Flagellar motility is critical for Listeria monocytogenes biofilm formation.
Lemon, Katherine P; Higgins, Darren E; Kolter, Roberto
2007-06-01
The food-borne pathogen Listeria monocytogenes attaches to environmental surfaces and forms biofilms that can be a source of food contamination, yet little is known about the molecular mechanisms of its biofilm development. We observed that nonmotile mutants were defective in biofilm formation. To investigate how flagella might function during biofilm formation, we compared the wild type with flagellum-minus and paralyzed-flagellum mutants. Both nonmotile mutants were defective in biofilm development, presumably at an early stage, as they were also defective in attachment to glass during the first few hours of surface exposure. This attachment defect could be significantly overcome by providing exogenous movement toward the surface via centrifugation. However, this centrifugation did not restore mature biofilm formation. Our results indicate that it is flagellum-mediated motility that is critical for both initial surface attachment and subsequent biofilm formation. Also, any role for L. monocytogenes flagella as adhesins on abiotic surfaces appears to be either minimal or motility dependent under the conditions we examined.
DEFF Research Database (Denmark)
Doyscher, Dominik; Fieseler, Lars; Dons, Lone Elisabet
2013-01-01
Despite its prominent role as an intracellular human pathogen, Listeria monocytogenes normally features a saprophytic lifestyle, and shares many environmental habitats with predatory protozoa. Earlier studies claimed that Acanthamoeba may act as environmental reservoirs for L.?monocytogenes, wher......Despite its prominent role as an intracellular human pathogen, Listeria monocytogenes normally features a saprophytic lifestyle, and shares many environmental habitats with predatory protozoa. Earlier studies claimed that Acanthamoeba may act as environmental reservoirs for L.......?monocytogenes, whereas others failed to confirm this hypothesis. Our findings support the latter and provide clear evidence that L.?monocytogenes is unable to persist in Acanthamoeba castellanii and A.?polyphaga. Instead, external Listeria cells are rapidly immobilized on the surface of Acanthamoeba trophozoites......-lapse microscopy revealed that shortly after the bacteria are collected, the amoeba can change direction of movement, phagocytose the backpack and continue to repeat the process. The phenomenon was also observed with avirulent L.?monocytogenes mutants, non-pathogenic Listeria, and other motile bacteria, indicating...
Directory of Open Access Journals (Sweden)
Lisa Gorski
Full Text Available The role of flagella and motility in the attachment of the foodborne pathogen Listeria monocytogenes to various surfaces is mixed with some systems requiring flagella for an interaction and others needing only motility for cells to get to the surface. In nature this bacterium is a saprophyte and contaminated produce is an avenue for infection. Previous studies have documented the ability of this organism to attach to and colonize plant tissue. Motility mutants were generated in three wild type strains of L. monocytogenes by deleting either flaA, the gene encoding flagellin, or motAB, genes encoding part of the flagellar motor, and tested for both the ability to colonize sprouts and for the fitness of that colonization. The motAB mutants were not affected in the colonization of alfalfa, radish, and broccoli sprouts; however, some of the flaA mutants showed reduced colonization ability. The best colonizing wild type strain was reduced in colonization on all three sprout types as a result of a flaA deletion. A mutant in another background was only affected on alfalfa. The third, a poor alfalfa colonizer was not affected in colonization ability by any of the deletions. Fitness of colonization was measured in experiments of competition between mixtures of mutant and parent strains on sprouts. Here the flaA and motAB mutants of the three strain backgrounds were impaired in fitness of colonization of alfalfa and radish sprouts, and one strain background showed reduced fitness of both mutant types on broccoli sprouts. Together these data indicate a role for flagella for some strains to physically colonize some plants, while the fitness of that colonization is positively affected by motility in almost all cases.
Directory of Open Access Journals (Sweden)
Changyong Cheng
2017-06-01
Full Text Available Microbes employ the thioredoxin system to defend against oxidative stress and ensure correct disulfide bonding to maintain protein function. Listeria monocytogenes has been shown to encode a putative thioredoxin, TrxA, but its biological roles and underlying mechanisms remain unknown. Here, we showed that expression of L. monocytogenes TrxA is significantly induced in bacteria treated with the thiol-specific oxidizing agent, diamide. Deletion of trxA markedly compromised tolerance of the pathogen to diamide, and mainly impaired early stages of infection in human intestinal epithelial Caco-2 cells. In addition, most trxA mutant bacteria were not associated with polymerized actin, and the rare bacteria that were associated with polymerized actin displayed very short tails or clouds during infection. Deletion or constitutive overexpression of TrxA, which was regulated by SigH, severely attenuated the virulence of the pathogen. Transcriptome analysis of L. monocytogenes revealed over 270 genes that were differentially transcribed in the ΔtrxA mutant compared to the wild-type, especially for the virulence-associated genes plcA, mpl, hly, actA, and plcB. Particularly, deletion of TrxA completely reduced LLO expression, and thereby led to a thoroughly impaired hemolytic activity. Expression of these virulence factors are positively regulated by the master regulator PrfA that was found here to use TrxA to maintain its reduced forms for activation. Interestingly, the trxA deletion mutant completely lacked flagella and was non-motile. We further confirmed that this deficiency is attributable to TrxA in maintaining the reduced intracellular monomer status of MogR, the key regulator for flagellar formation, to ensure correct dimerization. In summary, we demonstrated for the first time that L. monocytogenes thioredoxin A as a vital cellular reductase is essential for maintaining a highly reducing environment in the bacterial cytosol, which provides a
Cheng, Changyong; Dong, Zhimei; Han, Xiao; Wang, Hang; Jiang, Li; Sun, Jing; Yang, Yongchun; Ma, Tiantian; Shao, Chunyan; Wang, Xiaodu; Chen, Zhongwei; Fang, Weihuan; Freitag, Nancy E; Huang, Huarong; Song, Houhui
2017-01-01
Microbes employ the thioredoxin system to defend against oxidative stress and ensure correct disulfide bonding to maintain protein function. Listeria monocytogenes has been shown to encode a putative thioredoxin, TrxA, but its biological roles and underlying mechanisms remain unknown. Here, we showed that expression of L. monocytogenes TrxA is significantly induced in bacteria treated with the thiol-specific oxidizing agent, diamide. Deletion of trxA markedly compromised tolerance of the pathogen to diamide, and mainly impaired early stages of infection in human intestinal epithelial Caco-2 cells. In addition, most trxA mutant bacteria were not associated with polymerized actin, and the rare bacteria that were associated with polymerized actin displayed very short tails or clouds during infection. Deletion or constitutive overexpression of TrxA, which was regulated by SigH, severely attenuated the virulence of the pathogen. Transcriptome analysis of L. monocytogenes revealed over 270 genes that were differentially transcribed in the Δ trxA mutant compared to the wild-type, especially for the virulence-associated genes plcA, mpl, hly, actA , and plcB . Particularly, deletion of TrxA completely reduced LLO expression, and thereby led to a thoroughly impaired hemolytic activity. Expression of these virulence factors are positively regulated by the master regulator PrfA that was found here to use TrxA to maintain its reduced forms for activation. Interestingly, the trxA deletion mutant completely lacked flagella and was non-motile. We further confirmed that this deficiency is attributable to TrxA in maintaining the reduced intracellular monomer status of MogR, the key regulator for flagellar formation, to ensure correct dimerization. In summary, we demonstrated for the first time that L. monocytogenes thioredoxin A as a vital cellular reductase is essential for maintaining a highly reducing environment in the bacterial cytosol, which provides a favorable condition for
Directory of Open Access Journals (Sweden)
2006-04-01
Full Text Available Flagella are surface structures critical for motility and virulence of many bacterial species. In Listeria monocytogenes, MogR tightly represses expression of flagellin (FlaA during extracellular growth at 37 degrees C and during intracellular infection. MogR is also required for full virulence in a murine model of infection. Using in vitro and in vivo infection models, we determined that the severe virulence defect of MogR-negative bacteria is due to overexpression of FlaA. Specifically, overproduction of FlaA in MogR-negative bacteria caused pleiotropic defects in bacterial division (chaining phenotype, intracellular spread, and virulence in mice. DNA binding and microarray analyses revealed that MogR represses transcription of all known flagellar motility genes by binding directly to a minimum of two TTTT-N(5-AAAA recognition sites positioned within promoter regions such that RNA polymerase binding is occluded. Analysis of MogR protein levels demonstrated that modulation of MogR repression activity confers the temperature-specificity to flagellar motility gene expression. Epistasis analysis revealed that MogR repression of transcription is antagonized in a temperature-dependent manner by the DegU response regulator and that DegU further regulates FlaA levels through a posttranscriptional mechanism. These studies provide the first known example to our knowledge of a transcriptional repressor functioning as a master regulator controlling nonhierarchal expression of flagellar motility genes.
CHALLENGE TESTS WITH LISTERIA MONOCYTOGENES IN SALAMI: PRELIMINARY RESULTS
Directory of Open Access Journals (Sweden)
R. Mioni
2013-02-01
Full Text Available Challenge tests are the preferable methodology to study the behaviour of Listeria monocytogenes on ready to eat foods, according to Regulation (EC 2073/2005. Challenge testing using L. monocytogenes in seasoned salami from different food business operators showed, after seasoning of the product, a count reduction of the inoculated organisms without any further growth of the pathogen; however differences of L. monocytogenes behaviour could be observed according to different production protocols.
A dynamical systems approach to actin-based motility in Listeria monocytogenes
Hotton, S.
2010-11-01
A simple kinematic model for the trajectories of Listeria monocytogenes is generalized to a dynamical system rich enough to exhibit the resonant Hopf bifurcation structure of excitable media and simple enough to be studied geometrically. It is shown how L. monocytogenes trajectories and meandering spiral waves are organized by the same type of attracting set.
Single cell swimming dynamics of Listeria monocytogenes using a nanoporous microfluidic platform
Energy Technology Data Exchange (ETDEWEB)
Wright, Evan [University of Guelph, Canada; Neethirajan, Suresh [University of Guelph; Warriner, Keith [University of Guelph; Retterer, Scott T [ORNL; Srijanto, Bernadeta R [ORNL
2014-01-01
Listeria monocytogenes remains a significant foodborne pathogen due to its virulence and ability to become established in food processing facilities. The pathogen is characterized by its ability to grow over a wide temperature range and withstand a broad range of stresses. The following reports on the chemotaxis and motility of the L. monocytogenes when exposed to relatively small concentrations of acetic acid. Using the developed nanoporous microfluidic device to precisely modulate the cellular environment, we exposed the individual Listeria cells to acetic acid and, in real time and with high resolution, observed how the cells reacted to the change in their surroundings. Our results showed that concentrations of acetic acid below 10 mM had very little, if any, effect on the motility. However, when exposed to 100 mM acetic acid, the cells exhibited a sharp drop in velocity and displayed a more random pattern of motion. These results indicate that at appropriate concentrations, acetic acid has the ability to disable the flagellum of the cells, thus impairing their motility. This drop in motility has numerous effects on the cell; its main effects being the obstruction of the cell's ability to properly form biofilms and a reduction in the overall infectivity of the cells. Since these characteristics are especially useful in controlling the proliferation of L. monocytogenes, acetic acid shows potential for application in the food industry as an active compound in designing a food packaging environment and as an antimicrobial agent.
Directory of Open Access Journals (Sweden)
Ninoska eCordero
2016-03-01
Full Text Available Listeria monocytogenes has become one of the principal foodborne pathogens worldwide. The capacity of this bacterium to grow at low temperatures has opened an interesting field of study in terms of the identification and classification of new strains of L. monocytogenes with different growth capacities at low temperatures. We determined the growth rate at 8 ºC of 110 strains of L. monocytogenes isolated from different food matrices. We identified a group of slow and fast strains according to their growth rate at 8 °C and performed a global transcriptomic assay in strains previously adapted to low temperature. We then identified shared and specific transcriptional mechanisms, metabolic and cellular processes of both groups; bacterial motility was the principal process capable of differentiating the adaptation capacity of L. monocytogenes strains with different ranges of tolerance to low temperatures. Strains belonging to the fast group were less motile, which may allow these strains to achieve a greater rate of proliferation at low temperature.
Glycerol metabolism induces Listeria monocytogenes biofilm formation at the air-liquid interface.
Crespo Tapia, Natalia; den Besten, Heidy M W; Abee, Tjakko
2018-05-20
Listeria monocytogenes is a food-borne pathogen that can grow as a biofilm on surfaces. Biofilm formation in food-processing environments is a big concern for food safety, as it can cause product contamination through the food-processing line. Although motile aerobic bacteria have been described to form biofilms at the air-liquid interface of cell cultures, to our knowledge, this type of biofilm has not been described in L. monocytogenes before. In this study we report L. monocytogenes biofilm formation at the air-liquid interface of aerobically grown cultures, and that this phenotype is specifically induced when the media is supplemented with glycerol as a carbon and energy source. Planktonic growth, metabolic activity assays and HPLC measurements of glycerol consumption over time showed that glycerol utilization in L. monocytogenes is restricted to growth under aerobic conditions. Gene expression analysis showed that genes encoding the glycerol transporter GlpF, the glycerol kinase GlpK and the glycerol 3-phosphate dehydrogenase GlpD were upregulated in the presence of oxygen, and downregulated in absence of oxygen. Additionally, motility assays revealed the induction of aerotaxis in the presence of glycerol. Our results demonstrate that the formation of biofilms at the air-liquid interface is dependent on glycerol-induced aerotaxis towards the surface of the culture, where L. monocytogenes has access to higher concentrations of oxygen, and is therefore able to utilize this compound as a carbon source. Copyright © 2018 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Ryan Chong
Full Text Available Intracellular bacterial pathogens, such as Listeria monocytogenes and Rickettsia conorii display actin-based motility in the cytosol of infected cells and spread from cell to cell through the formation of membrane protrusions at the cell cortex. Whereas the mechanisms supporting cytosolic actin-based motility are fairly well understood, it is unclear whether specific host factors may be required for supporting the formation and resolution of membrane protrusions. To address this gap in knowledge, we have developed high-throughput fluorescence microscopy and computer-assisted image analysis procedures to quantify pathogen spread in human epithelial cells. We used the approach to screen a siRNA library covering the human kinome and identified 7 candidate kinases whose depletion led to severe spreading defects in cells infected with L. monocytogenes. We conducted systematic validation procedures with redundant silencing reagents and confirmed the involvement of the serine/threonine kinases, CSNK1A1 and CSNK2B. We conducted secondary assays showing that, in contrast with the situation observed in CSNK2B-depleted cells, L. monocytogenes formed wild-type cytosolic tails and displayed wild-type actin-based motility in the cytosol of CSNK1A1-depleted cells. Furthermore, we developed a protrusion formation assay and showed that the spreading defect observed in CSNK1A1-depleted cells correlated with the formation of protrusion that did not resolve into double-membrane vacuoles. Moreover, we developed sending and receiving cell-specific RNAi procedures and showed that CSNK1A was required in the sending cells, but was dispensable in the receiving cells, for protrusion resolution. Finally, we showed that the observed defects were specific to Listeria monocytogenes, as Rickettsia conorii displayed wild-type cell-to-cell spread in CSNK1A1- and CSNK2B-depleted cells. We conclude that, in addition to the specific host factors supporting cytosolic actin
Guariglia-Oropeza, Veronica; Orsi, Renato H.; Guldimann, Claudia; Wiedmann, Martin; Boor, Kathryn J.
2018-01-01
Listeria monocytogenes uses a variety of transcriptional regulation strategies to adapt to the extra-host environment, the gastrointestinal tract, and the intracellular host environment. While the alternative sigma factor SigB has been proposed to be a key transcriptional regulator that facilitates L. monocytogenes adaptation to the gastrointestinal environment, the L. monocytogenes' transcriptional response to bile exposure is not well-understood. RNA-seq characterization of the bile stimulon was performed in two L. monocytogenes strains representing lineages I and II. Exposure to bile at pH 5.5 elicited a large transcriptomic response with ~16 and 23% of genes showing differential transcription in 10403S and H7858, respectively. The bile stimulon includes genes involved in motility and cell wall modification mechanisms, as well as genes in the PrfA regulon, which likely facilitate survival during the gastrointestinal stages of infection that follow bile exposure. The fact that bile exposure induced the PrfA regulon, but did not induce further upregulation of the SigB regulon (beyond that expected by exposure to pH 5.5), suggests a model where at the earlier stages of gastrointestinal infection (e.g., acid exposure in the stomach), SigB-dependent gene expression plays an important role. Subsequent exposure to bile induces the PrfA regulon, potentially priming L. monocytogenes for subsequent intracellular infection stages. Some members of the bile stimulon showed lineage- or strain-specific distribution when 27 Listeria genomes were analyzed. Even though sigB null mutants showed increased sensitivity to bile, the SigB regulon was not found to be upregulated in response to bile beyond levels expected by exposure to pH 5.5. Comparison of wildtype and corresponding ΔsigB strains newly identified 26 SigB-dependent genes, all with upstream putative SigB-dependent promoters. PMID:29467736
Directory of Open Access Journals (Sweden)
Roberta Ortenzi
2015-09-01
Full Text Available In the present study, a microbiological challenge test in artificially contaminated raw milk Pecorino Umbro cheese during cheese-making was carried out. Raw ewe milk was contaminated by a suspension of particular Listeria monocytogenes strains. The number of L. monocytogenes and L. monocytogenes dynamic growth were evaluated during cheese-making and storage. A significant decrease of the viable count of L. monocytogenes was observed during ripening and L. monocytogenes viable count was below the limit of quantification during storage. The results show that the product is unable to support the growth of the pathogen.
Listeria monocytogenes as a vector for anti-cancer therapies.
LENUS (Irish Health Repository)
Tangney, Mark
2012-01-31
The intracellular pathogen Listeria monocytogenes represents a promising therapeutic vector for the delivery of DNA, RNA or protein to cancer cells or to prime immune responses against tumour-specific antigens. A number of biological properties make L. monocytogenes a promising platform for development as a vector for either gene therapy or as an anti-cancer vaccine vector. L. monocytogenes is particularly efficient in mediating internalization into host cells. Once inside cells, the bacterium produces specific virulence factors which lyse the vaculolar membrane and allow escape into the cytoplasm. Once in the cytosol, L. monocytogenes is capable of actin-based motility and cell-to-cell spread without an extracellular phase. The cytoplasmic location of L. monocytogenes is significant as this potentiates entry of antigens into the MHC Class I antigen processing pathway leading to priming of specific CD8(+) T cell responses. The cytoplasmic location is also beneficial for the delivery of DNA (bactofection) by L. monocytogenes whilst cell-to-cell spread may facilitate access of the vector to cells throughout the tumour. Several preclinical studies have demonstrated the ability of L. monocytogenes for intracellular gene or protein delivery in vitro and in vivo, and this vector has also displayed safety and efficacy in clinical trial. Here, we review the features of the L. monocytogenes host-pathogen interaction that make this bacterium such an attractive candidate with which to induce appropriate therapeutic responses. We focus primarily upon work that has led to attenuation of the pathogen, demonstrated DNA, RNA or protein delivery to tumour cells as well as research that shows the efficacy of L. monocytogenes as a vector for tumour-specific vaccine delivery.
Juck, Gregory; Gonzalez, Verapaz; Allen, Ann-Christine Olsson; Sutzko, Meredith; Seward, Kody; Muldoon, Mark T
2018-04-27
The Romer Labs RapidChek ® Listeria monocytogenes test system (Performance Tested Method ℠ 011805) was validated against the U.S. Department of Agriculture-Food Safety and Inspection Service Microbiology Laboratory Guidebook (USDA-FSIS/MLG), U.S. Food and Drug Association Bacteriological Analytical Manual (FDA/BAM), and AOAC Official Methods of Analysis ℠ (AOAC/OMA) cultural reference methods for the detection of L. monocytogenes on selected foods including hot dogs, frozen cooked breaded chicken, frozen cooked shrimp, cured ham, and ice cream, and environmental surfaces including stainless steel and plastic in an unpaired study design. The RapidChek method uses a proprietary enrichment media system, a 44-48 h enrichment at 30 ± 1°C, and detects L. monocytogenes on an immunochromatographic lateral flow device within 10 min. Different L. monocytogenes strains were used to spike each of the matrixes. Samples were confirmed based on the reference method confirmations and an alternate confirmation method. A total of 140 low-level spiked samples were tested by the RapidChek method after enrichment for 44-48 h in parallel with the cultural reference method. There were 88 RapidChek presumptive positives. One of the presumptive positives was not confirmed culturally. Additionally, one of the culturally confirmed samples did not exhibit a presumptive positive. No difference between the alternate confirmation method and reference confirmation method was observed. The respective cultural reference methods (USDA-FSIS/MLG, FDA/BAM, and AOAC/OMA) produced a total of 63 confirmed positive results. Nonspiked samples from all foods were reported as negative for L. monocytogenes by all methods. Probability of detection analysis demonstrated no significant differences in the number of positive samples detected by the RapidChek method and the respective cultural reference method.
Bacterial spread from cell to cell: beyond actin-based motility.
Kuehl, Carole J; Dragoi, Ana-Maria; Talman, Arthur; Agaisse, Hervé
2015-09-01
Several intracellular pathogens display the ability to propagate within host tissues by displaying actin-based motility in the cytosol of infected cells. As motile bacteria reach cell-cell contacts they form plasma membrane protrusions that project into adjacent cells and resolve into vacuoles from which the pathogen escapes, thereby achieving spread from cell to cell. Seminal studies have defined the bacterial and cellular factors that support actin-based motility. By contrast, the mechanisms supporting the formation of protrusions and their resolution into vacuoles have remained elusive. Here, we review recent advances in the field showing that Listeria monocytogenes and Shigella flexneri have evolved pathogen-specific mechanisms of bacterial spread from cell to cell. Copyright © 2015 Elsevier Ltd. All rights reserved.
Schmitter, Sibylle; Fieseler, Lars; Klumpp, Jochen; Bertram, Ralph; Loessner, Martin J
2017-08-01
To enable specific and tightly controlled gene expression both in vitro and during the intracellular lifecycle of the pathogen Listeria monocytogenes, a TetR-dependent genetic induction system was developed. Highest concentration of cytoplasmic TetR and best repression of tetO-controlled genes was obtained by tetR expression from the synthetic promoter Pt 17 . Anhydrotetracycline (ATc) as inducer permitted concentration-dependent, fine-tuned expression of genes under control of the tetO operator and a suitable promoter. The actin-polymerizing ActA protein represents a major virulence factor of L. monocytogenes, required for actin-based motility and cell-to-cell spread in infected host cells. To be able to observe its spatial and temporal distribution on intracellular L. monocytogenes cells, conditional mutants featuring actA placed under TetR control were used to infect PtK2 epithelial cells. Following induction at different time intervals, the subsequent recruitment of actin by L. monocytogenes could be monitored. We found that cells displayed functional ActA after approximately 15 min, while formation of polarized actin tail was complete after 90-120 min. At this point, intracellular motility of the induced mutants was indistinguishable from wild-type bacteria. Interestingly, de novo ActA synthesis in intracellular Listeria also demonstrated the temporal, asymmetric redistribution of the membrane-anchored proteins from the lateral walls toward the cell poles. © 2017 John Wiley & Sons Ltd.
The virulence regulator PrfA promotes biofilm formation by Listeria monocytogenes.
Lemon, Katherine P; Freitag, Nancy E; Kolter, Roberto
2010-08-01
Listeria monocytogenes is a food-borne facultative intracellular pathogen. It is widespread in the environment and has several distinct life-styles. The key transcriptional activator PrfA positively regulates L. monocytogenes virulence genes to mediate the transition from extracellular, flagellum-propelled cell to intracellular pathogen. Here we report the first evidence that PrfA also has a significant positive impact on extracellular biofilm formation. Mutants lacking prfA were defective in surface-adhered biofilm formation. The DeltaprfA mutant exhibited wild-type flagellar motility, and its biofilm defect occurred after initial surface adhesion. We also observed that mutations that led to the constitutive expression of PrfA-dependent virulence genes had a minimal impact on biofilm formation. Furthermore, biofilm development was enhanced in a mutant encoding a PrfA protein variant unable to fully transition from the extracellular form to the virulent, intracellular activity conformation. These results indicate that PrfA positively regulates biofilm formation and suggest that PrfA has a global role in modulating the life-style of L. monocytogenes. The requirement of PrfA for optimal biofilm formation may provide selective pressure to maintain this critical virulence regulator when L. monocytogenes is outside host cells in the environment.
In silico reconstitution of actin-based symmetry breaking and motility.
Directory of Open Access Journals (Sweden)
Mark J Dayel
2009-09-01
Full Text Available Eukaryotic cells assemble viscoelastic networks of crosslinked actin filaments to control their shape, mechanical properties, and motility. One important class of actin network is nucleated by the Arp2/3 complex and drives both membrane protrusion at the leading edge of motile cells and intracellular motility of pathogens such as Listeria monocytogenes. These networks can be reconstituted in vitro from purified components to drive the motility of spherical micron-sized beads. An Elastic Gel model has been successful in explaining how these networks break symmetry, but how they produce directed motile force has been less clear. We have combined numerical simulations with in vitro experiments to reconstitute the behavior of these motile actin networks in silico using an Accumulative Particle-Spring (APS model that builds on the Elastic Gel model, and demonstrates simple intuitive mechanisms for both symmetry breaking and sustained motility. The APS model explains observed transitions between smooth and pulsatile motion as well as subtle variations in network architecture caused by differences in geometry and conditions. Our findings also explain sideways symmetry breaking and motility of elongated beads, and show that elastic recoil, though important for symmetry breaking and pulsatile motion, is not necessary for smooth directional motility. The APS model demonstrates how a small number of viscoelastic network parameters and construction rules suffice to recapture the complex behavior of motile actin networks. The fact that the model not only mirrors our in vitro observations, but also makes novel predictions that we confirm by experiment, suggests that the model captures much of the essence of actin-based motility in this system.
Mitchell, Gabriel
2017-01-01
Listeria monocytogenes causes listeriosis, a foodborne disease that poses serious risks to fetuses, newborns and immunocompromised adults. This intracellular bacterial pathogen proliferates in the host cytosol and exploits the host actin polymerization machinery to spread from cell-to-cell and disseminate in the host. Here, we report that during several days of infection in human hepatocytes or trophoblast cells, L. monocytogenes switches from this active motile lifestyle to a stage of persistence in vacuoles. Upon intercellular spread, bacteria gradually stopped producing the actin-nucleating protein ActA and became trapped in lysosome-like vacuoles termed Listeria-Containing Vacuoles (LisCVs). Subpopulations of bacteria resisted degradation in LisCVs and entered a slow/non-replicative state. During the subculture of host cells harboring LisCVs, bacteria showed a capacity to cycle between the vacuolar and the actin-based motility stages. When ActA was absent, such as in ΔactA mutants, vacuolar bacteria parasitized host cells in the so-called “viable but non-culturable” state (VBNC), preventing their detection by conventional colony counting methods. The exposure of infected cells to high doses of gentamicin did not trigger the formation of LisCVs, but selected for vacuolar and VBNC bacteria. Together, these results reveal the ability of L. monocytogenes to enter a persistent state in a subset of epithelial cells, which may favor the asymptomatic carriage of this pathogen, lengthen the incubation period of listeriosis, and promote bacterial survival during antibiotic therapy. PMID:29190284
Spanu, Carlo; Scarano, Christian; Ibba, Michela; Pala, Carlo; Spanu, Vincenzo; De Santis, Enrico Pietro Luigi
2014-12-09
Food business operators (FBOs) are the primary responsible for the safety of food they place on the market. The definition and validation of the product's shelf-life is an essential part for ensuring microbiological safety of food and health of consumers. In the frame of the Regulation (EC) No 2073/2005 on microbiological criteria for foodstuffs, FBOs shall conduct shelf-life studies in order to assure that their food does not exceed the food safety criteria throughout the defined shelf-life. In particular this is required for ready-to-eat (RTE) food that supports the growth of Listeria monocytogenes . Among other studies, FBOs can rely on the conclusion drawn by microbiological challenge tests. A microbiological challenge test consists in the artificial contamination of a food with a pathogen microorganism and aims at simulating its behaviour during processing and distribution under the foreseen storage and handling conditions. A number of documents published by international health authorities and research institutions describes how to conduct challenge studies. The authors reviewed the existing literature and described the methodology for implementing such laboratory studies. All the main aspects for the conduction of L. monocytogenes microbiological challenge tests were considered, from the selection of the strains, preparation and choice of the inoculum level and method of contamination, to the experimental design and data interpretation. The objective of the present document is to provide an exhaustive and practical guideline for laboratories that want to implement L. monocytogenes challenge testing on RTE food.
Occurrence of Listeria monocytogens in raw milk of ruminants in Basrah province
Directory of Open Access Journals (Sweden)
B. A. Abbas
2012-01-01
Full Text Available The present study was performed on three hundred raw milk samples, 100 each from cows, sheep and buffaloes were collected from different places of Basrah city. 7.3 % of the samples were found to be positive for Listeria spp. Cow's milk was found to be more infected than other animals milk with this bacteria. All bacterial isolates were confirmed as L. monocytogens by colony characteristics, beta haemolysis, cold enrichment procedure, selective media, Anton test, tumbling and inverted pine tree motility and sugar fermentation tests. Most isolates were found to be sensitive to cefotaxine, sulfamethoxazol, chloramphenical and tobramycin. rifampicin was found to have less effect on these isolates. Effects of pH and temperature on bacterial growth were also studied to test the ability of this microorganism to survive in milk under severe conditions. The pH range for growth was from 4 to 9.5. The temperature range was between 4 – 45 ºC.
Mechanics model for actin-based motility.
Lin, Yuan
2009-02-01
We present here a mechanics model for the force generation by actin polymerization. The possible adhesions between the actin filaments and the load surface, as well as the nucleation and capping of filament tips, are included in this model on top of the well-known elastic Brownian ratchet formulation. A closed form solution is provided from which the force-velocity relationship, summarizing the mechanics of polymerization, can be drawn. Model predictions on the velocity of moving beads driven by actin polymerization are consistent with experiment observations. This model also seems capable of explaining the enhanced actin-based motility of Listeria monocytogenes and beads by the presence of Vasodilator-stimulated phosphoprotein, as observed in recent experiments.
Directory of Open Access Journals (Sweden)
Carlo Spanu
2014-12-01
Full Text Available Food business operators (FBOs are the primary responsible for the safety of food they place on the market. The definition and validation of the product’s shelf-life is an essential part for ensuring microbiological safety of food and health of consumers. In the frame of the Regulation (EC No 2073/2005 on microbiological criteria for foodstuffs, FBOs shall conduct shelf-life studies in order to assure that their food does not exceed the food safety criteria throughout the defined shelf-life. In particular this is required for ready-to-eat (RTE food that supports the growth of Listeria monocytogenes. Among other studies, FBOs can rely on the conclusion drawn by microbiological challenge tests. A microbiological challenge test consists in the artificial contamination of a food with a pathogen microorganism and aims at simulating its behaviour during processing and distribution under the foreseen storage and handling conditions. A number of documents published by international health authorities and research institutions describes how to conduct challenge studies. The authors reviewed the existing literature and described the methodology for implementing such laboratory studies. All the main aspects for the conduction of L. monocytogenes microbiological challenge tests were considered, from the selection of the strains, preparation and choice of the inoculum level and method of contamination, to the experimental design and data interpretation. The objective of the present document is to provide an exhaustive and practical guideline for laboratories that want to implement L. monocytogenes challenge testing on RTE food.
Andritsos, Nikolaos D; Mataragas, Marios; Paramithiotis, Spiros; Drosinos, Eleftherios H
2013-12-01
Listeria monocytogenes poses a serious threat to public health, and the majority of cases of human listeriosis are associated with contaminated food. Reliable microbiological testing is needed for effective pathogen control by food industry and competent authorities. The aims of this work were to estimate the prevalence and concentration of L. monocytogenes in minced pork meat by the application of a Bayesian modeling approach, and also to determine the performance of three culture media commonly used for detecting L. monocytogenes in foods from a deterministic and stochastic perspective. Samples (n = 100) collected from local markets were tested for L. monocytogenes using in parallel the PALCAM, ALOA and RAPID'L.mono selective media according to ISO 11290-1:1996 and 11290-2:1998 methods. Presence of the pathogen was confirmed by conducting biochemical and molecular tests. Independent experiments (n = 10) for model validation purposes were performed. Performance attributes were calculated from the presence-absence microbiological test results by combining the results obtained from the culture media and confirmative tests. Dirichlet distribution, the multivariate expression of a Beta distribution, was used to analyze the performance data from a stochastic perspective. No L. monocytogenes was enumerated by direct-plating (media were best at ruling in L. monocytogenes presence than ruling it out. Sensitivity and specificity varied depending on the culture-dependent method. None of the culture media was perfect in detecting L. monocytogenes in minced pork meat alone. The use of at least two culture media in parallel enhanced the efficiency of L. monocytogenes detection. Bayesian modeling may reduce the time needed to draw conclusions regarding L. monocytogenes presence and the uncertainty of the results obtained. Furthermore, the problem of observing zero counts may be overcome by applying Bayesian analysis, making the determination of a test performance feasible
LISTERIA MONOCYTOGENES RISK EVALUATION IN READY TO EAT DELI PRODUCTS
Directory of Open Access Journals (Sweden)
T Civera
2013-02-01
Full Text Available Listeria monocytogenes has become one of the major concerns for food safety. Its ability to survive and replicate at low temperature, pH and high salt concentration, makes the bacterium a threat, mostly for RTE products. For these reasons, the present research was aimed at detecting the ability of growth of L. monocytogenes in RTE products retrieved from one deli store. Samples were analysed for L. monocytogenes detection, then inoculated with the pathogen (105cell/ml and stored at refrigeration temperature for the duration of their shelf-life (15-60 days. In all the products L. monocytogenes was not detected before experimental contamination. The challenge test evidenced that experimentally inoculated L. monocytogenes was not able to multiply for the duration of the entire shelf-life. These results indicated that the tested products could be considered as foods which are not able to support the growth of L. monocytogenes, as indicated by E.C. Regulation 2073/05. However, in order to guarantee consumer’s safety, it needs to be emphasized the need of a correct application of the GMPs, required for lowering the risk of initial contamination.
Hollenstein, Michael; Thwaites, Philip; Bütikofer, Simon; Heinrich, Henriette; Sauter, Matthias; Ulmer, Irina; Pohl, Daniel; Ang, Daphne; Eberli, Daniel; Schwizer, Werner; Fried, Michael; Distler, Oliver; Fox, Mark; Misselwitz, Benjamin
2017-09-01
The factors that determine how people eat when they are healthy or have disease have not been defined. We used high resolution manometry (HRM) to assess pharyngeal swallowing and oesophageal motility during ingestion of a solid test meal (STM) in healthy volunteers and patients with motility disorders. This study was based at University Hospital Zurich (Zürich, Switzerland). Healthy volunteers who responded to an advertisement completed HRM with ten single water swallows (SWS) in recumbent and upright positions followed by a 200 g rice STM in the upright position. Healthy volunteers were stratified for age and sex to ensure a representative population. For comparison, consecutive patients with major motility disorders on SWS and patients with dysphagia but no major motility disorders on SWS (disease controls) were selected from a database that was assembled prospectively; the rice meal data were analysed retrospectively. During STM, pharyngeal swallows were timed and oesophageal contractions were classified as representing normal motility or different types of abnormal motility in accordance with established metrics. Factors that could potentially be associated with eating speed were investigated, including age, sex, body-mass index, and presence of motility disorder. We compared diagnoses based on SWS findings, assessed with the Chicago Classification v3.0, with those based on STM findings, assessed with the Chicago Classification adapted for solids. These studies are registered with ClinicalTrials.gov, numbers NCT02407938 and NCT02397616. Between April 2, 2014, and May 13, 2015, 72 healthy volunteers were recruited and underwent HRM. Additionally, we analysed data from 54 consecutive patients with major motility disorders and 53 with dysphagia but no major motility disorders recruited between April 2, 2013, and Dec 18, 2014. We found important variations in oesophageal motility and eating speed during meal ingestion in healthy volunteers and patients. Increased
Scintigraphic evaluation of gastrointestinal motility disorders
Energy Technology Data Exchange (ETDEWEB)
Choe, Jae Gol [College of Medicine, Korea Univ., Seoul (Korea, Republic of)
2001-02-01
Current scintigraphic tests of gastrointestinal motor function provides relevant pathophysiologic information, but their clinical utility is controversial. Many scintigraphic methods are developed to investigate gastrointestinal motility from oral cavity to colon. These are esophageal transit scintigraphy, oropharyngeal transit study, gastric emptying test, small bowel transit time measurement, colon transit study and gastroesopahgeal reflux scintigraphy. Scintigraphy of gastrointestinal tract is the most physiologic and noninvasive method to evaluate gastrointestinal motility disorders. Stomach emptying test is regarded as a gold standard in motility study. Gastrointestinal transit scintigraphy also has a certain role in assessment of drug effect to GI motility and changes after theraphy of motility disorders. Scintigraphy provides noninvasive and quantitative assessment of physiological transit throughout the gastrointestinal tract, and it is extremely useful for diagnosing gastrointestinal motor dysfunction. This article reviews the current procedures, indications, significance and guidelines for gastrointestinal motility measurements by scintigraphy.
Scintigraphic evaluation of gastrointestinal motility disorders
International Nuclear Information System (INIS)
Choe, Jae Gol
2001-01-01
Current scintigraphic tests of gastrointestinal motor function provides relevant pathophysiologic information, but their clinical utility is controversial. Many scintigraphic methods are developed to investigate gastrointestinal motility from oral cavity to colon. These are esophageal transit scintigraphy, oropharyngeal transit study, gastric emptying test, small bowel transit time measurement, colon transit study and gastroesopahgeal reflux scintigraphy. Scintigraphy of gastrointestinal tract is the most physiologic and noninvasive method to evaluate gastrointestinal motility disorders. Stomach emptying test is regarded as a gold standard in motility study. Gastrointestinal transit scintigraphy also has a certain role in assessment of drug effect to GI motility and changes after theraphy of motility disorders. Scintigraphy provides noninvasive and quantitative assessment of physiological transit throughout the gastrointestinal tract, and it is extremely useful for diagnosing gastrointestinal motor dysfunction. This article reviews the current procedures, indications, significance and guidelines for gastrointestinal motility measurements by scintigraphy
Caballero, Oscar; Alles, Susan; Le, Quynh-Nhi; Gray, R Lucas; Hosking, Edan; Pinkava, Lisa; Norton, Paul; Tolan, Jerry; Mozola, Mark; Rice, Jennifer; Chen, Yi; Ryser, Elliot; Odumeru, Joseph
2016-01-01
Work was conducted to validate performance of the ANSR(®) for Listeria monocytogenes method in selected food and environmental matrixes. This DNA-based assay involves amplification of nucleic acid via an isothermal reaction based on nicking enzyme amplification technology. Following single-step sample enrichment for 16-24 h for most matrixes, the assay is completed in 40 min using only simple instrumentation. When 50 distinct strains of L. monocytogenes were tested for inclusivity, 48 produced positive results, the exceptions being two strains confirmed by PCR to lack the assay target gene. Forty-seven nontarget strains (30 species), including multiple non-monocytogenes Listeria species as well as non-Listeria, Gram-positive bacteria, were tested, and all generated negative ANSR assay results. Performance of the ANSR method was compared with that of the U.S. Department of Agriculture, Food Safety and Inspection Service Microbiology Laboratory Guidebook reference culture procedure for detection of L. monocytogenes in hot dogs, pasteurized liquid egg, and sponge samples taken from an inoculated stainless steel surface. In addition, ANSR performance was measured against the U.S. Food and Drug Administration Bacteriological Analytical Manual reference method for detection of L. monocytogenes in Mexican-style cheese, cantaloupe, sprout irrigation water, and guacamole. With the single exception of pasteurized liquid egg at 16 h, ANSR method performance as quantified by the number of positives obtained was not statistically different from that of the reference methods. Robustness trials demonstrated that deliberate introduction of small deviations to the normal assay parameters did not affect ANSR method performance. Results of accelerated stability testing conducted using two manufactured lots of reagents predicts stability at the specified storage temperature of 4°C of more than 1 year.
Uyttendaele, M; Busschaert, P; Valero, A; Geeraerd, A H; Vermeulen, A; Jacxsens, L; Goh, K K; De Loy, A; Van Impe, J F; Devlieghere, F
2009-07-31
Processed ready-to-eat (RTE) foods with a prolonged shelf-life under refrigeration are at risk products for listeriosis. This manuscript provides an overview of prevalence data (n=1974) and challenge tests (n=299) related to Listeria monocytogenes for three categories of RTE food i) mayonnaise-based deli-salads (1187 presence/absence tests and 182 challenge tests), ii) cooked meat products (639 presence/absence tests and 92 challenge tests), and iii) smoked fish (90 presence/absence tests and 25 challenge tests), based on data records obtained from various food business operators in Belgium in the frame of the validation and verification of their HACCP plans over the period 2005-2007. Overall, the prevalence of L. monocytogenes in these RTE foods in the present study was lower compared to former studies in Belgium. For mayonnaise-based deli-salads, in 80 out of 1187 samples (6.7%) the pathogen was detected in 25 g. L. monocytogenes positive samples were often associated with smoked fish deli-salads. Cooked meat products showed a 1.1% (n=639) prevalence of the pathogen. For both food categories, numbers per gram never exceeded 100 CFU. L. monocytogenes was detected in 27.8% (25/90) smoked fish samples, while 4/25 positive samples failed to comply to the 100 CFU/g limit set out in EU Regulation 2073/2005. Challenge testing showed growth potential in 18/182 (9.9%) deli-salads and 61/92 (66%) cooked meat products. Nevertheless, both for deli-salads and cooked meat products, appropriate product formulation and storage conditions based upon hurdle technology could guarantee no growth of L. monocytogenes throughout the shelf-life as specified by the food business operator. Challenge testing of smoked fish showed growth of L. monocytogenes in 12/25 samples stored for 3-4 weeks at 4 degrees C. Of 45 (non-inoculated) smoked fish samples (13 of which were initially positive in 25 g) which were subjected to shelf-life testing, numbers exceeded 100 CFU/g in only one sample
Listeria monocytogenes in retailed raw chicken meat in Turkey.
Siriken, Belgin; Ayaz, Naim Deniz; Erol, Irfan
2014-01-01
The objectives of this study were, to find the prevalence and antimicrobial resistance of L. monocytogenes from a total of 116 chicken meat samples including 50 carcasses and 66 meat parts marketed in Turkey between 2008 and 2009 using immunomagnetic separation (IMS) based cultivation technique, to detect the hlyA gene for the verification of the isolates by PCR, and to identify the genoserotypes of the L. monocytogenes isolates by multiplex PCR assay. In the study, 51 L. monocytogenes colonies were isolated from 34 (29.3%) chicken meat samples (eleven [22.0%] carcasses and 23 [34.8%] pieces of meat) by IMS based cultivation technique and confirmed by PCR. According to the multiplex PCR results, all the 51 isolates were identified as genoserotype IIa (1/2a or 3a). L. monocytogenes isolates were also tested for their susceptibility to eight antibiotic (gentamicin, vancomycin, chloramphenicol, streptomycin, tetracycline, ampicillin, penicillin G, erythromycin) agents using the disk diffusion method. 14 isolates (27.45%) were susceptible to all eight antimicrobials drugs tested and the remaining 37 isolates (72.54%) were resistant to gentamicin (one isolate, 1.96%), vancomycin (four isolates, 7.84%), penicillin G (six isolates, 11.76%), streptomycin (nine isolates, 17.64%; resistant or intermediate), tetracycline (seven isolates, 13.72%) and ampicillin (six isolates, 11.76%). This study showed that antimicrobial resistance is not highly prevalent in L. monocytogenes isolated from chicken carcasses and pieces of meat. The presence of L. monocytogenes in chicken samples suggests an importance of this pathogen in chicken.
Fødevarebetinget listeria monocytogenes endokarditis
DEFF Research Database (Denmark)
Frydland, Martin; Bundgaard, Henning; Moser, Claus
2014-01-01
Infection with Listeria monocytogenes is rare and mainly seen in immunosuppressed patients. Infection with L. monocytogenes has a mortality rate of 30%. We present a case report of L. monocytogenes bacteraemia and endocarditis in a 70-year-old man with several co-morbidities and following four...... major surgical procedures. This illustrates the findings and characteristics in one of the 16 patients who died in 2013 and 2014 this summer due to sausage-related L. monocytogenes infection....
DEFF Research Database (Denmark)
Dalgaard, Paw; Jørgensen, Lasse Vigel
1998-01-01
with various types of seafoods. Storage trials clearly showed the growth of L. monocytogenes in naturally contaminated cold-smoked salmon to be markedly slower than growth in inoculated challenge tests. Consequently, all four models substantially overestimated growth in the naturally contaminated products...
Relationship between Listeria monocytogenes and Listeria spp. in seafood processing plants.
Alali, Walid Q; Schaffner, Donald W
2013-07-01
The objective of this study was to evaluate the relationship between prevalence of Listeria monocytogenes as an outcome and Listeria spp. as an explanatory variable by food products, food contact surfaces, and nonfood contact surfaces in seafood processing plants by using peer-reviewed published data. Nine sets of prevalence data of L. monocytogenes and Listeria spp. were collected from published studies and used for the analyses. Based on our analysis, the relationship between L. monocytogenes prevalence and Listeria spp. prevalence in food products (incoming raw materials and finish products) was significant (P = 0.04) with (low) R² = 0.36. Furthermore, Listeria spp. were not a good indicator for L. monocytogenes when testing food contact surfaces (R² = 0.10). Listeria spp. were a good indicator for L. monocytogenes only on nonfood contact surfaces (R² = 0.90). On the other hand, the presence of Listeria spp. on food contact surfaces (R² = 0.002) and nonfood contact surfaces (R² = 0.03) was not a good indicator for L. monocytogenes presence in food products. In general, prevalence of Listeria spp. does not seem to be a good indicator for L. monocytogenes prevalence in seafood processing plants.
Directory of Open Access Journals (Sweden)
Do Rim Kim
2015-01-01
Full Text Available Genetic defects during spermatogenesis can lead to a reduction in sperm motility and cause male infertility. The cation channels of sperm (CatSper play a role in the regulation of hyperactivated sperm motility in mouse testes. The effect of Trigonellae Semen (TS on the male reproductive system and CatSper protein in mouse testes during spermatogenesis was examined. C57BL/c mice were divided into the following five groups: normal, cyclophosphamide- (CP- only treated (control group, and three groups treated with varying concentrations of TS with CP (100, 500, and 1000 mg/kg TS and 100 mg/kg CP. Real-time PCR, western blot analysis, and a testosterone immunoassay were performed to assess CatSper protein levels in the five groups. Additionally, sperm cell counts and motility were examined. Results indicate that sperm motility and sperm counts increased in the TS treated groups in a dose-dependent manner (p<0.01. CatSper levels were also significantly higher in the TS treated groups compared to that of the control group (p<0.001. Therefore, TS treatment could enhance sperm function by promoting spermatogenesis and the expression of CatSper proteins in mouse testes.
Antimicrobial resistance of Listeria monocytogenes isolated from dairy-based food products.
Harakeh, Steve; Saleh, Imane; Zouhairi, Omar; Baydoun, Elias; Barbour, Elie; Alwan, Nisreen
2009-06-15
In this study Listeria monocytogenes (L. monocytogenes) was isolated from three traditionally consumed Lebanese dairy-based food products. One hundred and sixty four samples (45 samples of Baladi cheese, 36 samples of Shankleesh and 83 of Kishk) were collected from the Bekaa Valley in the Northeast region of Lebanon. Suspected Listeria colonies were selected and initially identified by using standard biochemical tests. Initial identification of the positive L. monocytogenes colonies was confirmed at the molecular level by Polymerase Chain Reaction (n=30) and the confirmed isolates were evaluated for their susceptibility to 10 commonly used antimicrobials. All of the 30 isolates were confirmed to be L. monocytogenes yielding a PCR product of approximately 660 base pairs (bp). L. monocytogenes was detected in 26.67%, 13.89% and 7.23% of the Baladi cheese, Shankleesh and Kishk samples, respectively. The highest resistance in L. monocytogenes isolates was noted against oxacillin (93.33%) followed by penicillin (90%). The results provide an indication of the contamination levels of dairy-based foods in Lebanon and highlight the emergence of multi-drug resistant Listeria in the environment.
Skowron, Krzysztof; Kwiecińska-Piróg, Joanna; Grudlewska, Katarzyna; Świeca, Agnieszka; Paluszak, Zbigniew; Bauza-Kaszewska, Justyna; Wałecka-Zacharska, Ewa; Gospodarek-Komkowska, Eugenia
2018-06-13
The aim of this research was to investigate the occurrence of Listeria monocytogenes in fish and fish processing plant and to determine their transmission, virulence and antibiotic resistance. L. monocytogenes was isolated according to the ISO 11290-1. The identification of L. monocytogenes was confirmed by multiplex PCR method. Genetic similarity of L. monocytogenes strains was determined with the Pulsed-Filed Gene Electrophoresis (PFGE) method. The multiplex PCR was used for identification of L. monocytogenes serogroups and detection of selected virulence genes (actA, fbpA, hlyA, iap, inlA, inlB, mpl, plcA, plcB, prfA). The L. monocytogens isolates susceptibility to penicillin, ampicillin, meropenem, erythromycin, trimethoprim/sulfamethoxazole was evaluated with disc diffusion method according to EUCAST v. 7.1. The presence of 237 L. monocytogenes isolates (before genetic similarity assessment) in 614 examined samples was confirmed. After strain differentiation by PFGE techniques the presence of 161 genetically different strains were confirmed. The genetic similarity of the examined isolates suggested that the source of the L. monocytogenes strains were fishes originating from farms. All tested strains possessed all detected virulence genes. Among examined strains, the most (26, 38.6%) belonged to the group 1/2a-3a. The most of tested strains were resistant to erythromycin (47.1%) and trimethoprim/sulfamethoxazole (47.1%). Copyright © 2018. Published by Elsevier B.V.
Frequency of contamination Listeria monocytogenes of raw dried cured vacuum packed sausages
Directory of Open Access Journals (Sweden)
Hristo Daskalov
2014-03-01
Full Text Available The aim of this study was to collect actual data concerning the frequency of contamination with Listeria monocytogenes of some very popular in Bulgaria raw dried cured vacuum packed sausages, produced from October 2004 till May 2008. 148 vacuum-packed samples were taken from 9 different food business operators during all seasons of the year. The samples were analyzed according to USDA method for meat foods. Ten specimens were positive for presence of Listeria monocytogenes equal to 6,75% of all tested samples. In two other raw dried cured sausages L.welshimeri and L.innocua were found, but these species are not pathogenic for consumers. In the period before the official implementation of HACCP system (01.01.2006 in Bulgaria, 52 samples were examined and 5 Listeria monocytogenes isolates were found (~10%. 2,5 years after the HACCP implementation, 96 specimens from the same meat factories were tested and 5 Listeria monocytogenes isolates (5,2% were detected. Samples taken from lots, produced in winter time were contaminated with Listeria monocytogenes more often (7 of all 10 than specimens taken during other seasons. Data were discussed through the point of view of the effectiveness of hygienic practices and HACCP system application. Also, application of ‘microbiological criterion’ set in COMMISSION REGULATION (EC No 2073/2005 for ready-to-eat foods unable to support the growth of L. monocytogenes was considered.
Sakaridis, I; Soultos, N; Iossifidou, E; Papa, A; Ambrosiadis, I; Koidis, P
2011-06-01
This study was conducted to determine the prevalence and antimicrobial resistance of Listeria monocytogenes recovered from chicken carcasses in slaughterhouses in Northern Greece. A total of 100 poultry samples (300 carcasses) were examined for Listeria spp. The samples were neck skin taken from four different slaughterhouses in Northern Greece. Forty samples were also taken from the environment of the slaughterhouses. Identification of L. monocytogenes was carried out by PCR and fingerprinting of the isolates by random amplified polymorphic DNA. L. monocytogenes strains isolated from chicken carcasses and from the environment of the slaughterhouses were also examined for antibiotic resistance. Fifty-five isolates of L. monocytogenes were tested for susceptibility to 20 antibiotics using the disk diffusion method. Listeria spp. were present in 99 of the poultry samples tested (99%), and 38 yielded L monocytogenes (38%). L. monocytogenes was also isolated in 80% of samples from the environment of a certain slaughterhouse, while the other slaughterhouses were found to be contaminated only with Listeria spp. All isolates were resistant to nalidixic acid and oxolinic acid, the majority of them to clindamycin, and only a few to tetracycline and oxytetracycline, whereas they were found to be susceptible to all other antimicrobials. The results of this study demonstrate a high prevalence of L. monocytogenes contamination in chicken carcasses, and all isolates were found to be sensitive to the antimicrobials most commonly used to treat human listeriosis.
Directory of Open Access Journals (Sweden)
Bahador
2015-08-01
Full Text Available Background Listeria monocytogenes is a foodborne pathogen and a serious threat to the public health in the world. Consumption of traditional foods such as dairy and meat products can be a major reason for relative abundance and isolation of these bacteria. Objectives The purpose of this study was to determine the phenotypic and genotypic characteristics of L. monocytogenes strains isolated from dairy and meat products. Materials and Methods A total of 317 dairy products and meat-processed samples were collected. Antibiotic susceptibility test was performed on each sample by the disk diffusion method (Kirby Bauer. Five reference loci were used for typing of L. monocytogenes strains by MLVA (Multiple Locus VNTR Analysis Technique. Results A total of 24 L. monocytogenes isolates were collected from the dairy and meat products. Resistance of isolated L. monocytogenes strains to penicillin G were 54.54% (from dairy products and 46.15% (from processed meat. Genetic relatedness of isolates were assessed by MLVA. Out of 13 different types, type 2 with 6 strains and type 3 with 4 strains, were the most common types. Conclusions MLVA analysis showed that samples obtained from different sources could have similar genetic profile. As a result, administration of penicillin in patients with listeriosis (especially pregnant women and antibiotic susceptibility test are recommended. The fast and accurate methods such as MLVA for tracking of pollution sources of L. monocytogenes are recommended during outbreaks.
Bres, Vanessa; Yang, Hua; Hsu, Ernie; Ren, Yan; Cheng, Ying; Wisniewski, Michele; Hanhan, Maesa; Zaslavsky, Polina; Noll, Nathan; Weaver, Brett; Campbell, Paul; Reshatoff, Michael; Becker, Michael
2014-01-01
The Atlas Listeria monocytogenes LmG2 Detection Assay, developed by Roka Bioscience Inc., was compared to a reference culture method for seven food types (hot dogs, cured ham, deli turkey, chicken salad, vanilla ice cream, frozen chocolate cream pie, and frozen cheese pizza) and one surface (stainless steel, grade 316). A 125 g portion of deli turkey was tested using a 1:4 food:media dilution ratio, and a 25 g portion for all other foods was tested using 1:9 food:media dilution ratio. The enrichment time and media for Roka's method was 24 to 28 h for 25 g food samples and environmental surfaces, and 44 to 48 h for 125 g at 35 ± 2°C in PALCAM broth containing 0.02 g/L nalidixic acid. Comparison of the Atlas Listeria monocytogenes LmG2 Detection Assay to the reference method required an unpaired approach. For each matrix, 20 samples inoculated at a fractional level and five samples inoculated at a high level with a different strain of Listeria monocytogenes were tested by each method. The Atlas Listeria monocytogenes LmG2 Detection Assay was compared to the Official Methods of Analysis of AOAC INTERNATIONAL 993.12 method for dairy products, the U.S. Department of Agriculture, Food Safety and Inspection Service, Microbiology Laboratory Guidebook 8.08 method for ready-to-eat meat and environmental samples, and the U.S. Food and Drug Administration Bacteriological Analytical Manual, Chapter 10 method for frozen foods. In the method developer studies, Roka's method, at 24 h (or 44 h for 125 g food samples), had 126 positives out of 200 total inoculated samples, compared to 102 positives for the reference methods at 48 h. In the independent laboratory studies, vanilla ice cream, deli turkey and stainless steel grade 316 were evaluated. Roka's method, at 24 h (or 44 h for 125 g food samples), had 64 positives out of 75 total inoculated samples compared to 54 positives for the reference methods at 48 h. The Atlas Listeria monocytogenes LmG2 Detection Assay detected all 50
Netterling, Sakura; Vaitkevicius, Karolis; Nord, Stefan; Johansson, Jörgen
2012-08-01
Listeria monocytogenes, a Gram-positive food-borne human pathogen, is able to grow at temperatures close to 0°C and is thus of great concern for the food industry. In this work, we investigated the physiological role of one DExD-box RNA helicase in Listeria monocytogenes. The RNA helicase Lmo1722 was required for optimal growth at low temperatures, whereas it was dispensable at 37°C. A Δlmo1722 strain was less motile due to downregulation of the major subunit of the flagellum, FlaA, caused by decreased flaA expression. By ribosomal fractionation experiments, it was observed that Lmo1722 was mainly associated with the 50S subunit of the ribosome. Absence of Lmo1722 decreased the fraction of 50S ribosomal subunits and mature 70S ribosomes and affected the processing of the 23S precursor rRNA. The ribosomal profile could be restored to wild-type levels in a Δlmo1722 strain expressing Lmo1722. Interestingly, the C-terminal part of Lmo1722 was redundant for low-temperature growth, motility, 23S rRNA processing, and appropriate ribosomal maturation. However, Lmo1722 lacking the C terminus showed a reduced affinity for the 50S and 70S fractions, suggesting that the C terminus is important for proper guidance of Lmo1722 to the 50S subunit. Taken together, our results show that the Listeria RNA helicase Lmo1722 is essential for growth at low temperatures, motility, and rRNA processing and is important for ribosomal maturation, being associated mainly with the 50S subunit of the ribosome.
First Trimester Listeria monocytogenes Septicemia
Goddijn, M.; Schipper, H. G.; Spanjaard, L.; Wolf, H.
1997-01-01
Background: Little is known about fetal outcome after Listeria monocytogenes septicemia in the first trimester of pregnancy.Case: A primigravida with L. monocytogenes septicemia at 9 weeks gestation was treated with amoxicillin. At 40 weeks gestation a healthy female infant was born.Conclusion: This
REAL-TIME PCR DETECTION OF LISTERIA MONOCYTOGENES IN FOOD SAMPLES OF ANIMAL ORIGIN
Directory of Open Access Journals (Sweden)
Jaroslav Pochop
2013-02-01
Full Text Available The aim of this study was to follow the contamination of food with Listeria monocytogenes by using Step One real time polymerase chain reaction (PCR. We used the PrepSEQ Rapid Spin Sample Preparation Kit for isolation of DNA and SensiFAST SYBR Hi-ROX Kit for the real-time PCR performance. In 24 samples of food of animal origin without incubation were detected strains of Listeria monocytogenes in 15 samples (swabs. Nine samples were negative. Our results indicated that the real-time PCR assay developed in this study could sensitively detect Listeria monocytogenes in food of animal origin without incubation. This could prevent infection caused by Listeria monocytogenes, and also could benefit food manufacturing companies by extending their product’s shelf-life as well as saving the cost of warehousing their food products while awaiting pathogen testing results. The rapid real-time PCR-based method performed very well compared to the conventional method. It is a fast, simple, specific and sensitive way to detect nucleic acids, which could be used in clinical diagnostic tests in the future.
Listeria monocytogenes Identification in Food of Animal Origin Used with Real Time PCR
Directory of Open Access Journals (Sweden)
Jaroslav Pochop
2013-10-01
Full Text Available The aim of this study was to follow the contamination of food with Listeria monocytogenes by using Step One real time polymerase chain reaction (RT PCR. We used the PrepSEQ Rapid Spin Sample Preparation Kit for isolation of DNA and SensiFAST SYBR Hi-ROX Kit for the real-time PCR performance. In 20 samples of food of animal origin with incubation were detected strains of Listeria monocytogenes in 9 samples (swabs. Eleven samples were negative. Our results indicated that the real-time PCR assay developed in this study could sensitively detect Listeria monocytogenes in food of animal origin without incubation. This could prevent infection caused by Listeria monocytogenes, and also could benefit food manufacturing companies by extending their product’s shelf-life as well as saving the cost of warehousing their food products while awaiting pathogen testing results. The rapid real-time PCR-based method performed very well compared to the conventional method. It is a fast, simple, specific and sensitive way to detect nucleic acids, which could be used in clinical diagnostic tests in the future.
Growth potential of Listeria monocytogenes in sliced turkey bresaola packed in modified atmosphere
Directory of Open Access Journals (Sweden)
Elena Dalzini
2014-02-01
Full Text Available According to EC Regulation No 2073/2005, for food business operators that produce ready-to-eat (RTE product, it is crucial to be able to demonstrate if the product supports the growth of Listeria monocytogenes. The objective of the study was therefore to evaluate the behaviour of L. monocytogenes in sliced RTE turkey bresaola (made by cured turkey breast 4.5% NaCl, 1% sodium lactate, sodium nitrite 150 ppm and flavouring during the shelf life of the product, simulating a contamination during the slicing operation. Considering a shelf life of 90 days, as defined by manufacturer, the packages of sliced bresaola were stored at 5°C for 7 days and at 8°C for the remaining storage time (83 days. L. monocytogenes count decreased during storage test from 1.43/1.98 log cfu/g in the three batches tested to 1.03 log cfu/g in one batch and to undetectable levels in the other two batches. The results show that the investigated product is unable to support the growth of L. monocytogenes.
Recombinant phage probes for Listeria monocytogenes
Carnazza, S.; Gioffrè, G.; Felici, F.; Guglielmino, S.
2007-10-01
Monitoring of food and environmental samples for biological threats, such as Listeria monocytogenes, requires probes that specifically bind biological agents and ensure their immediate and efficient detection. There is a need for robust and inexpensive affinity probes as an alternative to antibodies. These probes may be recruited from random peptide libraries displayed on filamentous phage. In this study, we selected from two phage peptide libraries phage clones displaying peptides capable of specific and strong binding to the L. monocytogenes cell surface. The ability of isolated phage clones to interact specifically with L. monocytogenes was demonstrated using enzyme-linked immunosorbent assay (ELISA) and confirmed by co-precipitation assay. We also assessed the sensitivity of phage-bacteria binding by PCR on phage-captured Listeria cells, which could be detected at a concentration of 104 cells ml-1. In addition, as proof-of-concept, we tested the possibility of immobilizing the affinity-selected phages to a putative biosensor surface. The quality of phage deposition was monitored by ELISA and fluorescent microscopy. Phage-bacterial binding was confirmed by high power optical phase contrast microscopy. Overall, the results of this work validate the concept of affinity-selected recombinant filamentous phages as probes for detecting and monitoring bacterial agents under any conditions that warrant their recognition, including in food products.
Listeria monocytogenes, a down-to-earth pathogen.
Vivant, Anne-Laure; Garmyn, Dominique; Piveteau, Pascal
2013-01-01
Listeria monocytogenes is the causative agent of the food-borne life threatening disease listeriosis. This pathogenic bacterium received much attention in the endeavor of deciphering the cellular mechanisms that underlie the onset of infection and its ability to adapt to the food processing environment. Although information is available on the presence of L. monocytogenes in many environmental niches including soil, water, plants, foodstuff and animals, understanding the ecology of L. monocytogenes in outdoor environments has received less attention. Soil is an environmental niche of pivotal importance in the transmission of this bacterium to plants and animals. Soil composition, microbial communities and macrofauna are extrinsic edaphic factors that direct the fate of L. monocytogenes in the soil environment. Moreover, farming practices may further affect its incidence. The genome of L. monocytogenes presents an extensive repertoire of genes encoding transport proteins and regulators, a characteristic of the genome of ubiquitous bacteria. Postgenomic analyses bring new insights in the process of soil adaptation. In the present paper focussing on soil, we review these extrinsic and intrinsic factors that drive environmental adaptation of L. monocytogenes.
Zittermann, Sandra I; Stanghini, Brenda; See, Ryan Soo; Melano, Roberto G; Boleszczuk, Peter; Murphy, Allana; Maki, Anne; Mallo, Gustavo V
2016-01-01
Detection of Listeria monocytogenes in food is currently based on enrichment methods. When L. monocytogenes is present with other Listeria species in food, the species compete during the enrichment process. Overgrowth competition of the nonpathogenic Listeria species might result in false-negative results obtained with the current reference methods. This potential issue was noted when 50 food samples artificially spiked with L. monocytogenes were tested with a real-time PCR assay and Canada's current reference method, MFHPB-30. Eleven of the samples studied were from foods naturally contaminated with Listeria species other than those used for spiking. The real-time PCR assay detected L. monocytogenes in all 11 of these samples; however, only 6 of these samples were positive by the MFHPB-30 method. To determine whether L. monocytogenes detection can be affected by other species of the same genus due to competition, an L. monocytogenes strain and a Listeria innocua strain with a faster rate of growth in the enrichment broth were artificially coinoculated at different ratios into ground pork meat samples and cultured according to the MFHPB-30 method. L. monocytogenes was detected only by the MFHPB-30 method when L. monocytogenes/L. innocua ratios were 6.0 or higher. In contrast, using the same enrichments, the real-time PCR assay detected L. monocytogenes at ratios as low as 0.6. Taken together, these findings support the hypothesis that L. monocytogenes can be outcompeted by L. innocua during the MFHPB-30 enrichment phase. However, more reliable detection of L. monocytogenes in this situation can be achieved by a PCR-based method mainly because of its sensitivity.
Directory of Open Access Journals (Sweden)
Hayat Ennaji
2008-09-01
Full Text Available Hayat Ennaji1,2, Mohammed Timinouni2, My Mustapha Ennaji3, Mohammed Hassar1, Nozha Cohen11Laboratoire de Microbiologie et Hygiène des Aliments et de l’Environnement, Institut Pasteur du Maroc., Casablanca, Morocco; 2Laboratoire de Microbiologie et Biologie Moléculaire, Institut Pasteur du Maroc., Casablanca, Morocco; 3Laboratoire de Virologie et Hygiène and Microbiologie., Faculté des Sciences et Techniques - Mohammedia, Université Hassan II, Mohammedia, MoroccoAbstract: This study was carried out on 426 samples of raw meats collected from butcheries and supermarkets in Casablanca, Morocco. The samples were examined for the occurrence of Listeria species. Strains of Listeria monocytogenes were characterized by several biochemical tests and confirmed by polymerase chain reaction (PCR. β-hemolytic cultures and nonhemolytic isolates were tested for biochemical properties with the Listeria API test. Among the 43 Listeria species isolates; we identified 10 strains for L. monocytogenes (23.3%, 31 strains for L. innocua (72.1% and 2 strains for L. welshimeri (4.6%. Strains of L. monocytogenes were separated by multiplex PCR; two serogroups IIb and IVb were thus differentiated. Antibiotic susceptibility of L. monocytogenes to 21 antibiotics was determined by the disk diffusion method. All isolates were susceptible to a wide range of the tested antibiotics with the exception of nalidixic acid, colistine and cephalosporins second and third generation for which they were all resistant.Keywords: antibiotic susceptibility, Listeria monocytogenes, meat, PCR
Role of Extracellular DNA during Biofilm Formation by Listeria monocytogenes
DEFF Research Database (Denmark)
Harmsen, Morten; Lappann, Martin; Knøchel, S
2010-01-01
(eDNA) may be the only central component of the biofilm matrix and that it is necessary for both initial attachment and early biofilm formation for 41 L. monocytogenes strains that were tested. DNase I treatment resulted in dispersal of biofilms, not only in microtiter tray assays but also in flow......Listeria monocytogenes is a food-borne pathogen that is capable of living in harsh environments. It is believed to do this by forming biofilms, which are surface-associated multicellular structures encased in a self-produced matrix. In this paper we show that in L. monocytogenes extracellular DNA...... cell biofilm assays. However, it was also demonstrated that in a culture without eDNA, neither Listeria genomic DNA nor salmon sperm DNA by itself could restore the capacity to adhere. A search for additional necessary components revealed that peptidoglycan (PG), specifically N-acetylglucosamine (NAG...
Inactivation of Listeria monocytogenes in raw fruits by enterocin AS-48.
Molinos, Antonio Cobo; Abriouel, Hikmate; Ben Omar, Nabil; Lucas, Rosario; Valdivia, Eva; Gálvez, Antonio
2008-12-01
The purpose of this study was to determine the effect of enterocin AS-48 on Listeria monocytogenes CECT 4032 in fruits and fruit juice. Fruits were contaminated with a L. monocytogenes cell suspension, washed with enterocin AS-48 (25 microg/ml) or with sterile distilled water as control, and stored at different temperatures (-20, 6, 15, 22 degrees C). Washing treatments significantly inhibited or completely inactivated L. monocytogenes in strawberries, raspberries, and blackberries stored at 15 and 22 degrees C for up to 2 days and in blackberries and strawberries at 6 degrees C for up to 7 days. Washing treatments with enterocin AS-48 also reduced viable counts in sliced melon, watermelon, pear, and kiwi but did not avoid proliferation of survivors during storage at 15 and 22 degrees C. Added enterocin (25 microg/ml) completely inactivated L. monocytogenes in watermelon juice within 24 h. To enhance the antilisterial activity of treatments, enterocin AS-48 was tested in combination with other antimicrobial substances on sliced melon stored at 22 degrees C. The combinations of enterocin AS-48 and trisodium trimetaphosphate, sodium lactate, lactic acid, polyphosphoric acid, carvacrol, hydrocinnamic acid, p-hydroxybenzoic acid, n-propyl p-hydroxybenzoate, or 2-nitropropanol showed increased antilisterial activities compared with each antimicrobial tested separately. Washing treatments with enterocin AS-48 in combination with 12 mM carvacrol, as well as with 100 mM n-propyl p-hydroxybenzoate, avoided regrowth of Listeria during storage at 22 degrees C. Results from this study indicate that enterocin AS-48 alone or in combination with other preservatives could serve as an additional hurdle against L. monocytogenes in fruits and fruit juices.
Dual-species biofilm of Listeria monocytogenes and Escherichia coli on stainless steel surface.
de Grandi, Aline Zago; Pinto, Uelinton Manoel; Destro, Maria Teresa
2018-04-12
Listeria monocytogenes is a Gram-positive bacterium commonly associated with foodborne diseases. Due its ability to survive under adverse environmental conditions and to form biofilm, this bacterium is a major concern for the food industry, since it can compromise sanitation procedures and increase the risk of post-processing contamination. Little is known about the interaction between L. monocytogenes and Gram-negative bacteria on biofilm formation. Thus, in order to evaluate this interaction, Escherichia coli and L. monocytogenes were tested for their ability to form biofilms together or in monoculture. We also aimed to evaluate the ability of L. monocytogenes 1/2a and its isogenic mutant strain (ΔprfA ΔsigB) to form biofilm in the presence of E. coli. We assessed the importance of the virulence regulators, PrfA and σ B , in this process since they are involved in many aspects of L. monocytogenes pathogenicity. Biofilm formation was assessed using stainless steel AISI 304 #4 slides immersed into brain heart infusion broth, reconstituted powder milk and E. coli preconditioned medium at 25 °C. Our results indicated that a higher amount of biofilm was formed by the wild type strain of L. monocytogenes than by its isogenic mutant, indicating that prfA and sigB are important for biofilm development, especially maturation under our experimental conditions. The presence of E. coli or its metabolites in preconditioned medium did not influence biofilm formation by L. monocytogenes. Our results confirm the possibility of concomitant biofilm formation by L. monocytogenes and E. coli, two bacteria of major significance in the food industry.
Recombinant phage probes for Listeria monocytogenes
Energy Technology Data Exchange (ETDEWEB)
Carnazza, S; Gioffre, G; Felici, F; Guglielmino, S [Department of Microbiological, Genetic and Molecular Sciences, University of Messina, Messina (Italy)
2007-10-03
Monitoring of food and environmental samples for biological threats, such as Listeria monocytogenes, requires probes that specifically bind biological agents and ensure their immediate and efficient detection. There is a need for robust and inexpensive affinity probes as an alternative to antibodies. These probes may be recruited from random peptide libraries displayed on filamentous phage. In this study, we selected from two phage peptide libraries phage clones displaying peptides capable of specific and strong binding to the L. monocytogenes cell surface. The ability of isolated phage clones to interact specifically with L. monocytogenes was demonstrated using enzyme-linked immunosorbent assay (ELISA) and confirmed by co-precipitation assay. We also assessed the sensitivity of phage-bacteria binding by PCR on phage-captured Listeria cells, which could be detected at a concentration of 10{sup 4} cells ml{sup -1}. In addition, as proof-of-concept, we tested the possibility of immobilizing the affinity-selected phages to a putative biosensor surface. The quality of phage deposition was monitored by ELISA and fluorescent microscopy. Phage-bacterial binding was confirmed by high power optical phase contrast microscopy. Overall, the results of this work validate the concept of affinity-selected recombinant filamentous phages as probes for detecting and monitoring bacterial agents under any conditions that warrant their recognition, including in food products.
Assessment of Listeria monocytogenes virulence in the Galleria mellonella insect larvae model.
Rakic Martinez, Mira; Wiedmann, Martin; Ferguson, Martine; Datta, Atin R
2017-01-01
Several animal models have been used to understand the molecular basis of the pathogenicity, infectious dose and strain to strain variation of Listeria monocytogenes. The greater wax worm Galleria mellonella, as an alternative model, provides some useful advantages not available with other models and has already been described as suitable for the virulence assessment of various pathogens including L. monocytogenes. The objectives of this study are: 1) confirming the usefulness of this model with a wide panel of Listeria spp. including non-pathogenic L. innocua, L. seeligeri, L. welshimeri and animal pathogen L. ivanovii; 2) assessment of virulence of several isogenic in-frame deletion mutants in virulence and stress related genes of L. monocytogenes and 3) virulence assessment of paired food and clinical isolates of L. monocytogenes from 14 major listeriosis outbreaks occurred worldwide between 1980 and 2015. Larvae injected with different concentrations of Listeria were incubated at 37°C and monitored over seven days for time needed to kill 50% of larvae (LT50) and to determine change of bacterial population in G. mellonella, 2 and 24 hours post-inoculation. Non-pathogenic members of Listeria and L. ivanovii showed significantly (P monocytogenes strains. Isogenic mutants of L. monocytogenes with the deletions in prfA, plcA, hly, actA and virR genes, also showed significantly (P monocytogenes strains related to non-invasive (gastroenteritis) outbreaks of listeriosis showed significantly (P < 0.05) lower virulence than isolates of the same serotype obtained from outbreaks with invasive symptoms. The difference, however, was dose and strain- dependent. No significant differences in virulence were observed among the serotype tested in this study.
Berzins,-A; Horman,-A; Lunden,-J; Korkeala,-H
2007-01-01
A total of 312 samples of sliced, vacuum packaged, cold-smoked pork from 15 meat processing plants in Latvia and Lithuania, obtained over a 15-month period from 2003 until 2004, were analyzed for the presence of Listeria monocytogenes at the end of their shelf-life. Overall, 120 samples (38%) tested positive for L. monocytogenes. Despite the long storing period, the levels of L. monocytogenes in cold-smoked pork products were low. Manufacturing processes were studied at seven meat processing ...
Jovanović, Gordana D; Klaus, Anita S; Nikšić, Miomir P
2016-01-01
The antibacterial activity of chitosan coatings prepared with acetic or lactic acid, as well as of composite chitosan-gelatin films prepared with essential oils, was evaluated in fresh shredded black radish samples inoculated with Listeria monocytogenes ATCC 19115 and L. monocytogenes ATCC 19112 during seven days of storage at 4°C. The chitosan coating prepared with acetic acid showed the most effective antibacterial activity. All tested formulations of chitosan films exhibited strong antimicrobial activity on the growth of L. monocytogenes on black radish, although a higher inhibition of pathogens was achieved at higher concentrations of chitosan. The antimicrobial effect of chitosan films was even more pronounced with the addition of essential oils. Chitosan-gelatin films with thyme essential oils showed the most effective antimicrobial activity. A reduction of 2.4log10CFU/g for L. monocytogenes ATCC 19115 and 2.1log10CFU/g for L. monocytogenes ATCC 19112 was achieved in the presence of 1% chitosan film containing 0.2% of thyme essential oil after 24h of storage. Copyright © 2016 Asociación Argentina de Microbiología. Publicado por Elsevier España, S.L.U. All rights reserved.
International Nuclear Information System (INIS)
Hannig, C.; Rummeny, E.; Wuttge-Hannig, A.
2007-01-01
For the better understanding of esophageal motility, the muscle texture and the distribution of skeletal and smooth muscle fibers in the esophagus are of crucial importance. Esophageal physiology will be shortly mentioned as far as necessary for a comprehensive understanding of peristaltic disturbances. Besides the pure depiction of morphologic criteria, a complete esophageal study has to include an analysis of the motility. New diagnostic tools with reduced radiation for dynamic imaging (digital fluoroscopy, videofluoroscopy) at 4-30 frames/s are available. Radiomanometry is a combination of a functional pressure measurement and a simultaneous dynamic morphologic analysis. Esophageal motility disorders are subdivided by radiologic and manometric criteria into primary, secondary, and nonclassifiable forms. Primary motility disorders of the esophagus are achalasia, diffuse esophageal spasm, nutcracker esophagus, and the hypertonic lower esophageal sphincter. The secondary motility disorders include pseudoachalasia, reflux-associated motility disorders, functionally caused impactions, Boerhaave's syndrome, Chagas' disease, scleroderma, and presbyesophagus. The nonclassificable motility disorders (NEMD) are a very heterogeneous collective. (orig.) [de
Occurrence of Listeria monocytogenes in smoked fish in Sokoto ...
African Journals Online (AJOL)
STORAGESEVER
2008-09-03
Sep 3, 2008 ... monocytogenes and other Listeria species are common contaminant of smoked fish, and this may pose serious public health implications. Key words: Smoked fish, Listeria monocytogenes, contamination, public health. INTRODUCTION ... L. monocytogenes belong to the recently emerging psychrotrophic ...
Directory of Open Access Journals (Sweden)
V. López
2006-12-01
. monocytogenes strains. Despite this great step forward, there is not a single marker available to test the virulence of field isolates of this species. In the future, the combination of different molecular markers will probably allow the screening of food contamination by only the virulent clones of L. monocytogenes, thus improving the prevention of foodborne human listeriosis.
Listeria monocytogenes infection in pregnancy and neonatal sepsis
Directory of Open Access Journals (Sweden)
Francesca Pascale
2008-06-01
Full Text Available Authors report a fatal neonatal sepsis caused by Listeria monocytogenes. While the diagnostic procedure aimed to identify the microrganism is described, it is emphasized the importance to recover Streptococcus agalactiae (GBS and L. monocytogenes by means of vaginal-rectal swab culture. The intrapartum screening for L. monocytogenes, by Polymerase Chain Reaction (PCR providing results in 75 minutes is also evaluated.
Directory of Open Access Journals (Sweden)
Rafael C.R. Martinez
2005-03-01
Full Text Available Bacteriocin-producing Lactobacillus sakei 1 was cultivated in Brain-Heart Infusion broth (24 h at 25ºC. The culture supernatant was neutralized, filter sterilized and used to test the activity of bacteriocin against Listeria monocytogenes 1/2a, at 8ºC and 15ºC. Non-bacteriocinogenic Lactobacillus sakei ATCC 15521 was used as a negative control. L. monocytogenes 1/2a was inoculated in culture supernatant medium from L. sakei 1 and L. sakei ATCC 15521 and the listerial populations were determined after 0, 5 and 10 days. The bacteriocin production was quantified as arbitrary units per mL (AU/mL using agar antagonism test. Additionally, to investigate if L. monocytogenes virulence pattern could be changed after bactericion exposure, the ability of L. monocytogenes to cause haemolysis in sheep red blood cells was determined, before and after exposure to bacteriocin at 8ºC. In the presence of the antimicrobial peptide, at 8ºC, L. monocytogenes population decreased, but growth of resistant cells was observed. At 15ºC, there was no difference between test and control. Furthermore, the haemolytic activity of L. monocytogenes 1/2a was not altered by exposure to L. sakei 1 bacteriocin, which suggests no change in its virulence pattern.Lactobacillus sakei 1 produtor de bacteriocina foi cultivado em caldo Infusão Cérebro-Coração por 24h a 25ºC. O sobrenadante da cultura foi neutralizado, esterilizado por filtração e usado para testar a atividade da bacteriocina frente a Listeria monocytogenes 1/2a, a 8ºC e 15ºC. Lactobacillus sakei ATCC 15521 não bacteriocinogênico, foi utilizado como controle negativo. L. monocytogenes 1/2a foi inoculada no sobrenadante da cultura de L.sakei 1 e L. sakei ATCC 15521 e as populações listeriais foram determinadas após 0, 5 e 10 dias. A produção de bacteriocina foi quantificada como unidades arbitrárias por mL (UA/mL, utilizando-se o teste de antagonismo em ágar. Adicionalmente, para investigar se o padr
Listeria spp., y L. monocytogenes EN LECHE CRUDA DE CABRA
Directory of Open Access Journals (Sweden)
Yolanda Albarracín C
2008-08-01
Full Text Available Objective. To test non-pasteurized goat’s milk from the village of ‘la Garita’, Northern Santander, for Listeria monocytogenes. Material and methods. 90 samples of non-pasteurized goat’s milk were obtained over a 4 month period; pH and temperature of each sample were measured. The INVIMA technique was used to isolate L. monocytogenes; the species was confirmed by PCR. Results. The study showed that eight goat milk providers of the zone neither had refrigeration nor pasteurized the milk. The prevalence of L. monocytogenes was 3%; 15% of the samples had other species of Listeria. The milk obtained from this zone contained the pathogen that may cause listeriosis in children less than 5 years of age, pregnant women, adults and immunologically compromised patients. Conclusions. This study shows the occurrence of this pathogen in goat’s milk and identified areas of risk for those people who drink goat’s milk.
[Analysis of antibiotic susceptibility of foodborne Listeria monocytogenes in China].
Yang, Yang; Fu, Ping; Guo, Yunchang; Liu, Xiurmei
2008-03-01
To study the antibiotic susceptibility of foodborne Listeria monocytogenes in China. The susceptibilities of 476 strains of foodborne Listeria monocytogenes to antibiotics were determined in Broth Microdilution Susceptibility Testing in Clinical and Laboratory Standards Institute. The antibiotics of gentamicin, ampicillin, penicillin, tetracycline, doxycycline, imipenem, erythromycin, ciprofloxacin, levofloxacin, cephalothin, rifampin, vancomycin, chloramphenicol, Trimethoprim-sulfamethoxazole, ampicillin-sulbactam were used. The rates of antibiotic resistance in 467 is olates were 4.5%. Tetracycline resistance was most prevalent, accouting for 4.07% . The foods that the rates of antibiotic resistance were highest were vegetable (10%). Among 14 provinces, Jilin, Hubei and Hebei were the third top, the rate of which were 19.6% and 9.1% and 8%, respectively. It was suggested that antibiotic resistance exists in foodborne Listeria monocytogenes to a certain extent in China. It should pay more attention to the use of drugs in prevention and clinic treatment to reduce the antibiotic resistant strains.
High motility reduces grazing mortality of planktonic bacteria
DEFF Research Database (Denmark)
Matz, Carsten; Jurgens, K.
2005-01-01
We tested the impact of bacterial swimming speed on the survival of planktonic bacteria in the presence of protozoan grazers. Grazing experiments with three common bacterivorous nanoflagellates revealed low clearance rates for highly motile bacteria. High-resolution video microscopy demonstrated...... size revealed highest grazing losses for moderately motile bacteria with a cell size between 0.2 and 0.4 mum(3). Grazing mortality was lowest for cells of >0.5 mum(3) and small, highly motile bacteria. Survival efficiencies of >95% for the ultramicrobacterial isolate CP-1 (less than or equal to0.1 mum......(3), >50 mum s(-1)) illustrated the combined protective action of small cell size and high motility. Our findings suggest that motility has an important adaptive function in the survival of planktonic bacteria during protozoan grazing....
Listeria monocytogenes - Danger for health safety vegetable production.
Kljujev, Igor; Raicevic, Vera; Jovicic-Petrovic, Jelena; Vujovic, Bojana; Mirkovic, Milica; Rothballer, Michael
2018-04-22
The microbiologically contaminated vegetables represent a risk for consumers, especially vegetables without thermal processing. It is known that human pathogen bacteria, such as Listeria monocytogenes, could exist on fresh vegetables. The fresh vegetables could become Listeria-contaminated if they come in touch with contaminated soil, manure, irrigation water. The aim of this work was to investigate the presence of Listeria spp. and L. monocytogenes in different kind of vegetables grown in field and greenhouse condition as well as surface and endophytic colonization plant roots of different vegetables species by L. monocytogenes in laboratory conditions. The detection of Listeria spp. and L. monocytogenes in vegetable samples was done using ISO and PCR methods. The investigation of colonization vegetable roots and detection Listeria-cells inside plant root tissue was done using Fluorescence in situ hybridization (FISH) method in combination with confocal laser scanning microscopy (CLSM). The results showed that 25.58% vegetable samples were positive for Listeria spp. and only one sample (carrot) was positive for L. monocytogenes out of 43 samples in total collected from field and greenhouse. The strain L. monocytogenes EGD-E surface and endophytic colonized carrot root in highest degree while strain L. monocytogenes SV4B was the most represented at leafy vegetable plants, such at lettuce (1.68 × 10 6 cells/mm 3 absolutely dry root) and spinach (1.39 × 10 6 cells/mm 3 absolutely dry root) root surface. The cells of L. monocytogenes SV4B were visible as single cells in interior tissue of plant roots (celery and sweet corn roots) as well as in the interior of the plant root cell at sweet corn root. The cells of L. monocytogenes EGD-E bind to the surface of the plant root and they were less commonly found out on root hair. In the inner layers of the root, those bacterial cells were inhabited intercellular spaces mainly as single cells very close to the
An insight into the isolation, enumeration and molecular detection of Listeria monocytogenes in food
Directory of Open Access Journals (Sweden)
Jodi Woan-Fei Law
2015-11-01
Full Text Available Listeria monocytogenes, a foodborne pathogen that can cause listeriosis through the consumption of food contaminated with this pathogen. The ability of L. monocytogenes to survive in extreme conditions and cause food contaminations have become a major concern. Hence, routine microbiological food testing is necessary to prevent food contamination and outbreaks of foodborne illness. This review provides insight into the methods for cultural detection, enumeration and molecular identification of L. monocytogenes in various food samples. There are a number of enrichment and plating media that can be used for the isolation of L. monocytogenes from food samples. Enrichment media such as buffered Listeria Enrichment Broth (BLEB, Fraser broth and University of Vermont Medium (UVM Listeria enrichment broth are recommended by regulatory agencies such as FDA-BAM, USDA-FSIS and ISO. Many plating media are available for the isolation of L. monocytogenes, for instance, PALCAM, Oxford and other chromogenic media. Besides, reference methods like FDA-BAM, ISO 11290 method and USDA-FSIS method are usually applied for the cultural detection or enumeration of L. monocytogenes. MPN technique is applied for the enumeration of L. monocytogenes in the case of low level contamination. Molecular methods including polymerase chain reaction (PCR, multiplex polymerase chain reaction (mPCR, real-time/quantitative polymerase chain reaction (qPCR, nucleic acid sequence-based amplification (NASBA, loop-mediated isothermal amplification (LAMP, DNA microarray and Next Generation Sequencing (NGS technology for the detection and identification of L. monocytogenes are discussed in this review. Overall, molecular methods are rapid, sensitive, specific, time- and labour-saving. In future, there are chances for the development of new techniques for the detection and identification of foodborne with improved features.
Chen, Jianshun; Jiang, Lingli; Chen, Xueyan; Luo, Xiaokai; Chen, Yang; Yu, Ying; Tian, Guoming; Liu, Dongyou; Fang, Weihuan
2009-03-01
The genus Listeria consists of six closely related species and forms three phylogenetic groups: L. monocytogenes- L. innocua, L. ivanovii-L. seeligeri-L. welshimeri, and L. grayi. In this report, we attempted to examine the evolutionary relationship in the L. monocytogenes-L. innocua group by probing the nucleotide sequences of 23S rRNA and 16S rRNA, and the gene clusters lmo0029-lmo0042, ascBdapE, rplS-infC, and prs-ldh in L. monocytogenes serovars 1/2a, 4a, and 4b, and L. innocua. Additionally, we assessed the status of L. monocytogenes-specific inlA and inlB genes and 10 L. innocua-specific genes in these species/serovars, together with phenotypic characterization by using in vivo and in vitro procedures. The results indicate that L. monocytogenes serovar 4a strains are genetically similar to L. innocua in the lmo0035-lmo0042, ascB-dapE, and rplS-infC regions and also possess L. innocua-specific genes lin0372 and lin1073. Furthermore, both L. monocytogenes serovar 4a and L. innocua exhibit impaired intercellular spread ability and negligible pathogenicity in mouse model. On the other hand, despite resembling L. monocytogenes serovars 1/2a and 4b in having a nearly identical virulence gene cluster, and inlA and inlB genes, these serovar 4a strains differ from serovars 1/2a and 4b by harboring notably altered actA and plcB genes, displaying strong phospholipase activity and subdued in vivo and in vitro virulence. Thus, by possessing many genes common to L. monocytogenes serovars 1/2a and 4b, and sharing many similar gene deletions with L. innocua, L. monocytogenes serovar 4a represents a possible evolutionary intermediate between L. monocytogenes serovars 1/2a and 4b and L. innocua.
Biofilm Formation of Listeria monocytogenes on Various Surfaces
Directory of Open Access Journals (Sweden)
M Mahdavi
2007-10-01
Full Text Available Introduction & Objective: Listeria monocytogenes is considered as a ubiquitous foodborne pathogen which can lead to serious infections, especially in newborns, elderly, pregnant, and immunocompromised people. The organism has been isolated from many foods and may cause meningitis, septicemia and abortion in pregnant women. Also L. monocytogenes forms biofilms on many food contact surface materials and medical devices. Development of biofilms on many surfaces is a potential source of contamination of foods that may lead to spoilage or transmission of foodborne pathogens. Materials & Methods: Biofilm formation of L. monocytogenes (RITCC 1293 serotype 4a was investigated. Hydrophobicity of L. monocytogenes was measured by MATH method. Then biofilm formation of the organism was assessed at 2, 4, 8, 16 and 20 hours on stainless steel (type 304 no 2B, polyethylene and glass by drop plate method. Results: Results indicated that L. monocytogenes with 85% of hydrophobicity formed biofilm on each of three surfaces. Biofilm formation on stainless steel surfaces was significantly more than other surfaces (p<0.05. Conclusion: The ability of biofilm formation of L. monocytogenes on medical devices and food containers is very important as far as hygiene and disease outbreaks are concerned.
Directory of Open Access Journals (Sweden)
Maria da Graça F. Nascimento
1994-12-01
Full Text Available Autoclaved distilled water samples were inoculated with L. monocytogenes strain V7 and strain VPH-1, and incubated aerobically, at 30 C for 48 hours. Each strain was tested individually, and growth curves were determined at 1, 2, 3, 4, 5, 21, 24, and 48 hours. The growth or survival of L. monocytogenes was similar for both strains, with survivors at 24 hour-incubation. The microbicidal activity of one synthetic cationic peptide (NP-2 was examined against L. monocytogenes strain V7, in a water system. Antibacterial activity of NP-2 (1, 5, and 10 g/ml was best expressed at 60 minute-incubation, with 10 g/ml of peptide, at 30 C.Amostras de água destilada, autoclavadas, foram inoculadas com L. monocytogenes cepa V7 e cepa VPH-1, e incubadas, aerobicamente, a 30ºC por 48 horas. Cada cepa foi testada individualmente, e determinou-se curvas de crescimento a 1, 2, 3, 4, 5, 21, 24, e 48 horas. O crescimento ou sobrevivência das duas cepas foi semelhante e encontrou-se sobreviventes em 24 horas de incubação. Examinou-se a atividade bactericida de um dos peptídeos catiônicos sintéticos (NP-2 contra L. monocytogenes cepa V7, em sistema aquoso. A atividade antibacteriana de NP-2 (1, 5, and 10µg/ml foi melhor aos 60 minutos de incubação, com 10µg/ml de peptídeo, a 30 C.
Rückerl, I; Muhterem-Uyar, M; Muri-Klinger, S; Wagner, K-H; Wagner, M; Stessl, B
2014-10-17
The aim of this study was to analyze the changing patterns of Listeria monocytogenes contamination in a cheese processing facility manufacturing a wide range of ready-to-eat products. Characterization of L. monocytogenes isolates included genotyping by pulsed-field gel electrophoresis (PFGE) and multi-locus sequence typing (MLST). Disinfectant-susceptibility tests and the assessment of L. monocytogenes survival in fresh cheese were also conducted. During the sampling period between 2010 and 2013, a total of 1284 environmental samples were investigated. Overall occurrence rates of Listeria spp. and L. monocytogenes were 21.9% and 19.5%, respectively. Identical L. monocytogenes genotypes were found in the food processing environment (FPE), raw materials and in products. Interventions after the sampling events changed contamination scenarios substantially. The high diversity of globally, widely distributed L. monocytogenes genotypes was reduced by identifying the major sources of contamination. Although susceptible to a broad range of disinfectants and cleaners, one dominant L. monocytogenes sequence type (ST) 5 could not be eradicated from drains and floors. Significantly, intense humidity and steam could be observed in all rooms and water residues were visible on floors due to increased cleaning strategies. This could explain the high L. monocytogenes contamination of the FPE (drains, shoes and floors) throughout the study (15.8%). The outcome of a challenge experiment in fresh cheese showed that L. monocytogenes could survive after 14days of storage at insufficient cooling temperatures (8 and 16°C). All efforts to reduce L. monocytogenes environmental contamination eventually led to a transition from dynamic to stable contamination scenarios. Consequently, implementation of systematic environmental monitoring via in-house systems should either aim for total avoidance of FPE colonization, or emphasize a first reduction of L. monocytogenes to sites where
78 FR 27939 - Draft Interagency Risk Assessment-Listeria monocytogenes
2013-05-13
... Listeria (L.) monocytogenes contamination of certain ready-to-eat (RTE) foods, for example cheese, deli... Scott, V.N., Survey of Listeria monocytogenes in ready-to-eat foods. Journal of Food Protection, 2003... monocytogenes in ready-to-eat processed meat and poultry collected in four FoodNet states in International...
Presence of Listeria monocytogenes in Mediterranean-Style Dry Fermented Sausages
Directory of Open Access Journals (Sweden)
Domenico Meloni
2015-03-01
Full Text Available The morphological, physiological and epidemiological features of L. monocytogenes, together with the severity of human listeriosis infections, make L. monocytogenes of particular concern for manufacturers of cold-stored “ready to eat” (RTE foods. L. monocytogenes has been isolated from a wide variety of RTE foods and is responsible for several outbreaks associated with the consumption of RTE meat, poultry, dairy, fish and vegetable products. Although L. monocytogenes is among the most frequently-detected pathogens in dry fermented sausages, these products could be included in the category of RTE products in which the growth of L. monocytogenes is not favored and have rarely been implicated in listeriosis outbreaks. However, L. monocytogenes is highly difficult to control in fermented sausage processing environments due to its high tolerance to low pH and high salt concentration. In many Mediterranean-style dry fermented sausages, an empirical application of the hurdle technology often occurs and the frequent detection of L. monocytogenes in these products at the end of ripening highlights the need for food business operators to properly apply hurdle technology and to control the contamination routes of L. monocytogenes in the processing plants. In the following, through an up-to-date review of (personal and un- published data, the main aspects of the presence of L. monocytogenes in Mediterranean-style dry fermented sausages will be discussed.
Presence of Listeria monocytogenes in Mediterranean-Style Dry Fermented Sausages.
Meloni, Domenico
2015-03-12
The morphological, physiological and epidemiological features of L. monocytogenes , together with the severity of human listeriosis infections, make L. monocytogenes of particular concern for manufacturers of cold-stored "ready to eat" (RTE) foods. L. monocytogenes has been isolated from a wide variety of RTE foods and is responsible for several outbreaks associated with the consumption of RTE meat, poultry, dairy, fish and vegetable products. Although L. monocytogenes is among the most frequently-detected pathogens in dry fermented sausages, these products could be included in the category of RTE products in which the growth of L. monocytogenes is not favored and have rarely been implicated in listeriosis outbreaks. However, L. monocytogenes is highly difficult to control in fermented sausage processing environments due to its high tolerance to low pH and high salt concentration. In many Mediterranean-style dry fermented sausages, an empirical application of the hurdle technology often occurs and the frequent detection of L. monocytogenes in these products at the end of ripening highlights the need for food business operators to properly apply hurdle technology and to control the contamination routes of L. monocytogenes in the processing plants. In the following, through an up-to-date review of (personal and un-) published data, the main aspects of the presence of L. monocytogenes in Mediterranean-style dry fermented sausages will be discussed.
Incorporation of Listeria monocytogenes strains in raw milk biofilms.
Weiler, Christiane; Ifland, Andrea; Naumann, Annette; Kleta, Sylvia; Noll, Matthias
2013-02-01
Biofilms develop successively on devices of milk production without sufficient cleaning and originate from the microbial community of raw milk. The established biofilm matrices enable incorporation of pathogens like Listeria monocytogenes, which can cause a continuous contamination of food processing plants. L. monocytogenes is frequently found in raw milk and non-pasteurized raw milk products and as part of a biofilm community in milk meters and bulk milk tanks. The aim of this study was to analyze whether different L. monocytogenes strains are interacting with the microbial community of raw milk in terms of biofilm formation in the same manner, and to identify at which stage of biofilm formation a selected L. monocytogenes strain settles best. Bacterial community structure and composition of biofilms were analyzed by a cloning and sequencing approach and terminal restriction fragment length polymorphism analysis (T-RFLP) based on the bacterial 16S rRNA gene. The chemical composition of biofilms was analyzed by Fourier transform infrared spectroscopy (FTIR), while settled L. monocytogenes cells were quantified by fluorescence in situ hybridization (FISH). Addition of individual L. monocytogenes strains to raw milk caused significant shifts in the biofilm biomass, in the chemical as well as in the bacterial community composition. Biofilm formation and attachment of L. monocytogenes cells were not serotype but strain specific. However, the added L. monocytogenes strains were not abundant since mainly members of the genera Citrobacter and Lactococcus dominated the bacterial biofilm community. Overall, added L. monocytogenes strains led to a highly competitive interaction with the raw milk community and triggered alterations in biofilm formation. Copyright © 2012 Elsevier B.V. All rights reserved.
Prevalence and growth of Listeria monocytogenes in naturally contaminated seafood
DEFF Research Database (Denmark)
Jørgensen, Lasse Vigel; Huss, Hans Henrik
1998-01-01
Listeria monocytogenes contamination of seafood varies with product category. The highest prevalence was found in cold- smoked fish (34-60%), while the lowest was found in heat- treated and cured seafood (4-12%). The prevalence of L. monocytogenes differed greatly in cold-smoked salmon between...... production sites, ranging from monocytogenes. The organism showed moderate growth...... in naturally contaminated cold-smoked, and 'gravad', fish while the growth appeared faster in hot smoked fish. Thus L. monocytogenes is not under control in these products. Finally, the prevalence and growth of L. monocytogenes in naturally contaminated cold-smoked salmon are discussed in relation...
Regional gastrointestinal contractility parameters using the wireless motility capsule
DEFF Research Database (Denmark)
Farmer, A D; Wegeberg, A-M L; Brock, B
2018-01-01
BACKGROUND: The wireless motility capsule concurrently measures temperature, pH and pressure as it traverses the gastrointestinal tract. AIMS: To describe normative values for motility/contractility parameters across age, gender and testing centres. METHODS: Healthy participants underwent...
Listeria monocytogenes endophthalmitis following keratoconjunctivitis
Directory of Open Access Journals (Sweden)
Shoughy SS
2014-01-01
Full Text Available Samir S Shoughy,1 Khalid F Tabbara1–31The Eye Center and The Eye Foundation for Research in Ophthalmology, Riyadh, Saudi Arabia; 2Department of Ophthalmology, College of Medicine, King Saud University, Riyadh, Saudi Arabia; 3The Wilmer Ophthalmological Institute of The Johns Hopkins University School of Medicine, Baltimore, MD, USAAbstract: Endophthalmitis due to endogenous or exogenous bacteria is a rare infection of the eye. We report a case of endophthalmitis following Listeria monocytogenes keratoconjunctivitis in a 27-year-old healthy white male presenting with hand motion visual acuity, right eye mucopurulent conjunctivitis, elevated intraocular pressure, and pigmented hypopyon 6 months post-keratectomy. The conjunctivitis was unresponsive to a 5-day course of topical tobramycin eye drops, and the patient developed keratitis with pain that progressed to endophthalmitis after 21 days. Diagnostic B-scan revealed vitreous exudates. Intraocular fluid specimen showed Gram-positive organisms and the aqueous culture grew penicillin-/aminoglycoside-sensitive L. monocytogenes. The patient was given intravitreal and systemic vancomycin and ceftazidime. The eye was unresponsive to intravenous penicillin and gentamicin; the anterior chamber progressively flattened and developed phthisis bulbi. L. monocytogenes keratoconjunctivitis may lead to bacterial endophthalmitis. Prompt culture and early antibiotic therapy are recommended.Keywords: conjunctivitis, L. monocytogenes, endophthalmitis
An outbreak of an unusual strain of Listeria monocytogenes infection in North-East Scotland
Directory of Open Access Journals (Sweden)
Emmanuel Okpo
2015-11-01
Full Text Available Summary: Listeria monocytogenes infection is an important cause of illness and hospitalization in vulnerable individuals. In the present study, we describe a community outbreak of Listeria monocytogenes in the North-East region of Scotland, which was epidemiologically, environmentally and microbiologically linked to a local meat product and ready-to-eat product manufacturer. Infected individuals were interviewed, and an environmental investigation was conducted. Clinical and environmental samples were tested by culture, and isolates were typed by fluorescent amplified fragment length polymorphism (fAFLP. Three cases of Listeria monocytogenes were linked geographically, had the same serotype (1/2a and were indistinguishable by fAFLP type XII.6. The human, food and environmental isolates were of the same serotype and were indistinguishable by molecular typing.This is the first community outbreak of L. monocytogenes reported in Scotland since the current outbreak surveillance was established in 1996. Epidemiological and laboratory evidence indicated poor hand hygiene, unhygienic practices and cross-contamination throughout the manufacturing process of ready-to-eat foods as a possible cause of the outbreak. More stringent control of commercial food establishments that provide ready-to-eat food and the need to advise specifically vulnerable groups, e.g., pregnant women, of the risk of L. monocytogenes in ready-to-eat food is urgently needed. Keywords: Listeria monocytogenes, Outbreak, Foodborne, Community acquired infection, Listeriosis
Law, Jodi Woan-Fei; Ab Mutalib, Nurul-Syakima; Chan, Kok-Gan; Lee, Learn-Han
2015-01-01
Listeria monocytogenes, a foodborne pathogen that can cause listeriosis through the consumption of food contaminated with this pathogen. The ability of L. monocytogenes to survive in extreme conditions and cause food contaminations have become a major concern. Hence, routine microbiological food testing is necessary to prevent food contamination and outbreaks of foodborne illness. This review provides insight into the methods for cultural detection, enumeration, and molecular identification of L. monocytogenes in various food samples. There are a number of enrichment and plating media that can be used for the isolation of L. monocytogenes from food samples. Enrichment media such as buffered Listeria enrichment broth, Fraser broth, and University of Vermont Medium (UVM) Listeria enrichment broth are recommended by regulatory agencies such as Food and Drug Administration-bacteriological and analytical method (FDA-BAM), US Department of Agriculture-Food and Safety (USDA-FSIS), and International Organization for Standardization (ISO). Many plating media are available for the isolation of L. monocytogenes, for instance, polymyxin acriflavin lithium-chloride ceftazidime aesculin mannitol, Oxford, and other chromogenic media. Besides, reference methods like FDA-BAM, ISO 11290 method, and USDA-FSIS method are usually applied for the cultural detection or enumeration of L. monocytogenes. most probable number technique is applied for the enumeration of L. monocytogenes in the case of low level contamination. Molecular methods including polymerase chain reaction, multiplex polymerase chain reaction, real-time/quantitative polymerase chain reaction, nucleic acid sequence-based amplification, loop-mediated isothermal amplification, DNA microarray, and next generation sequencing technology for the detection and identification of L. monocytogenes are discussed in this review. Overall, molecular methods are rapid, sensitive, specific, time- and labor-saving. In future, there are
Modeling and predicting the growth boundary of Listeria monocytogenes in lightly preserved seafood
DEFF Research Database (Denmark)
Mejlholm, Ole; Dalgaard, Paw
2007-01-01
The antimicrobial effect of diacetate and lactate against Listeria monocytogenes was evaluated in challenge tests with vacuum-packaged or modified atmosphere packaged (MAP) cold-smoked salmon, marinated salmon, cold-smoked Greenland halibut, marinated Greenland halibut, and gravad salmon. MAP col...... characteristics required to prevent the growth of L. monocytogenes, thereby making it possible to identify critical control points, and is useful for compliance with the new European Union regulation on ready-to-eat foods (EC 2073/2005)....
Directory of Open Access Journals (Sweden)
Michela Ibba
2013-09-01
Full Text Available Listeria monocytogenes harbouring niches established in the processing plant support post-process contamination of dairy products made from pasteurised or thermised milk. The present study investigated L. monocytogenes environmental contamination in two sheep’s milk cheese-making plants. Persistence of contamination in the area at higher risk was also investigated. During a one-year survey 7 samplings were carried out in each dairy plant, along the production lines of Pecorino Romano and ricotta salata cheese. A total of 613 environmental samples collected from food contact and non-food contact surfaces were analysed according to ISO 11290-1:2005 standard method. Identification of the isolated strains was carried out by polymerase chain reaction. L. monocytogenes prevalence was 23.2% in dairy A and 13.1% in dairy B, respectively. The higher prevalence rate was found in the following areas: salting, products washing, packaging, ricotta salata storage and Pecorino Romano ripening rooms. L. monocytogenes was never found in the cheese-making area. The probability of observing samples positive for the presence of L. monocytogenes was asso- ciated with dairy plant, sampling area and the period of cheese-making (P<0.001. The greater persistence of contamination over time was observed in the washing, salting, and Pecorino Romano ripening areas. The control of persistent environmental contamination relies on the identification of L. monocytogenes niches within the processing environment and the prevention of harborage sites formation. The importance of strict cleaning and sanitising procedure in controlling L. monocytogenes environmental contamination is confirmed by the lower level of contamination observed after these procedures were correctly implemented.
Zanini, S F; Silva-Angulo, A B; Rosenthal, A; Rodrigo, D; Martínez, A
2014-05-01
The aim of this study was to evaluate the antibiotic susceptibility of Listeria innocua (L. innocua) and Listeria monocytogenes (L. monocytogenes) cells in the presence of citral and carvacrol at sublethal concentrations in an agar medium. The presence of terpenes in the L. monocytogenes and L. innocua culture medium provided a reduction in the minimal inhibitory concentration (MIC) of all the antibiotics tested. These effects were dependent on the concentration of terpenes present in the culture medium. The combination of citral and carvacrol potentiated antibiotic activity by reducing the MIC values of bacitracin and colistin from 32.0 and 128.0 μg ml⁻¹ to 1.0 and 2.0 μg ml⁻¹, respectively. Thus, both Listeria species became more susceptible to these drugs. In this way, the colistin and bacitracin resistance of L. monocytogenes and L. innocua was reversed in the presence of terpenes. Results obtained in this study show that the phytochemicals citral and carvacrol potentiate antibiotic activity, reducing the MIC values of cultured L. monocytogenes and L. innocua. Phytochemicals citral and carvacrol potentiate antibiotic activity of erythromycin, bacitracin and colistin by reducing the MIC values of cultured Listeria monocytogenes and Listeria innocua. This effect in reducing the MIC values of the antibiotics tested in both micro-organisms was increased when natural antimicrobials were combined. This finding indicated that the combination among terpenes and antibiotic may contribute in reducing the required dosage of antibiotics due to the possible effect of terpenes on permeation barrier of the micro-organism cell membrane. © 2014 The Society for Applied Microbiology.
Listeria monocytogenes endophthalmitis following keratoconjunctivitis.
Shoughy, Samir S; Tabbara, Khalid F
2014-01-01
Endophthalmitis due to endogenous or exogenous bacteria is a rare infection of the eye. We report a case of endophthalmitis following Listeria monocytogenes keratoconjunctivitis in a 27-year-old healthy white male presenting with hand motion visual acuity, right eye mucopurulent conjunctivitis, elevated intraocular pressure, and pigmented hypopyon 6 months post-keratectomy. The conjunctivitis was unresponsive to a 5-day course of topical tobramycin eye drops, and the patient developed keratitis with pain that progressed to endophthalmitis after 21 days. Diagnostic B-scan revealed vitreous exudates. Intraocular fluid specimen showed Gram-positive organisms and the aqueous culture grew penicillin-/aminoglycoside-sensitive L. monocytogenes. The patient was given intravitreal and systemic vancomycin and ceftazidime. The eye was unresponsive to intravenous penicillin and gentamicin; the anterior chamber progressively flattened and developed phthisis bulbi. L. monocytogenes keratoconjunctivitis may lead to bacterial endophthalmitis. Prompt culture and early antibiotic therapy are recommended.
Isolation and biochemical and molecular characterization of Listeria monocytogenes in food
International Nuclear Information System (INIS)
Helel, Salma
2008-01-01
monocytogenes is a Gram-positive bacteria, saprophytic, non-spore. This is an extremely resistant seeds to environmental conditions outside, especially since the cold psychrotrophic. It can contaminate raw vegetables, cooked meals ready for consumption or foods to be stored in the refrigerator, such as cheese or meat. It is the bacteria responsible for listeriosis. It threatens first unborn children, infants, pregnant women, the elderly and people whose immune system is weakened. Strains of Listeria spp isolated from foods (seafood, meat, meat) were first identified at the stage of the genus by classical tests (Gram staining, catalase test, oxidase test and mobility) and stage of the test case by hemolysis, CAMP test and the gallery Api Listeria. Biochemical characterization allowed after a numerical analysis, to assign 100% of isolates to the genus Listeria. Molecular characterization was performed by PCR amplification of genes coding for protein p60 (iap), the listeriolysine O (hly), the Phosphatidylinositol Phospholipase C (PI-PLC plca) Phosphatidylcholine Phospholipase C (plcB). The result showed an amplification of the iap gene of 100% of the hly gene, plca, plcB of 31.81%. This characterization represents an identification of the collection on the genetic level and shows that 31.81% of isolates, is likely to express the genes responsible for virulence factors of L. monocytogenes, to produce listeriolysine O, phospholipase C and Lecithinase. The molecular identification was performed by microarray technique and identified isolates L. September monocytogenes (five original clinical isolates and two food-borne), fourteen L. innocua (of food) and a strain not identified by DNA chip.. (Author)
Activity of daptomycin against Listeria monocytogenes isolates from cerebrospinal fluid
Spanjaard, Lodewijk; Vandenbroucke-Grauls, Christina M. J. E.
2008-01-01
We tested the activity of daptomycin against 76 Listeria monocytogenes isolates from cerebrospinal fluid by broth dilution and Etest methods. For the broth dilution method, the MIC range was 1.0 to 8.0 and the MIC at which 90% of the isolates tested were inhibited (MIC(90)) was 4.0 mg/liter. For the
Assessment of Listeria monocytogenes virulence in the Galleria mellonella insect larvae model.
Directory of Open Access Journals (Sweden)
Mira Rakic Martinez
Full Text Available Several animal models have been used to understand the molecular basis of the pathogenicity, infectious dose and strain to strain variation of Listeria monocytogenes. The greater wax worm Galleria mellonella, as an alternative model, provides some useful advantages not available with other models and has already been described as suitable for the virulence assessment of various pathogens including L. monocytogenes. The objectives of this study are: 1 confirming the usefulness of this model with a wide panel of Listeria spp. including non-pathogenic L. innocua, L. seeligeri, L. welshimeri and animal pathogen L. ivanovii; 2 assessment of virulence of several isogenic in-frame deletion mutants in virulence and stress related genes of L. monocytogenes and 3 virulence assessment of paired food and clinical isolates of L. monocytogenes from 14 major listeriosis outbreaks occurred worldwide between 1980 and 2015. Larvae injected with different concentrations of Listeria were incubated at 37°C and monitored over seven days for time needed to kill 50% of larvae (LT50 and to determine change of bacterial population in G. mellonella, 2 and 24 hours post-inoculation. Non-pathogenic members of Listeria and L. ivanovii showed significantly (P < 0.05 higher LT50 (lower virulence than the wild type L. monocytogenes strains. Isogenic mutants of L. monocytogenes with the deletions in prfA, plcA, hly, actA and virR genes, also showed significantly (P < 0.05 higher LT50 than the wild type strain at the inoculum of 106CFU/larva. Food isolates had significantly (P < 0.05 lower virulence than the paired clinical isolates, at all three inoculum concentrations. L. monocytogenes strains related to non-invasive (gastroenteritis outbreaks of listeriosis showed significantly (P < 0.05 lower virulence than isolates of the same serotype obtained from outbreaks with invasive symptoms. The difference, however, was dose and strain- dependent. No significant differences in
Simmons, Courtenay; Stasiewicz, Matthew J; Wright, Emily; Warchocki, Steven; Roof, Sherry; Kause, Janell R; Bauer, Nathan; Ibrahim, Salam; Wiedmann, Martin; Oliver, Haley F
2014-11-01
Postprocessing contamination in processing plants has historically been a significant source of Listeria monocytogenes in ready-to-eat delicatessen meats, and therefore a major cause of human listeriosis cases and outbreaks. Recent risk assessments suggest that a majority of human listeriosis cases linked to consumption of contaminated deli meats may be due to L. monocytogenes contamination that occurs at the retail level. To better understand the ecology and transmission of Listeria spp. in retail delicatessens, food and nonfood contact surfaces were tested for L. monocytogenes and other Listeria spp. in a longitudinal study conducted in 30 retail delis in three U.S. states. In phase I of the study, seven sponge samples were collected monthly for 3 months in 15 delis (5 delis per state) prior to start of daily operation; in phase II, 28 food contact and nonfood contact sites were sampled in each of 30 delis during daily operation for 6 months. Among the 314 samples collected during phase I, 6.8% were positive for L. monocytogenes. Among 4,503 samples collected during phase II, 9.5% were positive for L. monocytogenes; 9 of 30 delis showed low L. monocytogenes prevalence (Listeria spp. isolates, including 184 Listeria innocua, 48 Listeria seeligeri, and 13 Listeria welshimeri were characterized. Pulsed-field gel electrophoresis (PFGE) was used to characterize 446 L. monocytogenes isolates. PFGE showed that for 12 of 30 delis, one or more PFGE types were isolated on at least three separate occasions, providing evidence for persistence of a given L. monocytogenes subtype in the delis. For some delis, PFGE patterns for isolates from nonfood contact surfaces were distinct from patterns for occasional food contact surface isolates, suggesting limited cross-contamination between these sites in some delis. This study provides longitudinal data on L. monocytogenes contamination patterns in retail delis, which should facilitate further development of control strategies in
Ultrasonic cleaning of conveyor belt materials using Listeria monocytogenes as a model organism.
Tolvanén, Riina; Lunden, Janne; Korkeala, Hannu; Wirtanen, Gun
2007-03-01
Persistent Listeria monocytogenes contamination of food industry equipment is a difficult problem to solve. Ultrasonic cleaning offers new possibilities for cleaning conveyors and other equipment that are not easy to clean. Ultrasonic cleaning was tested on three conveyor belt materials: polypropylene, acetal, and stainless steel (cold-rolled, AISI 304). Cleaning efficiency was tested at two temperatures (30 and 45 degrees C) and two cleaning times (30 and 60 s) with two cleaning detergents (KOH, and NaOH combined with KOH). Conveyor belt materials were soiled with milk-based soil and L. monocytogenes strains V1, V3, and B9, and then incubated for 72 h to attach bacteria to surfaces. Ultrasonic cleaning treatments reduced L. monocytogenes counts on stainless steel 4.61 to 5.90 log units; on acetal, 3.37 to 5.55 log units; and on polypropylene, 2.31 to 4.40 log units. The logarithmic reduction differences were statistically analyzed by analysis of variance using Statistical Package for the Social Sciences software. The logarithmic reduction was significantly greater in stainless steel than in plastic materials (P conveyor belt materials.
Directory of Open Access Journals (Sweden)
Voltaire Sant'Anna
2013-12-01
Full Text Available The antimicrobial activity of the bacteriocin-like substance (BLS P34 against Listeria monocytogenes was investigated in chicken sausage. The BLS was applied to chicken sausages (256 AU g-1 previously inoculated with a suspension of 10² cfu g-1 of L. monocytogenes. BLS P34 inhibited the indicator microorganism in situ in all incubation times for up to 10 days at 5 °C. The effectiveness of BLS P34 was increased when it was added in combination with nisin. The bacteriocin was also tested in natural eatable natural bovine wrapping (salty semi-dried tripe against the same indicator microorganism, also showing inhibitory capability in vitro. BLS P34 showed potential to control L. monocytogenes in refrigerated meat products.
Listeria monocytogenes Monographic Study
Directory of Open Access Journals (Sweden)
Emil Tirziu
2010-05-01
Full Text Available Listeria monocytogenes is a ubiquitous bacteria with a remarkable resistance in discordant condition which produce listeriosis, an infectious disease that affects multiple domestic and wild animals’ species, but also humans. Receptive to listeriosis are the majority of domestic or wild mammals and birds, in the last years being registered an increase of receptivity in humans. The concept of listeriosis in human pathology, a disease caused by eating or drinking contaminated food and water, appeared for the first time in 1981, during an outbreak in Canada with seven cases in adults and 34 cases of maternalfetal listeriosis. The alimentary origin of human listeriosis can be easily explained if considered some general characteristics of the bacteria. Thus, resistance in various conditions, especially at lower temperatures, justifies its dissemination and food contamination, particularly when is conserved by refrigeration. Also, L. monocytogenes has a significant presence in alimentary products. Some studies showed that 4% of the milk products, 29% of the meat products, 5% of the vegetable products and 26% of the products obtained from fishes and shell fishes are positive for L. monocytogenes, which allows us to say that battle against these bacteria is a war against microbial contamination.
Schrama, D; Helliwell, N; Neto, L; Faleiro, M L
2013-06-01
The aim of this study was to evaluate the effect of the acid and salt adaptation in a cheese-based medium on the virulence potential of Listeria monocytogenes strains isolated from cheese and dairy processing environment using the Galleria mellonella model. Four L. monocytogenes strains were exposed to a cheese-based medium in conditions of induction of an acid tolerance response and osmotolerance response (pH 5·5 and 3·5% w/v NaCl) and injected in G. mellonella insects. The survival of insects and the L. monocytogenes growth kinetics in insects were evaluated. The gene expression of hly, actA and inlA genes was determined by real-time PCR. The adapted cells of two dairy strains showed reduced insect mortality (P 0·05) was found between adapted and nonadapted cells. The gene expression results evidenced an overexpression of virulence genes in cheese-based medium, but not in simulated insect-induced conditions. Our results suggest that adaptation to low pH and salt in a cheese-based medium can affect the virulence of L. monocytogenes, but this effect is strain dependent. In this study, the impact of adaptation to low pH and salt in a cheese-based medium on L. monocytogenes virulence was tested using the Wax Moth G. mellonella model. This model allowed the differentiation of the virulence potential between the L. monocytogenes strains. The effect of adaptation on virulence is strain dependent. The G. mellonella model revealed to be a prompt method to test food-related factors on L. monocytogenes virulence. © 2013 The Society for Applied Microbiology.
Evaluation of the Thermo Scientific SureTect Listeria monocytogenes Assay.
Cloke, Jonathan; Leon-Velarde, Carlos; Larson, Nathan; Dave, Keron; Evans, Katharine; Crabtree, David; Hughes, Annette; Hopper, Craig; Simpson, Helen; Withey, Sophie; Oleksiuk, Milena; Holopainen, Jani; Wickstrand, Nina; Kauppinen, Mikko
2014-01-01
The Thermo Scientific SureTect Listeria monocytogenes Assay is a new real-time PCR assay for the detection of Listeria monocytogenes in food and environmental samples. This assay was validated using the AOAC Research Institute (AOAC-RI) Performance Tested Methods program in comparison to the reference method detailed in International Organization for Standardization 11290-1:1996, including Amendment 1:2004 with the following foods and food contact surfaces: smoked salmon, processed cheese, fresh bagged spinach, fresh cantaloupe, cooked prawns (chilled product), cooked sliced turkey meat (chilled product), ice cream, pork frankfurters, salami, ground raw beef meat (12% fat), plastic, and stainless steel. All matrixes were tested by Thermo Fisher Scientific, Microbiology Division, Basingstoke, UK. In addition, three matrixes (pork frankfurters, bagged lettuce, and stainless steel) were analyzed independently as part of the AOAC-RI controlled laboratory study by the University of Guelph, Canada. Using probability of detection (POD) statistical analysis, a significant difference was demonstrated between the candidate and reference methods for salami, cooked sliced turkey and ice cream in favor of the SureTect assay. For all other matrixes, no significant difference by POD was seen between the two methods during the study. Inclusivity and exclusivity testing was also conducted with 53 and 30 isolates, respectively, which demonstrated that the SureTect assay was able to detect all serotypes of L. monocytogenes. None of the exclusivity isolates analyzed were detected by the SureTect assay. Ruggedness testing was conducted to evaluate the performance of the assay with specific method deviations outside the recommended parameters open to variation, i.e., enrichment time and temperature and lysis temperature, which demonstrated that the assay gave reliable performance. Accelerated stability testing was also conducted, validating the assay shelf life.
Listeria monocytogenes associated kerato-conjunctivitis in four horses in Norway.
Revold, Tobias; Abayneh, Takele; Brun-Hansen, Hege; Kleppe, Signe L; Ropstad, Ernst-Otto; Hellings, Robert A; Sørum, Henning
2015-11-09
Listeria monocytogenes has been reported to cause various infectious diseases in both humans and animals. More rarely, ocular infections have been reported. To our knowledge, only two cases of Listeria keratitis have been described in horses. We report kerato-conjunctivitis in four Norwegian horses associated with L. monocytogenes. Clinically, all cases were presented with recurrent unilateral kerato-conjunctivitis. L. monocytogenes bacteria were isolated from swab samples from all cases, and cytology carried out in 3 cases was indicative of L. monocytogenes infection. The present report describes the first known cases in which L. monocytogenes has been isolated from keratitic lesions in horses in Norway. A potential risk factor may be feeding of silage or haylage, but other sources of infection cannot be ruled out. The phenotypic features including antimicrobial susceptibility and serotype of the isolates are described. Laboratory detection of L. monocytogenes demands extra caution since only low numbers of bacteria were detected in the eye-swabs, probably due to the low volume of sample material and the intracellular niche of the bacterium. A general poor response to treatment in all these cases indicates that clinicians should pay extra attention to intensity and duration of treatment if L. monocytogenes is identified in connection with equine kerato-conjunctivitis.
Directory of Open Access Journals (Sweden)
Ok Kyung Koo
Full Text Available BACKGROUND: Listeria monocytogenes, an intracellular foodborne pathogen, infects immunocompromised hosts. The primary route of transmission is through contaminated food. In the gastrointestinal tract, it traverses the epithelial barrier through intracellular or paracellular routes. Strategies to prevent L. monocytogenes entry can potentially minimize infection in high-risk populations. Listeria adhesion protein (LAP aids L. monocytogenes in crossing epithelial barriers via the paracellular route. The use of recombinant probiotic bacteria expressing LAP would aid targeted clearance of Listeria from the gut and protect high-risk populations from infection. METHODOLOGY/PRINCIPAL FINDINGS: The objective was to investigate the ability of probiotic bacteria or LAP-expressing recombinant probiotic Lactobacillus paracasei (Lbp(LAP to prevent L. monocytogenes adhesion, invasion, and transwell-based transepithelial translocation in a Caco-2 cell culture model. Several wild type probiotic bacteria showed strong adhesion to Caco-2 cells but none effectively prevented L. monocytogenes infection. Pre-exposure to Lbp(LAP for 1, 4, 15, or 24 h significantly (P<0.05 reduced adhesion, invasion, and transepithelial translocation of L. monocytogenes in Caco-2 cells, whereas pre-exposure to parental Lb. paracasei had no significant effect. Similarly, Lbp(LAP pre-exposure reduced L. monocytogenes translocation by as much as 46% after 24 h. Lbp(LAP also prevented L. monocytogenes-mediated cell damage and compromise of tight junction integrity. Furthermore, Lbp(LAP cells reduced L. monocytogenes-mediated cell cytotoxicity by 99.8% after 1 h and 79% after 24 h. CONCLUSIONS/SIGNIFICANCE: Wild type probiotic bacteria were unable to prevent L. monocytogenes infection in vitro. In contrast, Lbp(LAP blocked adhesion, invasion, and translocation of L. monocytogenes by interacting with host cell receptor Hsp60, thereby protecting cells from infection. These data show promise
Prevalence and location of Listeria monocytogenes in farmed rainbow trout.
Miettinen, Hanna; Wirtanen, Gun
2005-10-15
A total of 510 rainbow trout originating from fish farms in lakes and sea areas around Finland were studied for the presence of Listeria monocytogenes. Samples were studied as pools from five fish. Gill, viscera, and skin from the pooled samples were analysed separately. The individual samples were analysed later if the pooled sample was found to be Listeria positive. The prevalence of Listeria spp. and L. monocytogenes in pooled unprocessed fresh rainbow trout was on average 35.0% and 14.6%, respectively. On the other hand, the prevalence of Listeria spp. and L. monocytogenes in individual thawed fish was found to be 14.3% and 8.8%, respectively. These numbers tend to overestimate and underestimate the real situation because not all fish in pooled samples were necessarily contaminated and in some of the Listeria positive pooled samples all individual samples turned out to be Listeria free. The prevalence of L. monocytogenes varied greatly between different fish farms from zero to 100% in pooled samples and from zero to 75% according to individually studied fish samples. Some indications of the influence of weather conditions and seasonal variations that strongly affected the Listeria contamination of fish were also noticed. The location of Listeria spp. and L. monocytogenes in different parts of the fish differed with statistical significance in rainbow trout. Up to 95.6% of the L. monocytogenes and 84.5% of Listeria spp. positive samples were gill samples. Only 4.4% (2/45) of the L. monocytogenes positive samples were obtained from skin or viscera. Closer study at one fish farm revealed that there was only one L. monocytogenes ribotype present in the contaminated fish, although water and surfaces were heavily contaminated with six other L. monocytogenes ribotypes.
Essential oils of thyme and Rosemary in the control of Listeria monocytogenes in raw beef
Directory of Open Access Journals (Sweden)
Maíra Maciel Mattos de Oliveira
2013-12-01
Full Text Available This study was developed in order to evaluate two alternatives for the control of Listeria monocytogenes in raw bovine meat pieces, both based on the use of Thymus vulgaris and Rosmarinus officinalis essential oils (EOs. The antilisterial activity of different concentrations of the EOs was tested in vitro using agar dilution and disk volatilization techniques. In addition, L. monocytogenes was inoculated in meat pieces, which were submerged in edible gelatin coatings containing 2% (v/v EOs or submitted to the vapor of EOs (0.74 μL.cm-3. L. monocytogenes was quantified after one, 48 and 96 hours of storage (7 °C. In the in vitro tests, the EO of T. vulgaris presented higher activity. The two options used (edible gelatin coating and vapor activity, in spite of exercising effects with differentiated behaviors, presented antibacterial activity against L. monocytogenes inoculated in raw bovine meat (p < 0.05. Greatest antibacterial activity were obtained in the experiment that used edible coatings containing EOs, at 48 hours of storage reductions in bacterial counts between 1.09 and 1.25 Log CFU.g-1 were obtained. In the vapor effect experiment, the EO of T. vulgaris caused the highest reduction in the population of bacteria inoculated in raw bovine meat (p < 0.05, 0.40 Log CFU.g-1 at 96 hours of storage. This study supplied important information regarding new and promising natural alternatives, based on the concept of active packaging, for the control of L. monocytogenes in the meat industry.
A case of bovine raw milk contamination with Listeria monocytogenes
Directory of Open Access Journals (Sweden)
Hunt Karen
2012-07-01
Full Text Available Abstract During routine sampling of bulk raw milk on a dairy farm, the pathogenic bacteria Listeria monocytogenes was found to be a contaminant, at numbers L. monocytogenes, indicating a possible case of excretion of the L. monocytogenes directly into the milk. Milk samples were collected from the individual cows and analysed, resulting in the identification of L. monocytogenes excretion (at 280 cfu/ml from one of the 4 mammary quarters of one dairy cow out of 180. When the infected cow was isolated from the herd, no L. monocytogenes was detected from the remaining herd. The pulsed-field gel electrophoresis pattern of the strain from the individual cow was indistinguishable from that originally isolated from the bulk milk. The infected cow did not show any clinical signs of disease, nor did the appearance of the milk have any physical abnormalities. Antibiotic treatment of the infected mammary quarter was found to be ineffective. This study shows that there can be risks associated with direct contamination of raw milk with L. monocytogenes.
Inhibition of sortase A by chalcone prevents Listeria monocytogenes infection.
Li, Hongen; Chen, Yutao; Zhang, Bing; Niu, Xiaodi; Song, Meng; Luo, Zhaoqing; Lu, Gejin; Liu, Bowen; Zhao, Xiaoran; Wang, Jianfeng; Deng, Xuming
2016-04-15
The critical role of sortase A in gram-positive bacterial pathogenicity makes this protein a good potential target for antimicrobial therapy. In this study, we report for the first time the crystal structure of Listeria monocytogenes sortase A and identify the active sites that mediate its transpeptidase activity. We also used a sortase A (SrtA) enzyme activity inhibition assay, simulation, and isothermal titration calorimetry analysis to discover that chalcone, an agent with little anti-L. monocytogenes activity, could significantly inhibit sortase A activity with an IC50 of 28.41 ± 5.34 μM by occupying the active site of SrtA. The addition of chalcone to a co-culture of L. monocytogenes and Caco-2 cells significantly inhibited bacterial entry into the cells and L. monocytogenes-mediated cytotoxicity. Additionally, chalcone treatment decreased the mortality of infected mice, the bacterial burden in target organs, and the pathological damage to L. monocytogenes-infected mice. In conclusion, these findings suggest that chalcone is a promising candidate for the development of treatment against L. monocytogenes infection. Copyright © 2016 Elsevier Inc. All rights reserved.
Lineage specific recombination rates and microevolution in Listeria monocytogenes
Directory of Open Access Journals (Sweden)
Nightingale Kendra K
2008-10-01
Full Text Available Abstract Background The bacterium Listeria monocytogenes is a saprotroph as well as an opportunistic human foodborne pathogen, which has previously been shown to consist of at least two widespread lineages (termed lineages I and II and an uncommon lineage (lineage III. While some L. monocytogenes strains show evidence for considerable diversification by homologous recombination, our understanding of the contribution of recombination to L. monocytogenes evolution is still limited. We therefore used STRUCTURE and ClonalFrame, two programs that model the effect of recombination, to make inferences about the population structure and different aspects of the recombination process in L. monocytogenes. Analyses were performed using sequences for seven loci (including the house-keeping genes gap, prs, purM and ribC, the stress response gene sigB, and the virulence genes actA and inlA for 195 L. monocytogenes isolates. Results Sequence analyses with ClonalFrame and the Sawyer's test showed that recombination is more prevalent in lineage II than lineage I and is most frequent in two house-keeping genes (ribC and purM and the two virulence genes (actA and inlA. The relative occurrence of recombination versus point mutation is about six times higher in lineage II than in lineage I, which causes a higher genetic variability in lineage II. Unlike lineage I, lineage II represents a genetically heterogeneous population with a relatively high proportion (30% average of genetic material imported from external sources. Phylograms, constructed with correcting for recombination, as well as Tajima's D data suggest that both lineages I and II have suffered a population bottleneck. Conclusion Our study shows that evolutionary lineages within a single bacterial species can differ considerably in the relative contributions of recombination to genetic diversification. Accounting for recombination in phylogenetic studies is critical, and new evolutionary models that
Resistance of Listeria monocytogenes biofilms to sanitizing agents
Listeria monocytogenes is notorious for its capacity to colonize the environment and equipment of food processing facilities and to persist in the processing plant ecosystem, sometimes for decades. Such persistence is mediated by multiple attributes of L. monocytogenes, including the pathogen’s capa...
Piercey, Marta J; Hingston, Patricia A; Truelstrup Hansen, Lisbeth
2016-04-16
Listeria monocytogenes is a pathogenic foodborne bacterium whose persistence in food processing environments is in part attributed to its biofilm formation. Most biofilm studies have been carried out at 30-37 °C rather than at temperatures found in the food processing plants (i.e., 10-20 °C). The objective of the present study was to mine for novel genes that contribute to L. monocytogenes biofilm formation at 15 °C using the random insertional mutagenesis approach. A library of 11,024 L. monocytogenes 568 (serotype 1/2a) Himar1 insertional mutants was created. Mutants with reduced or enhanced biofilm formation at 15 °C were detected in microtiter plate assays with crystal violet and safranin staining. Fourteen mutants expressed enhanced biofilm phenotypes, and harbored transposon insertions in genes encoding cell wall biosynthesis, motility, metabolism, stress response, and cell surface associated proteins. Deficient mutants (n=5) contained interruptions in genes related to peptidoglycan, teichoic acid, or lipoproteins. Enhanced mutants produced significantly (pbiofilm formed on stainless steel (SS) coupons at 15 °C (48 h) than deficient mutants, which were also more sensitive to benzalkonium chloride. All biofilm deficient mutants and four enhanced mutants in the microtiter plate assay (flaA, cheR, lmo2563 and lmo2488) formed no biofilm in a peg lid assay (Calgary biofilm device) while insertions in lmo1224 and lmo0543 led to excess biofilm in all assays. Two enhanced biofilm formers were more resistant to enzymatic removal with DNase, proteinase K or pectinase than the parent strain. Scanning electron microscopy of individual biofilms made by five mutants and the parent on SS surfaces showed formation of heterogeneous biofilm with dense zones by immotile mutants, while deficient mutants exhibited sparse growth. In conclusion, interruptions of 9 genes not previously linked to biofilm formation in L. monocytogenes (lmo2572, lmo2488 (uvrA), lmo1224, lmo0434
Apprenticeship-based training in neurogastroenterology and motility.
Vasant, Dipesh H; Sharma, Amol; Bhagatwala, Jigar; Viswanathan, Lavanya; Rao, Satish S C
2018-03-01
Although neurogastroenterology and motility (NGM) disorders affect 50% of patients seen in clinics, many gastroenterologists receive limited NGM training. One-month apprenticeship-based NGM training has been provided at ten centers in the USA for a decade, however, outcomes of this training are unclear. Our goal was to describe the effectiveness of this program from a trainees perspective. Areas covered: We describe the training model, learning experiences, and outcomes of one-month apprenticeship-based training in NGM at a center of excellence, using a detailed individual observer account and data from 12 consecutive trainees that completed the program. During a one-month training period, 302 procedures including; breath tests (BT) n = 132, anorectal manometry (ARM) n = 29 and esophageal manometry (EM) n = 28, were performed. Post-training, all trainees (n = 12) knew indications for motility tests, and the majority achieved independence in basic interpretation of BT, EM and ARM. Additionally, in a multiple-choice NGM written-test paper, trainees achieved significant improvements in test scores post-training (P = 0.003). Expert commentary: One-month training at a high-volume center can facilitate rapid learning of NGM and the indications, basic interpretation and utility of motility tests. Trainees demonstrate significant independence, and this training model provides an ideal platform for those interested in sub-specialty NGM.
Weller, Daniel; Shiwakoti, Suvash; Bergholz, Peter; Grohn, Yrjo; Wiedmann, Martin
2015-01-01
Technological advancements, particularly in the field of geographic information systems (GIS), have made it possible to predict the likelihood of foodborne pathogen contamination in produce production environments using geospatial models. Yet, few studies have examined the validity and robustness of such models. This study was performed to test and refine the rules associated with a previously developed geospatial model that predicts the prevalence of Listeria monocytogenes in produce farms in New York State (NYS). Produce fields for each of four enrolled produce farms were categorized into areas of high or low predicted L. monocytogenes prevalence using rules based on a field's available water storage (AWS) and its proximity to water, impervious cover, and pastures. Drag swabs (n = 1,056) were collected from plots assigned to each risk category. Logistic regression, which tested the ability of each rule to accurately predict the prevalence of L. monocytogenes, validated the rules based on water and pasture. Samples collected near water (odds ratio [OR], 3.0) and pasture (OR, 2.9) showed a significantly increased likelihood of L. monocytogenes isolation compared to that for samples collected far from water and pasture. Generalized linear mixed models identified additional land cover factors associated with an increased likelihood of L. monocytogenes isolation, such as proximity to wetlands. These findings validated a subset of previously developed rules that predict L. monocytogenes prevalence in produce production environments. This suggests that GIS and geospatial models can be used to accurately predict L. monocytogenes prevalence on farms and can be used prospectively to minimize the risk of preharvest contamination of produce. PMID:26590280
Ortega, Fabian E.; Rengarajan, Michelle; Chavez, Natalie; Radhakrishnan, Prathima; Gloerich, Martijn; Bianchini, Julie; Siemers, Kathleen; Luckett, William S.; Lauer, Peter; Nelson, W. James; Theriot, Julie A.
2017-01-01
The intestinal epithelium is the first physiological barrier breached by the Gram-positive facultative pathogen Listeria monocytogenes during an in vivo infection. Listeria monocytogenes binds to the epithelial host cell receptor E-cadherin, which mediates a physical link between the bacterium and filamentous actin (F-actin). However, the importance of anchoring the bacterium to F-actin through E-cadherin for bacterial invasion has not been tested directly in epithelial cells. Here we demonstrate that depleting αE-catenin, which indirectly links E-cadherin to F-actin, did not decrease L. monocytogenes invasion of epithelial cells in tissue culture. Instead, invasion increased due to increased bacterial adhesion to epithelial monolayers with compromised cell–cell junctions. Furthermore, expression of a mutant E-cadherin lacking the intracellular domain was sufficient for efficient L. monocytogenes invasion of epithelial cells. Importantly, direct biotin-mediated binding of bacteria to surface lipids in the plasma membrane of host epithelial cells was sufficient for uptake. Our results indicate that the only requirement for L. monocytogenes invasion of epithelial cells is adhesion to the host cell surface, and that E-cadherin–mediated coupling of the bacterium to F-actin is not required. PMID:28877987
Vadia, Stephen; Seveau, Stephanie
2014-03-01
Listeria monocytogenes is responsible for the life-threatening food-borne disease listeriosis. This disease mainly affects elderly and immunocompromised individuals, causing bacteremia and meningoencephalitis. In pregnant women, L. monocytogenes infection leads to abortion and severe infection of the fetus or newborn. The L. monocytogenes intracellular life cycle is critical for pathogenesis. Previous studies have established that the major virulence factor of L. monocytogenes, the pore-forming toxin listeriolysin O (LLO), is sufficient to induce L. monocytogenes internalization into human epithelial cell lines. This internalization pathway strictly requires the formation of LLO pores in the plasma membrane and can be stimulated by the heterologous pore-forming toxin pneumolysin, suggesting that LLO acts nonspecifically by forming transmembrane pores. The present work tested the hypothesis that Ca2+ and K+ fluxes subsequent to perforation by LLO control L. monocytogenes internalization. We report that L. monocytogenes perforates the host cell plasma membrane in an LLO-dependent fashion at the early stage of invasion. In response to perforation, host cells undergo Ca2+ -dependent but K+ -independent resealing of their plasma membrane. In contrast to the plasma membrane resealing process, LLO-induced L. monocytogenes internalization requires both Ca2+ and K+ fluxes. Further linking ion fluxes to bacterial internalization, treating cells with a combination of Ca2+ and K+ ionophores but not with individual ionophores is sufficient to induce efficient internalization of large cargoes, such as 1-μm polystyrene beads and bacteria. We propose that LLO-induced L. monocytogenes internalization requires a Ca2+ - and K+ -dependent internalization pathway that is mechanistically distinct from the process of plasma membrane resealing.
Motility Disorders in Children.
Nurko, Samuel
2017-06-01
Gastrointestinal motility disorders in the pediatric population are common and can range from benign processes to more serious disorders. Performing and interpreting motility evaluations in children present unique challenges. There are primary motility disorders but abnormal motility may be secondary due to other disease processes. Diagnostic studies include radiographic scintigraphic and manometry studies. Although recent advances in the genetics, biology, and technical aspects are having an important impact and have allowed for a better understanding of the pathophysiology and therapy for gastrointestinal motility disorders in children, further research is needed to be done to have better understanding of the pathophysiology and for better therapies. Copyright © 2017 Elsevier Inc. All rights reserved.
An outbreak of an unusual strain of Listeria monocytogenes infection in North-East Scotland.
Okpo, Emmanuel; Leith, Jayne; Smith-Palmer, Alison; Bell, John; Parks, Duncan; Browning, Fiona; Byers, Lynn; Corrigan, Helen; Webster, Diana; Karcher, Anne M; Murray, Andrew; Storey, Tom
2015-01-01
Listeria monocytogenes infection is an important cause of illness and hospitalization in vulnerable individuals. In the present study, we describe a community outbreak of Listeria monocytogenes in the North-East region of Scotland, which was epidemiologically, environmentally and microbiologically linked to a local meat product and ready-to-eat product manufacturer. Infected individuals were interviewed, and an environmental investigation was conducted. Clinical and environmental samples were tested by culture, and isolates were typed by fluorescent amplified fragment length polymorphism (fAFLP). Three cases of Listeria monocytogenes were linked geographically, had the same serotype (1/2a) and were indistinguishable by fAFLP type XII.6. The human, food and environmental isolates were of the same serotype and were indistinguishable by molecular typing. This is the first community outbreak of L. monocytogenes reported in Scotland since the current outbreak surveillance was established in 1996. Epidemiological and laboratory evidence indicated poor hand hygiene, unhygienic practices and cross-contamination throughout the manufacturing process of ready-to-eat foods as a possible cause of the outbreak. More stringent control of commercial food establishments that provide ready-to-eat food and the need to advise specifically vulnerable groups, e.g., pregnant women, of the risk of L. monocytogenes in ready-to-eat food is urgently needed. Copyright © 2015 King Saud Bin Abdulaziz University for Health Sciences. Published by Elsevier Ltd. All rights reserved.
da Silva Fernandes, Meg; Kabuki, Dirce Yorika; Kuaye, Arnaldo Yoshiteru
2015-05-04
The formation of mono-species biofilm (Listeria monocytogenes) and multi-species biofilms (Enterococcus faecium, Enterococcus faecalis, and L. monocytogenes) was evaluated. In addition, the effectiveness of sanitation procedures for the control of the multi-species biofilm also was evaluated. The biofilms were grown on stainless steel coupons at various incubation temperatures (7, 25 and 39°C) and contact times (0, 1, 2, 4, 6 and 8 days). In all tests, at 7°C, the microbial counts were below 0.4 log CFU/cm(2) and not characteristic of biofilms. In mono-species biofilm, the counts of L. monocytogenes after 8 days of contact were 4.1 and 2.8 log CFU/cm(2) at 25 and 39°C, respectively. In the multi-species biofilms, Enterococcus spp. were present at counts of 8 log CFU/cm(2) at 25 and 39°C after 8 days of contact. However, the L. monocytogenes in multi-species biofilms was significantly affected by the presence of Enterococcus spp. and by temperature. At 25°C, the growth of L. monocytogenes biofilms was favored in multi-species cultures, with counts above 6 log CFU/cm(2) after 8 days of contact. In contrast, at 39°C, a negative effect was observed for L. monocytogenes biofilm growth in mixed cultures, with a significant reduction in counts over time and values below 0.4 log CFU/cm(2) starting at day 4. Anionic tensioactive cleaning complemented with another procedure (acid cleaning, disinfection or acid cleaning+disinfection) eliminated the multi-species biofilms under all conditions tested (counts of all micro-organismsbiofilms under all tested conditions (counts of the all microorganisms biofilms under all the test conditions. Copyright © 2015 Elsevier B.V. All rights reserved.
Alvarez, Diego E; Agaisse, Hervé
2016-06-01
Listeria monocytogenes is an intracellular pathogen that disseminates within the intestinal epithelium through acquisition of actin-based motility and formation of plasma membrane protrusions that project into adjacent cells. The resolution of membrane protrusions into vacuoles from which the pathogen escapes results in bacterial spread from cell to cell. This dissemination process relies on the mlp-actA-plcB operon, which encodes ActA, a bacterial nucleation-promoting factor that mediates actin-based motility, and PlcB, a phospholipase that mediates vacuole escape. Here we investigated the role of the metalloprotease Mpl in the dissemination process. In agreement with previous findings showing that Mpl is required for PlcB activation, infection of epithelial cells with the ΔplcB or Δmpl strains resulted in the formation of small infection foci. As expected, the ΔplcB strain displayed a strong defect in vacuole escape. However, the Δmpl strain showed an unexpected defect in the resolution of protrusions into vacuoles, in addition to the expected but mild defect in vacuole escape. The Δmpl strain displayed increased levels of ActA on the bacterial surface in protrusions. We mapped an Mpl-dependent processing site in ActA between amino acid residues 207 to 238. Similar to the Δmpl strain, the ΔactA207-238 strain displayed increased levels of ActA on the bacterial surface in protrusions. Although the ΔactA207-238 strain displayed wild-type actin-based motility, it formed small infection foci and failed to resolve protrusions into vacuoles. We propose that, in addition to its role in PlcB processing and vacuole escape, the metalloprotease Mpl is required for ActA processing and protrusion resolution. Copyright © 2016, American Society for Microbiology. All Rights Reserved.
Internalization of Listeria monocytogenes in cantaloupes during dump tank washing and hydrocooling.
Macarisin, Dumitru; Wooten, Anna; De Jesus, Antonio; Hur, Minji; Bae, Seonjae; Patel, Jitendra; Evans, Peter; Brown, Eric; Hammack, Thomas; Chen, Yi
2017-09-18
Recent listeriosis outbreaks and recalls associated with cantaloupes urge for studies to understand the mechanisms of cantaloupe contamination by Listeria monocytogenes. Postharvest practices such as washing and hydrocooling were suggested to facilitate the contamination of fresh fruits by human pathogens. This study assessed the potential of L. monocytogenes internalization into cantaloupes during dump tank washing and immersion-type hydrocooling in water contaminated with L. monocytogenes. The effect of cantaloupe cultivar, water temperature, and harvesting technique on L. monocytogenes internalization was also evaluated. Full slip (cantaloupe without any residual stem) Western and Eastern cultivar cantaloupes were pre-warmed to 42°C (to imitate peak-high field temperatures of freshly harvested cantaloupes) and then immersed in water at 6°C and 18°C containing 4 and 6logCFU/ml of L. monocytogenes. Clipped (cantaloupe with short stem residues obtained by clipping the stem at harvest) Western and Eastern cantaloupes were pre-warmed to 42°C and then immersed in water at 6°C containing 6logCFU/ml of L. monocytogenes. Additionally, full slip and clipped Western cantaloupes were equilibrated to 18°C and then immersed in water at 18°C containing 6logCFU/ml of L. monocytogenes (isothermal immersion without temperature differential). Water containing L. monocytogenes infiltrated both full slip and clipped cantaloupes through the stems/stem scars and was then distributed along the vascular system in hypodermal mesocarp reaching the calyx area of the fruit. The current study demonstrated that, under experimental conditions, L. monocytogenes can internalize into cantaloupes during immersion in water contaminated by L. monocytogenes, both in the presence and absence of temperature differential, and that temperature differential moderately enhanced the internalization of L. monocytogenes. The incidence and levels of L. monocytogenes internalized in the middle
Listeria monocytogenes growth limits and stress resistance mechanisms
Veen, van der S.
2008-01-01
The food-borne pathogen Listeria monocytogenes is a Gram-positive facultative anaerobic rod, which is the causative agent of listeriosis. Due to the severity of the disease and the fact that its incidence is increasing in numerous European countries, L. monocytogenes is of great public health
Chaitiemwong, N.; Hazeleger, W.C.; Beumer, R.R.
2014-01-01
To simulate food contact surfaces with pits or cracks, stainless steel plates with grooves (depths between 0.2 and 5 mm) were constructed. These plates were artificially contaminated with Listeria monocytogenes in clean conditions, with organic soiling, or after 14 days of biofilm formation after
DEFF Research Database (Denmark)
Ojeniyi, B.; Wegener, Henrik Caspar; Jensen, N.E.
1996-01-01
Listeria monocytogenes was isolated from 11/236 (4 . 7%) caecal samples from parent flocks, providing broilers to the abattoirs investigated. Caecal samples from 2078 broilers representing 90 randomly selected broiler flocks were negative for L. monocytogenes. A total of 3080 samples from seven...... abattoirs including poultry processing line samples, and final products were also examined for L. monocytogenes. Listeria monocytogenes was isolated in 0 . 3% to 18 . 7% of the samples collected in the different abattoirs. Epidemiological typing of 247 L. monocytogenes isolates, including serotyping, phage...... isolates of L. monocytogenes since only 120/247 (48 . 6%) isolates were typable by phage typing and 230/247 (93 . 1%) L. monocytogenes belonged to serotype 01 while 6/247 (2 . 4%) belonged to 04. The discovery of a few dominating clones in each abattoir might indicate an endemic occurrence of L...
Aerosol studies with Listeria innocua and Listeria monocytogenes.
Zhang, Guodong; Ma, Li; Oyarzabal, Omar A; Doyle, Michael P
2007-08-01
Aerosol studies of Listeria monocytogenes in food processing plants have been limited by lack of a suitable surrogate microorganism. The objective of this study was to investigate the potential of using green fluorescent protein-labeled strains of Listeria innocua as a surrogate for L. monocytogenes for aerosol studies. These studies were conducted in a laboratory bioaerosol chamber and a pilot food-processing facility. Four strains of L. innocua and five strains of L. monocytogenes were used. In the laboratory chamber study, Listeria cells were released into the environment at two different cell numbers and under two airflow conditions. Trypticase soy agar (TSA) plates and oven-roasted breasts of chicken and turkey were placed in the chamber to monitor Listeria cell numbers deposited from aerosols. A similar experimental design was used in the pilot plant study; however, only L. innocua was used. Results showed that L. monocytogenes and L. innocua survived equally well on chicken and turkey breast meats and TSA plates. No-fan and continuous fan applications, which affected airflow, had no significant effect on settling rates of aerosolized L. monocytogenes and L. innocua in the bioaerosol chamber or L. innocua in the pilot plant study. Listeriae cell numbers in the air decreased rapidly during the first 1.5 h following release, with few to no listeriae detected in the air at 3 h. Aerosol particles with diameters of 1 and 2 microM correlated directly with the number of Listeria cells in the aerosol but not with particles that were 0.3, 0.5, and 5 microM in diameter. Results indicate that L. innocua can be used as a surrogate for L. monocytogenes in an aerosol study.
Weller, Daniel; Shiwakoti, Suvash; Bergholz, Peter; Grohn, Yrjo; Wiedmann, Martin; Strawn, Laura K
2016-02-01
Technological advancements, particularly in the field of geographic information systems (GIS), have made it possible to predict the likelihood of foodborne pathogen contamination in produce production environments using geospatial models. Yet, few studies have examined the validity and robustness of such models. This study was performed to test and refine the rules associated with a previously developed geospatial model that predicts the prevalence of Listeria monocytogenes in produce farms in New York State (NYS). Produce fields for each of four enrolled produce farms were categorized into areas of high or low predicted L. monocytogenes prevalence using rules based on a field's available water storage (AWS) and its proximity to water, impervious cover, and pastures. Drag swabs (n = 1,056) were collected from plots assigned to each risk category. Logistic regression, which tested the ability of each rule to accurately predict the prevalence of L. monocytogenes, validated the rules based on water and pasture. Samples collected near water (odds ratio [OR], 3.0) and pasture (OR, 2.9) showed a significantly increased likelihood of L. monocytogenes isolation compared to that for samples collected far from water and pasture. Generalized linear mixed models identified additional land cover factors associated with an increased likelihood of L. monocytogenes isolation, such as proximity to wetlands. These findings validated a subset of previously developed rules that predict L. monocytogenes prevalence in produce production environments. This suggests that GIS and geospatial models can be used to accurately predict L. monocytogenes prevalence on farms and can be used prospectively to minimize the risk of preharvest contamination of produce. Copyright © 2016, American Society for Microbiology. All Rights Reserved.
Low prevalence of Listeria monocytogenes in cull sows and pork.
Wesley, Irene V; Larsen, Steven; Hurd, H Scott; McKean, James D; Griffith, Ronald; Rivera, Fernando; Nannapaneni, Ramakrishna; Cox, Mandy; Johnson, Michael; Wagner, Dean; de Martino, Mary
2008-03-01
The goal of this study was to determine the prevalence of Listeria monocytogenes in sows slaughtered at a single Midwestern plant on two occasions (trial 1, n = 179 sows; trial 2, n = 160 sows). Fecal samples collected antemortem (trial 1) as well as animal tissues, and carcass swabs collected at the abattoir (trials 1 and 2) were analyzed. Eight isolates of L. monocytogenes were recovered from five samples that represented 0.18% of the total samples (n = 2,775). In trial 1, L. monocytogenes was detected in a tonsil sample (0.6%; 1 positive of 181 tonsils), in a carcass (0.6%; 1 positive of 179 carcasses), which was sampled prior to the organic rinse, and in two chopped meat block samples (1.2%; 2 positive of 165 samples). In trial 2, L. monocytogenes was only detected in a single chopped meat block sample (0.15%; 1 positive of 688 total samples). These data indicate the low prevalence of L. monocytogenes in the cull sow.
Behaviour of Listeria monocytogenes in packaged fresh mushrooms (Agaricus bisporus).
González-Fandos, E; Olarte, C; Giménez, M; Sanz, S; Simón, A
2001-11-01
The aim of this study was to evaluate the potential of Listeria monocytogenes to grow in mushrooms packaged in two different types of PVC films when stored at 4 degrees C and 10 degrees C. Mushrooms were packed in two polymeric films (perforated and nonperforated PVC) and stored at 4 degrees C and 10 degrees C. The carbon dioxide and oxygen content inside the packages, aerobic mesophiles, psychrotrophs, Pseudomonas spp., Listeria monocytogenes, faecal coliforms, Escherichia coli, anaerobic spores and major sensory factors were determined. The mushrooms packaged in nonperforated film and stored at 4 degrees C had the most desirable quality parameters (texture, development stage and absence of moulds). Listeria monocytogenes was able to grow at 4 degrees C and 10 degrees C in inoculated mushrooms packaged in perforated and nonperforated films between 1 and 2 log units during the first 48 h. After 10 d of storage, the populations of L. monocytogenes were higher in mushrooms packaged in nonperforated film and stored at 10 degrees C. MAP followed by storage at 4 degrees C or 10 degrees C extends the shelf life by maintaining an acceptable appearance, but allows the growth and survival of L. monocytogenes. According to this study additional hurdles must be studied in order to prevent the growth of L. monocytogenes.
Jadhav, Snehal; Sevior, Danielle; Bhave, Mrinal; Palombo, Enzo A
2014-01-31
Conventional methods used for primary detection of Listeria monocytogenes from foods and subsequent confirmation of presumptive positive samples involve prolonged incubation and biochemical testing which generally require four to five days to obtain a result. In the current study, a simple and rapid proteomics-based MALDI-TOF MS approach was developed to detect L. monocytogenes directly from selective enrichment broths. Milk samples spiked with single species and multiple species cultures were incubated in a selective enrichment broth for 24h, followed by an additional 6h secondary enrichment. As few as 1 colony-forming unit (cfu) of L. monocytogenes per mL of initial selective broth culture could be detected within 30h. On applying the same approach to solid foods previously implicated in listeriosis, namely chicken pâté, cantaloupe and Camembert cheese, detection was achieved within the same time interval at inoculation levels of 10cfu/mL. Unlike the routine application of MALDI-TOF MS for identification of bacteria from solid media, this study proposes a cost-effective and time-saving detection scheme for direct identification of L. monocytogenes from broth cultures.This article is part of a Special Issue entitled: Trends in Microbial Proteomics. Globally, foodborne diseases are major causes of illness and fatalities in humans. Hence, there is a continual need for reliable and rapid means for pathogen detection from food samples. Recent applications of MALDI-TOF MS for diagnostic microbiology focused on detection of microbes from clinical specimens. However, the current study has emphasized its use as a tool for detecting the major foodborne pathogen, Listeria monocytogenes, directly from selective enrichment broths. This proof-of-concept study proposes a detection scheme that is more rapid and simple compared to conventional methods of Listeria detection. Very low levels of the pathogen could be identified from different food samples post-enrichment in
Chen, Y I; Burall, Laurel S; Macarisin, Dumitru; Pouillot, Régis; Strain, Errol; DE Jesus, Antonio J; Laasri, Anna; Wang, Hua; Ali, Laila; Tatavarthy, Aparna; Zhang, Guodong; Hu, Lijun; Day, James; Kang, Jihun; Sahu, Surasri; Srinivasan, Devayani; Klontz, Karl; Parish, Mickey; Evans, Peter S; Brown, Eric W; Hammack, Thomas S; Zink, Donald L; Datta, Atin R
2016-11-01
A most-probable-number (MPN) method was used to enumerate Listeria monocytogenes in 2,320 commercial ice cream scoops manufactured on a production line that was implicated in a 2015 listeriosis outbreak in the United States. The analyzed samples were collected from seven lots produced in November 2014, December 2014, January 2015, and March 2015. L. monocytogenes was detected in 99% (2,307 of 2,320) of the tested samples (lower limit of detection, 0.03 MPN/g), 92% of which were contaminated at ice cream products linked to a listeriosis outbreak provided a unique data set for further understanding the risk associated with L. monocytogenes contamination for highly susceptible populations.
Osaili, Tareq M; Al-Nabulsi, Anas A; Shaker, Reyad R; Jaradat, Ziad W; Taha, Mohammad; Al-Kherasha, Mohammed; Meherat, Mervet; Holley, Richard
2014-01-01
The presence of Salmonella, Listeria monocytogenes, and Escherichia coli O157:H7 in ready-to-eat (RTE) meat products is considered a major concern for food control authorities worldwide. The aims of this study were to determine (i) the prevalence of Salmonella, L. monocytogenes, and E. coli O157:H7 in Mediterranean RTE chicken and beef (CB) products sold in Jordanian restaurants and (ii) the susceptibility of the isolates to antibiotics. A total of 1,028 samples of various types of RTE CB products (550 RTE chicken and 478 RTE beef products) were analyzed by methods described by the International Organization for Standardization followed by molecular confirmation of the isolates. The VITEK2 automated system was used for testing antibiotic susceptibility of the isolates. The overall prevalence of Salmonella serovars in RTE CB products was 0.5%, with 0.8 and 0.2% in RTE chicken and RTE beef, respectively. The overall prevalence of L. monocytogenes in RTE CB products was 2%, with 2.7 and 1.5% in RTE chicken and RTE beef products, respectively. E. coli O157:H7 was not isolated from any of the tested samples. Multidrug-resistant Salmonella and L. monocytogenes isolates were found. The majority of Salmonella isolates were sensitive to most of the tested antibiotics, and all of the isolates were resistant to more than one antibiotic. Similarly, more than 85% of L. monocytogenes isolates were sensitive to nine antibiotics, and the majority of L. monocytogenes isolates were resistant to fosfomycin and oxacillin.
Prevalence and characteristics of Listeria monocytogenes in bovine colostrum in Japan.
Hasegawa, Megumi; Iwabuchi, Eriko; Yamamoto, Shiori; Esaki, Hidetake; Kobayashi, Kazuhiko; Ito, Masahiko; Hirai, Katsuya
2013-02-01
This study was conducted to determine the prevalence and characteristics of Listeria monocytogenes in bovine colostrum in Japan. We collected bovine colostrum samples from 210 dams from 21 dairy farms in Hokkaido prefecture (Japan) between March and June 2009. L. monocytogenes was detected in samples from 6 (28.6%) of the 21 farms. Of the 210 samples, 16 (7.6%) were positive for L. monocytogenes. We recovered 80 L. monocytogenes isolates; 44 (55%) isolates were classified as serotype 1/2b and 36 (45%) were classified as serotype 4b. The isolates were susceptible to penicillin, ampicillin, amoxicillin, gentamicin, kanamycin, streptomycin, erythromycin, vancomycin, tetracycline, chloramphenicol, ciprofloxacin, and trimethoprim-sulfamethoxazole. Pulsed-field gel electrophoresis (PFGE) characterization of the 80 isolates revealed six PFGE types. Two PFGE types corresponded to human listeriosis cases. Most L. monocytogenes isolates possessed virulence-associated genes (actA, hly, iap, inlA, inlC, mpl, plcA, plcB, opuCA, prfA, and clpC). One PFGE type isolate possessed an epidemic clone II marker. Our findings suggest that isolates from bovine colostrum have the potential to cause human and animal listeriosis. This is the first study on the prevalence and characteristics of L. monocytogenes isolated from bovine colostrum obtained from dairy farms. Our results have important implications for improving public health and elucidating the epidemiology of L. monocytogenes in bovine colostrum.
Prevalence of Listeria monocytogenes in poultry meat
Directory of Open Access Journals (Sweden)
Mehmet ELMALI
2015-01-01
Full Text Available AbstractThe objectives of this study were i to isolate Listeria spp. and Listeria monocytogenes in broiler wing meat samples, ii to confirm the isolates by PCR, based on prs and hly A gene sequences, iii to determine the seasonal and monthly distribution of the isolates. A total of 120 broiler wing meat samples (60 packaged pieces wrapped using strech film in styrofoam plates and 60 unpackaged pieces bought from different markets in Hatay province were analysed. Listeria spp. was isolated from 57 (47.5% out of 120 samples. Fifty-four, out of 57 Listeria spp. isolates were identified as L. monocytogenes. L. monocytogenes was isolated from the samples collected during the spring, winter, summer, and autumn at the levels of 26.6%, 40%, 53.3%, 60%, respectively. In this study, the isolation rates were found to be the highest in autumn, while the isolation rates were found to be the lowest in spring. As a consequence, high prevalence of Listeria spp. and L. monocytogenes in poultry wing meat samples may pose a risk for human health. We consider that with obeying the rules of good hygiene practices (GHP, good manufacturing practices (GMP and HACCP can minimize the contamination with Listeria spp.
Influence of Organic Material and Biofilms on Disinfectant Efficacy Against Listeria monocytogenes
Directory of Open Access Journals (Sweden)
Hilda Nyati
2012-04-01
Full Text Available The effects of organic material and biofilm formation on the efficacy of Suma Tab D4 chlorine tablets and Suma Bac D10 quaternary ammonium compound (QAC against Listeria monocytogenes was determined in suspension and on stainless steel and polystyrene surfaces according to standard disinfectant test methodology. Exposure to 200 and 740 mg L-1 QAC and to 150 mg L-1 active chlorine resulted in a > 5.0 log10 CFU mL-1 and > 5.0 log10 CFU/coupon reduction of six L. monocytogenes strains within one minute, in suspension tests, and on stainless steel surfaces, respectively. Additionally, there was a reduction by as much as 5 log10 CFU/coupon or 5 log10 CFU/well of reference strains EGDe and Scott A biofilms within five minutes on stainless steel and polystyrene surfaces. Organic material, added as bovine serum albumin at 0.3% (w/v completely prevented the inactivation of L. monocytogenes in 150 mg L-1 chlorine, while reductions of only 0.6 +- 0.1 log10 CFU mL-1 were recorded in the presence of UHT milk at 3% (v/v. In contrast, reductions of 5 log10 CFU mL-1 were recorded within one minute on exposure to 740 mg L-1 QAC in the presence of 0.3% (w/v bovine serum albumin and within two minutes in the presence of 20 % (v/v UHT milk. Although Suma D4 chlorine tablets and Suma Bac D10 QAC are effective listericidal agents at recommended concentrations, Suma Tab D4 chlorine efficacy against L. monocytogenes is impaired by the presence of low concentrations of organic material, while Suma Bac D10 QAC maintains its listericidal activity in high organic loads.
Directory of Open Access Journals (Sweden)
Wanessa Altimiras Costa
2009-12-01
Full Text Available Este estudo avaliou um sistema de biocontrole para inibição de Listeria monocytogenes em couve minimamente processada, objetivando sua segurança durante estocagem sob refrigeração e em condições de abuso de temperatura. O potencial inibitório de bactérias láticas tolerantes ao sal e psicrotróficas contaminantes naturais da couve e Lactobacillus plantarum, Lactobacillus delbrueckii ATCC 9649 e Lactobacillus casei CCT 1465 foram avaliadas contra L. monocytogenes. O isolado de couve identificado como P. acidilactici CCA3 inibiu L. monocytogenes a 10 e 15 °C em ágar MRS e foi selecionado como possível agente de biocontrole. O número de L. monocytogenes na couve minimamente processada aumentou 3,7 e 4,7 ciclos logarítmicos a 5 e 10 °C, respectivamente, após 20 dias de armazenamento e 4,6 ciclos logarítmicos após oito dias a 15 °C. Entretanto, quando 10(8 UFC.g-1 de P. acidilactici CCA3 foram inoculados no produto processado, o crescimento de L. monocytogenes reduziu 2,3 ciclos logarítmicos sob temperatura abusiva de 15 °C. A acidez titulável e as características sensoriais da couve não foram alteradas pela presença de CCA3 ao longo do período de vida útil. Estes resultados sugerem o potencial de aplicação dos bioconservantes na couve minimamente processada, que necessitam estar associados à refrigeração e sanitização para garantir segurança.This study evaluated a biological control system for the inhibition of Listeria monocytogenes in minimally processed kale focusing on its freshness under refrigeration and extreme temperatures. The inhibitory potential of salt and cold tolerant lactic bacteria from natural microflora of kale, Lactobacillus delbrueckii ATCC 9649, Lactobacillus plantarum, and Lactobacillus casei CCT 1465 strains were evaluated against L. monocytogenes. Pediococcus acidilactici CCA3 isolated from kale exhibited a large inhibition zone of L. monocytogenes at 10 and 15 °C in MRS agar and was
Inhibition of Listeria monocytogenes by propionic acid-based ingredients in cured deli-style Turkey.
Glass, Kathleen A; McDonnell, Lindsey M; Von Tayson, Roxanne; Wanless, Brandon; Badvela, Mani
2013-12-01
Listeria monocytogenes growth can be controlled on ready-to-eat meats through the incorporation of antimicrobial ingredients into the formulation or by postlethality kill steps. However, alternate approaches are needed to provide options that reduce sodium content but maintain protection against pathogen growth in meats after slicing. The objective of this study was to determine the inhibition of L. monocytogenes by propionic acid-based ingredients in high-moisture, cured turkey stored at 4 or 7°C. Six formulations of sliced, cured (120 ppm of NaNO2 ), deli-style turkey were tested, including control without antimicrobials, 3.2% lactate-diacetate blend (LD), 0.4% of a liquid propionate-benzoate-containing ingredient, or 0.3, 0.4, and 0.5% of a liquid propionate-containing ingredient. Products were inoculated with 5 log CFU L. monocytogenes per 100-g package (3 log CFU/ml rinsate), vacuum-sealed, and stored at 4 or 7°C for up to 12 weeks; and populations were enumerated by plating on modified Oxford agar. As expected, the control without antimicrobials supported rapid growth, with >2 log average per ml rinsate increase within 4 weeks of storage at 4°C, whereas growth was observed at 6 weeks for the LD treatment. For both replicate trials, all treatments that contained liquid propionate or propionate-benzoate limited L. monocytogenes growth to an increase of 1-log increase) was observed in individual samples for all propionate-containing treatments at weeks 10, 11, and 12. As expected, L. monocytogenes grew more rapidly when products were stored at 7°C, but trends in relative inhibition were similar to those observed at 4°C. These results verify that propionate-based ingredients inhibit growth of L. monocytogenes on sliced, high-moisture, cured turkey and can be considered as an alternative to reduce sodium-based salts while maintaining food safety.
Directory of Open Access Journals (Sweden)
Erica Tirloni
2017-12-01
Full Text Available Objective of the present study was to test the performances of a loop-mediated isothermal amplification (LAMP-based method for the detection of Listeria monocytogenes, with particular focus on the dairy products. The specificity of the method was evaluated on 42 different Listeria spp. strains from collections, food and environmental samples. 100% (32 of 32 of the L. monocytogenes strains were correctly recognised, and none of other 10 Listeria spp. strains was misidentified. The sensitivity was evaluated on four L. monocytogenes strains from different sources. The instrument was able to detect 10-400 CFU/mL. The ability to detect low initial numbers of L. monocytogenes (0.3- 0.7 Log CFU/g was also evaluated, in duplicate, in pasteurised milk (whole and skimmed and dairy samples (fresh ricotta, crescenza, mascarpone, mozzarella, cottage cheese, cream cheese, taleggio, gorgonzola. The analysis was performed after 18, 24 and 48 h of incubation, and was coupled with the count of L. monocytogenes in the broth. Microbial loads were insufficient to achieve a positive result after 18 and 24 h in most of the samples; after 48 h, all the products, except taleggio and one gorgonzola sample, were identified as positive; the sensitivity of the method when applied to contaminated dairy foods was about 5 Log CFU/g. The LAMP method tested can be considered a very useful tool, as it is a costeffective and easy-functioning method. The preliminary data obtained should be confirmed with a validation process taking into account different food typologies.
Listeria monocytogenes in Fresh Produce: Outbreaks, Prevalence and Contamination Levels
Directory of Open Access Journals (Sweden)
Qi Zhu
2017-03-01
Full Text Available Listeria monocytogenes, a member of the genus Listeria, is widely distributed in agricultural environments, such as soil, manure and water. This organism is a recognized foodborne pathogenic bacterium that causes many diseases, from mild gastroenteritis to severe blood and/or central nervous system infections, as well as abortion in pregnant women. Generally, processed ready-to-eat and cold-stored meat and dairy products are considered high-risk foods for L. monocytogenes infections that cause human illness (listeriosis. However, recently, several listeriosis outbreaks have been linked to fresh produce contamination around the world. Additionally, many studies have detected L. monocytogenes in fresh produce samples and even in some minimally processed vegetables. Thus L. monocytogenes may contaminate fresh produce if present in the growing environment (soil and water. Prevention of biofilm formation is an important control measure to reduce the prevalence and survival of L. monocytogenes in growing environments and on fresh produce. This article specifically focuses on fresh produce–associated listeriosis outbreaks, prevalence in growing environments, contamination levels of fresh produce, and associated fresh produce safety challenges.
Commensal microbes provide first line defense against Listeria monocytogenes infection
Littmann, Eric R.; Kim, Sohn G.; Morjaria, Sejal M.; Ling, Lilan; Gyaltshen, Yangtsho; Taur, Ying; Leiner, Ingrid M.
2017-01-01
Listeria monocytogenes is a foodborne pathogen that causes septicemia, meningitis and chorioamnionitis and is associated with high mortality. Immunocompetent humans and animals, however, can tolerate high doses of L. monocytogenes without developing systemic disease. The intestinal microbiota provides colonization resistance against many orally acquired pathogens, and antibiotic-mediated depletion of the microbiota reduces host resistance to infection. Here we show that a diverse microbiota markedly reduces Listeria monocytogenes colonization of the gut lumen and prevents systemic dissemination. Antibiotic administration to mice before low dose oral inoculation increases L. monocytogenes growth in the intestine. In immunodeficient or chemotherapy-treated mice, the intestinal microbiota provides nonredundant defense against lethal, disseminated infection. We have assembled a consortium of commensal bacteria belonging to the Clostridiales order, which exerts in vitro antilisterial activity and confers in vivo resistance upon transfer into germ free mice. Thus, we demonstrate a defensive role of the gut microbiota against Listeria monocytogenes infection and identify intestinal commensal species that, by enhancing resistance against this pathogen, represent potential probiotics. PMID:28588016
Directory of Open Access Journals (Sweden)
Daniel R. Rissi
2010-01-01
Full Text Available São descritos sete casos de doença neurológica em ovinos por Listeria monocytogenes no Rio Grande do Sul e Paraná entre 2000 e 2007. Foram afetados ovinos com idades entre 12-24 meses. Os casos ocorreram no verão e início da primavera e os índices gerais de morbidade e letalidade foram de 3,15% e 100%, respectivamente. Quando essa informação estava disponível, nenhum dos ovinos afetados era alimentado com silagem. Em três propriedades havia contato próximo dos ovinos afetados com outras espécies. A evolução do quadro clínico foi de 12 horas a três dias e os sinais clínicos foram caracterizados por decúbito (7/7, desvio da cabeça (4/7, incoordenação (3/7, depressão (3/7, andar em círculos (2/7, cegueira unilateral, emagrecimento progressivo, febre, midríase, movimentos de pedalagem, nistagmo lateral, opistótono, paralisia flácida dos membros pélvicos ou dos quatro membros, salivação excessiva e tremores (1/7 cada. Histologicamente observou-se encefalite com microabscessos, predominantemente unilateral com variáveis graus de gliose e alterações degenerativas como esferóides axonais e infiltração de células Gitter. As lesões se estendiam desde a medula oblonga até o mesencéfalo. Antígenos de Listeria monocytogenes foram detectados por imuno-histoquímica em seções de tronco encefálico de todos os ovinos afetados. O diagnóstico foi realizado com base nos achados epidemiológicos e clinico-patológicos, e confirmado pela imuno-histoquímica (IHQ utilizando anticorpo policlonal anti-L. monocytogenes.Seven cases of neurological disease in sheep caused by Listeria monocytogenes in Rio Grande do Sul and Paraná state, southern Brazil are described. The cases occurred between 2000 and 2007 and 12-24-month-old sheep were affected. Overall morbidity and lethality rates were 3.15% and 100%, respectively. Cases occurred in the summer and early spring. When this information was available, affected sheep had not been
Listeria monocytogenes infection of HD11, chicken macrophage-like cells.
Jarvis, N A; Donaldson, J R; O'Bryan, C A; Ricke, S C; Crandall, P G
2017-04-01
Listeria monocytogenes can be carried by and infect poultry, although the clinical disease in birds is rare. Escape from macrophage phagocytosis is a key step in pathogenesis for L. monocytogenes. Therefore, we investigated the infection of the chicken macrophage-like cell line HD11 with 2 strains of L. monocytogenes EGD-e and Scott A. After infection, L. monocytogenes was quantified by spread plating and HD11 was quantified with trypan blue exclusion stain before enumeration. The standard macrophage killing protocols require washing the cell monolayers 3 times with PBS, which was found to negatively influence HD11 monolayers. Maximum bacterial densities within macrophages were not different between the 2 Listeria strains. HD11 required more than 11 h to effectively reduce intracellular L. monocytogenes Scott A, and Scott A was more susceptible to HD11 killing than EGD-e. It appears that Listeria infection initially causes attenuation of HD11 growth, and infected HD11 cells do not begin to lyse until at least 11 h post infection. These results suggest that there are subtle strain to strain differences in response to HD11 macrophage phagocytosis. The long lead-time required for HD11 to kill L. monocytogenes cells means that there is sufficient time available for chicken macrophages to circulate in the blood and transfer the intracellular Listeria to multiple tissues. © 2016 Poultry Science Association Inc.
Survival of Bactericidal Antibiotic Treatment by a Persister Subpopulation of Listeria monocytogenes
DEFF Research Database (Denmark)
Knudsen, Gitte Maegaard; Ng, Yin; Gram, Lone
2013-01-01
Listeria monocytogenes can cause the serious infection listeriosis, which despite antibiotic treatment has a high mortality. Understanding the response of L. monocytogenes to antibiotic exposure is therefore important to ensure treatment success. Some bacteria survive antibiotic treatment...... by formation of persisters, which are a dormant antibiotic-tolerant subpopulation. The purpose of this study was to determine whether L. monocytogenes can form persisters and how bacterial physiology affects the number of persisters in the population. A stationary-phase culture of L. monocytogenes was adjusted...... that eradication of persisters is possible. Our study adds L. monocytogenes to the list of bacterial species capable of surviving bactericidal antibiotics in a dormant stage, and this persister phenomenon should be borne in mind when developing treatment regimens....
Analysis of process factors of dry fermented salami to control Listeria monocytogenes
Directory of Open Access Journals (Sweden)
Enrico Novelli
2017-01-01
Full Text Available Challenge tests are a clear opportunity for manufacturers interested in the evaluation of their management system with the aim to reduce the spread of foodborne pathogens. This is a main concern especially in ready-to-eat food in relation to the risk associated with Listeria monocytogenes. For small and medium-scale food industry the manufacturing practices and products formulation are characterised by a wider variability and poor repeatability. The use of ad hoc challenge test and the comparison among different processing systems are strongly required. This paper reports a preliminary comparison among different challenge tests (n=12 commissioned by three manufacturers of raw-fermented salami during a period of three years (2013-2016. The challenge tests were designed to evaluate the growth potential (δ of L. monocytogenes during the whole processing period of the salami. The doughs were prepared according to different formulations: the simplest formulation was represented by the use of salt, potassium nitrate, black pepper and starter cultures, while the most composited formulations also included the use of sugars and ascorbic acid in addition to nitrite salt. All the processing steps were conducted within an experimental laboratory dedicated for the processing of meat. After stuffing, the salami were dried and ripened under temperature and relative humidity control. The sugar inclusion can be considered as a protective factor, while the drying step at high temperature (above 20°C was associated with higher δ values (δ>0.5 log10 cfu/g. The addition of starter cultures, and the subsequent acidification highlighted the importance of pH as the parameter able to affect the L. monocytogenes growth.
Analysis of Process Factors of Dry Fermented Salami to Control Listeria Monocytogenes
Novelli, Enrico; Dal Santo, Lucia; Balzan, Stefania; Cardazzo, Barbara; Spolaor, Dino; Lombardi, Angiolella; Carraro, Lisa; Fasolato, Luca
2017-01-01
Challenge tests are a clear opportunity for manufacturers interested in the evaluation of their management system with the aim to reduce the spread of foodborne pathogens. This is a main concern especially in ready-to-eat food in relation to the risk associated with Listeria monocytogenes. For small and medium-scale food industry the manufacturing practices and products formulation are characterised by a wider variability and poor repeatability. The use of ad hoc challenge test and the comparison among different processing systems are strongly required. This paper reports a preliminary comparison among different challenge tests (n=12) commissioned by three manufacturers of raw-fermented salami during a period of three years (2013-2016). The challenge tests were designed to evaluate the growth potential (δ) of L. monocytogenes during the whole processing period of the salami. The doughs were prepared according to different formulations: the simplest formulation was represented by the use of salt, potassium nitrate, black pepper and starter cultures, while the most composited formulations also included the use of sugars and ascorbic acid in addition to nitrite salt. All the processing steps were conducted within an experimental laboratory dedicated for the processing of meat. After stuffing, the salami were dried and ripened under temperature and relative humidity control. The sugar inclusion can be considered as a protective factor, while the drying step at high temperature (above 20°C) was associated with higher δ values (δ>0.5 log10 cfu/g). The addition of starter cultures, and the subsequent acidification highlighted the importance of pH as the parameter able to affect the L. monocytogenes growth. PMID:28462203
Kureljušić, J.; Rokvić, N.; Jezdimirović, N.; Kureljušić, B.; Pisinov, B.; Karabasil, N.
2017-09-01
Listeria is the genus of a bacteria found in soil and water and some animals, including poultry and cattle. It can be present in raw milk and food made from raw milk. It can also live in food processing plants and contaminate a variety of processed meats. Microscopically, Listeria species appear as small, Gram-positive rods, which are sometimes arranged in short chains. In direct smears, they can be coccoid, so they can be mistaken for streptococci. Longer cells can resemble corynebacteria. Flagella are produced at room temperature but not at 37°C. Haemolytic activity on blood agar has been used as a marker to distinguish Listeria monocytogenes among other Listeria species, but it is not an absolutely definitive criterion. Further biochemical characterization is necessary to distinguish between the different Listeria species. The objective of this study was to detect, isolate and identify Listeria monocytogenes from poultry meat. Within a period of six months from January to June 2017, a total of 15 samples were collected. Three samples were positive for the presence of Listeria monocytogenes. Biochemical and microbiological tests as well as PCR technique using specific primers were used to confirm L. Monocytogenes in the samples.
Directory of Open Access Journals (Sweden)
Luisa Zanolli Moreno
2014-01-01
Full Text Available In the last decade, atypical Listeria monocytogenes and L. innocua strains have been detected in food and the environment. Because of mutations in the major virulence genes, these strains have different virulence intensities in eukaryotic cells. In this study, we performed phenotypic and genotypic characterization of atypical L. monocytogenes and L. innocua isolates obtained from swine slaughterhouses and meat markets. Forty strains were studied, including isolates of L. monocytogenes and L. innocua with low-hemolytic activity. The isolates were characterized using conventional phenotypic Listeria identification tests and by the detection and analysis of L. monocytogenes-specific genes. Analysis of 16S rRNA was used for the molecular identification of the Listeria species. The L. monocytogenes isolates were positive for all of the virulence genes studied. The atypical L. innocua strains were positive for hly, plcA, and inlC. Mutations in the InlC, InlB, InlA, PI-PLC, PC-PLC, and PrfA proteins were detected in the atypical isolates. Further in vitro and transcriptomic studies are being developed to confirm the role of these mutations in Listeria virulence.
Dailey, Rachel C; Welch, Lacinda J; Hitchins, Anthony D; Smiley, R Derike
2015-04-01
The presence of multiple species of Listeria in regulated food products is not uncommon and can complicate the recovery of Listeria monocytogenes particularly on a non-differentiating medium. The potential complications of Listeria seeligeri and Listeria welshimeri on the recovery of L. monocytogenes from inoculated food test samples using the U.S. Food and Drug Administration's (FDA) selective enrichment procedure was investigated. Post-enrichment enumeration, in the absence of food product, indicates that some L. seeligeri and L. monocytogenes pairings may have population differentials as great as 2.7 ± 0.1 logs with L. seeligeri being the predominant species. A similar observation was noted for L. welshimeri and L. monocytogenes pairings which resulted in population differentials as large as 3.7 ± 0.2 logs with L. welshimeri being the predominant species. Select strain pairings were used to inoculate guacamole, crab meat, broccoli, and cheese with subsequent recovery by the FDA Bacteriological Analytical Manual (BAM) method with 10 colonies per sample selected for confirmation. The presence of L. seeligeri had little effect on the recovery of L. monocytogenes. The presence of L. welshimeri resulted in the failure to recover L. monocytogenes in three out of the four food matrices. This work extends the observation that non-pathogenic species of Listeria can complicate the recovery of L. monocytogenes and that competition during selective enrichment is not limited to the presence of just Listeria innocua. Published by Elsevier Ltd.
Dailey, Rachel C.; Welch, Lacinda J.; Hitchins, Anthony D.; Smiley, R. Derike
2016-01-01
The presence of multiple species of Listeria in regulated food products is not uncommon and can complicate the recovery of Listeria monocytogenes particularly on a non-differentiating medium. The potential complications of Listeria seeligeri and Listeria welshimeri on the recovery of L. monocytogenes from inoculated food test samples using the U.S. Food and Drug Administration's (FDA) selective enrichment procedure was investigated. Post-enrichment enumeration, in the absence of food product, indicates that some L. seeligeri and L. monocytogenes pairings may have population differentials as great as 2.7 ± 0.1 logs with L. seeligeri being the predominant species. A similar observation was noted for L. welshimeri and L. monocytogenes pairings which resulted in population differentials as large as 3.7 ± 0.2 logs with L. welshimeri being the predominant species. Select strain pairings were used to inoculate guacamole, crab meat, broccoli, and cheese with subsequent recovery by the FDA Bacteriological Analytical Manual (BAM) method with 10 colonies per sample selected for confirmation. The presence of L. seeligeri had little effect on the recovery of L. monocytogenes. The presence of L. welshimeri resulted in the failure to recover L. monocytogenes in three out of the four food matrices. This work extends the observation that non-pathogenic species of Listeria can complicate the recovery of L. monocytogenes and that competition during selective enrichment is not limited to the presence of just Listeria innocua. PMID:25475325
Detection of Listeria Spp. and Listeria monocytogenes in vegetables ...
African Journals Online (AJOL)
This paper aimed to study the prevalence and antibiotic resistance pattern among Listeria monocytogenes in raw vegetables sourced from commercial farms and local farms in Terengganu. Thirteen types of vegetables investigated for the presence of L. monocytogenes using multiplex PCR and LAMP methods. Isolation of ...
Prevalence and populations of Listeria monocytogenes in meat products retailed in Sao Paulo, Brazil.
Ristori, Christiane Asturiano; Rowlands, Ruth Estela Gravato; Martins, Cecília Geraldes; Barbosa, Maria Luisa; Yoshida, Júlia T U; Franco, Bernadette D G de Melo
2014-12-01
This study evaluated the prevalence of the populations and serotypes of Listeria monocytogenes in 552 refrigerated samples of ground beef, chicken leg, hot dog, and pork sausage collected in supermarkets in the city of Sao Paulo, SP, Brazil, between May 2008 and July 2009. The supermarkets were selected after stratification by geographical region and by random draw. Tests for presence and enumeration of L. monocytogenes were based on ISO 11290-1:1996/Amd.1:2004 and ISO 11290-2:1998 methods, respectively. Listeria spp. were detected in 469 (85.0%) of the studied meat products. The most frequently isolated species was L. innocua (64.1%), followed by L. monocytogenes (48.7%), L. welshimeri (13.4%), L. seeligeri (7.1%), L. ivanovii (0.2%), and L. grayi subspecies murrayi (0.2%). L. monocytogenes was detected in 269 (48.7%) samples, with highest prevalence in ground beef (59.4%) followed by chicken legs (58.0%), pork sausages (39.8%), and hot dogs (37.7%). The populations were Prevalence of serotypes varied according to the type of meat product. These data are relevant for estimating the risks of listeriosis associated with consumption of meat products in Sao Paulo, and for establishing science-based intervention strategies aimed at reducing these risks, especially for pregnant women and immunocompromised individuals.
Early trigeminal nerve involvement in Listeria monocytogenes rhombencephalitis
DEFF Research Database (Denmark)
Karlsson, William K; Harboe, Zitta Barrella; Roed, Casper
2017-01-01
dysfunction on that side. In addition, we identified another 120 cases of Listeria rhombencephalitis following a systematic review. Cranial nerves VII, V, IX, and X, respectively, medulla oblongata, cerebellum and pons, were the most frequently involved brain structures. The present clinical and radiological...... findings corroborate earlier data from animal experiments, indicating that L. monocytogenes may be capable of retrograde intra-axonal migration along the cranial nerves. We suggest that in a subset of patients with rhombencephalitis L. monocytogenes enters the cerebellopontine angle through the trigeminal......Listeria monocytogenes is associated with rhombencephalitis. However, the exact mechanisms of brainstem invasion remains poorly understood. Here, we demonstrate clinical and radiological data suggesting that Listeria may invade the brainstem via the trigeminal nerve. Three females (41, 64 and 70...
Sugiri, Yoni Darmawan; Gölz, Greta; Meeyam, Tongkorn; Baumann, Maximilian P O; Kleer, Josef; Chaisowwong, Warangkhana; Alter, Thomas
2014-08-01
This study was conducted to determine the prevalence and quantify the number of Listeria monocytogenes in fresh chicken carcasses sold in traditional markets and supermarkets in Bandung, West Java, Indonesia, and to determine the antimicrobial resistance patterns of the isolated L. monocytogenes strains. The overall prevalence of L. monocytogenes in chicken carcasses was 15.8% (29/184). When comparing samples from traditional markets and supermarkets, no significant difference in the L. monocytogenes prevalence was detectable (15.2 versus 16.3%). Of the samples, 97.3% had L. monocytogenes counts study were grouped into the molecular serogroup IIb, comprising the serovars 1/2b, 3b, and 7.
Silva, A; Genovés, S; Martorell, P; Zanini, S F; Rodrigo, D; Martinez, A
2015-09-01
The aim of this study was to evaluate the effect of two antimicrobial substances, carvacrol and citral, on Listeria monocytogenes and Listeria innocua cells, as well as possible virulence changes in injured cells, using Caenorhabditis elegans as a model test. The results indicated that the percentage of sublethal damage was higher in L. monocytogenes than in L. innocua. The results of the study carried out by using C. elegans indicated that C. elegans fed in a lawn of L. monocytogenes previously treated with carvacrol showed a loss in life span (p ≤ 0.05) as compared with L. monocytogenes treated with citral, Escherichia coli OP50 as a negative control, and treated and untreated L. innocua. Egg laying was also affected: worms fed in a lawn of treated and untreated L. monocytogenes laid fewer eggs than those fed in a lawn of treated and untreated L. innocua or fed with OP50 as a negative control. Worms fed in a lawn of treated and untreated L. innocua also laid fewer eggs than those fed with OP50 as a negative control. A phenotype named bag of worms and an undescribed new one, "vulva inflammation", were also observed. Copyright © 2015 Elsevier Ltd. All rights reserved.
Morphological Change and Decreasing Transfer Rate of Biofilm-Featured Listeria monocytogenes EGDe.
Lee, Yuejia; Wang, Chinling
2017-03-01
Listeria monocytogenes , a lethal foodborne pathogen, has the ability to resist the hostile food processing environment and thus frequently contaminates ready-to-eat foods during processing. It is commonly accepted that the tendency of L. monocytogenes ' to generate biofilms on various surfaces enhances its resistance to the harshness of the food processing environment. However, the role of biofilm formation in the transferability of L. monocytogenes EGDe remains controversial. We examined the growth of Listeria biofilms on stainless steel surfaces and their effect on the transferability of L. monocytogenes EGDe. The experiments were a factorial 2 × 2 design with at least three biological replicates. Through scanning electron microscopy, a mature biofilm with intensive aggregates of cells was observed on the surface of stainless steel after 3 or 5 days of incubation, depending on the initial level of inoculation. During biofilm development, L. monocytogenes EGDe carried out binary fission vigorously before a mature biofilm was formed and subsequently changed its cellular morphology from rod shaped to sphere shaped. Furthermore, static biofilm, which was formed after 3 days of incubation at 25°C, significantly inhibited the transfer rate of L. monocytogenes EGDe from stainless steel blades to 15 bologna slices. During 7 days of storage at 4°C, however, bacterial growth rate was not significantly impacted by whether bacteria were transferred from biofilm and the initial concentrations of transferred bacteria on the slice. In conclusion, this study is the first to report a distinct change in morphology of L. monocytogenes EGDe at the late stage of biofilm formation. More importantly, once food is contaminated by L. monocytogenes EGDe, contamination proceeds independently of biofilm development and the initial level of contamination when food is stored at 4°C, even if contamination with L. monocytogenes EGDe was initially undetectable before storage.
Modeling the growth of Listeria monocytogenes in soft blue-white cheese
DEFF Research Database (Denmark)
Rosshaug, Per Sand; Detmer, Ann; Ingmer, Hanne
2012-01-01
The aim of this study was to develop a predictive model simulating growth over time of the pathogenic bacterium Listeria monocytogenes in a soft blue-white cheese. The physicochemical properties in a matrix such as cheese are essential controlling factors influencing the growth of L. monocytogenes....... We developed a predictive tertiary model of the bacterial growth of L. monocytogenes as a function of temperature, pH, NaCl, and lactic acid. We measured the variations over time of the physicochemical properties in the cheese. Our predictive model was developed based on broth data produced...... production and retail conditions showed that the number of L. monocytogenes cells increases 3 to 3.5 log within the shelf life of the cheese....
Lotfollahi, Lida; Chaharbalesh, Ardalan; Ahangarzadeh Rezaee, Mohammad; Hasani, Alka
2017-06-01
Listeria monocytogenes is a foodborne pathogen causing listeriosis, which potentially affects all individuals, especially pregnant women and immunocompromised persons. The present study investigated the prevalence, antimicrobial susceptibility and serotypes distribution of the isolated L. monocytogenes from Iran. Twenty two (4.97%) of 442 human, food and livestock samples were found to be positive for L. monocytogenes. L. monocytogenes was identified in 8.8% of 125 human samples, 2.99% of 267 food and 6% of 50 livestock samples. The standard disk diffusion method and minimum inhibitory concentration (MIC) assay were used for antimicrobial susceptibility testing and multiplex PCR for serotyping. Among the 22 isolates tested, 6 (27.2%) displayed resistance to penicillin G, with all of the isolates and 2 (9%) of them showing intermediate susceptibility to clindamycin and rifampicin, respectively. According to the MIC assay, the rate of resistance to penicillin G was the same as that of disk diffusion method, but 16 (72.7%) of isolates showed intermediate susceptibility to clindamycin using E-test. In the multiplex PCR, 19 (86.4%) of isolates belonged to serotype 1/2c or 3c and the remaining 3 isolates were identified as (4b, 4d or 4e) and (1/2a or 3a), respectively. The occurrence of resistance to penicillin G, which can be used in the treatment of listeriosis, is very alarming and more prevalence of 1/2c serotype, in comparison to 3 other important ones (1/2a, 1/2b and 4b), in Iran has been reported for the first time. To the best of our knowledge, this is the first study showing the distribution of various serogroups of L. monocytogenes from human and livestock in Iran. Copyright © 2017 Elsevier Ltd. All rights reserved.
Symbiosis and the origin of eukaryotic motility
Margulis, L.; Hinkle, G.
1991-01-01
Ongoing work to test the hypothesis of the origin of eukaryotic cell organelles by microbial symbioses is discussed. Because of the widespread acceptance of the serial endosymbiotic theory (SET) of the origin of plastids and mitochondria, the idea of the symbiotic origin of the centrioles and axonemes for spirochete bacteria motility symbiosis was tested. Intracellular microtubular systems are purported to derive from symbiotic associations between ancestral eukaryotic cells and motile bacteria. Four lines of approach to this problem are being pursued: (1) cloning the gene of a tubulin-like protein discovered in Spirocheata bajacaliforniesis; (2) seeking axoneme proteins in spirochets by antibody cross-reaction; (3) attempting to cultivate larger, free-living spirochetes; and (4) studying in detail spirochetes (e.g., Cristispira) symbiotic with marine animals. Other aspects of the investigation are presented.
Ndahetuye, Jean Baptiste; Koo, Ok Kyung; O'Bryan, Corliss A; Ricke, Steven C; Crandall, Philip G
2012-08-01
The study was conducted to evaluate the attachment of three lactic acid bacteria (LAB) strains and their combination in a cocktail, to stainless steel coupons from a deli slicer, and their ability to inhibit the attachment of Listeria monocytogenes. In a previous study, three LAB strains, Pediococcus acidilactici, Lactobacillus amylovorus, and Lactobacillus animalis, were isolated from ready-to-eat meat and exhibited antilisterial effect. In the study reported here, hydrophobicity tests were determined according to the method of microbial adhesion to solvent. The attachment of the cells was evaluated on stainless steel coupons from deli slicers. Extracellular carbohydrates were determined with a colorimetric method. Based on these tests, L. animalis exhibited the greatest hydrophobicity (26.3%), and its adherence increased sharply from 24 to 72 h, whereas L. amylovorus yielded the lowest hydrophobicity (3.86%) and was weakly adherent. Although P. acidilactici had moderate hydrophobicity (10.1%), it adhered strongly. The attached LAB strains produced significantly (P < 0.05) higher total carbohydrates than their planktonic counterparts did, which is an important characteristic for attachment. Three conditions were simulated to evaluate the ability of the LAB cocktail (10(8) CFU/ml) to competitively exclude L. monocytogenes (10(3) CFU/ml) on the surface of the coupons. The coupons were pretreated with the LAB cocktail for 24 h prior to the addition of L. monocytogenes, simultaneously treated with the LAB cocktail and L. monocytogenes, or pretreated with L. monocytogenes 24 h prior to the addition of the LAB cocktail. The LAB cocktail was able to reduce the attachment L. monocytogenes significantly (P < 0.05). The LAB cocktail indicated potential attachment on stainless steel and bacteriostatic activity toward L. monocytogenes attached on stainless steel, which indicates a possible role for LAB as a biosanitizer in the food industry.
Occurrence of Listeria monocytogenes in smoked fish in Sokoto ...
African Journals Online (AJOL)
The present study was conducted to determine the prevalence of Listeria monocytogenes in smoked fish in Sokoto, Nigeria. A total of 115 different species of smoked fish from the various retail outlets and market places within the metropolis were analysed for the presence of L. monocytogenes using ISO culture method.
Effekt av ulike desinfeksjonsstrategier mot Listeria monocytogenes
Fossmo, Sabine
2013-01-01
Kontroll med bakterier som Listeria utgjør en stor utfordring for mange matprodusenter. Listeria monocytogenes er hovedsakelig et produksjonshygienisk problem, forbedret hygiene kan derfor være tiltak for å redusere overlevelse og smitteoverføring av bakterien i produksjonsmiljø. Hensikten med forsøkene i oppgaven var å undersøke effekten av ulike desinfeksjonsstrategier på drap av L. monocytogenes, både når bakteriene var i biofilm og i suspensjon. Dette inkluderte bruk av tradisjonelle desi...
Directory of Open Access Journals (Sweden)
Dara eLeong
2014-08-01
Full Text Available Although rates of listeriosis are low in comparison to other foodborne pathogenic illnesses, listeriosis poses a significant risk to human health as the invasive form can have a mortality rate as high as 30%. Food processors, especially those who produce ready-to-eat products, need to be vigilant against Listeria monocytogenes, the causative pathogen of listeriosis, and as such, the occurrence of L. monocytogenes in food and in the food processing environment needs to be carefully monitored. To examine the prevalence and patterns of contamination in food processing facilities in Ireland, 48 food processors submitted 8 samples every 2 months from March 2013 to March 2014 to be analyzed for L. monocytogenes. No positive samples were detected for 38% of the processing facilities tested. Isolates found at the remaining 62% of facilities were characterized by serotyping and Pulsed Field Gel Electrophoresis (PFGE. A general L. monocytogenes prevalence of 4.6% was seen in all samples analyzed with similar rates seen in food and environmental samples. Differences in prevalence were seen across different food processors, food sectors, sampling months etc. and PFGE analysis allowed for the examination of contamination patterns and for the identification of several persistent strains. Seven of the food processing facilities tested showed contamination with persistent strains and evidence of bacterial transfer from the processing environment to food (the same pulsotype found in both was seen in four of the food processing facilities tested.
Leong, Dara; Alvarez-Ordóñez, Avelino; Jordan, Kieran
2014-01-01
Although rates of listeriosis are low in comparison to other foodborne pathogenic illness, listeriosis poses a significant risk to human health as the invasive form can have a mortality rate as high as 30%. Food processors, especially those who produce ready-to-eat (RTE) products, need to be vigilant against Listeria monocytogenes, the causative pathogen of listeriosis, and as such, the occurrence of L. monocytogenes in food and in the food processing environment needs to be carefully monitored. To examine the prevalence and patterns of contamination in food processing facilities in Ireland, 48 food processors submitted 8 samples every 2 months from March 2013 to March 2014 to be analyzed for L. monocytogenes. No positive samples were detected at 38% of the processing facilities tested. Isolates found at the remaining 62% of facilities were characterized by serotyping and Pulsed Field Gel Electrophoresis (PFGE). A general L. monocytogenes prevalence of 4.6% was seen in all samples analyzed with similar rates seen in food and environmental samples. Differences in prevalence were seen across different food processors, food sectors, sampling months etc. and PFGE analysis allowed for the examination of contamination patterns and for the identification of several persistent strains. Seven of the food processing facilities tested showed contamination with persistent strains and evidence of bacterial transfer from the processing environment to food (the same pulsotype found in both) was seen in four of the food processing facilities tested.
Meloni, Domenico; Galluzzo, Pietro; Mureddu, Anna; Piras, Francesca; Griffiths, Mansel; Mazzette, Rina
2009-02-15
The aims of the present study were: (a) to investigate the prevalence and the enumeration of Listeria monocytogenes in 200 samples of ready to eat (RTE) foods of animal and vegetal origin collected from different outlets and processing plants in Sardinia; (b) to characterize the isolates by phenotypical and molecular methods; (c) to analyze a subset of 42 L. monocytogenes by automated EcoRI ribotyping in order to predict the strain's potential virulence for humans. The strains were isolated from: smoked fish products, cooked marinated products, meat products and pre-packaged mixed vegetable salads. Of the samples tested, 22% were positive for Listeria spp. The prevalence of L. monocytogenes was 9.5%, while the level of L. monocytogenes in the positive samples was 93%), belonging to 17 different DuPont Identification Library Codes (DUP-IDs) clones. The Simpson's numerical index of discrimination was 0.911. Cluster analysis pointed out a high similarity among strains isolated from meat, fish, and vegetables of different origin. These results confirmed the existence of a widespread population of L. monocytogenes, characterized by highly related strains existing in different geographical areas. 65% of these strains belonged to lineage II (serotypes 1/2a and 1/2c), subtypes known to be associated with sporadic human listeriosis outbreaks. The remaining 35% of the isolates (serotypes 1/2b, 3b and 4b) were allocated to lineage I and belong to distinct clonal groups (DUP-ID 1038 and 1042), which again have been associated with several outbreaks of human listeriosis. Neither atypical profiles nor lineage III strains were found. EcoRI ribotyping was confirmed as a rapid and reliable method for L. monocytogenes typing, providing useful data for epidemiologic and clonality surveys of L. monocytogenes strains isolated from RTE foods.
Monitoring paneer for Listeria monocytogenes - A high risk food ...
African Journals Online (AJOL)
A multiplex polymerase chain reaction (PCR) assay was developed and applied to spiked and natural paneer samples to detect Listeria monocytogenes, a high risk food pathogen. The sensitivity of the assay on L. monocytogenes spiked paneer samples was 104 cells prior to enrichment, was improved to 103 cells after 4 h ...
Lenz, Peter
2008-01-01
Cell motility is a fascinating example of cell behavior which is fundamentally important to a number of biological and pathological processes. It is based on a complex self-organized mechano-chemical machine consisting of cytoskeletal filaments and molecular motors. In general, the cytoskeleton is responsible for the movement of the entire cell and for movements within the cell. The main challenge in the field of cell motility is to develop a complete physical description on how and why cells move. For this purpose new ways of modeling the properties of biological cells have to be found. This long term goal can only be achieved if new experimental techniques are developed to extract physical information from these living systems and if theoretical models are found which bridge the gap between molecular and mesoscopic length scales. Cell Motility gives an authoritative overview of the fundamental biological facts, theoretical models, and current experimental developments in this fascinating area.
Sharma, Sanjita; Sharma, Vishnu; Dahiya, Dinesh Kumar; Khan, Aarif; Mathur, Manisha; Sharma, Amit
2017-03-01
Listeriosis is a serious foodborne disease of a global concern, and can effectively be controlled by a continuous surveillance of the virulent and multidrug-resistant strains of Listeria monocytogenes. This study was planned to investigate prevalence of L. monocytogenes in bovine raw milk samples. A total of 457 raw milk samples collected from 15 major cities in Rajasthan, India, were analyzed for the presence of L. monocytogenes by using standard microbiological and molecular methods. Five of the 457 samples screen tested positive for L. monocytogenes. Multiplex serotyping showed that 3/5 strains belonged to serotype 4b followed by one strain each to 1/2a and to 1/2c. Further virulence potential assessment indicated that all strains possessed inlA and inlC internalins, and, in addition, two strains also possessed the gene for inlB. All strains were positive for Listeriolysin O (LLO) and showed phosphatidylinositol-specific phospholipase C (PI-PLC) activity on an in vitro agar medium with variations in production levels among the strains. A good correlation between the in vitro pathogenicity test and the chick embryo test was observed, as the strains showing higher LLO and PI-PLC activity were found to be lethal to fertilized chick embryos. All strains were resistant to the majority of antibiotics and were designated as multidrug-resistant strains. However, these strains were susceptible to 9 of the 22 tested antibiotics. The maximum zone of inhibition (mm) and acceptable minimum inhibitory concentration were observed with azithromycin, and thus it could be the first choice of a treatment. Overall, the presence of multidrug-resistant L. monocytogenes strains in the raw milk of Rajasthan region is an indicator of public health hazard and highlighting the need of consumer awareness in place and implementation of stricter food safety regulations at all levels of milk production.
Genome sequences of Listeria monocytogenes strains with resistance to arsenic
Listeria monocytogenes frequently exhibits resistance to arsenic. We report here the draft genome sequences of eight genetically diverse arsenic-resistant L. monocytogenes strains from human listeriosis and food-associated environments. Availability of these genomes would help to elucidate the role ...
Effects of prebiotics on the infective potential of Listeria monocytogenes
DEFF Research Database (Denmark)
Ebersbach, Tine
% xylooligosaccharides (XOS), galactooligosaccharides (GOS), inulin, apple pectin or polydextrose for three weeks before oral challenge with L. monocytogenes. XOS and GOS significantly improved resistance of guinea pigs to L. monocytogenes, while inulin and apple pectin decreased the resistance. No significant effect...
Measuring Borrelia burgdorferi Motility and Chemotaxis.
Zhang, Kai; Li, Chunhao
2018-01-01
Swimming plate, cell motion tracking, and capillary tube assays are very useful tools to quantitatively measure bacterial motility and chemotaxis. These methods were modified and applied to study Borrelia burgdorferi motility and chemotaxis. By using these methods, numerous motility and chemotaxis mutants have been characterized and several chemoattractants were identified. With the assistance of these tools, the role of motility and chemotaxis in the pathogenicity of B. burgdorferi has been established. In addition, these tools also facilitate the study of motility and chemotaxis in other spirochetes.
Wang, Y T; Mohammed, S D; Farmer, A D; Wang, D; Zarate, N; Hobson, A R; Hellström, P M; Semler, J R; Kuo, B; Rao, S S; Hasler, W L; Camilleri, M; Scott, S M
2015-09-01
The wireless motility capsule (WMC) offers the ability to investigate luminal gastrointestinal (GI) physiology in a minimally invasive manner. To investigate the effect of testing protocol, gender, age and study country on regional GI transit times and associated pH values using the WMC. Regional GI transit times and pH values were determined in 215 healthy volunteers from USA and Sweden studied using the WMC over a 6.5-year period. The effects of test protocol, gender, age and study country were examined. For GI transit times, testing protocol was associated with differences in gastric emptying time (GET; shorter with protocol 2 (motility capsule ingested immediately after meal) vs. protocol 1 (motility capsule immediately before): median difference: 52 min, P = 0.0063) and colonic transit time (CTT; longer with protocol 2: median 140 min, P = 0.0189), but had no overall effect on whole gut transit time. Females had longer GET (by median 17 min, P = 0.0307), and also longer CTT by (104 min, P = 0.0285) and whole gut transit time by (263 min, P = 0.0077). Increasing age was associated with shorter small bowel transit time (P = 0.002), and study country also influenced small bowel and CTTs. Whole gut and CTTs showed clustering of data at values separated by 24 h, suggesting that describing these measures as continuous variables is invalid. Testing protocol, gender and study country also significantly influenced pH values. Regional GI transit times and pH values, delineated using the wireless motility capsule (WMC), vary based on testing protocol, gender, age and country. Standardisation of testing is crucial for cross-referencing in clinical practice and future research. © 2015 John Wiley & Sons Ltd.
Schoder, Dagmar; Melzner, Daniela; Schmalwieser, Alois; Zangana, Abdoulla; Winter, Petra; Wagner, Martin
2011-06-01
The aim of this study was to determine the transmission routs of Listeria spp. in dairy farms manufacturing fresh cheese made from ovine and caprine raw milk and to evaluate the impact of Listeria monocytogenes mastitis on raw milk contamination. Overall, 5,799 samples, including 835 environmental samples, 230 milk and milk product samples, and 4,734 aseptic half-udder foremilk samples were collected from 53 dairy farms in the dairy intensive area of Lower Austria. Farms were selected for the study because raw milk was processed to cheese that was sold directly to consumers. A total of 153 samples were positive for Listeria spp., yielding an overall prevalence of 2.6%; L. monocytogenes was found in 0.9% of the samples. Bulk tank milk, cheese, and half-udder samples were negative for Listeria spp. Because none of the sheep and goats tested positive from udder samples, L. monocytogenes mastitis was excluded as a significant source of raw milk contamination. L. monocytogenes was detected at 30.2% of all inspected farms. Swab samples from working boots and fecal samples had a significantly higher overall prevalence (P < 0.001) of L. monocytogenes (15.7 and 13.0%, respectively) than did swab samples from the milk processing environment (7.9%). A significant correlation was found between the prevalence of L. monocytogenes in the animal and in the milk processing environment and the silage feeding practices. Isolation of L. monocytogenes was three to seven times more likely from farms where silage was fed to animals throughout the year than from farms where silage was not fed to the animals.
Restraining reactive oxygen species in Listeria monocytogenes promotes the apoptosis of glial cells.
Li, Sen; Li, Yixuan; Chen, Guowei; Zhang, Jingchen; Xu, Fei; Wu, Man
2017-07-01
Listeria monocytogenes is a facultative anaerobic foodborne pathogen that can traverse the blood-brain barrier and cause brain infection. L. monocytogenes infection induces host cell apoptosis in several cell types. In this study, we investigated the apoptosis of human glioma cell line U251 invaded by L. monocytogenes and evaluated the function of bacterial reactive oxygen species (ROS) during infection. Bacterial ROS level was reduced by carrying out treatment with N-acetyl cysteine (NAC) and diphenyleneiodonium chloride (DPI). After infection, the apoptosis of U251 cells was examined by flow cytometry assay and propidium iodide staining. DPI and NAC efficiently decreased ROS level in L. monocytogenes without affecting bacterial growth. Moreover, the apoptosis of glial cells was enhanced upon invasion of DPI- and NAC-pretreated L. monocytogenes. Results indicate that the apoptosis of glial cells can be induced by L. monocytogenes, and that the inhibition of bacterial ROS increases the apoptosis of host cells.
Primary Esophageal Motility Disorders: Beyond Achalasia.
Schlottmann, Francisco; Patti, Marco G
2017-06-30
The best-defined primary esophageal motor disorder is achalasia. However, symptoms such as dysphagia, regurgitation and chest pain can be caused by other esophageal motility disorders. The Chicago classification introduced new manometric parameters and better defined esophageal motility disorders. Motility disorders beyond achalasia with the current classification are: esophagogastric junction outflow obstruction, major disorders of peristalsis (distal esophageal spasm, hypercontractile esophagus, absent contractility) and minor disorders of peristalsis (ineffective esophageal motility, fragmented peristalsis). The aim of this study was to review the current diagnosis and management of esophageal motility disorders other than achalasia.
Directory of Open Access Journals (Sweden)
M.N. Indu
2006-06-01
Full Text Available Antibacterial activity of extracts of Allium sativum (garlic, Myristica fragrans (nutmeg, Zingiber officinale (ginger, Allium cepa (onion and Piper nigrum (pepper has been evaluated against 20 different serogroups of Escherichia coli, 8 serotypes of Salmonella, Listeria monocytogenes and Aeromonas hydrophila. Garlic extract showed excellent antibacterial activity against all the test organisms, except L. monocytogenes. Nutmeg showed good anti-listerial activity, although activity against E. coli and Salmonella were serotype dependent. Both garlic and nutmeg extracts were effective against A. hydrophila. Extracts of ginger showed inhibitory activity against two serogroups of E. coli: as O8 (enterotoxigenic E. coli and O88 only. Extracts of onion and pepper did not show any antibacterial activity against the test organisms.Avaliou-se a atividade antimicrobiana de extratos de alho (Allium sativum, noz-moscada (Mysritica frangrans, gengibre (Zingiber officinale cebola (Allium cepa e pimenta do reino (Piper nigrum sobre 20 sorotipos de Escherichia coli, 8 sorotipos de Salmonella, Listeria monocytogenes e Aeromonas hydrophila. O alho apresentou atividade antimicrobiana excelente sobre todos os microrganismos testados, excepto L. monocytogenes. A noz-moscada apresentou boa atividade antilisteria, emboara atividade sobre E. coli e Salmonella tenha sido sorotipo-dependente. Tanto alho como noz-moscada foram eficientes contra A. hydrophila. O extrato de gengibre apresentou atividade inibitória sobre dois sorotipos de E. coli: 08 (enterotoxigenico e 088. Os extratos de cebola e pimenta do reino não apresentaram nenhuma atividade contra os microrganismos testados.
Listeria monocytogenes internalizes in Romaine Lettuce grown in greenhouse conditions
Listeria monocytogenes has been implicated in a number of outbreaks involving fresh produce, including an outbreak in 2016 resulting from contaminated packaged salads. The persistence and internalization potential of L. monocytogenes in romaine lettuce was evaluated, and the persistence of two L. mo...
Growth inhibition of Listeria monocytogenes by a nonbacteriocinogenic Carnobacterium piscicola
DEFF Research Database (Denmark)
Nilsson, Lilian; Bech Hansen, T.; Garrido, P.
2005-01-01
Aims: This study elucidates the mechanisms by which a nonbacteriocinogenic Carnobacterium piscicola inhibits growth of Listeria monocytogenes. Methods and Results: Listeria monocytogenes was exposed to live cultures of a bacteriocin-negative variant of C. piscicola A9b in co-culture, in a diffusion...... chamber system, and to a cell-free supernatant. Suppression of maximum cell density (0-3.5 log units) of L. monocytogenes was proportional to initial levels of C. pisciola (10(3)-10(7) CFU ml(-1)). Cell-to-cell contact was not required to cause inhibition. The cell-free C. piscicola supernatant caused...... a decrease in L. monocytogenes maximum cell density, which was abolished by glucose addition but not by amino acid, vitamin or mineral addition. The fermentate also gave rise to a longer lag phase and a reduction in growth rate. These effects were independent of glucose and may have been caused by acetate...
Prevalence and serotypes of Listeria monocytogenes contamination in Chinese beef processing plants.
Zhu, Lixian; Feng, Xiaohui; Zhang, Lihua; Zhu, Ruiliang; Luo, Xin
2012-06-01
The aim of this work was to study the epidemiology of Listeria spp., particularly Listeria monocytogenes, and to identify the serotypes present in contaminated samples from beef processing plants in China. A total of 439 samples were obtained from bovine feces, hides, and carcasses at three commercial processing plants. A standard protocol (ISO 11290-1) was followed to detect Listeria spp. and L. monocytogenes, and multiplex polymerase chain reaction was used to identify the various L. monocytogenes serotypes. The overall prevalences of Listeria spp. and L. monocytogenes were 65.6% and 26.4%, respectively, and the contamination was highest in the hide samples. The identified L. monocytogenes serotypes were 1/2c and 1/2a. The results of the current study indicate that Listeria spp. contamination is common in Chinese beef processing plants; specific measures should be taken to prevent and/or treat L. monocytogenes contamination of feces and hides in beef slaughter plants. Furthermore, because Listeria spp. contamination was found to be prevalent, it should, therefore, be studied further. The prevention of cases of sporadic listeriosis in China should also be addressed.
Said, Al-Hasen; Reed, Michael L
2015-07-01
The purpose of this study was to quantitate changes in seminal volume, sperm count, motility, qualitative forward progression, and total motile sperm cells per ejaculate, across three consecutive ejaculates collected from individuals within 24 h preceding an IVF cycle. Men presenting with oligoasthenozoospermia or asthenozoospemia attempted three ejaculates within 24 h preceding IVF. Ejaculate 1 was produced the afternoon prior to oocyte retrieval, and ejaculates 2 and 3 were produced the morning of oocyte retrieval with 2-3 h between collections. Ejaculates 1 and 2 were extended 1:1 v/v with room temperature rTYBS. Test tubes were placed into a beaker of room temperature water, then placed at 4 °C for gradual cooling. Ejaculate 3 was not extended, but pooled with ejaculates 1 and 2 and processed for intracytoplasmic sperm injection (ICSI). Out of 109 oocyte retrievals, 28 men were asked to attempt multiple consecutive ejaculations. Among this population, 25/28 (89.3 %) were successful, and 3/28 men (10.7 %) could only produce two ejaculates. Mean volumes for ejaculates 1, 2, and 3 were significantly different from each other (p sperm counts, motility, qualitative forward progression, and total motile cells per ejaculate for the ejaculates1, 2, and 3 demonstrated the following: ejaculates 2 and 3 were not significantly different, but counts, motility, and total motile sperm were improved over ejaculate 1 (p sperm in this population by 8-fold compared to the first ejaculate alone, facilitating avoidance of sperm cryopreservation and additional centrifugation steps that could affect sperm viability and/or function.
Ottesen, Andrea; Ramachandran, Padmini; Reed, Elizabeth; White, James R; Hasan, Nur; Subramanian, Poorani; Ryan, Gina; Jarvis, Karen; Grim, Christopher; Daquiqan, Ninalynn; Hanes, Darcy; Allard, Marc; Colwell, Rita; Brown, Eric; Chen, Yi
2016-11-16
Microbiota that co-enrich during efforts to recover pathogens from foodborne outbreaks interfere with efficient detection and recovery. Here, dynamics of co-enriching microbiota during recovery of Listeria monocytogenes from naturally contaminated ice cream samples linked to an outbreak are described for three different initial enrichment formulations used by the Food and Drug Administration (FDA), the International Organization of Standardization (ISO), and the United States Department of Agriculture (USDA). Enrichment cultures were analyzed using DNA extraction and sequencing from samples taken every 4 h throughout 48 h of enrichment. Resphera Insight and CosmosID analysis tools were employed for high-resolution profiling of 16S rRNA amplicons and whole genome shotgun data, respectively. During enrichment, other bacterial taxa were identified, including Anoxybacillus, Geobacillus, Serratia, Pseudomonas, Erwinia, and Streptococcus spp. Surprisingly, incidence of L. monocytogenes was proportionally greater at hour 0 than when tested 4, 8, and 12 h later with all three enrichment schemes. The corresponding increase in Anoxybacillus and Geobacillus spp.indicated these taxa co-enriched in competition with L. monocytogenes during early enrichment hours. L. monocytogenes became dominant after 24 h in all three enrichments. DNA sequences obtained from shotgun metagenomic data of Listeria monocytogenes at 48 h were assembled to produce a consensus draft genome which appeared to have a similar tracking utility to pure culture isolates of L. monocytogenes. All three methods performed equally well for enrichment of Listeria monocytogenes. The observation of potential competitive exclusion of L. mono by Anoxybacillus and Geobacillus in early enrichment hours provided novel information that may be used to further optimize enrichment formulations. Application of Resphera Insight for high-resolution analysis of 16S amplicon sequences accurately identified L. monocytogenes
Survival strategies of Listeria monocytogenes - roles of regulators and transporters
Wemekamp-Kamphuis, H.H.
2003-01-01
Outbreaks of the food-borne pathogen Listeria monocytogenes are mainly associated with ready-to-eatfoods. Survival strategies of L. monocytogenes in relation to minimally processed foods were studied.
Yang, S E; Chou, C C
2000-07-01
Growth and survival of Escherichia coli O157:H7 and Listeria monocytogenes in steamed eggs and scrambled eggs held at different temperatures (5, 18, 22, 37, 55, and 60 degrees C) were investigated in the present study. Among the holding temperatures tested, both pathogens multiplied best at 37 degrees C followed by 22, 18, and 5 degrees C. In general, E. coli O157:H7 grew better in the egg products than L. monocytogenes did at all the storage temperatures tested except at 5 degrees C. E. coli O157:H7 did not grow in steamed eggs and scrambled eggs held at 5 degrees C. L. monocytogenes showed a slight population increase of approximately 0.6 to 0.9 log CFU/g in these egg products at the end of the 36-h storage period at 5 degrees C. The population of both pathogens detected in the egg products was affected by the initial population, holding temperature, and length of the holding period. It was also noted that L. monocytogenes was more susceptible than E. coli O157:H7 in steamed eggs held at 60 degrees C. After holding at 60 degrees C for 1 h, no detectable viable cells of L. monocytogenes with a population reduction of 5.4 log CFU/g was observed in steamed eggs, whereas a lower population reduction of only approximately 0.5 log CFU/ml was noted for E. coli O157:H7.
DEFF Research Database (Denmark)
Nørrung, Birgit
2000-01-01
This paper shortly summarizes data related to risk assessment of Listeria monocytogenes. From available data on risk assessment, it is concluded that the levels of L. monocytogenes consumed is an important factor affecting the incidence of listeriosis. Foods that do not support the growth of L....... monocytogenes are unlikely to be a source of listeriosis, whereas foods that support the growth to high levels, should be the target of risk management efforts. Based on current epidemiological information from several countries, a concentration of L. monocytogenes not exceeding 100/g of food at the time...... of L. monocytogenes in the food during prevailing storage and distribution conditions is needed....
Prevalence of Listeria monocytogenes in raw milk in North Lebanon
International Nuclear Information System (INIS)
Al Kassaa, I; El Omari, Kh.; Esmail, B.; Hamze, M; Saati, M.
2016-01-01
Listeriosis, although a zoonosis, is an invasive disease that can affect newborns, pregnant women and immunocompromised adults. Clinical manifestations can be expressedby febrile gastroenteritis, invasive forms including severe sepsis, meningitis, rhombencephalitis, prenatal infections and abortions. Species of Listeria bacteria are ubiquitous and adaptableto the environment in animal and plant foods. This study aimed to determine the prevalence of Listeria monocytogenes in 100 samples of fresh cow milk collected from different areas of North Lebanon. Listeria monocytogenes was detected by using the Grand VIDAS technique (Biomérieux France). The results obtained revealed the absence of Listeria monocytogenes inall analyzed samples. (Author)
Prebiotic Oligosaccharides Potentiate Host Protective Responses against L. Monocytogenes Infection
Directory of Open Access Journals (Sweden)
Poyin Chen
2017-12-01
Full Text Available Prebiotic oligosaccharides are used to modulate enteric pathogens and reduce pathogen shedding. The interactions with prebiotics that alter Listeria monocytogenes infection are not yet clearly delineated. L. monocytogenes cellular invasion requires a concerted manipulation of host epithelial cell membrane receptors to initiate internalization and infection often via receptor glycosylation. Bacterial interactions with host glycans are intimately involved in modulating cellular responses through signaling cascades at the membrane and in intracellular compartments. Characterizing the mechanisms underpinning these modulations is essential for predictive use of dietary prebiotics to diminish pathogen association. We demonstrated that human milk oligosaccharide (HMO pretreatment of colonic epithelial cells (Caco-2 led to a 50% decrease in Listeria association, while Biomos pretreatment increased host association by 150%. L. monocytogenes-induced gene expression changes due to oligosaccharide pretreatment revealed global alterations in host signaling pathways that resulted in differential subcellular localization of L. monocytogenes during early infection. Ultimately, HMO pretreatment led to bacterial clearance in Caco-2 cells via induction of the unfolded protein response and eIF2 signaling, while Biomos pretreatment resulted in the induction of host autophagy and L. monocytogenes vacuolar escape earlier in the infection progression. This study demonstrates the capacity of prebiotic oligosaccharides to minimize infection through induction of host-intrinsic protective responses.
Deciphering the landscape of host barriers to Listeria monocytogenes infection.
Zhang, Ting; Abel, Sören; Abel Zur Wiesch, Pia; Sasabe, Jumpei; Davis, Brigid M; Higgins, Darren E; Waldor, Matthew K
2017-06-13
Listeria monocytogenes is a common food-borne pathogen that can disseminate from the intestine and infect multiple organs. Here, we used sequence tag-based analysis of microbial populations (STAMP) to investigate L monocytogenes population dynamics during infection. We created a genetically barcoded library of murinized L monocytogenes and then used deep sequencing to track the pathogen's dissemination routes and quantify its founding population ( N b ) sizes in different organs. We found that the pathogen disseminates from the gastrointestinal tract to distal sites through multiple independent routes and that N b sizes vary greatly among tissues, indicative of diverse host barriers to infection. Unexpectedly, comparative analyses of sequence tags revealed that fecally excreted organisms are largely derived from the very small number of L. monocytogenes cells that colonize the gallbladder. Immune depletion studies suggest that distinct innate immune cells restrict the pathogen's capacity to establish replicative niches in the spleen and liver. Finally, studies in germ-free mice suggest that the microbiota plays a critical role in the development of the splenic, but not the hepatic, barriers that prevent L. monocytogenes from seeding these organs. Collectively, these observations illustrate the potency of the STAMP approach to decipher the impact of host factors on population dynamics of pathogens during infection.
Directory of Open Access Journals (Sweden)
Soghra Rabiey
2014-01-01
Full Text Available This study was conducted to evaluate the antibacterial effect of Carum copticum essential oil (Ajowan EO against Listeria monocytogenes in fish model system. Ajowan EO chemical composition was determined by gas chromatography/mass spectral analysis and the highest concentration of Carum copticum essential oil without any significant changes on sensory properties of kutum fish (Rutilus frisii kutum was assigned. Then the inhibitory effect of Ajowan EO at different concentrations in presence of salt and smoke component was tested on L. monocytogenes growth in fish peptone broth (FPB, kutum broth and cold smoked kutum broth at 4 ºC for 12 days. Ajowan EO completely decreased the number of L. monocytogenes in FPB after 12 days of storage, however, antimicrobial effect of EO significantly reduced in kutum and cold smoked kutum broth. Addition of 4% NaCl and smoke component improved the anti-listerial activity of Ajowan EO in all fish model broths.
Soni, Dharmendra Kumar; Singh, Durg Vijai; Dubey, Suresh Kumar
2015-09-01
Listeria monocytogenes, a life-threatening pathogen, poses severe risk during pregnancy, may cause abortion, fetal death or neonatal morbidity in terms of septicemia and meningitis. The present study aimed at characterizing L. monocytogenes isolated from pregnant women based on serotyping, antibiotic susceptibility, virulence genes, in vivo pathogenicity test and ERIC- and REP-PCR fingerprint analyses. The results revealed that out of 3700 human clinical samples, a total of 30 (0.81%) isolates [12 (0.80%) from placental bit (1500), 18 (0.81%) from vaginal swab (2200)] were positive for L. monocytogenes. All the isolates belonged to serogroup 4b, and were + ve for virulence genes tested i.e. inlA, inlC, inlJ, plcA, prfA, actA, hlyA, and iap. Based on the mice inoculation tests, 20 isolates showed 100% and 4 isolates 60% relative virulence while 6 isolates were non-pathogenic. Moreover, 2 and 10 isolates were resistant to ciprofloxacin and cefoxitin, respectively, while the rest susceptible to other antibiotics used in this study. ERIC- and REP-PCR collectively depicted that the isolates from placental bit and vaginal swab had distinct PCR fingerprints except a few isolates with identical patterns. This study demonstrates prevalence of pathogenic strains mostly resistant to cefoxitin and/or ciprofloxacin. The results indicate the importance of isolating and characterizing the pathogen from human clinical samples as the pre-requisite for accurate epidemiological investigations.
Yang, Hua; Kendall, Patricia A; Medeiros, Lydia; Sofos, John N
2009-06-01
Solutions of selected household products were tested for their effectiveness against Listeria monocytogenes, Escherichia coli O157:H7, and Salmonella Typhimurium. Hydrogen peroxide (1.5 and 3%), vinegar (2.5 and 5% acetic acid), baking soda (11, 33, and 50% sodium bicarbonate), household bleach (0.0314, 0.0933, and 0.670% sodium hypochlorite), 5% acetic acid (prepared from glacial acetic acid), and 5% citric acid solutions were tested against the three pathogens individually (five-strain composites of each, 10(8) CFU/ml) by using a modified AOAC International suspension test at initial temperatures of 25 and 55degrees C for 1 and 10 min. All bleach solutions (pH 8.36 to 10.14) produced a >5-log reduction of all pathogens tested after 1 min at 25 degrees C, whereas all baking soda solutions (pH 7.32 to 7.55) were ineffective (5-log reduction of both Salmonella Typhimurium and E. coli O157:H7, whereas undiluted vinegar (pH 2.58) had a similar effect only against Salmonella Typhimurium. Compared with 1 min at 25 degrees C, greater reductions of L. monocytogenes (P 3% hydrogen peroxide > undiluted vinegar and 5% acetic acid > 5% citric acid > baking soda (50% sodium bicarbonate). The sensitivity of the tested pathogens to all tested household compounds followed the sequence of Salmonella Typhimurium > E. coli O157: H7 > L. monocytogenes.
Listeria monocytogenes: diagnostic problems
Beumer, R.R.; Hazeleger, W.C.
2003-01-01
The first isolation methods for the detection of Listeria spp. were generally based on the direct culture of samples on simple agar media, but isolation of the pathogenic Listeria monocytogenes was difficult. In time, new techniques were developed, based on a variety of selective and elective agents
Rocha, Cláudia E; Mol, Juliana P S; Garcia, Luize N N; Costa, Luciana F; Santos, Renato L; Paixão, Tatiane A
2017-01-01
Listeria monocytogenes is a Gram-positive, facultative intracellular and invasive bacterium that has tropism to the placenta, and causes fetal morbidity and mortality in several mammalian species. While infection with L. monocytogenes and L. ivanovii are known as important causes of abortion and reproductive failure in cattle, the pathogenesis of maternal-fetal listeriosis in this species is poorly known. This study used the bovine chorioallantoic membrane explant model to investigate the kinetics of L. monocytogenes, L. ivanovii, and L. innocua infections in bovine trophoblastic cells for up to 8 h post infection. L. monocytogenes and L. ivanovii were able to invade and multiply in trophoblastic cells without causing cell death or inducing expression of pro-inflammatory genes. Although L. innocua was unable to multiply in bovine trophoblastic cells, it induced transcription of the pro-inflammatory mediator CXCL6. This study demonstrated for the first time the susceptibility of bovine trophoblastic cells to L. monocytogenes and L. ivanovii infection.
Motility versus fluctuations in mixtures of self-motile and passive agents.
Hinz, Denis F; Panchenko, Alexander; Kim, Tae-Yeon; Fried, Eliot
2014-12-07
Many biological systems consist of self-motile and passive agents both of which contribute to overall functionality. However, little is known about the properties of such mixtures. Here we formulate a model for mixtures of self-motile and passive agents and show that the model gives rise to three different dynamical phases: a disordered mesoturbulent phase, a polar flocking phase, and a vortical phase characterized by large-scale counter rotating vortices. We use numerical simulations to construct a phase diagram and compare the statistical properties of the different phases with observed features of self-motile bacterial suspensions. Our findings afford specific insights regarding the interaction of microorganisms and passive particles and provide novel strategic guidance for efficient technological realizations of artificial active matter.
Olaimat, Amin N; Holley, Richard A
2016-08-01
Ready-to-eat meats are considered foods at high risk to cause life-threatening Listeria monocytogenes infections. This study screened 5 L. monocytogenes strains for their ability to hydrolyze sinigrin (a glucosinolate in Oriental mustard), which formed allyl isothiocyanate (AITC) and reduced L. monocytogenes viability on inoculated vacuum-packed, cooked, cured roast chicken slices at 4 °C. Tests involved incorporation of 25-50 μl/g AITC directly or 100-250 mg/g Oriental mustard extract in 0.5% (w/v) κ-carrageenan/2% (w/v) chitosan-based coatings prepared using 1.5% malic or acetic acid. L. monocytogenes strains hydrolyzed 33.6%-48.4% pure sinigrin in MH broth by 21 d at 25 °C. Acidified κ-carrageenan/chitosan coatings containing 25-50 μl/g AITC or 100-250 mg/g mustard reduced the viability of L. monocytogenes and aerobic bacteria on cooked, cured roast chicken slices by 4.1 to >7.0 log10 CFU/g compared to uncoated chicken stored at 4 °C for 70 d. Coatings containing malic acid were significantly more antimicrobial than those with acetic acid. During storage for 70 d, acidified κ-carrageenan/chitosan coatings containing 25-50 μl/g AITC or 250 mg/g mustard extract reduced lactic acid bacteria (LAB) numbers 3.8 to 5.4 log10 CFU/g on chicken slices compared to uncoated samples. Acidified κ-carrageenan/chitosan-based coatings containing either AITC or Oriental mustard extract at the concentrations tested had the ability to control L. monocytogenes viability and delay growth of potential spoilage bacteria on refrigerated, vacuum-packed cured roast chicken. Copyright © 2016. Published by Elsevier Ltd.
Incidence and control of Listeria monocytogenes in foods in Denmark
DEFF Research Database (Denmark)
Nørrung, Birgit; Andersen, Jens Kirk; Schlundt, Jørgen
1999-01-01
The Danish regulatory policy on Listeria monocytogenes in foods is based on the principles of HACCP and was developed using a health risk assessment approach. The Danish policy focuses examinations and criteria for L. monocytogenes in ready-to-eat foods and is based on a combination of inspection...
Spontaneous Loss of Virulence in Natural Populations of Listeria monocytogenes.
Maury, Mylène M; Chenal-Francisque, Viviane; Bracq-Dieye, Hélène; Han, Lei; Leclercq, Alexandre; Vales, Guillaume; Moura, Alexandra; Gouin, Edith; Scortti, Mariela; Disson, Olivier; Vázquez-Boland, José A; Lecuit, Marc
2017-11-01
The pathogenesis of Listeria monocytogenes depends on the ability of this bacterium to escape from the phagosome of the host cells via the action of the pore-forming toxin listeriolysin O (LLO). Expression of the LLO-encoding gene ( hly ) requires the transcriptional activator PrfA, and both hly and prfA genes are essential for L. monocytogenes virulence. Here, we used the hemolytic activity of LLO as a phenotypic marker to screen for spontaneous virulence-attenuating mutations in L. monocytogenes Sixty nonhemolytic isolates were identified among a collection of 57,820 confirmed L. monocytogenes strains isolated from a variety of sources (0.1%). In most cases (56/60; 93.3%), the nonhemolytic phenotype resulted from nonsense, missense, or frameshift mutations in prfA Five strains carried hly mutations leading to a single amino acid substitution (G299V) or a premature stop codon causing strong virulence attenuation in mice. In one strain, both hly and gshF (encoding a glutathione synthase required for full PrfA activity) were missing due to genomic rearrangements likely caused by a transposable element. The PrfA/LLO loss-of-function (PrfA - /LLO - ) mutants belonged to phylogenetically diverse clades of L. monocytogenes , and most were identified among nonclinical strains (57/60). Consistent with the rare occurrence of loss-of-virulence mutations, we show that prfA and hly are under purifying selection. Although occurring at a low frequency, PrfA - /LLO - mutational events in L. monocytogenes lead to niche restriction and open an evolutionary path for obligate saprophytism in this facultative intracellular pathogen. Copyright © 2017 Maury et al.
Efficacy of chlorine dioxide against Listeria monocytogenes in brine chilling solutions.
Valderrama, W B; Mills, E W; Cutter, C N
2009-11-01
Chilled brine solutions are used by the food industry to rapidly cool ready-to-eat meat products after cooking and before packaging. Chlorine dioxide (ClO(2)) was investigated as an antimicrobial additive to eliminate Listeria monocytogenes. Several experiments were performed using brine solutions made of sodium chloride (NaCl) and calcium chloride (CaCl(2)) inoculated with L. monocytogenes and/or treated with 3 ppm of ClO(2). First, 10 and 20% CaCl(2) and NaCl solutions (pH 7.0) were inoculated with a five-strain cocktail of L. monocytogenes to obtain approximately 7 log CFU/ml and incubated 8 h at 0 degrees C. The results demonstrated that L. monocytogenes survived in 10% CaCl(2), 10 and 20% NaCl, and pure water. L. monocytogenes levels were reduced approximately 1.2 log CFU/ml in 20% CaCl(2). Second, inoculated ( approximately 7 log CFU/ml) brine solutions (10 and 20% NaCl and 10% CaCl(2)) treated with 3 ppm of ClO(2) resulted in a approximately 4-log reduction of the pathogen within 90 s. The same was not observed in a solution of 20% CaCl(2); further investigation demonstrated that high levels of divalent cations interfere with the disinfectant. Spent brine solutions from hot dog and ham chilling were treated with ClO(2) at concentrations of 3 or 30 ppm. At these concentrations, ClO(2) did not reduce L. monocytogenes. Removal of divalent cations and organic material in brine solutions prior to disinfection with ClO(2) should be investigated to improve the efficacy of the compound against L. monocytogenes. The information from this study may be useful to processing establishments and researchers who are investigating antimicrobials in chilling brine solutions.
Review of Prosthetic Joint Infection from Listeria monocytogenes.
Bader, Gilbert; Al-Tarawneh, Mohammed; Myers, James
2016-12-01
Prosthetic joint infection from Listeria monocytogenes is rare. We decided to shed light on this illness and review the reported cases to better understand its characteristics. We conducted a comprehensive review of the English literature using PubMed. We also included one case that we had managed. We found 25 cases of prosthetic joint infection from L. monocytogenes reported individually and a retrospective study of 43 cases of joint and bone listerial infection, including 34 with prosthetic joint infection, conducted in France. We have described their clinical and para-clinical features and tried to elaborate on the pathophysiology, treatment, and prevention. Prosthetic joint infection from L. monocytogenes is mainly late. Systemic inflammation may be absent. Although rare, it must be suspected in patients at high risk for both prosthetic joint and listerial infections. In addition, those patients must be instructed on appropriate preventive measures.
Animal models for oral transmission of Listeria monocytogenes
Directory of Open Access Journals (Sweden)
Sarah E F D'Orazio
2014-02-01
Full Text Available Listeria monocytogenes has been recognized as a food borne pathogen in humans since the 1980s, but we still understand very little about oral transmission of L. monocytogenes or the host factors that determine susceptibility to gastrointestinal infection, due to the lack of an appropriate small animal model of oral listeriosis. Early feeding trials suggested that many animals were highly resistant to oral infection, and the more reproducible intravenous or intraperitoneal routes of inoculation soon came to be favored. There are a fair number of previously published studies using an oral infection route, but the work varies widely in terms of bacterial strain choice, the methods used for oral transmission, and various manipulations used to enhance infectivity. This mini review will summarize the published literature using oral routes of L. monocytogenes infection and will highlight recent technological advances that have made oral infection a more attractive model system.
Weyker, Robert E; Glass, Kathleen A; Milkowski, Andrew L; Seman, Dennis L; Sindelar, Jeffrey J
2016-03-01
Interest in natural/organic meat products has resulted in the need to validate the effectiveness of clean label antimicrobials to increase safety and shelf life of these products. A Response Surface Methodology (RSM) was used to investigate the effects of varying levels of moisture, pH, and a commercial "clean-label" antimicrobial (cultured sugar-vinegar blend; CSVB) on the growth rate of Listeria monocytogenes and Leuconostoc mesenteroides in uncured turkey stored at 4 °C for 16 wk. Twenty treatment combinations of moisture (60% to 80%), pH (5.8 to 6.4), and CSVB (2.5% to 5.0%) were evaluated during phase I to develop growth curves for both microbe types, whereas the interactive effects of pH (5.8 to 6.4) and CSVB (0.0 to 4.75) were tested in 16 treatment combinations during Phase II at a single moisture level using L. monocytogenes only. CSVB inhibited L. monocytogenes growth in 14 of the 20 treatments tested in Phase I and in 12 of the 16 treatments in Phase II through 16 and 8 wk, respectively. In contrast, CSVB had little effect on L. mesenteroides, with growth inhibited in only 4 of 20 treatments in Phase I and was therefore not tested further in Phase II. Significant interactions of the RSM design coefficients yielded a predictive model for L. mesenteroides growth rate, but due to lack of growth, no growth rate model was developed for L. monocytogenes. CSVB was found to be an effective antilisteral antimicrobial, while having little effect on a spoilage microorganism. © 2016 Institute of Food Technologists®
Directory of Open Access Journals (Sweden)
Anzabi Younes
2015-10-01
Full Text Available Objective: One control method of pathogenic microorganisms is using synthetic chemical preservatives and antibiotics. Because of being generally recognized as safe, antibacterial compounds with organic origin are considered important for health. This study was done in order to investigate the antibacterial effects of methanol extracts of the Berberis vulgaris (Barberry, Actinidia deliciosa (Kiwi and Allium cepa L. (Onions on the standard strain (ATCC:19114 of Listeria monocytogenes (L. monocytogenes, as it seems that it is possible to find some important organic and health safe anti-Listerial compounds. Materials and Methods: After collecting the mentioned plants phytology study was done. Then methanol extracts of named plants were prepared and antibacterial effects of these plants against the mentioned strain of L. monocytogenes by the Disk Diffusion, minimum inhibitory concentration (MIC and minimal bactericidal concentration (MBC methods were performed. Also Ampicillin (10 μg/disc was used as the reference antibacterial substance. In order to find the relationship between antibacterial properties of plants extracts independent t test, chi-square and analysis of variance (ANOVA tests were used. Results: Results showed that the extracts of all the three studied plants had antibacterial effects on L. monocytogenes. Average diagonal of growing area in disk diffusion test for barberry, kiwi and onions in order was 12, 15.5 and 11 mm. Also MIC of mentioned plants extracts in order was 125, 62.5, and 125 μg/ml and MBC of named plants was 500, 250 and 500 μg/ ml, respectively. Conclusion: The results of this work showed that methanol extracts of kiwi had stronger anti-Listerial effect than barberry’s and onion’s extracts.
ASSESSMENT OF ACTION OF DISINFECTANTS AGAINST LISTERIA MONOCYTOGENES BIOFILMS
Directory of Open Access Journals (Sweden)
T. K. CABEÇA
2008-12-01
Full Text Available
The purpose of this study was to assess the action of various disinfectants used in food industry against biofilm cells of Listeria monocytogenes formed on stainless steel surfaces during 24, 72 and 120 hours. Numbers of viable biofilm cells decreased after treatment with all the tested disinfectants (iodine, biguanide, quaternary ammonium compounds, peracetic acid and sodium hypochlorite. Sodium hypochlorite was the most effective disinfectant against the biofilm cells, while biguanide and iodine were the least. Scanning electron microscopy observations demonstrated attached cells on stainless steel surfaces after treatment with all the disinfectants. These observations showed that microorganisms were not completely removed from stainless steel surfaces after treatment with the disinfectants, however, the attachment did not means the viability of remaining cells. The biofilm age in hours (24, 72 and 120 had no apparent influence on resistance of microbiological cells to the disinfectants under study. In conclusion biofilm cells of L. monocytogenes can withstand disinfectants action.
Tolvanen, Riina; Lundén, Janne; Hörman, Ari; Korkeala, Hannu
2009-02-01
Ultrasonic cleaning of a conveyor belt was studied by building a pilot-scale conveyor with an ultrasonic cleaning bath. A piece of the stainless steel conveyor belt was contaminated with meat-based soil and Listeria monocytogenes strains (V1, V3, and B9) and incubated for 72 h to allow bacteria to attach to the conveyor belt surfaces. The effect of ultrasound with a potassium hydroxide-based cleaning detergent was determined by using the cleaning bath at 45 and 50 degrees C for 30 s with and without ultrasound. The detachment of L. monocytogenes from the conveyor belt caused by the ultrasonic treatment was significantly greater at 45 degrees C (independent samples t test, P conveyor belt is effective even with short treatment times.
Sakaridis, Ioannis; Ganopoulos, Ioannis; Madesis, Panagiotis; Tsaftaris, Athanasios; Argiriou, Anagnostis
2014-01-02
An outbreak situation of human listeriosis requires a fast and accurate protocol for typing Listeria monocytogenes . Existing techniques are either characterized by low discriminatory power or are laborious and require several days to give a final result. Polymerase chain reaction (PCR) coupled with high resolution melting (HRM) analysis was investigated in this study as an alternative tool for a rapid and precise genotyping of L. monocytogenes isolates. Fifty-five isolates of L. monocytogenes isolated from poultry carcasses and the environment of four slaughterhouses were typed by HRM analysis using two specific markers, internalin B and ssrA genes. The analysis of genotype confidence percentage of L. monocytogenes isolates produced by HRM analysis generated dendrograms with two major groups and several subgroups. Furthermore, the analysis of the HRM curves revealed that all L. monocytogenes isolates could easily be distinguished. In conclusion, HRM was proven to be a fast and powerful tool for genotyping isolates of L. monocytogenes .
Prevalence of Listeria monocytogenes in poultry production in France.
Chemaly, Marianne; Toquin, Marie-Therese; Le Nôtre, Yolene; Fravalo, Philippe
2008-10-01
This study aimed to update and create a data set from laying hens and broilers regarding contamination by Listeria monocytogenes. Two hundred laying-hen flocks were sampled, with 88 flocks reared in cages and 112 reared on the floor. One hundred forty-five broiler flocks were sampled, with 85 conventional and 60 free-range flocks. A total of 774 and 725 samples were analyzed from laying hens and broilers, respectively. L. monocytogenes was detected in 31 of 200 flocks, yielding an estimated prevalence of 15.5% in laying-hen flocks. Among positive flocks, there appeared a significant (P = 0.004) difference between caged and floor-reared hens, with a higher detection in dust samples from floor-reared hens. In positive caged hen flocks, significant (P = 0.028) differences between dust and fecal samples appeared, with a higher detection in feces than in dust samples. In broiler flocks, L. monocytogenes was isolated in 46 of 145 flocks, yielding an estimated prevalence of 32% (28% in conventional flocks versus 37% in the free-range flocks). L. monocytogenes was isolated in samples taken from conventional flocks with a lower frequency than in free-range flocks (13 versus 18%, respectively). The serotyping of L. monocytogenes strains showed that the majority belonged to type 1/2a in laying-hen flocks (74.3%) and in broiler flocks (40.5%). A significant difference (P = 0.007) between laying hens and broilers was shown for serogroup 4 and for serovar 1/2b (P = 0.007); these serogroups were more prevalent in broilers (40%) than in laying hens (5.7%).
SABIL, SYAHRIANA
2015-01-01
2015 SYAHRIANA SABIL (I 111 11 273). Pasteurisasi High Temperature Short Time (HTST) Susu terhadap Listeria monocytogenes pada Penyimpanan Refrigerator. Dibimbing oleh RATMAWATI MALAKA dan FARIDA NUR YULIATI. Pasteurisasi High Temperature Short Time (HTST) merupakan proses pemanasan susu di bawah titik didih yang diharapkan dapat membunuh Listeria monocytogenes (L. monocytogenes) karena bersifat patogen dan mengakibatkan listeriosis yang merupakan penyakit zoonosis. Tu...
Hodžić, Snjezana; Hukić, Mirsada; Franciosa, Giovanna; Aureli, Paolo
2011-09-01
Listeria monocytogenes is often present in meat and meat products that are sold in the area of northeast Bosnia and Herzegovina. The major objective of this study was to examine the virulence of L. monocytogenes strains isolated from these types of food in that geographic area. Polymerase chain reaction was used to detect eight genes responsible for virulence of this pathogen, namely, prfA, inlA, inlB, hly, plcA, plcB, actA, and mpl. All examined isolates were confirmed to possess the eight virulence genes. Ten different pulsed-field gel electrophoresis (PFGE) macrorestriction profiles were recognized among 19 L. monocytogenes strains after restriction with two different endonucleases (ApaI and AscI). The pathogenicity of three different PFGE types of L. monocytogenes was confirmed through in vivo tests, which were performed on female white mice (Pasteur strain), and it ranged from 3.55 × 10(8) LD50 to 1.58 × 10(10) LD50. All of the three different PFGE types of L. monocytogenes were regarded as moderately virulent in relation to the reference strain L. monocytogenes Scott A. This result might be one of the reasons for the absence of reported listeriosis in northeast Bosnia and Herzegovina, despite the high degree of food contamination with this pathogen.
An outbreak of febrile gastroenteritis associated with corn contaminated by Listeria monocytogenes.
Aureli, P; Fiorucci, G C; Caroli, D; Marchiaro, G; Novara, O; Leone, L; Salmaso, S
2000-04-27
On May 21, 1997, numerous cases of febrile gastrointestinal illness were reported among the students and staff of two primary schools in northern Italy, all of whom had eaten at cafeterias served by the same caterer. We interviewed people who ate at the cafeterias about symptoms and foods consumed on May 20. There were no samples of foods left at the cafeterias, but we tested routine samples taken on May 20 by the caterer and environmental specimens at the catering plant. The hospitalized patients were tested for common enteropathogens and toxins. Of the 2189 persons interviewed (82 percent of those exposed), 1566 (72 percent) reported symptoms; of these, 292 (19 percent) were hospitalized. Among samples obtained from hospitalized patients, all but two of the stool specimens and all blood specimens were negative for common enteropathogens. Listeria monocytogenes was isolated from one blood specimen and from 123 of the 141 stool specimens. Consumption of a cold salad of corn and tuna was associated with the development of symptoms (relative risk, 6.19; 95 percent confidence interval, 4.81 to 7.98; Pcaterer's sample of the salad and from environmental specimens collected from the catering plant. All listeria isolates were serotype 4b and were found to be identical on DNA analysis. Experimental contamination of sterile samples of the implicated foods showed that L. monocytogenes grew on corn when kept for at least 10 hours at 25 degrees C. Food-borne infection with L. monocytogenes can cause febrile illness with gastroenteritis in immunocompetent persons.
Pasqualotto, Eleonora B.; Daitch, James A.; Hendin, Benjamin N.; Falcone, Tommaso; Thomas, Anthony J.; Nelson, David R.; Agarwal, Ashok
1999-01-01
Purpose:This study sought (i) to investigate the relationship between postwash total motile sperm count and postwash percentage motile sperm in predicting successful intrauterine insemination and (ii) to determine the minimal postwash total motile sperm count required to achieve pregnancy with intrauterine insemination.
Novel Cadmium Resistance Determinant in Listeria monocytogenes.
Parsons, Cameron; Lee, Sangmi; Jayeola, Victor; Kathariou, Sophia
2017-03-01
Listeria monocytogenes is a foodborne pathogen that can cause severe disease (listeriosis) in susceptible individuals. It is ubiquitous in the environment and often exhibits resistance to heavy metals. One of the determinants that enables Listeria to tolerate exposure to cadmium is the cadAC efflux system, with CadA being a P-type ATPase. Three different cadA genes (designated cadA1 to cadA3 ) were previously characterized in L. monocytogenes A novel putative cadmium resistance gene ( cadA4 ) was recently identified through whole-genome sequencing, but experimental confirmation for its involvement in cadmium resistance is lacking. In this study, we characterized cadA4 in L. monocytogenes strain F8027, a cadmium-resistant strain of serotype 4b. By screening a mariner-based transposon library of this strain, we identified a mutant with reduced tolerance to cadmium and that harbored a single transposon insertion in cadA4 The tolerance to cadmium was restored by genetic complementation with the cadmium resistance cassette ( cadA4C ), and enhanced cadmium tolerance was conferred to two unrelated cadmium-sensitive strains via heterologous complementation with cadA4C Cadmium exposure induced cadA4 expression, even at noninhibitory levels. Virulence assessments in the Galleria mellonella model suggested that a functional cadA4 suppressed virulence, potentially promoting commensal colonization of the insect larvae. Biofilm assays suggested that cadA4 inactivation reduced biofilm formation. These data not only confirm cadA4 as a novel cadmium resistance determinant in L. monocytogenes but also provide evidence for roles in virulence and biofilm formation. IMPORTANCE Listeria monocytogenes is an intracellular foodborne pathogen causing the disease listeriosis, which is responsible for numerous hospitalizations and deaths every year. Among the adaptations that enable the survival of Listeria in the environment are the abilities to persist in biofilms, grow in the cold, and
Naik, Milind Mohan; Bhangui, Purva; Bhat, Chinmay
2017-12-01
Listeria monocytogenes are Gram-positive well-known emerging food-borne pathogens causing listeriosis in humans. In the present study, we have isolated biofilm-forming Listeria sp. from utensils used by a local milk collection dairy society at Usgao Goa, which collects milk for Goa dairy. Through biochemical tests and 16S rRNA sequence analysis, the bacterium was confirmed to be L. monocytogenes and designated as strain BN3, having GenBank accession number MF095110. We report for the first time Gram-positive L. monocytogenes strain BN3 producing iron-chelating siderophores by chrome azurol S (CAS) agar test. Also, this is a first report which reveals that L. monocytogenes strain BN3 responds to N-hexanoyl-homoserine lactone molecule (C 6 -HSL) by gradual increase in their biofilm-forming potential with a gradual increase in AHL (C 6 -HSL) concentration (250, 500 nM-1 μM) as compared to control revealed by crystal violet assay (CV) in microtiter plate. These results were further confirmed by scanning electron microscopy (SEM). A significant decrease in biofilm formation was observed when L. monocytogenes strain BN3 was treated with 10 µg/ml (R)-2-(2-hydroxynaphthalen-1-yl)thiazolidine-4-carboxylic acid, but when 250 and 500 nM AHL molecules were added, biofilm formation in strain BN3 was found to be enhanced as compared to control even in the presence of antibacterial compound, (R)-2-(2-hydroxynaphthalen-1-yl)thiazolidine-4-carboxylic acid. These results revealed that AHL molecules nullify the effect of antimicrobial compound and promote biofilm formation in L. monocytogenes strain BN3.
Dreux, N; Albagnac, C; Federighi, M; Carlin, F; Morris, C E; Nguyen-the, C
2007-10-01
To investigate the presence of viable but non-culturable Listeria monocytogenes during survival on parsley leaves under low relative humidity (RH) and to evaluate the ability of L. monocytogenes to recover from VBNC to culturable state under satured humidity. Under low RH (47-69%) on parsley leaves, the initial number of L. monocytogenes populations counted on non selective media (10(9) L. monocytogenes per leaf on TSA) was reduced by 6 log10 scales in 15 days, whereas number of viable L. monocytogenes counted under the microscope was reduced by 3-4 log10 scales, indicating the presence of VBNC cells. This was demonstrated on three L. monocytogenes strains (EGDe, Bug 1995 and LmP60). Changing from low to 100% RH permitted an increase of the culturable counts of L. monocytogenes and this growth was observed only when residual culturable cells were present. Moreover, VBNC L. monocytogenes inoculated on parsley leaves did not become culturable after incubation under 100% RH. Dry conditions induced VBNC L. monocytogenes on parsley leaves but these VBNC were likely unable to recover culturability after transfer to satured humidity. Enumeration on culture media presumably under-estimates the number of viable L. monocytogenes on fresh produce after exposure to low RH.
Age-Dependent Differences in Systemic and Cell-Autonomous Immunity to L. monocytogenes
Directory of Open Access Journals (Sweden)
Ashley M. Sherrid
2013-01-01
Full Text Available Host defense against infection can broadly be categorized into systemic immunity and cell-autonomous immunity. Systemic immunity is crucial for all multicellular organisms, increasing in importance with increasing cellular complexity of the host. The systemic immune response to Listeria monocytogenes has been studied extensively in murine models; however, the clinical applicability of these findings to the human newborn remains incompletely understood. Furthermore, the ability to control infection at the level of an individual cell, known as “cell-autonomous immunity,” appears most relevant following infection with L. monocytogenes; as the main target, the monocyte is centrally important to innate as well as adaptive systemic immunity to listeriosis. We thus suggest that the overall increased risk to suffer and die from L. monocytogenes infection in the newborn period is a direct consequence of age-dependent differences in cell-autonomous immunity of the monocyte to L. monocytogenes. We here review what is known about age-dependent differences in systemic innate and adaptive as well as cell-autonomous immunity to infection with Listeria monocytogenes.
A novel suicide plasmid for efficient gene mutation in Listeria monocytogenes
Although several plasmids have been used in Listeria monocytogenes for generating mutants by allelic exchange, construction of L. monocytogenes mutants has been inefficient due to lack of effective selection markers for first and second recombination events. To address this problem, we have develope...
Directory of Open Access Journals (Sweden)
Regiane Priscilla Ratti
2010-12-01
Full Text Available Listeria monocytogenes is a foodborne pathogen which may survive in biofilms and persist in food processing plants. In this study, the ability of Leuconostoc mesenteroides (bac+ and bac- to inhibit biofilm formation by L. monocytogenes ATCC 19115 was studied with stainless steel coupons immersed in BHI broth and BHI broth plus sucrose in combination with the Lactic Acid Bacteria (LAB. Adhered cells were collected with swabs and enumerated on selective agars (Oxford for listeria and MRS for leuconostoc. Leuconostoc mesenteroides bac+ in co-culture with L. monocytogenes was effective to inhibit biofilm formation by listeria for up to 3 hours of incubation, but at 24 hours, biofilm was present in all conditions tested, as confirmed by observations of stainless steel coupons under Scanning Electron Microscopy (SEM. It was also observed that in the presence of L. mesenteroides bac+ in BHI plus sucrose, a high number of elongated cells of L. monocytogenes was present, which may indicate an adaptation response of the pathogen to stress conditions with important implications for food safety.
DEFF Research Database (Denmark)
Bernbom, Nete; Licht, Tine Rask; Saadbye, Peter
2006-01-01
The ability of the pediocin AcH producing Lactobacillus plantarum DDEN 11007 and its non-producing plasmid-cured isogenic variant, DDEN 12305 to prevent the persistence and growth of Listeria monocytogenes EP2 in two gastrointestinal (GI) tract models was examined. In vitro studies conducted...... in a two-stage continuous flow system showed that L. plantarum DDEN 11007 inhibited L. monocytogenes EP2 under these conditions, while less effect was seen of the non-bacteriocin producing variant. The inhibitory effect was more pronounced at pH 5 than at pH 7. No effect on persistence of L. monocytogenes...... in the GI tract was seen in gnotobiotic rats colonized with either the pediocin AcH producing or the non-bacteriocin producing variant of L. plantarum when compared to rats inoculated with L. monocytogenes EP2 alone. Surprisingly, inoculation of the gnotobiotic animals with either of the L. plantarum...
Effect of eugenol on growth and listeriolysin o production by Listeria monocytogenes
Directory of Open Access Journals (Sweden)
Cristina Tostes Filgueiras
2006-05-01
Full Text Available The inhibitory effect of eugenol, a naturally occurring compound mainly present in the essential oil fraction of cloves, was studied on the growth and listeriolysin O (LLO production by Listeria monocytogenes. Potassium efflux from cells promoted by eugenol was also determined after 24 h incubation in phosphate buffered saline. Eugenol promoted a delay on the growth of L. monocytogenes at concentrations of 100, 300 and 500 µg mL-1and above 800 µg mL-1 the effect was bactericidal. Production of LLO by L. monocytogenes in the presence of eugenol was reduced 80-100%. An accumulation of external K+ was observed above 300 µg mL-1 of eugenol which indicated that the cell membrane was affected. The results showed the effectiveness of eugenol in controlling growth and LLO production of L. monocytogenes cells.O efeito inibitório do eugenol, o principal constituinte do óleo essencial de cravo, foi avaliado sobre o crescimento e produção de listeriolisina O (LLO por Listeria monocytogenes. O efluxo de íons potássio das células também foi determinado após 24 h de incubação em solução tampão, contendo eugenol. Concentrações de 100, 300 e 500 µg mL-1 de eugenol promoveram a inibição do crescimento de L. monocytogenes e, em concentrações acima de 800 µg mL-1, constatou-se um efeito bactericida. O crescimento de L. monocytogenes na presença de eugenol resultou na inibição de 80 a 100% da produção de LLO. O efluxo de K+ promovido pelo eugenol indicou que a membrana celular foi afetada. Estes resultados indicam a efetividade do eugenol para o controle do crescimento e da produção de LLO por L. monocytogenes.
Chen, Bang-Yuan; Pyla, Rajkumar; Kim, Tae-Jo; Silva, Juan L; Jung, Yean-Sung
2010-08-01
Catfish skins, intestines, fresh fillets, processing surfaces at different production stages, chiller water and non-food contact surfaces were sampled for Listeria monocytogenes and other Listeria species. Among 315 samples, prevalence of L. monocytogenes, Listeria innocua and a group of Listeria seeligeri-Listeria welshimeri-Listeria ivanovii was 21.6, 13.0 and 29.5%, respectively. No Listeria grayi was detected in this survey. While no L. monocytogenes strains were isolated from catfish skins and intestines, the strains were found with a frequency of 76.7% in chilled fresh catfish fillets and 43.3% in unchilled fillets. L. monocytogenes and Listeria spp. were also detected in fish contact surfaces such as deheading machine, trimming board, chiller water, conveyor belts at different stages, and fillet weighing table. Among L. monocytogenes, 1/2b (47.0%), 3b (16.0%) and 4c (14%) were the predominant serotypes isolated, whereas 4b, 4e, 1/2c and 1/2a were detected at much lower frequencies. Genotype analyses of L. monocytogenes isolates using serotyping, pulsed-field gel electrophoresis (PFGE) and enterobacterial repetitive intergenic consensus (ERIC)-PCR revealed that chiller water represented an important contamination source of L. monocytogenes in the chilled catfish fillets of two processing facilities, whereas fillet weighing table significantly contributed to the catfish fillet contamination of the third facility. This study suggests that L. monocytogenes contamination in the processed catfish fillets originates from the processing environment, rather than directly from catfish. Results from this study can aid the catfish industry to develop a plant-specific proper cleaning and sanitation procedure for equipment and the processing environment designed to specifically target L. monocytogenes contamination. Copyright 2010 Elsevier Ltd. All rights reserved.
Di Ciccio, Pierluigi; Meloni, Domenico; Festino, Anna Rita; Conter, Mauro; Zanardi, Emanuela; Ghidini, Sergio; Vergara, Alberto; Mazzette, Rina; Ianieri, Adriana
2012-08-01
The aim of the present study was to investigate the sources of Listeria monocytogenes contamination in a cold smoked salmon processing environment over a period of six years (2003-2008). A total of 170 samples of raw material, semi-processed, final product and processing surfaces at different production stages were tested for the presence of L. monocytogenes. The L. monocytogenes isolates were characterized by multiplex PCR for the analysis of virulence factors and for serogrouping. The routes of contamination over the six year period were traced by PFGE. L. monocytogenes was isolated from 24% of the raw salmon samples, 14% of the semi-processed products and 12% of the final products. Among the environmental samples, 16% were positive for L. monocytogenes. Serotyping yielded three serovars: 1/2a, 1/2b, 4b, with the majority belonging to serovars 1/2a (46%) and 1/2b (39%). PFGE yielded 14 profiles: two of them were repeatedly isolated in 2005-2006 and in 2007-2008 mainly from the processing environment and final products but also from raw materials. The results of this longitudinal study highlighted that contamination of smoked salmon occurs mainly during processing rather than originating from raw materials, even if raw fish can be a contamination source of the working environment. Molecular subtyping is critical for the identification of the contamination routes of L. monocytogenes and its niches into the production plant when control strategies must be implemented with the aim to reduce its prevalence during manufacturing. Copyright © 2012 Elsevier B.V. All rights reserved.
Efficacy of ultraviolet light exposure against survival of Listeria monocytogenes on conveyor belts.
Morey, Amit; McKee, Shelly R; Dickson, James S; Singh, Manpreet
2010-06-01
Listeria monocytogenes has been repeatedly isolated from foods and food-processing facilities including food contact surfaces such as conveyor belts (CB). CBs are often difficult to clean and require rigorous sanitation programs for decontamination. Ultraviolet (UV) light has exhibited microbicidal properties on food contact surfaces and this study was conducted to determine the efficacy of UV against L. monocytogenes on CB made of different materials. A four-strain cocktail of L. monocytogenes (serotypes 3A, 4A, 4B, and 4C) was made to give a suspension of approximately 10(7) CFU/mL. CBs made from four different types of materials, (1) Ropanyl DM 8/2 A2 + 04 (belt 1), (2) Volta FRMW-3.0 (belt 2), (3) Volta FRMB-3.0 (belt 3), and (4) Ropanyl DM (belt 4), were inoculated with 1 mL of the four-strain cocktail (approximately 10(7) CFU/mL) of the bacterial suspension. CBs were treated with UV light (254 nm) for 1 and 3 sec at 5.53 and 5.95 mW/cm(2). Three replications of the experiments were conducted. Two-way analysis of variance of survival populations of L. monocytogenes showed that bacterial counts were significantly reduced (p belt types irrespective of UV light intensities and times of exposure. L. monocytogenes populations were reduced (p belts 1, 2, and 3 after exposure to 5.95 mW/cm(2) UV light intensity for 3 sec. L. monocytogenes-inoculated CBs that were exposed to 5.53 mW/cm(2) showed higher (p Belt 4 showed survival populations of L. monocytogenes ranging from 1.42 to 1.73 log(10) CFU/cm(2) after UV light treatment for 1 and 3 sec. UV light can be effectively used to reduce L. monocytogenes contamination on CBs.
Directory of Open Access Journals (Sweden)
Pintu Patra
2016-06-01
Full Text Available Myxococcus xanthus, a model organism for studies of multicellular behavior in bacteria, moves exclusively on solid surfaces using two distinct but coordinated motility mechanisms. One of these, social (S motility is powered by the extension and retraction of type IV pili and requires the presence of exopolysaccharides (EPS produced by neighboring cells. As a result, S motility requires close cell-to-cell proximity and isolated cells do not translocate. Previous studies measuring S motility by observing the colony expansion of cells deposited on agar have shown that the expansion rate increases with initial cell density, but the biophysical mechanisms involved remain largely unknown. To understand the dynamics of S motility-driven colony expansion, we developed a reaction-diffusion model describing the effects of cell density, EPS deposition and nutrient exposure on the expansion rate. Our results show that at steady state the population expands as a traveling wave with a speed determined by the interplay of cell motility and growth, a well-known characteristic of Fisher's equation. The model explains the density-dependence of the colony expansion by demonstrating the presence of a lag phase-a transient period of very slow expansion with a duration dependent on the initial cell density. We propose that at a low initial density, more time is required for the cells to accumulate enough EPS to activate S-motility resulting in a longer lag period. Furthermore, our model makes the novel prediction that following the lag phase the population expands at a constant rate independent of the cell density. These predictions were confirmed by S motility experiments capturing long-term expansion dynamics.
Patra, Pintu; Kissoon, Kimberley; Cornejo, Isabel; Kaplan, Heidi B; Igoshin, Oleg A
2016-06-01
Myxococcus xanthus, a model organism for studies of multicellular behavior in bacteria, moves exclusively on solid surfaces using two distinct but coordinated motility mechanisms. One of these, social (S) motility is powered by the extension and retraction of type IV pili and requires the presence of exopolysaccharides (EPS) produced by neighboring cells. As a result, S motility requires close cell-to-cell proximity and isolated cells do not translocate. Previous studies measuring S motility by observing the colony expansion of cells deposited on agar have shown that the expansion rate increases with initial cell density, but the biophysical mechanisms involved remain largely unknown. To understand the dynamics of S motility-driven colony expansion, we developed a reaction-diffusion model describing the effects of cell density, EPS deposition and nutrient exposure on the expansion rate. Our results show that at steady state the population expands as a traveling wave with a speed determined by the interplay of cell motility and growth, a well-known characteristic of Fisher's equation. The model explains the density-dependence of the colony expansion by demonstrating the presence of a lag phase-a transient period of very slow expansion with a duration dependent on the initial cell density. We propose that at a low initial density, more time is required for the cells to accumulate enough EPS to activate S-motility resulting in a longer lag period. Furthermore, our model makes the novel prediction that following the lag phase the population expands at a constant rate independent of the cell density. These predictions were confirmed by S motility experiments capturing long-term expansion dynamics.
Directory of Open Access Journals (Sweden)
Paula Judith Pérez Espitia
2013-09-01
Full Text Available Listeria monocytogenes is a foodborne pathogen, able to survive and proliferate at refrigeration temperatures. As a result, ready-to-eat meat products have been associated with major outbreaks. Producing meat products involves lethal preservation treatments, e.g. thermal treatments. Listeria contamination, however, may be introduced when products are sliced and packaged at retail businesses or delicatessens. In Brazil, sliced bologna is very popular at retail markets. After slicing, however, bologna has a short shelf-life. The aim of this work was to study the effects of pediocin incorporation on the load at break, water vapor permeability rate and structure, by microscopic analysis, of antimicrobial cellulosic packaging. The potential application of the developed packaging for the preservation of bologna and inhibition of Listeria biofilm formation was also studied. Cellulosic antimicrobial packaging films were produced with cellulose acetate and acetone. Pediocin (commercially available concentrate ALTA TM 2341 was incorporated at 30, 40 and 50 % w/w. The load at break of films was studied using the Universal Testing Machine (Instron at 10 °C and 25 °C. The water vapor permeability was determined by gravimetric method. A scanning electron microscope was used to study the developed packaging structure. Antimicrobial activity of films against Listeria innoucua and L. monocytogenes was tested both in vitro and in bologna samples. Results showed that values of load at break decreased with increasing concentrations of pediocin at 10 °C and 25 °C. Regarding water vapor permeability, only the control and 50 % pediocin films presented statistical difference, with the 50 % pediocin film being more permeable. In vitro tests showed antimicrobial activity against L. innocua. Cellulosic film with 50 % pediocin reduced L. monocytogenes growth on sliced bologna by 1.2 log cycles after 9 days and prevented biofilm formation on packaging and bologna
Radionuclide Esophageal Transit Study in the Esophageal Motility Disorders
Energy Technology Data Exchange (ETDEWEB)
Choi, Jae Gol; Lee, Min Jae; Song, Chi Wook [Korea University College of Medicine, Seoul (Korea, Republic of)
1993-07-15
Esophageal motility was evaluated from the analysis of 10 consecutive swallows using liquid bolus containing 0.5 mCi of {sup 99m}Tc tin colloid. We have reviewed our experience of esophageal transit study in the 20 normal volunteers and 55 patients with dysphagia that was not related to mechanical obstruction. The purpose of this study is to measure the esophageal transit in normal subjects and in patients with various esophageal motility disorders. The overall sensitivity and specificity of radionuclide esophageal transit study in detecting esophageal motor abnormality were compared with manometric results as a gold standard, which were 80% and 100% respectively. Radionuclide transit study is a safe, rapid, noninvasive test and suitable as a screening test for esophageal motor disorders.
Radionuclide Esophageal Transit Study in the Esophageal Motility Disorders
International Nuclear Information System (INIS)
Choi, Jae Gol; Lee, Min Jae; Song, Chi Wook
1993-01-01
Esophageal motility was evaluated from the analysis of 10 consecutive swallows using liquid bolus containing 0.5 mCi of 99m Tc tin colloid. We have reviewed our experience of esophageal transit study in the 20 normal volunteers and 55 patients with dysphagia that was not related to mechanical obstruction. The purpose of this study is to measure the esophageal transit in normal subjects and in patients with various esophageal motility disorders. The overall sensitivity and specificity of radionuclide esophageal transit study in detecting esophageal motor abnormality were compared with manometric results as a gold standard, which were 80% and 100% respectively. Radionuclide transit study is a safe, rapid, noninvasive test and suitable as a screening test for esophageal motor disorders.
A multiplex PCR for detection of Listeria monocytogenes and its lineages.
Rawool, Deepak B; Doijad, Swapnil P; Poharkar, Krupali V; Negi, Mamta; Kale, Satyajit B; Malik, S V S; Kurkure, Nitin V; Chakraborty, Trinad; Barbuddhe, Sukhadeo B
2016-11-01
A novel multiplex PCR assay was developed to identify genus Listeria, and discriminate Listeria monocytogenes and its major lineages (LI, LII, LIII). This assay is a rapid and inexpensive subtyping method for screening and characterization of L. monocytogenes. Copyright © 2016 Elsevier B.V. All rights reserved.
DEFF Research Database (Denmark)
Kastbjerg, Vicky Gaedt; Gram, Lone
2012-01-01
or tolerance would evolve in L. monocytogenes under continued selection in three industrial disinfectants. L. monocytogenes EGD was exposed to Desinfect CL (hypochlorite) and Incimaxx DES (peracedic acid and hydrogen peroxide) for several hundred generations. This caused no increase in the minimal inhibitory......, and that the disinfectants are still efficient for controlling microorganisms such as L. monocytogenes....
Lloyd, T; Alvarado, C Z; Brashears, M M; Thompson, L D; McKee, S R; Berrang, M
2009-10-01
The growth of Listeria monocytogenes in further-processed meat products has become a major concern and an important food safety issue. The meat and poultry industries have incorporated interventions such as organic acids in marinades to inhibit the growth of L. monocytogenes. In this study, organic acids were utilized in the raw product and as a postcook dip to determine their inhibitory effect on the growth of L. monocytogenes in turkey deli loaves. The turkey deli loaves were processed, cooked, cooled, inoculated with streptomycin-resistant L. monocytogenes, and then dipped. Treatments were potassium lactate (PL) in the raw product with sodium lactate (SL), sodium diacetate (SD) dip, PL with SL/PL/SD dip, SL with SL/SD dip, and SL with SL/PL/SD dip. There was also a positive (inoculated) and negative (noninoculated) control, which was dipped in distilled water. Days 0, 7, 14, 21, 28, 42, and 56 were sampled for L. monocytogenes. There were no differences (P>0.05) among the organic acid treatments in the turkey deli loaves at any time points; therefore, all of the treatments increased the lag phase of L. monocytogenes, extending the shelf-life of the product. However, there was a difference between the treatments and the positive control at d 7, 14, 21, 28, 42, and 56. The growth of L. monocytogenes increased immediately in the positive control, whereas the negative control appeared to have no growth. These organic acids can provide meat processors with a useful method for extending the lag phase of L. monocytogenes in ready-to-eat meat and poultry products.
Metabolic responses of primary and transformed cells to intracellular Listeria monocytogenes.
Directory of Open Access Journals (Sweden)
Nadine Gillmaier
Full Text Available The metabolic response of host cells, in particular of primary mammalian cells, to bacterial infections is poorly understood. Here, we compare the carbon metabolism of primary mouse macrophages and of established J774A.1 cells upon Listeria monocytogenes infection using (13C-labelled glucose or glutamine as carbon tracers. The (13C-profiles of protein-derived amino acids from labelled host cells and intracellular L. monocytogenes identified active metabolic pathways in the different cell types. In the primary cells, infection with live L. monocytogenes increased glycolytic activity and enhanced flux of pyruvate into the TCA cycle via pyruvate dehydrogenase and pyruvate carboxylase, while in J774A.1 cells the already high glycolytic and glutaminolytic activities hardly changed upon infection. The carbon metabolism of intracellular L. monocytogenes was similar in both host cells. Taken together, the data suggest that efficient listerial replication in the cytosol of the host cells mainly depends on the glycolytic activity of the hosts.
[Risk assessment of Listeria monocytogenes in deli meats and vegetable salads].
Tian, Jing; Liu, Xiu-mei
2009-09-01
To analysis risk from Listeria monocytogenes in deli meats and vegetable salads. Use Risk Ranger which is a software programme developed by the University of Hobart, Australia and answer 11 questions on affecting the risk from hazards in the specific foods by combining data from national foodborne diseases surveillance network and some references to make semi-quantitative risk assessment for the specific food. Relative risk from Listeria monocytogenes in deli meats and vegetable salads is 61 and 52, respectively. Incidence of listeriosis caused by deli meats-Listeria monocytogenes pairs and vegetable salads-Listeria monocytogenes pairs is 5.4 and 0.2 cases per million people, respectively. Risk from the former is 32 times than that from the latter. By changing the selection for some risk factors in the model, it was known that the risks from two food-hazard combinations could decrease 10 times, if taking necessary actions after processing. Deli meats is a kind of high risk food for listeriosis.
Pagliano, Pasquale; Ascione, Tiziana; Boccia, Giovanni; De Caro, Francesco; Esposito, Silvano
2016-06-01
Listeria monocytogenes is a Gram-positive bacillus and facultative intracellular bacterium whose transmission occurs mainly through the consumption of contaminated food, L. monocytogenes invades the host cells using various protein and can escape to the human T-cell immune system by cell-to-cell spreading. If the infection is not controlled at the stage in which the bacterium is in the liver, for instance, due to a severe immunodepression, a secondary bacteraemia can be developed and L. monocytogenes reaches the preferred sites transgressing the blood-brain barrier or the placental barrier. Individuals with T-cell dysfunction, such as pregnant women, the elderly, and those receiving immunosuppressive therapy are at the highest risk of contracting the disease. Average life expectancy throughout developed countries has rapidly increased during the latter half of the 20th century and geriatric infectious diseases have become an increasingly important issue. L. monocytogenes meningitis in young previously healthy adults has been reported only in anecdotal observations. Differently, L. monocytogenes is the third most common cause of bacterial meningitis in the elderly population, after Streptococcus pneumoniae and Neisseria meningitidis. Patients with L. monocytogenes meningitis presented with signs and symptoms that were similar to those of the general population with community-acquired bacterial meningitis, but reported a longer prodromal phase. According to literature data, the prevalence of the classic triad of fever, neck stiffness, and altered mental status is 43%, and almost all patients present with at least 2 of the 4 classic symptoms of headache, fever, neck stiffness, and altered mental status. On the basis of our published data, in patients aged over 50 years, diagnosing L. monocytogenes meningitis was more challenging than pneumococcal meningitis, as demonstrated by the lower percentage of cases receiving a correct diagnosis within 48 hours from the onset
Motility of Pseudomonas aeruginosa contributes to SOS-inducible biofilm formation.
Chellappa, Shakinah T; Maredia, Reshma; Phipps, Kara; Haskins, William E; Weitao, Tao
2013-12-01
DNA-damaging antibiotics such as ciprofloxacin induce biofilm formation and the SOS response through autocleavage of SOS-repressor LexA in Pseudomonas aeruginosa. However, the biofilm-SOS connection remains poorly understood. It was investigated with 96-well and lipid biofilm assays. The effects of ciprofloxacin were examined on biofilm stimulation of the SOS mutant and wild-type strains. The stimulation observed in the wild-type in which SOS was induced was reduced in the mutant in which LexA was made non-cleavable (LexAN) and thus SOS non-inducible. Therefore, the stimulation appeared to involve SOS. The possible mechanisms of inducible biofilm formation were explored by subproteomic analysis of outer membrane fractions extracted from biofilms. The data predicted an inhibitory role of LexA in flagellum function. This premise was tested first by functional and morphological analyses of flagellum-based motility. The flagellum swimming motility decreased in the LexAN strain treated with ciprofloxacin. Second, the motility-biofilm assay was performed, which tested cell migration and biofilm formation. The results showed that wild-type biofilm increased significantly over the LexAN. These results suggest that LexA repression of motility, which is the initial event in biofilm development, contributes to repression of SOS-inducible biofilm formation. Copyright © 2013 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.
Schirmer, B C T; Heir, E; Møretrø, T; Skaar, I; Langsrud, S
2013-10-01
The background microbiota of 5 Norwegian small-scale cheese production sites was examined and the effect of the isolated strains on the growth and survival of Listeria monocytogenes was investigated. Samples were taken from the air, food contact surfaces (storage surfaces, cheese molds, and brine) and noncontact surfaces (floor, drains, and doors) and all isolates were identified by sequencing and morphology (mold). A total of 1,314 isolates were identified and found to belong to 55 bacterial genera, 1 species of yeast, and 6 species of mold. Lactococcus spp. (all of which were Lactococcus lactis), Staphylococcus spp., Microbacterium spp., and Psychrobacter sp. were isolated from all 5 sites and Rhodococcus spp. and Chryseobacterium spp. from 4 sites. Thirty-two genera were only found in 1 out of 5 facilities each. Great variations were observed in the microbial background flora both between the 5 producers, and also within the various production sites. The greatest diversity of bacteria was found in drains and on rubber seals of doors. The flora on cheese storage shelves and in salt brines was less varied. A total of 62 bacterial isolates and 1 yeast isolate were tested for antilisterial activity in an overlay assay and a spot-on-lawn assay, but none showed significant inhibitory effects. Listeria monocytogenes was also co-cultured on ceramic tiles with bacteria dominating in the cheese production plants: Lactococcus lactis, Pseudomonas putida, Staphylococcus equorum, Rhodococcus spp., or Psychrobacter spp. None of the tested isolates altered the survival of L. monocytogenes on ceramic tiles. The conclusion of the study was that no common background flora exists in cheese production environments. None of the tested isolates inhibited the growth of L. monocytogenes. Hence, this study does not support the hypothesis that the natural background flora in cheese production environments inhibits the growth or survival of L. monocytogenes. Copyright © 2013 American
Suppression of Listeria monocytogenes by the Native Micro-Flora in Teewurst Sausage.
Austin-Watson, Clytrice; Grant, Ar'Quette; Brice, Michline
2013-10-21
Modern consumers are interested in the use of non-chemical methods to control pathogens when heat sterilization is not an option. Such is the case with teewurst sausage, a raw spreadable sausage and a popular German commodity. Although Listeria was not found in teewurst, the optimal microbial growing conditions of teewurst coupled with the ubiquity of L. monocytogenes in nature, makes the possibility of contamination of products very possible. This pilot study was conducted to examine teewurst's native micro-flora's ability to suppress the outgrowth of L. monocytogenes at 10 °C using standard plate counts and PCR-DGGE. Traditional plating methods showed L. monocytogenes growth significantly decreased when in competition with the teewurst's native micro-flora ( p flora of the teewurst suppressed the overall growth of L. monocytogenes by an average of two logs, under these conditions. Denaturing Gradient Gel Electrophoresis (DGGE) amplicons with unique banding patterns were extracted from DGGE gel for identification. Brochothrix thermosphacta and Lactobacillus curvatus were identified as a part of the teewurst's native micro-flora. Although the native micro-flora did not decrease L. monocytogenes to below limits of detection, it was enough of a decrease to warrant further investigation.
Inhibitory Effect of Nisin on Listeria monocytogenes Inoculated into Surimi and Minced Meat
Directory of Open Access Journals (Sweden)
Masoud Rezaei
2012-02-01
Full Text Available Background & Objective: Listeria monocytogenes has already established as an important food born pathogen which induce listeriosis in human. Use of bacteriocins to provide food safety has been increased dramatically. Nisin has a wide spectrum inhibitory effect than the other bacteriocins and inhibits food-borne pathogens such as L. monocytogenes and many other Gram-positive spoilage microorganisms. The purpose of this study was to investigate the inhibitory effect of Nisin on population of Listeria monocytogenes and the role of changes in food components on the antilisterial properties of Nisin. Materials & Methods: The minced meat and surimi samples were inoculated by 1×104 cfu/g of L. monocytogenes. Then samples exposed to Nisin at the levels of 500 or 1000 IU/g were prepared. All treatments after packaging in plastic bags were kept for 12 days at refrigerator temperature. Samples were cultured on CHROMagarTM Listeria every 2 days and the number of listeria monocytogenes was counted. Results: two different concentrations of Nisin (500 or 1000 IU/g was not able to inhibit L. monocytogenes below the acceptable level for raw food (100 cells per g in minced meat and surimi of silver carp. But the number of bacteria reduces more in fish surimi as compared to the mince meal. Also, antilisterial activity of Nisin was reduced during the storage period. Conclusion: Inhibitory property of Nisin against L. monocytogenes in surimi significantly was higher than the minced (P<0.05. So it is possible the antilisterial properties of Nisin will increase by elimination of some enzymes during processing.
Jones, Ronald N; Stilwell, Matthew G
2013-06-01
Dalbavancin is an investigational lipoglycopeptide having an extended serum elimination half-life allowing once-weekly dosing. Data from testing 1357 strains of uncommonly isolated species expand the dalbavancin spectrum details as follows (MIC50/90): β-haemolytic streptococcal serogroups C, F, and G (≤0.03/≤0.03 μg/mL), 7 viridans group of streptococci (≤0.03/≤0.03-0.06 μg/mL), 5 Corynebacterium spp. (0.06/0.12 μg/mL), Listeria monocytogenes (0.06/0.12 μg/mL), and Micrococcus spp. (≤0.03/≤0.03 μg/mL). Among all reported isolates, 99.8% of tested strains were inhibited at dalbavancin MIC values at ≤0.12 μg/mL. Dalbavancin remains very potent against rarer Gram-positive pathogens, using in vitro test experience with organisms cultured through 2011. Copyright © 2013 Elsevier Inc. All rights reserved.
Primary Esophageal Motility Disorders: Beyond Achalasia
Schlottmann, Francisco; Patti, Marco G.
2017-01-01
The best-defined primary esophageal motor disorder is achalasia. However, symptoms such as dysphagia, regurgitation and chest pain can be caused by other esophageal motility disorders. The Chicago classification introduced new manometric parameters and better defined esophageal motility disorders. Motility disorders beyond achalasia with the current classification are: esophagogastric junction outflow obstruction, major disorders of peristalsis (distal esophageal spasm, hypercontractile esoph...
Cousin, Fabien J; Lynch, Shónagh M; Harris, Hugh M B; McCann, Angela; Lynch, Denise B; Neville, B Anne; Irisawa, Tomohiro; Okada, Sanae; Endo, Akihito; O'Toole, Paul W
2015-02-01
Lactobacillus is the largest genus within the lactic acid bacteria (LAB), with almost 180 species currently identified. Motility has been reported for at least 13 Lactobacillus species, all belonging to the Lactobacillus salivarius clade. Motility in lactobacilli is poorly characterized. It probably confers competitive advantages, such as superior nutrient acquisition and niche colonization, but it could also play an important role in innate immune system activation through flagellin–Toll-like receptor 5 (TLR5) interaction. We now report strong evidence of motility in a species outside the L. salivarius clade, Lactobacillus curvatus (strain NRIC0822). The motility of L. curvatus NRIC 0822 was revealed by phase-contrast microscopy and soft-agar motility assays. Strain NRIC 0822 was motile at temperatures between 15 °C and 37 °C, with a range of different carbohydrates, and under varying atmospheric conditions. We sequenced the L. curvatus NRIC 0822 genome, which revealed that the motility genes are organized in a single operon and that the products are very similar (>98.5% amino acid similarity over >11,000 amino acids) to those encoded by the motility operon of Lactobacillus acidipiscis KCTC 13900 (shown for the first time to be motile also). Moreover, the presence of a large number of mobile genetic elements within and flanking the motility operon of L. curvatus suggests recent horizontal transfer between members of two distinct Lactobacillus clades: L. acidipiscis in the L. salivarius clade and L. curvatus inthe L. sakei clade. This study provides novel phenotypic, genetic, and phylogenetic insights into flagellum-mediated motility in lactobacilli.
Incidence of Listeria monocytogenes and Listeria spp. in a small-scale mushroom production facility.
Viswanath, Prema; Murugesan, Latha; Knabel, Stephen J; Verghese, Bindhu; Chikthimmah, Naveen; Laborde, Luke F
2013-04-01
Listeria monocytogenes is a foodborne pathogen of significant concern to the agricultural and food processing industry because of its ability to grow and persist in cool and moist environments and its association with listeriosis, a disease with a very high mortality rate. Although there have been no listeriosis outbreaks attributed to fresh mushrooms in the United States, retail surveys and recalls are evidence that L. monocytogenes contamination of mushrooms (Agaricus bisporus) can occur. The objective of this study was to determine the prevalence of Listeria spp., including L. monocytogenes, in a small-scale mushroom production facility on the campus of the Pennsylvania State University in the United States. Of 184 samples taken from five production zones within the facility, 29 (15.8%) samples were positive for Listeria spp. Among the Listeria spp. isolates, L. innocua was most prevalent (10.3%) followed by L. welshimeri (3.3%), L. monocytogenes (1.6%), and L. grayi (0.5%). L. monocytogenes was recovered only from the phase I raw material composting area. Isolates of L. monocytogenes were confirmed and serotyped by multiplex PCR. The epidemiological relatedness of the three L. monocytogenes isolates to those serotypes or lineages frequently encountered in listeriosis infections was determined by multi-virulence-locus sequence typing using six virulence genes, namely, prfA, inlB, inlC, dal, clpP, and lisR. The phylogenetic positions of the three isolates in the dendrogram prepared with data from other isolates of L. monocytogenes showed that all isolates were grouped with serotype 4a, lineage IIIA. To date, this serotype has rarely been reported in foodborne disease outbreaks.
An ecological perspective of Listeria monocytogenes biofilms in food processing facilities.
Valderrama, Wladir B; Cutter, Catherine N
2013-01-01
Listeria monocytogenes can enter the food chain at virtually any point. However, food processing environments seem to be of particular importance. From an ecological point of view, food processing facilities are microbial habitats that are constantly disturbed by cleaning and sanitizing procedures. Although L. monocytogenes is considered ubiquitous in nature, it is important to recognize that not all L. monocytogenes strains appear to be equally distributed; the distribution of the organism seems to be related to certain habitats. Currently, no direct evidence exists that L. monocytogenes-associated biofilms have played a role in food contamination or foodborne outbreaks, likely because biofilm isolation and identification are not part of an outbreak investigation, or the definition of biofilm is unclear. Because L. monocytogenes is known to colonize surfaces, we suggest that contamination patterns may be studied in the context of how biofilm formation is influenced by the environment within food processing facilities. In this review, direct and indirect epidemiological and phenotypic evidence of lineage-related biofilm formation capacity to specific ecological niches will be discussed. A critical view on the development of the biofilm concept, focused on the practical implications, strengths, and weaknesses of the current definitions also is discussed. The idea that biofilm formation may be an alternative surrogate for microbial fitness is proposed. Furthermore, current research on the influence of environmental factors on biofilm formation is discussed.
Modulation of vagal tone enhances gastroduodenal motility and reduces somatic pain sensitivity
DEFF Research Database (Denmark)
Frøkjaer, J B; Bergmann, S; Brock, C
2016-01-01
algometry, conditioned pain modulation using a cold pressor test and a liquid meal ultrasonographic gastroduodenal motility test were performed. KEY RESULTS: Cardiac vagal tone increased during active treatment with t-VNS and DSB compared to sham (p = 0.009). In comparison to sham, thresholds to bone pain...... increased (p = 0.001), frequency of antral contractions increased (p = 0.004) and gastroduodenal motility index increased (p = 0.016) with active treatment. However, no effect on muscle pain thresholds and conditioned pain modulation was seen. CONCLUSIONS & INFERENCES: This experimental study suggests...
Antimicrobial treatments to control Listeria monocytogenes in queso fresco.
Lourenço, António; Kamnetz, Mary B; Gadotti, Camila; Diez-Gonzalez, Francisco
2017-06-01
Queso fresco, is a Hispanic non-fermented cheese highly susceptible to contamination with L. monocytogenes. This research was aimed to determine the effect of GRAS antimicrobial ingredients to control L. monocytogenes. Antimicrobials included caprylic acid (CA), Nisaplin ® (N, 2.5% nisin), a mixture of sodium lactate and sodium diacetate (SL/SD), Lactococcus lactis sbp. lactis DPC 3147, monolaurin, and lactic acid (LA). Batches of queso fresco curds were inoculated with 10 4 CFU/g and stored at 4 °C for three weeks. During storage the count of L. monocytogenes reached 7 to 8 Log CFU/g in control samples. Most individual antimicrobial treatments resulted in less than 1 Log CFU/g reductions in final counts, with the exception of N (0.5 g/kg) and CA (2.9 g/kg) that caused more than 3 and 5 Log CFU/g differences with controls, respectively. Mixtures of ingredients were more effective in inhibiting L. monocytogenes growth, and treatments with N and CA consistently delivered 6 Log CFU/g less counts than controls. Supplementation of 12 g/kg LA to treatments with SL/SD (3%/0.22%) caused differences of more than 4 Log CFU/g in final Listeria populations. Samples treated with the binary mixtures of N and CA (0.5 and 0.7 g/kg, respectively) were evaluated in a consumer panel (n = 67). Panelists slightly preferred control and commercial over treated samples, but all samples were in average rated between "slightly liking" and "moderately liking." These experiments indicated that combined use of antimicrobial ingredients may be an effective way to control the population of Listeria monocytogenes in queso fresco. Copyright © 2016 Elsevier Ltd. All rights reserved.
Vagal activation by sham feeding improves gastric motility in functional dyspepsia.
Lunding, J A; Nordström, L M; Haukelid, A-O; Gilja, O H; Berstad, A; Hausken, T
2008-06-01
Antral hypomotility and impaired gastric accommodation in patients with functional dyspepsia have been ascribed to vagal dysfunction. We investigated whether vagal stimulation by sham feeding would improve meal-induced gastric motor function in these patients. Fourteen healthy volunteers and 14 functional dyspepsia patients underwent a drink test twice, once with and once without simultaneous sham feeding. After ingesting 500 mL clear meat soup (20 kcal, 37 degrees C) in 4 min, sham feeding was performed for 10 min by chewing a sugar-containing chewing gum while spitting out saliva. Using two- and three-dimensional ultrasound, antral motility index (contraction amplitude x frequency) and intragastric volumes were estimated. Without sham feeding, functional dyspepsia patients had lower motility index than healthy volunteers (area under curve 8.0 +/- 1.2 vs 4.4 +/- 1.0 min(-1), P = 0.04). In functional dyspepsia patients, but not in healthy volunteers, motility index increased and intragastric volume tended to increase by sham feeding (P = 0.04 and P = 0.06 respectively). The change in motility index was negatively correlated to the change in pain score (r = -0.59, P = 0.007). In functional dyspepsia patients, vagal stimulation by sham feeding improves antral motility in response to a soup meal. The result supports the view that impaired vagal stimulation is implicated in the pathogenesis of gastric motility disturbances in functional dyspepsia.
High-resolution esophageal pressure topography for esophageal motility disorders
Directory of Open Access Journals (Sweden)
Hashem Fakhre Yaseri
2016-04-01
Full Text Available Background: High-resolution manometer (HRM of the esophagus has become the main diagnostic test in the evaluation of esophageal motility disorders. The development of high-resolution manometry catheters and software displays of manometry recordings in color-coded pressure plots have changed the diagnostic assessment of esophageal disease. The first step of the Chicago classification described abnormal esophagogastric junction deglutitive relaxation. The latest classification system, proposed by Pandolfino et al, includes contraction patterns and peristalsis integrity based on integrated relaxation pressure 4 (IRP4. It can be discriminating the achalasia from non-achalasia esophageal motility disorders. The aim of this study was to assessment of clinical findings in non-achalasia esophageal motility disorders based on the most recent Chicago classification. Methods: We conducted a prospective cross-sectional study of 963 patients that had been referred to manometry department of Gastrointestinal and Liver Research Center, Firozgar Hospital, Tehran, Iran, from April, 2012 to April, 2015. They had upper GI disorder (Dysphasia, non-cardiac chest pain, regurgitation, heartburn, vomiting and asthma and weight loss. Data were collected from clinical examinations as well as patient questionnaires. Manometry, water-perfused, was done for all patients. Manometry criteria of the patients who had integrated relaxation pressure 4 (IRP4 ≤ 15 mmHg were studied. Results: Our finding showed that the non-achalasia esophageal motility disorders (58% was more common than the achalasia (18.2%. Heartburn (68.5%, regurgitation (65.4% and non-cardiac chest pain (60.6% were the most common clinical symptoms. Although, vomiting (91.7% and weight loss (63% were the most common symptoms in referring patients but did not discriminate this disorders from each other’s. Borderline motor function (67.2% was the most common, absent peristalsis (97% and the hyper
Vojkovska, H; Kubikova, I; Kralik, P
2015-03-01
Epidemiological data indicate that raw vegetables are associated with outbreaks of Listeria monocytogenes. Therefore, there is a demand for the availability of rapid and sensitive methods, such as PCR assays, for the detection and accurate discrimination of L. monocytogenes. However, the efficiency of PCR methods can be negatively affected by inhibitory compounds commonly found in vegetable matrices that may cause false-negative results. Therefore, the sample processing and DNA isolation steps must be carefully evaluated prior to the introduction of such methods into routine practice. In this study, we compared the ability of three column-based and four magnetic bead-based commercial DNA isolation kits to extract DNA of the model micro-organism L. monocytogenes from raw vegetables. The DNA isolation efficiency of all isolation kits was determined using a triplex real-time qPCR assay designed to specifically detect L. monocytogenes. The kit with best performance, the PowerSoil(™) Microbial DNA Isolation Kit, is suitable for the extraction of amplifiable DNA from L. monocytogenes cells in vegetable with efficiencies ranging between 29.6 and 70.3%. Coupled with the triplex real-time qPCR assay, this DNA isolation kit is applicable to the samples with bacterial loads of 10(3) bacterial cells per gram of L. monocytogenes. Several recent outbreaks of Listeria monocytogenes have been associated with the consumption of fruits and vegetables. Real-time PCR assays allow fast detection and accurate quantification of microbes. However, the success of real-time PCR is dependent on the success with which template DNA can be extracted. The results of this study suggest that the PowerSoil(™) Microbial DNA Isolation Kit can be used for the extraction of amplifiable DNA from L. monocytogenes cells in vegetable with efficiencies ranging between 29.6 and 70.3%. This method is applicable to samples with bacterial loads of 10(3) bacterial cells per gram of L. monocytogenes. © 2014
Chen, Bang-Yuan; Wang, Chung-Yi; Wang, Chia-Lan; Fan, Yang-Chi; Weng, I-Ting; Chou, Chung-Hsi
2016-11-01
A 2-year study was performed at two ready-to-eat tilapia sashimi processing plants (A and B) to identify possible routes of contamination with Listeria monocytogenes during processing. Samples were collected from the aquaculture environments, transportation tanks, processing plants, and final products. Seventy-nine L. monocytogenes isolates were found in the processing environments and final products; 3.96% (50 of 1,264 samples) and 3.86% (29 of 752 samples) of the samples from plants A and B, respectively, were positive for L. monocytogenes . No L. monocytogenes was detected in the aquaculture environments or transportation tanks. The predominant L. monocytogenes serotypes were 1/2b (55.70%) and 4b (37.97%); serotypes 3b and 4e were detected at much lower percentages. At both plants, most processing sections were contaminated with L. monocytogenes before the start of processing, which indicated that the cleaning and sanitizing methods did not achieve adequate pathogen removal. Eleven seropulsotypes were revealed by pulsed-field gel electrophoresis and serotyping. Analysis of seropulsotype distribution revealed that the contamination was disseminated by the processing work; the same seropulsotypes were repeatedly found along the work flow line and in the final products. Specific seropulsotypes were persistently found during different sampling periods, which suggests that the sanitation procedures or equipment used at these plants were inadequate. Plant staff should improve the sanitation procedures and equipment to reduce the risk of L. monocytogenes cross-contamination and ensure the safety of ready-to-eat tilapia products.
Camargo, Anderson Carlos; Woodward, Joshua John; Call, Douglas Ruben; Nero, Luís Augusto
2017-11-01
Listeria monocytogenes is a foodborne pathogen that contaminates food-processing environments and persists within biofilms on equipment, utensils, floors, and drains, ultimately reaching final products by cross-contamination. This pathogen grows even under high salt conditions or refrigeration temperatures, remaining viable in various food products until the end of their shelf life. While the estimated incidence of listeriosis is lower than other enteric illnesses, infections caused by L. monocytogenes are more likely to lead to hospitalizations and fatalities. Despite the description of L. monocytogenes occurrence in Brazilian food-processing facilities and foods, there is a lack of consistent data regarding listeriosis cases and outbreaks directly associated with food consumption. Listeriosis requires rapid treatment with antibiotics and most drugs suitable for Gram-positive bacteria are effective against L. monocytogenes. Only a minority of clinical antibiotic-resistant L. monocytogenes strains have been described so far; whereas many strains recovered from food-processing facilities and foods exhibited resistance to antimicrobials not suitable against listeriosis. L. monocytogenes control in food industries is a challenge, demanding proper cleaning and application of sanitization procedures to eliminate this foodborne pathogen from the food-processing environment and ensure food safety. This review focuses on presenting the L. monocytogenes distribution in food-processing environment, food contamination, and control in the food industry, as well as the consequences of listeriosis to human health, providing a comparison of the current Brazilian situation with the international scenario.
Listeria monocytogenes response regulators important for stress tolerance and pathogenesis
DEFF Research Database (Denmark)
Kallipolitis, B H; Ingmer, H
2001-01-01
Environmental sensing by two-component signal transduction systems is likely to play a role for growth and survival of Listeria monocytogenes both during transmission in food products and within a host organism. Two-component systems typically consist of a membrane-associated sensor histidine...... kinase and a gene regulatory protein, the response regulator (RR). We have identified seven putative RR genes in L. monocytogenes LO28 by PCR using degenerate oligonucleotide primers. By insertional inactivation we obtained data suggesting that three of the putative RRs contribute to the pathogenicity...... of L. monocytogenes in mice. Strikingly, the mutants that were attenuated in virulence also had a decreased ability to grow in the presence of various stress conditions potentially encountered in an infection process. Thus, our data point to a connection between the ability of the putative two...
Achalasia and Esophageal Motility Disorders
... Tumors Mediastinal Tumors Achalasia and Esophageal Motility Disorders Pleural Diseases Mesothelioma Achalasia and Esophageal Motility Disorders Overview The esophagus (ĕ-sof´ah-gus) is the hollow, muscular tube that moves food and liquid from your mouth to your stomach. If the ...
Mechanism of Nisin, Pediocin 34, and Enterocin FH99 Resistance in Listeria monocytogenes.
Kaur, Gurpreet; Singh, Tejinder Pal; Malik, Ravinder Kumar; Bhardwaj, Arun
2012-03-01
Nisin-, pediocin 34-, and enterocin FH99-resistant variants of Listeria monocytogenes ATCC 53135 were developed. In an attempt to clarify the possible mechanisms underlying bacteriocin resistance in L. monocytogenes ATCC 53135, sensitivity of the resistant strains of L. monocytogenes ATCC 53135 to nisin, pediocin 34, and enterocin FH99 in the absence and presence of different divalent cations was assessed, and the results showed that the addition of divalent cations significantly reduced the inhibitory activity of nisin, pediocin 34, and enterocin FH99 against resistant variants of L. monocytogenes ATCC 53135. The addition of EDTA, however, restored this activity suggesting that the divalent cations seem to affect the initial electrostatic interaction between the positively charged bacteriocin and the negatively charged phospholipids of the membrane. Nisin-, pediocin 34-, and enterocin-resistant variants of L. monocytogenes ATCC 53135 were more resistant to lysozyme as compared to the wild-type strain both in the presence as well as absence of nisin, pediocin 34, and enterocin FH99. Ultra structural profiles of bacteriocin-sensitive L. monocytogenes and its bacteriocin-resistant counterparts revealed that the cells of wild-type strain of L. monocytogenes were maximally in pairs or short chains, whereas, its nisin-, pediocin 34-, and enterocin FH99-resistant variants tend to form aggregates. Results indicated that without a cell wall, the acquired nisin, pediocin 34, and enterocin FH99 resistance of the variants was lost. Although the bacteriocin-resistant variants appeared to lose their acquired resistance toward nisin, pediocin 34, and enterocin FH99, the protoplasts of the resistant variants appeared to be more resistant to bacteriocins than the protoplasts of their wild-type counterparts.
Performance of Isfahan North Wastewater Treatment Plant in the Removal of Listeria monocytogenes
Directory of Open Access Journals (Sweden)
nahid Navijouy
2013-08-01
Full Text Available Listeria and in particular Listeria monocytogenes is considered a ubiquitous foodborne pathogen which can lead listeriosis in human and animals. Listeriosis can be serious and may cause meningitis, septicemia and abortion in pregnant women. Although wastewater or sludge may contaminate foods of plant origin, there are no data on occurrence of Listeria spp. in wastewater and sludge in Iran. The purpose of current investigation was to study the occurrence of Listeria spp. in various samples of wastewater and sludge in Isfahan North wastewater treatment plant. Influent, effluent, raw sludge and dried sludge samples were collected from Isfahan North municipal wastewater treatment plant. L. monocytogenes were enumerated by a three–tube most probable number (MPN assay using enrichment Fraser broth. A total of 65 various samples from five step in 13 visits were collected. The presence of Listeria spp. also was determined using USDA procedure. Then, phenotypically identified L. monocytogenes were further confirmed by Polymerase Chain Reaction amplification. L. monocytogenes isolated from 76.9%, 38.5%, 84.6%, 69.2% and 46.2% of influent, effluent, raw sludge, stabilized sludge and dried sludge respectively. The efficiency of wastewater treatment processes, digester tank and drying bed in removal L. monocytogenes were 69.6%, 64.7% and 73.4% respectively. All phenotypically identified L. monocytogenes were further confirmed by Polymerase Chain Reaction. The results of present study have shown that Listeriaspp. and L. monocytogenes in particular, were present in wastewater treatment plant effluents and sludge at high level. The bacteria may spread on agriculture land and contaminate foods of plant origin. This may cause a risk of spreading disease to human and animals.
Novel Biocontrol Methods for Listeria monocytogenes Biofilms in Food Production Facilities.
Gray, Jessica A; Chandry, P Scott; Kaur, Mandeep; Kocharunchitt, Chawalit; Bowman, John P; Fox, Edward M
2018-01-01
High mortality and hospitalization rates have seen Listeria monocytogenes as a foodborne pathogen of public health importance for many years and of particular concern for high-risk population groups. Food manufactures face an ongoing challenge in preventing the entry of L. monocytogenes into food production environments (FPEs) due to its ubiquitous nature. In addition to this, the capacity of L. monocytogenes strains to colonize FPEs can lead to repeated identification of L. monocytogenes in FPE surveillance. The contamination of food products requiring product recall presents large economic burden to industry and is further exacerbated by damage to the brand. Poor equipment design, facility layout, and worn or damaged equipment can result in Listeria hotspots and biofilms where traditional cleaning and disinfecting procedures may be inadequate. Novel biocontrol methods may offer FPEs effective means to help improve control of L. monocytogenes and decrease cross contamination of food. Bacteriophages have been used as a medical treatment for many years for their ability to infect and lyse specific bacteria. Endolysins, the hydrolytic enzymes of bacteriophages responsible for breaking the cell wall of Gram-positive bacteria, are being explored as a biocontrol method for food preservation and in nanotechnology and medical applications. Antibacterial proteins known as bacteriocins have been used as alternatives to antibiotics for biopreservation and food product shelf life extension. Essential oils are natural antimicrobials formed by plants and have been used as food additives and preservatives for many years and more recently as a method to prevent food spoilage by microorganisms. Competitive exclusion occurs naturally among bacteria in the environment. However, intentionally selecting and applying bacteria to effect competitive exclusion of food borne pathogens has potential as a biocontrol application. This review discusses these novel biocontrol methods and their
Listeria monocytogenes Prevalence and Characteristics in Retail Raw Foods in China.
Wu, Shi; Wu, Qingping; Zhang, Jumei; Chen, Moutong; Yan, Ze An; Hu, Huijuan
2015-01-01
The prevalence and levels of Listeria monocytogenes in retail raw foods covering most provincial capitals in China were studied with testing of 1036 samples of vegetables, edible mushrooms, raw meat, aquatic products and quick-frozen products from September 2012 to January 2014. The total prevalence of Listeria monocytogenes was 20.0% (207/1036), and the most probable number (MPN) values of 65.7% of the positive samples ranged from 0.3 to 110 MPN/g. Geographical differences were observed in this survey, and the results of both qualitative and quantitative methods indicated that the levels in the samples from North China were higher than those in the samples from South China. A total of 248 isolates were analyzed, of which approximately half belonged to molecular serogroup 1/2a-3a (45.2%), followed by 1/2b-3b-7 (30.6%), 1/2c-3c (16.1%), 4b-4d-4e (5.2%) and 4a-4c (2.8%). Most of the isolates carried hly (100%), inlB (98.8%), inlA (99.6%), inlC (98.0%) and inlJ (99.2%), and 44.8% of the isolates were llsX-positive. Seventeen epidemic clones (ECs) were detected, with 7 strains belonging to ECI (2.8%) and 10 belonging to ECIII (4.03%). Resistance to clindamycin (46.8%) was commonly observed, and 59 strains (23.8%) were susceptible to all 14 tested antibiotics, whereas 84 (33.9%) showed an intermediate level of resistance or were resistant to two or more antibiotics, including 7 multi-resistant strains that exhibited resistance to more than 10 antibiotics. The data obtained in the present study provides useful information for assessment of the possible risk posed to Chinese consumers, and this information will have a significant public health impact in China. Furthermore, the presence of virulence markers, epidemic clones, as well as the antibiotic resistance amongst the isolates strongly implies that many of these strains might be capable of causing listeriosis, and more accurate treatment of human listeriosis with effective antibiotics should be considered. This
Listeria monocytogenes Prevalence and Characteristics in Retail Raw Foods in China.
Directory of Open Access Journals (Sweden)
Shi Wu
Full Text Available The prevalence and levels of Listeria monocytogenes in retail raw foods covering most provincial capitals in China were studied with testing of 1036 samples of vegetables, edible mushrooms, raw meat, aquatic products and quick-frozen products from September 2012 to January 2014. The total prevalence of Listeria monocytogenes was 20.0% (207/1036, and the most probable number (MPN values of 65.7% of the positive samples ranged from 0.3 to 110 MPN/g. Geographical differences were observed in this survey, and the results of both qualitative and quantitative methods indicated that the levels in the samples from North China were higher than those in the samples from South China. A total of 248 isolates were analyzed, of which approximately half belonged to molecular serogroup 1/2a-3a (45.2%, followed by 1/2b-3b-7 (30.6%, 1/2c-3c (16.1%, 4b-4d-4e (5.2% and 4a-4c (2.8%. Most of the isolates carried hly (100%, inlB (98.8%, inlA (99.6%, inlC (98.0% and inlJ (99.2%, and 44.8% of the isolates were llsX-positive. Seventeen epidemic clones (ECs were detected, with 7 strains belonging to ECI (2.8% and 10 belonging to ECIII (4.03%. Resistance to clindamycin (46.8% was commonly observed, and 59 strains (23.8% were susceptible to all 14 tested antibiotics, whereas 84 (33.9% showed an intermediate level of resistance or were resistant to two or more antibiotics, including 7 multi-resistant strains that exhibited resistance to more than 10 antibiotics. The data obtained in the present study provides useful information for assessment of the possible risk posed to Chinese consumers, and this information will have a significant public health impact in China. Furthermore, the presence of virulence markers, epidemic clones, as well as the antibiotic resistance amongst the isolates strongly implies that many of these strains might be capable of causing listeriosis, and more accurate treatment of human listeriosis with effective antibiotics should be considered. This
Listeria monocytogenes Prevalence and Characteristics in Retail Raw Foods in China
Wu, Shi; Wu, Qingping; Zhang, Jumei; Chen, Moutong; Yan, Ze′an; Hu, Huijuan
2015-01-01
The prevalence and levels of Listeria monocytogenes in retail raw foods covering most provincial capitals in China were studied with testing of 1036 samples of vegetables, edible mushrooms, raw meat, aquatic products and quick-frozen products from September 2012 to January 2014. The total prevalence of Listeria monocytogenes was 20.0% (207/1036), and the most probable number (MPN) values of 65.7% of the positive samples ranged from 0.3 to 110 MPN/g. Geographical differences were observed in this survey, and the results of both qualitative and quantitative methods indicated that the levels in the samples from North China were higher than those in the samples from South China. A total of 248 isolates were analyzed, of which approximately half belonged to molecular serogroup 1/2a-3a (45.2%), followed by 1/2b-3b-7 (30.6%), 1/2c-3c (16.1%), 4b-4d-4e (5.2%) and 4a-4c (2.8%). Most of the isolates carried hly (100%), inlB (98.8%), inlA (99.6%), inlC (98.0%) and inlJ (99.2%), and 44.8% of the isolates were llsX-positive. Seventeen epidemic clones (ECs) were detected, with 7 strains belonging to ECI (2.8%) and 10 belonging to ECIII (4.03%). Resistance to clindamycin (46.8%) was commonly observed, and 59 strains (23.8%) were susceptible to all 14 tested antibiotics, whereas 84 (33.9%) showed an intermediate level of resistance or were resistant to two or more antibiotics, including 7 multi-resistant strains that exhibited resistance to more than 10 antibiotics. The data obtained in the present study provides useful information for assessment of the possible risk posed to Chinese consumers, and this information will have a significant public health impact in China. Furthermore, the presence of virulence markers, epidemic clones, as well as the antibiotic resistance amongst the isolates strongly implies that many of these strains might be capable of causing listeriosis, and more accurate treatment of human listeriosis with effective antibiotics should be considered. This
Initial adhesion of Listeria monocytogenes to solid surfaces under liquid flow
DEFF Research Database (Denmark)
Szlavik, Julie; Soares Paiva, Dionísio; Mørk, Nils
2012-01-01
.001) was observed but not of interactions between surface-shear stress. No correlation between surface hydrophobicity and IAR was observed. Addition of 5% NaCl during propagation resulted in a decrease in IAR whilst propagation in low nutrient media caused an increase indicating a general change in surface......Some strains of the food borne pathogen Listeria monocytogenes persist in food processing environments. The exact reason behind this phenomenon is not known, but strain differences in the ability to adhere to solid surfaces could offer an explanation. In the present work, initial adhesion of nine...... strains of L. monocytogenes was investigated under liquid flow at two levels of shear stress on six different surfaces using a flow chamber set-up with microscopy measurements. The surfaces tested were glass and PVC, and glass coated with beef extract, casein, and homogenised and unhomogenised milk...
Asian motility studies in irritable bowel syndrome.
Lee, Oh Young
2010-04-01
Altered motility remains one of the important pathophysiologic factors in patients with irritable bowel syndrome (IBS) who commonly complain of abdominal pain and stool changes such as diarrhea and constipation. The prevalence of IBS has increased among Asian populations these days. Gastrointestinal (GI) physiology may vary between Asian and Western populations because of differences in diets, socio-cultural backgrounds, and genetic factors. The characteristics and differences of GI dysmotility in Asian IBS patients were reviewed. MEDLINE search work was performed including following terms, 'IBS,' 'motility,' 'transit time,' 'esophageal motility,' 'gastric motility,' 'small intestinal motility,' 'colonic motility,' 'anorectal function,' and 'gallbladder motility' and over 100 articles were categorized under 'esophagus,' 'stomach,' 'small intestine,' 'colon,' 'anorectum,' 'gallbladder,' 'transit,' 'motor pattern,' and 'effect of stressors.' Delayed gastric emptying, slow tansit in constipation predominant IBS patients, rapid transit in diarrhea predominant IBS patients, accelerated motility responses to various stressors such as meals, mental stress, or corticotrophin releasing hormones, and altered rectal compliance and altered rectal accomodation were reported in many Asian studies regarding IBS. Many conflicting results were found among these studies and there are still controversies to conclude these as unique features of Asian IBS patients. Multinational and multicenter studies are needed to be performed vigorously in order to elaborate characteristics as well as differences of altered motililty in Asian patients with IBS.
Vongkamjan, Kitiya; Benjakul, Soottawat; Kim Vu, Hue Thi; Vuddhakul, Varaporn
2017-09-01
Listeria monocytogenes is a foodborne pathogen commonly found in environments of seafood processing, thus presenting a challenge for eradication from seafood processing facilities. Monitoring the prevalence and subtype diversity of L. monocytogenes together with phages that are specific to Listeria spp. ("Listeria phages") will provide knowledge on the bacteria-phage ecology in food processing plants. In this work, a total of 595 samples were collected from raw material, finished seafood products and environmental samples from different sites of a seafood processing plant during 17 sampling visits in 1.5 years of study. L. monocytogenes and Listeria spp. (non-monocytogenes) were found in 22 (3.7%) and 43 (7.2%) samples, respectively, whereas 29 Listeria phages were isolated from 9 (1.5%) phage-positive samples. DNA fingerprint analysis of L. monocytogenes isolates revealed 11 Random Amplified Polymorphic DNA (RAPD) profiles, with two subtypes were frequently observed over time. Our data reveal a presence of Listeria phages within the same seafood processing environments where a diverse set of L. monocytogenes subtypes was also found. Although serotype 4b was observed at lower frequency, data indicate that isolates from this seafood processing plant belonged to both epidemiologically important serotypes 1/2a and 4b, which may suggest a potential public health risk. Phages (all showed a unique genome size of 65 ± 2 kb) were classified into 9 host range groups, representing both broad- and narrow-host range. While most L. monocytogenes isolates from this facility were susceptible to phages, five isolates showed resistance to 12-20 phages. Variations in phage host range among Listeria phages isolated from food processing plant may affect a presence of a diverse set of L. monocytogenes isolates derived from the same processing environment in Thailand. Copyright © 2017 Elsevier Ltd. All rights reserved.
Esophageal motility abnormalities in gastroesophageal reflux disease
Martinucci, Irene; de Bortoli, Nicola; Giacchino, Maria; Bodini, Giorgia; Marabotto, Elisa; Marchi, Santino; Savarino, Vincenzo; Savarino, Edoardo
2014-01-01
Esophageal motility abnormalities are among the main factors implicated in the pathogenesis of gastroesophageal reflux disease. The recent introduction in clinical and research practice of novel esophageal testing has markedly improved our understanding of the mechanisms contributing to the development of gastroesophageal reflux disease, allowing a better management of patients with this disorder. In this context, the present article intends to provide an overview of the current literature about esophageal motility dysfunctions in patients with gastroesophageal reflux disease. Esophageal manometry, by recording intraluminal pressure, represents the gold standard to diagnose esophageal motility abnormalities. In particular, using novel techniques, such as high resolution manometry with or without concurrent intraluminal impedance monitoring, transient lower esophageal sphincter (LES) relaxations, hypotensive LES, ineffective esophageal peristalsis and bolus transit abnormalities have been better defined and strongly implicated in gastroesophageal reflux disease development. Overall, recent findings suggest that esophageal motility abnormalities are increasingly prevalent with increasing severity of reflux disease, from non-erosive reflux disease to erosive reflux disease and Barrett’s esophagus. Characterizing esophageal dysmotility among different subgroups of patients with reflux disease may represent a fundamental approach to properly diagnose these patients and, thus, to set up the best therapeutic management. Currently, surgery represents the only reliable way to restore the esophagogastric junction integrity and to reduce transient LES relaxations that are considered to be the predominant mechanism by which gastric contents can enter the esophagus. On that ground, more in depth future studies assessing the pathogenetic role of dysmotility in patients with reflux disease are warranted. PMID:24868489
Directory of Open Access Journals (Sweden)
Chong-Tao Du
2018-03-01
Full Text Available The gut microbiota and microRNAs play important roles in the defense against infection. However, the role of miR-146a in L. monocytogenes infection and gut microbiota remains unclear. We tried to determine whether miR-146a controlled L. monocytogenes infection by regulating the gut microbiota. Wild-type and miR-146a-deficient mice or macrophages were used to characterize the impact of miR-146a on animal survival, cell death, bacterial clearance, and gut microbiota following L. monocytogenes challenge. We found that L. monocytogenes infection induced miR-146a expression both in vitro and in vivo. When compared to wild-type mice, miR-146a-deficient mice were more resistant to L. monocytogenes infection. MiR-146a deficiency in macrophages resulted in reduced invasion and intracellular survival of L. monocytogenes. High-throughput sequencing of 16S rRNA revealed that the gut microbiota composition differed between miR-146a-deficient and wild-type mice. Relative to wild-type mice, miR-146a-deficient mice had decreased levels of the Proteobacteria phylum, Prevotellaceae family, and Parasutterella genus, and significantly increased short-chain fatty acid producing bacteria, including the genera Alistipes, Blautia, Coprococcus_1, and Ruminococcus_1. Wild-type mice co-housed with miR-146a-deficient mice had increased resistance to L. monocytogenes, indicating that miR-146a deficiency guides the gut microbiota to alleviate infection. Together, these results suggest that miR-146a deficiency protects against L. monocytogenes infection by regulating the gut microbiota.
Du, Chong-Tao; Gao, Wei; Ma, Ke; Yu, Shui-Xing; Li, Na; Yan, Shi-Qing; Zhou, Feng-Hua; Liu, Zhen-Zhen; Chen, Wei; Lei, Lian-Cheng; Yang, Yong-Jun; Han, Wen-Yu
2018-03-26
The gut microbiota and microRNAs play important roles in the defense against infection. However, the role of miR-146a in L. monocytogenes infection and gut microbiota remains unclear. We tried to determine whether miR-146a controlled L. monocytogenes infection by regulating the gut microbiota. Wild-type and miR-146a-deficient mice or macrophages were used to characterize the impact of miR-146a on animal survival, cell death, bacterial clearance, and gut microbiota following L. monocytogenes challenge. We found that L. monocytogenes infection induced miR-146a expression both in vitro and in vivo. When compared to wild-type mice, miR-146a-deficient mice were more resistant to L. monocytogenes infection. MiR-146a deficiency in macrophages resulted in reduced invasion and intracellular survival of L. monocytogenes . High-throughput sequencing of 16S rRNA revealed that the gut microbiota composition differed between miR-146a-deficient and wild-type mice. Relative to wild-type mice, miR-146a-deficient mice had decreased levels of the Proteobacteria phylum, Prevotellaceae family, and Parasutterella genus, and significantly increased short-chain fatty acid producing bacteria, including the genera Alistipes , Blautia , Coprococcus_1, and Ruminococcus_1 . Wild-type mice co-housed with miR-146a-deficient mice had increased resistance to L. monocytogenes , indicating that miR-146a deficiency guides the gut microbiota to alleviate infection. Together, these results suggest that miR-146a deficiency protects against L. monocytogenes infection by regulating the gut microbiota.
Suppression of Listeria monocytogenes by the Native Micro-Flora in Teewurst Sausage
Directory of Open Access Journals (Sweden)
Michline Brice
2013-10-01
Full Text Available Modern consumers are interested in the use of non-chemical methods to control pathogens when heat sterilization is not an option. Such is the case with teewurst sausage, a raw spreadable sausage and a popular German commodity. Although Listeria was not found in teewurst, the optimal microbial growing conditions of teewurst coupled with the ubiquity of L. monocytogenes in nature, makes the possibility of contamination of products very possible. This pilot study was conducted to examine teewurst’s native micro-flora’s ability to suppress the outgrowth of L. monocytogenes at 10 °C using standard plate counts and PCR-DGGE. Traditional plating methods showed L. monocytogenes growth significantly decreased when in competition with the teewurst’s native micro-flora (p < 0.05. The native micro-flora of the teewurst suppressed the overall growth of L. monocytogenes by an average of two logs, under these conditions. Denaturing Gradient Gel Electrophoresis (DGGE amplicons with unique banding patterns were extracted from DGGE gel for identification. Brochothrix thermosphacta and Lactobacillus curvatus were identified as a part of the teewurst’s native micro-flora. Although the native micro-flora did not decrease L. monocytogenes to below limits of detection, it was enough of a decrease to warrant further investigation.
DEFF Research Database (Denmark)
Prag, Søren; Lepekhin, Eugene A; Kolkova, Kateryna
2002-01-01
Cell migration is required during development of the nervous system. The regulatory mechanisms for this process, however, are poorly elucidated. We show here that expression of or exposure to the neural cell adhesion molecule (NCAM) strongly affected the motile behaviour of glioma cells...... independently of homophilic NCAM interactions. Expression of the transmembrane 140 kDa isoform of NCAM (NCAM-140) caused a significant reduction in cellular motility, probably through interference with factors regulating cellular attachment, as NCAM-140-expressing cells exhibited a decreased attachment...... to a fibronectin substratum compared with NCAM-negative cells. Ectopic expression of the cytoplasmic part of NCAM-140 also inhibited cell motility, presumably via the non-receptor tyrosine kinase p59(fyn) with which NCAM-140 interacts. Furthermore, we showed that the extracellular part of NCAM acted as a paracrine...
International Nuclear Information System (INIS)
Suklim, Kannapha; Flick, George J.; Vichitphan, Kanit
2014-01-01
Blue swimming crab lump (backfin) meat were exposed to 2, 4, and 6 kGy doses of Co 60 irradiation and evaluated for changes in physical, sensory properties, and Listeria monocytogenes inactivation. Irradiation up to 6 kGy resulted in no textural changes (p>0.05) in maximum shear forces; however, these exposures resulted in sensory quality changes (p<0.05) as determined by a triangle overall difference test (n=50) at each irradiation level. Irradiation had no effect (p>0.05) on L ⁎ color value. Irradiation at 4 and 6 kGy resulted in listericidal reductions greater than 6.65 (Department of Medical Science, Ministry of Health, Thailand, [DMST] 1783) and 7.56 logs (DMST 4553). Irradiation doses of 1 and 2 kGy resulted in a reduction of 2.10 and 5.35 logs respectively of L. monocytogenes DMST 1783 and 1.56 and 4.19 logs respectively of L. monocytogenes DMST 4553. The D 10 values of L. monocytogenes DMST 1783 and 4553 were 0.35 and 0.45 kGy. The study indicated that low-dose gamma irradiation would increase the safety of blue swimming crab meat without unacceptable changes in texture and L ⁎ color value. - Highlights: • γ-irradiation up to 6 kGy caused no changes in fresh crab meat textural properties. • γ-irradiation increased safety of ready-to-eat product i.e. fresh crab meat. • γ-irradiation had either listericidal or listeristatic effect on L. monocytogenes. • L. monocytogenes were completely inactivated by 4 kGy and 6 kGy γ-irradiation. • 1–2 kGy lethally injured L. monocytogenes but survivors increased during storage
Marques, Juliana de Lima; Funck, Graciele Daiana; Dannenberg, Guilherme da Silva; Cruxen, Claudio Eduardo Dos Santos; Halal, Shanise Lisie Mello El; Dias, Alvaro Renato Guerra; Fiorentini, Ângela Maria; Silva, Wladimir Padilha da
2017-05-01
The aim of this study was to evaluate the effectiveness of a biodegradable film, with antimicrobial metabolites produced by Lactobacillus curvatus P99 incorporated, targeting the control of Listeria monocytogenes in sliced "Prato" cheese. Tests were performed to evaluate the spectrum of action of cell-free supernatant (CFS) of P99 against different microorganisms, as well as to detect the minimum inhibitory (MIC) and bactericidal (MBC) concentrations against L. monocytogenes Scott A. The detection of genes that encode for the production of bacteriocins and evaluation of their expression were performed. Antimicrobial films were prepared, followed by in vitro and in situ analysis. The MIC and MBC of CFS against L. monocytogenes Scott A was 15.6 μL/mL and 62.5 μL/mL, respectively. Lactobacillus curvatus P99 presented two genes coding for the bacteriocins, which were expressed. Films with added MBC showed activity against different indicator microorganisms and were able to control L. monocytogenes Scott A when used in sliced "Prato" cheese. Copyright © 2016 Elsevier Ltd. All rights reserved.
Social motility in african trypanosomes.
Directory of Open Access Journals (Sweden)
Michael Oberholzer
2010-01-01
Full Text Available African trypanosomes are devastating human and animal pathogens that cause significant human mortality and limit economic development in sub-Saharan Africa. Studies of trypanosome biology generally consider these protozoan parasites as individual cells in suspension cultures or in animal models of infection. Here we report that the procyclic form of the African trypanosome Trypanosoma brucei engages in social behavior when cultivated on semisolid agarose surfaces. This behavior is characterized by trypanosomes assembling into multicellular communities that engage in polarized migrations across the agarose surface and cooperate to divert their movements in response to external signals. These cooperative movements are flagellum-mediated, since they do not occur in trypanin knockdown parasites that lack normal flagellum motility. We term this behavior social motility based on features shared with social motility and other types of surface-induced social behavior in bacteria. Social motility represents a novel and unexpected aspect of trypanosome biology and offers new paradigms for considering host-parasite interactions.
Solar irradiance limits the long-term survival of Listeria monocytogenes in seawater.
NicAogáin, K; Magill, D; O'Donoghue, B; Conneely, A; Bennett, C; O'Byrne, C P
2018-03-01
Seafood has often been implicated in outbreaks of food-borne illness caused by Listeria monocytogenes but the source of contamination is usually not known. In this study we investigated the possibility that this pathogen could survive in seawater for an extended time period. Freshly collected seawater samples were inoculated with 1 × 10 8 CFU per ml of L. monocytogenes EGD-e and survival was monitored by plate counting for up to 25 days. When incubated in the dark, either at ambient temperatures (4-14°C) or at 16°C, >10 4 CFU per ml survivors were present after 25 days. However, when the seawater cell suspensions were exposed to ambient light (solar irradiation) and temperatures, L. monocytogenes lost viability rapidly and no survivors could be detected after the 80 h time point. Both UV-A and visible light in the blue region of the spectrum (470 nm) were found to contribute to this effect. The stress inducible sigma factor σ B was found to play a role in survival of L. monocytogenes in seawater. Together these data demonstrate that solar irradiation is a critical determinant of L. monocytogenes survival in marine environments. The data further suggest the possibility of controlling this food-borne pathogen in food-processing environments using visible light. Listeria monocytogenes is a food-borne bacterial pathogen capable of causing the life-threatening infection, listeriosis. In seafood the route of contamination from the environment is often not well understood as this pathogen is not generally thought to survive well in seawater. Here we provide evidence that L. monocytogenes is capable of surviving for long periods of time in seawater when light is excluded. Sunlight is demonstrated to have a significant effect on the survival of this pathogen in seawater, and both visible (470 nm) and UV-A light are shown to contribute to this effect. © 2017 The Society for Applied Microbiology.
Listeria monocytogenes serotype prevalence and biodiversity in diverse food products.
Hadjilouka, Agni; Andritsos, Nikolaos D; Paramithiotis, Spiros; Mataragas, Marios; Drosinos, Eleftherios H
2014-12-01
The aim of this study was to assess serotype prevalence and biodiversity of Listeria monocytogenes strains isolated from diverse food products, i.e., minced pork, fruits, and vegetables. Three hundred twenty-six samples previously purchased from supermarkets and street markets within the Athens area were studied for L. monocytogenes prevalence. A total of 121 strains were isolated from the 36 samples that were positive for L. monocytogenes. Serotyping was performed with multiplex PCR, and biodiversity was assessed with random amplified polymorphic DNA (RAPD) PCR analysis using M13, UBC155, and HLWL85 as primers and with repetitive element palindromic (rep) PCR analysis using (GTG)5 as the primer. The majority (17 of 22) of the contaminated minced pork samples contained strains identified as serotype 1/2a, either alone or in combination with strains belonging to serotypes 1/2b, 4a, 4c, or 4ab. However, all L. monocytogenes isolates from fruits and vegetables belonged to serotype 4b. Rep-PCR provided better differentiation of the isolates than did RAPD PCR and resulted in discrimination of the isolates into a larger number of unique profiles. Complete differentiation was achieved only with the combination of these subtyping techniques.
COMPARISON OF TWO METHODS FOR THE DETECTION OF LISTERIA MONOCYTOGENES
Directory of Open Access Journals (Sweden)
G. Tantillo
2013-02-01
Full Text Available The aim of this study was to compare the performance of the conventional methods for detection of Listeria monocytogenes in food using media Oxford and ALOA (Agar Listeria acc. to Ottaviani & Agosti in according to the ISO 11290-1 to a new chromogenic medium “CHROMagar Listeria” standardized in 2005 AFNOR ( CHR – 21/1-12/01. A total of 40 pre-packed ready-to-eat food samples were examined. Using two methods six samples were found positive for Listeria monocytogenes but the medium “CHROMagar Listeria” was more selective in comparison with the others. In conclusion this study has demonstrated that isolation medium able to target specifically the detection of L. monocytogenes such as “CHROMagar Listeria” is highly recommendable because of that detection time is significantly reduced and the analysis cost is less expensive.
Dietary probiotic supplement positively affects sperm motility in obese murine models
DEFF Research Database (Denmark)
Dardmeh, Fereshteh; Alipour, Hiva; Gazerani, Parisa
2015-01-01
Obesity in adult men in recent years has inconsistently been associated with low semen quality and sub-fecundity. Probiotics have gained high interest as alternatives to pharmacological compounds. However, their possible effect on male fertility has been less investigated. This study aimed...... dose (1x109CFU) of L.Rhamnusus (test group) or physiological saline (control group) for 4 weeks. Sperm motility and kinematics were assessed by the Sperm Class Analyzer (SCA). The control group maintained a raising trend in weight gain leading to a significant difference on week 5 continuing to week 8...... whereas the DIO mice in the test group did not gain significant weight after the start of probiotic test. The test group showed a significantly higher progressive motility compared to the control group after 4 weeks of receiving the probiotic treatment. L.Rhamnusus supplementation demonstrated a higher...
Williams, Shanna K; Roof, Sherry; Boyle, Elizabeth A; Burson, Dennis; Thippareddi, Harshavardhan; Geornaras, Ifigenia; Sofos, John N; Wiedmann, Martin; Nightingale, Kendra
2011-01-01
A longitudinal study was conducted to track Listeria contamination patterns in ready-to-eat meats from six small or very small meat processing plants located in three states over 1 year. A total of 688 environmental sponge samples were collected from nonfood contact surfaces during bimonthly visits to each plant. Overall, L. monocytogenes was isolated from 42 (6.1%) environmental samples, and its prevalence ranged from 1.7 to 10.8% across different plants. Listeria spp., other than L. monocytogenes, were isolated from 9.5% of samples overall, with the prevalence ranging from 1.5 to 18.3% across different plants. The prevalence of L. monocytogenes correlated well with that of other Listeria spp. for some but not all plants. One L. monocytogenes isolate representing each positive sample was characterized by molecular serotyping, EcoRI ribotyping, and pulsed-field gel electrophoresis typing. Seven sample sites tested positive for L. monocytogenes on more than one occasion, and the same ribotype was detected more than once at five of these sites. Partial sigB sequencing was used to speciate other Listeria spp. isolates and assign an allelic type to each isolate. Other Listeria spp. were isolated more than once from 14 sample sites, and the same sigB allelic type was recovered at least twice from seven of these sites. One plant was colonized by an atypical hemolytic L. innocua strain. Our findings indicate that small and very small meat processing plants that produce ready-to-eat meat products are characterized by a varied prevalence of Listeria, inconsistent correlation between contamination by L. monocytogenes and other Listeria spp., and a unique Listeria molecular ecology.
Locatelli, Aude; Lewis, Micah A.; Rothrock, Michael J.
2017-01-01
The occurrence of Listeria monocytogenes has been widely investigated in the poultry production chain from the processing plant to the final product. However, limited data are available on Listeria species, including Listeria monocytogenes, in the poultry farm environment. Therefore, fecal and soil samples from 37 pastured poultry flocks from 10 all-natural farms over 3 years were assessed to determine the prevalence and diversity of Listeria within these alternative poultry farm environments using standard cultural and molecular methods. Listeria species were isolated in 15% of poultry farm samples and included Listeria innocua (65.7%), L. monocytogenes (17.4%), and Listeria welshimeri (15.1%). Additional multiplex PCR serotyping showed group 1/2a-3a to be the most dominant L. monocytogenes serovar group. Based on these results, monoculture growth experiments were conducted on four Listeria soil isolates (three L. monocytogenes isolates representing the three recovered serovar groups and one L. innocua isolate) to determine if culture medium [tripticase soy broth (TSB) and University of Vermont modified Listeria enrichment broth (UVM)], inoculum concentration (102 or 105 CFU/ml), or incubation temperature (20, 30, and 42°C) differentially affected these Listeria species. Overall, very few significant growth differences were observed between the behavior of the three L. monocytogenes isolates (representing the three recovered serovar groups) under the growth conditions tested. Alternatively, at 30°C in UVM with the lower inoculum concentration, the L. innocua isolate had a significantly shorter lag phase than the L. monocytogenes isolates. In coculture growth studies under these same incubation conditions, the lag phase of L. innocua and L. monocytogenes was similar, but the final concentration of L. innocua was significantly higher than L. monocytogenes. However, cocultures in UVM for high inoculum concentration did not show preferential growth of L. innocua
Locatelli, Aude; Lewis, Micah A; Rothrock, Michael J
2017-01-01
The occurrence of Listeria monocytogenes has been widely investigated in the poultry production chain from the processing plant to the final product. However, limited data are available on Listeria species, including Listeria monocytogenes , in the poultry farm environment. Therefore, fecal and soil samples from 37 pastured poultry flocks from 10 all-natural farms over 3 years were assessed to determine the prevalence and diversity of Listeria within these alternative poultry farm environments using standard cultural and molecular methods. Listeria species were isolated in 15% of poultry farm samples and included Listeria innocua (65.7%), L. monocytogenes (17.4%), and Listeria welshimeri (15.1%). Additional multiplex PCR serotyping showed group 1/2a-3a to be the most dominant L. monocytogenes serovar group. Based on these results, monoculture growth experiments were conducted on four Listeria soil isolates (three L. monocytogenes isolates representing the three recovered serovar groups and one L. innocua isolate) to determine if culture medium [tripticase soy broth (TSB) and University of Vermont modified Listeria enrichment broth (UVM)], inoculum concentration (10 2 or 10 5 CFU/ml), or incubation temperature (20, 30, and 42°C) differentially affected these Listeria species. Overall, very few significant growth differences were observed between the behavior of the three L. monocytogenes isolates (representing the three recovered serovar groups) under the growth conditions tested. Alternatively, at 30°C in UVM with the lower inoculum concentration, the L. innocua isolate had a significantly shorter lag phase than the L. monocytogenes isolates. In coculture growth studies under these same incubation conditions, the lag phase of L. innocua and L. monocytogenes was similar, but the final concentration of L. innocua was significantly higher than L. monocytogenes . However, cocultures in UVM for high inoculum concentration did not show preferential growth of L
Directory of Open Access Journals (Sweden)
Shi eWu
2016-02-01
Full Text Available Eighty Listeria monocytogenes isolates were obtained from Chinese retail ready-to-eat (RTE food and were previously characterized with serotyping and antibiotic susceptibility tests. The aim of this study was to characterize the subtype and virulence potential of these L. monocytogenes isolates by multilocus sequence typing (MLST, virulence-associate genes, epidemic clones (ECs and sequence analysis of the important virulence factor: internalin A (inlA. The result of MLST revealed that these L. monocytogenes isolates belonged to 14 different sequence types (STs. With the exception of four new STs (ST804, ST805, ST806 and ST807, all other STs observed in this study have been associated with human listeriosis and outbreaks to varying extents. Six virulence-associate genes (inlA, inlB, inlC, inlJ, hly and llsX were selected and their presence was investigated using PCR. All strains carried inlA, inlB, inlC, inlJ, and hly, whereas 38.8% (31/80 of strains harbored the listeriolysin S genes (llsX. A multiplex PCR assay was used to evaluate the presence of markers specific to epidemic clones of L. monocytogenes and identified 26.3% (21/80 of ECI in the 4b-4d-4e strains. Further study of inlA sequencing revealed that most strains contained the full-length InlA required for host cell invasion, whereas three mutations lead to premature stop codons (PMSC within a novel PMSCs at position 326 (GAA→TAA. MLST and inlA sequence analysis results were concordant, and different virulence potentials within isolates were observed. These findings suggest that L. monocytogenes isolates from RTE food in China could be virulent and be capable of causing human illness. Furthermore, the STs and virulence profiles of L. monocytogenes isolates have significant implications for epidemiological and public health studies of this pathogen.
Wu, Shi; Wu, Qingping; Zhang, Jumei; Chen, Moutong; Guo, Weipeng
2016-01-01
Eighty Listeria monocytogenes isolates were obtained from Chinese retail ready-to-eat (RTE) food and were previously characterized with serotyping and antibiotic susceptibility tests. The aim of this study was to characterize the subtype and virulence potential of these L. monocytogenes isolates by multilocus sequence typing (MLST), virulence-associate genes, epidemic clones (ECs), and sequence analysis of the important virulence factor: internalin A (inlA). The result of MLST revealed that these L. monocytogenes isolates belonged to 14 different sequence types (STs). With the exception of four new STs (ST804, ST805, ST806, and ST807), all other STs observed in this study have been associated with human listeriosis and outbreaks to varying extents. Six virulence-associate genes (inlA, inlB, inlC, inlJ, hly, and llsX) were selected and their presence was investigated using PCR. All strains carried inlA, inlB, inlC, inlJ, and hly, whereas 38.8% (31/80) of strains harbored the listeriolysin S genes (llsX). A multiplex PCR assay was used to evaluate the presence of markers specific to epidemic clones of L. monocytogenes and identified 26.3% (21/80) of ECI in the 4b-4d-4e strains. Further study of inlA sequencing revealed that most strains contained the full-length InlA required for host cell invasion, whereas three mutations lead to premature stop codons (PMSC) within a novel PMSCs at position 326 (GAA → TAA). MLST and inlA sequence analysis results were concordant, and different virulence potentials within isolates were observed. These findings suggest that L. monocytogenes isolates from RTE food in China could be virulent and be capable of causing human illness. Furthermore, the STs and virulence profiles of L. monocytogenes isolates have significant implications for epidemiological and public health studies of this pathogen.
Directory of Open Access Journals (Sweden)
Atefeh Taherkhani
2013-01-01
Full Text Available Aims: The objective of this study was to evaluate the prevalence of Listeria spp. in the river water before and after discharge of the effluent of the municipal wastewater treatment plant (WWTP in Isfahan, Iran. Materials and Methods: A total of 66 samples were collected bi-weekly over 4 months from eleven discrete sampling locations in Zayandehrood River, Iran. Three sampling sites were located above the discharge point and five sites were located after the discharge point of WWTP. Samples were also collected from the influent and the effluent of WWTP. Listeria spp. were isolated using a selective enrichment procedure and a subculture onto polymyxin-acriflavine-lithium chloride-ceftazidime-esculin-mannitol Agar. All isolates were subjected to standard biochemical tests. Results: L. monocytogenes was isolated from influent (83%, effluent (50% and (18.5% river water. Listeria spp. was not found before the discharge point in river water. However, L. monocytogenes was isolated in samples collected from 200 m (33%, 500 m (33%, 2 km (16.5%, 5 km (16.5% and 10 km (16.5% downstream from the WWTP. Listeria innocua (9% and Listeria seeligeri (10% were the second most frequently isolated species. Conclusion: During the wastewater treatment, Listeria spp. is not removed completely. L. monocytogenes is widely distributed in the Zayandehrood river. L. monocytogenes released into surface water demonstrates a potential risk for public health. These results indicate the need for appropriate water management in order to reduce human and animal exposure to such pathogens.
Effect of voltage-gated sodium channels blockers on motility and viability of human sperm in vitro
Directory of Open Access Journals (Sweden)
Hammad Ahmad Gakhar
2018-01-01
Full Text Available Objective: To test the effect of voltage-gated sodium channels (VGSCs blockers on the motility and viability of human sperm in-vitro and to evaluate the tested compounds as potential contact spermicidal.Methods: Sperm samples were obtained from healthy nonsmoking volunteers of age 25-30 years who had not taken any drug 3 months before and during the course of the study. The effect of VGSCs blockers evaluated from two pharmacological classes including antiarrhythmic (amiodarone, procainamide and disopyramide and antiepileptic (carbamazepine, oxcarbazepine, phenytoin, and lamotrigine drugs. They were tested on the in-vitro motility and viability of human sperm using Computer Assisted Semen Analyzer.Results: All tested drugs except oxcarbazepine showed dose dependent inhibition of total motility with significant reduction (P<0.05 at the maximum concentration of 200 μΜ when compared with the control. The concentrations of drugs that reduced total sperm motility to 50% of control (half maximal inhibitory concentration were 2.76, 14.16 and 20.29 μΜ for phenytoin, lamotrigine and carbamazepine, respectively; and 2.53, 5.32 and 0.37 μΜ for amiodarone, procainamide and disopyramide, respectively. The anti-motility effects were reversible to various degrees. There was statistically insignificant difference in the inhibition of sperm viability among amiodarone, procainamide and disopyramide. Phenytoin demonstrated the most potent spermicidal action.Conclusions: VGSCs blockers have significant adverse effects on in-vitro motility of human spermatozoa. So in-vivo studies are required to determine their potential toxicological effects on human semen quality, which is an important factor regarding fertility. Moreover, these drugs have the potential to be developed into contact spermicidal.
Gelbícová, T; Karpísková, R
2012-04-01
Evaluation of the incidence and characteristics of L. monocytogenes in samples of raw cow's milk collected on farms (bulk tank milk samples) and from vending machines. Detection of L. monocytogenes and enumeration were carried out according to EN/ISO 11290--1, 2. Strains were characterised by serotyping and macrorestriction analysis using pulsed-field gel electrophoresis. The presence of L. monocytogenes was detected in 3,2 % (11/346) of bulk tank milk samples and 1,8 % (4/219) samples of raw cow's milk from vending machines. Findings of L. monocytogenes in raw milk were sporadic. Only on one farm strains of L. monocytogenes were detected repeatedly. Thirteen strains of L. monocytogenes belonged to serotype 1/2a, two strains to serotype 1/2b and one to serotype 4b. Macrorestriction analysis revealed considerable heterogeinity of profiles, with nine different pulsotypes being detected. Pulsotype 711 was the most frequent. This pulsotype was found on three different farms. The incidence of L. monocytogenes in raw cow's milk is relatively low in the Czech Republic. The results confirmed that some clones of L. monocytogenes from raw milk are identical with food and human strains.
Radiation-induced motility alterations in medulloblastoma cells
International Nuclear Information System (INIS)
Rieken, Stefan; Rieber, Juliane; Brons, Stephan
2015-01-01
Photon irradiation has been repeatedly suspected of increasing tumor cell motility and promoting locoregional recurrence of disease. This study was set up to analyse possible mechanisms underlying the potentially radiation-altered motility in medulloblastoma cells. Medulloblastoma cell lines D425 and Med8A were analyzed in migration and adhesion experiments with and without photon and carbon ion irradiation. Expression of integrins was determined by quantitative FACS analysis. Matrix metalloproteinase concentrations within cell culture supernatants were investigated by enzyme-linked immunosorbent assay (ELISA). Statistical analysis was performed using Student's t-test. Both photon and carbon ion irradiation significantly reduced chemotactic medulloblastoma cell transmigration through 8-μm pore size membranes, while simultaneously increasing adherence to fibronectin- and collagen I- and IV-coated surfaces. Correspondingly, both photon and carbon ion irradiation downregulate soluble MMP9 concentrations, while upregulating cell surface expression of proadhesive extracellular matrix protein-binding integrin α 5 . The observed phenotype of radiation-altered motility is more pronounced following carbon ion than photon irradiation. Both photon and (even more so) carbon ion irradiation are effective in inhibiting medulloblastoma cell migration through downregulation of matrix metalloproteinase 9 and upregulation of proadhesive cell surface integrin α 5 , which lead to increased cell adherence to extracellular matrix proteins. (author)
Directory of Open Access Journals (Sweden)
J.A. Khan
2013-09-01
Full Text Available Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO. A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG; R: CCTCCAGAGTGATCGATGTT complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR. PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%, followed by fish meat (4.0%, and then beef (2.5%. Among various milk and milk products, curd (2.0% showed the highest prevalence, followed by raw milk (1.3%. The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 µL and 50 µL of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro resulted positive in twenty four
Martínez-Gonzáles, N E; Martínez-Chávez, L; Cabrera-Díaz, E; Martínez-Cárdenas, C; Gutiérrez-González, P; Castillo, A
2016-05-01
Polymyxin Ceftazidime Oxford Medium (PCOM), a novel selective and differential plating medium for Listeria monocytogenes was compared with Modified Oxford Agar (MOX) for efficacy to isolate L. monocytogenes and other Listeria spp. naturally present in non-pasteurized Mexican-style cheese (n = 50), non-pasteurized fresh squeezed orange juice (n = 50), raw beef chunks (n = 36), and fresh cabbage (n = 125). Samples were collected from retail markets and farms in Mexico and tested following the US Department of Agriculture enrichment technique. Listeria spp. were isolated from 23.4% of analyzed samples, and from those, 75.0% corresponded to raw beef chunks, 38.0% to non-pasteurized Mexican-style cheese, and 30.0% to fresh squeezed orange juice. No Listeria spp. were isolated from fresh cabbage samples. L. monocytogenes was recovered from 15.3% of food samples analyzed. Non-pasteurized Mexican-style cheese showed the highest proportion of L. monocytogenes positive samples (36.0%), followed by orange juice (26.0%) and raw beef (25.0%). The frequency of isolation of Listeria spp. and L. monocytogenes was not different (P > 0.05) between PCOM and MOX. The advantages of using PCOM when comparing to MOX, include the easier way to identify Listeria species, the lower cost per plate and the availability of its ingredients for Latin-American countries. Copyright © 2015 Elsevier Ltd. All rights reserved.
Caggiano, Giuseppina; De Giglio, Osvalda; Lovero, Grazia; Rutigliano, Serafina; Diella, Giusy; Balbino, Stella; Napoli, Christian; Montagna, Maria Teresa
2015-01-01
Listeria monocytogenes is currently considered a relevant emerging food-borne pathogen. In particular, the European Centre for Disease Prevention and Control (ECDC) illustrates its widespread presence in different foods. In the present article, L. monocytogenes prevalence was estimated in cooked ready-to-eat foods sampled from a catering service in a Apulia city, southern Italy. The study was carried out from January to June 2014 in according to Regulation (EC) No. 852/2004, and ISO 11290-1:1996/Amd.1:2004 methods. Listeria spp. was isolated in 8.3% of the samples: L. monocytogenes was identified with the highest prevalence in potato gateau (66.6%), followed by rice dishes (11.1%), Listeria innocua was isolated from potato purea (11.1%) and cooked vegetables (11.1%). These preliminary results confirm the diffusion of the microorganism in ready-to-eat products; therefore, strategies aimed at protecting the consumers should be adopted. First of all, correct hygiene procedures should be followed and then microbiological tests should be implemented in order to early detect Listeria spp. (not only LM) contamination in cooked foods.
LACTIC FLORA-LISTERIA MONOCYTOGENES INTERACTION
Directory of Open Access Journals (Sweden)
S. Colombo
2012-08-01
Full Text Available The EC Regulation 2073/2005 (1 requires that food processors evaluate the capability of ready-to-use (RTE products to support the development of Listeria monocytogenes when their pH and aW values are favourable to the growth of this microorganism. It is renown that the lactic flora plays an important role in many different foods, both from a technological and a food safety standpoint. This study was aimed to observe the behaviour and the potential anti-Listeria effect of some natural lactic flora present in Italian liver patè crostini (chicken heart and liver, anchovies, onions, capers, starch, no added preservatives through the Combase Predictor – Max Growth Rate predictive software. The natural lactic flora of the crostini demonstrated a variable capability to inhibit the growth of Listeria monocytogenes which depends upon : the concentration of the lactic flora at the beginning of the shelf life period and the subsequent lag phase, the possible release of anti-Listeria substances, and the maximum growth rate.
Inactivation of Listeria monocytogenes in milk by pulsed electric field.
Reina, L D; Jin, Z T; Zhang, Q H; Yousef, A E
1998-09-01
Pasteurized whole, 2%, and skim milk were inoculated with Listeria monocytogenes Scott A and treated with high-voltage pulsed electric field (PEF). The effects of milk composition (fat content) and PEF parameters (electric field strength, treatment time, and treatment temperature) on the inactivation of the bacterium were studied. No significant differences were observed in the inactivation of L. monocytogenes Scott A in three types of milk by PEF treatment. With treatment at 25 degrees C, 1- to 3-log reductions of L. monocytogenes were observed. PEF lethal effect was a function of field strength and treatment time. Higher field strength or longer treatment time resulted in a greater reduction of viable cells. A 4-log reduction of the bacterium was obtained by increasing the treatment temperature to 50 degrees C. Results indicate that the use of a high-voltage PEF is a promising technology for inactivation of foodborne pathogens.
Listeria monocytogenes inhibition by defatted mustard meal-based edible films.
Lee, Hahn-Bit; Noh, Bong Soo; Min, Sea C
2012-02-01
An antimicrobial edible film was developed from defatted mustard meal (Sinapis alba) (DMM), a byproduct from the bio-fuel industry, without incorporating external antimicrobials and its antimicrobial activity against Listeria monocytogenes and physical properties were investigated. The DMM colloidal solution consisting of 184 g water, 14 g DMM, and 2g glycerol was homogenized and incubated at 37°C for 0.2, 0.5, 24 or 48 h to prepare a film-forming solution. The pH of a portion of the film-forming solution (pH 5.5) was adjusted to 2.0 or 4.0. Films were formed by drying the film-forming solutions at 23°C for 48 h. The film-forming solution incubated for 48 h inhibited L. monocytogenes in broth and on agar media. Antimicrobial effects of the film prepared from the 48 h-incubated solution increased with decrease in pH of the solution from 5.5 to 2.0. The film from the film forming solution incubated for 48 h (pH 2.0) initially inhibited more than 4.0 log CFU/g of L. monocytogenes inoculated on film-coated salmon. The film-coating retarded the growth of L. monocytogenes in smoked salmon at 5, 10, and 15°C and the antimicrobial effect during storage was more noticeable when the coating was applied before inoculation than when it was applied after inoculation. The tensile strength, percentage elongation, solubility in watercxu, and water vapor permeability of the anti microbial film were 2.44 ± 0.19 MPa, 6.40 ± 1.13%, 3.19 ± 0.90%, and 3.18 ± 0.63 gmm/kPa hm(2), respectively. The antimicrobial DMM films have demonstrated a potential to be applied to foods as wraps or coatings to control the growth of L. monocytogenes. Copyright © 2011 Elsevier B.V. All rights reserved.
Flagellar motility confers epiphytic fitness advantages upon Pseudomonas syringae
International Nuclear Information System (INIS)
Haefele, D.M.; Lindow, S.E.
1987-01-01
The role of flagellar motility in determining the epiphytic fitness of an ice-nucleation-active strain of Pseudomonas syringae was examined. The loss of flagellar motility reduced the epiphytic fitness of a normally motile P. syringae strain as measured by its growth, survival, and competitive ability on bean leaf surfaces. Equal population sizes of motile parental or nonmotile mutant P. syringae strains were maintained on bean plants for at least 5 days following the inoculation of fully expanded primary leaves. However, when bean seedlings were inoculated before the primary leaves had expanded and bacterial populations on these leaves were quantified at full expansion, the population size of the nonmotile derivative strain reached only 0.9% that of either the motile parental or revertant strain. When fully expanded bean primary leaves were coinoculated with equal numbers of motile and nonmotile cells, the population size of a nonmotile derivative strain was one-third of that of the motile parental or revertant strain after 8 days. Motile and nonmotile cells were exposed in vitro and on plants to UV radiation and desiccating conditions. The motile and nonmotile strains exhibited equal resistance to both stresses in vitro. However, the population size of a nonmotile strain on leaves was less than 20% that of a motile revertant strain when sampled immediately after UV irradiation. Epiphytic populations of both motile and nonmotile P. syringae declined under desiccating conditions on plants, and after 8 days, the population size of a nonmotile strain was less than one-third that of the motile parental or revertant strain
Novel Biocontrol Methods for Listeria monocytogenes Biofilms in Food Production Facilities
Directory of Open Access Journals (Sweden)
Jessica A. Gray
2018-04-01
Full Text Available High mortality and hospitalization rates have seen Listeria monocytogenes as a foodborne pathogen of public health importance for many years and of particular concern for high-risk population groups. Food manufactures face an ongoing challenge in preventing the entry of L. monocytogenes into food production environments (FPEs due to its ubiquitous nature. In addition to this, the capacity of L. monocytogenes strains to colonize FPEs can lead to repeated identification of L. monocytogenes in FPE surveillance. The contamination of food products requiring product recall presents large economic burden to industry and is further exacerbated by damage to the brand. Poor equipment design, facility layout, and worn or damaged equipment can result in Listeria hotspots and biofilms where traditional cleaning and disinfecting procedures may be inadequate. Novel biocontrol methods may offer FPEs effective means to help improve control of L. monocytogenes and decrease cross contamination of food. Bacteriophages have been used as a medical treatment for many years for their ability to infect and lyse specific bacteria. Endolysins, the hydrolytic enzymes of bacteriophages responsible for breaking the cell wall of Gram-positive bacteria, are being explored as a biocontrol method for food preservation and in nanotechnology and medical applications. Antibacterial proteins known as bacteriocins have been used as alternatives to antibiotics for biopreservation and food product shelf life extension. Essential oils are natural antimicrobials formed by plants and have been used as food additives and preservatives for many years and more recently as a method to prevent food spoilage by microorganisms. Competitive exclusion occurs naturally among bacteria in the environment. However, intentionally selecting and applying bacteria to effect competitive exclusion of food borne pathogens has potential as a biocontrol application. This review discusses these novel biocontrol
Novel Biocontrol Methods for Listeria monocytogenes Biofilms in Food Production Facilities
Gray, Jessica A.; Chandry, P. Scott; Kaur, Mandeep; Kocharunchitt, Chawalit; Bowman, John P.; Fox, Edward M.
2018-01-01
High mortality and hospitalization rates have seen Listeria monocytogenes as a foodborne pathogen of public health importance for many years and of particular concern for high-risk population groups. Food manufactures face an ongoing challenge in preventing the entry of L. monocytogenes into food production environments (FPEs) due to its ubiquitous nature. In addition to this, the capacity of L. monocytogenes strains to colonize FPEs can lead to repeated identification of L. monocytogenes in FPE surveillance. The contamination of food products requiring product recall presents large economic burden to industry and is further exacerbated by damage to the brand. Poor equipment design, facility layout, and worn or damaged equipment can result in Listeria hotspots and biofilms where traditional cleaning and disinfecting procedures may be inadequate. Novel biocontrol methods may offer FPEs effective means to help improve control of L. monocytogenes and decrease cross contamination of food. Bacteriophages have been used as a medical treatment for many years for their ability to infect and lyse specific bacteria. Endolysins, the hydrolytic enzymes of bacteriophages responsible for breaking the cell wall of Gram-positive bacteria, are being explored as a biocontrol method for food preservation and in nanotechnology and medical applications. Antibacterial proteins known as bacteriocins have been used as alternatives to antibiotics for biopreservation and food product shelf life extension. Essential oils are natural antimicrobials formed by plants and have been used as food additives and preservatives for many years and more recently as a method to prevent food spoilage by microorganisms. Competitive exclusion occurs naturally among bacteria in the environment. However, intentionally selecting and applying bacteria to effect competitive exclusion of food borne pathogens has potential as a biocontrol application. This review discusses these novel biocontrol methods and their
Curriculum for neurogastroenterology and motility training
DEFF Research Database (Denmark)
Gyawali, C P; Savarino, E; Lazarescu, A
2018-01-01
Although neurogastroenterology and motility (NGM) disorders are some of the most frequent disorders encountered by practicing gastroenterologists, a structured competency-based training curriculum developed by NGM experts is lacking. The American Neurogastroenterology and Motility Society (ANMS) ...
Aparecida de Oliveira, Maria; Abeid Ribeiro, Eliana Guimarães; Morato Bergamini, Alzira Maria; Pereira De Martinis, Elaine Cristina
2010-02-01
Modern lifestyle markedly changed eating habits worldwide, with an increasing demand for ready-to-eat foods, such as minimally processed fruits and leafy greens. Packaging and storage conditions of those products may favor the growth of psychrotrophic bacteria, including the pathogen Listeria monocytogenes. In this work, minimally processed leafy vegetables samples (n = 162) from retail market from Ribeirão Preto, São Paulo, Brazil, were tested for the presence or absence of Listeria spp. by the immunoassay Listeria Rapid Test, Oxoid. Two L. monocytogenes positive and six artificially contaminated samples of minimally processed leafy vegetables were evaluated by the Most Probable Number (MPN) with detection by classical culture method and also culture method combined with real-time PCR (RTi-PCR) for 16S rRNA genes of L. monocytogenes. Positive MPN enrichment tubes were analyzed by RTi-PCR with primers specific for L. monocytogenes using the commercial preparation ABSOLUTE QPCR SYBR Green Mix (ABgene, UK). Real-time PCR assay presented good exclusivity and inclusivity results and no statistical significant difference was found in comparison with the conventional culture method (p < 0.05). Moreover, RTi-PCR was fast and easy to perform, with MPN results obtained in ca. 48 h for RTi-PCR in comparison to 7 days for conventional method.
Evaluation of a monoclonal antibody able to detect live Listeria monocytogenes and Listeria innocua
DEFF Research Database (Denmark)
Sølve, Marianne; Boel, Jeppe; Nørrung, Birgit
2000-01-01
A monoclonal Listeria antibody, designated B4, was evaluated. The ability of the antibody to bind to viable bacteria belonging to Listeria spp, compared to bacteria of the same species killed by beat treatment, acid or base treatment, sanitizers, and irradiation was examined. The antibody was found...... to react with viable L. monocytogenes and L. innocua, but not with heat-killed (72 degrees C, 5 min) strains of these organisms. When L. monocytogenes and L. innocua were killed by methods other than heat treatment, it was ambiguous whether the antibody detected the organism or not. It was concluded...... that the B4 antibody has potential to be used in an immune capture step to capture live L, monocytogenes and L. innocua from foods prior to identification of L. monocytogenes by polymerase chain reaction (PCR)....
Plankton motility patterns and encounter rates
DEFF Research Database (Denmark)
Visser, Andre; Kiørboe, Thomas
2006-01-01
measure of run length to reaction distance determines whether the underlying encounter is ballistic or diffusive. Since ballistic interactions are intrinsically more efficient than diffusive, we predict that organisms will display motility with long correlation run lengths compared to their reaction...... distances to their prey, but short compared to the reaction distances of their predators. We show motility data for planktonic organisms ranging from bacteria to copepods that support this prediction. We also present simple ballistic and diffusive motility models for estimating encounter rates, which lead...
DEFF Research Database (Denmark)
Nightingale, K. K.; Lyles, K.; Ayodele, M.
2006-01-01
population are identified (TreeStats test). Analysis of sequence data for 120 L. monocytogenes isolates revealed evidence of clustering between isolates from the same source, based on the phylogenies inferred from actA and inlA (P = 0.02 and P = 0.07, respectively; SourceCluster test). Overall, the Tree...... are biologically valid. Overall, our data show that (i) the SourceCluster and TreeStats tests can identify biologically meaningful source-associated phylogenetic clusters and (ii) L. monocytogenes includes clonal groups that have adapted to infect specific host species or colonize nonhost environments......., including humans, animals, and food. If the null hypothesis that the genetic distances for isolates within and between source populations are identical can be rejected (SourceCluster test), then particular clades in the phylogenetic tree with significant overrepresentation of sequences from a given source...
Listeria monocytogenes : nog steeds een probleem?
Beumer, R.R.
2011-01-01
Listeria monocytogenes is net als vele andere bacteriële voedselpathogenen al tientallen jaren bekend. De meeste grondstoffen voor voedingsmiddelen komen uit de akker- en tuinbouw, de veehouderij en de visserij. Besmetting vindt daar plaats met micro-organismen afkomstig uit grond, fecaliën, water,
Ketotifen, a mast cell blocker improves sperm motility in asthenospermic infertile men
Directory of Open Access Journals (Sweden)
Nasrin Saharkhiz
2013-01-01
Full Text Available Aim: This study aimed to evaluate the efficacy of ketotifen on sperm motility of asthenospermic infertile men. Setting and Design: It is a prospective study designed in vivo. Materials and Methods: In this interventional experimental study, a total of 40 infertile couples with asthenospermic infertility factor undergoing assisted reproductive technology (ART cycles were enrolled. The couples were randomly assigned to one of two groups at the starting of the cycle. In control group (n = 20, the men did not receive Ketotifen, while in experiment group (n = 20, the men received oraly ketotifen (1 mg Bid for 2 months. Semen analysis, under optimal circumferences, was obtained prior to initiation of treatment. The second semen analysis was done 2-3 weeks after stopped ketotifen treatment and sperm motility was defined. Clinical pregnancy was identified as the presence of a fetal sac by vaginal ultrasound examination. Statistical Analysis Used: All data are expressed as the mean ± standard error of mean (SEM. t test was used for comparing the data of the control and treated groups. Results: The mean sperm motility increased significantly (from 16.7% to 21.4% after ketotifen treatment (P < 0.001. This sperm motility improvement was more pronounced in the primary infertility cases (P < 0.003. The rate of pregnancy was 12.5% in infertile couples that their men receiving 1 mg/twice a day ketotifen. In 52% of infertile men′s semen, the percentage of sperm motility was increased from 5% to 35% and this sperm motility improvement was also observed in 33% of necrospermia (0% motility cases. Conclusion: These results suggest that ketotifen may represent as a novel therapeutic approach to improve sperm motility in the infertile men with cause of asthenospermia or necrospermia.
Hwang, Cheng-An; Sheen, Shiowshuh
2011-05-01
This study examined the growth characteristics of Listeria monocytogenes as affected by a native microflora in cooked ham at refrigerated and abuse temperatures. A five-strain mixture of L. monocytogenes and a native microflora, consisting of Brochothrix spp., isolated from cooked meat were inoculated alone (monocultured) or co-inoculated (co-cultured) onto cooked ham slices. The growth characteristics, lag phase duration (LPD, h), growth rate (GR, log(10) cfu/h), and maximum population density (MPD, log(10) cfu/g), of L. monocytogenes and the native microflora in vacuum-packed ham slices stored at 4, 6, 8, 10, and 12 °C for up to 5 weeks were determined. At 4-12 °C, the LPDs of co-cultured L. monocytogenes were not significantly different from those of monocultured L. monocytogenes in ham, indicating the LPDs of L. monocytogenes at 4-12 °C were not influenced by the presence of the native microflora. At 4-8 °C, the GRs of co-cultured L. monocytogenes (0.0114-0.0130 log(10) cfu/h) were statistically but marginally lower than those of monocultured L. monocytogenes (0.0132-0.0145 log(10) cfu/h), indicating the GRs of L. monocytogenes at 4-8 °C were reduced by the presence of the native microflora. The GRs of L. monocytogenes were reduced by 8-7% with the presence of the native microflora at 4-8 °C, whereas there was less influence of the native microflora on the GRs of L. monocytogenes at 10 and 12 °C. The MPDs of L. monocytogenes at 4-8 °C were also reduced by the presence of the native microflora. Data from this study provide additional information regarding the growth suppression of L. monocytogenes by the native microflora for assessing the survival and growth of L. monocytogenes in ready-to-eat meat products. Published by Elsevier Ltd.
Gamma irradiation as a means to eliminate Listeria monocytogenes from frozen chicken meat
International Nuclear Information System (INIS)
Kamat, A.S.; Nair, M.P.
1995-01-01
Cells of Listeria monocytogenes ATCC 35152 were sensitive to gamma irradiation in phosphate buffer, pH 7.00 (D 10 , dose required for 10% survival—0.15 kGy) at 0–5°C. The cells showed higher radiation survival when irradiated under frozen condition, with a D 10 of 0.3 kGy. The protection offered by shrimp/chicken/kheema homogenates (100 g litre−1) was evidenced by even higher D 10 values (0.5 kGy) at both 0–5°C and cryogenic temperature. Boneless chicken meat samples were artificially inoculated with L monocytogenes ATCC 35152 cells at low (5 × 10 3 ) colony-forming unit (cfu) g −1 and high (5 × 10 6 cfu g −1 ) concentrations and irradiated at 1, 3, 4, 6 kGy doses under cryogenic conditions. The efficacy of the radiation process was evaluated by detecting L monocytogenes during storage at 2–4°C in the irradiated samples. These studies, when repeated with three other serotypes of L monocytogenes, clearly suggested the need for a dose of 3 kGy for elimination of 10 3 cfu cells of L monocytogenes g −1 from air-packed frozen chicken meat. (author)
2012-01-01
Background Immunomagnetic separation (IMS) and immunoassays are widely used for pathogen detection. However, novel technology platforms with highly selective antibodies are essential to improve detection sensitivity, specificity and performance. In this study, monoclonal antibodies (MAbs) against Internalin A (InlA) and p30 were generated and used on paramagnetic beads of varying diameters for concentration, as well as on fiber-optic sensor for detection. Results Anti-InlA MAb-2D12 (IgG2a subclass) was specific for Listeria monocytogenes and L. ivanovii, and p30-specific MAb-3F8 (IgM) was specific for the genus Listeria. At all bacterial concentrations (103–108 CFU/mL) tested in the IMS assay; the 1-μm diameter MyOne beads had significantly higher capture efficiency (P Listeria antibody (9 %). Furthermore, capture efficiency for MyOne-2D12 was highly specific for L. monocytogenes and L. ivanovii. Subsequently, we captured L. monocytogenes by MyOne-2D12 and MyOne-3F8 from hotdogs inoculated with mono- or co-cultures of L. monocytogenes and L. innocua (10–40 CFU/g), enriched for 18 h and detected by fiber-optic sensor and confirmed by plating, light-scattering, and qPCR assays. The detection limit for L. monocytogenes and L. ivanovii by the fiber-optic immunosensor was 3 × 102 CFU/mL using MAb-2D12 as capture and reporter antibody. Selective media plating, light-scattering, and qPCR assays confirmed the IMS and fiber-optic results. Conclusions IMS coupled with a fiber-optic sensor using anti-InlA MAb is highly specific for L. monocytogenes and L. ivanovii and enabled detection of these pathogens at low levels from buffer or food. PMID:23176167
Directory of Open Access Journals (Sweden)
abazar pournajaf
2013-09-01
Full Text Available Background: Listeria monocytogenes is a facultative intracellular pathogen that causes listeriosis which has extensive clinical manifestations. Infections with L. monocytogenes are a serious threat to immunocompromised persons. The aim of this study was to determine the frequency of L. monocytogenes strains recovered from clinical and non-clinical samples using phenotypic methods and confirmed by PCR. Materials and Methods: In this study, 617 specimens were analyzed. All specimens were cultured in the specific PALCAM agar. Colonies were initially identified by routine biochemical tests. Finally, PCR assays using primers specific for inlA gene were performed. Results: In all, 46 (8.2% L. monocytogenes isolates were recovered from 617 specimens. Fourteen (8.2% strains, including 4 (7.5%, 2 (5.7%, 5 (14.2% and 3 (8.5% isolates were obtained from placental tissue, urine, vaginal and rectal swabs, respectively. In addition, 9 (7.4% strains of L. monocytogenes which were isolated from 107 different dairy products originated from cheese 5 (7.1%, cream 2 (10% and kashk 2 (11.7%, respectively. Among 11 (5.2% strains isolated from 210 different meat products, 5 (5.5%, 4 (7.2% and 2 (3% strains belonged to sausage, meat and poultry extracts, respectively. Finally, 12 (9.2% Listeria strains were recovered from 130 animal specimens that included 6 (10%, 4 (8% and 2 (10% strains from goat, sheep and cattle, respectively. Furthermore, all Listeria isolates (100% were found to be carriers of inlA gene in PCR assay. Conclusion: The present study showed that the clinical and non-clinical specimens were contaminated with L. monocytogenes. So, it seems necessary to use a simple and standard technique such as PCR for rapid detection of this organism from various sources.
How Listeria monocytogenes organizes its surface for virulence
Carvalho, Filipe; Sousa, Sandra; Cabanes, Didier
2014-01-01
Listeria monocytogenes is a Gram-positive pathogen responsible for the manifestation of human listeriosis, an opportunistic foodborne disease with an associated high mortality rate. The key to the pathogenesis of listeriosis is the capacity of this bacterium to trigger its internalization by non-phagocytic cells and to survive and even replicate within phagocytes. The arsenal of virulence proteins deployed by L. monocytogenes to successfully promote the invasion and infection of host cells has been progressively unveiled over the past decades. A large majority of them is located at the cell envelope, which provides an interface for the establishment of close interactions between these bacterial factors and their host targets. Along the multistep pathways carrying these virulence proteins from the inner side of the cytoplasmic membrane to their cell envelope destination, a multiplicity of auxiliary proteins must act on the immature polypeptides to ensure that they not only maturate into fully functional effectors but also are placed or guided to their correct position in the bacterial surface. As the major scaffold for surface proteins, the cell wall and its metabolism are critical elements in listerial virulence. Conversely, the crucial physical support and protection provided by this structure make it an ideal target for the host immune system. Therefore, mechanisms involving fine modifications of cell envelope components are activated by L. monocytogenes to render it less recognizable by the innate immunity sensors or more resistant to the activity of antimicrobial effectors. This review provides a state-of-the-art compilation of the mechanisms used by L. monocytogenes to organize its surface for virulence, with special focus on those proteins that work “behind the frontline”, either supporting virulence effectors or ensuring the survival of the bacterium within its host. PMID:24809022
Encefalitis del tallo cerebral y mielitis por Listeria monocytogenes
Directory of Open Access Journals (Sweden)
Aracelly Castro
2013-09-01
Full Text Available La romboencefalitis por Listeria monocytogenes es una presentación poco común de la listeriosis del sistema nervioso central; sin embargo, es la presentación más común en personas inmunocompetentes. Aun más rara es la combinación de romboencefalitis con mielitis causada por L. monocytogenes; no obstante, en este artículo se reporta un caso de encefalitis del tallo y mielitis grave en un paciente sin compromiso del sistema inmunitario. Se presenta un paciente de 21 años de edad, sin deficiencias del sistema inmunitario, que consumió productos lácteos no pasteurizados y, posteriormente, presentó un cuadro de cefalea, vómito, deterioro de su estado general y, finalmente, alteración del estado de conciencia y muerte. Consultó al Instituto Neurológico de Colombia y se hizo diagnóstico de encefalitis del tallo y mielitis por L. monocytogenes. Se discuten las diferencias entre el caso presentado y los reportados en la literatura científica. Ante un paciente con signos de compromiso del tallo cerebral, de posible origen infeccioso, es prudente iniciar tratamiento antibiótico para L. monocytogenes y, en caso de poca respuesta, escalar rápidamente en dicho tratamiento. También lo es extender el estudio radiológico hacia la columna vertebral, con el fin de descartar compromiso de la médula espinal. doi: http://dx.doi.org/10.7705/biomedica.v33i3.1482
Wan, J; Harmark, K; Davidson, B E; Hillier, A J; Gordon, J B; Wilcock, A; Hickey, M W; Coventry, M J
1997-03-01
The effect of bacteriocin, piscicolin 126, on the growth of Listeria monocytogenes and cheese starter bacteria was investigated in milk and in Camembert cheese manufactured from milk challenged with 10(2) cfu ml(-1) L. monocytogenes. In milk incubated at 30 degrees C, piscicolin 126 added in the range of 512-2,048 AU ml(-1) effectively inhibited growth of L. monocytogenes for more than 20 d when challenged with approximately 10(2) cfu ml(-1) L. monocytogenes. At higher challenge levels (10(4) and 10(6) cfu ml(-1)), piscicolin 126 reduced the viable count of L. monocytogenes by 4-5 log units immediately after addition of the bacteriocin; however, growth of Listeria occurred within 24 h. The minimum inhibitory concentration (MIC) of piscicolin 126 against lactic acid cheese starter bacteria was generally greater than 204,800 AU ml(-1) , and the viable count and acid production of these starter cultures in milk were not affected by the addition of 2,048 AU ml(-1) piscicolin 126. Camembert cheeses made from milk challenged with L. monocytogenes and with added piscicolin 126 showed a viable count of L. monocytogenes 3-4 log units lower than those without piscicolin 126. Inactivation of piscicolin 126 by proteolytic enzymes from cheese starter bacteria and mould together with the emergence of piscicolin 126-resistant isolates was responsible for the recovery of L. monocytogenes in the cheeses during ripening.
Occurrence and antimicrobial resistance patterns of Listeria monocytogenes isolated from vegetables
Byrne,Vanessa de Vasconcelos; Hofer,Ernesto; Vallim,Deyse Christina; Almeida,Rogeria Comastri de Castro
2016-01-01
Abstract Although the consumption of fresh and minimally processed vegetables is considered healthy, outbreaks related to the contamination of these products are frequently reported. Among the food-borne pathogens that contaminate vegetables is Listeria monocytogenes, a ubiquitous organism that exhibits the ability to survive and multiply at refrigerated temperatures. This study aimed to evaluate the occurrence of L. monocytogenes in vegetables as well as the antimicrobial resistance of isola...
Listeria monocytogenes Infection in Hairy Cell Leukemia: A Case Report and Literature Review
Directory of Open Access Journals (Sweden)
James C. Barton
2018-01-01
Full Text Available Listeria monocytogenes infections have been described in patients with diverse types of malignancy, especially leukemia. We report the case of a 65-year-old man with previously untreated hairy cell leukemia characterized by CD5 positivity and trisomy 12 (3% of blood lymphocytes who developed bacteremia due to L. monocytogenes serotype 1/2b. We summarize clinical features and treatment of this patient and five previously reported patients with hairy cell leukemia who also had L. monocytogenes infections. All six patients were men. Their mean age at infection diagnosis was 70 y. Three men had undergone splenectomy 4–11 y before they developed L. monocytogenes infection. The central nervous system was the primary site of infection in four men. Bacteremia alone occurred in two other men. At diagnosis of infection, one man was receiving antileukemia chemotherapy and another man was receiving treatment for Kaposi’s sarcoma. Two other patients had other comorbid conditions. All six men recovered from their infections.
Ndahi, M D; Kwaga, J K P; Bello, M; Kabir, J; Umoh, V J; Yakubu, S E; Nok, A J
2014-03-01
The bacterial genera Listeria and Staphylococcus have been frequently isolated from food products and are responsible for a number of animal and human diseases. The aim of the study was to simultaneously isolate and characterize L. monocytogenes and Staphylococcus species from 300 samples of raw meat and meat products, to determine the susceptibility of the organisms to commonly used antimicrobial agents and to determine the presence of haemolysin A (hyl) virulence gene in L. monocytogenes and staphylococcal cassette chromosome mecA (SCCmec) gene in the Staph. aureus isolates using PCR. Of the 85 Listeria isolates tested, 12 L. monocytogenes were identified and tested for their sensitivity to 14 antimicrobial agents. All the 12 isolates (100%) were resistant to nine antimicrobial agents, but however sensitive to gentamicin. Only one isolate was found to harbour the hylA gene. Twenty-nine isolates were confirmed as Staph. aureus by the Microbact 12S identification system and were all presumptively identified as methicillin-resistant Staph. aureus species using oxacillin-resistant Staph. aureus basal medium (ORSAB). The 29 Staph. aureus isolates were tested for their sensitivity to 16 antimicrobial agents, and 11 were resistant to methicillin. None of the 11 Staph. aureus isolates harboured the methicillin resistance, mecA gene. Listeria monocytogenes and Staphylococcus aureus are important agents of foodborne diseases. Occurrence of these infectious agents was established in meat and meat products in Zaria, Nigeria. Majority of isolates obtained from this study, displayed multidrug resistance to commonly used antimicrobial agents, including methicillin resistance among the Staph. aureus isolates. The potential virulence of L. monocytogenes found in ready-to-eat food was documented by the carriage of hly A gene by one of the isolates. A different mechanism of methicillin resistance or different homologue of mec A gene may be circulating among Nigerian
Gelbíčová, T; Pantůček, R; Karpíšková, R
2016-08-01
The aim of this study was to assess the potential risk posed to the human population by the presence of Listeria monocytogenes serotype 1/2c in food based on the characterization of virulence factors of Listeria involved in the invasion of host cells and sensitivity to antimicrobial agents. In addition to sequencing of the inlA and inlB genes, the presence of genes lapB, aut, fbpA, ami, vip and llsX was tested. A premature stop codon (PMSC) in the inlA gene was detected in all tested strains of serotype 1/2c and, concurrently, two novel PMSC mutation types were identified. However, neither PMSC in the inlB gene nor deletion of the lapB, aut, fbpA, ami and vip genes were found in any of the strains. The presence of the llsX gene was not confirmed. Even though all L. monocytogenes strains showed sensitivity to the tested antimicrobials on the basis of their phenotype, sequencing revealed the presence of IS1542 insertion in the inlA gene, indicating the possibility of sharing of mobile genetic elements associated with antimicrobial resistance among strains. Other than the presence of PMSCs in the inlA gene, no PMSC in inlB or deletion of other factors linked to the invasiveness of listeria were detected. Tested strains showed sensitivity to antibiotics used in the therapy of listeriosis. Strains of L. monocytogenes serotype 1/2c typically carry a PMSC in the inlA gene, but these strains still represent a potential threat to public health. The possibility of transfer of IS1542, associated with resistance to vancomycin, between enterococci and Listeria spp. was revealed. © 2016 The Society for Applied Microbiology.
Ceylan, Erdogan; McMahon, Wendy; Garren, Donna M
2017-09-01
Thermal inactivation of Listeria monocytogenes and Salmonella was evaluated on peas, spinach, broccoli, potatoes, and carrots that were treated with hot water and steam. One gram-positive bacterium, L. monocytogenes, and one gram-negative bacterium, Salmonella, were selected as pertinent human pathogens for evaluation. Samples were inoculated with a composite of five strains each of L. monocytogenes and Salmonella to achieve approximately 10 8 to 10 9 CFU/g. Inoculated samples were treated with hot water at 85 and 87.8°C and with steam at 85 and 96.7°C for up to 3.5 min. A greater than 5-log reduction of L. monocytogenes and Salmonella was achieved on all products within 0.5 min by hot water blanching at 85 and 87.8°C. Steam blanching at 85°C reduced Salmonella populations by greater than 5 log on spinach and peas within 2 min and on carrots and broccoli within 3.5 min. Populations of Salmonella were reduced by more than 5 log within 1 min on carrot, spinach, and broccoli and within 2 min on peas by steam blanching at 96.7°C. Steam blanching at 85°C reduced L. monocytogenes populations by more than 5 log on carrots and spinach within 2 min and on broccoli and peas within 3.5 min. L. monocytogenes populations were reduced more than 5 log within 1 min on carrot, spinach, peas and broccoli by steam blanching at 96.7°C. Longer treatment times and higher temperatures were required for steam-blanched samples than for samples blanched with hot water. Results suggest that hot water and steam blanching practices commonly used by the frozen vegetable industry will achieve the desired 5-log lethality of L. monocytogenes and Salmonella and will enhance microbiological safety prior to freezing.
Silver as antibacterial towards Listeria monocytogenes
Directory of Open Access Journals (Sweden)
Simone eBelluco
2016-03-01
Full Text Available Listeria monocytogenes is a serious foodborne pathogen that can contaminate food during processing and can grow during food shelf-life. New types of safe and effective food contact materials embedding antimicrobial agents, like silver, can play an important role in the food industry. The present work aimed at evaluating the in vitro growth kinetics of different strains of L. monocytogenes in the presence of silver, both in its ionic and nano form. The antimicrobial effect was determined by assaying the number of culturable bacterial cells, which formed colonies after incubation in the presence of silver nanoparticles (AgNPs or silver nitrate (AgNO3. Ionic release experiments were performed in parallel. A different reduction of bacterial viability between silver ionic and nano forms was observed, with a time delayed effect exerted by AgNPs. An association between antimicrobial activity and ions concentration was shown by both silver chemical forms, suggesting the major role of ions in the antimicrobial mode of action.
REALIS: Postgenomic Analysis of Listeria Monocytogenes
Directory of Open Access Journals (Sweden)
The REALIS Consortium
2006-04-01
Full Text Available Listeria monocytogenes is a remarkably successful food-borne pathogen. It is capable a of surviving and proliferating under conditions that exist within the food chain, such as at low temperatures, high salt and low pH and b of colonizing animal host tissues after ingestion of contaminated food, causing opportunistic infections mainly, but not exclusively, in immunocompromised hosts. The ultimate goals of REALIS are two fold: Firstly, it aims to completely decipher all genes required for survival in and adaptation of Listeria monocytogenes to two very different environments, ie., the infected host and the external environment. Secondly, using genomics and postgenomic tools, REALIS seeks to precisely address fundamental questions regarding evolutionary relationships between pathogenic and non-pathogenic Listeria and to define qualities of particularly successful clonal pathovariants in causing disease. This project will provide both industry and health care managers with rational approaches to curbing food-borne contamination, minimising risks of infection and providing novel pharmacological approaches for halting the fulminant course of infection.
Directory of Open Access Journals (Sweden)
Caplan Marius Eduard
2014-06-01
Full Text Available Listeria monocytogenes are o distribuţie ubiquitară în natură şi poate contamina produsele alimentare de origine animală, provocând infecţii severe la om. Până în prezent există foarte puține date cu privire la profilurile de rezistenţă ale tulpinilor circulante în România. Scopul acestui studiu a fost determinarea pattern-urilor de rezistenţă la antibiotice ale unor tulpini de L. monocytogenes (n=37 izolate din produse alimentare de origine animală şi din probe clinice. Probele din alimente (carne şi produse lactate, au fost colectate în perioada 2009-2013. Probele clinice au fost recoltate de la pacienţi cu septicemie, meningită/meningo-encefalită, cazuri de avort spontan şi nou-născuţi, spitalizaţi în perioada Aprilie 2010 - Aprilie 2013 în trei Instituţii Medicale din Bucureşti: Spitalul Elias, Spitalul Victor Babes si Institutul Naţional de Boli Infecţioase (INBI Matei Bals. Toate tulpinile testate au prezentat rezistenţă la cefalosporine şi acidul nalidixic; o tulpină izolată din melci fierţi a fost rezistentă la Trimetoprim/sulfametoxazol. Rezistenţa unora dintre tulpinile analizate la ampicilina, antibiotic de elecţie pentru terapia infecţiilor cauzate de L. monocytogenes, subliniază necesitatea testării in vitro a sensibilitatii la antibiotice a fiecarui izolat clinic pentru a stabili eficienţa diferitelor antibiotice, precum şi a unor studii epidemiologice extinse în scopul stabilirii profilurilor de rezistenţă ale tulpinilor de L. monocytogenes circulante în ţara noastră.
Puri, Madhu; La Pietra, Luigi; Mraheil, Mobarak Abu; Lucas, Rudolf; Chakraborty, Trinad; Pillich, Helena
2017-09-05
Autophagy, a well-established defense mechanism, enables the elimination of intracellular pathogens including Listeria monocytogenes . Host cell recognition results in ubiquitination of L . monocytogenes and interaction with autophagy adaptors p62/SQSTM1 and NDP52, which target bacteria to autophagosomes by binding to microtubule-associated protein 1 light chain 3 (LC3). Although studies have indicated that L . monocytogenes induces autophagy, the significance of this process in the infectious cycle and the mechanisms involved remain poorly understood. Here, we examined the role of the autophagy adaptor optineurin (OPTN), the phosphorylation of which by the TANK binding kinase 1 (TBK1) enhances its affinity for LC3 and promotes autophagosomal degradation, during L . monocytogenes infection. In LC3- and OPTN-depleted host cells, intracellular replicating L . monocytogenes increased, an effect not seen with a mutant lacking the pore-forming toxin listeriolysin O (LLO). LLO induced the production of OPTN. In host cells expressing an inactive TBK1, bacterial replication was also inhibited. Our studies have uncovered an OPTN-dependent pathway in which L . monocytogenes uses LLO to restrict bacterial growth. Hence, manipulation of autophagy by L . monocytogenes , either through induction or evasion, represents a key event in its intracellular life style and could lead to either cytosolic growth or persistence in intracellular vacuolar structures.
Quereda, Juan J; Meza-Torres, Jazmín; Cossart, Pascale; Pizarro-Cerdá, Javier
2017-07-04
Listeria monocytogenes is a Gram-positive food-borne pathogen that in humans may traverse the intestinal, placental and blood/brain barriers, causing gastroenteritis, abortions and meningitis. Crossing of these barriers is dependent on the bacterial ability to enter host cells, and several L. monocytogenes surface and secreted virulence factors are known to facilitate entry and the intracellular lifecycle. The study of L. monocytogenes strains associated to human listeriosis epidemics has revealed the presence of novel virulence factors. One such factor is Listeriolysin S, a thiazole/oxazole modified microcin that displays bactericidal activity and modifies the host microbiota during infection. Our recent results therefore highlight the interaction of L. monocytogenes with gut microbes as a crucial step in epidemic listeriosis. In this article, we will discuss novel implications for this family of toxins in the pathogenesis of diverse medically relevant microorganisms.
PRÉVALENCE DE LISTERIA MONOCYTOGENES DANS LE LAIT CRU DE VACHE AU LIBAN NORD
Directory of Open Access Journals (Sweden)
Imad al Kassaa
2016-06-01
Full Text Available Al Kassaa Imad, Khaled el Omari, Marwa Saati, Bachar Ismail and Monzer Hamze. 2016. Prevalence of Listeria monocytogenes in raw cow milk in north Lebanon. Lebanese Science Journal, 17(1: 39-45. Listeriosis, although a zoonosis, is an invasive disease that can affect newborns, pregnant women and immunocompromised adults. Clinical manifestations can be expressed by febrile gastroenteritis, invasive forms including severe sepsis, meningitis, rhombencephalitis, prenatal infections and abortions. Species of Listeria bacteria are ubiquitous and adaptable to the environment in animal and plant foods. This study aimed to determine the prevalence of Listeria monocytogenes in 100 samples of fresh cow milk collected from different areas of North Lebanon. Listeria monocytogenes was detected by using the Grand VIDAS technique (Biomérieux France. The results obtained revealed the absence of Listeria monocytogenes in all analyzed samples.
da Silva Malheiros, Patrícia; Sant'Anna, Voltaire; Micheletto, Yasmine Miguel Serafini; da Silveira, Nadya Pesce; Brandelli, Adriano
2011-08-01
Antimicrobial peptide P34, a substance showing antibacterial activity against pathogenic and food spoilage bacteria, was encapsulated in liposomes prepared from partially purified soybean phosphatidylcholine, and their physicochemical characteristics were evaluated. The antimicrobial activity was estimated by agar diffusion assay using Listeria monocytogenes ATCC 7644 as indicator strain. A concentration of 3,200 AU/mL of P34 was encapsulated in nanovesicles and stocked at 4 °C. No significant difference ( p > 0.05) in the biological activity of free and encapsulated P34 was observed through 24 days. Size and PDI of liposomes, investigated by light scattering analysis, were on average 150 nm and 0.22 respectively. Zeta potential was -27.42 mV. There was no significant change ( p > 0.05) in the physicochemical properties of liposomes during the time of evaluation. The liposomes presented closed spherical morphology as visualized by transmission electron microscopy (TEM). The mode of action of liposome-encapsulated P34 under L. monocytogenes cells was investigated by TEM. Liposomes appeared to adhere but not fuse with the bacterial cell wall, suggesting that the antimicrobial is released from nanovesicles to act against the microorganism. The effect of free and encapsulated P34 was tested against L. monocytogenes, showing that free bacteriocin inhibited the pathogen more quickly than the encapsulated P34. Liposomes prepared with low-cost lipid showed high encapsulation efficiency for a new antimicrobial peptide and were stable during storage. The mode of action against the pathogen L. monocytogenes was characterized.
The presence of Listeria monocytogenes on the surfaces of equipment and workers' hands during different production stages, as well as on fish skin and meat during processing and storage of cold-smoked trout, was investigated. Listeria monocytogenes was recovered from 10 (6.06%) of a total 165 cotto...
Directory of Open Access Journals (Sweden)
Shahin Gaini
2015-01-01
Full Text Available A 51-year-old Caucasian woman with Listeria monocytogenes meningitis was treated and discharged after an uncomplicated course. Her medical history included immunosuppressive treatment with prednisolone and azathioprine for autoimmune hepatitis. A diagnostic work-up after the meningitis episode revealed that she had low levels of the IgG4 subclass. To our knowledge, this is the first case report describing a possible association between autoimmune hepatitis and the occurrence of Listeria monocytogenes meningitis, describing a possible association between Listeria monocytogenes meningitis and deficiency of the IgG4 subclass and finally describing a possible association between Listeria monocytogenes meningitis and immunosuppressive therapy with prednisolone and azathioprine.
DEFF Research Database (Denmark)
Gaini, Shahin
2015-01-01
A 51-year-old Caucasian woman with Listeria monocytogenes meningitis was treated and discharged after an uncomplicated course. Her medical history included immunosuppressive treatment with prednisolone and azathioprine for autoimmune hepatitis. A diagnostic work-up after the meningitis episode...... revealed that she had low levels of the IgG4 subclass. To our knowledge, this is the first case report describing a possible association between autoimmune hepatitis and the occurrence of Listeria monocytogenes meningitis, describing a possible association between Listeria monocytogenes meningitis...... and deficiency of the IgG4 subclass and finally describing a possible association between Listeria monocytogenes meningitis and immunosuppressive therapy with prednisolone and azathioprine....
Stevia rebaudiana Bertoni effect on the hemolytic potential of Listeria monocytogenes.
Sansano, S; Rivas, A; Pina-Pérez, M C; Martinez, A; Rodrigo, D
2017-06-05
The effect of Stevia rebaudiana Bertoni on the hemolytic potential of Listeria monocytogenes was studied by means of the assessment of the Listeriolysin O (LLO) production. The three factors under study, stevia concentration in the range [0-2.5] % (w/v), incubation temperature (10 and 37°C), and exposure time (0-65h) significantly affected (p≤0.05) the hemolytic activity of L. monocytogenes. Results showed that at the lower incubation temperature the hemolytic potential of the bacterium was significantly reduced, from 100% at 37°C to 8% at 10°C (after 65h of incubation) in unsupplemented substrate (0% stevia). Irrespective of the temperature, 10 or 37°C, supplementation of the medium with stevia at 2.5 % (w/v) reduced the bacterium's hemolytic activity by a maximum of 100%. Furthermore, the time of exposure to 2.5 % (w/v) stevia concentration was also a significant factor reducing the hemolytic capability of L. monocytogenes. The possibility of reducing the pathogenic potential of L. monocytogenes (hemolysis) by exposure to stevia should be confirmed in real food matrices, opening a research niche with a valuable future impact on food safety. Copyright © 2017 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Analía L. Laciar
2000-03-01
Full Text Available Central nervous system infections caused by Listeria monocytogenes produce a wide range of clinical symptoms which include cerebral abscesses, meningitis and nonmeningitic parenchymal cerebritis. A case study is presented of early listeriosis with signs of meningitis accompanied with septicemia and complicated with severe hydrocephalus.As infecções do sistema nervoso central produzidas por Listeria monocytogenes provocam una grande variedade de sintomas clínicos que incluem abscessos cerebrais, meningites e cerebrites parenquimáticas não meningíticas. Apresenta-se um caso de listeriose precoce com sinais de meningite acompanhada de septicemia e agravado com hidrocefalia grave.
Supraspinal inhibitory effects of chimeric peptide MCRT on gastrointestinal motility in mice.
He, Chunbo; Li, Hailan; Zhang, Jing; Kang, Yanping; Jia, Fang; Dong, Shouliang; Zhou, Lanxia
2017-09-01
Chimeric peptide MCRT, based on morphiceptin and PFRTic-NH 2 , was a bifunctional ligand of μ- and δ-opioid receptors (MOR-DOR) and produced potent analgesia in tail-withdrawal test. The study focused on the supraspinal effects of morphiceptin, PFRTic-NH 2 and MCRT on gastrointestinal motility. Moreover, opioid receptor antagonists, naloxone (non-selective), cyprodime (MOR selective) and naltrindole (DOR selective) were utilized to explore the mechanisms. Intracerebroventricular administration was achieved via the implanted cannula. Gastric emptying and intestinal transit were measured to evaluate gastrointestinal motility. (1) At supraspinal level, morphiceptin, PFRTic-NH 2 and MCRT significantly decreased gastric emptying and intestinal transit; (2) MCRT at 1 nmol/mouse, far higher than its analgesic dose (ED 50 = 29.8 pmol/mouse), failed to regulate the gastrointestinal motility; (3) MCRT-induced gastrointestinal dysfunction could be completely blocked by naloxone and naltrindole, but not affected by cyprodime. (1) Morphiceptin and PFRTic-NH 2 played important roles in the regulation of gastrointestinal motility; (2) MCRT possessed higher bioactivity of pain relief than gastrointestinal regulation, suggesting its promising analgesic property; (3) MCRT-induced motility disorders were sensitive to DOR but not to MOR blockade, indicating the pain-relieving specificity of speculated MOR subtype or splice variant or MOR-DOR heterodimer. © 2017 Royal Pharmaceutical Society.
Modelling the growth of Listeria monocytogenes on the surface of smear- or mould-ripened cheese
Directory of Open Access Journals (Sweden)
Sol eSchvartzman
2014-07-01
Full Text Available Surface-ripened cheeses are matured by means of manual or mechanical technologies posing a risk of cross-contamination, if any cheeses are contaminated with Listeria monocytogenes. In predictive microbiology, primary models are used to describe microbial responses, such as growth rate over time and secondary models explain how those responses change with environmental factors. In this way, primary models were used to assess the growth rate of L. monocytogenes during ripening of the cheeses and the secondary models to test how much the growth rate was affected by either the pH and/or the water activity (aw of the cheeses. The two models combined can be used to predict outcomes. The purpose of these experiments was to test three primary (the modified Gompertz equation, the Baranyi and Roberts model and the Logistic model and three secondary (the Cardinal model, the Ratowski model and the Presser model mathematical models in order to define which combination of models would best predict the growth of L. monocytogenes on the surface of artificially contaminated surface-ripened cheeses. Growth on the surface of the cheese was assessed and modelled. The primary models were firstly fitted to the data and the effects of pH and aw on the growth rate (μmax were incorporated and assessed one by one with the secondary models. The Logistic primary model by itself did not show a better fit of the data among the other primary models tested, but the inclusion of the Cardinal secondary model improved the final fit. The aw was not related to the growth of Listeria. This study suggests that surface-ripened cheese should be separately regulated within EU microbiological food legislation and results expressed as counts per surface area rather than per gram.
Modeling the growth of Listeria monocytogenes on the surface of smear- or mold-ripened cheese.
Schvartzman, M Sol; Gonzalez-Barron, Ursula; Butler, Francis; Jordan, Kieran
2014-01-01
Surface-ripened cheeses are matured by means of manual or mechanical technologies posing a risk of cross-contamination, if any cheeses are contaminated with Listeria monocytogenes. In predictive microbiology, primary models are used to describe microbial responses, such as growth rate over time and secondary models explain how those responses change with environmental factors. In this way, primary models were used to assess the growth rate of L. monocytogenes during ripening of the cheeses and the secondary models to test how much the growth rate was affected by either the pH and/or the water activity (aw) of the cheeses. The two models combined can be used to predict outcomes. The purpose of these experiments was to test three primary (the modified Gompertz equation, the Baranyi and Roberts model, and the Logistic model) and three secondary (the Cardinal model, the Ratowski model, and the Presser model) mathematical models in order to define which combination of models would best predict the growth of L. monocytogenes on the surface of artificially contaminated surface-ripened cheeses. Growth on the surface of the cheese was assessed and modeled. The primary models were firstly fitted to the data and the effects of pH and aw on the growth rate (μmax) were incorporated and assessed one by one with the secondary models. The Logistic primary model by itself did not show a better fit of the data among the other primary models tested, but the inclusion of the Cardinal secondary model improved the final fit. The aw was not related to the growth of Listeria. This study suggests that surface-ripened cheese should be separately regulated within EU microbiological food legislation and results expressed as counts per surface area rather than per gram.
Directory of Open Access Journals (Sweden)
Valeria Braga
Full Text Available ABSTRACT The aim of this work was to study the prevalence of Listeria monocytogenes in foods obtained in retail shops and food industries located in Montevideo-Uruguay, and to identify the serogroups of the obtained isolates. Three-thousand one-hundred and seventy-five food samples (frozen, deli meats, ready-to-eat and cheese were analyzed. The obtained isolates were serogrouped by multiplex PCR and serotyped by conventional procedure. Genetic comparisons were performed using pulsed-field gel electrophoresis on a sub-set of isolates belonging to the same serotype successively recovered from the same establishment. L. monocytogenes was isolated from 11.2% of samples. The highest prevalence was observed in frozen foods (38%, followed by cheese (10%. 1/2b and 4b were the most frequently identified serotypes. In six of 236 analyzed establishments we successively recovered L. monocytogenes isolates belonging to the same serotype. Most of them corresponded to serotype 1/2b. Pulsed-field gel electrophoresis profiles suggest that at least 33% of L. monocytogenes 1/2b isolates are genetically related and that may remain viable for prolonged periods. The observed prevalence of L. monocytogenes was lower than reported in neighboring countries. Our findings highlight the role that frozen foods may play in the spread of this pathogen, and the relevance of serotypes 1/2b and 4b.
Directory of Open Access Journals (Sweden)
Élen Silveira Nalério
2009-09-01
Full Text Available Listeria monocytogenes é uma bactéria patogênica que se tornou um grande desafio para as indústrias de alimentos, entre elas a de frangos, assim como para os órgãos de vigilância sanitária. Apesar da produção de frangos estar em expansão na região sul do Rio Grande do Sul, não há relatos sobre esse patógeno, dessa forma, objetivou-se avaliar a prevalência de L. monocytogenes e de seus sorotipos nos diversos segmentos dessa cadeia produtiva. Nos aviários isolou-se L. monocytogenes em 2,9% (1/35 das amostras de swabs cloacais, não se isolando o microrganismo em amostras provenientes das camas de aviários. No abatedouro, 11,7% (15/128 das amostras apresentaram contaminação por L. monocytogenes e nos frangos resfriados procedentes do comércio, a prevalência foi de 33,3% (15/45.Observou-se que 51,6% (16/31 das cepas de L. monocytogenes pertenciam ao sorotipo 1/2b; 22,5% (7/31 ao sorotipo 4e; 16,1% (5/31 ao sorotipo 1/2a; 6,4% (2/31 ao sorotipo 4b; e 3,2% (1/31 ao sorotipo 1/2c. Há disseminação de L. monocytogenes na cadeia produtiva de frangos da região sul do Rio Grande do Sul e a presença de sorotipos prevalentes em casos/surtos de listeriose traz preocupação à saúde pública.Listeria monocytogenes is a pathogenic bacterium which has become a huge challenge to the food industries, including the poultry industry, and to the health surveillance agencies. Although poultry production is in expansion in southern of Rio Grande do Sul, Brazil, there are not reports about this pathogen thus this study aimed at assessing the prevalence of L monocytogenes and its serotypes in the several segments of this productive chain. In the broilers flocks L. monocytogenes were isolated in 2.9% (1/35 from cloacal swabs samples. This microorganism was not isolated from broiler houses samples. In the abattoir, 11% of the samples presented L. monocytogenes contamination, and in the chilled chicken from retailers its prevalence was 33.3% (15
Directory of Open Access Journals (Sweden)
Jin-Qiang Chen
2017-09-01
Full Text Available Listeria monocytogenes, one of the most important foodborne pathogens, can cause listeriosis, a lethal disease for humans. L. ivanovii, which is closely related to L. monocytogenes, is also widely distributed in nature and infects mainly warm-blooded ruminants, causing economic loss. Thus, there are high priority needs for methodologies for rapid, specific, cost-effective and accurate detection, characterization and subtyping of L. monocytogenes and L. ivanovii in foods and environmental sources. In this review, we (A described L. monocytogenes and L. ivanovii, world-wide incidence of listeriosis, and prevalence of various L. monocytogenes strains in food and environmental sources; (B comprehensively reviewed different types of traditional and newly developed methodologies, including culture-based, antigen/antibody-based, LOOP-mediated isothermal amplification, matrix-assisted laser desorption ionization-time of flight-mass spectrometry, DNA microarray, and genomic sequencing for detection and characterization of L. monocytogenes in foods and environmental sources; (C comprehensively summarized different subtyping methodologies, including pulsed-field gel electrophoresis, multi-locus sequence typing, ribotyping, and phage-typing, and whole genomic sequencing etc. for subtyping of L. monocytogenes strains from food and environmental sources; and (D described the applications of these methodologies in detection and subtyping of L. monocytogenes in foods and food processing facilities.
Stochastic models of cell motility
DEFF Research Database (Denmark)
Gradinaru, Cristian
2012-01-01
Cell motility and migration are central to the development and maintenance of multicellular organisms, and errors during this process can lead to major diseases. Consequently, the mechanisms and phenomenology of cell motility are currently under intense study. In recent years, a new...... interdisciplinary field focusing on the study of biological processes at the nanoscale level, with a range of technological applications in medicine and biological research, has emerged. The work presented in this thesis is at the interface of cell biology, image processing, and stochastic modeling. The stochastic...... models introduced here are based on persistent random motion, which I apply to real-life studies of cell motility on flat and nanostructured surfaces. These models aim to predict the time-dependent position of cell centroids in a stochastic manner, and conversely determine directly from experimental...
Motility of electric cable bacteria
DEFF Research Database (Denmark)
Bjerg, Jesper Tataru; Damgaard, Lars Riis; Holm, Simon Agner
2016-01-01
Cable bacteria are filamentous bacteria that electrically couple sulfide oxidation and oxygen reduction at centimeter distances, and observations in sediment environments have suggested that they are motile. By time-lapse microscopy, we found that cable bacteria used gliding motility on surfaces...... with a highly variable speed of 0.50.3 ms1 (meanstandard deviation) and time between reversals of 155108 s. They frequently moved forward in loops, and formation of twisted loops revealed helical rotation of the filaments. Cable bacteria responded to chemical gradients in their environment, and around the oxic......-anoxic interface, they curled and piled up, with straight parts connecting back to the source of sulfide. Thus, it appears that motility serves the cable bacteria in establishing and keeping optimal connections between their distant electron donor and acceptors in a dynamic sediment environment....
Chen, Poyin; den Bakker, Henk C; Korlach, Jonas; Kong, Nguyet; Storey, Dylan B; Paxinos, Ellen E; Ashby, Meredith; Clark, Tyson; Luong, Khai; Wiedmann, Martin; Weimer, Bart C
2017-02-01
Listeria monocytogenes is a bacterial pathogen that is found in a wide variety of anthropogenic and natural environments. Genome sequencing technologies are rapidly becoming a powerful tool in facilitating our understanding of how genotype, classification phenotypes, and virulence phenotypes interact to predict the health risks of individual bacterial isolates. Currently, 57 closed L. monocytogenes genomes are publicly available, representing three of the four phylogenetic lineages, and they suggest that L. monocytogenes has high genomic synteny. This study contributes an additional 15 closed L. monocytogenes genomes that were used to determine the associations between the genome and methylome with host invasion magnitude. In contrast to previous findings, large chromosomal inversions and rearrangements were detected in five isolates at the chromosome terminus and within rRNA genes, including a previously undescribed inversion within rRNA-encoding regions. Each isolate's epigenome contained highly diverse methyltransferase recognition sites, even within the same serotype and methylation pattern. Eleven strains contained a single chromosomally encoded methyltransferase, one strain contained two methylation systems (one system on a plasmid), and three strains exhibited no methylation, despite the occurrence of methyltransferase genes. In three isolates a new, unknown DNA modification was observed in addition to diverse methylation patterns, accompanied by a novel methylation system. Neither chromosome rearrangement nor strain-specific patterns of epigenome modification observed within virulence genes were correlated with serotype designation, clonal complex, or in vitro infectivity. These data suggest that genome diversity is larger than previously considered in L. monocytogenes and that as more genomes are sequenced, additional structure and methylation novelty will be observed in this organism. Listeria monocytogenes is the causative agent of listeriosis, a disease
Flagellar Motility of Trypanosoma cruzi Epimastigotes
Directory of Open Access Journals (Sweden)
G. Ballesteros-Rodea
2012-01-01
Full Text Available The hemoflagellate Trypanosoma cruzi is the causative agent of American trypanosomiasis. Despite the importance of motility in the parasite life cycle, little is known about T. cruzi motility, and there is no quantitative description of its flagellar beating. Using video microscopy and quantitative vectorial analysis of epimastigote trajectories, we find a forward parasite motility defined by tip-to-base symmetrical flagellar beats. This motion is occasionally interrupted by base-to-tip highly asymmetric beats, which represent the ciliary beat of trypanosomatid flagella. The switch between flagellar and ciliary beating facilitates the parasite's reorientation, which produces a large variability of movement and trajectories that results in different distance ranges traveled by the cells. An analysis of the distance, speed, and rotational angle indicates that epimastigote movement is not completely random, and the phenomenon is highly dependent on the parasite behavior and is characterized by directed and tumbling parasite motion as well as their combination, resulting in the alternation of rectilinear and intricate motility paths.
Mammalian Sperm Motility: Observation and Theory
Gaffney, E.A.
2011-01-21
Mammalian spermatozoa motility is a subject of growing importance because of rising human infertility and the possibility of improving animal breeding. We highlight opportunities for fluid and continuum dynamics to provide novel insights concerning the mechanics of these specialized cells, especially during their remarkable journey to the egg. The biological structure of the motile sperm appendage, the flagellum, is described and placed in the context of the mechanics underlying the migration of mammalian sperm through the numerous environments of the female reproductive tract. This process demands certain specific changes to flagellar movement and motility for which further mechanical insight would be valuable, although this requires improved modeling capabilities, particularly to increase our understanding of sperm progression in vivo. We summarize current theoretical studies, highlighting the synergistic combination of imaging and theory in exploring sperm motility, and discuss the challenges for future observational and theoretical studies in understanding the underlying mechanics. © 2011 by Annual Reviews. All rights reserved.
Kuan, Chee Hao; Wong, Woan Chwen; Pui, Chai Fung; Mahyudin, Nor Ainy; Tang, John Yew Huat; Nishibuchi, Mitsuaki; Radu, Son
2013-12-01
A total of 63 beef offal samples (beef liver = 16; beef lung = 14; beef intestine = 9; beef tripe = 15; beef spleen = 9) from three wet markets (A, B, and C) in Selangor, Malaysia were examined for the prevalence and microbial load of Listeria monocytogenes. A combination of the most probable number and polymerase chain reaction (MPN-PCR) method was employed in this study. It was found that L. monocytogenes detected in 33.33% of the beef offal samples. The prevalence of L. monocytogenes in beef offal purchased from wet markets A, B, and C were 22.73%, 37.50% and 41.18% respectively. The density of L. monocytogenes in all the samples ranged from 2,400 MPN/g. The findings in this study indicate that beef offal can be a potential vehicle of foodborne listeriosis.
Variations in virulence between different electrophoretic types of Listeria monocytogenes
DEFF Research Database (Denmark)
Nørrung, Birgit; Andersen, Jens Kirk
2000-01-01
A total of 245 strains of Listeria monocytogenes, representing 33 different electrophoretic types (ETs), were examined quantitatively for haemolytic activity. No significant difference was observed in the mean haemolytic activity between different ETs. Eighty four out of 91 strains examined were...... compared with 3.64 among food isolates). The explanation for this may be that more virulent strains are more prone to cause human infection. It is, however, also possible that strains oft. monocytogenes may become more virulent while multiplying in a living organism compared with multiplying in foods....
Esophageal motility disorders; Motilitaetsstoerungen des Oesophagus
Energy Technology Data Exchange (ETDEWEB)
Hannig, C.; Rummeny, E. [Klinikum rechts der Isar der Technischen Universitaet Muenchen, Institut fuer Roentgendiagnostik, Muenchen (Germany); Wuttge-Hannig, A. [Gemeinschaftspraxis fuer Radiologie, Nuklearmedizin und Strahlentherapie, Muenchen (Germany)
2007-02-15
For the better understanding of esophageal motility, the muscle texture and the distribution of skeletal and smooth muscle fibers in the esophagus are of crucial importance. Esophageal physiology will be shortly mentioned as far as necessary for a comprehensive understanding of peristaltic disturbances. Besides the pure depiction of morphologic criteria, a complete esophageal study has to include an analysis of the motility. New diagnostic tools with reduced radiation for dynamic imaging (digital fluoroscopy, videofluoroscopy) at 4-30 frames/s are available. Radiomanometry is a combination of a functional pressure measurement and a simultaneous dynamic morphologic analysis. Esophageal motility disorders are subdivided by radiologic and manometric criteria into primary, secondary, and nonclassifiable forms. Primary motility disorders of the esophagus are achalasia, diffuse esophageal spasm, nutcracker esophagus, and the hypertonic lower esophageal sphincter. The secondary motility disorders include pseudoachalasia, reflux-associated motility disorders, functionally caused impactions, Boerhaave's syndrome, Chagas' disease, scleroderma, and presbyesophagus. The nonclassificable motility disorders (NEMD) are a very heterogeneous collective. (orig.) [German] Zum Verstaendnis der Motilitaet des Oesophagus sind muskulaere Architektur und Verteilung der quergestreiften und glatten Muskelfasern von Bedeutung. Die Physiologie des Oesophagus wird in soweit kurz dargestellt, als sie fuer das Verstaendnis von peristaltischen Stoerungen notwendig ist. Neben der Erfassung rein morphologischer Kriterien ist bei der Untersuchung der Speiseroehre eine diagnostische Bewertung der Motilitaet erforderlich. Es stehen uns heute strahlungsarme dynamische Aufzeichnungsverfahren (digitale dynamische Aufzeichnung, Videofluoroskopie) mit Bildsequenzen von 4-30 Bildern/s zur Verfuegung. Die Kombination einer funktionellen Methode zur Darstellung der Morphologie und der
Barre, Léna; Angelidis, Apostolos S; Boussaid, Djouher; Brasseur, Emilie Decourseulles; Manso, Eléonore; Gnanou Besse, Nathalie
2016-12-05
During the past six years, new species of the genus Listeria have been isolated from foods and other environmental niches worldwide. The Standard method EN ISO 11290-1 that is currently under revision will include in its scope all Listeria species in addition to L. monocytogenes. The objective of this project was to evaluate the ability of the Standard EN ISO 11290-1 method to detect and identify the newly discovered Listeria spp., and to assess potential over-growth effects of the new species in mixed cultures with L. monocytogenes during each step of the enrichment process. This objective was addressed by the generation of necessary data on the behavior of the new species during the pre-enrichment and the enrichment steps of the reference method as well as data on their phenotypic characteristics on rich and selective media used for isolation and identification. Most of the new Listeria species developed well on selective agar media for Listeria, however the recovery of some species was difficult due to poor growth in Half Fraser and Fraser broth. Good results (consistently positive) were obtained for confirmation at the genus level via the catalase test, the Gram test and the blueish appearance test on non-selective medium, but not with the VP test, as most of the new species yielded a negative result. In the light of results obtained in co-culture experiments and inhibition tests, and considering the growth rates in Half Fraser and Fraser broths, the new species do not seem to interfere with the detection of L. monocytogenes. Copyright © 2016 Elsevier B.V. All rights reserved.
2014-01-01
The cholesterol-dependent cytolysins (CDCs) are a large family of pore-forming toxins that are produced by numerous Gram-positive bacterial pathogens. These toxins are released in the extracellular environment as water-soluble monomers or dimers that bind to cholesterol-rich membranes and assemble into large pore complexes. Depending upon their concentration, the nature of the host cell and membrane (cytoplasmic or intracellular) they target, the CDCs can elicit many different cellular responses. Among the CDCs, listeriolysin O (LLO), which is a major virulence factor of the facultative intracellular pathogen Listeria monocytogenes, is involved in several stages of the intracellular lifecycle of the bacterium and displays unique characteristics. It has long been known that following L. monocytogenes internalization into host cells, LLO disrupts the internalization vacuole, enabling the bacterium to replicate into the host cell cytosol. LLO is then used by cytosolic bacteria to spread from cell to cell, avoiding bacterial exposure to the extracellular environment. Although LLO is continuously produced during the intracellular lifecycle of L. monocytogenes, several processes limit its toxicity to ensure the survival of infected cells. It was previously thought that LLO activity was limited to mediating vacuolar escape during bacterial entry and cell to cell spreading. This concept has been challenged by compelling evidence suggesting that LLO secreted by extracellular L. monocytogenes perforates the host cell plasma membrane, triggering important host cell responses. This chapter provides an overview of the well-established intracellular activity of LLO and the multiple roles attributed to LLO secreted by extracellular L. monocytogenes. PMID:24798012
Colonic motility and enema spreading
International Nuclear Information System (INIS)
Hardy, J.G.; Wood, E.; Clark, A.G.; Reynolds, J.R.; Queen's Medical Centre, Nottingham
1986-01-01
Radiolabelled enema solution was administered to eight healthy subjects, both in fasted and fed states. Enema spreading was monitored over a 4-h period using gamma scintigraphy and colonic motility was recorded simultaneously using a pressure sensitive radiotelemetry capsule. The rate and extent of enema dispersion were unaffected by eating. Spreading could be correlated with colonic motility and was inhibited by aboral propulsion of the colonic contents. (orig.)
Listeria Monocytogenes Persistence in Ready-to-Eat Sausages and in Processing Plants.
Mureddu, Anna; Mazza, Roberta; Fois, Federica; Meloni, Domenico; Bacciu, Roberto; Piras, Francesca; Mazzette, Rina
2014-01-21
Listeria monocytogenes is of major concern in the fermented meat products and is able to persist in their processing environments. The aim of the present work was to evaluate the virulence profile and the persistence capacity of L. monocytogenes strains isolated in Sardinian fermented sausages processing plants. Food (ground meat, sausages at the end of acidification and ripening stage) and environmental samples (a total of n. 385), collected from 4 meat processing plants located in Sardinia (Italy), were examined to detect L. monocytogenes presence. All the L. monocytogenes isolates were identified by polymerase chain reaction (PCR) method. A subset of strains was also characterised by multiplex PCR-based serogrouping, using the lmo0737 , lmo1118 , ORF2819 and ORF2110 genes. Three different multiplex PCRs were used to obtain the virulence profiles by the rrn , hlyA , actA , prfA , inlA , inlB , iap , plcA , plcB and mpl marker genes. Furthermore, in vitro biofilm forming ability and resistance to disinfectants were carried out on microtiter plate. The overall prevalence was 31.5% in food, and 68.5% in environmental samples. The prevalent serotype resulted 1/2c (43%), followed by 1/2a (40%), 4b (8.6%), and 1/2b (8.6%). The amplification products of the virulence genes were found in all the isolates with the following prevalence: 77.1% hlyA ; 100% rrn ; 100% prfA ; 97.1% iap ; 65.7% inlB ; 88.6% inlA ; 100% plcA ; 100% plcB and 74.3% mpl . As for biofilm forming ability, 37.1% of the strains were positive and resulted weak producer, but all the isolates were sensible to disinfectants showing a reduction of L. monocytogenes growth after each incubation time. More appropriate technologies and application of measures of hygienic control should be implemented to prevent the L. monocytogenes growth and cross-contamination in salsiccia sarda processing plants.
Listeria monocytogenes persistence in ready-to-eat sausages and in processing plants
Directory of Open Access Journals (Sweden)
Anna Mureddu
2014-02-01
Full Text Available Listeria monocytogenes is of major concern in the fermented meat products and is able to persist in their processing environments. The aim of the present work was to evaluate the virulence profile and the persistence capacity of L. monocytogenes strains isolated in Sardinian fermented sausages processing plants. Food (ground meat, sausages at the end of acidification and ripening stage and environmental samples (a total of n. 385, collected from 4 meat processing plants located in Sardinia (Italy, were examined to detect L. monocytogenes presence. All the L. monocytogenes isolates were identified by polymerase chain reaction (PCR method. A subset of strains was also characterised by multiplex PCR-based serogrouping, using the lmo0737, lmo1118, ORF2819 and ORF2110 genes. Three different multiplex PCRs were used to obtain the virulence profiles by the rrn, hlyA, actA, prfA, inlA, inlB, iap, plcA, plcB and mpl marker genes. Furthermore, in vitro biofilm forming ability and resistance to disinfectants were carried out on microtiter plate. The overall prevalence was 31.5% in food, and 68.5% in environmental samples. The prevalent serotype resulted 1/2c (43%, followed by 1/2a (40%, 4b (8.6%, and 1/2b (8.6%. The amplification products of the virulence genes were found in all the isolates with the following prevalence: 77.1% hlyA; 100% rrn; 100% prfA; 97.1% iap; 65.7% inlB; 88.6% inlA; 100% plcA; 100% plcB and 74.3% mpl. As for biofilm forming ability, 37.1% of the strains were positive and resulted weak producer, but all the isolates were sensible to disinfectants showing a reduction of L. monocytogenes growth after each incubation time. More appropriate technologies and application of measures of hygienic control should be implemented to prevent the L. monocytogenes growth and crosscontamination in salsiccia sarda processing plants.
Jadhav, Snehal; Gulati, Vandana; Fox, Edward M; Karpe, Avinash; Beale, David J; Sevior, Danielle; Bhave, Mrinal; Palombo, Enzo A
2015-06-02
Listeria monocytogenes is an important foodborne pathogen responsible for the sometimes fatal disease listeriosis. Public health concerns and stringent regulations associated with the presence of this pathogen in food and food processing environments underline the need for rapid and reliable detection and subtyping techniques. In the current study, the application of matrix assisted laser desorption/ionisation-time-of-flight mass spectrometry (MALDI-TOF MS) as a single identification and source-tracking tool for a collection of L. monocytogenes isolates, obtained predominantly from dairy sources within Australia, was explored. The isolates were cultured on different growth media and analysed using MALDI-TOF MS at two incubation times (24 and 48 h). Whilst reliable genus-level identification was achieved from most media, identification at the species level was found to be dependent on culture conditions. Successful speciation was highest for isolates cultured on the chromogenic Agar Listeria Ottaviani Agosti agar (ALOA, 91% of isolates) and non-selective horse blood agar (HBA, 89%) for 24h. Chemometric statistical analysis of the MALDI-TOF MS data enabled source-tracking of L. monocytogenes isolates obtained from four different dairy sources. Strain-level discrimination was also observed to be influenced by culture conditions. In addition, t-test/analysis of variance (ANOVA) was used to identify potential biomarker peaks that differentiated the isolates according to their source of isolation. Source-tracking using MALDI-TOF MS was compared and correlated with the gold standard pulsed-field gel electrophoresis (PFGE) technique. The discriminatory index and the congruence between both techniques were compared using the Simpsons Diversity Index and adjusted Rand and Wallace coefficients. Overall, MALDI-TOF MS based source-tracking (using data obtained by culturing the isolates on HBA) and PFGE demonstrated good congruence with a Wallace coefficient of 0.71 and
Yi, Na Young; Park, Shin Ae; Jeong, Man Bok; Kim, Won Tae; Kim, Se Eun; Kim, Ji Youn; Chae, Je Min; Jang, Kyoung Jin; Seong, Je Kyung; Seo, Kang Moon
2009-01-01
To evaluate motility of silicone orbital implants and corneoscleral prostheses, with and without use of a motility coupling post (MCP) in dogs. Eighteen mixed-breed dogs. The motility of an orbital silicone implant and corneoscleral prosthesis after enucleation (n = 6), evisceration (n = 6), or use of a MCP with evisceration (n = 6) in dogs were compared. One eye from each dog had surgery whereas the opposite eye was used as a control. Clinical evaluations were performed three times a week. Histopathology of the orbital tissues was performed 8 and 12 weeks after surgery. Implant motility in dogs with evisceration (vertical movement [VM] 8.04 +/- 2.13; horizontal movement [HM] 11 +/- 3.05) and evisceration with MCP (VM 9.61 +/- 1.59); HM was significantly greater than the enucleation group (VM 0.51 +/- 0.5; HM 1.22 +/- 0.68) (P dogs with evisceration with MCP was significantly greater than in dogs with evisceration; dogs with evisceration had significantly greater motility than dogs with enucleation (P dogs. This study supports the use of MCP in silicone orbital implants to enhance corneoscleral prosthesis motility and cosmetics in dogs.
An Assessment of Different Genomic Approaches for Inferring Phylogeny of Listeria monocytogenes
DEFF Research Database (Denmark)
Henri, Clementine; Leekitcharoenphon, Pimlapas; Carleton, Heather A.
2017-01-01
Background/objectives: Whole genome sequencing (WGS) has proven to be a powerful subtyping tool for foodborne pathogenic bacteria like L. monocytogenes. The interests of genome-scale analysis for national surveillance, outbreak detection or source tracking has been largely documented. The genomic......MLPPST) or pan genome (wgMLPPST). Currently, there are little comparisons studies of these different analytical approaches. Our objective was to assess and compare different genomic methods that can be implemented in order to cluster isolates of L monocytogenes.Methods: The clustering methods were evaluated...... on a collection of 207 L. monocytogenes genomes of food origin representative of the genetic diversity of the Anses collection. The trees were then compared using robust statistical analyses.Results: The backward comparability between conventional typing methods and genomic methods revealed a near...
Henriques, A R; Gama, L T; Fraqueza, M J
2017-02-02
Listeria monocytogenes isolates collected from final products and food contact surfaces of 10 ready-to-eat meat-based food products (RTEMP) producing industries were analyzed to relate their virulence-associated characteristics and genetic profiles with the hygiene assessment of those industries. Together with sample collection, an audit was performed to evaluate the implemented food safety management system and to investigate the specific audit requisites more associated to the occurrence of those L. monocytogenes serogroups frequently related with human disease. L. monocytogenes was present in 18% of the samples. The isolates (n=62) were serogrouped and detection of virulence-associated genes inlA, inlB, inlC and inlJ, and also plcA, hlyA, actA and iap was done by multiplex PCR. After this initial characterization, selected isolates (n=31) were submitted to antibiotic resistance testing by the disk diffusion method for the currently most used human and veterinary antibiotics and resistance was low. These isolates were also subtyped by pulsed-field gel electrophoresis. Genotyping and serogrouping of L. monocytogenes isolates revealed a genetically diverse population. Our data indicate that contamination of final products does not seem to be uniquely related to the sampled food surfaces. The occurrence of those L. monocytogenes serogroups more commonly associated with human disease in industries with a high hygienic audit classification could be the result of a previous identification of the pathogen, with an enforcement of the hygiene program without recognizing the real source of contamination. This reinforces the importance of a conjoined diagnosis using audit data and microbiological testing. Food safety management systems of those industries need improvement, particularly in cleaning and sanitizing operations, analytical control, preventive maintenance, personal hygiene and root cause analysis. Copyright © 2016. Published by Elsevier B.V.
Zhang, Cathy X. Y.; Brooks, Brian W.; Huang, Hongsheng; Pagotto, Franco
2016-01-01
ABSTRACT The Gram-positive bacterium Listeria monocytogenes causes a significant percentage of the fatalities among foodborne illnesses in humans. Surface proteins specifically expressed in a wide range of L. monocytogenes serotypes under selective enrichment culture conditions could serve as potential biomarkers for detection and isolation of this pathogen via antibody-based methods. Our study aimed to identify such biomarkers. Interrogation of the L. monocytogenes serotype 4b strain F2365 genome identified 130 putative or known surface proteins. The homologues of four surface proteins, LMOf2365_0578, LMOf2365_0581, LMOf2365_0639, and LMOf2365_2117, were assessed as biomarkers due to the presence of conserved regions among strains of L. monocytogenes which are variable among other Listeria species. Rabbit polyclonal antibodies against the four recombinant proteins revealed the expression of only LMOf2365_0639 on the surface of serotype 4b strain LI0521 cells despite PCR detection of mRNA transcripts for all four proteins in the organism. Three of 35 monoclonal antibodies (MAbs) to LMOf2365_0639, MAbs M3643, M3644, and M3651, specifically recognized 42 (91.3%) of 46 L. monocytogenes lineage I and II isolates grown in nonselective brain heart infusion medium. While M3644 and M3651 reacted with 14 to 15 (82.4 to 88.2%) of 17 L. monocytogenes lineage I and II isolates, M3643 reacted with 22 (91.7%) of 24 lineage I, II, and III isolates grown in selective enrichment media (UVM1, modified Fraser, Palcam, and UVM2 media). The three MAbs exhibited only weak reactivities (the optical densities at 414 nm were close to the cutoff value) to some other Listeria species grown in selective enrichment media. Collectively, the data indicate the potential of LMOf2365_0639 as a surface biomarker of L. monocytogenes, with the aid of specific MAbs, for pathogen detection, identification, and isolation in clinical, environmental, and food samples. IMPORTANCE L. monocytogenes is
Directory of Open Access Journals (Sweden)
Catherine E Jobbings
Full Text Available Whilst mast cells participate in the immune defence against the intracellular bacterium Listeria monocytogenes, there is conflicting evidence regarding the ability of L. monocytogenes to infect mast cells. It is known that the pore-forming toxin listeriolysin (LLO is important for mast cell activation, degranulation and the release of pro-inflammatory cytokines. Mast cells, however, are a potential source of a wide range of cytokines, chemokines and other mediators including osteopontin, which contributes to the clearing of L. monocytogenes infections in vivo, although its source is unknown. We therefore aimed to resolve the controversy of mast cell infection by L. monocytogenes and investigated the extent of mediator release in response to the bacterium. In this paper we show that the infection of bone marrow-derived mast cells by L. monocytogenes is inefficient and LLO-independent. LLO, however, is required for calcium-independent mast cell degranulation as well as for the transient and selective downregulation of cell surface CD117 (c-kit on mast cells. We demonstrate that in addition to the key pro-inflammatory cytokines TNF-α and IL-6, mast cells release a wide range of other mediators in response to L. monocytogenes. Osteopontin, IL-2, IL-4, IL-13 and granulocyte macrophage colony-stimulating factor (GM-CSF, and chemokines including CCL2, CCL3, CCL4 and CCL5 are released in a MyD88-dependent manner. The wide range of mediators released by mast cells in response to L. monocytogenes may play an important role in the recruitment and activation of a variety of immune cells in vivo. The cocktail of mediators, however, is unlikely to skew the immune response to a particular effector response. We propose that mast cells provide a hitherto unreported source of osteopontin, and may provide an important role in co-ordinating the immune response during Listeria infection.
Control options for Listeria monocytogenes in seafoods
DEFF Research Database (Denmark)
Huss, Hans Henrik; Jørgensen, Lasse Vigel; Vogel, Birte Fonnesbech
2000-01-01
At least three outbreaks of listeriosis associated with seafood have been reported. Listeria monocytogenes is widely distributed in the general environment including fresh water, coastal water and live fish from these areas. Contamination or recontamination of seafood may also take place during...
Chromatographic and anti-motility studies on extracts of Loranthus ...
African Journals Online (AJOL)
The anti-motility properties of the leaves of African mistletoe, Loranthus micranthus (Linn), Loranthaceae harvested from Kola acuminate host tree was studied by the charcoal meal test in mice. The intraperitoneal LD50 of the methanol extract was determined in mice by the Locke's method. The phytochemical constituents of ...
Directory of Open Access Journals (Sweden)
N. Soultos
2014-11-01
Full Text Available Aim: In the current study, a contribution to the knowledge on the prevalence and level of contamination of Listeria monocytogenes in ready-to-eat (RTE seafood marketed in Thessaloniki (Northern Greece was provided; the serovar identity of the L. monocytogenes isolates was also determined. Materials and Methods: A total of 132 RTE seafood samples consisting of 74 smoked fish products, 18 salted fish products, 16 dried fish products, 9 raw marinated fish products, 10 cooked marinated cephalopods and 5 surimi crab stick products were analyzed. L. monocytogenes were isolated and enumerated based on ISO 11290-1/A1 and ISO 11290-2/A1 protocols, respectively, and identified using a multiplex polymerase chain reaction (PCR system utilizing genus and species specific primers. For the identification of serotypes a second multiplex PCR assay was used which clusters L. monocytogenes strains into four major serogroups. Results: Of the samples examined, 11 (8.3% proved positive for Listeria spp. with 8 (6.1% yielding L. monocytogenes. Only in one sample of smoked mackerel the level of L. monocytogenes exceeded the legal safety limit of 100 cfu/g set out in Commission Regulation (EC No. 1441/2007. Serotyping showed higher percentages of isolates belonging to PCR serogroup 3:1/2b, 3b, 7 (46.7% and serogroup 1:1/2a, 3a (40% followed by serogroup 4:4b, 4d, 4e (13.3%. Conclusion: This study demonstrated that L. monocytogenes can be isolated from processed RTE seafood products at retail in Thessaloniki (Northern Greece in low concentrations. However, the presence of this human pathogen in RTE seafood should not be overlooked, but it should be considered as having significance public health implications, particularly among the persons who are at greater risk. Therefore, RTE seafood should be produced under appropriate hygienic and technological conditions since the product does not undergo any treatment before consumption.
Prevalence and contamination levels of listeria monocytogenes in ready-to-eat foods in Tokyo, Japan.
Shimojima, Yukako; Ida, Miki; Nakama, Akiko; Nishino, Yukari; Fukui, Rie; Kuroda, Sumiyo; Hirai, Akihiko; Kai, Akemi; Sadamasu, Kenji
2016-08-01
We surveyed prevalence and contamination levels of Listeria monocytogenes in ready-to-eat foods between 2000 and 2012 in Tokyo. L. monocytogenes was isolated from 52 (1.7%) out of 2,980 samples. Comparing the prevalence in the study period, 2.2% were positive in the former period (2000-2005) and 1.2% in the latter (2006-2012). Using the most probable number (MPN) technique, 32 samples were contaminated with fewer than 0.3 L. monocytogenes/g, 10 samples with 0.3-1.0/g and 4 samples with more than 1.0/g (the maximum was 2.3/g). The most common serovar was 1/2a, followed by 1/2b, 4b and 1/2c. We revealed that ready-to-eat foods in Tokyo were contaminated with L. monocytogenes, although the contamination levels were low.
Kuan, Chee Hao; Wong, Woan Chwen; Pui, Chai Fung; Mahyudin, Nor Ainy; Tang, John Yew Huat; Nishibuchi, Mitsuaki; Radu, Son
2013-01-01
A total of 63 beef offal samples (beef liver = 16; beef lung = 14; beef intestine = 9; beef tripe = 15; beef spleen = 9) from three wet markets (A, B, and C) in Selangor, Malaysia were examined for the prevalence and microbial load of Listeria monocytogenes. A combination of the most probable number and polymerase chain reaction (MPN-PCR) method was employed in this study. It was found that L. monocytogenes detected in 33.33% of the beef offal samples. The prevalence of L. monocytogenes in beef offal purchased from wet markets A, B, and C were 22.73%, 37.50% and 41.18% respectively. The density of L. monocytogenes in all the samples ranged from 2,400 MPN/g. The findings in this study indicate that beef offal can be a potential vehicle of foodborne listeriosis. PMID:24688507
Directory of Open Access Journals (Sweden)
Chee Hao Kuan
2013-12-01
Full Text Available A total of 63 beef offal samples (beef liver = 16; beef lung = 14; beef intestine = 9; beef tripe = 15; beef spleen = 9 from three wet markets (A, B, and C in Selangor, Malaysia were examined for the prevalence and microbial load of Listeria monocytogenes. A combination of the most probable number and polymerase chain reaction (MPN-PCR method was employed in this study. It was found that L. monocytogenes detected in 33.33% of the beef offal samples. The prevalence of L. monocytogenes in beef offal purchased from wet markets A, B, and C were 22.73%, 37.50% and 41.18% respectively. The density of L. monocytogenes in all the samples ranged from 2,400 MPN/g. The findings in this study indicate that beef offal can be a potential vehicle of foodborne listeriosis.
Growth, viability and architecture of biofilms of Listeria monocytogenes formed on abiotic surfaces
Directory of Open Access Journals (Sweden)
Fernanda Barbosa dos Reis-Teixeira
Full Text Available Abstract The pathogenic bacterium Listeria monocytogenes can persist in food processing plants for many years, even when appropriate hygienic measures are in place, with potential for contaminating ready-to-eat products and, its ability to form biofilms on abiotic surfaces certainly contributes for the environmental persistence. In this research, L. monocytogenes was grown in biofilms up 8 days attached to stainless steel and glass surfaces, contributing for advancing the knowledge on architecture of mature biofilms, since many literature studies carried out on this topic considered only early stages of cell adhesion. In this study, biofilm populations of two strains of L. monocytogenes (serotypes 1/2a and 4b on stainless steel coupons and glass were examined using regular fluorescence microscopy, confocal laser scanning microscopy and classic culture method. The biofilms formed were not very dense and microscopic observations revealed uneven biofilm structures, with presence of exopolymeric matrix surrounding single cells, small aggregates and microcolonies, in a honeycomb-like arrangement. Moreover, planktonic population of L. monocytogenes (present in broth media covering the abiotic surface remained stable throughout the incubation time, which indicates an efficient dispersal mechanism, since the culture medium was replaced daily. In conclusion, even if these strains of L. monocytogenes were not able to form thick multilayer biofilms, it was noticeable their high persistence on abiotic surfaces, reinforcing the need to focus on measures to avoid biofilm formation, instead of trying to eradicate mature biofilms.
Growth, viability and architecture of biofilms of Listeria monocytogenes formed on abiotic surfaces.
Reis-Teixeira, Fernanda Barbosa Dos; Alves, Virgínia Farias; de Martinis, Elaine Cristina Pereira
The pathogenic bacterium Listeria monocytogenes can persist in food processing plants for many years, even when appropriate hygienic measures are in place, with potential for contaminating ready-to-eat products and, its ability to form biofilms on abiotic surfaces certainly contributes for the environmental persistence. In this research, L. monocytogenes was grown in biofilms up 8 days attached to stainless steel and glass surfaces, contributing for advancing the knowledge on architecture of mature biofilms, since many literature studies carried out on this topic considered only early stages of cell adhesion. In this study, biofilm populations of two strains of L. monocytogenes (serotypes 1/2a and 4b) on stainless steel coupons and glass were examined using regular fluorescence microscopy, confocal laser scanning microscopy and classic culture method. The biofilms formed were not very dense and microscopic observations revealed uneven biofilm structures, with presence of exopolymeric matrix surrounding single cells, small aggregates and microcolonies, in a honeycomb-like arrangement. Moreover, planktonic population of L. monocytogenes (present in broth media covering the abiotic surface) remained stable throughout the incubation time, which indicates an efficient dispersal mechanism, since the culture medium was replaced daily. In conclusion, even if these strains of L. monocytogenes were not able to form thick multilayer biofilms, it was noticeable their high persistence on abiotic surfaces, reinforcing the need to focus on measures to avoid biofilm formation, instead of trying to eradicate mature biofilms. Copyright © 2017. Published by Elsevier Editora Ltda.
Miladi, Hanene; Elabed, Hamouda; Ben Slama, Rihab; Rhim, Amel; Bakhrouf, Amina
2017-03-01
Listeria monocytogenes is a food-borne pathogen of humans and other animals. The striking ability to survive several stresses usually used for food preservation makes L. monocytogenes one of the biggest concerns to the food industry. This ubiquity can be partly explained by the ability of the organism to grow and persist at very low temperatures, a consequence of its ability to accumulate cryoprotective compound called osmolytes. A quantitative RT-PCR assay was used to measure mRNA transcript accumulation for the stress response genes opuCA and betL (encoding carnitine and betaine transporters, respectively) and the housekeeping gene 16S rRNA. Assays were conducted on mid-exponential phase L. monocytogenes cells exposed to conditions reflecting cold and freezing stress, conditions usually used to preserve foods. We showed that expression of the two cold-adapted genes encoded the transporters of the cryoprotectants carnitine and betaine in ATCC 19115 and the food-isolated L. monocytogenes S1 is induced after cold and freezing stress exposure. Furthermore, transcriptional analysis of the genes encoding opuCA and betL revealed that each transporter is induced to different degrees upon cold shock of L. monocytogenes ATCC 19115 and S1. Our results confirm an increase in carnitine uptake at low temperatures more than in betaine after cold-shocked temperature compared to the non-stress control treatment. It was concluded the use of carnitine and betaine as cryoprotectants is essential for rapid induction of the tested stress response under conditions typically encountered during food preservation.
Directory of Open Access Journals (Sweden)
Jozi Fagundes de Mello
2008-03-01
Full Text Available The polymorphic region sequences in the iap gene were analyzed in 25 strains of Listeria monocytogenes isolated from cheeses in the state of Rio Grande do Sul, and compared with reference strains. This investigation distinguished two clusters of L. monocytogenes: I (20 strains and II (5 strains.A seqüência da região polimórfica do gene iap foi analisada em 25 cepas de Listeria monocytogenes isoladas de queijo no Estado do Rio Grande do Sul e comparadas com cepas referências. Esta investigação distinguiu L. monocytogenes em dois grupos: I (20 cepas e II (5 cepas.
Wang, Jianfeng; Liu, Bowen; Teng, Zihao; Zhou, Xuan; Wang, Xiyan; Zhang, Bing; Lu, Gejin; Niu, Xiaodi; Yang, Yongjun; Deng, Xuming
2017-01-01
The critical roles of sortase A (SrtA) and listeriolysin O (LLO) in Listeria monocytogenes pathogenicity render these two virulence factors as ideal targets for the development of anti-virulence agents against L. monocytogenes infection. Additionally, the structures of SrtA and LLO are highly conserved among the members of sortase enzyme family and cholesterol dependent toxin family. Here, phloretin, a natural polyphenolic compound derived from apples and pears that has little anti- L. monocytogenes activity, was identified to simultaneously inhibit LLO expression and neutralize SrtA catalytic activity. Phloretin neutralized SrtA activity by causing a conformational change in the protein's active pocket, which prevented engagement with its substrate. Treatment with phloretin simultaneously reduced L. monocytogenes invasion into host cells and blocked the escape of vacuole-entrapped L. monocytogenes into cytoplasm. Further, L. monocytogenes -infected mice that received phloretin showed lower mortality, decreased bacterial burden and reduced pathological injury. Our results demonstrate that phloretin is a promising anti-infective therapeutic for infections caused by L. monocytogenes due to its simultaneous targeting of SrtA and LLO, which may result in fewer side effects than those caused by other antibiotics.
PLAG1 deficiency impairs spermatogenesis and sperm motility in mice.
Juma, Almas R; Grommen, Sylvia V H; O'Bryan, Moira K; O'Connor, Anne E; Merriner, D Jo; Hall, Nathan E; Doyle, Stephen R; Damdimopoulou, Pauliina E; Barriga, Daniel; Hart, Adam H; Van de Ven, Wim J M; De Groef, Bert
2017-07-13
Deficiency in pleomorphic adenoma gene 1 (PLAG1) leads to reduced fertility in male mice, but the mechanism by which PLAG1 contributes to reproduction is unknown. To investigate the involvement of PLAG1 in testicular function, we determined (i) the spatial distribution of PLAG1 in the testis using X-gal staining; (ii) transcriptomic consequences of PLAG1 deficiency in knock-out and heterozygous mice compared to wild-type mice using RNA-seq; and (iii) morphological and functional consequences of PLAG1 deficiency by determining testicular histology, daily sperm production and sperm motility in knock-out and wild-type mice. PLAG1 was sparsely expressed in germ cells and in Sertoli cells. Genes known to be involved in spermatogenesis were downregulated in the testes of knock-out mice, as well as Hsd17b3, which encodes a key enzyme in androgen biosynthesis. In the absence of Plag1, a number of genes involved in immune processes and epididymis-specific genes were upregulated in the testes. Finally, loss of PLAG1 resulted in significantly lowered daily sperm production, in reduced sperm motility, and in several animals, in sloughing of the germinal epithelium. Our results demonstrate that the subfertility seen in male PLAG1-deficient mice is, at least in part, the result of significantly reduced sperm output and sperm motility.
Veen, van der S.; Wagendorp, A.; Abee, T.; Wells-Bennik, M.H.J.
2009-01-01
Listeria monocytogenes is a foodborne pathogen that has the ability to survive relatively high temperatures compared with other nonsporulating foodborne pathogens. This study was performed to determine whether L. monocytogenes strains with relatively high heat resistances are adequately inactivated
The effects of daikenchuto (DKT) on propulsive motility in the colon.
Wood, Michael J; Hyman, Neil H; Mawe, Gary M
2010-11-01
The purpose of this study is to examine the use of daikenchuto (DKT), a traditional Japanese medicine, as a potential treatment for opiate-induced slowing of intestinal transit in an isolated guinea pig colon model of motility. Isolated segments of distal guinea pig colon were mounted in a perfusion chamber and imaged with a digital video camera interfaced with a computer. Fecal pellets were inserted into the oral end of the colonic segment and the rates of propulsive motility over a 3 to 4 cm segment of colon were determined in the presence and absence of test compounds. In addition, intracellular recordings were obtained from intact circular muscle, and the responsiveness of inhibitory and excitatory junction potentials to DKT was evaluated. The addition of D-Ala2, N-Me-Phe4, Gly-ol5 (DAMGO), a selective μ-receptor agonist, caused a concentration dependent decrease in colon motility. Naloxone did not affect basal activity, but partially restored motility in the DAMGO treated preparations. DKT (1 × 10(-4)-3 × 10(-4)g/mL) also reversed the inhibitory effect of DAMGO treated colon in a concentration dependent manner. At higher concentrations (1 × 10(-3)-3 × 10(-3)g/mL), however, this effect was lost. Motility slowed even further when naloxone and DKT were combined with noticeable disruptions in spatiotemporal patterns. Interestingly, when added alone, DKT resulted in reverse peristalsis of the pellet. In electrophysiologic studies DKT inhibited both excitatory and inhibitory junction potentials. DKT appears to be as effective as naloxone in restoring motility in DAMGO treated colon. These two agents, however, do not appear to have an additive effect. When used on untreated colon segments, DKT appears to cause disruptions in the intrinsic reflex circuit of the gut resulting in a disruption of neuromuscular communication. Copyright © 2010 Elsevier Inc. All rights reserved.
A Meta-analysis of the Rates of Listeria monocytogenes and Enterococcus in Febrile Infants.
Leazer, Rianna; Perkins, Amy M; Shomaker, Kyrie; Fine, Bryan
2016-04-01
A change in the epidemiology of pathogens causing serious bacterial infection (SBI) has been noted since original recommendations were made for the empirical antibiotic choices for young infants with fever. To assess the prevalence of SBI caused by Listeria monocytogenes and Enterococcus species. A literature search was conducted on keywords related to SBI, L. monocytogenes, and Enterococcus spp. infections. Eligible studies were those conducted in the United States and published between January 1998 and June 2014 focusing on SBI in infants≤90 days of age. The rates of urinary tract infection, bacteremia, and meningitis for each pathogen were recorded for each study. Meta-analysis was performed to calculate the prevalence for each pathogen in a random effects model with 0.5 continuity correction added to studies with zero events. Sixteen studies were included. A total of 20,703 blood cultures were included, with weighted prevalences for L. monocytogenes and Enterococcus spp. bacteremia of 0.03% and 0.09%, respectively. A total of 13,775 cerebrospinal fluid cultures were included with event rates (unweighted prevalences) for L. monocytogenes and Enterococcus spp. meningitis of 0.02% and 0.03%, respectively. A total of 18,283 urine cultures were included, with no cases of L. monocytogenes and a weighted prevalence for Enterococcus spp. urinary tract infection of 0.28%. There may have been reporting bias or incomplete retrieval or inadvertent exclusion of relevant studies. SBI caused by L. monocytogenes and Enterococcus spp. in febrile infants is rare, and therefore clinicians may consider a change in empirical antibiotic choices. Copyright © 2016 by the American Academy of Pediatrics.
Rapid detection of Listeria monocytogenes in foods, by a combination of PCR and DNA probe.
Ingianni, A; Floris, M; Palomba, P; Madeddu, M A; Quartuccio, M; Pompei, R
2001-10-01
Listeria monocytogenes is a frequent contaminant of water and foods. Its rapid detection is needed before some foods can be prepared for marketing. In this work L. monocytogenes has been searched for in foods, by a combination of polymerase chain reaction (PCR) and a DNA probe. Both PCR and the probe were prepared for recognizing a specific region of the internalin gene, which is responsible for the production of one of the most important pathogenic factors of Listeria. The combined use of PCR and the DNA probe was used for the detection of L. monocytogenes in over 180 environmental and food samples. Several detection methods were compared in this study, namely conventional culture methods; direct PCR; PCR after an enrichment step; a DNA probe alone; a DNA probe after enrichment and another commercially available gene-probe. Finally PCR and the DNA probe were used in series on all the samples collected. When the DNA probe was associated with the PCR, specific and accurate detection of listeria in the samples could be obtained in about a working-day. The present molecular method showed some advantages in terms of rapidity and specificity in comparison to the other aforementioned tests. In addition, it resulted as being easy to handle, even for non-specialized personnel in small diagnostic microbiology laboratories. Copyright 2001 Academic Press.
Cauchon, Kaitlin E; Hitchins, Anthony D; Smiley, R Derike
2017-09-01
Three selective enrichment methods, the United States Food and Drug Administration's (FDA method), the United States Department of Agriculture Food Safety Inspection Service's (USDA method), and the EN ISO 11290-1 standard method, were assessed for their suitability for recovery of Listeria monocytogenes from spiked mung bean sprouts. Three parameters were evaluated; the enrichment L. monocytogenes population from singly-spiked sprouts, the enrichment L. monocytogenes population from doubly-spiked (L. monocytogenes and Listeria innocua) sprouts, and the population differential resulting from the enrichment of doubly-spiked sprouts. Considerable L. monocytogenes inter-strain variation was observed. The mean enrichment L. monocytogenes populations for singly-spiked sprouts were 6.1 ± 1.2, 4.9 ± 1.2, and 6.9 ± 2.3 log CFU/mL for the FDA, USDA, and EN ISO 11290-1 methods, respectively. The mean L. monocytogenes populations for doubly-spiked sprouts were 4.7 ± 1.1, 5.5 ± 1.3, and 4.6 ± 1.4 log CFU/mL for the FDA, USDA, and ISO 11290-1 enrichment methods, respectively. The corresponding mean population differentials were 2.8 ± 1.1, 3.3 ± 1.3, and 3.6 ± 1.4 Δlog CFU/mL for the same three enrichment methods, respectively. The presence of L. innocua and resident microorganisms on the sprouts negatively impacted final levels of L. monocytogenes with all three enrichment methods. Published by Elsevier Ltd.
Day, J B; Basavanna, U
2015-01-01
To develop a rapid detection procedure for Listeria monocytogenes in infant formula and lettuce using a macrophage-based enrichment protocol and real-time PCR. A macrophage cell culture system was employed for the isolation and enrichment of L. monocytogenes from infant formula and lettuce for subsequent identification using real-time PCR. Macrophage monolayers were exposed to infant formula and lettuce contaminated with a serial dilution series of L. monocytogenes. As few as approx. 10 CFU ml(-1) or g(-1) of L. monocytogenes were detected in infant formula and lettuce after 16 h postinfection by real-time PCR. Internal positive PCR controls were utilized to eliminate the possibility of false-negative results. Co-inoculation with Listeria innocua did not reduce the L. monocytogenes detection sensitivity. Intracellular L. monocytogenes could also be isolated on Listeria selective media from infected macrophage lysates for subsequent confirmation. The detection method is highly sensitive and specific for L. monocytogenes in infant formula and lettuce and establishes a rapid identification time of 20 and 48 h for presumptive and confirmatory identification, respectively. The method is a promising alternative to many currently used q-PCR detection methods which employ traditional selective media for enrichment of contaminated food samples. Macrophage enrichment of L. monocytogenes eliminates PCR inhibitory food elements and contaminating food microflora which produce cleaner samples that increase the rapidity and sensitivity of detection. Published 2014. This article is a U.S. Government work and is in the public domain in the USA.
Occurrence and antimicrobial resistance patterns of Listeria monocytogenes isolated from vegetables
Directory of Open Access Journals (Sweden)
Vanessa de Vasconcelos Byrne
2016-06-01
Full Text Available Abstract Although the consumption of fresh and minimally processed vegetables is considered healthy, outbreaks related to the contamination of these products are frequently reported. Among the food-borne pathogens that contaminate vegetables is Listeria monocytogenes, a ubiquitous organism that exhibits the ability to survive and multiply at refrigerated temperatures. This study aimed to evaluate the occurrence of L. monocytogenes in vegetables as well as the antimicrobial resistance of isolates. The results showed that 3.03% of samples were contaminated with L. monocytogenes, comprising 2.22% of raw vegetables and 5.56% of ready-to-eat vegetables. Multiplex PCR confirmed the virulence potential of the isolates. Antimicrobial resistance profiling showed that 50% of the isolates were susceptible to the antibiotics used. The resistance of one isolate to penicillin G, a commonly employed therapeutic agent, and the presence of serotype 4b, a serotype commonly associated with food-borne outbreaks, could be potential health hazards for consumers.
The effect of the freezing curve type on bull spermatozoa motility after thawing
Directory of Open Access Journals (Sweden)
Martina Doležalová
2015-01-01
Full Text Available The objective of this work was to determine the effect of selected freezing curves on spermatozoa survivability after thawing, defined by its motility. The ejaculates of nine selected sires of the same age, breed, and frequency of collecting, bred under the same breeding conditions including handling, stabling, feeding system and feeding ratio composition, were repeatedly collected and evaluated. Sperm samples of each sire were diluted using only one extender and divided into four parts. Selected four freezing curves – the standard, commercially recommended three-phase curve; a two-phase curve; a slow three-phase curve; and a fast three-phase curve, differing in the course of temperature vs time, were applied. The percentage rate of progressive motile spermatozoa above head was determined immediately after thawing, and after 30, 60, 90, and 120 min of the thermodynamic test (TDT. Moreover, average spermatozoa motility (AMOT and spermatozoa motility decrease (MODE throughout the entire TDT were evaluated. Insemination doses frozen using the simpler two-phase curve demonstrated the highest motility values (+2.97% to +10.37%; P < 0.05–0.01 immediately after thawing and during the entire TDT. Concurrently, the highest AMOT (+4.37% to +8.82%; P < 0.01 was determined. The highest spermatozoa motility values were detected after thawing doses frozen by the two-phase freezing curve in eight out of nine sires. Simultaneously, a significant effect of sire individuality was clearly confirmed. Inter-sire differences of spermatozoa motility during TDT as well as AMOT and MODE were significant (P < 0.01. The findings describing both factors of interaction indicate the necessity of individual cryopreservation of the ejaculate to increase its fertilization capability after thawing.
Cellular and molecular investigations of the adhesion and mechanics of Listeria monocytogenes
Eskhan, Asma Omar
Atomic force microscopy has been used to quantify the adherence and mechanical properties of an array of L. monocytogenes strains and their surface biopolymers. First, eight L. monocytogenes strains that represented the two major lineages of the species were compared for their adherence and mechanics at cellular and molecular levels. Our results indicated that strains of lineage' II were characterized by higher adhesion and Young's moduli, longer and more rigid surface biopolymers and lower specific and nonspecific forces when compared to lineage' I strains. Additionally, adherence and mechanical properties of eight L. monocytogenes epidemic and environmental strains were probed. Our results pointed to that environmental and epidemic strains representative of a given lineage were similar in their adherence and mechanical properties when investigated at a cellular level. However, when the molecular properties of the strains were considered, epidemic strains were characterized by higher specific and nonspecific forces, shorter, denser and more flexible biopolymers compared to environmental strains. Second, the role of environmental pH conditions of growth on the adhesion and mechanics of a pathogenic L. monocytogenes EGDe was investigated. Our results pointed to a transition in the adhesion energies for cells cultured at pH 7. In addition, when the types of molecular forces that govern the adhesion were quantified using Poisson statistical approach and using a new proposed method, specific hydrogen-bond energies dominated the bacterial adhesion process. Such a finding is instrumental to researchers designing methods to control bacterial adhesion. Similarly, bacterial cells underwent a transition in their mechanical properties. We have shown that cells cultured at pH 7 were the most rigid compared to those cultured in lower or higher pH conditions of growth. Due to transitions observed in adherence and mechanics when cells were cultured at pH 7, we hypothesized that
Mechanistic studies of the agmatine deiminase from Listeria monocytogenes.
Soares, Charles A; Knuckley, Bryan
2016-06-01
Listeria monocytogenes is a Gram-positive food-borne pathogen that is capable of living within extreme environments (i.e. low temperatures and pH). This ability to survive in such conditions may arise, at least in part, from agmatine catabolism via the agmatine deiminase system (AgDS). This catabolic pathway utilizes an agmatine deiminase (AgD) to hydrolyse agmatine into N-carbamoylputrescine (NCP), with concomitant release of ammonia, which increases the pH, thus mitigating the ill effects of the acidic environment. Given the potential significance of this pathway for cell survival, we set out to study the catalytic mechanism of the AgD encoded by L. monocytogenes In the present paper, we describe the catalytic mechanism employed by this enzyme based on pH profiles, pKa measurements of the active site cysteine and solvent isotope effects (SIE). In addition, we report inhibition of this enzyme by two novel AgD inhibitors, i.e. N-(4-aminobutyl)-2-fluoro-ethanimidamide (ABFA) and N-(4-aminobutyl)-2-chloro-ethanimidamide (ABCA). In contrast with other orthologues, L. monocytogenes AgD does not use the reverse protonation or substrate-assisted mechanism, which requires an active site cysteine with a high pKa and has been commonly seen in other members of the guanidinium-modifying enzyme (GME) superfamily. Instead, the L. monocytogenes AgD has a low pKa cysteine in the active site leading to an alternative mechanism of catalysis. This is the first time that this mechanism has been observed in the GME superfamily and is significant because it explains why previously developed mechanism-based inactivators of AgDs are ineffective against this orthologue. © 2016 The Author(s). published by Portland Press Limited on behalf of the Biochemical Society.
Transverse loop colostomy and colonic motility.
Pucciani, F; Ringressi, M N; Maltinti, G; Bechi, P
2014-11-01
The motility of the defunctionalized colon, distal to transverse loop colostomy, has never been studied "in vivo." The aim of our study was to evaluate the influence of transverse loop colostomy on colonic motility. Thirteen patients were examined before stoma closure by means of clinical evaluation and colonic manometry; we studied both the right and distal colon in both fasting and fed patients in order to detect motor activity. Quantitative and qualitative manometric analyses showed that the diverted colon had motor activity even if no regular colonic motor pattern was observed. The spreading of aboral propagated contractions (PCs) was sometimes recorded from the right colon to the distal colon. The response of the proximal and distal colon to a standard meal, when compared to fasting values, increased more than 40 and 35 %, respectively. Stool and gas ejections from the colostomy were never related to a particular type of colonic motility: Motor quiescence such as PCs was chaotically related to stool escape. In conclusion, motility of the defunctionalized colon is preserved in patients with transverse loop colostomy.
Directory of Open Access Journals (Sweden)
Tian Ding
2017-05-01
Full Text Available This study firstly developed a multiplex real-time PCR (RT-PCR technique combined with a pre-enrichment step to simultaneously detect Staphylococcus aureus (S. aureus, Listeria monocytogenes (L. monocytogenes and Salmonella spp. in raw milk and the dairy farm environment (feces, soil, feed, water in one reaction. Brain heart infusion (BHI broth was selected for the enrichment step to increase the density of the target bacteria by using an incubation of 4 h before multiplex RT-PCR. The results showed that the detection limit of the multiplex real-time assay was approximately 102 CFU/mL for pure cultures and artificially contaminated milk without enrichment, while 12, 14, and 10 CFU/25 mL, respectively, for S. aureus, L. monocytogenes, and Salmonella spp. after pre-enrichment. The newly developed multiplex RT-PCR assay was applied to 46 dairy farm environmental samples and raw milk samples covering a wide variety of sample types. The results demonstrated that the multiplex RT-PCR assay coupled with the BHI enrichment broth was suitable for the simultaneous screening of S. aureus, L. monocytogenes, and Salmonella spp. in the pasture environment and in raw milk. The multiplex RT-PCR assay clearly and successfully shortened the total detection time and reduced labor compared to conventional culture-based methods for testing natural samples.
Fravalo, Philippe; Cherifi, Tamazight; Neira Feliciano, Kersti Dina; Letellier, Ann; Fairbrother, Julie-Hélène; Bekal, Sadjia
2017-01-01
The introduction of Listeria monocytogenes into the food production chain is a concern, with numerous grouped cases of listeriosis associated with milk-derived or pork-derived products have been documented. Management of this zoonotic pathogen considers all strains as an equal risk. Recently, a new perspective for characterisation of strain virulence was introduced with the discovery of the unaltered sequence of InlA as a determinant of strain virulence; this has also been reported as an infrequent finding among so-called environmental strains, that is, strains isolated from food or from surfaces in food industries. The aim of this study was to differentiate L monocytogenes strains isolated from animal cases versus those from human cases and to differentiate clinical strains from environmental ones using a Caenorhabditis elegans virulence testing model. In Quebec in 2013/2014, the surveillance of L monocytogenes clinical isolates registered a total of 20 strains of animal origin and 16 pulsed-field gel electrophoresis types isolated from human cases. The mixed PCR multiplex agglutination protocol used for geno-serotyping clearly discriminated genogroup IVB strains from bovine and human origins. The presence of a premature stop codon single nucleotide polymorphism in the inlA gene sequence in clinical strains and the identical behaviour of particular strains in the C elegans model are discussed in this paper from the perspective of industrial management of L monocytogenes risk. PMID:28761668
Biofilm formation by Listeria monocytogenes on stainless steel surface and biotransfer potential
Directory of Open Access Journals (Sweden)
Maíra Maciel Mattos de Oliveira
2010-03-01
Full Text Available An experimental model was proposed to study biofilm formation by Listeria monocytogenes ATCC 19117 on AISI 304 (#4 stainless steel surface and biotransfer potential during this process. In this model, biofilm formation was conducted on the surface of stainless steel coupons, set on a stainless steel base with 4 divisions, each one supporting 21 coupons. Trypic Soy Broth was used as bacterial growth substrate, with incubation at 37 ºC and stirring of 50 rpm. The number of adhered cells was determined after 3, 48, 96, 144, 192 and 240 hours of biofilm formation and biotransfer potential from 96 hours. Stainless steel coupons were submitted to Scanning Electron Microscopy (SEM after 3, 144 and 240 hours. Based on the number of adhered cells and SEM, it was observed that L. monocytogenes adhered rapidly to the stainless steel surface, with mature biofilm being formed after 240 hours. The biotransfer potential of bacterium to substrate occurred at all the stages analyzed. The rapid capacity of adhesion to surface, combined with biotransfer potential throughout the biofilm formation stages, make L. monocytogenes a potential risk to the food industry. Both the experimental model developed and the methodology used were efficient in the study of biofilm formation by L. monocytogenes on stainless steel surface and biotransfer potential.
Biofilm formation by Listeria monocytogenes on stainless steel surface and biotransfer potential.
de Oliveira, Maíra Maciel Mattos; Brugnera, Danilo Florisvaldo; Alves, Eduardo; Piccoli, Roberta Hilsdorf
2010-01-01
An experimental model was proposed to study biofilm formation by Listeria monocytogenes ATCC 19117 on AISI 304 (#4) stainless steel surface and biotransfer potential during this process. In this model, biofilm formation was conducted on the surface of stainless steel coupons, set on a stainless steel base with 4 divisions, each one supporting 21 coupons. Trypic Soy Broth was used as bacterial growth substrate, with incubation at 37 °C and stirring of 50 rpm. The number of adhered cells was determined after 3, 48, 96, 144, 192 and 240 hours of biofilm formation and biotransfer potential from 96 hours. Stainless steel coupons were submitted to Scanning Electron Microscopy (SEM) after 3, 144 and 240 hours. Based on the number of adhered cells and SEM, it was observed that L. monocytogenes adhered rapidly to the stainless steel surface, with mature biofilm being formed after 240 hours. The biotransfer potential of bacterium to substrate occurred at all the stages analyzed. The rapid capacity of adhesion to surface, combined with biotransfer potential throughout the biofilm formation stages, make L. monocytogenes a potential risk to the food industry. Both the experimental model developed and the methodology used were efficient in the study of biofilm formation by L. monocytogenes on stainless steel surface and biotransfer potential.
Sakaridis, I; Soultos, N; Dovas, C I; Papavergou, E; Ambrosiadis, I; Koidis, P
2012-02-01
This study was conducted to isolate psychrotrophic lactic acid bacteria (LAB) from chicken carcasses with inhibitory activity against strains of Salmonella spp. and Listeria monocytogenes. A total of 100 broiler samples were examined for the presence of LAB. Ninety-two LAB isolates that showed antimicrobial effects against Salmonella spp. and L. monocytogenes were further analysed to examine their LAB (Gram-positive, catalase negative, oxidase negative) and psychrotrophic characteristics (ability to grow at 7 °C). Fifty isolates were further selected and identified initially using standard biochemical tests in miniature (Micro-kits API CH 50) and then by sequencing of the 16s-23s rRNA gene boundary region (Intergenic Spacer Region). By molecular identification, these isolates were classified into 5 different LAB species: Lactobacillus salivarius, Lactobacillus reuteri, Lactobacillus johnsonii, Pediococcus acidilactici, and Lactobacillus paralimentarius. None of the isolates produced tyramine or histamine. Copyright © 2011 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Moutong eChen
2015-09-01
Full Text Available Listeria monocytogenes is an important foodborne pathogen that can cause serious illness in immunocompromised individuals, pregnant women, the elderly, and newborns. The aim of this study was to: (i evaluate the prevalence and contamination level (most probable number, MPN of L. monocytogenes in 567 retail raw foods (fishery products, n=154; raw/fresh meat, n=123; frozen foods, n=110; edible fungi, n=108; vegetables, n=72 collected from South China and (ii to gain further knowledge on the phenotype and genotype distributions of this important foodborne pathogen. Approximately 22% of the samples were positive for L. monocytogenes. The contamination levels were between 0.3 and 10 MPN/g in 75.0%, between 10 and 100 MPN/g in 11.0% and less than 100 MPN/g in 14.0% of the countable samples. Five serogroups were identified among the177 foodborne L. monocytogenes isolates, with1/2a-3a (42.4% and1/2b-3b (26.0% serogroups being the most dominant. Serogroup I.1 and II.2 were only found in the edible mushrooms, while serogroup III was dominant in the fishery products, suggesting that specific serogroups of L. monocytogenes may have distinct ecological niches. Ten (5.6% L. monocytogenes isolates exhibited multidrug resistance. Genetic relatedness analysis revealed the absence of distinct associations between specific food types, antibiotic resistance, serogroups, and genetic diversity. The present study provided the first baseline data on the prevalence, contamination level, and characteristics of L. monocytogenes isolated from raw foods in South China. Some multidrug resistant strains belonged to the epidemiologically important serogroups (I.1 and II.1, implying a potential public health risk. In addition, these findings also provide basic information for the Chinese food safety associated authorities to draft appropriate standards to control L. monocytogenes contamination and improve microbiological safety of raw foods.
Local Outbreak of Listeria monocytogenes Serotype 4b Sequence Type 6 Due to Contaminated Meat Pâté.
Althaus, Denise; Jermini, Marco; Giannini, Petra; Martinetti, Gladys; Reinholz, Danuta; Nüesch-Inderbinen, Magdalena; Lehner, Angelika; Stephan, Roger
2017-04-01
In January and February 2016, five cases of confirmed and two cases of probable infection due to Listeria monocytogenes serotype 4b, sequence type (ST) 6 belonging to a single pulsed-field gel electrophoresis pulsotype pattern were registered in a region of southern Switzerland. L. monocytogenes was detected in blood samples (four cases) and pleural fluid (one case). Furthermore, L. monocytogenes 4b ST6 was detected in a stool sample of an asymptomatic person exposed to a common food. Forthwith, the food safety authority and a local gourmet meat producer reported L. monocytogenes contamination of meat pâté. Analysis of further food and environmental samples from the premises of the producer yielded isolates matching the clinical strains and confirmed the presence of L. monocytogenes 4b ST6 in the mincing machine as the cause of the food contamination.
DEFF Research Database (Denmark)
Kastbjerg, Vicky Gaedt; Hein-Kristensen, Line; Gram, Lone
2014-01-01
Exposure of the human food-borne pathogen Listeria monocytogenes to sublethal concentrations of triclosan can cause resistance to several aminoglycosides. Aminoglycoside-resistant isolates exhibit two colony morphologies: normal-size and pinpoint colonies. The purposes of the present study were...... to characterize the small colonies of L. monocytogenes and to determine if specific genetic changes could explain the triclosan-induced aminoglycoside resistance in both pinpoint and normal-size isolates. Isolates from the pinpoint colonies grew poorly under aerated conditions, but growth was restored by addition......I and that exposure to triclosan can cause resistance to antibiotics that enters the cell via active transport. Further studies are needed to elucidate if L. monocytogenes pinpoint isolates could have any clinical impact, e.g., in persistent infections....
Effect of starter cultures on survival of Listeria monocytogenes in Čajna sausage
Bošković, M.; Tadić, V.; Đorđević, J.; Glišić, M.; Lakićević, B.; Dimitrijević, M.; Baltić, M. Ž.
2017-09-01
The aim of the study was to evaluate the survival of Listeria monocytogenes during the production of Čajna sausage with short maturation time. Sausage batter was inoculated with three different serotypes 4b and serotype 1/2a of L. monocytogenes. Control sausages were without any starter culture added; the second batch was inoculated with strains of Lactobacillus sakei, Staphylococcus carnosus and Staphylococcus xylosus, and the third batch was inoculated with strains of Debaryomyces hansenii, Lactobacillus sakei, Pediococcus acidilactici, Pediococcus pentosaceus, Staphylococcus carnosus and Staphylococcus xylosus. After 18 days of ripening, L. monocytogenes was not detected in any of the sausages, but during this fermentation and drying, the numbers of this pathogen was lower in the sausages inoculated with starter cultures.
Esophageal motility in eosinophilic esophagitis.
Weiss, A H; Iorio, N; Schey, R
2015-01-01
Eosinophilic esophagitis (EoE) is characterized by eosinophilic infiltration of the esophagus and is a potential cause of dysphagia and food impaction, most commonly affecting young men. Esophageal manometry findings vary from normal motility to aperistalsis, simultaneous contractions, diffuse esophageal spasm, nutcracker esophagus or hypotonic lower esophageal sphincter (LES). It remains unclear whether esophageal dysmotility plays a significant role in the clinical symptoms of EoE. Our aim is to review the pathogenesis, diagnosis, and effect of treatment on esophageal dysmotility in EoE. A literature search utilizing the PubMed database was performed using keywords: eosinophilic esophagitis, esophageal dysmotility, motility, manometry, impedance planimetry, barium esophagogram, endoscopic ultrasound, and dysphagia. Fifteen studies, totaling 387 patients with eosinophilic esophagitis were identified as keeping in accordance with the aim of this study and included in this review. The occurrence of abnormal esophageal manometry was reported to be between 4 and 87% among patients with EoE. Esophageal motility studies have shown reduced distensibility, abnormal peristalsis, and hypotonicity of the LES in patients with EoE, which may also mimic other esophageal motility disorders such as achalasia or nutcracker esophagus. Studies have shown conflicting results regarding the presence of esophageal dysmotility and symptoms with some reports suggesting a higher rate of food impaction, while others report no correlation between motor function and dysphagia. Motility dysfunction of the esophagus in EoE has not been well reported in the literature and studies have reported conflicting evidence regarding the clinical significance of dysmotility seen in EoE. The correlation between esophageal dysmotility and symptoms of EoE remains unclear. Larger studies are needed to investigate the incidence of esophageal dysmotility, clinical implications, and effect of treatment on
Xayarath, Bobbi; Alonzo, Francis; Freitag, Nancy E.
2015-01-01
Listeria monocytogenes is a Gram-positive facultative intracellular bacterial pathogen that invades mammalian cells and escapes from membrane-bound vacuoles to replicate within the host cell cytosol. Gene products required for intracellular bacterial growth and bacterial spread to adjacent cells are regulated by a transcriptional activator known as PrfA. PrfA becomes activated following L. monocytogenes entry into host cells, however the signal that stimulates PrfA activation has not yet been defined. Here we provide evidence for L. monocytogenes secretion of a small peptide pheromone, pPplA, which enhances the escape of L. monocytogenes from host cell vacuoles and may facilitate PrfA activation. The pPplA pheromone is generated via the proteolytic processing of the PplA lipoprotein secretion signal peptide. While the PplA lipoprotein is dispensable for pathogenesis, bacteria lacking the pPplA pheromone are significantly attenuated for virulence in mice and have a reduced efficiency of bacterial escape from the vacuoles of nonprofessional phagocytic cells. Mutational activation of PrfA restores virulence and eliminates the need for pPplA-dependent signaling. Experimental evidence suggests that the pPplA peptide may help signal to L. monocytogenes its presence within the confines of the host cell vacuole, stimulating the expression of gene products that contribute to vacuole escape and facilitating PrfA activation to promote bacterial growth within the cytosol. PMID:25822753
Oxaran, Virginie; Lee, Sarah Hwa In; Chaul, Luíza Toubas; Corassin, Carlos Humberto; Barancelli, Giovana Verginia; Alves, Virgínia Farias; de Oliveira, Carlos Augusto Fernandes; Gram, Lone; De Martinis, Elaine Cristina Pereira
2017-12-01
Listeria monocytogenes can cause listeriosis, a severe foodborne disease. In Brazil, despite very few reported cases of listeriosis, the pathogen has been repeatedly isolated from dairies. This has led the government to implement specific legislation to reduce the hazard. Here, we determined the incidence of L. monocytogenes in five dairies and retail products in the Southeast and Midwest regions of Brazil over eight months. Of 437 samples, three samples (0.7%) from retail and only one sample (0.2%) from the dairies were positive for L. monocytogenes. Thus, the contamination rate was significantly reduced as compared to previous studies. MultiLocus Sequence Typing (MLST) was used to determine if contamination was caused by new or persistent clones leading to the first MLST profile of L. monocytogenes from the Brazilian dairy industry. The processing environment isolate is of concern being a sequence-type (ST) 2, belonging to the lineage I responsible for the majority of listeriosis outbreaks. Also, ST3 and ST8 found in commercialized cheese have previously been reported in outbreaks. Despite the lower incidence, dairy products still pose a potential health risk and the occurrence of L. monocytogenes in dairies and retail products emphasize the need for continuous surveillance of this pathogen in the Brazilian dairy industry. Copyright © 2017 Elsevier Ltd. All rights reserved.
Nastou, Aikaterini; Rhoades, Jonathan; Smirniotis, Petros; Makri, Ioanna; Kontominas, Michael; Likotrafiti, Eleni
2012-10-15
The efficacy of household decontamination methods at reducing Listeria monocytogenes on fresh lettuce (Lactuca sativa), cucumber (Cucumis sativus) and parsley (Petroselinum sativum) was studied. Inoculated vegetable pieces were immersed in washing solutions and surviving L. monocytogenes enumerated. Parameters investigated were storage temperature prior to washing, dipping water temperature, agitation, acetic acid concentration and immersion time. The results indicated that the storage temperature significantly affects the efficacy of dipping vegetables in water for the control of L. monocytogenes, as the reduction in count was greatest when products had been stored at cooler temperatures. Decontamination with acetic acid (up to 2.0% v/v) was shown to have some effect in most cases, but the highest observed decrease in count was 2.6 log cfu/g. Experiments investigating the effect of exposure time to acetic acid (0.5% and 1.0% v/v, up to 30 min immersion) indicated that immersing the vegetables for more than 10 min is of minimal benefit. The most significant factor affecting washing and decontamination efficacy was the vegetable itself: L. monocytogenes colonizing cucumber epidermis was far more resistant to removal by washing and to acid treatment than that on the leafy vegetables, and L. monocytogenes on parsley was the most susceptible. This shows that published decontamination experiments (often performed with lettuce) cannot necessarily be extrapolated to other vegetables. Copyright © 2012 Elsevier B.V. All rights reserved.
Pochop, Jaroslav; Kačániová, Miroslava; Hleba, Lukáš; Lopasovský, L'ubomír; Bobková, Alica; Zeleňáková, Lucia; Stričík, Michal
2012-01-01
The aim of this study was to follow contamination of ready-to-eat food with Listeria monocytogenes by using the Step One real time polymerase chain reaction (PCR). We used the PrepSEQ Rapid Spin Sample Preparation Kit for isolation of DNA and MicroSEQ® Listeria monocytogenes Detection Kit for the real-time PCR performance. In 30 samples of ready-to-eat milk and meat products without incubation we detected strains of Listeria monocytogenes in five samples (swabs). Internal positive control (IPC) was positive in all samples. Our results indicated that the real-time PCR assay developed in this study could sensitively detect Listeria monocytogenes in ready-to-eat food without incubation.
The challenge of setting risk-based microbiological criteria for Listeria monocytogenes
DEFF Research Database (Denmark)
Andersen, Jens Kirk; Nørrung, Birgit
2011-01-01
After more than 20 years of work with discussing the setting of microbiological criteria for Listeria monocytogenes in foods, Codex Alimentarius on Food Hygiene has finalised a proposal that was recently adopted by the Codex Alimentarius Commission. The effort of developing procedures for making...... the microbiological criteria risk-based to the greatest extent possible has challenged scientists and managers during this long time period. Yet, the establishment of microbiological criteria for L. monocytogenes is still being discussed and several approaches are possible. Setting of microbiological criteria...
Barriers to bacterial motility on unsaturated surfaces
DEFF Research Database (Denmark)
Dechesne, Arnaud; Smets, Barth F.
2013-01-01
Our knowledge of the spatial organization and spatial dynamics of microbial populations in soil at a scale close to that of the microorganisms is scarce. While passive dispersal via water ow or soil biota is probably a major dispersal route, it is reasonable to consider that active dispersal also...... and their isogenic mutants unable to express various type of motility we aimed to quantify the physical limits of bacterial motility. Our results demonstrate how hydration controls bacterial motility under unsaturated conditions. They can form the base of improved biodegradation models that include microbial...
Listeria monocytogenes presence during fermentation, drying and storage of Petrovská klobása sausage
Janković, V.; Mitrović, R.; Lakićević, B.; Velebit, B.; Baltić, T.
2017-09-01
The majority of human listeriosis cases appear to be caused by consumption of ready-to-eat (RTE) foods contaminated at the time of consumption with high levels of Listeria monocytogenes. Although strategies to prevent growth of L. monocytogenes in RTE products are critical for reducing the incidence of human listeriosis, this pathogen is highly difficult to control in fermented sausage processing environments due to its high tolerance to low pH and high salt concentration. The aims of the present study were to investigate the occurrence, presence and elimination of L. monocytogenes in Petrovská klobása sausage during processing, fermentation, drying and storage. L. monocytogenes, which was detected at the beginning of the production cycle, disappeared before day 30. The pathogen decline was much faster in those sausages which were dried in controlled, industrial conditions than in those dried applying the traditional, household technique.
Cui, H Y; Wu, J; Lin, L
2016-08-01
Listeria monocytogenes infection in dairy products is of mounting public concern. To inhibit bacterial growth, we engineered stimuli-responsive liposomes containing lemongrass oil for this study. The controlled release of liposome-entrapped lemongrass oil is triggered by listerolysin O, secreted by L. monocytogenes. We investigated the antibiotic activities of lemongrass oil liposomes against L. monocytogenes in cheese. We also assessed their possible effects on the quality of the cheese. Liposomes containing lemongrass oil (5.0mg/mL) presented the optimal polydispersity index (0.246), zeta-potential (-58.9mV) and entrapment efficiency (25.7%). The liposomes displayed satisfactory antibiotic activity against L. monocytogenes in cheese over the storage period at 4°C. We observed no effects on the physical and sensory properties of the cheese after the liposome treatment. Copyright © 2016 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
McDonnell, Lindsey M; Glass, Kathleen A; Sindelar, Jeffrey J
2013-08-01
The objective of this study was to identify ingredients that inhibit Listeria monocytogenes in natural, organic, or clean-label ready-to-eat meat and poultry products. Fourteen ingredients were screened in uncured (no-nitrate-or-nitrite-added), traditional-cured (156 ppm of purified sodium nitrite), cultured (alternative cured, natural nitrate source, and Staphylococcus carnosus), or preconverted (alternative cured, natural nitrite source) turkey slurries. Slurries were cooked, cooled, inoculated to yield 3 log CFU/ml L. monocytogenes, stored at 4°C, and tested weekly for 4 weeks. Three antimicrobial ingredients, 1.5 % vinegar-lemon-cherry powder blend, 2.5 % buffered vinegar, and 3.0 % cultured sugar-vinegar blend, were incorporated into alternative-cured ham and uncured roast beef and deli-style turkey breast. Controls included all three meat products without antimicrobial ingredients and a traditional-cured ham with 2.8 % sodium lactate-diacetate. Cooked, sliced products were inoculated with 3 log CFU/g L. monocytogenes, vacuum packed, and stored at 4 or 7°C, for up to 12 weeks. For control products without antimicrobial agents stored at 4°C, a 2-log L. monocytogenes increase was observed at 2 weeks for ham and turkey and at 4 weeks for roast beef. Growth (>1-log increase) in the sodium lactate-diacetate was delayed until week 6. Compared with the control, the addition of either vinegar-lemon-cherry powder blend or buffered vinegar delayed L. monocytogenes growth for an additional 2 weeks, while the addition of cultured sugar-vinegar blend delayed growth for an additional 4 weeks for both ham and turkey. The greatest L. monocytogenes delay was observed in roast beef containing any of the three antimicrobial ingredients, with no growth detected through 12 weeks at 4°C for all the treatments. As expected, L. monocytogenes grew substantially faster in products stored at 7°C than at 4°C. These data suggest that antimicrobial ingredients from a natural source
Weller, Daniel; Wiedmann, Martin
2015-01-01
While rain and irrigation events have been associated with an increased prevalence of foodborne pathogens in produce production environments, quantitative data are needed to determine the effects of various spatial and temporal factors on the risk of produce contamination following these events. This study was performed to quantify these effects and to determine the impact of rain and irrigation events on the detection frequency and diversity of Listeria species (including L. monocytogenes) and L. monocytogenes in produce fields. Two spinach fields, with high and low predicted risks of L. monocytogenes isolation, were sampled 24, 48, 72, and 144 to 192 h following irrigation and rain events. Predicted risk was a function of the field's proximity to water and roads. Factors were evaluated for their association with Listeria species and L. monocytogenes isolation by using generalized linear mixed models (GLMMs). In total, 1,492 (1,092 soil, 334 leaf, 14 fecal, and 52 water) samples were collected. According to the GLMM, the likelihood of Listeria species and L. monocytogenes isolation from soil samples was highest during the 24 h immediately following an event (odds ratios [ORs] of 7.7 and 25, respectively). Additionally, Listeria species and L. monocytogenes isolates associated with irrigation events showed significantly lower sigB allele type diversity than did isolates associated with precipitation events (P = monocytogenes contamination. Small changes in management practices (e.g., not irrigating fields before harvest) may therefore reduce the risk of L. monocytogenes contamination of fresh produce. PMID:26116668
Effect of hospitalization on gastrointestinal motility and pH in dogs.
Warrit, Kanawee; Boscan, Pedro; Ferguson, Leah E; Bradley, Allison M; Dowers, Kristy L; Twedt, David C
2017-07-01
OBJECTIVE To determine the effect of hospitalization on gastrointestinal motility and pH in healthy dogs. DESIGN Experimental study. ANIMALS 12 healthy adult dogs. PROCEDURES A wireless motility capsule (WMC) that measured pressure, transit time, and pH within the gastrointestinal tract was administered orally to dogs in 2 phases. In the first phase, dogs received the WMC at the hospital and then returned to their home to follow their daily routine. In the second phase, dogs were hospitalized, housed individually, had abdominal radiography performed daily, and were leash exercised 4 to 6 times/d until the WMC passed in the feces. All dogs received the same diet twice per day in both phases. Data were compared between phases with the Wilcoxon signed rank test. RESULTS Data were collected from 11 dogs; 1 dog was excluded because the WMC failed to exit the stomach. Median gastric emptying time during hospitalization (71.8 hours; range, 10.7 to 163.0 hours) was significantly longer than at home (17.6 hours; range, 9.7 to 80.8 hours). Values of all other gastric, small bowel, and large bowel parameters (motility index, motility pattern, pH, and transit time) were similar between phases. No change in gastric pH was detected over the hospitalization period. High interdog variability was evident for all measured parameters. CONCLUSIONS AND CLINICAL RELEVANCE Hospitalization of dogs may result in a prolonged gastric emptying time, which could adversely affect gastric emptying of meals, transit of orally administered drugs, or assessments of underlying motility disorders.
Parasites in motion: flagellum-driven cell motility in African trypanosomes
Hill, Kent L.
2011-01-01
SUMMARY Motility of the sleeping sickness parasite, Trypanosoma brucei, impacts disease transmission and pathogenesis. Trypanosome motility is driven by a flagellum that harbors a canonical 9 + 2 axoneme, together with trypanosome-specific elaborations. Trypanosome flagellum biology and motility have been the object of intense research over the last two years. These studies have led to the discovery of a novel form of motility, termed social motility, and provided revision of long-standing models for cell propulsion. Recent work has also uncovered novel structural features and motor proteins associated with the flagellar apparatus and has identified candidate signaling molecules that are predicted to regulate flagellar motility. Together with earlier inventories of flagellar proteins from proteomic and genomic studies, the stage is now set to move forward with functional studies to elucidate molecular mechanisms and investigate parasite motility in the context of host-parasite interactions. PMID:20591724
Kadam, S.R.; Besten, den H.M.W.; Veen, van der S.; Zwietering, M.H.; Moezelaar, R.; Abee, T.
2013-01-01
The foodborne pathogen Listeria monocytogenes has the ability to produce biofilms in food-processing environments and then contaminate food products, which is a major concern for food safety. The biofilm forming behavior of 143 L. monocytogenes strains was determined in four different media that
Listeria monocytogenes, a well-described cause of encephalitis and abortion in ruminants and of food-borne illness in humans, is rarely associated with disease in companion animals. A case of urinary tract infection associated with an atypical, weakly hemolytic L. monocytogenes strain is described i...
Directory of Open Access Journals (Sweden)
Danielle N. Furtado
2015-03-01
Full Text Available Listeria monocytogenes is a pathogen frequently found in dairy products. Its control in fresh cheeses is difficult, due to the psychrotrophic properties and salt tolerance. Bacteriocinogenic lactic acid bacteria (LAB with proven in vitro antilisterial activity can be an innovative technological approach but their application needs to be evaluated by means of in situ tests. In this study, a novel bacteriocinogenic Lactococcus lactis strain (Lc. lactis DF4Mi, isolated from raw goat milk, was tested for control of growth of L. monocytogenes in artificially contaminated fresh Minas type goat cheese during storage under refrigeration. A bacteriostatic effect was achieved, and counts after 10 days were 3 log lower than in control cheeses with no added LAB. However, this effect did not differ significantly from that obtained with a non-bacteriocinogenic Lc. lactis strain. Addition of nisin (12.5 mg/kg caused a rapid decrease in the number of viable L. monocytogenes in the cheeses, suggesting that further studies with the purified bacteriocin DF4Mi may open new possibilities for this strain as biopreservative in dairy products.
International Nuclear Information System (INIS)
Dietrich, Grzegorz J.; Dietrich, Mariola; Kowalski, R.K.; Dobosz, Stefan; Karol, Halina; Demianowicz, Wieslaw; Glogowski, Jan
2010-01-01
In the current work, seminal plasma was used for the first time as an incubation medium for monitoring short-time exposure effects of sublethal concentrations of mercury and cadmium ions on rainbow trout sperm. Sperm motility parameters (CASA) and hatching rates were used as gamete quality markers. Additionally live/dead sperm viability test and comet assay of DNA fragmentation were performed. We demonstrated that computer-assisted sperm motility analysis (CASA) may serve as a predictor of reproductive success, when milt contaminated with heavy metals is used. Results presented in this study demonstrate that mercury ions altered sperm motility characteristics at 1-10 mg Hg 2+ /l and 10 mg Cd 2+ /l and hatching rates at 10 mg Hg 2+ /l and 10 mg Cd 2+ /l after 4 h of exposure. Although mercury ions affected sperm motility parameters immediately after dilution with milt as well as at 4 h of exposure, no differences in sperm motility parameters were found between intact and mercury-treated milt after 24 h of exposure. Our results suggest that rainbow trout seminal plasma has a protective role against the toxic effects of mercury ions of rainbow trout sperm motility.
Kuan, C H; Goh, S G; Loo, Y Y; Chang, W S; Lye, Y L; Puspanadan, S; Tang, J Y H; Nakaguchi, Y; Nishibuchi, M; Mahyudin, N A; Radu, S
2013-06-01
A total of 216 chicken offal samples (chicken liver = 72; chicken heart = 72; chicken gizzard = 72) from wet markets and hypermarkets in Selangor, Malaysia, were examined for the presence and density of Listeria monocytogenes by using a combination of the most probable number and PCR method. The prevalence of L. monocytogenes in 216 chicken offal samples examined was 26.39%, and among the positive samples, the chicken gizzard showed the highest percentage at 33.33% compared with chicken liver (25.00%) and chicken heart (20.83%). The microbial load of L. monocytogenes in chicken offal samples ranged from Malaysia.
Effect of humidity and temperature on the survival of Listeria monocytogenes on surfaces.
Redfern, J; Verran, J
2017-04-01
Listeria monocytogenes is a pathogenic bacterium, with human disease and infection linked to dairy products, seafood, ready-to-eat meat and raw & undercooked meats. Stainless steel is the most common food preparation surface and therefore, it is important to understand how food storage conditions such as surface materials, temperature and relative humidity can affect survival of L. monocytogenes. In this study, survival of L. monocytogenes on stainless steel was investigated at three temperatures (4, 10 and 21°C), each approx. 11, 50 and 85% humidity. Results indicate that the lower the temperature, the more cells were recovered in all three humidity environments, while medium humidity enhances survival, irrespective of temperature. Lower humidity decreases recovery at all temperatures. These data support the guidance noted above that humidity control is important, and that lower humidity environments are less likely to support retention of viable L. monocytogenes on a stainless steel surface. Understanding survival of potential food-borne pathogens is essential for the safe production and preparation of food. While it has long been 'common knowledge' that relative humidity can affect the growth and survival of micro-organisms, this study systematically describes the survival of L. monocytogenes on stainless steel under varying humidity and temperatures for the first time. The outcomes from this paper will allow those involved with food manufacture and preparation to make informed judgement on environmental conditions relating to humidity control, which is lacking in the food standards guidelines. © 2017 The Society for Applied Microbiology.
Lu, Chunye; Marjanovic, Olivera; Kiang, David
2017-01-01
ABSTRACT Listeria monocytogenes is an important foodborne pathogen. Here, we present the annotated whole genome of Listeria monocytogenes strains F14M01297-C2 and F14M01297-C4, isolated from nectarines distributed by a packing facility in California during an investigation of listeriosis associated with stone fruit in 2014. PMID:28729255
Bahador; Sadeghi Kalani; Valian; Irajian; Lotfollahi
2015-01-01
Background Listeria monocytogenes is a foodborne pathogen and a serious threat to the public health in the world. Consumption of traditional foods such as dairy and meat products can be a major reason for relative abundance and isolation of these bacteria. Objectives The purpose of this study was to determine the phenotypic and genotypic characteristics of L. monocytogenes strains isolated from dairy and meat products. ...
Horne, Shelley M; Sayler, Joseph; Scarberry, Nicholas; Schroeder, Meredith; Lynnes, Ty; Prüß, Birgit M
2016-11-08
Heterogeneity and niche adaptation in bacterial biofilm involve changes to the genetic makeup of the bacteria and gene expression control. We hypothesized that i) spontaneous mutations in the flhD operon can either increase or decrease motility and that ii) the resulting motility heterogeneity in the biofilm might lead to a long-term increase in biofilm biomass. We allowed the highly motile E. coli K-12 strain MC1000 to form seven- and fourteen-day old biofilm, from which we recovered reduced motility isolates at a substantially greater frequency (5.4 %) than from a similar experiment with planktonic bacteria (0.1 %). Biofilms formed exclusively by MC1000 degraded after 2 weeks. In contrast, biofilms initiated with a 1:1 ratio of MC1000 and its isogenic flhD::kn mutant remained intact at 4 weeks and the two strains remained in equilibrium for at least two weeks. These data imply that an 'optimal' biofilm may contain a mixture of motile and non-motile bacteria. Twenty-eight of the non-motile MC1000 isolates contained an IS1 element in proximity to the translational start of FlhD or within the open reading frames for FlhD or FlhC. Two isolates had an IS2 and one isolate had an IS5 in the open reading frame for FlhD. An additional three isolates contained deletions that included the RNA polymerase binding site, five isolates contained point mutations and small deletions in the open reading frame for FlhC. The locations of all these mutations are consistent with the lack of motility and further downstream within the flhD operon than previously published IS elements that increased motility. We believe that the location of the mutation within the flhD operon determines whether the effect on motility is positive or negative. To test the second part of our hypothesis where motility heterogeneity in a biofilm may lead to a long-term increase in biofilm biomass, we quantified biofilm biomass by MC1000, MC1000 flhD::kn, and mixtures of the two strains at ratios of 1:1, 10
Vongkamjan, Kitiya; Fuangpaiboon, Janejira; Turner, Matthew P; Vuddhakul, Varaporn
2016-02-01
Listeriosis outbreaks have been associated with a variety of foods. This study investigated the prevalence and diversity of Listeria monocytogenes and Listeria spp. in ready-to-eat (RTE) products and evaluated the performance of a rapid detection method, the 3M molecular detection assay for L. monocytogenes (MDA-LM), for detection of L. monocytogenes. Assay results were compared with those obtained using the U.S. Food and Drug Administration standard culture method described in the Bacteriological Analytical Manual. Products (n = 200) were purchased from retail stores: 122 aquatic products, 22 products of animal origin, 18 vegetarian products, 15 deli meat products, 13 salad and vegetable products, 4 desserts, 2 egg-based products, and 4 other products. L. monocytogenes prevalence was comparable with both methods. Overall, 15 (7.5%) of 200 samples were positive for L. monocytogenes: 3% of aquatic products, 1.5% of products of animal origin, 1% of vegetarian products, and 2% of deli meat products. Compared with the standard culture method, the sensitivity, specificity, and the accuracy of the MDA-LM were 86.7% (95% confidence interval, 58.4 to 97.7%), 98.4% (95% confidence interval, 95.0 to 99.6%), and 97.5%, respectively. Using the culture-based method, 18 (9%) of 200 samples were positive for Listeria species other than L. monocytogenes. Listeria isolates from these samples were classified into nine allelic types (ATs). The majority of isolates were classified as ATs 58 and 74, which were identified as L. monocytogenes lineages I and IV, respectively. Listeria innocua and Listeria welshimeri also were represented by isolates of multiple ATs. The MDA-LM is a rapid and reliable technique for detecting L. monocytogenes in various RTE foods. Further study is needed to develop effective control strategies to reduce L. monocytogenes contamination in RTE foods.
Exploratory Research on Latent Esophageal Motility Disorders in Dysphagia Patients.
Kawaguchi, Shinpei; Takeuchi, Toshihisa; Inoue, Yousuke; Takahashi, Yoshiaki; Ozaki, Haruhiko; Ota, Kazuhiro; Harada, Satoshi; Edogawa, Shoko; Kojima, Yuichi; Yamashita, Hiroshi; Fukuchi, Takumi; Ashida, Kiyoshi; Higuchi, Kazuhide
2017-01-01
High-resolution manometry (HRM) has been applied to assess esophageal motility disorders. However, the frequency and types of motility disorders in patients with dysphagia, which are frequently seen in clinical practice, are not clear. We evaluated latent esophageal motility disorders associated with dysphagia. The study included patients without erosive esophageal mucosal damage and with dysphagia symptoms refractory to at least 8 weeks of standard-dose proton pump inhibitors. After enrolment, HRM was used to evaluate for esophageal motility disorder based on the Chicago classification. Esophageal motility disorder was found in 58 of 100 patients and was classified based on the causes: achalasia (13%), esophagogastric junction outflow obstruction (16%), distal esophageal spasms (3%), weak peristalsis (14%), frequently failed peristalsis (5%), and hypertensive peristalsis (7%). Primary esophageal motility disorder was found in approximately 50% of cases in dysphagia patients. Therefore, esophageal motility disorder is not an uncommon condition and should be sought for in order to elucidate precisely the cause of dysphagia. © 2017 S. Karger AG, Basel.
Hadjilouka, Agni; Mantzourani, Kyriaki-Sofia; Katsarou, Anastasia; Cavaiuolo, Marina; Ferrante, Antonio; Paramithiotis, Spiros; Mataragas, Marios; Drosinos, Eleftherios H
2015-02-01
The aims of the present study were to determine the prevalence and levels of Listeria monocytogenes and Escherichia coli O157:H7 in rocket and cucumber samples by deterministic (estimation of a single value) and stochastic (estimation of a range of values) approaches. In parallel, the chromogenic media commonly used for the recovery of these microorganisms were evaluated and compared, and the efficiency of an enzyme-linked immunosorbent assay (ELISA)-based protocol was validated. L. monocytogenes and E. coli O157:H7 were detected and enumerated using agar Listeria according to Ottaviani and Agosti plus RAPID' L. mono medium and Fluorocult plus sorbitol MacConkey medium with cefixime and tellurite in parallel, respectively. Identity was confirmed with biochemical and molecular tests and the ELISA. Performance indices of the media and the prevalence of both pathogens were estimated using Bayesian inference. In rocket, prevalence of both L. monocytogenes and E. coli O157:H7 was estimated at 7% (7 of 100 samples). In cucumber, prevalence was 6% (6 of 100 samples) and 3% (3 of 100 samples) for L. monocytogenes and E. coli O157:H7, respectively. The levels derived from the presence-absence data using Bayesian modeling were estimated at 0.12 CFU/25 g (0.06 to 0.20) and 0.09 CFU/25 g (0.04 to 0.170) for L. monocytogenes in rocket and cucumber samples, respectively. The corresponding values for E. coli O157:H7 were 0.59 CFU/25 g (0.43 to 0.78) and 1.78 CFU/25 g (1.38 to 2.24), respectively. The sensitivity and specificity of the culture media differed for rocket and cucumber samples. The ELISA technique had a high level of cross-reactivity. Parallel testing with at least two culture media was required to achieve a reliable result for L. monocytogenes or E. coli O157:H7 prevalence in rocket and cucumber samples.
Seyoum, Eyasu Tigabu; Woldetsadik, Daniel Asrat; Mekonen, Tesfu Kassa; Gezahegn, Haile Alemayehu; Gebreyes, Wondwossen Abebe
2015-11-30
Listeria monocytogenes is of major significance in human and veterinary medicine. Most human Listeria infections are foodborne and the association of contaminated milk and dairy produce consumption with human listeriosis is noteworthy. In Ethiopia, there is limited data regarding the prevalence of L. monocytogenes in raw bovine milk and dairy products. The aim of this study was, therefore, to determine the prevalence of L. monocytogenes in raw bovine milk and dairy produce. A total of 443 milk and milk product samples were microbiologically analyzed following methods recommended by the U.S. Food and Drug Administration Bacteriological Analytical Manual to isolate Listeria spp. The overall prevalence of Listeria spp. was 28.4% and specifically that of L. monocytogenes was 5.6%. Taking the prevalence of Listeria spp. into consideration, cheese was found to be highly contaminated at 60%, followed by pasteurized milk samples (40%), raw milk (18.9%) and yoghurt (5%). Considering the prevalence of Listeria monocytogenes only, raw milk had the lowest contamination while cheese had the highest, followed by pasteurized milk and yoghurt. Raw milk and milk products produced in urban and peri-urban areas of central Ethiopia were contaminated with pathogenic bacteria, L. monocytogenes. The detection of this pathogen in raw milk and milk products warrants an urgent regulatory mechanism to be put in place and also the potential role of milk processing plants in the contamination of dairy products should be investigated.
Uppal, Kamaldeep K; Getty, Kelly J K; Boyle, Elizabeth A E; Harper, Nigel M; Lobaton-Sulabo, April Shayne S; Barry, Bruce
2012-01-01
The objective of our study was to determine effect of packaging method and storage time on reducing Listeria monocytogenes in shelf-stable meat snacks. Commercially available kippered beef steak strips and turkey tenders were dipped into a 5-strain L. monocytogenes cocktail, and dried at 23 °C until a water activity of 0.80 was achieved. Inoculated samples were packaged with 4 treatments: (1) vacuum, (2) nitrogen flushed with oxygen scavenger, (3) heat sealed with oxygen scavenger, and (4) heat sealed without oxygen scavenger. Samples were stored at 23 °C and evaluated for L. monocytogenes levels at 0, 24, 48, and 72 h. Initial levels (time 0) of L. monocytogenes were approximately 5.7 log CFU/cm² for steak and tenders. After 24 h of storage time, a 1 log CFU/cm² reduction of L. monocytogenes was observed for turkey tenders for all packaging treatments. After 48 h, turkey tenders showed >1 log CFU/cm² reduction of L. monocytogenes for all packaging treatments except for vacuum, where only 0.9 log CFU/cm² reduction was observed. After 72 h, reductions for all packaging treatments for turkey tenders ranged from 1.5 to 2.4 log CFU/cm². For kippered beef steak, there was no interaction between the packaging treatments and all storage times (P > 0.05) whereas, time was different (P packaging treatments and a 2.1 log CFU/ cm² L. monocytogenes reduction at 72 h of storage time. Processors of kippered beef steak and turkey tenders could use a combination of vacuum or nitrogen-flushing or heat sealed with an oxygen scavenger packaging methods and a holding time of 24 h prior to shipping to reduce potential L. monocytogenes numbers by ≥1 log. However, processors should be encouraged to hold packaged product a minimum of 72 h to enhance the margin of safety for L. monocytogenes control. © 2011 Institute of Food Technologists®
Barancelli, Giovana V; Camargo, Tarsila M; Gagliardi, Natália G; Porto, Ernani; Souza, Roberto A; Campioni, Fabio; Falcão, Juliana P; Hofer, Ernesto; Cruz, Adriano G; Oliveira, Carlos A F
2014-03-03
This study aimed to evaluate the occurrence of Listeria monocytogenes in cheese and in the environment of three small-scale dairy plants (A, B, C) located in the Northern region state of São Paulo, Brazil, and to characterize the isolates using conventional serotyping and PFGE. A total of 393 samples were collected and analyzed from October 2008 to September 2009. From these, 136 came from dairy plant A, where only L. seeligeri was isolated. In dairy plant B, 136 samples were analyzed, and L. innocua, L. seeligeri and L. welshimeri were isolated together with L. monocytogenes. In dairy plant C, 121 samples were analyzed, and L. monocytogenes and L. innocua were isolated. Cheese from dairy plants B and C were contaminated with Listeria spp, with L. innocua being found in Minas frescal cheese from both dairy plants, and L. innocua and L. monocytogenes in Prato cheese from dairy plant C. A total of 85 L. monocytogenes isolates were classified in 3 serotypes: 1/2b, 1/2c, and 4b, with predominance of serotype 4b in both dairy plants. The 85 isolates found in the dairy plants were characterized by genomic macrorestriction using ApaI and AscI with Pulsed Field Gel Electrophoresis (PFGE). Macrorestriction yielded 30 different pulsotypes. The presence of indistinguishable profiles repeatedly isolated during a 12-month period indicated the persistence of L. monocytogenes in dairy plants B and C, which were more than 100 km away from each other. Brine used in dairy plant C contained more than one L. monocytogenes lineage. The routes of contamination were identified in plants B and C, and highlighted the importance of using molecular techniques and serotyping to track L. monocytogenes sources of contamination, distribution, and routes of contamination in dairy plants, and to develop improved control strategies for L. monocytogenes in dairy plants and dairy products. Copyright © 2013 Elsevier B.V. All rights reserved.
Bouayad, Leila; Hamdi, Taha M; Naim, Malek; Leclercq, Alexandre; Lecuit, Marc
2015-07-01
Products from three broiler abattoirs were sampled for Listeria species to evaluate the changes in the prevalence and contamination rates at two stages of processing. Sampling was performed at the evisceration stage and at the end of processing after packaging and refrigerating at 4°C for 24 h. A total of 212 samples were collected; 52 were from abattoir A, and 80 samples each were collected from abattoirs B and C. Among all samples, 99 (46.7%) tested positive for Listeria, including L. monocytogenes 19 (8.9%), L. innocua 69 (32.5%), L. grayi 10 (4.7%), and L. welshimeri 1 (0.5%). The L. monocytogenes contamination rate varied from 5% to 11.5% in the 3 abattoirs. L. innocua was the most common species identified and was found in 8.8% of the samples from abattoir A and 33.7% of the samples from both abattoirs B and C. Twenty-six of the L. monocytogenes isolates obtained from positive samples were subjected to serotyping by multiplex polymerase chain reaction and characterization by the pulsed-field gel electrophoresis (PFGE) method using two cutting enzymes, ApaI and AscI. Three molecular serogroups were identified: IIa, IIb, and IVb. Serogroup IIa was common to all abattoirs, and serogroups IIb and IVb were found only in abattoir C. The 10 different obtained PFGE profiles were grouped into 7 clusters; some of these clusters were common to the 3 abattoirs, and others were specific to the abattoirs in which they were identified. This study revealed a high prevalence of Listeria spp., particularly L. monocytogenes, in raw broilers. This high incidence presents a risk to consumers due to the potential occurrence of cross-contamination with other foods in domestic refrigerators and the ability of these microorganisms to survive in undercooked products.
Motility of copepod nauplii and implications for food encounter
DEFF Research Database (Denmark)
Titelman, Josefin; Kiørboe, Thomas
2003-01-01
(Centropages typicus, Calanus helgolandicus, Temora longicornis, Acartia tonsa, Eurytemora affinis and Euterpina acutifrons). Behaviors of individual nauphi were divided into sequences of sinking, swimming and jumping events. Motility behavior is both stage- and species-specific in terms of appearance......Velocity differences drive all encounter processes. Therefore, knowledge of both prey and predator motility are essential in order to understand feeding behavior and predict food acquisition rates. Here, we describe and quantify the motility behavior of young and old naupliar stages of 6 copepods...... of tracks, speeds, durations and frequencies of events as well as time budgets. Motility mode often changes drastically during naupliar ontogeny. Crudely, nauplii can be divided into those moving with a jump-sink type of motility of various frequencies (1 min(-1) to 3 s(-1)) and those swimming...
Directory of Open Access Journals (Sweden)
Joelle K. Salazar
2018-01-01
Full Text Available This study assessed the growth of Listeria monocytogenes in milkshakes made using the process-contaminated ice cream associated with a listeriosis outbreak in comparison to milkshakes made with artificially contaminated ice cream. For all temperatures, growth kinetics including growth rates, lag phases, maximum populations, and population increases were determined for the naturally and artificially derived contaminants at 5, 10, 15, and 25°C storage for 144 h. The artificially inoculated L. monocytogenes presented lower growth rates and shorter lag phases than the naturally contaminated populations at all temperatures except for 5°C, where the reverse was observed. At 25°C, lag phases of the naturally and artificially contaminated L. monocytogenes were 11.6 and 7.8 h, respectively. The highest increase in population was observed for the artificially inoculated pathogen at 15°C after 96 h (6.16 log CFU/mL of storage. Growth models for both contamination states in milkshakes were determined. In addition, this study evaluated the antimicrobial effectiveness of flavoring agents, including strawberry, chocolate and mint, on the growth of the pathogen in milkshakes during 10°C storage. All flavor additions resulted in decreased growth rates of L. monocytogenes for both contamination states. The addition of chocolate and mint flavoring also resulted in significantly longer lag phases for both contamination states. This study provides insight into the differences in growth between naturally and artificially contaminated L. monocytogenes in a food product.
Salazar, Joelle K; Bathija, Vriddi M; Carstens, Christina K; Narula, Sartaj S; Shazer, Arlette; Stewart, Diana; Tortorello, Mary Lou
2018-01-01
This study assessed the growth of Listeria monocytogenes in milkshakes made using the process-contaminated ice cream associated with a listeriosis outbreak in comparison to milkshakes made with artificially contaminated ice cream. For all temperatures, growth kinetics including growth rates, lag phases, maximum populations, and population increases were determined for the naturally and artificially derived contaminants at 5, 10, 15, and 25°C storage for 144 h. The artificially inoculated L. monocytogenes presented lower growth rates and shorter lag phases than the naturally contaminated populations at all temperatures except for 5°C, where the reverse was observed. At 25°C, lag phases of the naturally and artificially contaminated L. monocytogenes were 11.6 and 7.8 h, respectively. The highest increase in population was observed for the artificially inoculated pathogen at 15°C after 96 h (6.16 log CFU/mL) of storage. Growth models for both contamination states in milkshakes were determined. In addition, this study evaluated the antimicrobial effectiveness of flavoring agents, including strawberry, chocolate and mint, on the growth of the pathogen in milkshakes during 10°C storage. All flavor additions resulted in decreased growth rates of L. monocytogenes for both contamination states. The addition of chocolate and mint flavoring also resulted in significantly longer lag phases for both contamination states. This study provides insight into the differences in growth between naturally and artificially contaminated L. monocytogenes in a food product.
Directory of Open Access Journals (Sweden)
Ana K. Carrascal-Camacho
2009-12-01
Full Text Available Effect of cooking time and temperature on sausages artificially inoculated with Listeria monocytogenes. Objective. To find whetherthe cooking times traditionally used by consumers are enough to inactivate Listeria monocytogenes artificially inoculated into sausages.Materials and methods. A survey asking about sausage cooking habits was completed with 50 housewives. We analyzed 60 samples ofsausages previously inoculated with 103 CFU g-1 from a pool of 5 strains of L. monocytogenes, then the cooking procedures described inthe survey were applied to the samples, and counting was done immediately after. Additionally, a complementary test was carried out byinoculating 20 samples of sausages with 103 CFU g-1 and exposing them to 72 oC and 73 oC for 30 seg. Results. The survey showed that15 minute boiling and 5 minute frying are the most frequent ways of preparing sausages by consumers. We established that the time andcooking conditions used in our assay had a statistically significant effect (p: 0.016 on the inoculated samples. In the complementary assay,statistical data (p: 0.0001 indicated that internal temperatures of 73 oC are enough to inactivate the pathogen at an industrial scale.Conclusion. Cooking by 15 minute boiling and 5 minute frying are enough to inactive concentrations of 103 g-1 of Listeria monocytogenesartificially inoculated into sausages.
Ericson, Megan E.; Frank, Matthew W.
2016-01-01
Enoyl-acyl carrier protein reductase catalyzes the last step in each elongation cycle of type II bacterial fatty acid synthesis and is a key regulatory protein in bacterial fatty acid synthesis. Genes of the facultative intracellular pathogen Listeria monocytogenes encode two functional enoyl-acyl carrier protein isoforms based on their ability to complement the temperature-sensitive growth phenotype of Escherichia coli strain JP1111 [fabI(Ts)]. The FabI isoform was inactivated by the FabI selective inhibitor AFN-1252, but the FabK isoform was not affected by the drug, as expected. Inhibition of FabI by AFN-1252 decreased endogenous fatty acid synthesis by 80% and lowered the growth rate of L. monocytogenes in laboratory medium. Robust exogenous fatty acid incorporation was not detected in L. monocytogenes unless the pathway was partially inactivated by AFN-1252 treatment. However, supplementation with exogenous fatty acids did not restore normal growth in the presence of AFN-1252. FabI inactivation prevented the intracellular growth of L. monocytogenes, showing that neither FabK nor the incorporation of host cellular fatty acids was sufficient to support the intracellular growth of L. monocytogenes. Our results show that FabI is the primary enoyl-acyl carrier protein reductase of type II bacterial fatty acid synthesis and is essential for the intracellular growth of L. monocytogenes. PMID:27736774
Occurrence and antimicrobial resistance patterns of Listeria monocytogenes isolated from vegetables.
de Vasconcelos Byrne, Vanessa; Hofer, Ernesto; Vallim, Deyse Christina; de Castro Almeida, Rogeria Comastri
2016-01-01
Although the consumption of fresh and minimally processed vegetables is considered healthy, outbreaks related to the contamination of these products are frequently reported. Among the food-borne pathogens that contaminate vegetables is Listeria monocytogenes, a ubiquitous organism that exhibits the ability to survive and multiply at refrigerated temperatures. This study aimed to evaluate the occurrence of L. monocytogenes in vegetables as well as the antimicrobial resistance of isolates. The results showed that 3.03% of samples were contaminated with L. monocytogenes, comprising 2.22% of raw vegetables and 5.56% of ready-to-eat vegetables. Multiplex PCR confirmed the virulence potential of the isolates. Antimicrobial resistance profiling showed that 50% of the isolates were susceptible to the antibiotics used. The resistance of one isolate to penicillin G, a commonly employed therapeutic agent, and the presence of serotype 4b, a serotype commonly associated with food-borne outbreaks, could be potential health hazards for consumers. Copyright © 2016 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.
Flagellum density regulates Proteus mirabilis swarmer cell motility in viscous environments.
Tuson, Hannah H; Copeland, Matthew F; Carey, Sonia; Sacotte, Ryan; Weibel, Douglas B
2013-01-01
Proteus mirabilis is an opportunistic pathogen that is frequently associated with urinary tract infections. In the lab, P. mirabilis cells become long and multinucleate and increase their number of flagella as they colonize agar surfaces during swarming. Swarming has been implicated in pathogenesis; however, it is unclear how energetically costly changes in P. mirabilis cell morphology translate into an advantage for adapting to environmental changes. We investigated two morphological changes that occur during swarming--increases in cell length and flagellum density--and discovered that an increase in the surface density of flagella enabled cells to translate rapidly through fluids of increasing viscosity; in contrast, cell length had a small effect on motility. We found that swarm cells had a surface density of flagella that was ∼5 times larger than that of vegetative cells and were motile in fluids with a viscosity that inhibits vegetative cell motility. To test the relationship between flagellum density and velocity, we overexpressed FlhD(4)C(2), the master regulator of the flagellar operon, in vegetative cells of P. mirabilis and found that increased flagellum density produced an increase in cell velocity. Our results establish a relationship between P. mirabilis flagellum density and cell motility in viscous environments that may be relevant to its adaptation during the infection of mammalian urinary tracts and movement in contact with indwelling catheters.
Bringing statistics up to speed with data in analysis of lymphocyte motility.
Letendre, Kenneth; Donnadieu, Emmanuel; Moses, Melanie E; Cannon, Judy L
2015-01-01
Two-photon (2P) microscopy provides immunologists with 3D video of the movement of lymphocytes in vivo. Motility parameters extracted from these videos allow detailed analysis of lymphocyte motility in lymph nodes and peripheral tissues. However, standard parametric statistical analyses such as the Student's t-test are often used incorrectly, and fail to take into account confounds introduced by the experimental methods, potentially leading to erroneous conclusions about T cell motility. Here, we compare the motility of WT T cell versus PKCθ-/-, CARMA1-/-, CCR7-/-, and PTX-treated T cells. We show that the fluorescent dyes used to label T cells have significant effects on T cell motility, and we demonstrate the use of factorial ANOVA as a statistical tool that can control for these effects. In addition, researchers often choose between the use of "cell-based" parameters by averaging multiple steps of a single cell over time (e.g. cell mean speed), or "step-based" parameters, in which all steps of a cell population (e.g. instantaneous speed) are grouped without regard for the cell track. Using mixed model ANOVA, we show that we can maintain cell-based analyses without losing the statistical power of step-based data. We find that as we use additional levels of statistical control, we can more accurately estimate the speed of T cells as they move in lymph nodes as well as measure the impact of individual signaling molecules on T cell motility. As there is increasing interest in using computational modeling to understand T cell behavior in in vivo, these quantitative measures not only give us a better determination of actual T cell movement, they may prove crucial for models to generate accurate predictions about T cell behavior.
In vitro motility evaluation of aggregated cancer cells by means of automatic image processing.
De Hauwer, C; Darro, F; Camby, I; Kiss, R; Van Ham, P; Decaesteker, C
1999-05-01
Set up of an automatic image processing based method that enables the motility of in vitro aggregated cells to be evaluated for a number of hours. Our biological model included the PC-3 human prostate cancer cell line growing as a monolayer on the bottom of Falcon plastic dishes containing conventional culture media. Our equipment consisted of an incubator, an inverted phase contrast microscope, a Charge Coupled Device (CCD) video camera, and a computer equipped with an image processing software developed in our laboratory. This computer-assisted microscope analysis of aggregated cells enables global cluster motility to be evaluated. This analysis also enables the trajectory of each cell to be isolated and parametrized within a given cluster or, indeed, the trajectories of individual cells outside a cluster. The results show that motility inside a PC-3 cluster is not restricted to slight motion due to cluster expansion, but rather consists of a marked cell movement within the cluster. The proposed equipment enables in vitro aggregated cell motility to be studied. This method can, therefore, be used in pharmacological studies in order to select anti-motility related compounds. The compounds selected by the equipment described could then be tested in vivo as potential anti-metastatic.
DEFF Research Database (Denmark)
Fang, Weihuan; Budde, Birgitte Bjørn; Siegumfeldt, Henrik
2006-01-01
A mixed culture of single cells of Listeria monocytogenes and the bacteriocin producing Leuconostoc carnosum 4010 showed growth inhibition of L. monocytogenes, although the intracellular pH (pHi) of L. monocytogenes followed by fluorescence ratio imaging microscopy was not affected. Furthermore, L...
Electrical stimulation of gut motility guided by an in silico model
Barth, Bradley B.; Henriquez, Craig S.; Grill, Warren M.; Shen, Xiling
2017-12-01
Objective. Neuromodulation of the central and peripheral nervous systems is becoming increasingly important for treating a diverse set of diseases—ranging from Parkinson’s Disease and epilepsy to chronic pain. However, neuromodulation of the gastrointestinal (GI) tract has achieved relatively limited success in treating functional GI disorders, which affect a significant population, because the effects of stimulation on the enteric nervous system (ENS) and gut motility are not well understood. Here we develop an integrated neuromechanical model of the ENS and assess neurostimulation strategies for enhancing gut motility, validated by in vivo experiments. Approach. The computational model included a network of enteric neurons, smooth muscle fibers, and interstitial cells of Cajal, which regulated propulsion of a virtual pellet in a model of gut motility. Main results. Simulated extracellular stimulation of ENS-mediated motility revealed that sinusoidal current at 0.5 Hz was more effective at increasing intrinsic peristalsis and reducing colon transit time than conventional higher frequency rectangular current pulses, as commonly used for neuromodulation therapy. Further analysis of the model revealed that the 0.5 Hz sinusoidal currents were more effective at modulating the pacemaker frequency of interstitial cells of Cajal. To test the predictions of the model, we conducted in vivo electrical stimulation of the distal colon while measuring bead propulsion in awake rats. Experimental results confirmed that 0.5 Hz sinusoidal currents were more effective than higher frequency pulses at enhancing gut motility. Significance. This work demonstrates an in silico GI neuromuscular model to enable GI neuromodulation parameter optimization and suggests that low frequency sinusoidal currents may improve the efficacy of GI pacing.
DEFF Research Database (Denmark)
Piercey, Marta J.; C. Ells, Timothy; Macintosh, Andrew J.
2017-01-01
needed to inhibit the formation of biofilm by LGI1/CC8 strains during incubation for 48 h and 6 days compared to other strains. Formation of biofilm on stainless steel was not significantly (p > 0.05) different among the strains. Analysis of genetic sequence data from desiccation and BAC sensitive (CP4 5......Listeria monocytogenes is a pathogenic foodborne microorganism noted for its ability to survive in the environment and food processing facilities. Survival may be related to the phenotype of individual strains including the ability to form biofilms and resist desiccation and/or sanitizer exposure....... The objectives of this research were to compare 14 L. monocytogenes strains isolated from blood (3), food (6) and water (5) with respect to their benzalkonium chloride (BAC) sensitivity, desiccation resistance, and ability to form biofilm. Correlations were tested between those responses, and the presence...
Meloni, Domenico; Piras, Francesca; Mureddu, Anna; Fois, Federica; Consolati, Simonetta Gianna; Lamon, Sonia; Mazzette, Rina
2013-11-01
In a 3-year study (2008 to 2011) to estimate the prevalence and the contamination sources of Listeria monocytogenes in pork meat in Sardinia, Italy, 211 samples were collected from five Sardinian swine slaughterhouses: 171 samples from slaughtered pigs and 40 from the slaughterhouse environment. Fifty L. monocytogenes isolates were characterized by PCR-based serotyping, presence of virulence-associated genes, and pulsed-field gel electrophoresis restriction analysis. The overall prevalence of L. monocytogenes was 33% in swine carcasses, 7% in cecal material, 23% on meat contact surfaces, and 25% on noncontact surfaces. Only two serotypes were detected: 1/2c (78%) and 1/2a (22%). In all, based on the presence of virulence-associated genes, eight pathogenic profiles were detected. Only 42% of all isolates carried the full complement of virulence-associated genes and were allotted to profile 1. Six pulsed-field gel electrophoresis profiles persisted in the slaughterhouses; restriction profiles appeared to be specific to each plant.
Listeria monocytogenes cross-contamination of cheese: risk throughout the food supply chain.
Sauders, B D; D'Amico, D J
2016-10-01
Listeria monocytogenes has been the most common microbial cause of cheese-related recalls in both the United States and Canada in recent years. Since L. monocytogenes is inactivated by pasteurization, the majority of these cases have been linked to environmental and cross-contamination of fresh-soft, soft-ripened, and semi-soft cheeses. Cross-contamination of foods with L. monocytogenes is a continuous risk throughout the food supply chain and presents unique challenges for subsequent illness and outbreak investigations. Reports on outbreaks of listeriosis attributed to cross-contamination downstream from primary processing help highlight the critical role of epidemiological investigation coupled with coordinated molecular subtyping and surveillance in the recognition and investigation of complex foodborne outbreaks. Despite their complexity, environmental sampling throughout the supply chain coupled with improved genotyping approaches and concomitant analysis of foodborne illness epidemiological exposure data are needed to help resolve these and similar cases more rapidly and with greater confidence.
Directory of Open Access Journals (Sweden)
Karla Sequeira Mendonça
2016-01-01
Full Text Available ABSTRACT: Listeria monocytogenes is of notable concern to the food industry, due to its ubiquitous nature and ability to grow in adverse conditions. This study aimed to determine the genotypic profile of L. monocytogenes strains isolated from refrigerated chickens marketed in the southern part of Rio Grande do Sul, Brazil. The strains of L. monocytogenes isolated were characterized by serotyping and Pulsed Field Gel Electrophoresis (PFGE. Three different serotypes (1/2a, 1/2b and 4e were evaluated by PFGE, and the macrorestriction patterns utilizing enzymes AscI and ApaI, revealed five different pulsotypes. The presence of such varied genotypic profiles demonstrates the prevalence of L. monocytogenes contamination of chicken processing environments, which combined with ineffective cleaning procedures, allowing the survival, adaptation and proliferation of these pathogens, not only in the processing environment, but also in local grocery stores.
Energy Technology Data Exchange (ETDEWEB)
Schlech, W.F. III
1984-01-01
The route or mechanism of transmission of Listeria monocytogenes from its rural veterinary reservoir to newborn and older human populations has been obscure. Anecdotal reports of milk-borne infection from cows with Listeria mastitis have been published, but intensive investigations of small outbreaks of L. monocytogenes infections in humans have not supported a gastrointestinal mode of infection. Several recent studies, however, strongly suggest this possibility, and case-control studies of epidemic listeriosis in the Canadian Maritime provinces in 1981 documented an association between ingestion of uncooked vegetables and the development of illness (p = 0.02). In that study, coleslaw from a regional producer which was distributed throughout the Maritimes was considered to be the vehicle of transmission. Cabbage, the raw product in the production of coleslaw, was contaminated at a farm prior to arrival at the plant. Contamination occurred through fertilization with raw manure from a flock of sheep known to harbor L. monocytogenes. Therefore, an indirect link was established between Listeria monocytogenes infection of sheep on a cabbage farm and subsequent development of invasive listeriosis in humans. This study supports findings from other epidemiologic studies of human listeriosis and is consistent with results of investigations into the mode of transmission of natural and laboratory-acquired listeriosis in animals. 34 references.
Aging and intestinal motility: a review of factors that affect intestinal motility in the aged.
LENUS (Irish Health Repository)
O'Mahony, Denis
2012-02-03
Normal aging is associated with significant changes in the function of most organs and tissues. In this regard, the gastrointestinal tract is no exception. The purpose of this review is to detail the important age-related changes in motor function of the various parts of the gastrointestinal tract and to highlight some of the important motility changes that may occur, either in relation to common age-related disorders, or as a result of certain drugs commonly prescribed in the aged. A major confounding factor in the interpretation of motor phenomena throughout the gastrointestinal tract in this age group is the frequent coexistence of neurological, endocrinological and other disease states, which may be independently associated with dysmotility. Overall, current data are insufficient to implicate normal aging as a cause of dysmotility in the elderly. Normal aging is associated with various changes in gastrointestinal motility, but the clinical significance of such changes remains unclear. More important is the impact of various age-related diseases on gastrointestinal motility in the elderly: for example, long-standing diabetes mellitus may reduce gastric emptying in up to 50% of patients; depression significantly prolongs whole-gut transit time; hypothyroidism may prolong oro-caecal transit time; and chronic renal failure is associated with impaired gastric emptying. In addition, various, frequently used drugs in the elderly cause disordered gastrointestinal motility. These drugs include anticholinergics, especially antidepressants with an anticholinergic effect, opioid analgesics and calcium antagonists.
Persistent enhancement of bacterial motility increases tumor penetration.
Thornlow, Dana N; Brackett, Emily L; Gigas, Jonathan M; Van Dessel, Nele; Forbes, Neil S
2015-11-01
Motile bacteria can overcome the transport limitations that hinder many cancer therapies. Active bacteria can penetrate through tissue to deliver treatment to resistant tumor regions. Bacterial therapy has had limited success, however, because this motility is heterogeneous, and within a population many individuals are non-motile. In human trials, heterogeneity led to poor dispersion and incomplete tumor colonization. To address these problems, a swarm-plate selection method was developed to increase swimming velocity. Video microscopy was used to measure the velocity distribution of selected bacteria and a microfluidic tumor-on-a-chip device was used to measure penetration through tumor cell masses. Selection on swarm plates increased average velocity fourfold, from 4.9 to 18.7 μm/s (P < 0.05) and decreased the number of non-motile individuals from 51% to 3% (P < 0.05). The selected phenotype was both robust and stable. Repeating the selection process consistently increased velocity and eliminated non-motile individuals. When selected strains were cryopreserved and subcultured for 30.1 doublings, the high-motility phenotype was preserved. In the microfluidic device, selected Salmonella penetrated deeper into cell masses than unselected controls. By 10 h after inoculation, control bacteria accumulated in the front 30% of cell masses, closest to the flow channel. In contrast, selected Salmonella accumulated in the back 30% of cell masses, farthest from the channel. Selection increased the average penetration distance from 150 to 400 μm (P < 0.05). This technique provides a simple and rapid method to generate high-motility Salmonella that has increased penetration and potential for greater tumor dispersion and clinical efficacy. © 2015 Wiley Periodicals, Inc.
The use of Listeria monocytogenes as a DNA delivery vector for cancer gene therapy.
LENUS (Irish Health Repository)
Tangney, Mark
2012-01-31
Listeria monocytogenes is an intracellular pathogen that lyses the phagosomal vacuole of infected cells, proliferates in the host cell cytoplasm and can actively enter adjacent cells. The pathogen is therefore well suited to exploitation as a vector for the delivery of DNA to target cells as the lifecycle favors cellular targeting with vector amplification and the potential for cell-to-cell spread. We have recently demonstrated DNA transfer by L. monocytogenes in growing tumors in murine models. Our approach exploited an ampicillin sensitive stain of L. monocytogenes which can be lysed through systemic administration of ampicillin to facilitate release of plasmid DNA for expression by infected mammalian cells. Here, we discuss the implications of this technology and the potential for future improvements of the system.
Weller, Daniel; Wiedmann, Martin; Strawn, Laura K
2015-09-01
While rain and irrigation events have been associated with an increased prevalence of foodborne pathogens in produce production environments, quantitative data are needed to determine the effects of various spatial and temporal factors on the risk of produce contamination following these events. This study was performed to quantify these effects and to determine the impact of rain and irrigation events on the detection frequency and diversity of Listeria species (including L. monocytogenes) and L. monocytogenes in produce fields. Two spinach fields, with high and low predicted risks of L. monocytogenes isolation, were sampled 24, 48, 72, and 144 to 192 h following irrigation and rain events. Predicted risk was a function of the field's proximity to water and roads. Factors were evaluated for their association with Listeria species and L. monocytogenes isolation by using generalized linear mixed models (GLMMs). In total, 1,492 (1,092 soil, 334 leaf, 14 fecal, and 52 water) samples were collected. According to the GLMM, the likelihood of Listeria species and L. monocytogenes isolation from soil samples was highest during the 24 h immediately following an event (odds ratios [ORs] of 7.7 and 25, respectively). Additionally, Listeria species and L. monocytogenes isolates associated with irrigation events showed significantly lower sigB allele type diversity than did isolates associated with precipitation events (P = <0.001), suggesting that irrigation water may be a point source of L. monocytogenes contamination. Small changes in management practices (e.g., not irrigating fields before harvest) may therefore reduce the risk of L. monocytogenes contamination of fresh produce. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Directory of Open Access Journals (Sweden)
Hurtado Ana
2009-01-01
Full Text Available Abstract Background Listeria monocytogenes is among the most important foodborne bacterial pathogens due to the high mortality rate and severity of the infection. L. monocytogenes is a ubiquitous organism occasionally present in the intestinal tract of various animal species and faecal shedding by asymptomatically infected livestock poses a risk for contamination of farm environments and raw food at the pre-harvest stages. The aim of this study was to determine the prevalence and strain diversity of L. monocytogenes in healthy ruminants and swine herds. Results Faecal samples from 30 animals per herd were collected from 343 herds (120 sheep, 124 beef cattle, 82 dairy cattle and 17 swine in the Basque Country and screened in pools by an automated enzyme-linked fluorescent immunoassay (VIDAS® to estimate the prevalence of positive herds. Positive samples were subcultured onto the selective and differential agar ALOA and biochemically confirmed. L. monocytogenes was isolated from 46.3% of dairy cattle, 30.6% beef cattle and 14.2% sheep herds, but not from swine. Within-herd prevalence investigated by individually analysing 197 sheep and 221 cattle detected 1.5% of faecal shedders in sheep and 21.3% in cattle. Serotyping of 114 isolates identified complex 4b as the most prevalent (84.2%, followed by 1/2a (13.2%, and PFGE analysis of 68 isolates showed a highly diverse L. monocytogenes population in ruminant herds. Conclusion These results suggested that cattle represent a potentially important reservoir for L. monocytogenes in the Basque Country, and highlighted the complexity of pathogen control at the farm level.
Smout, André J. P. M.
2004-01-01
PURPOSE OF REVIEW: In the past year, many studies were published in which new and relevant information on small intestinal motility in humans and laboratory animals was obtained. RECENT FINDINGS: Although the reported findings are heterogeneous, some themes appear to be particularly interesting and
Demirdjian, Sally; Schutz, Kristin; Wargo, Matthew J; Lam, Joseph S; Berwin, Brent
2017-12-01
The bacterial pathogen Pseudomonas aeruginosa undergoes adaptation and selection over the course of chronic respiratory tract infections which results in repeatedly-observed phenotypic changes that are proposed to enable its persistence. Two of the clinically significant P. aeruginosa phenotypic changes are loss of flagellar motility and modifications to LPS structure, including loss of O-antigen expression. The effect of loss of O-antigen, frequently described as conversion from smooth to rough LPS, and the combined effect of loss of motility and O-antigen on phagocytic susceptibility by immune cells remain unknown. To address this, we generated genetic deletion mutants of waaL, which encodes the O-antigen ligase responsible for linking O-antigen to lipid A-core oligosaccharide, in both motile and non-motile P. aeruginosa strains. With the use of these bacterial strains we provide the first demonstration that, despite a progressive selection for P. aeruginosa with rough LPS during chronic pulmonary infections, loss of the LPS O-antigen does not confer phagocytic resistance in vitro. However, use of the waaLmotABmotCD mutant revealed that loss of motility confers resistance to phagocytosis regardless of the smooth or rough LPS phenotype. These findings reveal how the O-antigen of P. aeruginosa can influence bacterial clearance during infection and expand our current knowledge about the impact of bacterial phenotypic changes during chronic infection. Copyright © 2017 Elsevier Ltd. All rights reserved.
Barre, Léna; Brasseur, Emilie; Doux, Camille; Lombard, Bertrand; Besse, Nathalie Gnanou
2015-06-01
For the enumeration of Listeria monocytogenes (L. monocytogenes) in food, a sensitive enumeration method has been recently developed. This method is based on a membrane filtration of the food suspension followed by transfer of the filter on a selective medium to enumerate L. monocytogenes. An evaluation of this method was performed with several categories of foods naturally contaminated with L. monocytogenes. The results obtained with this technique were compared with those obtained from the modified reference EN ISO 11290-2 method for the enumeration of L. monocytogenes in food, and are found to provide more precise results. In most cases, the filtration method enabled to examine a greater quantity of food thus greatly improving the sensitivity of the enumeration. However, it was hardly applicable to some food categories because of filtration problems and background microbiota interference. Copyright © 2014 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Mario Montanino Oliva
2016-01-01
Full Text Available Motility is the feature that allows spermatozoa to actively reach and penetrate the female gamete during fertilization. When this function is altered, and especially decreased, troubles in conceiving may occur. In this study, we demonstrated that treating fertile women with myo-inositol (MI vaginal suppositories ameliorated their partners’ sperm motility and also positively affected their conceiving capacity, without changes in cervical mucus structural and biochemical characteristics. Indeed, by means of the postcoital test on female cervical mucus, a significant improvement especially in progressive sperm motility was recorded after MI suppository use. Concomitantly, after MI treatment, a reduction of immotile spermatozoa percentage was observed. Importantly, MI vaginal supplementation positively correlated with a pregnancy for 5 of the 50 couples enrolled in the study, leading us to speculate that this substance may substantially contribute to create in the cervical mucus an ideal milieu that makes spermatozoa more motile and functionally able to fertilize. Even though the detailed mechanism is still unclear, these results should encourage MI vaginal use for the clinical improvement of male infertility, through their partners.
Modelling the growth of Listeria monocytogenes in fresh green coconut (Cocos nucifera L.) water.
Walter, Eduardo H M; Kabuki, Dirce Y; Esper, Luciana M R; Sant'Ana, Anderson S; Kuaye, Arnaldo Y
2009-09-01
The behaviour of Listeria monocytogenes in the fresh coconut water stored at 4 degrees C, 10 degrees C and 35 degrees C was studied. The coconut water was aseptically extracted from green coconuts (Cocos nucifera L.) and samples were inoculated in triplicate with a mixture of 5 strains of L. monocytogenes with a mean population of approximately 3 log(10) CFU/mL. The kinetic parameters of the bacteria were estimated from the Baranyi model, and compared with predictions of the Pathogen Modelling Program so as to predict its behaviour in the beverage. The results demonstrated that fresh green coconut water was a beverage propitious for the survival and growth of L. monocytogenes and that refrigeration at 10 degrees C or 4 degrees C retarded, but did not inhibit, growth of this bacterium. Temperature abuse at 35 degrees C considerably reduced the lagtimes. The study shows that L. monocytogenes growth in fresh green coconut water is controlled for several days by storage at low temperature, mainly at 4 degrees C. Thus, for risk population this product should only be drunk directly from the coconut or despite the sensorial alterations should be consumed pasteurized.
Balay, Danielle R; Dangeti, Ramana V; Kaur, Kamaljit; McMullen, Lynn M
2017-08-16
The aims of this study were to improve the method for purification of leucocin A to increase yield of peptide and to evaluate the efficacy of leucocin A and an analogue of leucocin A (leucocin N17L) to inhibit the growth of Listeria monocytogenes on wieners in the presence of spoilage organisms. Leucocin A was produced by Leuconostoc gelidum UAL187 and purified with a five-fold increase in yield; leucocin N17L was synthesized replacing asparagine at residue 17 with leucine. Five strains of L. monocytogenes associated with foodborne illness were used to assess bacteriocin efficacy in vitro and in situ. Minimum inhibitory concentrations could not be determined in broth; however, on agar the minimum inhibitory concentrations ranged from 11.7-62.5μM and 62.5->500μM for leucocin A and leucocin N17L, respectively. Leucocin N17L was less effective than the native bacteriocin at controlling the growth of L. monocytogenes. The inactivation profiles of L. monocytogenes in broth in the presence of leucocin A suggested each isolate had different levels of resistance to the bacteriocin as determined by the initial bactericidal effect. The formation of spontaneously resistance subpopulations were also observed for each strain of L. monocytogenes. In situ, wieners were inoculated with the spoilage organisms, Carnobacterium divergens and Brochothrix thermosphacta, followed by surface application of purified leucocin A, and inoculated with a cocktail of L. monocytogenes. Wieners were vacuum packaged and stored at 7°C for 16d. Leucocin A reduced the counts L. monocytogenes on wieners during storage, regardless of the presence of C. divergens. B. thermosphacta was unaffected by the presence of leucocin A on wieners over the duration of storage. This study suggests that leucocin A may be beneficial to industry as a surface application on wieners to help reduce L. monocytogenes counts due to post-processing contamination even in the presence of spoilage organisms. However, further
Stea, Emma C; Purdue, Laura M; Jamieson, Rob C; Yost, Chris K; Truelstrup Hansen, Lisbeth
2015-06-01
Foods and related processing environments are commonly contaminated with the pathogenic Listeria monocytogenes. To investigate potential environmental reservoirs of Listeria spp. and L. monocytogenes, surface water and point source pollution samples from an urban and a rural municipal water supply watershed in Nova Scotia, Canada, were examined over 18 months. Presumptive Listeria spp. were cultured from 72 and 35% of rural and urban water samples, respectively, with 24% of the positive samples containing two or three different Listeria spp. The L. innocua (56%) and L. welshimeri (43%) groups were predominant in the rural and urban watersheds, respectively. Analysis by the TaqMan assay showed a significantly (P monocytogenes of 62% versus 17% by the culture-based method. Both methods revealed higher prevalences in the rural watershed and during the fall and winter seasons. Elevated Escherichia coli (≥ 100 CFU/100 ml) levels were not associated with the pathogen regardless of the detection method. Isolation of Listeria spp. were associated with 70 times higher odds of isolating L. monocytogenes (odds ratio = 70; P monocytogenes isolates, followed by IVb (16.1%), IIb (15.8%), and IIc (0.4%). L. monocytogenes was detected in cow feces and raw sewage but not in septic tank samples. Pulsotyping of representative water (n = 54) and local human (n = 19) isolates suggested genetic similarities among some environmental and human L. monocytogenes isolates. In conclusion, temperate surface waters contain a diverse Listeria species population and could be a potential reservoir for L. monocytogenes, especially in rural agricultural watersheds. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Jamali, Hossein; Paydar, Mohammadjavad; Ismail, Salmah; Looi, Chung Yeng; Wong, Won Fen; Radmehr, Behrad; Abedini, Atefeh
2015-07-25
The aim of this study was to investigate the prevalence and characterization of Listeria species and Listeria monocytogenes isolated from raw fish and open-air fish market environments. Eight hundred and sixty two samples including raw fish and fish market environments (samples from workers' hands, workers' knives, containers and work surface) were collected from the open-air fish markets in the Northern region of Iran. Listeria spp. was isolated from 104/488 (21.3%) raw fish and 29/374 (7.8%) of samples from open-air fish market environment. The isolates of Listeria spp. included L. innocua (35.3%), L. monocytogenes (32.3%), L. seeligeri (18%), and L. ivanovii (14.3%). Of the 43 L. monocytogenes isolates, 31 (72.1%), 10 (23.3%) and 2 (4.7%) belonged to serovars 1/2a, 4b, and 1/2b, respectively. The inlA, inlB, inlC, inlJ, actA, hlyA, iap, plcA, and prfA virulence-associated genes were detected in almost all of the L. monocytogenes isolates. The Listeria spp. isolates showed high resistance against tetracycline (23.3%), penicillin G, and cephalothin (each 16.5%). Besides, we observed significant resistance level to tetracycline (27.9%), ampicillin (20.9%), cephalothin, penicillin G, and streptomycin (each 16.3%) in the L. monocytogenes isolates. All of the isolates were susceptible to cefotaxime, gentamicin, kanamycin, and pefloxacin. We found that tetM (25.6%), tetA (23.3%), ampC (14%), and penA (11.6%) were the most prevalent antibiotic resistance genes in the L. monocytogenes isolates. Recovery of potentially pathogenic L. monocytogenes from raw fish and environment of open-air fish market samples in this study is a convincing evidence for the zoonotic potential of listeriosis.
Liu, Xiaoji; Basu, Urmila; Miller, Petr; McMullen, Lynn M
2017-05-01
This study reports the gene expression and filamentation in Listeria monocytogenes 08-5923 following exposure to food preservatives sodium lactate (NaL) and sodium diacetate (SD). L. monocytogenes 08-5923 was challenged with a mixture of NaL/SD, NaL or sodium acetate at 37 °C in tryptic soy broth. In the initial study, L. monocytogenes 08-5923 was exposed to NaL/SD for 24 h. The transcriptome was investigated by RNA sequencing. A stress response network was discovered in L. monocytogenes 08-5923, which is mediated by genes encoding two-component systems (hisJ, lisK, OmpR family gene, resE) and RNA polymerase factors (sigC, sigH). NaL/SD resulted in the down-regulation of genes in glycolysis (pykA, eno, fbaA, pgm) and up-regulation of genes in DNA repair (radC), cell division (ftsE) and cell structure synthesis (flagella synthesis: flgK, fliF, fliD). Filamentation was monitored by flow cytometry. NaL/SD mixture resulted in filamentation in L. monocytogenes 08-5923. Longer exposure was required to induce filamentation in L. monocytogenes for SD (24 h) than for NaL (8 h) when cells were exposed to individual salt. The quantitative real time PCR analysis revealed the down-regulation of ftsE in filamented cells of Listeria exposed to NaL or sodium acetate. Copyright © 2016 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Cronin Michael
2008-06-01
Full Text Available Abstract Background The foodborne, gram-positive pathogen, Listeria monocytogenes, is capable of causing lethal infections in compromised individuals. In the post genomic era of L. monocytogenes research, techniques are required to identify and validate genes involved in the pathogenicity and environmental biology of the organism. The aim here was to develop a widely applicable method to tag L. monocytogenes strains, with a particular emphasis on the development of multiple strain competitive index assays. Results We have constructed a new site-specific integrative vector, pIMC, based on pPL2, for the selection of L. monocytogenes from complex samples. The pIMC vector was further modified through the incorporation of IPTG inducible markers (antibiotic and phenotypic to produce a suite of four vectors which allowed the discrimination of multiple strains from a single sample. We were able to perform murine infection studies with up to four EGDe isolates within a single mouse and showed that the tags did not impact upon growth rate or virulence. The system also allowed the identification of subtle differences in virulence between strains of L. monocytogenes commonly used in laboratory studies. Conclusion This study has developed a competitive index assay that can be broadly applied to all L. monocytogenes strains. Improved statistical robustness of the data was observed, resulting in fewer mice being required for virulence assays. The competitive index assays provide a powerful method to analyse the virulence or fitness of L. monocytogenes in complex biological samples.
DEFF Research Database (Denmark)
Gimenez, B.; Dalgaard, Paw
2004-01-01
Aims: To evaluate and model the simultaneous growth of Listeria monocytogenes and spoilage micro-organisms in cold-smoked salmon.Methods and Results: Growth kinetics of L. monocytogenes, lactic acid bacteria (LAB), Enterobacteriaceae, enterococci and Photobacterium phosphoreum were determined...
Listeria monocytogenes repellence by enzymatically modified PES surfaces
Veen, van der S.; Nady, N.; Franssen, M.C.R.; Zuilhof, H.; Boom, R.M.; Abee, T.; Schroën, C.G.P.H.
2015-01-01
: The effect of enzyme-catalyzed modification of poly(ethersulfone) (PES) on the adhesion and biofilm formation of two Listeria monocytogenes strains is evaluated under static and dynamic flow conditions. PES has been modified with gallic acid, ferulic acid and 4-hydroxybenzoic acid. The surfaces
9 CFR 430.4 - Control of Listeria monocytogenes in post-lethality exposed ready-to-eat products.
2010-01-01
... post-lethality exposed ready-to-eat products. 430.4 Section 430.4 Animals and Animal Products FOOD... Control of Listeria monocytogenes in post-lethality exposed ready-to-eat products. (a) Listeria... comes into direct contact with a food contact surface which is contaminated with L. monocytogenes. (b...
Listeria monocytogenes is a foodborne pathogen that has been associated with poultry products. This organism is ubiquitous in nature and has been found to enter poultry further processing plants on incoming raw product. Once in the plant, L. monocytogenes can become a long term persistent colonize...
Directory of Open Access Journals (Sweden)
Roberto Degenhardt
2007-06-01
Full Text Available Dry sausages have been considered ready-to-eat products with low risk of causing listeriosis due to the hurdles created during the manufacturing process such as low pH and a w, high salt concentration and presence of lactic acid bacteria (LAB. However, several studies have detected survival of Listeria monocytogenes in these products and also shown that process parameters, LAB and L. monocytogenes strains directly influence the results. In this work, survival of the pathogen in sausages prepared with three different formulations (one standard formulation, one formulation added of Lactobacillus plantarum and one added of 2% sodium lactate, using the manufacturing process usually employed in Brazil, was evaluated. Naturally contaminated sausages presented a small increase in the counts of L. monocytogenes in the first days of the process, followed by a gradual decrease until the end of the process. In experimentally contaminated samples containing L. plantarum, the reduction of counts of L. monocytogenes during processing was considerable, but there wasn´t significant differences between the treatments.Salames têm sido considerados produtos prontos para o consumo com baixo risco de provocar listeriose devido aos obstáculos criados no processo de fabricação e suas características de pH e atividade água baixos, alta concentração de sal e presença de bactérias lácticas. Entretanto, a sobrevivência de Listeria monocytogenes nesta classe de produtos é verificada e estudos de processo visando à redução da contaminação por este patógeno, têm demonstrado que particularidades como variação dos parâmetros de processo, cepas de bactérias lácticas e de L. monocytogenes influenciam diretamente os resultados. Neste estudo três formulações foram avaliadas (uma padrão, uma com inoculação da cultura Lactobacillus plantarum e outra com adição 2% de lactato de sódio empregando parâmetros de processo comumente praticados no Brasil
Sperm motility and morphology as changing parameters linked to sperm count variations.
Dua A; Vaidya S
1996-01-01
Variations in semen analyses of 177 males over a 1 year period were assessed. The average means of total counts, motility, morphology, total motile count and non-motile % were determined for 5 classes of patients ranging from azoospermic to normospermic. Positive relationships between a falling sperm count, a decrease in motility and total motile counts were seen. Also, increasingly, abnormal forms were found with lower sperm counts.
Chicago Classification of Esophageal Motility Disorders: Lessons Learned
Rohof, W. O. A.; Bredenoord, A. J.
2017-01-01
High-resolution manometry (HRM) is increasingly performed worldwide, to study esophageal motility. The Chicago classification is subsequently applied to interpret the manometric findings and facilitate a diagnosis of esophageal motility disorders. This review will discuss new insights regarding the
Changes in gene expression during adaptation of Listeria monocytogenes to the soil environment.
Piveteau, Pascal; Depret, Géraldine; Pivato, Barbara; Garmyn, Dominique; Hartmann, Alain
2011-01-01
Listeria monocytogenes is a ubiquitous opportunistic pathogen responsible for listeriosis. In order to study the processes underlying its ability to adapt to the soil environment, whole-genome arrays were used to analyse transcriptome modifications 15 minutes, 30 minutes and 18 h after inoculation of L. monocytogenes EGD-e in soil extracts. Growth was observed within the first day of incubation and large numbers were still detected in soil extract and soil microcosms one year after the start of the experiment. Major transcriptional reprofiling was observed. Nutrient acquisition mechanisms (phosphoenolpyruvate-dependent phosphotransferase systems and ABC transporters) and enzymes involved in catabolism of specific carbohydrates (β-glucosidases; chitinases) were prevalent. This is consistent with the overrepresentation of the CodY regulon that suggests that in a nutrient depleted environment, L. monocytogenes recruits its extensive repertoire of transporters to acquire a range of substrates for energy production.
Directory of Open Access Journals (Sweden)
Ewa Sawosz
2010-08-01
Full Text Available Ewa Sawosz1, André Chwalibog2, Jacek Szeliga3, Filip Sawosz2, Marta Grodzik1, Marlena Rupiewicz1, Tomasz Niemiec1, Katarzyna Kacprzyk11Division of Biotechnology and Biochemistry of Nutrition, Warsaw University of Life Sciences, Warsaw, Poland; 2Department of Basic Animal and Veterinary Sciences, University of Copenhagen, Copenhagen, Denmark; 3Division of Microbiology of Analytical Centre, Warsaw University of Life Sciences, Warsaw, PolandPurpose: Rapid development of nanotechnology has recently brought significant attention to the extraordinary biological features of nanomaterials. The objective of the present investigation was to evaluate morphological characteristics of the assembles of gold and platinum nanoparticles (nano-Au and nano-Pt respectively, with Salmonella Enteritidis (Gram-negative and Listeria monocytogenes (Gram-positive, to reveal possibilities of constructing bacteria-nanoparticle vehicles.Methods: Hydrocolloids of nano-Au or nano-Pt were added to two bacteria suspensions in the following order: nano-Au + Salmonella Enteritidis; nano-Au + Listeria monocytogenes; nano-Pt + Salmonella Enteritidis; nano-Pt + Listeria monocytogenes. Samples were inspected by transmission electron microscope.Results: Visualization of morphological interaction between nano-Au and Salmonella Enteritidis and Listeria monocytogenes, showed that nano-Au were aggregated within flagella or biofilm network and did not penetrate the bacterial cell. The analysis of morphological effects of interaction of nano-Pt with bacteria revealed that nano-Pt entered cells of Listeria monocytogenes and were removed from the cells. In the case of Salmonella Enteritidis, nano-Pt were seen inside bacteria cells, probably bound to DNA and partly left bacterial cells. After washing and centrifugation, some of the nano-Pt-DNA complexes were observed within Salmonella Enteritidis.Conclusion: The results indicate that the bacteria could be used as a vehicle to deliver nano
Hague, Angela; Jones, Gareth E
2008-10-01
This report summarises practical aspects to measuring cell motility in culture. The methods described here were discussed at a 1-day European Tissue Culture Society (ETCS-UK) workshop organised by John Masters and Gareth E Jones that was held at University College London on 19th April 2007.
Directory of Open Access Journals (Sweden)
Gusman Vera
2014-01-01
Full Text Available Listeria monocytogenes is pathogenic bacterium that can contaminate food products during and after processing. As ready-to-eat food does not undergo any treatment to ensure its safety before consumption, the risk of foodborne disease must be considered if this pathogen is present in the food. As diseases caused by contaminated food are an important public health problem today, the aim of this study was to determine the prevalence of Listeria monocytogenes in different ready-to-eat food products. In the seven-month period from June 1 to December 31, 2011, a total of 1 380 food samples were examined in the Division of Sanitary Bacteriology, Center for Microbiology, Institute of Public Health of Vojvodina in Novi Sad. A total of 912 samples were analyzed for the presence of Listeria monocytogenes according to ISO 11290-2. The identity of suspected Listeria monocytogenes was confirmed using the VITEK 2 Compact system (BioMerieux, France. Out of 912 samples, Listeria monocytogenes was detected in 18 (1.97%. Listeria monocytogenes was mostly found in cooked meals (in 6 samples out of 18, sandwiches (4 samples and frozen food, such as ice-cream and frozen vegetables (4 samples. It was also found in tofu bread spreads (2 samples, cream cheese (1 sample and cakes (1 sample. The presence of Listeria monocytogenes in some ready-to-eat food could present a public health hazard, particularly to the high-risk population group, because of the high mortality rate associated with listeriosis and the widespread nature of the organism. Monitoring of listeriosis is essential to prevent foodborne outbreaks, and in assessing human health risk in ready-to-eat foods.
Møretrø, Trond; Schirmer, Bjørn C T; Heir, Even; Fagerlund, Annette; Hjemli, Pernille; Langsrud, Solveig
2017-01-16
The antibacterial effect of disinfectants is crucial for the control of Listeria monocytogenes in food processing environments. Tolerance of L. monocytogenes to sublethal levels of disinfectants based on quaternary ammonium compounds (QAC) is conferred by the resistance determinants qacH and bcrABC. The presence and distribution of these genes have been anticipated to have a role in the survival and growth of L. monocytogenes in food processing environments where QAC based disinfectants are in common use. In this study, a panel of 680 L. monocytogenes from nine Norwegian meat- and salmon processing plants were grouped into 36 MLVA profiles. The presence of qacH and bcrABC was determined in 101 isolates from the 26 most common MLVA profiles. Five MLVA profiles contained qacH and two contained bcrABC. Isolates with qacH and bcrABC showed increased tolerance to the QAC Benzalkonium chloride (BC), with minimal inhibitory concentrations (MICs) of 5-12, 10-13 and 100ppm). A sample with lower BC concentrations (14ppm of chain length C-12 and 2.7ppm of chain length C-14) inhibited growth of L. monocytogenes not containing bcrABC or qacH, compared to strains with these genes. The study has shown that L. monocytogenes harbouring the QAC resistance genes qacH and bcrABC are prevalent in the food industry and that residuals of QAC may be present in concentrations after sanitation in the industry that result in a growth advantage for bacteria with such resistance genes. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Todoriki, Setsuko; Bari, Latiful; Kitta, Kazumi; Ohba, Mika; Ito, Yasuhiro; Tsujimoto, Yuka; Kanamori, Norihito; Yano, Erika; Moriyama, Tatsuya; Kawamura, Yukio; Kawamoto, Shinichi
2009-01-01
The presence of Listeria monocytogenes in fresh produce is a growing concern because of the possibility of food-borne illness. Ionizing radiation is an effective non-thermal means of eliminating pathogenic bacteria in fresh produce; however, the effect of ionizing irradiation on the allergenic properties of the host commodities remains unknown. This study aimed (i) to determine the effective dose of gamma-irradiation in eliminating L. monocytogenes on whole cherry tomatoes and (ii) to evaluate the effect of gamma-irradiation on the allergenic properties of tomato proteins. Cherry tomatoes that were inoculated with a mixture of five L. monocytogenes strains were treated with gamma-rays from a 60 Co source. A 1.25 kGy dose of gamma-irradiation was found to be sufficient to eliminate L. monocytogenes on whole cherry tomatoes. The immunoblot profile of serum samples obtained from two patients with tomato allergy revealed that gamma-irradiation did not affect the allergenicity of tomato proteins for up to 7 days after irradiation when the tomatoes were stored at 20 deg. C. Additionally, the m-RNA levels of β-fructofuranosidase, polygalacturonase, pectin esterase, and superoxide dismutase, the main allergenic proteins in tomato, were not affected by the applied irradiation dose. Thus, this study demonstrated that a 1.25 kGy dose of gamma-irradiation effectively eliminates L. monocytogenes on cherry tomatoes without affecting the expression of allergenic proteins in the fruits.
Todoriki, Setsuko; Bari, Latiful; Kitta, Kazumi; Ohba, Mika; Ito, Yasuhiro; Tsujimoto, Yuka; Kanamori, Norihito; Yano, Erika; Moriyama, Tatsuya; Kawamura, Yukio; Kawamoto, Shinichi
2009-07-01
The presence of Listeria monocytogenes in fresh produce is a growing concern because of the possibility of food-borne illness. Ionizing radiation is an effective non-thermal means of eliminating pathogenic bacteria in fresh produce; however, the effect of ionizing irradiation on the allergenic properties of the host commodities remains unknown. This study aimed (i) to determine the effective dose of gamma-irradiation in eliminating L. monocytogenes on whole cherry tomatoes and (ii) to evaluate the effect of gamma-irradiation on the allergenic properties of tomato proteins. Cherry tomatoes that were inoculated with a mixture of five L. monocytogenes strains were treated with gamma-rays from a 60Co source. A 1.25 kGy dose of gamma-irradiation was found to be sufficient to eliminate L. monocytogenes on whole cherry tomatoes. The immunoblot profile of serum samples obtained from two patients with tomato allergy revealed that gamma-irradiation did not affect the allergenicity of tomato proteins for up to 7 days after irradiation when the tomatoes were stored at 20 °C. Additionally, the m-RNA levels of β-fructofuranosidase, polygalacturonase, pectin esterase, and superoxide dismutase, the main allergenic proteins in tomato, were not affected by the applied irradiation dose. Thus, this study demonstrated that a 1.25 kGy dose of gamma-irradiation effectively eliminates L. monocytogenes on cherry tomatoes without affecting the expression of allergenic proteins in the fruits.
Energy Technology Data Exchange (ETDEWEB)
Todoriki, Setsuko [National Food Research Institute, Tsukuba, Ibaraki 305-8642 (Japan)], E-mail: setsuko@affrc.go.jp; Bari, Latiful; Kitta, Kazumi; Ohba, Mika; Ito, Yasuhiro; Tsujimoto, Yuka [National Food Research Institute, Tsukuba, Ibaraki 305-8642 (Japan); Kanamori, Norihito [Japan International Research Center for Agricultural Science, Tsukuba, Ibaraki 305-8686 (Japan); Yano, Erika; Moriyama, Tatsuya; Kawamura, Yukio [School of Agriculture, Kinki University, Nara-city, Nara 631-8505 (Japan); Kawamoto, Shinichi [National Food Research Institute, Tsukuba, Ibaraki 305-8642 (Japan)
2009-07-15
The presence of Listeria monocytogenes in fresh produce is a growing concern because of the possibility of food-borne illness. Ionizing radiation is an effective non-thermal means of eliminating pathogenic bacteria in fresh produce; however, the effect of ionizing irradiation on the allergenic properties of the host commodities remains unknown. This study aimed (i) to determine the effective dose of gamma-irradiation in eliminating L. monocytogenes on whole cherry tomatoes and (ii) to evaluate the effect of gamma-irradiation on the allergenic properties of tomato proteins. Cherry tomatoes that were inoculated with a mixture of five L. monocytogenes strains were treated with gamma-rays from a {sup 60}Co source. A 1.25 kGy dose of gamma-irradiation was found to be sufficient to eliminate L. monocytogenes on whole cherry tomatoes. The immunoblot profile of serum samples obtained from two patients with tomato allergy revealed that gamma-irradiation did not affect the allergenicity of tomato proteins for up to 7 days after irradiation when the tomatoes were stored at 20 deg. C. Additionally, the m-RNA levels of {beta}-fructofuranosidase, polygalacturonase, pectin esterase, and superoxide dismutase, the main allergenic proteins in tomato, were not affected by the applied irradiation dose. Thus, this study demonstrated that a 1.25 kGy dose of gamma-irradiation effectively eliminates L. monocytogenes on cherry tomatoes without affecting the expression of allergenic proteins in the fruits.
Wang, Junping; Xie, Xinfang; Feng, Jinsong; Chen, Jessica C; Du, Xin-jun; Luo, Jiangzhao; Lu, Xiaonan; Wang, Shuo
2015-07-02
Listeria monocytogenes is a facultatively anaerobic, Gram-positive, rod-shape foodborne bacterium causing invasive infection, listeriosis, in susceptible populations. Rapid and high-throughput detection of this pathogen in dairy products is critical as milk and other dairy products have been implicated as food vehicles in several outbreaks. Here we evaluated confocal micro-Raman spectroscopy (785 nm laser) coupled with chemometric analysis to distinguish six closely related Listeria species, including L. monocytogenes, in both liquid media and milk. Raman spectra of different Listeria species and other bacteria (i.e., Staphylococcus aureus, Salmonella enterica and Escherichia coli) were collected to create two independent databases for detection in media and milk, respectively. Unsupervised chemometric models including principal component analysis and hierarchical cluster analysis were applied to differentiate L. monocytogenes from Listeria and other bacteria. To further evaluate the performance and reliability of unsupervised chemometric analyses, supervised chemometrics were performed, including two discriminant analyses (DA) and soft independent modeling of class analogies (SIMCA). By analyzing Raman spectra via two DA-based chemometric models, average identification accuracies of 97.78% and 98.33% for L. monocytogenes in media, and 95.28% and 96.11% in milk were obtained, respectively. SIMCA analysis also resulted in satisfied average classification accuracies (over 93% in both media and milk). This Raman spectroscopic-based detection of L. monocytogenes in media and milk can be finished within a few hours and requires no extensive sample preparation. Copyright © 2015 Elsevier B.V. All rights reserved.
Overlevingsstrategieën Listeria monocytogenes bij lage temperatuur
Wemekamp-Kamphuis, H.H.; Abee, T.
2004-01-01
Listeria monocytogenes is an important food-borne pathogen that may cause severe infections in humans. Many outbreaks caused by this organism have been associated with ready-to-eat foods wich may have undergone some form of minimal processing, or have been contaminated after processing. Ready-to-eat
Incidence of Listeria monocytogenes and Other Bacteria in ...
African Journals Online (AJOL)
Prof. Ogunji
Abstract. The involvement of Listeria monocytogenes in spontaneous abortion in Jos was investigated. One hundred blood and 100 placenta samples were collected from spontaneous abortion patients in Jos. The samples were inoculated first into Listeria enrichment broth. Incubation was at 37o C, followed by cold ...
Hingston, Patricia; Chen, Jessica; Dhillon, Bhavjinder K.; Laing, Chad; Bertelli, Claire; Gannon, Victor; Tasara, Taurai; Allen, Kevin; Brinkman, Fiona S. L.; Truelstrup Hansen, Lisbeth; Wang, Siyun
2017-01-01
The human pathogen Listeria monocytogenes is a large concern in the food industry where its continuous detection in food products has caused a string of recalls in North America and Europe. Most recognized for its ability to grow in foods during refrigerated storage, L. monocytogenes can also tolerate several other food-related stresses with some strains possessing higher levels of tolerances than others. The objective of this study was to use a combination of phenotypic analyses and whole genome sequencing to elucidate potential relationships between L. monocytogenes genotypes and food-related stress tolerance phenotypes. To accomplish this, 166 L. monocytogenes isolates were sequenced and evaluated for their ability to grow in cold (4°C), salt (6% NaCl, 25°C), and acid (pH 5, 25°C) stress conditions as well as survive desiccation (33% RH, 20°C). The results revealed that the stress tolerance of L. monocytogenes is associated with serotype, clonal complex (CC), full length inlA profiles, and the presence of a plasmid which was identified in 55% of isolates. Isolates with full length inlA exhibited significantly (p monocytogenes sequence types, a new inlA PMSC, and several connections between CCs and the presence/absence or variations of specific genetic elements. A whole genome single-nucleotide-variants phylogeny revealed sporadic distribution of tolerant isolates and closely related sensitive and tolerant isolates, highlighting that minor genetic differences can influence the stress tolerance of L. monocytogenes. Specifically, a number of cold and desiccation sensitive isolates contained PMSCs in σB regulator genes (rsbS, rsbU, rsbV). Collectively, the results suggest that knowing the sequence type of an isolate in addition to screening for the presence of full-length inlA and a plasmid, could help food processors and food agency investigators determine why certain isolates might be persisting in a food processing environment. Additionally, increased
Crépet, Amélie; Albert, Isabelle; Dervin, Catherine; Carlin, Frédéric
2007-01-01
A normal distribution and a mixture model of two normal distributions in a Bayesian approach using prevalence and concentration data were used to establish the distribution of contamination of the food-borne pathogenic bacteria Listeria monocytogenes in unprocessed and minimally processed fresh vegetables. A total of 165 prevalence studies, including 15 studies with concentration data, were taken from the scientific literature and from technical reports and used for statistical analysis. The predicted mean of the normal distribution of the logarithms of viable L. monocytogenes per gram of fresh vegetables was −2.63 log viable L. monocytogenes organisms/g, and its standard deviation was 1.48 log viable L. monocytogenes organisms/g. These values were determined by considering one contaminated sample in prevalence studies in which samples are in fact negative. This deliberate overestimation is necessary to complete calculations. With the mixture model, the predicted mean of the distribution of the logarithm of viable L. monocytogenes per gram of fresh vegetables was −3.38 log viable L. monocytogenes organisms/g and its standard deviation was 1.46 log viable L. monocytogenes organisms/g. The probabilities of fresh unprocessed and minimally processed vegetables being contaminated with concentrations higher than 1, 2, and 3 log viable L. monocytogenes organisms/g were 1.44, 0.63, and 0.17%, respectively. Introducing a sensitivity rate of 80 or 95% in the mixture model had a small effect on the estimation of the contamination. In contrast, introducing a low sensitivity rate (40%) resulted in marked differences, especially for high percentiles. There was a significantly lower estimation of contamination in the papers and reports of 2000 to 2005 than in those of 1988 to 1999 and a lower estimation of contamination of leafy salads than that of sprouts and other vegetables. The interest of the mixture model for the estimation of microbial contamination is discussed. PMID
Genetic Separation of Listeria monocytogenes Causing Central Nervous System Infections in Animals
Directory of Open Access Journals (Sweden)
Lisandra Aguilar-Bultet
2018-02-01
Full Text Available Listeria monocytogenes is a foodborne pathogen that causes abortion, septicemia, gastroenteritis and central nervous system (CNS infections in ruminants and humans. L. monocytogenes strains mainly belong to two distinct phylogenetic groups, named lineages I and II. In general, clinical cases in humans and animals, in particular CNS infections, are caused by lineage I strains, while most of the environmental and food strains belong to lineage II. Little is known about why lineage I is more virulent than lineage II, even though various molecular factors and mechanisms associated with pathogenesis are known. In this study, we have used a variety of whole genome sequence analyses and comparative genomic tools in order to find characteristics that distinguish lineage I from lineage II strains and CNS infection strains from non-CNS strains. We analyzed 225 strains and identified single nucleotide variants between lineages I and II, as well as differences in the gene content. Using a novel approach based on Reads Per Kilobase per Million Mapped (RPKM, we identified 167 genes predominantly absent in lineage II but present in lineage I. These genes are mostly encoding for membrane-associated proteins. Additionally, we found 77 genes that are largely absent in the non-CNS associated strains, while 39 genes are especially lacking in our defined “non-clinical” group. Based on the RPKM analysis and the metadata linked to the L. monocytogenes strains, we identified 6 genes potentially associated with CNS cases, which include a transcriptional regulator, an ABC transporter and a non-coding RNA. Although there is not a clear separation between pathogenic and non-pathogenic strains based on phylogenetic lineages, the presence of the genes identified in our study reveals potential pathogenesis traits in ruminant L. monocytogenes strains. Ultimately, the differences that we have found in our study will help steer future studies in understanding the virulence
Genetic Separation of Listeria monocytogenes Causing Central Nervous System Infections in Animals
Aguilar-Bultet, Lisandra; Nicholson, Pamela; Rychener, Lorenz; Dreyer, Margaux; Gözel, Bulent; Origgi, Francesco C.; Oevermann, Anna; Frey, Joachim; Falquet, Laurent
2018-01-01
Listeria monocytogenes is a foodborne pathogen that causes abortion, septicemia, gastroenteritis and central nervous system (CNS) infections in ruminants and humans. L. monocytogenes strains mainly belong to two distinct phylogenetic groups, named lineages I and II. In general, clinical cases in humans and animals, in particular CNS infections, are caused by lineage I strains, while most of the environmental and food strains belong to lineage II. Little is known about why lineage I is more virulent than lineage II, even though various molecular factors and mechanisms associated with pathogenesis are known. In this study, we have used a variety of whole genome sequence analyses and comparative genomic tools in order to find characteristics that distinguish lineage I from lineage II strains and CNS infection strains from non-CNS strains. We analyzed 225 strains and identified single nucleotide variants between lineages I and II, as well as differences in the gene content. Using a novel approach based on Reads Per Kilobase per Million Mapped (RPKM), we identified 167 genes predominantly absent in lineage II but present in lineage I. These genes are mostly encoding for membrane-associated proteins. Additionally, we found 77 genes that are largely absent in the non-CNS associated strains, while 39 genes are especially lacking in our defined “non-clinical” group. Based on the RPKM analysis and the metadata linked to the L. monocytogenes strains, we identified 6 genes potentially associated with CNS cases, which include a transcriptional regulator, an ABC transporter and a non-coding RNA. Although there is not a clear separation between pathogenic and non-pathogenic strains based on phylogenetic lineages, the presence of the genes identified in our study reveals potential pathogenesis traits in ruminant L. monocytogenes strains. Ultimately, the differences that we have found in our study will help steer future studies in understanding the virulence mechanisms of the
Engineering bacterial motility towards hydrogen-peroxide.
Virgile, Chelsea; Hauk, Pricila; Wu, Hsuan-Chen; Shang, Wu; Tsao, Chen-Yu; Payne, Gregory F; Bentley, William E
2018-01-01
Synthetic biologists construct innovative genetic/biological systems to treat environmental, energy, and health problems. Many systems employ rewired cells for non-native product synthesis, while a few have employed the rewired cells as 'smart' devices with programmable function. Building on the latter, we developed a genetic construct to control and direct bacterial motility towards hydrogen peroxide, one of the body's immune response signaling molecules. A motivation for this work is the creation of cells that can target and autonomously treat disease, the latter signaled by hydrogen peroxide release. Bacteria naturally move towards a variety of molecular cues (e.g., nutrients) in the process of chemotaxis. In this work, we engineered bacteria to recognize and move towards hydrogen peroxide, a non-native chemoattractant and potential toxin. Our system exploits oxyRS, the native oxidative stress regulon of E. coli. We first demonstrated H2O2-mediated upregulation motility regulator, CheZ. Using transwell assays, we showed a two-fold increase in net motility towards H2O2. Then, using a 2D cell tracking system, we quantified bacterial motility descriptors including velocity, % running (of tumble/run motions), and a dynamic net directionality towards the molecular cue. In CheZ mutants, we found that increased H2O2 concentration (0-200 μM) and induction time resulted in increased running speeds, ultimately reaching the native E. coli wild-type speed of ~22 μm/s with a ~45-65% ratio of running to tumbling. Finally, using a microfluidic device with stable H2O2 gradients, we characterized responses and the potential for "programmed" directionality towards H2O2 in quiescent fluids. Overall, the synthetic biology framework and tracking analysis in this work will provide a framework for investigating controlled motility of E. coli and other 'smart' probiotics for signal-directed treatment.
Survival of Listeria monocytogenes in Soil Requires AgrA-Mediated Regulation.
Vivant, Anne-Laure; Garmyn, Dominique; Gal, Laurent; Hartmann, Alain; Piveteau, Pascal
2015-08-01
In a recent paper, we demonstrated that inactivation of the Agr system affects the patterns of survival of Listeria monocytogenes (A.-L. Vivant, D. Garmyn, L. Gal, and P. Piveteau, Front Cell Infect Microbiol 4:160, http://dx.doi.org/10.3389/fcimb.2014.00160). In this study, we investigated whether the Agr-mediated response is triggered during adaptation in soil, and we compared survival patterns in a set of 10 soils. The fate of the parental strain L. monocytogenes L9 (a rifampin-resistant mutant of L. monocytogenes EGD-e) and that of a ΔagrA deletion mutant were compared in a collection of 10 soil microcosms. The ΔagrA mutant displayed significantly reduced survival in these biotic soil microcosms, and differential transcriptome analyses showed large alterations of the transcriptome when AgrA was not functional, while the variations in the transcriptomes between the wild type and the ΔagrA deletion mutant were modest under abiotic conditions. Indeed, in biotic soil environments, 578 protein-coding genes and an extensive repertoire of noncoding RNAs (ncRNAs) were differentially transcribed. The transcription of genes coding for proteins involved in cell envelope and cellular processes, including the phosphotransferase system and ABC transporters, and proteins involved in resistance to antimicrobial peptides was affected. Under sterilized soil conditions, the differences were limited to 86 genes and 29 ncRNAs. These results suggest that the response regulator AgrA of the Agr communication system plays important roles during the saprophytic life of L. monocytogenes in soil. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Sperm motility and morphology as changing parameters linked to sperm count variations.
Directory of Open Access Journals (Sweden)
Dua A
1996-10-01
Full Text Available Variations in semen analyses of 177 males over a 1 year period were assessed. The average means of total counts, motility, morphology, total motile count and non-motile % were determined for 5 classes of patients ranging from azoospermic to normospermic. Positive relationships between a falling sperm count, a decrease in motility and total motile counts were seen. Also, increasingly, abnormal forms were found with lower sperm counts.
High-resolution esophageal pressure topography for esophageal motility disorders
Hashem Fakhre Yaseri; Gholamreza Hamsi; Tayeb Ramim
2016-01-01
Background: High-resolution manometer (HRM) of the esophagus has become the main diagnostic test in the evaluation of esophageal motility disorders. The development of high-resolution manometry catheters and software displays of manometry recordings in color-coded pressure plots have changed the diagnostic assessment of esophageal disease. The first step of the Chicago classification described abnormal esophagogastric junction deglutitive relaxation. The latest classification system, proposed...
Uncovering Listeria monocytogenes hypervirulence by harnessing its biodiversity
Charlier, Caroline; Touchon, Marie; Chenal-Francisque, Viviane; Leclercq, Alexandre; Criscuolo, Alexis; Gaultier, Charlotte; Roussel, Sophie; Brisabois, Anne; Disson, Olivier; Rocha, Eduardo P. C.; Brisse, Sylvain; Lecuit, Marc
2016-01-01
Microbial pathogenesis studies are typically performed with reference strains, thereby overlooking microbial intra-species virulence heterogeneity. Here we integrated human epidemiological and clinical data with bacterial population genomics to harness the biodiversity of the model foodborne pathogen Listeria monocytogenes and decipher the basis of its neural and placental tropisms. Taking advantage of the clonal structure of this bacterial species, we identify clones epidemiologically associated with either food or human central nervous system (CNS) and maternal-neonatal (MN) listeriosis. The latter are also most prevalent in patients without immunosuppressive comorbidities. Strikingly, CNS and MN clones are hypervirulent in a humanized mouse model of listeriosis. By integrating epidemiological data and comparative genomics, we uncovered multiple novel putative virulence factors and demonstrated experimentally the contribution of the first gene cluster mediating Listeria monocytogenes neural and placental tropisms. This study illustrates the exceptional power of harnessing microbial biodiversity to identify clinically relevant microbial virulence attributes. PMID:26829754
Depletion of proton motive force by nisin in Listeria monocytogenes cells.
Bruno, M E; Kaiser, A; Montville, T J
1992-07-01
The basal proton motive force (PMF) levels and the influence of the bacteriocin nisin on the PMF were determined in Listeria monocytogenes Scott A. In the absence of nisin, the interconversion of the pH gradient (Z delta pH) and the membrane potential (delta psi) led to the maintenance of a fairly constant PMF at -160 mV over the external pH range 5.5 to 7.0. The addition of nisin at concentrations of greater than or equal to 5 micrograms/ml completely dissipated PMF in cells at external pH values of 5.5 and 7.0. With 1 microgram of nisin per ml, delta pH was completely dissipated but delta psi decreased only slightly. The action of nisin on PMF in L. monocytogenes Scott A was both time and concentration dependent. Valinomycin depleted only delta pH, whereas nigericin and carbonyl cyanide m-chlorophenylhydrazone depleted only delta psi, under conditions in which nisin depleted both. Four other L. monocytogenes strains had basal PMF parameters similar to those of strain Scott A. Nisin (2.5 micrograms/ml) also completely dissipated PMF in these strains.
Jiang, Xiaobing; Yu, Tao; Liang, Yu; Ji, Shengdong; Guo, Xiaowei; Ma, Jianmin; Zhou, Lijun
2016-01-18
In this study, efflux pump-mediated benzalkonium chloride (BC) resistance, including plasmid-encoded (Qac protein family and BcrABC) and chromosome-borne efflux pumps, was investigated in Listeria monocytogenes from retail food in China. Among the 59 L. monocytogenes strains, 13 (22.0%) strains were resistant to BC. The PCR results showed that bcrABC was harbored by 2 of 13 BC resistant strains. However, none of the qac genes were detected among the 59 strains. The bcrABC was absent in both of the plasmid cured strains, indicating that this BC resistance determinant was plasmid-encoded in the two bcrABC-positive strains. In the presence of reserpine, most of the bcrABC-negative strains had decreases in the MICs of BC, suggesting the existence of other efflux pumps and their role in BC resistance. After exposed to reserpine, the reduction in BC MICs was observed in the two cured strains, indicating that efflux pumps located on chromosome was also involved in BC resistance. Our findings suggest that food products may act as reservoirs for BC resistant isolates of L. monocytogenes and plasmid- and chromosome-encoded efflux pumps could mediate the BC resistance of L. monocytogenes, which is especially relevant to the adaption of this organism in food-related environments with frequent BC use. Copyright © 2015 Elsevier B.V. All rights reserved.
Modeling the effect of temperature on survival rate of Listeria monocytogenes in yogurt.
Szczawiński, J; Szczawińska, M E; Łobacz, A; Jackowska-Tracz, A
2016-01-01
The aim of the study was to (i) evaluate the behavior of Listeria monocytogenes in a commercially produced yogurt, (ii) determine the survival/inactivation rates of L. monocytogenes during cold storage of yogurt and (iii) to generate primary and secondary mathematical models to predict the behavior of these bacteria during storage at different temperatures. The samples of yogurt were inoculated with the mixture of three L. monocytogenes strains and stored at 3, 6, 9, 12 and 15°C for 16 days. The number of listeriae was determined after 0, 1, 2, 3, 5, 7, 9, 12, 14 and 16 days of storage. From each sample a series of decimal dilutions were prepared and plated onto ALOA agar (agar for Listeria according to Ottaviani and Agosti). It was found that applied temperature and storage time significantly influenced the survival rate of listeriae (pbacteria was found in the samples stored at 6°C (D-10 value = 243.9 h), whereas the highest reduction in the number of the bacteria was observed in the samples stored at 15°C (D-10 value = 87.0 h). The number of L. monocytogenes was correlated with the pH value of the samples (pyogurt stored under temperature range from 3 to 15°C, however, the polynomial model gave a better fit to the experimental data.
DEFF Research Database (Denmark)
Hingston, Patricia A.; Chen, Jessica; Dhillon, Bhavjinder K
2017-01-01
elements. A whole genome single-nucleotide-variants phylogeny revealed sporadic distribution of tolerant isolates and closely related sensitive and tolerant isolates, highlighting that minor genetic differences can influence the stress tolerance of L. monocytogenes. Specifically, a number of cold......The human pathogen Listeria monocytogenes is a large concern in the food industry where its continuous detection in food products has caused a string of recalls in North America and Europe. Most recognized for its ability to grow in foods during refrigerated storage, L. monocytogenes can also...... tolerate several other food-related stresses with some strains possessing higher levels of tolerances than others. The objective of this study was to use a combination of phenotypic analyses and whole genome sequencing to elucidate potential relationships between L. monocytogenes genotypes and food...
Automatic Bowel Motility Evaluation Technique for Noncontact Sound Recordings
Directory of Open Access Journals (Sweden)
Ryunosuke Sato
2018-06-01
Full Text Available Information on bowel motility can be obtained via magnetic resonance imaging (MRIs and X-ray imaging. However, these approaches require expensive medical instruments and are unsuitable for frequent monitoring. Bowel sounds (BS can be conveniently obtained using electronic stethoscopes and have recently been employed for the evaluation of bowel motility. More recently, our group proposed a novel method to evaluate bowel motility on the basis of BS acquired using a noncontact microphone. However, the method required manually detecting BS in the sound recordings, and manual segmentation is inconvenient and time consuming. To address this issue, herein, we propose a new method to automatically evaluate bowel motility for noncontact sound recordings. Using simulations for the sound recordings obtained from 20 human participants, we showed that the proposed method achieves an accuracy of approximately 90% in automatic bowel sound detection when acoustic feature power-normalized cepstral coefficients are used as inputs to artificial neural networks. Furthermore, we showed that bowel motility can be evaluated based on the three acoustic features in the time domain extracted by our method: BS per minute, signal-to-noise ratio, and sound-to-sound interval. The proposed method has the potential to contribute towards the development of noncontact evaluation methods for bowel motility.
Investigation of Listeria monocytogenes transmission from environmental sources associated with pasture-raised chickens to poultry products is needed to determine ways to prevent potential foodborne illness. Here, we report the complete genome sequence of Listeria monocytogenes MR310, one of the iso...
Sperm motility of externally fertilizing fish and amphibians.
Browne, R K; Kaurova, S A; Uteshev, V K; Shishova, N V; McGinnity, D; Figiel, C R; Mansour, N; Agney, D; Wu, M; Gakhova, E N; Dzyuba, B; Cosson, J
2015-01-01
We review the phylogeny, sperm competition, morphology, physiology, and fertilization environments of the sperm of externally fertilizing fish and amphibians. Increased sperm competition in both fish and anurans generally increases sperm numbers, sperm length, and energy reserves. The difference between the internal osmolarity and iconicity of sperm cells and those of the aquatic medium control the activation, longevity, and velocity of sperm motility. Hypo-osmolarity of the aquatic medium activates the motility of freshwater fish and amphibian sperm and hyperosmolarity activates the motility of marine fish sperm. The average longevity of the motility of marine fish sperm (~550 seconds) was significantly (P amphibian sperm in general and anurans reversion from internal to external fertilization. Our findings provide a greater understanding of the reproductive biology of externally fertilizing fish and amphibians, and a biological foundation for the further development of reproduction technologies for their sustainable management.
Heir, Even; Møretrø, Trond; Simensen, Andreas; Langsrud, Solveig
2018-06-20
Interactions and competition between resident bacteria in food processing environments could affect their ability to survive, grow and persist in microhabitats and niches in the food industry. In this study, the competitive ability of L. monocytogenes strains grown together in separate culture mixes with other L. monocytogenes (L. mono mix), L. innocua (Listeria mix), Gram-negative bacteria (Gram- mix) and with a multigenera mix (Listeria + Gram- mix) was investigated in biofilms on stainless steel and in suspensions at 12 °C. The mixed cultures included resident bacteria from processing surfaces in meat and salmon industry represented by L. monocytogenes (n = 6), L. innocua (n = 5) and Gram-negative bacteria (n = 6; Acinetobacter sp., Pseudomonas fragi, Pseudomonas fluorescens, Serratia liquefaciens, Stenotrophomonas maltophilia). Despite hampered in growth in mixed cultures, L. monocytogenes established in biofilms with counts at day nine between 7.3 and 9.0 log per coupon with the lowest counts in the Listeria + G- mix that was dominated by Pseudomonas. Specific L. innocua inhibited growth of L. monocytogenes strains differently; inhibition that was further enhanced by the background Gram-negative microbiota. In these multispecies and multibacteria cultures, the growth competitive effects lead to the dominance of a strong competitor L. monocytogenes strain that was only slightly inhibited by L. innocua and showed strong competitive abilities in mixed cultures with resident Gram-negative bacteria. The results indicates complex patterns of bacterial interactions and L. monocytogenes inhibition in the multibacteria cultures that only partially depend on cell contact and likely involve various antagonistic and bacterial tolerance mechanisms. The study indicates large variations among L. monocytogenes in their competitiveness under multibacterial culture conditions that should be considered in further studies towards understanding of L
Directory of Open Access Journals (Sweden)
Callum J. Highmore
2018-04-01
Full Text Available The microbiological safety of fresh produce is monitored almost exclusively by culture-based detection methods. However, bacterial food-borne pathogens are known to enter a viable-but-nonculturable (VBNC state in response to environmental stresses such as chlorine, which is commonly used for fresh produce decontamination. Here, complete VBNC induction of green fluorescent protein-tagged Listeria monocytogenes and Salmonella enterica serovar Thompson was achieved by exposure to 12 and 3 ppm chlorine, respectively. The pathogens were subjected to chlorine washing following incubation on spinach leaves. Culture data revealed that total viable L. monocytogenes and Salmonella Thompson populations became VBNC by 50 and 100 ppm chlorine, respectively, while enumeration by direct viable counting found that chlorine caused a <1-log reduction in viability. The pathogenicity of chlorine-induced VBNC L. monocytogenes and Salmonella Thompson was assessed by using Caenorhabditis elegans. Ingestion of VBNC pathogens by C. elegans resulted in a significant life span reduction (P = 0.0064 and P < 0.0001, and no significant difference between the life span reductions caused by the VBNC and culturable L. monocytogenes treatments was observed. L. monocytogenes was visualized beyond the nematode intestinal lumen, indicating resuscitation and cell invasion. These data emphasize the risk that VBNC food-borne pathogens could pose to public health should they continue to go undetected.
Software-assisted small bowel motility analysis using free-breathing MRI: feasibility study.
Bickelhaupt, Sebastian; Froehlich, Johannes M; Cattin, Roger; Raible, Stephan; Bouquet, Hanspeter; Bill, Urs; Patak, Michael A
2014-01-01
To validate a software prototype allowing for small bowel motility analysis in free breathing by comparing it to manual measurements. In all, 25 patients (15 male, 10 female; mean age 39 years) were included in this Institutional Review Board-approved, retrospective study. Magnetic resonance imaging (MRI) was performed on a 1.5T system after standardized preparation acquiring motility sequences in free breathing over 69-84 seconds. Small bowel motility was analyzed manually and with the software. Functional parameters, measurement time, and reproducibility were compared using the coefficient of variance and paired Student's t-test. Correlation was analyzed using Pearson's correlation coefficient and linear regression. The 25 segments were analyzed twice both by hand and using the software with automatic breathing correction. All assessed parameters significantly correlated between the methods (P software (3.90%, standard deviation [SD] ± 5.69) than manual examinations (9.77%, SD ± 11.08). The time needed was significantly less (P software (4.52 minutes, SD ± 1.58) compared to manual measurement, lasting 17.48 minutes for manual (SD ± 1.75 minutes). The use of the software proves reliable and faster small bowel motility measurements in free-breathing MRI compared to manual analyses. The new technique allows for analyses of prolonged sequences acquired in free breathing, improving the informative value of the examinations by amplifying the evaluable data. Copyright © 2013 Wiley Periodicals, Inc.
Pathogenic potential of Listeria monocytogenes isolated from cattle ...
African Journals Online (AJOL)
Listeria monocytogenes is an opportunistic food-borne pathogen causing listeriosis especially among immune-compromised persons. Its high rate of morbidity and mortality has classed the organism among the top watch list in foods. It is known to produce several virulence factors which aid its survival in harsh conditions ...
Incidence of Listeria monocytogenes and Other Bacteria in ...
African Journals Online (AJOL)
The involvement of Listeria monocytogenes in spontaneous abortion in Jos was investigated. One hundred blood and 100 placenta samples were collected from spontaneous abortion patients in Jos. The samples were inoculated first into Listeria enrichment broth. Incubation was at 37o C, followed by cold enrichment at ...
Prevalence and antibiotic susceptibility of Listeria monocytogenes in ...
African Journals Online (AJOL)
One hundred and ninety two raw milk samples were collected from lactating cows identified in Fulani herds and small scale dairy farms within Sokoto metropolis in order to investigate the presence and determine the antibiotic susceptibility of Listeria monocytogenes in the milk. Selective culture and identification method ...
Listeria monocytogenes meningitis in the Netherlands, 1985-2014: A nationwide surveillance study.
Koopmans, Merel M; Bijlsma, Merijn W; Brouwer, Matthijs C; van de Beek, Diederik; van der Ende, Arie
2017-07-01
Listeria monocytogenes can cause sepsis and meningitis. We report national surveillance data on L. monocytogenes meningitis in the Netherlands, describing incidence changes, genetic epidemiology and fatality rate. We analyzed data from the Netherlands Reference Laboratory of Bacterial Meningitis for cases of L. monocytogenes meningitis. Strains were assessed by serotyping and bacterial population structure by multi-locus sequence typing. A total of 375 cases of Listeria meningitis were identified between 1985 and 2014. Peak incidence rates were observed in neonates (0.61 per 100,000 live births) and older adults (peak at 87 year; 0.53 cases per 100,000 population of the same age). Neonatal listerial meningitis decreased 17-fold from 1.95 per 100,000 live births between 1985 and 1989, to 0.11 per 100,000 live births between 2010 and 2014. Overall case fatality rate was 31%, in a multivariate analysis older age and concomitant bacteremia were associated with mortality (both p listeria meningitis has remained high. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.
Listeria spp. E Listeria monocytogenes NA PRODUÇÃO DE SALSICHAS TIPO HOT DOG
Directory of Open Access Journals (Sweden)
ALESSANDRA PARO RODRIGUES CESAR
2011-06-01
Full Text Available Listeria monocytogenes is widely distributed in the environment and it has been isolated from food that were associated to outbreaks of high lethality in many countries. Thus, this bacterium represents an important pathogen to the public health. Ready-to-eat products, likecooked stuffed food, within them, frankfurters, are associated to human listeriosis in many countries. Taking into consideration the importance of the subject and the need of more data about it, the occurrence of Listeria spp. and L. monocytogenes in industrial plants, in meat raw materials, in slurry and frankfurters was investigated.These samples were collected in two production plants with SIF (Federal Inspection Service; in one of them GMP, HACCP and SOP were implemented. The results of the 1 06 microbiological analysis were submitted to the program @Risk to obtain the risk analysis; the meanvalues results showed that 7 to 9% of the frankfurters in the market may have L. monocytogenes. The analysis indicated that 88 strains of L. monocytogenes were obtained from 1 06 samples; among them, 76 werecollected in the industrial plants that participate in the experiment, and 30 were collected in the market. In serological typification, 95% of these strains were classified as serotypes 4b, 1 /2a and 1 /2b. Besides the presence of the bacterium in frankfurthers consumed inBrazil and the risk factors associated to this pathogen, the situation concerns because of the lack of epidemiological data, absence of patterns and the deficient information given to the consumer, specially information related to the presence of L. monocytogenes, particularly important to the groups at risk, as well as information related to the importance of heating the product
A Dual Microscopy-Based Assay To Assess Listeria monocytogenes Cellular Entry and Vacuolar Escape.
Quereda, Juan J; Pizarro-Cerdá, Javier; Balestrino, Damien; Bobard, Alexandre; Danckaert, Anne; Aulner, Nathalie; Shorte, Spencer; Enninga, Jost; Cossart, Pascale
2016-01-01
Listeria monocytogenes is a Gram-positive bacterium and a facultative intracellular pathogen that invades mammalian cells, disrupts its internalization vacuole, and proliferates in the host cell cytoplasm. Here, we describe a novel image-based microscopy assay that allows discrimination between cellular entry and vacuolar escape, enabling high-content screening to identify factors specifically involved in these two steps. We first generated L. monocytogenes and Listeria innocua strains expressing a β-lactamase covalently attached to the bacterial cell wall. These strains were then incubated with HeLa cells containing the Förster resonance energy transfer (FRET) probe CCF4 in their cytoplasm. The CCF4 probe was cleaved by the bacterial surface β-lactamase only in cells inoculated with L. monocytogenes but not those inoculated with L. innocua, thereby demonstrating bacterial access to the host cytoplasm. Subsequently, we performed differential immunofluorescence staining to distinguish extracellular versus total bacterial populations in samples that were also analyzed by the FRET-based assay. With this two-step analysis, bacterial entry can be distinguished from vacuolar rupture in a single experiment. Our novel approach represents a powerful tool for identifying factors that determine the intracellular niche of L. monocytogenes. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Microfabricated ratchet structures for concentrating and patterning motile bacterial cells
International Nuclear Information System (INIS)
Kim, Sang Yub; Lee, Eun Se; Lee, Ho Jae; Lee, Se Yeon; Lee, Sung Kuk; Kim, Taesung
2010-01-01
We present a novel microfabricated concentrator for Escherichia coli that can be a stand-alone and self-contained microfluidic device because it utilizes the motility of cells. First of all, we characterize the motility of E. coli cells and various ratcheting structures that can guide cells to move in a desired direction in straight and circular channels. Then, we combine these ratcheting microstructures with the intrinsic tendency of cells to swim on the right side in microchannels to enhance the concentration rates up to 180 fold until the concentrators are fully filled with cells. Furthermore, we demonstrate that cells can be positioned and concentrated with a constant spacing distance on a surface, allowing spatial patterning of motile cells. These results can be applied to biosorption or biosensor devices that are powered by motile cells because they can be highly concentrated without any external mechanical and electrical energy sources. Hence, we believe that the concentrator design holds considerable potential to be applied for concentrating and patterning other motile microbes and providing a versatile structure for motility study of bacterial cells.
Cycles of light and dark co-ordinate reversible colony differentiation in Listeria monocytogenes.
Tiensuu, Teresa; Andersson, Christopher; Rydén, Patrik; Johansson, Jörgen
2013-02-01
Recently, several light receptors have been identified in non-phototrophic bacteria, but their physiological roles still remain rather elusive. Here we show that colonies of the saprophytic bacterium Listeria monocytogenes undergo synchronized multicellular behaviour on agar plates, in response to oscillating light/dark conditions, giving rise to alternating ring formation (opaque and translucent rings). On agar plates, bacteria from opaque rings survive increased levels of reactive oxygen species (ROS), as well as repeated cycles of light and dark, better than bacteria from translucent rings. The ring formation is strictly dependent on a blue-light receptor, Lmo0799, acting through the stress-sigma factor, σ(B) . A transposon screening identified 48 mutants unable to form rings at alternating light conditions, with several of them showing a decreased σ(B) activity/level. However, some of the tested mutants displayed a varied σ(B) activity depending on which of the two stress conditions tested (light or H(2) O(2) exposure). Intriguingly, the transcriptional regulator PrfA and the virulence factor ActA were shown to be required for ring formation by a mechanism involving activation of σ(B) . All in all, this suggests a distinct pathway for Lmo0799 that converge into a common signalling pathway for σ(B) activation. Our results show that night and day cycles co-ordinate a reversible differentiation of a L. monocytogenes colony at room temperature, by a process synchronized by a blue-light receptor and σ(B) . © 2013 Blackwell Publishing Ltd.
Analysis of the impact of cryopreservation and theophylline on motility of sperm
Directory of Open Access Journals (Sweden)
Elaheh Gorji
2018-06-01
Full Text Available Objective: Sperm parameters, particularly motility, decrease during cryopreservation. Theophylline generally enhances sperm motility. We analyzed effects of theophylline and freezing on sperm motility.Design: Experimental study.Setting: Private IVF lab.Setting: IVF lab of Mehrgan Hospital. Method: 22–55 year-old men participated in this study (30 fresh ejaculation and 8 TESE samples. After sperm analysis, we added theophylline (40 mM to half of our samples as case group to compare motility with the remaining samples as control group. Cryopreservation was performed in two groups. After thawing, motility of both groups was recorded. Furthermore, theophylline (40 mM was applied to both groups after thawing again. Result: After adding theophylline, sperm motility improved significantly in all samples. Sperm motility reduced in control group more than the study group after freeze-thaw procedure (P < 0.002, normal morphology <5%. Sperm motility was not enhanced significantly by re-adding of theophylline to the two groups. Interactions between stages and groups were statistically significant in semen and biopsy samples (p < 0.001. Conclusion: Adding theophylline before freezing can preserve motility of sperms in samples with different parameters and even sperms extracted in testicular biopsy. Theophylline may have protective impact on sperms in freezing procedure. Keywords: Sperm motility, Theophylline, Freezing, Morphology, Biopsy
Mitochondrial respiratory efficiency is positively correlated with human sperm motility.
Ferramosca, Alessandra; Provenzano, Sara Pinto; Coppola, Lamberto; Zara, Vincenzo
2012-04-01
To correlate sperm mitochondrial respiratory efficiency with variations in sperm motility and with sperm morphologic anomalies. Sperm mitochondrial respiratory activity was evaluated with a polarographic assay of oxygen consumption carried out in hypotonically-treated sperm cells. A possible relationship among sperm mitochondrial respiratory efficiency, sperm motility, and morphologic anomalies was investigated. Mitochondrial respiratory efficiency was positively correlated with sperm motility and negatively correlated with the percentage of immotile spermatozoa. Moreover, midpiece defects impaired mitochondrial functionality. Our data indicate that an increase in sperm motility requires a parallel increase in mitochondrial respiratory capacity, thereby supporting the fundamental role played by mitochondrial oxidative phosphorylation in sperm motility of normozoospermic subjects. These results are of physiopathological relevance because they suggest that disturbances of sperm mitochondrial function and of energy production could be responsible for asthenozoospermia. Copyright © 2012 Elsevier Inc. All rights reserved.
Rodríguez-López, Pedro; Saá-Ibusquiza, Paula; Mosquera-Fernández, Maruxa; López-Cabo, Marta
2015-08-03
In order to find out how real Listeria monocytogenes-carrying biofilms are in industrial settings, a total of 270 environmental samples belonging to work surfaces from fish (n = 123), meat (n = 75) and dairy industries (n = 72) were analysed in order to detect L. monocytogenes. 12 samples were positive for L. monocytogenes and a total of 18 different species were identified as accompanying microbiota in fish and meat industry. No L. monocytogenes was found in samples from dairy industry. Molecular characterisation combining results of AscI and ApaI macrorestriction PFGE assays yielded 7 different subtypes of L. monocytogenes sharing in 71.43% of cases the same serogroup (1/2a-3a). Results from dynamic numerical characterisation between L. monocytogenes monospecies biofilms on stainless steel (SS) using MATLAB-based tool BIOFILMDIVER demonstrated that except in isolate A1, in which a significant increase in the percentage of covered area (CA), average diffusion distance (ADD) and maximum diffusion distance (MDD) was observed after 120 h of culture, no significant differences were observed in the dynamics of the rest of the L. monocytogenes isolates. Quantitative dual-species biofilm association experiments performed on SS indicated that L. monocytogenes cell counts presented lower values in mixed-species cultures with certain species at 24 and 48 h compared with mono-species culture. However, they remained unaltered after 72 h except when co-cultured with Serratia fonticola which presented differences in all sampling times and was also the dominant species within the dual-species biofilm. When considering frequency of appearance of accompanying species, an ecological distribution was demonstrated as Escherichia coli appeared to be the most abundant in fish industry and Carnobacterium spp. in meat industry. Copyright © 2015 Elsevier B.V. All rights reserved.
Effects of irradiation on bacterial load and Listeria monocytogenes in raw chicken
International Nuclear Information System (INIS)
Varabioff, Y.; Mitchell, G.E.; Nottingham, S.M.
1992-01-01
After irradiation of chickens to a dose of 2.5 kGy, the decrease in the standard plate count (SPC) was similar in air and in vacuum-packaged chickens. During storage at 4 degrees C for 15 d, the SPC increased progressively in both types of packaged chickens. At the end of the storage period, the SPC was higher in air-packaged chicken than in vacuum-packaged chickens. In irradiated chickens, Listeria monocytogenes was only recovered from the vacuum-packaged chickens after 7 d cold storage. In unirradiated chickens, L. monocytogenes proliferated similarly in both air- and vacuum-packaged chickens
Effect of pulmonary irradiation from inhaled 90Y on immunity to Listeria monocytogenes in mice
International Nuclear Information System (INIS)
Sanchez, A.; Lundgren, D.L.; McClellan, R.O.
1976-01-01
The immunological response of mice subjected to irradiation from particles deposited in the lungs and challenged with Listeria monocytogenes was investigated. Mice, exposed by inhalation to 90 Y (a beta-emitting radionuclide) in relatively insoluble fused aluminosilicate particles, were immunized with L. monocytogenes either before or after exposure. Two additional groups of mice were either immunized or irradiated only. A group of control mice received no irradiation or immunization. The beta radiation dose absorbed by the lungs of each mouse at time of challenge averaged 10,000 rads. Fourteen days after immunization, all mice were challenged with 2 LD 50 doses of L. monocytogenes via the respiratory route. Survival of all immunized mice either with or without exposure to 90 Y varied from 90 to 100% as compared to 10 to 20% for the mice irradiated only and for control mice through 14 days after challenge. Pulmonary clearance of inhaled L. monocytogenes during the first 4 hr after challenge was suppressed in the mice irradiated only but not in those immunized only, or in the immunized and irradiated groups, and control mice. There appeared to be a suppression of proliferation of L. monocytogenes in lungs and spleen in the immunized groups 72 hr after challenge, whereas the lungs and spleens of the mice irradiated only and the control mice had extensive bacterial invasion. It was concluded that the 10,000 rads of beta radiation absorbed by the lungs did not suppress the immune mechanisms of the immunized mice
Vivant, Anne-Laure; Garmyn, Dominique; Maron, Pierre-Alain; Nowak, Virginie; Piveteau, Pascal
2013-01-01
Understanding the ecology of pathogenic organisms is important in order to monitor their transmission in the environment and the related health hazards. We investigated the relationship between soil microbial diversity and the barrier effect against Listeria monocytogenes invasion. By using a dilution-to-extinction approach, we analysed the consequence of eroding microbial diversity on L. monocytogenes population dynamics under standardised conditions of abiotic parameters and microbial abundance in soil microcosms. We demonstrated that highly diverse soil microbial communities act as a biological barrier against L. monocytogenes invasion and that phylogenetic composition of the community also has to be considered. This suggests that erosion of diversity may have damaging effects regarding circulation of pathogenic microorganisms in the environment.
Aarnisalo, Kaarina; Vihavainen, Elina; Rantala, Leila; Maijala, Riitta; Suihko, Maija-Liisa; Hielm, Sebastian; Tuominen, Pirkko; Ranta, Jukka; Raaska, Laura
2008-02-10
Microbial risk assessment provides a means of estimating consumer risks associated with food products. The methods can also be applied at the plant level. In this study results of microbiological analyses were used to develop a robust single plant level risk assessment. Furthermore, the prevalence and numbers of Listeria monocytogenes in marinated broiler legs in Finland were estimated. These estimates were based on information on the prevalence, numbers and genotypes of L. monocytogenes in 186 marinated broiler legs from 41 retail stores. The products were from three main Finnish producers, which produce 90% of all marinated broiler legs sold in Finland. The prevalence and numbers of L. monocytogenes were estimated by Monte Carlo simulation using WinBUGS, but the model is applicable to any software featuring standard probability distributions. The estimated mean annual number of L. monocytogenes-positive broiler legs sold in Finland was 7.2x10(6) with a 95% credible interval (CI) 6.7x10(6)-7.7x10(6). That would be 34%+/-1% of the marinated broiler legs sold in Finland. The mean number of L. monocytogenes in marinated broiler legs estimated at the sell-by-date was 2 CFU/g, with a 95% CI of 0-14 CFU/g. Producer-specific L. monocytogenes strains were recovered from the products throughout the year, which emphasizes the importance of characterizing the isolates and identifying strains that may cause problems as part of risk assessment studies. As the levels of L. monocytogenes were low, the risk of acquiring listeriosis from these products proved to be insignificant. Consequently there was no need for a thorough national level risk assessment. However, an approach using worst-case and average point estimates was applied to produce an example of single producer level risk assessment based on limited data. This assessment also indicated that the risk from these products was low. The risk-based approach presented in this work can provide estimation of public health risk
Automated measurement of cell motility and proliferation
Directory of Open Access Journals (Sweden)
Goff Julie
2005-04-01
Full Text Available Abstract Background Time-lapse microscopic imaging provides a powerful approach for following changes in cell phenotype over time. Visible responses of whole cells can yield insight into functional changes that underlie physiological processes in health and disease. For example, features of cell motility accompany molecular changes that are central to the immune response, to carcinogenesis and metastasis, to wound healing and tissue regeneration, and to the myriad developmental processes that generate an organism. Previously reported image processing methods for motility analysis required custom viewing devices and manual interactions that may introduce bias, that slow throughput, and that constrain the scope of experiments in terms of the number of treatment variables, time period of observation, replication and statistical options. Here we describe a fully automated system in which images are acquired 24/7 from 384 well plates and are automatically processed to yield high-content motility and morphological data. Results We have applied this technology to study the effects of different extracellular matrix compounds on human osteoblast-like cell lines to explore functional changes that may underlie processes involved in bone formation and maintenance. We show dose-response and kinetic data for induction of increased motility by laminin and collagen type I without significant effects on growth rate. Differential motility response was evident within 4 hours of plating cells; long-term responses differed depending upon cell type and surface coating. Average velocities were increased approximately 0.1 um/min by ten-fold increases in laminin coating concentration in some cases. Comparison with manual tracking demonstrated the accuracy of the automated method and highlighted the comparative imprecision of human tracking for analysis of cell motility data. Quality statistics are reported that associate with stage noise, interference by non
Liu, Z; Meng, R; Zhao, X; Shi, C; Zhang, X; Zhang, Y; Guo, N
2016-12-01
Listeria monocytogenes (L. monocytogenes) is a Gram-positive bacterium that causes infections in humans. In this study, the effects of tea tree oil (TTO) at subinhibitory concentrations on L. monocytogenes growth and two important exotoxin proteins secreted by L. monocytogenes were researched. Treatment with half of minimal inhibitory concentration of TTO demonstrated very little or no reduction in numbers of viable ATCC 19115 cells. Listeriolysin O (LLO) and p60, were investigated. A listeriolysin assay was used to investigate the hemolytic activities of L. monocytogenes exposed to TTO, and the secretion of LLO and p60 was detected by immunoblot analysis. Additionally, real-time RT-PCR was used to analyse the influence of TTO on the transcription of LLO and p60 encoded genes hly and iap respectively. According to our experimental results, we propose that TTO could be used as a promising natural compound against L. monocytogenes and its virulence factors. This is the first report on the influence of subinhibitory concentrations of tea tree oil (TTO) on the secretion of listeriolysin O (LLO) and p60, the critical virulence factors involved in Listeria pathogenesis. The results showed that TTO at 0·25 mg ml -1 reduced the secretion of LLO and p60 to 10 and 34·9% respectively, in addtion, the transcription of hly and iap was reduced to 10 and 4·3% at 0·5 mg ml -1 respectively. We propose that TTO could be used as a promising antimicrobial compound and virulence inhibitor against L. monocytogenes. © 2016 The Society for Applied Microbiology.
The Chicago classification of motility disorders: an update.
Roman, Sabine; Gyawali, C Prakash; Xiao, Yinglian; Pandolfino, John E; Kahrilas, Peter J
2014-10-01
The Chicago Classification defines esophageal motility disorders in high resolution manometry. This is based on individual scoring of 10 swallows performed in supine position. Disorders of esophago-gastric junction (EGJ) outflow obstruction are defined by a median integrated relaxation pressure above the limit of normal and divided into 3 achalasia subtypes and EGJ outflow obstruction. Major motility disorders (aperistalsis, distal esophageal spasm, and hypercontractile esophagus) are patterns not encountered in controls in the context of normal EGJ relaxation. Finally with the latest version of the Chicago Classification, only two minor motor disorders are considered: ineffective esophageal motility and fragmented peristalsis. Copyright © 2014 Elsevier Inc. All rights reserved.
Guévremont, Evelyne; Lamoureux, Lisyanne; Généreux, Mylène; Côté, Caroline
2017-07-01
Irrigation water has been identified as a possible source of vegetable contamination by foodborne pathogens. Risk management for pathogens such as Campylobacter spp. and Listeria monocytogenes in fields can be influenced by the source of the irrigation water and the time interval between last irrigation and harvest. Plots of romaine lettuce were irrigated with manure-contaminated water or aerated pond water 21, 7, or 3 days prior to harvesting, and water and muck soil samples were collected at each irrigation treatment. Lettuce samples were collected at the end of the trials. The samples were tested for the presence of Campylobacter spp. and L. monocytogenes. Campylobacter coli was isolated from 33% of hog manure samples (n = 9) and from 11% of the contaminated water samples (n = 27), but no lettuce samples were positive (n = 288). L. monocytogenes was not found in manure, and only one sample of manure-contaminated irrigation water (n = 27) and one lettuce sample (n = 288) were positive. No Campylobacter or L. monocytogenes was recovered from the soil samples (n = 288). Because of the low incidence of pathogens, it was not possible to link the contamination of either soil or lettuce with the type of irrigation water. Nevertheless, experimental field trials mimicking real conditions provide new insights into the survival of two significant foodborne pathogens on romaine lettuce.
Chen, Jianshun; Fang, Chun; Zheng, Tianlun; Zhu, Ningyu; Bei, Yijiang; Fang, Weihuan
2012-02-01
The ability to survive and proliferate in acidic environments is a prerequisite for the infection of Listeria monocytogenes. The glutamate decarboxylase (GAD) system is responsible for acid resistance, and three GAD homologs have been identified in L. monocytogenes: gadD1, gadD2, and gadD3. To examine whether GAD genes are specific to lineage, serovar, or certain subpopulation, we performed a systematic investigation on the prevalence of GAD genes in 164 L. monocytogenes. In contrast to gadD2 and gadD3 conserved in all L. monocytogenes strains, gadD1 was identified in 36.6% (60/164) of L. monocytogenes strains, including all serovar 1/2c and 68.5% (37/54) of serovar 1/2a strains, as well as a small fraction of serovar 1/2b (3.4%, 1/29) and lineage III (13.8%, 4/29) strains. All serovar 4b and lineage IV strains lacked this gene. According to the ascB-dapE structure, L. monocytogenes strains were classified into four subpopulations, carrying inlC2DE, inlGC2DE, inlGHE, or no internalin cluster, respectively. All L. monocytogenes strains with inlGC2DE or inlGHE pattern harbored gadD1, whereas those bearing inlC2DE or no internalin cluster between ascB and dapE lacked gadD1. In addition, other five non-monocytogenes Listeria species lacking ascB-dapE internalin cluster were gadD1-negative. Overall, the presence of gadD1 is not fully dependent on lineages or serovars but correlates with ascB-dapE internalin profiles, suggesting gadD1 might have co-evolved with the ascB-dapE internalin cluster in the primitive L. monocytogenes before divergence of serovars.
Pricope-Ciolacu, Luminita; Nicolau, Anca Ioana; Wagner, Martin; Rychli, Kathrin
2013-08-16
Nearly all cases of human listeriosis have been associated with consumption of contaminated food, therefore the investigation of the virulence of Listeria (L.) monocytogenes after exposure to environmental conditions in food matrices is critical in order to understand and control its impact on public health. As milk and dairy products have been implicated in more than half of the listeriosis outbreaks, we investigated the in vitro virulence of L. monocytogenes incubated in different milk types at various storage conditions. Incubation in pasteurized milk at refrigeration conditions (4°C) revealed a higher invasion and intracellular proliferation of four different L. monocytogenes strains compared to raw milk using human intestinal epithelial Caco-2 cells. Furthermore the period of storage, which increased L. monocytogenes cell numbers, decreased in vitro virulence. However, L. monocytogenes stored for 3weeks at 4°C in milk are still able to invade and proliferate into the host cell. Interestingly abused storage temperatures (25°C and 30°C) for a short time period (2h) revealed an attenuated impact on the in vitro virulence of L. monocytogenes compared to the storage temperature of 4°C. Regarding the major milk compounds, the level of milk fat significantly affected the in vitro virulence of L. monocytogenes. Pre-incubation in milk with high fat content (3.6%) resulted in a lower invasion capability compared to milk with low fat content. In contrast casein and lactose did not influence the invasiveness of L. monocytogenes into the host cell. In conclusion our study shows that the milk environment and different storage conditions influence the in vitro virulence of L. monocytogenes, both of which have to be considered in the risk assessment of contaminated food. Copyright © 2013 Elsevier B.V. All rights reserved.
Effect of Listeria monocytogenes inoculation, sodium acetate and ...
African Journals Online (AJOL)
Jane
2011-08-08
Aug 8, 2011 ... monocytogenes has been isolated from surface fresh waters and ... been reported that contamination of aquatic products with ..... In fish sausage treated with nisin, the peroxide value was lower in comparison with that of control (Raju et al., 2003). TBA assay is usually used as indicator for the assessment of.
Pombinho, Rita; Camejo, Ana; Vieira, Ana; Reis, Olga; Carvalho, Filipe; Almeida, Maria Teresa; Pinheiro, Jorge Campos; Sousa, Sandra; Cabanes, Didier
2017-05-01
Listeria monocytogenes is a major intracellular human foodborne bacterial pathogen. We previously revealed L. monocytogenes cadC as highly expressed during mouse infection. Here we show that L. monocytogenes CadC is a sequence-specific, DNA-binding and cadmium-dependent regulator of CadA, an efflux pump conferring cadmium resistance. CadC but not CadA is required for L. monocytogenes infection in vivo. Interestingly, CadC also directly represses lspB, a gene encoding a lipoprotein signal peptidase whose expression appears detrimental for infection. lspB overexpression promotes the release of the LpeA lipoprotein to the extracellular medium, inducing tumor necrosis factor α and interleukin 6 expression, thus impairing L. monocytogenes survival in macrophages. We propose that L. monocytogenes uses CadC to repress lspB expression during infection to avoid LpeA exposure to the host immune system, diminishing inflammatory cytokine expression and promoting intramacrophagic survival and virulence. CadC appears as the first metal efflux pump regulator repurposed during infection to fine-tune lipoprotein processing and host responses. © The Author 2017. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail: journals.permissions@oup.com.
Evaluation of Esophageal Motility Utilizing the Functional Lumen Imaging Probe.
Carlson, Dustin A; Kahrilas, Peter J; Lin, Zhiyue; Hirano, Ikuo; Gonsalves, Nirmala; Listernick, Zoe; Ritter, Katherine; Tye, Michael; Ponds, Fraukje A; Wong, Ian; Pandolfino, John E
2016-12-01
Esophagogastric junction (EGJ) distensibility and distension-mediated peristalsis can be assessed with the functional lumen imaging probe (FLIP) during a sedated upper endoscopy. We aimed to describe esophageal motility assessment using FLIP topography in patients presenting with dysphagia. In all, 145 patients (aged 18-85 years, 54% female) with dysphagia that completed upper endoscopy with a 16-cm FLIP assembly and high-resolution manometry (HRM) were included. HRM was analyzed according to the Chicago Classification of esophageal motility disorders; major esophageal motility disorders were considered "abnormal". FLIP studies were analyzed using a customized program to calculate the EGJ-distensibility index (DI) and generate FLIP topography plots to identify esophageal contractility patterns. FLIP topography was considered "abnormal" if EGJ-DI was esophageal motility and 29 normal motility. In all, 17 (50%) had abnormal FLIP topography including 13 (37%) with abnormal EGJ-DI. FLIP topography provides a well-tolerated method for esophageal motility assessment (especially to identify achalasia) at the time of upper endoscopy. FLIP topography findings that are discordant with HRM may indicate otherwise undetected abnormalities of esophageal function, thus FLIP provides an alternative and complementary method to HRM for evaluation of non-obstructive dysphagia.
DEFF Research Database (Denmark)
Oxaran, Virginie; In Lee, Sarah Hwa; Chaul, Luiza Toubas
2017-01-01
the incidence of L. monocytogenes in five dairies and retail products in the Southeast and Midwest regions of Brazil over eight months. Of 437 samples, three samples (0.7%) from retail and only one sample (0.2%) from the dairies were positive for L. monocytogenes. Thus, the contamination rate was significantly...... reduced as compared to previous studies. MultiLocus Sequence Typing (MLST) was used to determine if contamination was caused by new or persistent clones leading to the first MLST profile of L. monocytogenes from the Brazilian dairy industry. The processing environment isolate is of concern being...... a sequence-type (ST) 2, belonging to the lineage I responsible for the majority of listeriosis outbreaks. Also, ST3 and ST8 found in commercialized cheese have previously been reported in outbreaks. Despite the lower incidence, dairy products still pose a potential health risk and the occurrence of L...
Infectious Dose of Listeria monocytogenes in Outbreak Linked to Ice Cream, United States, 2015.
Pouillot, Régis; Klontz, Karl C; Chen, Yi; Burall, Laurel S; Macarisin, Dumitru; Doyle, Matthew; Bally, Kären M; Strain, Errol; Datta, Atin R; Hammack, Thomas S; Van Doren, Jane M
2016-12-01
The relationship between the number of ingested Listeria monocytogenes cells in food and the likelihood of developing listeriosis is not well understood. Data from an outbreak of listeriosis linked to milkshakes made from ice cream produced in 1 factory showed that contaminated products were distributed widely to the public without any reported cases, except for 4 cases of severe illness in persons who were highly susceptible. The ingestion of high doses of L. monocytogenes by these patients infected through milkshakes was unlikely if possible additional contamination associated with the preparation of the milkshake is ruled out. This outbreak illustrated that the vast majority of the population did not become ill after ingesting a low level of L. monocytogenes but raises the question of listeriosis cases in highly susceptible persons after distribution of low-level contaminated products that did not support the growth of this pathogen.
Directory of Open Access Journals (Sweden)
Maysa A. I. Awadallah
2014-10-01
Full Text Available Aim: This study aimed to investigate the occurrence of some virulence genes distributed in Listeria monocytogenes isolated from ready-to-eat (RTE meat products and consumers in Cairo province, Egypt. Materials and Methods: A total of 120 beef luncheon, chicken luncheon and frankfurter beef (40 samples, each were collected from 10 different local shops situated in Al-salam city, Cairo province, Egypt. Stool samples were collected from 40 people who had the habit of consuming RTE meat. The suspected L. monocytogenes isolates were subjected to a multiplex polymerase chain reaction (PCR for rapid speciation and virulence determination using primers specific for inIA, inIC, and inIJ genes. Results: Culture examination of all samples on Oxford media revealed presence of colonies characteristic to L. monocytogenes in 6 beef luncheon (15%, 4 chicken luncheon (10%, 1 frankfurter beef (2.5% and 1 human stool (2.5% samples. Species identity of L. monocytogenes was verified through the amplification of a 800 bp fragment with inIA primers in 2 out of 6 culture isolates from beef luncheon (5%, and 1 out 4 culture isolates from chicken luncheon (2.5% samples. Statistical analysis revealed no significant difference between the occurrence of L. monocytogenes in different food samples examined (p>0.05. The virulence of these strains was ascertained by the presence of 517 bp and 238 bp fragments of inIC and inIJ genes, respectively in the isolates that contained the 800 bp fragment. The culture isolates obtained from one frankfurter beef sample, and one human stool sample were found negative by multiplex PCR for the presence of L. monocytogenes and its virulence specific genes. Conclusion: It could be concluded that L. monocytogenes are circulating in beef and chicken luncheon sold in Cairo, Egypt. Multiplex PCR is reliable for confirmation of L. monocytogenes. This study suggests the implementation of hygienic measures at all levels from production to consumption
Sperm motility in fishes. (II) Effects of ions and osmolality: a review.
Alavi, Sayyed Mohammad Hadi; Cosson, Jacky
2006-01-01
The spermatozoa of most fish species are immotile in the testis and seminal plasma. Therefore, motility is induced after the spermatozoa are released into the aqueous environment during natural reproduction or into the diluent during artificial reproduction. There are clear relationships between seminal plasma composition and osmolality and the duration of fish sperm motility. Various parameters such as ion concentrations (K+, Na+, and Ca2+), osmotic pressure, pH, temperature and dilution rate affect motility. In the present paper, we review the roles of these ions on sperm motility in Salmonidae, Cyprinidae, Acipenseridae and marine fishes, and their relationship with seminal plasma composition. Results in the literature show that: 1. K+ is a key ion controlling sperm motility in Salmonidae and Acipenseridae in combination with osmotic pressure; this control is more simple in other fish species: sperm motility is prevented when the osmotic pressure is high (Cyprinidae) or low (marine fishes) compared to that of the seminal fluid. 2. Cations (mostly divalent, such as Ca2+) are antagonistic with the inhibitory effect of K+ on sperm motility. 3. In many species, Ca2+ influx and K+ or Na+ efflux through specific ionic channels change the membrane potential and eventually lead to an increase in cAMP concentration in the cell, which constitutes the initiation signal for sperm motility in Salmonidae. 4. Media that are hyper- and hypo-osmotic relative to seminal fluid trigger sperm motility in marine and freshwater fishes, respectively. 5. The motility of fish spermatozoa is controlled through their sensitivity to osmolality and ion concentrations. This phenomenon is related to ionic channel activities in the membrane and governs the motility mechanisms of axonemes.
Microscopic Analysis of Bacterial Motility at High Pressure
Nishiyama, Masayoshi; Sowa, Yoshiyuki
2012-01-01
The bacterial flagellar motor is a molecular machine that converts an ion flux to the rotation of a helical flagellar filament. Counterclockwise rotation of the filaments allows them to join in a bundle and propel the cell forward. Loss of motility can be caused by environmental factors such as temperature, pH, and solvation. Hydrostatic pressure is also a physical inhibitor of bacterial motility, but the detailed mechanism of this inhibition is still unknown. Here, we developed a high-pressure microscope that enables us to acquire high-resolution microscopic images, regardless of applied pressures. We also characterized the pressure dependence of the motility of swimming Escherichia coli cells and the rotation of single flagellar motors. The fraction and speed of swimming cells decreased with increased pressure. At 80 MPa, all cells stopped swimming and simply diffused in solution. After the release of pressure, most cells immediately recovered their initial motility. Direct observation of the motility of single flagellar motors revealed that at 80 MPa, the motors generate torque that should be sufficient to join rotating filaments in a bundle. The discrepancy in the behavior of free swimming cells and individual motors could be due to the applied pressure inhibiting the formation of rotating filament bundles that can propel the cell body in an aqueous environment. PMID:22768943
DEFF Research Database (Denmark)
Walmod, P S; Foley, A; Berezin, A
1998-01-01
-term recordings and measurements of mean-cell speed, the reduction in the motile behaviour was shown to correlate with the teratogenic potency of the tested compounds. The observed effects of VPA on cell motility was independent of the employed L-cell clone, and could be reproduced in cells containing...... the neuronal marker NCAM and in the neuronal cell line N2a. Furthermore, the observed effect was independent of culture substratum, being observed for L-cells grown on fibronectin as well as on plastic. Immunofluorescence microscopy revealed that VPA-treatment of mouse L-cells caused a redistribution of F...
DEFF Research Database (Denmark)
Vogel, Birte Fonnesbech; Huss, Hans Henrik; Ojeniyi, B.
2001-01-01
and environment could not be excluded. Contamination of the product occurred in specific areas (the brining and slicing areas). In plant I, the same RAPD type (RAPD type 12) was found over a 4-year period, indicating that an established in-house flora persisted and was not eliminated by routine hygienic......, monocytogenes). A total of 429 strains of L. monocytogenes were subsequently compared by random amplified polymorphic DNA (RAPD) profiling, and 55 different RAPD types were found. The RAPD types detected on the products were identical to types found on the processing equipment and in the processing environment...... procedures. In plant II, where the prevalence of L, monocytogenes was much tower, no RAPD type persisted over long periods of time, and several different L, monocytogenes RAPD types were isolated. This indicates that persistent strains may be avoided by rigorous cleaning and sanitation; however, due...
Grant, I R; Patterson, M F
1995-10-01
The effect of heating alone (60, 65 or 70 degrees C), heating after irradiation (0.8 kGy) and heating after irradiation and storage for 14 days at 2-3 degrees C on the destruction of Listeria monocytogenes and Salmonella typhimurium in artifically inoculated minced cook-chill roast beef and gravy was investigated. Inoculated minced roast beef samples (5 g) were heated in Stomacher bags completely immersed in a water bath at each of the test temperatures. Survivors were enumerated and D and z values were determined for each of the pathogens. Observed thermal D values for two strains of L. monocytogenes at 60, 65 and 70 degrees C in the absence of pre-irradiation were 90.0-97.5 s, 34.0-53.0 s and 22.4-28.0 s, respectively, whereas thermal D values after pre-irradiation were 44.0-46.4 s, 15.3-16.8 s and 5.5-7.8 s at 60, 65 and 70 degrees C, respectively. This reduction in D values provides evidence for radiation-induced heat-sensitisation in L. monocytogenes. There was some evidence of heat-sensitisation of S. typhimurium at 60 degrees C, but not at either 65 or 70 degrees C. The z value also decreased as a consequence of pre-irradiation to a dose of 0.8 kGy (11.0-12.7 degrees C). The radiation-induced heat-sensitivity in L. monocytogenes was found to persist for up to 2 weeks storage at 2-3 degrees C prior to heating. As cook-chill products are intended to be reheated prior to consumption the results of the present study suggest that any L. monocytogenes present in a cook-chill product would be more easily killed during reheating if it were to be treated with a low dose of gamma radiation during manufacture.
Hoelzer, Karin; Sauders, Brian D; Sanchez, Maria D; Olsen, Peter T; Pickett, Michele M; Mangione, Kurt J; Rice, Daniel H; Corby, Joe; Stich, Stephen; Fortes, Esther D; Roof, Sherry E; Grohn, Yrjo T; Wiedmann, Martin; Oliver, Haley F
2011-07-01
Despite growing concerns about cross-contamination of ready-to-eat foods with Listeria monocytogenes, our knowledge about the ecology and transmission of L. monocytogenes in retail establishments has remained limited. We conducted a cross-sectional study to characterize the prevalence, distribution, and subtype diversity of L. monocytogenes in 120 New York State retail deli establishments that were hypothesized to present an increased risk for environmental L. monocytogenes contamination (i.e., small establishments and establishments with a history of failed New York State Agriculture and Markets inspections). Analysis of these data along with previously reported data for 121 predominantly larger retail establishments in New York State identified establishment size, geographic location, and inspection history as significant predictors of L. monocytogenes presence and prevalence. The odds of an establishment being L. monocytogenes positive were approximately twice as high for large establishments, establishments located in New York City, or establishments with poor inspection history (as compared with establishments without these attributes), even though correlation between location and inspection history complicated interpretation of results. Within an establishment, L. monocytogenes was significantly more prevalent on nonfood contact surfaces than on food contact surfaces; prevalence was particularly high for floors and in floor drains, sinks, the dairy case, and milk crates. L. monocytogenes subtype diversity differed between sites, with lineage I isolates significantly associated with nonfood contact surfaces and lineage II isolates significantly associated with food contact surfaces. Isolates belonging to the same ribotype were often found dispersed across multiple sites within an operation. Copyright ©, International Association for Food Protection
Distribution of the bacteria Listeria monocytogenes in the western part of the Sea of Okhotsk
Terekhova, V. E.; Sosnin, V. A.; Buzoleva, L. S.; Shakirov, R. B.
2010-04-01
The Amur River’s influence on the distribution of the opportunistic bacteria Listeria monocytogenes in the western part of the Sea of Okhotsk is discussed. The presence of Listeria in the seawater, sea ice, and sediments on the northeastern Sakhalin shelf and slope supports the idea of its connection with the Amur River discharge. The hypothesis of the allochtonic parentage of L. monocytogenes in the sea’s development is proved.
International Nuclear Information System (INIS)
Menys, Alex; Atkinson, David; Ahmed, Asia; Punwani, Shonit; Halligan, Steve; Odille, Freddy; Novelli, Marco; Rodriguez-Justo, Manuel; Proctor, Ian; Taylor, Stuart A.
2012-01-01
To compare quantified terminal ileal (TI) motility during MR enterography (MRE) with histopathological severity of acute inflammation in Crohn's disease. A total of 28 Crohn's patients underwent MRE and endoscopic TI biopsy. Axial and coronal TrueFISP, HASTE and post-gadolinium VIBE images were supplemented by multiple coronal TrueFISP cine motility sequences through the small bowel volume. TI motility index (MI) was quantified using validated software; an acute inflammation score (eAIS; 0-6) was assigned to the biopsy. Two observers qualitatively scored mural thickness, T2 signal, contrast enhancement and perimural oedema (0-3) to produce an activity score (aMRIs) based on anatomical MRI. The association among the MI, eAIS and aMRIs was tested using Spearman's rank correlation. Wilcoxon rank sum test compared motility in subjects with and without histopathological inflammation. Mean MI and mean eAIS were 0.27 (range 0.06-0.55) and 1.5 (range 0-5), respectively. There was a significant difference in MI between non-inflamed (mean 0.37, range 0.13-0.55) and inflamed (mean 0.19, range 0.06-0.44) TI, P = 0.002, and a significant negative correlation between MI and both eAIS (Rho = -0.52, P = 0.005) and aMRIs (R = -0.7, P < 0.001). Quantified TI motility negatively correlates with histopathological measures of disease activity and existing anatomical MRI activity biomarkers. (orig.)
Directory of Open Access Journals (Sweden)
Paul Priyesh Vijayakumar
2017-03-01
Full Text Available Bacteriocin-producing (Bac+ lactic acid bacteria (LAB comprising selected strains of Lactobacillus curvatus, Lactococcus lactis, Pediococcus acidilactici, and Enterococcus faecium and thailandicus were examined for inhibition of Listeria monocytogenes during hotdog challenge studies. The Bac+ strains, or their cell-free supernatants (CFS, were grouped according to mode-of-action (MOA as determined from prior studies. Making a mixture of as many MOAs as possible is a practical way to obtain a potent natural antimicrobial mixture to address L. monocytogenes contamination of RTE meat products (i.e., hotdogs. The heat resistance of the bacteriocins allowed the use of pasteurization to eliminate residual producer cells for use as post-process surface application or their inclusion into hotdog meat emulsion during cooking. The use of Bac+ LAB comprising 3× MOAs directly as co-inoculants on hotdogs was not effective at inhibiting L. monocytogenes. However, the use of multiple MOA Bac+ CFS mixtures in a variety of trials demonstrated the effectiveness of this approach by showing a >2-log decrease of L. monocytogenes in treatment samples and 6–7 log difference vs. controls. These data suggest that surface application of multiple mode-of-action bacteriocin mixtures can provide for an Alternative 2, and possibly Alternative 1, process category as specified by USDA-FSIS for control of L. monocytogenes on RTE meat products.
Bajor, Anna; Luhr, Anke; Brockmann, Dorothee; Suerbaum, Sebastian; Framme, Carsten; Sedlacek, Ludwig
2016-07-16
The majority of cases of endophthalmitis are caused by exogenous pathogens; only 5-10 % are of endogenous origin. One cause of these rare cases of endogenous endophthalmitis is Listeria monocytogenes. Twenty-six cases of endophthalmitis due to this pathogen have been published over the last twenty years. The aim of this review is to summarize the main risk factors and common clinical findings of endogenous endophthalmitis due to Listeria monocytogenes. We report on a 62-year-old female presenting with a sterile hypopyon iritis with secondary glaucoma and an underlying rheumatoid disease. In microbiological analysis we identified Listeria monocytogenes. Further we searched through all published cases for typical signs, risk factors, details of medical and surgical treatment and outcome of endogenous endophthalmitis due to this rare pathogen. Ocular symptoms in almost all of these published cases included pain, redness of the eye, and decreased vision. Main clinical features included elevated intraocular pressure and fibrinous anterior chamber reaction, as well as a dark hypopyon. While the infection is typically spread endogenously, neither an exogenous nor endogenous source of infection could be identified in most cases. Immunocompromised patients are at higher risk of being infected than immunocompetent patients. The clinical course of endophthalmitis caused by Listeria monocytogenes had different visual outcomes. In some cases, the infection led to enucleation, blindness, or strong visual loss, whereas most patients showed a tendency of visual improvement during therapy. Early diagnosis and treatment initiation are crucial factors in the outcome of endogenous endophthalmitis caused by Listeria monocytogenes. This possible differential diagnosis should be kept in mind while treating patients with presumable sterile hypopyon and anterior uveitis having a high intraocular pressure. A bacterial source should be considered with a prompt initiation of systemic