asso- ciated with dairy plant, sampling area and the period of cheese-making (P<0.001. The greater persistence of contamination over time was observed in the washing, salting, and Pecorino Romano ripening areas. The control of persistent environmental contamination relies on the identification of L. monocytogenes niches within the processing environment and the prevention of harborage sites formation. The importance of strict cleaning and sanitising procedure in controlling L. monocytogenes environmental contamination is confirmed by the lower level of contamination observed after these procedures were correctly implemented.
Recombinant Lipases and Phospholipases and Their Use as Biocatalysts for Industrial Applications
Borrelli, Grazia M.; Trono, Daniela
2015-01-01
Lipases and phospholipases are interfacial enzymes that hydrolyze hydrophobic ester linkages of triacylglycerols and phospholipids, respectively. In addition to their role as esterases, these enzymes catalyze a plethora of other reactions; indeed, lipases also catalyze esterification, transesterification and interesterification reactions, and phospholipases also show acyltransferase, transacylase and transphosphatidylation activities. Thus, lipases and phospholipases represent versatile bioc...
Quercetin modulates activities of Taiwan cobra phospholipase A 2 ...
Indian Academy of Sciences (India)
Home; Journals; Journal of Biosciences; Volume 37; Issue 2. Quercetin modulates activities of Taiwan cobra phospholipase A2 via its effects on membrane structure and membrane-bound mode of phospholipase A2. Yi-Ling Chiou Shinne-Ren Lin Wan-Ping Hu Long-Sen Chang. Articles Volume 37 Issue 2 June 2012 pp ...
Long, Qin; Yue, Fang; Liu, Ruochen; Song, Shuiqing; Li, Xianbi; Ding, Bo; Yan, Xingying; Pei, Yan
2018-05-11
Cotton fibers are the most important natural raw material used in textile industries world-wide. Fiber length, strength, and fineness are the three major traits which determine the quality and economic value of cotton. It is known that exogenous application of phosphatidylinositols (PtdIns), important structural phospholipids, can promote cotton fiber elongation. Here, we sought to increase the in planta production of PtdIns to improve fiber traits. Transgenic cotton plants were generated in which the expression of a cotton phosphatidylinositol synthase gene (i.e., GhPIS) was controlled by the fiber-specific SCFP promoter element, resulting in the specific up-regulation of GhPIS during cotton fiber development. We demonstrate that PtdIns content was significantly enhanced in transgenic cotton fibers and the elevated level of PtdIns stimulated the expression of genes involved in PtdIns phosphorylation as well as promoting lignin/lignin-like phenolic biosynthesis. Fiber length, strength and fineness were also improved in the transgenic plants as compared to the wild-type cotton, with no loss in overall fiber yield. Our data indicate that fiber-specific up-regulation of PtdIns synthesis is a promising strategy for cotton fiber quality improvement.
International Nuclear Information System (INIS)
Hwang, P.M.; Verma, A.; Bredt, D.S.; Snyder, S.H.
1990-01-01
To assess the role of phosphatidylinositol turnover in taste transduction we have visualized, in rat tongue, ATP-dependent endoplasmic reticular accumulation of 45 Ca 2+ , inositol 1,4,5-trisphosphate receptor binding sites, and phosphatidylinositol turnover monitored by autoradiography of [ 3 H]cytidine diphosphate diacylglycerol formed from [ 3 H]cytidine. Accumulated 45 Ca 2+ , inositol 1,4,5-trisphosphate receptors, and phosphatidylinositol turnover are selectively localized to apical areas of the taste buds of circumvallate papillae, which are associated with bitter taste. Further evidence for a role of phosphatidylinositol turnover in bitter taste is our observation of a rapid, selective increase in mass levels of inositol 1,4,5-trisphosphate elicited by low concentrations of denatonium, a potently bitter tastant
Directory of Open Access Journals (Sweden)
J.A. Khan
2013-09-01
Full Text Available Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO. A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG; R: CCTCCAGAGTGATCGATGTT complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR. PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%, followed by fish meat (4.0%, and then beef (2.5%. Among various milk and milk products, curd (2.0% showed the highest prevalence, followed by raw milk (1.3%. The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 µL and 50 µL of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro resulted positive in twenty four
Listeria monocytogenes endophthalmitis following keratoconjunctivitis.
Shoughy, Samir S; Tabbara, Khalid F
2014-01-01
Endophthalmitis due to endogenous or exogenous bacteria is a rare infection of the eye. We report a case of endophthalmitis following Listeria monocytogenes keratoconjunctivitis in a 27-year-old healthy white male presenting with hand motion visual acuity, right eye mucopurulent conjunctivitis, elevated intraocular pressure, and pigmented hypopyon 6 months post-keratectomy. The conjunctivitis was unresponsive to a 5-day course of topical tobramycin eye drops, and the patient developed keratitis with pain that progressed to endophthalmitis after 21 days. Diagnostic B-scan revealed vitreous exudates. Intraocular fluid specimen showed Gram-positive organisms and the aqueous culture grew penicillin-/aminoglycoside-sensitive L. monocytogenes. The patient was given intravitreal and systemic vancomycin and ceftazidime. The eye was unresponsive to intravenous penicillin and gentamicin; the anterior chamber progressively flattened and developed phthisis bulbi. L. monocytogenes keratoconjunctivitis may lead to bacterial endophthalmitis. Prompt culture and early antibiotic therapy are recommended.
Meloni, Domenico; Piras, Francesca; Mureddu, Anna; Fois, Federica; Consolati, Simonetta Gianna; Lamon, Sonia; Mazzette, Rina
2013-11-01
In a 3-year study (2008 to 2011) to estimate the prevalence and the contamination sources of Listeria monocytogenes in pork meat in Sardinia, Italy, 211 samples were collected from five Sardinian swine slaughterhouses: 171 samples from slaughtered pigs and 40 from the slaughterhouse environment. Fifty L. monocytogenes isolates were characterized by PCR-based serotyping, presence of virulence-associated genes, and pulsed-field gel electrophoresis restriction analysis. The overall prevalence of L. monocytogenes was 33% in swine carcasses, 7% in cecal material, 23% on meat contact surfaces, and 25% on noncontact surfaces. Only two serotypes were detected: 1/2c (78%) and 1/2a (22%). In all, based on the presence of virulence-associated genes, eight pathogenic profiles were detected. Only 42% of all isolates carried the full complement of virulence-associated genes and were allotted to profile 1. Six pulsed-field gel electrophoresis profiles persisted in the slaughterhouses; restriction profiles appeared to be specific to each plant.
Hingston, Patricia; Chen, Jessica; Dhillon, Bhavjinder K.; Laing, Chad; Bertelli, Claire; Gannon, Victor; Tasara, Taurai; Allen, Kevin; Brinkman, Fiona S. L.; Truelstrup Hansen, Lisbeth; Wang, Siyun
2017-01-01
The human pathogen Listeria monocytogenes is a large concern in the food industry where its continuous detection in food products has caused a string of recalls in North America and Europe. Most recognized for its ability to grow in foods during refrigerated storage, L. monocytogenes can also tolerate several other food-related stresses with some strains possessing higher levels of tolerances than others. The objective of this study was to use a combination of phenotypic analyses and whole genome sequencing to elucidate potential relationships between L. monocytogenes genotypes and food-related stress tolerance phenotypes. To accomplish this, 166 L. monocytogenes isolates were sequenced and evaluated for their ability to grow in cold (4°C), salt (6% NaCl, 25°C), and acid (pH 5, 25°C) stress conditions as well as survive desiccation (33% RH, 20°C). The results revealed that the stress tolerance of L. monocytogenes is associated with serotype, clonal complex (CC), full length inlA profiles, and the presence of a plasmid which was identified in 55% of isolates. Isolates with full length inlA exhibited significantly (p monocytogenes sequence types, a new inlA PMSC, and several connections between CCs and the presence/absence or variations of specific genetic elements. A whole genome single-nucleotide-variants phylogeny revealed sporadic distribution of tolerant isolates and closely related sensitive and tolerant isolates, highlighting that minor genetic differences can influence the stress tolerance of L. monocytogenes. Specifically, a number of cold and desiccation sensitive isolates contained PMSCs in σB regulator genes (rsbS, rsbU, rsbV). Collectively, the results suggest that knowing the sequence type of an isolate in addition to screening for the presence of full-length inlA and a plasmid, could help food processors and food agency investigators determine why certain isolates might be persisting in a food processing environment. Additionally, increased
Novel Biocontrol Methods for Listeria monocytogenes Biofilms in Food Production Facilities
Directory of Open Access Journals (Sweden)
Jessica A. Gray
2018-04-01
Full Text Available High mortality and hospitalization rates have seen Listeria monocytogenes as a foodborne pathogen of public health importance for many years and of particular concern for high-risk population groups. Food manufactures face an ongoing challenge in preventing the entry of L. monocytogenes into food production environments (FPEs due to its ubiquitous nature. In addition to this, the capacity of L. monocytogenes strains to colonize FPEs can lead to repeated identification of L. monocytogenes in FPE surveillance. The contamination of food products requiring product recall presents large economic burden to industry and is further exacerbated by damage to the brand. Poor equipment design, facility layout, and worn or damaged equipment can result in Listeria hotspots and biofilms where traditional cleaning and disinfecting procedures may be inadequate. Novel biocontrol methods may offer FPEs effective means to help improve control of L. monocytogenes and decrease cross contamination of food. Bacteriophages have been used as a medical treatment for many years for their ability to infect and lyse specific bacteria. Endolysins, the hydrolytic enzymes of bacteriophages responsible for breaking the cell wall of Gram-positive bacteria, are being explored as a biocontrol method for food preservation and in nanotechnology and medical applications. Antibacterial proteins known as bacteriocins have been used as alternatives to antibiotics for biopreservation and food product shelf life extension. Essential oils are natural antimicrobials formed by plants and have been used as food additives and preservatives for many years and more recently as a method to prevent food spoilage by microorganisms. Competitive exclusion occurs naturally among bacteria in the environment. However, intentionally selecting and applying bacteria to effect competitive exclusion of food borne pathogens has potential as a biocontrol application. This review discusses these novel biocontrol
Novel Biocontrol Methods for Listeria monocytogenes Biofilms in Food Production Facilities
Gray, Jessica A.; Chandry, P. Scott; Kaur, Mandeep; Kocharunchitt, Chawalit; Bowman, John P.; Fox, Edward M.
2018-01-01
High mortality and hospitalization rates have seen Listeria monocytogenes as a foodborne pathogen of public health importance for many years and of particular concern for high-risk population groups. Food manufactures face an ongoing challenge in preventing the entry of L. monocytogenes into food production environments (FPEs) due to its ubiquitous nature. In addition to this, the capacity of L. monocytogenes strains to colonize FPEs can lead to repeated identification of L. monocytogenes in FPE surveillance. The contamination of food products requiring product recall presents large economic burden to industry and is further exacerbated by damage to the brand. Poor equipment design, facility layout, and worn or damaged equipment can result in Listeria hotspots and biofilms where traditional cleaning and disinfecting procedures may be inadequate. Novel biocontrol methods may offer FPEs effective means to help improve control of L. monocytogenes and decrease cross contamination of food. Bacteriophages have been used as a medical treatment for many years for their ability to infect and lyse specific bacteria. Endolysins, the hydrolytic enzymes of bacteriophages responsible for breaking the cell wall of Gram-positive bacteria, are being explored as a biocontrol method for food preservation and in nanotechnology and medical applications. Antibacterial proteins known as bacteriocins have been used as alternatives to antibiotics for biopreservation and food product shelf life extension. Essential oils are natural antimicrobials formed by plants and have been used as food additives and preservatives for many years and more recently as a method to prevent food spoilage by microorganisms. Competitive exclusion occurs naturally among bacteria in the environment. However, intentionally selecting and applying bacteria to effect competitive exclusion of food borne pathogens has potential as a biocontrol application. This review discusses these novel biocontrol methods and their
DEFF Research Database (Denmark)
Hingston, Patricia A.; Chen, Jessica; Dhillon, Bhavjinder K
2017-01-01
elements. A whole genome single-nucleotide-variants phylogeny revealed sporadic distribution of tolerant isolates and closely related sensitive and tolerant isolates, highlighting that minor genetic differences can influence the stress tolerance of L. monocytogenes. Specifically, a number of cold......The human pathogen Listeria monocytogenes is a large concern in the food industry where its continuous detection in food products has caused a string of recalls in North America and Europe. Most recognized for its ability to grow in foods during refrigerated storage, L. monocytogenes can also...... tolerate several other food-related stresses with some strains possessing higher levels of tolerances than others. The objective of this study was to use a combination of phenotypic analyses and whole genome sequencing to elucidate potential relationships between L. monocytogenes genotypes and food...
Directory of Open Access Journals (Sweden)
Nidiane D R Prado
Full Text Available Antivenoms, produced using animal hyperimmune plasma, remains the standard therapy for snakebites. Although effective against systemic damages, conventional antivenoms have limited efficacy against local tissue damage. Additionally, the hypersensitivity reactions, often elicited by antivenoms, the high costs for animal maintenance, the difficulty of producing homogeneous lots, and the instability of biological products instigate the search for innovative products for antivenom therapy. In this study, camelid antibody fragments (VHH with specificity to Bothropstoxin I and II (BthTX-I and BthTX-II, two myotoxic phospholipases from Bothrops jararacussu venom, were selected from an immune VHH phage display library. After biopanning, 28 and 6 clones recognized BthTX-I and BthTX-II by ELISA, respectively. Complementarity determining regions (CDRs and immunoglobulin frameworks (FRs of 13 VHH-deduced amino acid sequences were identified, as well as the camelid hallmark amino acid substitutions in FR2. Three VHH clones (KF498607, KF498608, and KC329718 were capable of recognizing BthTX-I by Western blot and showed affinity constants in the nanomolar range against both toxins. VHHs inhibited the BthTX-II phospholipase A2 activity, and when tested for cross-reactivity, presented specificity to the Bothrops genus in ELISA. Furthermore, two clones (KC329718 and KF498607 neutralized the myotoxic effects induced by B. jararacussu venom, BthTX-I, BthTX-II, and by a myotoxin from Bothrops brazili venom (MTX-I in mice. Molecular docking revealed that VHH CDRs are expected to bind the C-terminal of both toxins, essential for myotoxic activity, and to epitopes in the BthTX-II enzymatic cleft. Identified VHHs could be a biotechnological tool to improve the treatment for snake envenomation, an important and neglected world public health problem.
Directory of Open Access Journals (Sweden)
Hongzhuan Xuan
2011-01-01
Full Text Available To understand the mechanisms underlying the anti-inflammatory action of Chinese propolis, we investigated its effect on the activity of phosphatidylcholine-specific phospholipase C (PC-PLC that plays critical roles in control of vascular endothelial cell (VEC function and inflammatory responses. Furthermore, p53 and reactive oxygen species (ROS levels and mitochondrial membrane potential (Δψm were investigated. Our data indicated that treatment of Chinese propolis 6.25 and 12.5 μg/ml for 12 hours increased VEC viability obviously. Exposure to Chinese propolis 6.25, 12.5, and 25 μg/ml for 6 and 12 hours significantly decreased PC-PLC activity and p53 level, and ROS levels were depressed by Chinese propolis 12.5 μg/ml and 25 μg/ml dramatically. The Δψm of VECs was not affected by Chinese propolis at low concentration but disrupted by the propolis at 25 μg/ml significantly, which indicated that Chinese propolis depressed PC-PLC activity and the levels of p53 and ROS in VECs but disrupted Δψm at a high concentration.
Listeria monocytogenes Monographic Study
Directory of Open Access Journals (Sweden)
Emil Tirziu
2010-05-01
Full Text Available Listeria monocytogenes is a ubiquitous bacteria with a remarkable resistance in discordant condition which produce listeriosis, an infectious disease that affects multiple domestic and wild animals’ species, but also humans. Receptive to listeriosis are the majority of domestic or wild mammals and birds, in the last years being registered an increase of receptivity in humans. The concept of listeriosis in human pathology, a disease caused by eating or drinking contaminated food and water, appeared for the first time in 1981, during an outbreak in Canada with seven cases in adults and 34 cases of maternalfetal listeriosis. The alimentary origin of human listeriosis can be easily explained if considered some general characteristics of the bacteria. Thus, resistance in various conditions, especially at lower temperatures, justifies its dissemination and food contamination, particularly when is conserved by refrigeration. Also, L. monocytogenes has a significant presence in alimentary products. Some studies showed that 4% of the milk products, 29% of the meat products, 5% of the vegetable products and 26% of the products obtained from fishes and shell fishes are positive for L. monocytogenes, which allows us to say that battle against these bacteria is a war against microbial contamination.
Features of the Phosphatidylinositol Cycle and its Role in Signal Transduction.
Epand, Richard M
2017-08-01
The phosphatidylinositol cycle (PI-cycle) has a central role in cell signaling. It is the major pathway for the synthesis of phosphatidylinositol and its phosphorylated forms. In addition, some lipid intermediates of the PI-cycle, including diacylglycerol and phosphatidic acid, are also important lipid signaling agents. The PI-cycle has some features that are important for the understanding of its role in the cell. As a cycle, the intermediates will be regenerated. The PI-cycle requires a large amount of metabolic energy. There are different steps of the cycle that occur in two different membranes, the plasma membrane and the endoplasmic reticulum. In order to complete the PI-cycle lipid must be transferred between the two membranes. The role of the Nir proteins in the process has recently been elucidated. The lipid intermediates of the PI-cycle are normally highly enriched with 1-stearoyl-2-arachidonoyl molecular species in mammals. This enrichment will be retained as long as the intermediates are segregated from other lipids of the cell. However, there is a significant fraction (>15 %) of lipids in the PI-cycle of normal cells that have other acyl chains. Phosphatidylinositol largely devoid of arachidonoyl chains are found in cancer cells. Phosphatidylinositol species with less unsaturation will not be as readily converted to phosphatidylinositol-3,4,5-trisphosphate, the lipid required for the activation of Akt with resulting effects on cell proliferation. Thus, the cyclical nature of the PI-cycle, its dependence on acyl chain composition and its requirement for lipid transfer between two membranes, explain many of the biological properties of this cycle.
Changes in gene expression during adaptation of Listeria monocytogenes to the soil environment.
Piveteau, Pascal; Depret, Géraldine; Pivato, Barbara; Garmyn, Dominique; Hartmann, Alain
2011-01-01
Listeria monocytogenes is a ubiquitous opportunistic pathogen responsible for listeriosis. In order to study the processes underlying its ability to adapt to the soil environment, whole-genome arrays were used to analyse transcriptome modifications 15 minutes, 30 minutes and 18 h after inoculation of L. monocytogenes EGD-e in soil extracts. Growth was observed within the first day of incubation and large numbers were still detected in soil extract and soil microcosms one year after the start of the experiment. Major transcriptional reprofiling was observed. Nutrient acquisition mechanisms (phosphoenolpyruvate-dependent phosphotransferase systems and ABC transporters) and enzymes involved in catabolism of specific carbohydrates (β-glucosidases; chitinases) were prevalent. This is consistent with the overrepresentation of the CodY regulon that suggests that in a nutrient depleted environment, L. monocytogenes recruits its extensive repertoire of transporters to acquire a range of substrates for energy production.
An outbreak of an unusual strain of Listeria monocytogenes infection in North-East Scotland.
Okpo, Emmanuel; Leith, Jayne; Smith-Palmer, Alison; Bell, John; Parks, Duncan; Browning, Fiona; Byers, Lynn; Corrigan, Helen; Webster, Diana; Karcher, Anne M; Murray, Andrew; Storey, Tom
2015-01-01
Listeria monocytogenes infection is an important cause of illness and hospitalization in vulnerable individuals. In the present study, we describe a community outbreak of Listeria monocytogenes in the North-East region of Scotland, which was epidemiologically, environmentally and microbiologically linked to a local meat product and ready-to-eat product manufacturer. Infected individuals were interviewed, and an environmental investigation was conducted. Clinical and environmental samples were tested by culture, and isolates were typed by fluorescent amplified fragment length polymorphism (fAFLP). Three cases of Listeria monocytogenes were linked geographically, had the same serotype (1/2a) and were indistinguishable by fAFLP type XII.6. The human, food and environmental isolates were of the same serotype and were indistinguishable by molecular typing. This is the first community outbreak of L. monocytogenes reported in Scotland since the current outbreak surveillance was established in 1996. Epidemiological and laboratory evidence indicated poor hand hygiene, unhygienic practices and cross-contamination throughout the manufacturing process of ready-to-eat foods as a possible cause of the outbreak. More stringent control of commercial food establishments that provide ready-to-eat food and the need to advise specifically vulnerable groups, e.g., pregnant women, of the risk of L. monocytogenes in ready-to-eat food is urgently needed. Copyright © 2015 King Saud Bin Abdulaziz University for Health Sciences. Published by Elsevier Ltd. All rights reserved.
Oxaran, Virginie; Lee, Sarah Hwa In; Chaul, Luíza Toubas; Corassin, Carlos Humberto; Barancelli, Giovana Verginia; Alves, Virgínia Farias; de Oliveira, Carlos Augusto Fernandes; Gram, Lone; De Martinis, Elaine Cristina Pereira
2017-12-01
Listeria monocytogenes can cause listeriosis, a severe foodborne disease. In Brazil, despite very few reported cases of listeriosis, the pathogen has been repeatedly isolated from dairies. This has led the government to implement specific legislation to reduce the hazard. Here, we determined the incidence of L. monocytogenes in five dairies and retail products in the Southeast and Midwest regions of Brazil over eight months. Of 437 samples, three samples (0.7%) from retail and only one sample (0.2%) from the dairies were positive for L. monocytogenes. Thus, the contamination rate was significantly reduced as compared to previous studies. MultiLocus Sequence Typing (MLST) was used to determine if contamination was caused by new or persistent clones leading to the first MLST profile of L. monocytogenes from the Brazilian dairy industry. The processing environment isolate is of concern being a sequence-type (ST) 2, belonging to the lineage I responsible for the majority of listeriosis outbreaks. Also, ST3 and ST8 found in commercialized cheese have previously been reported in outbreaks. Despite the lower incidence, dairy products still pose a potential health risk and the occurrence of L. monocytogenes in dairies and retail products emphasize the need for continuous surveillance of this pathogen in the Brazilian dairy industry. Copyright © 2017 Elsevier Ltd. All rights reserved.
Osh4p exchanges sterols for phosphatidylinositol 4-phosphate between lipid bilayers
de Saint-Jean, Maud; Delfosse, Vanessa; Douguet, Dominique; Chicanne, Gaetan; Payrastre, Bernard; Bourguet, William; Antonny, Bruno; Drin, Guillaume
2011-01-01
Osh/Orp proteins transport sterols between organelles and are involved in phosphoinositide metabolism. The link between these two aspects remains elusive. Using novel assays, we address the influence of membrane composition on the ability of Osh4p/Kes1p to extract, deliver, or transport dehydroergosterol (DHE). Surprisingly, phosphatidylinositol 4-phosphate (PI(4)P) specifically inhibited DHE extraction because PI(4)P was itself efficiently extracted by Osh4p. We solve the structure of the Os...
Purification of phospholipase A2 from Bothrops atrox venom
Directory of Open Access Journals (Sweden)
B. Quevedo
1999-01-01
Full Text Available Phospholipase A2 (PLA2 from Bothrops atrox (Sensu lato venom, from Chiriguaná (Colombia was purified using exclusión chromatography on Sephadex G-75, obtaining five fractions one of which showed phospholipase A2 activity. After further purification on Mono S cationic exchange column, eight fractions with PLA2 activity, measured using the hemolytic method, were obtained.
Mastronicolis, Sofia K; Berberi, Anita; Diakogiannis, Ioannis; Petrova, Evanthia; Kiaki, Irene; Baltzi, Triantafillia; Xenikakis, Polydoros
2010-10-01
This study provides a first approach to observe the effects on Listeria monocytogenes of cellular exposure to acid stress at low or neutral pH, notably how phospho- or neutral lipids are involved in this mechanism, besides the fatty acid profile alteration. A thorough investigation of the composition of polar and neutral lipids from L. monocytogenes grown at pH 5.5 in presence of hydrochloric, acetic and lactic acids, or at neutral pH 7.3 in presence of benzoic acid, is described relative to cells grown in acid-free medium. The results showed that only low pH values enhance the antimicrobial activity of an acid. We suggest that, irrespective of pH, the acid adaptation response will lead to a similar alteration in fatty acid composition [decreasing the ratio of branched chain/saturated straight fatty acids of total lipids], mainly originating from the neutral lipid class of adapted cultures. Acid adaptation in L. monocytogenes was correlated with a decrease in total lipid phosphorus and, with the exception of cells adapted to benzoic acid, this change in the amount of phosphorus reflected a higher content of the neutral lipid class. Upon acetic or benzoic acid stress the lipid phosphorus proportion was analysed in the main phospholipids present: cardiolipin, phosphatidylglycerol, phosphoaminolipid and phosphatidylinositol. Interestingly only benzoic acid had a dramatic effect on the relative quantities of these four phospholipids.
Energy Technology Data Exchange (ETDEWEB)
Lambeau, G.; Barhanin, J.; Schweitz, H.; Qar, J.; Lazdunski, M. (Centre de Biochimie, Nice (France))
1989-07-05
Four new monochain phospholipases were purified from the Oxyuranus scutellatus (taipan) venom. Three of them were highly toxic when injected into mice brain. One of these neurotoxic phospholipases, OS2, was iodinated and used in binding experiments to demonstrate the presence of two families of specific binding sites in rat brain synaptic membranes. The affinities were exceptionally high, Kd1 = 1.5 +/- 0.5 pM and Kd2 = 45 +/- 10 pM, and the maximal binding capacities were Bmax 1 = 1 +/- 0.4 and Bmax 2 = 3 +/- 0.5 pmol/mg of protein. Both binding sites were sensitive to proteolysis and demonstrated to be located on proteins of Mr 85,000-88,000 and 36,000-51,000 by cross-linking and photoaffinity labeling techniques. The binding of {sup 125}I-OS2 to synaptic membranes was dependent on Ca2+ ions and enhanced by Zn2+ ions which inhibit phospholipase activity. Competition experiments have shown that, except for beta-bungarotoxin, a number of known toxic snake or bee phospholipases have very high affinities for the newly identified binding sites. A good correlation (r = 0.80) was observed between toxicity and affinity but not between phospholipase activity and affinity.
Listeria monocytogenes associated kerato-conjunctivitis in four horses in Norway.
Revold, Tobias; Abayneh, Takele; Brun-Hansen, Hege; Kleppe, Signe L; Ropstad, Ernst-Otto; Hellings, Robert A; Sørum, Henning
2015-11-09
Listeria monocytogenes has been reported to cause various infectious diseases in both humans and animals. More rarely, ocular infections have been reported. To our knowledge, only two cases of Listeria keratitis have been described in horses. We report kerato-conjunctivitis in four Norwegian horses associated with L. monocytogenes. Clinically, all cases were presented with recurrent unilateral kerato-conjunctivitis. L. monocytogenes bacteria were isolated from swab samples from all cases, and cytology carried out in 3 cases was indicative of L. monocytogenes infection. The present report describes the first known cases in which L. monocytogenes has been isolated from keratitic lesions in horses in Norway. A potential risk factor may be feeding of silage or haylage, but other sources of infection cannot be ruled out. The phenotypic features including antimicrobial susceptibility and serotype of the isolates are described. Laboratory detection of L. monocytogenes demands extra caution since only low numbers of bacteria were detected in the eye-swabs, probably due to the low volume of sample material and the intracellular niche of the bacterium. A general poor response to treatment in all these cases indicates that clinicians should pay extra attention to intensity and duration of treatment if L. monocytogenes is identified in connection with equine kerato-conjunctivitis.
Phosphatidylinositol 4-kinases: Function, structure, and inhibition
International Nuclear Information System (INIS)
Boura, Evzen; Nencka, Radim
2015-01-01
The phosphatidylinositol 4-kinases (PI4Ks) synthesize phosphatidylinositol 4-phosphate (PI4P), a key member of the phosphoinositide family. PI4P defines the membranes of Golgi and trans-Golgi network (TGN) and regulates trafficking to and from the Golgi. Humans have two type II PI4Ks (α and β) and two type III enzymes (α and β). Recently, the crystal structures were solved for both type II and type III kinase revealing atomic details of their function. Importantly, the type III PI4Ks are hijacked by +RNA viruses to create so-called membranous web, an extensively phosphorylated and modified membrane system dedicated to their replication. Therefore, selective and potent inhibitors of PI4Ks have been developed as potential antiviral agents. Here we focus on the structure and function of PI4Ks and their potential in human medicine
Phosphatidylinositol 4-kinases: Function, structure, and inhibition
Energy Technology Data Exchange (ETDEWEB)
Boura, Evzen, E-mail: boura@uochb.cas.cz; Nencka, Radim, E-mail: nencka@uochb.cas.cz
2015-10-01
The phosphatidylinositol 4-kinases (PI4Ks) synthesize phosphatidylinositol 4-phosphate (PI4P), a key member of the phosphoinositide family. PI4P defines the membranes of Golgi and trans-Golgi network (TGN) and regulates trafficking to and from the Golgi. Humans have two type II PI4Ks (α and β) and two type III enzymes (α and β). Recently, the crystal structures were solved for both type II and type III kinase revealing atomic details of their function. Importantly, the type III PI4Ks are hijacked by +RNA viruses to create so-called membranous web, an extensively phosphorylated and modified membrane system dedicated to their replication. Therefore, selective and potent inhibitors of PI4Ks have been developed as potential antiviral agents. Here we focus on the structure and function of PI4Ks and their potential in human medicine.
Day, J B; Basavanna, U
2015-01-01
To develop a rapid detection procedure for Listeria monocytogenes in infant formula and lettuce using a macrophage-based enrichment protocol and real-time PCR. A macrophage cell culture system was employed for the isolation and enrichment of L. monocytogenes from infant formula and lettuce for subsequent identification using real-time PCR. Macrophage monolayers were exposed to infant formula and lettuce contaminated with a serial dilution series of L. monocytogenes. As few as approx. 10 CFU ml(-1) or g(-1) of L. monocytogenes were detected in infant formula and lettuce after 16 h postinfection by real-time PCR. Internal positive PCR controls were utilized to eliminate the possibility of false-negative results. Co-inoculation with Listeria innocua did not reduce the L. monocytogenes detection sensitivity. Intracellular L. monocytogenes could also be isolated on Listeria selective media from infected macrophage lysates for subsequent confirmation. The detection method is highly sensitive and specific for L. monocytogenes in infant formula and lettuce and establishes a rapid identification time of 20 and 48 h for presumptive and confirmatory identification, respectively. The method is a promising alternative to many currently used q-PCR detection methods which employ traditional selective media for enrichment of contaminated food samples. Macrophage enrichment of L. monocytogenes eliminates PCR inhibitory food elements and contaminating food microflora which produce cleaner samples that increase the rapidity and sensitivity of detection. Published 2014. This article is a U.S. Government work and is in the public domain in the USA.
Directory of Open Access Journals (Sweden)
Ok Kyung Koo
Full Text Available BACKGROUND: Listeria monocytogenes, an intracellular foodborne pathogen, infects immunocompromised hosts. The primary route of transmission is through contaminated food. In the gastrointestinal tract, it traverses the epithelial barrier through intracellular or paracellular routes. Strategies to prevent L. monocytogenes entry can potentially minimize infection in high-risk populations. Listeria adhesion protein (LAP aids L. monocytogenes in crossing epithelial barriers via the paracellular route. The use of recombinant probiotic bacteria expressing LAP would aid targeted clearance of Listeria from the gut and protect high-risk populations from infection. METHODOLOGY/PRINCIPAL FINDINGS: The objective was to investigate the ability of probiotic bacteria or LAP-expressing recombinant probiotic Lactobacillus paracasei (Lbp(LAP to prevent L. monocytogenes adhesion, invasion, and transwell-based transepithelial translocation in a Caco-2 cell culture model. Several wild type probiotic bacteria showed strong adhesion to Caco-2 cells but none effectively prevented L. monocytogenes infection. Pre-exposure to Lbp(LAP for 1, 4, 15, or 24 h significantly (P<0.05 reduced adhesion, invasion, and transepithelial translocation of L. monocytogenes in Caco-2 cells, whereas pre-exposure to parental Lb. paracasei had no significant effect. Similarly, Lbp(LAP pre-exposure reduced L. monocytogenes translocation by as much as 46% after 24 h. Lbp(LAP also prevented L. monocytogenes-mediated cell damage and compromise of tight junction integrity. Furthermore, Lbp(LAP cells reduced L. monocytogenes-mediated cell cytotoxicity by 99.8% after 1 h and 79% after 24 h. CONCLUSIONS/SIGNIFICANCE: Wild type probiotic bacteria were unable to prevent L. monocytogenes infection in vitro. In contrast, Lbp(LAP blocked adhesion, invasion, and translocation of L. monocytogenes by interacting with host cell receptor Hsp60, thereby protecting cells from infection. These data show promise
Prevalence and location of Listeria monocytogenes in farmed rainbow trout.
Miettinen, Hanna; Wirtanen, Gun
2005-10-15
A total of 510 rainbow trout originating from fish farms in lakes and sea areas around Finland were studied for the presence of Listeria monocytogenes. Samples were studied as pools from five fish. Gill, viscera, and skin from the pooled samples were analysed separately. The individual samples were analysed later if the pooled sample was found to be Listeria positive. The prevalence of Listeria spp. and L. monocytogenes in pooled unprocessed fresh rainbow trout was on average 35.0% and 14.6%, respectively. On the other hand, the prevalence of Listeria spp. and L. monocytogenes in individual thawed fish was found to be 14.3% and 8.8%, respectively. These numbers tend to overestimate and underestimate the real situation because not all fish in pooled samples were necessarily contaminated and in some of the Listeria positive pooled samples all individual samples turned out to be Listeria free. The prevalence of L. monocytogenes varied greatly between different fish farms from zero to 100% in pooled samples and from zero to 75% according to individually studied fish samples. Some indications of the influence of weather conditions and seasonal variations that strongly affected the Listeria contamination of fish were also noticed. The location of Listeria spp. and L. monocytogenes in different parts of the fish differed with statistical significance in rainbow trout. Up to 95.6% of the L. monocytogenes and 84.5% of Listeria spp. positive samples were gill samples. Only 4.4% (2/45) of the L. monocytogenes positive samples were obtained from skin or viscera. Closer study at one fish farm revealed that there was only one L. monocytogenes ribotype present in the contaminated fish, although water and surfaces were heavily contaminated with six other L. monocytogenes ribotypes.
A case of bovine raw milk contamination with Listeria monocytogenes
Directory of Open Access Journals (Sweden)
Hunt Karen
2012-07-01
Full Text Available Abstract During routine sampling of bulk raw milk on a dairy farm, the pathogenic bacteria Listeria monocytogenes was found to be a contaminant, at numbers L. monocytogenes, indicating a possible case of excretion of the L. monocytogenes directly into the milk. Milk samples were collected from the individual cows and analysed, resulting in the identification of L. monocytogenes excretion (at 280 cfu/ml from one of the 4 mammary quarters of one dairy cow out of 180. When the infected cow was isolated from the herd, no L. monocytogenes was detected from the remaining herd. The pulsed-field gel electrophoresis pattern of the strain from the individual cow was indistinguishable from that originally isolated from the bulk milk. The infected cow did not show any clinical signs of disease, nor did the appearance of the milk have any physical abnormalities. Antibiotic treatment of the infected mammary quarter was found to be ineffective. This study shows that there can be risks associated with direct contamination of raw milk with L. monocytogenes.
Inhibition of sortase A by chalcone prevents Listeria monocytogenes infection.
Li, Hongen; Chen, Yutao; Zhang, Bing; Niu, Xiaodi; Song, Meng; Luo, Zhaoqing; Lu, Gejin; Liu, Bowen; Zhao, Xiaoran; Wang, Jianfeng; Deng, Xuming
2016-04-15
The critical role of sortase A in gram-positive bacterial pathogenicity makes this protein a good potential target for antimicrobial therapy. In this study, we report for the first time the crystal structure of Listeria monocytogenes sortase A and identify the active sites that mediate its transpeptidase activity. We also used a sortase A (SrtA) enzyme activity inhibition assay, simulation, and isothermal titration calorimetry analysis to discover that chalcone, an agent with little anti-L. monocytogenes activity, could significantly inhibit sortase A activity with an IC50 of 28.41 ± 5.34 μM by occupying the active site of SrtA. The addition of chalcone to a co-culture of L. monocytogenes and Caco-2 cells significantly inhibited bacterial entry into the cells and L. monocytogenes-mediated cytotoxicity. Additionally, chalcone treatment decreased the mortality of infected mice, the bacterial burden in target organs, and the pathological damage to L. monocytogenes-infected mice. In conclusion, these findings suggest that chalcone is a promising candidate for the development of treatment against L. monocytogenes infection. Copyright © 2016 Elsevier Inc. All rights reserved.
Nisenbom, H E; Seki, C; Vidal, J C
1986-01-01
One single protein species with phospholipase activity has been isolated from Bothrops alternatus venom by a procedure involving gel-filtration on Sephadex G-50 (Step 1), chromatography on SP-Sephadex C-50 (Step 2) and gel-filtration on Sephadex G-75 (Step 3). The purified sample behaved as a homogeneous, monodisperse protein with a molecular weight of 15,000 and isoelectric point of 5.04. The yield in enzyme activity was 48% of the starting material and the apparent purification was 51-fold. When assayed on 1,2-diheptanoyl- or 1,2-dimyristoyl-sn-glycero-3-phosphorylcholine, fatty acids and lysolecithins were the only reaction products, in accordance with the predicted stoichiometry. Studies on positional specificity suggested that the enzyme is a phospholipase A2. The enzyme requires Ca2+ ions for activity and exhibited stereochemical specificity, since the enantiomeric 2, 3-diheptanoyl-sn-glycero-1-phosphorylcholine was not hydrolyzed. Under the experimental conditions employed, reaction products representative of either phospholipase B or C activities could not be detected. After Step 1, the phospholipase activity recovered was higher than the total activity in the crude venom sample, which is explained by the separation of an inhibitor during enzyme purification. The inhibitor was responsible for the initial lag period that characterized the kinetics of the enzyme reaction with crude venom acting on aggregated substrates (lipoprotein, vesicles or micelles), while the rate of hydrolysis of monomeric lecithins was not affected.
CHALLENGE TESTS WITH LISTERIA MONOCYTOGENES IN SALAMI: PRELIMINARY RESULTS
Directory of Open Access Journals (Sweden)
R. Mioni
2013-02-01
Full Text Available Challenge tests are the preferable methodology to study the behaviour of Listeria monocytogenes on ready to eat foods, according to Regulation (EC 2073/2005. Challenge testing using L. monocytogenes in seasoned salami from different food business operators showed, after seasoning of the product, a count reduction of the inoculated organisms without any further growth of the pathogen; however differences of L. monocytogenes behaviour could be observed according to different production protocols.
Resistance of Listeria monocytogenes biofilms to sanitizing agents
Listeria monocytogenes is notorious for its capacity to colonize the environment and equipment of food processing facilities and to persist in the processing plant ecosystem, sometimes for decades. Such persistence is mediated by multiple attributes of L. monocytogenes, including the pathogen’s capa...
Seyoum, Eyasu Tigabu; Woldetsadik, Daniel Asrat; Mekonen, Tesfu Kassa; Gezahegn, Haile Alemayehu; Gebreyes, Wondwossen Abebe
2015-11-30
Listeria monocytogenes is of major significance in human and veterinary medicine. Most human Listeria infections are foodborne and the association of contaminated milk and dairy produce consumption with human listeriosis is noteworthy. In Ethiopia, there is limited data regarding the prevalence of L. monocytogenes in raw bovine milk and dairy products. The aim of this study was, therefore, to determine the prevalence of L. monocytogenes in raw bovine milk and dairy produce. A total of 443 milk and milk product samples were microbiologically analyzed following methods recommended by the U.S. Food and Drug Administration Bacteriological Analytical Manual to isolate Listeria spp. The overall prevalence of Listeria spp. was 28.4% and specifically that of L. monocytogenes was 5.6%. Taking the prevalence of Listeria spp. into consideration, cheese was found to be highly contaminated at 60%, followed by pasteurized milk samples (40%), raw milk (18.9%) and yoghurt (5%). Considering the prevalence of Listeria monocytogenes only, raw milk had the lowest contamination while cheese had the highest, followed by pasteurized milk and yoghurt. Raw milk and milk products produced in urban and peri-urban areas of central Ethiopia were contaminated with pathogenic bacteria, L. monocytogenes. The detection of this pathogen in raw milk and milk products warrants an urgent regulatory mechanism to be put in place and also the potential role of milk processing plants in the contamination of dairy products should be investigated.
Demel, R.A.; Geurts van Kessel, W.S.M.; Zwaal, R.F.A.; Roelofsen, B.; Deenen, L.L.M. van
1975-01-01
The action of purified phospholipases on monomolecular films of various interfacial pressures is compared with the action on erythrocyte membranes. The phospholipases which cannot hydrolyse phospholipids of the intact erythrocyte membrane, phospholipase C from Bacillus cereus, phospholipase A2 from
Directory of Open Access Journals (Sweden)
Ninoska eCordero
2016-03-01
Full Text Available Listeria monocytogenes has become one of the principal foodborne pathogens worldwide. The capacity of this bacterium to grow at low temperatures has opened an interesting field of study in terms of the identification and classification of new strains of L. monocytogenes with different growth capacities at low temperatures. We determined the growth rate at 8 ºC of 110 strains of L. monocytogenes isolated from different food matrices. We identified a group of slow and fast strains according to their growth rate at 8 °C and performed a global transcriptomic assay in strains previously adapted to low temperature. We then identified shared and specific transcriptional mechanisms, metabolic and cellular processes of both groups; bacterial motility was the principal process capable of differentiating the adaptation capacity of L. monocytogenes strains with different ranges of tolerance to low temperatures. Strains belonging to the fast group were less motile, which may allow these strains to achieve a greater rate of proliferation at low temperature.
Lactadherin inhibits secretory phospholipase A2 activity on pre-apoptotic leukemia cells.
Directory of Open Access Journals (Sweden)
Steffen Nyegaard
Full Text Available Secretory phospholipase A2 (sPLA2 is a critical component of insect and snake venoms and is secreted by mammalian leukocytes during inflammation. Elevated secretory PLA2 concentrations are associated with autoimmune diseases and septic shock. Many sPLA2's do not bind to plasma membranes of quiescent cells but bind and digest phospholipids on the membranes of stimulated or apoptotic cells. The capacity of these phospholipases to digest membranes of stimulated or apoptotic cells correlates to the exposure of phosphatidylserine. In the present study, the ability of the phosphatidyl-L-serine-binding protein, lactadherin to inhibit phospholipase enzyme activity has been assessed. Inhibition of human secretory phospholipase A2-V on phospholipid vesicles exceeded 90%, whereas inhibition of Naja mossambica sPLA2 plateaued at 50-60%. Lactadherin inhibited 45% of activity of Naja mossambica sPLA2 and >70% of human secretory phospholipase A2-V on the membranes of human NB4 leukemia cells treated with calcium ionophore A23187. The data indicate that lactadherin may decrease inflammation by inhibiting sPLA2.
International Nuclear Information System (INIS)
Lapetina, E.G.; Reep, B.R.
1987-01-01
We have assessed the binding of [alpha- 32 P]GTP to platelet proteins from cytosolic and membrane fractions. Proteins were separated by NaDodSO 4 /PAGE and electrophoretically transferred to nitrocellulose. Incubation of the nitrocellulose blots with [alpha- 32 P]GTP indicated the presence of specific and distinct GTP-binding proteins in cytosol and membranes. Binding was prevented by 10-100 nM GTP and by 100 nM guanosine 5'-[gamma-thio]triphosphate (GTP[gamma S]) or GDP; binding was unaffected by 1 nM-1 microM ATP. One main GTP-binding protein (29.5 kDa) was detected in the membrane fraction, while three others (29, 27, and 21 kDa) were detected in the soluble fraction. Two cytosolic GTP-binding proteins (29 and 27 kDa) were degraded by trypsin; another cytosolic protein (21 kDa) and the membrane-bound protein (29.5 kDa) were resistant to the action of trypsin. Treatment of intact platelets with trypsin or thrombin, followed by lysis and fractionation, did not affect the binding of [alpha- 32 P]GTP to the membrane-bound protein. GTP[gamma S] still stimulated phospholipase C in permeabilized platelets already preincubated with trypsin. This suggests that trypsin-resistant GTP-binding proteins might regulate phospholipase C stimulated by GTP[gamma S
Directory of Open Access Journals (Sweden)
Maysa A. I. Awadallah
2014-10-01
Full Text Available Aim: This study aimed to investigate the occurrence of some virulence genes distributed in Listeria monocytogenes isolated from ready-to-eat (RTE meat products and consumers in Cairo province, Egypt. Materials and Methods: A total of 120 beef luncheon, chicken luncheon and frankfurter beef (40 samples, each were collected from 10 different local shops situated in Al-salam city, Cairo province, Egypt. Stool samples were collected from 40 people who had the habit of consuming RTE meat. The suspected L. monocytogenes isolates were subjected to a multiplex polymerase chain reaction (PCR for rapid speciation and virulence determination using primers specific for inIA, inIC, and inIJ genes. Results: Culture examination of all samples on Oxford media revealed presence of colonies characteristic to L. monocytogenes in 6 beef luncheon (15%, 4 chicken luncheon (10%, 1 frankfurter beef (2.5% and 1 human stool (2.5% samples. Species identity of L. monocytogenes was verified through the amplification of a 800 bp fragment with inIA primers in 2 out of 6 culture isolates from beef luncheon (5%, and 1 out 4 culture isolates from chicken luncheon (2.5% samples. Statistical analysis revealed no significant difference between the occurrence of L. monocytogenes in different food samples examined (p>0.05. The virulence of these strains was ascertained by the presence of 517 bp and 238 bp fragments of inIC and inIJ genes, respectively in the isolates that contained the 800 bp fragment. The culture isolates obtained from one frankfurter beef sample, and one human stool sample were found negative by multiplex PCR for the presence of L. monocytogenes and its virulence specific genes. Conclusion: It could be concluded that L. monocytogenes are circulating in beef and chicken luncheon sold in Cairo, Egypt. Multiplex PCR is reliable for confirmation of L. monocytogenes. This study suggests the implementation of hygienic measures at all levels from production to consumption
Relationship between Listeria monocytogenes and Listeria spp. in seafood processing plants.
Alali, Walid Q; Schaffner, Donald W
2013-07-01
The objective of this study was to evaluate the relationship between prevalence of Listeria monocytogenes as an outcome and Listeria spp. as an explanatory variable by food products, food contact surfaces, and nonfood contact surfaces in seafood processing plants by using peer-reviewed published data. Nine sets of prevalence data of L. monocytogenes and Listeria spp. were collected from published studies and used for the analyses. Based on our analysis, the relationship between L. monocytogenes prevalence and Listeria spp. prevalence in food products (incoming raw materials and finish products) was significant (P = 0.04) with (low) R² = 0.36. Furthermore, Listeria spp. were not a good indicator for L. monocytogenes when testing food contact surfaces (R² = 0.10). Listeria spp. were a good indicator for L. monocytogenes only on nonfood contact surfaces (R² = 0.90). On the other hand, the presence of Listeria spp. on food contact surfaces (R² = 0.002) and nonfood contact surfaces (R² = 0.03) was not a good indicator for L. monocytogenes presence in food products. In general, prevalence of Listeria spp. does not seem to be a good indicator for L. monocytogenes prevalence in seafood processing plants.
DEFF Research Database (Denmark)
Vogel, Birte Fonnesbech; Huss, Hans Henrik; Ojeniyi, B.
2001-01-01
and environment could not be excluded. Contamination of the product occurred in specific areas (the brining and slicing areas). In plant I, the same RAPD type (RAPD type 12) was found over a 4-year period, indicating that an established in-house flora persisted and was not eliminated by routine hygienic......, monocytogenes). A total of 429 strains of L. monocytogenes were subsequently compared by random amplified polymorphic DNA (RAPD) profiling, and 55 different RAPD types were found. The RAPD types detected on the products were identical to types found on the processing equipment and in the processing environment...... procedures. In plant II, where the prevalence of L, monocytogenes was much tower, no RAPD type persisted over long periods of time, and several different L, monocytogenes RAPD types were isolated. This indicates that persistent strains may be avoided by rigorous cleaning and sanitation; however, due...
Directory of Open Access Journals (Sweden)
N. Soultos
2014-11-01
Full Text Available Aim: In the current study, a contribution to the knowledge on the prevalence and level of contamination of Listeria monocytogenes in ready-to-eat (RTE seafood marketed in Thessaloniki (Northern Greece was provided; the serovar identity of the L. monocytogenes isolates was also determined. Materials and Methods: A total of 132 RTE seafood samples consisting of 74 smoked fish products, 18 salted fish products, 16 dried fish products, 9 raw marinated fish products, 10 cooked marinated cephalopods and 5 surimi crab stick products were analyzed. L. monocytogenes were isolated and enumerated based on ISO 11290-1/A1 and ISO 11290-2/A1 protocols, respectively, and identified using a multiplex polymerase chain reaction (PCR system utilizing genus and species specific primers. For the identification of serotypes a second multiplex PCR assay was used which clusters L. monocytogenes strains into four major serogroups. Results: Of the samples examined, 11 (8.3% proved positive for Listeria spp. with 8 (6.1% yielding L. monocytogenes. Only in one sample of smoked mackerel the level of L. monocytogenes exceeded the legal safety limit of 100 cfu/g set out in Commission Regulation (EC No. 1441/2007. Serotyping showed higher percentages of isolates belonging to PCR serogroup 3:1/2b, 3b, 7 (46.7% and serogroup 1:1/2a, 3a (40% followed by serogroup 4:4b, 4d, 4e (13.3%. Conclusion: This study demonstrated that L. monocytogenes can be isolated from processed RTE seafood products at retail in Thessaloniki (Northern Greece in low concentrations. However, the presence of this human pathogen in RTE seafood should not be overlooked, but it should be considered as having significance public health implications, particularly among the persons who are at greater risk. Therefore, RTE seafood should be produced under appropriate hygienic and technological conditions since the product does not undergo any treatment before consumption.
Expression of Enzymatically Inactive Wasp Venom Phospholipase A1 in Pichia pastoris
DEFF Research Database (Denmark)
Borodina, Irina; Jensen, Bettina M.; Wagner, Tim
2011-01-01
Wasp venom allergy is the most common insect venom allergy in Europe. It is manifested by large local reaction or anaphylactic shock occurring after a wasp sting. The allergy can be treated by specific immunotherapy with whole venom extracts. Wasp venom is difficult and costly to obtain...... and is a subject to composition variation, therefore it can be advantageous to substitute it with a cocktail of recombinant allergens. One of the major venom allergens is phospholipase A1, which so far has been expressed in Escherichia coli and in insect cells. Our aim was to produce the protein in secreted form...... in yeast Pichia pastoris, which can give high yields of correctly folded protein on defined minimal medium and secretes relatively few native proteins simplifying purification.Residual amounts of enzymatically active phospholipase A1 could be expressed, but the venom protein had a deleterious effect...
Expression of enzymatically inactive wasp venom phospholipase A1 in Pichia pastoris
DEFF Research Database (Denmark)
Borodina, Irina; Jensen, Bettina M.; Wagner, Tim
Wasp venom allergy is the most common insect venom allergy in Europe. It is manifested by large local reaction or anaphylactic shock occurring after a wasp sting. The allergy can be treated by specific immunotherapy with whole venom extracts. Wasp venom is difficult and costly to obtain...... and is a subject to composition variation, therefore it can be advantageous to substitute it with a cocktail of recombinant allergens. One of the major venom allergens is phospholipase A1, which so far has been expressed in Escherichia coli and in insect cells. Our aim was to produce the protein in secreted form...... in yeast Pichia pastoris, which can give high yields of correctly folded protein on defined minimal medium and secretes relatively few native proteins simplifying purification. Residual amounts of enzymatically active phospholipase A1 could be expressed, but the venom protein had a deleterious effect...
Expression of enzymatically inactive wasp venom phospholipase A1 in Pichia pastoris
DEFF Research Database (Denmark)
Borodina, Irina; Jensen, Bettina M; Wagner, Tim
2011-01-01
Wasp venom allergy is the most common insect venom allergy in Europe. It is manifested by large local reaction or anaphylactic shock occurring after a wasp sting. The allergy can be treated by specific immunotherapy with whole venom extracts. Wasp venom is difficult and costly to obtain...... and is a subject to composition variation, therefore it can be advantageous to substitute it with a cocktail of recombinant allergens. One of the major venom allergens is phospholipase A1, which so far has been expressed in Escherichia coli and in insect cells. Our aim was to produce the protein in secreted form...... in yeast Pichia pastoris, which can give high yields of correctly folded protein on defined minimal medium and secretes relatively few native proteins simplifying purification.Residual amounts of enzymatically active phospholipase A1 could be expressed, but the venom protein had a deleterious effect...
LISTERIA MONOCYTOGENES RISK EVALUATION IN READY TO EAT DELI PRODUCTS
Directory of Open Access Journals (Sweden)
T Civera
2013-02-01
Full Text Available Listeria monocytogenes has become one of the major concerns for food safety. Its ability to survive and replicate at low temperature, pH and high salt concentration, makes the bacterium a threat, mostly for RTE products. For these reasons, the present research was aimed at detecting the ability of growth of L. monocytogenes in RTE products retrieved from one deli store. Samples were analysed for L. monocytogenes detection, then inoculated with the pathogen (105cell/ml and stored at refrigeration temperature for the duration of their shelf-life (15-60 days. In all the products L. monocytogenes was not detected before experimental contamination. The challenge test evidenced that experimentally inoculated L. monocytogenes was not able to multiply for the duration of the entire shelf-life. These results indicated that the tested products could be considered as foods which are not able to support the growth of L. monocytogenes, as indicated by E.C. Regulation 2073/05. However, in order to guarantee consumer’s safety, it needs to be emphasized the need of a correct application of the GMPs, required for lowering the risk of initial contamination.
Kuipers, O P; Dekker, N; Verheij, H M; de Haas, G H
1990-06-26
The role of Tyr-69 of porcine pancreatic phospholipase A2 in substrate binding was studied with the help of proteins modified by site-directed mutagenesis and phospholipid analogues with a changed head-group geometry. Two mutants were used containing Phe and Lys, respectively, at position 69. Modifications in the phospholipids included introduction of a sulfur at the phosphorus (thionophospholipids), removal of the negative charge at phosphorus (phosphatidic acid dimethyl ester), and reduction (phosphonolipids) or extension (diacylbutanetriol choline phosphate) of the distance between the phosphorus and the acyl ester bond. Replacement of Tyr-69 by Lys reduces enzymatic activity, but the mutant enzyme retains both the stereospecificity and positional specificity of native phospholipase A2. The Phe-69 mutant not only hydrolyzes the Rp isomer of thionophospholipids more efficiently than the wild-type enzyme, but the Sp thiono isomer is hydrolyzed too, although at a low (approximately 4%) rate. Phosphonolipids are hydrolyzed by native phospholipase A2 about 7 times more slowly than natural phospholipids, with retention of positional specificity and a (partial) loss of stereospecificity. The dimethyl ester of phosphatidic acid is degraded efficiently in a calcium-dependent and positional-specific way by native phospholipase A2 and by the mutants, indicating that a negative charge at phosphorus is not an absolute substrate requirement. The activities on the phosphatidic acid dimethyl ester of native enzyme and the Lys-69 mutant are lower than those on the corresponding lecithin, in contrast to the Phe-69 mutant, which has equal activities on both substrates.(ABSTRACT TRUNCATED AT 250 WORDS)
Internalization of Listeria monocytogenes in cantaloupes during dump tank washing and hydrocooling.
Macarisin, Dumitru; Wooten, Anna; De Jesus, Antonio; Hur, Minji; Bae, Seonjae; Patel, Jitendra; Evans, Peter; Brown, Eric; Hammack, Thomas; Chen, Yi
2017-09-18
Recent listeriosis outbreaks and recalls associated with cantaloupes urge for studies to understand the mechanisms of cantaloupe contamination by Listeria monocytogenes. Postharvest practices such as washing and hydrocooling were suggested to facilitate the contamination of fresh fruits by human pathogens. This study assessed the potential of L. monocytogenes internalization into cantaloupes during dump tank washing and immersion-type hydrocooling in water contaminated with L. monocytogenes. The effect of cantaloupe cultivar, water temperature, and harvesting technique on L. monocytogenes internalization was also evaluated. Full slip (cantaloupe without any residual stem) Western and Eastern cultivar cantaloupes were pre-warmed to 42°C (to imitate peak-high field temperatures of freshly harvested cantaloupes) and then immersed in water at 6°C and 18°C containing 4 and 6logCFU/ml of L. monocytogenes. Clipped (cantaloupe with short stem residues obtained by clipping the stem at harvest) Western and Eastern cantaloupes were pre-warmed to 42°C and then immersed in water at 6°C containing 6logCFU/ml of L. monocytogenes. Additionally, full slip and clipped Western cantaloupes were equilibrated to 18°C and then immersed in water at 18°C containing 6logCFU/ml of L. monocytogenes (isothermal immersion without temperature differential). Water containing L. monocytogenes infiltrated both full slip and clipped cantaloupes through the stems/stem scars and was then distributed along the vascular system in hypodermal mesocarp reaching the calyx area of the fruit. The current study demonstrated that, under experimental conditions, L. monocytogenes can internalize into cantaloupes during immersion in water contaminated by L. monocytogenes, both in the presence and absence of temperature differential, and that temperature differential moderately enhanced the internalization of L. monocytogenes. The incidence and levels of L. monocytogenes internalized in the middle
Listeria monocytogenes growth limits and stress resistance mechanisms
Veen, van der S.
2008-01-01
The food-borne pathogen Listeria monocytogenes is a Gram-positive facultative anaerobic rod, which is the causative agent of listeriosis. Due to the severity of the disease and the fact that its incidence is increasing in numerous European countries, L. monocytogenes is of great public health
DEFF Research Database (Denmark)
Ojeniyi, B.; Wegener, Henrik Caspar; Jensen, N.E.
1996-01-01
Listeria monocytogenes was isolated from 11/236 (4 . 7%) caecal samples from parent flocks, providing broilers to the abattoirs investigated. Caecal samples from 2078 broilers representing 90 randomly selected broiler flocks were negative for L. monocytogenes. A total of 3080 samples from seven...... abattoirs including poultry processing line samples, and final products were also examined for L. monocytogenes. Listeria monocytogenes was isolated in 0 . 3% to 18 . 7% of the samples collected in the different abattoirs. Epidemiological typing of 247 L. monocytogenes isolates, including serotyping, phage...... isolates of L. monocytogenes since only 120/247 (48 . 6%) isolates were typable by phage typing and 230/247 (93 . 1%) L. monocytogenes belonged to serotype 01 while 6/247 (2 . 4%) belonged to 04. The discovery of a few dominating clones in each abattoir might indicate an endemic occurrence of L...
Aerosol studies with Listeria innocua and Listeria monocytogenes.
Zhang, Guodong; Ma, Li; Oyarzabal, Omar A; Doyle, Michael P
2007-08-01
Aerosol studies of Listeria monocytogenes in food processing plants have been limited by lack of a suitable surrogate microorganism. The objective of this study was to investigate the potential of using green fluorescent protein-labeled strains of Listeria innocua as a surrogate for L. monocytogenes for aerosol studies. These studies were conducted in a laboratory bioaerosol chamber and a pilot food-processing facility. Four strains of L. innocua and five strains of L. monocytogenes were used. In the laboratory chamber study, Listeria cells were released into the environment at two different cell numbers and under two airflow conditions. Trypticase soy agar (TSA) plates and oven-roasted breasts of chicken and turkey were placed in the chamber to monitor Listeria cell numbers deposited from aerosols. A similar experimental design was used in the pilot plant study; however, only L. innocua was used. Results showed that L. monocytogenes and L. innocua survived equally well on chicken and turkey breast meats and TSA plates. No-fan and continuous fan applications, which affected airflow, had no significant effect on settling rates of aerosolized L. monocytogenes and L. innocua in the bioaerosol chamber or L. innocua in the pilot plant study. Listeriae cell numbers in the air decreased rapidly during the first 1.5 h following release, with few to no listeriae detected in the air at 3 h. Aerosol particles with diameters of 1 and 2 microM correlated directly with the number of Listeria cells in the aerosol but not with particles that were 0.3, 0.5, and 5 microM in diameter. Results indicate that L. innocua can be used as a surrogate for L. monocytogenes in an aerosol study.
Vongkamjan, Kitiya; Fuangpaiboon, Janejira; Turner, Matthew P; Vuddhakul, Varaporn
2016-02-01
Listeriosis outbreaks have been associated with a variety of foods. This study investigated the prevalence and diversity of Listeria monocytogenes and Listeria spp. in ready-to-eat (RTE) products and evaluated the performance of a rapid detection method, the 3M molecular detection assay for L. monocytogenes (MDA-LM), for detection of L. monocytogenes. Assay results were compared with those obtained using the U.S. Food and Drug Administration standard culture method described in the Bacteriological Analytical Manual. Products (n = 200) were purchased from retail stores: 122 aquatic products, 22 products of animal origin, 18 vegetarian products, 15 deli meat products, 13 salad and vegetable products, 4 desserts, 2 egg-based products, and 4 other products. L. monocytogenes prevalence was comparable with both methods. Overall, 15 (7.5%) of 200 samples were positive for L. monocytogenes: 3% of aquatic products, 1.5% of products of animal origin, 1% of vegetarian products, and 2% of deli meat products. Compared with the standard culture method, the sensitivity, specificity, and the accuracy of the MDA-LM were 86.7% (95% confidence interval, 58.4 to 97.7%), 98.4% (95% confidence interval, 95.0 to 99.6%), and 97.5%, respectively. Using the culture-based method, 18 (9%) of 200 samples were positive for Listeria species other than L. monocytogenes. Listeria isolates from these samples were classified into nine allelic types (ATs). The majority of isolates were classified as ATs 58 and 74, which were identified as L. monocytogenes lineages I and IV, respectively. Listeria innocua and Listeria welshimeri also were represented by isolates of multiple ATs. The MDA-LM is a rapid and reliable technique for detecting L. monocytogenes in various RTE foods. Further study is needed to develop effective control strategies to reduce L. monocytogenes contamination in RTE foods.
Some aspects of rat platelet and serum phospholipase A2 activities
Aarsman, A.J.; Roosenboom, C.F.P.; Geffen, G.E.W. van; Bosch, H. van den
1985-01-01
Rat platelet lysate contained appreciable phospholipase A2 activity. In agreement with literature data this enzymatic activity eluted in the void volume of a Sephadex G-100 column. When the void volume peak was chromatographed over a Matrex gel blue A column, part of the phospholipase A2 activity
Kureljušić, J.; Rokvić, N.; Jezdimirović, N.; Kureljušić, B.; Pisinov, B.; Karabasil, N.
2017-09-01
Listeria is the genus of a bacteria found in soil and water and some animals, including poultry and cattle. It can be present in raw milk and food made from raw milk. It can also live in food processing plants and contaminate a variety of processed meats. Microscopically, Listeria species appear as small, Gram-positive rods, which are sometimes arranged in short chains. In direct smears, they can be coccoid, so they can be mistaken for streptococci. Longer cells can resemble corynebacteria. Flagella are produced at room temperature but not at 37°C. Haemolytic activity on blood agar has been used as a marker to distinguish Listeria monocytogenes among other Listeria species, but it is not an absolutely definitive criterion. Further biochemical characterization is necessary to distinguish between the different Listeria species. The objective of this study was to detect, isolate and identify Listeria monocytogenes from poultry meat. Within a period of six months from January to June 2017, a total of 15 samples were collected. Three samples were positive for the presence of Listeria monocytogenes. Biochemical and microbiological tests as well as PCR technique using specific primers were used to confirm L. Monocytogenes in the samples.
Low prevalence of Listeria monocytogenes in cull sows and pork.
Wesley, Irene V; Larsen, Steven; Hurd, H Scott; McKean, James D; Griffith, Ronald; Rivera, Fernando; Nannapaneni, Ramakrishna; Cox, Mandy; Johnson, Michael; Wagner, Dean; de Martino, Mary
2008-03-01
The goal of this study was to determine the prevalence of Listeria monocytogenes in sows slaughtered at a single Midwestern plant on two occasions (trial 1, n = 179 sows; trial 2, n = 160 sows). Fecal samples collected antemortem (trial 1) as well as animal tissues, and carcass swabs collected at the abattoir (trials 1 and 2) were analyzed. Eight isolates of L. monocytogenes were recovered from five samples that represented 0.18% of the total samples (n = 2,775). In trial 1, L. monocytogenes was detected in a tonsil sample (0.6%; 1 positive of 181 tonsils), in a carcass (0.6%; 1 positive of 179 carcasses), which was sampled prior to the organic rinse, and in two chopped meat block samples (1.2%; 2 positive of 165 samples). In trial 2, L. monocytogenes was only detected in a single chopped meat block sample (0.15%; 1 positive of 688 total samples). These data indicate the low prevalence of L. monocytogenes in the cull sow.
Directory of Open Access Journals (Sweden)
Luisa Zanolli Moreno
2014-01-01
Full Text Available In the last decade, atypical Listeria monocytogenes and L. innocua strains have been detected in food and the environment. Because of mutations in the major virulence genes, these strains have different virulence intensities in eukaryotic cells. In this study, we performed phenotypic and genotypic characterization of atypical L. monocytogenes and L. innocua isolates obtained from swine slaughterhouses and meat markets. Forty strains were studied, including isolates of L. monocytogenes and L. innocua with low-hemolytic activity. The isolates were characterized using conventional phenotypic Listeria identification tests and by the detection and analysis of L. monocytogenes-specific genes. Analysis of 16S rRNA was used for the molecular identification of the Listeria species. The L. monocytogenes isolates were positive for all of the virulence genes studied. The atypical L. innocua strains were positive for hly, plcA, and inlC. Mutations in the InlC, InlB, InlA, PI-PLC, PC-PLC, and PrfA proteins were detected in the atypical isolates. Further in vitro and transcriptomic studies are being developed to confirm the role of these mutations in Listeria virulence.
Kishimura, Hideki; Hayashi, Kenji
2005-01-01
Phospholipase A (PLA) activities in the pyloric ceca and viscera from seven species of marine invertebrates (four starfish, one sea urchin, and two shellfish) were determined. Relatively high PLA specific activities were found in the pyloric ceca of two species of starfish (Coscinasterias acutispina and Plazaster borealis). Phospholipase A2s (PLA2s) were partially purified from the pyloric ceca of the starfish, C. acutispina PLA2 (C-PLA2) and P. borealis PLA2 (P-PLA2). The C-PLA2 and P-PLA2 m...
Directory of Open Access Journals (Sweden)
Iulia Glovaci
Full Text Available The lateral entorhinal cortex receives strong inputs from midbrain dopamine neurons that can modulate its sensory and mnemonic function. We have previously demonstrated that 1 µM dopamine facilitates synaptic transmission in layer II entorhinal cortex cells via activation of D1-like receptors, increased cAMP-PKA activity, and a resulting enhancement of AMPA-receptor mediated currents. The present study assessed the contribution of phosphatidylinositol (PI-linked D1 receptors to the dopaminergic facilitation of transmission in layer II of the rat entorhinal cortex, and the involvement of phospholipase C activity and release of calcium from internal stores. Whole-cell patch-clamp recordings of glutamate-mediated evoked excitatory postsynaptic currents were obtained from pyramidal and fan cells. Activation of D1-like receptors using SKF38393, SKF83959, or 1 µM dopamine induced a reversible facilitation of EPSCs which was abolished by loading cells with either the phospholipase C inhibitor U-73122 or the Ca2+ chelator BAPTA. Neither the L-type voltage-gated Ca2+ channel blocker nifedipine, nor the L/N-type channel blocker cilnidipine, blocked the facilitation of synaptic currents. However, the facilitation was blocked by blocking Ca2+ release from internal stores via inositol 1,4,5-trisphosphate (InsP3 receptors or ryanodine receptors. Follow-up studies demonstrated that inhibiting CaMKII activity with KN-93 failed to block the facilitation, but that application of the protein kinase C inhibitor PKC(19-36 completely blocked the dopamine-induced facilitation. Overall, in addition to our previous report indicating a role for the cAMP-PKA pathway in dopamine-induced facilitation of synaptic transmission, we demonstrate here that the dopaminergic facilitation of synaptic responses in layer II entorhinal neurons also relies on a signaling cascade dependent on PI-linked D1 receptors, PLC, release of Ca2+ from internal stores, and PKC activation which is
Cyclopentanoid analogs of phosphatidylcholine: susceptibility to phospholipase A2.
Lister, M D; Hancock, A J
1988-10-01
Six isomers of dipalmitoylcyclopentanetriol phosphocholine (cyclopentano-lecithin) were tested as potential substrates for phospholipase A2. Since each of these analogs possesses a configuration that mimics a narrow range of conformations of a glycerophospholipid molecule, the analogs were used to assess the enzyme's conformational requirements. Studies showed that all of the analogs containing the phosphocholine at the C-1 (or C-3) position could be hydrolyzed, while only one of the three analogs that contains the polar head group at the C-2 position was susceptible. Kinetic studies, however, revealed that only the all-trans-(1,3/2-1P)-cyclopentano-lecithin gave initial rates of hydrolysis that were measurable by pH-stat. Acyl group specificity of the enzyme towards the all-trans isomer was determined with an analog was acyl groups were distinguishable. The synthesis of this mixed-acid-cyclopentano-PC is described herein. When this analog was enzymatically assayed, results unequivocally showed the enzyme to be specific for C-2 acyl hydrolysis. This specificity, and data showing that the all-trans analog is stereospecifically hydrolyzed, indicate that it is acted on in an analogous manner to dipalmitoylphosphatidylcholine. These studies indicate that although the configuration of the analog is not necessarily a prerequisite for hydrolysis, there does appear to be an optimal spatial orientation for enzymatic activity. The analogy between the susceptibilities of all-trans-(1,3/2-1P)-cyclopentano-lecithin and glycero-lecithin suggests that the conformation of the glycero-lecithin during phospholipase A2-mediated hydrolysis may be best simulated by the all-trans orientation of C-O bonds in the artificial substrate.
Functional interaction between Cerebratulus lacteus cytolysin A-III and phospholipase A2
International Nuclear Information System (INIS)
Liu, J.; Blumenthal, K.M.
1988-01-01
A study on the interaction between bee venom phospholipase A 2 and Cerebratulus lacteus cytolysin A-III, a major hemolysin secreted by this organism has been carried out. The hemolytic activity of A-III in phosphate-buffered saline is increased 5-fold in the presence of phospholipase A 2 from bee venom. Dansylphosphatidylethanolamine (DPE) labeled, phosphatidylcholine-containing liposomes and human erythrocyte membranes were employed to study the interaction between these two proteins. In DPE-liposomes, A-III alone had no effect on DPE fluorescence nor did it enhance either the phospholipase A 2 -dependent fluorescence increase or blue shift in emission maximum, indicating that the cytolysis is not a major phospholipase A 2 -activator. However, when DPE was incorporated into erythrocyte membranes, A-III alone induced a 40% fluorescence increase and a 5 nm blue shift, implying a transient activation of an endogenous phospholipase A 2 . Further studies using synthetic lysophosphatidylcholine and free fatty acids demonstrated that the hemolytic activity of A-III is potentiated by free fatty acids, a product of phospholipid degradation catalyzed by phospholipase A 2 . Subsequent analysis of this phenomenon by gel filtration chromatography, analytical ultracentrifugation, chemical cross-linking, and measurement of [ 14 C]oleic acid binding by the cytolysin demonstrated that binding of oleic acid to A-III causes aggregation of the toxin molecules to a tetrameric form which has a higher α-helix content and a greater activity than the monomer
Chen, Poyin; den Bakker, Henk C; Korlach, Jonas; Kong, Nguyet; Storey, Dylan B; Paxinos, Ellen E; Ashby, Meredith; Clark, Tyson; Luong, Khai; Wiedmann, Martin; Weimer, Bart C
2017-02-01
Listeria monocytogenes is a bacterial pathogen that is found in a wide variety of anthropogenic and natural environments. Genome sequencing technologies are rapidly becoming a powerful tool in facilitating our understanding of how genotype, classification phenotypes, and virulence phenotypes interact to predict the health risks of individual bacterial isolates. Currently, 57 closed L. monocytogenes genomes are publicly available, representing three of the four phylogenetic lineages, and they suggest that L. monocytogenes has high genomic synteny. This study contributes an additional 15 closed L. monocytogenes genomes that were used to determine the associations between the genome and methylome with host invasion magnitude. In contrast to previous findings, large chromosomal inversions and rearrangements were detected in five isolates at the chromosome terminus and within rRNA genes, including a previously undescribed inversion within rRNA-encoding regions. Each isolate's epigenome contained highly diverse methyltransferase recognition sites, even within the same serotype and methylation pattern. Eleven strains contained a single chromosomally encoded methyltransferase, one strain contained two methylation systems (one system on a plasmid), and three strains exhibited no methylation, despite the occurrence of methyltransferase genes. In three isolates a new, unknown DNA modification was observed in addition to diverse methylation patterns, accompanied by a novel methylation system. Neither chromosome rearrangement nor strain-specific patterns of epigenome modification observed within virulence genes were correlated with serotype designation, clonal complex, or in vitro infectivity. These data suggest that genome diversity is larger than previously considered in L. monocytogenes and that as more genomes are sequenced, additional structure and methylation novelty will be observed in this organism. Listeria monocytogenes is the causative agent of listeriosis, a disease
A Dual Microscopy-Based Assay To Assess Listeria monocytogenes Cellular Entry and Vacuolar Escape.
Quereda, Juan J; Pizarro-Cerdá, Javier; Balestrino, Damien; Bobard, Alexandre; Danckaert, Anne; Aulner, Nathalie; Shorte, Spencer; Enninga, Jost; Cossart, Pascale
2016-01-01
Listeria monocytogenes is a Gram-positive bacterium and a facultative intracellular pathogen that invades mammalian cells, disrupts its internalization vacuole, and proliferates in the host cell cytoplasm. Here, we describe a novel image-based microscopy assay that allows discrimination between cellular entry and vacuolar escape, enabling high-content screening to identify factors specifically involved in these two steps. We first generated L. monocytogenes and Listeria innocua strains expressing a β-lactamase covalently attached to the bacterial cell wall. These strains were then incubated with HeLa cells containing the Förster resonance energy transfer (FRET) probe CCF4 in their cytoplasm. The CCF4 probe was cleaved by the bacterial surface β-lactamase only in cells inoculated with L. monocytogenes but not those inoculated with L. innocua, thereby demonstrating bacterial access to the host cytoplasm. Subsequently, we performed differential immunofluorescence staining to distinguish extracellular versus total bacterial populations in samples that were also analyzed by the FRET-based assay. With this two-step analysis, bacterial entry can be distinguished from vacuolar rupture in a single experiment. Our novel approach represents a powerful tool for identifying factors that determine the intracellular niche of L. monocytogenes. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Antimicrobial resistance of Listeria monocytogenes isolated from dairy-based food products.
Harakeh, Steve; Saleh, Imane; Zouhairi, Omar; Baydoun, Elias; Barbour, Elie; Alwan, Nisreen
2009-06-15
In this study Listeria monocytogenes (L. monocytogenes) was isolated from three traditionally consumed Lebanese dairy-based food products. One hundred and sixty four samples (45 samples of Baladi cheese, 36 samples of Shankleesh and 83 of Kishk) were collected from the Bekaa Valley in the Northeast region of Lebanon. Suspected Listeria colonies were selected and initially identified by using standard biochemical tests. Initial identification of the positive L. monocytogenes colonies was confirmed at the molecular level by Polymerase Chain Reaction (n=30) and the confirmed isolates were evaluated for their susceptibility to 10 commonly used antimicrobials. All of the 30 isolates were confirmed to be L. monocytogenes yielding a PCR product of approximately 660 base pairs (bp). L. monocytogenes was detected in 26.67%, 13.89% and 7.23% of the Baladi cheese, Shankleesh and Kishk samples, respectively. The highest resistance in L. monocytogenes isolates was noted against oxacillin (93.33%) followed by penicillin (90%). The results provide an indication of the contamination levels of dairy-based foods in Lebanon and highlight the emergence of multi-drug resistant Listeria in the environment.
Behaviour of Listeria monocytogenes in packaged fresh mushrooms (Agaricus bisporus).
González-Fandos, E; Olarte, C; Giménez, M; Sanz, S; Simón, A
2001-11-01
The aim of this study was to evaluate the potential of Listeria monocytogenes to grow in mushrooms packaged in two different types of PVC films when stored at 4 degrees C and 10 degrees C. Mushrooms were packed in two polymeric films (perforated and nonperforated PVC) and stored at 4 degrees C and 10 degrees C. The carbon dioxide and oxygen content inside the packages, aerobic mesophiles, psychrotrophs, Pseudomonas spp., Listeria monocytogenes, faecal coliforms, Escherichia coli, anaerobic spores and major sensory factors were determined. The mushrooms packaged in nonperforated film and stored at 4 degrees C had the most desirable quality parameters (texture, development stage and absence of moulds). Listeria monocytogenes was able to grow at 4 degrees C and 10 degrees C in inoculated mushrooms packaged in perforated and nonperforated films between 1 and 2 log units during the first 48 h. After 10 d of storage, the populations of L. monocytogenes were higher in mushrooms packaged in nonperforated film and stored at 10 degrees C. MAP followed by storage at 4 degrees C or 10 degrees C extends the shelf life by maintaining an acceptable appearance, but allows the growth and survival of L. monocytogenes. According to this study additional hurdles must be studied in order to prevent the growth of L. monocytogenes.
The role of phosphatidylinositol-transfer proteins at membrane contact sites.
Selitrennik, Michael; Lev, Sima
2016-04-15
Phosphatidylinositol-transfer proteins (PITPs) have been initially identified as soluble factors that accelerate the monomeric exchange of either phosphatidylinositol (PI) or phosphatidylcholine (PC) between membrane bilayersin vitro They are highly conserved in eukaryotes and have been implicated in different cellular processes, including vesicular trafficking, signal transduction, and lipid metabolism. Recent studies suggest that PITPs function at membrane contact sites (MCSs) to facilitate the transport of PI from its synthesis site at the endoplasmic reticulum (ER) to various membrane compartments. In this review, we describe the underlying mechanism of PITPs targeting to MCSs, discuss their cellular roles and potential mode of action. © 2016 Authors; published by Portland Press Limited.
Pombinho, Rita; Camejo, Ana; Vieira, Ana; Reis, Olga; Carvalho, Filipe; Almeida, Maria Teresa; Pinheiro, Jorge Campos; Sousa, Sandra; Cabanes, Didier
2017-05-01
Listeria monocytogenes is a major intracellular human foodborne bacterial pathogen. We previously revealed L. monocytogenes cadC as highly expressed during mouse infection. Here we show that L. monocytogenes CadC is a sequence-specific, DNA-binding and cadmium-dependent regulator of CadA, an efflux pump conferring cadmium resistance. CadC but not CadA is required for L. monocytogenes infection in vivo. Interestingly, CadC also directly represses lspB, a gene encoding a lipoprotein signal peptidase whose expression appears detrimental for infection. lspB overexpression promotes the release of the LpeA lipoprotein to the extracellular medium, inducing tumor necrosis factor α and interleukin 6 expression, thus impairing L. monocytogenes survival in macrophages. We propose that L. monocytogenes uses CadC to repress lspB expression during infection to avoid LpeA exposure to the host immune system, diminishing inflammatory cytokine expression and promoting intramacrophagic survival and virulence. CadC appears as the first metal efflux pump regulator repurposed during infection to fine-tune lipoprotein processing and host responses. © The Author 2017. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail: journals.permissions@oup.com.
Le Guédard, Marina; Bessoule, Jean-Jacques; Boyer, Valérie; Ayciriex, Sophie; Velours, Gisèle; Kulik, Willem; Ejsing, Christer S.; Shevchenko, Andrej; Coulon, Denis; Lessire, René; Testet, Eric
2009-01-01
In yeast, both phosphatidylinositol and phosphatidylserine are synthesized from cytidine diphosphate-diacylglycerol. Because, as in other eukaryotes, phosphatidylinositol contains more saturated fatty acids than phosphatidylserine (and other phospholipids), it has been hypothesized that either
Prevalence and characteristics of Listeria monocytogenes in bovine colostrum in Japan.
Hasegawa, Megumi; Iwabuchi, Eriko; Yamamoto, Shiori; Esaki, Hidetake; Kobayashi, Kazuhiko; Ito, Masahiko; Hirai, Katsuya
2013-02-01
This study was conducted to determine the prevalence and characteristics of Listeria monocytogenes in bovine colostrum in Japan. We collected bovine colostrum samples from 210 dams from 21 dairy farms in Hokkaido prefecture (Japan) between March and June 2009. L. monocytogenes was detected in samples from 6 (28.6%) of the 21 farms. Of the 210 samples, 16 (7.6%) were positive for L. monocytogenes. We recovered 80 L. monocytogenes isolates; 44 (55%) isolates were classified as serotype 1/2b and 36 (45%) were classified as serotype 4b. The isolates were susceptible to penicillin, ampicillin, amoxicillin, gentamicin, kanamycin, streptomycin, erythromycin, vancomycin, tetracycline, chloramphenicol, ciprofloxacin, and trimethoprim-sulfamethoxazole. Pulsed-field gel electrophoresis (PFGE) characterization of the 80 isolates revealed six PFGE types. Two PFGE types corresponded to human listeriosis cases. Most L. monocytogenes isolates possessed virulence-associated genes (actA, hly, iap, inlA, inlC, mpl, plcA, plcB, opuCA, prfA, and clpC). One PFGE type isolate possessed an epidemic clone II marker. Our findings suggest that isolates from bovine colostrum have the potential to cause human and animal listeriosis. This is the first study on the prevalence and characteristics of L. monocytogenes isolated from bovine colostrum obtained from dairy farms. Our results have important implications for improving public health and elucidating the epidemiology of L. monocytogenes in bovine colostrum.
Rapid detection of Listeria monocytogenes in foods, by a combination of PCR and DNA probe.
Ingianni, A; Floris, M; Palomba, P; Madeddu, M A; Quartuccio, M; Pompei, R
2001-10-01
Listeria monocytogenes is a frequent contaminant of water and foods. Its rapid detection is needed before some foods can be prepared for marketing. In this work L. monocytogenes has been searched for in foods, by a combination of polymerase chain reaction (PCR) and a DNA probe. Both PCR and the probe were prepared for recognizing a specific region of the internalin gene, which is responsible for the production of one of the most important pathogenic factors of Listeria. The combined use of PCR and the DNA probe was used for the detection of L. monocytogenes in over 180 environmental and food samples. Several detection methods were compared in this study, namely conventional culture methods; direct PCR; PCR after an enrichment step; a DNA probe alone; a DNA probe after enrichment and another commercially available gene-probe. Finally PCR and the DNA probe were used in series on all the samples collected. When the DNA probe was associated with the PCR, specific and accurate detection of listeria in the samples could be obtained in about a working-day. The present molecular method showed some advantages in terms of rapidity and specificity in comparison to the other aforementioned tests. In addition, it resulted as being easy to handle, even for non-specialized personnel in small diagnostic microbiology laboratories. Copyright 2001 Academic Press.
Prevalence of Listeria monocytogenes in poultry meat
Directory of Open Access Journals (Sweden)
Mehmet ELMALI
2015-01-01
Full Text Available AbstractThe objectives of this study were i to isolate Listeria spp. and Listeria monocytogenes in broiler wing meat samples, ii to confirm the isolates by PCR, based on prs and hly A gene sequences, iii to determine the seasonal and monthly distribution of the isolates. A total of 120 broiler wing meat samples (60 packaged pieces wrapped using strech film in styrofoam plates and 60 unpackaged pieces bought from different markets in Hatay province were analysed. Listeria spp. was isolated from 57 (47.5% out of 120 samples. Fifty-four, out of 57 Listeria spp. isolates were identified as L. monocytogenes. L. monocytogenes was isolated from the samples collected during the spring, winter, summer, and autumn at the levels of 26.6%, 40%, 53.3%, 60%, respectively. In this study, the isolation rates were found to be the highest in autumn, while the isolation rates were found to be the lowest in spring. As a consequence, high prevalence of Listeria spp. and L. monocytogenes in poultry wing meat samples may pose a risk for human health. We consider that with obeying the rules of good hygiene practices (GHP, good manufacturing practices (GMP and HACCP can minimize the contamination with Listeria spp.
Directory of Open Access Journals (Sweden)
Wanessa Altimiras Costa
2009-12-01
Full Text Available Este estudo avaliou um sistema de biocontrole para inibição de Listeria monocytogenes em couve minimamente processada, objetivando sua segurança durante estocagem sob refrigeração e em condições de abuso de temperatura. O potencial inibitório de bactérias láticas tolerantes ao sal e psicrotróficas contaminantes naturais da couve e Lactobacillus plantarum, Lactobacillus delbrueckii ATCC 9649 e Lactobacillus casei CCT 1465 foram avaliadas contra L. monocytogenes. O isolado de couve identificado como P. acidilactici CCA3 inibiu L. monocytogenes a 10 e 15 °C em ágar MRS e foi selecionado como possível agente de biocontrole. O número de L. monocytogenes na couve minimamente processada aumentou 3,7 e 4,7 ciclos logarítmicos a 5 e 10 °C, respectivamente, após 20 dias de armazenamento e 4,6 ciclos logarítmicos após oito dias a 15 °C. Entretanto, quando 10(8 UFC.g-1 de P. acidilactici CCA3 foram inoculados no produto processado, o crescimento de L. monocytogenes reduziu 2,3 ciclos logarítmicos sob temperatura abusiva de 15 °C. A acidez titulável e as características sensoriais da couve não foram alteradas pela presença de CCA3 ao longo do período de vida útil. Estes resultados sugerem o potencial de aplicação dos bioconservantes na couve minimamente processada, que necessitam estar associados à refrigeração e sanitização para garantir segurança.This study evaluated a biological control system for the inhibition of Listeria monocytogenes in minimally processed kale focusing on its freshness under refrigeration and extreme temperatures. The inhibitory potential of salt and cold tolerant lactic bacteria from natural microflora of kale, Lactobacillus delbrueckii ATCC 9649, Lactobacillus plantarum, and Lactobacillus casei CCT 1465 strains were evaluated against L. monocytogenes. Pediococcus acidilactici CCA3 isolated from kale exhibited a large inhibition zone of L. monocytogenes at 10 and 15 °C in MRS agar and was
Listeria monocytogenes in retailed raw chicken meat in Turkey.
Siriken, Belgin; Ayaz, Naim Deniz; Erol, Irfan
2014-01-01
The objectives of this study were, to find the prevalence and antimicrobial resistance of L. monocytogenes from a total of 116 chicken meat samples including 50 carcasses and 66 meat parts marketed in Turkey between 2008 and 2009 using immunomagnetic separation (IMS) based cultivation technique, to detect the hlyA gene for the verification of the isolates by PCR, and to identify the genoserotypes of the L. monocytogenes isolates by multiplex PCR assay. In the study, 51 L. monocytogenes colonies were isolated from 34 (29.3%) chicken meat samples (eleven [22.0%] carcasses and 23 [34.8%] pieces of meat) by IMS based cultivation technique and confirmed by PCR. According to the multiplex PCR results, all the 51 isolates were identified as genoserotype IIa (1/2a or 3a). L. monocytogenes isolates were also tested for their susceptibility to eight antibiotic (gentamicin, vancomycin, chloramphenicol, streptomycin, tetracycline, ampicillin, penicillin G, erythromycin) agents using the disk diffusion method. 14 isolates (27.45%) were susceptible to all eight antimicrobials drugs tested and the remaining 37 isolates (72.54%) were resistant to gentamicin (one isolate, 1.96%), vancomycin (four isolates, 7.84%), penicillin G (six isolates, 11.76%), streptomycin (nine isolates, 17.64%; resistant or intermediate), tetracycline (seven isolates, 13.72%) and ampicillin (six isolates, 11.76%). This study showed that antimicrobial resistance is not highly prevalent in L. monocytogenes isolated from chicken carcasses and pieces of meat. The presence of L. monocytogenes in chicken samples suggests an importance of this pathogen in chicken.
Iakimova, E.T.; Michaeli, R.; Woltering, E.J.
2013-01-01
Phospholipase D (PLD) and its product phosphatidic acid (PA) are incorporated in a complex metabolic network in which the individual PLD isoforms are suggested to regulate specific developmental and stress responses, including plant programmed cell death (PCD). Despite the accumulating knowledge,
Commensal microbes provide first line defense against Listeria monocytogenes infection
Littmann, Eric R.; Kim, Sohn G.; Morjaria, Sejal M.; Ling, Lilan; Gyaltshen, Yangtsho; Taur, Ying; Leiner, Ingrid M.
2017-01-01
Listeria monocytogenes is a foodborne pathogen that causes septicemia, meningitis and chorioamnionitis and is associated with high mortality. Immunocompetent humans and animals, however, can tolerate high doses of L. monocytogenes without developing systemic disease. The intestinal microbiota provides colonization resistance against many orally acquired pathogens, and antibiotic-mediated depletion of the microbiota reduces host resistance to infection. Here we show that a diverse microbiota markedly reduces Listeria monocytogenes colonization of the gut lumen and prevents systemic dissemination. Antibiotic administration to mice before low dose oral inoculation increases L. monocytogenes growth in the intestine. In immunodeficient or chemotherapy-treated mice, the intestinal microbiota provides nonredundant defense against lethal, disseminated infection. We have assembled a consortium of commensal bacteria belonging to the Clostridiales order, which exerts in vitro antilisterial activity and confers in vivo resistance upon transfer into germ free mice. Thus, we demonstrate a defensive role of the gut microbiota against Listeria monocytogenes infection and identify intestinal commensal species that, by enhancing resistance against this pathogen, represent potential probiotics. PMID:28588016
Directory of Open Access Journals (Sweden)
Daniel R. Rissi
2010-01-01
Full Text Available São descritos sete casos de doença neurológica em ovinos por Listeria monocytogenes no Rio Grande do Sul e Paraná entre 2000 e 2007. Foram afetados ovinos com idades entre 12-24 meses. Os casos ocorreram no verão e início da primavera e os índices gerais de morbidade e letalidade foram de 3,15% e 100%, respectivamente. Quando essa informação estava disponível, nenhum dos ovinos afetados era alimentado com silagem. Em três propriedades havia contato próximo dos ovinos afetados com outras espécies. A evolução do quadro clínico foi de 12 horas a três dias e os sinais clínicos foram caracterizados por decúbito (7/7, desvio da cabeça (4/7, incoordenação (3/7, depressão (3/7, andar em círculos (2/7, cegueira unilateral, emagrecimento progressivo, febre, midríase, movimentos de pedalagem, nistagmo lateral, opistótono, paralisia flácida dos membros pélvicos ou dos quatro membros, salivação excessiva e tremores (1/7 cada. Histologicamente observou-se encefalite com microabscessos, predominantemente unilateral com variáveis graus de gliose e alterações degenerativas como esferóides axonais e infiltração de células Gitter. As lesões se estendiam desde a medula oblonga até o mesencéfalo. Antígenos de Listeria monocytogenes foram detectados por imuno-histoquímica em seções de tronco encefálico de todos os ovinos afetados. O diagnóstico foi realizado com base nos achados epidemiológicos e clinico-patológicos, e confirmado pela imuno-histoquímica (IHQ utilizando anticorpo policlonal anti-L. monocytogenes.Seven cases of neurological disease in sheep caused by Listeria monocytogenes in Rio Grande do Sul and Paraná state, southern Brazil are described. The cases occurred between 2000 and 2007 and 12-24-month-old sheep were affected. Overall morbidity and lethality rates were 3.15% and 100%, respectively. Cases occurred in the summer and early spring. When this information was available, affected sheep had not been
Directory of Open Access Journals (Sweden)
Anouk C.M. Platteel
2017-08-01
Full Text Available Proteasome-catalyzed peptide splicing (PCPS generates peptides that are presented by MHC class I molecules, but because their identification is challenging, the immunological relevance of spliced peptides remains unclear. Here, we developed a reverse immunology-based multi-level approach to identify proteasome-generated spliced epitopes. Applying this strategy to a murine Listeria monocytogenes infection model, we identified two spliced epitopes within the secreted bacterial phospholipase PlcB that primed antigen-specific CD8+ T cells in L. monocytogenes-infected mice. While reacting to the spliced epitopes, these CD8+ T cells failed to recognize the non-spliced peptide parts in the context of their natural flanking sequences. Thus, we here show that PCPS expands the CD8+ T cell response against L. monocytogenes by exposing spliced epitopes on the cell surface. Moreover, our multi-level strategy opens up opportunities to systematically investigate proteins for spliced epitope candidates and thus strategies for immunotherapies or vaccine design.
Genetically encoded fluorescent probe to visualize phosphatidylinositol
Czech Academy of Sciences Publication Activity Database
Eisenreichová, Andrea; Humpolíčková, Jana; Bouřa, Evžen
2017-01-01
Roč. 284, Suppl 1 (2017), s. 364-365 ISSN 1742-464X. [FEBS Congress /42./ From Molecules to Cells and Back. 10.09.2017-14.09.2017, Jerusalem] R&D Projects: GA ČR GJ15-21030Y; GA MŠk LO1302 Institutional support: RVO:61388963 Keywords : phosphatidylinositol * fluorescent probe Subject RIV: CE - Biochemistry
Cellular and molecular investigations of the adhesion and mechanics of Listeria monocytogenes
Eskhan, Asma Omar
Atomic force microscopy has been used to quantify the adherence and mechanical properties of an array of L. monocytogenes strains and their surface biopolymers. First, eight L. monocytogenes strains that represented the two major lineages of the species were compared for their adherence and mechanics at cellular and molecular levels. Our results indicated that strains of lineage' II were characterized by higher adhesion and Young's moduli, longer and more rigid surface biopolymers and lower specific and nonspecific forces when compared to lineage' I strains. Additionally, adherence and mechanical properties of eight L. monocytogenes epidemic and environmental strains were probed. Our results pointed to that environmental and epidemic strains representative of a given lineage were similar in their adherence and mechanical properties when investigated at a cellular level. However, when the molecular properties of the strains were considered, epidemic strains were characterized by higher specific and nonspecific forces, shorter, denser and more flexible biopolymers compared to environmental strains. Second, the role of environmental pH conditions of growth on the adhesion and mechanics of a pathogenic L. monocytogenes EGDe was investigated. Our results pointed to a transition in the adhesion energies for cells cultured at pH 7. In addition, when the types of molecular forces that govern the adhesion were quantified using Poisson statistical approach and using a new proposed method, specific hydrogen-bond energies dominated the bacterial adhesion process. Such a finding is instrumental to researchers designing methods to control bacterial adhesion. Similarly, bacterial cells underwent a transition in their mechanical properties. We have shown that cells cultured at pH 7 were the most rigid compared to those cultured in lower or higher pH conditions of growth. Due to transitions observed in adherence and mechanics when cells were cultured at pH 7, we hypothesized that
Dynamics of Phosphoinositide-Dependent Signaling in Sympathetic Neurons
Kruse, Martin; Vivas, Oscar; Traynor-Kaplan, Alexis; Hille, Bertil
2016-01-01
In neurons, loss of plasma membrane phosphatidylinositol 4,5-bisphosphate [PI(4,5)P2] leads to a decrease in exocytosis and changes in electrical excitability. Restoration of PI(4,5)P2 levels after phospholipase C activation is therefore essential for a return to basal neuronal activity. However, the dynamics of phosphoinositide metabolism have not been analyzed in neurons. We measured dynamic changes of PI(4,5)P2, phosphatidylinositol 4-phosphate, diacylglycerol, inositol 1,4,5-trisphosphate...
Listeria monocytogenes infection of HD11, chicken macrophage-like cells.
Jarvis, N A; Donaldson, J R; O'Bryan, C A; Ricke, S C; Crandall, P G
2017-04-01
Listeria monocytogenes can be carried by and infect poultry, although the clinical disease in birds is rare. Escape from macrophage phagocytosis is a key step in pathogenesis for L. monocytogenes. Therefore, we investigated the infection of the chicken macrophage-like cell line HD11 with 2 strains of L. monocytogenes EGD-e and Scott A. After infection, L. monocytogenes was quantified by spread plating and HD11 was quantified with trypan blue exclusion stain before enumeration. The standard macrophage killing protocols require washing the cell monolayers 3 times with PBS, which was found to negatively influence HD11 monolayers. Maximum bacterial densities within macrophages were not different between the 2 Listeria strains. HD11 required more than 11 h to effectively reduce intracellular L. monocytogenes Scott A, and Scott A was more susceptible to HD11 killing than EGD-e. It appears that Listeria infection initially causes attenuation of HD11 growth, and infected HD11 cells do not begin to lyse until at least 11 h post infection. These results suggest that there are subtle strain to strain differences in response to HD11 macrophage phagocytosis. The long lead-time required for HD11 to kill L. monocytogenes cells means that there is sufficient time available for chicken macrophages to circulate in the blood and transfer the intracellular Listeria to multiple tissues. © 2016 Poultry Science Association Inc.
Survival of Bactericidal Antibiotic Treatment by a Persister Subpopulation of Listeria monocytogenes
DEFF Research Database (Denmark)
Knudsen, Gitte Maegaard; Ng, Yin; Gram, Lone
2013-01-01
Listeria monocytogenes can cause the serious infection listeriosis, which despite antibiotic treatment has a high mortality. Understanding the response of L. monocytogenes to antibiotic exposure is therefore important to ensure treatment success. Some bacteria survive antibiotic treatment...... by formation of persisters, which are a dormant antibiotic-tolerant subpopulation. The purpose of this study was to determine whether L. monocytogenes can form persisters and how bacterial physiology affects the number of persisters in the population. A stationary-phase culture of L. monocytogenes was adjusted...... that eradication of persisters is possible. Our study adds L. monocytogenes to the list of bacterial species capable of surviving bactericidal antibiotics in a dormant stage, and this persister phenomenon should be borne in mind when developing treatment regimens....
Wimalasekera, Rinukshi; Pejchar, Premysl; Holk, André; Martinec, Jan; Scherer, Günther F E
2010-05-01
Phosphatidylcholine-hydrolyzing phospholipase C (PC-PLC) catalyzes the hydrolysis of phosphatidylcholine (PC) to generate phosphocholine and diacylglycerol (DAG). PC-PLC has a long tradition in animal signal transduction to generate DAG as a second messenger besides the classical phosphatidylinositol splitting phospholipase C (PI-PLC). Based on amino acid sequence similarity to bacterial PC-PLC, six putative PC-PLC genes (NPC1 to NPC6) were identified in the Arabidopsis genome. RT-PCR analysis revealed overlapping expression pattern of NPC genes in root, stem, leaf, flower, and silique. In auxin-treated P(NPC3):GUS and P(NPC4):GUS seedlings, strong increase of GUS activity was visible in roots, leaves, and shoots and, to a weaker extent, in brassinolide-treated (BL) seedlings. P(NPC4):GUS seedlings also responded to cytokinin with increased GUS activity in young leaves. Compared to wild-type, T-DNA insertional knockouts npc3 and npc4 showed shorter primary roots and lower lateral root density at low BL concentrations but increased lateral root densities in response to exogenous 0.05-1.0 μM BL. BL-induced expression of TCH4 and LRX2, which are involved in cell expansion, was impaired but not impaired in repression of CPD, a BL biosynthesis gene, in BL-treated npc3 and npc4. These observations suggest NPC3 and NPC4 are important in BL-mediated signaling in root growth. When treated with 0.1 μM BL, DAG accumulation was observed in tobacco BY-2 cell cultures labeled with fluorescent PC as early as 15 min after application. We hypothesize that at least one PC-PLC is a plant signaling enzyme in BL signal transduction and, as shown earlier, in elicitor signal transduction.
Detection of Listeria Spp. and Listeria monocytogenes in vegetables ...
African Journals Online (AJOL)
This paper aimed to study the prevalence and antibiotic resistance pattern among Listeria monocytogenes in raw vegetables sourced from commercial farms and local farms in Terengganu. Thirteen types of vegetables investigated for the presence of L. monocytogenes using multiplex PCR and LAMP methods. Isolation of ...
Shak, S; Davitz, M A; Wolinsky, M L; Nussenzweig, V; Turner, M J; Gurnett, A
1988-03-15
The variant surface glycoprotein (VSG) of the African trypanosome is anchored in the cell membrane by a complex glycan attached to phosphatidylinositol. The carboxyl terminal portion of VSG contains a cryptic carbohydrate epitope, the cross-reacting determinant (CRD), that is revealed only after removal of the diacylglycerol by phosphatidylinositol-specific phospholipase C (PIPLC) or VSG lipase. Recently, we have shown that after hydrolysis by PIPLC, decay-accelerating factor (DAF)--a mammalian phosphatidylinositol-anchored protein--also contains the CRD epitope. Using a two site immunoradiometric assay in which the capturing antibody is a monoclonal antibody to DAF and the revealing antibody is anti-CRD, we now show that sugar phosphates significantly inhibited the binding of anti-CRD antibody to DAF released by PIPLC. DL-myo-inositol 1,2-cyclic phosphate was the most potent inhibitor of binding (IC50 less than 10(-8) M). Other sugar phosphates, such as alpha-D-glucose-1-phosphate, which also possess adjacent hydroxyl and phosphate moieties in cis also inhibited binding at low concentrations (IC50 = 10(-5) to 10(-4) M). In contrast, sugar phosphates which do not possess adjacent hydroxyl and phosphate moieties in cis and simple sugars weakly inhibited binding (IC50 greater than 10(-3) M). These results suggest that myo-inositol 1,2-cyclic phosphate contributes significantly to the epitope recognized by the anti-CRD antibody and is consistent with analysis of the carboxyl terminus of VSG, which also suggested the presence of the cyclic inositol phosphate. In light of the recent findings that human serum contains a glycan-phosphatidyl-inositol-specific phospholipase D, which converts DAF from a hydrophobic to a hydrophilic form lacking the CRD, the observation that the phosphate is crucial for expression of the epitope may be relevant in understanding the origin of CRD-negative DAF in urine and plasma.
Directory of Open Access Journals (Sweden)
Ewa Sawosz
2010-08-01
Full Text Available Ewa Sawosz1, André Chwalibog2, Jacek Szeliga3, Filip Sawosz2, Marta Grodzik1, Marlena Rupiewicz1, Tomasz Niemiec1, Katarzyna Kacprzyk11Division of Biotechnology and Biochemistry of Nutrition, Warsaw University of Life Sciences, Warsaw, Poland; 2Department of Basic Animal and Veterinary Sciences, University of Copenhagen, Copenhagen, Denmark; 3Division of Microbiology of Analytical Centre, Warsaw University of Life Sciences, Warsaw, PolandPurpose: Rapid development of nanotechnology has recently brought significant attention to the extraordinary biological features of nanomaterials. The objective of the present investigation was to evaluate morphological characteristics of the assembles of gold and platinum nanoparticles (nano-Au and nano-Pt respectively, with Salmonella Enteritidis (Gram-negative and Listeria monocytogenes (Gram-positive, to reveal possibilities of constructing bacteria-nanoparticle vehicles.Methods: Hydrocolloids of nano-Au or nano-Pt were added to two bacteria suspensions in the following order: nano-Au + Salmonella Enteritidis; nano-Au + Listeria monocytogenes; nano-Pt + Salmonella Enteritidis; nano-Pt + Listeria monocytogenes. Samples were inspected by transmission electron microscope.Results: Visualization of morphological interaction between nano-Au and Salmonella Enteritidis and Listeria monocytogenes, showed that nano-Au were aggregated within flagella or biofilm network and did not penetrate the bacterial cell. The analysis of morphological effects of interaction of nano-Pt with bacteria revealed that nano-Pt entered cells of Listeria monocytogenes and were removed from the cells. In the case of Salmonella Enteritidis, nano-Pt were seen inside bacteria cells, probably bound to DNA and partly left bacterial cells. After washing and centrifugation, some of the nano-Pt-DNA complexes were observed within Salmonella Enteritidis.Conclusion: The results indicate that the bacteria could be used as a vehicle to deliver nano
Early trigeminal nerve involvement in Listeria monocytogenes rhombencephalitis
DEFF Research Database (Denmark)
Karlsson, William K; Harboe, Zitta Barrella; Roed, Casper
2017-01-01
dysfunction on that side. In addition, we identified another 120 cases of Listeria rhombencephalitis following a systematic review. Cranial nerves VII, V, IX, and X, respectively, medulla oblongata, cerebellum and pons, were the most frequently involved brain structures. The present clinical and radiological...... findings corroborate earlier data from animal experiments, indicating that L. monocytogenes may be capable of retrograde intra-axonal migration along the cranial nerves. We suggest that in a subset of patients with rhombencephalitis L. monocytogenes enters the cerebellopontine angle through the trigeminal......Listeria monocytogenes is associated with rhombencephalitis. However, the exact mechanisms of brainstem invasion remains poorly understood. Here, we demonstrate clinical and radiological data suggesting that Listeria may invade the brainstem via the trigeminal nerve. Three females (41, 64 and 70...
Sugiri, Yoni Darmawan; Gölz, Greta; Meeyam, Tongkorn; Baumann, Maximilian P O; Kleer, Josef; Chaisowwong, Warangkhana; Alter, Thomas
2014-08-01
This study was conducted to determine the prevalence and quantify the number of Listeria monocytogenes in fresh chicken carcasses sold in traditional markets and supermarkets in Bandung, West Java, Indonesia, and to determine the antimicrobial resistance patterns of the isolated L. monocytogenes strains. The overall prevalence of L. monocytogenes in chicken carcasses was 15.8% (29/184). When comparing samples from traditional markets and supermarkets, no significant difference in the L. monocytogenes prevalence was detectable (15.2 versus 16.3%). Of the samples, 97.3% had L. monocytogenes counts study were grouped into the molecular serogroup IIb, comprising the serovars 1/2b, 3b, and 7.
Directory of Open Access Journals (Sweden)
Lior Lobel
2012-09-01
Full Text Available Intracellular bacterial pathogens are metabolically adapted to grow within mammalian cells. While these adaptations are fundamental to the ability to cause disease, we know little about the relationship between the pathogen's metabolism and virulence. Here we used an integrative Metabolic Analysis Tool that combines transcriptome data with genome-scale metabolic models to define the metabolic requirements of Listeria monocytogenes during infection. Twelve metabolic pathways were identified as differentially active during L. monocytogenes growth in macrophage cells. Intracellular replication requires de novo synthesis of histidine, arginine, purine, and branch chain amino acids (BCAAs, as well as catabolism of L-rhamnose and glycerol. The importance of each metabolic pathway during infection was confirmed by generation of gene knockout mutants in the respective pathways. Next, we investigated the association of these metabolic requirements in the regulation of L. monocytogenes virulence. Here we show that limiting BCAA concentrations, primarily isoleucine, results in robust induction of the master virulence activator gene, prfA, and the PrfA-regulated genes. This response was specific and required the nutrient responsive regulator CodY, which is known to bind isoleucine. Further analysis demonstrated that CodY is involved in prfA regulation, playing a role in prfA activation under limiting conditions of BCAAs. This study evidences an additional regulatory mechanism underlying L. monocytogenes virulence, placing CodY at the crossroads of metabolism and virulence.
Functional interaction between Cerebratulus lacteus cytolysin A-III and phospholipase A/sub 2/
Energy Technology Data Exchange (ETDEWEB)
Liu, J.; Blumenthal, K.M.
1988-05-15
A study on the interaction between bee venom phospholipase A/sub 2/ and Cerebratulus lacteus cytolysin A-III, a major hemolysin secreted by this organism has been carried out. The hemolytic activity of A-III in phosphate-buffered saline is increased 5-fold in the presence of phospholipase A/sub 2/ from bee venom. Dansylphosphatidylethanolamine (DPE) labeled, phosphatidylcholine-containing liposomes and human erythrocyte membranes were employed to study the interaction between these two proteins. In DPE-liposomes, A-III alone had no effect on DPE fluorescence nor did it enhance either the phospholipase A/sub 2/-dependent fluorescence increase or blue shift in emission maximum, indicating that the cytolysis is not a major phospholipase A/sub 2/-activator. However, when DPE was incorporated into erythrocyte membranes, A-III alone induced a 40% fluorescence increase and a 5 nm blue shift, implying a transient activation of an endogenous phospholipase A/sub 2/. Further studies using synthetic lysophosphatidylcholine and free fatty acids demonstrated that the hemolytic activity of A-III is potentiated by free fatty acids, a product of phospholipid degradation catalyzed by phospholipase A/sub 2/. Subsequent analysis of this phenomenon by gel filtration chromatography, analytical ultracentrifugation, chemical cross-linking, and measurement of (/sup 14/C)oleic acid binding by the cytolysin demonstrated that binding of oleic acid to A-III causes aggregation of the toxin molecules to a tetrameric form which has a higher ..cap alpha..-helix content and a greater activity than the monomer.
Phospholipase and proteinase activities of Candida spp. isolates from vulvovaginitis in Iran.
Shirkhani, S; Sepahvand, A; Mirzaee, M; Anbari, K
2016-09-01
This study aims to characterize phospholipase and proteinase activities of Candida isolates from 82 vulvovaginal candidiasis (VVC) and to study the relationship of these activities with vulvovaginitis. Totally 82 Candida isolates from vagina samples of VVC patients were randomly collected over the period between September and December 2014 from hospitalized patients at the general hospitals of Lorestan province, Iran. Isolates were previously identified by conventional mycological methods. The phospholipase and proteinase activities were evaluated by Egg yolk agar, Tween 80 opacity medium and agar plate methods. The most common Candida species was identified Candida albicans (n=34, 41.5%), followed by Candida famata (n=13, 15.8%), Candida tropicalis (n=11, 13.4%), and Candida parapsilosis (n=9, 11%). The most phospholipase activity was observed in Candida colliculosa (40%), followed by C. famata (38.5%), and Candida krusei (33.3%). The findings revealed that the correlation between phospholipase production by Candida spp. and the presence of VVC was not found to be statistically significant (P=0.91). All Candida spp. exhibited considerable proteinase activity; so that 100% of C. colliculosa, C. parapsilosis, Candida kefyr, and Candida intermedia isolates produced high proteinase activity with Pz 4+ scores. There was a significant correlation between proteinase production by Candida spp. and the presence of VVC (P=0.009). The obtained findings revealed that Candida spp. isolates may produce both virulence factors, phospholipase and proteinase. Although the phospholipase production was only observed in <40% of the isolates; however there was a significant association between proteinase production by Candida spp. and VVC. Copyright © 2016. Published by Elsevier Masson SAS.
Morphological Change and Decreasing Transfer Rate of Biofilm-Featured Listeria monocytogenes EGDe.
Lee, Yuejia; Wang, Chinling
2017-03-01
Listeria monocytogenes , a lethal foodborne pathogen, has the ability to resist the hostile food processing environment and thus frequently contaminates ready-to-eat foods during processing. It is commonly accepted that the tendency of L. monocytogenes ' to generate biofilms on various surfaces enhances its resistance to the harshness of the food processing environment. However, the role of biofilm formation in the transferability of L. monocytogenes EGDe remains controversial. We examined the growth of Listeria biofilms on stainless steel surfaces and their effect on the transferability of L. monocytogenes EGDe. The experiments were a factorial 2 × 2 design with at least three biological replicates. Through scanning electron microscopy, a mature biofilm with intensive aggregates of cells was observed on the surface of stainless steel after 3 or 5 days of incubation, depending on the initial level of inoculation. During biofilm development, L. monocytogenes EGDe carried out binary fission vigorously before a mature biofilm was formed and subsequently changed its cellular morphology from rod shaped to sphere shaped. Furthermore, static biofilm, which was formed after 3 days of incubation at 25°C, significantly inhibited the transfer rate of L. monocytogenes EGDe from stainless steel blades to 15 bologna slices. During 7 days of storage at 4°C, however, bacterial growth rate was not significantly impacted by whether bacteria were transferred from biofilm and the initial concentrations of transferred bacteria on the slice. In conclusion, this study is the first to report a distinct change in morphology of L. monocytogenes EGDe at the late stage of biofilm formation. More importantly, once food is contaminated by L. monocytogenes EGDe, contamination proceeds independently of biofilm development and the initial level of contamination when food is stored at 4°C, even if contamination with L. monocytogenes EGDe was initially undetectable before storage.
Directory of Open Access Journals (Sweden)
abazar pournajaf
2013-09-01
Full Text Available Background: Listeria monocytogenes is a facultative intracellular pathogen that causes listeriosis which has extensive clinical manifestations. Infections with L. monocytogenes are a serious threat to immunocompromised persons. The aim of this study was to determine the frequency of L. monocytogenes strains recovered from clinical and non-clinical samples using phenotypic methods and confirmed by PCR. Materials and Methods: In this study, 617 specimens were analyzed. All specimens were cultured in the specific PALCAM agar. Colonies were initially identified by routine biochemical tests. Finally, PCR assays using primers specific for inlA gene were performed. Results: In all, 46 (8.2% L. monocytogenes isolates were recovered from 617 specimens. Fourteen (8.2% strains, including 4 (7.5%, 2 (5.7%, 5 (14.2% and 3 (8.5% isolates were obtained from placental tissue, urine, vaginal and rectal swabs, respectively. In addition, 9 (7.4% strains of L. monocytogenes which were isolated from 107 different dairy products originated from cheese 5 (7.1%, cream 2 (10% and kashk 2 (11.7%, respectively. Among 11 (5.2% strains isolated from 210 different meat products, 5 (5.5%, 4 (7.2% and 2 (3% strains belonged to sausage, meat and poultry extracts, respectively. Finally, 12 (9.2% Listeria strains were recovered from 130 animal specimens that included 6 (10%, 4 (8% and 2 (10% strains from goat, sheep and cattle, respectively. Furthermore, all Listeria isolates (100% were found to be carriers of inlA gene in PCR assay. Conclusion: The present study showed that the clinical and non-clinical specimens were contaminated with L. monocytogenes. So, it seems necessary to use a simple and standard technique such as PCR for rapid detection of this organism from various sources.
Modeling the growth of Listeria monocytogenes in soft blue-white cheese
DEFF Research Database (Denmark)
Rosshaug, Per Sand; Detmer, Ann; Ingmer, Hanne
2012-01-01
The aim of this study was to develop a predictive model simulating growth over time of the pathogenic bacterium Listeria monocytogenes in a soft blue-white cheese. The physicochemical properties in a matrix such as cheese are essential controlling factors influencing the growth of L. monocytogenes....... We developed a predictive tertiary model of the bacterial growth of L. monocytogenes as a function of temperature, pH, NaCl, and lactic acid. We measured the variations over time of the physicochemical properties in the cheese. Our predictive model was developed based on broth data produced...... production and retail conditions showed that the number of L. monocytogenes cells increases 3 to 3.5 log within the shelf life of the cheese....
Heir, Even; Møretrø, Trond; Simensen, Andreas; Langsrud, Solveig
2018-06-20
Interactions and competition between resident bacteria in food processing environments could affect their ability to survive, grow and persist in microhabitats and niches in the food industry. In this study, the competitive ability of L. monocytogenes strains grown together in separate culture mixes with other L. monocytogenes (L. mono mix), L. innocua (Listeria mix), Gram-negative bacteria (Gram- mix) and with a multigenera mix (Listeria + Gram- mix) was investigated in biofilms on stainless steel and in suspensions at 12 °C. The mixed cultures included resident bacteria from processing surfaces in meat and salmon industry represented by L. monocytogenes (n = 6), L. innocua (n = 5) and Gram-negative bacteria (n = 6; Acinetobacter sp., Pseudomonas fragi, Pseudomonas fluorescens, Serratia liquefaciens, Stenotrophomonas maltophilia). Despite hampered in growth in mixed cultures, L. monocytogenes established in biofilms with counts at day nine between 7.3 and 9.0 log per coupon with the lowest counts in the Listeria + G- mix that was dominated by Pseudomonas. Specific L. innocua inhibited growth of L. monocytogenes strains differently; inhibition that was further enhanced by the background Gram-negative microbiota. In these multispecies and multibacteria cultures, the growth competitive effects lead to the dominance of a strong competitor L. monocytogenes strain that was only slightly inhibited by L. innocua and showed strong competitive abilities in mixed cultures with resident Gram-negative bacteria. The results indicates complex patterns of bacterial interactions and L. monocytogenes inhibition in the multibacteria cultures that only partially depend on cell contact and likely involve various antagonistic and bacterial tolerance mechanisms. The study indicates large variations among L. monocytogenes in their competitiveness under multibacterial culture conditions that should be considered in further studies towards understanding of L
Caballero, Oscar; Alles, Susan; Le, Quynh-Nhi; Gray, R Lucas; Hosking, Edan; Pinkava, Lisa; Norton, Paul; Tolan, Jerry; Mozola, Mark; Rice, Jennifer; Chen, Yi; Ryser, Elliot; Odumeru, Joseph
2016-01-01
Work was conducted to validate performance of the ANSR(®) for Listeria monocytogenes method in selected food and environmental matrixes. This DNA-based assay involves amplification of nucleic acid via an isothermal reaction based on nicking enzyme amplification technology. Following single-step sample enrichment for 16-24 h for most matrixes, the assay is completed in 40 min using only simple instrumentation. When 50 distinct strains of L. monocytogenes were tested for inclusivity, 48 produced positive results, the exceptions being two strains confirmed by PCR to lack the assay target gene. Forty-seven nontarget strains (30 species), including multiple non-monocytogenes Listeria species as well as non-Listeria, Gram-positive bacteria, were tested, and all generated negative ANSR assay results. Performance of the ANSR method was compared with that of the U.S. Department of Agriculture, Food Safety and Inspection Service Microbiology Laboratory Guidebook reference culture procedure for detection of L. monocytogenes in hot dogs, pasteurized liquid egg, and sponge samples taken from an inoculated stainless steel surface. In addition, ANSR performance was measured against the U.S. Food and Drug Administration Bacteriological Analytical Manual reference method for detection of L. monocytogenes in Mexican-style cheese, cantaloupe, sprout irrigation water, and guacamole. With the single exception of pasteurized liquid egg at 16 h, ANSR method performance as quantified by the number of positives obtained was not statistically different from that of the reference methods. Robustness trials demonstrated that deliberate introduction of small deviations to the normal assay parameters did not affect ANSR method performance. Results of accelerated stability testing conducted using two manufactured lots of reagents predicts stability at the specified storage temperature of 4°C of more than 1 year.
Cuscó, Ivon; Medrano, Andrés; Gener, Blanca; Vilardell, Mireia; Gallastegui, Fátima; Villa, Olaya; González, Eva; Rodríguez-Santiago, Benjamín; Vilella, Elisabet; Del Campo, Miguel; Pérez-Jurado, Luis A
2009-05-15
Autism spectrum disorders (ASDs) constitute a group of severe neurodevelopmental conditions with complex multifactorial etiology. In order to explore the hypothesis that submicroscopic genomic rearrangements underlie some ASD cases, we have analyzed 96 Spanish patients with idiopathic ASD after extensive clinical and laboratory screening, by array comparative genomic hybridization (aCGH) using a homemade bacterial artificial chromosome (BAC) array. Only 13 of the 238 detected copy number alterations, ranging in size from 89 kb to 2.4 Mb, were present specifically in the autistic population (12 out of 96 individuals, 12.5%). Following validation by additional molecular techniques, we have characterized these novel candidate regions containing 24 different genes including alterations in two previously reported regions of chromosome 7 associated with the ASD phenotype. Some of the genes located in ASD-specific copy number variants act in common pathways, most notably the phosphatidylinositol signaling and the glutamatergic synapse, both known to be affected in several genetic syndromes related with autism and previously associated with ASD. Our work supports the idea that the functional alteration of genes in related neuronal networks is involved in the etiology of the ASD phenotype and confirms a significant diagnostic yield for aCGH, which should probably be included in the diagnostic workup of idiopathic ASD.
Occurrence of Listeria monocytogenes in smoked fish in Sokoto ...
African Journals Online (AJOL)
The present study was conducted to determine the prevalence of Listeria monocytogenes in smoked fish in Sokoto, Nigeria. A total of 115 different species of smoked fish from the various retail outlets and market places within the metropolis were analysed for the presence of L. monocytogenes using ISO culture method.
Effekt av ulike desinfeksjonsstrategier mot Listeria monocytogenes
Fossmo, Sabine
2013-01-01
Kontroll med bakterier som Listeria utgjør en stor utfordring for mange matprodusenter. Listeria monocytogenes er hovedsakelig et produksjonshygienisk problem, forbedret hygiene kan derfor være tiltak for å redusere overlevelse og smitteoverføring av bakterien i produksjonsmiljø. Hensikten med forsøkene i oppgaven var å undersøke effekten av ulike desinfeksjonsstrategier på drap av L. monocytogenes, både når bakteriene var i biofilm og i suspensjon. Dette inkluderte bruk av tradisjonelle desi...
Phosphatidylinositol transfer protein alpha and its role in neurodegeneration
Bunte, H.
2007-01-01
Selective neuronal loss is a prominent feature in neurodegenerative disorders. Recently, a link between neurodegeneration and a deficiency in the protein phosphatidylinositol transfer protein alpha (PI-TPalpha) has been demonstrated. In this context it is of importance that fibroblasts
Directory of Open Access Journals (Sweden)
Antonella Souza Mattei
2013-06-01
Full Text Available Introduction Candida albicans is a commensal and opportunistic agent that causes infection in immunocompromised individuals. Several attributes contribute to the virulence and pathogenicity of this yeast, including the production of germ tubes (GTs and extracellular hydrolytic enzymes, particularly phospholipase and proteinase. This study aimed to investigate GT production and phospholipase and proteinase activities in bloodstream isolates of C. albicans. Methods One hundred fifty-three C. albicans isolates were obtained from blood samples and analyzed for GT, phospholipase, and proteinase production. The assays were performed in duplicate in egg yolk medium containing bovine serum albumin and human serum. Results Detectable amounts of proteinase were produced by 97% of the isolates, and 78% of the isolates produced phospholipase. GTs were produced by 95% of the isolates. A majority of the isolates exhibited low levels of phospholipase production and high levels of proteinase production. Conclusions Bloodstream isolates of C. albicans produce virulence factors such as GT and hydrolytic enzymes that enable them to cause infection under favorable conditions.
Rodriguez-Villalon, Antia; Gujas, Bojan; van Wijk, Ringo; Munnik, Teun; Hardtke, Christian S
2015-04-15
Protophloem is a specialized vascular tissue in growing plant organs, such as root meristems. In Arabidopsis mutants with impaired primary root protophloem differentiation, brevis radix (brx) and octopus (ops), meristematic activity and consequently overall root growth are strongly reduced. Second site mutation in the protophloem-specific presumed phosphoinositide 5-phosphatase cotyledon vascular pattern 2 (CVP2), but not in its homolog CVP2-like 1 (CVL1), partially rescues brx defects. Consistent with this finding, CVP2 hyperactivity in a wild-type background recreates a brx phenotype. Paradoxically, however, while cvp2 or cvl1 single mutants display no apparent root defects, the root phenotype of cvp2 cvl1 double mutants is similar to brx or ops, although, as expected, cvp2 cvl1 seedlings contain more phosphatidylinositol-4,5-biphosphate. Thus, tightly balanced phosphatidylinositol-4,5-biphosphate levels appear essential for proper protophloem differentiation. Genetically, OPS acts downstream of phosphatidylinositol-4,5-biphosphate levels, as cvp2 mutation cannot rescue ops defects, whereas increased OPS dose rescues cvp2 cvl1 defects. Finally, all three mutants display higher density and accelerated emergence of lateral roots, which correlates with increased auxin response in the root differentiation zone. This phenotype is also created by application of peptides that suppress protophloem differentiation, clavata3/embryo surrounding region 26 (CLE26) and CLE45. Thus, local changes in the primary root protophloem systemically shape overall root system architecture. © 2015. Published by The Company of Biologists Ltd.
Monitoring paneer for Listeria monocytogenes - A high risk food ...
African Journals Online (AJOL)
A multiplex polymerase chain reaction (PCR) assay was developed and applied to spiked and natural paneer samples to detect Listeria monocytogenes, a high risk food pathogen. The sensitivity of the assay on L. monocytogenes spiked paneer samples was 104 cells prior to enrichment, was improved to 103 cells after 4 h ...
Fayol, L; Beizig, S; Le Monnier, A; Lacroze, V; Simeoni, U
2009-04-01
We report the case of a pregnant woman with listeriosis at 26 gestational weeks followed by premature labor at 30 gestational weeks. Bacterial meningitis was suspected in the neonate with ventriculitis on sonography, a high level of protein in the cerebrospinal fluid (CSF), and an identified specific bacterial genome of Listeria monocytogenes (PCR 16S rDNA and sequencing and specific amplification of L. monocytogenes hly gene) in CSF. Neonatal meningitis was complicated with cerebral venous sinus thrombosis and ventriculomegaly. Listeriosis during pregnancy can lead to severe complications in the neonate. Thus, listeriosis should be a diagnostic concern in febrile pregnant women at any stage of pregnancy. First-line treatment is based on high-dose amoxicillin (> or =6g/day) and must be used for at least 3 weeks for treatment of listeriosis during pregnancy. If the fetus survives, longer therapy until delivery can be discussed.
Genome sequences of Listeria monocytogenes strains with resistance to arsenic
Listeria monocytogenes frequently exhibits resistance to arsenic. We report here the draft genome sequences of eight genetically diverse arsenic-resistant L. monocytogenes strains from human listeriosis and food-associated environments. Availability of these genomes would help to elucidate the role ...
Effects of prebiotics on the infective potential of Listeria monocytogenes
DEFF Research Database (Denmark)
Ebersbach, Tine
% xylooligosaccharides (XOS), galactooligosaccharides (GOS), inulin, apple pectin or polydextrose for three weeks before oral challenge with L. monocytogenes. XOS and GOS significantly improved resistance of guinea pigs to L. monocytogenes, while inulin and apple pectin decreased the resistance. No significant effect...
Lifescience Database Archive (English)
Full Text Available 10080535 Regulation of arachidonic acid release and cytosolic phospholipase A2activ...on of arachidonic acid release and cytosolic phospholipase A2activation. PubmedID 10080535 Title Regulation ...of arachidonic acid release and cytosolic phospholipase A2activation. Authors Gij
Restraining reactive oxygen species in Listeria monocytogenes promotes the apoptosis of glial cells.
Li, Sen; Li, Yixuan; Chen, Guowei; Zhang, Jingchen; Xu, Fei; Wu, Man
2017-07-01
Listeria monocytogenes is a facultative anaerobic foodborne pathogen that can traverse the blood-brain barrier and cause brain infection. L. monocytogenes infection induces host cell apoptosis in several cell types. In this study, we investigated the apoptosis of human glioma cell line U251 invaded by L. monocytogenes and evaluated the function of bacterial reactive oxygen species (ROS) during infection. Bacterial ROS level was reduced by carrying out treatment with N-acetyl cysteine (NAC) and diphenyleneiodonium chloride (DPI). After infection, the apoptosis of U251 cells was examined by flow cytometry assay and propidium iodide staining. DPI and NAC efficiently decreased ROS level in L. monocytogenes without affecting bacterial growth. Moreover, the apoptosis of glial cells was enhanced upon invasion of DPI- and NAC-pretreated L. monocytogenes. Results indicate that the apoptosis of glial cells can be induced by L. monocytogenes, and that the inhibition of bacterial ROS increases the apoptosis of host cells.
Listeria monocytogenes internalizes in Romaine Lettuce grown in greenhouse conditions
Listeria monocytogenes has been implicated in a number of outbreaks involving fresh produce, including an outbreak in 2016 resulting from contaminated packaged salads. The persistence and internalization potential of L. monocytogenes in romaine lettuce was evaluated, and the persistence of two L. mo...
Phosphatidylinositol 4-kinases: Function, structure, and inhibition
Czech Academy of Sciences Publication Activity Database
Bouřa, Evžen; Nencka, Radim
2015-01-01
Roč. 337, č. 2 (2015), s. 136-145 ISSN 0014-4827 R&D Projects: GA ČR GJ15-21030Y; GA MŠk LO1302; GA ČR GA15-09310S EU Projects: European Commission(XE) 333916 - STARPI4K Institutional support: RVO:61388963 Keywords : phosphatidylinositol 4-kinase * inhibitor * crystal structure * virus Subject RIV: CC - Organic Chemistry Impact factor: 3.378, year: 2015
Growth inhibition of Listeria monocytogenes by a nonbacteriocinogenic Carnobacterium piscicola
DEFF Research Database (Denmark)
Nilsson, Lilian; Bech Hansen, T.; Garrido, P.
2005-01-01
Aims: This study elucidates the mechanisms by which a nonbacteriocinogenic Carnobacterium piscicola inhibits growth of Listeria monocytogenes. Methods and Results: Listeria monocytogenes was exposed to live cultures of a bacteriocin-negative variant of C. piscicola A9b in co-culture, in a diffusion...... chamber system, and to a cell-free supernatant. Suppression of maximum cell density (0-3.5 log units) of L. monocytogenes was proportional to initial levels of C. pisciola (10(3)-10(7) CFU ml(-1)). Cell-to-cell contact was not required to cause inhibition. The cell-free C. piscicola supernatant caused...... a decrease in L. monocytogenes maximum cell density, which was abolished by glucose addition but not by amino acid, vitamin or mineral addition. The fermentate also gave rise to a longer lag phase and a reduction in growth rate. These effects were independent of glucose and may have been caused by acetate...
Imaging phosphatidylinositol 4-phosphate dynamics in living plant cells
Vermeer, J.E.M.; Thole, J.M.; Goedhart, J.; Nielsen, E.; Munnik, T.; Gadella, T.W.J.
2009-01-01
Polyphosphoinositides represent a minor group of phospholipids, accounting for less than 1% of the total. Despite their low abundance, these molecules have been implicated in various signalling and membrane trafficking events. Phosphatidylinositol 4-phosphate (PtdIns4P) is the most abundant
Chen, Jianshun; Fang, Chun; Zheng, Tianlun; Zhu, Ningyu; Bei, Yijiang; Fang, Weihuan
2012-02-01
The ability to survive and proliferate in acidic environments is a prerequisite for the infection of Listeria monocytogenes. The glutamate decarboxylase (GAD) system is responsible for acid resistance, and three GAD homologs have been identified in L. monocytogenes: gadD1, gadD2, and gadD3. To examine whether GAD genes are specific to lineage, serovar, or certain subpopulation, we performed a systematic investigation on the prevalence of GAD genes in 164 L. monocytogenes. In contrast to gadD2 and gadD3 conserved in all L. monocytogenes strains, gadD1 was identified in 36.6% (60/164) of L. monocytogenes strains, including all serovar 1/2c and 68.5% (37/54) of serovar 1/2a strains, as well as a small fraction of serovar 1/2b (3.4%, 1/29) and lineage III (13.8%, 4/29) strains. All serovar 4b and lineage IV strains lacked this gene. According to the ascB-dapE structure, L. monocytogenes strains were classified into four subpopulations, carrying inlC2DE, inlGC2DE, inlGHE, or no internalin cluster, respectively. All L. monocytogenes strains with inlGC2DE or inlGHE pattern harbored gadD1, whereas those bearing inlC2DE or no internalin cluster between ascB and dapE lacked gadD1. In addition, other five non-monocytogenes Listeria species lacking ascB-dapE internalin cluster were gadD1-negative. Overall, the presence of gadD1 is not fully dependent on lineages or serovars but correlates with ascB-dapE internalin profiles, suggesting gadD1 might have co-evolved with the ascB-dapE internalin cluster in the primitive L. monocytogenes before divergence of serovars.
Survival strategies of Listeria monocytogenes - roles of regulators and transporters
Wemekamp-Kamphuis, H.H.
2003-01-01
Outbreaks of the food-borne pathogen Listeria monocytogenes are mainly associated with ready-to-eatfoods. Survival strategies of L. monocytogenes in relation to minimally processed foods were studied.
International Nuclear Information System (INIS)
Sarafianos, S.G.; Nair, P.P.; Kumar, S.
1990-01-01
A procedure for the assay of free fatty acids which has been adapted for the assay of phospholipase A2 is described. This consists of the conversion of long chain fatty acids to fatty acyl-CoA using the Mg2(+)-dependent fatty acyl-CoA synthetase, [alpha-32P]ATP and coenzyme A. In order to ensure the complete conversion of the acid to its CoA ester pyrophosphatase is also added to the incubation mixture. AM32P formed in stoichiometric amounts is separated from the remaining AT32P by polyethyleneimine-cellulose thin-layer chromatography and the fatty acid content is calculated from the specific radioactivity of AT32P. As little as 1 to 3 nmol of fatty acids hydrolyzed from any phospholipid using nanogram amounts of phospholipase A2 can be estimated with reliability. The real advantage of the method is that it combines the sensitivity of a radiochemical procedure without having to use radiolabeled substrates for the assay of phospholipases
DEFF Research Database (Denmark)
Nørrung, Birgit
2000-01-01
This paper shortly summarizes data related to risk assessment of Listeria monocytogenes. From available data on risk assessment, it is concluded that the levels of L. monocytogenes consumed is an important factor affecting the incidence of listeriosis. Foods that do not support the growth of L....... monocytogenes are unlikely to be a source of listeriosis, whereas foods that support the growth to high levels, should be the target of risk management efforts. Based on current epidemiological information from several countries, a concentration of L. monocytogenes not exceeding 100/g of food at the time...... of L. monocytogenes in the food during prevailing storage and distribution conditions is needed....
Prevalence of Listeria monocytogenes in raw milk in North Lebanon
International Nuclear Information System (INIS)
Al Kassaa, I; El Omari, Kh.; Esmail, B.; Hamze, M; Saati, M.
2016-01-01
Listeriosis, although a zoonosis, is an invasive disease that can affect newborns, pregnant women and immunocompromised adults. Clinical manifestations can be expressedby febrile gastroenteritis, invasive forms including severe sepsis, meningitis, rhombencephalitis, prenatal infections and abortions. Species of Listeria bacteria are ubiquitous and adaptableto the environment in animal and plant foods. This study aimed to determine the prevalence of Listeria monocytogenes in 100 samples of fresh cow milk collected from different areas of North Lebanon. Listeria monocytogenes was detected by using the Grand VIDAS technique (Biomérieux France). The results obtained revealed the absence of Listeria monocytogenes inall analyzed samples. (Author)
DEFF Research Database (Denmark)
Le Guédard, Marina; Bessoule, Jean-Jacques; Boyer, Valérie
2009-01-01
complete disappearance of stearic (but not of palmitic acid) at the sn-1 position of this phospholipid. Moreover, it was found that, whereas glycerol 3-phosphate, lysophosphatidic acid and 1-acyl lysophosphatidylinositol acyltransferase activities were similar in microsomal membranes isolated from wild......-acyl-1-lysolysophosphatidylinositol acyltransferase activity was recovered, and was accompanied by a strong increase in the stearic acid content of lysophosphatidylinositol. As previously suggested for phosphatidylinositol from animal cells (which contains almost exclusively stearic acid...... as the saturated fatty acid), the results obtained in the present study demonstrate that the existence of phosphatidylinositol species containing stearic acid in yeast results from a remodeling of neo-synthesized molecules of phosphatidylinositol....
Prebiotic Oligosaccharides Potentiate Host Protective Responses against L. Monocytogenes Infection
Directory of Open Access Journals (Sweden)
Poyin Chen
2017-12-01
Full Text Available Prebiotic oligosaccharides are used to modulate enteric pathogens and reduce pathogen shedding. The interactions with prebiotics that alter Listeria monocytogenes infection are not yet clearly delineated. L. monocytogenes cellular invasion requires a concerted manipulation of host epithelial cell membrane receptors to initiate internalization and infection often via receptor glycosylation. Bacterial interactions with host glycans are intimately involved in modulating cellular responses through signaling cascades at the membrane and in intracellular compartments. Characterizing the mechanisms underpinning these modulations is essential for predictive use of dietary prebiotics to diminish pathogen association. We demonstrated that human milk oligosaccharide (HMO pretreatment of colonic epithelial cells (Caco-2 led to a 50% decrease in Listeria association, while Biomos pretreatment increased host association by 150%. L. monocytogenes-induced gene expression changes due to oligosaccharide pretreatment revealed global alterations in host signaling pathways that resulted in differential subcellular localization of L. monocytogenes during early infection. Ultimately, HMO pretreatment led to bacterial clearance in Caco-2 cells via induction of the unfolded protein response and eIF2 signaling, while Biomos pretreatment resulted in the induction of host autophagy and L. monocytogenes vacuolar escape earlier in the infection progression. This study demonstrates the capacity of prebiotic oligosaccharides to minimize infection through induction of host-intrinsic protective responses.
Deciphering the landscape of host barriers to Listeria monocytogenes infection.
Zhang, Ting; Abel, Sören; Abel Zur Wiesch, Pia; Sasabe, Jumpei; Davis, Brigid M; Higgins, Darren E; Waldor, Matthew K
2017-06-13
Listeria monocytogenes is a common food-borne pathogen that can disseminate from the intestine and infect multiple organs. Here, we used sequence tag-based analysis of microbial populations (STAMP) to investigate L monocytogenes population dynamics during infection. We created a genetically barcoded library of murinized L monocytogenes and then used deep sequencing to track the pathogen's dissemination routes and quantify its founding population ( N b ) sizes in different organs. We found that the pathogen disseminates from the gastrointestinal tract to distal sites through multiple independent routes and that N b sizes vary greatly among tissues, indicative of diverse host barriers to infection. Unexpectedly, comparative analyses of sequence tags revealed that fecally excreted organisms are largely derived from the very small number of L. monocytogenes cells that colonize the gallbladder. Immune depletion studies suggest that distinct innate immune cells restrict the pathogen's capacity to establish replicative niches in the spleen and liver. Finally, studies in germ-free mice suggest that the microbiota plays a critical role in the development of the splenic, but not the hepatic, barriers that prevent L. monocytogenes from seeding these organs. Collectively, these observations illustrate the potency of the STAMP approach to decipher the impact of host factors on population dynamics of pathogens during infection.
Listeria monocytogenes: diagnostic problems
Beumer, R.R.; Hazeleger, W.C.
2003-01-01
The first isolation methods for the detection of Listeria spp. were generally based on the direct culture of samples on simple agar media, but isolation of the pathogenic Listeria monocytogenes was difficult. In time, new techniques were developed, based on a variety of selective and elective agents
Zittermann, Sandra I; Stanghini, Brenda; See, Ryan Soo; Melano, Roberto G; Boleszczuk, Peter; Murphy, Allana; Maki, Anne; Mallo, Gustavo V
2016-01-01
Detection of Listeria monocytogenes in food is currently based on enrichment methods. When L. monocytogenes is present with other Listeria species in food, the species compete during the enrichment process. Overgrowth competition of the nonpathogenic Listeria species might result in false-negative results obtained with the current reference methods. This potential issue was noted when 50 food samples artificially spiked with L. monocytogenes were tested with a real-time PCR assay and Canada's current reference method, MFHPB-30. Eleven of the samples studied were from foods naturally contaminated with Listeria species other than those used for spiking. The real-time PCR assay detected L. monocytogenes in all 11 of these samples; however, only 6 of these samples were positive by the MFHPB-30 method. To determine whether L. monocytogenes detection can be affected by other species of the same genus due to competition, an L. monocytogenes strain and a Listeria innocua strain with a faster rate of growth in the enrichment broth were artificially coinoculated at different ratios into ground pork meat samples and cultured according to the MFHPB-30 method. L. monocytogenes was detected only by the MFHPB-30 method when L. monocytogenes/L. innocua ratios were 6.0 or higher. In contrast, using the same enrichments, the real-time PCR assay detected L. monocytogenes at ratios as low as 0.6. Taken together, these findings support the hypothesis that L. monocytogenes can be outcompeted by L. innocua during the MFHPB-30 enrichment phase. However, more reliable detection of L. monocytogenes in this situation can be achieved by a PCR-based method mainly because of its sensitivity.
Aarnisalo, Kaarina; Vihavainen, Elina; Rantala, Leila; Maijala, Riitta; Suihko, Maija-Liisa; Hielm, Sebastian; Tuominen, Pirkko; Ranta, Jukka; Raaska, Laura
2008-02-10
Microbial risk assessment provides a means of estimating consumer risks associated with food products. The methods can also be applied at the plant level. In this study results of microbiological analyses were used to develop a robust single plant level risk assessment. Furthermore, the prevalence and numbers of Listeria monocytogenes in marinated broiler legs in Finland were estimated. These estimates were based on information on the prevalence, numbers and genotypes of L. monocytogenes in 186 marinated broiler legs from 41 retail stores. The products were from three main Finnish producers, which produce 90% of all marinated broiler legs sold in Finland. The prevalence and numbers of L. monocytogenes were estimated by Monte Carlo simulation using WinBUGS, but the model is applicable to any software featuring standard probability distributions. The estimated mean annual number of L. monocytogenes-positive broiler legs sold in Finland was 7.2x10(6) with a 95% credible interval (CI) 6.7x10(6)-7.7x10(6). That would be 34%+/-1% of the marinated broiler legs sold in Finland. The mean number of L. monocytogenes in marinated broiler legs estimated at the sell-by-date was 2 CFU/g, with a 95% CI of 0-14 CFU/g. Producer-specific L. monocytogenes strains were recovered from the products throughout the year, which emphasizes the importance of characterizing the isolates and identifying strains that may cause problems as part of risk assessment studies. As the levels of L. monocytogenes were low, the risk of acquiring listeriosis from these products proved to be insignificant. Consequently there was no need for a thorough national level risk assessment. However, an approach using worst-case and average point estimates was applied to produce an example of single producer level risk assessment based on limited data. This assessment also indicated that the risk from these products was low. The risk-based approach presented in this work can provide estimation of public health risk
Alopecia in a viable phospholipase C delta 1 and phospholipase C delta 3 double mutant.
Directory of Open Access Journals (Sweden)
Fabian Runkel
Full Text Available BACKGROUND: Inositol 1,4,5trisphosphate (IP(3 and diacylglycerol (DAG are important intracellular signalling molecules in various tissues. They are generated by the phospholipase C family of enzymes, of which phospholipase C delta (PLCD forms one class. Studies with functional inactivation of Plcd isozyme encoding genes in mice have revealed that loss of both Plcd1 and Plcd3 causes early embryonic death. Inactivation of Plcd1 alone causes loss of hair (alopecia, whereas inactivation of Plcd3 alone has no apparent phenotypic effect. To investigate a possible synergy of Plcd1 and Plcd3 in postnatal mice, novel mutations of these genes compatible with life after birth need to be found. METHODOLOGY/PRINCIPAL FINDINGS: We characterise a novel mouse mutant with a spontaneously arisen mutation in Plcd3 (Plcd3(mNab that resulted from the insertion of an intracisternal A particle (IAP into intron 2 of the Plcd3 gene. This mutation leads to the predominant expression of a truncated PLCD3 protein lacking the N-terminal PH domain. C3H mice that carry one or two mutant Plcd3(mNab alleles are phenotypically normal. However, the presence of one Plcd3(mNab allele exacerbates the alopecia caused by the loss of functional Plcd1 in Del(9olt1Pas mutant mice with respect to the number of hair follicles affected and the body region involved. Mice double homozygous for both the Del(9olt1Pas and the Plcd3(mNab mutations survive for several weeks and exhibit total alopecia associated with fragile hair shafts showing altered expression of some structural genes and shortened phases of proliferation in hair follicle matrix cells. CONCLUSIONS/SIGNIFICANCE: The Plcd3(mNab mutation is a novel hypomorphic mutation of Plcd3. Our investigations suggest that Plcd1 and Plcd3 have synergistic effects on the murine hair follicle in specific regions of the body surface.
Directory of Open Access Journals (Sweden)
Lynch Vincent J
2007-01-01
Full Text Available Abstract Background Gene duplication followed by functional divergence has long been hypothesized to be the main source of molecular novelty. Convincing examples of neofunctionalization, however, remain rare. Snake venom phospholipase A2 genes are members of large multigene families with many diverse functions, thus they are excellent models to study the emergence of novel functions after gene duplications. Results Here, I show that positive Darwinian selection and neofunctionalization is common in snake venom phospholipase A2 genes. The pattern of gene duplication and positive selection indicates that adaptive molecular evolution occurs immediately after duplication events as novel functions emerge and continues as gene families diversify and are refined. Surprisingly, adaptive evolution of group-I phospholipases in elapids is also associated with speciation events, suggesting adaptation of the phospholipase arsenal to novel prey species after niche shifts. Mapping the location of sites under positive selection onto the crystal structure of phospholipase A2 identified regions evolving under diversifying selection are located on the molecular surface and are likely protein-protein interactions sites essential for toxin functions. Conclusion These data show that increases in genomic complexity (through gene duplications can lead to phenotypic complexity (venom composition and that positive Darwinian selection is a common evolutionary force in snake venoms. Finally, regions identified under selection on the surface of phospholipase A2 enzymes are potential candidate sites for structure based antivenin design.
A nutrient-regulated, dual localization phospholipase A2 in the symbiotic fungus Tuber borchii
Soragni, Elisabetta; Bolchi, Angelo; Balestrini, Raffaella; Gambaretto, Claudio; Percudani, Riccardo; Bonfante, Paola; Ottonello, Simone
2001-01-01
Important morphogenetic transitions in fungi are triggered by starvation-induced changes in the expression of structural surface proteins. Here, we report that nutrient deprivation causes a strong and reversible up-regulation of TbSP1, a surface-associated, Ca2+-dependent phospholipase from the mycorrhizal fungus Tuber borchii. TbSP1 is the first phospholipase A2 to be described in fungi and identifies a novel class of phospholipid-hydrolyzing enzymes. The TbSP1 phospholipase, which is synthesized initially as a pre-protein, is processed efficiently and secreted during the mycelial phase. The mature protein, however, also localizes to the inner cell wall layer, close to the plasma membrane, in both free-living and symbiosis-engaged hyphae. It thus appears that a dual localization phospholipase A2 is involved in the adaptation of a symbiotic fungus to conditions of persistent nutritional limitation. Moreover, the fact that TbSP1-related sequences are present in Streptomyces and Neurospora, and not in wholly sequenced non-filamentous microorganisms, points to a general role for TbSP1 phospholipases A2 in the organization of multicellular filamentous structures in bacteria and fungi. PMID:11566873
Rocha, Cláudia E; Mol, Juliana P S; Garcia, Luize N N; Costa, Luciana F; Santos, Renato L; Paixão, Tatiane A
2017-01-01
Listeria monocytogenes is a Gram-positive, facultative intracellular and invasive bacterium that has tropism to the placenta, and causes fetal morbidity and mortality in several mammalian species. While infection with L. monocytogenes and L. ivanovii are known as important causes of abortion and reproductive failure in cattle, the pathogenesis of maternal-fetal listeriosis in this species is poorly known. This study used the bovine chorioallantoic membrane explant model to investigate the kinetics of L. monocytogenes, L. ivanovii, and L. innocua infections in bovine trophoblastic cells for up to 8 h post infection. L. monocytogenes and L. ivanovii were able to invade and multiply in trophoblastic cells without causing cell death or inducing expression of pro-inflammatory genes. Although L. innocua was unable to multiply in bovine trophoblastic cells, it induced transcription of the pro-inflammatory mediator CXCL6. This study demonstrated for the first time the susceptibility of bovine trophoblastic cells to L. monocytogenes and L. ivanovii infection.
Incidence and control of Listeria monocytogenes in foods in Denmark
DEFF Research Database (Denmark)
Nørrung, Birgit; Andersen, Jens Kirk; Schlundt, Jørgen
1999-01-01
The Danish regulatory policy on Listeria monocytogenes in foods is based on the principles of HACCP and was developed using a health risk assessment approach. The Danish policy focuses examinations and criteria for L. monocytogenes in ready-to-eat foods and is based on a combination of inspection...
Skowron, Krzysztof; Kwiecińska-Piróg, Joanna; Grudlewska, Katarzyna; Świeca, Agnieszka; Paluszak, Zbigniew; Bauza-Kaszewska, Justyna; Wałecka-Zacharska, Ewa; Gospodarek-Komkowska, Eugenia
2018-06-13
The aim of this research was to investigate the occurrence of Listeria monocytogenes in fish and fish processing plant and to determine their transmission, virulence and antibiotic resistance. L. monocytogenes was isolated according to the ISO 11290-1. The identification of L. monocytogenes was confirmed by multiplex PCR method. Genetic similarity of L. monocytogenes strains was determined with the Pulsed-Filed Gene Electrophoresis (PFGE) method. The multiplex PCR was used for identification of L. monocytogenes serogroups and detection of selected virulence genes (actA, fbpA, hlyA, iap, inlA, inlB, mpl, plcA, plcB, prfA). The L. monocytogens isolates susceptibility to penicillin, ampicillin, meropenem, erythromycin, trimethoprim/sulfamethoxazole was evaluated with disc diffusion method according to EUCAST v. 7.1. The presence of 237 L. monocytogenes isolates (before genetic similarity assessment) in 614 examined samples was confirmed. After strain differentiation by PFGE techniques the presence of 161 genetically different strains were confirmed. The genetic similarity of the examined isolates suggested that the source of the L. monocytogenes strains were fishes originating from farms. All tested strains possessed all detected virulence genes. Among examined strains, the most (26, 38.6%) belonged to the group 1/2a-3a. The most of tested strains were resistant to erythromycin (47.1%) and trimethoprim/sulfamethoxazole (47.1%). Copyright © 2018. Published by Elsevier B.V.
Inuwa, A; Lunt, A; Czuprynski, C; Miller, G; Rankin, S A
2017-10-19
Although frozen dairy desserts have a strong record of safety, recent outbreaks of foodborne disease linked to ice creams have brought new attention to this industry. There is concern that small-scale frozen dessert equipment may not comply with or be reviewed against published comprehensive design and construction sanitation specifications (National Sanitation Foundation or 3-A sanitary standards). Equipment sanitary design issues may result in reduced efficacy of cleaning and sanitation, thus increasing the likelihood of postprocess contamination with pathogenic bacteria. In this context, and given that Listeria monocytogenes outbreaks are of great concern for the frozen dessert industry, a complementary study was conducted to evaluate the fate of L. monocytogenes in ice cream mix on a stainless steel surface. Our results showed that L. monocytogenes survived for up to 6 weeks at room temperature and 9 weeks at 4°C in contaminated ice cream on a stainless steel surface. Furthermore, chlorine- and acid-based surface sanitizers had no detrimental effect on the L. monocytogenes when used at a concentration and contact time (1 min) recommended by the manufacturer; significant reduction in CFU required 5 to 20 min of contact time.
Spontaneous Loss of Virulence in Natural Populations of Listeria monocytogenes.
Maury, Mylène M; Chenal-Francisque, Viviane; Bracq-Dieye, Hélène; Han, Lei; Leclercq, Alexandre; Vales, Guillaume; Moura, Alexandra; Gouin, Edith; Scortti, Mariela; Disson, Olivier; Vázquez-Boland, José A; Lecuit, Marc
2017-11-01
The pathogenesis of Listeria monocytogenes depends on the ability of this bacterium to escape from the phagosome of the host cells via the action of the pore-forming toxin listeriolysin O (LLO). Expression of the LLO-encoding gene ( hly ) requires the transcriptional activator PrfA, and both hly and prfA genes are essential for L. monocytogenes virulence. Here, we used the hemolytic activity of LLO as a phenotypic marker to screen for spontaneous virulence-attenuating mutations in L. monocytogenes Sixty nonhemolytic isolates were identified among a collection of 57,820 confirmed L. monocytogenes strains isolated from a variety of sources (0.1%). In most cases (56/60; 93.3%), the nonhemolytic phenotype resulted from nonsense, missense, or frameshift mutations in prfA Five strains carried hly mutations leading to a single amino acid substitution (G299V) or a premature stop codon causing strong virulence attenuation in mice. In one strain, both hly and gshF (encoding a glutathione synthase required for full PrfA activity) were missing due to genomic rearrangements likely caused by a transposable element. The PrfA/LLO loss-of-function (PrfA - /LLO - ) mutants belonged to phylogenetically diverse clades of L. monocytogenes , and most were identified among nonclinical strains (57/60). Consistent with the rare occurrence of loss-of-virulence mutations, we show that prfA and hly are under purifying selection. Although occurring at a low frequency, PrfA - /LLO - mutational events in L. monocytogenes lead to niche restriction and open an evolutionary path for obligate saprophytism in this facultative intracellular pathogen. Copyright © 2017 Maury et al.
Efficacy of chlorine dioxide against Listeria monocytogenes in brine chilling solutions.
Valderrama, W B; Mills, E W; Cutter, C N
2009-11-01
Chilled brine solutions are used by the food industry to rapidly cool ready-to-eat meat products after cooking and before packaging. Chlorine dioxide (ClO(2)) was investigated as an antimicrobial additive to eliminate Listeria monocytogenes. Several experiments were performed using brine solutions made of sodium chloride (NaCl) and calcium chloride (CaCl(2)) inoculated with L. monocytogenes and/or treated with 3 ppm of ClO(2). First, 10 and 20% CaCl(2) and NaCl solutions (pH 7.0) were inoculated with a five-strain cocktail of L. monocytogenes to obtain approximately 7 log CFU/ml and incubated 8 h at 0 degrees C. The results demonstrated that L. monocytogenes survived in 10% CaCl(2), 10 and 20% NaCl, and pure water. L. monocytogenes levels were reduced approximately 1.2 log CFU/ml in 20% CaCl(2). Second, inoculated ( approximately 7 log CFU/ml) brine solutions (10 and 20% NaCl and 10% CaCl(2)) treated with 3 ppm of ClO(2) resulted in a approximately 4-log reduction of the pathogen within 90 s. The same was not observed in a solution of 20% CaCl(2); further investigation demonstrated that high levels of divalent cations interfere with the disinfectant. Spent brine solutions from hot dog and ham chilling were treated with ClO(2) at concentrations of 3 or 30 ppm. At these concentrations, ClO(2) did not reduce L. monocytogenes. Removal of divalent cations and organic material in brine solutions prior to disinfection with ClO(2) should be investigated to improve the efficacy of the compound against L. monocytogenes. The information from this study may be useful to processing establishments and researchers who are investigating antimicrobials in chilling brine solutions.
Review of Prosthetic Joint Infection from Listeria monocytogenes.
Bader, Gilbert; Al-Tarawneh, Mohammed; Myers, James
2016-12-01
Prosthetic joint infection from Listeria monocytogenes is rare. We decided to shed light on this illness and review the reported cases to better understand its characteristics. We conducted a comprehensive review of the English literature using PubMed. We also included one case that we had managed. We found 25 cases of prosthetic joint infection from L. monocytogenes reported individually and a retrospective study of 43 cases of joint and bone listerial infection, including 34 with prosthetic joint infection, conducted in France. We have described their clinical and para-clinical features and tried to elaborate on the pathophysiology, treatment, and prevention. Prosthetic joint infection from L. monocytogenes is mainly late. Systemic inflammation may be absent. Although rare, it must be suspected in patients at high risk for both prosthetic joint and listerial infections. In addition, those patients must be instructed on appropriate preventive measures.
Animal models for oral transmission of Listeria monocytogenes
Directory of Open Access Journals (Sweden)
Sarah E F D'Orazio
2014-02-01
Full Text Available Listeria monocytogenes has been recognized as a food borne pathogen in humans since the 1980s, but we still understand very little about oral transmission of L. monocytogenes or the host factors that determine susceptibility to gastrointestinal infection, due to the lack of an appropriate small animal model of oral listeriosis. Early feeding trials suggested that many animals were highly resistant to oral infection, and the more reproducible intravenous or intraperitoneal routes of inoculation soon came to be favored. There are a fair number of previously published studies using an oral infection route, but the work varies widely in terms of bacterial strain choice, the methods used for oral transmission, and various manipulations used to enhance infectivity. This mini review will summarize the published literature using oral routes of L. monocytogenes infection and will highlight recent technological advances that have made oral infection a more attractive model system.
Directory of Open Access Journals (Sweden)
Roberta Ortenzi
2015-09-01
Full Text Available In the present study, a microbiological challenge test in artificially contaminated raw milk Pecorino Umbro cheese during cheese-making was carried out. Raw ewe milk was contaminated by a suspension of particular Listeria monocytogenes strains. The number of L. monocytogenes and L. monocytogenes dynamic growth were evaluated during cheese-making and storage. A significant decrease of the viable count of L. monocytogenes was observed during ripening and L. monocytogenes viable count was below the limit of quantification during storage. The results show that the product is unable to support the growth of the pathogen.
Directory of Open Access Journals (Sweden)
Nilma Cintra Lea
2013-09-01
Full Text Available Background: In Brazil, listeriosis is not a notifiable disease; thus, the incidence of Brazilian cases remains unknown. Listeria monocytogenes is not always included in automated systems, and its detection depends on the high skill level of microbiology laboratory professionals. This paper describes the characteristics of L. monocytogenes isolates fortuitously obtained from an endocarditis case in Recife, PE, Brazil. Methods: Six bacterial isolates obtained from six blood cultures from a 28-year-old male bearing a prosthetic mitral heart valve were analyzed by PCR using primers specific of L. monocytogenes to confirm a presumptive identification, determine the serotype and presence of the virulence genes (inlA, inlB, inlC, inlJ, hly, plcA, actA, prfA in an attempt to determine the Listeria genotype by PCR-ribotyping. Results: The samples were identified as L. monocytogenes 4b. All investigated virulence genes were amplified by PCR, and the identity of the amplified segments was confirmed by sequencing. A deletion of 105 base pairs was detected in the actA gene. All of the samples generated the same PCR-ribotype pattern, clustered into a single ribotype, and were considered a single strain. Conclusion: L. monocytogenes infection should be considered in endocarditis differential diagnoses, especially among high-risk groups, due to its high pathogenicity and the environmental ubiquity.
Study of phospholipases D and C in maturing and germinating seeds of Brassica napus
Czech Academy of Sciences Publication Activity Database
Novotná, Z.; Valentová, O.; Martinec, Jan; Feltl, Tomáš; Nokhrina, K.
2000-01-01
Roč. 28, - (2000), s. 817-818 ISSN 0300-5127 R&D Projects: GA ČR GA522/00/1332 Institutional research plan: CEZ:AV0Z5038910 Keywords : phospholipase C * phospholipase D Subject RIV: EF - Botanics Impact factor: 0.975, year: 2000
DEFF Research Database (Denmark)
Sawosz, Ewa; Chwalibog, André; Szeliga, Jacek
2010-01-01
-Au and nano-Pt respectively), with Salmonella Enteritidis (Gram-negative) and Listeria monocytogenes (Gram-positive), to reveal possibilities of constructing bacteria-nanoparticle vehicles. Methods: Hydrocolloids of nano-Au or nano-Pt were added to two bacteria suspensions in the following order: nano...... as a vehicle to deliver nano-Pt to specific points in the body....
Energy Technology Data Exchange (ETDEWEB)
Bell, M E; Peterson, R G; Eichberg, J
1982-07-01
The effect of chronic streptozotocin-induced diabetes on phospholipid metabolism in rat sciatic nerve in vitro was investigated. In normal nerve incubated for 2 h in Krebs-Ringer-bicarbonate buffer containing (/sup 32/P)orthophosphate, radioactivity was primarily incorporated into phosphatidylinositol-4,5-bisphosphate and phosphatidylcholine. Smaller amounts were present in phosphatidylinositol-4-phosphate, phosphatidylinositol, and phosphatidic acid. As compared to controls, phosphatidylinositol-4,5-bisphosphate in nerves from animals made diabetic 2, 10, and 20 weeks earlier accounted for 30-46% more of the isotope, expressed as a percentage, incorporated into all phospholipids. In contrast, the proportion of radioactivity in phosphatidylcholine decreased by 10-25%. When the results were expressed as the quantity of phosphorus incorporated into phospholipid, only phosphatidylinositol-4,5-bisphosphate displayed a change. The amount of isotope which entered this lipid increased 60% and 67% for 2- and 10-week diabetic animals, respectively. Increased phosphatidylinositol-4,5-bisphosphate labeling was observed when epineurial-free preparations were used or when the composition of the incubation medium was varied. Sciatic and caudal nerve conduction velocities were decreased after 10 and 20 weeks but were unchanged after 2 weeks. Researchers conclude that an increase in the turnover of phosphatidylinositol-4,5-bisphosphate in sciatic nerve from streptozotocin-diabetic rats appears relatively early and persists throughout the course of the disease. This metabolic alteration may be related to a primary defect responsible for the accompanying deficient peripheral nerve function.
Prevalence of Listeria monocytogenes in poultry production in France.
Chemaly, Marianne; Toquin, Marie-Therese; Le Nôtre, Yolene; Fravalo, Philippe
2008-10-01
This study aimed to update and create a data set from laying hens and broilers regarding contamination by Listeria monocytogenes. Two hundred laying-hen flocks were sampled, with 88 flocks reared in cages and 112 reared on the floor. One hundred forty-five broiler flocks were sampled, with 85 conventional and 60 free-range flocks. A total of 774 and 725 samples were analyzed from laying hens and broilers, respectively. L. monocytogenes was detected in 31 of 200 flocks, yielding an estimated prevalence of 15.5% in laying-hen flocks. Among positive flocks, there appeared a significant (P = 0.004) difference between caged and floor-reared hens, with a higher detection in dust samples from floor-reared hens. In positive caged hen flocks, significant (P = 0.028) differences between dust and fecal samples appeared, with a higher detection in feces than in dust samples. In broiler flocks, L. monocytogenes was isolated in 46 of 145 flocks, yielding an estimated prevalence of 32% (28% in conventional flocks versus 37% in the free-range flocks). L. monocytogenes was isolated in samples taken from conventional flocks with a lower frequency than in free-range flocks (13 versus 18%, respectively). The serotyping of L. monocytogenes strains showed that the majority belonged to type 1/2a in laying-hen flocks (74.3%) and in broiler flocks (40.5%). A significant difference (P = 0.007) between laying hens and broilers was shown for serogroup 4 and for serovar 1/2b (P = 0.007); these serogroups were more prevalent in broilers (40%) than in laying hens (5.7%).
SABIL, SYAHRIANA
2015-01-01
2015 SYAHRIANA SABIL (I 111 11 273). Pasteurisasi High Temperature Short Time (HTST) Susu terhadap Listeria monocytogenes pada Penyimpanan Refrigerator. Dibimbing oleh RATMAWATI MALAKA dan FARIDA NUR YULIATI. Pasteurisasi High Temperature Short Time (HTST) merupakan proses pemanasan susu di bawah titik didih yang diharapkan dapat membunuh Listeria monocytogenes (L. monocytogenes) karena bersifat patogen dan mengakibatkan listeriosis yang merupakan penyakit zoonosis. Tu...
Juck, Gregory; Gonzalez, Verapaz; Allen, Ann-Christine Olsson; Sutzko, Meredith; Seward, Kody; Muldoon, Mark T
2018-04-27
The Romer Labs RapidChek ® Listeria monocytogenes test system (Performance Tested Method ℠ 011805) was validated against the U.S. Department of Agriculture-Food Safety and Inspection Service Microbiology Laboratory Guidebook (USDA-FSIS/MLG), U.S. Food and Drug Association Bacteriological Analytical Manual (FDA/BAM), and AOAC Official Methods of Analysis ℠ (AOAC/OMA) cultural reference methods for the detection of L. monocytogenes on selected foods including hot dogs, frozen cooked breaded chicken, frozen cooked shrimp, cured ham, and ice cream, and environmental surfaces including stainless steel and plastic in an unpaired study design. The RapidChek method uses a proprietary enrichment media system, a 44-48 h enrichment at 30 ± 1°C, and detects L. monocytogenes on an immunochromatographic lateral flow device within 10 min. Different L. monocytogenes strains were used to spike each of the matrixes. Samples were confirmed based on the reference method confirmations and an alternate confirmation method. A total of 140 low-level spiked samples were tested by the RapidChek method after enrichment for 44-48 h in parallel with the cultural reference method. There were 88 RapidChek presumptive positives. One of the presumptive positives was not confirmed culturally. Additionally, one of the culturally confirmed samples did not exhibit a presumptive positive. No difference between the alternate confirmation method and reference confirmation method was observed. The respective cultural reference methods (USDA-FSIS/MLG, FDA/BAM, and AOAC/OMA) produced a total of 63 confirmed positive results. Nonspiked samples from all foods were reported as negative for L. monocytogenes by all methods. Probability of detection analysis demonstrated no significant differences in the number of positive samples detected by the RapidChek method and the respective cultural reference method.
Directory of Open Access Journals (Sweden)
Aurean D'Eça Júnior
2011-06-01
Full Text Available INTRODUCTION: Candida yeasts are commensals; however, if the balance of normal flora is disrupted or the immune defenses are compromised, Candida species can cause disease manifestations. Several attributes contribute to the virulence and pathogenicity of Candida, including the production of extracellular hydrolytic enzymes, particularly phospholipase and proteinase. This study aimed to investigate the in vitro activity of phospholipases and acid proteinases in clinical isolates of Candida spp. METHODS: Eighty-two isolates from hospitalized patients collected from various sites of origin were analyzed. Phospholipase production was performed in egg yolk medium and the production of proteinase was verified in a medium containing bovine serum albumin. The study was performed in triplicate. RESULTS: Fifty-six (68.3% of isolates tested were phospholipase positive and 16 (44.4% were positive for proteinase activity. C. tropicalis was the species with the highest number of positive isolates for phospholipase (91.7%. Statistically significant differences were observed in relation to production of phospholipases among species (p<0,0001 and among the strains from different sites of origin (p=0.014. Regarding the production of acid protease, the isolates of C. parapsilosis tested presented a larger number of producers (69.2%. Among the species analyzed, the percentage of protease producing isolates did not differ statistically (χ2=1.9 p=0.5901 (χ2=1.9 p=0.5901. CONCLUSIONS: The majority of C. non-albicans and all C. albicans isolates were great producers of hydrolytic enzymes and, consequently, might be able to cause infection under favorable conditions.
International Nuclear Information System (INIS)
Traynor-Kaplan, A.E.; Thompson, B.L.; Harris, A.L.; Taylor, P.; Omann, G.M.; Sklar, L.A.
1989-01-01
We recently showed that phosphatidylinositol trisphosphate (PIP3) was present in a unique lipid fraction generated in neutrophils during activation. Here, we demonstrate that the band containing this fraction isolated from thin layer chromatography consists primarily of PIP3 and that only small amounts of radiolabeled PIP3 exist prior to activation. In addition, high performance liquid chromatography of deacylated phospholipids from stimulated cells reveals an increase in a fraction eluting ahead of glycerophosphoinositol 4,5-P2. After removal of the glycerol we found that it coeluted with inositol 1,3,4-P3 when resubjected to high performance liquid chromatography. Thus, we have detected a second, novel form of phosphatidylinositol bisphosphate in activated neutrophils, PI-(3,4)P2. The elevation of PIP3 through the formyl peptide receptor is blocked by pretreatment with pertussis toxin, implicating mediation of the increase in PIP3 by a guanosine triphosphate-binding (G) protein. The rise in PIP3 is not secondary to calcium elevation. Buffering the rise in intracellular calcium did not diminish the increase in PIP3. The elevation of PIP3 appears to occur during activation with physiological agonists, its level varying with the degree of activation. Leukotriene B4, which elicits many of the same responses as stimulation of the formyl peptide receptor but with minimal oxidant production, stimulates a much attenuated rise in PIP3. Isoproterenol, which inhibits oxidant production also reduces the rise in PIP3. Hence formation of PI(3,4)P2 and PIP3 (presumed to be PI(3,4,5)P3) correlates closely with the early events of neutrophil activation
Dual-species biofilm of Listeria monocytogenes and Escherichia coli on stainless steel surface.
de Grandi, Aline Zago; Pinto, Uelinton Manoel; Destro, Maria Teresa
2018-04-12
Listeria monocytogenes is a Gram-positive bacterium commonly associated with foodborne diseases. Due its ability to survive under adverse environmental conditions and to form biofilm, this bacterium is a major concern for the food industry, since it can compromise sanitation procedures and increase the risk of post-processing contamination. Little is known about the interaction between L. monocytogenes and Gram-negative bacteria on biofilm formation. Thus, in order to evaluate this interaction, Escherichia coli and L. monocytogenes were tested for their ability to form biofilms together or in monoculture. We also aimed to evaluate the ability of L. monocytogenes 1/2a and its isogenic mutant strain (ΔprfA ΔsigB) to form biofilm in the presence of E. coli. We assessed the importance of the virulence regulators, PrfA and σ B , in this process since they are involved in many aspects of L. monocytogenes pathogenicity. Biofilm formation was assessed using stainless steel AISI 304 #4 slides immersed into brain heart infusion broth, reconstituted powder milk and E. coli preconditioned medium at 25 °C. Our results indicated that a higher amount of biofilm was formed by the wild type strain of L. monocytogenes than by its isogenic mutant, indicating that prfA and sigB are important for biofilm development, especially maturation under our experimental conditions. The presence of E. coli or its metabolites in preconditioned medium did not influence biofilm formation by L. monocytogenes. Our results confirm the possibility of concomitant biofilm formation by L. monocytogenes and E. coli, two bacteria of major significance in the food industry.
Novel Cadmium Resistance Determinant in Listeria monocytogenes.
Parsons, Cameron; Lee, Sangmi; Jayeola, Victor; Kathariou, Sophia
2017-03-01
Listeria monocytogenes is a foodborne pathogen that can cause severe disease (listeriosis) in susceptible individuals. It is ubiquitous in the environment and often exhibits resistance to heavy metals. One of the determinants that enables Listeria to tolerate exposure to cadmium is the cadAC efflux system, with CadA being a P-type ATPase. Three different cadA genes (designated cadA1 to cadA3 ) were previously characterized in L. monocytogenes A novel putative cadmium resistance gene ( cadA4 ) was recently identified through whole-genome sequencing, but experimental confirmation for its involvement in cadmium resistance is lacking. In this study, we characterized cadA4 in L. monocytogenes strain F8027, a cadmium-resistant strain of serotype 4b. By screening a mariner-based transposon library of this strain, we identified a mutant with reduced tolerance to cadmium and that harbored a single transposon insertion in cadA4 The tolerance to cadmium was restored by genetic complementation with the cadmium resistance cassette ( cadA4C ), and enhanced cadmium tolerance was conferred to two unrelated cadmium-sensitive strains via heterologous complementation with cadA4C Cadmium exposure induced cadA4 expression, even at noninhibitory levels. Virulence assessments in the Galleria mellonella model suggested that a functional cadA4 suppressed virulence, potentially promoting commensal colonization of the insect larvae. Biofilm assays suggested that cadA4 inactivation reduced biofilm formation. These data not only confirm cadA4 as a novel cadmium resistance determinant in L. monocytogenes but also provide evidence for roles in virulence and biofilm formation. IMPORTANCE Listeria monocytogenes is an intracellular foodborne pathogen causing the disease listeriosis, which is responsible for numerous hospitalizations and deaths every year. Among the adaptations that enable the survival of Listeria in the environment are the abilities to persist in biofilms, grow in the cold, and
A rapid phospholipase A2 bioassay using 14C-oleate-labelled E. coli bacterias.
Meyer, T; von Wichert, P; Weins, D
1989-02-01
Two methods of phospholipase A2 determination using 14C-labelled E. coli bacterias as substrate were compared. One method works with a filter membrane for separation of cleaved 14C-oleate from remaining phospholipids, the other uses the well-known thin-layer chromatography for lipid analysis. Some features of human serum phospholipase A2 regarding pH and Ca2+ dependency were investigated. Possible sources of errors were discussed. It was shown that either method can differentiate between normal and pathologically elevated phospholipase A2 levels, but that the filter method is superior in terms of sensitivity and workload.
Directory of Open Access Journals (Sweden)
Erica Tirloni
2017-12-01
Full Text Available Objective of the present study was to test the performances of a loop-mediated isothermal amplification (LAMP-based method for the detection of Listeria monocytogenes, with particular focus on the dairy products. The specificity of the method was evaluated on 42 different Listeria spp. strains from collections, food and environmental samples. 100% (32 of 32 of the L. monocytogenes strains were correctly recognised, and none of other 10 Listeria spp. strains was misidentified. The sensitivity was evaluated on four L. monocytogenes strains from different sources. The instrument was able to detect 10-400 CFU/mL. The ability to detect low initial numbers of L. monocytogenes (0.3- 0.7 Log CFU/g was also evaluated, in duplicate, in pasteurised milk (whole and skimmed and dairy samples (fresh ricotta, crescenza, mascarpone, mozzarella, cottage cheese, cream cheese, taleggio, gorgonzola. The analysis was performed after 18, 24 and 48 h of incubation, and was coupled with the count of L. monocytogenes in the broth. Microbial loads were insufficient to achieve a positive result after 18 and 24 h in most of the samples; after 48 h, all the products, except taleggio and one gorgonzola sample, were identified as positive; the sensitivity of the method when applied to contaminated dairy foods was about 5 Log CFU/g. The LAMP method tested can be considered a very useful tool, as it is a costeffective and easy-functioning method. The preliminary data obtained should be confirmed with a validation process taking into account different food typologies.
International Nuclear Information System (INIS)
Fernandes, Carlos A. H.; Gartuzo, Elaine C. G.; Pagotto, Ivan; Comparetti, Edson J.; Huancahuire-Vega, Salomón; Ponce-Soto, Luis Alberto; Costa, Tássia R.; Marangoni, Sergio; Soares, Andreimar M.; Fontes, Marcos R. M.
2012-01-01
Two myotoxic and noncatalytic Lys49-phospholipases A 2 (braziliantoxin-II and MT-II) and a myotoxic and catalytic phospholipase A 2 (braziliantoxin-III) from B. brazili were crystallized. X-ray diffraction data sets were collected and molecular-replacement solutions were obtained. Two myotoxic and noncatalytic Lys49-phospholipases A 2 (braziliantoxin-II and MT-II) and a myotoxic and catalytic phospholipase A 2 (braziliantoxin-III) from the venom of the Amazonian snake Bothrops brazili were crystallized. The crystals diffracted to resolutions in the range 2.56–2.05 Å and belonged to space groups P3 1 21 (braziliantoxin-II), P6 5 22 (braziliantoxin-III) and P2 1 (MT-II). The structures were solved by molecular-replacement techniques. Both of the Lys49-phospholipases A 2 (braziliantoxin-II and MT-II) contained a dimer in the asymmetric unit, while the Asp49-phospholipase A 2 braziliantoxin-III contained a monomer in its asymmetric unit. Analysis of the quaternary assemblies of the braziliantoxin-II and MT-II structures using the PISA program indicated that both models have a dimeric conformation in solution. The same analysis of the braziliantoxin-III structure indicated that this protein does not dimerize in solution and probably acts as a monomer in vivo, similar to other snake-venom Asp49-phospholipases A 2
Dreux, N; Albagnac, C; Federighi, M; Carlin, F; Morris, C E; Nguyen-the, C
2007-10-01
To investigate the presence of viable but non-culturable Listeria monocytogenes during survival on parsley leaves under low relative humidity (RH) and to evaluate the ability of L. monocytogenes to recover from VBNC to culturable state under satured humidity. Under low RH (47-69%) on parsley leaves, the initial number of L. monocytogenes populations counted on non selective media (10(9) L. monocytogenes per leaf on TSA) was reduced by 6 log10 scales in 15 days, whereas number of viable L. monocytogenes counted under the microscope was reduced by 3-4 log10 scales, indicating the presence of VBNC cells. This was demonstrated on three L. monocytogenes strains (EGDe, Bug 1995 and LmP60). Changing from low to 100% RH permitted an increase of the culturable counts of L. monocytogenes and this growth was observed only when residual culturable cells were present. Moreover, VBNC L. monocytogenes inoculated on parsley leaves did not become culturable after incubation under 100% RH. Dry conditions induced VBNC L. monocytogenes on parsley leaves but these VBNC were likely unable to recover culturability after transfer to satured humidity. Enumeration on culture media presumably under-estimates the number of viable L. monocytogenes on fresh produce after exposure to low RH.
Age-Dependent Differences in Systemic and Cell-Autonomous Immunity to L. monocytogenes
Directory of Open Access Journals (Sweden)
Ashley M. Sherrid
2013-01-01
Full Text Available Host defense against infection can broadly be categorized into systemic immunity and cell-autonomous immunity. Systemic immunity is crucial for all multicellular organisms, increasing in importance with increasing cellular complexity of the host. The systemic immune response to Listeria monocytogenes has been studied extensively in murine models; however, the clinical applicability of these findings to the human newborn remains incompletely understood. Furthermore, the ability to control infection at the level of an individual cell, known as “cell-autonomous immunity,” appears most relevant following infection with L. monocytogenes; as the main target, the monocyte is centrally important to innate as well as adaptive systemic immunity to listeriosis. We thus suggest that the overall increased risk to suffer and die from L. monocytogenes infection in the newborn period is a direct consequence of age-dependent differences in cell-autonomous immunity of the monocyte to L. monocytogenes. We here review what is known about age-dependent differences in systemic innate and adaptive as well as cell-autonomous immunity to infection with Listeria monocytogenes.
A novel suicide plasmid for efficient gene mutation in Listeria monocytogenes
Although several plasmids have been used in Listeria monocytogenes for generating mutants by allelic exchange, construction of L. monocytogenes mutants has been inefficient due to lack of effective selection markers for first and second recombination events. To address this problem, we have develope...
Short-term genome evolution of Listeria monocytogenes in a non-controlled environment
Directory of Open Access Journals (Sweden)
Ivy Reid A
2008-11-01
Full Text Available Abstract Background While increasing data on bacterial evolution in controlled environments are available, our understanding of bacterial genome evolution in natural environments is limited. We thus performed full genome analyses on four Listeria monocytogenes, including human and food isolates from both a 1988 case of sporadic listeriosis and a 2000 listeriosis outbreak, which had been linked to contaminated food from a single processing facility. All four isolates had been shown to have identical subtypes, suggesting that a specific L. monocytogenes strain persisted in this processing plant over at least 12 years. While a genome sequence for the 1988 food isolate has been reported, we sequenced the genomes of the 1988 human isolate as well as a human and a food isolate from the 2000 outbreak to allow for comparative genome analyses. Results The two L. monocytogenes isolates from 1988 and the two isolates from 2000 had highly similar genome backbone sequences with very few single nucleotide (nt polymorphisms (1 – 8 SNPs/isolate; confirmed by re-sequencing. While no genome rearrangements were identified in the backbone genome of the four isolates, a 42 kb prophage inserted in the chromosomal comK gene showed evidence for major genome rearrangements. The human-food isolate pair from each 1988 and 2000 had identical prophage sequence; however, there were significant differences in the prophage sequences between the 1988 and 2000 isolates. Diversification of this prophage appears to have been caused by multiple homologous recombination events or possibly prophage replacement. In addition, only the 2000 human isolate contained a plasmid, suggesting plasmid loss or acquisition events. Surprisingly, besides the polymorphisms found in the comK prophage, a single SNP in the tRNA Thr-4 prophage represents the only SNP that differentiates the 1988 isolates from the 2000 isolates. Conclusion Our data support the hypothesis that the 2000 human listeriosis
Phospholipase Cδ regulates germination of Dictyostelium spores
Dijken, Peter van; Haastert, Peter J.M. van
2001-01-01
Background: Many eukaryotes, including plants and fungi make spores that resist severe environmental stress. The micro-organism Dictyostelium contains a single phospholipase C gene (PLC); deletion of the gene has no effect on growth, cell movement and differentiation. In this report we show that PLC
Prevalence and risk factors for Listeria monocytogenes in broiler flocks in Shiraz, southern Iran.
Hosseinzadeh, Saeid; Shekarforoush, Seyed Shahram; Ansari-Lari, Maryam; EsalatPanah-Fard Jahromi, Mehdi; Berizi, Enayat; Abdollahi, Mostafa
2012-06-01
Listeria monocytogenes has been identified as an important foodborne pathogen in recent years. In humans, it most commonly affects pregnant women, neonates, children, elderly people, and persons with a suppressed immune system. It could contaminate both raw and cooked meat and poultry products. Studies regarding prevalence and risk factors of L. monocytogenes in broilers flocks are limited. Therefore, the present study was conducted to determine the prevalence and risk factors for L. monocytogenes in poultry flocks in Shiraz, southern Iran. During August to September 2009, in total, 100 broiler flocks were selected at slaughter, and 21 specimens were collected from cloacal samples from each flock. Polymerase chain reaction (PCR) was performed on the samples enriched in buffered Listeria enrichment broth (BLEB), using specific primers. Furthermore, enriched samples in BLEB and/or BLEB treated with 5% KOH were subcultured on Palcam medium. Data about farm and flocks were collected using a structured questionnaire. The prevalence of L. monocytogenes was 7% (95% CI, 2-12%) and 1% using PCR and culture, respectively. Results showed that using antibiotics during rearing period was dramatically reduced the rate of isolation (odds ratio [OR]=0.07, p=0.03), whereas house capacity of more than 10,000 birds (OR=24.03, p=0.04) and number of houses (OR=2, p=0.02) significantly increased the prevalence. The correlation between poor management of large poultry flocks and increasing the risk of contamination was more likely due to the recontamination of cooked poultry/undercooking or cross-contamination of other ready-to-eat foods.
Assessment of Listeria monocytogenes virulence in the Galleria mellonella insect larvae model.
Rakic Martinez, Mira; Wiedmann, Martin; Ferguson, Martine; Datta, Atin R
2017-01-01
Several animal models have been used to understand the molecular basis of the pathogenicity, infectious dose and strain to strain variation of Listeria monocytogenes. The greater wax worm Galleria mellonella, as an alternative model, provides some useful advantages not available with other models and has already been described as suitable for the virulence assessment of various pathogens including L. monocytogenes. The objectives of this study are: 1) confirming the usefulness of this model with a wide panel of Listeria spp. including non-pathogenic L. innocua, L. seeligeri, L. welshimeri and animal pathogen L. ivanovii; 2) assessment of virulence of several isogenic in-frame deletion mutants in virulence and stress related genes of L. monocytogenes and 3) virulence assessment of paired food and clinical isolates of L. monocytogenes from 14 major listeriosis outbreaks occurred worldwide between 1980 and 2015. Larvae injected with different concentrations of Listeria were incubated at 37°C and monitored over seven days for time needed to kill 50% of larvae (LT50) and to determine change of bacterial population in G. mellonella, 2 and 24 hours post-inoculation. Non-pathogenic members of Listeria and L. ivanovii showed significantly (P monocytogenes strains. Isogenic mutants of L. monocytogenes with the deletions in prfA, plcA, hly, actA and virR genes, also showed significantly (P monocytogenes strains related to non-invasive (gastroenteritis) outbreaks of listeriosis showed significantly (P < 0.05) lower virulence than isolates of the same serotype obtained from outbreaks with invasive symptoms. The difference, however, was dose and strain- dependent. No significant differences in virulence were observed among the serotype tested in this study.
Identification of human pulmonary alkaline phosphatase isoenzymes.
Capelli, A; Cerutti, C G; Lusuardi, M; Donner, C F
1997-04-01
An increase of alkaline phosphatase (ALP) activity has been observed in the bronchoalveolar lavage fluid (BALF) of patients affected by pulmonary fibrosis in chronic interstitial lung disorders. To characterize the ALP isoenzymes in such cases, we used gel filtration, agarose gel electrophoresis, heat and amino acid inhibition assays, wheat-germ agglutinin (WGA) precipitation, and an immunoassay specific for the bone-isoform of ALP. Only one anodic band representing a high-molecular-weight isoform of ALP (Mr approximately 2,000 kDa) was observed on electrophoresis of BALF. The inhibition assay results were consistent for a tissue-nonspecific isoenzyme sensitive to a temperature of 56 degrees C (71.9 +/- 2.5% inhibition) and to homoarginine (65.7 +/- 1.9%), and resistant to L-phenylalanine and L-leucine. Less than 13% of ALP activity was heat-stable. After incubation of BALF specimens with glycosyl-phosphatidylinositol-phospholipase D plus Nonidet P-40, or with phosphatidylinositol-phospholipase C alone, an electrophoretic cathodic band (Mr approximately 220 kDa) appeared near the bone band of a standard serum. With the WGA assay, 84.4 +/- 3.3% of ALP precipitated and the band disappeared. After immunoassay for the bone isoform, a mean of less than 5% enzyme activity was measured. We conclude that the ALP found in BALF is a pulmonary isoform of a tissue nonspecific isoenzyme.
DEFF Research Database (Denmark)
Bernbom, Nete; Licht, Tine Rask; Saadbye, Peter
2006-01-01
The ability of the pediocin AcH producing Lactobacillus plantarum DDEN 11007 and its non-producing plasmid-cured isogenic variant, DDEN 12305 to prevent the persistence and growth of Listeria monocytogenes EP2 in two gastrointestinal (GI) tract models was examined. In vitro studies conducted...... in a two-stage continuous flow system showed that L. plantarum DDEN 11007 inhibited L. monocytogenes EP2 under these conditions, while less effect was seen of the non-bacteriocin producing variant. The inhibitory effect was more pronounced at pH 5 than at pH 7. No effect on persistence of L. monocytogenes...... in the GI tract was seen in gnotobiotic rats colonized with either the pediocin AcH producing or the non-bacteriocin producing variant of L. plantarum when compared to rats inoculated with L. monocytogenes EP2 alone. Surprisingly, inoculation of the gnotobiotic animals with either of the L. plantarum...
Effect of eugenol on growth and listeriolysin o production by Listeria monocytogenes
Directory of Open Access Journals (Sweden)
Cristina Tostes Filgueiras
2006-05-01
Full Text Available The inhibitory effect of eugenol, a naturally occurring compound mainly present in the essential oil fraction of cloves, was studied on the growth and listeriolysin O (LLO production by Listeria monocytogenes. Potassium efflux from cells promoted by eugenol was also determined after 24 h incubation in phosphate buffered saline. Eugenol promoted a delay on the growth of L. monocytogenes at concentrations of 100, 300 and 500 µg mL-1and above 800 µg mL-1 the effect was bactericidal. Production of LLO by L. monocytogenes in the presence of eugenol was reduced 80-100%. An accumulation of external K+ was observed above 300 µg mL-1 of eugenol which indicated that the cell membrane was affected. The results showed the effectiveness of eugenol in controlling growth and LLO production of L. monocytogenes cells.O efeito inibitório do eugenol, o principal constituinte do óleo essencial de cravo, foi avaliado sobre o crescimento e produção de listeriolisina O (LLO por Listeria monocytogenes. O efluxo de íons potássio das células também foi determinado após 24 h de incubação em solução tampão, contendo eugenol. Concentrações de 100, 300 e 500 µg mL-1 de eugenol promoveram a inibição do crescimento de L. monocytogenes e, em concentrações acima de 800 µg mL-1, constatou-se um efeito bactericida. O crescimento de L. monocytogenes na presença de eugenol resultou na inibição de 80 a 100% da produção de LLO. O efluxo de K+ promovido pelo eugenol indicou que a membrana celular foi afetada. Estes resultados indicam a efetividade do eugenol para o controle do crescimento e da produção de LLO por L. monocytogenes.
Andreeva, Zornitza; Barton, Deborah; Armour, William J; Li, Min Y; Liao, Li-Fen; McKellar, Heather L; Pethybridge, Kylie A; Marc, Jan
2010-10-01
The phospholipase protein superfamily plays an important role in hormonal signalling and cellular responses to environmental stimuli. There is also growing evidence for interactions between phospholipases and the cytoskeleton. In this report we used a pharmacological approach to investigate whether inhibiting a member of the phospholipase superfamily, phospholipase C (PLC), affects microtubules and actin microfilaments as well as root growth and morphology of Arabidopsis thaliana seedlings. Inhibiting PLC activity using the aminosteroid U73122 significantly inhibited root elongation and disrupted root morphology in a concentration-dependent manner, with the response being saturated at 5 μM, whereas the inactive analogue U73343 was ineffective. The primary root appeared to lose growth directionality accompanied by root waving and formation of curls. Immunolabelling of roots exposed to increasingly higher U73122 concentrations revealed that the normal transverse arrays of cortical microtubules in the elongation zone became progressively more disorganized or depolymerized, with the disorganization appearing within 1 h of incubation. Likewise, actin microfilament arrays also were disrupted. Inhibiting PLC using an alternative inhibitor, neomycin, caused similar disruptions to both cytoskeletal organization and root morphology. In seedlings gravistimulated by rotating the culture plates by 90°, both U73122 and neomycin disrupted the normal gravitropic growth of roots and etiolated hypocotyls. The effects of PLC inhibitors are therefore consistent with the notion that, as with phospholipases A and D, PLC likewise interacts with the cytoskeleton, alters growth morphology, and is involved in gravitropism.
Subra, Caroline; Grand, David; Laulagnier, Karine; Stella, Alexandre; Lambeau, Gérard; Paillasse, Michael; De Medina, Philippe; Monsarrat, Bernard; Perret, Bertrand; Silvente-Poirot, Sandrine; Poirot, Marc; Record, Michel
2010-01-01
Exosomes are bioactive vesicles released from multivesicular bodies (MVB) by intact cells and participate in intercellular signaling. We investigated the presence of lipid-related proteins and bioactive lipids in RBL-2H3 exosomes. Besides a phospholipid scramblase and a fatty acid binding protein, the exosomes contained the whole set of phospholipases (A2, C, and D) together with interacting proteins such as aldolase A and Hsp 70. They also contained the phospholipase D (PLD) / phosphatidate phosphatase 1 (PAP1) pathway leading to the formation of diglycerides. RBL-2H3 exosomes also carried members of the three phospholipase A2 classes: the calcium-dependent cPLA2-IVA, the calcium-independent iPLA2-VIA, and the secreted sPLA2-IIA and V. Remarkably, almost all members of the Ras GTPase superfamily were present, and incubation of exosomes with GTPγS triggered activation of phospholipase A2 (PLA2)and PLD2. A large panel of free fatty acids, including arachidonic acid (AA) and derivatives such as prostaglandin E2 (PGE2) and 15-deoxy-Δ12,14-prostaglandinJ2 (15-d PGJ2), were detected. We observed that the exosomes were internalized by resting and activated RBL cells and that they accumulated in an endosomal compartment. Endosomal concentrations were in the micromolar range for prostaglandins; i.e., concentrations able to trigger prostaglandin-dependent biological responses. Therefore exosomes are carriers of GTP-activatable phospholipases and lipid mediators from cell to cell. PMID:20424270
International Nuclear Information System (INIS)
Grant, I.R.; Nixon, C.R.; Patterson, M.F.
1993-01-01
Specific growth rates of two strains of Listeria monocytogenes in unirradiated and irradiated (2 kGy) roast beef and gravy stored at 5° and 10°C were found to be similar. However, exponential growth of L. monocytogenes after irradiation was preceded by an extended lag period of 6–9 d at 5°C and 3–4 d at 10°C, compared with lag periods of 1–2 d and <0.1 d in unirradiated beef and gravy stored similarly
Efficacy of ultraviolet light exposure against survival of Listeria monocytogenes on conveyor belts.
Morey, Amit; McKee, Shelly R; Dickson, James S; Singh, Manpreet
2010-06-01
Listeria monocytogenes has been repeatedly isolated from foods and food-processing facilities including food contact surfaces such as conveyor belts (CB). CBs are often difficult to clean and require rigorous sanitation programs for decontamination. Ultraviolet (UV) light has exhibited microbicidal properties on food contact surfaces and this study was conducted to determine the efficacy of UV against L. monocytogenes on CB made of different materials. A four-strain cocktail of L. monocytogenes (serotypes 3A, 4A, 4B, and 4C) was made to give a suspension of approximately 10(7) CFU/mL. CBs made from four different types of materials, (1) Ropanyl DM 8/2 A2 + 04 (belt 1), (2) Volta FRMW-3.0 (belt 2), (3) Volta FRMB-3.0 (belt 3), and (4) Ropanyl DM (belt 4), were inoculated with 1 mL of the four-strain cocktail (approximately 10(7) CFU/mL) of the bacterial suspension. CBs were treated with UV light (254 nm) for 1 and 3 sec at 5.53 and 5.95 mW/cm(2). Three replications of the experiments were conducted. Two-way analysis of variance of survival populations of L. monocytogenes showed that bacterial counts were significantly reduced (p belt types irrespective of UV light intensities and times of exposure. L. monocytogenes populations were reduced (p belts 1, 2, and 3 after exposure to 5.95 mW/cm(2) UV light intensity for 3 sec. L. monocytogenes-inoculated CBs that were exposed to 5.53 mW/cm(2) showed higher (p Belt 4 showed survival populations of L. monocytogenes ranging from 1.42 to 1.73 log(10) CFU/cm(2) after UV light treatment for 1 and 3 sec. UV light can be effectively used to reduce L. monocytogenes contamination on CBs.
Ma, Xiaohong; Shor, Oded; Diminshtein, Sofia; Yu, Ling; Im, Yang Ju; Perera, Imara; Lomax, Aaron; Boss, Wendy F.; Moran, Nava
2009-01-01
In the animal world, the regulation of ion channels by phosphoinositides (PIs) has been investigated extensively, demonstrating a wide range of channels controlled by phosphatidylinositol (4,5)bisphosphate (PtdInsP2). To understand PI regulation of plant ion channels, we examined the in planta effect of PtdInsP2 on the K+-efflux channel of tobacco (Nicotiana tabacum), NtORK (outward-rectifying K channel). We applied a patch clamp in the whole-cell configuration (with fixed “cytosolic” Ca2+ concentration and pH) to protoplasts isolated from cultured tobacco cells with genetically manipulated plasma membrane levels of PtdInsP2 and cellular inositol (1,4,5)trisphosphate: “Low PIs” had depressed levels of these PIs, and “High PIs” had elevated levels relative to controls. In all of these cells, K channel activity, reflected in the net, steady-state outward K+ currents (IK), was inversely related to the plasma membrane PtdInsP2 level. Consistent with this, short-term manipulations decreasing PtdInsP2 levels in the High PIs, such as pretreatment with the phytohormone abscisic acid (25 μm) or neutralizing the bath solution from pH 5.6 to pH 7, increased IK (i.e. NtORK activity). Moreover, increasing PtdInsP2 levels in controls or in abscisic acid-treated high-PI cells, using the specific PI-phospholipase C inhibitor U73122 (2.5–4 μm), decreased NtORK activity. In all cases, IK decreases stemmed largely from decreased maximum attainable NtORK channel conductance and partly from shifted voltage dependence of channel gating to more positive potentials, making it more difficult to activate the channels. These results are consistent with NtORK inhibition by the negatively charged PtdInsP2 in the internal plasma membrane leaflet. Such effects are likely to underlie PI signaling in intact plant cells. PMID:19052153
A multiplex PCR for detection of Listeria monocytogenes and its lineages.
Rawool, Deepak B; Doijad, Swapnil P; Poharkar, Krupali V; Negi, Mamta; Kale, Satyajit B; Malik, S V S; Kurkure, Nitin V; Chakraborty, Trinad; Barbuddhe, Sukhadeo B
2016-11-01
A novel multiplex PCR assay was developed to identify genus Listeria, and discriminate Listeria monocytogenes and its major lineages (LI, LII, LIII). This assay is a rapid and inexpensive subtyping method for screening and characterization of L. monocytogenes. Copyright © 2016 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Nilma Cintra Leal
2013-09-01
Full Text Available Background: In Brazil, listeriosis is not a notifiable disease; thus, the incidence of Brazilian cases remains unknown. Listeria monocytogenes is not always included in automated systems, and its detection depends on the high skill level of microbiology laboratory professionals. This paper describes the characteristics of L. monocytogenes isolates fortuitously obtained from an endocarditis case in Recife, PE, Brazil. Methods: Six bacterial isolates obtained from six blood cultures from a 28-year-old male bearing a prosthetic mitral heart valve were analyzed by PCR using primers specific of L. monocytogenes to confirm a presumptive identification, determine the serotype and presence of the virulence genes (inlA, inlB, inlC, inlJ, hly, plcA, actA, prfA in an attempt to determine the Listeria genotype by PCR-ribotyping. Results: The samples were identified as L. monocytogenes 4b. All investigated virulence genes were amplified by PCR, and the identity of the amplified segments was confirmed by sequencing. A deletion of 105 base pairs was detected in the actA gene. All of the samples generated the same PCR-ribotype pattern, clustered into a single ribotype, and were considered a single strain. Conclusion: L. monocytogenes infection should be considered in endocarditis differential diagnoses, especially among high-risk groups, due to its high pathogenicity and the environmental ubiquity.
DEFF Research Database (Denmark)
Kastbjerg, Vicky Gaedt; Gram, Lone
2012-01-01
or tolerance would evolve in L. monocytogenes under continued selection in three industrial disinfectants. L. monocytogenes EGD was exposed to Desinfect CL (hypochlorite) and Incimaxx DES (peracedic acid and hydrogen peroxide) for several hundred generations. This caused no increase in the minimal inhibitory......, and that the disinfectants are still efficient for controlling microorganisms such as L. monocytogenes....
Lloyd, T; Alvarado, C Z; Brashears, M M; Thompson, L D; McKee, S R; Berrang, M
2009-10-01
The growth of Listeria monocytogenes in further-processed meat products has become a major concern and an important food safety issue. The meat and poultry industries have incorporated interventions such as organic acids in marinades to inhibit the growth of L. monocytogenes. In this study, organic acids were utilized in the raw product and as a postcook dip to determine their inhibitory effect on the growth of L. monocytogenes in turkey deli loaves. The turkey deli loaves were processed, cooked, cooled, inoculated with streptomycin-resistant L. monocytogenes, and then dipped. Treatments were potassium lactate (PL) in the raw product with sodium lactate (SL), sodium diacetate (SD) dip, PL with SL/PL/SD dip, SL with SL/SD dip, and SL with SL/PL/SD dip. There was also a positive (inoculated) and negative (noninoculated) control, which was dipped in distilled water. Days 0, 7, 14, 21, 28, 42, and 56 were sampled for L. monocytogenes. There were no differences (P>0.05) among the organic acid treatments in the turkey deli loaves at any time points; therefore, all of the treatments increased the lag phase of L. monocytogenes, extending the shelf-life of the product. However, there was a difference between the treatments and the positive control at d 7, 14, 21, 28, 42, and 56. The growth of L. monocytogenes increased immediately in the positive control, whereas the negative control appeared to have no growth. These organic acids can provide meat processors with a useful method for extending the lag phase of L. monocytogenes in ready-to-eat meat and poultry products.
Rückerl, I; Muhterem-Uyar, M; Muri-Klinger, S; Wagner, K-H; Wagner, M; Stessl, B
2014-10-17
The aim of this study was to analyze the changing patterns of Listeria monocytogenes contamination in a cheese processing facility manufacturing a wide range of ready-to-eat products. Characterization of L. monocytogenes isolates included genotyping by pulsed-field gel electrophoresis (PFGE) and multi-locus sequence typing (MLST). Disinfectant-susceptibility tests and the assessment of L. monocytogenes survival in fresh cheese were also conducted. During the sampling period between 2010 and 2013, a total of 1284 environmental samples were investigated. Overall occurrence rates of Listeria spp. and L. monocytogenes were 21.9% and 19.5%, respectively. Identical L. monocytogenes genotypes were found in the food processing environment (FPE), raw materials and in products. Interventions after the sampling events changed contamination scenarios substantially. The high diversity of globally, widely distributed L. monocytogenes genotypes was reduced by identifying the major sources of contamination. Although susceptible to a broad range of disinfectants and cleaners, one dominant L. monocytogenes sequence type (ST) 5 could not be eradicated from drains and floors. Significantly, intense humidity and steam could be observed in all rooms and water residues were visible on floors due to increased cleaning strategies. This could explain the high L. monocytogenes contamination of the FPE (drains, shoes and floors) throughout the study (15.8%). The outcome of a challenge experiment in fresh cheese showed that L. monocytogenes could survive after 14days of storage at insufficient cooling temperatures (8 and 16°C). All efforts to reduce L. monocytogenes environmental contamination eventually led to a transition from dynamic to stable contamination scenarios. Consequently, implementation of systematic environmental monitoring via in-house systems should either aim for total avoidance of FPE colonization, or emphasize a first reduction of L. monocytogenes to sites where
Hingston, Patricia; Chen, Jessica; Allen, Kevin; Truelstrup Hansen, Lisbeth
2017-01-01
The human pathogen Listeria monocytogenes continues to pose a challenge in the food industry, where it is known to contaminate ready-to-eat foods and grow during refrigerated storage. Increased knowledge of the cold-stress response of this pathogen will enhance the ability to control it in the food-supply-chain. This study utilized strand-specific RNA sequencing and whole cell fatty acid (FA) profiling to characterize the bacterium’s cold stress response. RNA and FAs were extracted from a cold-tolerant strain at five time points between early lag phase and late stationary-phase, both at 4°C and 20°C. Overall, more genes (1.3×) were suppressed than induced at 4°C. Late stationary-phase cells exhibited the greatest number (n = 1,431) and magnitude (>1,000-fold) of differentially expressed genes (>2-fold, pmonocytogenes, the growth-phase dependency of its cold-stress regulon, and the active roles of antisense transcripts in regulating its cold stress response. PMID:28662112
DEFF Research Database (Denmark)
Hingston, Patricia; Chen, Jessica; Allen, Kevin
2017-01-01
The human pathogen Listeria monocytogenes continues to pose a challenge in the food industry, where it is known to contaminate ready-to-eat foods and grow during refrigerated storage. Increased knowledge of the cold-stress response of this pathogen will enhance the ability to control it in the food-supply-chain....... This study utilized strand-specific RNA sequencing and whole cell fatty acid (FA) profiling to characterize the bacterium’s cold stress response. RNA and FAs were extracted from a cold-tolerant strain at five time points between early lag phase and late stationary-phase, both at 4°C and 20°C. Overall, more...... genes (1.3×) were suppressed than induced at 4°C. Late stationary-phase cells exhibited the greatest number (n = 1,431) and magnitude (>1,000-fold) of differentially expressed genes (>2-fold, pcold. A core set of 22 genes was upregulated at all growth phases, including nine genes...
Metabolic responses of primary and transformed cells to intracellular Listeria monocytogenes.
Directory of Open Access Journals (Sweden)
Nadine Gillmaier
Full Text Available The metabolic response of host cells, in particular of primary mammalian cells, to bacterial infections is poorly understood. Here, we compare the carbon metabolism of primary mouse macrophages and of established J774A.1 cells upon Listeria monocytogenes infection using (13C-labelled glucose or glutamine as carbon tracers. The (13C-profiles of protein-derived amino acids from labelled host cells and intracellular L. monocytogenes identified active metabolic pathways in the different cell types. In the primary cells, infection with live L. monocytogenes increased glycolytic activity and enhanced flux of pyruvate into the TCA cycle via pyruvate dehydrogenase and pyruvate carboxylase, while in J774A.1 cells the already high glycolytic and glutaminolytic activities hardly changed upon infection. The carbon metabolism of intracellular L. monocytogenes was similar in both host cells. Taken together, the data suggest that efficient listerial replication in the cytosol of the host cells mainly depends on the glycolytic activity of the hosts.
Plasma phospholipase, γ-CEHC and antioxidant capacity in fibromyalgia.
Fais, Antonella; Cacace, Enrico; Atzori, Luigi; Era, Benedetta; Ruggiero, Valeria
2017-05-01
Recent studies have suggested a possible role of high levels of plasma lysophosphocholines (lysoPCs) in fibromyalgia syndrome (FMS). The aim of this study was to evaluate the content of plasma phospholipases (e.g., Platelet Activating Factor Acetyl Hydrolase [PAF-AH], secretory Phospholipase A 2 [sPLA 2 ], Total Antioxidant Capacity [TAOC] and 2,7,8-trimethyl-2-(2-carboxyethyl)-6-hydroxy chroman [γ-CEHC]) in FMS patients and their association with clinical status and quality of life. Thirty-six females meeting the 2011 American College of Rheumatology criteria for the classification of FMS and thirty-four healthy females were enrolled for the study. Plasma enzyme levels were quantified using commercial enzyme-linked-immunosorbent-assay (ELISA). In order to assess the disease severity and the functional status of patients, the Fibromyalgia Impact Questionnarie (FIQ) was used. Higher levels of sPLA 2 and lower PAF-AH and γ-CEHC were observed in the plasma of FMS patients compared to the controls. A decrease in PAF-AH and TAOC levels were found in severe FMS (S-FMS) compared to mild/slight (MS-FMS) forms. The results of the study indicate a possible involvement of phospholipases and γ-CEHC in fibromyalgia syndrome. © 2015 Asia Pacific League of Associations for Rheumatology and Wiley Publishing Asia Pty Ltd.
Grabon, Aby; Orłowski, Adam; Tripathi, Ashutosh; Vuorio, Joni; Javanainen, Matti; Róg, Tomasz; Lönnfors, Max; McDermott, Mark I; Siebert, Garland; Somerharju, Pentti; Vattulainen, Ilpo; Bankaitis, Vytas A
2017-09-01
Phosphatidylinositol-transfer proteins (PITPs) regulate phosphoinositide signaling in eukaryotic cells. The defining feature of PITPs is their ability to exchange phosphatidylinositol (PtdIns) molecules between membranes, and this property is central to PITP-mediated regulation of lipid signaling. However, the details of the PITP-mediated lipid exchange cycle remain entirely obscure. Here, all-atom molecular dynamics simulations of the mammalian StART-like PtdIns/phosphatidylcholine (PtdCho) transfer protein PITPα, both on membrane bilayers and in solvated systems, informed downstream biochemical analyses that tested key aspects of the hypotheses generated by the molecular dynamics simulations. These studies provided five key insights into the PITPα lipid exchange cycle: (i) interaction of PITPα with the membrane is spontaneous and mediated by four specific protein substructures; (ii) the ability of PITPα to initiate closure around the PtdCho ligand is accompanied by loss of flexibility of two helix/loop regions, as well as of the C-terminal helix; (iii) the energy barrier of phospholipid extraction from the membrane is lowered by a network of hydrogen bonds between the lipid molecule and PITPα; (iv) the trajectory of PtdIns or PtdCho into and through the lipid-binding pocket is chaperoned by sets of PITPα residues conserved throughout the StART-like PITP family; and (v) conformational transitions in the C-terminal helix have specific functional involvements in PtdIns transfer activity. Taken together, these findings provide the first mechanistic description of key aspects of the PITPα PtdIns/PtdCho exchange cycle and offer a rationale for the high conservation of particular sets of residues across evolutionarily distant members of the metazoan StART-like PITP family. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
Pagliano, Pasquale; Ascione, Tiziana; Boccia, Giovanni; De Caro, Francesco; Esposito, Silvano
2016-06-01
Listeria monocytogenes is a Gram-positive bacillus and facultative intracellular bacterium whose transmission occurs mainly through the consumption of contaminated food, L. monocytogenes invades the host cells using various protein and can escape to the human T-cell immune system by cell-to-cell spreading. If the infection is not controlled at the stage in which the bacterium is in the liver, for instance, due to a severe immunodepression, a secondary bacteraemia can be developed and L. monocytogenes reaches the preferred sites transgressing the blood-brain barrier or the placental barrier. Individuals with T-cell dysfunction, such as pregnant women, the elderly, and those receiving immunosuppressive therapy are at the highest risk of contracting the disease. Average life expectancy throughout developed countries has rapidly increased during the latter half of the 20th century and geriatric infectious diseases have become an increasingly important issue. L. monocytogenes meningitis in young previously healthy adults has been reported only in anecdotal observations. Differently, L. monocytogenes is the third most common cause of bacterial meningitis in the elderly population, after Streptococcus pneumoniae and Neisseria meningitidis. Patients with L. monocytogenes meningitis presented with signs and symptoms that were similar to those of the general population with community-acquired bacterial meningitis, but reported a longer prodromal phase. According to literature data, the prevalence of the classic triad of fever, neck stiffness, and altered mental status is 43%, and almost all patients present with at least 2 of the 4 classic symptoms of headache, fever, neck stiffness, and altered mental status. On the basis of our published data, in patients aged over 50 years, diagnosing L. monocytogenes meningitis was more challenging than pneumococcal meningitis, as demonstrated by the lower percentage of cases receiving a correct diagnosis within 48 hours from the onset
Structural basis of the phospholipase C activity in neutral sphingomyelinase from Bacillus cereus
International Nuclear Information System (INIS)
Ago, Hideo; Miyano, Masashi
2007-01-01
Degradation of cell membrane and mucosa, of which phospholipids are major components, and production of lipid mediators are roles of phospholipases from pathogenic bacteria to grow, survive and spread in the host organism. The studies on the enzymes the important for the pathobiology of bacterial infectious disease. The crystal structure of Sphingomyelinase from Bacillus cereus revealed the structure basis of the phospholipase C and hemolysis activities in a divalent cation dependent manner. The water-bridged double divalent cations were concluded to be the catalytic architecture to the phospholipase C activity. In addition, the β-hairpin structure with aromatic amino acid residues was shown to be involved in the membrane binding of the enzyme as a part of the hemolysis activity. (author)
Witte, Anna Kristina; Fister, Susanne; Mester, Patrick; Schoder, Dagmar; Rossmanith, Peter
2016-11-01
Fast and reliable pathogen detection is an important issue for human health. Since conventional microbiological methods are rather slow, there is growing interest in detection and quantification using molecular methods. The droplet digital polymerase chain reaction (ddPCR) is a relatively new PCR method for absolute and accurate quantification without external standards. Using the Listeria monocytogenes specific prfA assay, we focused on the questions of whether the assay was directly transferable to ddPCR and whether ddPCR was suitable for samples derived from heterogeneous matrices, such as foodstuffs that often included inhibitors and a non-target bacterial background flora. Although the prfA assay showed suboptimal cluster formation, use of ddPCR for quantification of L. monocytogenes from pure bacterial cultures, artificially contaminated cheese, and naturally contaminated foodstuff was satisfactory over a relatively broad dynamic range. Moreover, results demonstrated the outstanding detection limit of one copy. However, while poorer DNA quality, such as resulting from longer storage, can impair ddPCR, internal amplification control (IAC) of prfA by ddPCR, that is integrated in the genome of L. monocytogenes ΔprfA, showed even slightly better quantification over a broader dynamic range. Graphical Abstract Evaluating the absolute quantification potential of ddPCR targeting Listeria monocytogenes prfA.
McGlade, C J; Ellis, C; Reedijk, M; Anderson, D; Mbamalu, G; Reith, A D; Panayotou, G; End, P; Bernstein, A; Kazlauskas, A
1992-01-01
The binding of cytoplasmic signaling proteins such as phospholipase C-gamma 1 and Ras GTPase-activating protein to autophosphorylated growth factor receptors is directed by their noncatalytic Src homology region 2 (SH2) domains. The p85 alpha regulatory subunit of phosphatidylinositol (PI) 3-kinase, which associates with several receptor protein-tyrosine kinases, also contains two SH2 domains. Both p85 alpha SH2 domains, when expressed individually as fusion proteins in bacteria, bound stably to the activated beta receptor for platelet-derived growth factor (PDGF). Complex formation required PDGF stimulation and was dependent on receptor tyrosine kinase activity. The bacterial p85 alpha SH2 domains recognized activated beta PDGF receptor which had been immobilized on a filter, indicating that SH2 domains contact autophosphorylated receptors directly. Several receptor tyrosine kinases within the PDGF receptor subfamily, including the colony-stimulating factor 1 receptor and the Steel factor receptor (Kit), also associate with PI 3-kinase in vivo. Bacterially expressed SH2 domains derived from the p85 alpha subunit of PI 3-kinase bound in vitro to the activated colony-stimulating factor 1 receptor and to Kit. We infer that the SH2 domains of p85 alpha bind to high-affinity sites on these receptors, whose creation is dependent on receptor autophosphorylation. The SH2 domains of p85 are therefore primarily responsible for the binding of PI 3-kinase to activated growth factor receptors. Images PMID:1372092
Frequency of contamination Listeria monocytogenes of raw dried cured vacuum packed sausages
Directory of Open Access Journals (Sweden)
Hristo Daskalov
2014-03-01
Full Text Available The aim of this study was to collect actual data concerning the frequency of contamination with Listeria monocytogenes of some very popular in Bulgaria raw dried cured vacuum packed sausages, produced from October 2004 till May 2008. 148 vacuum-packed samples were taken from 9 different food business operators during all seasons of the year. The samples were analyzed according to USDA method for meat foods. Ten specimens were positive for presence of Listeria monocytogenes equal to 6,75% of all tested samples. In two other raw dried cured sausages L.welshimeri and L.innocua were found, but these species are not pathogenic for consumers. In the period before the official implementation of HACCP system (01.01.2006 in Bulgaria, 52 samples were examined and 5 Listeria monocytogenes isolates were found (~10%. 2,5 years after the HACCP implementation, 96 specimens from the same meat factories were tested and 5 Listeria monocytogenes isolates (5,2% were detected. Samples taken from lots, produced in winter time were contaminated with Listeria monocytogenes more often (7 of all 10 than specimens taken during other seasons. Data were discussed through the point of view of the effectiveness of hygienic practices and HACCP system application. Also, application of ‘microbiological criterion’ set in COMMISSION REGULATION (EC No 2073/2005 for ready-to-eat foods unable to support the growth of L. monocytogenes was considered.
Suppression of Listeria monocytogenes by the Native Micro-Flora in Teewurst Sausage.
Austin-Watson, Clytrice; Grant, Ar'Quette; Brice, Michline
2013-10-21
Modern consumers are interested in the use of non-chemical methods to control pathogens when heat sterilization is not an option. Such is the case with teewurst sausage, a raw spreadable sausage and a popular German commodity. Although Listeria was not found in teewurst, the optimal microbial growing conditions of teewurst coupled with the ubiquity of L. monocytogenes in nature, makes the possibility of contamination of products very possible. This pilot study was conducted to examine teewurst's native micro-flora's ability to suppress the outgrowth of L. monocytogenes at 10 °C using standard plate counts and PCR-DGGE. Traditional plating methods showed L. monocytogenes growth significantly decreased when in competition with the teewurst's native micro-flora ( p flora of the teewurst suppressed the overall growth of L. monocytogenes by an average of two logs, under these conditions. Denaturing Gradient Gel Electrophoresis (DGGE) amplicons with unique banding patterns were extracted from DGGE gel for identification. Brochothrix thermosphacta and Lactobacillus curvatus were identified as a part of the teewurst's native micro-flora. Although the native micro-flora did not decrease L. monocytogenes to below limits of detection, it was enough of a decrease to warrant further investigation.
Inhibitory Effect of Nisin on Listeria monocytogenes Inoculated into Surimi and Minced Meat
Directory of Open Access Journals (Sweden)
Masoud Rezaei
2012-02-01
Full Text Available Background & Objective: Listeria monocytogenes has already established as an important food born pathogen which induce listeriosis in human. Use of bacteriocins to provide food safety has been increased dramatically. Nisin has a wide spectrum inhibitory effect than the other bacteriocins and inhibits food-borne pathogens such as L. monocytogenes and many other Gram-positive spoilage microorganisms. The purpose of this study was to investigate the inhibitory effect of Nisin on population of Listeria monocytogenes and the role of changes in food components on the antilisterial properties of Nisin. Materials & Methods: The minced meat and surimi samples were inoculated by 1×104 cfu/g of L. monocytogenes. Then samples exposed to Nisin at the levels of 500 or 1000 IU/g were prepared. All treatments after packaging in plastic bags were kept for 12 days at refrigerator temperature. Samples were cultured on CHROMagarTM Listeria every 2 days and the number of listeria monocytogenes was counted. Results: two different concentrations of Nisin (500 or 1000 IU/g was not able to inhibit L. monocytogenes below the acceptable level for raw food (100 cells per g in minced meat and surimi of silver carp. But the number of bacteria reduces more in fish surimi as compared to the mince meal. Also, antilisterial activity of Nisin was reduced during the storage period. Conclusion: Inhibitory property of Nisin against L. monocytogenes in surimi significantly was higher than the minced (P<0.05. So it is possible the antilisterial properties of Nisin will increase by elimination of some enzymes during processing.
Role of adiponectin/phosphatidylinositol 3-kinase/protein kinase B ...
African Journals Online (AJOL)
The adiponectin/phosphatidylinositol 3-kinase/protein kinase B (ADP/PI3k/Akt) signal transduction pathway has an important role in promoting cell survival. This study was designed to determine if the ADP/PI3K/Akt signaling pathway has a role in the mechanism of ischemia–reperfusion injury in vivo. Sprague–Dawley rats ...
Secretory Phospholipase A(2) Activity toward Diverse Substrates
DEFF Research Database (Denmark)
Madsen, Jesper Jonasson; Linderoth, Lars; Subramanian, Arun Kumar
2011-01-01
We have studied secretory phospholipase A(2)-IIA (sPLA(2)) activity toward different phospholipid analogues by performing biophysical 1 characterizations and molecular dynamics simulations. The phospholipids were natural substrates, triple alkyl phospholipids, a prodrug anticancer etherlipid, and...
Directory of Open Access Journals (Sweden)
Miguel A Martín-Acebes
Full Text Available West Nile virus (WNV is a neurovirulent mosquito-borne flavivirus, which main natural hosts are birds but it also infects equines and humans, among other mammals. As in the case of other plus-stranded RNA viruses, WNV replication is associated to intracellular membrane rearrangements. Based on results obtained with a variety of viruses, different cellular processes have been shown to play important roles on these membrane rearrangements for efficient viral replication. As these processes are related to lipid metabolism, fatty acid synthesis, as well as generation of a specific lipid microenvironment enriched in phosphatidylinositol-4-phosphate (PI4P, has been associated to it in other viral models. In this study, intracellular membrane rearrangements following infection with a highly neurovirulent strain of WNV were addressed by means of electron and confocal microscopy. Infection of WNV, and specifically viral RNA replication, were dependent on fatty acid synthesis, as revealed by the inhibitory effect of cerulenin and C75, two pharmacological inhibitors of fatty acid synthase, a key enzyme of this process. However, WNV infection did not induce redistribution of PI4P lipids, and PI4P did not localize at viral replication complex. Even more, WNV multiplication was not inhibited by the use of the phosphatidylinositol-4-kinase inhibitor PIK93, while infection by the enterovirus Coxsackievirus B5 was reduced. Similar features were found when infection by other flavivirus, the Usutu virus (USUV, was analyzed. These features of WNV replication could help to design specific antiviral approaches against WNV and other related flaviviruses.
Directory of Open Access Journals (Sweden)
George Naijil
2010-05-01
Full Text Available Abstract Curcumin, an active principle component in rhizome of Curcuma longa, has proved its merit for diabetes through its anti-oxidative and anti-inflammatory properties. This study aims at evaluating the effect of curcumin in modulating the altered dopaminergic receptors, CREB and phospholipase C in the cerebral cortex and cerebellum of STZ induced diabetic rats. Radioreceptor binding assays and gene expression was done in the cerebral cortex and cerebellum of male Wistar rats using specific ligands and probes. Total dopaminergic receptor binding parameter, Bmax showed an increase in cerebral cortex and decrease in the cerebellum of diabetic rats. Gene expression studies using real time PCR showed an increased expression of dopamine D1 and D2 receptor in the cerebral cortex of diabetic rats. In cerebellum dopamine D1 receptor was down regulated and D2 receptor showed an up regulation. Transcription factor CREB and phospholipase C showed a significant down regulation in cerebral cortex and cerebellum of diabetic rats. We report that curcumin supplementation reduces diabetes induced alteration of dopamine D1, D2 receptors, transcription factor CREB and phospholipase C to near control. Our results indicate that curcumin has a potential to regulate diabetes induced malfunctions of dopaminergic signalling, CREB and Phospholipase C expression in cerebral cortex and cerebellum and thereby improving the cognitive and emotional functions associated with these regions. Furthermore, in line with these studies an interaction between curcumin and dopaminergic receptors, CREB and phospholipase C is suggested, which attenuates the cortical and cerebellar dysfunction in diabetes. These results suggest that curcumin holds promise as an agent to prevent or treat CNS complications in diabetes.
Kumar, T Peeyush; Antony, Sherin; Gireesh, G; George, Naijil; Paulose, C S
2010-05-31
Curcumin, an active principle component in rhizome of Curcuma longa, has proved its merit for diabetes through its anti-oxidative and anti-inflammatory properties. This study aims at evaluating the effect of curcumin in modulating the altered dopaminergic receptors, CREB and phospholipase C in the cerebral cortex and cerebellum of STZ induced diabetic rats. Radioreceptor binding assays and gene expression was done in the cerebral cortex and cerebellum of male Wistar rats using specific ligands and probes. Total dopaminergic receptor binding parameter, B(max) showed an increase in cerebral cortex and decrease in the cerebellum of diabetic rats. Gene expression studies using real time PCR showed an increased expression of dopamine D1 and D2 receptor in the cerebral cortex of diabetic rats. In cerebellum dopamine D1 receptor was down regulated and D2 receptor showed an up regulation. Transcription factor CREB and phospholipase C showed a significant down regulation in cerebral cortex and cerebellum of diabetic rats. We report that curcumin supplementation reduces diabetes induced alteration of dopamine D1, D2 receptors, transcription factor CREB and phospholipase C to near control. Our results indicate that curcumin has a potential to regulate diabetes induced malfunctions of dopaminergic signalling, CREB and Phospholipase C expression in cerebral cortex and cerebellum and thereby improving the cognitive and emotional functions associated with these regions. Furthermore, in line with these studies an interaction between curcumin and dopaminergic receptors, CREB and phospholipase C is suggested, which attenuates the cortical and cerebellar dysfunction in diabetes. These results suggest that curcumin holds promise as an agent to prevent or treat CNS complications in diabetes.
Schmitter, Sibylle; Fieseler, Lars; Klumpp, Jochen; Bertram, Ralph; Loessner, Martin J
2017-08-01
To enable specific and tightly controlled gene expression both in vitro and during the intracellular lifecycle of the pathogen Listeria monocytogenes, a TetR-dependent genetic induction system was developed. Highest concentration of cytoplasmic TetR and best repression of tetO-controlled genes was obtained by tetR expression from the synthetic promoter Pt 17 . Anhydrotetracycline (ATc) as inducer permitted concentration-dependent, fine-tuned expression of genes under control of the tetO operator and a suitable promoter. The actin-polymerizing ActA protein represents a major virulence factor of L. monocytogenes, required for actin-based motility and cell-to-cell spread in infected host cells. To be able to observe its spatial and temporal distribution on intracellular L. monocytogenes cells, conditional mutants featuring actA placed under TetR control were used to infect PtK2 epithelial cells. Following induction at different time intervals, the subsequent recruitment of actin by L. monocytogenes could be monitored. We found that cells displayed functional ActA after approximately 15 min, while formation of polarized actin tail was complete after 90-120 min. At this point, intracellular motility of the induced mutants was indistinguishable from wild-type bacteria. Interestingly, de novo ActA synthesis in intracellular Listeria also demonstrated the temporal, asymmetric redistribution of the membrane-anchored proteins from the lateral walls toward the cell poles. © 2017 John Wiley & Sons Ltd.
Incidence of Listeria monocytogenes and Listeria spp. in a small-scale mushroom production facility.
Viswanath, Prema; Murugesan, Latha; Knabel, Stephen J; Verghese, Bindhu; Chikthimmah, Naveen; Laborde, Luke F
2013-04-01
Listeria monocytogenes is a foodborne pathogen of significant concern to the agricultural and food processing industry because of its ability to grow and persist in cool and moist environments and its association with listeriosis, a disease with a very high mortality rate. Although there have been no listeriosis outbreaks attributed to fresh mushrooms in the United States, retail surveys and recalls are evidence that L. monocytogenes contamination of mushrooms (Agaricus bisporus) can occur. The objective of this study was to determine the prevalence of Listeria spp., including L. monocytogenes, in a small-scale mushroom production facility on the campus of the Pennsylvania State University in the United States. Of 184 samples taken from five production zones within the facility, 29 (15.8%) samples were positive for Listeria spp. Among the Listeria spp. isolates, L. innocua was most prevalent (10.3%) followed by L. welshimeri (3.3%), L. monocytogenes (1.6%), and L. grayi (0.5%). L. monocytogenes was recovered only from the phase I raw material composting area. Isolates of L. monocytogenes were confirmed and serotyped by multiplex PCR. The epidemiological relatedness of the three L. monocytogenes isolates to those serotypes or lineages frequently encountered in listeriosis infections was determined by multi-virulence-locus sequence typing using six virulence genes, namely, prfA, inlB, inlC, dal, clpP, and lisR. The phylogenetic positions of the three isolates in the dendrogram prepared with data from other isolates of L. monocytogenes showed that all isolates were grouped with serotype 4a, lineage IIIA. To date, this serotype has rarely been reported in foodborne disease outbreaks.
DEFF Research Database (Denmark)
Piel, Mathilde S.; Peters, Günther H.J.; Brask, Jesper
2017-01-01
Phospholipases are ubiquitous in nature and the target of significant research aiming at both their physiological roles and technical applications in e.g. the food industry. In the search for sensitive and selective phospholipase assays, we have focused on synthetic FRET (Forster resonance energy...... lyso-(dansyl-FA)-GPE-dabcyl (6) and (dansyl-FA)2-GPE-dabcyl (7) were synthesized by a chemoenzymatic strategy, in which preparation of (6) further included a novel selective enzymatic esterification step. As proof of concept, activity of a handful of phospholipases, one from each of the PLA1, PLA2, PLC...
Antimicrobial treatments to control Listeria monocytogenes in queso fresco.
Lourenço, António; Kamnetz, Mary B; Gadotti, Camila; Diez-Gonzalez, Francisco
2017-06-01
Queso fresco, is a Hispanic non-fermented cheese highly susceptible to contamination with L. monocytogenes. This research was aimed to determine the effect of GRAS antimicrobial ingredients to control L. monocytogenes. Antimicrobials included caprylic acid (CA), Nisaplin ® (N, 2.5% nisin), a mixture of sodium lactate and sodium diacetate (SL/SD), Lactococcus lactis sbp. lactis DPC 3147, monolaurin, and lactic acid (LA). Batches of queso fresco curds were inoculated with 10 4 CFU/g and stored at 4 °C for three weeks. During storage the count of L. monocytogenes reached 7 to 8 Log CFU/g in control samples. Most individual antimicrobial treatments resulted in less than 1 Log CFU/g reductions in final counts, with the exception of N (0.5 g/kg) and CA (2.9 g/kg) that caused more than 3 and 5 Log CFU/g differences with controls, respectively. Mixtures of ingredients were more effective in inhibiting L. monocytogenes growth, and treatments with N and CA consistently delivered 6 Log CFU/g less counts than controls. Supplementation of 12 g/kg LA to treatments with SL/SD (3%/0.22%) caused differences of more than 4 Log CFU/g in final Listeria populations. Samples treated with the binary mixtures of N and CA (0.5 and 0.7 g/kg, respectively) were evaluated in a consumer panel (n = 67). Panelists slightly preferred control and commercial over treated samples, but all samples were in average rated between "slightly liking" and "moderately liking." These experiments indicated that combined use of antimicrobial ingredients may be an effective way to control the population of Listeria monocytogenes in queso fresco. Copyright © 2016 Elsevier Ltd. All rights reserved.
Purine analogs as phosphatidylinositol 4-kinase III beta inhibitors
Czech Academy of Sciences Publication Activity Database
Šála, Michal; Kögler, Martin; Plačková, Pavla; Mejdrová, Ivana; Hřebabecký, Hubert; Procházková, Eliška; Strunin, Dmytro; Lee, G.; Birkuš, G.; Weber, Jan; Mertlíková-Kaiserová, Helena; Nencka, Radim
2016-01-01
Roč. 26, č. 11 (2016), s. 2706-2712 ISSN 0960-894X R&D Projects: GA ČR GA15-09310S; GA MŠk LO1302 Institutional support: RVO:61388963 Keywords : phosphatidylinositol 4-kinase * purine * PI4K III beta * antiviral agent * hepatitis C virus Subject RIV: CC - Organic Chemistry Impact factor: 2.454, year: 2016
Chen, Jianshun; Chen, Qiaomiao; Jiang, Lingli; Cheng, Changyong; Bai, Fan; Wang, Jun; Mo, Fan; Fang, Weihuan
2010-03-31
Ecological, biochemical and genetic resemblance as well as clear differences of virulence between L. monocytogenes and L. innocua make this bacterial clade attractive as a model to examine evolution of pathogenicity. This study was attempted to examine the population structure of L. innocua and the microevolution in the L. innocua-L. monocytogenes clade via profiling of 37 internalin genes and multilocus sequence typing based on the sequences of 9 unlinked genes gyrB, sigB, dapE, hisJ, ribC, purM, gap, tuf and betL. L. innocua was genetically monophyletic compared to L. monocytogenes, and comprised four subgroups. Subgroups A and B correlated with internalin types 1 and 3 (except the strain 0063 belonging to subgroup C) and internalin types 2 and 4 respectively. The majority of L. innocua strains belonged to these two subgroups. Subgroup A harbored a whole set of L. monocytogenes-L. innocua common and L. innocua-specific internalin genes, and displayed higher recombination rates than those of subgroup B, including the relative frequency of occurrence of recombination versus mutation (rho/theta) and the relative effect of recombination versus point mutation (r/m). Subgroup A also exhibited a significantly smaller exterior/interior branch length ratio than expected under the coalescent model, suggesting a recent expansion of its population size. The phylogram based on the analysis with correction for recombination revealed that the time to the most recent common ancestor (TMRCA) of L. innocua subgroups A and B were similar. Additionally, subgroup D, which correlated with internalin type 5, branched off from the other three subgroups. All L. innocua strains lacked seventeen virulence genes found in L. monocytogenes (except for the subgroup D strain L43 harboring inlJ and two subgroup B strains bearing bsh) and were nonpathogenic to mice. L. innocua represents a young species descending from L. monocytogenes and comprises four subgroups: two major subgroups A and B
2010-01-01
Background Ecological, biochemical and genetic resemblance as well as clear differences of virulence between L. monocytogenes and L. innocua make this bacterial clade attractive as a model to examine evolution of pathogenicity. This study was attempted to examine the population structure of L. innocua and the microevolution in the L. innocua-L. monocytogenes clade via profiling of 37 internalin genes and multilocus sequence typing based on the sequences of 9 unlinked genes gyrB, sigB, dapE, hisJ, ribC, purM, gap, tuf and betL. Results L. innocua was genetically monophyletic compared to L. monocytogenes, and comprised four subgroups. Subgroups A and B correlated with internalin types 1 and 3 (except the strain 0063 belonging to subgroup C) and internalin types 2 and 4 respectively. The majority of L. innocua strains belonged to these two subgroups. Subgroup A harbored a whole set of L. monocytogenes-L. innocua common and L. innocua-specific internalin genes, and displayed higher recombination rates than those of subgroup B, including the relative frequency of occurrence of recombination versus mutation (ρ/θ) and the relative effect of recombination versus point mutation (r/m). Subgroup A also exhibited a significantly smaller exterior/interior branch length ratio than expected under the coalescent model, suggesting a recent expansion of its population size. The phylogram based on the analysis with correction for recombination revealed that the time to the most recent common ancestor (TMRCA) of L. innocua subgroups A and B were similar. Additionally, subgroup D, which correlated with internalin type 5, branched off from the other three subgroups. All L. innocua strains lacked seventeen virulence genes found in L. monocytogenes (except for the subgroup D strain L43 harboring inlJ and two subgroup B strains bearing bsh) and were nonpathogenic to mice. Conclusions L. innocua represents a young species descending from L. monocytogenes and comprises four subgroups: two
Directory of Open Access Journals (Sweden)
Shi eWu
2016-02-01
Full Text Available Eighty Listeria monocytogenes isolates were obtained from Chinese retail ready-to-eat (RTE food and were previously characterized with serotyping and antibiotic susceptibility tests. The aim of this study was to characterize the subtype and virulence potential of these L. monocytogenes isolates by multilocus sequence typing (MLST, virulence-associate genes, epidemic clones (ECs and sequence analysis of the important virulence factor: internalin A (inlA. The result of MLST revealed that these L. monocytogenes isolates belonged to 14 different sequence types (STs. With the exception of four new STs (ST804, ST805, ST806 and ST807, all other STs observed in this study have been associated with human listeriosis and outbreaks to varying extents. Six virulence-associate genes (inlA, inlB, inlC, inlJ, hly and llsX were selected and their presence was investigated using PCR. All strains carried inlA, inlB, inlC, inlJ, and hly, whereas 38.8% (31/80 of strains harbored the listeriolysin S genes (llsX. A multiplex PCR assay was used to evaluate the presence of markers specific to epidemic clones of L. monocytogenes and identified 26.3% (21/80 of ECI in the 4b-4d-4e strains. Further study of inlA sequencing revealed that most strains contained the full-length InlA required for host cell invasion, whereas three mutations lead to premature stop codons (PMSC within a novel PMSCs at position 326 (GAA→TAA. MLST and inlA sequence analysis results were concordant, and different virulence potentials within isolates were observed. These findings suggest that L. monocytogenes isolates from RTE food in China could be virulent and be capable of causing human illness. Furthermore, the STs and virulence profiles of L. monocytogenes isolates have significant implications for epidemiological and public health studies of this pathogen.
Wu, Shi; Wu, Qingping; Zhang, Jumei; Chen, Moutong; Guo, Weipeng
2016-01-01
Eighty Listeria monocytogenes isolates were obtained from Chinese retail ready-to-eat (RTE) food and were previously characterized with serotyping and antibiotic susceptibility tests. The aim of this study was to characterize the subtype and virulence potential of these L. monocytogenes isolates by multilocus sequence typing (MLST), virulence-associate genes, epidemic clones (ECs), and sequence analysis of the important virulence factor: internalin A (inlA). The result of MLST revealed that these L. monocytogenes isolates belonged to 14 different sequence types (STs). With the exception of four new STs (ST804, ST805, ST806, and ST807), all other STs observed in this study have been associated with human listeriosis and outbreaks to varying extents. Six virulence-associate genes (inlA, inlB, inlC, inlJ, hly, and llsX) were selected and their presence was investigated using PCR. All strains carried inlA, inlB, inlC, inlJ, and hly, whereas 38.8% (31/80) of strains harbored the listeriolysin S genes (llsX). A multiplex PCR assay was used to evaluate the presence of markers specific to epidemic clones of L. monocytogenes and identified 26.3% (21/80) of ECI in the 4b-4d-4e strains. Further study of inlA sequencing revealed that most strains contained the full-length InlA required for host cell invasion, whereas three mutations lead to premature stop codons (PMSC) within a novel PMSCs at position 326 (GAA → TAA). MLST and inlA sequence analysis results were concordant, and different virulence potentials within isolates were observed. These findings suggest that L. monocytogenes isolates from RTE food in China could be virulent and be capable of causing human illness. Furthermore, the STs and virulence profiles of L. monocytogenes isolates have significant implications for epidemiological and public health studies of this pathogen.
Fagerlund, Annette; Langsrud, Solveig; Schirmer, Bjørn C. T.; Møretrø, Trond; Heir, Even
2016-01-01
Listeria monocytogenes is an important foodborne pathogen responsible for the disease listeriosis, and can be found throughout the environment, in many foods and in food processing facilities. The main cause of listeriosis is consumption of food contaminated from sources in food processing environments. Persistence in food processing facilities has previously been shown for the L. monocytogenes sequence type (ST) 8 subtype. In the current study, five ST8 strains were subjected to whole-genome sequencing and compared with five additionally available ST8 genomes, allowing comparison of strains from salmon, poultry and cheese industry, in addition to a human clinical isolate. Genome-wide analysis of single-nucleotide polymorphisms (SNPs) confirmed that almost identical strains were detected in a Danish salmon processing plant in 1996 and in a Norwegian salmon processing plant in 2001 and 2011. Furthermore, we show that L. monocytogenes ST8 was likely to have been transferred between two poultry processing plants as a result of relocation of processing equipment. The SNP data were used to infer the phylogeny of the ST8 strains, separating them into two main genetic groups. Within each group, the plasmid and prophage content was almost entirely conserved, but between groups, these sequences showed strong divergence. The accessory genome of the ST8 strains harbored genetic elements which could be involved in rendering the ST8 strains resilient to incoming mobile genetic elements. These included two restriction-modification loci, one of which was predicted to show phase variable recognition sequence specificity through site-specific domain shuffling. Analysis indicated that the ST8 strains harbor all important known L. monocytogenes virulence factors, and ST8 strains are commonly identified as the causative agents of invasive listeriosis. Therefore, the persistence of this L. monocytogenes subtype in food processing facilities poses a significant concern for food safety
Directory of Open Access Journals (Sweden)
Maria da Graça F. Nascimento
1994-12-01
Full Text Available Autoclaved distilled water samples were inoculated with L. monocytogenes strain V7 and strain VPH-1, and incubated aerobically, at 30 C for 48 hours. Each strain was tested individually, and growth curves were determined at 1, 2, 3, 4, 5, 21, 24, and 48 hours. The growth or survival of L. monocytogenes was similar for both strains, with survivors at 24 hour-incubation. The microbicidal activity of one synthetic cationic peptide (NP-2 was examined against L. monocytogenes strain V7, in a water system. Antibacterial activity of NP-2 (1, 5, and 10 g/ml was best expressed at 60 minute-incubation, with 10 g/ml of peptide, at 30 C.Amostras de água destilada, autoclavadas, foram inoculadas com L. monocytogenes cepa V7 e cepa VPH-1, e incubadas, aerobicamente, a 30ºC por 48 horas. Cada cepa foi testada individualmente, e determinou-se curvas de crescimento a 1, 2, 3, 4, 5, 21, 24, e 48 horas. O crescimento ou sobrevivência das duas cepas foi semelhante e encontrou-se sobreviventes em 24 horas de incubação. Examinou-se a atividade bactericida de um dos peptídeos catiônicos sintéticos (NP-2 contra L. monocytogenes cepa V7, em sistema aquoso. A atividade antibacteriana de NP-2 (1, 5, and 10µg/ml foi melhor aos 60 minutos de incubação, com 10µg/ml de peptídeo, a 30 C.
Sakaridis, I; Soultos, N; Iossifidou, E; Papa, A; Ambrosiadis, I; Koidis, P
2011-06-01
This study was conducted to determine the prevalence and antimicrobial resistance of Listeria monocytogenes recovered from chicken carcasses in slaughterhouses in Northern Greece. A total of 100 poultry samples (300 carcasses) were examined for Listeria spp. The samples were neck skin taken from four different slaughterhouses in Northern Greece. Forty samples were also taken from the environment of the slaughterhouses. Identification of L. monocytogenes was carried out by PCR and fingerprinting of the isolates by random amplified polymorphic DNA. L. monocytogenes strains isolated from chicken carcasses and from the environment of the slaughterhouses were also examined for antibiotic resistance. Fifty-five isolates of L. monocytogenes were tested for susceptibility to 20 antibiotics using the disk diffusion method. Listeria spp. were present in 99 of the poultry samples tested (99%), and 38 yielded L monocytogenes (38%). L. monocytogenes was also isolated in 80% of samples from the environment of a certain slaughterhouse, while the other slaughterhouses were found to be contaminated only with Listeria spp. All isolates were resistant to nalidixic acid and oxolinic acid, the majority of them to clindamycin, and only a few to tetracycline and oxytetracycline, whereas they were found to be susceptible to all other antimicrobials. The results of this study demonstrate a high prevalence of L. monocytogenes contamination in chicken carcasses, and all isolates were found to be sensitive to the antimicrobials most commonly used to treat human listeriosis.
Camargo, Anderson Carlos; Woodward, Joshua John; Call, Douglas Ruben; Nero, Luís Augusto
2017-11-01
Listeria monocytogenes is a foodborne pathogen that contaminates food-processing environments and persists within biofilms on equipment, utensils, floors, and drains, ultimately reaching final products by cross-contamination. This pathogen grows even under high salt conditions or refrigeration temperatures, remaining viable in various food products until the end of their shelf life. While the estimated incidence of listeriosis is lower than other enteric illnesses, infections caused by L. monocytogenes are more likely to lead to hospitalizations and fatalities. Despite the description of L. monocytogenes occurrence in Brazilian food-processing facilities and foods, there is a lack of consistent data regarding listeriosis cases and outbreaks directly associated with food consumption. Listeriosis requires rapid treatment with antibiotics and most drugs suitable for Gram-positive bacteria are effective against L. monocytogenes. Only a minority of clinical antibiotic-resistant L. monocytogenes strains have been described so far; whereas many strains recovered from food-processing facilities and foods exhibited resistance to antimicrobials not suitable against listeriosis. L. monocytogenes control in food industries is a challenge, demanding proper cleaning and application of sanitization procedures to eliminate this foodborne pathogen from the food-processing environment and ensure food safety. This review focuses on presenting the L. monocytogenes distribution in food-processing environment, food contamination, and control in the food industry, as well as the consequences of listeriosis to human health, providing a comparison of the current Brazilian situation with the international scenario.
Listeria monocytogenes response regulators important for stress tolerance and pathogenesis
DEFF Research Database (Denmark)
Kallipolitis, B H; Ingmer, H
2001-01-01
Environmental sensing by two-component signal transduction systems is likely to play a role for growth and survival of Listeria monocytogenes both during transmission in food products and within a host organism. Two-component systems typically consist of a membrane-associated sensor histidine...... kinase and a gene regulatory protein, the response regulator (RR). We have identified seven putative RR genes in L. monocytogenes LO28 by PCR using degenerate oligonucleotide primers. By insertional inactivation we obtained data suggesting that three of the putative RRs contribute to the pathogenicity...... of L. monocytogenes in mice. Strikingly, the mutants that were attenuated in virulence also had a decreased ability to grow in the presence of various stress conditions potentially encountered in an infection process. Thus, our data point to a connection between the ability of the putative two...
Mechanism of Nisin, Pediocin 34, and Enterocin FH99 Resistance in Listeria monocytogenes.
Kaur, Gurpreet; Singh, Tejinder Pal; Malik, Ravinder Kumar; Bhardwaj, Arun
2012-03-01
Nisin-, pediocin 34-, and enterocin FH99-resistant variants of Listeria monocytogenes ATCC 53135 were developed. In an attempt to clarify the possible mechanisms underlying bacteriocin resistance in L. monocytogenes ATCC 53135, sensitivity of the resistant strains of L. monocytogenes ATCC 53135 to nisin, pediocin 34, and enterocin FH99 in the absence and presence of different divalent cations was assessed, and the results showed that the addition of divalent cations significantly reduced the inhibitory activity of nisin, pediocin 34, and enterocin FH99 against resistant variants of L. monocytogenes ATCC 53135. The addition of EDTA, however, restored this activity suggesting that the divalent cations seem to affect the initial electrostatic interaction between the positively charged bacteriocin and the negatively charged phospholipids of the membrane. Nisin-, pediocin 34-, and enterocin-resistant variants of L. monocytogenes ATCC 53135 were more resistant to lysozyme as compared to the wild-type strain both in the presence as well as absence of nisin, pediocin 34, and enterocin FH99. Ultra structural profiles of bacteriocin-sensitive L. monocytogenes and its bacteriocin-resistant counterparts revealed that the cells of wild-type strain of L. monocytogenes were maximally in pairs or short chains, whereas, its nisin-, pediocin 34-, and enterocin FH99-resistant variants tend to form aggregates. Results indicated that without a cell wall, the acquired nisin, pediocin 34, and enterocin FH99 resistance of the variants was lost. Although the bacteriocin-resistant variants appeared to lose their acquired resistance toward nisin, pediocin 34, and enterocin FH99, the protoplasts of the resistant variants appeared to be more resistant to bacteriocins than the protoplasts of their wild-type counterparts.
Performance of Isfahan North Wastewater Treatment Plant in the Removal of Listeria monocytogenes
Directory of Open Access Journals (Sweden)
nahid Navijouy
2013-08-01
Full Text Available Listeria and in particular Listeria monocytogenes is considered a ubiquitous foodborne pathogen which can lead listeriosis in human and animals. Listeriosis can be serious and may cause meningitis, septicemia and abortion in pregnant women. Although wastewater or sludge may contaminate foods of plant origin, there are no data on occurrence of Listeria spp. in wastewater and sludge in Iran. The purpose of current investigation was to study the occurrence of Listeria spp. in various samples of wastewater and sludge in Isfahan North wastewater treatment plant. Influent, effluent, raw sludge and dried sludge samples were collected from Isfahan North municipal wastewater treatment plant. L. monocytogenes were enumerated by a three–tube most probable number (MPN assay using enrichment Fraser broth. A total of 65 various samples from five step in 13 visits were collected. The presence of Listeria spp. also was determined using USDA procedure. Then, phenotypically identified L. monocytogenes were further confirmed by Polymerase Chain Reaction amplification. L. monocytogenes isolated from 76.9%, 38.5%, 84.6%, 69.2% and 46.2% of influent, effluent, raw sludge, stabilized sludge and dried sludge respectively. The efficiency of wastewater treatment processes, digester tank and drying bed in removal L. monocytogenes were 69.6%, 64.7% and 73.4% respectively. All phenotypically identified L. monocytogenes were further confirmed by Polymerase Chain Reaction. The results of present study have shown that Listeriaspp. and L. monocytogenes in particular, were present in wastewater treatment plant effluents and sludge at high level. The bacteria may spread on agriculture land and contaminate foods of plant origin. This may cause a risk of spreading disease to human and animals.
A dynamical systems approach to actin-based motility in Listeria monocytogenes
Hotton, S.
2010-11-01
A simple kinematic model for the trajectories of Listeria monocytogenes is generalized to a dynamical system rich enough to exhibit the resonant Hopf bifurcation structure of excitable media and simple enough to be studied geometrically. It is shown how L. monocytogenes trajectories and meandering spiral waves are organized by the same type of attracting set.
VAN Stelten, A; Roberts, A R; Manuel, C S; Nightingale, K K
2016-10-01
Listeria monocytogenes is a human foodborne pathogen that may cause an invasive disease known as listeriosis in susceptible individuals. Internalin A (InlA; encoded by inlA) is a virulence factor that facilitates crossing of host cell barriers by L. monocytogenes . At least 19 single nucleotide polymorphisms (SNPs) in inlA that result in a premature stop codon (PMSC) have been described worldwide. SNPs leading to a PMSC in inlA have been shown to be causally associated with attenuated virulence. L. monocytogenes pathogens carrying virulence-attenuating (VA) mutations in inlA have been commonly isolated from ready-to-eat (RTE) foods but rarely have been associated with human disease. This study was conducted to determine the prevalence of VA SNPs in inlA among L. monocytogenes from environments associated with RTE food production and handling. More than 700 L. monocytogenes isolates from RTE food processing plant (n = 409) and retail (n = 319) environments were screened for the presence of VA SNPs in inlA. Overall, 26.4% of isolates from RTE food processing plant and 32.6% of isolates from retail environments carried a VA mutation in inlA. Food contact surfaces sampled at retail establishments were significantly (P < 0.0001) more likely to be contaminated by a L. monocytogenes isolate carrying a VA mutation in inlA (56% of 55 isolates) compared with nonfood contact surfaces (28% of 264 isolates). Overall, a significant proportion of L. monocytogenes isolated from RTE food production and handling environments have reduced virulence. These data will be useful in the revision of current and the development of future risk assessments that incorporate strain-specific virulence parameters.
Darapladib, a lipoprotein-associated phospholipase A2 inhibitor, in diabetic macular edema
DEFF Research Database (Denmark)
Staurenghi, Giovanni; Ye, Li; Magee, Mindy H
2015-01-01
PURPOSE: To investigate the potential of lipoprotein-associated phospholipase A2 inhibition as a novel mechanism to reduce edema and improve vision in center-involved diabetic macular edema (DME). DESIGN: Prospective, multicenter, randomized, double-masked, placebo-controlled phase IIa study...... (AEs) and nonocular AEs were similar between treatment groups. CONCLUSIONS: Once-daily oral darapladib administered for 3 months demonstrated modest improvements in vision and macular edema that warrant additional investigation of this novel lipoprotein-associated phospholipase A2 inhibitory mechanism...
Directory of Open Access Journals (Sweden)
Chong-Tao Du
2018-03-01
Full Text Available The gut microbiota and microRNAs play important roles in the defense against infection. However, the role of miR-146a in L. monocytogenes infection and gut microbiota remains unclear. We tried to determine whether miR-146a controlled L. monocytogenes infection by regulating the gut microbiota. Wild-type and miR-146a-deficient mice or macrophages were used to characterize the impact of miR-146a on animal survival, cell death, bacterial clearance, and gut microbiota following L. monocytogenes challenge. We found that L. monocytogenes infection induced miR-146a expression both in vitro and in vivo. When compared to wild-type mice, miR-146a-deficient mice were more resistant to L. monocytogenes infection. MiR-146a deficiency in macrophages resulted in reduced invasion and intracellular survival of L. monocytogenes. High-throughput sequencing of 16S rRNA revealed that the gut microbiota composition differed between miR-146a-deficient and wild-type mice. Relative to wild-type mice, miR-146a-deficient mice had decreased levels of the Proteobacteria phylum, Prevotellaceae family, and Parasutterella genus, and significantly increased short-chain fatty acid producing bacteria, including the genera Alistipes, Blautia, Coprococcus_1, and Ruminococcus_1. Wild-type mice co-housed with miR-146a-deficient mice had increased resistance to L. monocytogenes, indicating that miR-146a deficiency guides the gut microbiota to alleviate infection. Together, these results suggest that miR-146a deficiency protects against L. monocytogenes infection by regulating the gut microbiota.
Du, Chong-Tao; Gao, Wei; Ma, Ke; Yu, Shui-Xing; Li, Na; Yan, Shi-Qing; Zhou, Feng-Hua; Liu, Zhen-Zhen; Chen, Wei; Lei, Lian-Cheng; Yang, Yong-Jun; Han, Wen-Yu
2018-03-26
The gut microbiota and microRNAs play important roles in the defense against infection. However, the role of miR-146a in L. monocytogenes infection and gut microbiota remains unclear. We tried to determine whether miR-146a controlled L. monocytogenes infection by regulating the gut microbiota. Wild-type and miR-146a-deficient mice or macrophages were used to characterize the impact of miR-146a on animal survival, cell death, bacterial clearance, and gut microbiota following L. monocytogenes challenge. We found that L. monocytogenes infection induced miR-146a expression both in vitro and in vivo. When compared to wild-type mice, miR-146a-deficient mice were more resistant to L. monocytogenes infection. MiR-146a deficiency in macrophages resulted in reduced invasion and intracellular survival of L. monocytogenes . High-throughput sequencing of 16S rRNA revealed that the gut microbiota composition differed between miR-146a-deficient and wild-type mice. Relative to wild-type mice, miR-146a-deficient mice had decreased levels of the Proteobacteria phylum, Prevotellaceae family, and Parasutterella genus, and significantly increased short-chain fatty acid producing bacteria, including the genera Alistipes , Blautia , Coprococcus_1, and Ruminococcus_1 . Wild-type mice co-housed with miR-146a-deficient mice had increased resistance to L. monocytogenes , indicating that miR-146a deficiency guides the gut microbiota to alleviate infection. Together, these results suggest that miR-146a deficiency protects against L. monocytogenes infection by regulating the gut microbiota.
Suppression of Listeria monocytogenes by the Native Micro-Flora in Teewurst Sausage
Directory of Open Access Journals (Sweden)
Michline Brice
2013-10-01
Full Text Available Modern consumers are interested in the use of non-chemical methods to control pathogens when heat sterilization is not an option. Such is the case with teewurst sausage, a raw spreadable sausage and a popular German commodity. Although Listeria was not found in teewurst, the optimal microbial growing conditions of teewurst coupled with the ubiquity of L. monocytogenes in nature, makes the possibility of contamination of products very possible. This pilot study was conducted to examine teewurst’s native micro-flora’s ability to suppress the outgrowth of L. monocytogenes at 10 °C using standard plate counts and PCR-DGGE. Traditional plating methods showed L. monocytogenes growth significantly decreased when in competition with the teewurst’s native micro-flora (p < 0.05. The native micro-flora of the teewurst suppressed the overall growth of L. monocytogenes by an average of two logs, under these conditions. Denaturing Gradient Gel Electrophoresis (DGGE amplicons with unique banding patterns were extracted from DGGE gel for identification. Brochothrix thermosphacta and Lactobacillus curvatus were identified as a part of the teewurst’s native micro-flora. Although the native micro-flora did not decrease L. monocytogenes to below limits of detection, it was enough of a decrease to warrant further investigation.
Rivoal, Katell; Fablet, Aurore; Courtillon, Céline; Bougeard, Stéphanie; Chemaly, Marianne; Protais, Jocelyne
2013-08-16
Human listeriosis, caused by Listeria monocytogenes, is a severe bacterial infection that can lead to meningitis, cerebromeningitis, bacteremia or septicemia, with acute lethality and potentially leading to death. A study has shown that 29.5% of the caged laying hens in France are contaminated by L. monocytogenes (Chemaly et al., 2008). However, very little information regarding egg and egg product contamination is currently available. The objective of this study is to determine the sanitary status of egg products and egg breaking plants in France regarding Listeria spp. and L. monocytogenes contaminations. The sampling scheme performed in five egg breaking plants in Western France during one year have revealed that 8.5% of raw egg products were contaminated by L. monocytogenes. No pasteurized egg products have been shown to be contaminated by L. monocytogenes. However, a high level of contamination by Listeria spp., and particularly by L. innocua, has been shown with 26.2% and 1.8% of raw and pasteurized egg products contaminated, respectively. This work has also revealed the presence of Listeria spp. and L. monocytogenes in the environment of egg breaking plants with 65.1% and 8.0% of contaminated samples, respectively. The typing of 253 isolates of L. monocytogenes by PFGE using ApaI and AscI enzymes has revealed a high diversity with 46 different pulsotypes and has shown that the raw material is a source of contamination of egg breaking plants. One L. monocytogenes cluster was dominant in the 5 egg-breaking plants during the four seasons studied. The issue of which strains are better adapted to egg products must be considered and studied in depth by comparing them to pulsotypes from strains of other chains. However, the traceability of L. monocytogenes in plants during the various seasons has also made it possible to highlight the presence of strains that are specific to egg breaking plants. The study of cleaning and disinfection methods in these plants as well
Directory of Open Access Journals (Sweden)
Nabila eDjafi
2013-08-01
Full Text Available Phosphoinositide-dependent phospholipases C (PI-PLCs are activated in response to various stimuli. They utilize substrates provided by type III-Phosphatidylinositol-4 kinases (PI4KIII to produce inositol triphosphate and diacylglycerol (DAG that is phosphorylated into phosphatidic acid (PA by DAG-kinases (DGKs. The roles of PI4KIIIs, PI-PLCs and DGKs in basal signalling are poorly understood. We investigated the control of gene expression by basal PI-PLC pathway in Arabidopsis thaliana suspension cells. A transcriptome-wide analysis allowed the identification of genes whose expression was altered by edelfosine, 30 µM wortmannin or R59022, inhibitors of PI-PLCs, PI4KIIIs and DGKs, respectively. We found that a gene responsive to one of these molecules is more likely to be similarly regulated by the other two inhibitors. The common action of these agents is to inhibit PA formation, showing that basal PI-PLCs act, in part, on gene expression through their coupling to DGKs. Amongst the genes up-regulated in presence of the inhibitors, were some DREB2 genes, in suspension cells and in seedlings. The DREB2 genes encode transcription factors with major roles in responses to environmental stresses, including dehydration. They bind to C-repeat motifs, known as Drought-Responsive Elements, that are indeed enriched in the promoters of genes up-regulated by PI-PLC pathway inhibitors. PA can also be produced by phospholipases D (PLDs. We show that the DREB2 genes that are up-regulated by PI-PLC inhibitors are positively or negatively regulated, or indifferent, to PLD basal activity. Our data show that the DREB2 genetic pathway is constitutively repressed in resting conditions and that DGK coupled to PI-PLC is active in this process, in suspension cells and seedlings. We discuss how this basal negative regulation of DREB2 genes is compatible with their stress-triggered positive regulation.
Lecuit, Marc; Nelson, D Michael; Smith, Steve D; Khun, Huot; Huerre, Michel; Vacher-Lavenu, Marie-Cécile; Gordon, Jeffrey I; Cossart, Pascale
2004-04-20
Listeria monocytogenes produces severe fetoplacental infections in humans. How it targets and crosses the maternofetal barrier is unknown. We used immunohistochemistry to examine the location of L. monocytogenes in placental and amniotic tissue samples obtained from women with fetoplacental listeriosis. The results raised the possibility that L. monocytogenes crosses the maternofetal barrier through the villous syncytiotrophoblast, with secondary infection occurring via the amniotic epithelium. Because epidemiological studies indicate that the bacterial surface protein, internalin (InlA), may play a role in human fetoplacental listeriosis, we investigated the cellular patterns of expression of its host receptor, E-cadherin, at the maternofetal interface. E-cadherin was found on the basal and apical plasma membranes of syncytiotrophoblasts and in villous cytotrophoblasts. Established trophoblastic cell lines, primary trophoblast cultures, and placental villous explants were each exposed to isogenic InlA+ or InlA- strains of L. monocytogenes, and to L. innocua expressing or not InlA. Quantitative assays of cellular invasion demonstrated that bacterial entry into syncytiotrophoblasts occurs via the apical membrane in an InlA-E-cadherin dependent manner. In human placental villous explants, bacterial invasion of the syncytiotrophoblast barrier and underlying villous tissue and subsequent replication produces histopathological lesions that mimic those seen in placentas of women with listeriosis. Thus, the InlA-E-cadherin interaction that plays a key role in the crossing of the intestinal barrier in humans is also exploited by L. monocytogenes to target and cross the placental barrier. Such a ligand-receptor interaction allowing a pathogen to specifically cross the placental villous trophoblast barrier has not been reported previously.
Directory of Open Access Journals (Sweden)
Joelle K Salazar
Full Text Available Listeria monocytogenes is a foodborne bacterial pathogen and the causative agent of an infectious disease, listeriosis. L. monocytogenes is ubiquitous in nature and has the ability to persist in food processing environments for extended periods of time by forming biofilms and resisting industrial sanitization. Human listeriosis outbreaks are commonly linked to contaminated dairy products, ready-to-eat meats, and in recent years, fresh produce such as lettuce and cantaloupes. We identified a putative Crp/Fnr family transcription factor Lmo0753 that is highly specific to human-associated genetic lineages of L. monocytogenes. Lmo0753 possesses two conserved functional domains similar to the major virulence regulator PrfA in L. monocytogenes. To determine if Lmo0753 is involved in environmental persistence-related mechanisms, we compared lmo0753 deletion mutants with respective wild type and complementation mutants of two fully sequenced L. monocytogenes genetic lineage II strains 10403S and EGDe for the relative ability of growth under different nutrient availability and temperatures, soil survival, biofilm productivity and attachment to select fresh produce surfaces including romaine lettuce leaves and cantaloupe rinds. Our results collectively suggested that Lmo0753 plays an important role in L. monocytogenes biofilm production and attachment to fresh produce, which may contribute to the environmental persistence and recent emergence of this pathogen in human listeriosis outbreaks linked to fresh produce.
Solar irradiance limits the long-term survival of Listeria monocytogenes in seawater.
NicAogáin, K; Magill, D; O'Donoghue, B; Conneely, A; Bennett, C; O'Byrne, C P
2018-03-01
Seafood has often been implicated in outbreaks of food-borne illness caused by Listeria monocytogenes but the source of contamination is usually not known. In this study we investigated the possibility that this pathogen could survive in seawater for an extended time period. Freshly collected seawater samples were inoculated with 1 × 10 8 CFU per ml of L. monocytogenes EGD-e and survival was monitored by plate counting for up to 25 days. When incubated in the dark, either at ambient temperatures (4-14°C) or at 16°C, >10 4 CFU per ml survivors were present after 25 days. However, when the seawater cell suspensions were exposed to ambient light (solar irradiation) and temperatures, L. monocytogenes lost viability rapidly and no survivors could be detected after the 80 h time point. Both UV-A and visible light in the blue region of the spectrum (470 nm) were found to contribute to this effect. The stress inducible sigma factor σ B was found to play a role in survival of L. monocytogenes in seawater. Together these data demonstrate that solar irradiation is a critical determinant of L. monocytogenes survival in marine environments. The data further suggest the possibility of controlling this food-borne pathogen in food-processing environments using visible light. Listeria monocytogenes is a food-borne bacterial pathogen capable of causing the life-threatening infection, listeriosis. In seafood the route of contamination from the environment is often not well understood as this pathogen is not generally thought to survive well in seawater. Here we provide evidence that L. monocytogenes is capable of surviving for long periods of time in seawater when light is excluded. Sunlight is demonstrated to have a significant effect on the survival of this pathogen in seawater, and both visible (470 nm) and UV-A light are shown to contribute to this effect. © 2017 The Society for Applied Microbiology.
Assessment of Listeria monocytogenes virulence in the Galleria mellonella insect larvae model.
Directory of Open Access Journals (Sweden)
Mira Rakic Martinez
Full Text Available Several animal models have been used to understand the molecular basis of the pathogenicity, infectious dose and strain to strain variation of Listeria monocytogenes. The greater wax worm Galleria mellonella, as an alternative model, provides some useful advantages not available with other models and has already been described as suitable for the virulence assessment of various pathogens including L. monocytogenes. The objectives of this study are: 1 confirming the usefulness of this model with a wide panel of Listeria spp. including non-pathogenic L. innocua, L. seeligeri, L. welshimeri and animal pathogen L. ivanovii; 2 assessment of virulence of several isogenic in-frame deletion mutants in virulence and stress related genes of L. monocytogenes and 3 virulence assessment of paired food and clinical isolates of L. monocytogenes from 14 major listeriosis outbreaks occurred worldwide between 1980 and 2015. Larvae injected with different concentrations of Listeria were incubated at 37°C and monitored over seven days for time needed to kill 50% of larvae (LT50 and to determine change of bacterial population in G. mellonella, 2 and 24 hours post-inoculation. Non-pathogenic members of Listeria and L. ivanovii showed significantly (P < 0.05 higher LT50 (lower virulence than the wild type L. monocytogenes strains. Isogenic mutants of L. monocytogenes with the deletions in prfA, plcA, hly, actA and virR genes, also showed significantly (P < 0.05 higher LT50 than the wild type strain at the inoculum of 106CFU/larva. Food isolates had significantly (P < 0.05 lower virulence than the paired clinical isolates, at all three inoculum concentrations. L. monocytogenes strains related to non-invasive (gastroenteritis outbreaks of listeriosis showed significantly (P < 0.05 lower virulence than isolates of the same serotype obtained from outbreaks with invasive symptoms. The difference, however, was dose and strain- dependent. No significant differences in
Directory of Open Access Journals (Sweden)
Wang Y
2017-01-01
Full Text Available Yi Wang,1 Hui Li,1,2 Yan Wang,1 Hua Li,1 Lijuan Luo,1 Jianguo Xu,1 Changyun Ye1 1State Key Laboratory of Infectious Disease Prevention and Control, National Institute for Communicable Disease Control and Prevention, Collaborative Innovation Center for Diagnosis and Treatment of Infectious Diseases, Chinese Center for Disease Control and Prevention, Changping, Beijing, 2Department of Microbiology, GuiZhou Medical University, Guiyang, Guizhou, People’s Republic of China Abstract: Listeria monocytogenes, one of most problematic foodborne pathogens, is responsible for listeriosis in both humans and animals and mainly transmitted through the food chain. In this report, we propose a simple, rapid, and nearly instrument-free molecular technique using multiple cross displacement amplification (MCDA label-based gold nanoparticles lateral flow biosensor (LFB for specific, sensitive, and visual detection of L. monocytogenes. The MCDA-LFB method was carried out at a constant temperature (61°C for only 20 min during the reaction stage, and then the amplification mixtures were directly detected by using LFB, eliminating the use of an electrophoresis instrument, special reagents, or amplicon analysis equipment. The whole procedure, from sample processing to result indicating, was finished within 1 h. The analytical specificity of MCDA-LFB method was successfully determined by distinguishing the target bacterium from other pathogens. The analytical sensitivity of the MCDA-LFB assay was 10 fg of genomic templates per reaction in pure culture, which was in complete accordance with MCDA by gel electrophoresis, real-time turbidity, and colorimetric indicator. The assay was also successfully applied to detecting L. monocytogenes in pork samples. Therefore, the rapidity, simplicity, and nearly equipment-free platform of the MCDA-LFB technique make it possible for food control, clinical diagnosis, and more. The proof-of-concept assay can be reconfigured to detect
Carbon dioxide and nisin act synergistically on Listeria monocytogenes
DEFF Research Database (Denmark)
Nilsson, Lilian; Chen, Y.H.; Chikindas, M.L.
2000-01-01
This paper examines the synergistic action of carbon dioxide and nisin on Listeria monocytogenes Scott A wild-type and nisin-resistant (Nis(r)) cells grown in broth at 4 degrees C. Carbon dioxide extended the lag phase and decreased the specific growth rate of both strains, but to a greater degree...... for cultures in CO2. This synergism between nisin and CO2 was examined mechanistically by following the leakage of carboxyfluorescein (CF) from listerial liposomes. Carbon dioxide enhanced nisin-induced CF leakage, indicating that the synergistic action of CO2 and nisin occurs at the cytoplasmic membrane...
Listeria monocytogenes serotype prevalence and biodiversity in diverse food products.
Hadjilouka, Agni; Andritsos, Nikolaos D; Paramithiotis, Spiros; Mataragas, Marios; Drosinos, Eleftherios H
2014-12-01
The aim of this study was to assess serotype prevalence and biodiversity of Listeria monocytogenes strains isolated from diverse food products, i.e., minced pork, fruits, and vegetables. Three hundred twenty-six samples previously purchased from supermarkets and street markets within the Athens area were studied for L. monocytogenes prevalence. A total of 121 strains were isolated from the 36 samples that were positive for L. monocytogenes. Serotyping was performed with multiplex PCR, and biodiversity was assessed with random amplified polymorphic DNA (RAPD) PCR analysis using M13, UBC155, and HLWL85 as primers and with repetitive element palindromic (rep) PCR analysis using (GTG)5 as the primer. The majority (17 of 22) of the contaminated minced pork samples contained strains identified as serotype 1/2a, either alone or in combination with strains belonging to serotypes 1/2b, 4a, 4c, or 4ab. However, all L. monocytogenes isolates from fruits and vegetables belonged to serotype 4b. Rep-PCR provided better differentiation of the isolates than did RAPD PCR and resulted in discrimination of the isolates into a larger number of unique profiles. Complete differentiation was achieved only with the combination of these subtyping techniques.
Directory of Open Access Journals (Sweden)
Bahador
2015-08-01
Full Text Available Background Listeria monocytogenes is a foodborne pathogen and a serious threat to the public health in the world. Consumption of traditional foods such as dairy and meat products can be a major reason for relative abundance and isolation of these bacteria. Objectives The purpose of this study was to determine the phenotypic and genotypic characteristics of L. monocytogenes strains isolated from dairy and meat products. Materials and Methods A total of 317 dairy products and meat-processed samples were collected. Antibiotic susceptibility test was performed on each sample by the disk diffusion method (Kirby Bauer. Five reference loci were used for typing of L. monocytogenes strains by MLVA (Multiple Locus VNTR Analysis Technique. Results A total of 24 L. monocytogenes isolates were collected from the dairy and meat products. Resistance of isolated L. monocytogenes strains to penicillin G were 54.54% (from dairy products and 46.15% (from processed meat. Genetic relatedness of isolates were assessed by MLVA. Out of 13 different types, type 2 with 6 strains and type 3 with 4 strains, were the most common types. Conclusions MLVA analysis showed that samples obtained from different sources could have similar genetic profile. As a result, administration of penicillin in patients with listeriosis (especially pregnant women and antibiotic susceptibility test are recommended. The fast and accurate methods such as MLVA for tracking of pollution sources of L. monocytogenes are recommended during outbreaks.
Jovanović, Gordana D; Klaus, Anita S; Nikšić, Miomir P
2016-01-01
The antibacterial activity of chitosan coatings prepared with acetic or lactic acid, as well as of composite chitosan-gelatin films prepared with essential oils, was evaluated in fresh shredded black radish samples inoculated with Listeria monocytogenes ATCC 19115 and L. monocytogenes ATCC 19112 during seven days of storage at 4°C. The chitosan coating prepared with acetic acid showed the most effective antibacterial activity. All tested formulations of chitosan films exhibited strong antimicrobial activity on the growth of L. monocytogenes on black radish, although a higher inhibition of pathogens was achieved at higher concentrations of chitosan. The antimicrobial effect of chitosan films was even more pronounced with the addition of essential oils. Chitosan-gelatin films with thyme essential oils showed the most effective antimicrobial activity. A reduction of 2.4log10CFU/g for L. monocytogenes ATCC 19115 and 2.1log10CFU/g for L. monocytogenes ATCC 19112 was achieved in the presence of 1% chitosan film containing 0.2% of thyme essential oil after 24h of storage. Copyright © 2016 Asociación Argentina de Microbiología. Publicado por Elsevier España, S.L.U. All rights reserved.
Evaluation of the Thermo Scientific SureTect Listeria monocytogenes Assay.
Cloke, Jonathan; Leon-Velarde, Carlos; Larson, Nathan; Dave, Keron; Evans, Katharine; Crabtree, David; Hughes, Annette; Hopper, Craig; Simpson, Helen; Withey, Sophie; Oleksiuk, Milena; Holopainen, Jani; Wickstrand, Nina; Kauppinen, Mikko
2014-01-01
The Thermo Scientific SureTect Listeria monocytogenes Assay is a new real-time PCR assay for the detection of Listeria monocytogenes in food and environmental samples. This assay was validated using the AOAC Research Institute (AOAC-RI) Performance Tested Methods program in comparison to the reference method detailed in International Organization for Standardization 11290-1:1996, including Amendment 1:2004 with the following foods and food contact surfaces: smoked salmon, processed cheese, fresh bagged spinach, fresh cantaloupe, cooked prawns (chilled product), cooked sliced turkey meat (chilled product), ice cream, pork frankfurters, salami, ground raw beef meat (12% fat), plastic, and stainless steel. All matrixes were tested by Thermo Fisher Scientific, Microbiology Division, Basingstoke, UK. In addition, three matrixes (pork frankfurters, bagged lettuce, and stainless steel) were analyzed independently as part of the AOAC-RI controlled laboratory study by the University of Guelph, Canada. Using probability of detection (POD) statistical analysis, a significant difference was demonstrated between the candidate and reference methods for salami, cooked sliced turkey and ice cream in favor of the SureTect assay. For all other matrixes, no significant difference by POD was seen between the two methods during the study. Inclusivity and exclusivity testing was also conducted with 53 and 30 isolates, respectively, which demonstrated that the SureTect assay was able to detect all serotypes of L. monocytogenes. None of the exclusivity isolates analyzed were detected by the SureTect assay. Ruggedness testing was conducted to evaluate the performance of the assay with specific method deviations outside the recommended parameters open to variation, i.e., enrichment time and temperature and lysis temperature, which demonstrated that the assay gave reliable performance. Accelerated stability testing was also conducted, validating the assay shelf life.
Modeling the growth of Listeria monocytogenes in mold-ripened cheeses.
Lobacz, Adriana; Kowalik, Jaroslaw; Tarczynska, Anna
2013-06-01
This study presents possible applications of predictive microbiology to model the safety of mold-ripened cheeses with respect to bacteria of the species Listeria monocytogenes during (1) the ripening of Camembert cheese, (2) cold storage of Camembert cheese at temperatures ranging from 3 to 15°C, and (3) cold storage of blue cheese at temperatures ranging from 3 to 15°C. The primary models used in this study, such as the Baranyi model and modified Gompertz function, were fitted to growth curves. The Baranyi model yielded the most accurate goodness of fit and the growth rates generated by this model were used for secondary modeling (Ratkowsky simple square root and polynomial models). The polynomial model more accurately predicted the influence of temperature on the growth rate, reaching the adjusted coefficients of multiple determination 0.97 and 0.92 for Camembert and blue cheese, respectively. The observed growth rates of L. monocytogenes in mold-ripened cheeses were compared with simulations run with the Pathogen Modeling Program (PMP 7.0, USDA, Wyndmoor, PA) and ComBase Predictor (Institute of Food Research, Norwich, UK). However, the latter predictions proved to be consistently overestimated and contained a significant error level. In addition, a validation process using independent data generated in dairy products from the ComBase database (www.combase.cc) was performed. In conclusion, it was found that L. monocytogenes grows much faster in Camembert than in blue cheese. Both the Baranyi and Gompertz models described this phenomenon accurately, although the Baranyi model contained a smaller error. Secondary modeling and further validation of the generated models highlighted the issue of usability and applicability of predictive models in the food processing industry by elaborating models targeted at a specific product or a group of similar products. Copyright © 2013 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Constantinides, Alexander; Kappelle, Paul J.W.H.; Lambert, Gilles; Dullaart, Robin P. F.
Background and Aims. Lipoprotein-associated phospholipase A(2) (Lp-PLA(2)) is a proatherogenic phospholipase A(2), which is predominantly complexed to low-density lipoprotein (LDL) particles. Proprotein convertase subtilisin-kexin type 9 (PCSK9) provides a key step in LDL metabolism by stimulating
Phospholipases A2 in ocular homeostasis and diseases
DEFF Research Database (Denmark)
Wang, Jinmei; Kolko, Miriam; Kolko, Miriam
2010-01-01
Phospholipases A(2) (PLA(2)s) and its generation of second messengers play an important role in signal transduction, cell proliferation, cell survival and gene expression. At low concentrations mediators of PLA(2) activity have a variety of physiological effects whereas high levels of PLA(2) and ...
Gelbícová, T; Karpísková, R
2012-04-01
Evaluation of the incidence and characteristics of L. monocytogenes in samples of raw cow's milk collected on farms (bulk tank milk samples) and from vending machines. Detection of L. monocytogenes and enumeration were carried out according to EN/ISO 11290--1, 2. Strains were characterised by serotyping and macrorestriction analysis using pulsed-field gel electrophoresis. The presence of L. monocytogenes was detected in 3,2 % (11/346) of bulk tank milk samples and 1,8 % (4/219) samples of raw cow's milk from vending machines. Findings of L. monocytogenes in raw milk were sporadic. Only on one farm strains of L. monocytogenes were detected repeatedly. Thirteen strains of L. monocytogenes belonged to serotype 1/2a, two strains to serotype 1/2b and one to serotype 4b. Macrorestriction analysis revealed considerable heterogeinity of profiles, with nine different pulsotypes being detected. Pulsotype 711 was the most frequent. This pulsotype was found on three different farms. The incidence of L. monocytogenes in raw cow's milk is relatively low in the Czech Republic. The results confirmed that some clones of L. monocytogenes from raw milk are identical with food and human strains.
Directory of Open Access Journals (Sweden)
GN Gómez
2012-01-01
Full Text Available Snake venoms are rich sources of active proteins that have been employed in the diagnosis and treatment of health disorders and antivenom therapy. Developing countries demand fast economical downstream processes for the purification of this biomolecule type without requiring sophisticated equipment. We developed an alternative, simple and easy to scale-up method, able to purify simultaneously protease and phospholipase A2 toxins from Bothrops alternatus venom. It comprises a multiple-step partition procedure with polyethylene-glycol/phosphate aqueous two-phase systems followed by a gel filtration chromatographic step. Two single bands in SDS-polyacrylamide gel electrophoresis and increased proteolytic and phospholipase A2 specific activities evidence the homogeneity of the isolated proteins.
Simmons, Courtenay; Stasiewicz, Matthew J; Wright, Emily; Warchocki, Steven; Roof, Sherry; Kause, Janell R; Bauer, Nathan; Ibrahim, Salam; Wiedmann, Martin; Oliver, Haley F
2014-11-01
Postprocessing contamination in processing plants has historically been a significant source of Listeria monocytogenes in ready-to-eat delicatessen meats, and therefore a major cause of human listeriosis cases and outbreaks. Recent risk assessments suggest that a majority of human listeriosis cases linked to consumption of contaminated deli meats may be due to L. monocytogenes contamination that occurs at the retail level. To better understand the ecology and transmission of Listeria spp. in retail delicatessens, food and nonfood contact surfaces were tested for L. monocytogenes and other Listeria spp. in a longitudinal study conducted in 30 retail delis in three U.S. states. In phase I of the study, seven sponge samples were collected monthly for 3 months in 15 delis (5 delis per state) prior to start of daily operation; in phase II, 28 food contact and nonfood contact sites were sampled in each of 30 delis during daily operation for 6 months. Among the 314 samples collected during phase I, 6.8% were positive for L. monocytogenes. Among 4,503 samples collected during phase II, 9.5% were positive for L. monocytogenes; 9 of 30 delis showed low L. monocytogenes prevalence (Listeria spp. isolates, including 184 Listeria innocua, 48 Listeria seeligeri, and 13 Listeria welshimeri were characterized. Pulsed-field gel electrophoresis (PFGE) was used to characterize 446 L. monocytogenes isolates. PFGE showed that for 12 of 30 delis, one or more PFGE types were isolated on at least three separate occasions, providing evidence for persistence of a given L. monocytogenes subtype in the delis. For some delis, PFGE patterns for isolates from nonfood contact surfaces were distinct from patterns for occasional food contact surface isolates, suggesting limited cross-contamination between these sites in some delis. This study provides longitudinal data on L. monocytogenes contamination patterns in retail delis, which should facilitate further development of control strategies in
Directory of Open Access Journals (Sweden)
Wang Jun
2010-03-01
Full Text Available Abstract Background Ecological, biochemical and genetic resemblance as well as clear differences of virulence between L. monocytogenes and L. innocua make this bacterial clade attractive as a model to examine evolution of pathogenicity. This study was attempted to examine the population structure of L. innocua and the microevolution in the L. innocua-L. monocytogenes clade via profiling of 37 internalin genes and multilocus sequence typing based on the sequences of 9 unlinked genes gyrB, sigB, dapE, hisJ, ribC, purM, gap, tuf and betL. Results L. innocua was genetically monophyletic compared to L. monocytogenes, and comprised four subgroups. Subgroups A and B correlated with internalin types 1 and 3 (except the strain 0063 belonging to subgroup C and internalin types 2 and 4 respectively. The majority of L. innocua strains belonged to these two subgroups. Subgroup A harbored a whole set of L. monocytogenes-L. innocua common and L. innocua-specific internalin genes, and displayed higher recombination rates than those of subgroup B, including the relative frequency of occurrence of recombination versus mutation (ρ/θ and the relative effect of recombination versus point mutation (r/m. Subgroup A also exhibited a significantly smaller exterior/interior branch length ratio than expected under the coalescent model, suggesting a recent expansion of its population size. The phylogram based on the analysis with correction for recombination revealed that the time to the most recent common ancestor (TMRCA of L. innocua subgroups A and B were similar. Additionally, subgroup D, which correlated with internalin type 5, branched off from the other three subgroups. All L. innocua strains lacked seventeen virulence genes found in L. monocytogenes (except for the subgroup D strain L43 harboring inlJ and two subgroup B strains bearing bsh and were nonpathogenic to mice. Conclusions L. innocua represents a young species descending from L. monocytogenes and
Chen, Jianshun; Chen, Fan; Cheng, Changyong; Fang, Weihuan
2013-04-01
Arginine deiminase and agmatine deiminase systems are involved in acid tolerance, and their encoding genes form the cluster lmo0036-0043 in Listeria monocytogenes. While lmo0042 and lmo0043 were conserved in all L. monocytogenes strains, the lmo0036-0041 region of this cluster was identified in all lineages I and II, and the majority of lineage IV (83.3%) strains, but absent in all lineage III and a small fraction of lineage IV (16.7%) strains, suggesting that the presence of the complete lmo0036-0043 cluster is dependent on lineages. lmo0036-0043-complete and -deficient lineage IV strains exhibit specific ascB-dapE profiles, which might represent two subpopulations with distinct genetic characteristics.
LACTIC FLORA-LISTERIA MONOCYTOGENES INTERACTION
Directory of Open Access Journals (Sweden)
S. Colombo
2012-08-01
Full Text Available The EC Regulation 2073/2005 (1 requires that food processors evaluate the capability of ready-to-use (RTE products to support the development of Listeria monocytogenes when their pH and aW values are favourable to the growth of this microorganism. It is renown that the lactic flora plays an important role in many different foods, both from a technological and a food safety standpoint. This study was aimed to observe the behaviour and the potential anti-Listeria effect of some natural lactic flora present in Italian liver patè crostini (chicken heart and liver, anchovies, onions, capers, starch, no added preservatives through the Combase Predictor – Max Growth Rate predictive software. The natural lactic flora of the crostini demonstrated a variable capability to inhibit the growth of Listeria monocytogenes which depends upon : the concentration of the lactic flora at the beginning of the shelf life period and the subsequent lag phase, the possible release of anti-Listeria substances, and the maximum growth rate.
Evidence for the presence of phospholipase A1 in Saccharomyces cerevisiae
International Nuclear Information System (INIS)
Watanabe, Yasuo; Murakami, Masako; Takakuwa, Masayoshi
1983-01-01
The cause of the autolysis of pressed Baker's yeast was examined. Softened pressed yeast cells (Saccharomyces cerevisiae), after about 10 days of storage at 30 deg C, was subjected to a series of extraction: the extraction with acetone was made to the supernatant after the centrifugation of the water-suspended yeast cell at 1000 x g for 10 min, and the obtained precipitation was mechanically (with a Potter teflon homogenizer) homogenized. After removing the residues by centrifugation, the protein was salted out with ammonium sulfate up to 0.6 saturation. An enzyme, phospholipase A 1 was thus obtained from the softened yeast cells. The activity of the enzyme thus obtained was assayed using L-α-phosphatidylethanolamine as the substrate. It was previously found that 14 C-labelled free fatty acids liberated from phosphatidylcholine (PC) accumulated in the softened yeast packed cake. The enzyme was identified as phospholipase A 1 having the optimal pH at around 8. Another evidence, obtained previously, together with the present finding suggest that the softening of the pressed Baker's yeast may be caused by the degradation of phospholipid by the combined action of phospholipase A 1 and lysophospholipase L 2 . (Yamashita, S.)
Hydrolysis of short-chain phosphatidylcholines by bee venom phospholipase A2.
Raykova, D; Blagoev, B
1986-01-01
In order to find out the aggregation state of the substrate, preferred by bee venom phospholipase A2 (EC 3.1.1.4), its action on short-chain phosphatidylcholines with two identical (C6-C10) fatty acids has been tested. The rate of hydrolysis as a function of acyl chain length showed a maximum at dioctanoylphosphatidylcholine. The effects of alcohols, NaCl and Triton X-100, which affect the aggregation state of phospholipids in water, were also studied. The addition of n-alcohol led to a significant inhibition of the hydrolysis of the substrates present in micellar form and activated the hydrolysis of substrates which form liposomes. The inhibitory effect increased with increasing length of the aliphatic carbon chain of the alcohol. Triton X-100 at low Triton/phospholipid molar ratios enhanced enzyme activity. These results do not agree with the accepted idea that bee venom phospholipase A2 hydrolyzes short-chain lecithins in their molecularly dispersed form and that micelles cannot act as substrates. The data indicate that short-chain lecithins in the aggregated state are hydrolyzed and that the requirements of bee venom phospholipase A2 for the aggregation state of the substrate are not strict.
Inactivation of Listeria monocytogenes in milk by pulsed electric field.
Reina, L D; Jin, Z T; Zhang, Q H; Yousef, A E
1998-09-01
Pasteurized whole, 2%, and skim milk were inoculated with Listeria monocytogenes Scott A and treated with high-voltage pulsed electric field (PEF). The effects of milk composition (fat content) and PEF parameters (electric field strength, treatment time, and treatment temperature) on the inactivation of the bacterium were studied. No significant differences were observed in the inactivation of L. monocytogenes Scott A in three types of milk by PEF treatment. With treatment at 25 degrees C, 1- to 3-log reductions of L. monocytogenes were observed. PEF lethal effect was a function of field strength and treatment time. Higher field strength or longer treatment time resulted in a greater reduction of viable cells. A 4-log reduction of the bacterium was obtained by increasing the treatment temperature to 50 degrees C. Results indicate that the use of a high-voltage PEF is a promising technology for inactivation of foodborne pathogens.
Secretory Phospholipase A(2)-IIA and Cardiovascular Disease
Holmes, Michael V.; Simon, Tabassome; Exeter, Holly J.; Folkersen, Lasse; Asselbergs, Folkert W.; Guardiola, Montse; Cooper, Jackie A.; Palmen, Jutta; Hubacek, Jaroslav A.; Carruthers, Kathryn F.; Horne, Benjamin D.; Brunisholz, Kimberly D.; Mega, Jessica L.; Van Iperen, Erik P. A.; Li, Mingyao; Leusink, Maarten; Trompet, Stella; Verschuren, Jeffrey J. W.; Hovingh, G. Kees; Dehghan, Abbas; Nelson, Christopher P.; Kotti, Salma; Danchin, Nicolas; Scholz, Markus; Haase, Christiane L.; Rothenbacher, Dietrich; Swerdlow, Daniel I.; Kuchenbaecker, Karoline B.; Staines-Urias, Eleonora; Goel, Anuj; van 't Hooft, Ferdinand; Gertow, Karl; de Faire, Ulf; Panayiotou, Andrie G.; Tremoli, Elena; Baldassarre, Damiano; Veglia, Fabrizio; Holdt, Lesca M.; Beutner, Frank; Gansevoort, Ron T.; Navis, Gerjan J.; Mateo Leach, Irene; Breitling, Lutz P.; Brenner, Hermann; Thiery, Joachim; Dallmeier, Dhayana; Franco-Cereceda, Anders; Boer, Jolanda M. A.; Stephens, Jeffrey W.; Hofker, Marten H.; Tedgui, Alain; Hofman, Albert; Uitterlinden, Andre G.; Adamkova, Vera; Pitha, Jan; Onland-Moret, N. Charlotte; Cramer, Maarten J.; Nathoe, Hendrik M.; Spiering, Wilko; Klungel, Olaf H.; Kumari, Meena; Whincup, Peter H.; Morrow, David A.; Braund, Peter S.; Hall, Alistair S.; Olsson, Anders G.; Doevendans, Pieter A.; Trip, Mieke D.; Tobin, Martin D.; Hamsten, Anders; Watkins, Hugh; Koenig, Wolfgang; Nicolaides, Andrew N.; Teupser, Daniel; Day, Ian N. M.; Carlquist, John F.; Gaunt, Tom R.; Ford, Ian; Sattar, Naveed; Tsimikas, Sotirios; Schwartz, Gregory G.; Lawlor, Debbie A.; Morris, Richard W.; Sandhu, Manjinder S.; Poledne, Rudolf; Maitland-van der Zee, Anke H.; Khaw, Kay-Tee; Keating, Brendan J.; van der Harst, Pim; Price, Jackie F.; Mehta, Shamir R.; Yusuf, Salim; Witteman, Jaqueline C. M.; Franco, Oscar H.; Jukema, J. Wouter; de Knijff, Peter; Tybjaerg-Hansen, Anne; Rader, Daniel J.; Farrall, Martin; Samani, Nilesh J.; Kivimaki, Mika; Fox, Keith A. A.; Humphries, Steve E.; Anderson, Jeffrey L.; Boekholdt, S. Matthijs; Palmer, Tom M.; Eriksson, Per; Pare, Guillaume; Hingorani, Aroon D.; Sabatine, Marc S.; Mallat, Ziad; Casas, Juan P.; Talmud, Philippa J.
2013-01-01
Objectives This study sought to investigate the role of secretory phospholipase A(2) (sPLA(2))-IIA in cardiovascular disease. Background Higher circulating levels of sPLA(2)-IIA mass or sPLA(2) enzyme activity have been associated with increased risk of cardiovascular events. However, it is not
Listeria monocytogenes inhibition by defatted mustard meal-based edible films.
Lee, Hahn-Bit; Noh, Bong Soo; Min, Sea C
2012-02-01
An antimicrobial edible film was developed from defatted mustard meal (Sinapis alba) (DMM), a byproduct from the bio-fuel industry, without incorporating external antimicrobials and its antimicrobial activity against Listeria monocytogenes and physical properties were investigated. The DMM colloidal solution consisting of 184 g water, 14 g DMM, and 2g glycerol was homogenized and incubated at 37°C for 0.2, 0.5, 24 or 48 h to prepare a film-forming solution. The pH of a portion of the film-forming solution (pH 5.5) was adjusted to 2.0 or 4.0. Films were formed by drying the film-forming solutions at 23°C for 48 h. The film-forming solution incubated for 48 h inhibited L. monocytogenes in broth and on agar media. Antimicrobial effects of the film prepared from the 48 h-incubated solution increased with decrease in pH of the solution from 5.5 to 2.0. The film from the film forming solution incubated for 48 h (pH 2.0) initially inhibited more than 4.0 log CFU/g of L. monocytogenes inoculated on film-coated salmon. The film-coating retarded the growth of L. monocytogenes in smoked salmon at 5, 10, and 15°C and the antimicrobial effect during storage was more noticeable when the coating was applied before inoculation than when it was applied after inoculation. The tensile strength, percentage elongation, solubility in watercxu, and water vapor permeability of the anti microbial film were 2.44 ± 0.19 MPa, 6.40 ± 1.13%, 3.19 ± 0.90%, and 3.18 ± 0.63 gmm/kPa hm(2), respectively. The antimicrobial DMM films have demonstrated a potential to be applied to foods as wraps or coatings to control the growth of L. monocytogenes. Copyright © 2011 Elsevier B.V. All rights reserved.
Andritsos, Nikolaos D; Mataragas, Marios; Paramithiotis, Spiros; Drosinos, Eleftherios H
2013-12-01
Listeria monocytogenes poses a serious threat to public health, and the majority of cases of human listeriosis are associated with contaminated food. Reliable microbiological testing is needed for effective pathogen control by food industry and competent authorities. The aims of this work were to estimate the prevalence and concentration of L. monocytogenes in minced pork meat by the application of a Bayesian modeling approach, and also to determine the performance of three culture media commonly used for detecting L. monocytogenes in foods from a deterministic and stochastic perspective. Samples (n = 100) collected from local markets were tested for L. monocytogenes using in parallel the PALCAM, ALOA and RAPID'L.mono selective media according to ISO 11290-1:1996 and 11290-2:1998 methods. Presence of the pathogen was confirmed by conducting biochemical and molecular tests. Independent experiments (n = 10) for model validation purposes were performed. Performance attributes were calculated from the presence-absence microbiological test results by combining the results obtained from the culture media and confirmative tests. Dirichlet distribution, the multivariate expression of a Beta distribution, was used to analyze the performance data from a stochastic perspective. No L. monocytogenes was enumerated by direct-plating (media were best at ruling in L. monocytogenes presence than ruling it out. Sensitivity and specificity varied depending on the culture-dependent method. None of the culture media was perfect in detecting L. monocytogenes in minced pork meat alone. The use of at least two culture media in parallel enhanced the efficiency of L. monocytogenes detection. Bayesian modeling may reduce the time needed to draw conclusions regarding L. monocytogenes presence and the uncertainty of the results obtained. Furthermore, the problem of observing zero counts may be overcome by applying Bayesian analysis, making the determination of a test performance feasible
Cholesterol regulates HERG K+ channel activation by increasing phospholipase C β1 expression.
Chun, Yoon Sun; Oh, Hyun Geun; Park, Myoung Kyu; Cho, Hana; Chung, Sungkwon
2013-01-01
Human ether-a-go-go-related gene (HERG) K(+) channel underlies the rapidly activating delayed rectifier K(+) conductance (IKr) during normal cardiac repolarization. Also, it may regulate excitability in many neuronal cells. Recently, we showed that enrichment of cell membrane with cholesterol inhibits HERG channels by reducing the levels of phosphatidylinositol 4,5-bisphosphate [PtdIns(4,5)P2] due to the activation of phospholipase C (PLC). In this study, we further explored the effect of cholesterol enrichment on HERG channel kinetics. When membrane cholesterol level was mildly increased in human embryonic kidney (HEK) 293 cells expressing HERG channel, the inactivation and deactivation kinetics of HERG current were not affected, but the activation rate was significantly decelerated at all voltages tested. The application of PtdIns(4,5)P2 or inhibitor for PLC prevented the effect of cholesterol enrichment, while the presence of antibody against PtdIns(4,5)P2 in pipette solution mimicked the effect of cholesterol enrichment. These results indicate that the effect of cholesterol enrichment on HERG channel is due to the depletion of PtdIns(4,5)P2. We also found that cholesterol enrichment significantly increases the expression of β1 and β3 isoforms of PLC (PLCβ1, PLCβ3) in the membrane. Since the effects of cholesterol enrichment on HERG channel were prevented by inhibiting transcription or by inhibiting PLCβ1 expression, we conclude that increased PLCβ1 expression leads to the deceleration of HERG channel activation rate via downregulation of PtdIns(4,5)P2. These results confirm a crosstalk between two plasma membrane-enriched lipids, cholesterol and PtdIns(4,5)P2, in the regulation of HERG channels.
Ben Bacha, Abir; Abid, Islem
2013-03-01
The best known physiologic function of secreted phospholipase A2 (sPLA2) group IIA (sPLA2-IIA) is defense against bacterial infection through hydrolytic degradation of bacterial membrane phospholipids. In fact, sPLA2-IIA effectively kills Gram-positive bacteria and to a lesser extent Gram-negative bacteria and is considered a major component of the eye's innate immune defense system. The antibacterial properties of sPLA2 have been demonstrated in rabbit and human tears. In this report, we have analyzed the bactericidal activity of dromedary tears and the subsequently purified sPLA2 on several Gram-positive bacteria. Our results showed that the sPLA2 displays a potent bactericidal activity against all the tested bacteria particularly against the Staphylococcus strains when tested in the ionic environment of tears. There is a synergic action of the sPLA2 with lysozyme when added to the bacteria culture prior to sPLA2. Interestingly, lysozyme purified from dromedary tears showed a significant bactericidal activity against Listeria monocytogene and Staphylococcus epidermidis, whereas the one purified from human tears displayed no activity against these two strains. We have also demonstrated that Ca(2+) is crucial for the activity of dromedary tear sPLA2 and to a less extent Mg(2+) ions. Given the presence of sPLA2 in tears and intestinal secretions, this enzyme may play a substantial role in innate mucosal and systemic bactericidal defenses against Gram-positive bacteria.
Evaluation of a monoclonal antibody able to detect live Listeria monocytogenes and Listeria innocua
DEFF Research Database (Denmark)
Sølve, Marianne; Boel, Jeppe; Nørrung, Birgit
2000-01-01
A monoclonal Listeria antibody, designated B4, was evaluated. The ability of the antibody to bind to viable bacteria belonging to Listeria spp, compared to bacteria of the same species killed by beat treatment, acid or base treatment, sanitizers, and irradiation was examined. The antibody was found...... to react with viable L. monocytogenes and L. innocua, but not with heat-killed (72 degrees C, 5 min) strains of these organisms. When L. monocytogenes and L. innocua were killed by methods other than heat treatment, it was ambiguous whether the antibody detected the organism or not. It was concluded...... that the B4 antibody has potential to be used in an immune capture step to capture live L, monocytogenes and L. innocua from foods prior to identification of L. monocytogenes by polymerase chain reaction (PCR)....
Chollet, F; Perret, B P; Chap, H; Douste-Blazy, L
1986-02-12
Human HDL3 (d 1.125-1.21 g/ml) were treated by an exogenous phospholipase A2 from Crotalus adamenteus in the presence of albumin. Phosphatidylcholine hydrolysis ranged between 30 and 90% and the reisolated particle was essentially devoid of lipolysis products. (1) An exchange of free cholesterol was recorded between radiolabelled erythrocytes at 5-10% haematocrit and HDL3 (0.6 mM total cholesterol) from 0 to 12-15 h. Isotopic equilibration was reached. Kinetic analysis of the data indicated a constant rate of free cholesterol exchange of 13.0 microM/h with a half-time of equilibration around 3 h. Very similar values of cholesterol exchange, specific radioactivities and kinetic parameters were measured when phospholipase-treated HDL replaced control HDL. (2) The lecithin: cholesterol acyltransferase reactivity of HDL3, containing different amounts of phosphatidylcholine, as achieved by various degrees of phospholipase A2 treatment, was measured using a crude preparation of lecithin: cholesterol acyltransferase (the d 1.21-1.25 g/ml plasma fraction). The rate of esterification was determined between 0 and 12 h. Following a 15-30% lipolysis, the lecithin: cholesterol acyltransferase reactivity of HDL3 was reduced about 30-40%, and then continued to decrease, though more slowly, as the phospholipid content was further lowered in the particle. (3) The addition of the lecithin: cholesterol acyltransferase preparation into an incubation medium made of labelled erythrocytes and HDL3 promoted a movement of radioactive cholesterol out of cells, above the values of exchange, and an accumulation of cholesteryl esters in HDL. This reflected a mass consumption of free cholesterol, from both the cellular and the lipoprotein compartments upon the lecithin: cholesterol acyltransferase action. As a consequence of a decreased reactivity, phospholipase-treated HDL (with 2/3 of phosphatidylcholine hydrolyzed) proved much less effective in the lecithin: cholesterol acyltransferase
Listeria monocytogenes : nog steeds een probleem?
Beumer, R.R.
2011-01-01
Listeria monocytogenes is net als vele andere bacteriële voedselpathogenen al tientallen jaren bekend. De meeste grondstoffen voor voedingsmiddelen komen uit de akker- en tuinbouw, de veehouderij en de visserij. Besmetting vindt daar plaats met micro-organismen afkomstig uit grond, fecaliën, water,
Hwang, Cheng-An; Sheen, Shiowshuh
2011-05-01
This study examined the growth characteristics of Listeria monocytogenes as affected by a native microflora in cooked ham at refrigerated and abuse temperatures. A five-strain mixture of L. monocytogenes and a native microflora, consisting of Brochothrix spp., isolated from cooked meat were inoculated alone (monocultured) or co-inoculated (co-cultured) onto cooked ham slices. The growth characteristics, lag phase duration (LPD, h), growth rate (GR, log(10) cfu/h), and maximum population density (MPD, log(10) cfu/g), of L. monocytogenes and the native microflora in vacuum-packed ham slices stored at 4, 6, 8, 10, and 12 °C for up to 5 weeks were determined. At 4-12 °C, the LPDs of co-cultured L. monocytogenes were not significantly different from those of monocultured L. monocytogenes in ham, indicating the LPDs of L. monocytogenes at 4-12 °C were not influenced by the presence of the native microflora. At 4-8 °C, the GRs of co-cultured L. monocytogenes (0.0114-0.0130 log(10) cfu/h) were statistically but marginally lower than those of monocultured L. monocytogenes (0.0132-0.0145 log(10) cfu/h), indicating the GRs of L. monocytogenes at 4-8 °C were reduced by the presence of the native microflora. The GRs of L. monocytogenes were reduced by 8-7% with the presence of the native microflora at 4-8 °C, whereas there was less influence of the native microflora on the GRs of L. monocytogenes at 10 and 12 °C. The MPDs of L. monocytogenes at 4-8 °C were also reduced by the presence of the native microflora. Data from this study provide additional information regarding the growth suppression of L. monocytogenes by the native microflora for assessing the survival and growth of L. monocytogenes in ready-to-eat meat products. Published by Elsevier Ltd.
Lianou, Alexandra; Sofos, John N
2007-09-01
Contamination of ready-to-eat products with Listeria monocytogenes may occur at several stages before consumption. Accessibility to the public and relatively limited control interventions at retail and food service establishments (compared with the processing sector of the food industry) and the lack of a specific regulatory framework increase the likelihood of introduction of this pathogen into some foods in these establishments. This review is a compilation of available information on the incidence and transmission of L. monocytogenes through ready-to-eat products at the retail and food service level. The potential transmission of L. monocytogenes within retail and food service operations has been indicated in epidemiological investigations and by survey data. Potential sources of the organism in these operations include the environment, food handlers, and incoming raw ingredients or processed products that have become contaminated after the lethality treatment at the manufacturing facility. L. monocytogenes may be present at retail and food service establishments in various ready-to-eat products, both prepackaged and those packaged in the store, and occasionally at high concentrations. This issue dictates the need for development and application of effective control measures, and potential control approaches are discussed here. Good manufacturing practices, appropriate cleaning, sanitation and hygiene programs, and temperature control required for prevention or inhibition of growth of the pathogen to high levels are critical for control of L. monocytogenes in the retail and food service sector. A comprehensive food safety system designed to be functional in retail and food service operations and based on the philosophy of hazard analysis and critical control point systems and a series of sound prerequisite programs can provide effective control of L. monocytogenes in these environments. However, competent delivery of food safety education and training to retail
Gamma irradiation as a means to eliminate Listeria monocytogenes from frozen chicken meat
International Nuclear Information System (INIS)
Kamat, A.S.; Nair, M.P.
1995-01-01
Cells of Listeria monocytogenes ATCC 35152 were sensitive to gamma irradiation in phosphate buffer, pH 7.00 (D 10 , dose required for 10% survival—0.15 kGy) at 0–5°C. The cells showed higher radiation survival when irradiated under frozen condition, with a D 10 of 0.3 kGy. The protection offered by shrimp/chicken/kheema homogenates (100 g litre−1) was evidenced by even higher D 10 values (0.5 kGy) at both 0–5°C and cryogenic temperature. Boneless chicken meat samples were artificially inoculated with L monocytogenes ATCC 35152 cells at low (5 × 10 3 ) colony-forming unit (cfu) g −1 and high (5 × 10 6 cfu g −1 ) concentrations and irradiated at 1, 3, 4, 6 kGy doses under cryogenic conditions. The efficacy of the radiation process was evaluated by detecting L monocytogenes during storage at 2–4°C in the irradiated samples. These studies, when repeated with three other serotypes of L monocytogenes, clearly suggested the need for a dose of 3 kGy for elimination of 10 3 cfu cells of L monocytogenes g −1 from air-packed frozen chicken meat. (author)
How Listeria monocytogenes organizes its surface for virulence
Carvalho, Filipe; Sousa, Sandra; Cabanes, Didier
2014-01-01
Listeria monocytogenes is a Gram-positive pathogen responsible for the manifestation of human listeriosis, an opportunistic foodborne disease with an associated high mortality rate. The key to the pathogenesis of listeriosis is the capacity of this bacterium to trigger its internalization by non-phagocytic cells and to survive and even replicate within phagocytes. The arsenal of virulence proteins deployed by L. monocytogenes to successfully promote the invasion and infection of host cells has been progressively unveiled over the past decades. A large majority of them is located at the cell envelope, which provides an interface for the establishment of close interactions between these bacterial factors and their host targets. Along the multistep pathways carrying these virulence proteins from the inner side of the cytoplasmic membrane to their cell envelope destination, a multiplicity of auxiliary proteins must act on the immature polypeptides to ensure that they not only maturate into fully functional effectors but also are placed or guided to their correct position in the bacterial surface. As the major scaffold for surface proteins, the cell wall and its metabolism are critical elements in listerial virulence. Conversely, the crucial physical support and protection provided by this structure make it an ideal target for the host immune system. Therefore, mechanisms involving fine modifications of cell envelope components are activated by L. monocytogenes to render it less recognizable by the innate immunity sensors or more resistant to the activity of antimicrobial effectors. This review provides a state-of-the-art compilation of the mechanisms used by L. monocytogenes to organize its surface for virulence, with special focus on those proteins that work “behind the frontline”, either supporting virulence effectors or ensuring the survival of the bacterium within its host. PMID:24809022
Kurokawa, Tatsuki; Takasuga, Shunsuke; Sakata, Souhei; Yamaguchi, Shinji; Horie, Shigeo; Homma, Koichi J; Sasaki, Takehiko; Okamura, Yasushi
2012-06-19
Voltage-sensing phosphatases (VSPs) consist of a voltage-sensor domain and a cytoplasmic region with remarkable sequence similarity to phosphatase and tensin homolog deleted on chromosome 10 (PTEN), a tumor suppressor phosphatase. VSPs dephosphorylate the 5' position of the inositol ring of both phosphatidylinositol 3,4,5-trisphosphate [PI(3,4,5)P(3)] and phosphatidylinositol 4,5-bisphosphate [PI(4,5)P(2)] upon voltage depolarization. However, it is unclear whether VSPs also have 3' phosphatase activity. To gain insights into this question, we performed in vitro assays of phosphatase activities of Ciona intestinalis VSP (Ci-VSP) and transmembrane phosphatase with tensin homology (TPTE) and PTEN homologous inositol lipid phosphatase (TPIP; one human ortholog of VSP) with radiolabeled PI(3,4,5)P(3). TLC assay showed that the 3' phosphate of PI(3,4,5)P(3) was not dephosphorylated, whereas that of phosphatidylinositol 3,4-bisphosphate [PI(3,4)P(2)] was removed by VSPs. Monitoring of PI(3,4)P(2) levels with the pleckstrin homology (PH) domain from tandem PH domain-containing protein (TAPP1) fused with GFP (PH(TAPP1)-GFP) by confocal microscopy in amphibian oocytes showed an increase of fluorescence intensity during depolarization to 0 mV, consistent with 5' phosphatase activity of VSP toward PI(3,4,5)P(3). However, depolarization to 60 mV showed a transient increase of GFP fluorescence followed by a decrease, indicating that, after PI(3,4,5)P(3) is dephosphorylated at the 5' position, PI(3,4)P(2) is then dephosphorylated at the 3' position. These results suggest that substrate specificity of the VSP changes with membrane potential.
Encefalitis del tallo cerebral y mielitis por Listeria monocytogenes
Directory of Open Access Journals (Sweden)
Aracelly Castro
2013-09-01
Full Text Available La romboencefalitis por Listeria monocytogenes es una presentación poco común de la listeriosis del sistema nervioso central; sin embargo, es la presentación más común en personas inmunocompetentes. Aun más rara es la combinación de romboencefalitis con mielitis causada por L. monocytogenes; no obstante, en este artículo se reporta un caso de encefalitis del tallo y mielitis grave en un paciente sin compromiso del sistema inmunitario. Se presenta un paciente de 21 años de edad, sin deficiencias del sistema inmunitario, que consumió productos lácteos no pasteurizados y, posteriormente, presentó un cuadro de cefalea, vómito, deterioro de su estado general y, finalmente, alteración del estado de conciencia y muerte. Consultó al Instituto Neurológico de Colombia y se hizo diagnóstico de encefalitis del tallo y mielitis por L. monocytogenes. Se discuten las diferencias entre el caso presentado y los reportados en la literatura científica. Ante un paciente con signos de compromiso del tallo cerebral, de posible origen infeccioso, es prudente iniciar tratamiento antibiótico para L. monocytogenes y, en caso de poca respuesta, escalar rápidamente en dicho tratamiento. También lo es extender el estudio radiológico hacia la columna vertebral, con el fin de descartar compromiso de la médula espinal. doi: http://dx.doi.org/10.7705/biomedica.v33i3.1482
Wan, J; Harmark, K; Davidson, B E; Hillier, A J; Gordon, J B; Wilcock, A; Hickey, M W; Coventry, M J
1997-03-01
The effect of bacteriocin, piscicolin 126, on the growth of Listeria monocytogenes and cheese starter bacteria was investigated in milk and in Camembert cheese manufactured from milk challenged with 10(2) cfu ml(-1) L. monocytogenes. In milk incubated at 30 degrees C, piscicolin 126 added in the range of 512-2,048 AU ml(-1) effectively inhibited growth of L. monocytogenes for more than 20 d when challenged with approximately 10(2) cfu ml(-1) L. monocytogenes. At higher challenge levels (10(4) and 10(6) cfu ml(-1)), piscicolin 126 reduced the viable count of L. monocytogenes by 4-5 log units immediately after addition of the bacteriocin; however, growth of Listeria occurred within 24 h. The minimum inhibitory concentration (MIC) of piscicolin 126 against lactic acid cheese starter bacteria was generally greater than 204,800 AU ml(-1) , and the viable count and acid production of these starter cultures in milk were not affected by the addition of 2,048 AU ml(-1) piscicolin 126. Camembert cheeses made from milk challenged with L. monocytogenes and with added piscicolin 126 showed a viable count of L. monocytogenes 3-4 log units lower than those without piscicolin 126. Inactivation of piscicolin 126 by proteolytic enzymes from cheese starter bacteria and mould together with the emergence of piscicolin 126-resistant isolates was responsible for the recovery of L. monocytogenes in the cheeses during ripening.
Occurrence and antimicrobial resistance patterns of Listeria monocytogenes isolated from vegetables
Byrne,Vanessa de Vasconcelos; Hofer,Ernesto; Vallim,Deyse Christina; Almeida,Rogeria Comastri de Castro
2016-01-01
Abstract Although the consumption of fresh and minimally processed vegetables is considered healthy, outbreaks related to the contamination of these products are frequently reported. Among the food-borne pathogens that contaminate vegetables is Listeria monocytogenes, a ubiquitous organism that exhibits the ability to survive and multiply at refrigerated temperatures. This study aimed to evaluate the occurrence of L. monocytogenes in vegetables as well as the antimicrobial resistance of isola...
Listeria monocytogenes Infection in Hairy Cell Leukemia: A Case Report and Literature Review
Directory of Open Access Journals (Sweden)
James C. Barton
2018-01-01
Full Text Available Listeria monocytogenes infections have been described in patients with diverse types of malignancy, especially leukemia. We report the case of a 65-year-old man with previously untreated hairy cell leukemia characterized by CD5 positivity and trisomy 12 (3% of blood lymphocytes who developed bacteremia due to L. monocytogenes serotype 1/2b. We summarize clinical features and treatment of this patient and five previously reported patients with hairy cell leukemia who also had L. monocytogenes infections. All six patients were men. Their mean age at infection diagnosis was 70 y. Three men had undergone splenectomy 4–11 y before they developed L. monocytogenes infection. The central nervous system was the primary site of infection in four men. Bacteremia alone occurred in two other men. At diagnosis of infection, one man was receiving antileukemia chemotherapy and another man was receiving treatment for Kaposi’s sarcoma. Two other patients had other comorbid conditions. All six men recovered from their infections.
Ceylan, Erdogan; McMahon, Wendy; Garren, Donna M
2017-09-01
Thermal inactivation of Listeria monocytogenes and Salmonella was evaluated on peas, spinach, broccoli, potatoes, and carrots that were treated with hot water and steam. One gram-positive bacterium, L. monocytogenes, and one gram-negative bacterium, Salmonella, were selected as pertinent human pathogens for evaluation. Samples were inoculated with a composite of five strains each of L. monocytogenes and Salmonella to achieve approximately 10 8 to 10 9 CFU/g. Inoculated samples were treated with hot water at 85 and 87.8°C and with steam at 85 and 96.7°C for up to 3.5 min. A greater than 5-log reduction of L. monocytogenes and Salmonella was achieved on all products within 0.5 min by hot water blanching at 85 and 87.8°C. Steam blanching at 85°C reduced Salmonella populations by greater than 5 log on spinach and peas within 2 min and on carrots and broccoli within 3.5 min. Populations of Salmonella were reduced by more than 5 log within 1 min on carrot, spinach, and broccoli and within 2 min on peas by steam blanching at 96.7°C. Steam blanching at 85°C reduced L. monocytogenes populations by more than 5 log on carrots and spinach within 2 min and on broccoli and peas within 3.5 min. L. monocytogenes populations were reduced more than 5 log within 1 min on carrot, spinach, peas and broccoli by steam blanching at 96.7°C. Longer treatment times and higher temperatures were required for steam-blanched samples than for samples blanched with hot water. Results suggest that hot water and steam blanching practices commonly used by the frozen vegetable industry will achieve the desired 5-log lethality of L. monocytogenes and Salmonella and will enhance microbiological safety prior to freezing.
Listeria spp., y L. monocytogenes EN LECHE CRUDA DE CABRA
Directory of Open Access Journals (Sweden)
Yolanda Albarracín C
2008-08-01
Full Text Available Objective. To test non-pasteurized goat’s milk from the village of ‘la Garita’, Northern Santander, for Listeria monocytogenes. Material and methods. 90 samples of non-pasteurized goat’s milk were obtained over a 4 month period; pH and temperature of each sample were measured. The INVIMA technique was used to isolate L. monocytogenes; the species was confirmed by PCR. Results. The study showed that eight goat milk providers of the zone neither had refrigeration nor pasteurized the milk. The prevalence of L. monocytogenes was 3%; 15% of the samples had other species of Listeria. The milk obtained from this zone contained the pathogen that may cause listeriosis in children less than 5 years of age, pregnant women, adults and immunologically compromised patients. Conclusions. This study shows the occurrence of this pathogen in goat’s milk and identified areas of risk for those people who drink goat’s milk.
[Analysis of antibiotic susceptibility of foodborne Listeria monocytogenes in China].
Yang, Yang; Fu, Ping; Guo, Yunchang; Liu, Xiurmei
2008-03-01
To study the antibiotic susceptibility of foodborne Listeria monocytogenes in China. The susceptibilities of 476 strains of foodborne Listeria monocytogenes to antibiotics were determined in Broth Microdilution Susceptibility Testing in Clinical and Laboratory Standards Institute. The antibiotics of gentamicin, ampicillin, penicillin, tetracycline, doxycycline, imipenem, erythromycin, ciprofloxacin, levofloxacin, cephalothin, rifampin, vancomycin, chloramphenicol, Trimethoprim-sulfamethoxazole, ampicillin-sulbactam were used. The rates of antibiotic resistance in 467 is olates were 4.5%. Tetracycline resistance was most prevalent, accouting for 4.07% . The foods that the rates of antibiotic resistance were highest were vegetable (10%). Among 14 provinces, Jilin, Hubei and Hebei were the third top, the rate of which were 19.6% and 9.1% and 8%, respectively. It was suggested that antibiotic resistance exists in foodborne Listeria monocytogenes to a certain extent in China. It should pay more attention to the use of drugs in prevention and clinic treatment to reduce the antibiotic resistant strains.
Silver as antibacterial towards Listeria monocytogenes
Directory of Open Access Journals (Sweden)
Simone eBelluco
2016-03-01
Full Text Available Listeria monocytogenes is a serious foodborne pathogen that can contaminate food during processing and can grow during food shelf-life. New types of safe and effective food contact materials embedding antimicrobial agents, like silver, can play an important role in the food industry. The present work aimed at evaluating the in vitro growth kinetics of different strains of L. monocytogenes in the presence of silver, both in its ionic and nano form. The antimicrobial effect was determined by assaying the number of culturable bacterial cells, which formed colonies after incubation in the presence of silver nanoparticles (AgNPs or silver nitrate (AgNO3. Ionic release experiments were performed in parallel. A different reduction of bacterial viability between silver ionic and nano forms was observed, with a time delayed effect exerted by AgNPs. An association between antimicrobial activity and ions concentration was shown by both silver chemical forms, suggesting the major role of ions in the antimicrobial mode of action.
REALIS: Postgenomic Analysis of Listeria Monocytogenes
Directory of Open Access Journals (Sweden)
The REALIS Consortium
2006-04-01
Full Text Available Listeria monocytogenes is a remarkably successful food-borne pathogen. It is capable a of surviving and proliferating under conditions that exist within the food chain, such as at low temperatures, high salt and low pH and b of colonizing animal host tissues after ingestion of contaminated food, causing opportunistic infections mainly, but not exclusively, in immunocompromised hosts. The ultimate goals of REALIS are two fold: Firstly, it aims to completely decipher all genes required for survival in and adaptation of Listeria monocytogenes to two very different environments, ie., the infected host and the external environment. Secondly, using genomics and postgenomic tools, REALIS seeks to precisely address fundamental questions regarding evolutionary relationships between pathogenic and non-pathogenic Listeria and to define qualities of particularly successful clonal pathovariants in causing disease. This project will provide both industry and health care managers with rational approaches to curbing food-borne contamination, minimising risks of infection and providing novel pharmacological approaches for halting the fulminant course of infection.
Directory of Open Access Journals (Sweden)
Yanxia Jia
Full Text Available Senescence is the last phase of the plant life cycle and has an important role in plant development. Degradation of membrane lipids is an essential process during leaf senescence. Several studies have reported fundamental changes in membrane lipids and phospholipase D (PLD activity as leaves senesce. Suppression of phospholipase Dα1 (PLDα1 retards abscisic acid (ABA-promoted senescence. However, given the absence of studies that have profiled changes in the compositions of membrane lipid molecules during leaf senescence, there is no direct evidence that PLD affects lipid composition during the process. Here, we show that application of n-butanol, an inhibitor of PLD, and N-Acylethanolamine (NAE 12∶0, a specific inhibitor of PLDα1, retarded ABA-promoted senescence to different extents. Furthermore, phospholipase Dδ (PLDδ was induced in leaves treated with ABA, and suppression of PLDδ retarded ABA-promoted senescence in Arabidopsis. Lipid profiling revealed that detachment-induced senescence had different effects on plastidic and extraplastidic lipids. The accelerated degradation of plastidic lipids during ABA-induced senescence in wild-type plants was attenuated in PLDδ-knockout (PLDδ-KO plants. Dramatic increases in phosphatidic acid (PA and decreases in phosphatidylcholine (PC during ABA-induced senescence were also suppressed in PLDδ-KO plants. Our results suggest that PLDδ-mediated hydrolysis of PC to PA plays a positive role in ABA-promoted senescence. The attenuation of PA formation resulting from suppression of PLDδ blocks the degradation of membrane lipids, which retards ABA-promoted senescence.
Puri, Madhu; La Pietra, Luigi; Mraheil, Mobarak Abu; Lucas, Rudolf; Chakraborty, Trinad; Pillich, Helena
2017-09-05
Autophagy, a well-established defense mechanism, enables the elimination of intracellular pathogens including Listeria monocytogenes . Host cell recognition results in ubiquitination of L . monocytogenes and interaction with autophagy adaptors p62/SQSTM1 and NDP52, which target bacteria to autophagosomes by binding to microtubule-associated protein 1 light chain 3 (LC3). Although studies have indicated that L . monocytogenes induces autophagy, the significance of this process in the infectious cycle and the mechanisms involved remain poorly understood. Here, we examined the role of the autophagy adaptor optineurin (OPTN), the phosphorylation of which by the TANK binding kinase 1 (TBK1) enhances its affinity for LC3 and promotes autophagosomal degradation, during L . monocytogenes infection. In LC3- and OPTN-depleted host cells, intracellular replicating L . monocytogenes increased, an effect not seen with a mutant lacking the pore-forming toxin listeriolysin O (LLO). LLO induced the production of OPTN. In host cells expressing an inactive TBK1, bacterial replication was also inhibited. Our studies have uncovered an OPTN-dependent pathway in which L . monocytogenes uses LLO to restrict bacterial growth. Hence, manipulation of autophagy by L . monocytogenes , either through induction or evasion, represents a key event in its intracellular life style and could lead to either cytosolic growth or persistence in intracellular vacuolar structures.
Quereda, Juan J; Meza-Torres, Jazmín; Cossart, Pascale; Pizarro-Cerdá, Javier
2017-07-04
Listeria monocytogenes is a Gram-positive food-borne pathogen that in humans may traverse the intestinal, placental and blood/brain barriers, causing gastroenteritis, abortions and meningitis. Crossing of these barriers is dependent on the bacterial ability to enter host cells, and several L. monocytogenes surface and secreted virulence factors are known to facilitate entry and the intracellular lifecycle. The study of L. monocytogenes strains associated to human listeriosis epidemics has revealed the presence of novel virulence factors. One such factor is Listeriolysin S, a thiazole/oxazole modified microcin that displays bactericidal activity and modifies the host microbiota during infection. Our recent results therefore highlight the interaction of L. monocytogenes with gut microbes as a crucial step in epidemic listeriosis. In this article, we will discuss novel implications for this family of toxins in the pathogenesis of diverse medically relevant microorganisms.
PRÉVALENCE DE LISTERIA MONOCYTOGENES DANS LE LAIT CRU DE VACHE AU LIBAN NORD
Directory of Open Access Journals (Sweden)
Imad al Kassaa
2016-06-01
Full Text Available Al Kassaa Imad, Khaled el Omari, Marwa Saati, Bachar Ismail and Monzer Hamze. 2016. Prevalence of Listeria monocytogenes in raw cow milk in north Lebanon. Lebanese Science Journal, 17(1: 39-45. Listeriosis, although a zoonosis, is an invasive disease that can affect newborns, pregnant women and immunocompromised adults. Clinical manifestations can be expressed by febrile gastroenteritis, invasive forms including severe sepsis, meningitis, rhombencephalitis, prenatal infections and abortions. Species of Listeria bacteria are ubiquitous and adaptable to the environment in animal and plant foods. This study aimed to determine the prevalence of Listeria monocytogenes in 100 samples of fresh cow milk collected from different areas of North Lebanon. Listeria monocytogenes was detected by using the Grand VIDAS technique (Biomérieux France. The results obtained revealed the absence of Listeria monocytogenes in all analyzed samples.
The presence of Listeria monocytogenes on the surfaces of equipment and workers' hands during different production stages, as well as on fish skin and meat during processing and storage of cold-smoked trout, was investigated. Listeria monocytogenes was recovered from 10 (6.06%) of a total 165 cotto...
Directory of Open Access Journals (Sweden)
Shahin Gaini
2015-01-01
Full Text Available A 51-year-old Caucasian woman with Listeria monocytogenes meningitis was treated and discharged after an uncomplicated course. Her medical history included immunosuppressive treatment with prednisolone and azathioprine for autoimmune hepatitis. A diagnostic work-up after the meningitis episode revealed that she had low levels of the IgG4 subclass. To our knowledge, this is the first case report describing a possible association between autoimmune hepatitis and the occurrence of Listeria monocytogenes meningitis, describing a possible association between Listeria monocytogenes meningitis and deficiency of the IgG4 subclass and finally describing a possible association between Listeria monocytogenes meningitis and immunosuppressive therapy with prednisolone and azathioprine.
DEFF Research Database (Denmark)
Gaini, Shahin
2015-01-01
A 51-year-old Caucasian woman with Listeria monocytogenes meningitis was treated and discharged after an uncomplicated course. Her medical history included immunosuppressive treatment with prednisolone and azathioprine for autoimmune hepatitis. A diagnostic work-up after the meningitis episode...... revealed that she had low levels of the IgG4 subclass. To our knowledge, this is the first case report describing a possible association between autoimmune hepatitis and the occurrence of Listeria monocytogenes meningitis, describing a possible association between Listeria monocytogenes meningitis...... and deficiency of the IgG4 subclass and finally describing a possible association between Listeria monocytogenes meningitis and immunosuppressive therapy with prednisolone and azathioprine....
Inactivation of Listeria monocytogenes in raw fruits by enterocin AS-48.
Molinos, Antonio Cobo; Abriouel, Hikmate; Ben Omar, Nabil; Lucas, Rosario; Valdivia, Eva; Gálvez, Antonio
2008-12-01
The purpose of this study was to determine the effect of enterocin AS-48 on Listeria monocytogenes CECT 4032 in fruits and fruit juice. Fruits were contaminated with a L. monocytogenes cell suspension, washed with enterocin AS-48 (25 microg/ml) or with sterile distilled water as control, and stored at different temperatures (-20, 6, 15, 22 degrees C). Washing treatments significantly inhibited or completely inactivated L. monocytogenes in strawberries, raspberries, and blackberries stored at 15 and 22 degrees C for up to 2 days and in blackberries and strawberries at 6 degrees C for up to 7 days. Washing treatments with enterocin AS-48 also reduced viable counts in sliced melon, watermelon, pear, and kiwi but did not avoid proliferation of survivors during storage at 15 and 22 degrees C. Added enterocin (25 microg/ml) completely inactivated L. monocytogenes in watermelon juice within 24 h. To enhance the antilisterial activity of treatments, enterocin AS-48 was tested in combination with other antimicrobial substances on sliced melon stored at 22 degrees C. The combinations of enterocin AS-48 and trisodium trimetaphosphate, sodium lactate, lactic acid, polyphosphoric acid, carvacrol, hydrocinnamic acid, p-hydroxybenzoic acid, n-propyl p-hydroxybenzoate, or 2-nitropropanol showed increased antilisterial activities compared with each antimicrobial tested separately. Washing treatments with enterocin AS-48 in combination with 12 mM carvacrol, as well as with 100 mM n-propyl p-hydroxybenzoate, avoided regrowth of Listeria during storage at 22 degrees C. Results from this study indicate that enterocin AS-48 alone or in combination with other preservatives could serve as an additional hurdle against L. monocytogenes in fruits and fruit juices.
Stevia rebaudiana Bertoni effect on the hemolytic potential of Listeria monocytogenes.
Sansano, S; Rivas, A; Pina-Pérez, M C; Martinez, A; Rodrigo, D
2017-06-05
The effect of Stevia rebaudiana Bertoni on the hemolytic potential of Listeria monocytogenes was studied by means of the assessment of the Listeriolysin O (LLO) production. The three factors under study, stevia concentration in the range [0-2.5] % (w/v), incubation temperature (10 and 37°C), and exposure time (0-65h) significantly affected (p≤0.05) the hemolytic activity of L. monocytogenes. Results showed that at the lower incubation temperature the hemolytic potential of the bacterium was significantly reduced, from 100% at 37°C to 8% at 10°C (after 65h of incubation) in unsupplemented substrate (0% stevia). Irrespective of the temperature, 10 or 37°C, supplementation of the medium with stevia at 2.5 % (w/v) reduced the bacterium's hemolytic activity by a maximum of 100%. Furthermore, the time of exposure to 2.5 % (w/v) stevia concentration was also a significant factor reducing the hemolytic capability of L. monocytogenes. The possibility of reducing the pathogenic potential of L. monocytogenes (hemolysis) by exposure to stevia should be confirmed in real food matrices, opening a research niche with a valuable future impact on food safety. Copyright © 2017 Elsevier B.V. All rights reserved.
The virulence regulator PrfA promotes biofilm formation by Listeria monocytogenes.
Lemon, Katherine P; Freitag, Nancy E; Kolter, Roberto
2010-08-01
Listeria monocytogenes is a food-borne facultative intracellular pathogen. It is widespread in the environment and has several distinct life-styles. The key transcriptional activator PrfA positively regulates L. monocytogenes virulence genes to mediate the transition from extracellular, flagellum-propelled cell to intracellular pathogen. Here we report the first evidence that PrfA also has a significant positive impact on extracellular biofilm formation. Mutants lacking prfA were defective in surface-adhered biofilm formation. The DeltaprfA mutant exhibited wild-type flagellar motility, and its biofilm defect occurred after initial surface adhesion. We also observed that mutations that led to the constitutive expression of PrfA-dependent virulence genes had a minimal impact on biofilm formation. Furthermore, biofilm development was enhanced in a mutant encoding a PrfA protein variant unable to fully transition from the extracellular form to the virulent, intracellular activity conformation. These results indicate that PrfA positively regulates biofilm formation and suggest that PrfA has a global role in modulating the life-style of L. monocytogenes. The requirement of PrfA for optimal biofilm formation may provide selective pressure to maintain this critical virulence regulator when L. monocytogenes is outside host cells in the environment.
Directory of Open Access Journals (Sweden)
Patricia Hingston
Full Text Available The human pathogen Listeria monocytogenes continues to pose a challenge in the food industry, where it is known to contaminate ready-to-eat foods and grow during refrigerated storage. Increased knowledge of the cold-stress response of this pathogen will enhance the ability to control it in the food-supply-chain. This study utilized strand-specific RNA sequencing and whole cell fatty acid (FA profiling to characterize the bacterium's cold stress response. RNA and FAs were extracted from a cold-tolerant strain at five time points between early lag phase and late stationary-phase, both at 4°C and 20°C. Overall, more genes (1.3× were suppressed than induced at 4°C. Late stationary-phase cells exhibited the greatest number (n = 1,431 and magnitude (>1,000-fold of differentially expressed genes (>2-fold, p<0.05 in response to cold. A core set of 22 genes was upregulated at all growth phases, including nine genes required for branched-chain fatty acid (BCFA synthesis, the osmolyte transporter genes opuCBCD, and the internalin A and D genes. Genes suppressed at 4°C were largely associated with cobalamin (B12 biosynthesis or the production/export of cell wall components. Antisense transcription accounted for up to 1.6% of total mapped reads with higher levels (2.5× observed at 4°C than 20°C. The greatest number of upregulated antisense transcripts at 4°C occurred in early lag phase, however, at both temperatures, antisense expression levels were highest in late stationary-phase cells. Cold-induced FA membrane changes included a 15% increase in the proportion of BCFAs and a 15% transient increase in unsaturated FAs between lag and exponential phase. These increases probably reduced the membrane phase transition temperature until optimal levels of BCFAs could be produced. Collectively, this research provides new information regarding cold-induced membrane composition changes in L. monocytogenes, the growth-phase dependency of its cold
Directory of Open Access Journals (Sweden)
Analía L. Laciar
2000-03-01
Full Text Available Central nervous system infections caused by Listeria monocytogenes produce a wide range of clinical symptoms which include cerebral abscesses, meningitis and nonmeningitic parenchymal cerebritis. A case study is presented of early listeriosis with signs of meningitis accompanied with septicemia and complicated with severe hydrocephalus.As infecções do sistema nervoso central produzidas por Listeria monocytogenes provocam una grande variedade de sintomas clínicos que incluem abscessos cerebrais, meningites e cerebrites parenquimáticas não meningíticas. Apresenta-se um caso de listeriose precoce com sinais de meningite acompanhada de septicemia e agravado com hidrocefalia grave.
El Sayed Zaki, Maysaa; El Shabrawy, Walaa Othman; El-Eshmawy, Mervat M; Aly Eletreby, Shahera
2011-09-01
Spontaneous bacterial peritonitis (SBP) is a potentially lethal complication of cirrhosis. It is probably the most characteristic infectious complication of cirrhosis. The aim of this study was to evaluate the bacterial and fungal causes of SBP in Egyptian population. Furthermore to predict the occurrence of rare pathogen like Listeria monocytogenes in those patients. The study included 100 patients with end stage liver disease associated with ascites. Patients were suspected to have SBP. The ascitic fluids were subjected to full cytological and microbiological study. The peritoneal fluid cytological study revealed that 50 samples had cell counts >250 cells/mm(3). 37 samples had growth and 13 samples had no growth (CNNA). The distribution of isolated pathogens was Gram positive cocci 48.8% followed by L. monocytogenes 24.4%, Gram negative bacilli 12.2% and Mycobacterium tuberculosis 7.3. The cells counts associated with listeria culture were 475 cells/mm(3) with sensitivity 70% and specificity 68%. The study highlights the prevalence of microorganisms in Egyptian patients with liver cirrhosis associated with ascites. It reflects the occurrence of L. monocytogenes as an important pathogen of such clinical situation. Other rare pathogens like M. tuberculosis are not uncommon in those patients. Copyright © 2011 King Saud Bin Abdulaziz University for Health Sciences. Published by Elsevier Ltd. All rights reserved.
Regulation of connexin43 gap junctional communication by phosphatidylinositol 4,5-bisphosphate
van Zeijl, Leonie; Ponsioen, Bas; Giepmans, Ben N G; Ariaens, Aafke; Postma, Friso R; Várnai, Péter; Balla, Tamas; Divecha, Nullin; Jalink, Kees; Moolenaar, Wouter H
2007-01-01
Cell-cell communication through connexin43 (Cx43)-based gap junction channels is rapidly inhibited upon activation of various G protein coupled receptors; however, the mechanism is unknown. We show that Cx43-based cell-cell communication is inhibited by depletion of phosphatidylinositol
Rieu, A; Guzzo, J; Piveteau, P
2010-02-01
To investigate how the survival of Listeria monocytogenes on parsley leaves may affect its ability to sustain process-related harsh conditions and its virulence. Parsley seedlings were spot inoculated with stationary phase cells of L. monocytogenes EGD-e and incubated for 15 days. Each day, bacterial cells were harvested and enumerated, and their ability to survive acetic acid challenge (90 min, pH 4.0), to colonize abiotic surfaces and to grow as biofilms was assessed. After a 3-log decrease over the first 48 h, the population stabilized to about 10(6) CFU g(-1) until the sixth day. After the sixth day, L. monocytogenes was no longer detected, even after specific enrichment. Incubation on parsley leaves affected the ability of L. monocytogenes to survive acetic acid challenge (90 min, pH 4.0) and to adhere to stainless steel although the ability to grow as biofilm was preserved. To further investigate these physiological alterations, the mRNA levels of six target genes (bsh, clpC, groEL, inlA, opuC, prfA) was quantified using reverse transcription qPCR after 5 h of incubation on parsley leaves. A decrease was observed in all but one (bsh) target, including groEL and clpC which are involved in resistance to salt and acid. Moreover, the decrease in the levels of inlA, prfA and opuC transcripts after incubation on parsley suggested a repression of some genes involved in pathogenicity. In vitro assessment of mammalian cell adherence and invasion using Caco-2 cells confirmed the repression of the virulence factor InlA; however, the virulence potential in vivo in the chick embryo model was not affected. Listeria monocytogenes did undergo rapid changes to adapt its physiology to the phyllosphere. This study highlights the physiological changes undergone by L. monocytogenes during/after survival on parsley leaves.
Directory of Open Access Journals (Sweden)
Valeria Braga
Full Text Available ABSTRACT The aim of this work was to study the prevalence of Listeria monocytogenes in foods obtained in retail shops and food industries located in Montevideo-Uruguay, and to identify the serogroups of the obtained isolates. Three-thousand one-hundred and seventy-five food samples (frozen, deli meats, ready-to-eat and cheese were analyzed. The obtained isolates were serogrouped by multiplex PCR and serotyped by conventional procedure. Genetic comparisons were performed using pulsed-field gel electrophoresis on a sub-set of isolates belonging to the same serotype successively recovered from the same establishment. L. monocytogenes was isolated from 11.2% of samples. The highest prevalence was observed in frozen foods (38%, followed by cheese (10%. 1/2b and 4b were the most frequently identified serotypes. In six of 236 analyzed establishments we successively recovered L. monocytogenes isolates belonging to the same serotype. Most of them corresponded to serotype 1/2b. Pulsed-field gel electrophoresis profiles suggest that at least 33% of L. monocytogenes 1/2b isolates are genetically related and that may remain viable for prolonged periods. The observed prevalence of L. monocytogenes was lower than reported in neighboring countries. Our findings highlight the role that frozen foods may play in the spread of this pathogen, and the relevance of serotypes 1/2b and 4b.
Directory of Open Access Journals (Sweden)
Élen Silveira Nalério
2009-09-01
Full Text Available Listeria monocytogenes é uma bactéria patogênica que se tornou um grande desafio para as indústrias de alimentos, entre elas a de frangos, assim como para os órgãos de vigilância sanitária. Apesar da produção de frangos estar em expansão na região sul do Rio Grande do Sul, não há relatos sobre esse patógeno, dessa forma, objetivou-se avaliar a prevalência de L. monocytogenes e de seus sorotipos nos diversos segmentos dessa cadeia produtiva. Nos aviários isolou-se L. monocytogenes em 2,9% (1/35 das amostras de swabs cloacais, não se isolando o microrganismo em amostras provenientes das camas de aviários. No abatedouro, 11,7% (15/128 das amostras apresentaram contaminação por L. monocytogenes e nos frangos resfriados procedentes do comércio, a prevalência foi de 33,3% (15/45.Observou-se que 51,6% (16/31 das cepas de L. monocytogenes pertenciam ao sorotipo 1/2b; 22,5% (7/31 ao sorotipo 4e; 16,1% (5/31 ao sorotipo 1/2a; 6,4% (2/31 ao sorotipo 4b; e 3,2% (1/31 ao sorotipo 1/2c. Há disseminação de L. monocytogenes na cadeia produtiva de frangos da região sul do Rio Grande do Sul e a presença de sorotipos prevalentes em casos/surtos de listeriose traz preocupação à saúde pública.Listeria monocytogenes is a pathogenic bacterium which has become a huge challenge to the food industries, including the poultry industry, and to the health surveillance agencies. Although poultry production is in expansion in southern of Rio Grande do Sul, Brazil, there are not reports about this pathogen thus this study aimed at assessing the prevalence of L monocytogenes and its serotypes in the several segments of this productive chain. In the broilers flocks L. monocytogenes were isolated in 2.9% (1/35 from cloacal swabs samples. This microorganism was not isolated from broiler houses samples. In the abattoir, 11% of the samples presented L. monocytogenes contamination, and in the chilled chicken from retailers its prevalence was 33.3% (15
Harter, Eva; Wagner, Eva Maria; Zaiser, Andreas; Halecker, Sabrina; Wagner, Martin; Rychli, Kathrin
2017-08-15
The foodborne pathogen Listeria monocytogenes is able to survive a variety of stress conditions leading to the colonization of different niches like the food processing environment. This study focuses on the hypervariable genetic hot spot lmo0443 to lmo0449 haboring three inserts: the stress survival islet 1 (SSI-1), the single-gene insert LMOf2365_0481 , and two homologous genes of the nonpathogenic species Listeria innocua : lin0464 , coding for a putative transcriptional regulator, and lin0465 , encoding an intracellular PfpI protease. Our prevalence study revealed a different distribution of the inserts between human and food-associated isolates. The lin0464-lin0465 insert was predominantly found in food-associated strains of sequence type 121 (ST121). Functional characterization of this insert showed that the putative PfpI protease Lin0465 is involved in alkaline and oxidative stress responses but not in acidic, gastric, heat, cold, osmotic, and antibiotic stresses. In parallel, deletion of lin0464 decreased survival under alkaline and oxidative stresses. The expression of both genes increased significantly under oxidative stress conditions independently of the alternative sigma factor σ B Furthermore, we showed that the expression of the protease gene lin0465 is regulated by the transcription factor lin0464 under stress conditions, suggesting that lin0464 and lin0465 form a functional unit. In conclusion, we identified a novel stress survival islet 2 (SSI-2), predominantly present in L. monocytogenes ST121 strains, beneficial for survival under alkaline and oxidative stresses, potentially supporting adaptation and persistence of L. monocytogenes in food processing environments. IMPORTANCE Listeria monocytogenes strains of ST121 are known to persist for months and even years in food processing environments, thereby increasing the risk of food contamination and listeriosis. However, the molecular mechanism underlying this remarkable niche-specific adaptation
Directory of Open Access Journals (Sweden)
Vanessa Danielle Muller
Full Text Available The Flaviviridae family includes several virus pathogens associated with human diseases worldwide. Within this family, Dengue virus is the most serious threat to public health, especially in tropical and sub-tropical regions of the world. Currently, there are no vaccines or specific antiviral drugs against Dengue virus or against most of the viruses of this family. Therefore, the development of vaccines and the discovery of therapeutic compounds against the medically most important flaviviruses remain a global public health priority. We previously showed that phospholipase A2 isolated from the venom of Crotalus durissus terrificus was able to inhibit Dengue virus and Yellow fever virus infection in Vero cells. Here, we present evidence that phospholipase A2 has a direct effect on Dengue virus particles, inducing a partial exposure of genomic RNA, which strongly suggests inhibition via the cleavage of glycerophospholipids at the virus lipid bilayer envelope. This cleavage might induce a disruption of the lipid bilayer that causes a destabilization of the E proteins on the virus surface, resulting in inactivation. We show by computational analysis that phospholipase A2 might gain access to the Dengue virus lipid bilayer through the pores found on each of the twenty 3-fold vertices of the E protein shell on the virus surface. In addition, phospholipase A2 is able to inactivate other enveloped viruses, highlighting its potential as a natural product lead for developing broad-spectrum antiviral drugs.
Paudyal, Ranju; Barnes, Ruth H; Karatzas, Kimon Andreas G
2018-02-01
Here it is demonstrated a novel approach in disinfection regimes where specific molecular acid resistance systems are inhibited aiming to eliminate microorganisms under acidic conditions. Despite the importance of the Glutamate Decarboxylase (GAD) system for survival of Listeria monocytogenes and other pathogens under acidic conditions, its potential inhibition by specific compounds that could lead to its elimination from foods or food preparation premises has not been studied. The effects of maleic acid on the acid resistance of L. monocytogenes were investigated and found that it has a higher antimicrobial activity under acidic conditions than other organic acids, while this could not be explained by its pKa or Ka values. The effects were found to be more pronounced on strains with higher GAD activity. Maleic acid affected the extracellular GABA levels while it did not affect the intracellular ones. Maleic acid had a major impact mainly on GadD2 activity as also shown in cell lysates. Furthermore, it was demonstrated that maleic acid is able to partly remove biofilms of L. monocytogenes. Maleic acid is able to inhibit the GAD of L. monocytogenes significantly enhancing its sensitivity to acidic conditions and together with its ability to remove biofilms, make a good candidate for disinfection regimes. Copyright © 2017 Elsevier Ltd. All rights reserved.
Bres, Vanessa; Yang, Hua; Hsu, Ernie; Ren, Yan; Cheng, Ying; Wisniewski, Michele; Hanhan, Maesa; Zaslavsky, Polina; Noll, Nathan; Weaver, Brett; Campbell, Paul; Reshatoff, Michael; Becker, Michael
2014-01-01
The Atlas Listeria monocytogenes LmG2 Detection Assay, developed by Roka Bioscience Inc., was compared to a reference culture method for seven food types (hot dogs, cured ham, deli turkey, chicken salad, vanilla ice cream, frozen chocolate cream pie, and frozen cheese pizza) and one surface (stainless steel, grade 316). A 125 g portion of deli turkey was tested using a 1:4 food:media dilution ratio, and a 25 g portion for all other foods was tested using 1:9 food:media dilution ratio. The enrichment time and media for Roka's method was 24 to 28 h for 25 g food samples and environmental surfaces, and 44 to 48 h for 125 g at 35 ± 2°C in PALCAM broth containing 0.02 g/L nalidixic acid. Comparison of the Atlas Listeria monocytogenes LmG2 Detection Assay to the reference method required an unpaired approach. For each matrix, 20 samples inoculated at a fractional level and five samples inoculated at a high level with a different strain of Listeria monocytogenes were tested by each method. The Atlas Listeria monocytogenes LmG2 Detection Assay was compared to the Official Methods of Analysis of AOAC INTERNATIONAL 993.12 method for dairy products, the U.S. Department of Agriculture, Food Safety and Inspection Service, Microbiology Laboratory Guidebook 8.08 method for ready-to-eat meat and environmental samples, and the U.S. Food and Drug Administration Bacteriological Analytical Manual, Chapter 10 method for frozen foods. In the method developer studies, Roka's method, at 24 h (or 44 h for 125 g food samples), had 126 positives out of 200 total inoculated samples, compared to 102 positives for the reference methods at 48 h. In the independent laboratory studies, vanilla ice cream, deli turkey and stainless steel grade 316 were evaluated. Roka's method, at 24 h (or 44 h for 125 g food samples), had 64 positives out of 75 total inoculated samples compared to 54 positives for the reference methods at 48 h. The Atlas Listeria monocytogenes LmG2 Detection Assay detected all 50
Kuan, Chee Hao; Wong, Woan Chwen; Pui, Chai Fung; Mahyudin, Nor Ainy; Tang, John Yew Huat; Nishibuchi, Mitsuaki; Radu, Son
2013-12-01
A total of 63 beef offal samples (beef liver = 16; beef lung = 14; beef intestine = 9; beef tripe = 15; beef spleen = 9) from three wet markets (A, B, and C) in Selangor, Malaysia were examined for the prevalence and microbial load of Listeria monocytogenes. A combination of the most probable number and polymerase chain reaction (MPN-PCR) method was employed in this study. It was found that L. monocytogenes detected in 33.33% of the beef offal samples. The prevalence of L. monocytogenes in beef offal purchased from wet markets A, B, and C were 22.73%, 37.50% and 41.18% respectively. The density of L. monocytogenes in all the samples ranged from 2,400 MPN/g. The findings in this study indicate that beef offal can be a potential vehicle of foodborne listeriosis.
Variations in virulence between different electrophoretic types of Listeria monocytogenes
DEFF Research Database (Denmark)
Nørrung, Birgit; Andersen, Jens Kirk
2000-01-01
A total of 245 strains of Listeria monocytogenes, representing 33 different electrophoretic types (ETs), were examined quantitatively for haemolytic activity. No significant difference was observed in the mean haemolytic activity between different ETs. Eighty four out of 91 strains examined were...... compared with 3.64 among food isolates). The explanation for this may be that more virulent strains are more prone to cause human infection. It is, however, also possible that strains oft. monocytogenes may become more virulent while multiplying in a living organism compared with multiplying in foods....
Vadia, Stephen; Seveau, Stephanie
2014-03-01
Listeria monocytogenes is responsible for the life-threatening food-borne disease listeriosis. This disease mainly affects elderly and immunocompromised individuals, causing bacteremia and meningoencephalitis. In pregnant women, L. monocytogenes infection leads to abortion and severe infection of the fetus or newborn. The L. monocytogenes intracellular life cycle is critical for pathogenesis. Previous studies have established that the major virulence factor of L. monocytogenes, the pore-forming toxin listeriolysin O (LLO), is sufficient to induce L. monocytogenes internalization into human epithelial cell lines. This internalization pathway strictly requires the formation of LLO pores in the plasma membrane and can be stimulated by the heterologous pore-forming toxin pneumolysin, suggesting that LLO acts nonspecifically by forming transmembrane pores. The present work tested the hypothesis that Ca2+ and K+ fluxes subsequent to perforation by LLO control L. monocytogenes internalization. We report that L. monocytogenes perforates the host cell plasma membrane in an LLO-dependent fashion at the early stage of invasion. In response to perforation, host cells undergo Ca2+ -dependent but K+ -independent resealing of their plasma membrane. In contrast to the plasma membrane resealing process, LLO-induced L. monocytogenes internalization requires both Ca2+ and K+ fluxes. Further linking ion fluxes to bacterial internalization, treating cells with a combination of Ca2+ and K+ ionophores but not with individual ionophores is sufficient to induce efficient internalization of large cargoes, such as 1-μm polystyrene beads and bacteria. We propose that LLO-induced L. monocytogenes internalization requires a Ca2+ - and K+ -dependent internalization pathway that is mechanistically distinct from the process of plasma membrane resealing.
2014-01-01
The cholesterol-dependent cytolysins (CDCs) are a large family of pore-forming toxins that are produced by numerous Gram-positive bacterial pathogens. These toxins are released in the extracellular environment as water-soluble monomers or dimers that bind to cholesterol-rich membranes and assemble into large pore complexes. Depending upon their concentration, the nature of the host cell and membrane (cytoplasmic or intracellular) they target, the CDCs can elicit many different cellular responses. Among the CDCs, listeriolysin O (LLO), which is a major virulence factor of the facultative intracellular pathogen Listeria monocytogenes, is involved in several stages of the intracellular lifecycle of the bacterium and displays unique characteristics. It has long been known that following L. monocytogenes internalization into host cells, LLO disrupts the internalization vacuole, enabling the bacterium to replicate into the host cell cytosol. LLO is then used by cytosolic bacteria to spread from cell to cell, avoiding bacterial exposure to the extracellular environment. Although LLO is continuously produced during the intracellular lifecycle of L. monocytogenes, several processes limit its toxicity to ensure the survival of infected cells. It was previously thought that LLO activity was limited to mediating vacuolar escape during bacterial entry and cell to cell spreading. This concept has been challenged by compelling evidence suggesting that LLO secreted by extracellular L. monocytogenes perforates the host cell plasma membrane, triggering important host cell responses. This chapter provides an overview of the well-established intracellular activity of LLO and the multiple roles attributed to LLO secreted by extracellular L. monocytogenes. PMID:24798012
Pradhan, Abani K; Ivanek, Renata; Gröhn, Yrjö T; Geornaras, Ifigenia; Sofos, John N; Wiedmann, Martin
2009-05-01
Foodborne disease associated with consumption of ready-to-eat foods contaminated with Listeria monocytogenes represents a considerable pubic health concern. In a risk assessment published in 2003, the U.S. Food and Drug Administration and the U.S. Food Safety and Inspection Service estimated that about 90% of human listeriosis cases in the United States are caused by consumption of contaminated deli meats. In this risk assessment, all deli meats were grouped into one of 23 categories of ready-to-eat foods, and only the postretail growth of L. monocytogenes was considered. To provide an improved risk assessment for L. monocytogenes in deli meats, we developed a revised risk assessment that (i) models risk for three subcategories of deli meats (i.e., ham, turkey, and roast beef) and (ii) models L. monocytogenes contamination and growth from production to consumption while considering subcategory-specific growth kinetics parameters (i.e., lag phase and exponential growth rate). This model also was used to assess how reformulation of the chosen deli meat subcategories with L. monocytogenes growth inhibitors (i.e., lactate and diacetate) would impact the number of human listeriosis cases. Use of product-specific growth parameters demonstrated how certain deli meat categories differ in the relative risk of causing listeriosis; products that support more rapid growth and have reduced lag phases (e.g., turkey) represent a higher risk. Although reformulation of deli meats with growth inhibitors was estimated to reduce by about 2.5- to 7.8-fold the number of human listeriosis cases linked to a given deli meat subcategory and thus would reduce the overall risk of human listeriosis, even with reformulation deli meats would still cause a considerable number of human listeriosis cases. A combination of strategies is thus needed to provide continued reduction of these cases. Risk assessment models such as that described here will be critical for evaluation of different control
Listeria Monocytogenes Persistence in Ready-to-Eat Sausages and in Processing Plants.
Mureddu, Anna; Mazza, Roberta; Fois, Federica; Meloni, Domenico; Bacciu, Roberto; Piras, Francesca; Mazzette, Rina
2014-01-21
Listeria monocytogenes is of major concern in the fermented meat products and is able to persist in their processing environments. The aim of the present work was to evaluate the virulence profile and the persistence capacity of L. monocytogenes strains isolated in Sardinian fermented sausages processing plants. Food (ground meat, sausages at the end of acidification and ripening stage) and environmental samples (a total of n. 385), collected from 4 meat processing plants located in Sardinia (Italy), were examined to detect L. monocytogenes presence. All the L. monocytogenes isolates were identified by polymerase chain reaction (PCR) method. A subset of strains was also characterised by multiplex PCR-based serogrouping, using the lmo0737 , lmo1118 , ORF2819 and ORF2110 genes. Three different multiplex PCRs were used to obtain the virulence profiles by the rrn , hlyA , actA , prfA , inlA , inlB , iap , plcA , plcB and mpl marker genes. Furthermore, in vitro biofilm forming ability and resistance to disinfectants were carried out on microtiter plate. The overall prevalence was 31.5% in food, and 68.5% in environmental samples. The prevalent serotype resulted 1/2c (43%), followed by 1/2a (40%), 4b (8.6%), and 1/2b (8.6%). The amplification products of the virulence genes were found in all the isolates with the following prevalence: 77.1% hlyA ; 100% rrn ; 100% prfA ; 97.1% iap ; 65.7% inlB ; 88.6% inlA ; 100% plcA ; 100% plcB and 74.3% mpl . As for biofilm forming ability, 37.1% of the strains were positive and resulted weak producer, but all the isolates were sensible to disinfectants showing a reduction of L. monocytogenes growth after each incubation time. More appropriate technologies and application of measures of hygienic control should be implemented to prevent the L. monocytogenes growth and cross-contamination in salsiccia sarda processing plants.
Listeria monocytogenes persistence in ready-to-eat sausages and in processing plants
Directory of Open Access Journals (Sweden)
Anna Mureddu
2014-02-01
Full Text Available Listeria monocytogenes is of major concern in the fermented meat products and is able to persist in their processing environments. The aim of the present work was to evaluate the virulence profile and the persistence capacity of L. monocytogenes strains isolated in Sardinian fermented sausages processing plants. Food (ground meat, sausages at the end of acidification and ripening stage and environmental samples (a total of n. 385, collected from 4 meat processing plants located in Sardinia (Italy, were examined to detect L. monocytogenes presence. All the L. monocytogenes isolates were identified by polymerase chain reaction (PCR method. A subset of strains was also characterised by multiplex PCR-based serogrouping, using the lmo0737, lmo1118, ORF2819 and ORF2110 genes. Three different multiplex PCRs were used to obtain the virulence profiles by the rrn, hlyA, actA, prfA, inlA, inlB, iap, plcA, plcB and mpl marker genes. Furthermore, in vitro biofilm forming ability and resistance to disinfectants were carried out on microtiter plate. The overall prevalence was 31.5% in food, and 68.5% in environmental samples. The prevalent serotype resulted 1/2c (43%, followed by 1/2a (40%, 4b (8.6%, and 1/2b (8.6%. The amplification products of the virulence genes were found in all the isolates with the following prevalence: 77.1% hlyA; 100% rrn; 100% prfA; 97.1% iap; 65.7% inlB; 88.6% inlA; 100% plcA; 100% plcB and 74.3% mpl. As for biofilm forming ability, 37.1% of the strains were positive and resulted weak producer, but all the isolates were sensible to disinfectants showing a reduction of L. monocytogenes growth after each incubation time. More appropriate technologies and application of measures of hygienic control should be implemented to prevent the L. monocytogenes growth and crosscontamination in salsiccia sarda processing plants.
Dahnrich, C.; Komorowski, L.; Probst, C.; Seitz-Polski, B.; Esnault, V.; Wetzels, J.F.M.; Hofstra, J.M.; Hoxha, E.; Stahl, R.A.K.; Lambeau, G.; Stocker, W.; Schlumberger, W.
2013-01-01
BACKGROUND: Autoantibodies against the M-type phospholipase A2 receptor (PLA2R1) are specific markers for primary membranous nephropathy (pMN) and anti-PLA2R1 serum levels may be useful to monitor disease activity. So far, a recombinant cell-based indirect immunofluorescence assay (RC-IFA) using
Growth potential of Listeria monocytogenes in sliced turkey bresaola packed in modified atmosphere
Directory of Open Access Journals (Sweden)
Elena Dalzini
2014-02-01
Full Text Available According to EC Regulation No 2073/2005, for food business operators that produce ready-to-eat (RTE product, it is crucial to be able to demonstrate if the product supports the growth of Listeria monocytogenes. The objective of the study was therefore to evaluate the behaviour of L. monocytogenes in sliced RTE turkey bresaola (made by cured turkey breast 4.5% NaCl, 1% sodium lactate, sodium nitrite 150 ppm and flavouring during the shelf life of the product, simulating a contamination during the slicing operation. Considering a shelf life of 90 days, as defined by manufacturer, the packages of sliced bresaola were stored at 5°C for 7 days and at 8°C for the remaining storage time (83 days. L. monocytogenes count decreased during storage test from 1.43/1.98 log cfu/g in the three batches tested to 1.03 log cfu/g in one batch and to undetectable levels in the other two batches. The results show that the investigated product is unable to support the growth of L. monocytogenes.
Lobel, Lior; Sigal, Nadejda; Borovok, Ilya; Belitsky, Boris R.; Sonenshein, Abraham L.; Herskovits, Anat A.
2015-01-01
Summary Metabolic adaptations are critical to the ability of bacterial pathogens to grow within host cells and are normally preceded by sensing of host-specific metabolic signals, which in turn can influence the pathogen's virulence state. Previously, we reported that the intracellular bacterial pathogen Listeria monocytogenes responds to low availability of branched-chain amino acids (BCAA) within mammalian cells by up-regulating both BCAA biosynthesis and virulence genes. The induction of virulence genes required the BCAA-responsive transcription regulator, CodY, but the molecular mechanism governing this mode of regulation was unclear. In this report, we demonstrate that CodY directly binds the coding sequence of the L. monocytogenes master virulence activator gene, prfA, 15 nt downstream of its start codon, and that this binding results in up-regulation of prfA transcription specifically under low concentrations of BCAA. Mutating this site abolished CodY binding and reduced prfA transcription in macrophages, and attenuated bacterial virulence in mice. Notably, the mutated binding site did not alter prfA transcription or PrfA activity under other conditions that are known to activate PrfA, such as during growth in the presence of glucose-1-phosphate. This study highlights the tight crosstalk between L. monocytogenes metabolism and virulence' while revealing novel features of CodY-mediated regulation. PMID:25430920
An Assessment of Different Genomic Approaches for Inferring Phylogeny of Listeria monocytogenes
DEFF Research Database (Denmark)
Henri, Clementine; Leekitcharoenphon, Pimlapas; Carleton, Heather A.
2017-01-01
Background/objectives: Whole genome sequencing (WGS) has proven to be a powerful subtyping tool for foodborne pathogenic bacteria like L. monocytogenes. The interests of genome-scale analysis for national surveillance, outbreak detection or source tracking has been largely documented. The genomic......MLPPST) or pan genome (wgMLPPST). Currently, there are little comparisons studies of these different analytical approaches. Our objective was to assess and compare different genomic methods that can be implemented in order to cluster isolates of L monocytogenes.Methods: The clustering methods were evaluated...... on a collection of 207 L. monocytogenes genomes of food origin representative of the genetic diversity of the Anses collection. The trees were then compared using robust statistical analyses.Results: The backward comparability between conventional typing methods and genomic methods revealed a near...
Bactericidal Antibiotics Do Not Appear To Cause Oxidative Stress in Listeria monocytogenes
DEFF Research Database (Denmark)
Feld, Louise; Knudsen, Gitte Maegaard; Gram, Lone
2012-01-01
Oxidative stress can be an important contributor to the lethal effect of bactericidal antibiotics in some bacteria, such as Escherichia coli and Staphylococcus aureus. Thus, despite the different target-specific actions of bactericidal antibiotics, they have a common mechanism leading to bacterial...... to cause oxidative stress in L. monocytogenes and propose that this is caused by its noncyclic tricarboxylic acid (TCA) pathway. Hence, in this noncyclic metabolism, there is a decoupling between the antibiotic-mediated cellular requirement for NADH and the induction of TCA enzyme activity, which...
Nishida, T
1968-09-01
The effect of phospholipase A on the interaction of low density lipoproteins of the S(f) 0-10 class with dextran sulfate was studied in phosphate buffer of pH 7.4, ionic strength 0.1, by chemical, spectrophotometric, and centrifugal methods. When low density lipoproteins that had been treated with phospholipase A were substituted for untreated lipoproteins, the amount of insoluble dextran sulfate-lipoprotein complex formed was greatly reduced. Hydrolysis of over 20% of the lecithin and phosphatidyl ethanolamine constituents of the lipoproteins prevented the formation of insoluble complex. However, even the lipoproteins in which almost all the phosphoglycerides were hydrolyzed produced soluble complex, which was converted to insoluble complex upon addition of magnesium sulfate. It is apparent that the lipoproteins altered extensively by treatment with phospholipase A retain many characteristic properties of native low density lipoproteins. Fatty acids, but not lysolecithin, released by the action of phospholipase A interfered with the formation of insoluble complex; this interference was due to association of the fatty acids with the lipoproteins. With increases in the concentration of the associated fatty acids, the amounts of magnesium ion required for the conversion of soluble complex to insoluble complex increased progressively. Charge interaction is evidently of paramount importance in the formation of sulfated polysaccharide-lipoprotein complexes.
Directory of Open Access Journals (Sweden)
Catherine E Jobbings
Full Text Available Whilst mast cells participate in the immune defence against the intracellular bacterium Listeria monocytogenes, there is conflicting evidence regarding the ability of L. monocytogenes to infect mast cells. It is known that the pore-forming toxin listeriolysin (LLO is important for mast cell activation, degranulation and the release of pro-inflammatory cytokines. Mast cells, however, are a potential source of a wide range of cytokines, chemokines and other mediators including osteopontin, which contributes to the clearing of L. monocytogenes infections in vivo, although its source is unknown. We therefore aimed to resolve the controversy of mast cell infection by L. monocytogenes and investigated the extent of mediator release in response to the bacterium. In this paper we show that the infection of bone marrow-derived mast cells by L. monocytogenes is inefficient and LLO-independent. LLO, however, is required for calcium-independent mast cell degranulation as well as for the transient and selective downregulation of cell surface CD117 (c-kit on mast cells. We demonstrate that in addition to the key pro-inflammatory cytokines TNF-α and IL-6, mast cells release a wide range of other mediators in response to L. monocytogenes. Osteopontin, IL-2, IL-4, IL-13 and granulocyte macrophage colony-stimulating factor (GM-CSF, and chemokines including CCL2, CCL3, CCL4 and CCL5 are released in a MyD88-dependent manner. The wide range of mediators released by mast cells in response to L. monocytogenes may play an important role in the recruitment and activation of a variety of immune cells in vivo. The cocktail of mediators, however, is unlikely to skew the immune response to a particular effector response. We propose that mast cells provide a hitherto unreported source of osteopontin, and may provide an important role in co-ordinating the immune response during Listeria infection.
Control options for Listeria monocytogenes in seafoods
DEFF Research Database (Denmark)
Huss, Hans Henrik; Jørgensen, Lasse Vigel; Vogel, Birte Fonnesbech
2000-01-01
At least three outbreaks of listeriosis associated with seafood have been reported. Listeria monocytogenes is widely distributed in the general environment including fresh water, coastal water and live fish from these areas. Contamination or recontamination of seafood may also take place during...
Concepcion, Dorothy; Johannes, Frank; Lo, Yuan Hung; Yao, Jay; Fong, Jerry; Hamilton, Bruce A.
Phosphatidylinositol transfer proteins (PITPs) mediate lipid signaling and membrane trafficking in eukaryotic cells. Loss-of-function mutations of the gene encoding PITP alpha in mice result in a range of dosage-sensitive phenotypes, including neurological dysfunction, neurodegeneration, and
Prevalence and contamination levels of listeria monocytogenes in ready-to-eat foods in Tokyo, Japan.
Shimojima, Yukako; Ida, Miki; Nakama, Akiko; Nishino, Yukari; Fukui, Rie; Kuroda, Sumiyo; Hirai, Akihiko; Kai, Akemi; Sadamasu, Kenji
2016-08-01
We surveyed prevalence and contamination levels of Listeria monocytogenes in ready-to-eat foods between 2000 and 2012 in Tokyo. L. monocytogenes was isolated from 52 (1.7%) out of 2,980 samples. Comparing the prevalence in the study period, 2.2% were positive in the former period (2000-2005) and 1.2% in the latter (2006-2012). Using the most probable number (MPN) technique, 32 samples were contaminated with fewer than 0.3 L. monocytogenes/g, 10 samples with 0.3-1.0/g and 4 samples with more than 1.0/g (the maximum was 2.3/g). The most common serovar was 1/2a, followed by 1/2b, 4b and 1/2c. We revealed that ready-to-eat foods in Tokyo were contaminated with L. monocytogenes, although the contamination levels were low.
Kuan, Chee Hao; Wong, Woan Chwen; Pui, Chai Fung; Mahyudin, Nor Ainy; Tang, John Yew Huat; Nishibuchi, Mitsuaki; Radu, Son
2013-01-01
A total of 63 beef offal samples (beef liver = 16; beef lung = 14; beef intestine = 9; beef tripe = 15; beef spleen = 9) from three wet markets (A, B, and C) in Selangor, Malaysia were examined for the prevalence and microbial load of Listeria monocytogenes. A combination of the most probable number and polymerase chain reaction (MPN-PCR) method was employed in this study. It was found that L. monocytogenes detected in 33.33% of the beef offal samples. The prevalence of L. monocytogenes in beef offal purchased from wet markets A, B, and C were 22.73%, 37.50% and 41.18% respectively. The density of L. monocytogenes in all the samples ranged from 2,400 MPN/g. The findings in this study indicate that beef offal can be a potential vehicle of foodborne listeriosis. PMID:24688507
Directory of Open Access Journals (Sweden)
Chee Hao Kuan
2013-12-01
Full Text Available A total of 63 beef offal samples (beef liver = 16; beef lung = 14; beef intestine = 9; beef tripe = 15; beef spleen = 9 from three wet markets (A, B, and C in Selangor, Malaysia were examined for the prevalence and microbial load of Listeria monocytogenes. A combination of the most probable number and polymerase chain reaction (MPN-PCR method was employed in this study. It was found that L. monocytogenes detected in 33.33% of the beef offal samples. The prevalence of L. monocytogenes in beef offal purchased from wet markets A, B, and C were 22.73%, 37.50% and 41.18% respectively. The density of L. monocytogenes in all the samples ranged from 2,400 MPN/g. The findings in this study indicate that beef offal can be a potential vehicle of foodborne listeriosis.
Growth, viability and architecture of biofilms of Listeria monocytogenes formed on abiotic surfaces
Directory of Open Access Journals (Sweden)
Fernanda Barbosa dos Reis-Teixeira
Full Text Available Abstract The pathogenic bacterium Listeria monocytogenes can persist in food processing plants for many years, even when appropriate hygienic measures are in place, with potential for contaminating ready-to-eat products and, its ability to form biofilms on abiotic surfaces certainly contributes for the environmental persistence. In this research, L. monocytogenes was grown in biofilms up 8 days attached to stainless steel and glass surfaces, contributing for advancing the knowledge on architecture of mature biofilms, since many literature studies carried out on this topic considered only early stages of cell adhesion. In this study, biofilm populations of two strains of L. monocytogenes (serotypes 1/2a and 4b on stainless steel coupons and glass were examined using regular fluorescence microscopy, confocal laser scanning microscopy and classic culture method. The biofilms formed were not very dense and microscopic observations revealed uneven biofilm structures, with presence of exopolymeric matrix surrounding single cells, small aggregates and microcolonies, in a honeycomb-like arrangement. Moreover, planktonic population of L. monocytogenes (present in broth media covering the abiotic surface remained stable throughout the incubation time, which indicates an efficient dispersal mechanism, since the culture medium was replaced daily. In conclusion, even if these strains of L. monocytogenes were not able to form thick multilayer biofilms, it was noticeable their high persistence on abiotic surfaces, reinforcing the need to focus on measures to avoid biofilm formation, instead of trying to eradicate mature biofilms.
Growth, viability and architecture of biofilms of Listeria monocytogenes formed on abiotic surfaces.
Reis-Teixeira, Fernanda Barbosa Dos; Alves, Virgínia Farias; de Martinis, Elaine Cristina Pereira
The pathogenic bacterium Listeria monocytogenes can persist in food processing plants for many years, even when appropriate hygienic measures are in place, with potential for contaminating ready-to-eat products and, its ability to form biofilms on abiotic surfaces certainly contributes for the environmental persistence. In this research, L. monocytogenes was grown in biofilms up 8 days attached to stainless steel and glass surfaces, contributing for advancing the knowledge on architecture of mature biofilms, since many literature studies carried out on this topic considered only early stages of cell adhesion. In this study, biofilm populations of two strains of L. monocytogenes (serotypes 1/2a and 4b) on stainless steel coupons and glass were examined using regular fluorescence microscopy, confocal laser scanning microscopy and classic culture method. The biofilms formed were not very dense and microscopic observations revealed uneven biofilm structures, with presence of exopolymeric matrix surrounding single cells, small aggregates and microcolonies, in a honeycomb-like arrangement. Moreover, planktonic population of L. monocytogenes (present in broth media covering the abiotic surface) remained stable throughout the incubation time, which indicates an efficient dispersal mechanism, since the culture medium was replaced daily. In conclusion, even if these strains of L. monocytogenes were not able to form thick multilayer biofilms, it was noticeable their high persistence on abiotic surfaces, reinforcing the need to focus on measures to avoid biofilm formation, instead of trying to eradicate mature biofilms. Copyright © 2017. Published by Elsevier Editora Ltda.
Directory of Open Access Journals (Sweden)
Jozi Fagundes de Mello
2008-03-01
Full Text Available The polymorphic region sequences in the iap gene were analyzed in 25 strains of Listeria monocytogenes isolated from cheeses in the state of Rio Grande do Sul, and compared with reference strains. This investigation distinguished two clusters of L. monocytogenes: I (20 strains and II (5 strains.A seqüência da região polimórfica do gene iap foi analisada em 25 cepas de Listeria monocytogenes isoladas de queijo no Estado do Rio Grande do Sul e comparadas com cepas referências. Esta investigação distinguiu L. monocytogenes em dois grupos: I (20 cepas e II (5 cepas.
Wang, Jianfeng; Liu, Bowen; Teng, Zihao; Zhou, Xuan; Wang, Xiyan; Zhang, Bing; Lu, Gejin; Niu, Xiaodi; Yang, Yongjun; Deng, Xuming
2017-01-01
The critical roles of sortase A (SrtA) and listeriolysin O (LLO) in Listeria monocytogenes pathogenicity render these two virulence factors as ideal targets for the development of anti-virulence agents against L. monocytogenes infection. Additionally, the structures of SrtA and LLO are highly conserved among the members of sortase enzyme family and cholesterol dependent toxin family. Here, phloretin, a natural polyphenolic compound derived from apples and pears that has little anti- L. monocytogenes activity, was identified to simultaneously inhibit LLO expression and neutralize SrtA catalytic activity. Phloretin neutralized SrtA activity by causing a conformational change in the protein's active pocket, which prevented engagement with its substrate. Treatment with phloretin simultaneously reduced L. monocytogenes invasion into host cells and blocked the escape of vacuole-entrapped L. monocytogenes into cytoplasm. Further, L. monocytogenes -infected mice that received phloretin showed lower mortality, decreased bacterial burden and reduced pathological injury. Our results demonstrate that phloretin is a promising anti-infective therapeutic for infections caused by L. monocytogenes due to its simultaneous targeting of SrtA and LLO, which may result in fewer side effects than those caused by other antibiotics.
Veen, van der S.; Wagendorp, A.; Abee, T.; Wells-Bennik, M.H.J.
2009-01-01
Listeria monocytogenes is a foodborne pathogen that has the ability to survive relatively high temperatures compared with other nonsporulating foodborne pathogens. This study was performed to determine whether L. monocytogenes strains with relatively high heat resistances are adequately inactivated
Bouayad, Leila; Hamdi, Taha M; Naim, Malek; Leclercq, Alexandre; Lecuit, Marc
2015-07-01
Products from three broiler abattoirs were sampled for Listeria species to evaluate the changes in the prevalence and contamination rates at two stages of processing. Sampling was performed at the evisceration stage and at the end of processing after packaging and refrigerating at 4°C for 24 h. A total of 212 samples were collected; 52 were from abattoir A, and 80 samples each were collected from abattoirs B and C. Among all samples, 99 (46.7%) tested positive for Listeria, including L. monocytogenes 19 (8.9%), L. innocua 69 (32.5%), L. grayi 10 (4.7%), and L. welshimeri 1 (0.5%). The L. monocytogenes contamination rate varied from 5% to 11.5% in the 3 abattoirs. L. innocua was the most common species identified and was found in 8.8% of the samples from abattoir A and 33.7% of the samples from both abattoirs B and C. Twenty-six of the L. monocytogenes isolates obtained from positive samples were subjected to serotyping by multiplex polymerase chain reaction and characterization by the pulsed-field gel electrophoresis (PFGE) method using two cutting enzymes, ApaI and AscI. Three molecular serogroups were identified: IIa, IIb, and IVb. Serogroup IIa was common to all abattoirs, and serogroups IIb and IVb were found only in abattoir C. The 10 different obtained PFGE profiles were grouped into 7 clusters; some of these clusters were common to the 3 abattoirs, and others were specific to the abattoirs in which they were identified. This study revealed a high prevalence of Listeria spp., particularly L. monocytogenes, in raw broilers. This high incidence presents a risk to consumers due to the potential occurrence of cross-contamination with other foods in domestic refrigerators and the ability of these microorganisms to survive in undercooked products.
A Meta-analysis of the Rates of Listeria monocytogenes and Enterococcus in Febrile Infants.
Leazer, Rianna; Perkins, Amy M; Shomaker, Kyrie; Fine, Bryan
2016-04-01
A change in the epidemiology of pathogens causing serious bacterial infection (SBI) has been noted since original recommendations were made for the empirical antibiotic choices for young infants with fever. To assess the prevalence of SBI caused by Listeria monocytogenes and Enterococcus species. A literature search was conducted on keywords related to SBI, L. monocytogenes, and Enterococcus spp. infections. Eligible studies were those conducted in the United States and published between January 1998 and June 2014 focusing on SBI in infants≤90 days of age. The rates of urinary tract infection, bacteremia, and meningitis for each pathogen were recorded for each study. Meta-analysis was performed to calculate the prevalence for each pathogen in a random effects model with 0.5 continuity correction added to studies with zero events. Sixteen studies were included. A total of 20,703 blood cultures were included, with weighted prevalences for L. monocytogenes and Enterococcus spp. bacteremia of 0.03% and 0.09%, respectively. A total of 13,775 cerebrospinal fluid cultures were included with event rates (unweighted prevalences) for L. monocytogenes and Enterococcus spp. meningitis of 0.02% and 0.03%, respectively. A total of 18,283 urine cultures were included, with no cases of L. monocytogenes and a weighted prevalence for Enterococcus spp. urinary tract infection of 0.28%. There may have been reporting bias or incomplete retrieval or inadvertent exclusion of relevant studies. SBI caused by L. monocytogenes and Enterococcus spp. in febrile infants is rare, and therefore clinicians may consider a change in empirical antibiotic choices. Copyright © 2016 by the American Academy of Pediatrics.
International Nuclear Information System (INIS)
Ullah, Anwar; Giuseppe, Priscila Oliveira de; Murakami, Mario Tyago; Trevisan-Silva, Dilza; Wille, Ana Carolina Martins; Chaves-Moreira, Daniele; Gremski, Luiza Helena; Silveira, Rafael Bertoni da; Sennf-Ribeiro, Andrea; Chaim, Olga Meiri; Veiga, Silvio Sanches; Arni, Raghuvir Krishnaswamy
2011-01-01
Wild-type and H12A-mutant class II phospholipase D from L. intermedia venom were crystallized; the crystals diffracted to maximum resolutions of 1.95 and 1.60 Å, respectively. Phospholipases D are the major dermonecrotic component of Loxosceles venom and catalyze the hydrolysis of phospholipids, resulting in the formation of lipid mediators such as ceramide-1-phosphate and lysophosphatidic acid which can induce pathological and biological responses. Phospholipases D can be classified into two classes depending on their catalytic efficiency and the presence of an additional disulfide bridge. In this work, both wild-type and H12A-mutant forms of the class II phospholipase D from L. intermedia venom were crystallized. Wild-type and H12A-mutant crystals were grown under very similar conditions using PEG 200 as a precipitant and belonged to space group P12 1 1, with unit-cell parameters a = 50.1, b = 49.5, c = 56.5 Å, β = 105.9°. Wild-type and H12A-mutant crystals diffracted to maximum resolutions of 1.95 and 1.60 Å, respectively
Cauchon, Kaitlin E; Hitchins, Anthony D; Smiley, R Derike
2017-09-01
Three selective enrichment methods, the United States Food and Drug Administration's (FDA method), the United States Department of Agriculture Food Safety Inspection Service's (USDA method), and the EN ISO 11290-1 standard method, were assessed for their suitability for recovery of Listeria monocytogenes from spiked mung bean sprouts. Three parameters were evaluated; the enrichment L. monocytogenes population from singly-spiked sprouts, the enrichment L. monocytogenes population from doubly-spiked (L. monocytogenes and Listeria innocua) sprouts, and the population differential resulting from the enrichment of doubly-spiked sprouts. Considerable L. monocytogenes inter-strain variation was observed. The mean enrichment L. monocytogenes populations for singly-spiked sprouts were 6.1 ± 1.2, 4.9 ± 1.2, and 6.9 ± 2.3 log CFU/mL for the FDA, USDA, and EN ISO 11290-1 methods, respectively. The mean L. monocytogenes populations for doubly-spiked sprouts were 4.7 ± 1.1, 5.5 ± 1.3, and 4.6 ± 1.4 log CFU/mL for the FDA, USDA, and ISO 11290-1 enrichment methods, respectively. The corresponding mean population differentials were 2.8 ± 1.1, 3.3 ± 1.3, and 3.6 ± 1.4 Δlog CFU/mL for the same three enrichment methods, respectively. The presence of L. innocua and resident microorganisms on the sprouts negatively impacted final levels of L. monocytogenes with all three enrichment methods. Published by Elsevier Ltd.
Directory of Open Access Journals (Sweden)
Laurent Dortet
2011-08-01
Full Text Available L. monocytogenes is a facultative intracellular bacterium responsible for listeriosis. It is able to invade, survive and replicate in phagocytic and non-phagocytic cells. The infectious process at the cellular level has been extensively studied and many virulence factors have been identified. Yet, the role of InlK, a member of the internalin family specific to L. monocytogenes, remains unknown. Here, we first show using deletion analysis and in vivo infection, that InlK is a bona fide virulence factor, poorly expressed in vitro and well expressed in vivo, and that it is anchored to the bacterial surface by sortase A. We then demonstrate by a yeast two hybrid screen using InlK as a bait, validated by pulldown experiments and immunofluorescence analysis that intracytosolic bacteria via an interaction with the protein InlK interact with the Major Vault Protein (MVP, the main component of cytoplasmic ribonucleoproteic particules named vaults. Although vaults have been implicated in several cellular processes, their role has remained elusive. Our analysis demonstrates that MVP recruitment disguises intracytosolic bacteria from autophagic recognition, leading to an increased survival rate of InlK over-expressing bacteria compared to InlK(- bacteria. Together these results reveal that MVP is hijacked by L. monocytogenes in order to counteract the autophagy process, a finding that could have major implications in deciphering the cellular role of vault particles.
Occurrence and antimicrobial resistance patterns of Listeria monocytogenes isolated from vegetables
Directory of Open Access Journals (Sweden)
Vanessa de Vasconcelos Byrne
2016-06-01
Full Text Available Abstract Although the consumption of fresh and minimally processed vegetables is considered healthy, outbreaks related to the contamination of these products are frequently reported. Among the food-borne pathogens that contaminate vegetables is Listeria monocytogenes, a ubiquitous organism that exhibits the ability to survive and multiply at refrigerated temperatures. This study aimed to evaluate the occurrence of L. monocytogenes in vegetables as well as the antimicrobial resistance of isolates. The results showed that 3.03% of samples were contaminated with L. monocytogenes, comprising 2.22% of raw vegetables and 5.56% of ready-to-eat vegetables. Multiplex PCR confirmed the virulence potential of the isolates. Antimicrobial resistance profiling showed that 50% of the isolates were susceptible to the antibiotics used. The resistance of one isolate to penicillin G, a commonly employed therapeutic agent, and the presence of serotype 4b, a serotype commonly associated with food-borne outbreaks, could be potential health hazards for consumers.
Mechanistic studies of the agmatine deiminase from Listeria monocytogenes.
Soares, Charles A; Knuckley, Bryan
2016-06-01
Listeria monocytogenes is a Gram-positive food-borne pathogen that is capable of living within extreme environments (i.e. low temperatures and pH). This ability to survive in such conditions may arise, at least in part, from agmatine catabolism via the agmatine deiminase system (AgDS). This catabolic pathway utilizes an agmatine deiminase (AgD) to hydrolyse agmatine into N-carbamoylputrescine (NCP), with concomitant release of ammonia, which increases the pH, thus mitigating the ill effects of the acidic environment. Given the potential significance of this pathway for cell survival, we set out to study the catalytic mechanism of the AgD encoded by L. monocytogenes In the present paper, we describe the catalytic mechanism employed by this enzyme based on pH profiles, pKa measurements of the active site cysteine and solvent isotope effects (SIE). In addition, we report inhibition of this enzyme by two novel AgD inhibitors, i.e. N-(4-aminobutyl)-2-fluoro-ethanimidamide (ABFA) and N-(4-aminobutyl)-2-chloro-ethanimidamide (ABCA). In contrast with other orthologues, L. monocytogenes AgD does not use the reverse protonation or substrate-assisted mechanism, which requires an active site cysteine with a high pKa and has been commonly seen in other members of the guanidinium-modifying enzyme (GME) superfamily. Instead, the L. monocytogenes AgD has a low pKa cysteine in the active site leading to an alternative mechanism of catalysis. This is the first time that this mechanism has been observed in the GME superfamily and is significant because it explains why previously developed mechanism-based inactivators of AgDs are ineffective against this orthologue. © 2016 The Author(s). published by Portland Press Limited on behalf of the Biochemical Society.
International Nuclear Information System (INIS)
Lempereur, C.; Capron, M.; Capron, A.
1980-01-01
A sensitive assay, using [ 14 C]lecithin as a substrate, has been developed for the measurement of phospholipase activity in rat peritoneal polymorphonuclear leukocytes. Cell extracts were found to contain a phospholipase D activity and indirect evidence suggested that eosinophils are responsible for the cleavage of lecithin. Intact peritoneal cells were also able to hydrolyze exogenous [ 14 C]lecithin in vitro. When [ 3 H]choline-labeled schistosomula were used as targets in antibody-dependent cytotoxicity experiments, the radioactivity of lecithin decreased more rapidly in a complete cytotoxicity system than in controls, suggesting that hydrolysis of schistosomula phospholipids occurred during the killing process. (Auth.)
Biofilm formation by Listeria monocytogenes on stainless steel surface and biotransfer potential
Directory of Open Access Journals (Sweden)
Maíra Maciel Mattos de Oliveira
2010-03-01
Full Text Available An experimental model was proposed to study biofilm formation by Listeria monocytogenes ATCC 19117 on AISI 304 (#4 stainless steel surface and biotransfer potential during this process. In this model, biofilm formation was conducted on the surface of stainless steel coupons, set on a stainless steel base with 4 divisions, each one supporting 21 coupons. Trypic Soy Broth was used as bacterial growth substrate, with incubation at 37 ºC and stirring of 50 rpm. The number of adhered cells was determined after 3, 48, 96, 144, 192 and 240 hours of biofilm formation and biotransfer potential from 96 hours. Stainless steel coupons were submitted to Scanning Electron Microscopy (SEM after 3, 144 and 240 hours. Based on the number of adhered cells and SEM, it was observed that L. monocytogenes adhered rapidly to the stainless steel surface, with mature biofilm being formed after 240 hours. The biotransfer potential of bacterium to substrate occurred at all the stages analyzed. The rapid capacity of adhesion to surface, combined with biotransfer potential throughout the biofilm formation stages, make L. monocytogenes a potential risk to the food industry. Both the experimental model developed and the methodology used were efficient in the study of biofilm formation by L. monocytogenes on stainless steel surface and biotransfer potential.
Biofilm formation by Listeria monocytogenes on stainless steel surface and biotransfer potential.
de Oliveira, Maíra Maciel Mattos; Brugnera, Danilo Florisvaldo; Alves, Eduardo; Piccoli, Roberta Hilsdorf
2010-01-01
An experimental model was proposed to study biofilm formation by Listeria monocytogenes ATCC 19117 on AISI 304 (#4) stainless steel surface and biotransfer potential during this process. In this model, biofilm formation was conducted on the surface of stainless steel coupons, set on a stainless steel base with 4 divisions, each one supporting 21 coupons. Trypic Soy Broth was used as bacterial growth substrate, with incubation at 37 °C and stirring of 50 rpm. The number of adhered cells was determined after 3, 48, 96, 144, 192 and 240 hours of biofilm formation and biotransfer potential from 96 hours. Stainless steel coupons were submitted to Scanning Electron Microscopy (SEM) after 3, 144 and 240 hours. Based on the number of adhered cells and SEM, it was observed that L. monocytogenes adhered rapidly to the stainless steel surface, with mature biofilm being formed after 240 hours. The biotransfer potential of bacterium to substrate occurred at all the stages analyzed. The rapid capacity of adhesion to surface, combined with biotransfer potential throughout the biofilm formation stages, make L. monocytogenes a potential risk to the food industry. Both the experimental model developed and the methodology used were efficient in the study of biofilm formation by L. monocytogenes on stainless steel surface and biotransfer potential.
Local Outbreak of Listeria monocytogenes Serotype 4b Sequence Type 6 Due to Contaminated Meat Pâté.
Althaus, Denise; Jermini, Marco; Giannini, Petra; Martinetti, Gladys; Reinholz, Danuta; Nüesch-Inderbinen, Magdalena; Lehner, Angelika; Stephan, Roger
2017-04-01
In January and February 2016, five cases of confirmed and two cases of probable infection due to Listeria monocytogenes serotype 4b, sequence type (ST) 6 belonging to a single pulsed-field gel electrophoresis pulsotype pattern were registered in a region of southern Switzerland. L. monocytogenes was detected in blood samples (four cases) and pleural fluid (one case). Furthermore, L. monocytogenes 4b ST6 was detected in a stool sample of an asymptomatic person exposed to a common food. Forthwith, the food safety authority and a local gourmet meat producer reported L. monocytogenes contamination of meat pâté. Analysis of further food and environmental samples from the premises of the producer yielded isolates matching the clinical strains and confirmed the presence of L. monocytogenes 4b ST6 in the mincing machine as the cause of the food contamination.
Effect of starter cultures on survival of Listeria monocytogenes in Čajna sausage
Bošković, M.; Tadić, V.; Đorđević, J.; Glišić, M.; Lakićević, B.; Dimitrijević, M.; Baltić, M. Ž.
2017-09-01
The aim of the study was to evaluate the survival of Listeria monocytogenes during the production of Čajna sausage with short maturation time. Sausage batter was inoculated with three different serotypes 4b and serotype 1/2a of L. monocytogenes. Control sausages were without any starter culture added; the second batch was inoculated with strains of Lactobacillus sakei, Staphylococcus carnosus and Staphylococcus xylosus, and the third batch was inoculated with strains of Debaryomyces hansenii, Lactobacillus sakei, Pediococcus acidilactici, Pediococcus pentosaceus, Staphylococcus carnosus and Staphylococcus xylosus. After 18 days of ripening, L. monocytogenes was not detected in any of the sausages, but during this fermentation and drying, the numbers of this pathogen was lower in the sausages inoculated with starter cultures.
Berzins,-A; Horman,-A; Lunden,-J; Korkeala,-H
2007-01-01
A total of 312 samples of sliced, vacuum packaged, cold-smoked pork from 15 meat processing plants in Latvia and Lithuania, obtained over a 15-month period from 2003 until 2004, were analyzed for the presence of Listeria monocytogenes at the end of their shelf-life. Overall, 120 samples (38%) tested positive for L. monocytogenes. Despite the long storing period, the levels of L. monocytogenes in cold-smoked pork products were low. Manufacturing processes were studied at seven meat processing ...
Xayarath, Bobbi; Alonzo, Francis; Freitag, Nancy E.
2015-01-01
Listeria monocytogenes is a Gram-positive facultative intracellular bacterial pathogen that invades mammalian cells and escapes from membrane-bound vacuoles to replicate within the host cell cytosol. Gene products required for intracellular bacterial growth and bacterial spread to adjacent cells are regulated by a transcriptional activator known as PrfA. PrfA becomes activated following L. monocytogenes entry into host cells, however the signal that stimulates PrfA activation has not yet been defined. Here we provide evidence for L. monocytogenes secretion of a small peptide pheromone, pPplA, which enhances the escape of L. monocytogenes from host cell vacuoles and may facilitate PrfA activation. The pPplA pheromone is generated via the proteolytic processing of the PplA lipoprotein secretion signal peptide. While the PplA lipoprotein is dispensable for pathogenesis, bacteria lacking the pPplA pheromone are significantly attenuated for virulence in mice and have a reduced efficiency of bacterial escape from the vacuoles of nonprofessional phagocytic cells. Mutational activation of PrfA restores virulence and eliminates the need for pPplA-dependent signaling. Experimental evidence suggests that the pPplA peptide may help signal to L. monocytogenes its presence within the confines of the host cell vacuole, stimulating the expression of gene products that contribute to vacuole escape and facilitating PrfA activation to promote bacterial growth within the cytosol. PMID:25822753
Nastou, Aikaterini; Rhoades, Jonathan; Smirniotis, Petros; Makri, Ioanna; Kontominas, Michael; Likotrafiti, Eleni
2012-10-15
The efficacy of household decontamination methods at reducing Listeria monocytogenes on fresh lettuce (Lactuca sativa), cucumber (Cucumis sativus) and parsley (Petroselinum sativum) was studied. Inoculated vegetable pieces were immersed in washing solutions and surviving L. monocytogenes enumerated. Parameters investigated were storage temperature prior to washing, dipping water temperature, agitation, acetic acid concentration and immersion time. The results indicated that the storage temperature significantly affects the efficacy of dipping vegetables in water for the control of L. monocytogenes, as the reduction in count was greatest when products had been stored at cooler temperatures. Decontamination with acetic acid (up to 2.0% v/v) was shown to have some effect in most cases, but the highest observed decrease in count was 2.6 log cfu/g. Experiments investigating the effect of exposure time to acetic acid (0.5% and 1.0% v/v, up to 30 min immersion) indicated that immersing the vegetables for more than 10 min is of minimal benefit. The most significant factor affecting washing and decontamination efficacy was the vegetable itself: L. monocytogenes colonizing cucumber epidermis was far more resistant to removal by washing and to acid treatment than that on the leafy vegetables, and L. monocytogenes on parsley was the most susceptible. This shows that published decontamination experiments (often performed with lettuce) cannot necessarily be extrapolated to other vegetables. Copyright © 2012 Elsevier B.V. All rights reserved.
Pochop, Jaroslav; Kačániová, Miroslava; Hleba, Lukáš; Lopasovský, L'ubomír; Bobková, Alica; Zeleňáková, Lucia; Stričík, Michal
2012-01-01
The aim of this study was to follow contamination of ready-to-eat food with Listeria monocytogenes by using the Step One real time polymerase chain reaction (PCR). We used the PrepSEQ Rapid Spin Sample Preparation Kit for isolation of DNA and MicroSEQ® Listeria monocytogenes Detection Kit for the real-time PCR performance. In 30 samples of ready-to-eat milk and meat products without incubation we detected strains of Listeria monocytogenes in five samples (swabs). Internal positive control (IPC) was positive in all samples. Our results indicated that the real-time PCR assay developed in this study could sensitively detect Listeria monocytogenes in ready-to-eat food without incubation.
The challenge of setting risk-based microbiological criteria for Listeria monocytogenes
DEFF Research Database (Denmark)
Andersen, Jens Kirk; Nørrung, Birgit
2011-01-01
After more than 20 years of work with discussing the setting of microbiological criteria for Listeria monocytogenes in foods, Codex Alimentarius on Food Hygiene has finalised a proposal that was recently adopted by the Codex Alimentarius Commission. The effort of developing procedures for making...... the microbiological criteria risk-based to the greatest extent possible has challenged scientists and managers during this long time period. Yet, the establishment of microbiological criteria for L. monocytogenes is still being discussed and several approaches are possible. Setting of microbiological criteria...
International Nuclear Information System (INIS)
Hanson, D.; DeLeo, V.
1990-01-01
Long wave ultraviolet radiation (UVA) has been shown to play an important role in the overall response of skin to solar radiation, including sunburn, tanning, premature aging, and non-melanoma skin cancer. UVA induction of inflammation in human skin is thought to be mediated by membrane lipid derived products. In order to investigate the mechanism of this response we examined the effect of UVA on phospholipid metabolism of human epidermal keratinocytes in culture. Keratinocytes were grown in serum free low calcium medium. The cells were prelabeled with [3H] arachidonic acid or [3H] choline and irradiated with UVA (Honle 2002-Hg vapor lamp). Identification and quantitation of specific membrane phospholipid-derived components was achieved using high-performance liquid chromatography, paper chromatography, and radioimmunoassay. UVA resulted in a linear dose dependent release of [3H] arachidonic acid into medium between 1 and 20 joule/cm2. This response was inhibited in an oxygen-reduced environment. The radiolabel released was predominantly free arachidonate and cyclooxygenase metabolites. Cyclooxygenase metabolites prostaglandin E2 and prostacyclin derivative, 6-keto-prostaglandin F1a, were stimulated following UVA irradiation, but the lipoxygenase metabolite, leukotriene B was not detected. Maximal release was measured immediately after irradiation and changed little over 24 h post-irradiation. UVA stimulated an increase of [3H] choline metabolites glycerophosphorylcholine and phosphorylcholine in media extracts suggesting UVA activation of phospholipase C and phospholipase A2 or diacylglyceride lipase
Membrane associated phospholipase C from bovine brain
International Nuclear Information System (INIS)
Lee, K.; Ryu, S.H.; Suh, P.; Choi, W.C.; Rhee, S.G.
1987-01-01
Cytosolic fractions of bovine brain contain 2 immunologically distinct phosphoinositide-specific phospholipase (PLC), PLC-I and PLC-II, whose MW are 150,000 and 145,000 respectively, under a denaturing condition. Monoclonal antibodies were derived against each form and specific radioimmunoassays were developed. Distribution of PLC-I and PLC-II in cytosolic and particulate fractions was measured using the radioimmunoassay. More than 90% of PLC-II was found in the cytosolic fraction, while the anti-PLC-I antibody cross-reacting protein was distributed nearly equally between the soluble fraction and the 2 M KCl extract of particulate fraction. The PLC enzyme in the particulate fraction was purified to homogeneity, yielding 2 proteins of 140 KDa and 150 KDa when analyzed on SDS-PAGE. Neither of the 2 enzymes cross-reacted with anti-PLC-II antibodies, but both could be immunoblotted by all 4 different anti-PLC-I antibodies. This suggests that the 140 KDa PLC was derived from the 150 KDa form. The 150 Kda form from particulate fraction was indistinguishable from the cytosolic PLC-I when their mixture was analyzed on SDS-PAGE. In addition, the elution profile of tryptic peptides derived from the 150 KDa particulate form was identical to that of cytosolic PLC-I. This result indicates that PLC-I is reversibly associated to membranes
Czech Academy of Sciences Publication Activity Database
Upham, B. L.; Bláha, L.; Babica, P.; Park, J.-S.; Sovadinová, I.; Pudrith, Ch.; Rummel, A.M.; Weis, L.M.; Sai, K.; Tithof, P.K.; Gužvič, M.; Vondráček, Jan; Machala, M.; Trosko, J.E.
2008-01-01
Roč. 99, č. 4 (2008), s. 696-705 ISSN 1347-9032 R&D Projects: GA ČR(CZ) GA524/05/0595 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : GJIC * phospholipases * tumor promotion Subject RIV: BO - Biophysics Impact factor: 3.471, year: 2008
Listeria monocytogenes presence during fermentation, drying and storage of Petrovská klobása sausage
Janković, V.; Mitrović, R.; Lakićević, B.; Velebit, B.; Baltić, T.
2017-09-01
The majority of human listeriosis cases appear to be caused by consumption of ready-to-eat (RTE) foods contaminated at the time of consumption with high levels of Listeria monocytogenes. Although strategies to prevent growth of L. monocytogenes in RTE products are critical for reducing the incidence of human listeriosis, this pathogen is highly difficult to control in fermented sausage processing environments due to its high tolerance to low pH and high salt concentration. The aims of the present study were to investigate the occurrence, presence and elimination of L. monocytogenes in Petrovská klobása sausage during processing, fermentation, drying and storage. L. monocytogenes, which was detected at the beginning of the production cycle, disappeared before day 30. The pathogen decline was much faster in those sausages which were dried in controlled, industrial conditions than in those dried applying the traditional, household technique.
Cui, H Y; Wu, J; Lin, L
2016-08-01
Listeria monocytogenes infection in dairy products is of mounting public concern. To inhibit bacterial growth, we engineered stimuli-responsive liposomes containing lemongrass oil for this study. The controlled release of liposome-entrapped lemongrass oil is triggered by listerolysin O, secreted by L. monocytogenes. We investigated the antibiotic activities of lemongrass oil liposomes against L. monocytogenes in cheese. We also assessed their possible effects on the quality of the cheese. Liposomes containing lemongrass oil (5.0mg/mL) presented the optimal polydispersity index (0.246), zeta-potential (-58.9mV) and entrapment efficiency (25.7%). The liposomes displayed satisfactory antibiotic activity against L. monocytogenes in cheese over the storage period at 4°C. We observed no effects on the physical and sensory properties of the cheese after the liposome treatment. Copyright © 2016 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Weller, Daniel; Wiedmann, Martin
2015-01-01
While rain and irrigation events have been associated with an increased prevalence of foodborne pathogens in produce production environments, quantitative data are needed to determine the effects of various spatial and temporal factors on the risk of produce contamination following these events. This study was performed to quantify these effects and to determine the impact of rain and irrigation events on the detection frequency and diversity of Listeria species (including L. monocytogenes) and L. monocytogenes in produce fields. Two spinach fields, with high and low predicted risks of L. monocytogenes isolation, were sampled 24, 48, 72, and 144 to 192 h following irrigation and rain events. Predicted risk was a function of the field's proximity to water and roads. Factors were evaluated for their association with Listeria species and L. monocytogenes isolation by using generalized linear mixed models (GLMMs). In total, 1,492 (1,092 soil, 334 leaf, 14 fecal, and 52 water) samples were collected. According to the GLMM, the likelihood of Listeria species and L. monocytogenes isolation from soil samples was highest during the 24 h immediately following an event (odds ratios [ORs] of 7.7 and 25, respectively). Additionally, Listeria species and L. monocytogenes isolates associated with irrigation events showed significantly lower sigB allele type diversity than did isolates associated with precipitation events (P = monocytogenes contamination. Small changes in management practices (e.g., not irrigating fields before harvest) may therefore reduce the risk of L. monocytogenes contamination of fresh produce. PMID:26116668
Overexpression of porcine lipoprotein-associated phospholipase A2 in swine
Tang, Xiaochun; Wang, Gangqi; Liu, Xingxing; Han, Xiaolei; Li, Zhuang; Ran, Guangyao; Li, Zhanjun; Song, Qi; Ji, Y; Wang, Haijun; Wang, Yuhui; Ouyang, Hongsheng; Pang, Daxin
2015-01-01
Lipoprotein-associated phospholipase A 2 (Lp-PLA2) is associated with the risk of vascular disease. It circulates in human blood predominantly in association with low-density lipoprotein cholesterol (LDL-C) and hydrolyses oxidized phospholipids into pro-inflammatory products. However, in the mouse
Lu, Shan; Chen, Linlin; Tao, Kai; Sun, Nannan; Wu, Yuren; Lu, Xiaoxue; Wang, Yuanchao; Dou, Daolong
2013-09-01
RxLR effectors produced by Phytophthora pathogens have been proposed to bind to phosphatidylinositol 3-phosphate (PtdIns(3)P) to mediate their translocation into host cells and/or to increase their stability in planta. Since the levels of PtdIns(3)P in plants are low, we examined whether Phytophthora species may produce PtdIns(3)P to promote infection. We observed that PtdIns(3)P-specific GFP biosensors could bind to P. parasitica and P. sojae hyphae during infection of Nicotiana benthamiana leaves transiently secreting the biosensors, suggesting that the hyphae exposed PtdIns(3)P on their plasma membrane and/or secreted PtdIns(3)P. Silencing of the phosphatidylinositol 3-kinases (PI3K) genes, treatment with LY294002, or expression of PtdIns(3)P-binding proteins by P. sojae reduced the virulence of the pathogen on soybean, indicating that pathogen-synthesized PtdIns(3)P was required for full virulence. Secretion of PtdIns(3)P-binding proteins or of a PI3P-5-kinase by N. benthamiana leaves significantly increased the level of resistance to infection by P. parasitica and P. capsici. Together, our results support the hypothesis that Phytophthora species produce external PtdIns(3)P to aid in infection, such as to promote entry of RxLR effectors into host cells. Our results derived from P. sojae RxLR effector Avr1b confirm that both the N-terminus and the C-terminus of this effector can bind PtdIns(3)P.
Kadam, S.R.; Besten, den H.M.W.; Veen, van der S.; Zwietering, M.H.; Moezelaar, R.; Abee, T.
2013-01-01
The foodborne pathogen Listeria monocytogenes has the ability to produce biofilms in food-processing environments and then contaminate food products, which is a major concern for food safety. The biofilm forming behavior of 143 L. monocytogenes strains was determined in four different media that
Listeria monocytogenes, a well-described cause of encephalitis and abortion in ruminants and of food-borne illness in humans, is rarely associated with disease in companion animals. A case of urinary tract infection associated with an atypical, weakly hemolytic L. monocytogenes strain is described i...
Kuan, C H; Goh, S G; Loo, Y Y; Chang, W S; Lye, Y L; Puspanadan, S; Tang, J Y H; Nakaguchi, Y; Nishibuchi, M; Mahyudin, N A; Radu, S
2013-06-01
A total of 216 chicken offal samples (chicken liver = 72; chicken heart = 72; chicken gizzard = 72) from wet markets and hypermarkets in Selangor, Malaysia, were examined for the presence and density of Listeria monocytogenes by using a combination of the most probable number and PCR method. The prevalence of L. monocytogenes in 216 chicken offal samples examined was 26.39%, and among the positive samples, the chicken gizzard showed the highest percentage at 33.33% compared with chicken liver (25.00%) and chicken heart (20.83%). The microbial load of L. monocytogenes in chicken offal samples ranged from Malaysia.
Effect of humidity and temperature on the survival of Listeria monocytogenes on surfaces.
Redfern, J; Verran, J
2017-04-01
Listeria monocytogenes is a pathogenic bacterium, with human disease and infection linked to dairy products, seafood, ready-to-eat meat and raw & undercooked meats. Stainless steel is the most common food preparation surface and therefore, it is important to understand how food storage conditions such as surface materials, temperature and relative humidity can affect survival of L. monocytogenes. In this study, survival of L. monocytogenes on stainless steel was investigated at three temperatures (4, 10 and 21°C), each approx. 11, 50 and 85% humidity. Results indicate that the lower the temperature, the more cells were recovered in all three humidity environments, while medium humidity enhances survival, irrespective of temperature. Lower humidity decreases recovery at all temperatures. These data support the guidance noted above that humidity control is important, and that lower humidity environments are less likely to support retention of viable L. monocytogenes on a stainless steel surface. Understanding survival of potential food-borne pathogens is essential for the safe production and preparation of food. While it has long been 'common knowledge' that relative humidity can affect the growth and survival of micro-organisms, this study systematically describes the survival of L. monocytogenes on stainless steel under varying humidity and temperatures for the first time. The outcomes from this paper will allow those involved with food manufacture and preparation to make informed judgement on environmental conditions relating to humidity control, which is lacking in the food standards guidelines. © 2017 The Society for Applied Microbiology.
Directory of Open Access Journals (Sweden)
Gopala K. Mannala
2017-12-01
Full Text Available microRNAs (miRNAs coordinate several physiological and pathological processes by regulating the fate of mRNAs. Studies conducted in vitro indicate a role of microRNAs in the control of host-microbe interactions. However, there is limited understanding of miRNA functions in in vivo models of bacterial infections. In this study, we systematically explored changes in miRNA expression levels of Galleria mellonella larvae (greater-wax moth, a model system that recapitulates the vertebrate innate immunity, following infection with L. monocytogenes. Using an insect-specific miRNA microarray with more than 2000 probes, we found differential expression of 90 miRNAs (39 upregulated and 51 downregulated in response to infection with L. monocytogenes. We validated the expression of a subset of miRNAs which have mammalian homologs of known or predicted function. In contrast, non-pathogenic L. innocua failed to induce these miRNAs, indicating a virulence-dependent miRNA deregulation. To predict miRNA targets using established algorithms, we generated a publically available G. mellonella transcriptome database. We identified miRNA targets involved in innate immunity, signal transduction and autophagy, including spätzle, MAP kinase, and optineurin, respectively, which exhibited a virulence-specific differential expression. Finally, in silico estimation of minimum free energy of miRNA-mRNA duplexes of validated microRNAs and target transcripts revealed a regulatory network of the host immune response to L. monocytogenes. In conclusion, this study provides evidence for a role of miRNAs in the regulation of the innate immune response following bacterial infection in a simple, rapid and scalable in vivo model that may predict host-microbe interactions in higher vertebrates.
Inhibition of Listeria monocytogenes by propionic acid-based ingredients in cured deli-style Turkey.
Glass, Kathleen A; McDonnell, Lindsey M; Von Tayson, Roxanne; Wanless, Brandon; Badvela, Mani
2013-12-01
Listeria monocytogenes growth can be controlled on ready-to-eat meats through the incorporation of antimicrobial ingredients into the formulation or by postlethality kill steps. However, alternate approaches are needed to provide options that reduce sodium content but maintain protection against pathogen growth in meats after slicing. The objective of this study was to determine the inhibition of L. monocytogenes by propionic acid-based ingredients in high-moisture, cured turkey stored at 4 or 7°C. Six formulations of sliced, cured (120 ppm of NaNO2 ), deli-style turkey were tested, including control without antimicrobials, 3.2% lactate-diacetate blend (LD), 0.4% of a liquid propionate-benzoate-containing ingredient, or 0.3, 0.4, and 0.5% of a liquid propionate-containing ingredient. Products were inoculated with 5 log CFU L. monocytogenes per 100-g package (3 log CFU/ml rinsate), vacuum-sealed, and stored at 4 or 7°C for up to 12 weeks; and populations were enumerated by plating on modified Oxford agar. As expected, the control without antimicrobials supported rapid growth, with >2 log average per ml rinsate increase within 4 weeks of storage at 4°C, whereas growth was observed at 6 weeks for the LD treatment. For both replicate trials, all treatments that contained liquid propionate or propionate-benzoate limited L. monocytogenes growth to an increase of 1-log increase) was observed in individual samples for all propionate-containing treatments at weeks 10, 11, and 12. As expected, L. monocytogenes grew more rapidly when products were stored at 7°C, but trends in relative inhibition were similar to those observed at 4°C. These results verify that propionate-based ingredients inhibit growth of L. monocytogenes on sliced, high-moisture, cured turkey and can be considered as an alternative to reduce sodium-based salts while maintaining food safety.
Lu, Chunye; Marjanovic, Olivera; Kiang, David
2017-01-01
ABSTRACT Listeria monocytogenes is an important foodborne pathogen. Here, we present the annotated whole genome of Listeria monocytogenes strains F14M01297-C2 and F14M01297-C4, isolated from nectarines distributed by a packing facility in California during an investigation of listeriosis associated with stone fruit in 2014. PMID:28729255
Bahador; Sadeghi Kalani; Valian; Irajian; Lotfollahi
2015-01-01
Background Listeria monocytogenes is a foodborne pathogen and a serious threat to the public health in the world. Consumption of traditional foods such as dairy and meat products can be a major reason for relative abundance and isolation of these bacteria. Objectives The purpose of this study was to determine the phenotypic and genotypic characteristics of L. monocytogenes strains isolated from dairy and meat products. ...
Lavieri, Nicolas A; Sebranek, Joseph G; Cordray, Joseph C; Dickson, James S; Jung, Stephanie; Manu, David K; Mendonça, Aubrey F; Brehm-Stecher, Byron F; Stock, Joseph; Stalder, Kenneth J
2014-05-01
A sublethally injured bacterial cell has been defined as a cell that survives a stress such as heating, freezing, acid treatment, or other antimicrobial intervention but can repair the cellular damage exerted by the stressor and later regain its original ability to grow. Consequently, sublethally injured cells are not likely to be included in conventional enumeration procedures, which could result in unrealistically low counts unless efforts are made to encourage recovery of the injured cells before enumeration. The objective of this study was to evaluate the use of the thin agar layer (TAL) method for the recovery of pressure-injured and heat-injured Listeria monocytogenes in a tryptic soy broth with 0.6% yeast extract system. Pressure injury consisted of treatment of a culture of mixed L. monocytogenes strains with high hydrostatic pressure at 400 or 600 MPa for 1 s, 2 min, 4 min, or 6 min at a process temperature of 12±2 °C. Heat injury consisted of treatment of a culture of mixed L. monocytogenes strains at 60±1 °C for 3, 6, or 9 min. Growth media were tryptic soy agar (TSA) with 0.6% yeast extract, modified Oxford medium (MOX), and TAL, which consisted of a 7-ml layer of TSA overlaid onto solidified MOX. Counts of viable L. monocytogenes on TAL were higher than those on MOX in the heat-injury experiment but not in the pressure-injury experiment. Therefore, the effectiveness of the TAL method may be specific to the type of injury applied to the microorganism and should be investigated in a variety of cellular injury scenarios.
Uppal, Kamaldeep K; Getty, Kelly J K; Boyle, Elizabeth A E; Harper, Nigel M; Lobaton-Sulabo, April Shayne S; Barry, Bruce
2012-01-01
The objective of our study was to determine effect of packaging method and storage time on reducing Listeria monocytogenes in shelf-stable meat snacks. Commercially available kippered beef steak strips and turkey tenders were dipped into a 5-strain L. monocytogenes cocktail, and dried at 23 °C until a water activity of 0.80 was achieved. Inoculated samples were packaged with 4 treatments: (1) vacuum, (2) nitrogen flushed with oxygen scavenger, (3) heat sealed with oxygen scavenger, and (4) heat sealed without oxygen scavenger. Samples were stored at 23 °C and evaluated for L. monocytogenes levels at 0, 24, 48, and 72 h. Initial levels (time 0) of L. monocytogenes were approximately 5.7 log CFU/cm² for steak and tenders. After 24 h of storage time, a 1 log CFU/cm² reduction of L. monocytogenes was observed for turkey tenders for all packaging treatments. After 48 h, turkey tenders showed >1 log CFU/cm² reduction of L. monocytogenes for all packaging treatments except for vacuum, where only 0.9 log CFU/cm² reduction was observed. After 72 h, reductions for all packaging treatments for turkey tenders ranged from 1.5 to 2.4 log CFU/cm². For kippered beef steak, there was no interaction between the packaging treatments and all storage times (P > 0.05) whereas, time was different (P packaging treatments and a 2.1 log CFU/ cm² L. monocytogenes reduction at 72 h of storage time. Processors of kippered beef steak and turkey tenders could use a combination of vacuum or nitrogen-flushing or heat sealed with an oxygen scavenger packaging methods and a holding time of 24 h prior to shipping to reduce potential L. monocytogenes numbers by ≥1 log. However, processors should be encouraged to hold packaged product a minimum of 72 h to enhance the margin of safety for L. monocytogenes control. © 2011 Institute of Food Technologists®
Barancelli, Giovana V; Camargo, Tarsila M; Gagliardi, Natália G; Porto, Ernani; Souza, Roberto A; Campioni, Fabio; Falcão, Juliana P; Hofer, Ernesto; Cruz, Adriano G; Oliveira, Carlos A F
2014-03-03
This study aimed to evaluate the occurrence of Listeria monocytogenes in cheese and in the environment of three small-scale dairy plants (A, B, C) located in the Northern region state of São Paulo, Brazil, and to characterize the isolates using conventional serotyping and PFGE. A total of 393 samples were collected and analyzed from October 2008 to September 2009. From these, 136 came from dairy plant A, where only L. seeligeri was isolated. In dairy plant B, 136 samples were analyzed, and L. innocua, L. seeligeri and L. welshimeri were isolated together with L. monocytogenes. In dairy plant C, 121 samples were analyzed, and L. monocytogenes and L. innocua were isolated. Cheese from dairy plants B and C were contaminated with Listeria spp, with L. innocua being found in Minas frescal cheese from both dairy plants, and L. innocua and L. monocytogenes in Prato cheese from dairy plant C. A total of 85 L. monocytogenes isolates were classified in 3 serotypes: 1/2b, 1/2c, and 4b, with predominance of serotype 4b in both dairy plants. The 85 isolates found in the dairy plants were characterized by genomic macrorestriction using ApaI and AscI with Pulsed Field Gel Electrophoresis (PFGE). Macrorestriction yielded 30 different pulsotypes. The presence of indistinguishable profiles repeatedly isolated during a 12-month period indicated the persistence of L. monocytogenes in dairy plants B and C, which were more than 100 km away from each other. Brine used in dairy plant C contained more than one L. monocytogenes lineage. The routes of contamination were identified in plants B and C, and highlighted the importance of using molecular techniques and serotyping to track L. monocytogenes sources of contamination, distribution, and routes of contamination in dairy plants, and to develop improved control strategies for L. monocytogenes in dairy plants and dairy products. Copyright © 2013 Elsevier B.V. All rights reserved.
Ortega, Fabian E.; Rengarajan, Michelle; Chavez, Natalie; Radhakrishnan, Prathima; Gloerich, Martijn; Bianchini, Julie; Siemers, Kathleen; Luckett, William S.; Lauer, Peter; Nelson, W. James; Theriot, Julie A.
2017-01-01
The intestinal epithelium is the first physiological barrier breached by the Gram-positive facultative pathogen Listeria monocytogenes during an in vivo infection. Listeria monocytogenes binds to the epithelial host cell receptor E-cadherin, which mediates a physical link between the bacterium and filamentous actin (F-actin). However, the importance of anchoring the bacterium to F-actin through E-cadherin for bacterial invasion has not been tested directly in epithelial cells. Here we demonstrate that depleting αE-catenin, which indirectly links E-cadherin to F-actin, did not decrease L. monocytogenes invasion of epithelial cells in tissue culture. Instead, invasion increased due to increased bacterial adhesion to epithelial monolayers with compromised cell–cell junctions. Furthermore, expression of a mutant E-cadherin lacking the intracellular domain was sufficient for efficient L. monocytogenes invasion of epithelial cells. Importantly, direct biotin-mediated binding of bacteria to surface lipids in the plasma membrane of host epithelial cells was sufficient for uptake. Our results indicate that the only requirement for L. monocytogenes invasion of epithelial cells is adhesion to the host cell surface, and that E-cadherin–mediated coupling of the bacterium to F-actin is not required. PMID:28877987
Chen, Grischa Y; McDougal, Courtney E; D'Antonio, Marc A; Portman, Jonathan L; Sauer, John-Demian
2017-03-21
Through unknown mechanisms, the host cytosol restricts bacterial colonization; therefore, only professional cytosolic pathogens are adapted to colonize this host environment. Listeria monocytogenes is a Gram-positive intracellular pathogen that is highly adapted to colonize the cytosol of both phagocytic and nonphagocytic cells. To identify L. monocytogenes determinants of cytosolic survival, we designed and executed a novel screen to isolate L. monocytogenes mutants with cytosolic survival defects. Multiple mutants identified in the screen were defective for synthesis of menaquinone (MK), an essential molecule in the electron transport chain. Analysis of an extensive set of MK biosynthesis and respiratory chain mutants revealed that cellular respiration was not required for cytosolic survival of L. monocytogenes but that, instead, synthesis of 1,4-dihydroxy-2-naphthoate (DHNA), an MK biosynthesis intermediate, was essential. Recent discoveries showed that modulation of the central metabolism of both host and pathogen can influence the outcome of host-pathogen interactions. Our results identify a potentially novel function of the MK biosynthetic intermediate DHNA and specifically highlight how L. monocytogenes metabolic adaptations promote cytosolic survival and evasion of host immunity. IMPORTANCE Cytosolic bacterial pathogens, such as Listeria monocytogenes and Francisella tularensis , are exquisitely evolved to colonize the host cytosol in a variety of cell types. Establishing an intracellular niche shields these pathogens from effectors of humoral immunity, grants access to host nutrients, and is essential for pathogenesis. Through yet-to-be-defined mechanisms, the host cytosol restricts replication of non-cytosol-adapted bacteria, likely through a combination of cell autonomous defenses (CADs) and nutritional immunity. Utilizing a novel genetic screen, we identified determinants of L. monocytogenes cytosolic survival and virulence and identified a role
Aparecida de Oliveira, Maria; Abeid Ribeiro, Eliana Guimarães; Morato Bergamini, Alzira Maria; Pereira De Martinis, Elaine Cristina
2010-02-01
Modern lifestyle markedly changed eating habits worldwide, with an increasing demand for ready-to-eat foods, such as minimally processed fruits and leafy greens. Packaging and storage conditions of those products may favor the growth of psychrotrophic bacteria, including the pathogen Listeria monocytogenes. In this work, minimally processed leafy vegetables samples (n = 162) from retail market from Ribeirão Preto, São Paulo, Brazil, were tested for the presence or absence of Listeria spp. by the immunoassay Listeria Rapid Test, Oxoid. Two L. monocytogenes positive and six artificially contaminated samples of minimally processed leafy vegetables were evaluated by the Most Probable Number (MPN) with detection by classical culture method and also culture method combined with real-time PCR (RTi-PCR) for 16S rRNA genes of L. monocytogenes. Positive MPN enrichment tubes were analyzed by RTi-PCR with primers specific for L. monocytogenes using the commercial preparation ABSOLUTE QPCR SYBR Green Mix (ABgene, UK). Real-time PCR assay presented good exclusivity and inclusivity results and no statistical significant difference was found in comparison with the conventional culture method (p < 0.05). Moreover, RTi-PCR was fast and easy to perform, with MPN results obtained in ca. 48 h for RTi-PCR in comparison to 7 days for conventional method.
Directory of Open Access Journals (Sweden)
Laura Mercurio
Full Text Available The chemokine receptor CXCR4 plays a crucial role in tumors, including glioblastoma multiforme (GBM, the most aggressive glioma. Phosphatidylcholine-specific phospholipase C (PC-PLC, a catabolic enzyme of PC metabolism, is involved in several aspects of cancer biology and its inhibition down-modulates the expression of growth factor membrane receptors interfering with their signaling pathways. In the present work we investigated the possible interplay between CXCR4 and PC-PLC in GBM cells.Confocal microscopy, immunoprecipitation, western blot analyses, and the evaluation of migration and invasion potential were performed on U87MG cells after PC-PLC inhibition with the xanthate D609. The intracellular metabolome was investigated by magnetic resonance spectroscopy; lactate levels and lactate dehydrogenase (LDH activity were analyzed by colorimetric assay.Our studies demonstrated that CXCR4 and PC-PLC co-localize and are associated on U87MG cell membrane. D609 reduced CXCR4 expression, cell proliferation and invasion, interfering with AKT and EGFR activation and expression. Metabolic analyses showed a decrease in intracellular lactate concentration together with a decrement in LDH activity.Our data suggest that inhibition of PC-PLC could represent a new molecular approach in glioma biology not only for its ability in modulating cell metabolism, glioma growth and motility, but also for its inhibitory effect on crucial molecules involved in cancer progression.
Directory of Open Access Journals (Sweden)
Joelle K. Salazar
2018-01-01
Full Text Available This study assessed the growth of Listeria monocytogenes in milkshakes made using the process-contaminated ice cream associated with a listeriosis outbreak in comparison to milkshakes made with artificially contaminated ice cream. For all temperatures, growth kinetics including growth rates, lag phases, maximum populations, and population increases were determined for the naturally and artificially derived contaminants at 5, 10, 15, and 25°C storage for 144 h. The artificially inoculated L. monocytogenes presented lower growth rates and shorter lag phases than the naturally contaminated populations at all temperatures except for 5°C, where the reverse was observed. At 25°C, lag phases of the naturally and artificially contaminated L. monocytogenes were 11.6 and 7.8 h, respectively. The highest increase in population was observed for the artificially inoculated pathogen at 15°C after 96 h (6.16 log CFU/mL of storage. Growth models for both contamination states in milkshakes were determined. In addition, this study evaluated the antimicrobial effectiveness of flavoring agents, including strawberry, chocolate and mint, on the growth of the pathogen in milkshakes during 10°C storage. All flavor additions resulted in decreased growth rates of L. monocytogenes for both contamination states. The addition of chocolate and mint flavoring also resulted in significantly longer lag phases for both contamination states. This study provides insight into the differences in growth between naturally and artificially contaminated L. monocytogenes in a food product.
Salazar, Joelle K; Bathija, Vriddi M; Carstens, Christina K; Narula, Sartaj S; Shazer, Arlette; Stewart, Diana; Tortorello, Mary Lou
2018-01-01
This study assessed the growth of Listeria monocytogenes in milkshakes made using the process-contaminated ice cream associated with a listeriosis outbreak in comparison to milkshakes made with artificially contaminated ice cream. For all temperatures, growth kinetics including growth rates, lag phases, maximum populations, and population increases were determined for the naturally and artificially derived contaminants at 5, 10, 15, and 25°C storage for 144 h. The artificially inoculated L. monocytogenes presented lower growth rates and shorter lag phases than the naturally contaminated populations at all temperatures except for 5°C, where the reverse was observed. At 25°C, lag phases of the naturally and artificially contaminated L. monocytogenes were 11.6 and 7.8 h, respectively. The highest increase in population was observed for the artificially inoculated pathogen at 15°C after 96 h (6.16 log CFU/mL) of storage. Growth models for both contamination states in milkshakes were determined. In addition, this study evaluated the antimicrobial effectiveness of flavoring agents, including strawberry, chocolate and mint, on the growth of the pathogen in milkshakes during 10°C storage. All flavor additions resulted in decreased growth rates of L. monocytogenes for both contamination states. The addition of chocolate and mint flavoring also resulted in significantly longer lag phases for both contamination states. This study provides insight into the differences in growth between naturally and artificially contaminated L. monocytogenes in a food product.
Detergent organisation in crystals of monomeric outer membrane phospholipase A
Snijder, HJ; Timmins, PA; Kalk, KH; Dijkstra, BW
The structure of the detergent in crystals of outer membrane phospholipase A (OMPLA) has been determined using neutron diffraction contrast variation. Large crystals were soaked in stabilising solutions, each containing a different H2O/D2O contrast. From the neutron diffraction at five contrasts,
Aluminum ions inhibit phospholipase D in a microtubule-dependent manner
Czech Academy of Sciences Publication Activity Database
Pejchar, Přemysl; Pleskot, R.; Schwarzerová, K.; Martinec, Jan; Valentová, O.; Novotná, Z.
2008-01-01
Roč. 32, č. 5 (2008), s. 554-556 ISSN 1065-6995 R&D Projects: GA ČR GA522/05/0340 Institutional research plan: CEZ:AV0Z50380511 Keywords : Aluminum toxicity * Phospholipase D * Microtubules Subject RIV: ED - Physiology Impact factor: 1.619, year: 2008
Ericson, Megan E.; Frank, Matthew W.
2016-01-01
Enoyl-acyl carrier protein reductase catalyzes the last step in each elongation cycle of type II bacterial fatty acid synthesis and is a key regulatory protein in bacterial fatty acid synthesis. Genes of the facultative intracellular pathogen Listeria monocytogenes encode two functional enoyl-acyl carrier protein isoforms based on their ability to complement the temperature-sensitive growth phenotype of Escherichia coli strain JP1111 [fabI(Ts)]. The FabI isoform was inactivated by the FabI selective inhibitor AFN-1252, but the FabK isoform was not affected by the drug, as expected. Inhibition of FabI by AFN-1252 decreased endogenous fatty acid synthesis by 80% and lowered the growth rate of L. monocytogenes in laboratory medium. Robust exogenous fatty acid incorporation was not detected in L. monocytogenes unless the pathway was partially inactivated by AFN-1252 treatment. However, supplementation with exogenous fatty acids did not restore normal growth in the presence of AFN-1252. FabI inactivation prevented the intracellular growth of L. monocytogenes, showing that neither FabK nor the incorporation of host cellular fatty acids was sufficient to support the intracellular growth of L. monocytogenes. Our results show that FabI is the primary enoyl-acyl carrier protein reductase of type II bacterial fatty acid synthesis and is essential for the intracellular growth of L. monocytogenes. PMID:27736774
Directory of Open Access Journals (Sweden)
Vodnar Dan C
2012-07-01
Full Text Available Abstract Background The consumer demands for better quality and safety of food products have given rise to the development and implementation of edible films. The use of antimicrobial films can be a promising tool for controlling L. monocytogenes on ready to eat products. The aim of this study was to develop effective antimicrobial films incorporating bioactive compounds from green and black teas into chitosan, for controlling L. monocytogenes ATCC 19115 on vacuum-packaged ham steak. The effectiveness of these antimicrobial films was evaluated at room temperature (20°C for 10 days and at refrigerated temperature (4°C for 8 weeks. Results The HPLC results clearly show that relative concentrations of catechins and caffeine in green tea ranked EGCG>EGC>CAF>ECG>EC>C while in black tea extracts ranked CAF>EGCG>ECG>EGC>EC>C. The chitosan-coated plastic films incorporating green tea and black tea extracts shows specific markers identified by FTIR. Incorporating natural extracts into chitosan showed that the growth of L monocytogenes ATCC 19115 was inhibited. The efficacy of antimicrobial effect of tea extracts incorporated into chitosan-coated plastic film was dose dependent. However, chitosan-coated films without addition of tea extracts did not inhibit the growth of L. monocytogenes ATCC 19115. Chitosan-coated plastic films incorporating 4% Green tea extract was the most effective antimicrobial, reducing the initial counts from 3.2 to 2.65 log CFU/cm2 during room temperature storage and from 3.2 to 1–1.5 log CFU/cm2 during refrigerated storage. Conclusions Incorporation of tea extracts into the chitosan-coated films considerably enhanced their effectiveness against L. monocytogenes ATCC 19115. 4% Green tea incorporated into chitosan-coated plastic film had a better antilisterial effect than 2% green tea or 2% and 4% black tea. Data from this study would provide new formulation options for developing antimicrobial packaging films using tea
Occurrence and antimicrobial resistance patterns of Listeria monocytogenes isolated from vegetables.
de Vasconcelos Byrne, Vanessa; Hofer, Ernesto; Vallim, Deyse Christina; de Castro Almeida, Rogeria Comastri
2016-01-01
Although the consumption of fresh and minimally processed vegetables is considered healthy, outbreaks related to the contamination of these products are frequently reported. Among the food-borne pathogens that contaminate vegetables is Listeria monocytogenes, a ubiquitous organism that exhibits the ability to survive and multiply at refrigerated temperatures. This study aimed to evaluate the occurrence of L. monocytogenes in vegetables as well as the antimicrobial resistance of isolates. The results showed that 3.03% of samples were contaminated with L. monocytogenes, comprising 2.22% of raw vegetables and 5.56% of ready-to-eat vegetables. Multiplex PCR confirmed the virulence potential of the isolates. Antimicrobial resistance profiling showed that 50% of the isolates were susceptible to the antibiotics used. The resistance of one isolate to penicillin G, a commonly employed therapeutic agent, and the presence of serotype 4b, a serotype commonly associated with food-borne outbreaks, could be potential health hazards for consumers. Copyright © 2016 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.
Bradley, Derek; McNeil, Brian; Laffey, John G; Rowan, Neil J
2012-06-01
The effects of mild conventional food-processing conditions on Listeria monocytogenes survival to pulsed UV (PUV) irradiation and virulence-associated characteristics were investigated. Specifically, this study describes the inability of 10 strains representative of 3 different culture forms or morphotypes of L. monocytogenes to adapt to normally lethal levels of PUV-irradiation after exposure to sub-lethal concentrations of salt (7.5% (w/v) NaCl for 1 h), acid (pH 5.5 for 1 h), heating (48 °C for 1 h) or PUV (UV dose 0.08 μJ/cm(2)). Findings showed that the order of increasing sensitivity of L. monocytogenes of non-adapted and stressed morphotypes to low pH (pH 3.5 for 5 h, adjusted with lactic), high salt (17.5% w/v NaCl for 5 h), heating (60 °C for 1 h) and PUV-irradiation (100 pulses at 7.2 J and 12.8 J, equivalent to UV doses of 2.7 and 8.4 μJ/cm(2) respectively) was typical wild-type smooth (S/WT), atypical filamentous rough (FR) and atypical multiple-cell-chain (MCR) variants. Exposure of L. monocytogenes cells to sub-lethal acid, salt or heating conditions resulted in similar or increased susceptibility to PUV treatments. Only prior exposure to mild heat stressing significantly enhanced invasion of Caco-2 cells, whereas subjection of L. monocytogenes cells to combined sub-lethal salt, acid and heating conditions produced the greatest reduction in invasiveness. Implications of these findings are discussed. This constitutes the first study to show that pre-exposure to mild conventional food-processing stresses enhances sensitivity of different culture morphotypes of L. monocytogenes to PUV, which is growing in popularity as an alternative or complementary approach for decontamination in the food environment. Copyright © 2011 Elsevier Ltd. All rights reserved.
DEFF Research Database (Denmark)
Fang, Weihuan; Budde, Birgitte Bjørn; Siegumfeldt, Henrik
2006-01-01
A mixed culture of single cells of Listeria monocytogenes and the bacteriocin producing Leuconostoc carnosum 4010 showed growth inhibition of L. monocytogenes, although the intracellular pH (pHi) of L. monocytogenes followed by fluorescence ratio imaging microscopy was not affected. Furthermore, L...
Ligand and membrane-binding behavior of the phosphatidylinositol transfer proteins PITPα and PITPβ.
Baptist, Matilda; Panagabko, Candace; Cockcroft, Shamshad; Atkinson, Jeffrey
2016-12-01
Phosphatidylinositol transfer proteins (PITPs) are believed to be lipid transfer proteins because of their ability to transfer either phosphatidylinositol (PI) or phosphatidylcholine (PC) between membrane compartments, in vitro. However, the detailed mechanism of this transfer process is not fully established. To further understand the transfer mechanism of PITPs we examined the interaction of PITPs with membranes using dual polarization interferometry (DPI), which measures protein binding affinity on a flat immobilized lipid surface. In addition, a fluorescence resonance energy transfer (FRET)-based assay was also employed to monitor how quickly PITPs transfer their ligands to lipid vesicles. DPI analysis revealed that PITPβ had a higher affinity to membranes compared with PITPα. Furthermore, the FRET-based transfer assay revealed that PITPβ has a higher ligand transfer rate compared with PITPα. However, both PITPα and PITPβ demonstrated a preference for highly curved membrane surfaces during ligand transfer. In other words, ligand transfer rate was higher when the accepting vesicles were highly curved.
Sivaramakrishnan, V; Ilamathi, M; Ghosh, K S; Sathish, S; Gowda, T V; Vishwanath, B S; Rangappa, K S; Dhananjaya, B L
2016-01-01
Due to the toxic pathophysiological role of snake venom phospholipase A2 (PLA2 ), its compelling limitations to anti-venom therapy in humans and the need for alternative therapy foster considerable pharmacological interest towards search of PLA2 specific inhibitors. In this study, an integrated approach involving homology modeling, molecular dynamics and molecular docking studies on VRV-PL-V (Vipera russellii venom phospholipase A2 fraction-V) belonging to Group II-B secretory PLA2 from Daboia russelli pulchella is carried out in order to study the structure-based inhibitor design. The accuracy of the model was validated using multiple computational approaches. The molecular docking study of this protein was undertaken using different classes of experimentally proven, structurally diverse synthetic inhibitors of secretory PLA2 whose selection is based on IC50 value that ranges from 25 μM to 100 μM. Estimation of protein-ligand contacts by docking analysis sheds light on the importance of His 47 and Asp 48 within the VRV-PL-V binding pocket as key residue for hydrogen bond interaction with ligands. Our virtual analysis revealed that compounds with different scaffold binds to the same active site region. ADME analysis was also further performed to filter and identify the best potential specific inhibitor against VRV-PL-V. Additionally, the e-pharmacophore was generated for the best potential specific inhibitor against VRV-PL-V and reported here. The present study should therefore play a guiding role in the experimental design of VRV-PL-V inhibitors that may provide better therapeutic molecular models for PLA2 recognition and anti-ophidian activity. Copyright © 2015 John Wiley & Sons, Ltd.
Listeria monocytogenes cross-contamination of cheese: risk throughout the food supply chain.
Sauders, B D; D'Amico, D J
2016-10-01
Listeria monocytogenes has been the most common microbial cause of cheese-related recalls in both the United States and Canada in recent years. Since L. monocytogenes is inactivated by pasteurization, the majority of these cases have been linked to environmental and cross-contamination of fresh-soft, soft-ripened, and semi-soft cheeses. Cross-contamination of foods with L. monocytogenes is a continuous risk throughout the food supply chain and presents unique challenges for subsequent illness and outbreak investigations. Reports on outbreaks of listeriosis attributed to cross-contamination downstream from primary processing help highlight the critical role of epidemiological investigation coupled with coordinated molecular subtyping and surveillance in the recognition and investigation of complex foodborne outbreaks. Despite their complexity, environmental sampling throughout the supply chain coupled with improved genotyping approaches and concomitant analysis of foodborne illness epidemiological exposure data are needed to help resolve these and similar cases more rapidly and with greater confidence.
Directory of Open Access Journals (Sweden)
Karla Sequeira Mendonça
2016-01-01
Full Text Available ABSTRACT: Listeria monocytogenes is of notable concern to the food industry, due to its ubiquitous nature and ability to grow in adverse conditions. This study aimed to determine the genotypic profile of L. monocytogenes strains isolated from refrigerated chickens marketed in the southern part of Rio Grande do Sul, Brazil. The strains of L. monocytogenes isolated were characterized by serotyping and Pulsed Field Gel Electrophoresis (PFGE. Three different serotypes (1/2a, 1/2b and 4e were evaluated by PFGE, and the macrorestriction patterns utilizing enzymes AscI and ApaI, revealed five different pulsotypes. The presence of such varied genotypic profiles demonstrates the prevalence of L. monocytogenes contamination of chicken processing environments, which combined with ineffective cleaning procedures, allowing the survival, adaptation and proliferation of these pathogens, not only in the processing environment, but also in local grocery stores.
Energy Technology Data Exchange (ETDEWEB)
Schlech, W.F. III
1984-01-01
The route or mechanism of transmission of Listeria monocytogenes from its rural veterinary reservoir to newborn and older human populations has been obscure. Anecdotal reports of milk-borne infection from cows with Listeria mastitis have been published, but intensive investigations of small outbreaks of L. monocytogenes infections in humans have not supported a gastrointestinal mode of infection. Several recent studies, however, strongly suggest this possibility, and case-control studies of epidemic listeriosis in the Canadian Maritime provinces in 1981 documented an association between ingestion of uncooked vegetables and the development of illness (p = 0.02). In that study, coleslaw from a regional producer which was distributed throughout the Maritimes was considered to be the vehicle of transmission. Cabbage, the raw product in the production of coleslaw, was contaminated at a farm prior to arrival at the plant. Contamination occurred through fertilization with raw manure from a flock of sheep known to harbor L. monocytogenes. Therefore, an indirect link was established between Listeria monocytogenes infection of sheep on a cabbage farm and subsequent development of invasive listeriosis in humans. This study supports findings from other epidemiologic studies of human listeriosis and is consistent with results of investigations into the mode of transmission of natural and laboratory-acquired listeriosis in animals. 34 references.
The use of Listeria monocytogenes as a DNA delivery vector for cancer gene therapy.
LENUS (Irish Health Repository)
Tangney, Mark
2012-01-31
Listeria monocytogenes is an intracellular pathogen that lyses the phagosomal vacuole of infected cells, proliferates in the host cell cytoplasm and can actively enter adjacent cells. The pathogen is therefore well suited to exploitation as a vector for the delivery of DNA to target cells as the lifecycle favors cellular targeting with vector amplification and the potential for cell-to-cell spread. We have recently demonstrated DNA transfer by L. monocytogenes in growing tumors in murine models. Our approach exploited an ampicillin sensitive stain of L. monocytogenes which can be lysed through systemic administration of ampicillin to facilitate release of plasmid DNA for expression by infected mammalian cells. Here, we discuss the implications of this technology and the potential for future improvements of the system.
Directory of Open Access Journals (Sweden)
Voltaire Sant'Anna
2013-12-01
Full Text Available The antimicrobial activity of the bacteriocin-like substance (BLS P34 against Listeria monocytogenes was investigated in chicken sausage. The BLS was applied to chicken sausages (256 AU g-1 previously inoculated with a suspension of 10² cfu g-1 of L. monocytogenes. BLS P34 inhibited the indicator microorganism in situ in all incubation times for up to 10 days at 5 °C. The effectiveness of BLS P34 was increased when it was added in combination with nisin. The bacteriocin was also tested in natural eatable natural bovine wrapping (salty semi-dried tripe against the same indicator microorganism, also showing inhibitory capability in vitro. BLS P34 showed potential to control L. monocytogenes in refrigerated meat products.
Moderate alcohol consumption and lipoprotein-associated phospholipase A2 activity
Beulens, J.W.J.; Berg, R. van den; Kok, F.J.; Helander, A.; Vermunt, S.H.F.; Hendriks, H.F.J.
2008-01-01
Background and aims: To investigate the effect of moderate alcohol consumption on lipoprotein-associated phospholipase A2 activity, markers of inflammation and oxidative stress and whether these effects are modified by BMI. Methods and results: Eleven lean (BMI: 18.5-25 kg/m2) and 9 overweight (BMI
Mataragas, M.; Zwietering, M.H.; Skandamis, P.N.; Drosinos, E.H.
2010-01-01
The presence of Listeria monocytogenes in a sliced cooked, cured ham-like meat product was quantitatively assessed. Sliced cooked, cured meat products are considered as high risk products. These ready-to-eat, RTE, products (no special preparation, e.g. thermal treatment, before eating is required),
Ottesen, Andrea; Ramachandran, Padmini; Reed, Elizabeth; White, James R; Hasan, Nur; Subramanian, Poorani; Ryan, Gina; Jarvis, Karen; Grim, Christopher; Daquiqan, Ninalynn; Hanes, Darcy; Allard, Marc; Colwell, Rita; Brown, Eric; Chen, Yi
2016-11-16
Microbiota that co-enrich during efforts to recover pathogens from foodborne outbreaks interfere with efficient detection and recovery. Here, dynamics of co-enriching microbiota during recovery of Listeria monocytogenes from naturally contaminated ice cream samples linked to an outbreak are described for three different initial enrichment formulations used by the Food and Drug Administration (FDA), the International Organization of Standardization (ISO), and the United States Department of Agriculture (USDA). Enrichment cultures were analyzed using DNA extraction and sequencing from samples taken every 4 h throughout 48 h of enrichment. Resphera Insight and CosmosID analysis tools were employed for high-resolution profiling of 16S rRNA amplicons and whole genome shotgun data, respectively. During enrichment, other bacterial taxa were identified, including Anoxybacillus, Geobacillus, Serratia, Pseudomonas, Erwinia, and Streptococcus spp. Surprisingly, incidence of L. monocytogenes was proportionally greater at hour 0 than when tested 4, 8, and 12 h later with all three enrichment schemes. The corresponding increase in Anoxybacillus and Geobacillus spp.indicated these taxa co-enriched in competition with L. monocytogenes during early enrichment hours. L. monocytogenes became dominant after 24 h in all three enrichments. DNA sequences obtained from shotgun metagenomic data of Listeria monocytogenes at 48 h were assembled to produce a consensus draft genome which appeared to have a similar tracking utility to pure culture isolates of L. monocytogenes. All three methods performed equally well for enrichment of Listeria monocytogenes. The observation of potential competitive exclusion of L. mono by Anoxybacillus and Geobacillus in early enrichment hours provided novel information that may be used to further optimize enrichment formulations. Application of Resphera Insight for high-resolution analysis of 16S amplicon sequences accurately identified L. monocytogenes
Cloning and Expression of Listeria monocytogenes Listeriolysin O in Lactobacillus plantarum
Directory of Open Access Journals (Sweden)
Masoumeh Hayati
2017-11-01
Full Text Available Background: The protein listeriolysin O (LLO encoded by hly gene, is one of the most important virulence factors of Listeria monocytogenes. This highly potent immunogenic cholesterol binding toxin has hemolytic activity, responsible for phagosomal membrane disruption and bacterial escape to the cytoplasm and facilitating the stimulation of CD8+ T cells and Th1 response. Recently pathobiotechnological vaccination using probiotic bacteria have been proposed. One of these strategies is expression of LLO in non-pathogenic bacteria such as lactic acid bacteria as delivery strains. Objectives: Our aim in this study was cloning of hly gene in a Lactobacillus species via pNZ8110, an inducible expression vector which is specific for Lactococcus species. Materials and Methods: hly gene was amplified by PCR and cloned into pNZ8110 by restriction enzymes cutting and ligation method. After transformation and propagation in E. coli MC1061 intermediate host, it was successfully electrotransformed into Lactobacillus plantarum. Results: Gel electrophoresis of colony PCR, extracted plasmids and restriction analysis along with sequencing confirmed the transformation. After induction using supernatant of nisin producer Lactococcus lactis NZ9700 strain, Expression of LLO was confirmed by SDS PAGE and western blot. Conclusion: Here, we have employed a nonpathogenic probiotic strain; Lactobacillus plantarum for the first time to express hly gene of Listeria monocytogenes in order to propose a new vaccine candidate.