
Sample records for monocytogenes phosphatidylinositol-specific phospholipase

  1. Phosphatidylinositol-specific phospholipase C activity in Lactobacillus rhamnosus with capacity to translocate. (United States)

    Rodriguez, A V; Baigorí, M D; Alvarez, S; Castro, G R; Oliver, G


    Phosphatidylinositol-specific phospholipase C (PI-PLC) activity was investigated in 25 different lactic acid bacteria (LAB) strains belonging to the genera Lactobacillus, Weisella, and Enterococcus. PI-PLC activity was detected in 44% of the strains studied in culture medium without carbon source. From the PI-PLC positive strains, Lactobacillus rhamnosus ATCC 7469 was selected for translocation studies. Healthy mice were orally administered with a daily dose of 2.0 x 10(9) of viable L. rhamnosus suspension. Viable bacteria were detected in liver and spleen of mice fed with LAB for 7 days. Bacterial colonies isolated from liver were biochemically characterized, and further subjected to randomly amplified polymorphic DNA. Amplification patterns of five strains displayed identical profiles to L. rhamnosus. PI-PLC activity was determined in the strains recovered from liver.

  2. Biochemical characterization of the tomato phosphatidylinositol-specific phospholipase C (PI-PLC) family and its role in plant immunity

    NARCIS (Netherlands)

    Abd-El-Haliem, Ahmed; Vossen, J.H.; Zeijl, van Arjan; Dezhsetan, Sara; Testerink, Christa; Seidl, M.F.; Beck, Martina; Strutt, James; Robatzek, Silke; Joosten, M.H.A.J.


    Plants possess effective mechanisms to quickly respond to biotic and abiotic stresses. The rapid activation of phosphatidylinositol-specific phospholipase C (PLC) enzymes occurs early after the stimulation of plant immune-receptors. Genomes of different plant species encode multiple PLC homologs

  3. Modulation of Bacillus thuringiensis Phosphatidylinositol-Specific Phospholipase C Activity by Mutations in the Putative Dimerization Interface

    Energy Technology Data Exchange (ETDEWEB)

    Shi, X.; Shao, C; Zhang, X; Zambonelli, C; Redfield, A; Head, J; Seaton, B; Roberts, M


    Cleavage of phosphatidylinositol (PI) to inositol 1,2-(cyclic)-phosphate (cIP) and cIP hydrolysis to inositol 1-phosphate by Bacillus thuringiensis phosphatidylinositol-specific phospholipase C are activated by the enzyme binding to phosphatidylcholine (PC) surfaces. Part of this reflects improved binding of the protein to interfaces. However, crystallographic analysis of an interfacially impaired phosphatidylinositol-specific phospholipase (W47A/W242A) suggested protein dimerization might occur on the membrane. In the W47A/W242A dimer, four tyrosine residues from one monomer interact with the same tyrosine cluster of the other, forming a tight dimer interface close to the membrane binding regions. We have constructed mutant proteins in which two or more of these tyrosine residues have been replaced with serine. Phospholipid binding and enzymatic activity of these mutants have been examined to assess the importance of these residues to enzyme function. Replacing two tyrosines had small effects on enzyme activity. However, removal of three or four tyrosine residues weakened PC binding and reduced PI cleavage by the enzyme as well as PC activation of cIP hydrolysis. Crystal structures of Y247S/Y251S in the absence and presence of myo-inositol as well as Y246S/Y247S/Y248S/Y251S indicate that both mutant proteins crystallized as monomers, were very similar to one another, and had no change in the active site region. Kinetic assays, lipid binding, and structural results indicate that either (i) a specific PC binding site, critical for vesicle activities and cIP activation, has been impaired, or (ii) the reduced dimerization potential for Y246S/Y247S/Y248S and Y246S/Y247S/Y248S/Y251S is responsible for their reduced catalytic activity in all assay systems.

  4. Glycolipid precursors for the membrane anchor of Trypanosoma brucei variant surface glycoproteins. II. Lipid structures of phosphatidylinositol-specific phospholipase C sensitive and resistant glycolipids

    International Nuclear Information System (INIS)

    Mayor, S.; Menon, A.K.; Cross, G.A.


    A common diagnostic feature of glycosylinositol phospholipid (GPI)-anchored proteins is their release from the membrane by a phosphatidylinositol-specific phospholipase C (PI-PLC). However, some GPI-anchored proteins are resistant to this enzyme. The best characterized example of this subclass is the human erythrocyte acetylcholinesterase, where the structural basis of PI-PLC resistance has been shown to be the acylation of an inositol hydroxyl group(s). Both PI-PLC-sensitive and resistant GPI-anchor precursors (P2 and P3, respectively) have been found in Trypanosoma brucei, where the major surface glycoprotein is anchored by a PI-PLC-sensitive glycolipid anchor. The accompanying paper shows that P2 and P3 have identical glycans, indistinguishable from the common core glycan found on all the characterized GPI protein anchors. This paper shows that the single difference between P2 and P3, and the basis for the PI-PLC insusceptibility of P3, is a fatty acid, ester-linked to the inositol residue in P3. The inositol-linked fatty acid can be removed by treatment with mild base to restore PI-PLC sensitivity. Biosynthetic labeling experiments with [3H]palmitic acid and [3H]myristic acid show that [3H]palmitic acid specifically labels the inositol residue in P3 while [3H]myristic acid labels the diacylglycerol portion. Possible models to account for the simultaneous presence of PI-PLC-resistant and sensitive glycolipids are discussed in the context of available information on the biosynthesis of GPI-anchors

  5. InlB-mediated Listeria monocytogenes internalization requires a balanced phospholipase D activity maintained through phospho-cofilin

    NARCIS (Netherlands)

    Han, Xuelin; Yu, Rentao; Ji, Lei; Zhen, Dongyu; Tao, Sha; Li, Shuai; Sun, Yansong; Huang, Liuyu; Feng, Zhe; Li, Xianping; Han, Gaige; Schmidt, Martina; Han, Li

    Internalization of Listeria monocytogenes into non-phagocytic cells is tightly controlled by host cell actin dynamics and cell membrane alterations. However, knowledge about the impact of phosphatidylcholine cleavage driven by host cell phospholipase D (PLD) on Listeria internalization into

  6. Stalling autophagy: a new function for Listeria phospholipases

    Directory of Open Access Journals (Sweden)

    Ivan Tattoli


    Full Text Available Listeria monocytogenes is a Gram-positive bacterial pathogen that induces its own uptake in non-phagocytic cells. Following invasion, Listeria escapes from the entry vacuole through the secretion of a pore-forming toxin, listeriolysin O (LLO that acts to damage and disrupt the vacuole membrane. Listeria then replicates in the cytosol and is able to spread from cell-to-cell using actin-based motility. In addition to LLO, Listeria produces two phospholipase toxins, a phosphatidylinositol-specific phospholipase C (PI-PLC, encoded by plcB and a broad-range phospholipase C (PC-PLC, encoded by plcA, which contribute to bacterial virulence. It has long been recognized that secretion of PI- and PC-PLC enables the disruption of the double membrane vacuole during cell-to-cell spread, and those phospholipases have also been shown to augment LLO-dependent escape from the entry endosome. However, a specific role for Listeria phospholipases during the cytosolic stage of infection has not been previously reported. In a recent study, we demonstrated that Listeria PI-PLC and PC-PLC contribute to the bacterial escape from autophagy through a mechanism that involves direct inhibition of the autophagic flux in the infected cells [Tattoli et al. EMBO J (2013, 32, 3066-3078].

  7. Listeria monocytogenes: Overview and Targeting Advances

    Directory of Open Access Journals (Sweden)

    Mostafa F.N. Abushahba


    Full Text Available Listeria monocytogenes is a serious foodborne zoonotic pathogen capable of causing gastroenteritis and severe systemic infections such as septicemia, meningitis or abortion in the infected individuals what is called listeriosis. The bacterium is reported as the third leading cause of death among the foodborne pathogens preceded by nontyphoidal Salmonella spp. and Toxoplasma gondii. The power to tolerate a wide range of temperatures is considered the most prominent trait distinguishing it from the other foodborne pathogens. Within the infected host, the bacteria harbor inside macrophages and jump from cell to another without leaving the safeguarding milieu of the host's cells utilizing a set of genes including hly (listeriolysin O, plcA (phosphatidylinositol-specific phospholipase c, plcB (phosphatidylcholine-phospholipase C and actA (actin-assembly inducing protein. In addition to the health concerns associated with antibiotics, treatment failure likely occurs among listeriosis-infected persons especially with the inability of most antibiotics to access intracellular replicative niches and achieve the optimum therapeutic concentrations within the infected cells. Recently, one novel choice, peptide nucleic acid (PNA, has been emerged to target this bacterium as a model of targeting intracellular pathogens with anti-sense agents. PNA is a one of the DNA analogues which works via specific inhibition of bacterial gene expression.

  8. Prevalence, Virulence Potential, and Antibiotic Susceptibility Profile of Listeria monocytogenes Isolated From Bovine Raw Milk Samples Obtained From Rajasthan, India. (United States)

    Sharma, Sanjita; Sharma, Vishnu; Dahiya, Dinesh Kumar; Khan, Aarif; Mathur, Manisha; Sharma, Amit


    Listeriosis is a serious foodborne disease of a global concern, and can effectively be controlled by a continuous surveillance of the virulent and multidrug-resistant strains of Listeria monocytogenes. This study was planned to investigate prevalence of L. monocytogenes in bovine raw milk samples. A total of 457 raw milk samples collected from 15 major cities in Rajasthan, India, were analyzed for the presence of L. monocytogenes by using standard microbiological and molecular methods. Five of the 457 samples screen tested positive for L. monocytogenes. Multiplex serotyping showed that 3/5 strains belonged to serotype 4b followed by one strain each to 1/2a and to 1/2c. Further virulence potential assessment indicated that all strains possessed inlA and inlC internalins, and, in addition, two strains also possessed the gene for inlB. All strains were positive for Listeriolysin O (LLO) and showed phosphatidylinositol-specific phospholipase C (PI-PLC) activity on an in vitro agar medium with variations in production levels among the strains. A good correlation between the in vitro pathogenicity test and the chick embryo test was observed, as the strains showing higher LLO and PI-PLC activity were found to be lethal to fertilized chick embryos. All strains were resistant to the majority of antibiotics and were designated as multidrug-resistant strains. However, these strains were susceptible to 9 of the 22 tested antibiotics. The maximum zone of inhibition (mm) and acceptable minimum inhibitory concentration were observed with azithromycin, and thus it could be the first choice of a treatment. Overall, the presence of multidrug-resistant L. monocytogenes strains in the raw milk of Rajasthan region is an indicator of public health hazard and highlighting the need of consumer awareness in place and implementation of stricter food safety regulations at all levels of milk production.

  9. Characteristics of the biologically active 35-kDa metalloprotease virulence factor from Listeria monocytogenes

    NARCIS (Netherlands)

    Coffey, A; van den Burg, B; Veltman, R; Abee, T

    Listeria monocytogenes, a facultative intracellular pathogen, synthesizes an extracellular protease which is responsible for the maturation of phosphatidylcholine phospholipase C (lecithinase), a virulence factor involved in cell-to-cell spread. This work describes the environmental parameters

  10. Listeria monocytogenes serovar 4a is a possible evolutionary intermediate between L. monocytogenes serovars 1/2a and 4b and L. innocua. (United States)

    Chen, Jianshun; Jiang, Lingli; Chen, Xueyan; Luo, Xiaokai; Chen, Yang; Yu, Ying; Tian, Guoming; Liu, Dongyou; Fang, Weihuan


    The genus Listeria consists of six closely related species and forms three phylogenetic groups: L. monocytogenes- L. innocua, L. ivanovii-L. seeligeri-L. welshimeri, and L. grayi. In this report, we attempted to examine the evolutionary relationship in the L. monocytogenes-L. innocua group by probing the nucleotide sequences of 23S rRNA and 16S rRNA, and the gene clusters lmo0029-lmo0042, ascBdapE, rplS-infC, and prs-ldh in L. monocytogenes serovars 1/2a, 4a, and 4b, and L. innocua. Additionally, we assessed the status of L. monocytogenes-specific inlA and inlB genes and 10 L. innocua-specific genes in these species/serovars, together with phenotypic characterization by using in vivo and in vitro procedures. The results indicate that L. monocytogenes serovar 4a strains are genetically similar to L. innocua in the lmo0035-lmo0042, ascB-dapE, and rplS-infC regions and also possess L. innocua-specific genes lin0372 and lin1073. Furthermore, both L. monocytogenes serovar 4a and L. innocua exhibit impaired intercellular spread ability and negligible pathogenicity in mouse model. On the other hand, despite resembling L. monocytogenes serovars 1/2a and 4b in having a nearly identical virulence gene cluster, and inlA and inlB genes, these serovar 4a strains differ from serovars 1/2a and 4b by harboring notably altered actA and plcB genes, displaying strong phospholipase activity and subdued in vivo and in vitro virulence. Thus, by possessing many genes common to L. monocytogenes serovars 1/2a and 4b, and sharing many similar gene deletions with L. innocua, L. monocytogenes serovar 4a represents a possible evolutionary intermediate between L. monocytogenes serovars 1/2a and 4b and L. innocua.

  11. Superantigen and HLA-DR ligation induce phospholipase-C gamma 1 activation in class II+ T cells

    DEFF Research Database (Denmark)

    Kanner, S B; Odum, Niels; Grosmaire, L


    Bacterial enterotoxin superantigens bind directly to HLA class II molecules (HLA-DR) expressed on both APC and activated human T cells, and simultaneously bind to certain V beta chains of the TCR. In this report, we compared early T cell signaling events in human alloantigen-stimulated T cells when...... activated by HLA-DR ligation through antibody cross-linking or by direct enterotoxin superantigen binding. Both types of stimuli induced tyrosine phosphorylation of phosphatidylinositol-specific phospholipase C gamma 1 (PLC gamma 1) and an increase in intracellular calcium concentration; however......, superantigen-induced signaling was stronger than class II ligation alone. Antibody-mediated ligation of HLA-DR with CD3 resulted in augmented PLC gamma 1 activation and increased calcium mobilization, consistent with a mechanism of superantigen activity through a combination of class II and CD3/Ti signals...

  12. The Propeptide of the Metalloprotease of Listeria monocytogenes Controls Compartmentalization of the Zymogen during Intracellular Infection▿


    O'Neil, Heather S.; Forster, Brian M.; Roberts, Kari L.; Chambers, Andrew J.; Bitar, Alan Pavinski; Marquis, Hélène


    Integral to the virulence of the intracellular bacterial pathogen Listeria monocytogenes is its metalloprotease (Mpl). Mpl regulates the activity and compartmentalization of the bacterial broad-range phospholipase C (PC-PLC). Mpl is secreted as a proprotein that undergoes intramolecular autocatalysis to release its catalytic domain. In related proteases, the propeptide serves as a folding catalyst and can act either in cis or in trans. Propeptides can also influence protein compartmentalizati...

  13. The Metalloprotease of Listeria monocytogenes Is Activated by Intramolecular Autocatalysis▿ †


    Bitar, Alan Pavinski; Cao, Min; Marquis, Hélène


    The metalloprotease (Mpl) of Listeria monocytogenes is a thermolysin-like protease that mediates the maturation of a broad-range phospholipase C, whose function contributes to the ability of this food-borne bacterial pathogen to survive intracellularly. Mpl is made as a proprotein that undergoes maturation by proteolytic cleavage of a large N-terminal prodomain. In this study, we identified the N terminus of mature Mpl and generated Mpl catalytic mutants to investigate the mechanism of Mpl ma...

  14. Listeria monocytogenes: diagnostic problems

    NARCIS (Netherlands)

    Beumer, R.R.; Hazeleger, W.C.


    The first isolation methods for the detection of Listeria spp. were generally based on the direct culture of samples on simple agar media, but isolation of the pathogenic Listeria monocytogenes was difficult. In time, new techniques were developed, based on a variety of selective and elective agents

  15. Listeria monocytogenes Monographic Study

    Directory of Open Access Journals (Sweden)

    Emil Tirziu


    Full Text Available Listeria monocytogenes is a ubiquitous bacteria with a remarkable resistance in discordant condition which produce listeriosis, an infectious disease that affects multiple domestic and wild animals’ species, but also humans. Receptive to listeriosis are the majority of domestic or wild mammals and birds, in the last years being registered an increase of receptivity in humans. The concept of listeriosis in human pathology, a disease caused by eating or drinking contaminated food and water, appeared for the first time in 1981, during an outbreak in Canada with seven cases in adults and 34 cases of maternalfetal listeriosis. The alimentary origin of human listeriosis can be easily explained if considered some general characteristics of the bacteria. Thus, resistance in various conditions, especially at lower temperatures, justifies its dissemination and food contamination, particularly when is conserved by refrigeration. Also, L. monocytogenes has a significant presence in alimentary products. Some studies showed that 4% of the milk products, 29% of the meat products, 5% of the vegetable products and 26% of the products obtained from fishes and shell fishes are positive for L. monocytogenes, which allows us to say that battle against these bacteria is a war against microbial contamination.

  16. First Trimester Listeria monocytogenes Septicemia

    NARCIS (Netherlands)

    Goddijn, M.; Schipper, H. G.; Spanjaard, L.; Wolf, H.


    Background: Little is known about fetal outcome after Listeria monocytogenes septicemia in the first trimester of pregnancy.Case: A primigravida with L. monocytogenes septicemia at 9 weeks gestation was treated with amoxicillin. At 40 weeks gestation a healthy female infant was born.Conclusion: This

  17. Isolation and biochemical and molecular characterization of Listeria monocytogenes in food

    International Nuclear Information System (INIS)

    Helel, Salma


    monocytogenes is a Gram-positive bacteria, saprophytic, non-spore. This is an extremely resistant seeds to environmental conditions outside, especially since the cold psychrotrophic. It can contaminate raw vegetables, cooked meals ready for consumption or foods to be stored in the refrigerator, such as cheese or meat. It is the bacteria responsible for listeriosis. It threatens first unborn children, infants, pregnant women, the elderly and people whose immune system is weakened. Strains of Listeria spp isolated from foods (seafood, meat, meat) were first identified at the stage of the genus by classical tests (Gram staining, catalase test, oxidase test and mobility) and stage of the test case by hemolysis, CAMP test and the gallery Api Listeria. Biochemical characterization allowed after a numerical analysis, to assign 100% of isolates to the genus Listeria. Molecular characterization was performed by PCR amplification of genes coding for protein p60 (iap), the listeriolysine O (hly), the Phosphatidylinositol Phospholipase C (PI-PLC plca) Phosphatidylcholine Phospholipase C (plcB). The result showed an amplification of the iap gene of 100% of the hly gene, plca, plcB of 31.81%. This characterization represents an identification of the collection on the genetic level and shows that 31.81% of isolates, is likely to express the genes responsible for virulence factors of L. monocytogenes, to produce listeriolysine O, phospholipase C and Lecithinase. The molecular identification was performed by microarray technique and identified isolates L. September monocytogenes (five original clinical isolates and two food-borne), fourteen L. innocua (of food) and a strain not identified by DNA chip.. (Author)

  18. Fødevarebetinget listeria monocytogenes endokarditis

    DEFF Research Database (Denmark)

    Frydland, Martin; Bundgaard, Henning; Moser, Claus


    Infection with Listeria monocytogenes is rare and mainly seen in immunosuppressed patients. Infection with L. monocytogenes has a mortality rate of 30%. We present a case report of L. monocytogenes bacteraemia and endocarditis in a 70-year-old man with several co-morbidities and following four...... major surgical procedures. This illustrates the findings and characteristics in one of the 16 patients who died in 2013 and 2014 this summer due to sausage-related L. monocytogenes infection....

  19. Cysteine Biosynthesis Controls Serratia marcescens Phospholipase Activity. (United States)

    Anderson, Mark T; Mitchell, Lindsay A; Mobley, Harry L T


    Serratia marcescens causes health care-associated opportunistic infections that can be difficult to treat due to a high incidence of antibiotic resistance. One of the many secreted proteins of S. marcescens is the PhlA phospholipase enzyme. Genes involved in the production and secretion of PhlA were identified by screening a transposon insertion library for phospholipase-deficient mutants on phosphatidylcholine-containing medium. Mutations were identified in four genes ( cyaA , crp , fliJ , and fliP ) that are involved in the flagellum-dependent PhlA secretion pathway. An additional phospholipase-deficient isolate harbored a transposon insertion in the cysE gene encoding a predicted serine O -acetyltransferase required for cysteine biosynthesis. The cysE requirement for extracellular phospholipase activity was confirmed using a fluorogenic phospholipase substrate. Phospholipase activity was restored to the cysE mutant by the addition of exogenous l-cysteine or O -acetylserine to the culture medium and by genetic complementation. Additionally, phlA transcript levels were decreased 6-fold in bacteria lacking cysE and were restored with added cysteine, indicating a role for cysteine-dependent transcriptional regulation of S. marcescens phospholipase activity. S. marcescens cysE mutants also exhibited a defect in swarming motility that was correlated with reduced levels of flhD and fliA flagellar regulator gene transcription. Together, these findings suggest a model in which cysteine is required for the regulation of both extracellular phospholipase activity and surface motility in S. marcescens IMPORTANCE Serratia marcescens is known to secrete multiple extracellular enzymes, but PhlA is unusual in that this protein is thought to be exported by the flagellar transport apparatus. In this study, we demonstrate that both extracellular phospholipase activity and flagellar function are dependent on the cysteine biosynthesis pathway. Furthermore, a disruption of cysteine

  20. Listeria monocytogenes endophthalmitis following keratoconjunctivitis. (United States)

    Shoughy, Samir S; Tabbara, Khalid F


    Endophthalmitis due to endogenous or exogenous bacteria is a rare infection of the eye. We report a case of endophthalmitis following Listeria monocytogenes keratoconjunctivitis in a 27-year-old healthy white male presenting with hand motion visual acuity, right eye mucopurulent conjunctivitis, elevated intraocular pressure, and pigmented hypopyon 6 months post-keratectomy. The conjunctivitis was unresponsive to a 5-day course of topical tobramycin eye drops, and the patient developed keratitis with pain that progressed to endophthalmitis after 21 days. Diagnostic B-scan revealed vitreous exudates. Intraocular fluid specimen showed Gram-positive organisms and the aqueous culture grew penicillin-/aminoglycoside-sensitive L. monocytogenes. The patient was given intravitreal and systemic vancomycin and ceftazidime. The eye was unresponsive to intravenous penicillin and gentamicin; the anterior chamber progressively flattened and developed phthisis bulbi. L. monocytogenes keratoconjunctivitis may lead to bacterial endophthalmitis. Prompt culture and early antibiotic therapy are recommended.

  1. Listeria monocytogenes endophthalmitis following keratoconjunctivitis

    Directory of Open Access Journals (Sweden)

    Shoughy SS


    Full Text Available Samir S Shoughy,1 Khalid F Tabbara1–31The Eye Center and The Eye Foundation for Research in Ophthalmology, Riyadh, Saudi Arabia; 2Department of Ophthalmology, College of Medicine, King Saud University, Riyadh, Saudi Arabia; 3The Wilmer Ophthalmological Institute of The Johns Hopkins University School of Medicine, Baltimore, MD, USAAbstract: Endophthalmitis due to endogenous or exogenous bacteria is a rare infection of the eye. We report a case of endophthalmitis following Listeria monocytogenes keratoconjunctivitis in a 27-year-old healthy white male presenting with hand motion visual acuity, right eye mucopurulent conjunctivitis, elevated intraocular pressure, and pigmented hypopyon 6 months post-keratectomy. The conjunctivitis was unresponsive to a 5-day course of topical tobramycin eye drops, and the patient developed keratitis with pain that progressed to endophthalmitis after 21 days. Diagnostic B-scan revealed vitreous exudates. Intraocular fluid specimen showed Gram-positive organisms and the aqueous culture grew penicillin-/aminoglycoside-sensitive L. monocytogenes. The patient was given intravitreal and systemic vancomycin and ceftazidime. The eye was unresponsive to intravenous penicillin and gentamicin; the anterior chamber progressively flattened and developed phthisis bulbi. L. monocytogenes keratoconjunctivitis may lead to bacterial endophthalmitis. Prompt culture and early antibiotic therapy are recommended.Keywords: conjunctivitis, L. monocytogenes, endophthalmitis

  2. Phospholipase D function in Saccharomyces cerevisiae. (United States)

    Mendonsa, Rima; Engebrecht, JoAnne


    Phosphatidylinositol 4,5-bisphosphate-regulated phosphatidylcholine-specific phospholipase D is conserved from yeast to man. The essential role of this enzyme in yeast is to mediate the fusion of Golgi and endosome-derived vesicles to generate the prospore membrane during the developmental program of sporulation, through the production of the fusogenic lipid phosphatidic acid. In addition to recruiting proteins required for fusion, phosphatidic acid is believed to lower the energy barrier to stimulate membrane curvature. During mitotic growth, phospholipase D activity is dispensable unless the major phosphatidylinositol/phosphatidylcholine transfer protein is absent; it also appears to play a nonessential role in the mating signal transduction pathway. The regulation of phospholipase D activity during both sporulation and mitotic growth is still not fully understood and awaits further characterization.

  3. Listeria monocytogenes en alimentos: ¿son todos los aislamientos igual de virulentos? Foodborne Listeria monocytogenes: are all the isolates equally virulent?

    Directory of Open Access Journals (Sweden)

    V. López


    Full Text Available Listeria monocytogenes es un patógeno humano que se transmite a través de los alimentos y que causa infecciones graves, con una alta tasa de mortalidad. A pesar de la ubicuidad del microorganismo, la tasa real de la enfermedad es bastante baja y se asocia casi siempre a condiciones predisponentes. Tradicionalmente se consideraba que los aislamientos presentes en los alimentos y en el ambiente tenían la misma capacidad patogénica que los aislamientos de origen clínico. Pero el análisis de mutaciones en los genes de determinados factores de virulencia (internalina, hemolisina, fosfolipasas, proteína de superficie ActA y proteína reguladora PrfA, los estudios cuantitativos realizados con cultivos celulares y la genética de poblaciones, están replanteando la discusión sobre la variabilidad de la virulencia de L. monocytogenes. A pesar de todos estos avances, no existe un único marcador que permita comprobar la virulencia de los aislamientos naturales de esta especie. Probablemente en el futuro, la combinación de diferentes marcadores moleculares permitirá detectar los alimentos contaminados sólo por los clones virulentos de L. monocytogenes, con lo que se mejorará la prevención de la listeriosis humana transmitida por alimentos.Listeria monocytogenes is a foodborne human pathogen responsible for invasive infections presenting overall a high mortality. Despite the ubiquity of the microorganism, the actual disease rate is quite low and the disease is most often associated with an underlying predisposition. Foodborne and environmental isolates were traditionally considered of similar pathogenicity compared to clinical isolates. But the analysis of mutations in the genes encoding specific virulence factors (internalin, hemolysin, phospholipases, surface protein ActA and regulator protein PrfA, quantitative studies with cell cultures and population genetics have raised considerable concerns about virulence differences among L

  4. Phospholipase Cδ regulates germination of Dictyostelium spores

    NARCIS (Netherlands)

    Dijken, Peter van; Haastert, Peter J.M. van


    Background: Many eukaryotes, including plants and fungi make spores that resist severe environmental stress. The micro-organism Dictyostelium contains a single phospholipase C gene (PLC); deletion of the gene has no effect on growth, cell movement and differentiation. In this report we show that PLC

  5. Relation between various phospholipase actions on human red cell membranes and the interfacial phospholipid pressure in monolayers

    NARCIS (Netherlands)

    Demel, R.A.; Geurts van Kessel, W.S.M.; Zwaal, R.F.A.; Roelofsen, B.; Deenen, L.L.M. van


    The action of purified phospholipases on monomolecular films of various interfacial pressures is compared with the action on erythrocyte membranes. The phospholipases which cannot hydrolyse phospholipids of the intact erythrocyte membrane, phospholipase C from Bacillus cereus, phospholipase A2 from

  6. Effects of dexamethasone on palate mesenchymal cell phospholipase activity

    International Nuclear Information System (INIS)

    Bulleit, R.F.; Zimmerman, E.F.


    Corticosteroids will induce cleft palate in mice. One suggested mechanism for this effect is through inhibition of phospholipase activity. This hypothesis was tested by measuring the effects of dexamethasone, a synthetic corticosteroid, on phospholipase activity in cultures of palate mesenchymal cells. Palate mesenchymal cells were prelabeled with [3H]arachidonic acid. The cells were subsequently treated with various concentrations of dexamethasone. Concurrently, cultures of M-MSV-transformed 3T3 cells were prepared identically. After treatment, phospholipase activity was stimulated by the addition of serum or epidermal growth factor (EGF), and radioactivity released into the medium was taken as a measure of phospholipase activity. Dexamethasone (1 X 10(-5) or 1 X 10(-4) M) could inhibit serum-stimulated phospholipase activity in transformed 3T3 cells after 1 to 24 hr of treatment. However, no inhibition of activity was measured in palate mesenchymal cells following this period of treatment. Not until 120 hr of treatment with dexamethasone (1 X 10(-4) M) was any significant inhibition of serum-stimulated phospholipase activity observed in palate mesenchymal cells. When EGF was used to stimulate phospholipase activity, dexamethasone (1 X 10(-5) M) caused an increase in phospholipase activity in palate mesenchymal cells. These observations suggested that phospholipase in transformed 3T3 cells was sensitive to inhibition by dexamethasone. However, palate mesenchymal cell phospholipase is only minimally sensitive to dexamethasone, and in certain instances can be enhanced. These results cannot support the hypothesis that corticosteroids mediate their teratogenic effect via inhibition of phospholipase activity

  7. A non-catalytic histidine residue influences the function of the metalloprotease of Listeria monocytogenes. (United States)

    Forster, Brian M; Bitar, Alan Pavinski; Marquis, Hélène


    Mpl, a thermolysin-like metalloprotease, and PC-PLC, a phospholipase C, are synthesized as proenzymes by the intracellular bacterial pathogen Listeria monocytogenes. During intracellular growth, L. monocytogenes is temporarily confined in a membrane-bound vacuole whose acidification leads to Mpl autolysis and Mpl-mediated cleavage of the PC-PLC N-terminal propeptide. Mpl maturation also leads to the secretion of both Mpl and PC-PLC across the bacterial cell wall. Previously, we identified negatively charged and uncharged amino acid residues within the N terminus of the PC-PLC propeptide that influence the ability of Mpl to mediate the maturation of PC-PLC, suggesting that these residues promote the interaction of the PC-PLC propeptide with Mpl. In the present study, we identified a non-catalytic histidine residue (H226) that influences Mpl secretion across the cell wall and its ability to process PC-PLC. Our results suggest that a positive charge at position 226 is required for Mpl functions other than autolysis. Based on the charge requirement at this position, we hypothesize that this residue contributes to the interaction of Mpl with the PC-PLC propeptide.

  8. Rapid colorimetric assay for detection of Listeria monocytogenes in food samples using LAMP formation of DNA concatemers and gold nanoparticle-DNA probe complex (United States)

    Wachiralurpan, Sirirat; Sriyapai, Thayat; Areekit, Supatra; Sriyapai, Pichapak; Augkarawaritsawong, Suphitcha; Santiwatanakul, Somchai; Chansiri, Kosum


    ABSTRACT Listeria monocytogenes is a major foodborne pathogen of global health concern. Herein, the rapid diagnosis of L. monocytogenes has been achieved using loop-mediated isothermal amplification (LAMP) based on the phosphatidylcholine-phospholipase C gene (plcB). Colorimetric detection was then performed through the formation of DNA concatemers and a gold nanoparticle/DNA probe complex (GNP/DNA probe). The overall detection process was accomplished within approximately 1 h with no need for complicated equipment. The limits of detection for L. monocytogenes in the forms of purified genomic DNA and pure culture were 800 fg and 2.82 CFU mL-1, respectively. No cross reactions were observed from closely related bacteria species. The LAMP-GNP/DNA probe assay was applied to the detection of 200 raw chicken meat samples and compared to routine standard methods. The data revealed that the specificity, sensitivity and accuracy were 100%, 90.20% and 97.50%, respectively. The present assay was 100% in conformity with LAMP-agarose gel electrophoresis assay. Five samples that were negative by both assays appeared to have the pathogen at below the level of detection. The assay can be applied as a rapid direct screening method for L. monocytogenes.

  9. Secretory Phospholipase A2-IIA and Cardiovascular Disease

    DEFF Research Database (Denmark)

    Holmes, Michael V; Simon, Tabassome; Exeter, Holly J


    This study sought to investigate the role of secretory phospholipase A2 (sPLA2)-IIA in cardiovascular disease.......This study sought to investigate the role of secretory phospholipase A2 (sPLA2)-IIA in cardiovascular disease....

  10. Purification of phospholipase A2 from Bothrops atrox venom

    Directory of Open Access Journals (Sweden)

    B. Quevedo


    Full Text Available Phospholipase A2 (PLA2 from Bothrops atrox (Sensu lato venom, from Chiriguaná (Colombia was purified using exclusión chromatography on Sephadex G-75, obtaining five fractions one of which showed phospholipase A2 activity. After further purification on Mono S cationic exchange column, eight fractions with PLA2 activity, measured using the hemolytic method, were obtained.

  11. Quercetin modulates activities of Taiwan cobra phospholipase A 2 ...

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Biosciences; Volume 37; Issue 2. Quercetin modulates activities of Taiwan cobra phospholipase A2 via its effects on membrane structure and membrane-bound mode of phospholipase A2. Yi-Ling Chiou Shinne-Ren Lin Wan-Ping Hu Long-Sen Chang. Articles Volume 37 Issue 2 June 2012 pp ...

  12. 40 CFR 721.4585 - Lecithins, phospholipase A2-hydrolyzed. (United States)


    ... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Lecithins, phospholipase A2-hydrolyzed... Substances § 721.4585 Lecithins, phospholipase A2-hydrolyzed. (a) Chemical substances and significant new uses subject to reporting. (1) The chemical substances identified generically as lecithins...

  13. Assay strategies and methods for phospholipases

    International Nuclear Information System (INIS)

    Reynolds, L.J.; Washburn, W.N.; Deems, R.A.; Dennis, E.A.


    Of the general considerations discussed, the two issues which are most important in choosing an assay are (1) what sensitivity is required to assay a particular enzyme and (2) whether the assay must be continuous. One can narrow the options further by considering substrate availability, enzyme specificity, assay convenience, or the presence of incompatible side reactions. In addition, the specific preference of a particular phospholipase for polar head group, micellar versus vesicular substrates, and anionic versus nonionic detergents may further restrict the options. Of the many assays described in this chapter, several have limited applicability or serious drawbacks and are not commonly employed. The most commonly used phospholipase assays are the radioactive TLC assay and the pH-stat assay. The TLC assay is probably the most accurate, sensitive assay available. These aspects often outweigh the disadvantages of being discontinuous, tedious, and expensive. The radioactive E. coli assay has become popular recently as an alternative to the TLC assay for the purification of the mammalian nonpancreatic phospholipases. The assay is less time consuming and less expensive than the TLC assay, but it is not appropriate when careful kinetics are required. Where less sensitivity is needed, or when a continuous assay is necessary, the pH-stat assay is often employed. With purified enzymes, when free thiol groups are not present, a spectrophotometric thiol assay can be used. This assay is ∼ as sensitive as the pH-stat assay but is more convenient and more reproducible, although the substrate is not available commercially. Despite the many assay choices available, the search continues for a convenient, generally applicable assay that is both sensitive and continuous

  14. Substance P Activates Ca2+-Permeable Nonselective Cation Channels through a Phosphatidylcholine-Specific Phospholipase C Signaling Pathway in nNOS-Expressing GABAergic Neurons in Visual Cortex. (United States)

    Endo, Toshiaki; Yanagawa, Yuchio; Komatsu, Yukio


    To understand the functions of the neocortex, it is essential to characterize the properties of neurons constituting cortical circuits. Here, we focused on a distinct group of GABAergic neurons that are defined by a specific colocalization of intense labeling for both neuronal nitric oxide synthase (nNOS) and substance P (SP) receptor [neurokinin 1 (NK1) receptors]. We investigated the mechanisms of the SP actions on these neurons in visual cortical slices obtained from young glutamate decarboxylase 67-green fluorescent protein knock-in mice. Bath application of SP induced a nonselective cation current leading to depolarization that was inhibited by the NK1 antagonists in nNOS-immunopositive neurons. Ruthenium red and La(3+), transient receptor potential (TRP) channel blockers, suppressed the SP-induced current. The SP-induced current was mediated by G proteins and suppressed by D609, an inhibitor of phosphatidylcholine-specific phospholipase C (PC-PLC), but not by inhibitors of phosphatidylinositol-specific PLC, adenylate cyclase or Src tyrosine kinases. Ca(2+) imaging experiments under voltage clamp showed that SP induced a rise in intracellular Ca(2+) that was abolished by removal of extracellular Ca(2+) but not by depletion of intracellular Ca(2+) stores. These results suggest that SP regulates nNOS neurons by activating TRP-like Ca(2+)-permeable nonselective cation channels through a PC-PLC-dependent signaling pathway. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail:

  15. 78 FR 27939 - Draft Interagency Risk Assessment-Listeria monocytogenes (United States)


    ... Listeria (L.) monocytogenes contamination of certain ready-to-eat (RTE) foods, for example cheese, deli... Scott, V.N., Survey of Listeria monocytogenes in ready-to-eat foods. Journal of Food Protection, 2003... monocytogenes in ready-to-eat processed meat and poultry collected in four FoodNet states in International...

  16. Occurrence of Listeria monocytogenes in smoked fish in Sokoto ...

    African Journals Online (AJOL)



    Sep 3, 2008 ... monocytogenes and other Listeria species are common contaminant of smoked fish, and this may pose serious public health implications. Key words: Smoked fish, Listeria monocytogenes, contamination, public health. INTRODUCTION ... L. monocytogenes belong to the recently emerging psychrotrophic ...

  17. Listeria monocytogenes infection in pregnancy and neonatal sepsis

    Directory of Open Access Journals (Sweden)

    Francesca Pascale


    Full Text Available Authors report a fatal neonatal sepsis caused by Listeria monocytogenes. While the diagnostic procedure aimed to identify the microrganism is described, it is emphasized the importance to recover Streptococcus agalactiae (GBS and L. monocytogenes by means of vaginal-rectal swab culture. The intrapartum screening for L. monocytogenes, by Polymerase Chain Reaction (PCR providing results in 75 minutes is also evaluated.

  18. Phospholipase C-β in immune cells. (United States)

    Kawakami, Toshiaki; Xiao, Wenbin


    Great progress has recently been made in structural and functional research of phospholipase C (PLC)-β. We now understand how PLC-β isoforms (β1-β4) are activated by GTP-bound Gαq downstream of G protein-coupled receptors. Numerous studies indicate that PLC-βs participate in the differentiation and activation of immune cells that control both the innate and adaptive immune systems. The PLC-β3 isoform also interplays with tyrosine kinase-based signaling pathways, to inhibit Stat5 activation by recruiting the protein-tyrosine phosphatase SHP-1, with which PLC-β3 and Stat5 form a multi-molecular signaling platform, named SPS complex. The SPS complex has important regulatory roles in tumorigenesis and immune cell activation. Copyright © 2013 Elsevier Ltd. All rights reserved.

  19. The mechanism of phospholipase Cγ1 activation

    Directory of Open Access Journals (Sweden)

    Paweł Krawczyk


    Full Text Available Phospholipase C is an enzyme which catalyzes the hydrolysis of phosphatidylinositol-4,5-bisphosphate (PI(4,5P2 into second messengers inositol-1,4,5-triphosphate (Ins(1,4,5P3 and diacylglycerol (DAG. These messengers then promote the activation of protein kinase C and release of Ca2 from intracellular stores, initiating numerous cellular events including proliferation, differentiation, signal transduction, endocytosis, cytoskeletal reorganization or activation of ion channels. There have been identified 14 isozymes of PLC among which PLCγ1 and PLCγ2 are of particular interest. PLC contains catalytic region XY and a few regulatory domains: PH, EF and C2. The most unique features of these two enzymes are the Src homology domains (SH2, SH3 and split PH domain within the catalytic barrel. PLC1 and PLCγ2 have an identical domain structure, but they differ in their function and occurrence. Phospholipase Cγ1 is expressed ubiquitously, especially in the brain, thymus and lungs.PLCγ1 can be activated by receptor tyrosine kinases (i.e.: PDGFR, EGFR, FGFR, Trk, as well as non-receptor protein kinases (Src, Syk, Tec or phosphatidic acid, tau protein and its analogue.The molecular mechanism of PLCγ1 activation includes membrane recruitment, phosphorylation, rearrangements and activation in the presence of growth factors.In reference to PLCγ1 regulation, a number of positive and negative modulators have been considered. The most important positive modulator is phosphatidylinositol-3,4,5-trisphosphate (PI(3,4,5P2. Protein kinase A and C, tyrosine phosphatases (SHP-1, PTP-1B and Cbl, Grb2, Jak2/PTP-1B complex proteins have been described as negative regulators of PLCγ1 activation.

  20. Secretory Phospholipase A(2) Activity toward Diverse Substrates

    DEFF Research Database (Denmark)

    Madsen, Jesper Jonasson; Linderoth, Lars; Subramanian, Arun Kumar


    We have studied secretory phospholipase A(2)-IIA (sPLA(2)) activity toward different phospholipid analogues by performing biophysical 1 characterizations and molecular dynamics simulations. The phospholipids were natural substrates, triple alkyl phospholipids, a prodrug anticancer etherlipid, and...

  1. Prevalence and growth of Listeria monocytogenes in naturally contaminated seafood

    DEFF Research Database (Denmark)

    Jørgensen, Lasse Vigel; Huss, Hans Henrik


    Listeria monocytogenes contamination of seafood varies with product category. The highest prevalence was found in cold- smoked fish (34-60%), while the lowest was found in heat- treated and cured seafood (4-12%). The prevalence of L. monocytogenes differed greatly in cold-smoked salmon between...... production sites, ranging from monocytogenes. The organism showed moderate growth...... in naturally contaminated cold-smoked, and 'gravad', fish while the growth appeared faster in hot smoked fish. Thus L. monocytogenes is not under control in these products. Finally, the prevalence and growth of L. monocytogenes in naturally contaminated cold-smoked salmon are discussed in relation...

  2. Effekt av ulike desinfeksjonsstrategier mot Listeria monocytogenes


    Fossmo, Sabine


    Kontroll med bakterier som Listeria utgjør en stor utfordring for mange matprodusenter. Listeria monocytogenes er hovedsakelig et produksjonshygienisk problem, forbedret hygiene kan derfor være tiltak for å redusere overlevelse og smitteoverføring av bakterien i produksjonsmiljø. Hensikten med forsøkene i oppgaven var å undersøke effekten av ulike desinfeksjonsstrategier på drap av L. monocytogenes, både når bakteriene var i biofilm og i suspensjon. Dette inkluderte bruk av tradisjonelle desi...

  3. Phospholipase B activity of a purified phospholipase A from Vipera palestinae venom. (United States)

    Shiloah, J; Klibansky, C; de Vries, A; Berger, A


    Phospholipase was isolated (in two fractions) from Vipera palestinae venom and it was shown to possess phospholipase A activity (hydrolyzing diacyl-sn-glycerophosphorylcholines, e.g., lecithin, in the 2-position) as well as lysophospholipase (phospholipase B) activity (hydrolyzing 1-monoacyl-sn-glycerophosphorylcholines, e.g., lysolecithin, yielding free fatty acid and glycerophosphorylcholine). Each of the two purified enzyme fractions was homogeneous as judged by electrophoresis on acrylamide gel and by immunodiffusion and immunoelectrophoresis, and both had essentially equal activities. The ratio of the specific activity, at various purification stages, to the specific activity of the whole venom was the same for A activity (substrate lecithin) as for B activity (substrate lysolecithin). The enzyme has a molecular weight of 16,000, six S-S bridges, and no free thiol groups. At pH 7, dimerization was observed in the ultracentrifuge. A dissociation constant of about 10(-5) m was estimated. The amino acid composition for both fractions (140 amino acid residues) was found to be essentially the same. The A activity had a pH optimum at 9; B activity was low at this pH but increased steadily beyond pH 10.5. For the hydrolysis of lysolecithin the Lineweaver-Burk plot was found to be linear, giving K(m) = 1.1 mm and k(cat) = 0.55 sec(-1) at 37 degrees C and pH 10. 2-Deoxylysolecithin was also hydrolyzed by the enzyme at pH 10, with k(cat) = 0.01 sec(-1) (zero-order kinetics in the range 0.5-2.5 mm). For lecithin these constants could not be determined, but at 0.25 mm substrate the hydrolysis rate (at pH 9) of lecithin was about 1000 times the hydrolysis rate of lysolecithin (at pH 10).

  4. Prevalence of Listeria monocytogenes in poultry meat

    Directory of Open Access Journals (Sweden)

    Mehmet ELMALI


    Full Text Available AbstractThe objectives of this study were i to isolate Listeria spp. and Listeria monocytogenes in broiler wing meat samples, ii to confirm the isolates by PCR, based on prs and hly A gene sequences, iii to determine the seasonal and monthly distribution of the isolates. A total of 120 broiler wing meat samples (60 packaged pieces wrapped using strech film in styrofoam plates and 60 unpackaged pieces bought from different markets in Hatay province were analysed. Listeria spp. was isolated from 57 (47.5% out of 120 samples. Fifty-four, out of 57 Listeria spp. isolates were identified as L. monocytogenes. L. monocytogenes was isolated from the samples collected during the spring, winter, summer, and autumn at the levels of 26.6%, 40%, 53.3%, 60%, respectively. In this study, the isolation rates were found to be the highest in autumn, while the isolation rates were found to be the lowest in spring. As a consequence, high prevalence of Listeria spp. and L. monocytogenes in poultry wing meat samples may pose a risk for human health. We consider that with obeying the rules of good hygiene practices (GHP, good manufacturing practices (GMP and HACCP can minimize the contamination with Listeria spp.

  5. Control options for Listeria monocytogenes in seafoods

    DEFF Research Database (Denmark)

    Huss, Hans Henrik; Jørgensen, Lasse Vigel; Vogel, Birte Fonnesbech


    At least three outbreaks of listeriosis associated with seafood have been reported. Listeria monocytogenes is widely distributed in the general environment including fresh water, coastal water and live fish from these areas. Contamination or recontamination of seafood may also take place during...

  6. Listeria monocytogenes : nog steeds een probleem?

    NARCIS (Netherlands)

    Beumer, R.R.


    Listeria monocytogenes is net als vele andere bacteriële voedselpathogenen al tientallen jaren bekend. De meeste grondstoffen voor voedingsmiddelen komen uit de akker- en tuinbouw, de veehouderij en de visserij. Besmetting vindt daar plaats met micro-organismen afkomstig uit grond, fecaliën, water,

  7. Membrane associated phospholipase C from bovine brain

    International Nuclear Information System (INIS)

    Lee, K.; Ryu, S.H.; Suh, P.; Choi, W.C.; Rhee, S.G.


    Cytosolic fractions of bovine brain contain 2 immunologically distinct phosphoinositide-specific phospholipase (PLC), PLC-I and PLC-II, whose MW are 150,000 and 145,000 respectively, under a denaturing condition. Monoclonal antibodies were derived against each form and specific radioimmunoassays were developed. Distribution of PLC-I and PLC-II in cytosolic and particulate fractions was measured using the radioimmunoassay. More than 90% of PLC-II was found in the cytosolic fraction, while the anti-PLC-I antibody cross-reacting protein was distributed nearly equally between the soluble fraction and the 2 M KCl extract of particulate fraction. The PLC enzyme in the particulate fraction was purified to homogeneity, yielding 2 proteins of 140 KDa and 150 KDa when analyzed on SDS-PAGE. Neither of the 2 enzymes cross-reacted with anti-PLC-II antibodies, but both could be immunoblotted by all 4 different anti-PLC-I antibodies. This suggests that the 140 KDa PLC was derived from the 150 KDa form. The 150 Kda form from particulate fraction was indistinguishable from the cytosolic PLC-I when their mixture was analyzed on SDS-PAGE. In addition, the elution profile of tryptic peptides derived from the 150 KDa particulate form was identical to that of cytosolic PLC-I. This result indicates that PLC-I is reversibly associated to membranes


    Directory of Open Access Journals (Sweden)

    R. Mioni


    Full Text Available Challenge tests are the preferable methodology to study the behaviour of Listeria monocytogenes on ready to eat foods, according to Regulation (EC 2073/2005. Challenge testing using L. monocytogenes in seasoned salami from different food business operators showed, after seasoning of the product, a count reduction of the inoculated organisms without any further growth of the pathogen; however differences of L. monocytogenes behaviour could be observed according to different production protocols.

  9. Recombinant Lipases and Phospholipases and Their Use as Biocatalysts for Industrial Applications


    Borrelli, Grazia M.; Trono, Daniela


    Lipases and phospholipases are interfacial enzymes that hydrolyze hydrophobic ester linkages of triacylglycerols and phospholipids, respectively. In addition to their role as esterases, these enzymes catalyze a plethora of other reactions; indeed, lipases also catalyze esterification, transesterification and interesterification reactions, and phospholipases also show acyltransferase, transacylase and transphosphatidylation activities. Thus, lipases and phospholipases represent versatile bioc...

  10. Enhanced Activity and Altered Specificity of Phospholipase A2 by Deletion of a Surface Loop

    NARCIS (Netherlands)

    Kuipers, Oscar P.; Thunnissen, Marjolein M.G.M.; Geus, Pieter de; Dijkstra, Bauke W.; Drenth, Jan; Verheij, Hubertus M.; Haas, Gerard H. de


    Protein engineering and x-ray crystallography have been used to study the role of a surface loop that is present in pancreatic phospholipases but is absent in snake venom phospholipases. Removal of residues 62 to 66 from porcine pancreatic phospholipase A2 does not change the binding constant for

  11. Novel Cadmium Resistance Determinant in Listeria monocytogenes. (United States)

    Parsons, Cameron; Lee, Sangmi; Jayeola, Victor; Kathariou, Sophia


    Listeria monocytogenes is a foodborne pathogen that can cause severe disease (listeriosis) in susceptible individuals. It is ubiquitous in the environment and often exhibits resistance to heavy metals. One of the determinants that enables Listeria to tolerate exposure to cadmium is the cadAC efflux system, with CadA being a P-type ATPase. Three different cadA genes (designated cadA1 to cadA3 ) were previously characterized in L. monocytogenes A novel putative cadmium resistance gene ( cadA4 ) was recently identified through whole-genome sequencing, but experimental confirmation for its involvement in cadmium resistance is lacking. In this study, we characterized cadA4 in L. monocytogenes strain F8027, a cadmium-resistant strain of serotype 4b. By screening a mariner-based transposon library of this strain, we identified a mutant with reduced tolerance to cadmium and that harbored a single transposon insertion in cadA4 The tolerance to cadmium was restored by genetic complementation with the cadmium resistance cassette ( cadA4C ), and enhanced cadmium tolerance was conferred to two unrelated cadmium-sensitive strains via heterologous complementation with cadA4C Cadmium exposure induced cadA4 expression, even at noninhibitory levels. Virulence assessments in the Galleria mellonella model suggested that a functional cadA4 suppressed virulence, potentially promoting commensal colonization of the insect larvae. Biofilm assays suggested that cadA4 inactivation reduced biofilm formation. These data not only confirm cadA4 as a novel cadmium resistance determinant in L. monocytogenes but also provide evidence for roles in virulence and biofilm formation. IMPORTANCE Listeria monocytogenes is an intracellular foodborne pathogen causing the disease listeriosis, which is responsible for numerous hospitalizations and deaths every year. Among the adaptations that enable the survival of Listeria in the environment are the abilities to persist in biofilms, grow in the cold, and

  12. Wasp venom proteins: phospholipase A1 and B. (United States)

    King, T P; Kochoumian, L; Joslyn, A


    Three major venom proteins from different species of wasps have been isolated and characterized. They are hyaluronidase, phospholipase, and antigen 5 of as yet unknown biochemical function. These three proteins are allergens in wasp venom-sensitive persons. The species of wasps studied, of the genus Polistes, were annularis, carolina, exclamans, fuscatus, and instabilis. Antigen 5 and phospholipase from wasp venoms were shown to be antigenically distinct from homologous proteins of yellowjacket venoms. The venom phospholipase from wasp, as well as that from yellowjacket (Vespula germanica), appears to have dual enzymatic specificities of the A1 and B types. That is, hydrolysis takes place at the 1-acyl residue of phosphatidylcholine and at the 1- or 2-acyl residue of lysophosphatidylcholine.

  13. Alopecia in a viable phospholipase C delta 1 and phospholipase C delta 3 double mutant.

    Directory of Open Access Journals (Sweden)

    Fabian Runkel

    Full Text Available BACKGROUND: Inositol 1,4,5trisphosphate (IP(3 and diacylglycerol (DAG are important intracellular signalling molecules in various tissues. They are generated by the phospholipase C family of enzymes, of which phospholipase C delta (PLCD forms one class. Studies with functional inactivation of Plcd isozyme encoding genes in mice have revealed that loss of both Plcd1 and Plcd3 causes early embryonic death. Inactivation of Plcd1 alone causes loss of hair (alopecia, whereas inactivation of Plcd3 alone has no apparent phenotypic effect. To investigate a possible synergy of Plcd1 and Plcd3 in postnatal mice, novel mutations of these genes compatible with life after birth need to be found. METHODOLOGY/PRINCIPAL FINDINGS: We characterise a novel mouse mutant with a spontaneously arisen mutation in Plcd3 (Plcd3(mNab that resulted from the insertion of an intracisternal A particle (IAP into intron 2 of the Plcd3 gene. This mutation leads to the predominant expression of a truncated PLCD3 protein lacking the N-terminal PH domain. C3H mice that carry one or two mutant Plcd3(mNab alleles are phenotypically normal. However, the presence of one Plcd3(mNab allele exacerbates the alopecia caused by the loss of functional Plcd1 in Del(9olt1Pas mutant mice with respect to the number of hair follicles affected and the body region involved. Mice double homozygous for both the Del(9olt1Pas and the Plcd3(mNab mutations survive for several weeks and exhibit total alopecia associated with fragile hair shafts showing altered expression of some structural genes and shortened phases of proliferation in hair follicle matrix cells. CONCLUSIONS/SIGNIFICANCE: The Plcd3(mNab mutation is a novel hypomorphic mutation of Plcd3. Our investigations suggest that Plcd1 and Plcd3 have synergistic effects on the murine hair follicle in specific regions of the body surface.

  14. Recombinant phage probes for Listeria monocytogenes

    Energy Technology Data Exchange (ETDEWEB)

    Carnazza, S; Gioffre, G; Felici, F; Guglielmino, S [Department of Microbiological, Genetic and Molecular Sciences, University of Messina, Messina (Italy)


    Monitoring of food and environmental samples for biological threats, such as Listeria monocytogenes, requires probes that specifically bind biological agents and ensure their immediate and efficient detection. There is a need for robust and inexpensive affinity probes as an alternative to antibodies. These probes may be recruited from random peptide libraries displayed on filamentous phage. In this study, we selected from two phage peptide libraries phage clones displaying peptides capable of specific and strong binding to the L. monocytogenes cell surface. The ability of isolated phage clones to interact specifically with L. monocytogenes was demonstrated using enzyme-linked immunosorbent assay (ELISA) and confirmed by co-precipitation assay. We also assessed the sensitivity of phage-bacteria binding by PCR on phage-captured Listeria cells, which could be detected at a concentration of 10{sup 4} cells ml{sup -1}. In addition, as proof-of-concept, we tested the possibility of immobilizing the affinity-selected phages to a putative biosensor surface. The quality of phage deposition was monitored by ELISA and fluorescent microscopy. Phage-bacterial binding was confirmed by high power optical phase contrast microscopy. Overall, the results of this work validate the concept of affinity-selected recombinant filamentous phages as probes for detecting and monitoring bacterial agents under any conditions that warrant their recognition, including in food products.

  15. Recombinant phage probes for Listeria monocytogenes (United States)

    Carnazza, S.; Gioffrè, G.; Felici, F.; Guglielmino, S.


    Monitoring of food and environmental samples for biological threats, such as Listeria monocytogenes, requires probes that specifically bind biological agents and ensure their immediate and efficient detection. There is a need for robust and inexpensive affinity probes as an alternative to antibodies. These probes may be recruited from random peptide libraries displayed on filamentous phage. In this study, we selected from two phage peptide libraries phage clones displaying peptides capable of specific and strong binding to the L. monocytogenes cell surface. The ability of isolated phage clones to interact specifically with L. monocytogenes was demonstrated using enzyme-linked immunosorbent assay (ELISA) and confirmed by co-precipitation assay. We also assessed the sensitivity of phage-bacteria binding by PCR on phage-captured Listeria cells, which could be detected at a concentration of 104 cells ml-1. In addition, as proof-of-concept, we tested the possibility of immobilizing the affinity-selected phages to a putative biosensor surface. The quality of phage deposition was monitored by ELISA and fluorescent microscopy. Phage-bacterial binding was confirmed by high power optical phase contrast microscopy. Overall, the results of this work validate the concept of affinity-selected recombinant filamentous phages as probes for detecting and monitoring bacterial agents under any conditions that warrant their recognition, including in food products.

  16. Detergent organisation in crystals of monomeric outer membrane phospholipase A

    NARCIS (Netherlands)

    Snijder, HJ; Timmins, PA; Kalk, KH; Dijkstra, BW

    The structure of the detergent in crystals of outer membrane phospholipase A (OMPLA) has been determined using neutron diffraction contrast variation. Large crystals were soaked in stabilising solutions, each containing a different H2O/D2O contrast. From the neutron diffraction at five contrasts,

  17. Secretory Phospholipase A(2)-IIA and Cardiovascular Disease

    NARCIS (Netherlands)

    Holmes, Michael V.; Simon, Tabassome; Exeter, Holly J.; Folkersen, Lasse; Asselbergs, Folkert W.; Guardiola, Montse; Cooper, Jackie A.; Palmen, Jutta; Hubacek, Jaroslav A.; Carruthers, Kathryn F.; Horne, Benjamin D.; Brunisholz, Kimberly D.; Mega, Jessica L.; Van Iperen, Erik P. A.; Li, Mingyao; Leusink, Maarten; Trompet, Stella; Verschuren, Jeffrey J. W.; Hovingh, G. Kees; Dehghan, Abbas; Nelson, Christopher P.; Kotti, Salma; Danchin, Nicolas; Scholz, Markus; Haase, Christiane L.; Rothenbacher, Dietrich; Swerdlow, Daniel I.; Kuchenbaecker, Karoline B.; Staines-Urias, Eleonora; Goel, Anuj; van 't Hooft, Ferdinand; Gertow, Karl; de Faire, Ulf; Panayiotou, Andrie G.; Tremoli, Elena; Baldassarre, Damiano; Veglia, Fabrizio; Holdt, Lesca M.; Beutner, Frank; Gansevoort, Ron T.; Navis, Gerjan J.; Mateo Leach, Irene; Breitling, Lutz P.; Brenner, Hermann; Thiery, Joachim; Dallmeier, Dhayana; Franco-Cereceda, Anders; Boer, Jolanda M. A.; Stephens, Jeffrey W.; Hofker, Marten H.; Tedgui, Alain; Hofman, Albert; Uitterlinden, Andre G.; Adamkova, Vera; Pitha, Jan; Onland-Moret, N. Charlotte; Cramer, Maarten J.; Nathoe, Hendrik M.; Spiering, Wilko; Klungel, Olaf H.; Kumari, Meena; Whincup, Peter H.; Morrow, David A.; Braund, Peter S.; Hall, Alistair S.; Olsson, Anders G.; Doevendans, Pieter A.; Trip, Mieke D.; Tobin, Martin D.; Hamsten, Anders; Watkins, Hugh; Koenig, Wolfgang; Nicolaides, Andrew N.; Teupser, Daniel; Day, Ian N. M.; Carlquist, John F.; Gaunt, Tom R.; Ford, Ian; Sattar, Naveed; Tsimikas, Sotirios; Schwartz, Gregory G.; Lawlor, Debbie A.; Morris, Richard W.; Sandhu, Manjinder S.; Poledne, Rudolf; Maitland-van der Zee, Anke H.; Khaw, Kay-Tee; Keating, Brendan J.; van der Harst, Pim; Price, Jackie F.; Mehta, Shamir R.; Yusuf, Salim; Witteman, Jaqueline C. M.; Franco, Oscar H.; Jukema, J. Wouter; de Knijff, Peter; Tybjaerg-Hansen, Anne; Rader, Daniel J.; Farrall, Martin; Samani, Nilesh J.; Kivimaki, Mika; Fox, Keith A. A.; Humphries, Steve E.; Anderson, Jeffrey L.; Boekholdt, S. Matthijs; Palmer, Tom M.; Eriksson, Per; Pare, Guillaume; Hingorani, Aroon D.; Sabatine, Marc S.; Mallat, Ziad; Casas, Juan P.; Talmud, Philippa J.


    Objectives This study sought to investigate the role of secretory phospholipase A(2) (sPLA(2))-IIA in cardiovascular disease. Background Higher circulating levels of sPLA(2)-IIA mass or sPLA(2) enzyme activity have been associated with increased risk of cardiovascular events. However, it is not

  18. Phospholipases A2 in ocular homeostasis and diseases

    DEFF Research Database (Denmark)

    Wang, Jinmei; Kolko, Miriam; Kolko, Miriam


    Phospholipases A(2) (PLA(2)s) and its generation of second messengers play an important role in signal transduction, cell proliferation, cell survival and gene expression. At low concentrations mediators of PLA(2) activity have a variety of physiological effects whereas high levels of PLA(2) and ...

  19. Presenilin dependence of phospholipase C and protein kinase C signaling

    DEFF Research Database (Denmark)

    Dehvari, Nodi; Cedazo-Minguez, Angel; Isacsson, Ola


    -stimulated phospholipase C (PLC) activity which was gamma-secretase dependent. To further evaluate the dependence of PLC on PSs we measured PLC activity and the activation of variant protein kinase C (PKC) isoforms in mouse embryonic fibroblasts (MEFs) lacking either PS1, PS2, or both. PLC activity and PKCalpha...

  20. Survival strategies of Listeria monocytogenes - roles of regulators and transporters

    NARCIS (Netherlands)

    Wemekamp-Kamphuis, H.H.


    Outbreaks of the food-borne pathogen Listeria monocytogenes are mainly associated with ready-to-eatfoods. Survival strategies of L. monocytogenes in relation to minimally processed foods were studied.

  1. Incidence and control of Listeria monocytogenes in foods in Denmark

    DEFF Research Database (Denmark)

    Nørrung, Birgit; Andersen, Jens Kirk; Schlundt, Jørgen


    The Danish regulatory policy on Listeria monocytogenes in foods is based on the principles of HACCP and was developed using a health risk assessment approach. The Danish policy focuses examinations and criteria for L. monocytogenes in ready-to-eat foods and is based on a combination of inspection...

  2. Listeria monocytogenes internalizes in Romaine Lettuce grown in greenhouse conditions (United States)

    Listeria monocytogenes has been implicated in a number of outbreaks involving fresh produce, including an outbreak in 2016 resulting from contaminated packaged salads. The persistence and internalization potential of L. monocytogenes in romaine lettuce was evaluated, and the persistence of two L. mo...

  3. Occurrence of Listeria monocytogenes in smoked fish in Sokoto ...

    African Journals Online (AJOL)

    The present study was conducted to determine the prevalence of Listeria monocytogenes in smoked fish in Sokoto, Nigeria. A total of 115 different species of smoked fish from the various retail outlets and market places within the metropolis were analysed for the presence of L. monocytogenes using ISO culture method.

  4. Detection of Listeria Spp. and Listeria monocytogenes in vegetables ...

    African Journals Online (AJOL)

    This paper aimed to study the prevalence and antibiotic resistance pattern among Listeria monocytogenes in raw vegetables sourced from commercial farms and local farms in Terengganu. Thirteen types of vegetables investigated for the presence of L. monocytogenes using multiplex PCR and LAMP methods. Isolation of ...

  5. Genome sequences of Listeria monocytogenes strains with resistance to arsenic (United States)

    Listeria monocytogenes frequently exhibits resistance to arsenic. We report here the draft genome sequences of eight genetically diverse arsenic-resistant L. monocytogenes strains from human listeriosis and food-associated environments. Availability of these genomes would help to elucidate the role ...

  6. Listeria monocytogenes growth limits and stress resistance mechanisms

    NARCIS (Netherlands)

    Veen, van der S.


    The food-borne pathogen Listeria monocytogenes is a Gram-positive facultative anaerobic rod, which is the causative agent of listeriosis. Due to the severity of the disease and the fact that its incidence is increasing in numerous European countries, L. monocytogenes is of great public health

  7. Resistance of Listeria monocytogenes biofilms to sanitizing agents (United States)

    Listeria monocytogenes is notorious for its capacity to colonize the environment and equipment of food processing facilities and to persist in the processing plant ecosystem, sometimes for decades. Such persistence is mediated by multiple attributes of L. monocytogenes, including the pathogen’s capa...

  8. Effects of prebiotics on the infective potential of Listeria monocytogenes

    DEFF Research Database (Denmark)

    Ebersbach, Tine

    % xylooligosaccharides (XOS), galactooligosaccharides (GOS), inulin, apple pectin or polydextrose for three weeks before oral challenge with L. monocytogenes. XOS and GOS significantly improved resistance of guinea pigs to L. monocytogenes, while inulin and apple pectin decreased the resistance. No significant effect...

  9. Monitoring paneer for Listeria monocytogenes - A high risk food ...

    African Journals Online (AJOL)

    A multiplex polymerase chain reaction (PCR) assay was developed and applied to spiked and natural paneer samples to detect Listeria monocytogenes, a high risk food pathogen. The sensitivity of the assay on L. monocytogenes spiked paneer samples was 104 cells prior to enrichment, was improved to 103 cells after 4 h ...

  10. Purification of lysosomal phospholipase A and demonstration of proteins that inhibit phospholipase A in a lysosomal fraction from rat kidney cortex

    International Nuclear Information System (INIS)

    Hostetler, K.Y.; Gardner, M.F.; Giordano, J.R.


    Phospholipase A has been isolated from a crude lysosomal fraction from rat kidney cortex and purified 7600-fold with a recovery of 9.8% of the starting activity. The purified enzyme is a glycoprotein having an isoelectric point of pH 5.4 and an apparent molecular weight of 30,000 by high-pressure liquid chromatography gel permeation. Naturally occurring inhibitors of lysosomal phospholipase A are present in two of the lysosomal-soluble protein fractions obtained in the purification. They inhibit hydrolysis of 1,2-di[1- 14 C]oleoylphosphatidylcholine by purified phospholipase A 1 with IC 50 values of 7-11 μg. The inhibition is abolished by preincubation with trypsin at 37 0 C, but preincubation with trypsin at 4 0 C has no effect, providing evidence that the inhibitors are proteins. The results suggest that the activity of lysosomal phospholipase A may be regulated in part by inhibitory proteins. Lysosomal phospholipase A from rat kidney hydrolyzes the sn-1 acyl group of phosphatidylcholine, does not require divalent cations for full activity, and is not inhibited by ethylenediaminetetraacetic acid. It has an acid pH optimum of 3.6-3.8. Neither rho-bromophenacyl bromide, diisopropyl fluorophosphate, nor mercuric ion inhibits phospholipase A 1 . In contrast to rat liver, which has two major isoenzymes of acid phospholipase A 1 , kidney cortex has only one isoenzyme of lysosomal phospholipase A 1

  11. Characterization of secretory phospholipase A₂ with phospholipase A₁ activity in tobacco, Nicotiana tabacum (L.). (United States)

    Fujikawa, Yukichi; Fujikawa, Ritsuko; Iijima, Noriaki; Esaka, Muneharu


    A cDNA encoding protein with homology to plant secretory phospholipase A₂ (sPLA₂), denoted as Nt1 PLA₂, was isolated from tobacco (Nicotiana tabacum). The cDNA encodes a mature protein of 118 amino acid residues with a putative signal peptide of 29 residues. The mature form of Nt1 PLA₂ has 12 cysteines, Ca²⁺ binding loop and catalytic site domain that are commonly conserved in plant sPLA₂s. The recombinant Nt1 PLA₂ was expressed as a fusion protein with thioredoxin in E. coli BL21 cells and was purified by an ion exchange chromatography after digestion of the fusion proteins by Factor Xa protease to obtain the mature form. Interestingly, Nt1 PLA₂ could hydrolyze the ester bond at the sn-1 position of glycerophospholipids as well as at the sn-2 position, when the activities were determined using mixed-micellar phospholipids with sodium cholate. Both activities for the sn-1 and -2 positions of glycerophospholipids required Ca²⁺ essentially, and maximal activities were found in an alkaline region when phosphatidylcholine, phosphatidylglycerol or phosphatidylethanolamine was used as a substrate. The level of Nt1 PLA₂ mRNA was detected at a higher level in tobacco flowers than stem, leaves and roots, and was induced by salicylic acid.

  12. Prevalence and location of Listeria monocytogenes in farmed rainbow trout. (United States)

    Miettinen, Hanna; Wirtanen, Gun


    A total of 510 rainbow trout originating from fish farms in lakes and sea areas around Finland were studied for the presence of Listeria monocytogenes. Samples were studied as pools from five fish. Gill, viscera, and skin from the pooled samples were analysed separately. The individual samples were analysed later if the pooled sample was found to be Listeria positive. The prevalence of Listeria spp. and L. monocytogenes in pooled unprocessed fresh rainbow trout was on average 35.0% and 14.6%, respectively. On the other hand, the prevalence of Listeria spp. and L. monocytogenes in individual thawed fish was found to be 14.3% and 8.8%, respectively. These numbers tend to overestimate and underestimate the real situation because not all fish in pooled samples were necessarily contaminated and in some of the Listeria positive pooled samples all individual samples turned out to be Listeria free. The prevalence of L. monocytogenes varied greatly between different fish farms from zero to 100% in pooled samples and from zero to 75% according to individually studied fish samples. Some indications of the influence of weather conditions and seasonal variations that strongly affected the Listeria contamination of fish were also noticed. The location of Listeria spp. and L. monocytogenes in different parts of the fish differed with statistical significance in rainbow trout. Up to 95.6% of the L. monocytogenes and 84.5% of Listeria spp. positive samples were gill samples. Only 4.4% (2/45) of the L. monocytogenes positive samples were obtained from skin or viscera. Closer study at one fish farm revealed that there was only one L. monocytogenes ribotype present in the contaminated fish, although water and surfaces were heavily contaminated with six other L. monocytogenes ribotypes.

  13. Incorporation of Listeria monocytogenes strains in raw milk biofilms. (United States)

    Weiler, Christiane; Ifland, Andrea; Naumann, Annette; Kleta, Sylvia; Noll, Matthias


    Biofilms develop successively on devices of milk production without sufficient cleaning and originate from the microbial community of raw milk. The established biofilm matrices enable incorporation of pathogens like Listeria monocytogenes, which can cause a continuous contamination of food processing plants. L. monocytogenes is frequently found in raw milk and non-pasteurized raw milk products and as part of a biofilm community in milk meters and bulk milk tanks. The aim of this study was to analyze whether different L. monocytogenes strains are interacting with the microbial community of raw milk in terms of biofilm formation in the same manner, and to identify at which stage of biofilm formation a selected L. monocytogenes strain settles best. Bacterial community structure and composition of biofilms were analyzed by a cloning and sequencing approach and terminal restriction fragment length polymorphism analysis (T-RFLP) based on the bacterial 16S rRNA gene. The chemical composition of biofilms was analyzed by Fourier transform infrared spectroscopy (FTIR), while settled L. monocytogenes cells were quantified by fluorescence in situ hybridization (FISH). Addition of individual L. monocytogenes strains to raw milk caused significant shifts in the biofilm biomass, in the chemical as well as in the bacterial community composition. Biofilm formation and attachment of L. monocytogenes cells were not serotype but strain specific. However, the added L. monocytogenes strains were not abundant since mainly members of the genera Citrobacter and Lactococcus dominated the bacterial biofilm community. Overall, added L. monocytogenes strains led to a highly competitive interaction with the raw milk community and triggered alterations in biofilm formation. Copyright © 2012 Elsevier B.V. All rights reserved.

  14. Listeria monocytogenes as a vector for anti-cancer therapies.

    LENUS (Irish Health Repository)

    Tangney, Mark


    The intracellular pathogen Listeria monocytogenes represents a promising therapeutic vector for the delivery of DNA, RNA or protein to cancer cells or to prime immune responses against tumour-specific antigens. A number of biological properties make L. monocytogenes a promising platform for development as a vector for either gene therapy or as an anti-cancer vaccine vector. L. monocytogenes is particularly efficient in mediating internalization into host cells. Once inside cells, the bacterium produces specific virulence factors which lyse the vaculolar membrane and allow escape into the cytoplasm. Once in the cytosol, L. monocytogenes is capable of actin-based motility and cell-to-cell spread without an extracellular phase. The cytoplasmic location of L. monocytogenes is significant as this potentiates entry of antigens into the MHC Class I antigen processing pathway leading to priming of specific CD8(+) T cell responses. The cytoplasmic location is also beneficial for the delivery of DNA (bactofection) by L. monocytogenes whilst cell-to-cell spread may facilitate access of the vector to cells throughout the tumour. Several preclinical studies have demonstrated the ability of L. monocytogenes for intracellular gene or protein delivery in vitro and in vivo, and this vector has also displayed safety and efficacy in clinical trial. Here, we review the features of the L. monocytogenes host-pathogen interaction that make this bacterium such an attractive candidate with which to induce appropriate therapeutic responses. We focus primarily upon work that has led to attenuation of the pathogen, demonstrated DNA, RNA or protein delivery to tumour cells as well as research that shows the efficacy of L. monocytogenes as a vector for tumour-specific vaccine delivery.

  15. Prevalence of Listeria monocytogenes in raw milk in North Lebanon

    International Nuclear Information System (INIS)

    Al Kassaa, I; El Omari, Kh.; Esmail, B.; Hamze, M; Saati, M.


    Listeriosis, although a zoonosis, is an invasive disease that can affect newborns, pregnant women and immunocompromised adults. Clinical manifestations can be expressedby febrile gastroenteritis, invasive forms including severe sepsis, meningitis, rhombencephalitis, prenatal infections and abortions. Species of Listeria bacteria are ubiquitous and adaptableto the environment in animal and plant foods. This study aimed to determine the prevalence of Listeria monocytogenes in 100 samples of fresh cow milk collected from different areas of North Lebanon. Listeria monocytogenes was detected by using the Grand VIDAS technique (Biomérieux France). The results obtained revealed the absence of Listeria monocytogenes inall analyzed samples. (Author)


    Directory of Open Access Journals (Sweden)

    S. Colombo


    Full Text Available The EC Regulation 2073/2005 (1 requires that food processors evaluate the capability of ready-to-use (RTE products to support the development of Listeria monocytogenes when their pH and aW values are favourable to the growth of this microorganism. It is renown that the lactic flora plays an important role in many different foods, both from a technological and a food safety standpoint. This study was aimed to observe the behaviour and the potential anti-Listeria effect of some natural lactic flora present in Italian liver patè crostini (chicken heart and liver, anchovies, onions, capers, starch, no added preservatives through the Combase Predictor – Max Growth Rate predictive software. The natural lactic flora of the crostini demonstrated a variable capability to inhibit the growth of Listeria monocytogenes which depends upon : the concentration of the lactic flora at the beginning of the shelf life period and the subsequent lag phase, the possible release of anti-Listeria substances, and the maximum growth rate.

  17. Silver as antibacterial towards Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Simone eBelluco


    Full Text Available Listeria monocytogenes is a serious foodborne pathogen that can contaminate food during processing and can grow during food shelf-life. New types of safe and effective food contact materials embedding antimicrobial agents, like silver, can play an important role in the food industry. The present work aimed at evaluating the in vitro growth kinetics of different strains of L. monocytogenes in the presence of silver, both in its ionic and nano form. The antimicrobial effect was determined by assaying the number of culturable bacterial cells, which formed colonies after incubation in the presence of silver nanoparticles (AgNPs or silver nitrate (AgNO3. Ionic release experiments were performed in parallel. A different reduction of bacterial viability between silver ionic and nano forms was observed, with a time delayed effect exerted by AgNPs. An association between antimicrobial activity and ions concentration was shown by both silver chemical forms, suggesting the major role of ions in the antimicrobial mode of action.

  18. REALIS: Postgenomic Analysis of Listeria Monocytogenes

    Directory of Open Access Journals (Sweden)

    The REALIS Consortium


    Full Text Available Listeria monocytogenes is a remarkably successful food-borne pathogen. It is capable a of surviving and proliferating under conditions that exist within the food chain, such as at low temperatures, high salt and low pH and b of colonizing animal host tissues after ingestion of contaminated food, causing opportunistic infections mainly, but not exclusively, in immunocompromised hosts. The ultimate goals of REALIS are two fold: Firstly, it aims to completely decipher all genes required for survival in and adaptation of Listeria monocytogenes to two very different environments, ie., the infected host and the external environment. Secondly, using genomics and postgenomic tools, REALIS seeks to precisely address fundamental questions regarding evolutionary relationships between pathogenic and non-pathogenic Listeria and to define qualities of particularly successful clonal pathovariants in causing disease. This project will provide both industry and health care managers with rational approaches to curbing food-borne contamination, minimising risks of infection and providing novel pharmacological approaches for halting the fulminant course of infection.

  19. Plasma phospholipase, γ-CEHC and antioxidant capacity in fibromyalgia. (United States)

    Fais, Antonella; Cacace, Enrico; Atzori, Luigi; Era, Benedetta; Ruggiero, Valeria


    Recent studies have suggested a possible role of high levels of plasma lysophosphocholines (lysoPCs) in fibromyalgia syndrome (FMS). The aim of this study was to evaluate the content of plasma phospholipases (e.g., Platelet Activating Factor Acetyl Hydrolase [PAF-AH], secretory Phospholipase A 2 [sPLA 2 ], Total Antioxidant Capacity [TAOC] and 2,7,8-trimethyl-2-(2-carboxyethyl)-6-hydroxy chroman [γ-CEHC]) in FMS patients and their association with clinical status and quality of life. Thirty-six females meeting the 2011 American College of Rheumatology criteria for the classification of FMS and thirty-four healthy females were enrolled for the study. Plasma enzyme levels were quantified using commercial enzyme-linked-immunosorbent-assay (ELISA). In order to assess the disease severity and the functional status of patients, the Fibromyalgia Impact Questionnarie (FIQ) was used. Higher levels of sPLA 2 and lower PAF-AH and γ-CEHC were observed in the plasma of FMS patients compared to the controls. A decrease in PAF-AH and TAOC levels were found in severe FMS (S-FMS) compared to mild/slight (MS-FMS) forms. The results of the study indicate a possible involvement of phospholipases and γ-CEHC in fibromyalgia syndrome. © 2015 Asia Pacific League of Associations for Rheumatology and Wiley Publishing Asia Pty Ltd.

  20. Purification and characterization of a phospholipase by Photobacterium damselae subsp. piscicida from cobia Rachycentron canadum. (United States)

    Hsu, Po-Yuan; Lee, Kuo-Kau; Hu, Chih-Chuang; Liu, Ping-Chung


    Toxicity of the extracellular products (ECPs) and the lethal attributes of phospholipase secreted by pathogenic Photobacterium damselae subsp. piscicida from cobia Rachycentron canadum was studied. An extracellular lethal toxin in the ECPs was partially purified by using Fast Protein Liquid Chromatography system. A protein band (27 kDa) exhibited phospholipase activity on Native-PAGE (by 0.3% egg yolk agar-overlay), was excised and eluted. The pI value of the purified phospholipase was determined as 3.65 and was determined as a phospholipase C by using the Amplex™ Red phosphatidylcholine -Specific phospholipase C Assay kit. The phospholipase showed maximum activity at temperature around 4-40 °C and maximal activity at pH between 8 and 9. The enzyme was inhibited by ethylenediamine-tetraacetic acid (EDTA) and sodium dodecyl sulfate (SDS); but was activated by Ca(2+) and Mg(2+) and inactivated by Zn(2+) and Cu(2+) . Both the ECPs and phospholipase were hemolytic against erythrocytes of cobia and lethal to the fish with LD50 values of 3.25 and 0.91 µg protein g(-1) fish, respectively. In toxicity neutralization test, the rabbit antisera against the phospholipase could neutralize the toxicity of ECPs, indicating that the phospholipase is a major extracellular toxin produced by the bacterium. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. Characterization of N-acyl phosphatidylethanolamine-specific phospholipase-D isoforms in the nematode Caenorhabditis elegans.

    Directory of Open Access Journals (Sweden)

    Neale Harrison

    Full Text Available N-acylethanolamines are an important class of lipid signaling molecules found in many species, including the nematode Caenorhabditis elegans (C. elegans where they are involved in development and adult lifespan. In mammals, the relative activity of the biosynthetic enzyme N-acyl phosphatidylethanolamine-specific phospholipase-D and the hydrolytic enzyme fatty acid amide hydrolase determine N-acylethanolamine levels. C. elegans has two N-acyl phosphatidylethanolamine-specific phospholipase-D orthologs, nape-1 and nape-2, that are likely to have arisen from a gene duplication event. Here, we find that recombinant C. elegans NAPE-1 and NAPE-2 are capable of generating N-acylethanolamines in vitro, confirming their functional conservation. In vivo, they exhibit overlapping expression in the pharynx and the nervous system, but are also expressed discretely in these and other tissues, suggesting divergent roles. Indeed, nape-1 over-expression results in delayed growth and shortened lifespan only at 25°C, while nape-2 over-expression results in significant larval arrest and increased adult lifespan at 15°C. Interestingly, deletion of the N-acylethanolamine degradation enzyme faah-1 exacerbates nape-1 over-expression phenotypes, but suppresses the larval arrest phenotype of nape-2 over-expression, suggesting that faah-1 is coupled to nape-2, but not nape-1, in a negative feedback loop. We also find that over-expression of either nape-1 or nape-2 significantly enhances recovery from the dauer larval stage in the insulin signaling mutant daf-2(e1368, but only nape-1 over-expression reduces daf-2 adult lifespan, consistent with increased levels of the N-acylethanolamine eicosapentaenoyl ethanolamine. These results provide evidence that N-acylethanolamine biosynthetic enzymes in C. elegans have conserved function and suggest a temperature-dependent, functional divergence between the two isoforms.

  2. Growth inhibition of Listeria monocytogenes by a nonbacteriocinogenic Carnobacterium piscicola

    DEFF Research Database (Denmark)

    Nilsson, Lilian; Bech Hansen, T.; Garrido, P.


    Aims: This study elucidates the mechanisms by which a nonbacteriocinogenic Carnobacterium piscicola inhibits growth of Listeria monocytogenes. Methods and Results: Listeria monocytogenes was exposed to live cultures of a bacteriocin-negative variant of C. piscicola A9b in co-culture, in a diffusion...... chamber system, and to a cell-free supernatant. Suppression of maximum cell density (0-3.5 log units) of L. monocytogenes was proportional to initial levels of C. pisciola (10(3)-10(7) CFU ml(-1)). Cell-to-cell contact was not required to cause inhibition. The cell-free C. piscicola supernatant caused...... a decrease in L. monocytogenes maximum cell density, which was abolished by glucose addition but not by amino acid, vitamin or mineral addition. The fermentate also gave rise to a longer lag phase and a reduction in growth rate. These effects were independent of glucose and may have been caused by acetate...


    Directory of Open Access Journals (Sweden)

    T Civera


    Full Text Available Listeria monocytogenes has become one of the major concerns for food safety. Its ability to survive and replicate at low temperature, pH and high salt concentration, makes the bacterium a threat, mostly for RTE products. For these reasons, the present research was aimed at detecting the ability of growth of L. monocytogenes in RTE products retrieved from one deli store. Samples were analysed for L. monocytogenes detection, then inoculated with the pathogen (105cell/ml and stored at refrigeration temperature for the duration of their shelf-life (15-60 days. In all the products L. monocytogenes was not detected before experimental contamination. The challenge test evidenced that experimentally inoculated L. monocytogenes was not able to multiply for the duration of the entire shelf-life. These results indicated that the tested products could be considered as foods which are not able to support the growth of L. monocytogenes, as indicated by E.C. Regulation 2073/05. However, in order to guarantee consumer’s safety, it needs to be emphasized the need of a correct application of the GMPs, required for lowering the risk of initial contamination.

  4. Behaviour of Listeria monocytogenes in packaged fresh mushrooms (Agaricus bisporus). (United States)

    González-Fandos, E; Olarte, C; Giménez, M; Sanz, S; Simón, A


    The aim of this study was to evaluate the potential of Listeria monocytogenes to grow in mushrooms packaged in two different types of PVC films when stored at 4 degrees C and 10 degrees C. Mushrooms were packed in two polymeric films (perforated and nonperforated PVC) and stored at 4 degrees C and 10 degrees C. The carbon dioxide and oxygen content inside the packages, aerobic mesophiles, psychrotrophs, Pseudomonas spp., Listeria monocytogenes, faecal coliforms, Escherichia coli, anaerobic spores and major sensory factors were determined. The mushrooms packaged in nonperforated film and stored at 4 degrees C had the most desirable quality parameters (texture, development stage and absence of moulds). Listeria monocytogenes was able to grow at 4 degrees C and 10 degrees C in inoculated mushrooms packaged in perforated and nonperforated films between 1 and 2 log units during the first 48 h. After 10 d of storage, the populations of L. monocytogenes were higher in mushrooms packaged in nonperforated film and stored at 10 degrees C. MAP followed by storage at 4 degrees C or 10 degrees C extends the shelf life by maintaining an acceptable appearance, but allows the growth and survival of L. monocytogenes. According to this study additional hurdles must be studied in order to prevent the growth of L. monocytogenes.

  5. Listeria monocytogenes, a down-to-earth pathogen. (United States)

    Vivant, Anne-Laure; Garmyn, Dominique; Piveteau, Pascal


    Listeria monocytogenes is the causative agent of the food-borne life threatening disease listeriosis. This pathogenic bacterium received much attention in the endeavor of deciphering the cellular mechanisms that underlie the onset of infection and its ability to adapt to the food processing environment. Although information is available on the presence of L. monocytogenes in many environmental niches including soil, water, plants, foodstuff and animals, understanding the ecology of L. monocytogenes in outdoor environments has received less attention. Soil is an environmental niche of pivotal importance in the transmission of this bacterium to plants and animals. Soil composition, microbial communities and macrofauna are extrinsic edaphic factors that direct the fate of L. monocytogenes in the soil environment. Moreover, farming practices may further affect its incidence. The genome of L. monocytogenes presents an extensive repertoire of genes encoding transport proteins and regulators, a characteristic of the genome of ubiquitous bacteria. Postgenomic analyses bring new insights in the process of soil adaptation. In the present paper focussing on soil, we review these extrinsic and intrinsic factors that drive environmental adaptation of L. monocytogenes.

  6. Biofilm Formation of Listeria monocytogenes on Various Surfaces

    Directory of Open Access Journals (Sweden)

    M Mahdavi


    Full Text Available Introduction & Objective: Listeria monocytogenes is considered as a ubiquitous foodborne pathogen which can lead to serious infections, especially in newborns, elderly, pregnant, and immunocompromised people. The organism has been isolated from many foods and may cause meningitis, septicemia and abortion in pregnant women. Also L. monocytogenes forms biofilms on many food contact surface materials and medical devices. Development of biofilms on many surfaces is a potential source of contamination of foods that may lead to spoilage or transmission of foodborne pathogens. Materials & Methods: Biofilm formation of L. monocytogenes (RITCC 1293 serotype 4a was investigated. Hydrophobicity of L. monocytogenes was measured by MATH method. Then biofilm formation of the organism was assessed at 2, 4, 8, 16 and 20 hours on stainless steel (type 304 no 2B, polyethylene and glass by drop plate method. Results: Results indicated that L. monocytogenes with 85% of hydrophobicity formed biofilm on each of three surfaces. Biofilm formation on stainless steel surfaces was significantly more than other surfaces (p<0.05. Conclusion: The ability of biofilm formation of L. monocytogenes on medical devices and food containers is very important as far as hygiene and disease outbreaks are concerned.

  7. Inhibition of sortase A by chalcone prevents Listeria monocytogenes infection. (United States)

    Li, Hongen; Chen, Yutao; Zhang, Bing; Niu, Xiaodi; Song, Meng; Luo, Zhaoqing; Lu, Gejin; Liu, Bowen; Zhao, Xiaoran; Wang, Jianfeng; Deng, Xuming


    The critical role of sortase A in gram-positive bacterial pathogenicity makes this protein a good potential target for antimicrobial therapy. In this study, we report for the first time the crystal structure of Listeria monocytogenes sortase A and identify the active sites that mediate its transpeptidase activity. We also used a sortase A (SrtA) enzyme activity inhibition assay, simulation, and isothermal titration calorimetry analysis to discover that chalcone, an agent with little anti-L. monocytogenes activity, could significantly inhibit sortase A activity with an IC50 of 28.41 ± 5.34 μM by occupying the active site of SrtA. The addition of chalcone to a co-culture of L. monocytogenes and Caco-2 cells significantly inhibited bacterial entry into the cells and L. monocytogenes-mediated cytotoxicity. Additionally, chalcone treatment decreased the mortality of infected mice, the bacterial burden in target organs, and the pathological damage to L. monocytogenes-infected mice. In conclusion, these findings suggest that chalcone is a promising candidate for the development of treatment against L. monocytogenes infection. Copyright © 2016 Elsevier Inc. All rights reserved.

  8. A case of bovine raw milk contamination with Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Hunt Karen


    Full Text Available Abstract During routine sampling of bulk raw milk on a dairy farm, the pathogenic bacteria Listeria monocytogenes was found to be a contaminant, at numbers L. monocytogenes, indicating a possible case of excretion of the L. monocytogenes directly into the milk. Milk samples were collected from the individual cows and analysed, resulting in the identification of L. monocytogenes excretion (at 280 cfu/ml from one of the 4 mammary quarters of one dairy cow out of 180. When the infected cow was isolated from the herd, no L. monocytogenes was detected from the remaining herd. The pulsed-field gel electrophoresis pattern of the strain from the individual cow was indistinguishable from that originally isolated from the bulk milk. The infected cow did not show any clinical signs of disease, nor did the appearance of the milk have any physical abnormalities. Antibiotic treatment of the infected mammary quarter was found to be ineffective. This study shows that there can be risks associated with direct contamination of raw milk with L. monocytogenes.

  9. Prevalence of Listeria monocytogenes in European cheeses

    DEFF Research Database (Denmark)

    Martinez Rios, Veronica; Dalgaard, Paw


    , respectively, pasteurized or un-pasteurized milk. Data from a total of 130,604 samples were analysed. Mean prevalence for presence during 2005-2015 estimated from scientific literature (2.3% with confidence interval (CI): 1.4-3.8%) was more than three times higher than results from EFSA reports (0.7%; CI: 0.......05) for cheeses produced from pasteurized (0.9%; CI: 0.4-1.9%) or un-pasteurized (1.0%; CI: 0.4-2.2%) milk. For cheese samples reported by EFSA 0.2% CI: 0.1-0.4% had concentration of L. monocytogenes above the critical European limits of 100 cfu/g. In addition, this systematic review focused on groups...

  10. Sensitivity of Listeria monocytogenes to irradiation

    International Nuclear Information System (INIS)

    Tarjan, Veronika


    Irradiation of Listeria monocytogenes (L.m.) was carried out in culture media and pork meat paste at room temperature with 60 Co radiation source of 6.6 kGy h -1 dose rate. The employed doses were 0, 0.5, 1, 2, 3, 4 and 6 kGy. One strain out of 3 survived as high as 4 kGy irradiation. Radiation with 2 kGy resulted 7 log cycles reduction of cell count. After lower irradiation doses the L.m. count decreased in proportion to increasing doses. It has been concluded that L.m. compared with Gram-negative pathogens, are less sensitive to irradiation. (author) 6 refs.; 4 figs

  11. The Metalloprotease Mpl Supports Listeria monocytogenes Dissemination through Resolution of Membrane Protrusions into Vacuoles. (United States)

    Alvarez, Diego E; Agaisse, Hervé


    Listeria monocytogenes is an intracellular pathogen that disseminates within the intestinal epithelium through acquisition of actin-based motility and formation of plasma membrane protrusions that project into adjacent cells. The resolution of membrane protrusions into vacuoles from which the pathogen escapes results in bacterial spread from cell to cell. This dissemination process relies on the mlp-actA-plcB operon, which encodes ActA, a bacterial nucleation-promoting factor that mediates actin-based motility, and PlcB, a phospholipase that mediates vacuole escape. Here we investigated the role of the metalloprotease Mpl in the dissemination process. In agreement with previous findings showing that Mpl is required for PlcB activation, infection of epithelial cells with the ΔplcB or Δmpl strains resulted in the formation of small infection foci. As expected, the ΔplcB strain displayed a strong defect in vacuole escape. However, the Δmpl strain showed an unexpected defect in the resolution of protrusions into vacuoles, in addition to the expected but mild defect in vacuole escape. The Δmpl strain displayed increased levels of ActA on the bacterial surface in protrusions. We mapped an Mpl-dependent processing site in ActA between amino acid residues 207 to 238. Similar to the Δmpl strain, the ΔactA207-238 strain displayed increased levels of ActA on the bacterial surface in protrusions. Although the ΔactA207-238 strain displayed wild-type actin-based motility, it formed small infection foci and failed to resolve protrusions into vacuoles. We propose that, in addition to its role in PlcB processing and vacuole escape, the metalloprotease Mpl is required for ActA processing and protrusion resolution. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  12. Listeria monocytogenes - Danger for health safety vegetable production. (United States)

    Kljujev, Igor; Raicevic, Vera; Jovicic-Petrovic, Jelena; Vujovic, Bojana; Mirkovic, Milica; Rothballer, Michael


    The microbiologically contaminated vegetables represent a risk for consumers, especially vegetables without thermal processing. It is known that human pathogen bacteria, such as Listeria monocytogenes, could exist on fresh vegetables. The fresh vegetables could become Listeria-contaminated if they come in touch with contaminated soil, manure, irrigation water. The aim of this work was to investigate the presence of Listeria spp. and L. monocytogenes in different kind of vegetables grown in field and greenhouse condition as well as surface and endophytic colonization plant roots of different vegetables species by L. monocytogenes in laboratory conditions. The detection of Listeria spp. and L. monocytogenes in vegetable samples was done using ISO and PCR methods. The investigation of colonization vegetable roots and detection Listeria-cells inside plant root tissue was done using Fluorescence in situ hybridization (FISH) method in combination with confocal laser scanning microscopy (CLSM). The results showed that 25.58% vegetable samples were positive for Listeria spp. and only one sample (carrot) was positive for L. monocytogenes out of 43 samples in total collected from field and greenhouse. The strain L. monocytogenes EGD-E surface and endophytic colonized carrot root in highest degree while strain L. monocytogenes SV4B was the most represented at leafy vegetable plants, such at lettuce (1.68 × 10 6  cells/mm 3 absolutely dry root) and spinach (1.39 × 10 6  cells/mm 3 absolutely dry root) root surface. The cells of L. monocytogenes SV4B were visible as single cells in interior tissue of plant roots (celery and sweet corn roots) as well as in the interior of the plant root cell at sweet corn root. The cells of L. monocytogenes EGD-E bind to the surface of the plant root and they were less commonly found out on root hair. In the inner layers of the root, those bacterial cells were inhabited intercellular spaces mainly as single cells very close to the

  13. Study of phospholipases D and C in maturing and germinating seeds of Brassica napus

    Czech Academy of Sciences Publication Activity Database

    Novotná, Z.; Valentová, O.; Martinec, Jan; Feltl, Tomáš; Nokhrina, K.


    Roč. 28, - (2000), s. 817-818 ISSN 0300-5127 R&D Projects: GA ČR GA522/00/1332 Institutional research plan: CEZ:AV0Z5038910 Keywords : phospholipase C * phospholipase D Subject RIV: EF - Botanics Impact factor: 0.975, year: 2000

  14. Inhibition of [3H]nitrendipine binding by phospholipase A2

    International Nuclear Information System (INIS)

    Goldman, M.E.; Pisano, J.J.


    Phospholipase A 2 from several sources inhibited [ 3 H]nitrendipine binding to membranes from brain, heart and ileal longitudinal muscle. The enzymes from bee venom and Russell's viper venom were most potent, having IC 50 values of approximately 5 and 14 ng/ml, respectively, in all three membrane preparations. Inhibition of binding by bee venom phospholipase A 2 was time- and dose-dependent. Mastoparan, a known facilitator of phospholipase A 2 enzymatic activity, shifted the bee venom phospholipase A 2 dose-response curve to the left. Pretreatment of brain membranes with bee venom phospholipase A 2 (10 ng/ml) for 15 min caused a 2-fold increase in the K/sub d/ without changing the B/sub max/ compared with untreated membranes. Extension of the preincubation period to 30 min caused no further increase in the K/sub d/ but significantly decreased the B/sub max/ to 71% the value for untreated membranes. [ 3 H]Nitrendipine, preincubated with bee venom phospholipase A 2 , was recovered and found to be fully active, indicating that the phospholipase A 2 did not modify the ligand. It is concluded that phospholipase A 2 acts on the membrane at or near the [ 3 H]nitrendipine binding site and that phospholipids play a key role in the interactions of 1,4 dihydropyridine calcium channel antagonists with the dihydropyridine binding site. 33 references, 3 figures, 1 table

  15. Some aspects of rat platelet and serum phospholipase A2 activities

    NARCIS (Netherlands)

    Aarsman, A.J.; Roosenboom, C.F.P.; Geffen, G.E.W. van; Bosch, H. van den


    Rat platelet lysate contained appreciable phospholipase A2 activity. In agreement with literature data this enzymatic activity eluted in the void volume of a Sephadex G-100 column. When the void volume peak was chromatographed over a Matrex gel blue A column, part of the phospholipase A2 activity

  16. DMPD: Regulation of arachidonic acid release and cytosolic phospholipase A2activation. [Dynamic Macrophage Pathway CSML Database

    Lifescience Database Archive (English)

    Full Text Available 10080535 Regulation of arachidonic acid release and cytosolic phospholipase A2activ...on of arachidonic acid release and cytosolic phospholipase A2activation. PubmedID 10080535 Title Regulation ...of arachidonic acid release and cytosolic phospholipase A2activation. Authors Gij

  17. Diversity Assessment of Heat Resistance of Listeria monocytogenes Strains in a Continuous-Flow Heating System

    NARCIS (Netherlands)

    Veen, van der S.; Wagendorp, A.; Abee, T.; Wells-Bennik, M.H.J.


    Listeria monocytogenes is a foodborne pathogen that has the ability to survive relatively high temperatures compared with other nonsporulating foodborne pathogens. This study was performed to determine whether L. monocytogenes strains with relatively high heat resistances are adequately inactivated

  18. Soybean phospholipase D activity determination. A comparison of two methods

    Directory of Open Access Journals (Sweden)

    Ré, E.


    Full Text Available Due to a discrepancy between previously published results, two methods to determine the soybean phospholipase D activity were evaluated. One method is based on the extraction of the enzyme from whole soybean flour, quantifying the enzyme activity on the extract. The other method quantifies the enzymatic activity on whole soybean flour without enzyme extraction. In the extraction-based-method, both the extraction time and the number of extractions were optimized. The highest phospholipase D activity values were obtained from the method without enzyme extraction. This method is less complex, requires less running-time and the conditions of the medium in which phospholipase D acts resemble the conditions found in the oil industrySe evaluaron dos métodos para determinar la actividad de la fosfolipasa D en soja debido a que existe discrepancia entre los resultados publicados. Un método se basa en la extracción de la enzima de la harina resultante de la molienda del grano de soja entero, cuantificando la actividad sobre el extracto. En el otro método, la cuantificación se realiza sobre la harina del grano entero molido, sin extraer la enzima. En el método de extracción se optimizaron tanto el tiempo como el número de extracciones. Los mayores valores de actividad de la fosfolipasa D se obtuvieron por el método sin extracción de la enzima. Este método es más simple, exige menos tiempo de ejecución y las condiciones del medio en que actúa la fosfolipasa D se asemejan a las condiciones encontradas en la industria aceitera.

  19. Hemolytic potency and phospholipase activity of some bee and wasp venoms. (United States)

    Watala, C; Kowalczyk, J K


    1. The action of crude venoms of four aculeate species: Apis mellifera, Vespa crabro, Vespula germanica and Vespula vulgaris on human erythrocytes was investigated in order to determine the lytic and phospholipase activity of different aculeate venoms and their ability to induce red blood cell hemolysis. 2. Bee venom was the only extract to completely lyse red blood cells at the concentration of 2-3 micrograms/ml. 3. Phospholipase activity in all of the examined vespid venoms was similar and the highest value was recorded in V. germanica. 4. Vespid venoms exhibited phospholipase B activity, which is lacking in honeybee venom. 5. In all membrane phospholipids but lecithin, lysophospholipase activity of vespid venoms was 2-6 times lower than the relevant phospholipase activity. 6. The incubation of red blood cells with purified bee venom phospholipase A2 was not accompanied by lysis and, when supplemented with purified melittin, the increase of red blood cell lysis was approximately 30%.

  20. Secretory phospholipase A2 in dromedary tears: a host defense against staphylococci and other gram-positive bacteria. (United States)

    Ben Bacha, Abir; Abid, Islem


    The best known physiologic function of secreted phospholipase A2 (sPLA2) group IIA (sPLA2-IIA) is defense against bacterial infection through hydrolytic degradation of bacterial membrane phospholipids. In fact, sPLA2-IIA effectively kills Gram-positive bacteria and to a lesser extent Gram-negative bacteria and is considered a major component of the eye's innate immune defense system. The antibacterial properties of sPLA2 have been demonstrated in rabbit and human tears. In this report, we have analyzed the bactericidal activity of dromedary tears and the subsequently purified sPLA2 on several Gram-positive bacteria. Our results showed that the sPLA2 displays a potent bactericidal activity against all the tested bacteria particularly against the Staphylococcus strains when tested in the ionic environment of tears. There is a synergic action of the sPLA2 with lysozyme when added to the bacteria culture prior to sPLA2. Interestingly, lysozyme purified from dromedary tears showed a significant bactericidal activity against Listeria monocytogene and Staphylococcus epidermidis, whereas the one purified from human tears displayed no activity against these two strains. We have also demonstrated that Ca(2+) is crucial for the activity of dromedary tear sPLA2 and to a less extent Mg(2+) ions. Given the presence of sPLA2 in tears and intestinal secretions, this enzyme may play a substantial role in innate mucosal and systemic bactericidal defenses against Gram-positive bacteria.

  1. Purification of lysosomal phospholipase A and demonstration of proteins that inhibit phospholipase A in a lysosomal fraction from rat kidney cortex

    Energy Technology Data Exchange (ETDEWEB)

    Hostetler, K.Y.; Gardner, M.F.; Giordano, J.R.


    Phospholipase A has been isolated from a crude lysosomal fraction from rat kidney cortex and purified 7600-fold with a recovery of 9.8% of the starting activity. The purified enzyme is a glycoprotein having an isoelectric point of pH 5.4 and an apparent molecular weight of 30,000 by high-pressure liquid chromatography gel permeation. Naturally occurring inhibitors of lysosomal phospholipase A are present in two of the lysosomal-soluble protein fractions obtained in the purification. They inhibit hydrolysis of 1,2-di(1-/sup 14/C)oleoylphosphatidylcholine by purified phospholipase A/sub 1/ with IC/sub 50/ values of 7-11 The inhibition is abolished by preincubation with trypsin at 37/sup 0/C, but preincubation with trypsin at 4/sup 0/C has no effect, providing evidence that the inhibitors are proteins. The results suggest that the activity of lysosomal phospholipase A may be regulated in part by inhibitory proteins. Lysosomal phospholipase A from rat kidney hydrolyzes the sn-1 acyl group of phosphatidylcholine, does not require divalent cations for full activity, and is not inhibited by ethylenediaminetetraacetic acid. It has an acid pH optimum of 3.6-3.8. Neither rho-bromophenacyl bromide, diisopropyl fluorophosphate, nor mercuric ion inhibits phospholipase A/sub 1/. In contrast to rat liver, which has two major isoenzymes of acid phospholipase A/sub 1/, kidney cortex has only one isoenzyme of lysosomal phospholipase A/sub 1/.

  2. Characterization and partial purification of phospholipase D from human placenta

    DEFF Research Database (Denmark)

    Vinggaard, Anne Marie; Hansen, Harald S.


    We report the existence in the human placenta of a phosphatidylcholine- hydrolyzing phospholipase D (PLD) activity, which has been characterized and partially purified. Triton X-100 effectively solubilized PLD from the particulate fraction of human placenta in a dose-dependent manner. However......, Triton X-100 caused decreasing enzyme activities. Maximum transphosphatidylation was obtained with 2% ethanol. The enzyme was found to have a pH optimum of 7.0-7.5 and an apparent K(m) of 33 mol% (or 0.8 mM). Ca and Mg was not required for the enzyme activity. Addition of phosphatidyl-4,5-bisphosphate...

  3. Meningoencefalite por Listeria monocytogenes em ovinos Meningoencephalitis in sheep caused by Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Daniel R. Rissi


    Full Text Available São descritos sete casos de doença neurológica em ovinos por Listeria monocytogenes no Rio Grande do Sul e Paraná entre 2000 e 2007. Foram afetados ovinos com idades entre 12-24 meses. Os casos ocorreram no verão e início da primavera e os índices gerais de morbidade e letalidade foram de 3,15% e 100%, respectivamente. Quando essa informação estava disponível, nenhum dos ovinos afetados era alimentado com silagem. Em três propriedades havia contato próximo dos ovinos afetados com outras espécies. A evolução do quadro clínico foi de 12 horas a três dias e os sinais clínicos foram caracterizados por decúbito (7/7, desvio da cabeça (4/7, incoordenação (3/7, depressão (3/7, andar em círculos (2/7, cegueira unilateral, emagrecimento progressivo, febre, midríase, movimentos de pedalagem, nistagmo lateral, opistótono, paralisia flácida dos membros pélvicos ou dos quatro membros, salivação excessiva e tremores (1/7 cada. Histologicamente observou-se encefalite com microabscessos, predominantemente unilateral com variáveis graus de gliose e alterações degenerativas como esferóides axonais e infiltração de células Gitter. As lesões se estendiam desde a medula oblonga até o mesencéfalo. Antígenos de Listeria monocytogenes foram detectados por imuno-histoquímica em seções de tronco encefálico de todos os ovinos afetados. O diagnóstico foi realizado com base nos achados epidemiológicos e clinico-patológicos, e confirmado pela imuno-histoquímica (IHQ utilizando anticorpo policlonal anti-L. monocytogenes.Seven cases of neurological disease in sheep caused by Listeria monocytogenes in Rio Grande do Sul and Paraná state, southern Brazil are described. The cases occurred between 2000 and 2007 and 12-24-month-old sheep were affected. Overall morbidity and lethality rates were 3.15% and 100%, respectively. Cases occurred in the summer and early spring. When this information was available, affected sheep had not been





    2015 SYAHRIANA SABIL (I 111 11 273). Pasteurisasi High Temperature Short Time (HTST) Susu terhadap Listeria monocytogenes pada Penyimpanan Refrigerator. Dibimbing oleh RATMAWATI MALAKA dan FARIDA NUR YULIATI. Pasteurisasi High Temperature Short Time (HTST) merupakan proses pemanasan susu di bawah titik didih yang diharapkan dapat membunuh Listeria monocytogenes (L. monocytogenes) karena bersifat patogen dan mengakibatkan listeriosis yang merupakan penyakit zoonosis. Tu...

  5. Industrial disinfectants do not select for resistance in Listeria monocytogenes following long term exposure

    DEFF Research Database (Denmark)

    Kastbjerg, Vicky Gaedt; Gram, Lone


    or tolerance would evolve in L. monocytogenes under continued selection in three industrial disinfectants. L. monocytogenes EGD was exposed to Desinfect CL (hypochlorite) and Incimaxx DES (peracedic acid and hydrogen peroxide) for several hundred generations. This caused no increase in the minimal inhibitory......, and that the disinfectants are still efficient for controlling microorganisms such as L. monocytogenes....

  6. Listeria monocytogenes in Fresh Produce: Outbreaks, Prevalence and Contamination Levels

    Directory of Open Access Journals (Sweden)

    Qi Zhu


    Full Text Available Listeria monocytogenes, a member of the genus Listeria, is widely distributed in agricultural environments, such as soil, manure and water. This organism is a recognized foodborne pathogenic bacterium that causes many diseases, from mild gastroenteritis to severe blood and/or central nervous system infections, as well as abortion in pregnant women. Generally, processed ready-to-eat and cold-stored meat and dairy products are considered high-risk foods for L. monocytogenes infections that cause human illness (listeriosis. However, recently, several listeriosis outbreaks have been linked to fresh produce contamination around the world. Additionally, many studies have detected L. monocytogenes in fresh produce samples and even in some minimally processed vegetables. Thus L. monocytogenes may contaminate fresh produce if present in the growing environment (soil and water. Prevention of biofilm formation is an important control measure to reduce the prevalence and survival of L. monocytogenes in growing environments and on fresh produce. This article specifically focuses on fresh produce–associated listeriosis outbreaks, prevalence in growing environments, contamination levels of fresh produce, and associated fresh produce safety challenges.

  7. Prebiotic Oligosaccharides Potentiate Host Protective Responses against L. Monocytogenes Infection

    Directory of Open Access Journals (Sweden)

    Poyin Chen


    Full Text Available Prebiotic oligosaccharides are used to modulate enteric pathogens and reduce pathogen shedding. The interactions with prebiotics that alter Listeria monocytogenes infection are not yet clearly delineated. L. monocytogenes cellular invasion requires a concerted manipulation of host epithelial cell membrane receptors to initiate internalization and infection often via receptor glycosylation. Bacterial interactions with host glycans are intimately involved in modulating cellular responses through signaling cascades at the membrane and in intracellular compartments. Characterizing the mechanisms underpinning these modulations is essential for predictive use of dietary prebiotics to diminish pathogen association. We demonstrated that human milk oligosaccharide (HMO pretreatment of colonic epithelial cells (Caco-2 led to a 50% decrease in Listeria association, while Biomos pretreatment increased host association by 150%. L. monocytogenes-induced gene expression changes due to oligosaccharide pretreatment revealed global alterations in host signaling pathways that resulted in differential subcellular localization of L. monocytogenes during early infection. Ultimately, HMO pretreatment led to bacterial clearance in Caco-2 cells via induction of the unfolded protein response and eIF2 signaling, while Biomos pretreatment resulted in the induction of host autophagy and L. monocytogenes vacuolar escape earlier in the infection progression. This study demonstrates the capacity of prebiotic oligosaccharides to minimize infection through induction of host-intrinsic protective responses.

  8. Low prevalence of Listeria monocytogenes in cull sows and pork. (United States)

    Wesley, Irene V; Larsen, Steven; Hurd, H Scott; McKean, James D; Griffith, Ronald; Rivera, Fernando; Nannapaneni, Ramakrishna; Cox, Mandy; Johnson, Michael; Wagner, Dean; de Martino, Mary


    The goal of this study was to determine the prevalence of Listeria monocytogenes in sows slaughtered at a single Midwestern plant on two occasions (trial 1, n = 179 sows; trial 2, n = 160 sows). Fecal samples collected antemortem (trial 1) as well as animal tissues, and carcass swabs collected at the abattoir (trials 1 and 2) were analyzed. Eight isolates of L. monocytogenes were recovered from five samples that represented 0.18% of the total samples (n = 2,775). In trial 1, L. monocytogenes was detected in a tonsil sample (0.6%; 1 positive of 181 tonsils), in a carcass (0.6%; 1 positive of 179 carcasses), which was sampled prior to the organic rinse, and in two chopped meat block samples (1.2%; 2 positive of 165 samples). In trial 2, L. monocytogenes was only detected in a single chopped meat block sample (0.15%; 1 positive of 688 total samples). These data indicate the low prevalence of L. monocytogenes in the cull sow.

  9. Commensal microbes provide first line defense against Listeria monocytogenes infection (United States)

    Littmann, Eric R.; Kim, Sohn G.; Morjaria, Sejal M.; Ling, Lilan; Gyaltshen, Yangtsho; Taur, Ying; Leiner, Ingrid M.


    Listeria monocytogenes is a foodborne pathogen that causes septicemia, meningitis and chorioamnionitis and is associated with high mortality. Immunocompetent humans and animals, however, can tolerate high doses of L. monocytogenes without developing systemic disease. The intestinal microbiota provides colonization resistance against many orally acquired pathogens, and antibiotic-mediated depletion of the microbiota reduces host resistance to infection. Here we show that a diverse microbiota markedly reduces Listeria monocytogenes colonization of the gut lumen and prevents systemic dissemination. Antibiotic administration to mice before low dose oral inoculation increases L. monocytogenes growth in the intestine. In immunodeficient or chemotherapy-treated mice, the intestinal microbiota provides nonredundant defense against lethal, disseminated infection. We have assembled a consortium of commensal bacteria belonging to the Clostridiales order, which exerts in vitro antilisterial activity and confers in vivo resistance upon transfer into germ free mice. Thus, we demonstrate a defensive role of the gut microbiota against Listeria monocytogenes infection and identify intestinal commensal species that, by enhancing resistance against this pathogen, represent potential probiotics. PMID:28588016

  10. Deciphering the landscape of host barriers to Listeria monocytogenes infection. (United States)

    Zhang, Ting; Abel, Sören; Abel Zur Wiesch, Pia; Sasabe, Jumpei; Davis, Brigid M; Higgins, Darren E; Waldor, Matthew K


    Listeria monocytogenes is a common food-borne pathogen that can disseminate from the intestine and infect multiple organs. Here, we used sequence tag-based analysis of microbial populations (STAMP) to investigate L monocytogenes population dynamics during infection. We created a genetically barcoded library of murinized L monocytogenes and then used deep sequencing to track the pathogen's dissemination routes and quantify its founding population ( N b ) sizes in different organs. We found that the pathogen disseminates from the gastrointestinal tract to distal sites through multiple independent routes and that N b sizes vary greatly among tissues, indicative of diverse host barriers to infection. Unexpectedly, comparative analyses of sequence tags revealed that fecally excreted organisms are largely derived from the very small number of L. monocytogenes cells that colonize the gallbladder. Immune depletion studies suggest that distinct innate immune cells restrict the pathogen's capacity to establish replicative niches in the spleen and liver. Finally, studies in germ-free mice suggest that the microbiota plays a critical role in the development of the splenic, but not the hepatic, barriers that prevent L. monocytogenes from seeding these organs. Collectively, these observations illustrate the potency of the STAMP approach to decipher the impact of host factors on population dynamics of pathogens during infection.

  11. Prevalence and antimicrobial susceptibility of Listeria monocytogenes on chicken carcasses in Bandung, Indonesia. (United States)

    Sugiri, Yoni Darmawan; Gölz, Greta; Meeyam, Tongkorn; Baumann, Maximilian P O; Kleer, Josef; Chaisowwong, Warangkhana; Alter, Thomas


    This study was conducted to determine the prevalence and quantify the number of Listeria monocytogenes in fresh chicken carcasses sold in traditional markets and supermarkets in Bandung, West Java, Indonesia, and to determine the antimicrobial resistance patterns of the isolated L. monocytogenes strains. The overall prevalence of L. monocytogenes in chicken carcasses was 15.8% (29/184). When comparing samples from traditional markets and supermarkets, no significant difference in the L. monocytogenes prevalence was detectable (15.2 versus 16.3%). Of the samples, 97.3% had L. monocytogenes counts study were grouped into the molecular serogroup IIb, comprising the serovars 1/2b, 3b, and 7.

  12. Behaviour of Listeria monocytogenes in artisanal raw milk Pecorino Umbro cheese: a microbiological challenge test

    Directory of Open Access Journals (Sweden)

    Roberta Ortenzi


    Full Text Available In the present study, a microbiological challenge test in artificially contaminated raw milk Pecorino Umbro cheese during cheese-making was carried out. Raw ewe milk was contaminated by a suspension of particular Listeria monocytogenes strains. The number of L. monocytogenes and L. monocytogenes dynamic growth were evaluated during cheese-making and storage. A significant decrease of the viable count of L. monocytogenes was observed during ripening and L. monocytogenes viable count was below the limit of quantification during storage. The results show that the product is unable to support the growth of the pathogen.

  13. Microbiological criteria for Listeria monocytogenes in foods under special consideration of risk assessment approaches

    DEFF Research Database (Denmark)

    Nørrung, Birgit


    This paper shortly summarizes data related to risk assessment of Listeria monocytogenes. From available data on risk assessment, it is concluded that the levels of L. monocytogenes consumed is an important factor affecting the incidence of listeriosis. Foods that do not support the growth of L....... monocytogenes are unlikely to be a source of listeriosis, whereas foods that support the growth to high levels, should be the target of risk management efforts. Based on current epidemiological information from several countries, a concentration of L. monocytogenes not exceeding 100/g of food at the time...... of L. monocytogenes in the food during prevailing storage and distribution conditions is needed....

  14. Early trigeminal nerve involvement in Listeria monocytogenes rhombencephalitis

    DEFF Research Database (Denmark)

    Karlsson, William K; Harboe, Zitta Barrella; Roed, Casper


    dysfunction on that side. In addition, we identified another 120 cases of Listeria rhombencephalitis following a systematic review. Cranial nerves VII, V, IX, and X, respectively, medulla oblongata, cerebellum and pons, were the most frequently involved brain structures. The present clinical and radiological...... findings corroborate earlier data from animal experiments, indicating that L. monocytogenes may be capable of retrograde intra-axonal migration along the cranial nerves. We suggest that in a subset of patients with rhombencephalitis L. monocytogenes enters the cerebellopontine angle through the trigeminal......Listeria monocytogenes is associated with rhombencephalitis. However, the exact mechanisms of brainstem invasion remains poorly understood. Here, we demonstrate clinical and radiological data suggesting that Listeria may invade the brainstem via the trigeminal nerve. Three females (41, 64 and 70...


    Directory of Open Access Journals (Sweden)

    G. Tantillo


    Full Text Available The aim of this study was to compare the performance of the conventional methods for detection of Listeria monocytogenes in food using media Oxford and ALOA (Agar Listeria acc. to Ottaviani & Agosti in according to the ISO 11290-1 to a new chromogenic medium “CHROMagar Listeria” standardized in 2005 AFNOR ( CHR – 21/1-12/01. A total of 40 pre-packed ready-to-eat food samples were examined. Using two methods six samples were found positive for Listeria monocytogenes but the medium “CHROMagar Listeria” was more selective in comparison with the others. In conclusion this study has demonstrated that isolation medium able to target specifically the detection of L. monocytogenes such as “CHROMagar Listeria” is highly recommendable because of that detection time is significantly reduced and the analysis cost is less expensive.

  16. [Analysis of antibiotic susceptibility of foodborne Listeria monocytogenes in China]. (United States)

    Yang, Yang; Fu, Ping; Guo, Yunchang; Liu, Xiurmei


    To study the antibiotic susceptibility of foodborne Listeria monocytogenes in China. The susceptibilities of 476 strains of foodborne Listeria monocytogenes to antibiotics were determined in Broth Microdilution Susceptibility Testing in Clinical and Laboratory Standards Institute. The antibiotics of gentamicin, ampicillin, penicillin, tetracycline, doxycycline, imipenem, erythromycin, ciprofloxacin, levofloxacin, cephalothin, rifampin, vancomycin, chloramphenicol, Trimethoprim-sulfamethoxazole, ampicillin-sulbactam were used. The rates of antibiotic resistance in 467 is olates were 4.5%. Tetracycline resistance was most prevalent, accouting for 4.07% . The foods that the rates of antibiotic resistance were highest were vegetable (10%). Among 14 provinces, Jilin, Hubei and Hebei were the third top, the rate of which were 19.6% and 9.1% and 8%, respectively. It was suggested that antibiotic resistance exists in foodborne Listeria monocytogenes to a certain extent in China. It should pay more attention to the use of drugs in prevention and clinic treatment to reduce the antibiotic resistant strains.

  17. Inactivation of Listeria monocytogenes in milk by pulsed electric field. (United States)

    Reina, L D; Jin, Z T; Zhang, Q H; Yousef, A E


    Pasteurized whole, 2%, and skim milk were inoculated with Listeria monocytogenes Scott A and treated with high-voltage pulsed electric field (PEF). The effects of milk composition (fat content) and PEF parameters (electric field strength, treatment time, and treatment temperature) on the inactivation of the bacterium were studied. No significant differences were observed in the inactivation of L. monocytogenes Scott A in three types of milk by PEF treatment. With treatment at 25 degrees C, 1- to 3-log reductions of L. monocytogenes were observed. PEF lethal effect was a function of field strength and treatment time. Higher field strength or longer treatment time resulted in a greater reduction of viable cells. A 4-log reduction of the bacterium was obtained by increasing the treatment temperature to 50 degrees C. Results indicate that the use of a high-voltage PEF is a promising technology for inactivation of foodborne pathogens.

  18. Role of Extracellular DNA during Biofilm Formation by Listeria monocytogenes

    DEFF Research Database (Denmark)

    Harmsen, Morten; Lappann, Martin; Knøchel, S


    (eDNA) may be the only central component of the biofilm matrix and that it is necessary for both initial attachment and early biofilm formation for 41 L. monocytogenes strains that were tested. DNase I treatment resulted in dispersal of biofilms, not only in microtiter tray assays but also in flow......Listeria monocytogenes is a food-borne pathogen that is capable of living in harsh environments. It is believed to do this by forming biofilms, which are surface-associated multicellular structures encased in a self-produced matrix. In this paper we show that in L. monocytogenes extracellular DNA...... cell biofilm assays. However, it was also demonstrated that in a culture without eDNA, neither Listeria genomic DNA nor salmon sperm DNA by itself could restore the capacity to adhere. A search for additional necessary components revealed that peptidoglycan (PG), specifically N-acetylglucosamine (NAG...

  19. Listeria spp., y L. monocytogenes EN LECHE CRUDA DE CABRA

    Directory of Open Access Journals (Sweden)

    Yolanda Albarracín C


    Full Text Available Objective. To test non-pasteurized goat’s milk from the village of ‘la Garita’, Northern Santander, for Listeria monocytogenes. Material and methods. 90 samples of non-pasteurized goat’s milk were obtained over a 4 month period; pH and temperature of each sample were measured. The INVIMA technique was used to isolate L. monocytogenes; the species was confirmed by PCR. Results. The study showed that eight goat milk providers of the zone neither had refrigeration nor pasteurized the milk. The prevalence of L. monocytogenes was 3%; 15% of the samples had other species of Listeria. The milk obtained from this zone contained the pathogen that may cause listeriosis in children less than 5 years of age, pregnant women, adults and immunologically compromised patients. Conclusions. This study shows the occurrence of this pathogen in goat’s milk and identified areas of risk for those people who drink goat’s milk.

  20. Review of Prosthetic Joint Infection from Listeria monocytogenes. (United States)

    Bader, Gilbert; Al-Tarawneh, Mohammed; Myers, James


    Prosthetic joint infection from Listeria monocytogenes is rare. We decided to shed light on this illness and review the reported cases to better understand its characteristics. We conducted a comprehensive review of the English literature using PubMed. We also included one case that we had managed. We found 25 cases of prosthetic joint infection from L. monocytogenes reported individually and a retrospective study of 43 cases of joint and bone listerial infection, including 34 with prosthetic joint infection, conducted in France. We have described their clinical and para-clinical features and tried to elaborate on the pathophysiology, treatment, and prevention. Prosthetic joint infection from L. monocytogenes is mainly late. Systemic inflammation may be absent. Although rare, it must be suspected in patients at high risk for both prosthetic joint and listerial infections. In addition, those patients must be instructed on appropriate preventive measures.

  1. Listeria monocytogenes response regulators important for stress tolerance and pathogenesis

    DEFF Research Database (Denmark)

    Kallipolitis, B H; Ingmer, H


    Environmental sensing by two-component signal transduction systems is likely to play a role for growth and survival of Listeria monocytogenes both during transmission in food products and within a host organism. Two-component systems typically consist of a membrane-associated sensor histidine...... kinase and a gene regulatory protein, the response regulator (RR). We have identified seven putative RR genes in L. monocytogenes LO28 by PCR using degenerate oligonucleotide primers. By insertional inactivation we obtained data suggesting that three of the putative RRs contribute to the pathogenicity...... of L. monocytogenes in mice. Strikingly, the mutants that were attenuated in virulence also had a decreased ability to grow in the presence of various stress conditions potentially encountered in an infection process. Thus, our data point to a connection between the ability of the putative two...

  2. Animal models for oral transmission of Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Sarah E F D'Orazio


    Full Text Available Listeria monocytogenes has been recognized as a food borne pathogen in humans since the 1980s, but we still understand very little about oral transmission of L. monocytogenes or the host factors that determine susceptibility to gastrointestinal infection, due to the lack of an appropriate small animal model of oral listeriosis. Early feeding trials suggested that many animals were highly resistant to oral infection, and the more reproducible intravenous or intraperitoneal routes of inoculation soon came to be favored. There are a fair number of previously published studies using an oral infection route, but the work varies widely in terms of bacterial strain choice, the methods used for oral transmission, and various manipulations used to enhance infectivity. This mini review will summarize the published literature using oral routes of L. monocytogenes infection and will highlight recent technological advances that have made oral infection a more attractive model system.

  3. Site-specific epsilon-NH2 monoacylation of pancreatic phospholipase A2. 2. Transformation of soluble phospholipase A2 into a highly penetrating "membrane-bound" form. (United States)

    Van der Wiele, F C; Atsma, W; Roelofsen, B; van Linde, M; Van Binsbergen, J; Radvanyi, F; Raykova, D; Slotboom, A J; De Haas, G H


    Long-chain lecithins present in bilayer structures like vesicles or membranes are only very poor substrates for pancreatic phospholipases A2. This is probably due to the fact that pancreatic phospholipases A2 cannot penetrate into the densely packed bilayer structures. To improve the weak penetrating properties of pancreatic phospholipases A2, we prepared and characterized a number of pancreatic phospholipase A2 mutants that have various long acyl chains linked covalently to Lys116 in porcine and to Lys10 in bovine phospholipase A2 [Van der Wiele, F.C., Atsma, W., Dijkman, R., Schreurs, A.M.M., Slotboom, A.J., & De Haas, G.H. (1988) Biochemistry (preceding paper in this issue)]. When monomolecular surface layers of L- and D-didecanoyllecithin were used, it was found that the introduction of caprinic, lauric, palmitic, and oleic acid at Lys116 in the porcine enzyme increases its penetrating power from 13 to about 17, 20, 32, and 22 dyn/cm, respectively, before long lag periods were obtained. Incorporation of a palmitoyl moiety at Lys10 in the bovine enzyme shifted the penetrating power from 11 to about 25 dyn/cm. Only the best penetrating mutant, viz., porcine phospholipase A2 having a palmitoyl moiety at Lys116, was able to cause complete leakage of 6-carboxyfluorescein entrapped in small unilamellar vesicles of egg lecithin under nonhydrolytic conditions. Similarly, only this latter palmitoylphospholipase A2 completely hydrolyzed all lecithin in the outer monolayer of the human erythrocyte at a rate much faster than Naja naja phospholipase A2, the most powerful penetrating snake venom enzyme presently known.

  4. Listeria monocytogenes in retailed raw chicken meat in Turkey. (United States)

    Siriken, Belgin; Ayaz, Naim Deniz; Erol, Irfan


    The objectives of this study were, to find the prevalence and antimicrobial resistance of L. monocytogenes from a total of 116 chicken meat samples including 50 carcasses and 66 meat parts marketed in Turkey between 2008 and 2009 using immunomagnetic separation (IMS) based cultivation technique, to detect the hlyA gene for the verification of the isolates by PCR, and to identify the genoserotypes of the L. monocytogenes isolates by multiplex PCR assay. In the study, 51 L. monocytogenes colonies were isolated from 34 (29.3%) chicken meat samples (eleven [22.0%] carcasses and 23 [34.8%] pieces of meat) by IMS based cultivation technique and confirmed by PCR. According to the multiplex PCR results, all the 51 isolates were identified as genoserotype IIa (1/2a or 3a). L. monocytogenes isolates were also tested for their susceptibility to eight antibiotic (gentamicin, vancomycin, chloramphenicol, streptomycin, tetracycline, ampicillin, penicillin G, erythromycin) agents using the disk diffusion method. 14 isolates (27.45%) were susceptible to all eight antimicrobials drugs tested and the remaining 37 isolates (72.54%) were resistant to gentamicin (one isolate, 1.96%), vancomycin (four isolates, 7.84%), penicillin G (six isolates, 11.76%), streptomycin (nine isolates, 17.64%; resistant or intermediate), tetracycline (seven isolates, 13.72%) and ampicillin (six isolates, 11.76%). This study showed that antimicrobial resistance is not highly prevalent in L. monocytogenes isolated from chicken carcasses and pieces of meat. The presence of L. monocytogenes in chicken samples suggests an importance of this pathogen in chicken.

  5. Aerosol studies with Listeria innocua and Listeria monocytogenes. (United States)

    Zhang, Guodong; Ma, Li; Oyarzabal, Omar A; Doyle, Michael P


    Aerosol studies of Listeria monocytogenes in food processing plants have been limited by lack of a suitable surrogate microorganism. The objective of this study was to investigate the potential of using green fluorescent protein-labeled strains of Listeria innocua as a surrogate for L. monocytogenes for aerosol studies. These studies were conducted in a laboratory bioaerosol chamber and a pilot food-processing facility. Four strains of L. innocua and five strains of L. monocytogenes were used. In the laboratory chamber study, Listeria cells were released into the environment at two different cell numbers and under two airflow conditions. Trypticase soy agar (TSA) plates and oven-roasted breasts of chicken and turkey were placed in the chamber to monitor Listeria cell numbers deposited from aerosols. A similar experimental design was used in the pilot plant study; however, only L. innocua was used. Results showed that L. monocytogenes and L. innocua survived equally well on chicken and turkey breast meats and TSA plates. No-fan and continuous fan applications, which affected airflow, had no significant effect on settling rates of aerosolized L. monocytogenes and L. innocua in the bioaerosol chamber or L. innocua in the pilot plant study. Listeriae cell numbers in the air decreased rapidly during the first 1.5 h following release, with few to no listeriae detected in the air at 3 h. Aerosol particles with diameters of 1 and 2 microM correlated directly with the number of Listeria cells in the aerosol but not with particles that were 0.3, 0.5, and 5 microM in diameter. Results indicate that L. innocua can be used as a surrogate for L. monocytogenes in an aerosol study.

  6. Spontaneous Loss of Virulence in Natural Populations of Listeria monocytogenes. (United States)

    Maury, Mylène M; Chenal-Francisque, Viviane; Bracq-Dieye, Hélène; Han, Lei; Leclercq, Alexandre; Vales, Guillaume; Moura, Alexandra; Gouin, Edith; Scortti, Mariela; Disson, Olivier; Vázquez-Boland, José A; Lecuit, Marc


    The pathogenesis of Listeria monocytogenes depends on the ability of this bacterium to escape from the phagosome of the host cells via the action of the pore-forming toxin listeriolysin O (LLO). Expression of the LLO-encoding gene ( hly ) requires the transcriptional activator PrfA, and both hly and prfA genes are essential for L. monocytogenes virulence. Here, we used the hemolytic activity of LLO as a phenotypic marker to screen for spontaneous virulence-attenuating mutations in L. monocytogenes Sixty nonhemolytic isolates were identified among a collection of 57,820 confirmed L. monocytogenes strains isolated from a variety of sources (0.1%). In most cases (56/60; 93.3%), the nonhemolytic phenotype resulted from nonsense, missense, or frameshift mutations in prfA Five strains carried hly mutations leading to a single amino acid substitution (G299V) or a premature stop codon causing strong virulence attenuation in mice. In one strain, both hly and gshF (encoding a glutathione synthase required for full PrfA activity) were missing due to genomic rearrangements likely caused by a transposable element. The PrfA/LLO loss-of-function (PrfA - /LLO - ) mutants belonged to phylogenetically diverse clades of L. monocytogenes , and most were identified among nonclinical strains (57/60). Consistent with the rare occurrence of loss-of-virulence mutations, we show that prfA and hly are under purifying selection. Although occurring at a low frequency, PrfA - /LLO - mutational events in L. monocytogenes lead to niche restriction and open an evolutionary path for obligate saprophytism in this facultative intracellular pathogen. Copyright © 2017 Maury et al.

  7. A rapid phospholipase A2 bioassay using 14C-oleate-labelled E. coli bacterias. (United States)

    Meyer, T; von Wichert, P; Weins, D


    Two methods of phospholipase A2 determination using 14C-labelled E. coli bacterias as substrate were compared. One method works with a filter membrane for separation of cleaved 14C-oleate from remaining phospholipids, the other uses the well-known thin-layer chromatography for lipid analysis. Some features of human serum phospholipase A2 regarding pH and Ca2+ dependency were investigated. Possible sources of errors were discussed. It was shown that either method can differentiate between normal and pathologically elevated phospholipase A2 levels, but that the filter method is superior in terms of sensitivity and workload.

  8. Chemoenzymatic synthesis of fluorogenic phospholipids and evaluation in assays of phospholipases A, C and D

    DEFF Research Database (Denmark)

    Piel, Mathilde S.; Peters, Günther H.J.; Brask, Jesper


    Phospholipases are ubiquitous in nature and the target of significant research aiming at both their physiological roles and technical applications in e.g. the food industry. In the search for sensitive and selective phospholipase assays, we have focused on synthetic FRET (Forster resonance energy...... lyso-(dansyl-FA)-GPE-dabcyl (6) and (dansyl-FA)2-GPE-dabcyl (7) were synthesized by a chemoenzymatic strategy, in which preparation of (6) further included a novel selective enzymatic esterification step. As proof of concept, activity of a handful of phospholipases, one from each of the PLA1, PLA2, PLC...

  9. Listeria monocytogenes in poultry and poultry products: Epidemiological investigations in seven Danish abattoirs

    DEFF Research Database (Denmark)

    Ojeniyi, B.; Wegener, Henrik Caspar; Jensen, N.E.


    Listeria monocytogenes was isolated from 11/236 (4 . 7%) caecal samples from parent flocks, providing broilers to the abattoirs investigated. Caecal samples from 2078 broilers representing 90 randomly selected broiler flocks were negative for L. monocytogenes. A total of 3080 samples from seven...... abattoirs including poultry processing line samples, and final products were also examined for L. monocytogenes. Listeria monocytogenes was isolated in 0 . 3% to 18 . 7% of the samples collected in the different abattoirs. Epidemiological typing of 247 L. monocytogenes isolates, including serotyping, phage...... isolates of L. monocytogenes since only 120/247 (48 . 6%) isolates were typable by phage typing and 230/247 (93 . 1%) L. monocytogenes belonged to serotype 01 while 6/247 (2 . 4%) belonged to 04. The discovery of a few dominating clones in each abattoir might indicate an endemic occurrence of L...

  10. Variations in virulence between different electrophoretic types of Listeria monocytogenes

    DEFF Research Database (Denmark)

    Nørrung, Birgit; Andersen, Jens Kirk


    A total of 245 strains of Listeria monocytogenes, representing 33 different electrophoretic types (ETs), were examined quantitatively for haemolytic activity. No significant difference was observed in the mean haemolytic activity between different ETs. Eighty four out of 91 strains examined were...... compared with 3.64 among food isolates). The explanation for this may be that more virulent strains are more prone to cause human infection. It is, however, also possible that strains oft. monocytogenes may become more virulent while multiplying in a living organism compared with multiplying in foods....

  11. Unconventional Trafficking of Mammalian Phospholipase D3 to Lysosomes

    Directory of Open Access Journals (Sweden)

    Adriana Carolina Gonzalez


    Full Text Available Variants in the phospholipase D3 (PLD3 gene have genetically been linked to late-onset Alzheimer's disease. We present a detailed biochemical analysis of PLD3 and reveal its endogenous localization in endosomes and lysosomes. PLD3 reaches lysosomes as a type II transmembrane protein via a (for mammalian cells uncommon intracellular biosynthetic route that depends on the ESCRT (endosomal sorting complex required for transport machinery. PLD3 is sorted into intraluminal vesicles of multivesicular endosomes, and ESCRT-dependent sorting correlates with ubiquitination. In multivesicular endosomes, PLD3 is subjected to proteolytic cleavage, yielding a stable glycosylated luminal polypeptide and a rapidly degraded N-terminal membrane-bound fragment. This pathway closely resembles the delivery route of carboxypeptidase S to the yeast vacuole. Our experiments reveal a biosynthetic route of PLD3 involving proteolytic processing and ESCRT-dependent sorting for its delivery to lysosomes in mammalian cells.

  12. Recent research progress with phospholipase C from Bacillus cereus. (United States)

    Lyu, Yan; Ye, Lidan; Xu, Jun; Yang, Xiaohong; Chen, Weiwei; Yu, Hongwei


    Phospholipase C (PLC) catalyzes the hydrolysis of phospholipids to produce phosphate monoesters and diacylglycerol. It has many applications in the enzymatic degumming of plant oils. PLC Bc , a bacterial PLC from Bacillus cereus, is an optimal choice for this activity in terms of its wide substrate spectrum, high activity, and approved safety. Unfortunately, its large-scale production and reliable high-throughput screening of PLC Bc remain challenging. Herein, we summarize the research progress regarding PLC Bc with emphasis on the screening methods, expression systems, catalytic mechanisms and inhibitor of PLC Bc . This review hopefully will inspire new achievements in related areas, to promote the sustainable development of PLC Bc and its application.

  13. Cyclopentanoid analogs of phosphatidylcholine: susceptibility to phospholipase A2. (United States)

    Lister, M D; Hancock, A J


    Six isomers of dipalmitoylcyclopentanetriol phosphocholine (cyclopentano-lecithin) were tested as potential substrates for phospholipase A2. Since each of these analogs possesses a configuration that mimics a narrow range of conformations of a glycerophospholipid molecule, the analogs were used to assess the enzyme's conformational requirements. Studies showed that all of the analogs containing the phosphocholine at the C-1 (or C-3) position could be hydrolyzed, while only one of the three analogs that contains the polar head group at the C-2 position was susceptible. Kinetic studies, however, revealed that only the all-trans-(1,3/2-1P)-cyclopentano-lecithin gave initial rates of hydrolysis that were measurable by pH-stat. Acyl group specificity of the enzyme towards the all-trans isomer was determined with an analog was acyl groups were distinguishable. The synthesis of this mixed-acid-cyclopentano-PC is described herein. When this analog was enzymatically assayed, results unequivocally showed the enzyme to be specific for C-2 acyl hydrolysis. This specificity, and data showing that the all-trans analog is stereospecifically hydrolyzed, indicate that it is acted on in an analogous manner to dipalmitoylphosphatidylcholine. These studies indicate that although the configuration of the analog is not necessarily a prerequisite for hydrolysis, there does appear to be an optimal spatial orientation for enzymatic activity. The analogy between the susceptibilities of all-trans-(1,3/2-1P)-cyclopentano-lecithin and glycero-lecithin suggests that the conformation of the glycero-lecithin during phospholipase A2-mediated hydrolysis may be best simulated by the all-trans orientation of C-O bonds in the artificial substrate.

  14. Overlevingsstrategieën Listeria monocytogenes bij lage temperatuur

    NARCIS (Netherlands)

    Wemekamp-Kamphuis, H.H.; Abee, T.


    Listeria monocytogenes is an important food-borne pathogen that may cause severe infections in humans. Many outbreaks caused by this organism have been associated with ready-to-eat foods wich may have undergone some form of minimal processing, or have been contaminated after processing. Ready-to-eat

  15. Effect of Listeria monocytogenes inoculation, sodium acetate and ...

    African Journals Online (AJOL)



    Aug 8, 2011 ... monocytogenes has been isolated from surface fresh waters and ... been reported that contamination of aquatic products with ..... In fish sausage treated with nisin, the peroxide value was lower in comparison with that of control (Raju et al., 2003). TBA assay is usually used as indicator for the assessment of.

  16. Listeria monocytogenes serotype prevalence and biodiversity in diverse food products. (United States)

    Hadjilouka, Agni; Andritsos, Nikolaos D; Paramithiotis, Spiros; Mataragas, Marios; Drosinos, Eleftherios H


    The aim of this study was to assess serotype prevalence and biodiversity of Listeria monocytogenes strains isolated from diverse food products, i.e., minced pork, fruits, and vegetables. Three hundred twenty-six samples previously purchased from supermarkets and street markets within the Athens area were studied for L. monocytogenes prevalence. A total of 121 strains were isolated from the 36 samples that were positive for L. monocytogenes. Serotyping was performed with multiplex PCR, and biodiversity was assessed with random amplified polymorphic DNA (RAPD) PCR analysis using M13, UBC155, and HLWL85 as primers and with repetitive element palindromic (rep) PCR analysis using (GTG)5 as the primer. The majority (17 of 22) of the contaminated minced pork samples contained strains identified as serotype 1/2a, either alone or in combination with strains belonging to serotypes 1/2b, 4a, 4c, or 4ab. However, all L. monocytogenes isolates from fruits and vegetables belonged to serotype 4b. Rep-PCR provided better differentiation of the isolates than did RAPD PCR and resulted in discrimination of the isolates into a larger number of unique profiles. Complete differentiation was achieved only with the combination of these subtyping techniques.

  17. Listeria monocytogenes repellence by enzymatically modified PES surfaces

    NARCIS (Netherlands)

    Veen, van der S.; Nady, N.; Franssen, M.C.R.; Zuilhof, H.; Boom, R.M.; Abee, T.; Schroën, C.G.P.H.


    : The effect of enzyme-catalyzed modification of poly(ethersulfone) (PES) on the adhesion and biofilm formation of two Listeria monocytogenes strains is evaluated under static and dynamic flow conditions. PES has been modified with gallic acid, ferulic acid and 4-hydroxybenzoic acid. The surfaces


    Directory of Open Access Journals (Sweden)

    A. Bragagnolo


    Full Text Available In recent years in the countries of the European Union have occurred profound and radical changes regarding the safety and hygiene of foodstuffs. The aim of this work is to highlight the significant changes made by the recent legislation in the control of Listeria monocytogenes.

  19. Incidence of Listeria monocytogenes and Other Bacteria in ...

    African Journals Online (AJOL)

    Prof. Ogunji

    Abstract. The involvement of Listeria monocytogenes in spontaneous abortion in Jos was investigated. One hundred blood and 100 placenta samples were collected from spontaneous abortion patients in Jos. The samples were inoculated first into Listeria enrichment broth. Incubation was at 37o C, followed by cold ...

  20. Influence of temperature on alkali stress adaptation in Listeria monocytogenes (United States)

    Listeria monocytogenes cells may induce alkali stress adaptation when exposed to sublethal concentrations of alkaline cleaners and sanitizers that may be frequently used in the food processing environment. In the present study, the effect of temperature on the induction and the stability of such alk...

  1. Activity of daptomycin against Listeria monocytogenes isolates from cerebrospinal fluid

    NARCIS (Netherlands)

    Spanjaard, Lodewijk; Vandenbroucke-Grauls, Christina M. J. E.


    We tested the activity of daptomycin against 76 Listeria monocytogenes isolates from cerebrospinal fluid by broth dilution and Etest methods. For the broth dilution method, the MIC range was 1.0 to 8.0 and the MIC at which 90% of the isolates tested were inhibited (MIC(90)) was 4.0 mg/liter. For the

  2. Listeria monocytogenes response regulators important for stress tolerance and pathogenesis

    DEFF Research Database (Denmark)

    Kallipolitis, B. H.; Ingmer, H.


    of L. monocytogenes in mice. Strikingly, the mutants that were attenuated in virulence also had a decreased ability to grow in the presence of various stress conditions potentially encountered in an infection process. Thus, our data point to a connection between the ability of the putative two...

  3. Formation of biofilm by strains of Listeria monocytogenes isolated ...

    African Journals Online (AJOL)

    Quantification of biofilm formation by 40 Listeria monocytogenes strains from wara soft cheese and its processing environment was assessed on glass vials surfaces. Attachement to glass surface was quantified using a crystal violet binding assay. All the 40 strains produced biofilms after 48 and 72 h incubation at 37oC.

  4. Pathogenic potential of Listeria monocytogenes isolated from cattle ...

    African Journals Online (AJOL)

    Listeria monocytogenes is an opportunistic food-borne pathogen causing listeriosis especially among immune-compromised persons. Its high rate of morbidity and mortality has classed the organism among the top watch list in foods. It is known to produce several virulence factors which aid its survival in harsh conditions ...

  5. Carrier status for Listeria monocytogenes and other Listeria species ...

    African Journals Online (AJOL)

    Background: Listeria organisms are documented to be zoonotic; one of the sources of infection is the domestic fowl where it could occur as in apparent infection. The carriage of Listeria monocytogenes and other Listeria in indigenous birds has not been documented in Kenya. Objective: To establish whether healthy looking ...

  6. Incidence of Listeria monocytogenes and Other Bacteria in ...

    African Journals Online (AJOL)

    The involvement of Listeria monocytogenes in spontaneous abortion in Jos was investigated. One hundred blood and 100 placenta samples were collected from spontaneous abortion patients in Jos. The samples were inoculated first into Listeria enrichment broth. Incubation was at 37o C, followed by cold enrichment at ...

  7. Prevalence and antibiotic susceptibility of Listeria monocytogenes in ...

    African Journals Online (AJOL)

    One hundred and ninety two raw milk samples were collected from lactating cows identified in Fulani herds and small scale dairy farms within Sokoto metropolis in order to investigate the presence and determine the antibiotic susceptibility of Listeria monocytogenes in the milk. Selective culture and identification method ...

  8. Inhibition of (/sup 3/H)nitrendipine binding by phospholipase A/sub 2/

    Energy Technology Data Exchange (ETDEWEB)

    Goldman, M.E.; Pisano, J.J.


    Phospholipase A/sub 2/ from several sources inhibited (/sup 3/H)nitrendipine binding to membranes from brain, heart and ileal longitudinal muscle. The enzymes from bee venom and Russell's viper venom were most potent, having IC/sub 50/ values of approximately 5 and 14 ng/ml, respectively, in all three membrane preparations. Inhibition of binding by bee venom phospholipase A/sub 2/ was time- and dose-dependent. Mastoparan, a known facilitator of phospholipase A/sub 2/ enzymatic activity, shifted the bee venom phospholipase A/sub 2/ dose-response curve to the left. Pretreatment of brain membranes with bee venom phospholipase A/sub 2/ (10 ng/ml) for 15 min caused a 2-fold increase in the K/sub d/ without changing the B/sub max/ compared with untreated membranes. Extension of the preincubation period to 30 min caused no further increase in the K/sub d/ but significantly decreased the B/sub max/ to 71% the value for untreated membranes. (/sup 3/H)Nitrendipine, preincubated with bee venom phospholipase A/sub 2/, was recovered and found to be fully active, indicating that the phospholipase A/sub 2/ did not modify the ligand. It is concluded that phospholipase A/sub 2/ acts on the membrane at or near the (/sup 3/H)nitrendipine binding site and that phospholipids play a key role in the interactions of 1,4 dihydropyridine calcium channel antagonists with the dihydropyridine binding site. 33 references, 3 figures, 1 table.

  9. Recombinant Lipases and Phospholipases and Their Use as Biocatalysts for Industrial Applications. (United States)

    Borrelli, Grazia M; Trono, Daniela


    Lipases and phospholipases are interfacial enzymes that hydrolyze hydrophobic ester linkages of triacylglycerols and phospholipids, respectively. In addition to their role as esterases, these enzymes catalyze a plethora of other reactions; indeed, lipases also catalyze esterification, transesterification and interesterification reactions, and phospholipases also show acyltransferase, transacylase and transphosphatidylation activities. Thus, lipases and phospholipases represent versatile biocatalysts that are widely used in various industrial applications, such as for biodiesels, food, nutraceuticals, oil degumming and detergents; minor applications also include bioremediation, agriculture, cosmetics, leather and paper industries. These enzymes are ubiquitous in most living organisms, across animals, plants, yeasts, fungi and bacteria. For their greater availability and their ease of production, microbial lipases and phospholipases are preferred to those derived from animals and plants. Nevertheless, traditional purification strategies from microbe cultures have a number of disadvantages, which include non-reproducibility and low yields. Moreover, native microbial enzymes are not always suitable for biocatalytic processes. The development of molecular techniques for the production of recombinant heterologous proteins in a host system has overcome these constraints, as this allows high-level protein expression and production of new redesigned enzymes with improved catalytic properties. These can meet the requirements of specific industrial process better than the native enzymes. The purpose of this review is to give an overview of the structural and functional features of lipases and phospholipases, to describe the recent advances in optimization of the production of recombinant lipases and phospholipases, and to summarize the information available relating to their major applications in industrial processes.

  10. Inventing an arsenal: adaptive evolution and neofunctionalization of snake venom phospholipase A2 genes

    Directory of Open Access Journals (Sweden)

    Lynch Vincent J


    Full Text Available Abstract Background Gene duplication followed by functional divergence has long been hypothesized to be the main source of molecular novelty. Convincing examples of neofunctionalization, however, remain rare. Snake venom phospholipase A2 genes are members of large multigene families with many diverse functions, thus they are excellent models to study the emergence of novel functions after gene duplications. Results Here, I show that positive Darwinian selection and neofunctionalization is common in snake venom phospholipase A2 genes. The pattern of gene duplication and positive selection indicates that adaptive molecular evolution occurs immediately after duplication events as novel functions emerge and continues as gene families diversify and are refined. Surprisingly, adaptive evolution of group-I phospholipases in elapids is also associated with speciation events, suggesting adaptation of the phospholipase arsenal to novel prey species after niche shifts. Mapping the location of sites under positive selection onto the crystal structure of phospholipase A2 identified regions evolving under diversifying selection are located on the molecular surface and are likely protein-protein interactions sites essential for toxin functions. Conclusion These data show that increases in genomic complexity (through gene duplications can lead to phenotypic complexity (venom composition and that positive Darwinian selection is a common evolutionary force in snake venoms. Finally, regions identified under selection on the surface of phospholipase A2 enzymes are potential candidate sites for structure based antivenin design.

  11. Functional interaction between Cerebratulus lacteus cytolysin A-III and phospholipase A2

    International Nuclear Information System (INIS)

    Liu, J.; Blumenthal, K.M.


    A study on the interaction between bee venom phospholipase A 2 and Cerebratulus lacteus cytolysin A-III, a major hemolysin secreted by this organism has been carried out. The hemolytic activity of A-III in phosphate-buffered saline is increased 5-fold in the presence of phospholipase A 2 from bee venom. Dansylphosphatidylethanolamine (DPE) labeled, phosphatidylcholine-containing liposomes and human erythrocyte membranes were employed to study the interaction between these two proteins. In DPE-liposomes, A-III alone had no effect on DPE fluorescence nor did it enhance either the phospholipase A 2 -dependent fluorescence increase or blue shift in emission maximum, indicating that the cytolysis is not a major phospholipase A 2 -activator. However, when DPE was incorporated into erythrocyte membranes, A-III alone induced a 40% fluorescence increase and a 5 nm blue shift, implying a transient activation of an endogenous phospholipase A 2 . Further studies using synthetic lysophosphatidylcholine and free fatty acids demonstrated that the hemolytic activity of A-III is potentiated by free fatty acids, a product of phospholipid degradation catalyzed by phospholipase A 2 . Subsequent analysis of this phenomenon by gel filtration chromatography, analytical ultracentrifugation, chemical cross-linking, and measurement of [ 14 C]oleic acid binding by the cytolysin demonstrated that binding of oleic acid to A-III causes aggregation of the toxin molecules to a tetrameric form which has a higher α-helix content and a greater activity than the monomer

  12. Prevalence of Listeria monocytogenes in poultry production in France. (United States)

    Chemaly, Marianne; Toquin, Marie-Therese; Le Nôtre, Yolene; Fravalo, Philippe


    This study aimed to update and create a data set from laying hens and broilers regarding contamination by Listeria monocytogenes. Two hundred laying-hen flocks were sampled, with 88 flocks reared in cages and 112 reared on the floor. One hundred forty-five broiler flocks were sampled, with 85 conventional and 60 free-range flocks. A total of 774 and 725 samples were analyzed from laying hens and broilers, respectively. L. monocytogenes was detected in 31 of 200 flocks, yielding an estimated prevalence of 15.5% in laying-hen flocks. Among positive flocks, there appeared a significant (P = 0.004) difference between caged and floor-reared hens, with a higher detection in dust samples from floor-reared hens. In positive caged hen flocks, significant (P = 0.028) differences between dust and fecal samples appeared, with a higher detection in feces than in dust samples. In broiler flocks, L. monocytogenes was isolated in 46 of 145 flocks, yielding an estimated prevalence of 32% (28% in conventional flocks versus 37% in the free-range flocks). L. monocytogenes was isolated in samples taken from conventional flocks with a lower frequency than in free-range flocks (13 versus 18%, respectively). The serotyping of L. monocytogenes strains showed that the majority belonged to type 1/2a in laying-hen flocks (74.3%) and in broiler flocks (40.5%). A significant difference (P = 0.007) between laying hens and broilers was shown for serogroup 4 and for serovar 1/2b (P = 0.007); these serogroups were more prevalent in broilers (40%) than in laying hens (5.7%).

  13. Antimicrobial treatments to control Listeria monocytogenes in queso fresco. (United States)

    Lourenço, António; Kamnetz, Mary B; Gadotti, Camila; Diez-Gonzalez, Francisco


    Queso fresco, is a Hispanic non-fermented cheese highly susceptible to contamination with L. monocytogenes. This research was aimed to determine the effect of GRAS antimicrobial ingredients to control L. monocytogenes. Antimicrobials included caprylic acid (CA), Nisaplin ® (N, 2.5% nisin), a mixture of sodium lactate and sodium diacetate (SL/SD), Lactococcus lactis sbp. lactis DPC 3147, monolaurin, and lactic acid (LA). Batches of queso fresco curds were inoculated with 10 4  CFU/g and stored at 4 °C for three weeks. During storage the count of L. monocytogenes reached 7 to 8 Log CFU/g in control samples. Most individual antimicrobial treatments resulted in less than 1 Log CFU/g reductions in final counts, with the exception of N (0.5 g/kg) and CA (2.9 g/kg) that caused more than 3 and 5 Log CFU/g differences with controls, respectively. Mixtures of ingredients were more effective in inhibiting L. monocytogenes growth, and treatments with N and CA consistently delivered 6 Log CFU/g less counts than controls. Supplementation of 12 g/kg LA to treatments with SL/SD (3%/0.22%) caused differences of more than 4 Log CFU/g in final Listeria populations. Samples treated with the binary mixtures of N and CA (0.5 and 0.7 g/kg, respectively) were evaluated in a consumer panel (n = 67). Panelists slightly preferred control and commercial over treated samples, but all samples were in average rated between "slightly liking" and "moderately liking." These experiments indicated that combined use of antimicrobial ingredients may be an effective way to control the population of Listeria monocytogenes in queso fresco. Copyright © 2016 Elsevier Ltd. All rights reserved.

  14. Validation of the ANSR(®) Listeria monocytogenes Method for Detection of Listeria monocytogenes in Selected Food and Environmental Samples. (United States)

    Caballero, Oscar; Alles, Susan; Le, Quynh-Nhi; Gray, R Lucas; Hosking, Edan; Pinkava, Lisa; Norton, Paul; Tolan, Jerry; Mozola, Mark; Rice, Jennifer; Chen, Yi; Ryser, Elliot; Odumeru, Joseph


    Work was conducted to validate performance of the ANSR(®) for Listeria monocytogenes method in selected food and environmental matrixes. This DNA-based assay involves amplification of nucleic acid via an isothermal reaction based on nicking enzyme amplification technology. Following single-step sample enrichment for 16-24 h for most matrixes, the assay is completed in 40 min using only simple instrumentation. When 50 distinct strains of L. monocytogenes were tested for inclusivity, 48 produced positive results, the exceptions being two strains confirmed by PCR to lack the assay target gene. Forty-seven nontarget strains (30 species), including multiple non-monocytogenes Listeria species as well as non-Listeria, Gram-positive bacteria, were tested, and all generated negative ANSR assay results. Performance of the ANSR method was compared with that of the U.S. Department of Agriculture, Food Safety and Inspection Service Microbiology Laboratory Guidebook reference culture procedure for detection of L. monocytogenes in hot dogs, pasteurized liquid egg, and sponge samples taken from an inoculated stainless steel surface. In addition, ANSR performance was measured against the U.S. Food and Drug Administration Bacteriological Analytical Manual reference method for detection of L. monocytogenes in Mexican-style cheese, cantaloupe, sprout irrigation water, and guacamole. With the single exception of pasteurized liquid egg at 16 h, ANSR method performance as quantified by the number of positives obtained was not statistically different from that of the reference methods. Robustness trials demonstrated that deliberate introduction of small deviations to the normal assay parameters did not affect ANSR method performance. Results of accelerated stability testing conducted using two manufactured lots of reagents predicts stability at the specified storage temperature of 4°C of more than 1 year.

  15. Genotyping of Listeria monocytogenes isolates from poultry carcasses using high resolution melting (HRM) analysis. (United States)

    Sakaridis, Ioannis; Ganopoulos, Ioannis; Madesis, Panagiotis; Tsaftaris, Athanasios; Argiriou, Anagnostis


    An outbreak situation of human listeriosis requires a fast and accurate protocol for typing Listeria monocytogenes . Existing techniques are either characterized by low discriminatory power or are laborious and require several days to give a final result. Polymerase chain reaction (PCR) coupled with high resolution melting (HRM) analysis was investigated in this study as an alternative tool for a rapid and precise genotyping of L. monocytogenes isolates. Fifty-five isolates of L. monocytogenes isolated from poultry carcasses and the environment of four slaughterhouses were typed by HRM analysis using two specific markers, internalin B and ssrA genes. The analysis of genotype confidence percentage of L. monocytogenes isolates produced by HRM analysis generated dendrograms with two major groups and several subgroups. Furthermore, the analysis of the HRM curves revealed that all L. monocytogenes isolates could easily be distinguished. In conclusion, HRM was proven to be a fast and powerful tool for genotyping isolates of L. monocytogenes .

  16. Restraining reactive oxygen species in Listeria monocytogenes promotes the apoptosis of glial cells. (United States)

    Li, Sen; Li, Yixuan; Chen, Guowei; Zhang, Jingchen; Xu, Fei; Wu, Man


    Listeria monocytogenes is a facultative anaerobic foodborne pathogen that can traverse the blood-brain barrier and cause brain infection. L. monocytogenes infection induces host cell apoptosis in several cell types. In this study, we investigated the apoptosis of human glioma cell line U251 invaded by L. monocytogenes and evaluated the function of bacterial reactive oxygen species (ROS) during infection. Bacterial ROS level was reduced by carrying out treatment with N-acetyl cysteine (NAC) and diphenyleneiodonium chloride (DPI). After infection, the apoptosis of U251 cells was examined by flow cytometry assay and propidium iodide staining. DPI and NAC efficiently decreased ROS level in L. monocytogenes without affecting bacterial growth. Moreover, the apoptosis of glial cells was enhanced upon invasion of DPI- and NAC-pretreated L. monocytogenes. Results indicate that the apoptosis of glial cells can be induced by L. monocytogenes, and that the inhibition of bacterial ROS increases the apoptosis of host cells.

  17. L. monocytogenes in a cheese processing facility: Learning from contamination scenarios over three years of sampling. (United States)

    Rückerl, I; Muhterem-Uyar, M; Muri-Klinger, S; Wagner, K-H; Wagner, M; Stessl, B


    The aim of this study was to analyze the changing patterns of Listeria monocytogenes contamination in a cheese processing facility manufacturing a wide range of ready-to-eat products. Characterization of L. monocytogenes isolates included genotyping by pulsed-field gel electrophoresis (PFGE) and multi-locus sequence typing (MLST). Disinfectant-susceptibility tests and the assessment of L. monocytogenes survival in fresh cheese were also conducted. During the sampling period between 2010 and 2013, a total of 1284 environmental samples were investigated. Overall occurrence rates of Listeria spp. and L. monocytogenes were 21.9% and 19.5%, respectively. Identical L. monocytogenes genotypes were found in the food processing environment (FPE), raw materials and in products. Interventions after the sampling events changed contamination scenarios substantially. The high diversity of globally, widely distributed L. monocytogenes genotypes was reduced by identifying the major sources of contamination. Although susceptible to a broad range of disinfectants and cleaners, one dominant L. monocytogenes sequence type (ST) 5 could not be eradicated from drains and floors. Significantly, intense humidity and steam could be observed in all rooms and water residues were visible on floors due to increased cleaning strategies. This could explain the high L. monocytogenes contamination of the FPE (drains, shoes and floors) throughout the study (15.8%). The outcome of a challenge experiment in fresh cheese showed that L. monocytogenes could survive after 14days of storage at insufficient cooling temperatures (8 and 16°C). All efforts to reduce L. monocytogenes environmental contamination eventually led to a transition from dynamic to stable contamination scenarios. Consequently, implementation of systematic environmental monitoring via in-house systems should either aim for total avoidance of FPE colonization, or emphasize a first reduction of L. monocytogenes to sites where

  18. Recombinant probiotic expressing Listeria adhesion protein attenuates Listeria monocytogenes virulence in vitro.

    Directory of Open Access Journals (Sweden)

    Ok Kyung Koo

    Full Text Available BACKGROUND: Listeria monocytogenes, an intracellular foodborne pathogen, infects immunocompromised hosts. The primary route of transmission is through contaminated food. In the gastrointestinal tract, it traverses the epithelial barrier through intracellular or paracellular routes. Strategies to prevent L. monocytogenes entry can potentially minimize infection in high-risk populations. Listeria adhesion protein (LAP aids L. monocytogenes in crossing epithelial barriers via the paracellular route. The use of recombinant probiotic bacteria expressing LAP would aid targeted clearance of Listeria from the gut and protect high-risk populations from infection. METHODOLOGY/PRINCIPAL FINDINGS: The objective was to investigate the ability of probiotic bacteria or LAP-expressing recombinant probiotic Lactobacillus paracasei (Lbp(LAP to prevent L. monocytogenes adhesion, invasion, and transwell-based transepithelial translocation in a Caco-2 cell culture model. Several wild type probiotic bacteria showed strong adhesion to Caco-2 cells but none effectively prevented L. monocytogenes infection. Pre-exposure to Lbp(LAP for 1, 4, 15, or 24 h significantly (P<0.05 reduced adhesion, invasion, and transepithelial translocation of L. monocytogenes in Caco-2 cells, whereas pre-exposure to parental Lb. paracasei had no significant effect. Similarly, Lbp(LAP pre-exposure reduced L. monocytogenes translocation by as much as 46% after 24 h. Lbp(LAP also prevented L. monocytogenes-mediated cell damage and compromise of tight junction integrity. Furthermore, Lbp(LAP cells reduced L. monocytogenes-mediated cell cytotoxicity by 99.8% after 1 h and 79% after 24 h. CONCLUSIONS/SIGNIFICANCE: Wild type probiotic bacteria were unable to prevent L. monocytogenes infection in vitro. In contrast, Lbp(LAP blocked adhesion, invasion, and translocation of L. monocytogenes by interacting with host cell receptor Hsp60, thereby protecting cells from infection. These data show promise

  19. Internalization of Listeria monocytogenes in cantaloupes during dump tank washing and hydrocooling. (United States)

    Macarisin, Dumitru; Wooten, Anna; De Jesus, Antonio; Hur, Minji; Bae, Seonjae; Patel, Jitendra; Evans, Peter; Brown, Eric; Hammack, Thomas; Chen, Yi


    Recent listeriosis outbreaks and recalls associated with cantaloupes urge for studies to understand the mechanisms of cantaloupe contamination by Listeria monocytogenes. Postharvest practices such as washing and hydrocooling were suggested to facilitate the contamination of fresh fruits by human pathogens. This study assessed the potential of L. monocytogenes internalization into cantaloupes during dump tank washing and immersion-type hydrocooling in water contaminated with L. monocytogenes. The effect of cantaloupe cultivar, water temperature, and harvesting technique on L. monocytogenes internalization was also evaluated. Full slip (cantaloupe without any residual stem) Western and Eastern cultivar cantaloupes were pre-warmed to 42°C (to imitate peak-high field temperatures of freshly harvested cantaloupes) and then immersed in water at 6°C and 18°C containing 4 and 6logCFU/ml of L. monocytogenes. Clipped (cantaloupe with short stem residues obtained by clipping the stem at harvest) Western and Eastern cantaloupes were pre-warmed to 42°C and then immersed in water at 6°C containing 6logCFU/ml of L. monocytogenes. Additionally, full slip and clipped Western cantaloupes were equilibrated to 18°C and then immersed in water at 18°C containing 6logCFU/ml of L. monocytogenes (isothermal immersion without temperature differential). Water containing L. monocytogenes infiltrated both full slip and clipped cantaloupes through the stems/stem scars and was then distributed along the vascular system in hypodermal mesocarp reaching the calyx area of the fruit. The current study demonstrated that, under experimental conditions, L. monocytogenes can internalize into cantaloupes during immersion in water contaminated by L. monocytogenes, both in the presence and absence of temperature differential, and that temperature differential moderately enhanced the internalization of L. monocytogenes. The incidence and levels of L. monocytogenes internalized in the middle

  20. Lineage specific recombination rates and microevolution in Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Nightingale Kendra K


    Full Text Available Abstract Background The bacterium Listeria monocytogenes is a saprotroph as well as an opportunistic human foodborne pathogen, which has previously been shown to consist of at least two widespread lineages (termed lineages I and II and an uncommon lineage (lineage III. While some L. monocytogenes strains show evidence for considerable diversification by homologous recombination, our understanding of the contribution of recombination to L. monocytogenes evolution is still limited. We therefore used STRUCTURE and ClonalFrame, two programs that model the effect of recombination, to make inferences about the population structure and different aspects of the recombination process in L. monocytogenes. Analyses were performed using sequences for seven loci (including the house-keeping genes gap, prs, purM and ribC, the stress response gene sigB, and the virulence genes actA and inlA for 195 L. monocytogenes isolates. Results Sequence analyses with ClonalFrame and the Sawyer's test showed that recombination is more prevalent in lineage II than lineage I and is most frequent in two house-keeping genes (ribC and purM and the two virulence genes (actA and inlA. The relative occurrence of recombination versus point mutation is about six times higher in lineage II than in lineage I, which causes a higher genetic variability in lineage II. Unlike lineage I, lineage II represents a genetically heterogeneous population with a relatively high proportion (30% average of genetic material imported from external sources. Phylograms, constructed with correcting for recombination, as well as Tajima's D data suggest that both lineages I and II have suffered a population bottleneck. Conclusion Our study shows that evolutionary lineages within a single bacterial species can differ considerably in the relative contributions of recombination to genetic diversification. Accounting for recombination in phylogenetic studies is critical, and new evolutionary models that

  1. Role of phospholipase C in Dictyostelium : Formation of inositol 1,4,5-trisphosphate and normal development in cells lacking phospholipase C activity

    NARCIS (Netherlands)

    Drayer, A. Lyndsay; Kaay, Jeroen van der; Mayr, Georg W.; Haastert, Peter J.M. van


    The micro-organism Dictyostelium uses extracellular cAMP to induce chemotaxis and cell differentiation. Signals are transduced via surface receptors, which activate G proteins, to effector enzymes. The deduced protein sequence of Dictyostelium discoideum phosphabidylinositol-specific phospholipase C

  2. Presence of Listeria monocytogenes in Mediterranean-Style Dry Fermented Sausages

    Directory of Open Access Journals (Sweden)

    Domenico Meloni


    Full Text Available The morphological, physiological and epidemiological features of L. monocytogenes, together with the severity of human listeriosis infections, make L. monocytogenes of particular concern for manufacturers of cold-stored “ready to eat” (RTE foods. L. monocytogenes has been isolated from a wide variety of RTE foods and is responsible for several outbreaks associated with the consumption of RTE meat, poultry, dairy, fish and vegetable products. Although L. monocytogenes is among the most frequently-detected pathogens in dry fermented sausages, these products could be included in the category of RTE products in which the growth of L. monocytogenes is not favored and have rarely been implicated in listeriosis outbreaks. However, L. monocytogenes is highly difficult to control in fermented sausage processing environments due to its high tolerance to low pH and high salt concentration. In many Mediterranean-style dry fermented sausages, an empirical application of the hurdle technology often occurs and the frequent detection of L. monocytogenes in these products at the end of ripening highlights the need for food business operators to properly apply hurdle technology and to control the contamination routes of L. monocytogenes in the processing plants. In the following, through an up-to-date review of (personal and un- published data, the main aspects of the presence of L. monocytogenes in Mediterranean-style dry fermented sausages will be discussed.

  3. Presence of Listeria monocytogenes in Mediterranean-Style Dry Fermented Sausages. (United States)

    Meloni, Domenico


    The morphological, physiological and epidemiological features of L. monocytogenes , together with the severity of human listeriosis infections, make L. monocytogenes of particular concern for manufacturers of cold-stored "ready to eat" (RTE) foods. L. monocytogenes has been isolated from a wide variety of RTE foods and is responsible for several outbreaks associated with the consumption of RTE meat, poultry, dairy, fish and vegetable products. Although L. monocytogenes is among the most frequently-detected pathogens in dry fermented sausages, these products could be included in the category of RTE products in which the growth of L. monocytogenes is not favored and have rarely been implicated in listeriosis outbreaks. However, L. monocytogenes is highly difficult to control in fermented sausage processing environments due to its high tolerance to low pH and high salt concentration. In many Mediterranean-style dry fermented sausages, an empirical application of the hurdle technology often occurs and the frequent detection of L. monocytogenes in these products at the end of ripening highlights the need for food business operators to properly apply hurdle technology and to control the contamination routes of L. monocytogenes in the processing plants. In the following, through an up-to-date review of (personal and un-) published data, the main aspects of the presence of L. monocytogenes in Mediterranean-style dry fermented sausages will be discussed.

  4. Inhibitory effects of Swietenia macrophylla on myotoxic phospholipases A2

    Directory of Open Access Journals (Sweden)

    Jaime A. Pereañez

    Full Text Available Activity-guided fractionation of an ethanol-soluble extract of the leaves of Swietenia macrophylla King, Meliaceae, led to several fractions. As a result, sample Sm13-16, 23 had the most promising activity against phospholipases A2 (PLA2, Asp49 and Lys49 types. This fraction inhibited PLA2 activity of the Asp49 PLA2, when aggregated substrate was used. On the other hand, this activity was weakly neutralized when monodispersed substrate was used. In addition, Sm13-16, 23 inhibited, in a dose dependent manner, the cytotoxicity, myotoxicity and edema induced by PLA2s, as well as the anticoagulant activity of Asp49 PLA2. Overall, this fraction exhibited a better inhibition of the toxic activities induced by the Lys49 PLA2than those caused by the Asp49 PLA2. The spectral data of Sm13-16, 23 suggested the presence of aromatic compounds (UV λ max (nm 655, 266, and 219; IR λ max KBr (cm-1: ~ 3600-3000 (OH, 2923.07 and 1438.90 (C-H, 1656.69 (C = O, 1618.63 and 1607.67 (C-O, 1285.47772.60. We suggest that phenolic compounds could interact and inhibit the toxins by several mechanisms. Further analysis of the compounds present in the active fraction could be a relevant contribution in the treatment of accidents caused by snake envenomation.

  5. Bee Venom Phospholipase A2: Yesterday's Enemy Becomes Today's Friend. (United States)

    Lee, Gihyun; Bae, Hyunsu


    Bee venom therapy has been used to treat immune-related diseases such as arthritis for a long time. Recently, it has revealed that group III secretory phospholipase A2 from bee venom (bee venom group III sPLA2) has in vitro and in vivo immunomodulatory effects. A growing number of reports have demonstrated the therapeutic effects of bee venom group III sPLA2. Notably, new experimental data have shown protective immune responses of bee venom group III sPLA2 against a wide range of diseases including asthma, Parkinson's disease, and drug-induced organ inflammation. It is critical to evaluate the beneficial and adverse effects of bee venom group III sPLA2 because this enzyme is known to be the major allergen of bee venom that can cause anaphylactic shock. For many decades, efforts have been made to avoid its adverse effects. At high concentrations, exposure to bee venom group III sPLA2 can result in damage to cellular membranes and necrotic cell death. In this review, we summarized the current knowledge about the therapeutic effects of bee venom group III sPLA2 on several immunological diseases and described the detailed mechanisms of bee venom group III sPLA2 in regulating various immune responses and physiopathological changes.

  6. Secreted Phospholipases A₂ from Animal Venoms in Pain and Analgesia. (United States)

    Zambelli, Vanessa O; Picolo, Gisele; Fernandes, Carlos A H; Fontes, Marcos R M; Cury, Yara


    Animal venoms comprise a complex mixture of components that affect several biological systems. Based on the high selectivity for their molecular targets, these components are also a rich source of potential therapeutic agents. Among the main components of animal venoms are the secreted phospholipases A₂ (sPLA₂s). These PLA₂ belong to distinct PLA₂s groups. For example, snake venom sPLA₂s from Elapidae and Viperidae families, the most important families when considering envenomation, belong, respectively, to the IA and IIA/IIB groups, whereas bee venom PLA₂ belongs to group III of sPLA₂s. It is well known that PLA₂, due to its hydrolytic activity on phospholipids, takes part in many pathophysiological processes, including inflammation and pain. Therefore, secreted PLA₂s obtained from animal venoms have been widely used as tools to (a) modulate inflammation and pain, uncovering molecular targets that are implicated in the control of inflammatory (including painful) and neurodegenerative diseases; (b) shed light on the pathophysiology of inflammation and pain observed in human envenomation by poisonous animals; and, (c) characterize molecular mechanisms involved in inflammatory diseases. The present review summarizes the knowledge on the nociceptive and antinociceptive actions of sPLA₂s from animal venoms, particularly snake venoms.

  7. Uncovering Listeria monocytogenes hypervirulence by harnessing its biodiversity (United States)

    Charlier, Caroline; Touchon, Marie; Chenal-Francisque, Viviane; Leclercq, Alexandre; Criscuolo, Alexis; Gaultier, Charlotte; Roussel, Sophie; Brisabois, Anne; Disson, Olivier; Rocha, Eduardo P. C.; Brisse, Sylvain; Lecuit, Marc


    Microbial pathogenesis studies are typically performed with reference strains, thereby overlooking microbial intra-species virulence heterogeneity. Here we integrated human epidemiological and clinical data with bacterial population genomics to harness the biodiversity of the model foodborne pathogen Listeria monocytogenes and decipher the basis of its neural and placental tropisms. Taking advantage of the clonal structure of this bacterial species, we identify clones epidemiologically associated with either food or human central nervous system (CNS) and maternal-neonatal (MN) listeriosis. The latter are also most prevalent in patients without immunosuppressive comorbidities. Strikingly, CNS and MN clones are hypervirulent in a humanized mouse model of listeriosis. By integrating epidemiological data and comparative genomics, we uncovered multiple novel putative virulence factors and demonstrated experimentally the contribution of the first gene cluster mediating Listeria monocytogenes neural and placental tropisms. This study illustrates the exceptional power of harnessing microbial biodiversity to identify clinically relevant microbial virulence attributes. PMID:26829754

  8. Biosensor for the detection of Listeria monocytogenes: emerging trends

    KAUST Repository

    Soni, Dharmendra Kumar


    The early detection of Listeria monocytogenes (L. monocytogenes) and understanding the disease burden is of paramount interest. The failure to detect pathogenic bacteria in the food industry may have terrible consequences, and poses deleterious effects on human health. Therefore, integration of methods to detect and trace the route of pathogens along the entire food supply network might facilitate elucidation of the main contamination sources. Recent research interest has been oriented towards the development of rapid and affordable pathogen detection tools/techniques. An innovative and new approach like biosensors has been quite promising in revealing the foodborne pathogens. In spite of the existing knowledge, advanced research is still needed to substantiate the expeditious nature and sensitivity of biosensors for rapid and in situ analysis of foodborne pathogens. This review summarizes recent developments in optical, piezoelectric, cell-based, and electrochemical biosensors for Listeria sp. detection in clinical diagnostics, food analysis, and environmental monitoring, and also lists their drawbacks and advantages.

  9. Inhibition of phospholipase C disrupts cytoskeletal organization and gravitropic growth in Arabidopsis roots. (United States)

    Andreeva, Zornitza; Barton, Deborah; Armour, William J; Li, Min Y; Liao, Li-Fen; McKellar, Heather L; Pethybridge, Kylie A; Marc, Jan


    The phospholipase protein superfamily plays an important role in hormonal signalling and cellular responses to environmental stimuli. There is also growing evidence for interactions between phospholipases and the cytoskeleton. In this report we used a pharmacological approach to investigate whether inhibiting a member of the phospholipase superfamily, phospholipase C (PLC), affects microtubules and actin microfilaments as well as root growth and morphology of Arabidopsis thaliana seedlings. Inhibiting PLC activity using the aminosteroid U73122 significantly inhibited root elongation and disrupted root morphology in a concentration-dependent manner, with the response being saturated at 5 μM, whereas the inactive analogue U73343 was ineffective. The primary root appeared to lose growth directionality accompanied by root waving and formation of curls. Immunolabelling of roots exposed to increasingly higher U73122 concentrations revealed that the normal transverse arrays of cortical microtubules in the elongation zone became progressively more disorganized or depolymerized, with the disorganization appearing within 1 h of incubation. Likewise, actin microfilament arrays also were disrupted. Inhibiting PLC using an alternative inhibitor, neomycin, caused similar disruptions to both cytoskeletal organization and root morphology. In seedlings gravistimulated by rotating the culture plates by 90°, both U73122 and neomycin disrupted the normal gravitropic growth of roots and etiolated hypocotyls. The effects of PLC inhibitors are therefore consistent with the notion that, as with phospholipases A and D, PLC likewise interacts with the cytoskeleton, alters growth morphology, and is involved in gravitropism.

  10. A nutrient-regulated, dual localization phospholipase A2 in the symbiotic fungus Tuber borchii (United States)

    Soragni, Elisabetta; Bolchi, Angelo; Balestrini, Raffaella; Gambaretto, Claudio; Percudani, Riccardo; Bonfante, Paola; Ottonello, Simone


    Important morphogenetic transitions in fungi are triggered by starvation-induced changes in the expression of structural surface proteins. Here, we report that nutrient deprivation causes a strong and reversible up-regulation of TbSP1, a surface-associated, Ca2+-dependent phospholipase from the mycorrhizal fungus Tuber borchii. TbSP1 is the first phospholipase A2 to be described in fungi and identifies a novel class of phospholipid-hydrolyzing enzymes. The TbSP1 phospholipase, which is synthesized initially as a pre-protein, is processed efficiently and secreted during the mycelial phase. The mature protein, however, also localizes to the inner cell wall layer, close to the plasma membrane, in both free-living and symbiosis-engaged hyphae. It thus appears that a dual localization phospholipase A2 is involved in the adaptation of a symbiotic fungus to conditions of persistent nutritional limitation. Moreover, the fact that TbSP1-related sequences are present in Streptomyces and Neurospora, and not in wholly sequenced non-filamentous microorganisms, points to a general role for TbSP1 phospholipases A2 in the organization of multicellular filamentous structures in bacteria and fungi. PMID:11566873

  11. Determination of germ tube, phospholipase, and proteinase production by bloodstream isolates of Candida albicans

    Directory of Open Access Journals (Sweden)

    Antonella Souza Mattei


    Full Text Available Introduction Candida albicans is a commensal and opportunistic agent that causes infection in immunocompromised individuals. Several attributes contribute to the virulence and pathogenicity of this yeast, including the production of germ tubes (GTs and extracellular hydrolytic enzymes, particularly phospholipase and proteinase. This study aimed to investigate GT production and phospholipase and proteinase activities in bloodstream isolates of C. albicans. Methods One hundred fifty-three C. albicans isolates were obtained from blood samples and analyzed for GT, phospholipase, and proteinase production. The assays were performed in duplicate in egg yolk medium containing bovine serum albumin and human serum. Results Detectable amounts of proteinase were produced by 97% of the isolates, and 78% of the isolates produced phospholipase. GTs were produced by 95% of the isolates. A majority of the isolates exhibited low levels of phospholipase production and high levels of proteinase production. Conclusions Bloodstream isolates of C. albicans produce virulence factors such as GT and hydrolytic enzymes that enable them to cause infection under favorable conditions.

  12. Lactadherin inhibits secretory phospholipase A2 activity on pre-apoptotic leukemia cells.

    Directory of Open Access Journals (Sweden)

    Steffen Nyegaard

    Full Text Available Secretory phospholipase A2 (sPLA2 is a critical component of insect and snake venoms and is secreted by mammalian leukocytes during inflammation. Elevated secretory PLA2 concentrations are associated with autoimmune diseases and septic shock. Many sPLA2's do not bind to plasma membranes of quiescent cells but bind and digest phospholipids on the membranes of stimulated or apoptotic cells. The capacity of these phospholipases to digest membranes of stimulated or apoptotic cells correlates to the exposure of phosphatidylserine. In the present study, the ability of the phosphatidyl-L-serine-binding protein, lactadherin to inhibit phospholipase enzyme activity has been assessed. Inhibition of human secretory phospholipase A2-V on phospholipid vesicles exceeded 90%, whereas inhibition of Naja mossambica sPLA2 plateaued at 50-60%. Lactadherin inhibited 45% of activity of Naja mossambica sPLA2 and >70% of human secretory phospholipase A2-V on the membranes of human NB4 leukemia cells treated with calcium ionophore A23187. The data indicate that lactadherin may decrease inflammation by inhibiting sPLA2.

  13. Mechanistic studies of the agmatine deiminase from Listeria monocytogenes. (United States)

    Soares, Charles A; Knuckley, Bryan


    Listeria monocytogenes is a Gram-positive food-borne pathogen that is capable of living within extreme environments (i.e. low temperatures and pH). This ability to survive in such conditions may arise, at least in part, from agmatine catabolism via the agmatine deiminase system (AgDS). This catabolic pathway utilizes an agmatine deiminase (AgD) to hydrolyse agmatine into N-carbamoylputrescine (NCP), with concomitant release of ammonia, which increases the pH, thus mitigating the ill effects of the acidic environment. Given the potential significance of this pathway for cell survival, we set out to study the catalytic mechanism of the AgD encoded by L. monocytogenes In the present paper, we describe the catalytic mechanism employed by this enzyme based on pH profiles, pKa measurements of the active site cysteine and solvent isotope effects (SIE). In addition, we report inhibition of this enzyme by two novel AgD inhibitors, i.e. N-(4-aminobutyl)-2-fluoro-ethanimidamide (ABFA) and N-(4-aminobutyl)-2-chloro-ethanimidamide (ABCA). In contrast with other orthologues, L. monocytogenes AgD does not use the reverse protonation or substrate-assisted mechanism, which requires an active site cysteine with a high pKa and has been commonly seen in other members of the guanidinium-modifying enzyme (GME) superfamily. Instead, the L. monocytogenes AgD has a low pKa cysteine in the active site leading to an alternative mechanism of catalysis. This is the first time that this mechanism has been observed in the GME superfamily and is significant because it explains why previously developed mechanism-based inactivators of AgDs are ineffective against this orthologue. © 2016 The Author(s). published by Portland Press Limited on behalf of the Biochemical Society.

  14. Encefalitis del tallo cerebral y mielitis por Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Aracelly Castro


    Full Text Available La romboencefalitis por Listeria monocytogenes es una presentación poco común de la listeriosis del sistema nervioso central; sin embargo, es la presentación más común en personas inmunocompetentes. Aun más rara es la combinación de romboencefalitis con mielitis causada por L. monocytogenes; no obstante, en este artículo se reporta un caso de encefalitis del tallo y mielitis grave en un paciente sin compromiso del sistema inmunitario. Se presenta un paciente de 21 años de edad, sin deficiencias del sistema inmunitario, que consumió productos lácteos no pasteurizados y, posteriormente, presentó un cuadro de cefalea, vómito, deterioro de su estado general y, finalmente, alteración del estado de conciencia y muerte. Consultó al Instituto Neurológico de Colombia y se hizo diagnóstico de encefalitis del tallo y mielitis por L. monocytogenes. Se discuten las diferencias entre el caso presentado y los reportados en la literatura científica. Ante un paciente con signos de compromiso del tallo cerebral, de posible origen infeccioso, es prudente iniciar tratamiento antibiótico para L. monocytogenes y, en caso de poca respuesta, escalar rápidamente en dicho tratamiento. También lo es extender el estudio radiológico hacia la columna vertebral, con el fin de descartar compromiso de la médula espinal.   doi:

  15. How Listeria monocytogenes organizes its surface for virulence (United States)

    Carvalho, Filipe; Sousa, Sandra; Cabanes, Didier


    Listeria monocytogenes is a Gram-positive pathogen responsible for the manifestation of human listeriosis, an opportunistic foodborne disease with an associated high mortality rate. The key to the pathogenesis of listeriosis is the capacity of this bacterium to trigger its internalization by non-phagocytic cells and to survive and even replicate within phagocytes. The arsenal of virulence proteins deployed by L. monocytogenes to successfully promote the invasion and infection of host cells has been progressively unveiled over the past decades. A large majority of them is located at the cell envelope, which provides an interface for the establishment of close interactions between these bacterial factors and their host targets. Along the multistep pathways carrying these virulence proteins from the inner side of the cytoplasmic membrane to their cell envelope destination, a multiplicity of auxiliary proteins must act on the immature polypeptides to ensure that they not only maturate into fully functional effectors but also are placed or guided to their correct position in the bacterial surface. As the major scaffold for surface proteins, the cell wall and its metabolism are critical elements in listerial virulence. Conversely, the crucial physical support and protection provided by this structure make it an ideal target for the host immune system. Therefore, mechanisms involving fine modifications of cell envelope components are activated by L. monocytogenes to render it less recognizable by the innate immunity sensors or more resistant to the activity of antimicrobial effectors. This review provides a state-of-the-art compilation of the mechanisms used by L. monocytogenes to organize its surface for virulence, with special focus on those proteins that work “behind the frontline”, either supporting virulence effectors or ensuring the survival of the bacterium within its host. PMID:24809022

  16. Assessment of Listeria sp. Interference Using a Molecular Assay To Detect Listeria monocytogenes in Food. (United States)

    Zittermann, Sandra I; Stanghini, Brenda; See, Ryan Soo; Melano, Roberto G; Boleszczuk, Peter; Murphy, Allana; Maki, Anne; Mallo, Gustavo V


    Detection of Listeria monocytogenes in food is currently based on enrichment methods. When L. monocytogenes is present with other Listeria species in food, the species compete during the enrichment process. Overgrowth competition of the nonpathogenic Listeria species might result in false-negative results obtained with the current reference methods. This potential issue was noted when 50 food samples artificially spiked with L. monocytogenes were tested with a real-time PCR assay and Canada's current reference method, MFHPB-30. Eleven of the samples studied were from foods naturally contaminated with Listeria species other than those used for spiking. The real-time PCR assay detected L. monocytogenes in all 11 of these samples; however, only 6 of these samples were positive by the MFHPB-30 method. To determine whether L. monocytogenes detection can be affected by other species of the same genus due to competition, an L. monocytogenes strain and a Listeria innocua strain with a faster rate of growth in the enrichment broth were artificially coinoculated at different ratios into ground pork meat samples and cultured according to the MFHPB-30 method. L. monocytogenes was detected only by the MFHPB-30 method when L. monocytogenes/L. innocua ratios were 6.0 or higher. In contrast, using the same enrichments, the real-time PCR assay detected L. monocytogenes at ratios as low as 0.6. Taken together, these findings support the hypothesis that L. monocytogenes can be outcompeted by L. innocua during the MFHPB-30 enrichment phase. However, more reliable detection of L. monocytogenes in this situation can be achieved by a PCR-based method mainly because of its sensitivity.

  17. Plasma Lipoprotein-associated Phospholipase A(2) Is Inversely Correlated with Proprotein Convertase Subtilisin-kexin Type 9

    NARCIS (Netherlands)

    Constantinides, Alexander; Kappelle, Paul J.W.H.; Lambert, Gilles; Dullaart, Robin P. F.

    Background and Aims. Lipoprotein-associated phospholipase A(2) (Lp-PLA(2)) is a proatherogenic phospholipase A(2), which is predominantly complexed to low-density lipoprotein (LDL) particles. Proprotein convertase subtilisin-kexin type 9 (PCSK9) provides a key step in LDL metabolism by stimulating

  18. Phospholipase C δ4 regulates cold sensitivity in mice. (United States)

    Yudin, Yevgen; Lutz, Brianna; Tao, Yuan-Xiang; Rohacs, Tibor


    The cold- and menthol-activated transient receptor potential melastatin 8 (TRPM8) channels are thought to be regulated by phospholipase C (PLC), but neither the specific PLC isoform nor the in vivo relevance of this regulation has been established. Here we identify PLCδ4 as the key PLC isoform involved in regulation of TRPM8 channels in vivo. We show that in small PLCδ4(-/-) TRPM8-positive dorsal root ganglion neurons cold, menthol and WS-12, a selective TRPM8 agonist, evoked significantly larger currents than in wild-type neurons, and action potential frequencies induced by menthol or by current injections were also higher in PLCδ4(-/-) neurons. PLCδ4(-/-) mice showed increased behavioural responses to evaporative cooling, and this effect was inhibited by a TRPM8 antagonist; behavioural responses to heat and mechanical stimuli were not altered. We provide evidence for the involvement of a specific PLC isoform in the regulation of cold sensitivity in mice by regulating TRPM8 activity. The transient receptor potential melastatin 8 (TRPM8) ion channel is a major sensor of environmental low temperatures. Ca(2+) -induced activation of phospholipase C (PLC) has been implied in the regulation of TRPM8 channels during menthol- and cold-induced desensitization in vitro. Here we identify PLCδ4 as the key PLC isoform involved in regulation of TRPM8 in sensory dorsal root ganglion (DRG) neurons. We identified two TRPM8-positive neuronal subpopulations, based on their cell body size. Most TRPM8-positive small neurons also responded to capsaicin, and had significantly larger menthol-induced inward current densities than medium-large cells, most of which did not respond to capsaicin. Small, but not medium-large, PLCδ4(-/-) neurons showed significantly larger currents induced by cold, menthol or WS-12, a specific TRPM8 agonist, compared to wild-type (WT) neurons, but TRPM8 protein levels were not different between the two groups. In current-clamp experiments small neurons

  19. Structural basis of the phospholipase C activity in neutral sphingomyelinase from Bacillus cereus

    International Nuclear Information System (INIS)

    Ago, Hideo; Miyano, Masashi


    Degradation of cell membrane and mucosa, of which phospholipids are major components, and production of lipid mediators are roles of phospholipases from pathogenic bacteria to grow, survive and spread in the host organism. The studies on the enzymes the important for the pathobiology of bacterial infectious disease. The crystal structure of Sphingomyelinase from Bacillus cereus revealed the structure basis of the phospholipase C and hemolysis activities in a divalent cation dependent manner. The water-bridged double divalent cations were concluded to be the catalytic architecture to the phospholipase C activity. In addition, the β-hairpin structure with aromatic amino acid residues was shown to be involved in the membrane binding of the enzyme as a part of the hemolysis activity. (author)

  20. Recombinant Lipases and Phospholipases and Their Use as Biocatalysts for Industrial Applications

    Directory of Open Access Journals (Sweden)

    Grazia M. Borrelli


    Full Text Available Lipases and phospholipases are interfacial enzymes that hydrolyze hydrophobic ester linkages of triacylglycerols and phospholipids, respectively. In addition to their role as esterases, these enzymes catalyze a plethora of other reactions; indeed, lipases also catalyze esterification, transesterification and interesterification reactions, and phospholipases also show acyltransferase, transacylase and transphosphatidylation activities. Thus, lipases and phospholipases represent versatile biocatalysts that are widely used in various industrial applications, such as for biodiesels, food, nutraceuticals, oil degumming and detergents; minor applications also include bioremediation, agriculture, cosmetics, leather and paper industries. These enzymes are ubiquitous in most living organisms, across animals, plants, yeasts, fungi and bacteria. For their greater availability and their ease of production, microbial lipases and phospholipases are preferred to those derived from animals and plants. Nevertheless, traditional purification strategies from microbe cultures have a number of disadvantages, which include non-reproducibility and low yields. Moreover, native microbial enzymes are not always suitable for biocatalytic processes. The development of molecular techniques for the production of recombinant heterologous proteins in a host system has overcome these constraints, as this allows high-level protein expression and production of new redesigned enzymes with improved catalytic properties. These can meet the requirements of specific industrial process better than the native enzymes. The purpose of this review is to give an overview of the structural and functional features of lipases and phospholipases, to describe the recent advances in optimization of the production of recombinant lipases and phospholipases, and to summarize the information available relating to their major applications in industrial processes.

  1. Functional interaction between Cerebratulus lacteus cytolysin A-III and phospholipase A/sub 2/

    Energy Technology Data Exchange (ETDEWEB)

    Liu, J.; Blumenthal, K.M.


    A study on the interaction between bee venom phospholipase A/sub 2/ and Cerebratulus lacteus cytolysin A-III, a major hemolysin secreted by this organism has been carried out. The hemolytic activity of A-III in phosphate-buffered saline is increased 5-fold in the presence of phospholipase A/sub 2/ from bee venom. Dansylphosphatidylethanolamine (DPE) labeled, phosphatidylcholine-containing liposomes and human erythrocyte membranes were employed to study the interaction between these two proteins. In DPE-liposomes, A-III alone had no effect on DPE fluorescence nor did it enhance either the phospholipase A/sub 2/-dependent fluorescence increase or blue shift in emission maximum, indicating that the cytolysis is not a major phospholipase A/sub 2/-activator. However, when DPE was incorporated into erythrocyte membranes, A-III alone induced a 40% fluorescence increase and a 5 nm blue shift, implying a transient activation of an endogenous phospholipase A/sub 2/. Further studies using synthetic lysophosphatidylcholine and free fatty acids demonstrated that the hemolytic activity of A-III is potentiated by free fatty acids, a product of phospholipid degradation catalyzed by phospholipase A/sub 2/. Subsequent analysis of this phenomenon by gel filtration chromatography, analytical ultracentrifugation, chemical cross-linking, and measurement of (/sup 14/C)oleic acid binding by the cytolysin demonstrated that binding of oleic acid to A-III causes aggregation of the toxin molecules to a tetrameric form which has a higher ..cap alpha..-helix content and a greater activity than the monomer.

  2. Phospholipase and proteinase activities of Candida spp. isolates from vulvovaginitis in Iran. (United States)

    Shirkhani, S; Sepahvand, A; Mirzaee, M; Anbari, K


    This study aims to characterize phospholipase and proteinase activities of Candida isolates from 82 vulvovaginal candidiasis (VVC) and to study the relationship of these activities with vulvovaginitis. Totally 82 Candida isolates from vagina samples of VVC patients were randomly collected over the period between September and December 2014 from hospitalized patients at the general hospitals of Lorestan province, Iran. Isolates were previously identified by conventional mycological methods. The phospholipase and proteinase activities were evaluated by Egg yolk agar, Tween 80 opacity medium and agar plate methods. The most common Candida species was identified Candida albicans (n=34, 41.5%), followed by Candida famata (n=13, 15.8%), Candida tropicalis (n=11, 13.4%), and Candida parapsilosis (n=9, 11%). The most phospholipase activity was observed in Candida colliculosa (40%), followed by C. famata (38.5%), and Candida krusei (33.3%). The findings revealed that the correlation between phospholipase production by Candida spp. and the presence of VVC was not found to be statistically significant (P=0.91). All Candida spp. exhibited considerable proteinase activity; so that 100% of C. colliculosa, C. parapsilosis, Candida kefyr, and Candida intermedia isolates produced high proteinase activity with Pz 4+ scores. There was a significant correlation between proteinase production by Candida spp. and the presence of VVC (P=0.009). The obtained findings revealed that Candida spp. isolates may produce both virulence factors, phospholipase and proteinase. Although the phospholipase production was only observed in <40% of the isolates; however there was a significant association between proteinase production by Candida spp. and VVC. Copyright © 2016. Published by Elsevier Masson SAS.

  3. Kinetic characterization of Escherichia coli outer membrane phospholipase A using mixed detergent-lipid micelles. (United States)

    Horrevoets, A J; Hackeng, T M; Verheij, H M; Dijkman, R; de Haas, G H


    The substrate specificity of Escherichia coli outer membrane phospholipase A was analyzed in mixed micelles of lipid with deoxycholate or Triton X-100. Diglycerides, monoglycerides, and Tweens 40 and 85 in Triton X-100 are hydrolyzed at rates comparable to those of phospholipids and lysophospholipids. p-Nitrophenyl esters of fatty acids with different chain lengths and triglycerides are not hydrolyzed. The minimal substrate characteristics consist of a long acyl chain esterified to a more or less hydrophilic headgroup as is the case for the substrate monopalmitoylglycol. Binding occurs via the hydrocarbon chain of the substrate; diacyl compounds are bound three to five times better than monoacyl compounds. When acting on lecithins, phospholipase A1 activity is six times higher than phospholipase A2 activity or 1-acyl lysophospholipase activity. Activity on the 2-acyl lyso compound is about two times less than that on the 1-acyl lysophospholipid. The enzyme therefore has a clear preference for the primary ester bond of phospholipids. In contrast to phospholipase A1 activity, phospholipase A2 activity is stereospecific. Only the L isomer of a lecithin analogue in which the primary acyl chain was replaced by an alkyl ether group is hydrolyzed. The D isomer of this analogue is a competitive inhibitor, bound with the same affinity as the L isomer. On these ether analogues the enzyme shows the same preference for the primary acyl chain as with the natural diester phospholipids. Despite its broad specificity, the enzyme will initially act as a phospholipase A1 in the E. coli envelope where it is embedded in phospholipids.

  4. In vitro differential activity of phospholipases and acid proteinases of clinical isolates of Candida

    Directory of Open Access Journals (Sweden)

    Aurean D'Eça Júnior


    Full Text Available INTRODUCTION: Candida yeasts are commensals; however, if the balance of normal flora is disrupted or the immune defenses are compromised, Candida species can cause disease manifestations. Several attributes contribute to the virulence and pathogenicity of Candida, including the production of extracellular hydrolytic enzymes, particularly phospholipase and proteinase. This study aimed to investigate the in vitro activity of phospholipases and acid proteinases in clinical isolates of Candida spp. METHODS: Eighty-two isolates from hospitalized patients collected from various sites of origin were analyzed. Phospholipase production was performed in egg yolk medium and the production of proteinase was verified in a medium containing bovine serum albumin. The study was performed in triplicate. RESULTS: Fifty-six (68.3% of isolates tested were phospholipase positive and 16 (44.4% were positive for proteinase activity. C. tropicalis was the species with the highest number of positive isolates for phospholipase (91.7%. Statistically significant differences were observed in relation to production of phospholipases among species (p<0,0001 and among the strains from different sites of origin (p=0.014. Regarding the production of acid protease, the isolates of C. parapsilosis tested presented a larger number of producers (69.2%. Among the species analyzed, the percentage of protease producing isolates did not differ statistically (χ2=1.9 p=0.5901 (χ2=1.9 p=0.5901. CONCLUSIONS: The majority of C. non-albicans and all C. albicans isolates were great producers of hydrolytic enzymes and, consequently, might be able to cause infection under favorable conditions.

  5. Diversity assessment of Listeria monocytogenes biofilm formation: Impact of growth condition, serotype and strain origin

    NARCIS (Netherlands)

    Kadam, S.R.; Besten, den H.M.W.; Veen, van der S.; Zwietering, M.H.; Moezelaar, R.; Abee, T.


    The foodborne pathogen Listeria monocytogenes has the ability to produce biofilms in food-processing environments and then contaminate food products, which is a major concern for food safety. The biofilm forming behavior of 143 L. monocytogenes strains was determined in four different media that

  6. A novel suicide plasmid for efficient gene mutation in Listeria monocytogenes (United States)

    Although several plasmids have been used in Listeria monocytogenes for generating mutants by allelic exchange, construction of L. monocytogenes mutants has been inefficient due to lack of effective selection markers for first and second recombination events. To address this problem, we have develope...

  7. Environmental prevalence and persistence of Listeria monocytogenes in cold-smoked trout processing plants (United States)

    The presence of Listeria monocytogenes on the surfaces of equipment and workers' hands during different production stages, as well as on fish skin and meat during processing and storage of cold-smoked trout, was investigated. Listeria monocytogenes was recovered from 10 (6.06%) of a total 165 cotto...

  8. Genome Sequences of Two Listeria monocytogenes Strains from Nectarines Associated with Listeriosis in 2014 (United States)

    Lu, Chunye; Marjanovic, Olivera; Kiang, David


    ABSTRACT Listeria monocytogenes is an important foodborne pathogen. Here, we present the annotated whole genome of Listeria monocytogenes strains F14M01297-C2 and F14M01297-C4, isolated from nectarines distributed by a packing facility in California during an investigation of listeriosis associated with stone fruit in 2014. PMID:28729255

  9. The occurrence, transmission, virulence and antibiotic resistance of Listeria monocytogenes in fish processing plant. (United States)

    Skowron, Krzysztof; Kwiecińska-Piróg, Joanna; Grudlewska, Katarzyna; Świeca, Agnieszka; Paluszak, Zbigniew; Bauza-Kaszewska, Justyna; Wałecka-Zacharska, Ewa; Gospodarek-Komkowska, Eugenia


    The aim of this research was to investigate the occurrence of Listeria monocytogenes in fish and fish processing plant and to determine their transmission, virulence and antibiotic resistance. L. monocytogenes was isolated according to the ISO 11290-1. The identification of L. monocytogenes was confirmed by multiplex PCR method. Genetic similarity of L. monocytogenes strains was determined with the Pulsed-Filed Gene Electrophoresis (PFGE) method. The multiplex PCR was used for identification of L. monocytogenes serogroups and detection of selected virulence genes (actA, fbpA, hlyA, iap, inlA, inlB, mpl, plcA, plcB, prfA). The L. monocytogens isolates susceptibility to penicillin, ampicillin, meropenem, erythromycin, trimethoprim/sulfamethoxazole was evaluated with disc diffusion method according to EUCAST v. 7.1. The presence of 237 L. monocytogenes isolates (before genetic similarity assessment) in 614 examined samples was confirmed. After strain differentiation by PFGE techniques the presence of 161 genetically different strains were confirmed. The genetic similarity of the examined isolates suggested that the source of the L. monocytogenes strains were fishes originating from farms. All tested strains possessed all detected virulence genes. Among examined strains, the most (26, 38.6%) belonged to the group 1/2a-3a. The most of tested strains were resistant to erythromycin (47.1%) and trimethoprim/sulfamethoxazole (47.1%). Copyright © 2018. Published by Elsevier B.V.

  10. A dynamical systems approach to actin-based motility in Listeria monocytogenes (United States)

    Hotton, S.


    A simple kinematic model for the trajectories of Listeria monocytogenes is generalized to a dynamical system rich enough to exhibit the resonant Hopf bifurcation structure of excitable media and simple enough to be studied geometrically. It is shown how L. monocytogenes trajectories and meandering spiral waves are organized by the same type of attracting set.

  11. A multiplex PCR for detection of Listeria monocytogenes and its lineages. (United States)

    Rawool, Deepak B; Doijad, Swapnil P; Poharkar, Krupali V; Negi, Mamta; Kale, Satyajit B; Malik, S V S; Kurkure, Nitin V; Chakraborty, Trinad; Barbuddhe, Sukhadeo B


    A novel multiplex PCR assay was developed to identify genus Listeria, and discriminate Listeria monocytogenes and its major lineages (LI, LII, LIII). This assay is a rapid and inexpensive subtyping method for screening and characterization of L. monocytogenes. Copyright © 2016 Elsevier B.V. All rights reserved.

  12. Isolation and characterization of an atypical Listeria monocytogenes associated with a canine urinary tract infection (United States)

    Listeria monocytogenes, a well-described cause of encephalitis and abortion in ruminants and of food-borne illness in humans, is rarely associated with disease in companion animals. A case of urinary tract infection associated with an atypical, weakly hemolytic L. monocytogenes strain is described i...

  13. Identification and measurement of rat eosinophil phospholipase D. Its activity on schistosomula phospholipids

    International Nuclear Information System (INIS)

    Lempereur, C.; Capron, M.; Capron, A.


    A sensitive assay, using [ 14 C]lecithin as a substrate, has been developed for the measurement of phospholipase activity in rat peritoneal polymorphonuclear leukocytes. Cell extracts were found to contain a phospholipase D activity and indirect evidence suggested that eosinophils are responsible for the cleavage of lecithin. Intact peritoneal cells were also able to hydrolyze exogenous [ 14 C]lecithin in vitro. When [ 3 H]choline-labeled schistosomula were used as targets in antibody-dependent cytotoxicity experiments, the radioactivity of lecithin decreased more rapidly in a complete cytotoxicity system than in controls, suggesting that hydrolysis of schistosomula phospholipids occurred during the killing process. (Auth.)

  14. The plant non-specific phospholipase C gene family. Novel competitors in lipid signalling

    Czech Academy of Sciences Publication Activity Database

    Pokotylo, Igor; Pejchar, Přemysl; Potocký, Martin; Kocourková, Daniela; Krčková, Zuzana; Ruelland, E.; Kravets, V.; Martinec, Jan


    Roč. 52, č. 1 (2013), s. 62-79 ISSN 0163-7827 R&D Projects: GA ČR(CZ) GAP501/12/1942; GA ČR(CZ) GPP501/12/P950; GA MŠk ME09108; GA AV ČR IAA601110916 Institutional research plan: CEZ:AV0Z50380511 Keywords : Plant nonspecific phospholipase C * Phosphatidylcholine-specific phospholipase C * Diacylglycerol Subject RIV: ED - Physiology Impact factor: 12.963, year: 2013

  15. Darapladib, a lipoprotein-associated phospholipase A2 inhibitor, in diabetic macular edema

    DEFF Research Database (Denmark)

    Staurenghi, Giovanni; Ye, Li; Magee, Mindy H


    PURPOSE: To investigate the potential of lipoprotein-associated phospholipase A2 inhibition as a novel mechanism to reduce edema and improve vision in center-involved diabetic macular edema (DME). DESIGN: Prospective, multicenter, randomized, double-masked, placebo-controlled phase IIa study...... (AEs) and nonocular AEs were similar between treatment groups. CONCLUSIONS: Once-daily oral darapladib administered for 3 months demonstrated modest improvements in vision and macular edema that warrant additional investigation of this novel lipoprotein-associated phospholipase A2 inhibitory mechanism...

  16. Comparative experimental infection of Listeria monocytogenes and Listeria ivanovii in bovine trophoblasts. (United States)

    Rocha, Cláudia E; Mol, Juliana P S; Garcia, Luize N N; Costa, Luciana F; Santos, Renato L; Paixão, Tatiane A


    Listeria monocytogenes is a Gram-positive, facultative intracellular and invasive bacterium that has tropism to the placenta, and causes fetal morbidity and mortality in several mammalian species. While infection with L. monocytogenes and L. ivanovii are known as important causes of abortion and reproductive failure in cattle, the pathogenesis of maternal-fetal listeriosis in this species is poorly known. This study used the bovine chorioallantoic membrane explant model to investigate the kinetics of L. monocytogenes, L. ivanovii, and L. innocua infections in bovine trophoblastic cells for up to 8 h post infection. L. monocytogenes and L. ivanovii were able to invade and multiply in trophoblastic cells without causing cell death or inducing expression of pro-inflammatory genes. Although L. innocua was unable to multiply in bovine trophoblastic cells, it induced transcription of the pro-inflammatory mediator CXCL6. This study demonstrated for the first time the susceptibility of bovine trophoblastic cells to L. monocytogenes and L. ivanovii infection.

  17. Survival of Bactericidal Antibiotic Treatment by a Persister Subpopulation of Listeria monocytogenes

    DEFF Research Database (Denmark)

    Knudsen, Gitte Maegaard; Ng, Yin; Gram, Lone


    Listeria monocytogenes can cause the serious infection listeriosis, which despite antibiotic treatment has a high mortality. Understanding the response of L. monocytogenes to antibiotic exposure is therefore important to ensure treatment success. Some bacteria survive antibiotic treatment...... by formation of persisters, which are a dormant antibiotic-tolerant subpopulation. The purpose of this study was to determine whether L. monocytogenes can form persisters and how bacterial physiology affects the number of persisters in the population. A stationary-phase culture of L. monocytogenes was adjusted...... that eradication of persisters is possible. Our study adds L. monocytogenes to the list of bacterial species capable of surviving bactericidal antibiotics in a dormant stage, and this persister phenomenon should be borne in mind when developing treatment regimens....

  18. Lactobacillus plantarum inhibits growth of Listeria monocytogenes in an in vitro continuous flow gut model, but promotes invasion of L. monocytogenes in the gut of gnotobiotic rats

    DEFF Research Database (Denmark)

    Bernbom, Nete; Licht, Tine Rask; Saadbye, Peter


    The ability of the pediocin AcH producing Lactobacillus plantarum DDEN 11007 and its non-producing plasmid-cured isogenic variant, DDEN 12305 to prevent the persistence and growth of Listeria monocytogenes EP2 in two gastrointestinal (GI) tract models was examined. In vitro studies conducted...... in a two-stage continuous flow system showed that L. plantarum DDEN 11007 inhibited L. monocytogenes EP2 under these conditions, while less effect was seen of the non-bacteriocin producing variant. The inhibitory effect was more pronounced at pH 5 than at pH 7. No effect on persistence of L. monocytogenes...... in the GI tract was seen in gnotobiotic rats colonized with either the pediocin AcH producing or the non-bacteriocin producing variant of L. plantarum when compared to rats inoculated with L. monocytogenes EP2 alone. Surprisingly, inoculation of the gnotobiotic animals with either of the L. plantarum...

  19. New Concepts in Phospholipase D Signaling in Inflammation and Cancer

    Directory of Open Access Journals (Sweden)

    Julian Gomez-Cambronero


    Full Text Available Phospholipase D (PLD catalyzes the hydrolysis of phosphatidylcholine to generate the lipid second messenger phosphatidic acid (PA and choline. PLD regulation in cells falls into two major signaling categories. One is via growth factors/mitogens, such as EGF, PDGF, insulin, and serum, and implicates tyrosine kinases; the other is via the small GTPase proteins Arf and Rho. We summarize here our lab's and other groups' contributions to those pathways and introduce several novel concepts. For the mitogen-induced signaling, new data indicate that an increase in cell transformation in PLD2-overexpressing cells is due to an increase of de novo DNA synthesis induced by PLD2, with the specific tyrosine residues involved in those functions being Y179 and Y511. Recent research has also implicated Grb2 in tyrosine phosphorylation of PLD2 that also involves Sos and the ERK pathway. The targets of phosphorylation within the PLD2 molecule that are key to its regulation have recently been precisely mapped. They are Y296, Y415, and Y511 and the responsible kinases are, respectively, EGFR, JAK3, and Src. Y296 is an inhibitory site and its phosphorylation explains the low PLD2 activity that exists in low-invasive MCF-7 breast cancer cells. Advances along the small GTPase front have implicated cell migration, as PLD1 and PLD2 cause an increase in chemotaxis of leukocytes and inflammation. PA is necessary for full chemotaxis. PA enriches the localization of the atypical guanine exchange factor (GEF, DOCK2, at the leading edge of polarized neutrophils. Further, extracellular PA serves as a neutrophil chemoattractant; PA enters the cell and activates the mTOR/S6K pathway (specifically, S6K. A clear connection between PLD with the mTOR/S6K pathway has been established, in that PA binds to mTOR and also binds to S6K independently of mTOR. Lastly, there is evidence in the upstream direction of cell signaling that mTOR and S6K keep PLD2 gene expression function down

  20. Patogénesis de Listeria monocytogenes, microorganismo zoonotico emergente

    Directory of Open Access Journals (Sweden)

    Kirvis Torres


    Full Text Available Listeria monocytogenes además de ser un paradigma para la investigación inmunológica se ha convertidoen sistema modelo apropiado para el análisis de los mecanismos moleculares del parasitismo intracelularde otras bacterias. Investigadores en el área de la inmunología se interesaron en este microorganismocuando se reconoció el riesgo que representaba para la salud pública y la seguridad en la industria dealimentos. Desde mediados de los años 80’s se ha investigado la biología molecular de los marcadores devirulencia de este microorganismo, la biología celular de las interacciones de los marcadores de virulenciacon los receptores de la célula hospedero, el citoesqueleto, las vías de transducción de señales y losmecanismos de inmunidad mediada por células del hospedero. El propósito de esta revisión es describiralgunas características taxonómicas y filogenéticas de Listeria monocytogenes , la incidencia humana yanimal de varios serotipos, la fisiopatología de la infección , modelos animales y de cultivo celular utilizadospara estudios de virulencia, las poblaciones de riesgo, manifestaciones clínicas de listeriosis humana yanimal, el tratamiento, la organización genética y evolución de los determinantes de virulencia, losmecanismos empleados para interactuar con la célula hospedera, y los mecanismos para escapar de losprocesos de muerte celular y pasar de una célula infectada a otra. La información recopilada resulta degran importancia para el personal de salud, industria, consumidores y población de riesgo; razón por lacual Listeria monocytogenes es un patógeno que representa una amenaza para la salud pública mundial.

  1. Control of Listeria monocytogenes in food production plants

    Directory of Open Access Journals (Sweden)

    Dimitrijević Mirjana


    Full Text Available L. monocytogenes has been established in different plants for the production of food, including dairy plants, abattoirs, plants for the processing of fish, as well as those for the production of ready-to-eat (RTE food and this fact is being considered as the primary mechanism of food contamination with this bacteria. There is also the factor of numerous and diverse contaminated production equipment, because it has certain parts that are inaccessible for the necessary cleaning and disinfection. The temperature, position, as well as the material of the work surface are also linked to the contamination of plants with this bacteria. Investigations carried out so far have helped toward the better understanding of the manner and time of contamination of food items in the course of the production process, but there are still unresolved problems, including most certainly the biggest one - the adherence of bacteria and the creation of a biofilm, when the bacteria is in that condition more resistant to so-called stress factors which are usually used in the food industry for the purpose of decontamination of the surfaces with which foods come into contact. The control of L. monocytogenes in food production plants is possible primarily by using an integrated programme, compatible with the systems Hazard Analysis Critical Control Point (HACCP and Good Hygiene Practice (GHP, necessary in the production of food that is safe for the consumer. Essentially, the control measures that can contribute to reducing the incidence of findings of L.monocytogenes in the finished product, as well as the reducing of the level of contamination with this bacteria are linked, on the one hand, with hygiene procedures in the production process, and, on the other, with the applied technological procedures.

  2. Combination of endolysins and high pressure to inactivate Listeria monocytogenes. (United States)

    van Nassau, Tomas J; Lenz, Christian A; Scherzinger, Anna S; Vogel, Rudi F


    Outbreaks of listeriosis are often related to the consumption of low-processed ready-to-eat food products (e.g. soft cheeses or smoked fish) contaminated with Listeria monocytogenes. Traditional preservation techniques, such as heat treatment, cannot eliminate Listeria from these products without strongly affecting the quality of the foods. We therefore investigated the use of endolysin (PlyP40, Ply511, or PlyP825) in combination with high hydrostatic pressure processing to kill L. monocytogenes in buffer. The results demonstrated a more than additive effect when both treatments were combined. For example, whereas 0.16 μg/mL PlyP825 or 300 MPa (1 min, 30 °C) applied individually reduced the cell count by 0.2 and 0.3 log cfu, respectively, a combined treatment resulted in a reduction of 5.5 log cfu. Similar results were obtained for the other endolysins combined with high pressure processing. We also showed that the synergistic inactivation of cells by endolysin and HHP is possible at a pressure level of only 200 MPa (2 min, 30 °C). Thus, the application of endolysins did not only substantially increase the bactericidal effect of high pressure, but it also enabled the inactivation of bacterial cells at much lower pressure levels. This shows the potential of using such combined processes for the inactivation of L. monocytogenes and food preservation. Copyright © 2017 Elsevier Ltd. All rights reserved.

  3. Crystallization and preliminary X-ray diffraction analysis of three myotoxic phospholipases A2 from Bothrops brazili venom

    International Nuclear Information System (INIS)

    Fernandes, Carlos A. H.; Gartuzo, Elaine C. G.; Pagotto, Ivan; Comparetti, Edson J.; Huancahuire-Vega, Salomón; Ponce-Soto, Luis Alberto; Costa, Tássia R.; Marangoni, Sergio; Soares, Andreimar M.; Fontes, Marcos R. M.


    Two myotoxic and noncatalytic Lys49-phospholipases A 2 (braziliantoxin-II and MT-II) and a myotoxic and catalytic phospholipase A 2 (braziliantoxin-III) from B. brazili were crystallized. X-ray diffraction data sets were collected and molecular-replacement solutions were obtained. Two myotoxic and noncatalytic Lys49-phospholipases A 2 (braziliantoxin-II and MT-II) and a myotoxic and catalytic phospholipase A 2 (braziliantoxin-III) from the venom of the Amazonian snake Bothrops brazili were crystallized. The crystals diffracted to resolutions in the range 2.56–2.05 Å and belonged to space groups P3 1 21 (braziliantoxin-II), P6 5 22 (braziliantoxin-III) and P2 1 (MT-II). The structures were solved by molecular-replacement techniques. Both of the Lys49-phospholipases A 2 (braziliantoxin-II and MT-II) contained a dimer in the asymmetric unit, while the Asp49-phospholipase A 2 braziliantoxin-III contained a monomer in its asymmetric unit. Analysis of the quaternary assemblies of the braziliantoxin-II and MT-II structures using the PISA program indicated that both models have a dimeric conformation in solution. The same analysis of the braziliantoxin-III structure indicated that this protein does not dimerize in solution and probably acts as a monomer in vivo, similar to other snake-venom Asp49-phospholipases A 2

  4. Moderate alcohol consumption and lipoprotein-associated phospholipase A2 activity

    NARCIS (Netherlands)

    Beulens, J.W.J.; Berg, R. van den; Kok, F.J.; Helander, A.; Vermunt, S.H.F.; Hendriks, H.F.J.


    Background and aims: To investigate the effect of moderate alcohol consumption on lipoprotein-associated phospholipase A2 activity, markers of inflammation and oxidative stress and whether these effects are modified by BMI. Methods and results: Eleven lean (BMI: 18.5-25 kg/m2) and 9 overweight (BMI

  5. M3 muscarinic receptor interaction with phospholipase C beta3 determines its signaling efficiency

    NARCIS (Netherlands)

    Kan, W.; Adjobo-Hermans, M.J.; Burroughs, M.; Faibis, G.; Malik, S.; Tall, G.G.; Smrcka, A.V.


    Phospholipase Cbeta (PLCbeta) enzymes are activated by G protein-coupled receptors through receptor-catalyzed guanine nucleotide exchange on Galphabetagamma heterotrimers containing Gq family G proteins. Here we report evidence for a direct interaction between M3 muscarinic receptor (M3R) and

  6. Hydrolysis of synthetic mixed-acid phosphatides by phospholipase A from human pancreas

    NARCIS (Netherlands)

    Deenen, L.L.M. van; Haas, Gerard H. de; Heemskerk, C.H.Th.


    An investigation was made into the action of a human pancreatic phospholipase A on various synthetic phosphatides. L-α-Phosphatidyl ethanolamines were readily hydrolysed in an aqueous system by this enzyme. Synthetic lecithins, however, were not attacked in an appreciable rate by the mammalian

  7. The action of cobra venom phospholipase A2 isoenzymes towards intact human erythrocytes

    NARCIS (Netherlands)

    Roelofsen, B.; Sibenius Trip, M.; Verheij, H.M.; Zevenbergen, J.L.


    1. 1. Cobra venom phospholipase A2 from three different sources has been fractionated into different isoenzymes by DEAE ion-exchange chromatography. 2. 2. Treatment of intact human erythrocytes with the various isoenzymes revealed significant differences in the degree of phosphatidylcholine

  8. Effects of a phospholipase A2 inhibitor on uptake and toxicity of liposomes containing plant phosphatidylinositol

    International Nuclear Information System (INIS)

    Jett, M.; Alving, C.R.


    Plant phosphatidylinositol (PI) has been shown by us to have a direct cytotoxic effect on cultured tumor cells but not on normal cells. Synthetic PI containing 14 C-linoleic acid in the sn-2 position, also showed the same pattern of selective cytotoxicity. When the metabolic fate of synthetic PI was examined with tumor cells, the radioactivity which no longer occurred as PI, was found as either products of phospholipase A 2 (93%, free fatty acids and phosphatidylcholine) or phospholipase C (7%, diglycerides). Uptake of liposomal PI was directly correlated with cytotoxicity. They tested a variety of inhibitors to see the effect on uptake and/or cytotoxicity of plant PI. General metabolic inhibitors such as metrizamide or sodium azide did not alter cellular uptake of the plant PI liposomes. Inhibitors of lipoxygenase formation, such as indomethacin, also did not alter the uptake or cytotoxicity induced by plant PI. Quinacrine, an inhibitor of phospholipase A 2 , decreased the uptake of the PI containing liposomes to 50% of that seen in the presence or absence of any other inhibitor. Although quinacrine is itself toxic to cells, at low concentrations of quinacrine, plant PI did not show the same degree of cytotoxicity as in the absence of quinacrine. These data are compatible with the hypothesis that plant PI exerts cytotoxicity by serving as a substrate for phospholipase A 2

  9. Calcium-independent phospholipase A₂, group VIA, is critical for RPE cell survival

    DEFF Research Database (Denmark)

    Kolko, Miriam; Vohra, Rupali; Westlund, Barbro S.


    PURPOSE: To investigate the significance of calcium-independent phospholipase A₂, group VIA (iPLA2-VIA), in RPE cell survival following responses to sodium iodate (SI) in cell cultures. METHODS: The human retinal pigment epithelium (RPE) cell line (ARPE-19) cells and primary mouse-RPE cultures were...


    Phospholipase A2 (PLA2) is a secretory digestive enzyme that hydrolyzes ester bond at sn-2 position of dietary phospholipids, creating free fatty acid and lysophopholipid. The free fatty acids (arachidonic acid) are absorbed into midgut cells. Aedes albopictus and Culex quinquefasciatus digestive PL...

  11. Overexpression of porcine lipoprotein-associated phospholipase A2 in swine

    NARCIS (Netherlands)

    Tang, Xiaochun; Wang, Gangqi; Liu, Xingxing; Han, Xiaolei; Li, Zhuang; Ran, Guangyao; Li, Zhanjun; Song, Qi; Ji, Y; Wang, Haijun; Wang, Yuhui; Ouyang, Hongsheng; Pang, Daxin


    Lipoprotein-associated phospholipase A 2 (Lp-PLA2) is associated with the risk of vascular disease. It circulates in human blood predominantly in association with low-density lipoprotein cholesterol (LDL-C) and hydrolyses oxidized phospholipids into pro-inflammatory products. However, in the mouse

  12. Secretory Phospholipase A2-IIA and Cardiovascular Disease: A Mendelian Randomization Study

    NARCIS (Netherlands)

    Holmes, Michael V.; Simon, Tabassome; Exeter, Holly J.; Folkersen, Lasse; Asselbergs, Folkert W.; Guardiola, Montse; Cooper, Jackie A.; Palmen, Jutta; Hubacek, Jaroslav A.; Carruthers, Kathryn F.; Horne, Benjamin D.; Brunisholz, Kimberly D.; Mega, Jessica L.; van Iperen, Erik P. A.; Li, Mingyao; Leusink, Maarten; Trompet, Stella; Verschuren, Jeffrey J. W.; Hovingh, G. Kees; Dehghan, Abbas; Nelson, Christopher P.; Kotti, Salma; Danchin, Nicolas; Scholz, Markus; Haase, Christiane L.; Rothenbacher, Dietrich; Swerdlow, Daniel I.; Kuchenbaecker, Karoline B.; Staines-Urias, Eleonora; Goel, Anuj; van 't Hooft, Ferdinand; Gertow, Karl; de Faire, Ulf; Panayiotou, Andrie G.; Tremoli, Elena; Baldassarre, Damiano; Veglia, Fabrizio; Holdt, Lesca M.; Beutner, Frank; Gansevoort, Ron T.; Navis, Gerjan J.; Mateo Leach, Irene; Breitling, Lutz P.; Brenner, Hermann; Thiery, Joachim; Dallmeier, Dhayana; Franco-Cereceda, Anders; Boer, Jolanda M. A.; Stephens, Jeffrey W.; Hofker, Marten H.; Tedgui, Alain; Hofman, Albert; Uitterlinden, André G.; Adamkova, Vera; Pitha, Jan; Onland-Moret, N. Charlotte; Cramer, Maarten J.; Nathoe, Hendrik M.; Spiering, Wilko; Klungel, Olaf H.; Kumari, Meena; Whincup, Peter H.; Morrow, David A.; Braund, Peter S.; Hall, Alistair S.; Olsson, Anders G.; Doevendans, Pieter A.; Trip, Mieke D.; Tobin, Martin D.; Hamsten, Anders; Watkins, Hugh; Koenig, Wolfgang; Nicolaides, Andrew N.; Teupser, Daniel; Day, Ian N. M.; Carlquist, John F.; Gaunt, Tom R.; Ford, Ian; Sattar, Naveed; Tsimikas, Sotirios; Schwartz, Gregory G.; Lawlor, Debbie A.; Morris, Richard W.; Sandhu, Manjinder S.; Poledne, Rudolf; Maitland-van der Zee, Anke H.; Khaw, Kay-Tee; Keating, Brendan J.; van der Harst, Pim; Price, Jackie F.; Mehta, Shamir R.; Yusuf, Salim; Witteman, Jaqueline C. M.; Franco, Oscar H.; Jukema, J. Wouter; de Knijff, Peter; Tybjaerg-Hansen, Anne; Rader, Daniel J.; Farrall, Martin; Samani, Nilesh J.; Kivimaki, Mika; Fox, Keith A. A.; Humphries, Steve E.; Anderson, Jeffrey L.; Boekholdt, S. Matthijs; Palmer, Tom M.; Eriksson, Per; Paré, Guillaume; Hingorani, Aroon D.; Sabatine, Marc S.; Mallat, Ziad; Casas, Juan P.; Talmud, Philippa J.


    This study sought to investigate the role of secretory phospholipase A2 (sPLA2)-IIA in cardiovascular disease. Higher circulating levels of sPLA2-IIA mass or sPLA2 enzyme activity have been associated with increased risk of cardiovascular events. However, it is not clear if this association is

  13. Lactadherin inhibits secretory phospholipase A2 activity on pre-apoptotic leukemia cells

    DEFF Research Database (Denmark)

    Nyegaard, Steffen; Novakovic, Valerie A.; Rasmussen, Jan Trige


    Secretory phospholipase A2 (sPLA2) is a critical component of insect and snake venoms and is secreted by mammalian leukocytes during inflammation. Elevated secretory PLA2 concentrations are associated with autoimmune diseases and septic shock. Many sPLA2’s do not bind to plasma membranes of quies...

  14. Phospholipase C-catalyzed sphingomyelin hydrolysis in a membrane reactor for ceramide production

    DEFF Research Database (Denmark)

    Zhang, Long; Liang, Shanshan; Hellgren, Lars


    A membrane reactor for the production of ceramide through sphingomyelin hydrolysis with phospholipase C from Clostridium perfringens was studied for the first time. Ceramide has raised a large interest as an active component in both pharmaceutical and cosmetic industry. The enzymatic hydrolysis...

  15. Effect of phospholipase A treatment of low density lipoproteins on the dextran sulfate--lipoprotein interaction. (United States)

    Nishida, T


    The effect of phospholipase A on the interaction of low density lipoproteins of the S(f) 0-10 class with dextran sulfate was studied in phosphate buffer of pH 7.4, ionic strength 0.1, by chemical, spectrophotometric, and centrifugal methods. When low density lipoproteins that had been treated with phospholipase A were substituted for untreated lipoproteins, the amount of insoluble dextran sulfate-lipoprotein complex formed was greatly reduced. Hydrolysis of over 20% of the lecithin and phosphatidyl ethanolamine constituents of the lipoproteins prevented the formation of insoluble complex. However, even the lipoproteins in which almost all the phosphoglycerides were hydrolyzed produced soluble complex, which was converted to insoluble complex upon addition of magnesium sulfate. It is apparent that the lipoproteins altered extensively by treatment with phospholipase A retain many characteristic properties of native low density lipoproteins. Fatty acids, but not lysolecithin, released by the action of phospholipase A interfered with the formation of insoluble complex; this interference was due to association of the fatty acids with the lipoproteins. With increases in the concentration of the associated fatty acids, the amounts of magnesium ion required for the conversion of soluble complex to insoluble complex increased progressively. Charge interaction is evidently of paramount importance in the formation of sulfated polysaccharide-lipoprotein complexes.

  16. Reassessing the role of phospholipase D in the Arabidopsis wounding response

    NARCIS (Netherlands)

    Bargmann, Bastiaan O.R.; Laxalt, Ana M.; Riet, Bas ter; Testerink, Christa; Merquiol, Emmanuelle; Mosblech, Alina; Leon Reyes, H.A.; Pieterse, C.M.J.; Haring, Michel A.; Heilmann, Ingo; Bartels, Dorothea; Munnik, Teun


    Plants respond to wounding by means of a multitude of reactions, with the purpose of stifling herbivore assault. Phospholipase D (PLD) has previously been implicated in the wounding response. Arabidopsis (Arabidopsis thaliana) AtPLDa1 has been proposed to be activated in intact cells, and the

  17. Uncarinic acids: phospholipase Cgamma1 inhibitors from hooks of Uncaria rhynchophylla. (United States)

    Lee, J S; Yang, M Y; Yeo, H; Kim, J; Lee, H S; Ahn, J S


    Bioactivity-guided fractionation of the CHCl3 extract from hooks of Uncaria rhynchophylla led to the isolation of two triterpene esters, namely uncarinic acids A (1) and B (2). Their structures were established by spectroscopic and chemical methods. These compounds inhibited phospholipase Cgamma1 with IC50 values of 35.66 and 44.55 microM, respectively.

  18. Action of phospholipases on the phosphatidylcholine exchange protein from beef liver

    NARCIS (Netherlands)

    Kamp, H.H.; Sprengers, E.D.; Westerman, J.; Wirtz, K.W.A.; Deenen, L.L.M. van


    Abstract The phospholipases A2, C and D have been used to investigate the localization of phosphatidylcholine in the phosphatidylcholine exchange protein from beef liver. The rate of enzymatic hydrolysis of the protein-bound phosphatidylcholine was found to be very low. Addition of deoxycholate,

  19. Regulation of cytosolic Phospholipase A2 activity plays a central role in cell responses

    NARCIS (Netherlands)

    Rossum, Gerarda Sophia Agnes Theodora van


    Phospholipases A2 are enzymes that hydrolyse fatty acids from the sn-2 position of phospholipids, resulting in the release of free fatty acids and lysophospholipids. The sn-2 position of phospholipids in mammalian cells is enriched with arachidonic acid, which is a substrate for cyclooxygenases,

  20. Molecular structure of phospholipase D and regulatory mechanisms of its activity in plant and animal cells

    Czech Academy of Sciences Publication Activity Database

    Kolesnikov, Y. S.; Nokhrina, K. P.; Kretynin, S. V.; Volotovski, I. D.; Martinec, Jan; Romanov, G. A.; Kravets, V. S.


    Roč. 77, č. 1 (2012), s. 1-14 ISSN 0006-2979 R&D Projects: GA ČR(CZ) GAP501/11/1654 Institutional research plan: CEZ:AV0Z50380511 Keywords : phospholipase D * domains * calcium Subject RIV: CE - Biochemistry Impact factor: 1.149, year: 2012

  1. Aluminum ions inhibit phospholipase D in a microtubule-dependent manner

    Czech Academy of Sciences Publication Activity Database

    Pejchar, Přemysl; Pleskot, R.; Schwarzerová, K.; Martinec, Jan; Valentová, O.; Novotná, Z.


    Roč. 32, č. 5 (2008), s. 554-556 ISSN 1065-6995 R&D Projects: GA ČR GA522/05/0340 Institutional research plan: CEZ:AV0Z50380511 Keywords : Aluminum toxicity * Phospholipase D * Microtubules Subject RIV: ED - Physiology Impact factor: 1.619, year: 2008

  2. Synthesis of structured phospholipids by immobilized phospholipase A2 catalyzed acidolysis

    DEFF Research Database (Denmark)

    Vikbjerg, Anders Falk; Vikbjerg, Anders Falk; Xu, Xuebing


    Acyl modification of the sn-2 position in phospholipids (PLs) was conducted by acidolysis reaction using immobilized phospholipase A2 (PLA2) as the catalyst. In the first stage we screened different carriers for their ability to immobilize PLA2. Several carriers were able to fix the enzyme...

  3. Anti-phospholipase A receptor antibodies correlate with clinical status in idiopathic membranous nephropathy

    NARCIS (Netherlands)

    Hofstra, J.M.; Beck Jr., L.H.; Beck, D.M.; Wetzels, J.F.M.; Salant, D.J.


    BACKGROUND AND OBJECTIVES: Circulating autoantibodies against the M-type phospholipase A(2) receptor (anti-PLA(2)R) were recently identified in the majority of patients in the United States with idiopathic membranous nephropathy (iMN). The objectives of this study were to assess the prevalence of


    Directory of Open Access Journals (Sweden)

    S Fisichella


    Full Text Available The aim of the present study is to investigate operative procedures that allow to minimize Listeria monocytogenes (L. m. hazard in the main traditional sausage of the internal areas of Marche (Italy: the Ciauscolo, that has received the quality trademark PGI. It is made from lean cuts of well mature pork that is finely minced, adding fat which give the salami his characteristic softness and flavour. It is characterized by having a very little maturing period that determine high aw levels and, for this peculiarity, it allows L. m development.

  5. Thermal resistance of Listeria monocytogenes in sausage meat. (United States)

    Farber, J M; Hughes, A; Holley, R; Brown, B


    The heat resistance of a mixture of 10 different strains of Listeria monocytogenes inoculated into ground meat and ground meat plus cure was examined. D-values for ground meat ranged from 1.01 min at 62 degrees C to 13.18 min at 56 degrees C. The D-values obtained for ground meat plus cure were approximately 5-8 fold times higher than those for ground meat alone. These results imply that rare meats and possibly some cooked fermented meats may not be heated adequately to inactivate Listeria.

  6. [Listeria monocytogenes nosocomial infection in the maternity ward]. (United States)

    Jean, D; Croize, J; Hirtz, P; Legeais, C; Pelloux, I; Favier, M; Mallaret, M R; Le Noc, P; Rambaud, P


    Nosocomial infection with Listeria monocytogenes 4b occurred in January 1990 in a maternity hospital in Grenoble. The 3 patients involved were born within a 24 hour-interval. The premature newborn responsible for contamination was asymptomatic. Two other newborns without any perinatal infectious risk presented with meningitis, one on the 5th day of life in the maternity hospital, the other one on the 11th day while already at home. The 3 strains of Listeria had the same serovar and lysovar. Epidemiologic investigations led to suspect a contamination in the delivery room and during the care of the children. Strict respect of hygiene orders is imperative to avoid nosocomial infections.

  7. Carbon dioxide and nisin act synergistically on Listeria monocytogenes

    DEFF Research Database (Denmark)

    Nilsson, Lilian; Chen, Y.H.; Chikindas, M.L.


    This paper examines the synergistic action of carbon dioxide and nisin on Listeria monocytogenes Scott A wild-type and nisin-resistant (Nis(r)) cells grown in broth at 4 degrees C. Carbon dioxide extended the lag phase and decreased the specific growth rate of both strains, but to a greater degree...... for cultures in CO2. This synergism between nisin and CO2 was examined mechanistically by following the leakage of carboxyfluorescein (CF) from listerial liposomes. Carbon dioxide enhanced nisin-induced CF leakage, indicating that the synergistic action of CO2 and nisin occurs at the cytoplasmic membrane...

  8. Phospholipase D family member 4, a transmembrane glycoprotein with no phospholipase D activity, expression in spleen and early postnatal microglia.

    Directory of Open Access Journals (Sweden)

    Fumio Yoshikawa

    Full Text Available BACKGROUND: Phospholipase D (PLD catalyzes conversion of phosphatidylcholine into choline and phosphatidic acid, leading to a variety of intracellular signal transduction events. Two classical PLDs, PLD1 and PLD2, contain phosphatidylinositide-binding PX and PH domains and two conserved His-x-Lys-(x(4-Asp (HKD motifs, which are critical for PLD activity. PLD4 officially belongs to the PLD family, because it possesses two HKD motifs. However, it lacks PX and PH domains and has a putative transmembrane domain instead. Nevertheless, little is known regarding expression, structure, and function of PLD4. METHODOLOGY/PRINCIPAL FINDINGS: PLD4 was analyzed in terms of expression, structure, and function. Expression was analyzed in developing mouse brains and non-neuronal tissues using microarray, in situ hybridization, immunohistochemistry, and immunocytochemistry. Structure was evaluated using bioinformatics analysis of protein domains, biochemical analyses of transmembrane property, and enzymatic deglycosylation. PLD activity was examined by choline release and transphosphatidylation assays. Results demonstrated low to modest, but characteristic, PLD4 mRNA expression in a subset of cells preferentially localized around white matter regions, including the corpus callosum and cerebellar white matter, during the first postnatal week. These PLD4 mRNA-expressing cells were identified as Iba1-positive microglia. In non-neuronal tissues, PLD4 mRNA expression was widespread, but predominantly distributed in the spleen. Intense PLD4 expression was detected around the marginal zone of the splenic red pulp, and splenic PLD4 protein recovered from subcellular membrane fractions was highly N-glycosylated. PLD4 was heterologously expressed in cell lines and localized in the endoplasmic reticulum and Golgi apparatus. Moreover, heterologously expressed PLD4 proteins did not exhibit PLD enzymatic activity. CONCLUSIONS/SIGNIFICANCE: Results showed that PLD4 is a non

  9. Listeria monocytogenes associated kerato-conjunctivitis in four horses in Norway. (United States)

    Revold, Tobias; Abayneh, Takele; Brun-Hansen, Hege; Kleppe, Signe L; Ropstad, Ernst-Otto; Hellings, Robert A; Sørum, Henning


    Listeria monocytogenes has been reported to cause various infectious diseases in both humans and animals. More rarely, ocular infections have been reported. To our knowledge, only two cases of Listeria keratitis have been described in horses. We report kerato-conjunctivitis in four Norwegian horses associated with L. monocytogenes. Clinically, all cases were presented with recurrent unilateral kerato-conjunctivitis. L. monocytogenes bacteria were isolated from swab samples from all cases, and cytology carried out in 3 cases was indicative of L. monocytogenes infection. The present report describes the first known cases in which L. monocytogenes has been isolated from keratitic lesions in horses in Norway. A potential risk factor may be feeding of silage or haylage, but other sources of infection cannot be ruled out. The phenotypic features including antimicrobial susceptibility and serotype of the isolates are described. Laboratory detection of L. monocytogenes demands extra caution since only low numbers of bacteria were detected in the eye-swabs, probably due to the low volume of sample material and the intracellular niche of the bacterium. A general poor response to treatment in all these cases indicates that clinicians should pay extra attention to intensity and duration of treatment if L. monocytogenes is identified in connection with equine kerato-conjunctivitis.

  10. Listeria monocytogenes in Food-Processing Facilities, Food Contamination, and Human Listeriosis: The Brazilian Scenario. (United States)

    Camargo, Anderson Carlos; Woodward, Joshua John; Call, Douglas Ruben; Nero, Luís Augusto


    Listeria monocytogenes is a foodborne pathogen that contaminates food-processing environments and persists within biofilms on equipment, utensils, floors, and drains, ultimately reaching final products by cross-contamination. This pathogen grows even under high salt conditions or refrigeration temperatures, remaining viable in various food products until the end of their shelf life. While the estimated incidence of listeriosis is lower than other enteric illnesses, infections caused by L. monocytogenes are more likely to lead to hospitalizations and fatalities. Despite the description of L. monocytogenes occurrence in Brazilian food-processing facilities and foods, there is a lack of consistent data regarding listeriosis cases and outbreaks directly associated with food consumption. Listeriosis requires rapid treatment with antibiotics and most drugs suitable for Gram-positive bacteria are effective against L. monocytogenes. Only a minority of clinical antibiotic-resistant L. monocytogenes strains have been described so far; whereas many strains recovered from food-processing facilities and foods exhibited resistance to antimicrobials not suitable against listeriosis. L. monocytogenes control in food industries is a challenge, demanding proper cleaning and application of sanitization procedures to eliminate this foodborne pathogen from the food-processing environment and ensure food safety. This review focuses on presenting the L. monocytogenes distribution in food-processing environment, food contamination, and control in the food industry, as well as the consequences of listeriosis to human health, providing a comparison of the current Brazilian situation with the international scenario.

  11. Prevalence and antimicrobial resistance of Listeria monocytogenes isolated in chicken slaughterhouses in Northern Greece. (United States)

    Sakaridis, I; Soultos, N; Iossifidou, E; Papa, A; Ambrosiadis, I; Koidis, P


    This study was conducted to determine the prevalence and antimicrobial resistance of Listeria monocytogenes recovered from chicken carcasses in slaughterhouses in Northern Greece. A total of 100 poultry samples (300 carcasses) were examined for Listeria spp. The samples were neck skin taken from four different slaughterhouses in Northern Greece. Forty samples were also taken from the environment of the slaughterhouses. Identification of L. monocytogenes was carried out by PCR and fingerprinting of the isolates by random amplified polymorphic DNA. L. monocytogenes strains isolated from chicken carcasses and from the environment of the slaughterhouses were also examined for antibiotic resistance. Fifty-five isolates of L. monocytogenes were tested for susceptibility to 20 antibiotics using the disk diffusion method. Listeria spp. were present in 99 of the poultry samples tested (99%), and 38 yielded L monocytogenes (38%). L. monocytogenes was also isolated in 80% of samples from the environment of a certain slaughterhouse, while the other slaughterhouses were found to be contaminated only with Listeria spp. All isolates were resistant to nalidixic acid and oxolinic acid, the majority of them to clindamycin, and only a few to tetracycline and oxytetracycline, whereas they were found to be susceptible to all other antimicrobials. The results of this study demonstrate a high prevalence of L. monocytogenes contamination in chicken carcasses, and all isolates were found to be sensitive to the antimicrobials most commonly used to treat human listeriosis.

  12. Prevalence and characteristics of Listeria monocytogenes in bovine colostrum in Japan. (United States)

    Hasegawa, Megumi; Iwabuchi, Eriko; Yamamoto, Shiori; Esaki, Hidetake; Kobayashi, Kazuhiko; Ito, Masahiko; Hirai, Katsuya


    This study was conducted to determine the prevalence and characteristics of Listeria monocytogenes in bovine colostrum in Japan. We collected bovine colostrum samples from 210 dams from 21 dairy farms in Hokkaido prefecture (Japan) between March and June 2009. L. monocytogenes was detected in samples from 6 (28.6%) of the 21 farms. Of the 210 samples, 16 (7.6%) were positive for L. monocytogenes. We recovered 80 L. monocytogenes isolates; 44 (55%) isolates were classified as serotype 1/2b and 36 (45%) were classified as serotype 4b. The isolates were susceptible to penicillin, ampicillin, amoxicillin, gentamicin, kanamycin, streptomycin, erythromycin, vancomycin, tetracycline, chloramphenicol, ciprofloxacin, and trimethoprim-sulfamethoxazole. Pulsed-field gel electrophoresis (PFGE) characterization of the 80 isolates revealed six PFGE types. Two PFGE types corresponded to human listeriosis cases. Most L. monocytogenes isolates possessed virulence-associated genes (actA, hly, iap, inlA, inlC, mpl, plcA, plcB, opuCA, prfA, and clpC). One PFGE type isolate possessed an epidemic clone II marker. Our findings suggest that isolates from bovine colostrum have the potential to cause human and animal listeriosis. This is the first study on the prevalence and characteristics of L. monocytogenes isolated from bovine colostrum obtained from dairy farms. Our results have important implications for improving public health and elucidating the epidemiology of L. monocytogenes in bovine colostrum.

  13. Relationship between Listeria monocytogenes and Listeria spp. in seafood processing plants. (United States)

    Alali, Walid Q; Schaffner, Donald W


    The objective of this study was to evaluate the relationship between prevalence of Listeria monocytogenes as an outcome and Listeria spp. as an explanatory variable by food products, food contact surfaces, and nonfood contact surfaces in seafood processing plants by using peer-reviewed published data. Nine sets of prevalence data of L. monocytogenes and Listeria spp. were collected from published studies and used for the analyses. Based on our analysis, the relationship between L. monocytogenes prevalence and Listeria spp. prevalence in food products (incoming raw materials and finish products) was significant (P = 0.04) with (low) R² = 0.36. Furthermore, Listeria spp. were not a good indicator for L. monocytogenes when testing food contact surfaces (R² = 0.10). Listeria spp. were a good indicator for L. monocytogenes only on nonfood contact surfaces (R² = 0.90). On the other hand, the presence of Listeria spp. on food contact surfaces (R² = 0.002) and nonfood contact surfaces (R² = 0.03) was not a good indicator for L. monocytogenes presence in food products. In general, prevalence of Listeria spp. does not seem to be a good indicator for L. monocytogenes prevalence in seafood processing plants.

  14. Expression of enzymatically inactive wasp venom phospholipase A1 in Pichia pastoris.

    Directory of Open Access Journals (Sweden)

    Irina Borodina

    Full Text Available Wasp venom allergy is the most common insect venom allergy in Europe. It is manifested by large local reaction or anaphylactic shock occurring after a wasp sting. The allergy can be treated by specific immunotherapy with whole venom extracts. Wasp venom is difficult and costly to obtain and is a subject to composition variation, therefore it can be advantageous to substitute it with a cocktail of recombinant allergens. One of the major venom allergens is phospholipase A1, which so far has been expressed in Escherichia coli and in insect cells. Our aim was to produce the protein in secreted form in yeast Pichia pastoris, which can give high yields of correctly folded protein on defined minimal medium and secretes relatively few native proteins simplifying purification.Residual amounts of enzymatically active phospholipase A1 could be expressed, but the venom protein had a deleterious effect on growth of the yeast cells. To overcome the problem we introduced three different point mutations at the critical points of the active site, where serine137, aspartate165 or histidine229 were replaced by alanine (S137A, D165A and H229A. All the three mutated forms could be expressed in P. pastoris. The H229A mutant did not have any detectable phospholipase A1 activity and was secreted at the level of several mg/L in shake flask culture. The protein was purified by nickel-affinity chromatography and its identity was confirmed by MALDI-TOF mass spectrometry. The protein could bind IgE antibodies from wasp venom allergic patients and could inhibit the binding of wasp venom to IgE antibodies specific for phospholipase A1 as shown by Enzyme Allergo-Sorbent Test (EAST. Moreover, the recombinant protein was allergenic in a biological assay as demonstrated by its capability to induce histamine release of wasp venom-sensitive basophils.The recombinant phospholipase A1 presents a good candidate for wasp venom immunotherapy.

  15. Exosomes account for vesicle-mediated transcellular transport of activatable phospholipases and prostaglandins[S (United States)

    Subra, Caroline; Grand, David; Laulagnier, Karine; Stella, Alexandre; Lambeau, Gérard; Paillasse, Michael; De Medina, Philippe; Monsarrat, Bernard; Perret, Bertrand; Silvente-Poirot, Sandrine; Poirot, Marc; Record, Michel


    Exosomes are bioactive vesicles released from multivesicular bodies (MVB) by intact cells and participate in intercellular signaling. We investigated the presence of lipid-related proteins and bioactive lipids in RBL-2H3 exosomes. Besides a phospholipid scramblase and a fatty acid binding protein, the exosomes contained the whole set of phospholipases (A2, C, and D) together with interacting proteins such as aldolase A and Hsp 70. They also contained the phospholipase D (PLD) / phosphatidate phosphatase 1 (PAP1) pathway leading to the formation of diglycerides. RBL-2H3 exosomes also carried members of the three phospholipase A2 classes: the calcium-dependent cPLA2-IVA, the calcium-independent iPLA2-VIA, and the secreted sPLA2-IIA and V. Remarkably, almost all members of the Ras GTPase superfamily were present, and incubation of exosomes with GTPγS triggered activation of phospholipase A2 (PLA2)and PLD2. A large panel of free fatty acids, including arachidonic acid (AA) and derivatives such as prostaglandin E2 (PGE2) and 15-deoxy-Δ12,14-prostaglandinJ2 (15-d PGJ2), were detected. We observed that the exosomes were internalized by resting and activated RBL cells and that they accumulated in an endosomal compartment. Endosomal concentrations were in the micromolar range for prostaglandins; i.e., concentrations able to trigger prostaglandin-dependent biological responses. Therefore exosomes are carriers of GTP-activatable phospholipases and lipid mediators from cell to cell. PMID:20424270

  16. Prevalence and contamination patterns of Listeria monocytogenes in catfish processing environment and fresh fillets. (United States)

    Chen, Bang-Yuan; Pyla, Rajkumar; Kim, Tae-Jo; Silva, Juan L; Jung, Yean-Sung


    Catfish skins, intestines, fresh fillets, processing surfaces at different production stages, chiller water and non-food contact surfaces were sampled for Listeria monocytogenes and other Listeria species. Among 315 samples, prevalence of L. monocytogenes, Listeria innocua and a group of Listeria seeligeri-Listeria welshimeri-Listeria ivanovii was 21.6, 13.0 and 29.5%, respectively. No Listeria grayi was detected in this survey. While no L. monocytogenes strains were isolated from catfish skins and intestines, the strains were found with a frequency of 76.7% in chilled fresh catfish fillets and 43.3% in unchilled fillets. L. monocytogenes and Listeria spp. were also detected in fish contact surfaces such as deheading machine, trimming board, chiller water, conveyor belts at different stages, and fillet weighing table. Among L. monocytogenes, 1/2b (47.0%), 3b (16.0%) and 4c (14%) were the predominant serotypes isolated, whereas 4b, 4e, 1/2c and 1/2a were detected at much lower frequencies. Genotype analyses of L. monocytogenes isolates using serotyping, pulsed-field gel electrophoresis (PFGE) and enterobacterial repetitive intergenic consensus (ERIC)-PCR revealed that chiller water represented an important contamination source of L. monocytogenes in the chilled catfish fillets of two processing facilities, whereas fillet weighing table significantly contributed to the catfish fillet contamination of the third facility. This study suggests that L. monocytogenes contamination in the processed catfish fillets originates from the processing environment, rather than directly from catfish. Results from this study can aid the catfish industry to develop a plant-specific proper cleaning and sanitation procedure for equipment and the processing environment designed to specifically target L. monocytogenes contamination. Copyright 2010 Elsevier Ltd. All rights reserved.

  17. Morphological Change and Decreasing Transfer Rate of Biofilm-Featured Listeria monocytogenes EGDe. (United States)

    Lee, Yuejia; Wang, Chinling


    Listeria monocytogenes , a lethal foodborne pathogen, has the ability to resist the hostile food processing environment and thus frequently contaminates ready-to-eat foods during processing. It is commonly accepted that the tendency of L. monocytogenes ' to generate biofilms on various surfaces enhances its resistance to the harshness of the food processing environment. However, the role of biofilm formation in the transferability of L. monocytogenes EGDe remains controversial. We examined the growth of Listeria biofilms on stainless steel surfaces and their effect on the transferability of L. monocytogenes EGDe. The experiments were a factorial 2 × 2 design with at least three biological replicates. Through scanning electron microscopy, a mature biofilm with intensive aggregates of cells was observed on the surface of stainless steel after 3 or 5 days of incubation, depending on the initial level of inoculation. During biofilm development, L. monocytogenes EGDe carried out binary fission vigorously before a mature biofilm was formed and subsequently changed its cellular morphology from rod shaped to sphere shaped. Furthermore, static biofilm, which was formed after 3 days of incubation at 25°C, significantly inhibited the transfer rate of L. monocytogenes EGDe from stainless steel blades to 15 bologna slices. During 7 days of storage at 4°C, however, bacterial growth rate was not significantly impacted by whether bacteria were transferred from biofilm and the initial concentrations of transferred bacteria on the slice. In conclusion, this study is the first to report a distinct change in morphology of L. monocytogenes EGDe at the late stage of biofilm formation. More importantly, once food is contaminated by L. monocytogenes EGDe, contamination proceeds independently of biofilm development and the initial level of contamination when food is stored at 4°C, even if contamination with L. monocytogenes EGDe was initially undetectable before storage.

  18. Listeria monocytogenes contamination in dairy plants: evaluation of Listeria monocytogenes environmental contamination in two cheese-making plants using sheeps milk

    Directory of Open Access Journals (Sweden)

    Michela Ibba


    Full Text Available Listeria monocytogenes harbouring niches established in the processing plant support post-process contamination of dairy products made from pasteurised or thermised milk. The present study investigated L. monocytogenes environmental contamination in two sheep’s milk cheese-making plants. Persistence of contamination in the area at higher risk was also investigated. During a one-year survey 7 samplings were carried out in each dairy plant, along the production lines of Pecorino Romano and ricotta salata cheese. A total of 613 environmental samples collected from food contact and non-food contact surfaces were analysed according to ISO 11290-1:2005 standard method. Identification of the isolated strains was carried out by polymerase chain reaction. L. monocytogenes prevalence was 23.2% in dairy A and 13.1% in dairy B, respectively. The higher prevalence rate was found in the following areas: salting, products washing, packaging, ricotta salata storage and Pecorino Romano ripening rooms. L. monocytogenes was never found in the cheese-making area. The probability of observing samples positive for the presence of L. monocytogenes was asso- ciated with dairy plant, sampling area and the period of cheese-making (P<0.001. The greater persistence of contamination over time was observed in the washing, salting, and Pecorino Romano ripening areas. The control of persistent environmental contamination relies on the identification of L. monocytogenes niches within the processing environment and the prevention of harborage sites formation. The importance of strict cleaning and sanitising procedure in controlling L. monocytogenes environmental contamination is confirmed by the lower level of contamination observed after these procedures were correctly implemented.

  19. Prevalence and quantification of Listeria monocytogenes in chicken offal at the retail level in Malaysia. (United States)

    Kuan, C H; Goh, S G; Loo, Y Y; Chang, W S; Lye, Y L; Puspanadan, S; Tang, J Y H; Nakaguchi, Y; Nishibuchi, M; Mahyudin, N A; Radu, S


    A total of 216 chicken offal samples (chicken liver = 72; chicken heart = 72; chicken gizzard = 72) from wet markets and hypermarkets in Selangor, Malaysia, were examined for the presence and density of Listeria monocytogenes by using a combination of the most probable number and PCR method. The prevalence of L. monocytogenes in 216 chicken offal samples examined was 26.39%, and among the positive samples, the chicken gizzard showed the highest percentage at 33.33% compared with chicken liver (25.00%) and chicken heart (20.83%). The microbial load of L. monocytogenes in chicken offal samples ranged from Malaysia.

  20. Flagellar motility is critical for Listeria monocytogenes biofilm formation. (United States)

    Lemon, Katherine P; Higgins, Darren E; Kolter, Roberto


    The food-borne pathogen Listeria monocytogenes attaches to environmental surfaces and forms biofilms that can be a source of food contamination, yet little is known about the molecular mechanisms of its biofilm development. We observed that nonmotile mutants were defective in biofilm formation. To investigate how flagella might function during biofilm formation, we compared the wild type with flagellum-minus and paralyzed-flagellum mutants. Both nonmotile mutants were defective in biofilm development, presumably at an early stage, as they were also defective in attachment to glass during the first few hours of surface exposure. This attachment defect could be significantly overcome by providing exogenous movement toward the surface via centrifugation. However, this centrifugation did not restore mature biofilm formation. Our results indicate that it is flagellum-mediated motility that is critical for both initial surface attachment and subsequent biofilm formation. Also, any role for L. monocytogenes flagella as adhesins on abiotic surfaces appears to be either minimal or motility dependent under the conditions we examined.

  1. Enterocin CRL35 inhibits Listeria monocytogenes in a murine model. (United States)

    Salvucci, Emiliano; Saavedra, Lucila; Hebert, Elvira Maria; Haro, Cecilia; Sesma, Fernando


    Listeria monocytogenes is a foodborne pathogen causative of opportunistic infections. Listeriosis is associated with severe infections in pregnant women causing abortion or neonatal listeriosis. An alternative to antibiotics are safe novel bacteriocins peptides such as enterocin CRL35 with strong antilisterial activity produced by Enterococcus mundtii CRL35. In the present paper, our goal is to study the effectiveness of this peptide and the producer strain in a murine model of pregnancy-associated listeriosis. A single dose of 5×10(9) colony-forming unit of L. monocytogenes FBUNT (Faculty of Biochemistry-University of Tucumán) resulted in translocation of pathogen to liver and spleen of BALB/c pregnant mice. The maximum level of Listeria was observed on day 3 postinfection. Interestingly, the intragastric administration of enterocin CRL35 significantly reduced the translocation of the pathogen to vital organs. On the other hand, the preadministration of E. mundtii CRL35 slightly inhibited this translocation. Listeria infection caused a significant increase in polymorphonuclear leukocytes at day 3 postinfection compared to the noninfected group. This value was reduced after the administration of enterocin CRL35. No significant changes were observed in either white blood cells or lymphocytes counts. Based on the data presented in the present work enterocin CRL35 would be a promising alternative for the prevention of Listeria infections.


    Directory of Open Access Journals (Sweden)

    T. K. CABEÇA


    Full Text Available

    The purpose of this study was to assess the action of various disinfectants used in food industry against biofilm cells of Listeria monocytogenes formed on stainless steel surfaces during 24, 72 and 120 hours. Numbers of viable biofilm cells decreased after treatment with all the tested disinfectants (iodine, biguanide, quaternary ammonium compounds, peracetic acid and sodium hypochlorite. Sodium hypochlorite was the most effective disinfectant against the biofilm cells, while biguanide and iodine were the least. Scanning electron microscopy observations demonstrated attached cells on stainless steel surfaces after treatment with all the disinfectants. These observations showed that microorganisms were not completely removed from stainless steel surfaces after treatment with the disinfectants, however, the attachment did not means the viability of remaining cells. The biofilm age in hours (24, 72 and 120 had no apparent influence on resistance of microbiological cells to the disinfectants under study. In conclusion biofilm cells of L. monocytogenes can withstand disinfectants action.

  3. Identification of Listeria monocytogenes on Green Mussels and Cockle Shell

    Directory of Open Access Journals (Sweden)

    Winiati Puji Rahayu


    Full Text Available AbstractGreen mussel (Perna viridis and cockle shell (Anadara granosa are one of many sources of animal protein which is many cultivated in Indonesia because their price is relatively affordable. This study was conducted to identify the presence of Listeria monocytogenes in 27 samples of green mussels and 3 samples of cockle shells using real-time Polymerase Chain Reaction (real-time PCR and biochemical methods. The target gene for amplification in real-time PCR was an hlyA gene because this gene was a determinant of virulence genes that produce listeriolysin O. Primers used in this study were forward primer DG69 (GTG CCG GGT AAA AGA CCA TA and reverse primer DG74 (CGC CAC TGA GAT ACT AT and fluorescence signals indicator using SYBR Green I. The results of analysis using real-time PCR were negative Listeria monocytogenes in all samples, while using biochemical methods there was one of 30 samples contaminated by Listeria welshimeri.

  4. Viable but non-culturable Listeria monocytogenes on parsley leaves and absence of recovery to a culturable state. (United States)

    Dreux, N; Albagnac, C; Federighi, M; Carlin, F; Morris, C E; Nguyen-the, C


    To investigate the presence of viable but non-culturable Listeria monocytogenes during survival on parsley leaves under low relative humidity (RH) and to evaluate the ability of L. monocytogenes to recover from VBNC to culturable state under satured humidity. Under low RH (47-69%) on parsley leaves, the initial number of L. monocytogenes populations counted on non selective media (10(9) L. monocytogenes per leaf on TSA) was reduced by 6 log10 scales in 15 days, whereas number of viable L. monocytogenes counted under the microscope was reduced by 3-4 log10 scales, indicating the presence of VBNC cells. This was demonstrated on three L. monocytogenes strains (EGDe, Bug 1995 and LmP60). Changing from low to 100% RH permitted an increase of the culturable counts of L. monocytogenes and this growth was observed only when residual culturable cells were present. Moreover, VBNC L. monocytogenes inoculated on parsley leaves did not become culturable after incubation under 100% RH. Dry conditions induced VBNC L. monocytogenes on parsley leaves but these VBNC were likely unable to recover culturability after transfer to satured humidity. Enumeration on culture media presumably under-estimates the number of viable L. monocytogenes on fresh produce after exposure to low RH.

  5. The Arabidopsis thaliana non-specific phospholipase C2 is involved in the response to Pseudomonas syringae attack

    Czech Academy of Sciences Publication Activity Database

    Krčková, Zuzana; Kocourková, Daniela; Daněk, Michal; Brouzdová, Jitka; Pejchar, Přemysl; Janda, Martin; Pokotylo, I.; Ott, P.G.; Valentová, O.; Martinec, Jan


    Roč. 121, č. 2 (2018), s. 297-310 ISSN 0305-7364 R&D Projects: GA ČR(CZ) GAP501/12/1942 Institutional support: RVO:61389030 Keywords : Arabidopsis thaliana * effector-triggered immunity * flagellin * MAMP-triggered immunity * non-specific phospholipase C * phosphatidylcholine-specific phospholipase C * Pseudomonas syringae * reactive oxygen species Subject RIV: ED - Physiology OBOR OECD: Plant sciences, botany Impact factor: 4.041, year: 2016

  6. Prevalence and quantification of Listeria monocytogenes in beef offal at retail level in Selangor, Malaysia (United States)

    Kuan, Chee Hao; Wong, Woan Chwen; Pui, Chai Fung; Mahyudin, Nor Ainy; Tang, John Yew Huat; Nishibuchi, Mitsuaki; Radu, Son


    A total of 63 beef offal samples (beef liver = 16; beef lung = 14; beef intestine = 9; beef tripe = 15; beef spleen = 9) from three wet markets (A, B, and C) in Selangor, Malaysia were examined for the prevalence and microbial load of Listeria monocytogenes. A combination of the most probable number and polymerase chain reaction (MPN-PCR) method was employed in this study. It was found that L. monocytogenes detected in 33.33% of the beef offal samples. The prevalence of L. monocytogenes in beef offal purchased from wet markets A, B, and C were 22.73%, 37.50% and 41.18% respectively. The density of L. monocytogenes in all the samples ranged from 2,400 MPN/g. The findings in this study indicate that beef offal can be a potential vehicle of foodborne listeriosis. PMID:24688507

  7. Modeling the growth of Listeria monocytogenes in soft blue-white cheese

    DEFF Research Database (Denmark)

    Rosshaug, Per Sand; Detmer, Ann; Ingmer, Hanne


    The aim of this study was to develop a predictive model simulating growth over time of the pathogenic bacterium Listeria monocytogenes in a soft blue-white cheese. The physicochemical properties in a matrix such as cheese are essential controlling factors influencing the growth of L. monocytogenes....... We developed a predictive tertiary model of the bacterial growth of L. monocytogenes as a function of temperature, pH, NaCl, and lactic acid. We measured the variations over time of the physicochemical properties in the cheese. Our predictive model was developed based on broth data produced...... production and retail conditions showed that the number of L. monocytogenes cells increases 3 to 3.5 log within the shelf life of the cheese....

  8. Prevalence and quantification of Listeria monocytogenes in beef offal at retail level in Selangor, Malaysia. (United States)

    Kuan, Chee Hao; Wong, Woan Chwen; Pui, Chai Fung; Mahyudin, Nor Ainy; Tang, John Yew Huat; Nishibuchi, Mitsuaki; Radu, Son


    A total of 63 beef offal samples (beef liver = 16; beef lung = 14; beef intestine = 9; beef tripe = 15; beef spleen = 9) from three wet markets (A, B, and C) in Selangor, Malaysia were examined for the prevalence and microbial load of Listeria monocytogenes. A combination of the most probable number and polymerase chain reaction (MPN-PCR) method was employed in this study. It was found that L. monocytogenes detected in 33.33% of the beef offal samples. The prevalence of L. monocytogenes in beef offal purchased from wet markets A, B, and C were 22.73%, 37.50% and 41.18% respectively. The density of L. monocytogenes in all the samples ranged from 2,400 MPN/g. The findings in this study indicate that beef offal can be a potential vehicle of foodborne listeriosis.

  9. Prevalence and quantification of Listeria monocytogenes in beef offal at retail level in Selangor, Malaysia

    Directory of Open Access Journals (Sweden)

    Chee Hao Kuan


    Full Text Available A total of 63 beef offal samples (beef liver = 16; beef lung = 14; beef intestine = 9; beef tripe = 15; beef spleen = 9 from three wet markets (A, B, and C in Selangor, Malaysia were examined for the prevalence and microbial load of Listeria monocytogenes. A combination of the most probable number and polymerase chain reaction (MPN-PCR method was employed in this study. It was found that L. monocytogenes detected in 33.33% of the beef offal samples. The prevalence of L. monocytogenes in beef offal purchased from wet markets A, B, and C were 22.73%, 37.50% and 41.18% respectively. The density of L. monocytogenes in all the samples ranged from 2,400 MPN/g. The findings in this study indicate that beef offal can be a potential vehicle of foodborne listeriosis.


    Directory of Open Access Journals (Sweden)

    Imad al Kassaa


    Full Text Available Al Kassaa Imad, Khaled el Omari, Marwa Saati, Bachar Ismail and Monzer Hamze. 2016. Prevalence of Listeria monocytogenes in raw cow milk in north Lebanon. Lebanese Science Journal, 17(1: 39-45. Listeriosis, although a zoonosis, is an invasive disease that can affect newborns, pregnant women and immunocompromised adults. Clinical manifestations can be expressed by febrile gastroenteritis, invasive forms including severe sepsis, meningitis, rhombencephalitis, prenatal infections and abortions. Species of Listeria bacteria are ubiquitous and adaptable to the environment in animal and plant foods. This study aimed to determine the prevalence of Listeria monocytogenes in 100 samples of fresh cow milk collected from different areas of North Lebanon. Listeria monocytogenes was detected by using the Grand VIDAS technique (Biomérieux France. The results obtained revealed the absence of Listeria monocytogenes in all analyzed samples.

  11. Genotypic profile of Listeria monocytogenes isolated in refrigerated chickens in southern Rio Grande do Sul, Brazil

    Directory of Open Access Journals (Sweden)

    Karla Sequeira Mendonça


    Full Text Available ABSTRACT: Listeria monocytogenes is of notable concern to the food industry, due to its ubiquitous nature and ability to grow in adverse conditions. This study aimed to determine the genotypic profile of L. monocytogenes strains isolated from refrigerated chickens marketed in the southern part of Rio Grande do Sul, Brazil. The strains of L. monocytogenes isolated were characterized by serotyping and Pulsed Field Gel Electrophoresis (PFGE. Three different serotypes (1/2a, 1/2b and 4e were evaluated by PFGE, and the macrorestriction patterns utilizing enzymes AscI and ApaI, revealed five different pulsotypes. The presence of such varied genotypic profiles demonstrates the prevalence of L. monocytogenes contamination of chicken processing environments, which combined with ineffective cleaning procedures, allowing the survival, adaptation and proliferation of these pathogens, not only in the processing environment, but also in local grocery stores.

  12. Prevalence and contamination levels of listeria monocytogenes in ready-to-eat foods in Tokyo, Japan. (United States)

    Shimojima, Yukako; Ida, Miki; Nakama, Akiko; Nishino, Yukari; Fukui, Rie; Kuroda, Sumiyo; Hirai, Akihiko; Kai, Akemi; Sadamasu, Kenji


    We surveyed prevalence and contamination levels of Listeria monocytogenes in ready-to-eat foods between 2000 and 2012 in Tokyo. L. monocytogenes was isolated from 52 (1.7%) out of 2,980 samples. Comparing the prevalence in the study period, 2.2% were positive in the former period (2000-2005) and 1.2% in the latter (2006-2012). Using the most probable number (MPN) technique, 32 samples were contaminated with fewer than 0.3 L. monocytogenes/g, 10 samples with 0.3-1.0/g and 4 samples with more than 1.0/g (the maximum was 2.3/g). The most common serovar was 1/2a, followed by 1/2b, 4b and 1/2c. We revealed that ready-to-eat foods in Tokyo were contaminated with L. monocytogenes, although the contamination levels were low.


    The detection of the human foodborne pathogen, Listeria monocytogenes, in food, environmental samples and clinical specimens associated with cases of listeriosis, a rare but high mortality-rate disease, requires distinguishing the pathogen from other Listeria species. Speciation...

  14. Listeriolysin S: A bacteriocin from epidemic Listeria monocytogenes strains that targets the gut microbiota. (United States)

    Quereda, Juan J; Meza-Torres, Jazmín; Cossart, Pascale; Pizarro-Cerdá, Javier


    Listeria monocytogenes is a Gram-positive food-borne pathogen that in humans may traverse the intestinal, placental and blood/brain barriers, causing gastroenteritis, abortions and meningitis. Crossing of these barriers is dependent on the bacterial ability to enter host cells, and several L. monocytogenes surface and secreted virulence factors are known to facilitate entry and the intracellular lifecycle. The study of L. monocytogenes strains associated to human listeriosis epidemics has revealed the presence of novel virulence factors. One such factor is Listeriolysin S, a thiazole/oxazole modified microcin that displays bactericidal activity and modifies the host microbiota during infection. Our recent results therefore highlight the interaction of L. monocytogenes with gut microbes as a crucial step in epidemic listeriosis. In this article, we will discuss novel implications for this family of toxins in the pathogenesis of diverse medically relevant microorganisms.

  15. Inhibitory effect of liposome-entrapped lemongrass oil on the growth of Listeria monocytogenes in cheese. (United States)

    Cui, H Y; Wu, J; Lin, L


    Listeria monocytogenes infection in dairy products is of mounting public concern. To inhibit bacterial growth, we engineered stimuli-responsive liposomes containing lemongrass oil for this study. The controlled release of liposome-entrapped lemongrass oil is triggered by listerolysin O, secreted by L. monocytogenes. We investigated the antibiotic activities of lemongrass oil liposomes against L. monocytogenes in cheese. We also assessed their possible effects on the quality of the cheese. Liposomes containing lemongrass oil (5.0mg/mL) presented the optimal polydispersity index (0.246), zeta-potential (-58.9mV) and entrapment efficiency (25.7%). The liposomes displayed satisfactory antibiotic activity against L. monocytogenes in cheese over the storage period at 4°C. We observed no effects on the physical and sensory properties of the cheese after the liposome treatment. Copyright © 2016 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  16. Evaluation of a monoclonal antibody able to detect live Listeria monocytogenes and Listeria innocua

    DEFF Research Database (Denmark)

    Sølve, Marianne; Boel, Jeppe; Nørrung, Birgit


    A monoclonal Listeria antibody, designated B4, was evaluated. The ability of the antibody to bind to viable bacteria belonging to Listeria spp, compared to bacteria of the same species killed by beat treatment, acid or base treatment, sanitizers, and irradiation was examined. The antibody was found...... to react with viable L. monocytogenes and L. innocua, but not with heat-killed (72 degrees C, 5 min) strains of these organisms. When L. monocytogenes and L. innocua were killed by methods other than heat treatment, it was ambiguous whether the antibody detected the organism or not. It was concluded...... that the B4 antibody has potential to be used in an immune capture step to capture live L, monocytogenes and L. innocua from foods prior to identification of L. monocytogenes by polymerase chain reaction (PCR)....

  17. Internalization of Listeria monocytogenes in cantaloupes during dump tank washing and hydrocooling (United States)

    Recent listeriosis outbreaks and recalls associated with cantaloupes urge for studies to understand the mechanisms of cantaloupe contamination by Listeria monocytogenes. Postharvest practices such as washing and hydrocooling were suggested to facilitate the contamination of fresh fruits by human pat...

  18. Characterization of antigen association with accessory cells: specific removal of processed antigens from the cell surface by phospholipases

    International Nuclear Information System (INIS)

    Falo, L.D. Jr.; Haber, S.I.; Herrmann, S.; Benacerraf, B.; Rock, K.L.


    To characterize the basis for the cell surface association of processed antigen with the antigen-presenting cell (APC) the authors analyzed its sensitivity to enzymatic digestion. Antigen-exposed APC that are treated with phospholipase and then immediately fixed lose their ability to stimulate antigen-plus-Ia-specific T-T hybridomas. This effect is seen with highly purified phospholipase A 2 and phospholipase C. In addition it is observed with three distinct antigens - ovalbumin, bovine insulin, and poly(LGlu 56 LLys 35 LPhe 9 )[(GluLysPhe)/sub n/]. The effect of phospholipases is highly specific. Identically treated APC are equivalent to control in their ability to stimulate alloreactive hybridomas specific for precisely the same Ia molecule that is corecognized by antigen-plus-Ia-specific hybrids. Furthermore, the antigen-presenting function of enzyme-treated, fixed APC can be reconstituted by the addition of exogenous in vitro processed or processing independent antigens. In parallel studies 125 I-labeled avidin was shown to specifically bind to APC that were previously exposed and allowed to process biotin-insulin. Biotin-insulin-exposed APC that are pretreated with phospholipase bind significantly less 125 I-labeled avidin than do untreated, exposed APC. Identical enzyme treatment does not reduce the binding of avidin to a biotinylated antibody already bound to class II major histocompatibility complex molecules of APC. These studies demonstrate that phospholipase effectively removes processed cell surface antigen

  19. Efficacy of ultraviolet light exposure against survival of Listeria monocytogenes on conveyor belts. (United States)

    Morey, Amit; McKee, Shelly R; Dickson, James S; Singh, Manpreet


    Listeria monocytogenes has been repeatedly isolated from foods and food-processing facilities including food contact surfaces such as conveyor belts (CB). CBs are often difficult to clean and require rigorous sanitation programs for decontamination. Ultraviolet (UV) light has exhibited microbicidal properties on food contact surfaces and this study was conducted to determine the efficacy of UV against L. monocytogenes on CB made of different materials. A four-strain cocktail of L. monocytogenes (serotypes 3A, 4A, 4B, and 4C) was made to give a suspension of approximately 10(7) CFU/mL. CBs made from four different types of materials, (1) Ropanyl DM 8/2 A2 + 04 (belt 1), (2) Volta FRMW-3.0 (belt 2), (3) Volta FRMB-3.0 (belt 3), and (4) Ropanyl DM (belt 4), were inoculated with 1 mL of the four-strain cocktail (approximately 10(7) CFU/mL) of the bacterial suspension. CBs were treated with UV light (254 nm) for 1 and 3 sec at 5.53 and 5.95 mW/cm(2). Three replications of the experiments were conducted. Two-way analysis of variance of survival populations of L. monocytogenes showed that bacterial counts were significantly reduced (p belt types irrespective of UV light intensities and times of exposure. L. monocytogenes populations were reduced (p belts 1, 2, and 3 after exposure to 5.95 mW/cm(2) UV light intensity for 3 sec. L. monocytogenes-inoculated CBs that were exposed to 5.53 mW/cm(2) showed higher (p Belt 4 showed survival populations of L. monocytogenes ranging from 1.42 to 1.73 log(10) CFU/cm(2) after UV light treatment for 1 and 3 sec. UV light can be effectively used to reduce L. monocytogenes contamination on CBs.

  20. MicroRNA-146a Deficiency Protects against Listeria monocytogenes Infection by Modulating the Gut Microbiota

    Directory of Open Access Journals (Sweden)

    Chong-Tao Du


    Full Text Available The gut microbiota and microRNAs play important roles in the defense against infection. However, the role of miR-146a in L. monocytogenes infection and gut microbiota remains unclear. We tried to determine whether miR-146a controlled L. monocytogenes infection by regulating the gut microbiota. Wild-type and miR-146a-deficient mice or macrophages were used to characterize the impact of miR-146a on animal survival, cell death, bacterial clearance, and gut microbiota following L. monocytogenes challenge. We found that L. monocytogenes infection induced miR-146a expression both in vitro and in vivo. When compared to wild-type mice, miR-146a-deficient mice were more resistant to L. monocytogenes infection. MiR-146a deficiency in macrophages resulted in reduced invasion and intracellular survival of L. monocytogenes. High-throughput sequencing of 16S rRNA revealed that the gut microbiota composition differed between miR-146a-deficient and wild-type mice. Relative to wild-type mice, miR-146a-deficient mice had decreased levels of the Proteobacteria phylum, Prevotellaceae family, and Parasutterella genus, and significantly increased short-chain fatty acid producing bacteria, including the genera Alistipes, Blautia, Coprococcus_1, and Ruminococcus_1. Wild-type mice co-housed with miR-146a-deficient mice had increased resistance to L. monocytogenes, indicating that miR-146a deficiency guides the gut microbiota to alleviate infection. Together, these results suggest that miR-146a deficiency protects against L. monocytogenes infection by regulating the gut microbiota.

  1. Modeling and predicting the growth boundary of Listeria monocytogenes in lightly preserved seafood

    DEFF Research Database (Denmark)

    Mejlholm, Ole; Dalgaard, Paw


    The antimicrobial effect of diacetate and lactate against Listeria monocytogenes was evaluated in challenge tests with vacuum-packaged or modified atmosphere packaged (MAP) cold-smoked salmon, marinated salmon, cold-smoked Greenland halibut, marinated Greenland halibut, and gravad salmon. MAP col...... characteristics required to prevent the growth of L. monocytogenes, thereby making it possible to identify critical control points, and is useful for compliance with the new European Union regulation on ready-to-eat foods (EC 2073/2005)....

  2. An insight into the isolation, enumeration and molecular detection of Listeria monocytogenes in food

    Directory of Open Access Journals (Sweden)

    Jodi Woan-Fei Law


    Full Text Available Listeria monocytogenes, a foodborne pathogen that can cause listeriosis through the consumption of food contaminated with this pathogen. The ability of L. monocytogenes to survive in extreme conditions and cause food contaminations have become a major concern. Hence, routine microbiological food testing is necessary to prevent food contamination and outbreaks of foodborne illness. This review provides insight into the methods for cultural detection, enumeration and molecular identification of L. monocytogenes in various food samples. There are a number of enrichment and plating media that can be used for the isolation of L. monocytogenes from food samples. Enrichment media such as buffered Listeria Enrichment Broth (BLEB, Fraser broth and University of Vermont Medium (UVM Listeria enrichment broth are recommended by regulatory agencies such as FDA-BAM, USDA-FSIS and ISO. Many plating media are available for the isolation of L. monocytogenes, for instance, PALCAM, Oxford and other chromogenic media. Besides, reference methods like FDA-BAM, ISO 11290 method and USDA-FSIS method are usually applied for the cultural detection or enumeration of L. monocytogenes. MPN technique is applied for the enumeration of L. monocytogenes in the case of low level contamination. Molecular methods including polymerase chain reaction (PCR, multiplex polymerase chain reaction (mPCR, real-time/quantitative polymerase chain reaction (qPCR, nucleic acid sequence-based amplification (NASBA, loop-mediated isothermal amplification (LAMP, DNA microarray and Next Generation Sequencing (NGS technology for the detection and identification of L. monocytogenes are discussed in this review. Overall, molecular methods are rapid, sensitive, specific, time- and labour-saving. In future, there are chances for the development of new techniques for the detection and identification of foodborne with improved features.

  3. Incidence of Listeria monocytogenes and Listeria spp. in a small-scale mushroom production facility. (United States)

    Viswanath, Prema; Murugesan, Latha; Knabel, Stephen J; Verghese, Bindhu; Chikthimmah, Naveen; Laborde, Luke F


    Listeria monocytogenes is a foodborne pathogen of significant concern to the agricultural and food processing industry because of its ability to grow and persist in cool and moist environments and its association with listeriosis, a disease with a very high mortality rate. Although there have been no listeriosis outbreaks attributed to fresh mushrooms in the United States, retail surveys and recalls are evidence that L. monocytogenes contamination of mushrooms (Agaricus bisporus) can occur. The objective of this study was to determine the prevalence of Listeria spp., including L. monocytogenes, in a small-scale mushroom production facility on the campus of the Pennsylvania State University in the United States. Of 184 samples taken from five production zones within the facility, 29 (15.8%) samples were positive for Listeria spp. Among the Listeria spp. isolates, L. innocua was most prevalent (10.3%) followed by L. welshimeri (3.3%), L. monocytogenes (1.6%), and L. grayi (0.5%). L. monocytogenes was recovered only from the phase I raw material composting area. Isolates of L. monocytogenes were confirmed and serotyped by multiplex PCR. The epidemiological relatedness of the three L. monocytogenes isolates to those serotypes or lineages frequently encountered in listeriosis infections was determined by multi-virulence-locus sequence typing using six virulence genes, namely, prfA, inlB, inlC, dal, clpP, and lisR. The phylogenetic positions of the three isolates in the dendrogram prepared with data from other isolates of L. monocytogenes showed that all isolates were grouped with serotype 4a, lineage IIIA. To date, this serotype has rarely been reported in foodborne disease outbreaks.

  4. The influence of Listeria monocytogenes cells on the primary immunologic response in irradiated mice

    International Nuclear Information System (INIS)

    Borowski, J.; Jokoniuk, P.


    The influence of killed Listeria monocytogenes cells on the primary immunologic response in mice irradiated with 300 or 500 R was studied. The immunologic response of the mice to sheep red blood cells used as antigen was assessed at the cellular level (by counting PFC) and humoral level. Injection of killed Listeria monocytogenes cells before irradiation of the mice diminished the immunosuppressive effect of roentgen radiation. Injection of the cells after irradiation accelerated regeneration of immunologic reactivity in the irradiated mice. (author)

  5. Occurrence and antimicrobial resistance patterns of Listeria monocytogenes isolated from vegetables


    Byrne,Vanessa de Vasconcelos; Hofer,Ernesto; Vallim,Deyse Christina; Almeida,Rogeria Comastri de Castro


    Abstract Although the consumption of fresh and minimally processed vegetables is considered healthy, outbreaks related to the contamination of these products are frequently reported. Among the food-borne pathogens that contaminate vegetables is Listeria monocytogenes, a ubiquitous organism that exhibits the ability to survive and multiply at refrigerated temperatures. This study aimed to evaluate the occurrence of L. monocytogenes in vegetables as well as the antimicrobial resistance of isola...

  6. Phenotypic and Genotypic Characteristics of Listeria monocytogenes Isolated From Dairy and Meat Products


    Bahador; Sadeghi Kalani; Valian; Irajian; Lotfollahi


    Background Listeria monocytogenes is a foodborne pathogen and a serious threat to the public health in the world. Consumption of traditional foods such as dairy and meat products can be a major reason for relative abundance and isolation of these bacteria. Objectives The purpose of this study was to determine the phenotypic and genotypic characteristics of L. monocytogenes strains isolated from dairy and meat products. ...

  7. Dual-species biofilm of Listeria monocytogenes and Escherichia coli on stainless steel surface. (United States)

    de Grandi, Aline Zago; Pinto, Uelinton Manoel; Destro, Maria Teresa


    Listeria monocytogenes is a Gram-positive bacterium commonly associated with foodborne diseases. Due its ability to survive under adverse environmental conditions and to form biofilm, this bacterium is a major concern for the food industry, since it can compromise sanitation procedures and increase the risk of post-processing contamination. Little is known about the interaction between L. monocytogenes and Gram-negative bacteria on biofilm formation. Thus, in order to evaluate this interaction, Escherichia coli and L. monocytogenes were tested for their ability to form biofilms together or in monoculture. We also aimed to evaluate the ability of L. monocytogenes 1/2a and its isogenic mutant strain (ΔprfA ΔsigB) to form biofilm in the presence of E. coli. We assessed the importance of the virulence regulators, PrfA and σ B , in this process since they are involved in many aspects of L. monocytogenes pathogenicity. Biofilm formation was assessed using stainless steel AISI 304 #4 slides immersed into brain heart infusion broth, reconstituted powder milk and E. coli preconditioned medium at 25 °C. Our results indicated that a higher amount of biofilm was formed by the wild type strain of L. monocytogenes than by its isogenic mutant, indicating that prfA and sigB are important for biofilm development, especially maturation under our experimental conditions. The presence of E. coli or its metabolites in preconditioned medium did not influence biofilm formation by L. monocytogenes. Our results confirm the possibility of concomitant biofilm formation by L. monocytogenes and E. coli, two bacteria of major significance in the food industry.

  8. MicroRNA-146a Deficiency Protects against Listeria monocytogenes Infection by Modulating the Gut Microbiota. (United States)

    Du, Chong-Tao; Gao, Wei; Ma, Ke; Yu, Shui-Xing; Li, Na; Yan, Shi-Qing; Zhou, Feng-Hua; Liu, Zhen-Zhen; Chen, Wei; Lei, Lian-Cheng; Yang, Yong-Jun; Han, Wen-Yu


    The gut microbiota and microRNAs play important roles in the defense against infection. However, the role of miR-146a in L. monocytogenes infection and gut microbiota remains unclear. We tried to determine whether miR-146a controlled L. monocytogenes infection by regulating the gut microbiota. Wild-type and miR-146a-deficient mice or macrophages were used to characterize the impact of miR-146a on animal survival, cell death, bacterial clearance, and gut microbiota following L. monocytogenes challenge. We found that L. monocytogenes infection induced miR-146a expression both in vitro and in vivo. When compared to wild-type mice, miR-146a-deficient mice were more resistant to L. monocytogenes infection. MiR-146a deficiency in macrophages resulted in reduced invasion and intracellular survival of L. monocytogenes . High-throughput sequencing of 16S rRNA revealed that the gut microbiota composition differed between miR-146a-deficient and wild-type mice. Relative to wild-type mice, miR-146a-deficient mice had decreased levels of the Proteobacteria phylum, Prevotellaceae family, and Parasutterella genus, and significantly increased short-chain fatty acid producing bacteria, including the genera Alistipes , Blautia , Coprococcus_1, and Ruminococcus_1 . Wild-type mice co-housed with miR-146a-deficient mice had increased resistance to L. monocytogenes , indicating that miR-146a deficiency guides the gut microbiota to alleviate infection. Together, these results suggest that miR-146a deficiency protects against L. monocytogenes infection by regulating the gut microbiota.

  9. Control of Listeria monocytogenes in turkey deli loaves using organic acids as formulation ingredients. (United States)

    Lloyd, T; Alvarado, C Z; Brashears, M M; Thompson, L D; McKee, S R; Berrang, M


    The growth of Listeria monocytogenes in further-processed meat products has become a major concern and an important food safety issue. The meat and poultry industries have incorporated interventions such as organic acids in marinades to inhibit the growth of L. monocytogenes. In this study, organic acids were utilized in the raw product and as a postcook dip to determine their inhibitory effect on the growth of L. monocytogenes in turkey deli loaves. The turkey deli loaves were processed, cooked, cooled, inoculated with streptomycin-resistant L. monocytogenes, and then dipped. Treatments were potassium lactate (PL) in the raw product with sodium lactate (SL), sodium diacetate (SD) dip, PL with SL/PL/SD dip, SL with SL/SD dip, and SL with SL/PL/SD dip. There was also a positive (inoculated) and negative (noninoculated) control, which was dipped in distilled water. Days 0, 7, 14, 21, 28, 42, and 56 were sampled for L. monocytogenes. There were no differences (P>0.05) among the organic acid treatments in the turkey deli loaves at any time points; therefore, all of the treatments increased the lag phase of L. monocytogenes, extending the shelf-life of the product. However, there was a difference between the treatments and the positive control at d 7, 14, 21, 28, 42, and 56. The growth of L. monocytogenes increased immediately in the positive control, whereas the negative control appeared to have no growth. These organic acids can provide meat processors with a useful method for extending the lag phase of L. monocytogenes in ready-to-eat meat and poultry products.

  10. Distribution of the bacteria Listeria monocytogenes in the western part of the Sea of Okhotsk (United States)

    Terekhova, V. E.; Sosnin, V. A.; Buzoleva, L. S.; Shakirov, R. B.


    The Amur River’s influence on the distribution of the opportunistic bacteria Listeria monocytogenes in the western part of the Sea of Okhotsk is discussed. The presence of Listeria in the seawater, sea ice, and sediments on the northeastern Sakhalin shelf and slope supports the idea of its connection with the Amur River discharge. The hypothesis of the allochtonic parentage of L. monocytogenes in the sea’s development is proved.

  11. Longitudinal monitoring of Listeria monocytogenes and Listeria phages in seafood processing environments in Thailand. (United States)

    Vongkamjan, Kitiya; Benjakul, Soottawat; Kim Vu, Hue Thi; Vuddhakul, Varaporn


    Listeria monocytogenes is a foodborne pathogen commonly found in environments of seafood processing, thus presenting a challenge for eradication from seafood processing facilities. Monitoring the prevalence and subtype diversity of L. monocytogenes together with phages that are specific to Listeria spp. ("Listeria phages") will provide knowledge on the bacteria-phage ecology in food processing plants. In this work, a total of 595 samples were collected from raw material, finished seafood products and environmental samples from different sites of a seafood processing plant during 17 sampling visits in 1.5 years of study. L. monocytogenes and Listeria spp. (non-monocytogenes) were found in 22 (3.7%) and 43 (7.2%) samples, respectively, whereas 29 Listeria phages were isolated from 9 (1.5%) phage-positive samples. DNA fingerprint analysis of L. monocytogenes isolates revealed 11 Random Amplified Polymorphic DNA (RAPD) profiles, with two subtypes were frequently observed over time. Our data reveal a presence of Listeria phages within the same seafood processing environments where a diverse set of L. monocytogenes subtypes was also found. Although serotype 4b was observed at lower frequency, data indicate that isolates from this seafood processing plant belonged to both epidemiologically important serotypes 1/2a and 4b, which may suggest a potential public health risk. Phages (all showed a unique genome size of 65 ± 2 kb) were classified into 9 host range groups, representing both broad- and narrow-host range. While most L. monocytogenes isolates from this facility were susceptible to phages, five isolates showed resistance to 12-20 phages. Variations in phage host range among Listeria phages isolated from food processing plant may affect a presence of a diverse set of L. monocytogenes isolates derived from the same processing environment in Thailand. Copyright © 2017 Elsevier Ltd. All rights reserved.

  12. An insight into the isolation, enumeration, and molecular detection of Listeria monocytogenes in food (United States)

    Law, Jodi Woan-Fei; Ab Mutalib, Nurul-Syakima; Chan, Kok-Gan; Lee, Learn-Han


    Listeria monocytogenes, a foodborne pathogen that can cause listeriosis through the consumption of food contaminated with this pathogen. The ability of L. monocytogenes to survive in extreme conditions and cause food contaminations have become a major concern. Hence, routine microbiological food testing is necessary to prevent food contamination and outbreaks of foodborne illness. This review provides insight into the methods for cultural detection, enumeration, and molecular identification of L. monocytogenes in various food samples. There are a number of enrichment and plating media that can be used for the isolation of L. monocytogenes from food samples. Enrichment media such as buffered Listeria enrichment broth, Fraser broth, and University of Vermont Medium (UVM) Listeria enrichment broth are recommended by regulatory agencies such as Food and Drug Administration-bacteriological and analytical method (FDA-BAM), US Department of Agriculture-Food and Safety (USDA-FSIS), and International Organization for Standardization (ISO). Many plating media are available for the isolation of L. monocytogenes, for instance, polymyxin acriflavin lithium-chloride ceftazidime aesculin mannitol, Oxford, and other chromogenic media. Besides, reference methods like FDA-BAM, ISO 11290 method, and USDA-FSIS method are usually applied for the cultural detection or enumeration of L. monocytogenes. most probable number technique is applied for the enumeration of L. monocytogenes in the case of low level contamination. Molecular methods including polymerase chain reaction, multiplex polymerase chain reaction, real-time/quantitative polymerase chain reaction, nucleic acid sequence-based amplification, loop-mediated isothermal amplification, DNA microarray, and next generation sequencing technology for the detection and identification of L. monocytogenes are discussed in this review. Overall, molecular methods are rapid, sensitive, specific, time- and labor-saving. In future, there are

  13. Molecular analysis of the iap gene of Listeria monocytogenes isolated from cheeses in Rio Grande do Sul, Brazil Análise molecular do gene iap de Listeria monocytogenes isoladas de queijos no Estado do Rio Grande do Sul, Brasil

    Directory of Open Access Journals (Sweden)

    Jozi Fagundes de Mello


    Full Text Available The polymorphic region sequences in the iap gene were analyzed in 25 strains of Listeria monocytogenes isolated from cheeses in the state of Rio Grande do Sul, and compared with reference strains. This investigation distinguished two clusters of L. monocytogenes: I (20 strains and II (5 strains.A seqüência da região polimórfica do gene iap foi analisada em 25 cepas de Listeria monocytogenes isoladas de queijo no Estado do Rio Grande do Sul e comparadas com cepas referências. Esta investigação distinguiu L. monocytogenes em dois grupos: I (20 cepas e II (5 cepas.

  14. Frequency of contamination Listeria monocytogenes of raw dried cured vacuum packed sausages

    Directory of Open Access Journals (Sweden)

    Hristo Daskalov


    Full Text Available The aim of this study was to collect actual data concerning the frequency of contamination with Listeria monocytogenes of some very popular in Bulgaria raw dried cured vacuum packed sausages, produced from October 2004 till May 2008. 148 vacuum-packed samples were taken from 9 different food business operators during all seasons of the year. The samples were analyzed according to USDA method for meat foods. Ten specimens were positive for presence of Listeria monocytogenes equal to 6,75% of all tested samples. In two other raw dried cured sausages L.welshimeri and L.innocua were found, but these species are not pathogenic for consumers. In the period before the official implementation of HACCP system (01.01.2006 in Bulgaria, 52 samples were examined and 5 Listeria monocytogenes isolates were found (~10%. 2,5 years after the HACCP implementation, 96 specimens from the same meat factories were tested and 5 Listeria monocytogenes isolates (5,2% were detected. Samples taken from lots, produced in winter time were contaminated with Listeria monocytogenes more often (7 of all 10 than specimens taken during other seasons. Data were discussed through the point of view of the effectiveness of hygienic practices and HACCP system application. Also, application of ‘microbiological criterion’ set in COMMISSION REGULATION (EC No 2073/2005 for ready-to-eat foods unable to support the growth of L. monocytogenes was considered.

  15. An outbreak of an unusual strain of Listeria monocytogenes infection in North-East Scotland

    Directory of Open Access Journals (Sweden)

    Emmanuel Okpo


    Full Text Available Summary: Listeria monocytogenes infection is an important cause of illness and hospitalization in vulnerable individuals. In the present study, we describe a community outbreak of Listeria monocytogenes in the North-East region of Scotland, which was epidemiologically, environmentally and microbiologically linked to a local meat product and ready-to-eat product manufacturer. Infected individuals were interviewed, and an environmental investigation was conducted. Clinical and environmental samples were tested by culture, and isolates were typed by fluorescent amplified fragment length polymorphism (fAFLP. Three cases of Listeria monocytogenes were linked geographically, had the same serotype (1/2a and were indistinguishable by fAFLP type XII.6. The human, food and environmental isolates were of the same serotype and were indistinguishable by molecular typing.This is the first community outbreak of L. monocytogenes reported in Scotland since the current outbreak surveillance was established in 1996. Epidemiological and laboratory evidence indicated poor hand hygiene, unhygienic practices and cross-contamination throughout the manufacturing process of ready-to-eat foods as a possible cause of the outbreak. More stringent control of commercial food establishments that provide ready-to-eat food and the need to advise specifically vulnerable groups, e.g., pregnant women, of the risk of L. monocytogenes in ready-to-eat food is urgently needed. Keywords: Listeria monocytogenes, Outbreak, Foodborne, Community acquired infection, Listeriosis

  16. Antimicrobial resistance of Listeria monocytogenes isolated from dairy-based food products. (United States)

    Harakeh, Steve; Saleh, Imane; Zouhairi, Omar; Baydoun, Elias; Barbour, Elie; Alwan, Nisreen


    In this study Listeria monocytogenes (L. monocytogenes) was isolated from three traditionally consumed Lebanese dairy-based food products. One hundred and sixty four samples (45 samples of Baladi cheese, 36 samples of Shankleesh and 83 of Kishk) were collected from the Bekaa Valley in the Northeast region of Lebanon. Suspected Listeria colonies were selected and initially identified by using standard biochemical tests. Initial identification of the positive L. monocytogenes colonies was confirmed at the molecular level by Polymerase Chain Reaction (n=30) and the confirmed isolates were evaluated for their susceptibility to 10 commonly used antimicrobials. All of the 30 isolates were confirmed to be L. monocytogenes yielding a PCR product of approximately 660 base pairs (bp). L. monocytogenes was detected in 26.67%, 13.89% and 7.23% of the Baladi cheese, Shankleesh and Kishk samples, respectively. The highest resistance in L. monocytogenes isolates was noted against oxacillin (93.33%) followed by penicillin (90%). The results provide an indication of the contamination levels of dairy-based foods in Lebanon and highlight the emergence of multi-drug resistant Listeria in the environment.

  17. Prevalence and serotypes of Listeria monocytogenes contamination in Chinese beef processing plants. (United States)

    Zhu, Lixian; Feng, Xiaohui; Zhang, Lihua; Zhu, Ruiliang; Luo, Xin


    The aim of this work was to study the epidemiology of Listeria spp., particularly Listeria monocytogenes, and to identify the serotypes present in contaminated samples from beef processing plants in China. A total of 439 samples were obtained from bovine feces, hides, and carcasses at three commercial processing plants. A standard protocol (ISO 11290-1) was followed to detect Listeria spp. and L. monocytogenes, and multiplex polymerase chain reaction was used to identify the various L. monocytogenes serotypes. The overall prevalences of Listeria spp. and L. monocytogenes were 65.6% and 26.4%, respectively, and the contamination was highest in the hide samples. The identified L. monocytogenes serotypes were 1/2c and 1/2a. The results of the current study indicate that Listeria spp. contamination is common in Chinese beef processing plants; specific measures should be taken to prevent and/or treat L. monocytogenes contamination of feces and hides in beef slaughter plants. Furthermore, because Listeria spp. contamination was found to be prevalent, it should, therefore, be studied further. The prevention of cases of sporadic listeriosis in China should also be addressed.

  18. Prevalence of Listeria monocytogenes in raw bovine milk and milk products from central highlands of Ethiopia. (United States)

    Seyoum, Eyasu Tigabu; Woldetsadik, Daniel Asrat; Mekonen, Tesfu Kassa; Gezahegn, Haile Alemayehu; Gebreyes, Wondwossen Abebe


    Listeria monocytogenes is of major significance in human and veterinary medicine. Most human Listeria infections are foodborne and the association of contaminated milk and dairy produce consumption with human listeriosis is noteworthy. In Ethiopia, there is limited data regarding the prevalence of L. monocytogenes in raw bovine milk and dairy products. The aim of this study was, therefore, to determine the prevalence of L. monocytogenes in raw bovine milk and dairy produce. A total of 443 milk and milk product samples were microbiologically analyzed following methods recommended by the U.S. Food and Drug Administration Bacteriological Analytical Manual to isolate Listeria spp. The overall prevalence of Listeria spp. was 28.4% and specifically that of L. monocytogenes was 5.6%. Taking the prevalence of Listeria spp. into consideration, cheese was found to be highly contaminated at 60%, followed by pasteurized milk samples (40%), raw milk (18.9%) and yoghurt (5%). Considering the prevalence of Listeria monocytogenes only, raw milk had the lowest contamination while cheese had the highest, followed by pasteurized milk and yoghurt. Raw milk and milk products produced in urban and peri-urban areas of central Ethiopia were contaminated with pathogenic bacteria, L. monocytogenes. The detection of this pathogen in raw milk and milk products warrants an urgent regulatory mechanism to be put in place and also the potential role of milk processing plants in the contamination of dairy products should be investigated.

  19. Phenotypic and Genotypic Characteristics of Listeria monocytogenes Isolated From Dairy and Meat Products

    Directory of Open Access Journals (Sweden)



    Full Text Available Background Listeria monocytogenes is a foodborne pathogen and a serious threat to the public health in the world. Consumption of traditional foods such as dairy and meat products can be a major reason for relative abundance and isolation of these bacteria. Objectives The purpose of this study was to determine the phenotypic and genotypic characteristics of L. monocytogenes strains isolated from dairy and meat products. Materials and Methods A total of 317 dairy products and meat-processed samples were collected. Antibiotic susceptibility test was performed on each sample by the disk diffusion method (Kirby Bauer. Five reference loci were used for typing of L. monocytogenes strains by MLVA (Multiple Locus VNTR Analysis Technique. Results A total of 24 L. monocytogenes isolates were collected from the dairy and meat products. Resistance of isolated L. monocytogenes strains to penicillin G were 54.54% (from dairy products and 46.15% (from processed meat. Genetic relatedness of isolates were assessed by MLVA. Out of 13 different types, type 2 with 6 strains and type 3 with 4 strains, were the most common types. Conclusions MLVA analysis showed that samples obtained from different sources could have similar genetic profile. As a result, administration of penicillin in patients with listeriosis (especially pregnant women and antibiotic susceptibility test are recommended. The fast and accurate methods such as MLVA for tracking of pollution sources of L. monocytogenes are recommended during outbreaks.

  20. Listeria monocytogenes infection of HD11, chicken macrophage-like cells. (United States)

    Jarvis, N A; Donaldson, J R; O'Bryan, C A; Ricke, S C; Crandall, P G


    Listeria monocytogenes can be carried by and infect poultry, although the clinical disease in birds is rare. Escape from macrophage phagocytosis is a key step in pathogenesis for L. monocytogenes. Therefore, we investigated the infection of the chicken macrophage-like cell line HD11 with 2 strains of L. monocytogenes EGD-e and Scott A. After infection, L. monocytogenes was quantified by spread plating and HD11 was quantified with trypan blue exclusion stain before enumeration. The standard macrophage killing protocols require washing the cell monolayers 3 times with PBS, which was found to negatively influence HD11 monolayers. Maximum bacterial densities within macrophages were not different between the 2 Listeria strains. HD11 required more than 11 h to effectively reduce intracellular L. monocytogenes Scott A, and Scott A was more susceptible to HD11 killing than EGD-e. It appears that Listeria infection initially causes attenuation of HD11 growth, and infected HD11 cells do not begin to lyse until at least 11 h post infection. These results suggest that there are subtle strain to strain differences in response to HD11 macrophage phagocytosis. The long lead-time required for HD11 to kill L. monocytogenes cells means that there is sufficient time available for chicken macrophages to circulate in the blood and transfer the intracellular Listeria to multiple tissues. © 2016 Poultry Science Association Inc.

  1. Cell Swelling Activates Phospholipase A2 in Ehrlich Ascites Tumor Cells

    DEFF Research Database (Denmark)

    Thoroed, S.M.; Lauritzen, L.; Lambert, I.H.


    Ehrlich ascites tumor cells! loaded with H-labeled arachidonic acid and C-labeled stearic acid for two hours, were washed and transferred to either isotonic or hypotonic media containing BSA to scavenge the labeled fatty acids released from the cells. During the first two minutes of hypo......-osmotic exposure the rate of H-labeled arachidonic acid release is 3.3 times higher than that observed at normal osmolality. Cell swelling also causes an increase in the production of C-stearic acid-labeled lysophosphatidylcholine. This indicates that a phospholipase A is activated by cell swelling in the Ehrlich...... cells. Within the same time frame there is no swelling-induced increase in C-labeled stearic acid release nor in the synthesis of phosphatidyl C-butanol in the presence of C-butanol. Furthermore, U7312, an inhibitor of phospholipase C, does not affect the swelling induced release of C...

  2. Static magnetic field changes the activity of venom phospholipase of Vipera Lebetina snakes

    International Nuclear Information System (INIS)

    Garibova, L.S.; Avetisyan, T.O.; Ajrapetyan, S.N.


    The effect of the static magnetic field (SMF) on the phospholipid activity of the class-A snake venom is studied. The Vipera Lebetina snake venom was subjected during 10 days to 30 minute impact of the CMF daily. It is established that increase in the phospholipase A 1 and A 2 approximately by 21 and 32 % correspondingly and in the phosphodiesterase C - by 33 % was observed. The decrease in the total protein level of the snake venom by 31.6 ± 2.2 % was noted thereby. It may be assumed that the described phospholipase and phosphoesterase changes may lead to essential shifts in the total metabolic activity of cells and organism as a whole. The activity index of these ferments may serve as an indicator of changes in the environmental magnetic field [ru

  3. Cross-reactivity and phospholipase A2 neutralization of anti-irradiated Bothrops jararaca venom antibodies

    International Nuclear Information System (INIS)

    Spencer, P.J.; Nascimento, N. do; Paula, R.A. de; Cardi, B.A.; Rogero, J.R.


    The detoxified Bothrops jararaca venom, immunized rabbits with the toxoid obtained and investigated cross-reactivity of the antibodies obtained against autologous and heterelogous venoms was presented. It was also investigated the ability of the IgGs, purified by affinity chromatography, from those sera to neutralize phospholipase. A 2 , an ubiquous enzyme in animal venoms. Results indicate that venom irradiation leads to an attenuation of toxicity of 84%. Cross-reactivity was investigated by ELISA and Western blot and all venoms were reactive to the antibodies. On what refers to phospholipase A 2 activity neutralization, the antibodies neutralized autologous venoms efficiently and, curiously, other venoms from the same genus were not neutralized, while Lachesis muta venom, a remote related specier, was neutralized by this serum. These data suggest that irradiation preserve important epitopes for induction of neutralizing antibodies and that these epitopes are not shared by all venoms assayed. (author). 8 refs, 2 figs, 3 tabs

  4. Expression of Enzymatically Inactive Wasp Venom Phospholipase A1 in Pichia pastoris

    DEFF Research Database (Denmark)

    Borodina, Irina; Jensen, Bettina M.; Wagner, Tim


    Wasp venom allergy is the most common insect venom allergy in Europe. It is manifested by large local reaction or anaphylactic shock occurring after a wasp sting. The allergy can be treated by specific immunotherapy with whole venom extracts. Wasp venom is difficult and costly to obtain...... and is a subject to composition variation, therefore it can be advantageous to substitute it with a cocktail of recombinant allergens. One of the major venom allergens is phospholipase A1, which so far has been expressed in Escherichia coli and in insect cells. Our aim was to produce the protein in secreted form...... in yeast Pichia pastoris, which can give high yields of correctly folded protein on defined minimal medium and secretes relatively few native proteins simplifying purification.Residual amounts of enzymatically active phospholipase A1 could be expressed, but the venom protein had a deleterious effect...

  5. Expression of enzymatically inactive wasp venom phospholipase A1 in Pichia pastoris

    DEFF Research Database (Denmark)

    Borodina, Irina; Jensen, Bettina M.; Wagner, Tim

    Wasp venom allergy is the most common insect venom allergy in Europe. It is manifested by large local reaction or anaphylactic shock occurring after a wasp sting. The allergy can be treated by specific immunotherapy with whole venom extracts. Wasp venom is difficult and costly to obtain...... and is a subject to composition variation, therefore it can be advantageous to substitute it with a cocktail of recombinant allergens. One of the major venom allergens is phospholipase A1, which so far has been expressed in Escherichia coli and in insect cells. Our aim was to produce the protein in secreted form...... in yeast Pichia pastoris, which can give high yields of correctly folded protein on defined minimal medium and secretes relatively few native proteins simplifying purification. Residual amounts of enzymatically active phospholipase A1 could be expressed, but the venom protein had a deleterious effect...

  6. Expression of enzymatically inactive wasp venom phospholipase A1 in Pichia pastoris

    DEFF Research Database (Denmark)

    Borodina, Irina; Jensen, Bettina M; Wagner, Tim


    Wasp venom allergy is the most common insect venom allergy in Europe. It is manifested by large local reaction or anaphylactic shock occurring after a wasp sting. The allergy can be treated by specific immunotherapy with whole venom extracts. Wasp venom is difficult and costly to obtain...... and is a subject to composition variation, therefore it can be advantageous to substitute it with a cocktail of recombinant allergens. One of the major venom allergens is phospholipase A1, which so far has been expressed in Escherichia coli and in insect cells. Our aim was to produce the protein in secreted form...... in yeast Pichia pastoris, which can give high yields of correctly folded protein on defined minimal medium and secretes relatively few native proteins simplifying purification.Residual amounts of enzymatically active phospholipase A1 could be expressed, but the venom protein had a deleterious effect...

  7. Evaluation of snake venom phospholipase A{sub 2}: hydrolysis of non-natural esters

    Energy Technology Data Exchange (ETDEWEB)

    Pirolla, Renan A.S.; Baldasso, Paulo A.; Marangoni, Sergio; Moran, Paulo J.S.; Rodrigues, Jose Augusto R., E-mail: jaugusto@iqm.unicamp.b [University of Campinas (UNICAMP), SP (Brazil). Inst. of Chemistry. Dept. of Organic Chemistry


    Phospholipase A2 from the rattlesnake Crotalus durissus terrificus was employed for the first time to test its enantioselectivity on the hydrolysis of different non-natural esters. It was observed that the structure of this small enzyme is restrictive in the choice of its lipase action with non-natural substrates. Two forms of the enzyme were used; free and as its cross-linked enzyme aggregate (CLEA). With all substrates, the free enzyme showed activity similar to the CLEA preparation. The advantage of the CLEA phospholipase is the possibility to reuse it in several consecutive reactions without a decrease of activity and selectivity with good but higher yields and ee than with the free enzyme. (author)

  8. Phospholipase A and the interaction of Rickettsia prowazekii and mouse fibroblasts (L-929 cells)

    International Nuclear Information System (INIS)

    Winkler, H.H.; Miller, E.T.


    L-929 cells were killed when approximately 50 viable Rickettsia prowazekii organisms per L-cell were centrifuged onto a monolayer. The glycerophospholipids of the L-cell were hydrolyzed to lysophosphatides and free fatty acids. Concomitantly, there was a loss of membrane integrity as shown by release of lactate dehydrogenase and 86Rb and permeability to trypan blue dye. No glycerophospholipid hydrolysis or cytotoxicity occurred when the rickettsiae were inactivated by heat, UV irradiation, N-ethylmaleimide, or metabolic inhibitors before their addition to the L-929 cells. On the other hand, treatment of the L929 cells with the cytoskeleton agents colchicine or cytochalasin B or with N-ethylmaleimide inhibited neither the phospholipase A activity nor the loss of membrane integrity. Cytochalasin B-treated cells could be damaged by even small numbers of rickettsiae. We suggest that this phospholipase A activity is used by the rickettsiae to escape from the phagosomes into the cytoplasm of host cells

  9. Factors associated with Listeria monocytogenes contamination of cold-smoked pork products produced in Latvia and Lithuania.


    Berzins,-A; Horman,-A; Lunden,-J; Korkeala,-H


    A total of 312 samples of sliced, vacuum packaged, cold-smoked pork from 15 meat processing plants in Latvia and Lithuania, obtained over a 15-month period from 2003 until 2004, were analyzed for the presence of Listeria monocytogenes at the end of their shelf-life. Overall, 120 samples (38%) tested positive for L. monocytogenes. Despite the long storing period, the levels of L. monocytogenes in cold-smoked pork products were low. Manufacturing processes were studied at seven meat processing ...

  10. Spontaneous Bacterial Peritonitis Caused by Infection with Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Michael Vincent F. Tablang


    Full Text Available Spontaneous bacterial peritonitis is a severe and life-threatening complication in patients with ascites caused by advanced liver disease. The organisms most commonly involved are coliform bacteria and third-generation cephalosporins are the empiric antibiotics of choice. This is an uncommon case of spontaneous bacterial peritonitis caused by Listeria monocytogenes in a female patient with liver cirrhosis from autoimmune hepatitis. She did not improve with ceftriaxone and her course was complicated by hepatic encephalopathy, seizures and multi-organ failure. This case emphasizes that a high index of suspicion should be maintained for timely diagnosis and treatment. Listerial peritonitis should be suspected in patients with end-stage liver disease and inadequate response to conventional antibiotics within 48–72 h. Ampicillin/sulbactam should be initiated while awaiting results of ascitic fluid or blood culture.

  11. Mitochondrial phospholipase A2 activated by reactive oxygen species in heart mitochondria induces mild uncoupling

    Czech Academy of Sciences Publication Activity Database

    Ježek, Jan; Jabůrek, Martin; Zelenka, Jaroslav; Ježek, Petr


    Roč. 59, č. 5 (2010), s. 737-747 ISSN 0862-8408 R&D Projects: GA ČR(CZ) GA303/07/0105; GA MŠk ME09018; GA AV ČR(CZ) KJB500110902 Institutional research plan: CEZ:AV0Z50110509 Keywords : Heart mitochondrial phospholipase A2 * Fatty Acids * Adenine nucleotide translocase Subject RIV: ED - Physiology Impact factor: 1.646, year: 2010

  12. A Model for the Interfacial Kinetics of Phospholipase D Activity on Long-Chain Lipids (United States)


    7506–7513. 18. Zografi, G., R. Verger, and G. H. de Haas. 1971. Kinetic analysis of the hydrolysis of lecithin monolayers by phospholipase A. Chem...ChemBioChem. 9:2853–2859. 54. Albrecht, O., H. Gruler, and E. Sackmann. 1981. Pressure-composition phase diagrams of cholesterol/ lecithin , cholesterol...phosphatidic acid, and lecithin /phosphatidic acid fixed monolayers: a Langmuit film balance study. J. Colloid Interface Sci. 79:319–338. 55. Morris, A

  13. Identification of the Elusive Mammalian Enzyme Phosphatidylcholine-Specific Phospholipase C (United States)


    Summary of Results. Task 1. To identify mammalian PC- PLC . Based on results published by other groups, we proposed to identify candidate PC- PLC mRNAs by...establishing the role of the elusive mammalian protein, phosphatidycholine- specific phospholipase C (PC- PLC ) in the inflammatory processes involved in...progression of rheumatoid arthritis (RA). Thus, the main scopes of this proposal are: 1. to identify the PC- PLC gene and protein; and 2. to test PC- PLC

  14. Phospholipase A2-activating protein is associated with a novel form of leukoencephalopathy. (United States)

    Falik Zaccai, Tzipora C; Savitzki, David; Zivony-Elboum, Yifat; Vilboux, Thierry; Fitts, Eric C; Shoval, Yishay; Kalfon, Limor; Samra, Nadra; Keren, Zohar; Gross, Bella; Chasnyk, Natalia; Straussberg, Rachel; Mullikin, James C; Teer, Jamie K; Geiger, Dan; Kornitzer, Daniel; Bitterman-Deutsch, Ora; Samson, Abraham O; Wakamiya, Maki; Peterson, Johnny W; Kirtley, Michelle L; Pinchuk, Iryna V; Baze, Wallace B; Gahl, William A; Kleta, Robert; Anikster, Yair; Chopra, Ashok K


    Leukoencephalopathies are a group of white matter disorders related to abnormal formation, maintenance, and turnover of myelin in the central nervous system. These disorders of the brain are categorized according to neuroradiological and pathophysiological criteria. Herein, we have identified a unique form of leukoencephalopathy in seven patients presenting at ages 2 to 4 months with progressive microcephaly, spastic quadriparesis, and global developmental delay. Clinical, metabolic, and imaging characterization of seven patients followed by homozygosity mapping and linkage analysis were performed. Next generation sequencing, bioinformatics, and segregation analyses followed, to determine a loss of function sequence variation in the phospholipase A 2 -activating protein encoding gene (PLAA). Expression and functional studies of the encoded protein were performed and included measurement of prostaglandin E 2 and cytosolic phospholipase A 2 activity in membrane fractions of fibroblasts derived from patients and healthy controls. Plaa-null mice were generated and prostaglandin E 2 levels were measured in different tissues. The novel phenotype of our patients segregated with a homozygous loss-of-function sequence variant, causing the substitution of leucine at position 752 to phenylalanine, in PLAA, which causes disruption of the protein's ability to induce prostaglandin E 2 and cytosolic phospholipase A 2 synthesis in patients' fibroblasts. Plaa-null mice were perinatal lethal with reduced brain levels of prostaglandin E 2 The non-functional phospholipase A 2 -activating protein and the associated neurological phenotype, reported herein for the first time, join other complex phospholipid defects that cause leukoencephalopathies in humans, emphasizing the importance of this axis in white matter development and maintenance. © The Author (2016). Published by Oxford University Press on behalf of the Guarantors of Brain. All rights reserved. For Permissions, please email

  15. Antioxidant tempol suppresses heart cytosolic phospholipase A(2)alpha stimulated by chronic intermittent hypoxia

    Czech Academy of Sciences Publication Activity Database

    Míčová, P.; Klevstig, Martina; Holzerová, Kristýna; Vecka, M.; Žurmanová, J.; Neckář, Jan; Kolář, František; Nováková, Olga; Novotný, J.; Hlaváčková, Markéta


    Roč. 95, č. 8 (2017), s. 920-927 ISSN 0008-4212 R&D Projects: GA ČR(CZ) GJ16-12420Y; GA ČR(CZ) GA13-10267S Institutional support: RVO:67985823 Keywords : heart * chronic intermittent hypoxia * oxidative stress * phospholipases A(2) * tempol Subject RIV: FA - Cardiovascular Diseases incl. Cardiotharic Surgery OBOR OECD: Biochemistry and molecular biology Impact factor: 1.822, year: 2016

  16. The Effect of Oxygen on Bile Resistance in Listeria monocytogenes (United States)

    Wright, Morgan L; Pendarvis, Ken; Nanduri, Bindu; Edelmann, Mariola J; Jenkins, Haley N; Reddy, Joseph S; Wilson, Jessica G; Ding, Xuan; Broadway, Paul R; Ammari, Mais G; Paul, Oindrila; Roberts, Brandy; Donaldson, Janet R


    Listeria monocytogenes is a Gram-positive facultative anaerobe that is the causative agent of the disease listeriosis. The infectious ability of this bacterium is dependent upon resistance to stressors encountered within the gastrointestinal tract, including bile. Previous studies have indicated bile salt hydrolase activity increases under anaerobic conditions, suggesting anaerobic conditions influence stress responses. Therefore, the goal of this study was to determine if reduced oxygen availability increased bile resistance of L. monocytogenes. Four strains representing three serovars were evaluated for changes in viability and proteome expression following exposure to bile in aerobic or anaerobic conditions. Viability for F2365 (serovar 4b), EGD-e (serovar 1/2a), and 10403S (serovar 1/2a) increased following exposure to 10% porcine bile under anaerobic conditions (P 0.05) in bile resistance between aerobic and anaerobic conditions, indicating that oxygen availability does not influence resistance in this strain. The proteomic analysis indicated F2365 and EGD-e had an increased expression of proteins associated with cell envelope and membrane bioenergetics under anaerobic conditions, including thioredoxin-disulfide reductase and cell division proteins. Interestingly, HCC23 had an increase in several dehydrogenases following exposure to bile under aerobic conditions, suggesting that the NADH:NAD+ is altered and may impact bile resistance. Variations were observed in the expression of the cell shape proteins between strains, which corresponded to morphological differences observed by scanning electron microscopy. These data indicate that oxygen availability influences bile resistance. Further research is needed to decipher how these changes in metabolism impact pathogenicity in vivo and also the impact that this has on susceptibility of a host to listeriosis. PMID:27274623

  17. Phospholipase D specific for the phosphatidylinositol anchor of cell-surface proteins is abundant in plasma

    International Nuclear Information System (INIS)

    Low, M.G.; Prasad, A.R.S.


    An enzyme activity capable of degrading the glycosyl-phosphatidylinositol membrane anchor of cell-surface proteins has previously been reported in a number of mammalian tissues. The experiments reported here demonstrate that this anchor-degrading activity is also abundant in mammalian plasma. The activity was inhibited by EGTA or 1,10-phenanthroline. It was capable of removing the anchor from alkaline phosphatase, 5'-nucleotidase, and variant surface glycoprotein but had little or no activity toward phosphatidylinositol or phosphatidylcholine. Phosphatidic acid was the only 3 H-labeled product when this enzyme hydrolyzed [ 3 H]myristate-labeled variant surface glycoprotein. It could be distinguished from the Ca 2 =-dependent inositol phospholipid-specific phospholipase C activity in several rat tissues on the basis of its molecular size and its sensitivity to 1,10-phenanthroline. The data therefore suggest that this activity is due to a phospholipase D with specificity for glycosylphosphatidylinositol structures. Although the precise physiological function of this anchor-specific phospholipase D remains to be determined, these findings indicate that it could play an important role in regulating the expression and release of cell-surface proteins in vivo

  18. Evidence for the presence of phospholipase A1 in Saccharomyces cerevisiae

    International Nuclear Information System (INIS)

    Watanabe, Yasuo; Murakami, Masako; Takakuwa, Masayoshi


    The cause of the autolysis of pressed Baker's yeast was examined. Softened pressed yeast cells (Saccharomyces cerevisiae), after about 10 days of storage at 30 deg C, was subjected to a series of extraction: the extraction with acetone was made to the supernatant after the centrifugation of the water-suspended yeast cell at 1000 x g for 10 min, and the obtained precipitation was mechanically (with a Potter teflon homogenizer) homogenized. After removing the residues by centrifugation, the protein was salted out with ammonium sulfate up to 0.6 saturation. An enzyme, phospholipase A 1 was thus obtained from the softened yeast cells. The activity of the enzyme thus obtained was assayed using L-α-phosphatidylethanolamine as the substrate. It was previously found that 14 C-labelled free fatty acids liberated from phosphatidylcholine (PC) accumulated in the softened yeast packed cake. The enzyme was identified as phospholipase A 1 having the optimal pH at around 8. Another evidence, obtained previously, together with the present finding suggest that the softening of the pressed Baker's yeast may be caused by the degradation of phospholipid by the combined action of phospholipase A 1 and lysophospholipase L 2 . (Yamashita, S.)

  19. Hydrolysis of short-chain phosphatidylcholines by bee venom phospholipase A2. (United States)

    Raykova, D; Blagoev, B


    In order to find out the aggregation state of the substrate, preferred by bee venom phospholipase A2 (EC, its action on short-chain phosphatidylcholines with two identical (C6-C10) fatty acids has been tested. The rate of hydrolysis as a function of acyl chain length showed a maximum at dioctanoylphosphatidylcholine. The effects of alcohols, NaCl and Triton X-100, which affect the aggregation state of phospholipids in water, were also studied. The addition of n-alcohol led to a significant inhibition of the hydrolysis of the substrates present in micellar form and activated the hydrolysis of substrates which form liposomes. The inhibitory effect increased with increasing length of the aliphatic carbon chain of the alcohol. Triton X-100 at low Triton/phospholipid molar ratios enhanced enzyme activity. These results do not agree with the accepted idea that bee venom phospholipase A2 hydrolyzes short-chain lecithins in their molecularly dispersed form and that micelles cannot act as substrates. The data indicate that short-chain lecithins in the aggregated state are hydrolyzed and that the requirements of bee venom phospholipase A2 for the aggregation state of the substrate are not strict.

  20. Listeria monocytogenes Meningitis in an Immunosuppressed Patient with Autoimmune Hepatitis and IgG4 Subclass Deficiency

    DEFF Research Database (Denmark)

    Gaini, Shahin


    A 51-year-old Caucasian woman with Listeria monocytogenes meningitis was treated and discharged after an uncomplicated course. Her medical history included immunosuppressive treatment with prednisolone and azathioprine for autoimmune hepatitis. A diagnostic work-up after the meningitis episode...... revealed that she had low levels of the IgG4 subclass. To our knowledge, this is the first case report describing a possible association between autoimmune hepatitis and the occurrence of Listeria monocytogenes meningitis, describing a possible association between Listeria monocytogenes meningitis...... and deficiency of the IgG4 subclass and finally describing a possible association between Listeria monocytogenes meningitis and immunosuppressive therapy with prednisolone and azathioprine....

  1. Symptomatic hydrocephalus in a newborn infected with listeria monocytogenes Hidrocefalia sintomática em um recém-nascido infectado com Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Analía L. Laciar


    Full Text Available Central nervous system infections caused by Listeria monocytogenes produce a wide range of clinical symptoms which include cerebral abscesses, meningitis and nonmeningitic parenchymal cerebritis. A case study is presented of early listeriosis with signs of meningitis accompanied with septicemia and complicated with severe hydrocephalus.As infecções do sistema nervoso central produzidas por Listeria monocytogenes provocam una grande variedade de sintomas clínicos que incluem abscessos cerebrais, meningites e cerebrites parenquimáticas não meningíticas. Apresenta-se um caso de listeriose precoce com sinais de meningite acompanhada de septicemia e agravado com hidrocefalia grave.

  2. Efficacy of chlorine dioxide against Listeria monocytogenes in brine chilling solutions. (United States)

    Valderrama, W B; Mills, E W; Cutter, C N


    Chilled brine solutions are used by the food industry to rapidly cool ready-to-eat meat products after cooking and before packaging. Chlorine dioxide (ClO(2)) was investigated as an antimicrobial additive to eliminate Listeria monocytogenes. Several experiments were performed using brine solutions made of sodium chloride (NaCl) and calcium chloride (CaCl(2)) inoculated with L. monocytogenes and/or treated with 3 ppm of ClO(2). First, 10 and 20% CaCl(2) and NaCl solutions (pH 7.0) were inoculated with a five-strain cocktail of L. monocytogenes to obtain approximately 7 log CFU/ml and incubated 8 h at 0 degrees C. The results demonstrated that L. monocytogenes survived in 10% CaCl(2), 10 and 20% NaCl, and pure water. L. monocytogenes levels were reduced approximately 1.2 log CFU/ml in 20% CaCl(2). Second, inoculated ( approximately 7 log CFU/ml) brine solutions (10 and 20% NaCl and 10% CaCl(2)) treated with 3 ppm of ClO(2) resulted in a approximately 4-log reduction of the pathogen within 90 s. The same was not observed in a solution of 20% CaCl(2); further investigation demonstrated that high levels of divalent cations interfere with the disinfectant. Spent brine solutions from hot dog and ham chilling were treated with ClO(2) at concentrations of 3 or 30 ppm. At these concentrations, ClO(2) did not reduce L. monocytogenes. Removal of divalent cations and organic material in brine solutions prior to disinfection with ClO(2) should be investigated to improve the efficacy of the compound against L. monocytogenes. The information from this study may be useful to processing establishments and researchers who are investigating antimicrobials in chilling brine solutions.

  3. Thermal Inactivation of Listeria monocytogenes and Salmonella during Water and Steam Blanching of Vegetables. (United States)

    Ceylan, Erdogan; McMahon, Wendy; Garren, Donna M


    Thermal inactivation of Listeria monocytogenes and Salmonella was evaluated on peas, spinach, broccoli, potatoes, and carrots that were treated with hot water and steam. One gram-positive bacterium, L. monocytogenes, and one gram-negative bacterium, Salmonella, were selected as pertinent human pathogens for evaluation. Samples were inoculated with a composite of five strains each of L. monocytogenes and Salmonella to achieve approximately 10 8 to 10 9 CFU/g. Inoculated samples were treated with hot water at 85 and 87.8°C and with steam at 85 and 96.7°C for up to 3.5 min. A greater than 5-log reduction of L. monocytogenes and Salmonella was achieved on all products within 0.5 min by hot water blanching at 85 and 87.8°C. Steam blanching at 85°C reduced Salmonella populations by greater than 5 log on spinach and peas within 2 min and on carrots and broccoli within 3.5 min. Populations of Salmonella were reduced by more than 5 log within 1 min on carrot, spinach, and broccoli and within 2 min on peas by steam blanching at 96.7°C. Steam blanching at 85°C reduced L. monocytogenes populations by more than 5 log on carrots and spinach within 2 min and on broccoli and peas within 3.5 min. L. monocytogenes populations were reduced more than 5 log within 1 min on carrot, spinach, peas and broccoli by steam blanching at 96.7°C. Longer treatment times and higher temperatures were required for steam-blanched samples than for samples blanched with hot water. Results suggest that hot water and steam blanching practices commonly used by the frozen vegetable industry will achieve the desired 5-log lethality of L. monocytogenes and Salmonella and will enhance microbiological safety prior to freezing.

  4. Prevalence and Persistence of Listeria monocytogenes in Ready-to-Eat Tilapia Sashimi Processing Plants. (United States)

    Chen, Bang-Yuan; Wang, Chung-Yi; Wang, Chia-Lan; Fan, Yang-Chi; Weng, I-Ting; Chou, Chung-Hsi


    A 2-year study was performed at two ready-to-eat tilapia sashimi processing plants (A and B) to identify possible routes of contamination with Listeria monocytogenes during processing. Samples were collected from the aquaculture environments, transportation tanks, processing plants, and final products. Seventy-nine L. monocytogenes isolates were found in the processing environments and final products; 3.96% (50 of 1,264 samples) and 3.86% (29 of 752 samples) of the samples from plants A and B, respectively, were positive for L. monocytogenes . No L. monocytogenes was detected in the aquaculture environments or transportation tanks. The predominant L. monocytogenes serotypes were 1/2b (55.70%) and 4b (37.97%); serotypes 3b and 4e were detected at much lower percentages. At both plants, most processing sections were contaminated with L. monocytogenes before the start of processing, which indicated that the cleaning and sanitizing methods did not achieve adequate pathogen removal. Eleven seropulsotypes were revealed by pulsed-field gel electrophoresis and serotyping. Analysis of seropulsotype distribution revealed that the contamination was disseminated by the processing work; the same seropulsotypes were repeatedly found along the work flow line and in the final products. Specific seropulsotypes were persistently found during different sampling periods, which suggests that the sanitation procedures or equipment used at these plants were inadequate. Plant staff should improve the sanitation procedures and equipment to reduce the risk of L. monocytogenes cross-contamination and ensure the safety of ready-to-eat tilapia products.

  5. Prevalence of Listeria monocytogenes in ready-to-eat seafood marketed in Thessaloniki (Northern Greece

    Directory of Open Access Journals (Sweden)

    N. Soultos


    Full Text Available Aim: In the current study, a contribution to the knowledge on the prevalence and level of contamination of Listeria monocytogenes in ready-to-eat (RTE seafood marketed in Thessaloniki (Northern Greece was provided; the serovar identity of the L. monocytogenes isolates was also determined. Materials and Methods: A total of 132 RTE seafood samples consisting of 74 smoked fish products, 18 salted fish products, 16 dried fish products, 9 raw marinated fish products, 10 cooked marinated cephalopods and 5 surimi crab stick products were analyzed. L. monocytogenes were isolated and enumerated based on ISO 11290-1/A1 and ISO 11290-2/A1 protocols, respectively, and identified using a multiplex polymerase chain reaction (PCR system utilizing genus and species specific primers. For the identification of serotypes a second multiplex PCR assay was used which clusters L. monocytogenes strains into four major serogroups. Results: Of the samples examined, 11 (8.3% proved positive for Listeria spp. with 8 (6.1% yielding L. monocytogenes. Only in one sample of smoked mackerel the level of L. monocytogenes exceeded the legal safety limit of 100 cfu/g set out in Commission Regulation (EC No. 1441/2007. Serotyping showed higher percentages of isolates belonging to PCR serogroup 3:1/2b, 3b, 7 (46.7% and serogroup 1:1/2a, 3a (40% followed by serogroup 4:4b, 4d, 4e (13.3%. Conclusion: This study demonstrated that L. monocytogenes can be isolated from processed RTE seafood products at retail in Thessaloniki (Northern Greece in low concentrations. However, the presence of this human pathogen in RTE seafood should not be overlooked, but it should be considered as having significance public health implications, particularly among the persons who are at greater risk. Therefore, RTE seafood should be produced under appropriate hygienic and technological conditions since the product does not undergo any treatment before consumption.

  6. Mechanism of Nisin, Pediocin 34, and Enterocin FH99 Resistance in Listeria monocytogenes. (United States)

    Kaur, Gurpreet; Singh, Tejinder Pal; Malik, Ravinder Kumar; Bhardwaj, Arun


    Nisin-, pediocin 34-, and enterocin FH99-resistant variants of Listeria monocytogenes ATCC 53135 were developed. In an attempt to clarify the possible mechanisms underlying bacteriocin resistance in L. monocytogenes ATCC 53135, sensitivity of the resistant strains of L. monocytogenes ATCC 53135 to nisin, pediocin 34, and enterocin FH99 in the absence and presence of different divalent cations was assessed, and the results showed that the addition of divalent cations significantly reduced the inhibitory activity of nisin, pediocin 34, and enterocin FH99 against resistant variants of L. monocytogenes ATCC 53135. The addition of EDTA, however, restored this activity suggesting that the divalent cations seem to affect the initial electrostatic interaction between the positively charged bacteriocin and the negatively charged phospholipids of the membrane. Nisin-, pediocin 34-, and enterocin-resistant variants of L. monocytogenes ATCC 53135 were more resistant to lysozyme as compared to the wild-type strain both in the presence as well as absence of nisin, pediocin 34, and enterocin FH99. Ultra structural profiles of bacteriocin-sensitive L. monocytogenes and its bacteriocin-resistant counterparts revealed that the cells of wild-type strain of L. monocytogenes were maximally in pairs or short chains, whereas, its nisin-, pediocin 34-, and enterocin FH99-resistant variants tend to form aggregates. Results indicated that without a cell wall, the acquired nisin, pediocin 34, and enterocin FH99 resistance of the variants was lost. Although the bacteriocin-resistant variants appeared to lose their acquired resistance toward nisin, pediocin 34, and enterocin FH99, the protoplasts of the resistant variants appeared to be more resistant to bacteriocins than the protoplasts of their wild-type counterparts.

  7. Assessment of Listeria monocytogenes virulence in the Galleria mellonella insect larvae model. (United States)

    Rakic Martinez, Mira; Wiedmann, Martin; Ferguson, Martine; Datta, Atin R


    Several animal models have been used to understand the molecular basis of the pathogenicity, infectious dose and strain to strain variation of Listeria monocytogenes. The greater wax worm Galleria mellonella, as an alternative model, provides some useful advantages not available with other models and has already been described as suitable for the virulence assessment of various pathogens including L. monocytogenes. The objectives of this study are: 1) confirming the usefulness of this model with a wide panel of Listeria spp. including non-pathogenic L. innocua, L. seeligeri, L. welshimeri and animal pathogen L. ivanovii; 2) assessment of virulence of several isogenic in-frame deletion mutants in virulence and stress related genes of L. monocytogenes and 3) virulence assessment of paired food and clinical isolates of L. monocytogenes from 14 major listeriosis outbreaks occurred worldwide between 1980 and 2015. Larvae injected with different concentrations of Listeria were incubated at 37°C and monitored over seven days for time needed to kill 50% of larvae (LT50) and to determine change of bacterial population in G. mellonella, 2 and 24 hours post-inoculation. Non-pathogenic members of Listeria and L. ivanovii showed significantly (P monocytogenes strains. Isogenic mutants of L. monocytogenes with the deletions in prfA, plcA, hly, actA and virR genes, also showed significantly (P monocytogenes strains related to non-invasive (gastroenteritis) outbreaks of listeriosis showed significantly (P < 0.05) lower virulence than isolates of the same serotype obtained from outbreaks with invasive symptoms. The difference, however, was dose and strain- dependent. No significant differences in virulence were observed among the serotype tested in this study.

  8. Listeria monocytogenes meningitis in the elderly: epidemiological, clinical and therapeutic findings. (United States)

    Pagliano, Pasquale; Ascione, Tiziana; Boccia, Giovanni; De Caro, Francesco; Esposito, Silvano


    Listeria monocytogenes is a Gram-positive bacillus and facultative intracellular bacterium whose transmission occurs mainly through the consumption of contaminated food, L. monocytogenes invades the host cells using various protein and can escape to the human T-cell immune system by cell-to-cell spreading. If the infection is not controlled at the stage in which the bacterium is in the liver, for instance, due to a severe immunodepression, a secondary bacteraemia can be developed and L. monocytogenes reaches the preferred sites transgressing the blood-brain barrier or the placental barrier. Individuals with T-cell dysfunction, such as pregnant women, the elderly, and those receiving immunosuppressive therapy are at the highest risk of contracting the disease. Average life expectancy throughout developed countries has rapidly increased during the latter half of the 20th century and geriatric infectious diseases have become an increasingly important issue. L. monocytogenes meningitis in young previously healthy adults has been reported only in anecdotal observations. Differently, L. monocytogenes is the third most common cause of bacterial meningitis in the elderly population, after Streptococcus pneumoniae and Neisseria meningitidis. Patients with L. monocytogenes meningitis presented with signs and symptoms that were similar to those of the general population with community-acquired bacterial meningitis, but reported a longer prodromal phase. According to literature data, the prevalence of the classic triad of fever, neck stiffness, and altered mental status is 43%, and almost all patients present with at least 2 of the 4 classic symptoms of headache, fever, neck stiffness, and altered mental status. On the basis of our published data, in patients aged over 50 years, diagnosing L. monocytogenes meningitis was more challenging than pneumococcal meningitis, as demonstrated by the lower percentage of cases receiving a correct diagnosis within 48 hours from the onset

  9. Inhibitory Effect of Nisin on Listeria monocytogenes Inoculated into Surimi and Minced Meat

    Directory of Open Access Journals (Sweden)

    Masoud Rezaei


    Full Text Available Background & Objective: Listeria monocytogenes has already established as an important food born pathogen which induce listeriosis in human. Use of bacteriocins to provide food safety has been increased dramatically. Nisin has a wide spectrum inhibitory effect than the other bacteriocins and inhibits food-borne pathogens such as L. monocytogenes and many other Gram-positive spoilage microorganisms. The purpose of this study was to investigate the inhibitory effect of Nisin on population of Listeria monocytogenes and the role of changes in food components on the antilisterial properties of Nisin. Materials & Methods: The minced meat and surimi samples were inoculated by 1×104 cfu/g of L. monocytogenes. Then samples exposed to Nisin at the levels of 500 or 1000 IU/g were prepared. All treatments after packaging in plastic bags were kept for 12 days at refrigerator temperature. Samples were cultured on CHROMagarTM Listeria every 2 days and the number of listeria monocytogenes was counted. Results: two different concentrations of Nisin (500 or 1000 IU/g was not able to inhibit L. monocytogenes below the acceptable level for raw food (100 cells per g in minced meat and surimi of silver carp. But the number of bacteria reduces more in fish surimi as compared to the mince meal. Also, antilisterial activity of Nisin was reduced during the storage period. Conclusion: Inhibitory property of Nisin against L. monocytogenes in surimi significantly was higher than the minced (P<0.05. So it is possible the antilisterial properties of Nisin will increase by elimination of some enzymes during processing.

  10. Performance of Isfahan North Wastewater Treatment Plant in the Removal of Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    nahid Navijouy


    Full Text Available Listeria and in particular Listeria monocytogenes is considered a ubiquitous foodborne pathogen which can lead listeriosis in human and animals. Listeriosis can be serious and may cause meningitis, septicemia and abortion in pregnant women. Although wastewater or sludge may contaminate foods of plant origin, there are no data on occurrence of Listeria spp. in wastewater and sludge in Iran. The purpose of current investigation was to study the occurrence of Listeria spp. in various samples of wastewater and sludge in Isfahan North wastewater treatment plant. Influent, effluent, raw sludge and dried sludge samples were collected from Isfahan North municipal wastewater treatment plant. L. monocytogenes were enumerated by a three–tube most probable number (MPN assay using enrichment Fraser broth. A total of 65 various samples from five step in 13 visits were collected. The presence of Listeria spp. also was determined using USDA procedure. Then, phenotypically identified L. monocytogenes were further confirmed by Polymerase Chain Reaction amplification. L. monocytogenes isolated from 76.9%, 38.5%, 84.6%, 69.2% and 46.2% of influent, effluent, raw sludge, stabilized sludge and dried sludge respectively. The efficiency of wastewater treatment processes, digester tank and drying bed in removal L. monocytogenes were 69.6%, 64.7% and 73.4% respectively. All phenotypically identified L. monocytogenes were further confirmed by Polymerase Chain Reaction. The results of present study have shown that Listeriaspp. and L. monocytogenes in particular, were present in wastewater treatment plant effluents and sludge at high level. The bacteria may spread on agriculture land and contaminate foods of plant origin. This may cause a risk of spreading disease to human and animals.

  11. Listeria monocytogenes alters mast cell phenotype, mediator and osteopontin secretion in a listeriolysin-dependent manner.

    Directory of Open Access Journals (Sweden)

    Catherine E Jobbings

    Full Text Available Whilst mast cells participate in the immune defence against the intracellular bacterium Listeria monocytogenes, there is conflicting evidence regarding the ability of L. monocytogenes to infect mast cells. It is known that the pore-forming toxin listeriolysin (LLO is important for mast cell activation, degranulation and the release of pro-inflammatory cytokines. Mast cells, however, are a potential source of a wide range of cytokines, chemokines and other mediators including osteopontin, which contributes to the clearing of L. monocytogenes infections in vivo, although its source is unknown. We therefore aimed to resolve the controversy of mast cell infection by L. monocytogenes and investigated the extent of mediator release in response to the bacterium. In this paper we show that the infection of bone marrow-derived mast cells by L. monocytogenes is inefficient and LLO-independent. LLO, however, is required for calcium-independent mast cell degranulation as well as for the transient and selective downregulation of cell surface CD117 (c-kit on mast cells. We demonstrate that in addition to the key pro-inflammatory cytokines TNF-α and IL-6, mast cells release a wide range of other mediators in response to L. monocytogenes. Osteopontin, IL-2, IL-4, IL-13 and granulocyte macrophage colony-stimulating factor (GM-CSF, and chemokines including CCL2, CCL3, CCL4 and CCL5 are released in a MyD88-dependent manner. The wide range of mediators released by mast cells in response to L. monocytogenes may play an important role in the recruitment and activation of a variety of immune cells in vivo. The cocktail of mediators, however, is unlikely to skew the immune response to a particular effector response. We propose that mast cells provide a hitherto unreported source of osteopontin, and may provide an important role in co-ordinating the immune response during Listeria infection.

  12. Alpha 1-adrenergic receptor-mediated phosphoinositide hydrolysis and prostaglandin E2 formation in Madin-Darby canine kidney cells. Possible parallel activation of phospholipase C and phospholipase A2

    International Nuclear Information System (INIS)

    Slivka, S.R.; Insel, P.A.


    alpha 1-Adrenergic receptors mediate two effects on phospholipid metabolism in Madin-Darby canine kidney (MDCK-D1) cells: hydrolysis of phosphoinositides and arachidonic acid release with generation of prostaglandin E2 (PGE2). The similarity in concentration dependence for the agonist (-)-epinephrine in eliciting these two responses implies that they are mediated by a single population of alpha 1-adrenergic receptors. However, we find that the kinetics of the two responses are quite different, PGE2 production occurring more rapidly and transiently than the hydrolysis of phosphoinositides. The antibiotic neomycin selectively decreases alpha 1-receptor-mediated phosphatidylinositol 4,5-bisphosphate hydrolysis without decreasing alpha 1-receptor-mediated arachidonic acid release and PGE2 generation. In addition, receptor-mediated inositol trisphosphate formation is independent of extracellular calcium, whereas release of labeled arachidonic acid is largely calcium-dependent. Moreover, based on studies obtained with labeled arachidonic acid, receptor-mediated generation of arachidonic acid cannot be accounted for by breakdown of phosphatidylinositol monophosphate, phosphatidylinositol bisphosphate, or phosphatidic acid. Further studies indicate that epinephrine produces changes in formation or turnover of several classes of membrane phospholipids in MDCK cells. We conclude that alpha 1-adrenergic receptors in MDCK cells appear to regulate phospholipid metabolism by the parallel activation of phospholipase C and phospholipase A2. This parallel activation of phospholipases contrasts with models described in other systems which imply sequential activation of phospholipase C and diacylglycerol lipase or phospholipase A2

  13. Leucocins 4010 from Leuconostoc carnosum cause a matrix related decrease in intracellular pH of Listeria monocytogenes

    DEFF Research Database (Denmark)

    Fang, Weihuan; Budde, Birgitte Bjørn; Siegumfeldt, Henrik


    A mixed culture of single cells of Listeria monocytogenes and the bacteriocin producing Leuconostoc carnosum 4010 showed growth inhibition of L. monocytogenes, although the intracellular pH (pHi) of L. monocytogenes followed by fluorescence ratio imaging microscopy was not affected. Furthermore, L...

  14. Identification and properties of very high affinity brain membrane-binding sites for a neurotoxic phospholipase from the taipan venom

    Energy Technology Data Exchange (ETDEWEB)

    Lambeau, G.; Barhanin, J.; Schweitz, H.; Qar, J.; Lazdunski, M. (Centre de Biochimie, Nice (France))


    Four new monochain phospholipases were purified from the Oxyuranus scutellatus (taipan) venom. Three of them were highly toxic when injected into mice brain. One of these neurotoxic phospholipases, OS2, was iodinated and used in binding experiments to demonstrate the presence of two families of specific binding sites in rat brain synaptic membranes. The affinities were exceptionally high, Kd1 = 1.5 +/- 0.5 pM and Kd2 = 45 +/- 10 pM, and the maximal binding capacities were Bmax 1 = 1 +/- 0.4 and Bmax 2 = 3 +/- 0.5 pmol/mg of protein. Both binding sites were sensitive to proteolysis and demonstrated to be located on proteins of Mr 85,000-88,000 and 36,000-51,000 by cross-linking and photoaffinity labeling techniques. The binding of {sup 125}I-OS2 to synaptic membranes was dependent on Ca2+ ions and enhanced by Zn2+ ions which inhibit phospholipase activity. Competition experiments have shown that, except for beta-bungarotoxin, a number of known toxic snake or bee phospholipases have very high affinities for the newly identified binding sites. A good correlation (r = 0.80) was observed between toxicity and affinity but not between phospholipase activity and affinity.

  15. Identification and properties of very high affinity brain membrane-binding sites for a neurotoxic phospholipase from the taipan venom

    International Nuclear Information System (INIS)

    Lambeau, G.; Barhanin, J.; Schweitz, H.; Qar, J.; Lazdunski, M.


    Four new monochain phospholipases were purified from the Oxyuranus scutellatus (taipan) venom. Three of them were highly toxic when injected into mice brain. One of these neurotoxic phospholipases, OS2, was iodinated and used in binding experiments to demonstrate the presence of two families of specific binding sites in rat brain synaptic membranes. The affinities were exceptionally high, Kd1 = 1.5 +/- 0.5 pM and Kd2 = 45 +/- 10 pM, and the maximal binding capacities were Bmax 1 = 1 +/- 0.4 and Bmax 2 = 3 +/- 0.5 pmol/mg of protein. Both binding sites were sensitive to proteolysis and demonstrated to be located on proteins of Mr 85,000-88,000 and 36,000-51,000 by cross-linking and photoaffinity labeling techniques. The binding of 125 I-OS2 to synaptic membranes was dependent on Ca2+ ions and enhanced by Zn2+ ions which inhibit phospholipase activity. Competition experiments have shown that, except for beta-bungarotoxin, a number of known toxic snake or bee phospholipases have very high affinities for the newly identified binding sites. A good correlation (r = 0.80) was observed between toxicity and affinity but not between phospholipase activity and affinity

  16. Biocontrole de Listeria monocytogenes por Pediococcus acidilactici em couve minimamente processada Biocontrol of Listeria monocytogenes by Pediococcus acidilactici in fresh-cut kale

    Directory of Open Access Journals (Sweden)

    Wanessa Altimiras Costa


    Full Text Available Este estudo avaliou um sistema de biocontrole para inibição de Listeria monocytogenes em couve minimamente processada, objetivando sua segurança durante estocagem sob refrigeração e em condições de abuso de temperatura. O potencial inibitório de bactérias láticas tolerantes ao sal e psicrotróficas contaminantes naturais da couve e Lactobacillus plantarum, Lactobacillus delbrueckii ATCC 9649 e Lactobacillus casei CCT 1465 foram avaliadas contra L. monocytogenes. O isolado de couve identificado como P. acidilactici CCA3 inibiu L. monocytogenes a 10 e 15 °C em ágar MRS e foi selecionado como possível agente de biocontrole. O número de L. monocytogenes na couve minimamente processada aumentou 3,7 e 4,7 ciclos logarítmicos a 5 e 10 °C, respectivamente, após 20 dias de armazenamento e 4,6 ciclos logarítmicos após oito dias a 15 °C. Entretanto, quando 10(8 UFC.g-1 de P. acidilactici CCA3 foram inoculados no produto processado, o crescimento de L. monocytogenes reduziu 2,3 ciclos logarítmicos sob temperatura abusiva de 15 °C. A acidez titulável e as características sensoriais da couve não foram alteradas pela presença de CCA3 ao longo do período de vida útil. Estes resultados sugerem o potencial de aplicação dos bioconservantes na couve minimamente processada, que necessitam estar associados à refrigeração e sanitização para garantir segurança.This study evaluated a biological control system for the inhibition of Listeria monocytogenes in minimally processed kale focusing on its freshness under refrigeration and extreme temperatures. The inhibitory potential of salt and cold tolerant lactic bacteria from natural microflora of kale, Lactobacillus delbrueckii ATCC 9649, Lactobacillus plantarum, and Lactobacillus casei CCT 1465 strains were evaluated against L. monocytogenes. Pediococcus acidilactici CCA3 isolated from kale exhibited a large inhibition zone of L. monocytogenes at 10 and 15 °C in MRS agar and was

  17. Evaluation of DNA extraction methods for PCR-based detection of Listeria monocytogenes from vegetables. (United States)

    Vojkovska, H; Kubikova, I; Kralik, P


    Epidemiological data indicate that raw vegetables are associated with outbreaks of Listeria monocytogenes. Therefore, there is a demand for the availability of rapid and sensitive methods, such as PCR assays, for the detection and accurate discrimination of L. monocytogenes. However, the efficiency of PCR methods can be negatively affected by inhibitory compounds commonly found in vegetable matrices that may cause false-negative results. Therefore, the sample processing and DNA isolation steps must be carefully evaluated prior to the introduction of such methods into routine practice. In this study, we compared the ability of three column-based and four magnetic bead-based commercial DNA isolation kits to extract DNA of the model micro-organism L. monocytogenes from raw vegetables. The DNA isolation efficiency of all isolation kits was determined using a triplex real-time qPCR assay designed to specifically detect L. monocytogenes. The kit with best performance, the PowerSoil(™) Microbial DNA Isolation Kit, is suitable for the extraction of amplifiable DNA from L. monocytogenes cells in vegetable with efficiencies ranging between 29.6 and 70.3%. Coupled with the triplex real-time qPCR assay, this DNA isolation kit is applicable to the samples with bacterial loads of 10(3) bacterial cells per gram of L. monocytogenes. Several recent outbreaks of Listeria monocytogenes have been associated with the consumption of fruits and vegetables. Real-time PCR assays allow fast detection and accurate quantification of microbes. However, the success of real-time PCR is dependent on the success with which template DNA can be extracted. The results of this study suggest that the PowerSoil(™) Microbial DNA Isolation Kit can be used for the extraction of amplifiable DNA from L. monocytogenes cells in vegetable with efficiencies ranging between 29.6 and 70.3%. This method is applicable to samples with bacterial loads of 10(3) bacterial cells per gram of L. monocytogenes. © 2014

  18. In vitro activity of naturally occurring peptides (defensins against Listeria monocytogenes Ação in vitro de peptídeos naturais (defensinas sobre Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Maria da Graça F. Nascimento


    Full Text Available Autoclaved distilled water samples were inoculated with L. monocytogenes strain V7 and strain VPH-1, and incubated aerobically, at 30 C for 48 hours. Each strain was tested individually, and growth curves were determined at 1, 2, 3, 4, 5, 21, 24, and 48 hours. The growth or survival of L. monocytogenes was similar for both strains, with survivors at 24 hour-incubation. The microbicidal activity of one synthetic cationic peptide (NP-2 was examined against L. monocytogenes strain V7, in a water system. Antibacterial activity of NP-2 (1, 5, and 10 g/ml was best expressed at 60 minute-incubation, with 10 g/ml of peptide, at 30 C.Amostras de água destilada, autoclavadas, foram inoculadas com L. monocytogenes cepa V7 e cepa VPH-1, e incubadas, aerobicamente, a 30ºC por 48 horas. Cada cepa foi testada individualmente, e determinou-se curvas de crescimento a 1, 2, 3, 4, 5, 21, 24, e 48 horas. O crescimento ou sobrevivência das duas cepas foi semelhante e encontrou-se sobreviventes em 24 horas de incubação. Examinou-se a atividade bactericida de um dos peptídeos catiônicos sintéticos (NP-2 contra L. monocytogenes cepa V7, em sistema aquoso. A atividade antibacteriana de NP-2 (1, 5, and 10µg/ml foi melhor aos 60 minutos de incubação, com 10µg/ml de peptídeo, a 30 C.

  19. Romer Labs RapidChek®Listeria monocytogenes Test System for the Detection of L. monocytogenes on Selected Foods and Environmental Surfaces. (United States)

    Juck, Gregory; Gonzalez, Verapaz; Allen, Ann-Christine Olsson; Sutzko, Meredith; Seward, Kody; Muldoon, Mark T


    The Romer Labs RapidChek ® Listeria monocytogenes test system (Performance Tested Method ℠ 011805) was validated against the U.S. Department of Agriculture-Food Safety and Inspection Service Microbiology Laboratory Guidebook (USDA-FSIS/MLG), U.S. Food and Drug Association Bacteriological Analytical Manual (FDA/BAM), and AOAC Official Methods of Analysis ℠ (AOAC/OMA) cultural reference methods for the detection of L. monocytogenes on selected foods including hot dogs, frozen cooked breaded chicken, frozen cooked shrimp, cured ham, and ice cream, and environmental surfaces including stainless steel and plastic in an unpaired study design. The RapidChek method uses a proprietary enrichment media system, a 44-48 h enrichment at 30 ± 1°C, and detects L. monocytogenes on an immunochromatographic lateral flow device within 10 min. Different L. monocytogenes strains were used to spike each of the matrixes. Samples were confirmed based on the reference method confirmations and an alternate confirmation method. A total of 140 low-level spiked samples were tested by the RapidChek method after enrichment for 44-48 h in parallel with the cultural reference method. There were 88 RapidChek presumptive positives. One of the presumptive positives was not confirmed culturally. Additionally, one of the culturally confirmed samples did not exhibit a presumptive positive. No difference between the alternate confirmation method and reference confirmation method was observed. The respective cultural reference methods (USDA-FSIS/MLG, FDA/BAM, and AOAC/OMA) produced a total of 63 confirmed positive results. Nonspiked samples from all foods were reported as negative for L. monocytogenes by all methods. Probability of detection analysis demonstrated no significant differences in the number of positive samples detected by the RapidChek method and the respective cultural reference method.

  20. 9 CFR 430.4 - Control of Listeria monocytogenes in post-lethality exposed ready-to-eat products. (United States)


    ... post-lethality exposed ready-to-eat products. 430.4 Section 430.4 Animals and Animal Products FOOD... Control of Listeria monocytogenes in post-lethality exposed ready-to-eat products. (a) Listeria... comes into direct contact with a food contact surface which is contaminated with L. monocytogenes. (b...

  1. Complete genome sequence of Listeria monocytogenes strain MR310, isolated from a pastured-flock poultry farm system (United States)

    Investigation of Listeria monocytogenes transmission from environmental sources associated with pasture-raised chickens to poultry products is needed to determine ways to prevent potential foodborne illness. Here, we report the complete genome sequence of Listeria monocytogenes MR310, one of the iso...

  2. Directed evolution and targeted mutagenesis to murinize Listeria monocytogenes internalin A for enhanced infectivity in the murine oral infection model.

    LENUS (Irish Health Repository)

    Monk, Ian R


    Internalin A (InlA) is a critical virulence factor which mediates the initiation of Listeria monocytogenes infection by the oral route in permissive hosts. The interaction of InlA with the host cell ligand E-cadherin efficiently stimulates L. monocytogenes entry into human enterocytes, but has only a limited interaction with murine cells.

  3. Modelling and predicting the simultaneous growth of Listeria monocytogenes and spoilage micro-organisms in cold-smoked salmon

    DEFF Research Database (Denmark)

    Gimenez, B.; Dalgaard, Paw


    Aims: To evaluate and model the simultaneous growth of Listeria monocytogenes and spoilage micro-organisms in cold-smoked salmon.Methods and Results: Growth kinetics of L. monocytogenes, lactic acid bacteria (LAB), Enterobacteriaceae, enterococci and Photobacterium phosphoreum were determined...

  4. [Occurrence and typing of Listeria monocytogenes isolated from raw cow's milk collected on farms and from vending machines]. (United States)

    Gelbícová, T; Karpísková, R


    Evaluation of the incidence and characteristics of L. monocytogenes in samples of raw cow's milk collected on farms (bulk tank milk samples) and from vending machines. Detection of L. monocytogenes and enumeration were carried out according to EN/ISO 11290--1, 2. Strains were characterised by serotyping and macrorestriction analysis using pulsed-field gel electrophoresis. The presence of L. monocytogenes was detected in 3,2 % (11/346) of bulk tank milk samples and 1,8 % (4/219) samples of raw cow's milk from vending machines. Findings of L. monocytogenes in raw milk were sporadic. Only on one farm strains of L. monocytogenes were detected repeatedly. Thirteen strains of L. monocytogenes belonged to serotype 1/2a, two strains to serotype 1/2b and one to serotype 4b. Macrorestriction analysis revealed considerable heterogeinity of profiles, with nine different pulsotypes being detected. Pulsotype 711 was the most frequent. This pulsotype was found on three different farms. The incidence of L. monocytogenes in raw cow's milk is relatively low in the Czech Republic. The results confirmed that some clones of L. monocytogenes from raw milk are identical with food and human strains.

  5. Prevalence and methodologies for detection, characterization and subtyping of Listeria monocytogenes and L. ivanovii in foods and environmental sources

    Directory of Open Access Journals (Sweden)

    Jin-Qiang Chen


    Full Text Available Listeria monocytogenes, one of the most important foodborne pathogens, can cause listeriosis, a lethal disease for humans. L. ivanovii, which is closely related to L. monocytogenes, is also widely distributed in nature and infects mainly warm-blooded ruminants, causing economic loss. Thus, there are high priority needs for methodologies for rapid, specific, cost-effective and accurate detection, characterization and subtyping of L. monocytogenes and L. ivanovii in foods and environmental sources. In this review, we (A described L. monocytogenes and L. ivanovii, world-wide incidence of listeriosis, and prevalence of various L. monocytogenes strains in food and environmental sources; (B comprehensively reviewed different types of traditional and newly developed methodologies, including culture-based, antigen/antibody-based, LOOP-mediated isothermal amplification, matrix-assisted laser desorption ionization-time of flight-mass spectrometry, DNA microarray, and genomic sequencing for detection and characterization of L. monocytogenes in foods and environmental sources; (C comprehensively summarized different subtyping methodologies, including pulsed-field gel electrophoresis, multi-locus sequence typing, ribotyping, and phage-typing, and whole genomic sequencing etc. for subtyping of L. monocytogenes strains from food and environmental sources; and (D described the applications of these methodologies in detection and subtyping of L. monocytogenes in foods and food processing facilities.

  6. Determining If Phylogenetic Relatedness of Listeria Monocytogenes Isolates Corresponds to Persistence in Poultry Processing Plants Using Whole-Genome Sequencing (United States)

    Introduction: Controlling Listeria monocytogenes on ready-to-eat meat and poultry products and in food processing facilities is challenging. Surveys have found that some L. monocytogenes types are more persistent in processing facilities than others, but the reason is unknown. It is possible persist...

  7. Self-contained chlorine dioxide generation and delivery pods for controlling Listeria monocytogenes in model floor drains. (United States)

    Listeria monocytogenes is a foodborne pathogen that has been associated with poultry products. This organism is ubiquitous in nature and has been found to enter poultry further processing plants on incoming raw product. Once in the plant, L. monocytogenes can become a long term persistent colonize...

  8. Spatial and Temporal Factors Associated with an Increased Prevalence of Listeria monocytogenes in Spinach Fields in New York State (United States)

    Weller, Daniel; Wiedmann, Martin


    While rain and irrigation events have been associated with an increased prevalence of foodborne pathogens in produce production environments, quantitative data are needed to determine the effects of various spatial and temporal factors on the risk of produce contamination following these events. This study was performed to quantify these effects and to determine the impact of rain and irrigation events on the detection frequency and diversity of Listeria species (including L. monocytogenes) and L. monocytogenes in produce fields. Two spinach fields, with high and low predicted risks of L. monocytogenes isolation, were sampled 24, 48, 72, and 144 to 192 h following irrigation and rain events. Predicted risk was a function of the field's proximity to water and roads. Factors were evaluated for their association with Listeria species and L. monocytogenes isolation by using generalized linear mixed models (GLMMs). In total, 1,492 (1,092 soil, 334 leaf, 14 fecal, and 52 water) samples were collected. According to the GLMM, the likelihood of Listeria species and L. monocytogenes isolation from soil samples was highest during the 24 h immediately following an event (odds ratios [ORs] of 7.7 and 25, respectively). Additionally, Listeria species and L. monocytogenes isolates associated with irrigation events showed significantly lower sigB allele type diversity than did isolates associated with precipitation events (P = monocytogenes contamination. Small changes in management practices (e.g., not irrigating fields before harvest) may therefore reduce the risk of L. monocytogenes contamination of fresh produce. PMID:26116668

  9. Inhibition of Listeria monocytogenes by piscicolin 126 in milk and Camembert cheese manufactured with a thermophilic starter. (United States)

    Wan, J; Harmark, K; Davidson, B E; Hillier, A J; Gordon, J B; Wilcock, A; Hickey, M W; Coventry, M J


    The effect of bacteriocin, piscicolin 126, on the growth of Listeria monocytogenes and cheese starter bacteria was investigated in milk and in Camembert cheese manufactured from milk challenged with 10(2) cfu ml(-1) L. monocytogenes. In milk incubated at 30 degrees C, piscicolin 126 added in the range of 512-2,048 AU ml(-1) effectively inhibited growth of L. monocytogenes for more than 20 d when challenged with approximately 10(2) cfu ml(-1) L. monocytogenes. At higher challenge levels (10(4) and 10(6) cfu ml(-1)), piscicolin 126 reduced the viable count of L. monocytogenes by 4-5 log units immediately after addition of the bacteriocin; however, growth of Listeria occurred within 24 h. The minimum inhibitory concentration (MIC) of piscicolin 126 against lactic acid cheese starter bacteria was generally greater than 204,800 AU ml(-1) , and the viable count and acid production of these starter cultures in milk were not affected by the addition of 2,048 AU ml(-1) piscicolin 126. Camembert cheeses made from milk challenged with L. monocytogenes and with added piscicolin 126 showed a viable count of L. monocytogenes 3-4 log units lower than those without piscicolin 126. Inactivation of piscicolin 126 by proteolytic enzymes from cheese starter bacteria and mould together with the emergence of piscicolin 126-resistant isolates was responsible for the recovery of L. monocytogenes in the cheeses during ripening.

  10. Genes that are involved in high hydrostatic pressure treatments in a Listeria monocytogenes Scott A ctsR deletion mutant (United States)

    Listeria monocytogenes is a food-borne pathogen of significant threat to public health. High Hydrostatic Pressure (HHP) treatment can be used to control L. monocytogenes in food. The CtsR (class three stress gene repressor) protein negatively regulates the expression of class III heat shock genes....

  11. Suppression of Listeria monocytogenes by the Native Micro-Flora in Teewurst Sausage

    Directory of Open Access Journals (Sweden)

    Michline Brice


    Full Text Available Modern consumers are interested in the use of non-chemical methods to control pathogens when heat sterilization is not an option. Such is the case with teewurst sausage, a raw spreadable sausage and a popular German commodity. Although Listeria was not found in teewurst, the optimal microbial growing conditions of teewurst coupled with the ubiquity of L. monocytogenes in nature, makes the possibility of contamination of products very possible. This pilot study was conducted to examine teewurst’s native micro-flora’s ability to suppress the outgrowth of L. monocytogenes at 10 °C using standard plate counts and PCR-DGGE. Traditional plating methods showed L. monocytogenes growth significantly decreased when in competition with the teewurst’s native micro-flora (p < 0.05. The native micro-flora of the teewurst suppressed the overall growth of L. monocytogenes by an average of two logs, under these conditions. Denaturing Gradient Gel Electrophoresis (DGGE amplicons with unique banding patterns were extracted from DGGE gel for identification. Brochothrix thermosphacta and Lactobacillus curvatus were identified as a part of the teewurst’s native micro-flora. Although the native micro-flora did not decrease L. monocytogenes to below limits of detection, it was enough of a decrease to warrant further investigation.

  12. Listeria monocytogenes Growth Kinetics in Milkshakes Made from Naturally and Artificially Contaminated Ice Cream

    Directory of Open Access Journals (Sweden)

    Joelle K. Salazar


    Full Text Available This study assessed the growth of Listeria monocytogenes in milkshakes made using the process-contaminated ice cream associated with a listeriosis outbreak in comparison to milkshakes made with artificially contaminated ice cream. For all temperatures, growth kinetics including growth rates, lag phases, maximum populations, and population increases were determined for the naturally and artificially derived contaminants at 5, 10, 15, and 25°C storage for 144 h. The artificially inoculated L. monocytogenes presented lower growth rates and shorter lag phases than the naturally contaminated populations at all temperatures except for 5°C, where the reverse was observed. At 25°C, lag phases of the naturally and artificially contaminated L. monocytogenes were 11.6 and 7.8 h, respectively. The highest increase in population was observed for the artificially inoculated pathogen at 15°C after 96 h (6.16 log CFU/mL of storage. Growth models for both contamination states in milkshakes were determined. In addition, this study evaluated the antimicrobial effectiveness of flavoring agents, including strawberry, chocolate and mint, on the growth of the pathogen in milkshakes during 10°C storage. All flavor additions resulted in decreased growth rates of L. monocytogenes for both contamination states. The addition of chocolate and mint flavoring also resulted in significantly longer lag phases for both contamination states. This study provides insight into the differences in growth between naturally and artificially contaminated L. monocytogenes in a food product.

  13. Effect of gamma-irradiation on the survival of Listeria monocytogenes and allergenicity of cherry tomatoes

    International Nuclear Information System (INIS)

    Todoriki, Setsuko; Bari, Latiful; Kitta, Kazumi; Ohba, Mika; Ito, Yasuhiro; Tsujimoto, Yuka; Kanamori, Norihito; Yano, Erika; Moriyama, Tatsuya; Kawamura, Yukio; Kawamoto, Shinichi


    The presence of Listeria monocytogenes in fresh produce is a growing concern because of the possibility of food-borne illness. Ionizing radiation is an effective non-thermal means of eliminating pathogenic bacteria in fresh produce; however, the effect of ionizing irradiation on the allergenic properties of the host commodities remains unknown. This study aimed (i) to determine the effective dose of gamma-irradiation in eliminating L. monocytogenes on whole cherry tomatoes and (ii) to evaluate the effect of gamma-irradiation on the allergenic properties of tomato proteins. Cherry tomatoes that were inoculated with a mixture of five L. monocytogenes strains were treated with gamma-rays from a 60 Co source. A 1.25 kGy dose of gamma-irradiation was found to be sufficient to eliminate L. monocytogenes on whole cherry tomatoes. The immunoblot profile of serum samples obtained from two patients with tomato allergy revealed that gamma-irradiation did not affect the allergenicity of tomato proteins for up to 7 days after irradiation when the tomatoes were stored at 20 deg. C. Additionally, the m-RNA levels of β-fructofuranosidase, polygalacturonase, pectin esterase, and superoxide dismutase, the main allergenic proteins in tomato, were not affected by the applied irradiation dose. Thus, this study demonstrated that a 1.25 kGy dose of gamma-irradiation effectively eliminates L. monocytogenes on cherry tomatoes without affecting the expression of allergenic proteins in the fruits.

  14. Gamma irradiation as a means to eliminate Listeria monocytogenes from frozen chicken meat

    International Nuclear Information System (INIS)

    Kamat, A.S.; Nair, M.P.


    Cells of Listeria monocytogenes ATCC 35152 were sensitive to gamma irradiation in phosphate buffer, pH 7.00 (D 10 , dose required for 10% survival—0.15 kGy) at 0–5°C. The cells showed higher radiation survival when irradiated under frozen condition, with a D 10 of 0.3 kGy. The protection offered by shrimp/chicken/kheema homogenates (100 g litre−1) was evidenced by even higher D 10 values (0.5 kGy) at both 0–5°C and cryogenic temperature. Boneless chicken meat samples were artificially inoculated with L monocytogenes ATCC 35152 cells at low (5 × 10 3 ) colony-forming unit (cfu) g −1 and high (5 × 10 6 cfu g −1 ) concentrations and irradiated at 1, 3, 4, 6 kGy doses under cryogenic conditions. The efficacy of the radiation process was evaluated by detecting L monocytogenes during storage at 2–4°C in the irradiated samples. These studies, when repeated with three other serotypes of L monocytogenes, clearly suggested the need for a dose of 3 kGy for elimination of 10 3 cfu cells of L monocytogenes g −1 from air-packed frozen chicken meat. (author)

  15. An ecological perspective of Listeria monocytogenes biofilms in food processing facilities. (United States)

    Valderrama, Wladir B; Cutter, Catherine N


    Listeria monocytogenes can enter the food chain at virtually any point. However, food processing environments seem to be of particular importance. From an ecological point of view, food processing facilities are microbial habitats that are constantly disturbed by cleaning and sanitizing procedures. Although L. monocytogenes is considered ubiquitous in nature, it is important to recognize that not all L. monocytogenes strains appear to be equally distributed; the distribution of the organism seems to be related to certain habitats. Currently, no direct evidence exists that L. monocytogenes-associated biofilms have played a role in food contamination or foodborne outbreaks, likely because biofilm isolation and identification are not part of an outbreak investigation, or the definition of biofilm is unclear. Because L. monocytogenes is known to colonize surfaces, we suggest that contamination patterns may be studied in the context of how biofilm formation is influenced by the environment within food processing facilities. In this review, direct and indirect epidemiological and phenotypic evidence of lineage-related biofilm formation capacity to specific ecological niches will be discussed. A critical view on the development of the biofilm concept, focused on the practical implications, strengths, and weaknesses of the current definitions also is discussed. The idea that biofilm formation may be an alternative surrogate for microbial fitness is proposed. Furthermore, current research on the influence of environmental factors on biofilm formation is discussed.

  16. Antimicrobial activity of chitosan coatings and films against Listeria monocytogenes on black radish. (United States)

    Jovanović, Gordana D; Klaus, Anita S; Nikšić, Miomir P


    The antibacterial activity of chitosan coatings prepared with acetic or lactic acid, as well as of composite chitosan-gelatin films prepared with essential oils, was evaluated in fresh shredded black radish samples inoculated with Listeria monocytogenes ATCC 19115 and L. monocytogenes ATCC 19112 during seven days of storage at 4°C. The chitosan coating prepared with acetic acid showed the most effective antibacterial activity. All tested formulations of chitosan films exhibited strong antimicrobial activity on the growth of L. monocytogenes on black radish, although a higher inhibition of pathogens was achieved at higher concentrations of chitosan. The antimicrobial effect of chitosan films was even more pronounced with the addition of essential oils. Chitosan-gelatin films with thyme essential oils showed the most effective antimicrobial activity. A reduction of 2.4log10CFU/g for L. monocytogenes ATCC 19115 and 2.1log10CFU/g for L. monocytogenes ATCC 19112 was achieved in the presence of 1% chitosan film containing 0.2% of thyme essential oil after 24h of storage. Copyright © 2016 Asociación Argentina de Microbiología. Publicado por Elsevier España, S.L.U. All rights reserved.

  17. Prevalence and serotype distribution of Listeria monocytogenes isolated from foods in Montevideo-Uruguay

    Directory of Open Access Journals (Sweden)

    Valeria Braga

    Full Text Available ABSTRACT The aim of this work was to study the prevalence of Listeria monocytogenes in foods obtained in retail shops and food industries located in Montevideo-Uruguay, and to identify the serogroups of the obtained isolates. Three-thousand one-hundred and seventy-five food samples (frozen, deli meats, ready-to-eat and cheese were analyzed. The obtained isolates were serogrouped by multiplex PCR and serotyped by conventional procedure. Genetic comparisons were performed using pulsed-field gel electrophoresis on a sub-set of isolates belonging to the same serotype successively recovered from the same establishment. L. monocytogenes was isolated from 11.2% of samples. The highest prevalence was observed in frozen foods (38%, followed by cheese (10%. 1/2b and 4b were the most frequently identified serotypes. In six of 236 analyzed establishments we successively recovered L. monocytogenes isolates belonging to the same serotype. Most of them corresponded to serotype 1/2b. Pulsed-field gel electrophoresis profiles suggest that at least 33% of L. monocytogenes 1/2b isolates are genetically related and that may remain viable for prolonged periods. The observed prevalence of L. monocytogenes was lower than reported in neighboring countries. Our findings highlight the role that frozen foods may play in the spread of this pathogen, and the relevance of serotypes 1/2b and 4b.

  18. Growth, viability and architecture of biofilms of Listeria monocytogenes formed on abiotic surfaces

    Directory of Open Access Journals (Sweden)

    Fernanda Barbosa dos Reis-Teixeira

    Full Text Available Abstract The pathogenic bacterium Listeria monocytogenes can persist in food processing plants for many years, even when appropriate hygienic measures are in place, with potential for contaminating ready-to-eat products and, its ability to form biofilms on abiotic surfaces certainly contributes for the environmental persistence. In this research, L. monocytogenes was grown in biofilms up 8 days attached to stainless steel and glass surfaces, contributing for advancing the knowledge on architecture of mature biofilms, since many literature studies carried out on this topic considered only early stages of cell adhesion. In this study, biofilm populations of two strains of L. monocytogenes (serotypes 1/2a and 4b on stainless steel coupons and glass were examined using regular fluorescence microscopy, confocal laser scanning microscopy and classic culture method. The biofilms formed were not very dense and microscopic observations revealed uneven biofilm structures, with presence of exopolymeric matrix surrounding single cells, small aggregates and microcolonies, in a honeycomb-like arrangement. Moreover, planktonic population of L. monocytogenes (present in broth media covering the abiotic surface remained stable throughout the incubation time, which indicates an efficient dispersal mechanism, since the culture medium was replaced daily. In conclusion, even if these strains of L. monocytogenes were not able to form thick multilayer biofilms, it was noticeable their high persistence on abiotic surfaces, reinforcing the need to focus on measures to avoid biofilm formation, instead of trying to eradicate mature biofilms.

  19. Characterization and antibiotic susceptibility of Listeria monocytogenes isolated from poultry and red meat in Morocco

    Directory of Open Access Journals (Sweden)

    Hayat Ennaji


    Full Text Available Hayat Ennaji1,2, Mohammed Timinouni2, My Mustapha Ennaji3, Mohammed Hassar1, Nozha Cohen11Laboratoire de Microbiologie et Hygiène des Aliments et de l’Environnement, Institut Pasteur du Maroc., Casablanca, Morocco; 2Laboratoire de Microbiologie et Biologie Moléculaire, Institut Pasteur du Maroc., Casablanca, Morocco; 3Laboratoire de Virologie et Hygiène and Microbiologie., Faculté des Sciences et Techniques - Mohammedia, Université Hassan II, Mohammedia, MoroccoAbstract: This study was carried out on 426 samples of raw meats collected from butcheries and supermarkets in Casablanca, Morocco. The samples were examined for the occurrence of Listeria species. Strains of Listeria monocytogenes were characterized by several biochemical tests and confirmed by polymerase chain reaction (PCR. β-hemolytic cultures and nonhemolytic isolates were tested for biochemical properties with the Listeria API test. Among the 43 Listeria species isolates; we identified 10 strains for L. monocytogenes (23.3%, 31 strains for L. innocua (72.1% and 2 strains for L. welshimeri (4.6%. Strains of L. monocytogenes were separated by multiplex PCR; two serogroups IIb and IVb were thus differentiated. Antibiotic susceptibility of L. monocytogenes to 21 antibiotics was determined by the disk diffusion method. All isolates were susceptible to a wide range of the tested antibiotics with the exception of nalidixic acid, colistine and cephalosporins second and third generation for which they were all resistant.Keywords: antibiotic susceptibility, Listeria monocytogenes, meat, PCR

  20. Age-Dependent Differences in Systemic and Cell-Autonomous Immunity to L. monocytogenes

    Directory of Open Access Journals (Sweden)

    Ashley M. Sherrid


    Full Text Available Host defense against infection can broadly be categorized into systemic immunity and cell-autonomous immunity. Systemic immunity is crucial for all multicellular organisms, increasing in importance with increasing cellular complexity of the host. The systemic immune response to Listeria monocytogenes has been studied extensively in murine models; however, the clinical applicability of these findings to the human newborn remains incompletely understood. Furthermore, the ability to control infection at the level of an individual cell, known as “cell-autonomous immunity,” appears most relevant following infection with L. monocytogenes; as the main target, the monocyte is centrally important to innate as well as adaptive systemic immunity to listeriosis. We thus suggest that the overall increased risk to suffer and die from L. monocytogenes infection in the newborn period is a direct consequence of age-dependent differences in cell-autonomous immunity of the monocyte to L. monocytogenes. We here review what is known about age-dependent differences in systemic innate and adaptive as well as cell-autonomous immunity to infection with Listeria monocytogenes.

  1. Efficacy of household washing treatments for the control of Listeria monocytogenes on salad vegetables. (United States)

    Nastou, Aikaterini; Rhoades, Jonathan; Smirniotis, Petros; Makri, Ioanna; Kontominas, Michael; Likotrafiti, Eleni


    The efficacy of household decontamination methods at reducing Listeria monocytogenes on fresh lettuce (Lactuca sativa), cucumber (Cucumis sativus) and parsley (Petroselinum sativum) was studied. Inoculated vegetable pieces were immersed in washing solutions and surviving L. monocytogenes enumerated. Parameters investigated were storage temperature prior to washing, dipping water temperature, agitation, acetic acid concentration and immersion time. The results indicated that the storage temperature significantly affects the efficacy of dipping vegetables in water for the control of L. monocytogenes, as the reduction in count was greatest when products had been stored at cooler temperatures. Decontamination with acetic acid (up to 2.0% v/v) was shown to have some effect in most cases, but the highest observed decrease in count was 2.6 log cfu/g. Experiments investigating the effect of exposure time to acetic acid (0.5% and 1.0% v/v, up to 30 min immersion) indicated that immersing the vegetables for more than 10 min is of minimal benefit. The most significant factor affecting washing and decontamination efficacy was the vegetable itself: L. monocytogenes colonizing cucumber epidermis was far more resistant to removal by washing and to acid treatment than that on the leafy vegetables, and L. monocytogenes on parsley was the most susceptible. This shows that published decontamination experiments (often performed with lettuce) cannot necessarily be extrapolated to other vegetables. Copyright © 2012 Elsevier B.V. All rights reserved.

  2. Effect of pulmonary irradiation from inhaled 90Y on immunity to Listeria monocytogenes in mice

    International Nuclear Information System (INIS)

    Sanchez, A.; Lundgren, D.L.; McClellan, R.O.


    The immunological response of mice subjected to irradiation from particles deposited in the lungs and challenged with Listeria monocytogenes was investigated. Mice, exposed by inhalation to 90 Y (a beta-emitting radionuclide) in relatively insoluble fused aluminosilicate particles, were immunized with L. monocytogenes either before or after exposure. Two additional groups of mice were either immunized or irradiated only. A group of control mice received no irradiation or immunization. The beta radiation dose absorbed by the lungs of each mouse at time of challenge averaged 10,000 rads. Fourteen days after immunization, all mice were challenged with 2 LD 50 doses of L. monocytogenes via the respiratory route. Survival of all immunized mice either with or without exposure to 90 Y varied from 90 to 100% as compared to 10 to 20% for the mice irradiated only and for control mice through 14 days after challenge. Pulmonary clearance of inhaled L. monocytogenes during the first 4 hr after challenge was suppressed in the mice irradiated only but not in those immunized only, or in the immunized and irradiated groups, and control mice. There appeared to be a suppression of proliferation of L. monocytogenes in lungs and spleen in the immunized groups 72 hr after challenge, whereas the lungs and spleens of the mice irradiated only and the control mice had extensive bacterial invasion. It was concluded that the 10,000 rads of beta radiation absorbed by the lungs did not suppress the immune mechanisms of the immunized mice

  3. Suppression of Listeria monocytogenes by the Native Micro-Flora in Teewurst Sausage. (United States)

    Austin-Watson, Clytrice; Grant, Ar'Quette; Brice, Michline


    Modern consumers are interested in the use of non-chemical methods to control pathogens when heat sterilization is not an option. Such is the case with teewurst sausage, a raw spreadable sausage and a popular German commodity. Although Listeria was not found in teewurst, the optimal microbial growing conditions of teewurst coupled with the ubiquity of L. monocytogenes in nature, makes the possibility of contamination of products very possible. This pilot study was conducted to examine teewurst's native micro-flora's ability to suppress the outgrowth of L. monocytogenes at 10 °C using standard plate counts and PCR-DGGE. Traditional plating methods showed L. monocytogenes growth significantly decreased when in competition with the teewurst's native micro-flora ( p flora of the teewurst suppressed the overall growth of L. monocytogenes by an average of two logs, under these conditions. Denaturing Gradient Gel Electrophoresis (DGGE) amplicons with unique banding patterns were extracted from DGGE gel for identification. Brochothrix thermosphacta and Lactobacillus curvatus were identified as a part of the teewurst's native micro-flora. Although the native micro-flora did not decrease L. monocytogenes to below limits of detection, it was enough of a decrease to warrant further investigation.

  4. Effect of gamma-irradiation on the survival of Listeria monocytogenes and allergenicity of cherry tomatoes (United States)

    Todoriki, Setsuko; Bari, Latiful; Kitta, Kazumi; Ohba, Mika; Ito, Yasuhiro; Tsujimoto, Yuka; Kanamori, Norihito; Yano, Erika; Moriyama, Tatsuya; Kawamura, Yukio; Kawamoto, Shinichi


    The presence of Listeria monocytogenes in fresh produce is a growing concern because of the possibility of food-borne illness. Ionizing radiation is an effective non-thermal means of eliminating pathogenic bacteria in fresh produce; however, the effect of ionizing irradiation on the allergenic properties of the host commodities remains unknown. This study aimed (i) to determine the effective dose of gamma-irradiation in eliminating L. monocytogenes on whole cherry tomatoes and (ii) to evaluate the effect of gamma-irradiation on the allergenic properties of tomato proteins. Cherry tomatoes that were inoculated with a mixture of five L. monocytogenes strains were treated with gamma-rays from a 60Co source. A 1.25 kGy dose of gamma-irradiation was found to be sufficient to eliminate L. monocytogenes on whole cherry tomatoes. The immunoblot profile of serum samples obtained from two patients with tomato allergy revealed that gamma-irradiation did not affect the allergenicity of tomato proteins for up to 7 days after irradiation when the tomatoes were stored at 20 °C. Additionally, the m-RNA levels of β-fructofuranosidase, polygalacturonase, pectin esterase, and superoxide dismutase, the main allergenic proteins in tomato, were not affected by the applied irradiation dose. Thus, this study demonstrated that a 1.25 kGy dose of gamma-irradiation effectively eliminates L. monocytogenes on cherry tomatoes without affecting the expression of allergenic proteins in the fruits.

  5. An outbreak of an unusual strain of Listeria monocytogenes infection in North-East Scotland. (United States)

    Okpo, Emmanuel; Leith, Jayne; Smith-Palmer, Alison; Bell, John; Parks, Duncan; Browning, Fiona; Byers, Lynn; Corrigan, Helen; Webster, Diana; Karcher, Anne M; Murray, Andrew; Storey, Tom


    Listeria monocytogenes infection is an important cause of illness and hospitalization in vulnerable individuals. In the present study, we describe a community outbreak of Listeria monocytogenes in the North-East region of Scotland, which was epidemiologically, environmentally and microbiologically linked to a local meat product and ready-to-eat product manufacturer. Infected individuals were interviewed, and an environmental investigation was conducted. Clinical and environmental samples were tested by culture, and isolates were typed by fluorescent amplified fragment length polymorphism (fAFLP). Three cases of Listeria monocytogenes were linked geographically, had the same serotype (1/2a) and were indistinguishable by fAFLP type XII.6. The human, food and environmental isolates were of the same serotype and were indistinguishable by molecular typing. This is the first community outbreak of L. monocytogenes reported in Scotland since the current outbreak surveillance was established in 1996. Epidemiological and laboratory evidence indicated poor hand hygiene, unhygienic practices and cross-contamination throughout the manufacturing process of ready-to-eat foods as a possible cause of the outbreak. More stringent control of commercial food establishments that provide ready-to-eat food and the need to advise specifically vulnerable groups, e.g., pregnant women, of the risk of L. monocytogenes in ready-to-eat food is urgently needed. Copyright © 2015 King Saud Bin Abdulaziz University for Health Sciences. Published by Elsevier Ltd. All rights reserved.

  6. Glycerol metabolism induces Listeria monocytogenes biofilm formation at the air-liquid interface. (United States)

    Crespo Tapia, Natalia; den Besten, Heidy M W; Abee, Tjakko


    Listeria monocytogenes is a food-borne pathogen that can grow as a biofilm on surfaces. Biofilm formation in food-processing environments is a big concern for food safety, as it can cause product contamination through the food-processing line. Although motile aerobic bacteria have been described to form biofilms at the air-liquid interface of cell cultures, to our knowledge, this type of biofilm has not been described in L. monocytogenes before. In this study we report L. monocytogenes biofilm formation at the air-liquid interface of aerobically grown cultures, and that this phenotype is specifically induced when the media is supplemented with glycerol as a carbon and energy source. Planktonic growth, metabolic activity assays and HPLC measurements of glycerol consumption over time showed that glycerol utilization in L. monocytogenes is restricted to growth under aerobic conditions. Gene expression analysis showed that genes encoding the glycerol transporter GlpF, the glycerol kinase GlpK and the glycerol 3-phosphate dehydrogenase GlpD were upregulated in the presence of oxygen, and downregulated in absence of oxygen. Additionally, motility assays revealed the induction of aerotaxis in the presence of glycerol. Our results demonstrate that the formation of biofilms at the air-liquid interface is dependent on glycerol-induced aerotaxis towards the surface of the culture, where L. monocytogenes has access to higher concentrations of oxygen, and is therefore able to utilize this compound as a carbon source. Copyright © 2018 Elsevier B.V. All rights reserved.

  7. Adhesion to the host cell surface is sufficient to mediate Listeria monocytogenes entry into epithelial cells (United States)

    Ortega, Fabian E.; Rengarajan, Michelle; Chavez, Natalie; Radhakrishnan, Prathima; Gloerich, Martijn; Bianchini, Julie; Siemers, Kathleen; Luckett, William S.; Lauer, Peter; Nelson, W. James; Theriot, Julie A.


    The intestinal epithelium is the first physiological barrier breached by the Gram-positive facultative pathogen Listeria monocytogenes during an in vivo infection. Listeria monocytogenes binds to the epithelial host cell receptor E-cadherin, which mediates a physical link between the bacterium and filamentous actin (F-actin). However, the importance of anchoring the bacterium to F-actin through E-cadherin for bacterial invasion has not been tested directly in epithelial cells. Here we demonstrate that depleting αE-catenin, which indirectly links E-cadherin to F-actin, did not decrease L. monocytogenes invasion of epithelial cells in tissue culture. Instead, invasion increased due to increased bacterial adhesion to epithelial monolayers with compromised cell–cell junctions. Furthermore, expression of a mutant E-cadherin lacking the intracellular domain was sufficient for efficient L. monocytogenes invasion of epithelial cells. Importantly, direct biotin-mediated binding of bacteria to surface lipids in the plasma membrane of host epithelial cells was sufficient for uptake. Our results indicate that the only requirement for L. monocytogenes invasion of epithelial cells is adhesion to the host cell surface, and that E-cadherin–mediated coupling of the bacterium to F-actin is not required. PMID:28877987

  8. Identification of a Peptide-Pheromone that Enhances Listeria monocytogenes Escape from Host Cell Vacuoles (United States)

    Xayarath, Bobbi; Alonzo, Francis; Freitag, Nancy E.


    Listeria monocytogenes is a Gram-positive facultative intracellular bacterial pathogen that invades mammalian cells and escapes from membrane-bound vacuoles to replicate within the host cell cytosol. Gene products required for intracellular bacterial growth and bacterial spread to adjacent cells are regulated by a transcriptional activator known as PrfA. PrfA becomes activated following L. monocytogenes entry into host cells, however the signal that stimulates PrfA activation has not yet been defined. Here we provide evidence for L. monocytogenes secretion of a small peptide pheromone, pPplA, which enhances the escape of L. monocytogenes from host cell vacuoles and may facilitate PrfA activation. The pPplA pheromone is generated via the proteolytic processing of the PplA lipoprotein secretion signal peptide. While the PplA lipoprotein is dispensable for pathogenesis, bacteria lacking the pPplA pheromone are significantly attenuated for virulence in mice and have a reduced efficiency of bacterial escape from the vacuoles of nonprofessional phagocytic cells. Mutational activation of PrfA restores virulence and eliminates the need for pPplA-dependent signaling. Experimental evidence suggests that the pPplA peptide may help signal to L. monocytogenes its presence within the confines of the host cell vacuole, stimulating the expression of gene products that contribute to vacuole escape and facilitating PrfA activation to promote bacterial growth within the cytosol. PMID:25822753

  9. Listeria monocytogenes incidence changes and diversity in some Brazilian dairy industries and retail products. (United States)

    Oxaran, Virginie; Lee, Sarah Hwa In; Chaul, Luíza Toubas; Corassin, Carlos Humberto; Barancelli, Giovana Verginia; Alves, Virgínia Farias; de Oliveira, Carlos Augusto Fernandes; Gram, Lone; De Martinis, Elaine Cristina Pereira


    Listeria monocytogenes can cause listeriosis, a severe foodborne disease. In Brazil, despite very few reported cases of listeriosis, the pathogen has been repeatedly isolated from dairies. This has led the government to implement specific legislation to reduce the hazard. Here, we determined the incidence of L. monocytogenes in five dairies and retail products in the Southeast and Midwest regions of Brazil over eight months. Of 437 samples, three samples (0.7%) from retail and only one sample (0.2%) from the dairies were positive for L. monocytogenes. Thus, the contamination rate was significantly reduced as compared to previous studies. MultiLocus Sequence Typing (MLST) was used to determine if contamination was caused by new or persistent clones leading to the first MLST profile of L. monocytogenes from the Brazilian dairy industry. The processing environment isolate is of concern being a sequence-type (ST) 2, belonging to the lineage I responsible for the majority of listeriosis outbreaks. Also, ST3 and ST8 found in commercialized cheese have previously been reported in outbreaks. Despite the lower incidence, dairy products still pose a potential health risk and the occurrence of L. monocytogenes in dairies and retail products emphasize the need for continuous surveillance of this pathogen in the Brazilian dairy industry. Copyright © 2017 Elsevier Ltd. All rights reserved.

  10. Effect of gamma-irradiation on the survival of Listeria monocytogenes and allergenicity of cherry tomatoes

    Energy Technology Data Exchange (ETDEWEB)

    Todoriki, Setsuko [National Food Research Institute, Tsukuba, Ibaraki 305-8642 (Japan)], E-mail:; Bari, Latiful; Kitta, Kazumi; Ohba, Mika; Ito, Yasuhiro; Tsujimoto, Yuka [National Food Research Institute, Tsukuba, Ibaraki 305-8642 (Japan); Kanamori, Norihito [Japan International Research Center for Agricultural Science, Tsukuba, Ibaraki 305-8686 (Japan); Yano, Erika; Moriyama, Tatsuya; Kawamura, Yukio [School of Agriculture, Kinki University, Nara-city, Nara 631-8505 (Japan); Kawamoto, Shinichi [National Food Research Institute, Tsukuba, Ibaraki 305-8642 (Japan)


    The presence of Listeria monocytogenes in fresh produce is a growing concern because of the possibility of food-borne illness. Ionizing radiation is an effective non-thermal means of eliminating pathogenic bacteria in fresh produce; however, the effect of ionizing irradiation on the allergenic properties of the host commodities remains unknown. This study aimed (i) to determine the effective dose of gamma-irradiation in eliminating L. monocytogenes on whole cherry tomatoes and (ii) to evaluate the effect of gamma-irradiation on the allergenic properties of tomato proteins. Cherry tomatoes that were inoculated with a mixture of five L. monocytogenes strains were treated with gamma-rays from a {sup 60}Co source. A 1.25 kGy dose of gamma-irradiation was found to be sufficient to eliminate L. monocytogenes on whole cherry tomatoes. The immunoblot profile of serum samples obtained from two patients with tomato allergy revealed that gamma-irradiation did not affect the allergenicity of tomato proteins for up to 7 days after irradiation when the tomatoes were stored at 20 deg. C. Additionally, the m-RNA levels of {beta}-fructofuranosidase, polygalacturonase, pectin esterase, and superoxide dismutase, the main allergenic proteins in tomato, were not affected by the applied irradiation dose. Thus, this study demonstrated that a 1.25 kGy dose of gamma-irradiation effectively eliminates L. monocytogenes on cherry tomatoes without affecting the expression of allergenic proteins in the fruits.

  11. Growth, viability and architecture of biofilms of Listeria monocytogenes formed on abiotic surfaces. (United States)

    Reis-Teixeira, Fernanda Barbosa Dos; Alves, Virgínia Farias; de Martinis, Elaine Cristina Pereira

    The pathogenic bacterium Listeria monocytogenes can persist in food processing plants for many years, even when appropriate hygienic measures are in place, with potential for contaminating ready-to-eat products and, its ability to form biofilms on abiotic surfaces certainly contributes for the environmental persistence. In this research, L. monocytogenes was grown in biofilms up 8 days attached to stainless steel and glass surfaces, contributing for advancing the knowledge on architecture of mature biofilms, since many literature studies carried out on this topic considered only early stages of cell adhesion. In this study, biofilm populations of two strains of L. monocytogenes (serotypes 1/2a and 4b) on stainless steel coupons and glass were examined using regular fluorescence microscopy, confocal laser scanning microscopy and classic culture method. The biofilms formed were not very dense and microscopic observations revealed uneven biofilm structures, with presence of exopolymeric matrix surrounding single cells, small aggregates and microcolonies, in a honeycomb-like arrangement. Moreover, planktonic population of L. monocytogenes (present in broth media covering the abiotic surface) remained stable throughout the incubation time, which indicates an efficient dispersal mechanism, since the culture medium was replaced daily. In conclusion, even if these strains of L. monocytogenes were not able to form thick multilayer biofilms, it was noticeable their high persistence on abiotic surfaces, reinforcing the need to focus on measures to avoid biofilm formation, instead of trying to eradicate mature biofilms. Copyright © 2017. Published by Elsevier Editora Ltda.

  12. Listeria monocytogenes Growth Kinetics in Milkshakes Made from Naturally and Artificially Contaminated Ice Cream. (United States)

    Salazar, Joelle K; Bathija, Vriddi M; Carstens, Christina K; Narula, Sartaj S; Shazer, Arlette; Stewart, Diana; Tortorello, Mary Lou


    This study assessed the growth of Listeria monocytogenes in milkshakes made using the process-contaminated ice cream associated with a listeriosis outbreak in comparison to milkshakes made with artificially contaminated ice cream. For all temperatures, growth kinetics including growth rates, lag phases, maximum populations, and population increases were determined for the naturally and artificially derived contaminants at 5, 10, 15, and 25°C storage for 144 h. The artificially inoculated L. monocytogenes presented lower growth rates and shorter lag phases than the naturally contaminated populations at all temperatures except for 5°C, where the reverse was observed. At 25°C, lag phases of the naturally and artificially contaminated L. monocytogenes were 11.6 and 7.8 h, respectively. The highest increase in population was observed for the artificially inoculated pathogen at 15°C after 96 h (6.16 log CFU/mL) of storage. Growth models for both contamination states in milkshakes were determined. In addition, this study evaluated the antimicrobial effectiveness of flavoring agents, including strawberry, chocolate and mint, on the growth of the pathogen in milkshakes during 10°C storage. All flavor additions resulted in decreased growth rates of L. monocytogenes for both contamination states. The addition of chocolate and mint flavoring also resulted in significantly longer lag phases for both contamination states. This study provides insight into the differences in growth between naturally and artificially contaminated L. monocytogenes in a food product.

  13. Rapid detection of Listeria monocytogenes in milk using confocal micro-Raman spectroscopy and chemometric analysis. (United States)

    Wang, Junping; Xie, Xinfang; Feng, Jinsong; Chen, Jessica C; Du, Xin-jun; Luo, Jiangzhao; Lu, Xiaonan; Wang, Shuo


    Listeria monocytogenes is a facultatively anaerobic, Gram-positive, rod-shape foodborne bacterium causing invasive infection, listeriosis, in susceptible populations. Rapid and high-throughput detection of this pathogen in dairy products is critical as milk and other dairy products have been implicated as food vehicles in several outbreaks. Here we evaluated confocal micro-Raman spectroscopy (785 nm laser) coupled with chemometric analysis to distinguish six closely related Listeria species, including L. monocytogenes, in both liquid media and milk. Raman spectra of different Listeria species and other bacteria (i.e., Staphylococcus aureus, Salmonella enterica and Escherichia coli) were collected to create two independent databases for detection in media and milk, respectively. Unsupervised chemometric models including principal component analysis and hierarchical cluster analysis were applied to differentiate L. monocytogenes from Listeria and other bacteria. To further evaluate the performance and reliability of unsupervised chemometric analyses, supervised chemometrics were performed, including two discriminant analyses (DA) and soft independent modeling of class analogies (SIMCA). By analyzing Raman spectra via two DA-based chemometric models, average identification accuracies of 97.78% and 98.33% for L. monocytogenes in media, and 95.28% and 96.11% in milk were obtained, respectively. SIMCA analysis also resulted in satisfied average classification accuracies (over 93% in both media and milk). This Raman spectroscopic-based detection of L. monocytogenes in media and milk can be finished within a few hours and requires no extensive sample preparation. Copyright © 2015 Elsevier B.V. All rights reserved.

  14. Growth characteristics of Listeria monocytogenes as affected by a native microflora in cooked ham under refrigerated and temperature abuse conditions. (United States)

    Hwang, Cheng-An; Sheen, Shiowshuh


    This study examined the growth characteristics of Listeria monocytogenes as affected by a native microflora in cooked ham at refrigerated and abuse temperatures. A five-strain mixture of L. monocytogenes and a native microflora, consisting of Brochothrix spp., isolated from cooked meat were inoculated alone (monocultured) or co-inoculated (co-cultured) onto cooked ham slices. The growth characteristics, lag phase duration (LPD, h), growth rate (GR, log(10) cfu/h), and maximum population density (MPD, log(10) cfu/g), of L. monocytogenes and the native microflora in vacuum-packed ham slices stored at 4, 6, 8, 10, and 12 °C for up to 5 weeks were determined. At 4-12 °C, the LPDs of co-cultured L. monocytogenes were not significantly different from those of monocultured L. monocytogenes in ham, indicating the LPDs of L. monocytogenes at 4-12 °C were not influenced by the presence of the native microflora. At 4-8 °C, the GRs of co-cultured L. monocytogenes (0.0114-0.0130 log(10) cfu/h) were statistically but marginally lower than those of monocultured L. monocytogenes (0.0132-0.0145 log(10) cfu/h), indicating the GRs of L. monocytogenes at 4-8 °C were reduced by the presence of the native microflora. The GRs of L. monocytogenes were reduced by 8-7% with the presence of the native microflora at 4-8 °C, whereas there was less influence of the native microflora on the GRs of L. monocytogenes at 10 and 12 °C. The MPDs of L. monocytogenes at 4-8 °C were also reduced by the presence of the native microflora. Data from this study provide additional information regarding the growth suppression of L. monocytogenes by the native microflora for assessing the survival and growth of L. monocytogenes in ready-to-eat meat products. Published by Elsevier Ltd.

  15. Local Outbreak of Listeria monocytogenes Serotype 4b Sequence Type 6 Due to Contaminated Meat Pâté. (United States)

    Althaus, Denise; Jermini, Marco; Giannini, Petra; Martinetti, Gladys; Reinholz, Danuta; Nüesch-Inderbinen, Magdalena; Lehner, Angelika; Stephan, Roger


    In January and February 2016, five cases of confirmed and two cases of probable infection due to Listeria monocytogenes serotype 4b, sequence type (ST) 6 belonging to a single pulsed-field gel electrophoresis pulsotype pattern were registered in a region of southern Switzerland. L. monocytogenes was detected in blood samples (four cases) and pleural fluid (one case). Furthermore, L. monocytogenes 4b ST6 was detected in a stool sample of an asymptomatic person exposed to a common food. Forthwith, the food safety authority and a local gourmet meat producer reported L. monocytogenes contamination of meat pâté. Analysis of further food and environmental samples from the premises of the producer yielded isolates matching the clinical strains and confirmed the presence of L. monocytogenes 4b ST6 in the mincing machine as the cause of the food contamination.

  16. Sensitive enumeration of Listeria monocytogenes and other Listeria species in various naturally contaminated matrices using a membrane filtration method. (United States)

    Barre, Léna; Brasseur, Emilie; Doux, Camille; Lombard, Bertrand; Besse, Nathalie Gnanou


    For the enumeration of Listeria monocytogenes (L. monocytogenes) in food, a sensitive enumeration method has been recently developed. This method is based on a membrane filtration of the food suspension followed by transfer of the filter on a selective medium to enumerate L. monocytogenes. An evaluation of this method was performed with several categories of foods naturally contaminated with L. monocytogenes. The results obtained with this technique were compared with those obtained from the modified reference EN ISO 11290-2 method for the enumeration of L. monocytogenes in food, and are found to provide more precise results. In most cases, the filtration method enabled to examine a greater quantity of food thus greatly improving the sensitivity of the enumeration. However, it was hardly applicable to some food categories because of filtration problems and background microbiota interference. Copyright © 2014 Elsevier Ltd. All rights reserved.

  17. Gangliosides inhibit bee venom melittin cytotoxicity but not phospholipase A2-induced degranulation in mast cells

    International Nuclear Information System (INIS)

    Nishikawa, Hirofumi; Kitani, Seiichi


    Sting accident by honeybee causes severe pain, inflammation and allergic reaction through IgE-mediated anaphylaxis. In addition to this hypersensitivity, an anaphylactoid reaction occurs by toxic effects even in a non-allergic person via cytolysis followed by similar clinical manifestations. Auto-injectable epinephrine might be effective for bee stings, but cannot inhibit mast cell lysis and degranulation by venom toxins. We used connective tissue type canine mast cell line (CM-MC) for finding an effective measure that might inhibit bee venom toxicity. We evaluated degranulation and cytotoxicity by measurement of β-hexosaminidase release and MTT assay. Melittin and crude bee venom induced the degranulation and cytotoxicity, which were strongly inhibited by mono-sialoganglioside (G M1 ), di-sialoganglioside (G D1a ) and tri-sialoganglioside (G T1b ). In contrast, honeybee venom-derived phospholipase A 2 induced the net degranulation directly without cytotoxicity, which was not inhibited by G M1 , G D1a and G T1b . For analysis of distribution of Gα q and Gα i protein by western blotting, lipid rafts were isolated by using discontinuous sucrose gradient centrifuge. Melittin disrupted the localization of Gα q and Gα i at lipid raft, but gangliosides stabilized the rafts. As a result from this cell-based study, bee venom-induced anaphylactoid reaction can be explained with melittin cytotoxicity and phospholipase A 2 -induced degranulation. Taken together, gangliosides inhibit the effect of melittin such as degranulation, cytotoxicity and lipid raft disruption but not phospholipase A 2 -induced degranulation in mast cells. Our study shows a potential of gangliosides as a therapeutic tool for anaphylactoid reaction by honeybee sting.

  18. Gangliosides inhibit bee venom melittin cytotoxicity but not phospholipase A(2)-induced degranulation in mast cells. (United States)

    Nishikawa, Hirofumi; Kitani, Seiichi


    Sting accident by honeybee causes severe pain, inflammation and allergic reaction through IgE-mediated anaphylaxis. In addition to this hypersensitivity, an anaphylactoid reaction occurs by toxic effects even in a non-allergic person via cytolysis followed by similar clinical manifestations. Auto-injectable epinephrine might be effective for bee stings, but cannot inhibit mast cell lysis and degranulation by venom toxins. We used connective tissue type canine mast cell line (CM-MC) for finding an effective measure that might inhibit bee venom toxicity. We evaluated degranulation and cytotoxicity by measurement of β-hexosaminidase release and MTT assay. Melittin and crude bee venom induced the degranulation and cytotoxicity, which were strongly inhibited by mono-sialoganglioside (G(M1)), di-sialoganglioside (G(D1a)) and tri-sialoganglioside (G(T1b)). In contrast, honeybee venom-derived phospholipase A(2) induced the net degranulation directly without cytotoxicity, which was not inhibited by G(M1), G(D1a) and G(T1b). For analysis of distribution of Gα(q) and Gα(i) protein by western blotting, lipid rafts were isolated by using discontinuous sucrose gradient centrifuge. Melittin disrupted the localization of Gα(q) and Gα(i) at lipid raft, but gangliosides stabilized the rafts. As a result from this cell-based study, bee venom-induced anaphylactoid reaction can be explained with melittin cytotoxicity and phospholipase A(2)-induced degranulation. Taken together, gangliosides inhibit the effect of melittin such as degranulation, cytotoxicity and lipid raft disruption but not phospholipase A(2)-induced degranulation in mast cells. Our study shows a potential of gangliosides as a therapeutic tool for anaphylactoid reaction by honeybee sting. Copyright © 2011 Elsevier Inc. All rights reserved.

  19. Effect of oral antiseptic agents on phospholipase and proteinase enzymes of Candida albicans. (United States)

    Uygun-Can, Banu; Kadir, Tanju; Gumru, Birsay


    Candida-associated denture stomatitis is the most prevalent form of oral candida infections among the denture wearers. Generally, antiseptic oral rinses used in the treatment of these infections are considered as an adjunct or alternative antifungal treatment. Studies have suggested that the intraoral concentrations of antiseptics decrease substantially to the sub-therapeutic levels on account of the dynamics of the oral cavity. This condition yields the question about the minimum antiseptic concentration that effect the character or pathogenesis of Candida during treatment. The extracellular phospholipase and proteinase enzymes of Candida albicans are regarded to have a crucial role in the pathogenesis of human fungal infections. Therefore, the aim of this study was to investigate the effect of different sub-therapeutic concentrations of chlorhexidine gluconate, hexetidine and triclosan on the production of these enzymes by C. albicans strains isolated from 20 patients with denture stomatitis. Phospholipase test was done by using Sabouraud dextrose agar with egg yolk, proteinase test was done by using bovine serum albumin agar. Phospholipase test was done by using Sabouraud dextrose agar with egg yolk, proteinase test was done by using bovine serum albumin agar. Exoenzyme production of 20 strains which were brief exposured to sub-therapeutic concentrations of three antiseptic agents decreased significantly compared with the strains that were not exposured with antiseptic values (pantiseptics (pantiseptic was compared, there were no significant differences between enzymatic activities (p>0.05). The results of this study show that sub-therapeutic levels of each antiseptic may modulate candidal exoenzyme production, consequently suppressing pathogenicity of C. albicans. Copyright © 2015 Elsevier Ltd. All rights reserved.

  20. Non-specific phospholipase C4 mediates response to aluminum toxicity in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Přemysl ePejchar


    Full Text Available Aluminum ions (Al have been recognized as a major toxic factor for crop production in acidic soils. The first indication of the Al toxicity in plants is the cessation of root growth, but the mechanism of root growth inhibition is largely unknown. Here we examined the impact of Al on the expression, activity and function of the non-specific phospholipase C4 (NPC4, a plasma membrane-bound isoform of NPC, a member of the plant phospholipase family, in Arabidopsis thaliana.We observed a lower expression of NPC4 using GUS assay and a decreased formation of labeled diacylglycerol, product of NPC activity, using fluorescently labeled phosphatidylcholine as a phospholipase substrate in Arabidopsis WT seedlings treated with AlCl3 for 2 h. The effect on in situ NPC activity persisted for longer Al treatment periods (8, 14 h. Interestingly, in seedlings overexpressing NPC4, the Al-mediated NPC-inhibiting effect was alleviated at 14 h. However, in vitro activity and localization of NPC4 were not affected by Al, thus excluding direct inhibition by Al ions or possible translocation of NPC4 as the mechanisms involved in NPC-inhibiting effect. Furthermore, the growth of tobacco pollen tubes rapidly arrested by Al was partially rescued by the overexpression of AtNPC4 while Arabidopsis npc4 knockout lines were found to be more sensitive to Al stress during long-term exposure of Al at low phosphate conditions.Our observations suggest that NPC4 plays a role in both early and long-term responses to Al stress.

  1. Phospholipase D1 increases Bcl-2 expression during neuronal differentiation of rat neural stem cells. (United States)

    Park, Shin-Young; Ma, Weina; Yoon, Sung Nyo; Kang, Min Jeong; Han, Joong-Soo


    We studied the possible role of phospholipase D1 (PLD1) in the neuronal differentiation, including neurite formation of neural stem cells. PLD1 protein and PLD activity increased during neuronal differentiation. Bcl-2 also increased. Downregulation of PLD1 by transfection with PLD1 siRNA or a dominant-negative form of PLD1 (DN-PLD1) inhibited both neurite outgrowth and Bcl-2 expression. PLD activity was dramatically reduced by a PLCγ (phospholipase Cγ) inhibitor (U73122), a Ca(2+)chelator (BAPTA-AM), and a PKCα (protein kinase Cα) inhibitor (RO320432). Furthermore, treatment with arachidonic acid (AA) which is generated by the action of PLA2 (phospholipase A2) on phosphatidic acid (a PLD1 product), increased the phosphorylation of p38 MAPK and CREB, as well as Bcl-2 expression, indicating that PLA2 is involved in the differentiation process resulting from PLD1 activation. PGE2 (prostaglandin E2), a cyclooxygenase product of AA, also increased during neuronal differentiation. Moreover, treatment with PGE2 increased the phosphorylation of p38 MAPK and CREB, as well as Bcl-2 expression, and this effect was inhibited by a PKA inhibitor (Rp-cAMP). As expected, inhibition of p38 MAPK resulted in loss of CREB activity, and when CREB activity was blocked with CREB siRNA, Bcl-2 production also decreased. We also showed that the EP4 receptor was required for the PKA/p38MAPK/CREB/Bcl-2 pathway. Taken together, these observations indicate that PLD1 is activated by PLCγ/PKCα signaling and stimulate Bcl-2 expression through PLA2/Cox2/EP4/PKA/p38MAPK/CREB during neuronal differentiation of rat neural stem cells.

  2. Genetic characteristics of Japanese clinical Listeria monocytogenes isolates.

    Directory of Open Access Journals (Sweden)

    Satoko Miya

    Full Text Available Listeria monocytogenes causes foodborne illnesses through consumption of ready-to-eat foods. Although 135-201annual listeriosis cases have been estimated in Japan, the details regarding the clinical isolates such as infection source, virulence level, and other genetic characteristics, are not known. In order to uncover the trends of listeriosis in Japan and use the knowledge for prevention measures to be taken, the genetic characteristics of the past human clinical isolates needs to be elucidated. For this purpose, multilocus tandem-repeat sequence analysis (MLTSA and multi-virulence-locus sequence typing (MVLST were used in this study. The clinical isolates showed a variety of genetically distant genotypes, indicating they were from sporadic cases. However, the MVLST profiles of 7 clinical isolates were identical to those of epidemic clone (EC I isolates, which have caused several serious outbreaks in other countries, suggesting the possibility that they have strong virulence potential and originated from a single outbreak. Moreover, 6 Japanese food isolates shared their genotypes with ECI isolates, indicating that there may be risks for listeriosis outbreak in Japan. This is the first investigational study on genetic characteristics of Japanese listeriosis isolates. The listeriosis cases happened in the past are presumably sporadic, but it is still possible that some isolates with strong virulence potential have caused listeriosis outbreaks, and future listeriosis risks also exist.

  3. OrfX, a Nucleomodulin Required for Listeria monocytogenes Virulence

    Directory of Open Access Journals (Sweden)

    Andrzej Prokop


    Full Text Available Listeria monocytogenes is a bacterial pathogen causing severe foodborne infections in humans and animals. Listeria can enter into host cells and survive and multiply therein, due to an arsenal of virulence determinants encoded in different loci on the chromosome. Several key Listeria virulence genes are clustered in Listeria pathogenicity island 1. This important locus also contains orfX (lmo0206, a gene of unknown function. Here, we found that OrfX is a small, secreted protein whose expression is positively regulated by PrfA, the major transcriptional activator of Listeria virulence genes. We provide evidence that OrfX is a virulence factor that dampens the oxidative response of infected macrophages, which contributes to intracellular survival of bacteria. OrfX is targeted to the nucleus and interacts with the regulatory protein RybP. We show that in macrophages, the expression of OrfX decreases the level of RybP, which controls cellular infection. Collectively, these data reveal that Listeria targets RybP and evades macrophage oxidative stress for efficient infection. Altogether, OrfX is after LntA, the second virulence factor acting directly in the nucleus.

  4. Enzymatic hydrolysis of short-chain lecithin/long-chain phospholipid unilamellar vesicles: sensitivity of phospholipases to matrix phase state. (United States)

    Gabriel, N E; Agman, N V; Roberts, M F


    Short-chain lecithin/long-chain phospholipid unilamellar vesicles (SLUVs), unlike pure long-chain lecithin vesicles, are excellent substrates for water-soluble phospholipases. Hemolysis assays show that greater than 99.5% of the short-chain lecithin is partitioned in the bilayer. In these binary component vesicles, the short-chain species is the preferred substrate, while the long-chain phospholipid can be treated as an inhibitor (phospholipase C) or poor substrate (phospholipase A2). For phospholipase C Bacillus cereus, apparent Km and Vmax values show that bilayer-solubilized diheptanoylphosphatidylcholine (diheptanoyl-PC) is nearly as good a substrate as pure micellar diheptanoyl-PC, although the extent of short-chain lecithin hydrolysis depends on the phase state of the long-chain lipid. For phospholipase A2 Naja naja naja, both Km and Vmax values show a greater range: in a gel-state matrix, diheptanoyl-PC is hydrolyzed with micellelike kinetic parameters; in a liquid-crystalline matrix, the short-chain lecithin becomes comparable to the long-chain component. Both enzymes also show an anomalous increase in specific activity toward diheptanoyl-PC around the phase transition temperature of the long-chain phospholipid. Since the short-chain lecithin does not exhibit a phase transition, this must reflect fluctuations in head-group area or vertical motions of the short-chain lecithin caused by surrounding long-chain lecithin molecules. These results are discussed in terms of a specific model for SLUV hydrolysis and a general explanation for the "interfacial activation" observed with water-soluble phospholipases.

  5. Bee Venom Phospholipase A2: Yesterday’s Enemy Becomes Today’s Friend


    Gihyun Lee; Hyunsu Bae


    Bee venom therapy has been used to treat immune-related diseases such as arthritis for a long time. Recently, it has revealed that group III secretory phospholipase A2 from bee venom (bee venom group III sPLA2) has in vitro and in vivo immunomodulatory effects. A growing number of reports have demonstrated the therapeutic effects of bee venom group III sPLA2. Notably, new experimental data have shown protective immune responses of bee venom group III sPLA2 against a wide range of diseases inc...

  6. Membrane Restructuring by Phospholipase A2 Is Regulated by the Presence of Lipid Domains

    DEFF Research Database (Denmark)

    Leidy, Chad; Ocampo, Jackson; Duelund, Lars


    Secretory phospholipase A2 (sPLA2) catalyzes the hydrolysis of glycerophospholipids. This enzyme is sensitive to membrane structure, and its activity has been shown to increase in the presence of liquid-crystalline/gel (Lα/Lβ) lipid domains. In this work, we explore whether lipid domains can also...... without necessarily destroying the membrane. We confirm by high-performance liquid chromatography the preferential hydrolysis of DMPC within the phase coexistence region of the DMPC/DSPC phase diagram, showing that this preferential hydrolysis is accentuated close to the solidus phase boundary...

  7. Immobilization of phospholipase C for the production of ceramide from sphingomyelin hydrolysis

    DEFF Research Database (Denmark)

    Zhang, Long; Hellgren, Lars; Xu, Xuebing


    The immobilization of Clostridium perfringens phospholipase C was studied for the first time and the catalytic properties of the immobilized enzyme were investigated for the hydrolysis of sphingomyelin to produce ceramide. Ceramide is of great commercial potentials in cosmetic and pharmaceutical...... industries such as in hair and skin care products, due to its major role in maintaining the water-retaining properties of the epidermis. The feasibility of enzymatic production of ceramide through hydrolysis of sphingomyelin has previously been proven. In order to improve the reusability of the enzyme...

  8. Inhibition of phospholipase cgamma1 and cancer cell proliferation by triterpene esters from Uncaria rhynchophylla. (United States)

    Lee, J S; Kim, J; Kim, B Y; Lee, H S; Ahn, J S; Chang, Y S


    Investigation of the hooks of Uncaria rhynchophylla resulted in isolation of six phospholipase Cgamma1 (PLCgamma1) inhibitors (1-6). The structures of these compounds were elucidated as pentacyclic triterpene esters by spectroscopic and chemical analysis. Three of them, namely uncarinic acids C (1), D (2), and E (3), are newly reported as natural products. All the compounds showed dose-dependent inhibitory activities against PLCgamma1 in vitro with IC(50) values of 9.5-44.6 microM and inhibited the proliferation of human cancer cells with IC(50) values of 0.5-6.5 microg/mL.

  9. Listeria monocytogenes cross-contamination of cheese: risk throughout the food supply chain. (United States)

    Sauders, B D; D'Amico, D J


    Listeria monocytogenes has been the most common microbial cause of cheese-related recalls in both the United States and Canada in recent years. Since L. monocytogenes is inactivated by pasteurization, the majority of these cases have been linked to environmental and cross-contamination of fresh-soft, soft-ripened, and semi-soft cheeses. Cross-contamination of foods with L. monocytogenes is a continuous risk throughout the food supply chain and presents unique challenges for subsequent illness and outbreak investigations. Reports on outbreaks of listeriosis attributed to cross-contamination downstream from primary processing help highlight the critical role of epidemiological investigation coupled with coordinated molecular subtyping and surveillance in the recognition and investigation of complex foodborne outbreaks. Despite their complexity, environmental sampling throughout the supply chain coupled with improved genotyping approaches and concomitant analysis of foodborne illness epidemiological exposure data are needed to help resolve these and similar cases more rapidly and with greater confidence.

  10. Microbial diversity and structure are drivers of the biological barrier effect against Listeria monocytogenes in soil. (United States)

    Vivant, Anne-Laure; Garmyn, Dominique; Maron, Pierre-Alain; Nowak, Virginie; Piveteau, Pascal


    Understanding the ecology of pathogenic organisms is important in order to monitor their transmission in the environment and the related health hazards. We investigated the relationship between soil microbial diversity and the barrier effect against Listeria monocytogenes invasion. By using a dilution-to-extinction approach, we analysed the consequence of eroding microbial diversity on L. monocytogenes population dynamics under standardised conditions of abiotic parameters and microbial abundance in soil microcosms. We demonstrated that highly diverse soil microbial communities act as a biological barrier against L. monocytogenes invasion and that phylogenetic composition of the community also has to be considered. This suggests that erosion of diversity may have damaging effects regarding circulation of pathogenic microorganisms in the environment.

  11. The use of Listeria monocytogenes as a DNA delivery vector for cancer gene therapy.

    LENUS (Irish Health Repository)

    Tangney, Mark


    Listeria monocytogenes is an intracellular pathogen that lyses the phagosomal vacuole of infected cells, proliferates in the host cell cytoplasm and can actively enter adjacent cells. The pathogen is therefore well suited to exploitation as a vector for the delivery of DNA to target cells as the lifecycle favors cellular targeting with vector amplification and the potential for cell-to-cell spread. We have recently demonstrated DNA transfer by L. monocytogenes in growing tumors in murine models. Our approach exploited an ampicillin sensitive stain of L. monocytogenes which can be lysed through systemic administration of ampicillin to facilitate release of plasmid DNA for expression by infected mammalian cells. Here, we discuss the implications of this technology and the potential for future improvements of the system.

  12. Listeria monocytogenes incidence changes and diversity in some Brazilian dairy industries and retail products

    DEFF Research Database (Denmark)

    Oxaran, Virginie; In Lee, Sarah Hwa; Chaul, Luiza Toubas


    the incidence of L. monocytogenes in five dairies and retail products in the Southeast and Midwest regions of Brazil over eight months. Of 437 samples, three samples (0.7%) from retail and only one sample (0.2%) from the dairies were positive for L. monocytogenes. Thus, the contamination rate was significantly...... reduced as compared to previous studies. MultiLocus Sequence Typing (MLST) was used to determine if contamination was caused by new or persistent clones leading to the first MLST profile of L. monocytogenes from the Brazilian dairy industry. The processing environment isolate is of concern being...... a sequence-type (ST) 2, belonging to the lineage I responsible for the majority of listeriosis outbreaks. Also, ST3 and ST8 found in commercialized cheese have previously been reported in outbreaks. Despite the lower incidence, dairy products still pose a potential health risk and the occurrence of L...

  13. Prevalence of L. monocytogenes in environmental samples collected in dairy plants of Sassari Province, Italy

    Directory of Open Access Journals (Sweden)

    Giovanni Terrosu


    Full Text Available Listeria (L. monocytogenes is frequently isolated from food production environment and often persists in dairy plants despite vigorous sanitation regimes. In recent years several alert notifications were sent to Rapid Alert System for Food Products system as a consequence of Listeria monocytogenes contamination of ricotta cheese. After the alert of 2012, competent authority (Local Health Unit of Sassari Province organised an environmental monitoring plan with the partnership of the Institute for Experimental Veterinary Medicine of Sardinia to verify analysis of dairy plants own-check according to Regulation (EC N° 2073/05 and further modifications. In 2014 n. 665 processing areas samples of n. 50 dairy plants of Sassari Province were examined. UNI EN ISO 11290-1:2005 for detection of L. monocytogenes was used. Non-compliance in n. 5 diary plants are observed (n. 8 positive samples. Post-non-compliance environmental sanitisation was efficient and own-check plans included appropriate corrective actions.

  14. Use Carum copticum essential oil for controlling the Listeria monocytogenes growth in fish model system

    Directory of Open Access Journals (Sweden)

    Soghra Rabiey


    Full Text Available This study was conducted to evaluate the antibacterial effect of Carum copticum essential oil (Ajowan EO against Listeria monocytogenes in fish model system. Ajowan EO chemical composition was determined by gas chromatography/mass spectral analysis and the highest concentration of Carum copticum essential oil without any significant changes on sensory properties of kutum fish (Rutilus frisii kutum was assigned. Then the inhibitory effect of Ajowan EO at different concentrations in presence of salt and smoke component was tested on L. monocytogenes growth in fish peptone broth (FPB, kutum broth and cold smoked kutum broth at 4 ºC for 12 days. Ajowan EO completely decreased the number of L. monocytogenes in FPB after 12 days of storage, however, antimicrobial effect of EO significantly reduced in kutum and cold smoked kutum broth. Addition of 4% NaCl and smoke component improved the anti-listerial activity of Ajowan EO in all fish model broths.

  15. Triclosan-Induced Aminoglycoside-Tolerant Listeria monocytogenes Isolates Can Appear as Small-Colony Variants

    DEFF Research Database (Denmark)

    Kastbjerg, Vicky Gaedt; Hein-Kristensen, Line; Gram, Lone


    Exposure of the human food-borne pathogen Listeria monocytogenes to sublethal concentrations of triclosan can cause resistance to several aminoglycosides. Aminoglycoside-resistant isolates exhibit two colony morphologies: normal-size and pinpoint colonies. The purposes of the present study were...... to characterize the small colonies of L. monocytogenes and to determine if specific genetic changes could explain the triclosan-induced aminoglycoside resistance in both pinpoint and normal-size isolates. Isolates from the pinpoint colonies grew poorly under aerated conditions, but growth was restored by addition......I and that exposure to triclosan can cause resistance to antibiotics that enters the cell via active transport. Further studies are needed to elucidate if L. monocytogenes pinpoint isolates could have any clinical impact, e.g., in persistent infections....

  16. Effect of starter cultures on survival of Listeria monocytogenes in Čajna sausage (United States)

    Bošković, M.; Tadić, V.; Đorđević, J.; Glišić, M.; Lakićević, B.; Dimitrijević, M.; Baltić, M. Ž.


    The aim of the study was to evaluate the survival of Listeria monocytogenes during the production of Čajna sausage with short maturation time. Sausage batter was inoculated with three different serotypes 4b and serotype 1/2a of L. monocytogenes. Control sausages were without any starter culture added; the second batch was inoculated with strains of Lactobacillus sakei, Staphylococcus carnosus and Staphylococcus xylosus, and the third batch was inoculated with strains of Debaryomyces hansenii, Lactobacillus sakei, Pediococcus acidilactici, Pediococcus pentosaceus, Staphylococcus carnosus and Staphylococcus xylosus. After 18 days of ripening, L. monocytogenes was not detected in any of the sausages, but during this fermentation and drying, the numbers of this pathogen was lower in the sausages inoculated with starter cultures.

  17. Changes in gene expression during adaptation of Listeria monocytogenes to the soil environment. (United States)

    Piveteau, Pascal; Depret, Géraldine; Pivato, Barbara; Garmyn, Dominique; Hartmann, Alain


    Listeria monocytogenes is a ubiquitous opportunistic pathogen responsible for listeriosis. In order to study the processes underlying its ability to adapt to the soil environment, whole-genome arrays were used to analyse transcriptome modifications 15 minutes, 30 minutes and 18 h after inoculation of L. monocytogenes EGD-e in soil extracts. Growth was observed within the first day of incubation and large numbers were still detected in soil extract and soil microcosms one year after the start of the experiment. Major transcriptional reprofiling was observed. Nutrient acquisition mechanisms (phosphoenolpyruvate-dependent phosphotransferase systems and ABC transporters) and enzymes involved in catabolism of specific carbohydrates (β-glucosidases; chitinases) were prevalent. This is consistent with the overrepresentation of the CodY regulon that suggests that in a nutrient depleted environment, L. monocytogenes recruits its extensive repertoire of transporters to acquire a range of substrates for energy production.

  18. A putative ABC transporter is involved in negative regulation of biofilm formation by Listeria monocytogenes

    DEFF Research Database (Denmark)

    Zhu, Xinna; Long, Fei; Chen, Yonghui


    Listeria monocytogenes may persist for long periods in food processing environments. In some instances, this may be due to aggregation or biofilm formation. To investigate the mechanism controlling biofilm formation in the food-borne pathogen L. monocytogenes, we characterized LM-49, a mutant...... with enhanced ability of biofilm-formation generated via transposon Tn917 mutagenesis of L. monocytogenes 4b G. In this mutant, a Tn917 insertion has disrupted the coding region of the gene encoding a putative ATP binding cassette (ABC) transporter permease identical to Lmof2365_1771 (a putative ABC...... the same amount of biofilm biomass as the wild-type strain. Furthermore, transcription of the downstream lm.G_1770 was not influenced by the upstream Tn917 insertion, and the presence of Tn917 has no effect on biofilm formation. These results suggest that lm.G_1771 was solely responsible for the negative...

  19. Infectious Dose of Listeria monocytogenes in Outbreak Linked to Ice Cream, United States, 2015. (United States)

    Pouillot, Régis; Klontz, Karl C; Chen, Yi; Burall, Laurel S; Macarisin, Dumitru; Doyle, Matthew; Bally, Kären M; Strain, Errol; Datta, Atin R; Hammack, Thomas S; Van Doren, Jane M


    The relationship between the number of ingested Listeria monocytogenes cells in food and the likelihood of developing listeriosis is not well understood. Data from an outbreak of listeriosis linked to milkshakes made from ice cream produced in 1 factory showed that contaminated products were distributed widely to the public without any reported cases, except for 4 cases of severe illness in persons who were highly susceptible. The ingestion of high doses of L. monocytogenes by these patients infected through milkshakes was unlikely if possible additional contamination associated with the preparation of the milkshake is ruled out. This outbreak illustrated that the vast majority of the population did not become ill after ingesting a low level of L. monocytogenes but raises the question of listeriosis cases in highly susceptible persons after distribution of low-level contaminated products that did not support the growth of this pathogen.

  20. Antibacterial activity of bacteriocin-like substance P34 on Listeria monocytogenes in chicken sausage

    Directory of Open Access Journals (Sweden)

    Voltaire Sant'Anna


    Full Text Available The antimicrobial activity of the bacteriocin-like substance (BLS P34 against Listeria monocytogenes was investigated in chicken sausage. The BLS was applied to chicken sausages (256 AU g-1 previously inoculated with a suspension of 10² cfu g-1 of L. monocytogenes. BLS P34 inhibited the indicator microorganism in situ in all incubation times for up to 10 days at 5 °C. The effectiveness of BLS P34 was increased when it was added in combination with nisin. The bacteriocin was also tested in natural eatable natural bovine wrapping (salty semi-dried tripe against the same indicator microorganism, also showing inhibitory capability in vitro. BLS P34 showed potential to control L. monocytogenes in refrigerated meat products.

  1. An Assessment of Different Genomic Approaches for Inferring Phylogeny of Listeria monocytogenes

    DEFF Research Database (Denmark)

    Henri, Clementine; Leekitcharoenphon, Pimlapas; Carleton, Heather A.


    Background/objectives: Whole genome sequencing (WGS) has proven to be a powerful subtyping tool for foodborne pathogenic bacteria like L. monocytogenes. The interests of genome-scale analysis for national surveillance, outbreak detection or source tracking has been largely documented. The genomic......MLPPST) or pan genome (wgMLPPST). Currently, there are little comparisons studies of these different analytical approaches. Our objective was to assess and compare different genomic methods that can be implemented in order to cluster isolates of L monocytogenes.Methods: The clustering methods were evaluated...... on a collection of 207 L. monocytogenes genomes of food origin representative of the genetic diversity of the Anses collection. The trees were then compared using robust statistical analyses.Results: The backward comparability between conventional typing methods and genomic methods revealed a near...

  2. Bradykinin and vasopressin activate phospholipase D in rat Leydig cells by a protein kinase C-dependent mechanism

    DEFF Research Database (Denmark)

    Vinggaard, Anne Marie; Hansen, Harald S.


    of PMA and vasopressin (AVP), PMA and bradykinin, or AVP and bradykinin produced no additive phosphatidylethanol or choline response, suggesting that AVP, bradykinin and PMA stimulated phospholipase D catalysed phosphatidylcholine hydrolysis by a similar protein kinase C-dependent mechanism. Furthermore......, LH (10 ng/ml), insulin (500 nmol/l), GH (100 ng/ml), interleukin-1ß (5 U/ml) and platelet-activating factor (200 nmol/l) were found not to activate phospholipase D, whereas the Ca ionophore A23187 (10 µmol/l) stimulated phosphatidylethanol formation, suggesting that Ca might be a regulator...

  3. PLA2G6, encoding a phospholipase A2, is mutated in neurodegenerative disorders with high brain iron (United States)

    Morgan, Neil V; Westaway, Shawn K; Morton, Jenny E V; Gregory, Allison; Gissen, Paul; Sonek, Scott; Cangul, Hakan; Coryell, Jason; Canham, Natalie; Nardocci, Nardo; Zorzi, Giovanna; Pasha, Shanaz; Rodriguez, Diana; Desguerre, Isabelle; Mubaidin, Amar; Bertini, Enrico; Trembath, Richard C; Simonati, Alessandro; Schanen, Carolyn; Johnson, Colin A; Levinson, Barbara; Woods, C Geoffrey; Wilmot, Beth; Kramer, Patricia; Gitschier, Jane; Maher, Eamonn R; Hayflick, Susan J


    Neurodegenerative disorders with high brain iron include Parkinson disease, Alzheimer disease and several childhood genetic disorders categorized as neuroaxonal dystrophies. We mapped a locus for infantile neuroaxonal dystrophy (INAD) and neurodegeneration with brain iron accumulation (NBIA) to chromosome 22q12-q13 and identified mutations in PLA2G6, encoding a calcium-independent group VI phospholipase A2, in NBIA, INAD and the related Karak syndrome. This discovery implicates phospholipases in the pathogenesis of neurodegenerative disorders with iron dyshomeostasis. PMID:16783378

  4. Characterization of phospholipase A2 from the pyloric ceca of two species of starfish, Coscinasterias acutispina and Plazaster borealis


    Kishimura, Hideki; Hayashi, Kenji


    Phospholipase A (PLA) activities in the pyloric ceca and viscera from seven species of marine invertebrates (four starfish, one sea urchin, and two shellfish) were determined. Relatively high PLA specific activities were found in the pyloric ceca of two species of starfish (Coscinasterias acutispina and Plazaster borealis). Phospholipase A2s (PLA2s) were partially purified from the pyloric ceca of the starfish, C. acutispina PLA2 (C-PLA2) and P. borealis PLA2 (P-PLA2). The C-PLA2 and P-PLA2 m...

  5. Novel Biocontrol Methods for Listeria monocytogenes Biofilms in Food Production Facilities

    Directory of Open Access Journals (Sweden)

    Jessica A. Gray


    Full Text Available High mortality and hospitalization rates have seen Listeria monocytogenes as a foodborne pathogen of public health importance for many years and of particular concern for high-risk population groups. Food manufactures face an ongoing challenge in preventing the entry of L. monocytogenes into food production environments (FPEs due to its ubiquitous nature. In addition to this, the capacity of L. monocytogenes strains to colonize FPEs can lead to repeated identification of L. monocytogenes in FPE surveillance. The contamination of food products requiring product recall presents large economic burden to industry and is further exacerbated by damage to the brand. Poor equipment design, facility layout, and worn or damaged equipment can result in Listeria hotspots and biofilms where traditional cleaning and disinfecting procedures may be inadequate. Novel biocontrol methods may offer FPEs effective means to help improve control of L. monocytogenes and decrease cross contamination of food. Bacteriophages have been used as a medical treatment for many years for their ability to infect and lyse specific bacteria. Endolysins, the hydrolytic enzymes of bacteriophages responsible for breaking the cell wall of Gram-positive bacteria, are being explored as a biocontrol method for food preservation and in nanotechnology and medical applications. Antibacterial proteins known as bacteriocins have been used as alternatives to antibiotics for biopreservation and food product shelf life extension. Essential oils are natural antimicrobials formed by plants and have been used as food additives and preservatives for many years and more recently as a method to prevent food spoilage by microorganisms. Competitive exclusion occurs naturally among bacteria in the environment. However, intentionally selecting and applying bacteria to effect competitive exclusion of food borne pathogens has potential as a biocontrol application. This review discusses these novel biocontrol

  6. Tolerance to quaternary ammonium compound disinfectants may enhance growth of Listeria monocytogenes in the food industry. (United States)

    Møretrø, Trond; Schirmer, Bjørn C T; Heir, Even; Fagerlund, Annette; Hjemli, Pernille; Langsrud, Solveig


    The antibacterial effect of disinfectants is crucial for the control of Listeria monocytogenes in food processing environments. Tolerance of L. monocytogenes to sublethal levels of disinfectants based on quaternary ammonium compounds (QAC) is conferred by the resistance determinants qacH and bcrABC. The presence and distribution of these genes have been anticipated to have a role in the survival and growth of L. monocytogenes in food processing environments where QAC based disinfectants are in common use. In this study, a panel of 680 L. monocytogenes from nine Norwegian meat- and salmon processing plants were grouped into 36 MLVA profiles. The presence of qacH and bcrABC was determined in 101 isolates from the 26 most common MLVA profiles. Five MLVA profiles contained qacH and two contained bcrABC. Isolates with qacH and bcrABC showed increased tolerance to the QAC Benzalkonium chloride (BC), with minimal inhibitory concentrations (MICs) of 5-12, 10-13 and 100ppm). A sample with lower BC concentrations (14ppm of chain length C-12 and 2.7ppm of chain length C-14) inhibited growth of L. monocytogenes not containing bcrABC or qacH, compared to strains with these genes. The study has shown that L. monocytogenes harbouring the QAC resistance genes qacH and bcrABC are prevalent in the food industry and that residuals of QAC may be present in concentrations after sanitation in the industry that result in a growth advantage for bacteria with such resistance genes. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

  7. A Meta-analysis of the Rates of Listeria monocytogenes and Enterococcus in Febrile Infants. (United States)

    Leazer, Rianna; Perkins, Amy M; Shomaker, Kyrie; Fine, Bryan


    A change in the epidemiology of pathogens causing serious bacterial infection (SBI) has been noted since original recommendations were made for the empirical antibiotic choices for young infants with fever. To assess the prevalence of SBI caused by Listeria monocytogenes and Enterococcus species. A literature search was conducted on keywords related to SBI, L. monocytogenes, and Enterococcus spp. infections. Eligible studies were those conducted in the United States and published between January 1998 and June 2014 focusing on SBI in infants≤90 days of age. The rates of urinary tract infection, bacteremia, and meningitis for each pathogen were recorded for each study. Meta-analysis was performed to calculate the prevalence for each pathogen in a random effects model with 0.5 continuity correction added to studies with zero events. Sixteen studies were included. A total of 20,703 blood cultures were included, with weighted prevalences for L. monocytogenes and Enterococcus spp. bacteremia of 0.03% and 0.09%, respectively. A total of 13,775 cerebrospinal fluid cultures were included with event rates (unweighted prevalences) for L. monocytogenes and Enterococcus spp. meningitis of 0.02% and 0.03%, respectively. A total of 18,283 urine cultures were included, with no cases of L. monocytogenes and a weighted prevalence for Enterococcus spp. urinary tract infection of 0.28%. There may have been reporting bias or incomplete retrieval or inadvertent exclusion of relevant studies. SBI caused by L. monocytogenes and Enterococcus spp. in febrile infants is rare, and therefore clinicians may consider a change in empirical antibiotic choices. Copyright © 2016 by the American Academy of Pediatrics.

  8. Faecal shedding and strain diversity of Listeria monocytogenes in healthy ruminants and swine in Northern Spain

    Directory of Open Access Journals (Sweden)

    Hurtado Ana


    Full Text Available Abstract Background Listeria monocytogenes is among the most important foodborne bacterial pathogens due to the high mortality rate and severity of the infection. L. monocytogenes is a ubiquitous organism occasionally present in the intestinal tract of various animal species and faecal shedding by asymptomatically infected livestock poses a risk for contamination of farm environments and raw food at the pre-harvest stages. The aim of this study was to determine the prevalence and strain diversity of L. monocytogenes in healthy ruminants and swine herds. Results Faecal samples from 30 animals per herd were collected from 343 herds (120 sheep, 124 beef cattle, 82 dairy cattle and 17 swine in the Basque Country and screened in pools by an automated enzyme-linked fluorescent immunoassay (VIDAS® to estimate the prevalence of positive herds. Positive samples were subcultured onto the selective and differential agar ALOA and biochemically confirmed. L. monocytogenes was isolated from 46.3% of dairy cattle, 30.6% beef cattle and 14.2% sheep herds, but not from swine. Within-herd prevalence investigated by individually analysing 197 sheep and 221 cattle detected 1.5% of faecal shedders in sheep and 21.3% in cattle. Serotyping of 114 isolates identified complex 4b as the most prevalent (84.2%, followed by 1/2a (13.2%, and PFGE analysis of 68 isolates showed a highly diverse L. monocytogenes population in ruminant herds. Conclusion These results suggested that cattle represent a potentially important reservoir for L. monocytogenes in the Basque Country, and highlighted the complexity of pathogen control at the farm level.

  9. Novel Biocontrol Methods for Listeria monocytogenes Biofilms in Food Production Facilities. (United States)

    Gray, Jessica A; Chandry, P Scott; Kaur, Mandeep; Kocharunchitt, Chawalit; Bowman, John P; Fox, Edward M


    High mortality and hospitalization rates have seen Listeria monocytogenes as a foodborne pathogen of public health importance for many years and of particular concern for high-risk population groups. Food manufactures face an ongoing challenge in preventing the entry of L. monocytogenes into food production environments (FPEs) due to its ubiquitous nature. In addition to this, the capacity of L. monocytogenes strains to colonize FPEs can lead to repeated identification of L. monocytogenes in FPE surveillance. The contamination of food products requiring product recall presents large economic burden to industry and is further exacerbated by damage to the brand. Poor equipment design, facility layout, and worn or damaged equipment can result in Listeria hotspots and biofilms where traditional cleaning and disinfecting procedures may be inadequate. Novel biocontrol methods may offer FPEs effective means to help improve control of L. monocytogenes and decrease cross contamination of food. Bacteriophages have been used as a medical treatment for many years for their ability to infect and lyse specific bacteria. Endolysins, the hydrolytic enzymes of bacteriophages responsible for breaking the cell wall of Gram-positive bacteria, are being explored as a biocontrol method for food preservation and in nanotechnology and medical applications. Antibacterial proteins known as bacteriocins have been used as alternatives to antibiotics for biopreservation and food product shelf life extension. Essential oils are natural antimicrobials formed by plants and have been used as food additives and preservatives for many years and more recently as a method to prevent food spoilage by microorganisms. Competitive exclusion occurs naturally among bacteria in the environment. However, intentionally selecting and applying bacteria to effect competitive exclusion of food borne pathogens has potential as a biocontrol application. This review discusses these novel biocontrol methods and their

  10. Inhibition of Listeria monocytogenes by propionic acid-based ingredients in cured deli-style Turkey. (United States)

    Glass, Kathleen A; McDonnell, Lindsey M; Von Tayson, Roxanne; Wanless, Brandon; Badvela, Mani


    Listeria monocytogenes growth can be controlled on ready-to-eat meats through the incorporation of antimicrobial ingredients into the formulation or by postlethality kill steps. However, alternate approaches are needed to provide options that reduce sodium content but maintain protection against pathogen growth in meats after slicing. The objective of this study was to determine the inhibition of L. monocytogenes by propionic acid-based ingredients in high-moisture, cured turkey stored at 4 or 7°C. Six formulations of sliced, cured (120 ppm of NaNO2 ), deli-style turkey were tested, including control without antimicrobials, 3.2% lactate-diacetate blend (LD), 0.4% of a liquid propionate-benzoate-containing ingredient, or 0.3, 0.4, and 0.5% of a liquid propionate-containing ingredient. Products were inoculated with 5 log CFU L. monocytogenes per 100-g package (3 log CFU/ml rinsate), vacuum-sealed, and stored at 4 or 7°C for up to 12 weeks; and populations were enumerated by plating on modified Oxford agar. As expected, the control without antimicrobials supported rapid growth, with >2 log average per ml rinsate increase within 4 weeks of storage at 4°C, whereas growth was observed at 6 weeks for the LD treatment. For both replicate trials, all treatments that contained liquid propionate or propionate-benzoate limited L. monocytogenes growth to an increase of 1-log increase) was observed in individual samples for all propionate-containing treatments at weeks 10, 11, and 12. As expected, L. monocytogenes grew more rapidly when products were stored at 7°C, but trends in relative inhibition were similar to those observed at 4°C. These results verify that propionate-based ingredients inhibit growth of L. monocytogenes on sliced, high-moisture, cured turkey and can be considered as an alternative to reduce sodium-based salts while maintaining food safety.

  11. Effect of citral and carvacrol on the susceptibility of Listeria monocytogenes and Listeria innocua to antibiotics. (United States)

    Zanini, S F; Silva-Angulo, A B; Rosenthal, A; Rodrigo, D; Martínez, A


    The aim of this study was to evaluate the antibiotic susceptibility of Listeria innocua (L. innocua) and Listeria monocytogenes (L. monocytogenes) cells in the presence of citral and carvacrol at sublethal concentrations in an agar medium. The presence of terpenes in the L. monocytogenes and L. innocua culture medium provided a reduction in the minimal inhibitory concentration (MIC) of all the antibiotics tested. These effects were dependent on the concentration of terpenes present in the culture medium. The combination of citral and carvacrol potentiated antibiotic activity by reducing the MIC values of bacitracin and colistin from 32.0 and 128.0 μg ml⁻¹ to 1.0 and 2.0 μg ml⁻¹, respectively. Thus, both Listeria species became more susceptible to these drugs. In this way, the colistin and bacitracin resistance of L. monocytogenes and L. innocua was reversed in the presence of terpenes. Results obtained in this study show that the phytochemicals citral and carvacrol potentiate antibiotic activity, reducing the MIC values of cultured L. monocytogenes and L. innocua. Phytochemicals citral and carvacrol potentiate antibiotic activity of erythromycin, bacitracin and colistin by reducing the MIC values of cultured Listeria monocytogenes and Listeria innocua. This effect in reducing the MIC values of the antibiotics tested in both micro-organisms was increased when natural antimicrobials were combined. This finding indicated that the combination among terpenes and antibiotic may contribute in reducing the required dosage of antibiotics due to the possible effect of terpenes on permeation barrier of the micro-organism cell membrane. © 2014 The Society for Applied Microbiology.

  12. Novel Biocontrol Methods for Listeria monocytogenes Biofilms in Food Production Facilities (United States)

    Gray, Jessica A.; Chandry, P. Scott; Kaur, Mandeep; Kocharunchitt, Chawalit; Bowman, John P.; Fox, Edward M.


    High mortality and hospitalization rates have seen Listeria monocytogenes as a foodborne pathogen of public health importance for many years and of particular concern for high-risk population groups. Food manufactures face an ongoing challenge in preventing the entry of L. monocytogenes into food production environments (FPEs) due to its ubiquitous nature. In addition to this, the capacity of L. monocytogenes strains to colonize FPEs can lead to repeated identification of L. monocytogenes in FPE surveillance. The contamination of food products requiring product recall presents large economic burden to industry and is further exacerbated by damage to the brand. Poor equipment design, facility layout, and worn or damaged equipment can result in Listeria hotspots and biofilms where traditional cleaning and disinfecting procedures may be inadequate. Novel biocontrol methods may offer FPEs effective means to help improve control of L. monocytogenes and decrease cross contamination of food. Bacteriophages have been used as a medical treatment for many years for their ability to infect and lyse specific bacteria. Endolysins, the hydrolytic enzymes of bacteriophages responsible for breaking the cell wall of Gram-positive bacteria, are being explored as a biocontrol method for food preservation and in nanotechnology and medical applications. Antibacterial proteins known as bacteriocins have been used as alternatives to antibiotics for biopreservation and food product shelf life extension. Essential oils are natural antimicrobials formed by plants and have been used as food additives and preservatives for many years and more recently as a method to prevent food spoilage by microorganisms. Competitive exclusion occurs naturally among bacteria in the environment. However, intentionally selecting and applying bacteria to effect competitive exclusion of food borne pathogens has potential as a biocontrol application. This review discusses these novel biocontrol methods and their

  13. Listeria spp. e listeria monocytogenes na produção de salsichas tipo hot dog


    Cesar, Alessandra Paro Rodrigues; Mesquita, Albenones José de; Prado, Cristiano Sales; Nunes, Iolanda Aparecida; Almeida Filho, Edivaldo Sampaio de


    v. 12, n. 2, p.339-352, abr./jun.2011. Listeria monocytogenes está amplamente distribuída no ambiente e tem sido isolada de alimentos associados a surtos de elevada letalidade, representando um risco para a saúde pública. Em alguns países, os produtos prontos para consumo, como embutidos cozidos, entre os quais as salsichas, estão associadas à listeriose humana. Considerando a relevância do tema e a necessidade de dados, analisou-se a ocorrência de Listeria spp. e L. monocytogenes na pr...

  14. Inhibition of Listeria monocytogenes by Lactobacillus bavaricus MN in beef systems at refrigeration temperatures.


    Winkowski, K; Crandall, A D; Montville, T J


    The ability of Lactobacillus bavaricus, a meat isolate, to inhibit the growth of three Listeria monocytogenes strains was examined in three beef systems: beef cubes, beef cubes in gravy, and beef cubes in gravy containing glucose. The beef was minimally heat treated, inoculated with L. bavaricus at 10(5) or 10(3) CFU/g and L. monocytogenes at 10(2) CFU/g, vacuum sealed, and stored at 4 or 10 degrees C. The meat samples were monitored for microbial growth, pH, and bacteriocin production. The p...

  15. Effect of eugenol on growth and listeriolysin o production by Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Cristina Tostes Filgueiras


    Full Text Available The inhibitory effect of eugenol, a naturally occurring compound mainly present in the essential oil fraction of cloves, was studied on the growth and listeriolysin O (LLO production by Listeria monocytogenes. Potassium efflux from cells promoted by eugenol was also determined after 24 h incubation in phosphate buffered saline. Eugenol promoted a delay on the growth of L. monocytogenes at concentrations of 100, 300 and 500 µg mL-1and above 800 µg mL-1 the effect was bactericidal. Production of LLO by L. monocytogenes in the presence of eugenol was reduced 80-100%. An accumulation of external K+ was observed above 300 µg mL-1 of eugenol which indicated that the cell membrane was affected. The results showed the effectiveness of eugenol in controlling growth and LLO production of L. monocytogenes cells.O efeito inibitório do eugenol, o principal constituinte do óleo essencial de cravo, foi avaliado sobre o crescimento e produção de listeriolisina O (LLO por Listeria monocytogenes. O efluxo de íons potássio das células também foi determinado após 24 h de incubação em solução tampão, contendo eugenol. Concentrações de 100, 300 e 500 µg mL-1 de eugenol promoveram a inibição do crescimento de L. monocytogenes e, em concentrações acima de 800 µg mL-1, constatou-se um efeito bactericida. O crescimento de L. monocytogenes na presença de eugenol resultou na inibição de 80 a 100% da produção de LLO. O efluxo de K+ promovido pelo eugenol indicou que a membrana celular foi afetada. Estes resultados indicam a efetividade do eugenol para o controle do crescimento e da produção de LLO por L. monocytogenes.

  16. Effects of irradiation on bacterial load and Listeria monocytogenes in raw chicken

    International Nuclear Information System (INIS)

    Varabioff, Y.; Mitchell, G.E.; Nottingham, S.M.


    After irradiation of chickens to a dose of 2.5 kGy, the decrease in the standard plate count (SPC) was similar in air and in vacuum-packaged chickens. During storage at 4 degrees C for 15 d, the SPC increased progressively in both types of packaged chickens. At the end of the storage period, the SPC was higher in air-packaged chicken than in vacuum-packaged chickens. In irradiated chickens, Listeria monocytogenes was only recovered from the vacuum-packaged chickens after 7 d cold storage. In unirradiated chickens, L. monocytogenes proliferated similarly in both air- and vacuum-packaged chickens

  17. Desiccation of adhering and biofilm Listeria monocytogenes on stainless steel: Survival and transfer to salmon products

    DEFF Research Database (Denmark)

    Hansen, Lisbeth Truelstrup; Vogel, Birte Fonnesbech


    The foodborne bacterial pathogen, Listeria monocytogenes, commonly contaminates foods during processing, where the microorganisms are potentially subjected to low relative humidity (RH) conditions for extended periods of time. The objective of this study was to examine survival during desiccation...... (43% RH and 15°C) of biofilm L. monocytogenes N53-1 cells on stainless steel coupons and to assess subsequent transfer to salmon products. Formation of static biofilm (2days at 100% RH and 15°C) prior to desiccation for 23days significantly (P...

  18. The challenge of setting risk-based microbiological criteria for Listeria monocytogenes

    DEFF Research Database (Denmark)

    Andersen, Jens Kirk; Nørrung, Birgit


    After more than 20 years of work with discussing the setting of microbiological criteria for Listeria monocytogenes in foods, Codex Alimentarius on Food Hygiene has finalised a proposal that was recently adopted by the Codex Alimentarius Commission. The effort of developing procedures for making...... the microbiological criteria risk-based to the greatest extent possible has challenged scientists and managers during this long time period. Yet, the establishment of microbiological criteria for L. monocytogenes is still being discussed and several approaches are possible. Setting of microbiological criteria...

  19. How the study of Listeria monocytogenes has led to new concepts in biology. (United States)

    Rolhion, Nathalie; Cossart, Pascale


    The opportunistic intracellular bacterial pathogen Listeria monocytogenes has in 30 years emerged as an exceptional bacterial model system in infection biology. Research on this bacterium has provided considerable insight into how pathogenic bacteria adapt to mammalian hosts, invade eukaryotic cells, move intracellularly, interfere with host cell functions and disseminate within tissues. It also contributed to unveil features of normal host cell pathways and unsuspected functions of previously known cellular proteins. This review provides an updated overview of our knowledge on this pathogen. In many examples, findings on L. monocytogenes provided the basis for new concepts in bacterial regulation, cell biology and infection processes.

  20. Sporadic case of listeriosis associated with the consumption of a Listeria monocytogenes-contaminated 'Camembert' cheese. (United States)

    Gilot, P; Hermans, C; Yde, M; Gigi, J; Janssens, M; Genicot, A; André, P; Wauters, G


    Listeria monocytogenes is an intracellular gram-positive organism responsible for severe infections in both humans and animals. Whereas the food-borne transmission of listeriosis was demonstrated in several outbreaks, most cases of listeriosis occur sporadically and are rarely linked with consumption of contaminated foods. In this paper a case of septicaemia with L. monocytogenes in a 73-year-old immunocompromised man is described. Evidence for the association of this case of listeriosis with the consumption of a contaminated 'Camembert' cheese is provided by serotyping, esterase typing, DNA macrorestriction patterns analysis and level of virulence of the isolated strains for mice.

  1. Survival of Listeria monocytogenes in mozzarella cheese and ice cream exposed to gamma irradiation

    International Nuclear Information System (INIS)

    Hashisaka, A.E.; Weagant, S.D.; Dong, F.M.


    The survival of Listeria monocytogenes preinoculated into ice cream and mozzarella cheese prior to gamma-irradiation treatment was determined. Samples were maintained at -78 degrees C and exposed to targeted doses of 2, 4, 8, 16, and 32 kGy of gamma-irradiation. The calculated D10 values were 1.4 kGy for mozzarella cheese and 2.0 kGy for ice cream. The effective level of irradiation (12D) for inactivating L. monocytogenes was 16.8 kGy for mozzarella cheese and 24.4 kGy for ice cream

  2. Modeling the high pressure inactivation kinetics of Listeria monocytogenes on RTE cooked meat products

    DEFF Research Database (Denmark)

    Hereu, A.; Dalgaard, Paw; Garriga, M.


    High pressure (HP) inactivation curves of Listeria monocytogenes CTC1034 (ca. 107CFU/g) on sliced RTE cooked meat products (ham and mortadella) were obtained at pressures from 300 to 800MPa. A clear tail shape was observed at pressures above 450MPa and the log-linear with tail primary model...... provided the best fit to the HP-inactivation kinetics. The relationships between the primary kinetic parameters (log kmax and log Nres) and pressure treatments were described by a polynomial secondary model. To estimate HP-inactivation of L. monocytogenes in log (N/N0) over time, a one-step global fitting...

  3. Long-wave ultraviolet light induces phospholipase activation in cultured human epidermal keratinocytes

    International Nuclear Information System (INIS)

    Hanson, D.; DeLeo, V.


    Long wave ultraviolet radiation (UVA) has been shown to play an important role in the overall response of skin to solar radiation, including sunburn, tanning, premature aging, and non-melanoma skin cancer. UVA induction of inflammation in human skin is thought to be mediated by membrane lipid derived products. In order to investigate the mechanism of this response we examined the effect of UVA on phospholipid metabolism of human epidermal keratinocytes in culture. Keratinocytes were grown in serum free low calcium medium. The cells were prelabeled with [3H] arachidonic acid or [3H] choline and irradiated with UVA (Honle 2002-Hg vapor lamp). Identification and quantitation of specific membrane phospholipid-derived components was achieved using high-performance liquid chromatography, paper chromatography, and radioimmunoassay. UVA resulted in a linear dose dependent release of [3H] arachidonic acid into medium between 1 and 20 joule/cm2. This response was inhibited in an oxygen-reduced environment. The radiolabel released was predominantly free arachidonate and cyclooxygenase metabolites. Cyclooxygenase metabolites prostaglandin E2 and prostacyclin derivative, 6-keto-prostaglandin F1a, were stimulated following UVA irradiation, but the lipoxygenase metabolite, leukotriene B was not detected. Maximal release was measured immediately after irradiation and changed little over 24 h post-irradiation. UVA stimulated an increase of [3H] choline metabolites glycerophosphorylcholine and phosphorylcholine in media extracts suggesting UVA activation of phospholipase C and phospholipase A2 or diacylglyceride lipase

  4. Efficient Extracellular Expression of Phospholipase D in Escherichia Coli with an Optimized Signal Peptide (United States)

    Yang, Leyun; Xu, Yu; Chen, Yong; Ying, Hanjie


    New secretion vectors containing the synthetic signal sequence (OmpA’) was constructed for the secretory production of recombinant proteins in Escherichia coli. The E. coli Phospholipase D structural gene (Accession number:NC_018658) fused to various signal sequence were expressed from the Lac promoter in E. coli Rosetta strains by induction with 0.4mM IPTG at 28°C for 48h. SDS-PaGe analysis of expression and subcellular fractions of recombinant constructs revealed the translocation of Phospholipase D (PLD) not only to the medium but also remained in periplasm of E. coli with OmpA’ signal sequence at the N-terminus of PLD. Thus the study on the effects of various surfactants on PLD extracellular production in Escherichia coli in shake flasks revealed that optimal PLD extracellular production could be achieved by adding 0.4% Triton X-100 into the medium. The maximal extracellular PLD production and extracellular enzyme activity were 0.23mg ml-1 and 16U ml-1, respectively. These results demonstrate the possibility of efficient secretory production of recombinant PLD in E. coli should be a potential industrial applications.

  5. Phosphatidylinositol-glycan-phospholipase D is involved in neurodegeneration in prion disease.

    Directory of Open Access Journals (Sweden)

    Jae-Kwang Jin

    Full Text Available PrPSc is formed from a normal glycosylphosphatidylinositol (GPI-anchored prion protein (PrPC by a posttranslational modification. Most GPI-anchored proteins have been shown to be cleaved by GPI phospholipases. Recently, GPI-phospholipase D (GPI-PLD was shown to be a strictly specific enzyme for GPI anchors. To investigate the involvement of GPI-PLD in the processes of neurodegeneration in prion diseases, we examined the mRNA and protein expression levels of GPI-PLD in the brains of a prion animal model (scrapie, and in both the brains and cerebrospinal fluids (CSF of sporadic and familial Creutzfeldt-Jakob disease (CJD patients. We found that compared with controls, the expression of GPI-PLD was dramatically down-regulated in the brains of scrapie-infected mice, especially in the caveolin-enriched membrane fractions. Interestingly, the observed decrease in GPI-PLD expression levels began at the same time that PrPSc began to accumulate in the infected brains and this decrease was also observed in both the brain and CSF of CJD patients; however, no differences in expression were observed in either the brains or CSF specimens from Alzheimer's disease patients. Taken together, these results suggest that the down-regulation of GPI-PLD protein may be involved in prion propagation in the brains of prion diseases.

  6. Elevation of oleate-activated phospholipase D activity during thymic atrophy (United States)

    Lee, Youngkyun; Song, Soo-Mee; Park, Heung Soon; Kim, Sungyeol; Koh, Eun-Hee; Choi, Myung Sun; Choi, Myung-Un


    Various phospholipases are thought to be associated with the in vitro apoptosis of thymocytes. In the present study, the in vivo phospholipase D (PLD) activity of rat thymus was studied after whole-body X-irradiation or injection of dexamethasone (DEX). Using exogenous [14C]dipalmitoyl phosphatidylcholine (PC) as the substrate, an elevation of oleate-activated PLD activity was observed during thymic atrophy. The activity increases were sevenfold at 48 hr after 5-Gy irradiation and fourfold at 72 hr after injection of 5 mg/kg DEX. The elevation of PLD activity appeared to parallel extensive thymus shrinkage. An increased level of thymic phosphatidic acid (PA), the presumed physiological product of PLD action on PC, was also detected. By comparing the acyl chains of PA with those of other phospholipids, PA appeared to originate from PC. To assess the role of PLD during thymic atrophy, thymocytes and stromal cells were isolated. Although thymocytes themselves exhibited significant PLD activation, the major elevation in PLD activity (greater than fourfold) was found in isolated stromal cells. PLD was also activated during in vitro phagocytosis of apoptotic thymocytes by the macrophage-like cell line P388D1. This in vitro phagocytosis was significantly inhibited by PLD action blockers, such as 2,3-diphosphoglycerate and 1-butanol. These observations strongly suggest that the alteration of oleate-activated PLD activity is part of an in vivo event in the progression of thymic atrophy, including phagocytic clearance of apoptotic thymocytes. PMID:12460188

  7. Mechanism of inhibition of human secretory phospholipase A2 by flavonoids: rationale for lead design (United States)

    Lättig, Jens; Böhl, Markus; Fischer, Petra; Tischer, Sandra; Tietböhl, Claudia; Menschikowski, Mario; Gutzeit, Herwig O.; Metz, Peter; Pisabarro, M. Teresa


    The human secretory phospholipase A2 group IIA (PLA2-IIA) is a lipolytic enzyme. Its inhibition leads to a decrease in eicosanoids levels and, thereby, to reduced inflammation. Therefore, PLA2-IIA is of high pharmacological interest in treatment of chronic diseases such as asthma and rheumatoid arthritis. Quercetin and naringenin, amongst other flavonoids, are known for their anti-inflammatory activity by modulation of enzymes of the arachidonic acid cascade. However, the mechanism by which flavonoids inhibit Phospholipase A2 (PLA2) remained unclear so far. Flavonoids are widely produced in plant tissues and, thereby, suitable targets for pharmaceutical extractions and chemical syntheses. Our work focuses on understanding the binding modes of flavonoids to PLA2, their inhibition mechanism and the rationale to modify them to obtain potent and specific inhibitors. Our computational and experimental studies focused on a set of 24 compounds including natural flavonoids and naringenin-based derivatives. Experimental results on PLA2-inhibition showed good inhibitory activity for quercetin, kaempferol, and galangin, but relatively poor for naringenin. Several naringenin derivatives were synthesized and tested for affinity and inhibitory activity improvement. 6-(1,1-dimethylallyl)naringenin revealed comparable PLA2 inhibition to quercetin-like compounds. We characterized the binding mode of these compounds and the determinants for their affinity, selectivity, and inhibitory potency. Based on our results, we suggest C(6) as the most promising position of the flavonoid scaffold to introduce chemical modifications to improve affinity, selectivity, and inhibition of PLA2-IIA by flavonoids.

  8. Phospholipase activity in rat liver mitochondria studied by the use of endogenous substrates. (United States)

    Bjornstad, P


    The hydrolysis of endogenous phosphatidyl ethanolamine and lecithin in rat liver mitochondria has been studied by using mitochondria from rats injected with ethanolamine-1,2-(14)C or choline-1,2-(14)C. A phospholipase A-like enzyme has been demonstrated, which catalyzes the hydrolysis of one fatty acid ester linkage in phosphatidyl ethanolamine and lecithin. Phosphatidyl ethanolamine is hydrolyzed in preference to lecithin and the main reaction products are free fatty acids and lysophosphatidyl ethanolamine. The further breakdown of lysophospholipids appears to be limited in mitochondria, which indicates that lysophospholipase activity is mainly located extramitochondrially. The enzymic system is greatly stimulated by calcium ions, and also slightly by magnesium ions, while EDTA inhibits it almost completely. These findings are discussed in relation to previous observations on the effect of calcium and of EDTA on the functions of mitochondria. The possible function of the mitochondrial phospholipase for the formation of phospholipids with special fatty acids at the alpha- and -position is discussed.

  9. Substance P receptor desensitization requires receptor activation but not phospholipase C

    International Nuclear Information System (INIS)

    Sugiya, Hiroshi; Putney, J.W. Jr.


    Previous studies have shown that exposure of parotid acinar cells to substance P at 37 degree C results in activation of phospholipase C, formation of [ 3 H]inositol 1,4,5-trisphosphate (IP 3 ), and persistent desensitization of the substance P response. In cells treated with antimycin in medium containing glucose, ATP was decreased to ∼20% of control values, IP 3 formation was completely inhibited, but desensitization was unaffected. When cells were treated with antimycin in the absence of glucose, cellular ATP was decreased to ∼5% of control values, and both IP 3 formation and desensitization were blocked. A series of substance P-related peptides increased the formation of [ 3 H]IP 3 and induced desensitization of the substance P response with a similar rank order of potencies. The substance P antagonist, [D-Pro 2 , D-Try 7,9 ]-substance P, inhibited substance P-induced IP 3 formation and desensitization but did not induce desensitization. These results suggest that the desensitization of substance P-induced IP 3 formation requires agonist activation of a P-type substance P receptor, and that one or more cellular ATP-dependent processes are required for this reaction. However, activation of phospholipase C and the generation of inositol phosphates does not seem to be a prerequisite for desensitization

  10. Listeriolysin O Regulates the Expression of Optineurin, an Autophagy Adaptor That Inhibits the Growth of Listeria monocytogenes. (United States)

    Puri, Madhu; La Pietra, Luigi; Mraheil, Mobarak Abu; Lucas, Rudolf; Chakraborty, Trinad; Pillich, Helena


    Autophagy, a well-established defense mechanism, enables the elimination of intracellular pathogens including Listeria monocytogenes . Host cell recognition results in ubiquitination of L . monocytogenes and interaction with autophagy adaptors p62/SQSTM1 and NDP52, which target bacteria to autophagosomes by binding to microtubule-associated protein 1 light chain 3 (LC3). Although studies have indicated that L . monocytogenes induces autophagy, the significance of this process in the infectious cycle and the mechanisms involved remain poorly understood. Here, we examined the role of the autophagy adaptor optineurin (OPTN), the phosphorylation of which by the TANK binding kinase 1 (TBK1) enhances its affinity for LC3 and promotes autophagosomal degradation, during L . monocytogenes infection. In LC3- and OPTN-depleted host cells, intracellular replicating L . monocytogenes increased, an effect not seen with a mutant lacking the pore-forming toxin listeriolysin O (LLO). LLO induced the production of OPTN. In host cells expressing an inactive TBK1, bacterial replication was also inhibited. Our studies have uncovered an OPTN-dependent pathway in which L . monocytogenes uses LLO to restrict bacterial growth. Hence, manipulation of autophagy by L . monocytogenes , either through induction or evasion, represents a key event in its intracellular life style and could lead to either cytosolic growth or persistence in intracellular vacuolar structures.

  11. Phloretin Attenuates Listeria monocytogenes Virulence Both In vitro and In vivo by Simultaneously Targeting Listeriolysin O and Sortase A. (United States)

    Wang, Jianfeng; Liu, Bowen; Teng, Zihao; Zhou, Xuan; Wang, Xiyan; Zhang, Bing; Lu, Gejin; Niu, Xiaodi; Yang, Yongjun; Deng, Xuming


    The critical roles of sortase A (SrtA) and listeriolysin O (LLO) in Listeria monocytogenes pathogenicity render these two virulence factors as ideal targets for the development of anti-virulence agents against L. monocytogenes infection. Additionally, the structures of SrtA and LLO are highly conserved among the members of sortase enzyme family and cholesterol dependent toxin family. Here, phloretin, a natural polyphenolic compound derived from apples and pears that has little anti- L. monocytogenes activity, was identified to simultaneously inhibit LLO expression and neutralize SrtA catalytic activity. Phloretin neutralized SrtA activity by causing a conformational change in the protein's active pocket, which prevented engagement with its substrate. Treatment with phloretin simultaneously reduced L. monocytogenes invasion into host cells and blocked the escape of vacuole-entrapped L. monocytogenes into cytoplasm. Further, L. monocytogenes -infected mice that received phloretin showed lower mortality, decreased bacterial burden and reduced pathological injury. Our results demonstrate that phloretin is a promising anti-infective therapeutic for infections caused by L. monocytogenes due to its simultaneous targeting of SrtA and LLO, which may result in fewer side effects than those caused by other antibiotics.

  12. Effect of Listeria seeligeri or Listeria welshimeri on Listeria monocytogenes detection in and recovery from buffered Listeria enrichment broth. (United States)

    Dailey, Rachel C; Welch, Lacinda J; Hitchins, Anthony D; Smiley, R Derike


    The presence of multiple species of Listeria in regulated food products is not uncommon and can complicate the recovery of Listeria monocytogenes particularly on a non-differentiating medium. The potential complications of Listeria seeligeri and Listeria welshimeri on the recovery of L. monocytogenes from inoculated food test samples using the U.S. Food and Drug Administration's (FDA) selective enrichment procedure was investigated. Post-enrichment enumeration, in the absence of food product, indicates that some L. seeligeri and L. monocytogenes pairings may have population differentials as great as 2.7 ± 0.1 logs with L. seeligeri being the predominant species. A similar observation was noted for L. welshimeri and L. monocytogenes pairings which resulted in population differentials as large as 3.7 ± 0.2 logs with L. welshimeri being the predominant species. Select strain pairings were used to inoculate guacamole, crab meat, broccoli, and cheese with subsequent recovery by the FDA Bacteriological Analytical Manual (BAM) method with 10 colonies per sample selected for confirmation. The presence of L. seeligeri had little effect on the recovery of L. monocytogenes. The presence of L. welshimeri resulted in the failure to recover L. monocytogenes in three out of the four food matrices. This work extends the observation that non-pathogenic species of Listeria can complicate the recovery of L. monocytogenes and that competition during selective enrichment is not limited to the presence of just Listeria innocua. Published by Elsevier Ltd.

  13. Effect of Listeria seeligeri or Listeria welshimeri on Listeria monocytogenes detection in and recovery from buffered Listeria enrichment broth☆ (United States)

    Dailey, Rachel C.; Welch, Lacinda J.; Hitchins, Anthony D.; Smiley, R. Derike


    The presence of multiple species of Listeria in regulated food products is not uncommon and can complicate the recovery of Listeria monocytogenes particularly on a non-differentiating medium. The potential complications of Listeria seeligeri and Listeria welshimeri on the recovery of L. monocytogenes from inoculated food test samples using the U.S. Food and Drug Administration's (FDA) selective enrichment procedure was investigated. Post-enrichment enumeration, in the absence of food product, indicates that some L. seeligeri and L. monocytogenes pairings may have population differentials as great as 2.7 ± 0.1 logs with L. seeligeri being the predominant species. A similar observation was noted for L. welshimeri and L. monocytogenes pairings which resulted in population differentials as large as 3.7 ± 0.2 logs with L. welshimeri being the predominant species. Select strain pairings were used to inoculate guacamole, crab meat, broccoli, and cheese with subsequent recovery by the FDA Bacteriological Analytical Manual (BAM) method with 10 colonies per sample selected for confirmation. The presence of L. seeligeri had little effect on the recovery of L. monocytogenes. The presence of L. welshimeri resulted in the failure to recover L. monocytogenes in three out of the four food matrices. This work extends the observation that non-pathogenic species of Listeria can complicate the recovery of L. monocytogenes and that competition during selective enrichment is not limited to the presence of just Listeria innocua. PMID:25475325

  14. Pulsed-Field Gel Electrophoresis characterization of Listeria monocytogenes isolates from cheese manufacturing plants in São Paulo, Brazil. (United States)

    Barancelli, Giovana V; Camargo, Tarsila M; Gagliardi, Natália G; Porto, Ernani; Souza, Roberto A; Campioni, Fabio; Falcão, Juliana P; Hofer, Ernesto; Cruz, Adriano G; Oliveira, Carlos A F


    This study aimed to evaluate the occurrence of Listeria monocytogenes in cheese and in the environment of three small-scale dairy plants (A, B, C) located in the Northern region state of São Paulo, Brazil, and to characterize the isolates using conventional serotyping and PFGE. A total of 393 samples were collected and analyzed from October 2008 to September 2009. From these, 136 came from dairy plant A, where only L. seeligeri was isolated. In dairy plant B, 136 samples were analyzed, and L. innocua, L. seeligeri and L. welshimeri were isolated together with L. monocytogenes. In dairy plant C, 121 samples were analyzed, and L. monocytogenes and L. innocua were isolated. Cheese from dairy plants B and C were contaminated with Listeria spp, with L. innocua being found in Minas frescal cheese from both dairy plants, and L. innocua and L. monocytogenes in Prato cheese from dairy plant C. A total of 85 L. monocytogenes isolates were classified in 3 serotypes: 1/2b, 1/2c, and 4b, with predominance of serotype 4b in both dairy plants. The 85 isolates found in the dairy plants were characterized by genomic macrorestriction using ApaI and AscI with Pulsed Field Gel Electrophoresis (PFGE). Macrorestriction yielded 30 different pulsotypes. The presence of indistinguishable profiles repeatedly isolated during a 12-month period indicated the persistence of L. monocytogenes in dairy plants B and C, which were more than 100 km away from each other. Brine used in dairy plant C contained more than one L. monocytogenes lineage. The routes of contamination were identified in plants B and C, and highlighted the importance of using molecular techniques and serotyping to track L. monocytogenes sources of contamination, distribution, and routes of contamination in dairy plants, and to develop improved control strategies for L. monocytogenes in dairy plants and dairy products. Copyright © 2013 Elsevier B.V. All rights reserved.

  15. Listeria monocytogenes and Listeria spp. contamination patterns in retail delicatessen establishments in three U.S. states. (United States)

    Simmons, Courtenay; Stasiewicz, Matthew J; Wright, Emily; Warchocki, Steven; Roof, Sherry; Kause, Janell R; Bauer, Nathan; Ibrahim, Salam; Wiedmann, Martin; Oliver, Haley F


    Postprocessing contamination in processing plants has historically been a significant source of Listeria monocytogenes in ready-to-eat delicatessen meats, and therefore a major cause of human listeriosis cases and outbreaks. Recent risk assessments suggest that a majority of human listeriosis cases linked to consumption of contaminated deli meats may be due to L. monocytogenes contamination that occurs at the retail level. To better understand the ecology and transmission of Listeria spp. in retail delicatessens, food and nonfood contact surfaces were tested for L. monocytogenes and other Listeria spp. in a longitudinal study conducted in 30 retail delis in three U.S. states. In phase I of the study, seven sponge samples were collected monthly for 3 months in 15 delis (5 delis per state) prior to start of daily operation; in phase II, 28 food contact and nonfood contact sites were sampled in each of 30 delis during daily operation for 6 months. Among the 314 samples collected during phase I, 6.8% were positive for L. monocytogenes. Among 4,503 samples collected during phase II, 9.5% were positive for L. monocytogenes; 9 of 30 delis showed low L. monocytogenes prevalence (Listeria spp. isolates, including 184 Listeria innocua, 48 Listeria seeligeri, and 13 Listeria welshimeri were characterized. Pulsed-field gel electrophoresis (PFGE) was used to characterize 446 L. monocytogenes isolates. PFGE showed that for 12 of 30 delis, one or more PFGE types were isolated on at least three separate occasions, providing evidence for persistence of a given L. monocytogenes subtype in the delis. For some delis, PFGE patterns for isolates from nonfood contact surfaces were distinct from patterns for occasional food contact surface isolates, suggesting limited cross-contamination between these sites in some delis. This study provides longitudinal data on L. monocytogenes contamination patterns in retail delis, which should facilitate further development of control strategies in

  16. Various Ready-to-Eat Products from Retail Stores Linked to Occurrence of Diverse Listeria monocytogenes and Listeria spp. Isolates. (United States)

    Vongkamjan, Kitiya; Fuangpaiboon, Janejira; Turner, Matthew P; Vuddhakul, Varaporn


    Listeriosis outbreaks have been associated with a variety of foods. This study investigated the prevalence and diversity of Listeria monocytogenes and Listeria spp. in ready-to-eat (RTE) products and evaluated the performance of a rapid detection method, the 3M molecular detection assay for L. monocytogenes (MDA-LM), for detection of L. monocytogenes. Assay results were compared with those obtained using the U.S. Food and Drug Administration standard culture method described in the Bacteriological Analytical Manual. Products (n = 200) were purchased from retail stores: 122 aquatic products, 22 products of animal origin, 18 vegetarian products, 15 deli meat products, 13 salad and vegetable products, 4 desserts, 2 egg-based products, and 4 other products. L. monocytogenes prevalence was comparable with both methods. Overall, 15 (7.5%) of 200 samples were positive for L. monocytogenes: 3% of aquatic products, 1.5% of products of animal origin, 1% of vegetarian products, and 2% of deli meat products. Compared with the standard culture method, the sensitivity, specificity, and the accuracy of the MDA-LM were 86.7% (95% confidence interval, 58.4 to 97.7%), 98.4% (95% confidence interval, 95.0 to 99.6%), and 97.5%, respectively. Using the culture-based method, 18 (9%) of 200 samples were positive for Listeria species other than L. monocytogenes. Listeria isolates from these samples were classified into nine allelic types (ATs). The majority of isolates were classified as ATs 58 and 74, which were identified as L. monocytogenes lineages I and IV, respectively. Listeria innocua and Listeria welshimeri also were represented by isolates of multiple ATs. The MDA-LM is a rapid and reliable technique for detecting L. monocytogenes in various RTE foods. Further study is needed to develop effective control strategies to reduce L. monocytogenes contamination in RTE foods.

  17. Fluxes of Ca2+ and K+ are required for the listeriolysin O-dependent internalization pathway of Listeria monocytogenes. (United States)

    Vadia, Stephen; Seveau, Stephanie


    Listeria monocytogenes is responsible for the life-threatening food-borne disease listeriosis. This disease mainly affects elderly and immunocompromised individuals, causing bacteremia and meningoencephalitis. In pregnant women, L. monocytogenes infection leads to abortion and severe infection of the fetus or newborn. The L. monocytogenes intracellular life cycle is critical for pathogenesis. Previous studies have established that the major virulence factor of L. monocytogenes, the pore-forming toxin listeriolysin O (LLO), is sufficient to induce L. monocytogenes internalization into human epithelial cell lines. This internalization pathway strictly requires the formation of LLO pores in the plasma membrane and can be stimulated by the heterologous pore-forming toxin pneumolysin, suggesting that LLO acts nonspecifically by forming transmembrane pores. The present work tested the hypothesis that Ca2+ and K+ fluxes subsequent to perforation by LLO control L. monocytogenes internalization. We report that L. monocytogenes perforates the host cell plasma membrane in an LLO-dependent fashion at the early stage of invasion. In response to perforation, host cells undergo Ca2+ -dependent but K+ -independent resealing of their plasma membrane. In contrast to the plasma membrane resealing process, LLO-induced L. monocytogenes internalization requires both Ca2+ and K+ fluxes. Further linking ion fluxes to bacterial internalization, treating cells with a combination of Ca2+ and K+ ionophores but not with individual ionophores is sufficient to induce efficient internalization of large cargoes, such as 1-μm polystyrene beads and bacteria. We propose that LLO-induced L. monocytogenes internalization requires a Ca2+ - and K+ -dependent internalization pathway that is mechanistically distinct from the process of plasma membrane resealing.

  18. Interaction between VEGF and Calcium-Independent Phospholipase A(2) in Proliferation and Migration of Retinal Pigment Epithelium

    DEFF Research Database (Denmark)

    Toft-Kehler, Anne Katrine; Andersen, Emelie Cammilla; Andreasen, Jens Rovelt


    Purpose: Inhibition of VEGF in the eye is an important treatment modality for reducing proliferation and migration of retinal pigment epithelium (RPE) in age-related macular degeneration (AMD). Additionally, previous studies suggest calcium-independent phospholipase A2 group VIA (iPLA2-VIA) to be...

  19. Involvement of phospholipases C and D in early response to SAR and ISR inducers in Brassica napus plants

    Czech Academy of Sciences Publication Activity Database

    Profotová, Bronislava; Burketová, Lenka; Novotná, Z.; Martinec, Jan; Valentová, O.


    Roč. 44, 2-3 (2006), s. 143-151 ISSN 0981-9428 R&D Projects: GA ČR GA522/03/0353 Institutional research plan: CEZ:AV0Z50380511 Keywords : Brassica napus * Induced resistance * Phospholipase C and D Subject RIV: CE - Biochemistry Impact factor: 1.847, year: 2006

  20. Silencing of the tomato phosphatidylinositol-phospholipase C2 (SlPLC2) reduces plant susceptibility to Botrytis cinerea

    NARCIS (Netherlands)

    Gonorazky, Gabriela; Guzzo, María Carla; Abd-El-Haliem, Ahmed M.; Joosten, Matthieu H.A.J.; Laxalt, Ana María


    The tomato [Solanum lycopersicum (Sl)] phosphatidylinositol-phospholipase C (PI-PLC) gene family is composed of six members, named SlPLC1 to SlPLC6, differentially regulated on pathogen attack. We have previously shown that the fungal elicitor xylanase induces a raise of SlPLC2 and SlPLC5

  1. Involvement of phospholipase D-related signal transduction in chemical-induced programmed cell death in tomato cell cultures

    NARCIS (Netherlands)

    Iakimova, E.T.; Michaeli, R.; Woltering, E.J.


    Phospholipase D (PLD) and its product phosphatidic acid (PA) are incorporated in a complex metabolic network in which the individual PLD isoforms are suggested to regulate specific developmental and stress responses, including plant programmed cell death (PCD). Despite the accumulating knowledge,

  2. Quercetin-induced downregulation of phospholipase D1 inhibits proliferation and invasion in U87 glioma cells

    Energy Technology Data Exchange (ETDEWEB)

    Park, Mi Hee [Department of Molecular Biology, College of Natural Science, Pusan National University, 30 Jangjeon dong, Geumjeong gu, Busan 609-735 (Korea, Republic of); Min, Do Sik, E-mail: [Department of Molecular Biology, College of Natural Science, Pusan National University, 30 Jangjeon dong, Geumjeong gu, Busan 609-735 (Korea, Republic of)


    Highlights: {yields} Quercetin, a bioactive flavonoid, suppresses expression and enzymatic activity of phospholipase D1. {yields} Quercetin abolishes NFkB-induced phospholipase D1 expression via inhibition of NFkB transactivation. {yields} Quercetin-induced suppression of phospholipase D1 inhibits invasion and proliferation of human glioma cells. -- Abstract: Phospholipase D (PLD) has been recognized as a regulator of cell proliferation and tumorigenesis, but little is known about the molecules regulating PLD expression. Thus, the identification of small molecules inhibiting PLD expression would be an important advance in PLD-mediated physiology. Quercetin, a ubiquitous bioactive flavonoid, is known to inhibit proliferation and induce apoptosis in a variety of cancer cells. In the present study, we examined the effect of quercetin on the expression of PLD in U87 glioma cells. Quercetin significantly suppressed the expression of PLD1 at the transcriptional level. Moreover, quercetin abolished the protein expression of PLD1 in a time and dose-dependent manner, as well as inhibited PLD activity. Quercetin suppressed NF{kappa}B-induced PLD1 expression via inhibition of NFkB transactivation. Furthermore, quercetin inhibited activation and invasion of metalloproteinase-2 (MMP-2), a key modulator of glioma cell invasion, induced by phosphatidic acid (PA), a product of PLD activity. Taken together these data demonstrate that quercetin abolishes PLD1 expression and subsequently inhibits invasion and proliferation of glioma cells.

  3. 1H-NMR and photochemically-induced dynamic nuclear polarization studies on bovine pancreatic phospholipase A2

    NARCIS (Netherlands)

    Egmond, M.R.; Slotboom, A.J.; Haas, G.H. de; Dijkstra, Klaas; Kaptein, R.


    Proton-NMR resonances of trytophan 3 and tyrosine 69 in bovine pancreatic phospholipase A2, its pro-enzyme and in Ala1-transaminated protein were assigned using photochemically-induced dynamic nuclear polarization (photo-CIDNP) as such or in combination with spin-echo measurements. In addition

  4. Activation of phospholipase A2 by temporin B: Formation of antimicrobial peptide-enzyme amyloid-type cofibrils

    NARCIS (Netherlands)

    Code, Christian; Domanov, Y.A.; Killian, J.A.; Kinnunen, P.K.J.


    Phospholipases A2 have been shown to be activated in a concentration dependent manner by a number of antimicrobial peptides, including melittin, magainin 2, indolicidin, and temporins B and L. Here we used fluorescently labelled bee venom PLA2 (PLA2D) and the saturated phospholipid substrate

  5. Draft Genome Sequence of Caenibacillus caldisaponilyticus B157T, a Thermophilic and Phospholipase-Producing Bacterium Isolated from Acidulocompost (United States)

    Tsujimoto, Yoshiyuki; Saito, Ryo; Sahara, Takehiko; Kimura, Nobutada; Tsuruoka, Naoki; Shigeri, Yasushi


    ABSTRACT Caenibacillus caldisaponilyticus B157T (= NBRC 111400T = DSM 101100T), in the family Sporolactobacillaceae, was isolated from acidulocompost as a thermophilic and phospholipid-degrading bacterium. Here, we report the 3.36-Mb draft genome sequence, with a G+C content of 51.8%, to provide the genetic information coding for phospholipases. PMID:28360164

  6. Secretory Phospholipase A2 Hydrolysis Phospholipid Analogs is Dependent on Water Accessibility to the Active Site

    DEFF Research Database (Denmark)

    Peters, Günther H.J.; Møller, Martin S.; Jørgensen, Kent


    A new and unnatural type of phospholipids with the head group attached to the 2-position of the glycerol backbone has been synthesized and shown to be a good substrate for secretory phospholipase A2 (sPLA2). To investigate the unexpected sPLA2 activity, we have compared three different phospholip...

  7. Yeast phospholipase C is required for stability of casein kinase I Yck2p and expression of hexose transporters

    Czech Academy of Sciences Publication Activity Database

    Zhang, T.; Galdieri, L.; Hašek, Jiří; Vančura, A.


    Roč. 364, č. 22 (2017), č. článku fnx227. ISSN 0378-1097 R&D Projects: GA ČR(CZ) GA16-05497S Institutional support: RVO:61388971 Keywords : phospholipase C * casein kinase I * hexose transporters Subject RIV: EE - Microbiology, Virology OBOR OECD: Microbiology Impact factor: 1.765, year: 2016

  8. Activities of Native and Tyrosine-69 Mutant Phospholipases A2 on Phospholipid Analogues. A Reevaluation of the Minimal Substrate Requirements

    NARCIS (Netherlands)

    Kuipers, Oscar P.; Dekker, Nicolaas; Verheij, Hubertus M.; Haas, Gerard H. de


    The role of Tyr-69 of porcine pancreatic phospholipase A2 in substrate binding was studied with the help of proteins modified by site-directed mutagenesis and phospholipid analogues with a changed head-group geometry. Two mutants were used containing Phe and Lys, respectively, at position 69.

  9. Phospholipase A2 from Bothrops alternatus (víbora de la cruz) venom. Purification and some characteristic properties. (United States)

    Nisenbom, H E; Seki, C; Vidal, J C


    One single protein species with phospholipase activity has been isolated from Bothrops alternatus venom by a procedure involving gel-filtration on Sephadex G-50 (Step 1), chromatography on SP-Sephadex C-50 (Step 2) and gel-filtration on Sephadex G-75 (Step 3). The purified sample behaved as a homogeneous, monodisperse protein with a molecular weight of 15,000 and isoelectric point of 5.04. The yield in enzyme activity was 48% of the starting material and the apparent purification was 51-fold. When assayed on 1,2-diheptanoyl- or 1,2-dimyristoyl-sn-glycero-3-phosphorylcholine, fatty acids and lysolecithins were the only reaction products, in accordance with the predicted stoichiometry. Studies on positional specificity suggested that the enzyme is a phospholipase A2. The enzyme requires Ca2+ ions for activity and exhibited stereochemical specificity, since the enantiomeric 2, 3-diheptanoyl-sn-glycero-1-phosphorylcholine was not hydrolyzed. Under the experimental conditions employed, reaction products representative of either phospholipase B or C activities could not be detected. After Step 1, the phospholipase activity recovered was higher than the total activity in the crude venom sample, which is explained by the separation of an inhibitor during enzyme purification. The inhibitor was responsible for the initial lag period that characterized the kinetics of the enzyme reaction with crude venom acting on aggregated substrates (lipoprotein, vesicles or micelles), while the rate of hydrolysis of monomeric lecithins was not affected.

  10. Phospholipase A/sub 2/ activity towards vesicles of DPPC and DMPC-DSPC containing small amounts of SMPC

    DEFF Research Database (Denmark)

    Høyrup, Lise Pernille Kristine; Mouritsen, Ole G.; Jørgensen, Kent


    Phospholipase A/sub 2/ (PLA/sub 2/) is an interfacially active enzyme whose hydrolytic activity is known to be enhanced in one-component phospholipid bilayer substrates exhibiting dynamic micro-heterogeneity. In this study the activity of PLA/sub 2/ towards large unilamellar vesicles composed of ...

  11. Crystallization and preliminary X-ray diffraction analysis of a class II phospholipase D from Loxosceles intermedia venom

    International Nuclear Information System (INIS)

    Ullah, Anwar; Giuseppe, Priscila Oliveira de; Murakami, Mario Tyago; Trevisan-Silva, Dilza; Wille, Ana Carolina Martins; Chaves-Moreira, Daniele; Gremski, Luiza Helena; Silveira, Rafael Bertoni da; Sennf-Ribeiro, Andrea; Chaim, Olga Meiri; Veiga, Silvio Sanches; Arni, Raghuvir Krishnaswamy


    Wild-type and H12A-mutant class II phospholipase D from L. intermedia venom were crystallized; the crystals diffracted to maximum resolutions of 1.95 and 1.60 Å, respectively. Phospholipases D are the major dermonecrotic component of Loxosceles venom and catalyze the hydrolysis of phospholipids, resulting in the formation of lipid mediators such as ceramide-1-phosphate and lysophosphatidic acid which can induce pathological and biological responses. Phospholipases D can be classified into two classes depending on their catalytic efficiency and the presence of an additional disulfide bridge. In this work, both wild-type and H12A-mutant forms of the class II phospholipase D from L. intermedia venom were crystallized. Wild-type and H12A-mutant crystals were grown under very similar conditions using PEG 200 as a precipitant and belonged to space group P12 1 1, with unit-cell parameters a = 50.1, b = 49.5, c = 56.5 Å, β = 105.9°. Wild-type and H12A-mutant crystals diffracted to maximum resolutions of 1.95 and 1.60 Å, respectively

  12. Human eosinophils express, relative to other circulating leukocytes, large amounts of secretory 14-kD phospholipase A2

    NARCIS (Netherlands)

    Blom, M.; Tool, A. T.; Wever, P. C.; Wolbink, G. J.; Brouwer, M. C. [=Maria Clara; Calafat, J.; Egesten, A.; Knol, E. F.; Hack, C. E.; Roos, D.; Verhoeven, A. J.


    Human eosinophils perform several functions dependent on phospholipase A2 (PLA2) activity, most notably the synthesis of platelet-activating factor (PAF) and leukotriene C4 (LTC4). Several forms of PLA2 have been identified in mammalian cells. In the present study, the 14-kD, secretory form of PLA2

  13. Stochastic modelling of Listeria monocytogenes single cell growth in cottage cheese with mesophilic lactic acid bacteria from aroma producing cultures

    DEFF Research Database (Denmark)

    Østergaard, Nina Bjerre; Christiansen, Lasse Engbo; Dalgaard, Paw


    . 2014. Modelling the effect of lactic acid bacteria from starter- and aroma culture on growth of Listeria monocytogenes in cottage cheese. International Journal of Food Microbiology. 188, 15-25]. Growth of L. monocytogenes single cells, using lag time distributions corresponding to three different......A stochastic model was developed for simultaneous growth of low numbers of Listeria monocytogenes and populations of lactic acid bacteria from the aroma producing cultures applied in cottage cheese. During more than two years, different batches of cottage cheese with aroma culture were analysed...

  14. Use of multi-locus sequencing typing as identification method for the food-borne pathogen Listeria monocytogenes: a review

    Directory of Open Access Journals (Sweden)

    Sonia Lamon


    Full Text Available Listeria monocytogenes is an ubiquitous, intracellular pathogen which has been implicated within the past decade as the causative organism in several outbreaks of foodborne diseases. In this review, a new approach to molecular typing primarily designed for global epidemiology has been described: multi-locus sequencing typing (MLST. This approach is novel, in that it uses data that allow the unambiguous characterization of bacterial strains via the Internet. Our aim is to present the currently available selection of references on L. monocytogenes MLST detection methods and to discuss its use as gold standard to L. monocytogenes subtyping method.

  15. Efflux pump-mediated benzalkonium chloride resistance in Listeria monocytogenes isolated from retail food. (United States)

    Jiang, Xiaobing; Yu, Tao; Liang, Yu; Ji, Shengdong; Guo, Xiaowei; Ma, Jianmin; Zhou, Lijun


    In this study, efflux pump-mediated benzalkonium chloride (BC) resistance, including plasmid-encoded (Qac protein family and BcrABC) and chromosome-borne efflux pumps, was investigated in Listeria monocytogenes from retail food in China. Among the 59 L. monocytogenes strains, 13 (22.0%) strains were resistant to BC. The PCR results showed that bcrABC was harbored by 2 of 13 BC resistant strains. However, none of the qac genes were detected among the 59 strains. The bcrABC was absent in both of the plasmid cured strains, indicating that this BC resistance determinant was plasmid-encoded in the two bcrABC-positive strains. In the presence of reserpine, most of the bcrABC-negative strains had decreases in the MICs of BC, suggesting the existence of other efflux pumps and their role in BC resistance. After exposed to reserpine, the reduction in BC MICs was observed in the two cured strains, indicating that efflux pumps located on chromosome was also involved in BC resistance. Our findings suggest that food products may act as reservoirs for BC resistant isolates of L. monocytogenes and plasmid- and chromosome-encoded efflux pumps could mediate the BC resistance of L. monocytogenes, which is especially relevant to the adaption of this organism in food-related environments with frequent BC use. Copyright © 2015 Elsevier B.V. All rights reserved.

  16. Enhanced biofilm formation in dual-species culture of Listeria monocytogenes and Ralstonia insidiosa (United States)

    In the environment, many microorganisms coexist in communities as biofilms. The objective of this study was to investigate the interactions between Listeria monocytogenes and Ralstonia insidiosa in dual species biofilms. Biofilm development was measured using crystal violet in 96-well microtiter pla...

  17. New perspectives on the gastrointestinal mode of transmission in invasive Listeria monocytogenes infection

    Energy Technology Data Exchange (ETDEWEB)

    Schlech, W.F. III


    The route or mechanism of transmission of Listeria monocytogenes from its rural veterinary reservoir to newborn and older human populations has been obscure. Anecdotal reports of milk-borne infection from cows with Listeria mastitis have been published, but intensive investigations of small outbreaks of L. monocytogenes infections in humans have not supported a gastrointestinal mode of infection. Several recent studies, however, strongly suggest this possibility, and case-control studies of epidemic listeriosis in the Canadian Maritime provinces in 1981 documented an association between ingestion of uncooked vegetables and the development of illness (p = 0.02). In that study, coleslaw from a regional producer which was distributed throughout the Maritimes was considered to be the vehicle of transmission. Cabbage, the raw product in the production of coleslaw, was contaminated at a farm prior to arrival at the plant. Contamination occurred through fertilization with raw manure from a flock of sheep known to harbor L. monocytogenes. Therefore, an indirect link was established between Listeria monocytogenes infection of sheep on a cabbage farm and subsequent development of invasive listeriosis in humans. This study supports findings from other epidemiologic studies of human listeriosis and is consistent with results of investigations into the mode of transmission of natural and laboratory-acquired listeriosis in animals. 34 references.

  18. Metabolic responses of primary and transformed cells to intracellular Listeria monocytogenes.

    Directory of Open Access Journals (Sweden)

    Nadine Gillmaier

    Full Text Available The metabolic response of host cells, in particular of primary mammalian cells, to bacterial infections is poorly understood. Here, we compare the carbon metabolism of primary mouse macrophages and of established J774A.1 cells upon Listeria monocytogenes infection using (13C-labelled glucose or glutamine as carbon tracers. The (13C-profiles of protein-derived amino acids from labelled host cells and intracellular L. monocytogenes identified active metabolic pathways in the different cell types. In the primary cells, infection with live L. monocytogenes increased glycolytic activity and enhanced flux of pyruvate into the TCA cycle via pyruvate dehydrogenase and pyruvate carboxylase, while in J774A.1 cells the already high glycolytic and glutaminolytic activities hardly changed upon infection. The carbon metabolism of intracellular L. monocytogenes was similar in both host cells. Taken together, the data suggest that efficient listerial replication in the cytosol of the host cells mainly depends on the glycolytic activity of the hosts.

  19. Comparative genomics analyses revealed two virulent Listeria monocytogenes strains isolated from ready-to-eat food. (United States)

    Lim, Shu Yong; Yap, Kien-Pong; Thong, Kwai Lin


    Listeria monocytogenes is an important foodborne pathogen that causes considerable morbidity in humans with high mortality rates. In this study, we have sequenced the genomes and performed comparative genomics analyses on two strains, LM115 and LM41, isolated from ready-to-eat food in Malaysia. The genome size of LM115 and LM41 was 2,959,041 and 2,963,111 bp, respectively. These two strains shared approximately 90% homologous genes. Comparative genomics and phylogenomic analyses revealed that LM115 and LM41 were more closely related to the reference strains F2365 and EGD-e, respectively. Our virulence profiling indicated a total of 31 virulence genes shared by both analysed strains. These shared genes included those that encode for internalins and L. monocytogenes pathogenicity island 1 (LIPI-1). Both the Malaysian L. monocytogenes strains also harboured several genes associated with stress tolerance to counter the adverse conditions. Seven antibiotic and efflux pump related genes which may confer resistance against lincomycin, erythromycin, fosfomycin, quinolone, tetracycline, and penicillin, and macrolides were identified in the genomes of both strains. Whole genome sequencing and comparative genomics analyses revealed two virulent L. monocytogenes strains isolated from ready-to-eat foods in Malaysia. The identification of strains with pathogenic, persistent, and antibiotic resistant potentials from minimally processed food warrant close attention from both healthcare and food industry.

  20. Growth potential of Listeria monocytogenes in sliced turkey bresaola packed in modified atmosphere

    Directory of Open Access Journals (Sweden)

    Elena Dalzini


    Full Text Available According to EC Regulation No 2073/2005, for food business operators that produce ready-to-eat (RTE product, it is crucial to be able to demonstrate if the product supports the growth of Listeria monocytogenes. The objective of the study was therefore to evaluate the behaviour of L. monocytogenes in sliced RTE turkey bresaola (made by cured turkey breast 4.5% NaCl, 1% sodium lactate, sodium nitrite 150 ppm and flavouring during the shelf life of the product, simulating a contamination during the slicing operation. Considering a shelf life of 90 days, as defined by manufacturer, the packages of sliced bresaola were stored at 5°C for 7 days and at 8°C for the remaining storage time (83 days. L. monocytogenes count decreased during storage test from 1.43/1.98 log cfu/g in the three batches tested to 1.03 log cfu/g in one batch and to undetectable levels in the other two batches. The results show that the investigated product is unable to support the growth of L. monocytogenes.

  1. The virulence regulator PrfA promotes biofilm formation by Listeria monocytogenes. (United States)

    Lemon, Katherine P; Freitag, Nancy E; Kolter, Roberto


    Listeria monocytogenes is a food-borne facultative intracellular pathogen. It is widespread in the environment and has several distinct life-styles. The key transcriptional activator PrfA positively regulates L. monocytogenes virulence genes to mediate the transition from extracellular, flagellum-propelled cell to intracellular pathogen. Here we report the first evidence that PrfA also has a significant positive impact on extracellular biofilm formation. Mutants lacking prfA were defective in surface-adhered biofilm formation. The DeltaprfA mutant exhibited wild-type flagellar motility, and its biofilm defect occurred after initial surface adhesion. We also observed that mutations that led to the constitutive expression of PrfA-dependent virulence genes had a minimal impact on biofilm formation. Furthermore, biofilm development was enhanced in a mutant encoding a PrfA protein variant unable to fully transition from the extracellular form to the virulent, intracellular activity conformation. These results indicate that PrfA positively regulates biofilm formation and suggest that PrfA has a global role in modulating the life-style of L. monocytogenes. The requirement of PrfA for optimal biofilm formation may provide selective pressure to maintain this critical virulence regulator when L. monocytogenes is outside host cells in the environment.

  2. Listeria Spp. and Listeria Monocytogenes Contamination in Ready-To-Eat Sandwiches Collected from Vending Machines. (United States)

    Cossu, Francesca; Spanu, Carlo; Deidda, Silvia; Mura, Erica; Casti, Daniele; Pala, Carlo; Lamon, Sonia; Spanu, Vincenzo; Ibba, Michela; Marrocu, Elena; Scarano, Christian; Piana, Andrea; De Santis, Enrico Pietro Luigi


    Ready-to-eat (RTE) food is characterised by a long shelf-life at refrigerated temperature and can be consumed as such, without any treatment. The aim of the work was to evaluate the presence of Listeria spp. and Listeria monocytogenes in RTEs collected from refrigerated vending machines placed in hospital environment and accessible to the hospitalised patients. In 4 different sampling, 55 RTEs were collected from vending machines of six hospitals located in different areas of Sardinia region. All the samples were characterised by similar manufacturing process, such as the use of modified atmosphere packaging and belonged to 5 different producers. Listeria spp. was not countable using the enumeration method in all of the analysed samples. Using the detection method, Listeria spp. was recovered from 9 sandwich samples. Interestingly, 3 of these samples (5.5%) made by the manufacturer, were positive for L. monocytogenes contamination. The risk related to the L. monocytogenes presence in RTEs proportionally increases when food is introduced in susceptible environments , such as hospitals and consumed by susceptible people . Although the RTEs analysed showed values that complied with the European microbiological criteria for foodstuffs, the availability of these products in a susceptible environment should be carefully checked. Therefore, in order to limit the possible exposition to L. monocytogenes , more information on the risk related to RTE consumption should be provided to the hospitalised patients.


    Directory of Open Access Journals (Sweden)

    Jaroslav Pochop


    Full Text Available The aim of this study was to follow the contamination of food with Listeria monocytogenes by using Step One real time polymerase chain reaction (PCR. We used the PrepSEQ Rapid Spin Sample Preparation Kit for isolation of DNA and SensiFAST SYBR Hi-ROX Kit for the real-time PCR performance. In 24 samples of food of animal origin without incubation were detected strains of Listeria monocytogenes in 15 samples (swabs. Nine samples were negative. Our results indicated that the real-time PCR assay developed in this study could sensitively detect Listeria monocytogenes in food of animal origin without incubation. This could prevent infection caused by Listeria monocytogenes, and also could benefit food manufacturing companies by extending their product’s shelf-life as well as saving the cost of warehousing their food products while awaiting pathogen testing results. The rapid real-time PCR-based method performed very well compared to the conventional method. It is a fast, simple, specific and sensitive way to detect nucleic acids, which could be used in clinical diagnostic tests in the future.

  4. Listeria monocytogenes Identification in Food of Animal Origin Used with Real Time PCR

    Directory of Open Access Journals (Sweden)

    Jaroslav Pochop


    Full Text Available The aim of this study was to follow the contamination of food with Listeria monocytogenes by using Step One real time polymerase chain reaction (RT PCR. We used the PrepSEQ Rapid Spin Sample Preparation Kit for isolation of DNA and SensiFAST SYBR Hi-ROX Kit for the real-time PCR performance. In 20 samples of food of animal origin with incubation were detected strains of Listeria monocytogenes in 9 samples (swabs. Eleven samples were negative. Our results indicated that the real-time PCR assay developed in this study could sensitively detect Listeria monocytogenes in food of animal origin without incubation. This could prevent infection caused by Listeria monocytogenes, and also could benefit food manufacturing companies by extending their product’s shelf-life as well as saving the cost of warehousing their food products while awaiting pathogen testing results. The rapid real-time PCR-based method performed very well compared to the conventional method. It is a fast, simple, specific and sensitive way to detect nucleic acids, which could be used in clinical diagnostic tests in the future.

  5. Listeria spp. and Listeria monocytogenes contamination in ready-to-eat sandwiches collected from vending machines

    Directory of Open Access Journals (Sweden)

    Francesca Cossu


    Full Text Available Ready-to-eat (RTE food is characterised by a long shelf-life at refrigerated temperature and can be consumed as such, without any treatment. The aim of the work was to evaluate the presence of Listeria spp. and Listeria monocytogenes in RTEs collected from refrigerated vending machines placed in hospital environment and accessible to the hospitalised patients. In 4 different sampling, 55 RTEs were collected from vending machines of six hospitals located in different areas of Sardinia region. All the samples were characterised by similar manufacturing process, such as the use of modified atmosphere packaging and belonged to 5 different producers. Listeria spp. was not countable using the enumeration method in all of the analysed samples. Using the detection method, Listeria spp. was recovered from 9 sandwich samples. Interestingly, 3 of these samples (5.5% made by the manufacturer, were positive for L. monocytogenes contamination. The risk related to the L. monocytogenes presence in RTEs proportionally increases when food is introduced in susceptible environments, such as hospitals and consumed by susceptible people. Although the RTEs analysed showed values that complied with the European microbiological criteria for foodstuffs, the availability of these products in a susceptible environment should be carefully checked. Therefore, in order to limit the possible exposition to L. monocytogenes, more information on the risk related to RTE consumption should be provided to the hospitalised patients.

  6. Integrative genomic analysis identifies isoleucine and CodY as regulators of Listeria monocytogenes virulence.

    Directory of Open Access Journals (Sweden)

    Lior Lobel


    Full Text Available Intracellular bacterial pathogens are metabolically adapted to grow within mammalian cells. While these adaptations are fundamental to the ability to cause disease, we know little about the relationship between the pathogen's metabolism and virulence. Here we used an integrative Metabolic Analysis Tool that combines transcriptome data with genome-scale metabolic models to define the metabolic requirements of Listeria monocytogenes during infection. Twelve metabolic pathways were identified as differentially active during L. monocytogenes growth in macrophage cells. Intracellular replication requires de novo synthesis of histidine, arginine, purine, and branch chain amino acids (BCAAs, as well as catabolism of L-rhamnose and glycerol. The importance of each metabolic pathway during infection was confirmed by generation of gene knockout mutants in the respective pathways. Next, we investigated the association of these metabolic requirements in the regulation of L. monocytogenes virulence. Here we show that limiting BCAA concentrations, primarily isoleucine, results in robust induction of the master virulence activator gene, prfA, and the PrfA-regulated genes. This response was specific and required the nutrient responsive regulator CodY, which is known to bind isoleucine. Further analysis demonstrated that CodY is involved in prfA regulation, playing a role in prfA activation under limiting conditions of BCAAs. This study evidences an additional regulatory mechanism underlying L. monocytogenes virulence, placing CodY at the crossroads of metabolism and virulence.

  7. Visualization of gold and platinum nanoparticles interacting with Salmonella enteritidis and Listeria monocytogenes

    DEFF Research Database (Denmark)

    Sawosz, Ewa; Chwalibog, André; Szeliga, Jacek


    -Au and nano-Pt respectively), with Salmonella Enteritidis (Gram-negative) and Listeria monocytogenes (Gram-positive), to reveal possibilities of constructing bacteria-nanoparticle vehicles. Methods: Hydrocolloids of nano-Au or nano-Pt were added to two bacteria suspensions in the following order: nano...... as a vehicle to deliver nano-Pt to specific points in the body....

  8. Inactivation of Listeria monocytogenes by disinfectants and bacteriophages in suspension and stainless steel carrier tests

    NARCIS (Netherlands)

    Chaitiemwong, N.; Hazeleger, W.C.; Beumer, R.R.


    To simulate food contact surfaces with pits or cracks, stainless steel plates with grooves (depths between 0.2 and 5 mm) were constructed. These plates were artificially contaminated with Listeria monocytogenes in clean conditions, with organic soiling, or after 14 days of biofilm formation after

  9. Stevia rebaudiana Bertoni effect on the hemolytic potential of Listeria monocytogenes. (United States)

    Sansano, S; Rivas, A; Pina-Pérez, M C; Martinez, A; Rodrigo, D


    The effect of Stevia rebaudiana Bertoni on the hemolytic potential of Listeria monocytogenes was studied by means of the assessment of the Listeriolysin O (LLO) production. The three factors under study, stevia concentration in the range [0-2.5] % (w/v), incubation temperature (10 and 37°C), and exposure time (0-65h) significantly affected (p≤0.05) the hemolytic activity of L. monocytogenes. Results showed that at the lower incubation temperature the hemolytic potential of the bacterium was significantly reduced, from 100% at 37°C to 8% at 10°C (after 65h of incubation) in unsupplemented substrate (0% stevia). Irrespective of the temperature, 10 or 37°C, supplementation of the medium with stevia at 2.5 % (w/v) reduced the bacterium's hemolytic activity by a maximum of 100%. Furthermore, the time of exposure to 2.5 % (w/v) stevia concentration was also a significant factor reducing the hemolytic capability of L. monocytogenes. The possibility of reducing the pathogenic potential of L. monocytogenes (hemolysis) by exposure to stevia should be confirmed in real food matrices, opening a research niche with a valuable future impact on food safety. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. Prevalence and populations of Listeria monocytogenes in meat products retailed in Sao Paulo, Brazil. (United States)

    Ristori, Christiane Asturiano; Rowlands, Ruth Estela Gravato; Martins, Cecília Geraldes; Barbosa, Maria Luisa; Yoshida, Júlia T U; Franco, Bernadette D G de Melo


    This study evaluated the prevalence of the populations and serotypes of Listeria monocytogenes in 552 refrigerated samples of ground beef, chicken leg, hot dog, and pork sausage collected in supermarkets in the city of Sao Paulo, SP, Brazil, between May 2008 and July 2009. The supermarkets were selected after stratification by geographical region and by random draw. Tests for presence and enumeration of L. monocytogenes were based on ISO 11290-1:1996/Amd.1:2004 and ISO 11290-2:1998 methods, respectively. Listeria spp. were detected in 469 (85.0%) of the studied meat products. The most frequently isolated species was L. innocua (64.1%), followed by L. monocytogenes (48.7%), L. welshimeri (13.4%), L. seeligeri (7.1%), L. ivanovii (0.2%), and L. grayi subspecies murrayi (0.2%). L. monocytogenes was detected in 269 (48.7%) samples, with highest prevalence in ground beef (59.4%) followed by chicken legs (58.0%), pork sausages (39.8%), and hot dogs (37.7%). The populations were Prevalence of serotypes varied according to the type of meat product. These data are relevant for estimating the risks of listeriosis associated with consumption of meat products in Sao Paulo, and for establishing science-based intervention strategies aimed at reducing these risks, especially for pregnant women and immunocompromised individuals.

  11. Prevalence of Listeria monocytogenes in the river receiving the effluent of municipal wastewater treatment plant

    Directory of Open Access Journals (Sweden)

    Atefeh Taherkhani


    Full Text Available Aims: The objective of this study was to evaluate the prevalence of Listeria spp. in the river water before and after discharge of the effluent of the municipal wastewater treatment plant (WWTP in Isfahan, Iran. Materials and Methods: A total of 66 samples were collected bi-weekly over 4 months from eleven discrete sampling locations in Zayandehrood River, Iran. Three sampling sites were located above the discharge point and five sites were located after the discharge point of WWTP. Samples were also collected from the influent and the effluent of WWTP. Listeria spp. were isolated using a selective enrichment procedure and a subculture onto polymyxin-acriflavine-lithium chloride-ceftazidime-esculin-mannitol Agar. All isolates were subjected to standard biochemical tests. Results: L. monocytogenes was isolated from influent (83%, effluent (50% and (18.5% river water. Listeria spp. was not found before the discharge point in river water. However, L. monocytogenes was isolated in samples collected from 200 m (33%, 500 m (33%, 2 km (16.5%, 5 km (16.5% and 10 km (16.5% downstream from the WWTP. Listeria innocua (9% and Listeria seeligeri (10% were the second most frequently isolated species. Conclusion: During the wastewater treatment, Listeria spp. is not removed completely. L. monocytogenes is widely distributed in the Zayandehrood river. L. monocytogenes released into surface water demonstrates a potential risk for public health. These results indicate the need for appropriate water management in order to reduce human and animal exposure to such pathogens.

  12. Isolation and detection of Listeria monocytogenes in poultry meat by standard culture methods and PCR (United States)

    Kureljušić, J.; Rokvić, N.; Jezdimirović, N.; Kureljušić, B.; Pisinov, B.; Karabasil, N.


    Listeria is the genus of a bacteria found in soil and water and some animals, including poultry and cattle. It can be present in raw milk and food made from raw milk. It can also live in food processing plants and contaminate a variety of processed meats. Microscopically, Listeria species appear as small, Gram-positive rods, which are sometimes arranged in short chains. In direct smears, they can be coccoid, so they can be mistaken for streptococci. Longer cells can resemble corynebacteria. Flagella are produced at room temperature but not at 37°C. Haemolytic activity on blood agar has been used as a marker to distinguish Listeria monocytogenes among other Listeria species, but it is not an absolutely definitive criterion. Further biochemical characterization is necessary to distinguish between the different Listeria species. The objective of this study was to detect, isolate and identify Listeria monocytogenes from poultry meat. Within a period of six months from January to June 2017, a total of 15 samples were collected. Three samples were positive for the presence of Listeria monocytogenes. Biochemical and microbiological tests as well as PCR technique using specific primers were used to confirm L. Monocytogenes in the samples.

  13. Prevalence of Listeria monocytogenes in Retail Lightly Pickled Vegetables and Its Successful Control at Processing Plants. (United States)

    Taguchi, Masumi; Kanki, Masashi; Yamaguchi, Yuko; Inamura, Hideichi; Koganei, Yosuke; Sano, Tetsuya; Nakamura, Hiromi; Asakura, Hiroshi


    Incidences of food poisoning traced to nonanimal food products have been increasingly reported. One of these was a recent large outbreak of Shiga toxin-producing Escherichia coli (STEC) O157 infection from the consumption of lightly pickled vegetables, indicating the necessity of imposing hygienic controls during manufacturing. However, little is known about the bacterial contamination levels in these minimally processed vegetables. Here we examined the prevalence of STEC, Salmonella spp., and Listeria monocytogenes in 100 lightly pickled vegetable products manufactured at 55 processing factories. Simultaneously, we also performed quantitative measurements of representative indicator bacteria (total viable counts, coliform counts, and β-glucuronidase-producing E. coli counts). STEC and Salmonella spp. were not detected in any of the samples; L. monocytogenes was detected in 12 samples manufactured at five of the factories. Microbiological surveillance at two factories (two surveys at factory A and three surveys at factory B) between June 2014 and January 2015 determined that the areas predominantly contaminated with L. monocytogenes included the refrigerators and packaging rooms. Genotyping provided further evidence that the contaminants found in these areas were linked to those found in the final products. Taken together, we demonstrated the prevalence of L. monocytogenes in lightly pickled vegetables sold at the retail level. Microbiological surveillance at the manufacturing factories further clarified the sources of the contamination in the retail products. These data indicate the necessity of implementing adequate monitoring programs to minimize health risks attributable to the consumption of these minimally processed vegetables.

  14. Extracting additional risk managers information from a risk assessment of Listeria monocytogenes in deli meats

    NARCIS (Netherlands)

    Pérez-Rodríguez, F.; Asselt, van E.D.; García-Gimeno, R.M.; Zurera, G.; Zwietering, M.H.


    The risk assessment study of Listeria monocytogenes in ready-to-eat foods conducted by the U.S. Food and Drug Administration is an example of an extensive quantitative microbiological risk assessment that could be used by risk analysts and other scientists to obtain information and by managers and

  15. Radiation sensitivities of Listeria monocytogenes isolated from chicken meat and their growth at refrigeration temperatures

    International Nuclear Information System (INIS)

    Harsojo; Banati, D.; Ito, H.


    Listeria monocytogenes were isolated in 5 lots, more than one cell in each 25-g sample of 10 lots of chicken meat, which was obtained from several different areas in Japan. From taxonomic study, the psychrotrophic type of 3 isolates grew well at 4°C on Trypticase soy agar slant, whereas 2 isolates grew poorly. Cells of all isolates were sensitive to γ-irradiation in phosphate buffer, and the D 10 values obtained were 0.16 to 0.18 kGy under aerobic irradiation conditions similar to the values of salmonellae. In the chicken meat sample, the D 10 value obtained was 0.42 kGy the same value as in phosphate buffer under anaerobic irradiation conditions, and the necessary dose for inactivation of L. monocytogenes was estimated to be 2 kGy in raw chicken meat below 10 -4 CFU (colony forming unit) per gram. In the storage study of chicken meat which was inoculated with about 3×10 3 CFU per gram of L. monocytogenes, the psychrotrophic type of the isolates grew quickly at 7 to 10°C storage. However, a dose of 1 kGy was also effective to suppress the growth of L. monocytogenes at refrigeration temperatures below 10°C

  16. Survival of Listeria monocytogenes on a conveyor belt material with or without antimicrobial additives

    NARCIS (Netherlands)

    Chaitiemwong, N.; Hazeleger, W.C.; Beumer, R.R.


    Survival of Listeria monocytogenes on a conveyor belt material with or without antimicrobial additives, in the absence or presence of food debris from meat, fish and vegetables and at temperatures of 10, 25 and 37 °C was investigated. The pathogen survived best at 10 °C, and better at 25 °C than at

  17. Biofilm formation by Listeria monocytogenes on stainless steel surface and biotransfer potential

    Directory of Open Access Journals (Sweden)

    Maíra Maciel Mattos de Oliveira


    Full Text Available An experimental model was proposed to study biofilm formation by Listeria monocytogenes ATCC 19117 on AISI 304 (#4 stainless steel surface and biotransfer potential during this process. In this model, biofilm formation was conducted on the surface of stainless steel coupons, set on a stainless steel base with 4 divisions, each one supporting 21 coupons. Trypic Soy Broth was used as bacterial growth substrate, with incubation at 37 ºC and stirring of 50 rpm. The number of adhered cells was determined after 3, 48, 96, 144, 192 and 240 hours of biofilm formation and biotransfer potential from 96 hours. Stainless steel coupons were submitted to Scanning Electron Microscopy (SEM after 3, 144 and 240 hours. Based on the number of adhered cells and SEM, it was observed that L. monocytogenes adhered rapidly to the stainless steel surface, with mature biofilm being formed after 240 hours. The biotransfer potential of bacterium to substrate occurred at all the stages analyzed. The rapid capacity of adhesion to surface, combined with biotransfer potential throughout the biofilm formation stages, make L. monocytogenes a potential risk to the food industry. Both the experimental model developed and the methodology used were efficient in the study of biofilm formation by L. monocytogenes on stainless steel surface and biotransfer potential.

  18. Biofilm formation by Listeria monocytogenes on stainless steel surface and biotransfer potential. (United States)

    de Oliveira, Maíra Maciel Mattos; Brugnera, Danilo Florisvaldo; Alves, Eduardo; Piccoli, Roberta Hilsdorf


    An experimental model was proposed to study biofilm formation by Listeria monocytogenes ATCC 19117 on AISI 304 (#4) stainless steel surface and biotransfer potential during this process. In this model, biofilm formation was conducted on the surface of stainless steel coupons, set on a stainless steel base with 4 divisions, each one supporting 21 coupons. Trypic Soy Broth was used as bacterial growth substrate, with incubation at 37 °C and stirring of 50 rpm. The number of adhered cells was determined after 3, 48, 96, 144, 192 and 240 hours of biofilm formation and biotransfer potential from 96 hours. Stainless steel coupons were submitted to Scanning Electron Microscopy (SEM) after 3, 144 and 240 hours. Based on the number of adhered cells and SEM, it was observed that L. monocytogenes adhered rapidly to the stainless steel surface, with mature biofilm being formed after 240 hours. The biotransfer potential of bacterium to substrate occurred at all the stages analyzed. The rapid capacity of adhesion to surface, combined with biotransfer potential throughout the biofilm formation stages, make L. monocytogenes a potential risk to the food industry. Both the experimental model developed and the methodology used were efficient in the study of biofilm formation by L. monocytogenes on stainless steel surface and biotransfer potential.

  19. Combined action of S-carvone and mild heat treatment on Listeria monocytogenes Scott A

    NARCIS (Netherlands)

    Karatzas, A.K.; Bennik, M.H.J.; Smid, E.J.; Kets, E.P.W.


    The combined action of the plant-derived volatile, S-carvone, and mild heat treatment on the food-borne pathogen, Listeria monocytogenes, was evaluated. The viability of exponential phase cultures grown at 8 °C could be reduced by 1.3 log units after exposure to S-carvone (5 mmol 1-1) for 30 min at

  20. [Risk assessment of Listeria monocytogenes in deli meats and vegetable salads]. (United States)

    Tian, Jing; Liu, Xiu-mei


    To analysis risk from Listeria monocytogenes in deli meats and vegetable salads. Use Risk Ranger which is a software programme developed by the University of Hobart, Australia and answer 11 questions on affecting the risk from hazards in the specific foods by combining data from national foodborne diseases surveillance network and some references to make semi-quantitative risk assessment for the specific food. Relative risk from Listeria monocytogenes in deli meats and vegetable salads is 61 and 52, respectively. Incidence of listeriosis caused by deli meats-Listeria monocytogenes pairs and vegetable salads-Listeria monocytogenes pairs is 5.4 and 0.2 cases per million people, respectively. Risk from the former is 32 times than that from the latter. By changing the selection for some risk factors in the model, it was known that the risks from two food-hazard combinations could decrease 10 times, if taking necessary actions after processing. Deli meats is a kind of high risk food for listeriosis.

  1. Listeria monocytogenes meningitis: serotype distribution and patient characteristics in The Netherlands, 1976-95

    NARCIS (Netherlands)

    Aouaj, Y.; Spanjaard, L.; van Leeuwen, N.; Dankert, J.


    Two hundred and seven cases of listeria meningitis that occurred in The Netherlands over 20 years were reviewed to study associations between Listeria monocytogenes serotype, age, underlying disease, and outcome. The mean annual incidence per 100000 population was 0.12 in 1981-90, decreasing to 0.07

  2. Evaluation of Listeria monocytogenes survival and infectivity in non-traditional agricultural waters (United States)

    Introduction: Listeria monocytogenes (Lm) is an enteric bacterium that can be found in environmental reservoirs. Restricted water availability for agriculture has increased interest in surface and reuse water sources which could potentially transmit Lm. Purpose: Persistence and infectivity of Lm re...

  3. A Dual Microscopy-Based Assay To Assess Listeria monocytogenes Cellular Entry and Vacuolar Escape. (United States)

    Quereda, Juan J; Pizarro-Cerdá, Javier; Balestrino, Damien; Bobard, Alexandre; Danckaert, Anne; Aulner, Nathalie; Shorte, Spencer; Enninga, Jost; Cossart, Pascale


    Listeria monocytogenes is a Gram-positive bacterium and a facultative intracellular pathogen that invades mammalian cells, disrupts its internalization vacuole, and proliferates in the host cell cytoplasm. Here, we describe a novel image-based microscopy assay that allows discrimination between cellular entry and vacuolar escape, enabling high-content screening to identify factors specifically involved in these two steps. We first generated L. monocytogenes and Listeria innocua strains expressing a β-lactamase covalently attached to the bacterial cell wall. These strains were then incubated with HeLa cells containing the Förster resonance energy transfer (FRET) probe CCF4 in their cytoplasm. The CCF4 probe was cleaved by the bacterial surface β-lactamase only in cells inoculated with L. monocytogenes but not those inoculated with L. innocua, thereby demonstrating bacterial access to the host cytoplasm. Subsequently, we performed differential immunofluorescence staining to distinguish extracellular versus total bacterial populations in samples that were also analyzed by the FRET-based assay. With this two-step analysis, bacterial entry can be distinguished from vacuolar rupture in a single experiment. Our novel approach represents a powerful tool for identifying factors that determine the intracellular niche of L. monocytogenes. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  4. Thermal inactivation of Listeria monocytogenes and Salmonella spp. in sous-vide processed marinated chicken breast (United States)

    The heat resistance of a cocktail of five Salmonella strains and five L. monocytogenes strains was determined in teriyaki-marinated chicken breasts. Inoculated meat, packaged in bags, were completely immersed in a circulating water bath and cooked to a final temperature of 55, 57.5 or 60C in one h...

  5. Antimicrobial resistance of Listeria monocytogenes and Listeria innocua from meat products and meat-processing environment. (United States)

    Gómez, Diego; Azón, Ester; Marco, Noelia; Carramiñana, Juan J; Rota, Carmina; Ariño, Agustín; Yangüela, Javier


    A total of 336 Listeria isolates from ready-to-eat (RTE) meat products and meat-processing environments, consisting of 206 Listeria monocytogenes, and 130 Listeria innocua isolates, were characterized by disc diffusion assay and minimum inhibitory concentration (MIC) values for antimicrobial susceptibility against twenty antimicrobials. Resistance to one or two antimicrobials was observed in 71 L. monocytogenes isolates (34.5%), and 56 L. innocua isolates (43.1%). Multidrug resistance was identified in 24 Listeria isolates, 18 belonging to L. innocua (13.9%) and 6 to L. monocytogenes (2.9%). Oxacillin resistance was the most common resistance phenotype and was identified in 100% Listeria isolates. A medium prevalence of resistance to clindamycin (39.3% isolates) and low incidence of resistance to tetracycline (3.9% isolates) were also detected. Listeria isolates from RTE meat products displayed higher overall antimicrobial resistance (31.3%) than those from the environment (13.4%). All the strains assayed were sensitive to the preferred antibiotics used to treat listeriosis. Results showed that although antimicrobial resistance in L. monocytogenes still occurs at a low prevalence, L. innocua can form a reservoir of resistance genes which may transfer between bacterial species, including transference to organisms capable of causing disease in humans. Copyright © 2014 Elsevier Ltd. All rights reserved.

  6. Morphological change and decreasing transfer rate of biofilm-featured Listeria monocytogenes EGDe (United States)

    Listeria monocytogenes, a lethal foodborne pathogen, has the ability to resist the hostile food-processing environment and, thus, frequently contaminates ready-to-eat foods during processing. It is commonly accepted that L. monocytogenes’ tendency to generate biofilms on various surfaces enhances it...

  7. Draft Genome Sequences of Historical Listeria monocytogenes from Human Listeriosis, 1933 (United States)

    We report here the draft genome sequences of two Listeria monocytogenes strains from some of the earliest reported cases of human listeriosis in North America. The strains were isolated in 1933 from patients in Massachusetts and Connecticut, USA, and belong to the widely disseminated hypervirulent c...

  8. A large outbreak of Listeria monocytogenes infection with short incubation period in a tertiary care hospital. (United States)

    Johnsen, Bjørn Odd; Lingaas, Egil; Torfoss, Dag; Strøm, Erik H; Nordøy, Ingvild


    Listeria monocytogenes is a foodborne pathogen with a high mortality rate. We report a large, nosocomial outbreak of Listeria monocytogenes infection. Patients with L. monocytogenes isolated from a sterile site, or from faeces when diarrhoea and fever were present, were included. Clinical data were collected from the patient records. The incubation period was calculated as the time between exposure and start of symptoms. Seventeen patients (11 women, median age 64 years) were infected of whom 15 patients were at increased risk for listeriosis. Eleven patients received empiric antibiotic treatment, eight of them with cephalosporins. Three patients died with a resulting mortality rate of 18%. The source of the outbreak was a Camembert cheese made from pasteurised milk containing up to 360 million colony forming units per portion. The median incubation period was 3-4 days. The incubation period in this outbreak was significantly shorter than previously reported, a fact that may be due to the high number of ingested bacteria. Furthermore, food restrictions in hospitals seem warranted, as do treatment with antibiotics effective against L. monocytogenes in at-risk populations. Copyright © 2010 The British Infection Association. Published by Elsevier Ltd. All rights reserved.

  9. Modelling the growth of Listeria monocytogenes in fresh green coconut (Cocos nucifera L.) water. (United States)

    Walter, Eduardo H M; Kabuki, Dirce Y; Esper, Luciana M R; Sant'Ana, Anderson S; Kuaye, Arnaldo Y


    The behaviour of Listeria monocytogenes in the fresh coconut water stored at 4 degrees C, 10 degrees C and 35 degrees C was studied. The coconut water was aseptically extracted from green coconuts (Cocos nucifera L.) and samples were inoculated in triplicate with a mixture of 5 strains of L. monocytogenes with a mean population of approximately 3 log(10) CFU/mL. The kinetic parameters of the bacteria were estimated from the Baranyi model, and compared with predictions of the Pathogen Modelling Program so as to predict its behaviour in the beverage. The results demonstrated that fresh green coconut water was a beverage propitious for the survival and growth of L. monocytogenes and that refrigeration at 10 degrees C or 4 degrees C retarded, but did not inhibit, growth of this bacterium. Temperature abuse at 35 degrees C considerably reduced the lagtimes. The study shows that L. monocytogenes growth in fresh green coconut water is controlled for several days by storage at low temperature, mainly at 4 degrees C. Thus, for risk population this product should only be drunk directly from the coconut or despite the sensorial alterations should be consumed pasteurized.

  10. Listeria monocytogenes Infection in Hairy Cell Leukemia: A Case Report and Literature Review

    Directory of Open Access Journals (Sweden)

    James C. Barton


    Full Text Available Listeria monocytogenes infections have been described in patients with diverse types of malignancy, especially leukemia. We report the case of a 65-year-old man with previously untreated hairy cell leukemia characterized by CD5 positivity and trisomy 12 (3% of blood lymphocytes who developed bacteremia due to L. monocytogenes serotype 1/2b. We summarize clinical features and treatment of this patient and five previously reported patients with hairy cell leukemia who also had L. monocytogenes infections. All six patients were men. Their mean age at infection diagnosis was 70 y. Three men had undergone splenectomy 4–11 y before they developed L. monocytogenes infection. The central nervous system was the primary site of infection in four men. Bacteremia alone occurred in two other men. At diagnosis of infection, one man was receiving antileukemia chemotherapy and another man was receiving treatment for Kaposi’s sarcoma. Two other patients had other comorbid conditions. All six men recovered from their infections.

  11. Effect of high pressure processing on reduction of Listeria monocytogenes in packaged Queso Fresco (United States)

    The effect of high hydrostatic pressure processing (HPP) on the survival of a five-strain rifampicin-resistant cocktail of Listeria monocytogenes in Queso Fresco (QF) was evaluated as a post-packaging intervention. QF was made using pasteurized, homogenized milk, was starter-free and was not pressed...

  12. Modeling the effect of temperature on survival rate of Listeria monocytogenes in yogurt. (United States)

    Szczawiński, J; Szczawińska, M E; Łobacz, A; Jackowska-Tracz, A


    The aim of the study was to (i) evaluate the behavior of Listeria monocytogenes in a commercially produced yogurt, (ii) determine the survival/inactivation rates of L. monocytogenes during cold storage of yogurt and (iii) to generate primary and secondary mathematical models to predict the behavior of these bacteria during storage at different temperatures. The samples of yogurt were inoculated with the mixture of three L. monocytogenes strains and stored at 3, 6, 9, 12 and 15°C for 16 days. The number of listeriae was determined after 0, 1, 2, 3, 5, 7, 9, 12, 14 and 16 days of storage. From each sample a series of decimal dilutions were prepared and plated onto ALOA agar (agar for Listeria according to Ottaviani and Agosti). It was found that applied temperature and storage time significantly influenced the survival rate of listeriae (pbacteria was found in the samples stored at 6°C (D-10 value = 243.9 h), whereas the highest reduction in the number of the bacteria was observed in the samples stored at 15°C (D-10 value = 87.0 h). The number of L. monocytogenes was correlated with the pH value of the samples (pyogurt stored under temperature range from 3 to 15°C, however, the polynomial model gave a better fit to the experimental data.

  13. Assessment of Listeria monocytogenes virulence in the Galleria mellonella insect larvae model.

    Directory of Open Access Journals (Sweden)

    Mira Rakic Martinez

    Full Text Available Several animal models have been used to understand the molecular basis of the pathogenicity, infectious dose and strain to strain variation of Listeria monocytogenes. The greater wax worm Galleria mellonella, as an alternative model, provides some useful advantages not available with other models and has already been described as suitable for the virulence assessment of various pathogens including L. monocytogenes. The objectives of this study are: 1 confirming the usefulness of this model with a wide panel of Listeria spp. including non-pathogenic L. innocua, L. seeligeri, L. welshimeri and animal pathogen L. ivanovii; 2 assessment of virulence of several isogenic in-frame deletion mutants in virulence and stress related genes of L. monocytogenes and 3 virulence assessment of paired food and clinical isolates of L. monocytogenes from 14 major listeriosis outbreaks occurred worldwide between 1980 and 2015. Larvae injected with different concentrations of Listeria were incubated at 37°C and monitored over seven days for time needed to kill 50% of larvae (LT50 and to determine change of bacterial population in G. mellonella, 2 and 24 hours post-inoculation. Non-pathogenic members of Listeria and L. ivanovii showed significantly (P < 0.05 higher LT50 (lower virulence than the wild type L. monocytogenes strains. Isogenic mutants of L. monocytogenes with the deletions in prfA, plcA, hly, actA and virR genes, also showed significantly (P < 0.05 higher LT50 than the wild type strain at the inoculum of 106CFU/larva. Food isolates had significantly (P < 0.05 lower virulence than the paired clinical isolates, at all three inoculum concentrations. L. monocytogenes strains related to non-invasive (gastroenteritis outbreaks of listeriosis showed significantly (P < 0.05 lower virulence than isolates of the same serotype obtained from outbreaks with invasive symptoms. The difference, however, was dose and strain- dependent. No significant differences in

  14. Solar irradiance limits the long-term survival of Listeria monocytogenes in seawater. (United States)

    NicAogáin, K; Magill, D; O'Donoghue, B; Conneely, A; Bennett, C; O'Byrne, C P


    Seafood has often been implicated in outbreaks of food-borne illness caused by Listeria monocytogenes but the source of contamination is usually not known. In this study we investigated the possibility that this pathogen could survive in seawater for an extended time period. Freshly collected seawater samples were inoculated with 1 × 10 8  CFU per ml of L. monocytogenes EGD-e and survival was monitored by plate counting for up to 25 days. When incubated in the dark, either at ambient temperatures (4-14°C) or at 16°C, >10 4  CFU per ml survivors were present after 25 days. However, when the seawater cell suspensions were exposed to ambient light (solar irradiation) and temperatures, L. monocytogenes lost viability rapidly and no survivors could be detected after the 80 h time point. Both UV-A and visible light in the blue region of the spectrum (470 nm) were found to contribute to this effect. The stress inducible sigma factor σ B was found to play a role in survival of L. monocytogenes in seawater. Together these data demonstrate that solar irradiation is a critical determinant of L. monocytogenes survival in marine environments. The data further suggest the possibility of controlling this food-borne pathogen in food-processing environments using visible light. Listeria monocytogenes is a food-borne bacterial pathogen capable of causing the life-threatening infection, listeriosis. In seafood the route of contamination from the environment is often not well understood as this pathogen is not generally thought to survive well in seawater. Here we provide evidence that L. monocytogenes is capable of surviving for long periods of time in seawater when light is excluded. Sunlight is demonstrated to have a significant effect on the survival of this pathogen in seawater, and both visible (470 nm) and UV-A light are shown to contribute to this effect. © 2017 The Society for Applied Microbiology.

  15. The correlation between anti phospholipase A 2 specific IgE and clinical symptoms after a bee sting in beekeepers

    Directory of Open Access Journals (Sweden)

    Jan Matysiak


    Full Text Available Introduction: Beekeepers are a group of people with high exposure to honeybee stings and with a very high risk of allergy to bee venom. Therefore, they are a proper population to study the correlations between clinical symptoms and results of diagnostic tests. Aim: The primary aim of our study was to assess the correlations between total IgE, venom- and phospholipase A 2 -specific IgE and clinical symptoms after a bee sting in beekeepers. The secondary aim was to compare the results of diagnostic tests in beekeepers and in individuals with standard exposure to bees. Material and methods: Fifty-four individuals were divided into two groups: beekeepers and control group. The levels of total IgE (tIgE, venom-specific IgE (venom sIgE, and phospholipase A 2 -specific IgE (phospholipase A 2 sIgE were analyzed. Results: Our study showed no statistically significant correlation between the clinical symptoms after a sting and tIgE in the entire analyzed group. There was also no correlation between venom sIgE level and clinical symptoms either in beekeepers or in the group with standard exposure to bees. We observed a statistically significant correlation between phospholipase A 2 sIgE level and clinical signs after a sting in the group of beekeepers, whereas no such correlation was detected in the control group. Significantly higher venom-specific IgE levels in the beekeepers, as compared to control individuals were shown. Conclusions : In beekeepers, the severity of clinical symptoms after a bee sting correlated better with phospholipase A 2 sIgE than with venom sIgE levels.

  16. Diverse regulation of retinal pigment epithelium phagocytosis of photoreceptor outer segments by calcium-independent phospholipase A₂, group VIA and secretory phospholipase A₂, group IB

    DEFF Research Database (Denmark)

    Zhan, Chen; Wang, Jinmei; Kolko, Miriam


    PURPOSE: To investigate the roles of the phospholipases A(2) (PLA(2)) subtypes, iPLA(2)-VIA and sPLA(2)-IB in retinal pigment epithelium (RPE) phagocytosis of photoreceptor outer segments (POS) and to explore a possible interaction between sPLA(2)-IB and iPLA(2)-VIA in the RPE. METHODS: To explore...... the role of iPLA(2)-VIA in RPE phagocytosis of POS, experiments with iPLA(2)-VIA vector transfection, iPLA(2)-VIA(-/-) knockout (KO) mice, and iPLA(2)-VIA inhibition by bromoenol lactone (BEL) were done. Exogenous addition of sPLA(2)-IB was used to investigate the role of sPLA(2)-IB in RPE phagocytosis....... A Luciferase Reporter Vector containing the iPLA(2)-VIA promoter was used to study the effects of sPLA(2)-IB on the iPLA(2)-VIA promoter. RESULTS: ARPE-19 and primary mouse RPE cells transfected with iPLA(2)-VIA showed increased phagocytosis. Phagocytosis was reduced in primary mouse RPE inhibited with BEL...

  17. Inherited human group IVA cytosolic phospholipase A2 deficiency abolishes platelet, endothelial, and leucocyte eicosanoid generation (United States)

    Kirkby, Nicholas S.; Reed, Daniel M.; Edin, Matthew L.; Rauzi, Francesca; Mataragka, Stefania; Vojnovic, Ivana; Bishop-Bailey, David; Milne, Ginger L.; Longhurst, Hilary; Zeldin, Darryl C.; Mitchell, Jane A.; Warner, Timothy D.


    Eicosanoids are important vascular regulators, but the phospholipase A2 (PLA2) isoforms supporting their production within the cardiovascular system are not fully understood. To address this, we have studied platelets, endothelial cells, and leukocytes from 2 siblings with a homozygous loss-of-function mutation in group IVA cytosolic phospholipase A2 (cPLA2α). Chromatography/mass spectrometry was used to determine levels of a broad range of eicosanoids produced by isolated vascular cells, and in plasma and urine. Eicosanoid release data were paired with studies of cellular function. Absence of cPLA2α almost abolished eicosanoid synthesis in platelets (e.g., thromboxane A2, control 20.5 ± 1.4 ng/ml vs. patient 0.1 ng/ml) and leukocytes [e.g., prostaglandin E2 (PGE2), control 21.9 ± 7.4 ng/ml vs. patient 1.9 ng/ml], and this was associated with impaired platelet activation and enhanced inflammatory responses. cPLA2α-deficient endothelial cells showed reduced, but not absent, formation of prostaglandin I2 (prostacyclin; control 956 ± 422 pg/ml vs. patient 196 pg/ml) and were primed for inflammation. In the urine, prostaglandin metabolites were selectively influenced by cPLA2α deficiency. For example, prostacyclin metabolites were strongly reduced (18.4% of control) in patients lacking cPLA2α, whereas PGE2 metabolites (77.8% of control) were similar to healthy volunteer levels. These studies constitute a definitive account, demonstrating the fundamental role of cPLA2α to eicosanoid formation and cellular responses within the human circulation.—Kirkby, N. S., Reed, D. M., Edin, M. L., Rauzi, F., Mataragka, S., Vojnovic, I., Bishop-Bailey, D., Milne, G. L., Longhurst, H., Zeldin, D. C., Mitchell, J. A., Warner, T. D. Inherited human group IVA cytosolic phospholipase A2 deficiency abolishes platelet, endothelial, and leucocyte eicosanoid generation. PMID:26183771

  18. Genetic Separation of Listeria monocytogenes Causing Central Nervous System Infections in Animals

    Directory of Open Access Journals (Sweden)

    Lisandra Aguilar-Bultet


    Full Text Available Listeria monocytogenes is a foodborne pathogen that causes abortion, septicemia, gastroenteritis and central nervous system (CNS infections in ruminants and humans. L. monocytogenes strains mainly belong to two distinct phylogenetic groups, named lineages I and II. In general, clinical cases in humans and animals, in particular CNS infections, are caused by lineage I strains, while most of the environmental and food strains belong to lineage II. Little is known about why lineage I is more virulent than lineage II, even though various molecular factors and mechanisms associated with pathogenesis are known. In this study, we have used a variety of whole genome sequence analyses and comparative genomic tools in order to find characteristics that distinguish lineage I from lineage II strains and CNS infection strains from non-CNS strains. We analyzed 225 strains and identified single nucleotide variants between lineages I and II, as well as differences in the gene content. Using a novel approach based on Reads Per Kilobase per Million Mapped (RPKM, we identified 167 genes predominantly absent in lineage II but present in lineage I. These genes are mostly encoding for membrane-associated proteins. Additionally, we found 77 genes that are largely absent in the non-CNS associated strains, while 39 genes are especially lacking in our defined “non-clinical” group. Based on the RPKM analysis and the metadata linked to the L. monocytogenes strains, we identified 6 genes potentially associated with CNS cases, which include a transcriptional regulator, an ABC transporter and a non-coding RNA. Although there is not a clear separation between pathogenic and non-pathogenic strains based on phylogenetic lineages, the presence of the genes identified in our study reveals potential pathogenesis traits in ruminant L. monocytogenes strains. Ultimately, the differences that we have found in our study will help steer future studies in understanding the virulence

  19. Listeria spp. E Listeria monocytogenes NA PRODUÇÃO DE SALSICHAS TIPO HOT DOG

    Directory of Open Access Journals (Sweden)



    Full Text Available Listeria monocytogenes is widely distributed in the environment and it has been isolated from food that were associated to outbreaks of high lethality in many countries. Thus, this bacterium represents an important pathogen to the public health. Ready-to-eat products, likecooked stuffed food, within them, frankfurters, are associated to human listeriosis in many countries. Taking into consideration the importance of the subject and the need of more data about it, the occurrence of Listeria spp. and L. monocytogenes in industrial plants, in meat raw materials, in slurry and frankfurters was investigated.These samples were collected in two production plants with SIF (Federal Inspection Service; in one of them GMP, HACCP and SOP were implemented. The results of the 1 06 microbiological analysis were submitted to the program @Risk to obtain the risk analysis; the meanvalues results showed that 7 to 9% of the frankfurters in the market may have L. monocytogenes. The analysis indicated that 88 strains of L. monocytogenes were obtained from 1 06 samples; among them, 76 werecollected in the industrial plants that participate in the experiment, and 30 were collected in the market. In serological typification, 95% of these strains were classified as serotypes 4b, 1 /2a and 1 /2b. Besides the presence of the bacterium in frankfurthers consumed inBrazil and the risk factors associated to this pathogen, the situation concerns because of the lack of epidemiological data, absence of patterns and the deficient information given to the consumer, specially information related to the presence of L. monocytogenes, particularly important to the groups at risk, as well as information related to the importance of heating the product

  20. Visualization of gold and platinum nanoparticles interacting with Salmonella Enteritidis and Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Ewa Sawosz


    Full Text Available Ewa Sawosz1, André Chwalibog2, Jacek Szeliga3, Filip Sawosz2, Marta Grodzik1, Marlena Rupiewicz1, Tomasz Niemiec1, Katarzyna Kacprzyk11Division of Biotechnology and Biochemistry of Nutrition, Warsaw University of Life Sciences, Warsaw, Poland; 2Department of Basic Animal and Veterinary Sciences, University of Copenhagen, Copenhagen, Denmark; 3Division of Microbiology of Analytical Centre, Warsaw University of Life Sciences, Warsaw, PolandPurpose: Rapid development of nanotechnology has recently brought significant attention to the extraordinary biological features of nanomaterials. The objective of the present ­investigation was to evaluate morphological characteristics of the assembles of gold and platinum nanoparticles (nano-Au and nano-Pt respectively, with Salmonella Enteritidis (Gram-negative and Listeria monocytogenes (Gram-positive, to reveal possibilities of constructing bacteria-nanoparticle vehicles.Methods: Hydrocolloids of nano-Au or nano-Pt were added to two bacteria suspensions in the following order: nano-Au + Salmonella Enteritidis; nano-Au + Listeria monocytogenes; nano-Pt + Salmonella Enteritidis; nano-Pt + Listeria monocytogenes. Samples were inspected by transmission electron microscope.Results: Visualization of morphological interaction between nano-Au and Salmonella Enteritidis and Listeria monocytogenes, showed that nano-Au were aggregated within flagella or biofilm network and did not penetrate the bacterial cell. The analysis of morphological effects of interaction of nano-Pt with bacteria revealed that nano-Pt entered cells of Listeria monocytogenes and were removed from the cells. In the case of Salmonella Enteritidis, nano-Pt were seen inside bacteria cells, probably bound to DNA and partly left bacterial cells. After washing and centrifugation, some of the nano-Pt-DNA complexes were observed within Salmonella Enteritidis.Conclusion: The results indicate that the bacteria could be used as a vehicle to deliver nano

  1. Comparative genomics and transcriptomics of lineages I, II, and III strains of Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Hain Torsten


    Full Text Available Abstract Background Listeria monocytogenes is a food-borne pathogen that causes infections with a high-mortality rate and has served as an invaluable model for intracellular parasitism. Here, we report complete genome sequences for two L. monocytogenes strains belonging to serotype 4a (L99 and 4b (CLIP80459, and transcriptomes of representative strains from lineages I, II, and III, thereby permitting in-depth comparison of genome- and transcriptome -based data from three lineages of L. monocytogenes. Lineage III, represented by the 4a L99 genome is known to contain strains less virulent for humans. Results The genome analysis of the weakly pathogenic L99 serotype 4a provides extensive evidence of virulence gene decay, including loss of several important surface proteins. The 4b CLIP80459 genome, unlike the previously sequenced 4b F2365 genome harbours an intact inlB invasion gene. These lineage I strains are characterized by the lack of prophage genes, as they share only a single prophage locus with other L. monocytogenes genomes 1/2a EGD-e and 4a L99. Comparative transcriptome analysis during intracellular growth uncovered adaptive expression level differences in lineages I, II and III of Listeria, notable amongst which was a strong intracellular induction of flagellar genes in strain 4a L99 compared to the other lineages. Furthermore, extensive differences between strains are manifest at levels of metabolic flux control and phosphorylated sugar uptake. Intriguingly, prophage gene expression was found to be a hallmark of intracellular gene expression. Deletion mutants in the single shared prophage locus of lineage II strain EGD-e 1/2a, the lma operon, revealed severe attenuation of virulence in a murine infection model. Conclusion Comparative genomics and transcriptome analysis of L. monocytogenes strains from three lineages implicate prophage genes in intracellular adaptation and indicate that gene loss and decay may have led to the emergence

  2. Inactivation of Listeria monocytogenes in raw fruits by enterocin AS-48. (United States)

    Molinos, Antonio Cobo; Abriouel, Hikmate; Ben Omar, Nabil; Lucas, Rosario; Valdivia, Eva; Gálvez, Antonio


    The purpose of this study was to determine the effect of enterocin AS-48 on Listeria monocytogenes CECT 4032 in fruits and fruit juice. Fruits were contaminated with a L. monocytogenes cell suspension, washed with enterocin AS-48 (25 microg/ml) or with sterile distilled water as control, and stored at different temperatures (-20, 6, 15, 22 degrees C). Washing treatments significantly inhibited or completely inactivated L. monocytogenes in strawberries, raspberries, and blackberries stored at 15 and 22 degrees C for up to 2 days and in blackberries and strawberries at 6 degrees C for up to 7 days. Washing treatments with enterocin AS-48 also reduced viable counts in sliced melon, watermelon, pear, and kiwi but did not avoid proliferation of survivors during storage at 15 and 22 degrees C. Added enterocin (25 microg/ml) completely inactivated L. monocytogenes in watermelon juice within 24 h. To enhance the antilisterial activity of treatments, enterocin AS-48 was tested in combination with other antimicrobial substances on sliced melon stored at 22 degrees C. The combinations of enterocin AS-48 and trisodium trimetaphosphate, sodium lactate, lactic acid, polyphosphoric acid, carvacrol, hydrocinnamic acid, p-hydroxybenzoic acid, n-propyl p-hydroxybenzoate, or 2-nitropropanol showed increased antilisterial activities compared with each antimicrobial tested separately. Washing treatments with enterocin AS-48 in combination with 12 mM carvacrol, as well as with 100 mM n-propyl p-hydroxybenzoate, avoided regrowth of Listeria during storage at 22 degrees C. Results from this study indicate that enterocin AS-48 alone or in combination with other preservatives could serve as an additional hurdle against L. monocytogenes in fruits and fruit juices.

  3. Effect of humidity and temperature on the survival of Listeria monocytogenes on surfaces. (United States)

    Redfern, J; Verran, J


    Listeria monocytogenes is a pathogenic bacterium, with human disease and infection linked to dairy products, seafood, ready-to-eat meat and raw & undercooked meats. Stainless steel is the most common food preparation surface and therefore, it is important to understand how food storage conditions such as surface materials, temperature and relative humidity can affect survival of L. monocytogenes. In this study, survival of L. monocytogenes on stainless steel was investigated at three temperatures (4, 10 and 21°C), each approx. 11, 50 and 85% humidity. Results indicate that the lower the temperature, the more cells were recovered in all three humidity environments, while medium humidity enhances survival, irrespective of temperature. Lower humidity decreases recovery at all temperatures. These data support the guidance noted above that humidity control is important, and that lower humidity environments are less likely to support retention of viable L. monocytogenes on a stainless steel surface. Understanding survival of potential food-borne pathogens is essential for the safe production and preparation of food. While it has long been 'common knowledge' that relative humidity can affect the growth and survival of micro-organisms, this study systematically describes the survival of L. monocytogenes on stainless steel under varying humidity and temperatures for the first time. The outcomes from this paper will allow those involved with food manufacture and preparation to make informed judgement on environmental conditions relating to humidity control, which is lacking in the food standards guidelines. © 2017 The Society for Applied Microbiology.

  4. In vivo transcriptional profiling of Listeria monocytogenes and mutagenesis identify new virulence factors involved in infection.

    Directory of Open Access Journals (Sweden)

    Ana Camejo


    Full Text Available Listeria monocytogenes is a human intracellular pathogen able to colonize host tissues after ingestion of contaminated food, causing severe invasive infections. In order to gain a better understanding of the nature of host-pathogen interactions, we studied the L. monocytogenes genome expression during mouse infection. In the spleen of infected mice, approximately 20% of the Listeria genome is differentially expressed, essentially through gene activation, as compared to exponential growth in rich broth medium. Data presented here show that, during infection, Listeria is in an active multiplication phase, as revealed by the high expression of genes involved in replication, cell division and multiplication. In vivo bacterial growth requires increased expression of genes involved in adaptation of the bacterial metabolism and stress responses, in particular to oxidative stress. Listeria interaction with its host induces cell wall metabolism and surface expression of virulence factors. During infection, L. monocytogenes also activates subversion mechanisms of host defenses, including resistance to cationic peptides, peptidoglycan modifications and release of muramyl peptides. We show that the in vivo differential expression of the Listeria genome is coordinated by a complex regulatory network, with a central role for the PrfA-SigB interplay. In particular, L. monocytogenes up regulates in vivo the two major virulence regulators, PrfA and VirR, and their downstream effectors. Mutagenesis of in vivo induced genes allowed the identification of novel L. monocytogenes virulence factors, including an LPXTG surface protein, suggesting a role for S-layer glycoproteins and for cadmium efflux system in Listeria virulence.

  5. Genetic Separation of Listeria monocytogenes Causing Central Nervous System Infections in Animals (United States)

    Aguilar-Bultet, Lisandra; Nicholson, Pamela; Rychener, Lorenz; Dreyer, Margaux; Gözel, Bulent; Origgi, Francesco C.; Oevermann, Anna; Frey, Joachim; Falquet, Laurent


    Listeria monocytogenes is a foodborne pathogen that causes abortion, septicemia, gastroenteritis and central nervous system (CNS) infections in ruminants and humans. L. monocytogenes strains mainly belong to two distinct phylogenetic groups, named lineages I and II. In general, clinical cases in humans and animals, in particular CNS infections, are caused by lineage I strains, while most of the environmental and food strains belong to lineage II. Little is known about why lineage I is more virulent than lineage II, even though various molecular factors and mechanisms associated with pathogenesis are known. In this study, we have used a variety of whole genome sequence analyses and comparative genomic tools in order to find characteristics that distinguish lineage I from lineage II strains and CNS infection strains from non-CNS strains. We analyzed 225 strains and identified single nucleotide variants between lineages I and II, as well as differences in the gene content. Using a novel approach based on Reads Per Kilobase per Million Mapped (RPKM), we identified 167 genes predominantly absent in lineage II but present in lineage I. These genes are mostly encoding for membrane-associated proteins. Additionally, we found 77 genes that are largely absent in the non-CNS associated strains, while 39 genes are especially lacking in our defined “non-clinical” group. Based on the RPKM analysis and the metadata linked to the L. monocytogenes strains, we identified 6 genes potentially associated with CNS cases, which include a transcriptional regulator, an ABC transporter and a non-coding RNA. Although there is not a clear separation between pathogenic and non-pathogenic strains based on phylogenetic lineages, the presence of the genes identified in our study reveals potential pathogenesis traits in ruminant L. monocytogenes strains. Ultimately, the differences that we have found in our study will help steer future studies in understanding the virulence mechanisms of the


    Directory of Open Access Journals (Sweden)

    Edith Burbano


    Full Text Available Objective. The aim of this study was to validate a method for detecting L. monocytogenes in raw milk.Materials and methods. The extraction procedure carried out using a chaotropic agent like NaI, toreduce fat in the sample to 0.2% w/v, which is the lowest limit for detection in the Gerber method, toavoid the polymerization. The raw milk samples were analyzed by using the traditional gold standardmethod for L. monocytogenes. Detection PCR was done on the specificity of primers that recognize theListeria genus by amplifying a specific fragment of about 938bp of the 16S rDNA. Several primer setswere use: L1 (CTCCATAAAGGTGACCCT, U1 (CAGCMGCCGCGGTAATWC, LF (CAAACGTTAACAACGCAGTAand LR (TCCAGAGTGATCGATGTTAA that recognize the hlyA gene of L. monocytogenes, amplifying a 750bpfragment. Results. The DNA of 39 strains evidenced high specificity of the technique since all the strainsof L. monocytogenes amplified the fragments 938bp and 750bp, specifically for genus and species,respectively. The detection limit of the PCR was 101 CFU/ml. T he PCR reproducibility showed a Kappa of0.85; the specificity and sensitivity of 100% were found, predictive positive and negative values were of100% respectively. Conclusions. These results demonstrate that is possible to detect of Listeria spp. byusing any of the three methods since they share the same sensitivity and specificity. One hundred percentof the predictive value for PCR (alternative method provides high reliability, and allows the detection ofthe positive samples. The extraction procedure combined with a PCR method can reduce in 15 days thetime of identification of L. monocytogenes in raw milk. This PCR technique could be adapted and validatedto be use for other types of food such as poultry, meat products and cheeses

  7. Multifaceted Activity of Listeriolysin O, the Cholesterol-Dependent Cytolysin of Listeria monocytogenes (United States)


    The cholesterol-dependent cytolysins (CDCs) are a large family of pore-forming toxins that are produced by numerous Gram-positive bacterial pathogens. These toxins are released in the extracellular environment as water-soluble monomers or dimers that bind to cholesterol-rich membranes and assemble into large pore complexes. Depending upon their concentration, the nature of the host cell and membrane (cytoplasmic or intracellular) they target, the CDCs can elicit many different cellular responses. Among the CDCs, listeriolysin O (LLO), which is a major virulence factor of the facultative intracellular pathogen Listeria monocytogenes, is involved in several stages of the intracellular lifecycle of the bacterium and displays unique characteristics. It has long been known that following L. monocytogenes internalization into host cells, LLO disrupts the internalization vacuole, enabling the bacterium to replicate into the host cell cytosol. LLO is then used by cytosolic bacteria to spread from cell to cell, avoiding bacterial exposure to the extracellular environment. Although LLO is continuously produced during the intracellular lifecycle of L. monocytogenes, several processes limit its toxicity to ensure the survival of infected cells. It was previously thought that LLO activity was limited to mediating vacuolar escape during bacterial entry and cell to cell spreading. This concept has been challenged by compelling evidence suggesting that LLO secreted by extracellular L. monocytogenes perforates the host cell plasma membrane, triggering important host cell responses. This chapter provides an overview of the well-established intracellular activity of LLO and the multiple roles attributed to LLO secreted by extracellular L. monocytogenes. PMID:24798012

  8. Listeria monocytogenes endophthalmitis - case report and review of risk factors and treatment outcomes. (United States)

    Bajor, Anna; Luhr, Anke; Brockmann, Dorothee; Suerbaum, Sebastian; Framme, Carsten; Sedlacek, Ludwig


    The majority of cases of endophthalmitis are caused by exogenous pathogens; only 5-10 % are of endogenous origin. One cause of these rare cases of endogenous endophthalmitis is Listeria monocytogenes. Twenty-six cases of endophthalmitis due to this pathogen have been published over the last twenty years. The aim of this review is to summarize the main risk factors and common clinical findings of endogenous endophthalmitis due to Listeria monocytogenes. We report on a 62-year-old female presenting with a sterile hypopyon iritis with secondary glaucoma and an underlying rheumatoid disease. In microbiological analysis we identified Listeria monocytogenes. Further we searched through all published cases for typical signs, risk factors, details of medical and surgical treatment and outcome of endogenous endophthalmitis due to this rare pathogen. Ocular symptoms in almost all of these published cases included pain, redness of the eye, and decreased vision. Main clinical features included elevated intraocular pressure and fibrinous anterior chamber reaction, as well as a dark hypopyon. While the infection is typically spread endogenously, neither an exogenous nor endogenous source of infection could be identified in most cases. Immunocompromised patients are at higher risk of being infected than immunocompetent patients. The clinical course of endophthalmitis caused by Listeria monocytogenes had different visual outcomes. In some cases, the infection led to enucleation, blindness, or strong visual loss, whereas most patients showed a tendency of visual improvement during therapy. Early diagnosis and treatment initiation are crucial factors in the outcome of endogenous endophthalmitis caused by Listeria monocytogenes. This possible differential diagnosis should be kept in mind while treating patients with presumable sterile hypopyon and anterior uveitis having a high intraocular pressure. A bacterial source should be considered with a prompt initiation of systemic

  9. Essential oils of thyme and Rosemary in the control of Listeria monocytogenes in raw beef

    Directory of Open Access Journals (Sweden)

    Maíra Maciel Mattos de Oliveira


    Full Text Available This study was developed in order to evaluate two alternatives for the control of Listeria monocytogenes in raw bovine meat pieces, both based on the use of Thymus vulgaris and Rosmarinus officinalis essential oils (EOs. The antilisterial activity of different concentrations of the EOs was tested in vitro using agar dilution and disk volatilization techniques. In addition, L. monocytogenes was inoculated in meat pieces, which were submerged in edible gelatin coatings containing 2% (v/v EOs or submitted to the vapor of EOs (0.74 μ L. monocytogenes was quantified after one, 48 and 96 hours of storage (7 °C. In the in vitro tests, the EO of T. vulgaris presented higher activity. The two options used (edible gelatin coating and vapor activity, in spite of exercising effects with differentiated behaviors, presented antibacterial activity against L. monocytogenes inoculated in raw bovine meat (p < 0.05. Greatest antibacterial activity were obtained in the experiment that used edible coatings containing EOs, at 48 hours of storage reductions in bacterial counts between 1.09 and 1.25 Log CFU.g-1 were obtained. In the vapor effect experiment, the EO of T. vulgaris caused the highest reduction in the population of bacteria inoculated in raw bovine meat (p < 0.05, 0.40 Log CFU.g-1 at 96 hours of storage. This study supplied important information regarding new and promising natural alternatives, based on the concept of active packaging, for the control of L. monocytogenes in the meat industry.

  10. Atlas(®) Listeria monocytogenes LmG2 Detection Assay Using Transcription Mediated Amplification to Detect Listeria monocytogenes in Selected Foods and Stainless Steel Surface. (United States)

    Bres, Vanessa; Yang, Hua; Hsu, Ernie; Ren, Yan; Cheng, Ying; Wisniewski, Michele; Hanhan, Maesa; Zaslavsky, Polina; Noll, Nathan; Weaver, Brett; Campbell, Paul; Reshatoff, Michael; Becker, Michael


    The Atlas Listeria monocytogenes LmG2 Detection Assay, developed by Roka Bioscience Inc., was compared to a reference culture method for seven food types (hot dogs, cured ham, deli turkey, chicken salad, vanilla ice cream, frozen chocolate cream pie, and frozen cheese pizza) and one surface (stainless steel, grade 316). A 125 g portion of deli turkey was tested using a 1:4 food:media dilution ratio, and a 25 g portion for all other foods was tested using 1:9 food:media dilution ratio. The enrichment time and media for Roka's method was 24 to 28 h for 25 g food samples and environmental surfaces, and 44 to 48 h for 125 g at 35 ± 2°C in PALCAM broth containing 0.02 g/L nalidixic acid. Comparison of the Atlas Listeria monocytogenes LmG2 Detection Assay to the reference method required an unpaired approach. For each matrix, 20 samples inoculated at a fractional level and five samples inoculated at a high level with a different strain of Listeria monocytogenes were tested by each method. The Atlas Listeria monocytogenes LmG2 Detection Assay was compared to the Official Methods of Analysis of AOAC INTERNATIONAL 993.12 method for dairy products, the U.S. Department of Agriculture, Food Safety and Inspection Service, Microbiology Laboratory Guidebook 8.08 method for ready-to-eat meat and environmental samples, and the U.S. Food and Drug Administration Bacteriological Analytical Manual, Chapter 10 method for frozen foods. In the method developer studies, Roka's method, at 24 h (or 44 h for 125 g food samples), had 126 positives out of 200 total inoculated samples, compared to 102 positives for the reference methods at 48 h. In the independent laboratory studies, vanilla ice cream, deli turkey and stainless steel grade 316 were evaluated. Roka's method, at 24 h (or 44 h for 125 g food samples), had 64 positives out of 75 total inoculated samples compared to 54 positives for the reference methods at 48 h. The Atlas Listeria monocytogenes LmG2 Detection Assay detected all 50

  11. Antimicrobial effect of blueberry (Vaccinium corymbosum L.) extracts against the growth of Listeria monocytogenes and Salmonella Enteritidis (United States)

    We studied the antimicrobial effects of berry extracts obtained from four cultivars (Elliott, Darrow, Bluecrop and Duke) of blueberry (Vaccinium corymbosum L.) on the growth of Listeria monocytogenes and Salmonella Enteritidis. The minimal inhibitory concentration (MIC) and minimal bactericidal conc...

  12. Detection of Listeria monocytogenes in ready-to-eat food by Step One real-time polymerase chain reaction. (United States)

    Pochop, Jaroslav; Kačániová, Miroslava; Hleba, Lukáš; Lopasovský, L'ubomír; Bobková, Alica; Zeleňáková, Lucia; Stričík, Michal


    The aim of this study was to follow contamination of ready-to-eat food with Listeria monocytogenes by using the Step One real time polymerase chain reaction (PCR). We used the PrepSEQ Rapid Spin Sample Preparation Kit for isolation of DNA and MicroSEQ® Listeria monocytogenes Detection Kit for the real-time PCR performance. In 30 samples of ready-to-eat milk and meat products without incubation we detected strains of Listeria monocytogenes in five samples (swabs). Internal positive control (IPC) was positive in all samples. Our results indicated that the real-time PCR assay developed in this study could sensitively detect Listeria monocytogenes in ready-to-eat food without incubation.

  13. Listeria monocytogenes presence during fermentation, drying and storage of Petrovská klobása sausage (United States)

    Janković, V.; Mitrović, R.; Lakićević, B.; Velebit, B.; Baltić, T.


    The majority of human listeriosis cases appear to be caused by consumption of ready-to-eat (RTE) foods contaminated at the time of consumption with high levels of Listeria monocytogenes. Although strategies to prevent growth of L. monocytogenes in RTE products are critical for reducing the incidence of human listeriosis, this pathogen is highly difficult to control in fermented sausage processing environments due to its high tolerance to low pH and high salt concentration. The aims of the present study were to investigate the occurrence, presence and elimination of L. monocytogenes in Petrovská klobása sausage during processing, fermentation, drying and storage. L. monocytogenes, which was detected at the beginning of the production cycle, disappeared before day 30. The pathogen decline was much faster in those sausages which were dried in controlled, industrial conditions than in those dried applying the traditional, household technique.

  14. Elucidation of Listeria monocytogenes contamination routes in cold-smoked salmon processing plants detected by DNA-based typing methods

    DEFF Research Database (Denmark)

    Vogel, Birte Fonnesbech; Huss, Hans Henrik; Ojeniyi, B.


    and environment could not be excluded. Contamination of the product occurred in specific areas (the brining and slicing areas). In plant I, the same RAPD type (RAPD type 12) was found over a 4-year period, indicating that an established in-house flora persisted and was not eliminated by routine hygienic......, monocytogenes). A total of 429 strains of L. monocytogenes were subsequently compared by random amplified polymorphic DNA (RAPD) profiling, and 55 different RAPD types were found. The RAPD types detected on the products were identical to types found on the processing equipment and in the processing environment...... procedures. In plant II, where the prevalence of L, monocytogenes was much tower, no RAPD type persisted over long periods of time, and several different L, monocytogenes RAPD types were isolated. This indicates that persistent strains may be avoided by rigorous cleaning and sanitation; however, due...

  15. Listeria monocytogenes Meningitis in an Immunosuppressed Patient with Autoimmune Hepatitis and IgG4 Subclass Deficiency

    Directory of Open Access Journals (Sweden)

    Shahin Gaini


    Full Text Available A 51-year-old Caucasian woman with Listeria monocytogenes meningitis was treated and discharged after an uncomplicated course. Her medical history included immunosuppressive treatment with prednisolone and azathioprine for autoimmune hepatitis. A diagnostic work-up after the meningitis episode revealed that she had low levels of the IgG4 subclass. To our knowledge, this is the first case report describing a possible association between autoimmune hepatitis and the occurrence of Listeria monocytogenes meningitis, describing a possible association between Listeria monocytogenes meningitis and deficiency of the IgG4 subclass and finally describing a possible association between Listeria monocytogenes meningitis and immunosuppressive therapy with prednisolone and azathioprine.

  16. Evaluation of Listeria Monocytogenes Based Vaccines for HER-2/neu in Mouse Transgenic Models of Breast Cancer

    National Research Council Canada - National Science Library

    Singh, Reshma


    ...% of all breast cancers. Five Listeria monocytogenes vaccines have been made consisting of fragments of HER-2/neu that are capable of stopping the growth of transplantable tumors in wild type FVB/N mice and can cause...

  17. Genotypes Associated with Listeria monocytogenes Isolates Displaying Impaired or Enhanced Tolerances to Cold, Salt, Acid, or Desiccation Stress

    DEFF Research Database (Denmark)

    Hingston, Patricia A.; Chen, Jessica; Dhillon, Bhavjinder K


    elements. A whole genome single-nucleotide-variants phylogeny revealed sporadic distribution of tolerant isolates and closely related sensitive and tolerant isolates, highlighting that minor genetic differences can influence the stress tolerance of L. monocytogenes. Specifically, a number of cold......The human pathogen Listeria monocytogenes is a large concern in the food industry where its continuous detection in food products has caused a string of recalls in North America and Europe. Most recognized for its ability to grow in foods during refrigerated storage, L. monocytogenes can also...... tolerate several other food-related stresses with some strains possessing higher levels of tolerances than others. The objective of this study was to use a combination of phenotypic analyses and whole genome sequencing to elucidate potential relationships between L. monocytogenes genotypes and food...

  18. Structure and function of lysosomal phospholipase A2 and lecithin:cholesterol acyltransferase (United States)

    Glukhova, Alisa; Hinkovska-Galcheva, Vania; Kelly, Robert; Abe, Akira; Shayman, James A.; Tesmer, John J. G.


    Lysosomal phospholipase A2 (LPLA2) and lecithin:cholesterol acyltransferase (LCAT) belong to a structurally uncharacterized family of key lipid-metabolizing enzymes responsible for lung surfactant catabolism and for reverse cholesterol transport, respectively. Whereas LPLA2 is predicted to underlie the development of drug-induced phospholipidosis, somatic mutations in LCAT cause fish eye disease and familial LCAT deficiency. Here we describe several high-resolution crystal structures of human LPLA2 and a low-resolution structure of LCAT that confirms its close structural relationship to LPLA2. Insertions in the α/β hydrolase core of LPLA2 form domains that are responsible for membrane interaction and binding the acyl chains and head groups of phospholipid substrates. The LCAT structure suggests the molecular basis underlying human disease for most of the known LCAT missense mutations, and paves the way for rational development of new therapeutics to treat LCAT deficiency, atherosclerosis and acute coronary syndrome.

  19. Didecanoyl phosphatidylcholine is a superior substrate for assaying mammalian phospholipase D

    DEFF Research Database (Denmark)

    Vinggaard, Anne Marie; Jensen, T.; Morgan, C.P.


    Phospholipase D (PLD) activity in crude or solubilized membranes from mammalian tissues is difficult to detect with the current assay techniques, unless a high radioactive concentration of substrate and/or long incubation times are employed. Generally, the enzyme has to be extracted and partially...... purified on one column before easy detection of activity. Furthermore, PLD activity in cultured cells can only be detected by the available assay techniques in the presence of guanosine 5'-[¿-thio]triphosphate (GTP[S]) and a cytosolic factor [usually ADP-ribosylation factor (Arf)]. In this paper we report...... that the use of didecanoyl phosphatidylcholine (C-PC) in mammalian PLD assays considerably increases the detection limit. C-PC was compared with the commonly used dipalmitoyl phosphatidylcholine (C-PC) as a substrate for PLD activity from membranes of human neutrophils, human placenta and pig brain, and from...

  20. Ammodytoxin, a neurotoxic secreted phospholipase A2, can act in the cytosol of the nerve cell

    International Nuclear Information System (INIS)

    Petrovic, Uros; Sribar, Jernej; Paris, Alenka; Rupnik, Marjan; Krzan, Mojca; Vardjan, Nina; Gubensek, Franc; Zorec, Robert; Krizaj, Igor


    Recent identification of intracellular proteins that bind ammodytoxin (calmodulin, 14-3-3 proteins, and R25) suggests that this snake venom presynaptically active phospholipase A 2 acts intracellularly. As these ammodytoxin acceptors are cytosolic and mitochondrial proteins, the toxin should be able to enter the cytosol of a target cell and remain stable there to interact with them. Using laser scanning confocal microscopy we show here that Alexa-labelled ammodytoxin entered the cytoplasm of the rat hippocampal neuron and subsequently also its nucleus. The transport of proteins into the nucleus proceeds via the cytosol of a cell, therefore, ammodytoxin passed the cytosol of the neuron on its way to the nucleus. Although it is not yet clear how ammodytoxin is translocated into the cytosol of the neuron, our results demonstrate that its stability in the cytosol is not in question, providing the evidence that the toxin can act in this cellular compartment