The effect of ozone and open air factor on surface-attached and biofilm environmental Listeria monocytogenes.

Science.gov (United States)

Nicholas, R; Dunton, P; Tatham, A; Fielding, L

2013-08-01

The effects of gaseous ozone and open air factor (OAF) on environmental Listeria monocytogenes attached to three common food contact surfaces were investigated. Listeria monocytogenes on different food contact surfaces was treated with ozone and OAF. Microbiological counts, scanning electron microscopy (SEM) and atomic force microscopy (AFM) were performed. Ozone at 10 ppm gave <1-log reduction when L. monocytogenes was attached to stainless steel, while 45 ppm gave a log reduction of 3.41. OAF gave better log reductions than 10 ppm ozone, but lower log reductions than 45 ppm. Significant differences were found between surfaces. Biofilm organisms were significantly more resistant than those surface attached on stainless steel. SEM and AFM demonstrated different membrane and cell surface modifications following ozone or OAF treatment. The strain used demonstrated higher resistance to ozone than previous studies. This may be due to the fact that it was isolated from a food manufacturing premises that used oxidizing disinfectants. OAF was more effective at reducing the levels of the organism than an ozone concentration of 10 ppm. Pathogen management strategies must account for resistance of environmental strains when validating cleaning and disinfection. OAF has shown potential for surface decontamination compared with ozone. SEM and AFM are valuable tools for determining mechanisms of action of antimicrobial agents. © 2013 The Society for Applied Microbiology.

Romer Labs RapidChek®Listeria monocytogenes Test System for the Detection of L. monocytogenes on Selected Foods and Environmental Surfaces.

Science.gov (United States)

Juck, Gregory; Gonzalez, Verapaz; Allen, Ann-Christine Olsson; Sutzko, Meredith; Seward, Kody; Muldoon, Mark T

2018-04-27

The Romer Labs RapidChek ® Listeria monocytogenes test system (Performance Tested Method ℠ 011805) was validated against the U.S. Department of Agriculture-Food Safety and Inspection Service Microbiology Laboratory Guidebook (USDA-FSIS/MLG), U.S. Food and Drug Association Bacteriological Analytical Manual (FDA/BAM), and AOAC Official Methods of Analysis ℠ (AOAC/OMA) cultural reference methods for the detection of L. monocytogenes on selected foods including hot dogs, frozen cooked breaded chicken, frozen cooked shrimp, cured ham, and ice cream, and environmental surfaces including stainless steel and plastic in an unpaired study design. The RapidChek method uses a proprietary enrichment media system, a 44-48 h enrichment at 30 ± 1°C, and detects L. monocytogenes on an immunochromatographic lateral flow device within 10 min. Different L. monocytogenes strains were used to spike each of the matrixes. Samples were confirmed based on the reference method confirmations and an alternate confirmation method. A total of 140 low-level spiked samples were tested by the RapidChek method after enrichment for 44-48 h in parallel with the cultural reference method. There were 88 RapidChek presumptive positives. One of the presumptive positives was not confirmed culturally. Additionally, one of the culturally confirmed samples did not exhibit a presumptive positive. No difference between the alternate confirmation method and reference confirmation method was observed. The respective cultural reference methods (USDA-FSIS/MLG, FDA/BAM, and AOAC/OMA) produced a total of 63 confirmed positive results. Nonspiked samples from all foods were reported as negative for L. monocytogenes by all methods. Probability of detection analysis demonstrated no significant differences in the number of positive samples detected by the RapidChek method and the respective cultural reference method.

Relationship between Listeria monocytogenes and Listeria spp. in seafood processing plants.

Science.gov (United States)

Alali, Walid Q; Schaffner, Donald W

2013-07-01

The objective of this study was to evaluate the relationship between prevalence of Listeria monocytogenes as an outcome and Listeria spp. as an explanatory variable by food products, food contact surfaces, and nonfood contact surfaces in seafood processing plants by using peer-reviewed published data. Nine sets of prevalence data of L. monocytogenes and Listeria spp. were collected from published studies and used for the analyses. Based on our analysis, the relationship between L. monocytogenes prevalence and Listeria spp. prevalence in food products (incoming raw materials and finish products) was significant (P = 0.04) with (low) R² = 0.36. Furthermore, Listeria spp. were not a good indicator for L. monocytogenes when testing food contact surfaces (R² = 0.10). Listeria spp. were a good indicator for L. monocytogenes only on nonfood contact surfaces (R² = 0.90). On the other hand, the presence of Listeria spp. on food contact surfaces (R² = 0.002) and nonfood contact surfaces (R² = 0.03) was not a good indicator for L. monocytogenes presence in food products. In general, prevalence of Listeria spp. does not seem to be a good indicator for L. monocytogenes prevalence in seafood processing plants.

Biofilm formation by Listeria monocytogenes on stainless steel surface and biotransfer potential

OpenAIRE

Oliveira,Maíra Maciel Mattos de; Brugnera,Danilo Florisvaldo; Alves,Eduardo; Piccoli,Roberta Hilsdorf

2010-01-01

An experimental model was proposed to study biofilm formation by Listeria monocytogenes ATCC 19117 on AISI 304 (#4) stainless steel surface and biotransfer potential during this process. In this model, biofilm formation was conducted on the surface of stainless steel coupons, set on a stainless steel base with 4 divisions, each one supporting 21 coupons. Trypic Soy Broth was used as bacterial growth substrate, with incubation at 37 ?C and stirring of 50 rpm. The number of adhered cells was de...

Listeria monocytogenes - Danger for health safety vegetable production.

Science.gov (United States)

Kljujev, Igor; Raicevic, Vera; Jovicic-Petrovic, Jelena; Vujovic, Bojana; Mirkovic, Milica; Rothballer, Michael

2018-04-22

The microbiologically contaminated vegetables represent a risk for consumers, especially vegetables without thermal processing. It is known that human pathogen bacteria, such as Listeria monocytogenes, could exist on fresh vegetables. The fresh vegetables could become Listeria-contaminated if they come in touch with contaminated soil, manure, irrigation water. The aim of this work was to investigate the presence of Listeria spp. and L. monocytogenes in different kind of vegetables grown in field and greenhouse condition as well as surface and endophytic colonization plant roots of different vegetables species by L. monocytogenes in laboratory conditions. The detection of Listeria spp. and L. monocytogenes in vegetable samples was done using ISO and PCR methods. The investigation of colonization vegetable roots and detection Listeria-cells inside plant root tissue was done using Fluorescence in situ hybridization (FISH) method in combination with confocal laser scanning microscopy (CLSM). The results showed that 25.58% vegetable samples were positive for Listeria spp. and only one sample (carrot) was positive for L. monocytogenes out of 43 samples in total collected from field and greenhouse. The strain L. monocytogenes EGD-E surface and endophytic colonized carrot root in highest degree while strain L. monocytogenes SV4B was the most represented at leafy vegetable plants, such at lettuce (1.68 × 10 6  cells/mm 3 absolutely dry root) and spinach (1.39 × 10 6  cells/mm 3 absolutely dry root) root surface. The cells of L. monocytogenes SV4B were visible as single cells in interior tissue of plant roots (celery and sweet corn roots) as well as in the interior of the plant root cell at sweet corn root. The cells of L. monocytogenes EGD-E bind to the surface of the plant root and they were less commonly found out on root hair. In the inner layers of the root, those bacterial cells were inhabited intercellular spaces mainly as single cells very close to the

Modelling the growth of Listeria monocytogenes on the surface of smear- or mould-ripened cheese

Directory of Open Access Journals (Sweden)

Sol eSchvartzman

2014-07-01

Full Text Available Surface-ripened cheeses are matured by means of manual or mechanical technologies posing a risk of cross-contamination, if any cheeses are contaminated with Listeria monocytogenes. In predictive microbiology, primary models are used to describe microbial responses, such as growth rate over time and secondary models explain how those responses change with environmental factors. In this way, primary models were used to assess the growth rate of L. monocytogenes during ripening of the cheeses and the secondary models to test how much the growth rate was affected by either the pH and/or the water activity (aw of the cheeses. The two models combined can be used to predict outcomes. The purpose of these experiments was to test three primary (the modified Gompertz equation, the Baranyi and Roberts model and the Logistic model and three secondary (the Cardinal model, the Ratowski model and the Presser model mathematical models in order to define which combination of models would best predict the growth of L. monocytogenes on the surface of artificially contaminated surface-ripened cheeses. Growth on the surface of the cheese was assessed and modelled. The primary models were firstly fitted to the data and the effects of pH and aw on the growth rate (μmax were incorporated and assessed one by one with the secondary models. The Logistic primary model by itself did not show a better fit of the data among the other primary models tested, but the inclusion of the Cardinal secondary model improved the final fit. The aw was not related to the growth of Listeria. This study suggests that surface-ripened cheese should be separately regulated within EU microbiological food legislation and results expressed as counts per surface area rather than per gram.

Modeling the growth of Listeria monocytogenes on the surface of smear- or mold-ripened cheese.

Science.gov (United States)

Schvartzman, M Sol; Gonzalez-Barron, Ursula; Butler, Francis; Jordan, Kieran

2014-01-01

Surface-ripened cheeses are matured by means of manual or mechanical technologies posing a risk of cross-contamination, if any cheeses are contaminated with Listeria monocytogenes. In predictive microbiology, primary models are used to describe microbial responses, such as growth rate over time and secondary models explain how those responses change with environmental factors. In this way, primary models were used to assess the growth rate of L. monocytogenes during ripening of the cheeses and the secondary models to test how much the growth rate was affected by either the pH and/or the water activity (aw) of the cheeses. The two models combined can be used to predict outcomes. The purpose of these experiments was to test three primary (the modified Gompertz equation, the Baranyi and Roberts model, and the Logistic model) and three secondary (the Cardinal model, the Ratowski model, and the Presser model) mathematical models in order to define which combination of models would best predict the growth of L. monocytogenes on the surface of artificially contaminated surface-ripened cheeses. Growth on the surface of the cheese was assessed and modeled. The primary models were firstly fitted to the data and the effects of pH and aw on the growth rate (μmax) were incorporated and assessed one by one with the secondary models. The Logistic primary model by itself did not show a better fit of the data among the other primary models tested, but the inclusion of the Cardinal secondary model improved the final fit. The aw was not related to the growth of Listeria. This study suggests that surface-ripened cheese should be separately regulated within EU microbiological food legislation and results expressed as counts per surface area rather than per gram.

Diamond like carbon Ag nanocomposites as a control measure against Campylobacter jejuni and Listeria monocytogenes on food preparation surfaces

DEFF Research Database (Denmark)

Tamulevičius, Sigitas; Zakarienė, Gintarė; Novoslavskij, Aleksandr

2018-01-01

on selective agars and quantitative real-time PCR (qPCR) including staining with propidium monoazide (PMA). It was determined, that DLC:Ag film was the most efficient coating in the reduction of C. jejuni and L. monocytogenes numbers. Culture-based enumeration revealed that C. jejuni numbers were reduced......:Ag antimicrobial surface showed a reduced ability to grow on culture media, but maintained viability during the whole experiment. Nonetheless, DLC:Ag antimicrobial surface could be further considered for the reduction of cross-contamination risk from food preparation surfaces due to their contamination with C....... jejuni and L. monocytogenes in domestic and commercial kitchens or food establishments....

Cleaning and Disinfection of Biofilms Composed of Listeria monocytogenes and Background Microbiota from Meat Processing Surfaces

Science.gov (United States)

Møretrø, Trond; Heir, Even; Briandet, Romain; Langsrud, Solveig

2017-01-01

ABSTRACT Surfaces of food processing premises are exposed to regular cleaning and disinfection (C&D) regimes, using biocides that are highly effective against bacteria growing as planktonic cells. However, bacteria growing in surface-associated communities (biofilms) are typically more tolerant toward C&D than their individual free-cell counterparts, and survival of pathogens such as Listeria monocytogenes may be affected by interspecies interactions within biofilms. In this study, Pseudomonas and Acinetobacter were the most frequently isolated genera surviving on conveyor belts subjected to C&D in meat processing plants. In the laboratory, Pseudomonas, Acinetobacter, and L. monocytogenes dominated the community, both in suspensions and in biofilms formed on conveyor belts, when cultures were inoculated with eleven-genus cocktails of representative bacterial strains from the identified background flora. When biofilms were exposed to daily C&D cycles mimicking treatments used in food industry, the levels of Acinetobacter and Pseudomonas mandelii diminished, and biofilms were instead dominated by Pseudomonas putida (65 to 76%), Pseudomonas fluorescens (11 to 15%) and L. monocytogenes (3 to 11%). The dominance of certain species after daily C&D correlated with high planktonic growth rates at 12°C and tolerance to C&D. In single-species biofilms, L. monocytogenes developed higher tolerance to C&D over time, for both the peracetic acid and quaternary ammonium disinfectants, indicating that a broad-spectrum mechanism was involved. Survival after C&D appeared to be a common property of L. monocytogenes strains, as persistent and sporadic subtypes showed equal survival rates in complex biofilms. Biofilms established preferentially in surface irregularities of conveyor belts, potentially constituting harborage sites for persistent contamination. IMPORTANCE In the food industry, efficient production hygiene is a key measure to avoid the accumulation of spoilage bacteria and

Cleaning and disinfection of biofilms composed of Listeria monocytogenes and background microbiota from meat processing surfaces.

Science.gov (United States)

Fagerlund, Annette; Møretrø, Trond; Heir, Even; Briandet, Romain; Langsrud, Solveig

2017-06-30

Surfaces of food processing premises are exposed to regular cleaning and disinfection (C&D) regimes, using biocides that are highly effective against bacteria growing as planktonic cells. However, bacteria growing in surface associated communities (biofilms) are typically more tolerant towards C&D than their individual free cells counterparts, and survival of pathogens such as Listeria monocytogenes may be affected by interspecies interactions within biofilms. In this study, Pseudomonas and Acinetobacter were the most frequently isolated genera surviving on conveyor belts subjected to C&D in meat processing plants. In the laboratory, Pseudomonas , Acinetobacter and L. monocytogenes dominated the community both in suspensions and in biofilms formed on conveyor belts, when cultures were inoculated with eleven-genera cocktails of representative bacterial strains from the identified background flora. When biofilms were exposed to daily C&D cycles, mimicking treatments used in food industry, the levels of Acinetobacter and Pseudomonas mandelii diminished, and biofilms were instead dominated by Pseudomonas putida (65-76%), Pseudomonas fluorescens (11-15%) and L. monocytogenes (3-11%). The dominance of certain species after daily C&D correlated with high planktonic growth rates at 12°C and tolerance to C&D. In single-species biofilms, L. monocytogenes developed higher tolerance to C&D over time, both for the peracetic acid and quaternary ammonium disinfectant, indicating that a broad-spectrum mechanism was involved. Survival after C&D appeared to be a common property of L. monocytogenes strains, as both persistent and sporadic subtypes showed equal survival in complex biofilms. Biofilms established preferentially in surface irregularities of conveyor belts, potentially constituting harborage sites for persistent contamination. IMPORTANCE In food industry, efficient production hygiene is a key measure to avoid accumulation of spoilage bacteria and eliminate pathogens

Inhibition of sortase A by chalcone prevents Listeria monocytogenes infection.

Science.gov (United States)

Li, Hongen; Chen, Yutao; Zhang, Bing; Niu, Xiaodi; Song, Meng; Luo, Zhaoqing; Lu, Gejin; Liu, Bowen; Zhao, Xiaoran; Wang, Jianfeng; Deng, Xuming

2016-04-15

The critical role of sortase A in gram-positive bacterial pathogenicity makes this protein a good potential target for antimicrobial therapy. In this study, we report for the first time the crystal structure of Listeria monocytogenes sortase A and identify the active sites that mediate its transpeptidase activity. We also used a sortase A (SrtA) enzyme activity inhibition assay, simulation, and isothermal titration calorimetry analysis to discover that chalcone, an agent with little anti-L. monocytogenes activity, could significantly inhibit sortase A activity with an IC50 of 28.41 ± 5.34 μM by occupying the active site of SrtA. The addition of chalcone to a co-culture of L. monocytogenes and Caco-2 cells significantly inhibited bacterial entry into the cells and L. monocytogenes-mediated cytotoxicity. Additionally, chalcone treatment decreased the mortality of infected mice, the bacterial burden in target organs, and the pathological damage to L. monocytogenes-infected mice. In conclusion, these findings suggest that chalcone is a promising candidate for the development of treatment against L. monocytogenes infection. Copyright © 2016 Elsevier Inc. All rights reserved.

Dual-species biofilm of Listeria monocytogenes and Escherichia coli on stainless steel surface.

Science.gov (United States)

de Grandi, Aline Zago; Pinto, Uelinton Manoel; Destro, Maria Teresa

2018-04-12

Listeria monocytogenes is a Gram-positive bacterium commonly associated with foodborne diseases. Due its ability to survive under adverse environmental conditions and to form biofilm, this bacterium is a major concern for the food industry, since it can compromise sanitation procedures and increase the risk of post-processing contamination. Little is known about the interaction between L. monocytogenes and Gram-negative bacteria on biofilm formation. Thus, in order to evaluate this interaction, Escherichia coli and L. monocytogenes were tested for their ability to form biofilms together or in monoculture. We also aimed to evaluate the ability of L. monocytogenes 1/2a and its isogenic mutant strain (ΔprfA ΔsigB) to form biofilm in the presence of E. coli. We assessed the importance of the virulence regulators, PrfA and σ B , in this process since they are involved in many aspects of L. monocytogenes pathogenicity. Biofilm formation was assessed using stainless steel AISI 304 #4 slides immersed into brain heart infusion broth, reconstituted powder milk and E. coli preconditioned medium at 25 °C. Our results indicated that a higher amount of biofilm was formed by the wild type strain of L. monocytogenes than by its isogenic mutant, indicating that prfA and sigB are important for biofilm development, especially maturation under our experimental conditions. The presence of E. coli or its metabolites in preconditioned medium did not influence biofilm formation by L. monocytogenes. Our results confirm the possibility of concomitant biofilm formation by L. monocytogenes and E. coli, two bacteria of major significance in the food industry.

Microbial background flora in small-scale cheese production facilities does not inhibit growth and surface attachment of Listeria monocytogenes.

Science.gov (United States)

Schirmer, B C T; Heir, E; Møretrø, T; Skaar, I; Langsrud, S

2013-10-01

The background microbiota of 5 Norwegian small-scale cheese production sites was examined and the effect of the isolated strains on the growth and survival of Listeria monocytogenes was investigated. Samples were taken from the air, food contact surfaces (storage surfaces, cheese molds, and brine) and noncontact surfaces (floor, drains, and doors) and all isolates were identified by sequencing and morphology (mold). A total of 1,314 isolates were identified and found to belong to 55 bacterial genera, 1 species of yeast, and 6 species of mold. Lactococcus spp. (all of which were Lactococcus lactis), Staphylococcus spp., Microbacterium spp., and Psychrobacter sp. were isolated from all 5 sites and Rhodococcus spp. and Chryseobacterium spp. from 4 sites. Thirty-two genera were only found in 1 out of 5 facilities each. Great variations were observed in the microbial background flora both between the 5 producers, and also within the various production sites. The greatest diversity of bacteria was found in drains and on rubber seals of doors. The flora on cheese storage shelves and in salt brines was less varied. A total of 62 bacterial isolates and 1 yeast isolate were tested for antilisterial activity in an overlay assay and a spot-on-lawn assay, but none showed significant inhibitory effects. Listeria monocytogenes was also co-cultured on ceramic tiles with bacteria dominating in the cheese production plants: Lactococcus lactis, Pseudomonas putida, Staphylococcus equorum, Rhodococcus spp., or Psychrobacter spp. None of the tested isolates altered the survival of L. monocytogenes on ceramic tiles. The conclusion of the study was that no common background flora exists in cheese production environments. None of the tested isolates inhibited the growth of L. monocytogenes. Hence, this study does not support the hypothesis that the natural background flora in cheese production environments inhibits the growth or survival of L. monocytogenes. Copyright © 2013 American

Listeria monocytogenes en alimentos: ¿son todos los aislamientos igual de virulentos?

Directory of Open Access Journals (Sweden)

V. López

Full Text Available Listeria monocytogenes es un patógeno humano que se transmite a través de los alimentos y que causa infecciones graves, con una alta tasa de mortalidad. A pesar de la ubicuidad del microorganismo, la tasa real de la enfermedad es bastante baja y se asocia casi siempre a condiciones predisponentes. Tradicionalmente se consideraba que los aislamientos presentes en los alimentos y en el ambiente tenían la misma capacidad patogénica que los aislamientos de origen clínico. Pero el análisis de mutaciones en los genes de determinados factores de virulencia (internalina, hemolisina, fosfolipasas, proteína de superficie ActA y proteína reguladora PrfA, los estudios cuantitativos realizados con cultivos celulares y la genética de poblaciones, están replanteando la discusión sobre la variabilidad de la virulencia de L. monocytogenes. A pesar de todos estos avances, no existe un único marcador que permita comprobar la virulencia de los aislamientos naturales de esta especie. Probablemente en el futuro, la combinación de diferentes marcadores moleculares permitirá detectar los alimentos contaminados sólo por los clones virulentos de L. monocytogenes, con lo que se mejorará la prevención de la listeriosis humana transmitida por alimentos.

Control of Listeria monocytogenes in turkey deli loaves using organic acids as formulation ingredients.

Science.gov (United States)

Lloyd, T; Alvarado, C Z; Brashears, M M; Thompson, L D; McKee, S R; Berrang, M

2009-10-01

The growth of Listeria monocytogenes in further-processed meat products has become a major concern and an important food safety issue. The meat and poultry industries have incorporated interventions such as organic acids in marinades to inhibit the growth of L. monocytogenes. In this study, organic acids were utilized in the raw product and as a postcook dip to determine their inhibitory effect on the growth of L. monocytogenes in turkey deli loaves. The turkey deli loaves were processed, cooked, cooled, inoculated with streptomycin-resistant L. monocytogenes, and then dipped. Treatments were potassium lactate (PL) in the raw product with sodium lactate (SL), sodium diacetate (SD) dip, PL with SL/PL/SD dip, SL with SL/SD dip, and SL with SL/PL/SD dip. There was also a positive (inoculated) and negative (noninoculated) control, which was dipped in distilled water. Days 0, 7, 14, 21, 28, 42, and 56 were sampled for L. monocytogenes. There were no differences (P>0.05) among the organic acid treatments in the turkey deli loaves at any time points; therefore, all of the treatments increased the lag phase of L. monocytogenes, extending the shelf-life of the product. However, there was a difference between the treatments and the positive control at d 7, 14, 21, 28, 42, and 56. The growth of L. monocytogenes increased immediately in the positive control, whereas the negative control appeared to have no growth. These organic acids can provide meat processors with a useful method for extending the lag phase of L. monocytogenes in ready-to-eat meat and poultry products.

Comparison of three Listeria monocytogenes strains in a guinea-pig model simulating food-borne exposure

DEFF Research Database (Denmark)

Roldgaard, Bent; Andersen, Jens Bo; Hansen, Tina Beck

2009-01-01

Three different Listeria monocytogenes strains, LO28 (a laboratory strain with truncated InlA), 4446 (a clinical isolate) and 7291 (a food isolate), were compared in a guinea-pig model designed to mimic food-borne exposure. The objectives were (1) to verify the applicability of the animal model...... for distinguishing between Listeria with different virulence properties and (2) to explore whether it was possible to reduce the required number of animals by dosing with mixed cultures instead of monocultures. Consistent with in vitro observations of infectivity in Caco-2 cells, faecal densities and presence...... of Listeria strains gave similar results as dosage with a mixture of the three strains; thus, the mixed infection approach was a feasible way to reduce the number of animals needed for determination of listerial virulence....

Morphological Change and Decreasing Transfer Rate of Biofilm-Featured Listeria monocytogenes EGDe.

Science.gov (United States)

Lee, Yuejia; Wang, Chinling

2017-03-01

Listeria monocytogenes , a lethal foodborne pathogen, has the ability to resist the hostile food processing environment and thus frequently contaminates ready-to-eat foods during processing. It is commonly accepted that the tendency of L. monocytogenes ' to generate biofilms on various surfaces enhances its resistance to the harshness of the food processing environment. However, the role of biofilm formation in the transferability of L. monocytogenes EGDe remains controversial. We examined the growth of Listeria biofilms on stainless steel surfaces and their effect on the transferability of L. monocytogenes EGDe. The experiments were a factorial 2 × 2 design with at least three biological replicates. Through scanning electron microscopy, a mature biofilm with intensive aggregates of cells was observed on the surface of stainless steel after 3 or 5 days of incubation, depending on the initial level of inoculation. During biofilm development, L. monocytogenes EGDe carried out binary fission vigorously before a mature biofilm was formed and subsequently changed its cellular morphology from rod shaped to sphere shaped. Furthermore, static biofilm, which was formed after 3 days of incubation at 25°C, significantly inhibited the transfer rate of L. monocytogenes EGDe from stainless steel blades to 15 bologna slices. During 7 days of storage at 4°C, however, bacterial growth rate was not significantly impacted by whether bacteria were transferred from biofilm and the initial concentrations of transferred bacteria on the slice. In conclusion, this study is the first to report a distinct change in morphology of L. monocytogenes EGDe at the late stage of biofilm formation. More importantly, once food is contaminated by L. monocytogenes EGDe, contamination proceeds independently of biofilm development and the initial level of contamination when food is stored at 4°C, even if contamination with L. monocytogenes EGDe was initially undetectable before storage.

60-day aging requirement does not ensure safety of surface-mold-ripened soft cheeses manufactured from raw or pasteurized milk when Listeria monocytogenes is introduced as a postprocessing contaminant.

Science.gov (United States)

D'Amico, Dennis J; Druart, Marc J; Donnelly, Catherine W

2008-08-01

Because of renewed interest in specialty cheeses, artisan and farmstead producers are manufacturing surface-mold-ripened soft cheeses from raw milk, using the 60-day holding standard (21 CFR 133.182) to achieve safety. This study compared the growth potential of Listeria monocytogenes on cheeses manufactured from raw or pasteurized milk and held for > 60 days at 4 degrees C. Final cheeses were within federal standards of identity for soft ripened cheese, with low moisture targets to facilitate the holding period. Wheels were surface inoculated with a five-strain cocktail of L. monocytogenes at approximately 0.2 CFU/ cm2 (low level) or 2 CFU/cm2 (high level), ripened, wrapped, and held at 4 degrees C. Listeria populations began to increase by day 28 for all treatments after initial population declines. From the low initial inoculation level, populations in raw and pasteurized milk cheese reached maximums of 2.96 +/- 2.79 and 2.33 +/- 2.10 log CFU/g, respectively, after 60 days of holding. Similar growth was observed in cheese inoculated at high levels, where populations reached 4.55 +/- 4.33 and 5.29 +/- 5.11 log CFU/g for raw and pasteurized milk cheeses, respectively. No significant differences (P milk types. Independent of the milk type, cheeses held for 60 days supported growth from very low initial levels of L. monocytogenes introduced as a postprocess contaminant. The safety of cheeses of this type must be achieved through control strategies other than aging, and thus revision of current federal regulations is warranted.

Listeria monocytogenes Isolates Carrying Virulence-Attenuating Mutations in Internalin A Are Commonly Isolated from Ready-to-Eat Food Processing Plant and Retail Environments.

Science.gov (United States)

VAN Stelten, A; Roberts, A R; Manuel, C S; Nightingale, K K

2016-10-01

Listeria monocytogenes is a human foodborne pathogen that may cause an invasive disease known as listeriosis in susceptible individuals. Internalin A (InlA; encoded by inlA) is a virulence factor that facilitates crossing of host cell barriers by L. monocytogenes . At least 19 single nucleotide polymorphisms (SNPs) in inlA that result in a premature stop codon (PMSC) have been described worldwide. SNPs leading to a PMSC in inlA have been shown to be causally associated with attenuated virulence. L. monocytogenes pathogens carrying virulence-attenuating (VA) mutations in inlA have been commonly isolated from ready-to-eat (RTE) foods but rarely have been associated with human disease. This study was conducted to determine the prevalence of VA SNPs in inlA among L. monocytogenes from environments associated with RTE food production and handling. More than 700 L. monocytogenes isolates from RTE food processing plant (n = 409) and retail (n = 319) environments were screened for the presence of VA SNPs in inlA. Overall, 26.4% of isolates from RTE food processing plant and 32.6% of isolates from retail environments carried a VA mutation in inlA. Food contact surfaces sampled at retail establishments were significantly (P < 0.0001) more likely to be contaminated by a L. monocytogenes isolate carrying a VA mutation in inlA (56% of 55 isolates) compared with nonfood contact surfaces (28% of 264 isolates). Overall, a significant proportion of L. monocytogenes isolated from RTE food production and handling environments have reduced virulence. These data will be useful in the revision of current and the development of future risk assessments that incorporate strain-specific virulence parameters.

Prevalence and characteristics of Listeria monocytogenes in bovine colostrum in Japan.

Science.gov (United States)

Hasegawa, Megumi; Iwabuchi, Eriko; Yamamoto, Shiori; Esaki, Hidetake; Kobayashi, Kazuhiko; Ito, Masahiko; Hirai, Katsuya

2013-02-01

This study was conducted to determine the prevalence and characteristics of Listeria monocytogenes in bovine colostrum in Japan. We collected bovine colostrum samples from 210 dams from 21 dairy farms in Hokkaido prefecture (Japan) between March and June 2009. L. monocytogenes was detected in samples from 6 (28.6%) of the 21 farms. Of the 210 samples, 16 (7.6%) were positive for L. monocytogenes. We recovered 80 L. monocytogenes isolates; 44 (55%) isolates were classified as serotype 1/2b and 36 (45%) were classified as serotype 4b. The isolates were susceptible to penicillin, ampicillin, amoxicillin, gentamicin, kanamycin, streptomycin, erythromycin, vancomycin, tetracycline, chloramphenicol, ciprofloxacin, and trimethoprim-sulfamethoxazole. Pulsed-field gel electrophoresis (PFGE) characterization of the 80 isolates revealed six PFGE types. Two PFGE types corresponded to human listeriosis cases. Most L. monocytogenes isolates possessed virulence-associated genes (actA, hly, iap, inlA, inlC, mpl, plcA, plcB, opuCA, prfA, and clpC). One PFGE type isolate possessed an epidemic clone II marker. Our findings suggest that isolates from bovine colostrum have the potential to cause human and animal listeriosis. This is the first study on the prevalence and characteristics of L. monocytogenes isolated from bovine colostrum obtained from dairy farms. Our results have important implications for improving public health and elucidating the epidemiology of L. monocytogenes in bovine colostrum.

Role of lactic acid bacteria as a biosanitizer to prevent attachment of Listeria monocytogenes F6900 on deli slicer contact surfaces.

Science.gov (United States)

Ndahetuye, Jean Baptiste; Koo, Ok Kyung; O'Bryan, Corliss A; Ricke, Steven C; Crandall, Philip G

2012-08-01

The study was conducted to evaluate the attachment of three lactic acid bacteria (LAB) strains and their combination in a cocktail, to stainless steel coupons from a deli slicer, and their ability to inhibit the attachment of Listeria monocytogenes. In a previous study, three LAB strains, Pediococcus acidilactici, Lactobacillus amylovorus, and Lactobacillus animalis, were isolated from ready-to-eat meat and exhibited antilisterial effect. In the study reported here, hydrophobicity tests were determined according to the method of microbial adhesion to solvent. The attachment of the cells was evaluated on stainless steel coupons from deli slicers. Extracellular carbohydrates were determined with a colorimetric method. Based on these tests, L. animalis exhibited the greatest hydrophobicity (26.3%), and its adherence increased sharply from 24 to 72 h, whereas L. amylovorus yielded the lowest hydrophobicity (3.86%) and was weakly adherent. Although P. acidilactici had moderate hydrophobicity (10.1%), it adhered strongly. The attached LAB strains produced significantly (P < 0.05) higher total carbohydrates than their planktonic counterparts did, which is an important characteristic for attachment. Three conditions were simulated to evaluate the ability of the LAB cocktail (10(8) CFU/ml) to competitively exclude L. monocytogenes (10(3) CFU/ml) on the surface of the coupons. The coupons were pretreated with the LAB cocktail for 24 h prior to the addition of L. monocytogenes, simultaneously treated with the LAB cocktail and L. monocytogenes, or pretreated with L. monocytogenes 24 h prior to the addition of the LAB cocktail. The LAB cocktail was able to reduce the attachment L. monocytogenes significantly (P < 0.05). The LAB cocktail indicated potential attachment on stainless steel and bacteriostatic activity toward L. monocytogenes attached on stainless steel, which indicates a possible role for LAB as a biosanitizer in the food industry.

Listeria monocytogenes contamination of the environment and surfaces of the equipment in the meat processing facilities in republic of Macedonia

Directory of Open Access Journals (Sweden)

Dean Jankuloski

2007-11-01

Full Text Available Listeria monocytogenes contamination of the environment and surfaces of the equipment was examined in seven meat processing facilities. Up to date prevalence of this foodborn pathogen in meat processing facilities facilities in Republic of Macedonia was unknown. Biofilms are composed from food spoilage microorganisms and food born pathogens. They are located on the surfaces of the equipment that come in contact with food and in facilities environment. Microorganisms in biofilm presenting micro eco system and are source of dissemination and contamination of food born pathogens in final meat products. During the preparation of this study we have covered a 7 meat processing facilities and we took a total of 39 swabs from surfaces that come in direct or indirect contact with food. Listeria monocytogenes was discovered in 10 (25,64% swabs (locations. Prevalence of other Listeria spp. compared with total number of taken samples was 15 (38,46% Listeria innocua, 3 (7,69% Listeria welshimeri and 1 (2,65% isolate Listeria seeligeri.

Encefalitis del tallo cerebral y mielitis por Listeria monocytogenes

Directory of Open Access Journals (Sweden)

Aracelly Castro

2013-09-01

Full Text Available La romboencefalitis por Listeria monocytogenes es una presentación poco común de la listeriosis del sistema nervioso central; sin embargo, es la presentación más común en personas inmunocompetentes. Aun más rara es la combinación de romboencefalitis con mielitis causada por L. monocytogenes; no obstante, en este artículo se reporta un caso de encefalitis del tallo y mielitis grave en un paciente sin compromiso del sistema inmunitario. Se presenta un paciente de 21 años de edad, sin deficiencias del sistema inmunitario, que consumió productos lácteos no pasteurizados y, posteriormente, presentó un cuadro de cefalea, vómito, deterioro de su estado general y, finalmente, alteración del estado de conciencia y muerte. Consultó al Instituto Neurológico de Colombia y se hizo diagnóstico de encefalitis del tallo y mielitis por L. monocytogenes. Se discuten las diferencias entre el caso presentado y los reportados en la literatura científica. Ante un paciente con signos de compromiso del tallo cerebral, de posible origen infeccioso, es prudente iniciar tratamiento antibiótico para L. monocytogenes y, en caso de poca respuesta, escalar rápidamente en dicho tratamiento. También lo es extender el estudio radiológico hacia la columna vertebral, con el fin de descartar compromiso de la médula espinal.   doi: http://dx.doi.org/10.7705/biomedica.v33i3.1482

The role of Listeria monocytogenes cell wall surface anchor protein LapB in virulence, adherence, and intracellular replication

Science.gov (United States)

Lmof2365_2117 is a Listeria monocytogenes putative cell wall surface anchor protein with a conserved domain found in collagen binding proteins. We constructed a deletion mutation in lmof2365_2117 in serotype 4b strain F2365, evaluated its virulence, and determined its ability to adhere and invade co...

Prevalence and contamination patterns of Listeria monocytogenes in catfish processing environment and fresh fillets.

Science.gov (United States)

Chen, Bang-Yuan; Pyla, Rajkumar; Kim, Tae-Jo; Silva, Juan L; Jung, Yean-Sung

2010-08-01

Catfish skins, intestines, fresh fillets, processing surfaces at different production stages, chiller water and non-food contact surfaces were sampled for Listeria monocytogenes and other Listeria species. Among 315 samples, prevalence of L. monocytogenes, Listeria innocua and a group of Listeria seeligeri-Listeria welshimeri-Listeria ivanovii was 21.6, 13.0 and 29.5%, respectively. No Listeria grayi was detected in this survey. While no L. monocytogenes strains were isolated from catfish skins and intestines, the strains were found with a frequency of 76.7% in chilled fresh catfish fillets and 43.3% in unchilled fillets. L. monocytogenes and Listeria spp. were also detected in fish contact surfaces such as deheading machine, trimming board, chiller water, conveyor belts at different stages, and fillet weighing table. Among L. monocytogenes, 1/2b (47.0%), 3b (16.0%) and 4c (14%) were the predominant serotypes isolated, whereas 4b, 4e, 1/2c and 1/2a were detected at much lower frequencies. Genotype analyses of L. monocytogenes isolates using serotyping, pulsed-field gel electrophoresis (PFGE) and enterobacterial repetitive intergenic consensus (ERIC)-PCR revealed that chiller water represented an important contamination source of L. monocytogenes in the chilled catfish fillets of two processing facilities, whereas fillet weighing table significantly contributed to the catfish fillet contamination of the third facility. This study suggests that L. monocytogenes contamination in the processed catfish fillets originates from the processing environment, rather than directly from catfish. Results from this study can aid the catfish industry to develop a plant-specific proper cleaning and sanitation procedure for equipment and the processing environment designed to specifically target L. monocytogenes contamination. Copyright 2010 Elsevier Ltd. All rights reserved.

Recombinant phage probes for Listeria monocytogenes

Science.gov (United States)

Carnazza, S.; Gioffrè, G.; Felici, F.; Guglielmino, S.

2007-10-01

Monitoring of food and environmental samples for biological threats, such as Listeria monocytogenes, requires probes that specifically bind biological agents and ensure their immediate and efficient detection. There is a need for robust and inexpensive affinity probes as an alternative to antibodies. These probes may be recruited from random peptide libraries displayed on filamentous phage. In this study, we selected from two phage peptide libraries phage clones displaying peptides capable of specific and strong binding to the L. monocytogenes cell surface. The ability of isolated phage clones to interact specifically with L. monocytogenes was demonstrated using enzyme-linked immunosorbent assay (ELISA) and confirmed by co-precipitation assay. We also assessed the sensitivity of phage-bacteria binding by PCR on phage-captured Listeria cells, which could be detected at a concentration of 104 cells ml-1. In addition, as proof-of-concept, we tested the possibility of immobilizing the affinity-selected phages to a putative biosensor surface. The quality of phage deposition was monitored by ELISA and fluorescent microscopy. Phage-bacterial binding was confirmed by high power optical phase contrast microscopy. Overall, the results of this work validate the concept of affinity-selected recombinant filamentous phages as probes for detecting and monitoring bacterial agents under any conditions that warrant their recognition, including in food products.

Practices and conditions which promote persistence of Listeria monocytogenes on equipment surfaces and transfer to cantaloupes in the packing environment

Science.gov (United States)

Introduction: Investigation of the 2011 U.S. listeriosis outbreak associated withcontaminated cantaloupes revealed that transfer of L. monocytogenes(Lm) from equipment surfaces to melons in the packing facility was a potential route of contamination. Purpose:This study examined the persistence of Lm...

Listeria monocytogenes contamination in dairy plants: evaluation of Listeria monocytogenes environmental contamination in two cheese-making plants using sheeps milk

Directory of Open Access Journals (Sweden)

Michela Ibba

2013-09-01

Full Text Available Listeria monocytogenes harbouring niches established in the processing plant support post-process contamination of dairy products made from pasteurised or thermised milk. The present study investigated L. monocytogenes environmental contamination in two sheep’s milk cheese-making plants. Persistence of contamination in the area at higher risk was also investigated. During a one-year survey 7 samplings were carried out in each dairy plant, along the production lines of Pecorino Romano and ricotta salata cheese. A total of 613 environmental samples collected from food contact and non-food contact surfaces were analysed according to ISO 11290-1:2005 standard method. Identification of the isolated strains was carried out by polymerase chain reaction. L. monocytogenes prevalence was 23.2% in dairy A and 13.1% in dairy B, respectively. The higher prevalence rate was found in the following areas: salting, products washing, packaging, ricotta salata storage and Pecorino Romano ripening rooms. L. monocytogenes was never found in the cheese-making area. The probability of observing samples positive for the presence of L. monocytogenes was asso- ciated with dairy plant, sampling area and the period of cheese-making (P<0.001. The greater persistence of contamination over time was observed in the washing, salting, and Pecorino Romano ripening areas. The control of persistent environmental contamination relies on the identification of L. monocytogenes niches within the processing environment and the prevention of harborage sites formation. The importance of strict cleaning and sanitising procedure in controlling L. monocytogenes environmental contamination is confirmed by the lower level of contamination observed after these procedures were correctly implemented.

Injury and recovery of salmonella, Escherichia coli 0157:H7 and Listeria Monocytogenes on cantaloupe rind surfaces after hyrdogren peroxide and minimal thermal treatment

Science.gov (United States)

Introduction: Produce surface structures vary and complicate decontamination treatments for reducing attached bacteria. Purpose: The objective of this study on survival and recovery of injured population of Salmonella, Escherichia coli O157:H7 and Listeria monocytogenes on cantaloupe rind surfaces...

Roles of a novel Crp/Fnr family transcription factor Lmo0753 in soil survival, biofilm production and surface attachment to fresh produce of Listeria monocytogenes.

Directory of Open Access Journals (Sweden)

Joelle K Salazar

Full Text Available Listeria monocytogenes is a foodborne bacterial pathogen and the causative agent of an infectious disease, listeriosis. L. monocytogenes is ubiquitous in nature and has the ability to persist in food processing environments for extended periods of time by forming biofilms and resisting industrial sanitization. Human listeriosis outbreaks are commonly linked to contaminated dairy products, ready-to-eat meats, and in recent years, fresh produce such as lettuce and cantaloupes. We identified a putative Crp/Fnr family transcription factor Lmo0753 that is highly specific to human-associated genetic lineages of L. monocytogenes. Lmo0753 possesses two conserved functional domains similar to the major virulence regulator PrfA in L. monocytogenes. To determine if Lmo0753 is involved in environmental persistence-related mechanisms, we compared lmo0753 deletion mutants with respective wild type and complementation mutants of two fully sequenced L. monocytogenes genetic lineage II strains 10403S and EGDe for the relative ability of growth under different nutrient availability and temperatures, soil survival, biofilm productivity and attachment to select fresh produce surfaces including romaine lettuce leaves and cantaloupe rinds. Our results collectively suggested that Lmo0753 plays an important role in L. monocytogenes biofilm production and attachment to fresh produce, which may contribute to the environmental persistence and recent emergence of this pathogen in human listeriosis outbreaks linked to fresh produce.

Recombinant phage probes for Listeria monocytogenes

Energy Technology Data Exchange (ETDEWEB)

Carnazza, S; Gioffre, G; Felici, F; Guglielmino, S [Department of Microbiological, Genetic and Molecular Sciences, University of Messina, Messina (Italy)

2007-10-03

Monitoring of food and environmental samples for biological threats, such as Listeria monocytogenes, requires probes that specifically bind biological agents and ensure their immediate and efficient detection. There is a need for robust and inexpensive affinity probes as an alternative to antibodies. These probes may be recruited from random peptide libraries displayed on filamentous phage. In this study, we selected from two phage peptide libraries phage clones displaying peptides capable of specific and strong binding to the L. monocytogenes cell surface. The ability of isolated phage clones to interact specifically with L. monocytogenes was demonstrated using enzyme-linked immunosorbent assay (ELISA) and confirmed by co-precipitation assay. We also assessed the sensitivity of phage-bacteria binding by PCR on phage-captured Listeria cells, which could be detected at a concentration of 10{sup 4} cells ml{sup -1}. In addition, as proof-of-concept, we tested the possibility of immobilizing the affinity-selected phages to a putative biosensor surface. The quality of phage deposition was monitored by ELISA and fluorescent microscopy. Phage-bacterial binding was confirmed by high power optical phase contrast microscopy. Overall, the results of this work validate the concept of affinity-selected recombinant filamentous phages as probes for detecting and monitoring bacterial agents under any conditions that warrant their recognition, including in food products.

Simultaneous Detection of Escherichia coli O157:H7, Salmonella enteritidis, and Listeria monocytogenes at a Very Low Level Using Simultaneous Enrichment Broth and Multichannel SPR Biosensor.

Science.gov (United States)

Zhang, Xiaoguang; Tsuji, Sachiko; Kitaoka, Hayato; Kobayashi, Hiroshi; Tamai, Mitsuru; Honjoh, Ken-Ichi; Miyamoto, Takahisa

2017-10-01

Detection of foodborne pathogens at very low levels is still a challenge. A custom-built multichannel surface plasmon resonance (SPR) biosensor and simultaneous enrichment broth (SEB) were used to develop a simultaneous detection method for 3 important foodborne pathogens, Escherichia coli O157:H7 (O157:H7), Salmonella enteritidis, and Listeria monocytogenes, at a very low level. These 3 foodborne pathogens at a very low level (14, 6, and 28 CFU/25 g (mL) for O157:H7, S. enteritidis, and L. monocytogenes, respectively) were inoculated in SEB and incubated at 37 ˚C for 24 h. Sample prepared from the simultaneous enrichment culture was analyzed using the multichannel SPR biosensor and sensor chip immobilized with polyclonal antibodies specific to each of the target pathogens. O157:H7, S. enteritidis, and L. monocytogenes in chicken were detected simultaneously at an inoculum dose of 14, 6, and 28 CFU/25 g, respectively. Our method using a custom-built multichannel SPR biosensor and enrichment in SEB is expected as a rapid and simultaneous detection method for low levels of O157:H7, S. enteritidis, and L. monocytogenes in food. Our method is expected as a rapid and simultaneous detection method for pathogens at very low levels. It has great potential for safety control of food and microbiological detection applications. © 2017 Institute of Food Technologists®.

Sensitivity to acetic acid, ability to colonize abiotic surfaces and virulence potential of Listeria monocytogenes EGD-e after incubation on parsley leaves.

Science.gov (United States)

Rieu, A; Guzzo, J; Piveteau, P

2010-02-01

To investigate how the survival of Listeria monocytogenes on parsley leaves may affect its ability to sustain process-related harsh conditions and its virulence. Parsley seedlings were spot inoculated with stationary phase cells of L. monocytogenes EGD-e and incubated for 15 days. Each day, bacterial cells were harvested and enumerated, and their ability to survive acetic acid challenge (90 min, pH 4.0), to colonize abiotic surfaces and to grow as biofilms was assessed. After a 3-log decrease over the first 48 h, the population stabilized to about 10(6) CFU g(-1) until the sixth day. After the sixth day, L. monocytogenes was no longer detected, even after specific enrichment. Incubation on parsley leaves affected the ability of L. monocytogenes to survive acetic acid challenge (90 min, pH 4.0) and to adhere to stainless steel although the ability to grow as biofilm was preserved. To further investigate these physiological alterations, the mRNA levels of six target genes (bsh, clpC, groEL, inlA, opuC, prfA) was quantified using reverse transcription qPCR after 5 h of incubation on parsley leaves. A decrease was observed in all but one (bsh) target, including groEL and clpC which are involved in resistance to salt and acid. Moreover, the decrease in the levels of inlA, prfA and opuC transcripts after incubation on parsley suggested a repression of some genes involved in pathogenicity. In vitro assessment of mammalian cell adherence and invasion using Caco-2 cells confirmed the repression of the virulence factor InlA; however, the virulence potential in vivo in the chick embryo model was not affected. Listeria monocytogenes did undergo rapid changes to adapt its physiology to the phyllosphere. This study highlights the physiological changes undergone by L. monocytogenes during/after survival on parsley leaves.

Prevalence of Listeria monocytogenes in poultry production in France.

Science.gov (United States)

Chemaly, Marianne; Toquin, Marie-Therese; Le Nôtre, Yolene; Fravalo, Philippe

2008-10-01

This study aimed to update and create a data set from laying hens and broilers regarding contamination by Listeria monocytogenes. Two hundred laying-hen flocks were sampled, with 88 flocks reared in cages and 112 reared on the floor. One hundred forty-five broiler flocks were sampled, with 85 conventional and 60 free-range flocks. A total of 774 and 725 samples were analyzed from laying hens and broilers, respectively. L. monocytogenes was detected in 31 of 200 flocks, yielding an estimated prevalence of 15.5% in laying-hen flocks. Among positive flocks, there appeared a significant (P = 0.004) difference between caged and floor-reared hens, with a higher detection in dust samples from floor-reared hens. In positive caged hen flocks, significant (P = 0.028) differences between dust and fecal samples appeared, with a higher detection in feces than in dust samples. In broiler flocks, L. monocytogenes was isolated in 46 of 145 flocks, yielding an estimated prevalence of 32% (28% in conventional flocks versus 37% in the free-range flocks). L. monocytogenes was isolated in samples taken from conventional flocks with a lower frequency than in free-range flocks (13 versus 18%, respectively). The serotyping of L. monocytogenes strains showed that the majority belonged to type 1/2a in laying-hen flocks (74.3%) and in broiler flocks (40.5%). A significant difference (P = 0.007) between laying hens and broilers was shown for serogroup 4 and for serovar 1/2b (P = 0.007); these serogroups were more prevalent in broilers (40%) than in laying hens (5.7%).

Prevalence and location of Listeria monocytogenes in farmed rainbow trout.

Science.gov (United States)

Miettinen, Hanna; Wirtanen, Gun

2005-10-15

A total of 510 rainbow trout originating from fish farms in lakes and sea areas around Finland were studied for the presence of Listeria monocytogenes. Samples were studied as pools from five fish. Gill, viscera, and skin from the pooled samples were analysed separately. The individual samples were analysed later if the pooled sample was found to be Listeria positive. The prevalence of Listeria spp. and L. monocytogenes in pooled unprocessed fresh rainbow trout was on average 35.0% and 14.6%, respectively. On the other hand, the prevalence of Listeria spp. and L. monocytogenes in individual thawed fish was found to be 14.3% and 8.8%, respectively. These numbers tend to overestimate and underestimate the real situation because not all fish in pooled samples were necessarily contaminated and in some of the Listeria positive pooled samples all individual samples turned out to be Listeria free. The prevalence of L. monocytogenes varied greatly between different fish farms from zero to 100% in pooled samples and from zero to 75% according to individually studied fish samples. Some indications of the influence of weather conditions and seasonal variations that strongly affected the Listeria contamination of fish were also noticed. The location of Listeria spp. and L. monocytogenes in different parts of the fish differed with statistical significance in rainbow trout. Up to 95.6% of the L. monocytogenes and 84.5% of Listeria spp. positive samples were gill samples. Only 4.4% (2/45) of the L. monocytogenes positive samples were obtained from skin or viscera. Closer study at one fish farm revealed that there was only one L. monocytogenes ribotype present in the contaminated fish, although water and surfaces were heavily contaminated with six other L. monocytogenes ribotypes.

Environmental prevalence and persistence of Listeria monocytogenes in cold-smoked trout processing plants

Science.gov (United States)

The presence of Listeria monocytogenes on the surfaces of equipment and workers' hands during different production stages, as well as on fish skin and meat during processing and storage of cold-smoked trout, was investigated. Listeria monocytogenes was recovered from 10 (6.06%) of a total 165 cotto...

Listeria monocytogenes contamination of the environment and surfaces of the equipment in the meat processing facilities in republic of Macedonia

OpenAIRE

Dean Jankuloski; Pavle Sekulovski; Risto Prodanov; Zehra Hajrulai Musliu; Biljana Stojanovska Dimzovska

2007-01-01

Listeria monocytogenes contamination of the environment and surfaces of the equipment was examined in seven meat processing facilities. Up to date prevalence of this foodborn pathogen in meat processing facilities facilities in Republic of Macedonia was unknown. Biofilms are composed from food spoilage microorganisms and food born pathogens. They are located on the surfaces of the equipment that come in contact with food and in facilities environment. Microorganisms in biofilm presenting micr...

Flagellar motility is critical for Listeria monocytogenes biofilm formation.

Science.gov (United States)

Lemon, Katherine P; Higgins, Darren E; Kolter, Roberto

2007-06-01

The food-borne pathogen Listeria monocytogenes attaches to environmental surfaces and forms biofilms that can be a source of food contamination, yet little is known about the molecular mechanisms of its biofilm development. We observed that nonmotile mutants were defective in biofilm formation. To investigate how flagella might function during biofilm formation, we compared the wild type with flagellum-minus and paralyzed-flagellum mutants. Both nonmotile mutants were defective in biofilm development, presumably at an early stage, as they were also defective in attachment to glass during the first few hours of surface exposure. This attachment defect could be significantly overcome by providing exogenous movement toward the surface via centrifugation. However, this centrifugation did not restore mature biofilm formation. Our results indicate that it is flagellum-mediated motility that is critical for both initial surface attachment and subsequent biofilm formation. Also, any role for L. monocytogenes flagella as adhesins on abiotic surfaces appears to be either minimal or motility dependent under the conditions we examined.

Efficacy of ultraviolet light exposure against survival of Listeria monocytogenes on conveyor belts.

Science.gov (United States)

Morey, Amit; McKee, Shelly R; Dickson, James S; Singh, Manpreet

2010-06-01

Listeria monocytogenes has been repeatedly isolated from foods and food-processing facilities including food contact surfaces such as conveyor belts (CB). CBs are often difficult to clean and require rigorous sanitation programs for decontamination. Ultraviolet (UV) light has exhibited microbicidal properties on food contact surfaces and this study was conducted to determine the efficacy of UV against L. monocytogenes on CB made of different materials. A four-strain cocktail of L. monocytogenes (serotypes 3A, 4A, 4B, and 4C) was made to give a suspension of approximately 10(7) CFU/mL. CBs made from four different types of materials, (1) Ropanyl DM 8/2 A2 + 04 (belt 1), (2) Volta FRMW-3.0 (belt 2), (3) Volta FRMB-3.0 (belt 3), and (4) Ropanyl DM (belt 4), were inoculated with 1 mL of the four-strain cocktail (approximately 10(7) CFU/mL) of the bacterial suspension. CBs were treated with UV light (254 nm) for 1 and 3 sec at 5.53 and 5.95 mW/cm(2). Three replications of the experiments were conducted. Two-way analysis of variance of survival populations of L. monocytogenes showed that bacterial counts were significantly reduced (p belt types irrespective of UV light intensities and times of exposure. L. monocytogenes populations were reduced (p belts 1, 2, and 3 after exposure to 5.95 mW/cm(2) UV light intensity for 3 sec. L. monocytogenes-inoculated CBs that were exposed to 5.53 mW/cm(2) showed higher (p Belt 4 showed survival populations of L. monocytogenes ranging from 1.42 to 1.73 log(10) CFU/cm(2) after UV light treatment for 1 and 3 sec. UV light can be effectively used to reduce L. monocytogenes contamination on CBs.

Fødevarebetinget listeria monocytogenes endokarditis

DEFF Research Database (Denmark)

Frydland, Martin; Bundgaard, Henning; Moser, Claus

2014-01-01

Infection with Listeria monocytogenes is rare and mainly seen in immunosuppressed patients. Infection with L. monocytogenes has a mortality rate of 30%. We present a case report of L. monocytogenes bacteraemia and endocarditis in a 70-year-old man with several co-morbidities and following four...... major surgical procedures. This illustrates the findings and characteristics in one of the 16 patients who died in 2013 and 2014 this summer due to sausage-related L. monocytogenes infection....

Fate of Listeria spp. on parsley leaves grown in laboratory and field cultures.

Science.gov (United States)

Dreux, N; Albagnac, C; Carlin, F; Morris, C E; Nguyen-The, C

2007-11-01

To investigate the population dynamics of Listeria monocytogenes and Listeria innocua on the aerial surfaces of parsley. Under 100% relative humidity (RH) in laboratory and regardless of the inoculum tested (10(3)-10(8) CFU per leaf), counts of L. monocytogenes EGDe, LO28, LmP60 and L. innocua CIP 80-12 tended towards approx. 10(5) CFU per leaf. Under low RH, Listeria spp. populations declined regardless to the inoculum size (10(4)-10(8) CFU per leaf). L. innocua CIP 80-12 survived slightly better than L. monocytogenes in the laboratory and was used in field cultures. Under field cultures, counts of L. innocua decreased more rapidly than in the laboratory, representing a decrease of 9 log(10) in 2 days in field conditions compared to a decrease of 4.5 log(10) in 8 days in the laboratory. Counts of L. innocua on tunnel parsley cultures were always higher (at least by 100 times) than those on unprotected parsley culture. Even with a high inoculum and under protected conditions (i.e. plastic tunnels), population of L. monocytogenes on the surface of parsley on the field would decrease by several log(10) scales within 2 days. Direct contamination of aerial surfaces of parsley with L. monocytogenes (i.e. through contaminated irrigation water) will not lead to contaminated produce unless it occurs very shortly before harvest.

The virulence regulator PrfA promotes biofilm formation by Listeria monocytogenes.

Science.gov (United States)

Lemon, Katherine P; Freitag, Nancy E; Kolter, Roberto

2010-08-01

Listeria monocytogenes is a food-borne facultative intracellular pathogen. It is widespread in the environment and has several distinct life-styles. The key transcriptional activator PrfA positively regulates L. monocytogenes virulence genes to mediate the transition from extracellular, flagellum-propelled cell to intracellular pathogen. Here we report the first evidence that PrfA also has a significant positive impact on extracellular biofilm formation. Mutants lacking prfA were defective in surface-adhered biofilm formation. The DeltaprfA mutant exhibited wild-type flagellar motility, and its biofilm defect occurred after initial surface adhesion. We also observed that mutations that led to the constitutive expression of PrfA-dependent virulence genes had a minimal impact on biofilm formation. Furthermore, biofilm development was enhanced in a mutant encoding a PrfA protein variant unable to fully transition from the extracellular form to the virulent, intracellular activity conformation. These results indicate that PrfA positively regulates biofilm formation and suggest that PrfA has a global role in modulating the life-style of L. monocytogenes. The requirement of PrfA for optimal biofilm formation may provide selective pressure to maintain this critical virulence regulator when L. monocytogenes is outside host cells in the environment.

Formation of biofilm by strains of Listeria monocytogenes isolated ...

African Journals Online (AJOL)

Quantification of biofilm formation by 40 Listeria monocytogenes strains from wara soft cheese and its processing environment was assessed on glass vials surfaces. Attachement to glass surface was quantified using a crystal violet binding assay. All the 40 strains produced biofilms after 48 and 72 h incubation at 37oC.

Increased Adhesion of Listeria monocytogenes Strains to Abiotic Surfaces under Cold Stress

Directory of Open Access Journals (Sweden)

Bo-Hyung Lee

2017-11-01

Full Text Available Food contamination by Listeria monocytogenes remains a major concern for some food processing chains, particularly for ready-to-eat foods, including processed foods. Bacterial adhesion on both biotic and abiotic surfaces is a source of contamination by pathogens that have become more tolerant or even persistent in food processing environments, including in the presence of adverse conditions such as cold and dehydration. The most distinct challenge that bacteria confront upon entry into food processing environments is the sudden downshift in temperature, and the resulting phenotypic effects are of interest. Crystal violet staining and the BioFilm Ring Test® were applied to assess the adhesion and biofilm formation of 22 listerial strains from different serogroups and origins under cold-stressed and cold-adapted conditions. The physicochemical properties of the bacterial surface were studied using the microbial adhesion to solvent technique. Scanning electron microscopy was performed to visualize cell morphology and biofilm structure. The results showed that adhesion to stainless-steel and polystyrene was increased by cold stress, whereas cold-adapted cells remained primarily in planktonic form. Bacterial cell surfaces exhibited electron-donating properties regardless of incubation temperature and became more hydrophilic as temperature decreased from 37 to 4°C. Moreover, the adhesion of cells grown at 4°C correlated with affinity for ethyl acetate, indicating the role of cell surface properties in adhesion.

Glycerol metabolism induces Listeria monocytogenes biofilm formation at the air-liquid interface.

Science.gov (United States)

Crespo Tapia, Natalia; den Besten, Heidy M W; Abee, Tjakko

2018-05-20

Listeria monocytogenes is a food-borne pathogen that can grow as a biofilm on surfaces. Biofilm formation in food-processing environments is a big concern for food safety, as it can cause product contamination through the food-processing line. Although motile aerobic bacteria have been described to form biofilms at the air-liquid interface of cell cultures, to our knowledge, this type of biofilm has not been described in L. monocytogenes before. In this study we report L. monocytogenes biofilm formation at the air-liquid interface of aerobically grown cultures, and that this phenotype is specifically induced when the media is supplemented with glycerol as a carbon and energy source. Planktonic growth, metabolic activity assays and HPLC measurements of glycerol consumption over time showed that glycerol utilization in L. monocytogenes is restricted to growth under aerobic conditions. Gene expression analysis showed that genes encoding the glycerol transporter GlpF, the glycerol kinase GlpK and the glycerol 3-phosphate dehydrogenase GlpD were upregulated in the presence of oxygen, and downregulated in absence of oxygen. Additionally, motility assays revealed the induction of aerotaxis in the presence of glycerol. Our results demonstrate that the formation of biofilms at the air-liquid interface is dependent on glycerol-induced aerotaxis towards the surface of the culture, where L. monocytogenes has access to higher concentrations of oxygen, and is therefore able to utilize this compound as a carbon source. Copyright © 2018 Elsevier B.V. All rights reserved.

Listeria monocytogenes in five Sardinian swine slaughterhouses: prevalence, serotype, and genotype characterization.

Science.gov (United States)

Meloni, Domenico; Piras, Francesca; Mureddu, Anna; Fois, Federica; Consolati, Simonetta Gianna; Lamon, Sonia; Mazzette, Rina

2013-11-01

In a 3-year study (2008 to 2011) to estimate the prevalence and the contamination sources of Listeria monocytogenes in pork meat in Sardinia, Italy, 211 samples were collected from five Sardinian swine slaughterhouses: 171 samples from slaughtered pigs and 40 from the slaughterhouse environment. Fifty L. monocytogenes isolates were characterized by PCR-based serotyping, presence of virulence-associated genes, and pulsed-field gel electrophoresis restriction analysis. The overall prevalence of L. monocytogenes was 33% in swine carcasses, 7% in cecal material, 23% on meat contact surfaces, and 25% on noncontact surfaces. Only two serotypes were detected: 1/2c (78%) and 1/2a (22%). In all, based on the presence of virulence-associated genes, eight pathogenic profiles were detected. Only 42% of all isolates carried the full complement of virulence-associated genes and were allotted to profile 1. Six pulsed-field gel electrophoresis profiles persisted in the slaughterhouses; restriction profiles appeared to be specific to each plant.

Prevalence, distribution, and diversity of Listeria monocytogenes in retail environments, focusing on small establishments and establishments with a history of failed inspections.

Science.gov (United States)

Hoelzer, Karin; Sauders, Brian D; Sanchez, Maria D; Olsen, Peter T; Pickett, Michele M; Mangione, Kurt J; Rice, Daniel H; Corby, Joe; Stich, Stephen; Fortes, Esther D; Roof, Sherry E; Grohn, Yrjo T; Wiedmann, Martin; Oliver, Haley F

2011-07-01

Despite growing concerns about cross-contamination of ready-to-eat foods with Listeria monocytogenes, our knowledge about the ecology and transmission of L. monocytogenes in retail establishments has remained limited. We conducted a cross-sectional study to characterize the prevalence, distribution, and subtype diversity of L. monocytogenes in 120 New York State retail deli establishments that were hypothesized to present an increased risk for environmental L. monocytogenes contamination (i.e., small establishments and establishments with a history of failed New York State Agriculture and Markets inspections). Analysis of these data along with previously reported data for 121 predominantly larger retail establishments in New York State identified establishment size, geographic location, and inspection history as significant predictors of L. monocytogenes presence and prevalence. The odds of an establishment being L. monocytogenes positive were approximately twice as high for large establishments, establishments located in New York City, or establishments with poor inspection history (as compared with establishments without these attributes), even though correlation between location and inspection history complicated interpretation of results. Within an establishment, L. monocytogenes was significantly more prevalent on nonfood contact surfaces than on food contact surfaces; prevalence was particularly high for floors and in floor drains, sinks, the dairy case, and milk crates. L. monocytogenes subtype diversity differed between sites, with lineage I isolates significantly associated with nonfood contact surfaces and lineage II isolates significantly associated with food contact surfaces. Isolates belonging to the same ribotype were often found dispersed across multiple sites within an operation. Copyright ©, International Association for Food Protection

Validation of the ANSR(®) Listeria monocytogenes Method for Detection of Listeria monocytogenes in Selected Food and Environmental Samples.

Science.gov (United States)

Caballero, Oscar; Alles, Susan; Le, Quynh-Nhi; Gray, R Lucas; Hosking, Edan; Pinkava, Lisa; Norton, Paul; Tolan, Jerry; Mozola, Mark; Rice, Jennifer; Chen, Yi; Ryser, Elliot; Odumeru, Joseph

2016-01-01

Work was conducted to validate performance of the ANSR(®) for Listeria monocytogenes method in selected food and environmental matrixes. This DNA-based assay involves amplification of nucleic acid via an isothermal reaction based on nicking enzyme amplification technology. Following single-step sample enrichment for 16-24 h for most matrixes, the assay is completed in 40 min using only simple instrumentation. When 50 distinct strains of L. monocytogenes were tested for inclusivity, 48 produced positive results, the exceptions being two strains confirmed by PCR to lack the assay target gene. Forty-seven nontarget strains (30 species), including multiple non-monocytogenes Listeria species as well as non-Listeria, Gram-positive bacteria, were tested, and all generated negative ANSR assay results. Performance of the ANSR method was compared with that of the U.S. Department of Agriculture, Food Safety and Inspection Service Microbiology Laboratory Guidebook reference culture procedure for detection of L. monocytogenes in hot dogs, pasteurized liquid egg, and sponge samples taken from an inoculated stainless steel surface. In addition, ANSR performance was measured against the U.S. Food and Drug Administration Bacteriological Analytical Manual reference method for detection of L. monocytogenes in Mexican-style cheese, cantaloupe, sprout irrigation water, and guacamole. With the single exception of pasteurized liquid egg at 16 h, ANSR method performance as quantified by the number of positives obtained was not statistically different from that of the reference methods. Robustness trials demonstrated that deliberate introduction of small deviations to the normal assay parameters did not affect ANSR method performance. Results of accelerated stability testing conducted using two manufactured lots of reagents predicts stability at the specified storage temperature of 4°C of more than 1 year.

Role of Extracellular DNA during Biofilm Formation by Listeria monocytogenes

DEFF Research Database (Denmark)

Harmsen, Morten; Lappann, Martin; Knøchel, S

2010-01-01

(eDNA) may be the only central component of the biofilm matrix and that it is necessary for both initial attachment and early biofilm formation for 41 L. monocytogenes strains that were tested. DNase I treatment resulted in dispersal of biofilms, not only in microtiter tray assays but also in flow......Listeria monocytogenes is a food-borne pathogen that is capable of living in harsh environments. It is believed to do this by forming biofilms, which are surface-associated multicellular structures encased in a self-produced matrix. In this paper we show that in L. monocytogenes extracellular DNA...... cell biofilm assays. However, it was also demonstrated that in a culture without eDNA, neither Listeria genomic DNA nor salmon sperm DNA by itself could restore the capacity to adhere. A search for additional necessary components revealed that peptidoglycan (PG), specifically N-acetylglucosamine (NAG...

Listeria monocytogenes impact on mature or old Pseudomonas fluorescens biofilms during growth at 4 and 20ºC

Directory of Open Access Journals (Sweden)

Puga eCH

2016-02-01

Full Text Available Changes in spatial organization, as observed by confocal laser scanning microscopy (CLSM, viable cell content, biovolume and substratum surface coverage of the biofilms formed on glass by Pseudomonas fluorescens resulting from co-culture with Listeria monocytogenes, were examined. Two strains of L. monocytogenes, two culture temperatures and two biofilm developmental stages were investigated. Both L. monocytogenes strains, a persistently sampled isolate (collected repeatedly along 3 years from a meat factory and Scott A, induced shrinkage in matrix volume, both at 20ºC and 4ºC, in mature or old biofilms, without loss of P. fluorescens cell count per surface unit. The nearly homogeneous pattern of surface coverage shown by mono-species P. fluorescens biofilms, turned into more irregular layouts in co-culture with L. monocytogenes. The upper layer of both mono and dual-species biofilms turned to predominantly consist of matrix, with plenty of viable cells underneath, in old biofilms cultured at 20ºC, but not in those grown at 4ºC. Between 15 and 56% of the substratum area was covered by biofilm, the extent depending on temperature, time and L. monocytogenes strain. Real biofilms in food-related surfaces may thus be very heterogeneous regarding their superficial components, i.e. those more accessible to disinfectants. It is therefore a hygienic challenge to choose an adequate agent to disrupt them.

9 CFR 430.4 - Control of Listeria monocytogenes in post-lethality exposed ready-to-eat products.

Science.gov (United States)

2010-01-01

... post-lethality exposed ready-to-eat products. 430.4 Section 430.4 Animals and Animal Products FOOD... Control of Listeria monocytogenes in post-lethality exposed ready-to-eat products. (a) Listeria... comes into direct contact with a food contact surface which is contaminated with L. monocytogenes. (b...

Listeriolysin S: A bacteriocin from epidemic Listeria monocytogenes strains that targets the gut microbiota.

Science.gov (United States)

Quereda, Juan J; Meza-Torres, Jazmín; Cossart, Pascale; Pizarro-Cerdá, Javier

2017-07-04

Listeria monocytogenes is a Gram-positive food-borne pathogen that in humans may traverse the intestinal, placental and blood/brain barriers, causing gastroenteritis, abortions and meningitis. Crossing of these barriers is dependent on the bacterial ability to enter host cells, and several L. monocytogenes surface and secreted virulence factors are known to facilitate entry and the intracellular lifecycle. The study of L. monocytogenes strains associated to human listeriosis epidemics has revealed the presence of novel virulence factors. One such factor is Listeriolysin S, a thiazole/oxazole modified microcin that displays bactericidal activity and modifies the host microbiota during infection. Our recent results therefore highlight the interaction of L. monocytogenes with gut microbes as a crucial step in epidemic listeriosis. In this article, we will discuss novel implications for this family of toxins in the pathogenesis of diverse medically relevant microorganisms.

Controlling Listeria monocytogenes Scott A on Surfaces of Fully Cooked Turkey Deli Product Using Organic Acid-Containing Marinades as Postlethality Dips.

Science.gov (United States)

Casco, Gerardo; Johnson, Jennifer L; Taylor, T Matthew; Gaytán, Carlos N; Brashears, Mindy M; Alvarado, Christine Z

2015-01-01

This study evaluated the efficacy of organic acids applied singly or in combination as postlethality dips to sliced uncured turkey deli loaves to inhibit the growth of Listeria monocytogenes (Lm) Scott A. Treatments consisted of sodium lactate (SL; 3.6%), potassium lactate (PL; 3.6%), sodium citrate (SC; 0.75%), a combination of SL and sodium diacetate (SDA; 0.25%), and a combination of SL/PL/SDA, alongside appropriate negative and positive controls. Products were inoculated with 10(4)-10(5) CFU/mL streptomycin-resistant (1500 μg/mL) Lm Scott A prior to treatment. Products were then stored at ~4°C and sampled at 0, 7, 14, 21, 28, 42, and 56 d. The SL/SDA combination applied to turkey slices extended the lag phase through 21 days of refrigerated storage. Numbers of Lm Scott A rose by 0.7 log10 CFU/g through the 56 d storage period. The application of the SL/PL/SDA treatment to turkey product surfaces extended the lag phase through 42 d, with pathogen numbers declining after 21 d. Combination organic acid dips prolonged the lag phase for 2 to 6 wk on turkey product surfaces and can be useful as antimicrobial agents for Lm control on postlethality exposed sliced deli products.

ASSESSMENT OF ACTION OF DISINFECTANTS AGAINST LISTERIA MONOCYTOGENES BIOFILMS

Directory of Open Access Journals (Sweden)

T. K. CABEÇA

2008-12-01

Full Text Available

The purpose of this study was to assess the action of various disinfectants used in food industry against biofilm cells of Listeria monocytogenes formed on stainless steel surfaces during 24, 72 and 120 hours. Numbers of viable biofilm cells decreased after treatment with all the tested disinfectants (iodine, biguanide, quaternary ammonium compounds, peracetic acid and sodium hypochlorite. Sodium hypochlorite was the most effective disinfectant against the biofilm cells, while biguanide and iodine were the least. Scanning electron microscopy observations demonstrated attached cells on stainless steel surfaces after treatment with all the disinfectants. These observations showed that microorganisms were not completely removed from stainless steel surfaces after treatment with the disinfectants, however, the attachment did not means the viability of remaining cells. The biofilm age in hours (24, 72 and 120 had no apparent influence on resistance of microbiological cells to the disinfectants under study. In conclusion biofilm cells of L. monocytogenes can withstand disinfectants action.

An ecological perspective of Listeria monocytogenes biofilms in food processing facilities.

Science.gov (United States)

Valderrama, Wladir B; Cutter, Catherine N

2013-01-01

Listeria monocytogenes can enter the food chain at virtually any point. However, food processing environments seem to be of particular importance. From an ecological point of view, food processing facilities are microbial habitats that are constantly disturbed by cleaning and sanitizing procedures. Although L. monocytogenes is considered ubiquitous in nature, it is important to recognize that not all L. monocytogenes strains appear to be equally distributed; the distribution of the organism seems to be related to certain habitats. Currently, no direct evidence exists that L. monocytogenes-associated biofilms have played a role in food contamination or foodborne outbreaks, likely because biofilm isolation and identification are not part of an outbreak investigation, or the definition of biofilm is unclear. Because L. monocytogenes is known to colonize surfaces, we suggest that contamination patterns may be studied in the context of how biofilm formation is influenced by the environment within food processing facilities. In this review, direct and indirect epidemiological and phenotypic evidence of lineage-related biofilm formation capacity to specific ecological niches will be discussed. A critical view on the development of the biofilm concept, focused on the practical implications, strengths, and weaknesses of the current definitions also is discussed. The idea that biofilm formation may be an alternative surrogate for microbial fitness is proposed. Furthermore, current research on the influence of environmental factors on biofilm formation is discussed.

Pele Erupting on Lo

Science.gov (United States)

2001-01-01

This image of Jupiter's moon, lo, was taken by the Chandra X-Ray Observatory (CXO). Shown here is the most extreme example of the effect of tidal forces as Lo is being pulled by massive Jupiter on one side and by the outer moons Europa, Callisto, and Ganymede on the other. The opposing tidal forces alternately squeeze and stretch its interior, causing the solid surface to rise and fall by about 100 meters. The enormous amount of heat and pressure generated by the resulting friction creates colossal volcanoes and fractures on the surface of this moon.

Role of initial contamination levels, biofilm maturity and presence of salt and fat on desiccation survival of Listeria monocytogenes on stainless steel surfaces.

Science.gov (United States)

Hingston, Patricia A; Stea, Emma C; Knøchel, Susanne; Hansen, Truelstrup

2013-10-01

This study investigated the effect of initial contamination levels, biofilm maturity and presence of salt and fatty food soils on desiccation survival of Listeria monocytogenes on stainless steel (SS) coupons. L. monocytogenes cultures grown (at 15 °C for 48 h) in Tryptic Soy Broth with 1% glucose (TSB-glu) containing either 0.5 or 5% (w/v) NaCl were re-suspended in TSB-glu containing either 0.5 or 5% NaCl and used to contaminate SS coupons at levels of 3.5, 5.5, and 7.5 log CFU/cm². Desiccation (at 15 °C for 20 days, 43% RH) commenced immediately (non-biofilm) or following biofilm formation (at 15 °C for 48 h, 100% RH). To study the impact of food lipids, non-biofilm L. monocytogenes cells were suspended in TSB-glu containing either canola oil (5-10%) or lard (20-60%) and desiccated as above on SS coupons. Following desiccation for 20 days, survivors decreased by 1.4-3.7 log CFU/cm² for non-biofilm L. monocytogenes cells. The contamination level had no significant (p > 0.05) effect on survival kinetics. SEM micrographs showed mature biofilms on coupons initially contaminated with 5.5 and 7.5 log CFU/cm². Mature biofilm cells were significantly (p biofilms formed by the lowest contamination level. Besides biofilm maturity/formation, previous osmoadaptation, exposure to lard (20-60%) or salt (5%) during desiccation significantly (p biofilms and salty or fatty soils on food contact surfaces. Copyright © 2013 Elsevier Ltd. All rights reserved.

Effect of Listeria monocytogenes inoculation, sodium acetate and ...

African Journals Online (AJOL)

Jane

2011-08-08

Aug 8, 2011 ... monocytogenes has been isolated from surface fresh waters and ... been reported that contamination of aquatic products with ..... In fish sausage treated with nisin, the peroxide value was lower in comparison with that of control (Raju et al., 2003). TBA assay is usually used as indicator for the assessment of.

Comparison of Listeria monocytogenes recoveries from spiked mung bean sprouts by the enrichment methods of three regulatory agencies.

Science.gov (United States)

Cauchon, Kaitlin E; Hitchins, Anthony D; Smiley, R Derike

2017-09-01

Three selective enrichment methods, the United States Food and Drug Administration's (FDA method), the United States Department of Agriculture Food Safety Inspection Service's (USDA method), and the EN ISO 11290-1 standard method, were assessed for their suitability for recovery of Listeria monocytogenes from spiked mung bean sprouts. Three parameters were evaluated; the enrichment L. monocytogenes population from singly-spiked sprouts, the enrichment L. monocytogenes population from doubly-spiked (L. monocytogenes and Listeria innocua) sprouts, and the population differential resulting from the enrichment of doubly-spiked sprouts. Considerable L. monocytogenes inter-strain variation was observed. The mean enrichment L. monocytogenes populations for singly-spiked sprouts were 6.1 ± 1.2, 4.9 ± 1.2, and 6.9 ± 2.3 log CFU/mL for the FDA, USDA, and EN ISO 11290-1 methods, respectively. The mean L. monocytogenes populations for doubly-spiked sprouts were 4.7 ± 1.1, 5.5 ± 1.3, and 4.6 ± 1.4 log CFU/mL for the FDA, USDA, and ISO 11290-1 enrichment methods, respectively. The corresponding mean population differentials were 2.8 ± 1.1, 3.3 ± 1.3, and 3.6 ± 1.4 Δlog CFU/mL for the same three enrichment methods, respectively. The presence of L. innocua and resident microorganisms on the sprouts negatively impacted final levels of L. monocytogenes with all three enrichment methods. Published by Elsevier Ltd.

Effects of curing sodium nitrite additive and natural meat fat on growth control of Listeria monocytogenes by the bacteriocin-producing Lactobacillus curvatus strain CWBI-B28.

Science.gov (United States)

Kouakou, P; Ghalfi, H; Destain, J; Dubois-Dauphin, R; Evrard, P; Thonart, P

2009-09-01

In realistic model meat systems, the separate and combined effects of fat content and sodium nitrite on the antilisterial activity of the bacteriocin of Lactobacillus curvatus CWBI-B28 were studied. In laboratory fermentations where Listeria monocytogenes was co-cultured at 4 degrees C with bacteriocin-producing CWBI-B28 in lean pork meat (fat content: 13%) without added nitrite, a strong antilisterial effect was observed after one week. The effect was maintained for an additional week, after which a slight and very gradual rebound was observed. Both added nitrite (20 ppm) and a high-fat content (43%) were found to antagonise this antilisterial effect, the Listeria cfu count reached after six weeks being 200 times as high in high-fat meat with added nitrite than in lean meat without nitrite. This antagonism could not be attributed to slower growth of the bacteriocin-producing strain, since CWBI-B28 grew optimally in fat-rich meat with 20 ppm sodium nitrite. Bacteriocin activity was also measured in the samples. The observed activity levels are discussed in relation to the degree of antilisterial protection conferred.

Prevalence of Listeria monocytogenes in raw bovine milk and milk products from central highlands of Ethiopia.

Science.gov (United States)

Seyoum, Eyasu Tigabu; Woldetsadik, Daniel Asrat; Mekonen, Tesfu Kassa; Gezahegn, Haile Alemayehu; Gebreyes, Wondwossen Abebe

2015-11-30

Listeria monocytogenes is of major significance in human and veterinary medicine. Most human Listeria infections are foodborne and the association of contaminated milk and dairy produce consumption with human listeriosis is noteworthy. In Ethiopia, there is limited data regarding the prevalence of L. monocytogenes in raw bovine milk and dairy products. The aim of this study was, therefore, to determine the prevalence of L. monocytogenes in raw bovine milk and dairy produce. A total of 443 milk and milk product samples were microbiologically analyzed following methods recommended by the U.S. Food and Drug Administration Bacteriological Analytical Manual to isolate Listeria spp. The overall prevalence of Listeria spp. was 28.4% and specifically that of L. monocytogenes was 5.6%. Taking the prevalence of Listeria spp. into consideration, cheese was found to be highly contaminated at 60%, followed by pasteurized milk samples (40%), raw milk (18.9%) and yoghurt (5%). Considering the prevalence of Listeria monocytogenes only, raw milk had the lowest contamination while cheese had the highest, followed by pasteurized milk and yoghurt. Raw milk and milk products produced in urban and peri-urban areas of central Ethiopia were contaminated with pathogenic bacteria, L. monocytogenes. The detection of this pathogen in raw milk and milk products warrants an urgent regulatory mechanism to be put in place and also the potential role of milk processing plants in the contamination of dairy products should be investigated.

A Meta-analysis of the Rates of Listeria monocytogenes and Enterococcus in Febrile Infants.

Science.gov (United States)

Leazer, Rianna; Perkins, Amy M; Shomaker, Kyrie; Fine, Bryan

2016-04-01

A change in the epidemiology of pathogens causing serious bacterial infection (SBI) has been noted since original recommendations were made for the empirical antibiotic choices for young infants with fever. To assess the prevalence of SBI caused by Listeria monocytogenes and Enterococcus species. A literature search was conducted on keywords related to SBI, L. monocytogenes, and Enterococcus spp. infections. Eligible studies were those conducted in the United States and published between January 1998 and June 2014 focusing on SBI in infants≤90 days of age. The rates of urinary tract infection, bacteremia, and meningitis for each pathogen were recorded for each study. Meta-analysis was performed to calculate the prevalence for each pathogen in a random effects model with 0.5 continuity correction added to studies with zero events. Sixteen studies were included. A total of 20,703 blood cultures were included, with weighted prevalences for L. monocytogenes and Enterococcus spp. bacteremia of 0.03% and 0.09%, respectively. A total of 13,775 cerebrospinal fluid cultures were included with event rates (unweighted prevalences) for L. monocytogenes and Enterococcus spp. meningitis of 0.02% and 0.03%, respectively. A total of 18,283 urine cultures were included, with no cases of L. monocytogenes and a weighted prevalence for Enterococcus spp. urinary tract infection of 0.28%. There may have been reporting bias or incomplete retrieval or inadvertent exclusion of relevant studies. SBI caused by L. monocytogenes and Enterococcus spp. in febrile infants is rare, and therefore clinicians may consider a change in empirical antibiotic choices. Copyright © 2016 by the American Academy of Pediatrics.

Hygienic Shortcomings of Frozen Dessert Freezing Equipment and Fate of Listeria monocytogenes on Ice Cream-Soiled Stainless Steel.

Science.gov (United States)

Inuwa, A; Lunt, A; Czuprynski, C; Miller, G; Rankin, S A

2017-10-19

Although frozen dairy desserts have a strong record of safety, recent outbreaks of foodborne disease linked to ice creams have brought new attention to this industry. There is concern that small-scale frozen dessert equipment may not comply with or be reviewed against published comprehensive design and construction sanitation specifications (National Sanitation Foundation or 3-A sanitary standards). Equipment sanitary design issues may result in reduced efficacy of cleaning and sanitation, thus increasing the likelihood of postprocess contamination with pathogenic bacteria. In this context, and given that Listeria monocytogenes outbreaks are of great concern for the frozen dessert industry, a complementary study was conducted to evaluate the fate of L. monocytogenes in ice cream mix on a stainless steel surface. Our results showed that L. monocytogenes survived for up to 6 weeks at room temperature and 9 weeks at 4°C in contaminated ice cream on a stainless steel surface. Furthermore, chlorine- and acid-based surface sanitizers had no detrimental effect on the L. monocytogenes when used at a concentration and contact time (1 min) recommended by the manufacturer; significant reduction in CFU required 5 to 20 min of contact time.

First Trimester Listeria monocytogenes Septicemia

NARCIS (Netherlands)

Goddijn, M.; Schipper, H. G.; Spanjaard, L.; Wolf, H.

1997-01-01

Background: Little is known about fetal outcome after Listeria monocytogenes septicemia in the first trimester of pregnancy.Case: A primigravida with L. monocytogenes septicemia at 9 weeks gestation was treated with amoxicillin. At 40 weeks gestation a healthy female infant was born.Conclusion: This

Comparison of the Prevalences and Diversities of Listeria Species and Listeria monocytogenes in an Urban and a Rural Agricultural Watershed.

Science.gov (United States)

Stea, Emma C; Purdue, Laura M; Jamieson, Rob C; Yost, Chris K; Truelstrup Hansen, Lisbeth

2015-06-01

Foods and related processing environments are commonly contaminated with the pathogenic Listeria monocytogenes. To investigate potential environmental reservoirs of Listeria spp. and L. monocytogenes, surface water and point source pollution samples from an urban and a rural municipal water supply watershed in Nova Scotia, Canada, were examined over 18 months. Presumptive Listeria spp. were cultured from 72 and 35% of rural and urban water samples, respectively, with 24% of the positive samples containing two or three different Listeria spp. The L. innocua (56%) and L. welshimeri (43%) groups were predominant in the rural and urban watersheds, respectively. Analysis by the TaqMan assay showed a significantly (P monocytogenes of 62% versus 17% by the culture-based method. Both methods revealed higher prevalences in the rural watershed and during the fall and winter seasons. Elevated Escherichia coli (≥ 100 CFU/100 ml) levels were not associated with the pathogen regardless of the detection method. Isolation of Listeria spp. were associated with 70 times higher odds of isolating L. monocytogenes (odds ratio = 70; P monocytogenes isolates, followed by IVb (16.1%), IIb (15.8%), and IIc (0.4%). L. monocytogenes was detected in cow feces and raw sewage but not in septic tank samples. Pulsotyping of representative water (n = 54) and local human (n = 19) isolates suggested genetic similarities among some environmental and human L. monocytogenes isolates. In conclusion, temperate surface waters contain a diverse Listeria species population and could be a potential reservoir for L. monocytogenes, especially in rural agricultural watersheds. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Listeria monocytogenes, a down-to-earth pathogen.

Science.gov (United States)

Vivant, Anne-Laure; Garmyn, Dominique; Piveteau, Pascal

2013-01-01

Listeria monocytogenes is the causative agent of the food-borne life threatening disease listeriosis. This pathogenic bacterium received much attention in the endeavor of deciphering the cellular mechanisms that underlie the onset of infection and its ability to adapt to the food processing environment. Although information is available on the presence of L. monocytogenes in many environmental niches including soil, water, plants, foodstuff and animals, understanding the ecology of L. monocytogenes in outdoor environments has received less attention. Soil is an environmental niche of pivotal importance in the transmission of this bacterium to plants and animals. Soil composition, microbial communities and macrofauna are extrinsic edaphic factors that direct the fate of L. monocytogenes in the soil environment. Moreover, farming practices may further affect its incidence. The genome of L. monocytogenes presents an extensive repertoire of genes encoding transport proteins and regulators, a characteristic of the genome of ubiquitous bacteria. Postgenomic analyses bring new insights in the process of soil adaptation. In the present paper focussing on soil, we review these extrinsic and intrinsic factors that drive environmental adaptation of L. monocytogenes.

L. monocytogenes in a cheese processing facility: Learning from contamination scenarios over three years of sampling.

Science.gov (United States)

Rückerl, I; Muhterem-Uyar, M; Muri-Klinger, S; Wagner, K-H; Wagner, M; Stessl, B

2014-10-17

contamination of the processed product is unlikely. Drying of surfaces after cleaning is highly recommended to facilitate the L. monocytogenes eradication. Copyright © 2014 Elsevier B.V. All rights reserved.

Occurrence of Listeria monocytogenes in Ready-to-Eat Meat Products and Meat Processing Plants in Spain

Directory of Open Access Journals (Sweden)

Diego Gómez

2015-07-01

Full Text Available The aim of this work was to study the occurrence of Listeria monocytogenes in several types of ready-to-eat (RTE meat products and in the environment of meat processing plants. A total of 129 samples of RTE meat products and 110 samples from work surfaces and equipment were analyzed. L. monocytogenes was detected in 6 out of 35 cooked products (17.14%, 21 out of 57 raw-cured products (36.84%, and 9 out of 37 dry-cured, salted products (24.32%. The number of sample units that exceeded the food safety limit of 100 cfu/g decreased from the manufacture date to half shelf life, and then it was further reduced at the end of shelf life. L. monocytogenes was detected in 25 out of 110 (22.72% food contact surfaces. The number of positive and negative results from both food and environmental samples were cross-tabulated and the calculated Cohen’s kappa coefficient (κ was 0.3233, indicating a fair agreement in terms of Listeria contamination. L. monocytogenes was recovered after cleaning and disinfection procedures in four plants, highlighting the importance of thorough cleaning and disinfection.

Influence of Organic Material and Biofilms on Disinfectant Efficacy Against Listeria monocytogenes

Directory of Open Access Journals (Sweden)

Hilda Nyati

2012-04-01

Full Text Available The effects of organic material and biofilm formation on the efficacy of Suma Tab D4 chlorine tablets and Suma Bac D10 quaternary ammonium compound (QAC against Listeria monocytogenes was determined in suspension and on stainless steel and polystyrene surfaces according to standard disinfectant test methodology. Exposure to 200 and 740 mg L-1 QAC and to 150 mg L-1 active chlorine resulted in a > 5.0 log10 CFU mL-1 and > 5.0 log10 CFU/coupon reduction of six L. monocytogenes strains within one minute, in suspension tests, and on stainless steel surfaces, respectively. Additionally, there was a reduction by as much as 5 log10 CFU/coupon or 5 log10 CFU/well of reference strains EGDe and Scott A biofilms within five minutes on stainless steel and polystyrene surfaces. Organic material, added as bovine serum albumin at 0.3% (w/v completely prevented the inactivation of L. monocytogenes in 150 mg L-1 chlorine, while reductions of only 0.6 +- 0.1 log10 CFU mL-1 were recorded in the presence of UHT milk at 3% (v/v. In contrast, reductions of 5 log10 CFU mL-1 were recorded within one minute on exposure to 740 mg L-1 QAC in the presence of 0.3% (w/v bovine serum albumin and within two minutes in the presence of 20 % (v/v UHT milk. Although Suma D4 chlorine tablets and Suma Bac D10 QAC are effective listericidal agents at recommended concentrations, Suma Tab D4 chlorine efficacy against L. monocytogenes is impaired by the presence of low concentrations of organic material, while Suma Bac D10 QAC maintains its listericidal activity in high organic loads.

Impact of environmental factors on the culturability and viability of Listeria monocytogenes under conditions encountered in food processing plants.

Science.gov (United States)

Overney, Anaïs; Jacques-André-Coquin, Joséphine; Ng, Patricia; Carpentier, Brigitte; Guillier, Laurent; Firmesse, Olivier

2017-03-06

The ability of Listeria monocytogenes to adhere to and persist on surfaces for months or even years may be responsible for its transmission from contaminated surfaces to food products. Hence the necessity to find effective means to prevent the establishment of L. monocytogenes in food processing environments. The aim of this study was to assess, through a fractional experimental design, the environmental factors that could affect the survival of L. monocytogenes cells on surfaces to thereby prevent the persistence of this pathogen in conditions mimicking those encountered in food processing plants: culture with smoked salmon juice or meat exudate, use of two materials with different hygiene status, biofilm of L. monocytogenes in pure-culture or dual-culture with a Pseudomonas fluorescens strain, application of a drying step after cleaning and disinfection (C&D) and comparison of two strains of L. monocytogenes. Bacterial survival was assessed by culture, qPCR to quantify total cells, and propidium monoazide coupled with qPCR to quantify viable cells and highlight viable but non-culturable (VBNC) cells. Our results showed that failure to apply C&D causes cell persistence on surfaces. Moreover, the sanitation procedure leads only to a loss of culturability and appearance of VBNC populations. However, an additional daily drying step after C&D optimises the effectiveness of these procedures to reduce culturable populations. Our results reinforce the importance to use molecular tools to monitor viable pathogens in food processing plants to avoid underestimating the amounts of cells using only methods based on cell culture. Copyright © 2017 Elsevier B.V. All rights reserved.

Growth of Listeria monocytogenes in Camembert and other soft cheeses at refrigeration temperatures.

Science.gov (United States)

Back, J P; Langford, S A; Kroll, R G

1993-08-01

Listeria monocytogenes survived and, under most conditions, multiplied when inoculated directly into the cheese milk of laboratory made Camembert cheeses. The rate and extent of growth was reduced at lower storage temperatures. Significantly higher rates of growth occurred at the surface compared with the centre of the cheeses, and these were probably associated with increased pH and proteolysis at the cheese surface due to the mould ripening process. Similar results were obtained with Camenbert cheeses surface inoculated after manufacture. There was also temperature-dependent growth of List. monocytogenes on a range of inoculated commercially manufactured soft cheeses. Significant growth occurred in Cambazola, French and English Brie, blue and white Lymeswold, French Camembert and Brie with garlic. Little if any growth occurred in blue and white Stilton, Mycella, Chaume and full fat soft cheese with garlic and herbs at the temperatures examined.

TetR-dependent gene regulation in intracellular Listeria monocytogenes demonstrates the spatiotemporal surface distribution of ActA.

Science.gov (United States)

Schmitter, Sibylle; Fieseler, Lars; Klumpp, Jochen; Bertram, Ralph; Loessner, Martin J

2017-08-01

To enable specific and tightly controlled gene expression both in vitro and during the intracellular lifecycle of the pathogen Listeria monocytogenes, a TetR-dependent genetic induction system was developed. Highest concentration of cytoplasmic TetR and best repression of tetO-controlled genes was obtained by tetR expression from the synthetic promoter Pt 17 . Anhydrotetracycline (ATc) as inducer permitted concentration-dependent, fine-tuned expression of genes under control of the tetO operator and a suitable promoter. The actin-polymerizing ActA protein represents a major virulence factor of L. monocytogenes, required for actin-based motility and cell-to-cell spread in infected host cells. To be able to observe its spatial and temporal distribution on intracellular L. monocytogenes cells, conditional mutants featuring actA placed under TetR control were used to infect PtK2 epithelial cells. Following induction at different time intervals, the subsequent recruitment of actin by L. monocytogenes could be monitored. We found that cells displayed functional ActA after approximately 15 min, while formation of polarized actin tail was complete after 90-120 min. At this point, intracellular motility of the induced mutants was indistinguishable from wild-type bacteria. Interestingly, de novo ActA synthesis in intracellular Listeria also demonstrated the temporal, asymmetric redistribution of the membrane-anchored proteins from the lateral walls toward the cell poles. © 2017 John Wiley & Sons Ltd.

Inhibition of Listeria monocytogenes on Ready-to-Eat Meats Using Bacteriocin Mixtures Based on Mode-of-Action

Directory of Open Access Journals (Sweden)

Paul Priyesh Vijayakumar

2017-03-01

Full Text Available Bacteriocin-producing (Bac+ lactic acid bacteria (LAB comprising selected strains of Lactobacillus curvatus, Lactococcus lactis, Pediococcus acidilactici, and Enterococcus faecium and thailandicus were examined for inhibition of Listeria monocytogenes during hotdog challenge studies. The Bac+ strains, or their cell-free supernatants (CFS, were grouped according to mode-of-action (MOA as determined from prior studies. Making a mixture of as many MOAs as possible is a practical way to obtain a potent natural antimicrobial mixture to address L. monocytogenes contamination of RTE meat products (i.e., hotdogs. The heat resistance of the bacteriocins allowed the use of pasteurization to eliminate residual producer cells for use as post-process surface application or their inclusion into hotdog meat emulsion during cooking. The use of Bac+ LAB comprising 3× MOAs directly as co-inoculants on hotdogs was not effective at inhibiting L. monocytogenes. However, the use of multiple MOA Bac+ CFS mixtures in a variety of trials demonstrated the effectiveness of this approach by showing a >2-log decrease of L. monocytogenes in treatment samples and 6–7 log difference vs. controls. These data suggest that surface application of multiple mode-of-action bacteriocin mixtures can provide for an Alternative 2, and possibly Alternative 1, process category as specified by USDA-FSIS for control of L. monocytogenes on RTE meat products.

Rapid detection of Listeria monocytogenes in milk using confocal micro-Raman spectroscopy and chemometric analysis.

Science.gov (United States)

Wang, Junping; Xie, Xinfang; Feng, Jinsong; Chen, Jessica C; Du, Xin-jun; Luo, Jiangzhao; Lu, Xiaonan; Wang, Shuo

2015-07-02

Listeria monocytogenes is a facultatively anaerobic, Gram-positive, rod-shape foodborne bacterium causing invasive infection, listeriosis, in susceptible populations. Rapid and high-throughput detection of this pathogen in dairy products is critical as milk and other dairy products have been implicated as food vehicles in several outbreaks. Here we evaluated confocal micro-Raman spectroscopy (785 nm laser) coupled with chemometric analysis to distinguish six closely related Listeria species, including L. monocytogenes, in both liquid media and milk. Raman spectra of different Listeria species and other bacteria (i.e., Staphylococcus aureus, Salmonella enterica and Escherichia coli) were collected to create two independent databases for detection in media and milk, respectively. Unsupervised chemometric models including principal component analysis and hierarchical cluster analysis were applied to differentiate L. monocytogenes from Listeria and other bacteria. To further evaluate the performance and reliability of unsupervised chemometric analyses, supervised chemometrics were performed, including two discriminant analyses (DA) and soft independent modeling of class analogies (SIMCA). By analyzing Raman spectra via two DA-based chemometric models, average identification accuracies of 97.78% and 98.33% for L. monocytogenes in media, and 95.28% and 96.11% in milk were obtained, respectively. SIMCA analysis also resulted in satisfied average classification accuracies (over 93% in both media and milk). This Raman spectroscopic-based detection of L. monocytogenes in media and milk can be finished within a few hours and requires no extensive sample preparation. Copyright © 2015 Elsevier B.V. All rights reserved.

Listeria monocytogenes behaviour in presence of non-UV-irradiated titanium dioxide nanoparticles.

Directory of Open Access Journals (Sweden)

Maria Grazia Ammendolia

Full Text Available Listeria monocytogenes is the agent of listeriosis, a food-borne disease. It represents a serious problem for the food industry because of its environmental persistence mainly due to its ability to form biofilm on a variety of surfaces. Microrganisms attached on the surfaces are a potential source of contamination for environment and animals and humans. Titanium dioxide nanoparticles (TiO2 NPs are used in food industry in a variety of products and it was reported that daily exposure to these nanomaterials is very high. Anti-listerial activity of TiO2 NPs was investigated only with UV-irradiated nanomaterials, based on generation of reactive oxigen species (ROS with antibacterial effect after UV exposure. Since both Listeria monocytogenes and TiO2 NPs are veicolated with foods, this study explores the interaction between Listeria monocytogenes and non UV-irradiated TiO2 NPs, with special focus on biofilm formation and intestinal cell interaction. Scanning electron microscopy and quantitative measurements of biofilm mass indicate that NPs influence both production and structural architecture of listerial biofilm. Moreover, TiO2 NPs show to interfere with bacterial interaction to intestinal cells. Increased biofilm production due to TiO2 NPs exposure may favour bacterial survival in environment and its transmission to animal and human hosts.

Purification of leucocin A for use on wieners to inhibit Listeria monocytogenes in the presence of spoilage organisms.

Science.gov (United States)

Balay, Danielle R; Dangeti, Ramana V; Kaur, Kamaljit; McMullen, Lynn M

2017-08-16

The aims of this study were to improve the method for purification of leucocin A to increase yield of peptide and to evaluate the efficacy of leucocin A and an analogue of leucocin A (leucocin N17L) to inhibit the growth of Listeria monocytogenes on wieners in the presence of spoilage organisms. Leucocin A was produced by Leuconostoc gelidum UAL187 and purified with a five-fold increase in yield; leucocin N17L was synthesized replacing asparagine at residue 17 with leucine. Five strains of L. monocytogenes associated with foodborne illness were used to assess bacteriocin efficacy in vitro and in situ. Minimum inhibitory concentrations could not be determined in broth; however, on agar the minimum inhibitory concentrations ranged from 11.7-62.5μM and 62.5->500μM for leucocin A and leucocin N17L, respectively. Leucocin N17L was less effective than the native bacteriocin at controlling the growth of L. monocytogenes. The inactivation profiles of L. monocytogenes in broth in the presence of leucocin A suggested each isolate had different levels of resistance to the bacteriocin as determined by the initial bactericidal effect. The formation of spontaneously resistance subpopulations were also observed for each strain of L. monocytogenes. In situ, wieners were inoculated with the spoilage organisms, Carnobacterium divergens and Brochothrix thermosphacta, followed by surface application of purified leucocin A, and inoculated with a cocktail of L. monocytogenes. Wieners were vacuum packaged and stored at 7°C for 16d. Leucocin A reduced the counts L. monocytogenes on wieners during storage, regardless of the presence of C. divergens. B. thermosphacta was unaffected by the presence of leucocin A on wieners over the duration of storage. This study suggests that leucocin A may be beneficial to industry as a surface application on wieners to help reduce L. monocytogenes counts due to post-processing contamination even in the presence of spoilage organisms. However, further

Influence of flow direction and flow rate on the initial adhesion of seven Listeria monocytogenes strains to fine polished stainless steel

DEFF Research Database (Denmark)

Skovager, Anne; Whitehead, Kathryn; Siegumfeldt, Henrik

2012-01-01

The effects of flow direction and shear stress on the adhesion of different strains of Listeria monocytogenes to fine polished stainless steel under liquid flow conditions were investigated. Furthermore, the relationship between cell surface properties and cell size and the initial adhesion rate...... (IAR) was studied. A method, including fluorescence microscopy and a flow perfusion system, was developed and used to examine the real-time initial cell adhesion of different L. monocytogenes species in situ to opaque surfaces under flow conditions. The results demonstrated that shear stress...... was the determining factor for the initial adhesion of L. monocytogenes under flow conditions. The flow direction in relation to the orientation of surface features (the scratches) could be disregarded. IARs were dependent on the shear stress and strain type. The strain EGDe, which had the lowest IAR, had the largest...

Occurrence of Listeria monocytogenes in smoked fish in Sokoto ...

African Journals Online (AJOL)

STORAGESEVER

2008-09-03

Sep 3, 2008 ... monocytogenes and other Listeria species are common contaminant of smoked fish, and this may pose serious public health implications. Key words: Smoked fish, Listeria monocytogenes, contamination, public health. INTRODUCTION ... L. monocytogenes belong to the recently emerging psychrotrophic ...

In vivo transcriptional profiling of Listeria monocytogenes and mutagenesis identify new virulence factors involved in infection.

Directory of Open Access Journals (Sweden)

Ana Camejo

2009-05-01

Full Text Available Listeria monocytogenes is a human intracellular pathogen able to colonize host tissues after ingestion of contaminated food, causing severe invasive infections. In order to gain a better understanding of the nature of host-pathogen interactions, we studied the L. monocytogenes genome expression during mouse infection. In the spleen of infected mice, approximately 20% of the Listeria genome is differentially expressed, essentially through gene activation, as compared to exponential growth in rich broth medium. Data presented here show that, during infection, Listeria is in an active multiplication phase, as revealed by the high expression of genes involved in replication, cell division and multiplication. In vivo bacterial growth requires increased expression of genes involved in adaptation of the bacterial metabolism and stress responses, in particular to oxidative stress. Listeria interaction with its host induces cell wall metabolism and surface expression of virulence factors. During infection, L. monocytogenes also activates subversion mechanisms of host defenses, including resistance to cationic peptides, peptidoglycan modifications and release of muramyl peptides. We show that the in vivo differential expression of the Listeria genome is coordinated by a complex regulatory network, with a central role for the PrfA-SigB interplay. In particular, L. monocytogenes up regulates in vivo the two major virulence regulators, PrfA and VirR, and their downstream effectors. Mutagenesis of in vivo induced genes allowed the identification of novel L. monocytogenes virulence factors, including an LPXTG surface protein, suggesting a role for S-layer glycoproteins and for cadmium efflux system in Listeria virulence.

Acanthamoeba feature a unique backpacking strategy to trap and feed on Listeria monocytogenes and other motile bacteria

DEFF Research Database (Denmark)

Doyscher, Dominik; Fieseler, Lars; Dons, Lone Elisabet

2013-01-01

Despite its prominent role as an intracellular human pathogen, Listeria monocytogenes normally features a saprophytic lifestyle, and shares many environmental habitats with predatory protozoa. Earlier studies claimed that Acanthamoeba may act as environmental reservoirs for L.?monocytogenes, wher......Despite its prominent role as an intracellular human pathogen, Listeria monocytogenes normally features a saprophytic lifestyle, and shares many environmental habitats with predatory protozoa. Earlier studies claimed that Acanthamoeba may act as environmental reservoirs for L.......?monocytogenes, whereas others failed to confirm this hypothesis. Our findings support the latter and provide clear evidence that L.?monocytogenes is unable to persist in Acanthamoeba castellanii and A.?polyphaga. Instead, external Listeria cells are rapidly immobilized on the surface of Acanthamoeba trophozoites......-lapse microscopy revealed that shortly after the bacteria are collected, the amoeba can change direction of movement, phagocytose the backpack and continue to repeat the process. The phenomenon was also observed with avirulent L.?monocytogenes mutants, non-pathogenic Listeria, and other motile bacteria, indicating...

Evaluation of Listeria monocytogenes survival and infectivity in non-traditional agricultural waters

Science.gov (United States)

Introduction: Listeria monocytogenes (Lm) is an enteric bacterium that can be found in environmental reservoirs. Restricted water availability for agriculture has increased interest in surface and reuse water sources which could potentially transmit Lm. Purpose: Persistence and infectivity of Lm re...

Listeria monocytogenes infection in pregnancy and neonatal sepsis

Directory of Open Access Journals (Sweden)

Francesca Pascale

2008-06-01

Full Text Available Authors report a fatal neonatal sepsis caused by Listeria monocytogenes. While the diagnostic procedure aimed to identify the microrganism is described, it is emphasized the importance to recover Streptococcus agalactiae (GBS and L. monocytogenes by means of vaginal-rectal swab culture. The intrapartum screening for L. monocytogenes, by Polymerase Chain Reaction (PCR providing results in 75 minutes is also evaluated.

Control of Listeria monocytogenes in food production plants

Directory of Open Access Journals (Sweden)

Dimitrijević Mirjana

2008-01-01

Full Text Available L. monocytogenes has been established in different plants for the production of food, including dairy plants, abattoirs, plants for the processing of fish, as well as those for the production of ready-to-eat (RTE food and this fact is being considered as the primary mechanism of food contamination with this bacteria. There is also the factor of numerous and diverse contaminated production equipment, because it has certain parts that are inaccessible for the necessary cleaning and disinfection. The temperature, position, as well as the material of the work surface are also linked to the contamination of plants with this bacteria. Investigations carried out so far have helped toward the better understanding of the manner and time of contamination of food items in the course of the production process, but there are still unresolved problems, including most certainly the biggest one - the adherence of bacteria and the creation of a biofilm, when the bacteria is in that condition more resistant to so-called stress factors which are usually used in the food industry for the purpose of decontamination of the surfaces with which foods come into contact. The control of L. monocytogenes in food production plants is possible primarily by using an integrated programme, compatible with the systems Hazard Analysis Critical Control Point (HACCP and Good Hygiene Practice (GHP, necessary in the production of food that is safe for the consumer. Essentially, the control measures that can contribute to reducing the incidence of findings of L.monocytogenes in the finished product, as well as the reducing of the level of contamination with this bacteria are linked, on the one hand, with hygiene procedures in the production process, and, on the other, with the applied technological procedures.

Listeria monocytogenes serovar 4a is a possible evolutionary intermediate between L. monocytogenes serovars 1/2a and 4b and L. innocua.

Science.gov (United States)

Chen, Jianshun; Jiang, Lingli; Chen, Xueyan; Luo, Xiaokai; Chen, Yang; Yu, Ying; Tian, Guoming; Liu, Dongyou; Fang, Weihuan

2009-03-01

The genus Listeria consists of six closely related species and forms three phylogenetic groups: L. monocytogenes- L. innocua, L. ivanovii-L. seeligeri-L. welshimeri, and L. grayi. In this report, we attempted to examine the evolutionary relationship in the L. monocytogenes-L. innocua group by probing the nucleotide sequences of 23S rRNA and 16S rRNA, and the gene clusters lmo0029-lmo0042, ascBdapE, rplS-infC, and prs-ldh in L. monocytogenes serovars 1/2a, 4a, and 4b, and L. innocua. Additionally, we assessed the status of L. monocytogenes-specific inlA and inlB genes and 10 L. innocua-specific genes in these species/serovars, together with phenotypic characterization by using in vivo and in vitro procedures. The results indicate that L. monocytogenes serovar 4a strains are genetically similar to L. innocua in the lmo0035-lmo0042, ascB-dapE, and rplS-infC regions and also possess L. innocua-specific genes lin0372 and lin1073. Furthermore, both L. monocytogenes serovar 4a and L. innocua exhibit impaired intercellular spread ability and negligible pathogenicity in mouse model. On the other hand, despite resembling L. monocytogenes serovars 1/2a and 4b in having a nearly identical virulence gene cluster, and inlA and inlB genes, these serovar 4a strains differ from serovars 1/2a and 4b by harboring notably altered actA and plcB genes, displaying strong phospholipase activity and subdued in vivo and in vitro virulence. Thus, by possessing many genes common to L. monocytogenes serovars 1/2a and 4b, and sharing many similar gene deletions with L. innocua, L. monocytogenes serovar 4a represents a possible evolutionary intermediate between L. monocytogenes serovars 1/2a and 4b and L. innocua.

Influence of freezing stress on morphological alteration and biofilm formation by Listeria monocytogenes: relationship with cell surface hydrophobicity and membrane fluidity.

Science.gov (United States)

Miladi, Hanene; Ammar, Emna; Ben Slama, Rihab; Sakly, Nawfel; Bakhrouf, Amina

2013-11-01

The morphological changes and adhesive property of three Listeria monocytogenes strains submitted to freezing stress (-20 °C) were studied. The atomic force micrographs showed a reduction in the cell size and an evolution to coccoid shape. The phenotypic slime production of L. monocytogenes and the expression of the adhesive gene were investigated before and after 10 months of incubation in salmon at -20°. Our results showed that after ten months, stressed stains become more adherent and able to produce slime. In addition, we noted that this pathogen presents same physiological changes to adapt to starvation conditions. The cellular fatty acids composition of adhered and floating cells of three L. monocytogenes strains was taken into consideration. The stressed strains presented different chain lengths and therefore an increase in the hydrophobicity level. Moreover, we noted that the adhesive property of L. monocytogenes strains affects the Benzalkonium chloride bacterial sensitivity which increased after biofilm formation.

Lo uno y lo diverso

Directory of Open Access Journals (Sweden)

José Rojas Bez

2015-01-01

Full Text Available El arte no solo tiene ese poder para agudizar las miradas Toda creación, apreciación y educación artística está vinculada a una observación y comprensión más incisiva y honda del hombre y del mundo. Al arte y a la educación estética corresponde, pues, un importante papel en esta rica dialéctica entre lo singular y lo universal, en la creación y apreciación de lo uno en lo diverso y de la diversidad en la unidad.

Morphological change and decreasing transfer rate of biofilm-featured Listeria monocytogenes EGDe

Science.gov (United States)

Listeria monocytogenes, a lethal foodborne pathogen, has the ability to resist the hostile food-processing environment and, thus, frequently contaminates ready-to-eat foods during processing. It is commonly accepted that L. monocytogenes’ tendency to generate biofilms on various surfaces enhances it...

78 FR 27939 - Draft Interagency Risk Assessment-Listeria monocytogenes

Science.gov (United States)

2013-05-13

... Listeria (L.) monocytogenes contamination of certain ready-to-eat (RTE) foods, for example cheese, deli... Scott, V.N., Survey of Listeria monocytogenes in ready-to-eat foods. Journal of Food Protection, 2003... monocytogenes in ready-to-eat processed meat and poultry collected in four FoodNet states in International...

Presence of Listeria monocytogenes in Mediterranean-Style Dry Fermented Sausages

Directory of Open Access Journals (Sweden)

Domenico Meloni

2015-03-01

Full Text Available The morphological, physiological and epidemiological features of L. monocytogenes, together with the severity of human listeriosis infections, make L. monocytogenes of particular concern for manufacturers of cold-stored “ready to eat” (RTE foods. L. monocytogenes has been isolated from a wide variety of RTE foods and is responsible for several outbreaks associated with the consumption of RTE meat, poultry, dairy, fish and vegetable products. Although L. monocytogenes is among the most frequently-detected pathogens in dry fermented sausages, these products could be included in the category of RTE products in which the growth of L. monocytogenes is not favored and have rarely been implicated in listeriosis outbreaks. However, L. monocytogenes is highly difficult to control in fermented sausage processing environments due to its high tolerance to low pH and high salt concentration. In many Mediterranean-style dry fermented sausages, an empirical application of the hurdle technology often occurs and the frequent detection of L. monocytogenes in these products at the end of ripening highlights the need for food business operators to properly apply hurdle technology and to control the contamination routes of L. monocytogenes in the processing plants. In the following, through an up-to-date review of (personal and un- published data, the main aspects of the presence of L. monocytogenes in Mediterranean-style dry fermented sausages will be discussed.

Presence of Listeria monocytogenes in Mediterranean-Style Dry Fermented Sausages.

Science.gov (United States)

Meloni, Domenico

2015-03-12

The morphological, physiological and epidemiological features of L. monocytogenes , together with the severity of human listeriosis infections, make L. monocytogenes of particular concern for manufacturers of cold-stored "ready to eat" (RTE) foods. L. monocytogenes has been isolated from a wide variety of RTE foods and is responsible for several outbreaks associated with the consumption of RTE meat, poultry, dairy, fish and vegetable products. Although L. monocytogenes is among the most frequently-detected pathogens in dry fermented sausages, these products could be included in the category of RTE products in which the growth of L. monocytogenes is not favored and have rarely been implicated in listeriosis outbreaks. However, L. monocytogenes is highly difficult to control in fermented sausage processing environments due to its high tolerance to low pH and high salt concentration. In many Mediterranean-style dry fermented sausages, an empirical application of the hurdle technology often occurs and the frequent detection of L. monocytogenes in these products at the end of ripening highlights the need for food business operators to properly apply hurdle technology and to control the contamination routes of L. monocytogenes in the processing plants. In the following, through an up-to-date review of (personal and un-) published data, the main aspects of the presence of L. monocytogenes in Mediterranean-style dry fermented sausages will be discussed.

Incorporation of Listeria monocytogenes strains in raw milk biofilms.

Science.gov (United States)

Weiler, Christiane; Ifland, Andrea; Naumann, Annette; Kleta, Sylvia; Noll, Matthias

2013-02-01

Biofilms develop successively on devices of milk production without sufficient cleaning and originate from the microbial community of raw milk. The established biofilm matrices enable incorporation of pathogens like Listeria monocytogenes, which can cause a continuous contamination of food processing plants. L. monocytogenes is frequently found in raw milk and non-pasteurized raw milk products and as part of a biofilm community in milk meters and bulk milk tanks. The aim of this study was to analyze whether different L. monocytogenes strains are interacting with the microbial community of raw milk in terms of biofilm formation in the same manner, and to identify at which stage of biofilm formation a selected L. monocytogenes strain settles best. Bacterial community structure and composition of biofilms were analyzed by a cloning and sequencing approach and terminal restriction fragment length polymorphism analysis (T-RFLP) based on the bacterial 16S rRNA gene. The chemical composition of biofilms was analyzed by Fourier transform infrared spectroscopy (FTIR), while settled L. monocytogenes cells were quantified by fluorescence in situ hybridization (FISH). Addition of individual L. monocytogenes strains to raw milk caused significant shifts in the biofilm biomass, in the chemical as well as in the bacterial community composition. Biofilm formation and attachment of L. monocytogenes cells were not serotype but strain specific. However, the added L. monocytogenes strains were not abundant since mainly members of the genera Citrobacter and Lactococcus dominated the bacterial biofilm community. Overall, added L. monocytogenes strains led to a highly competitive interaction with the raw milk community and triggered alterations in biofilm formation. Copyright © 2012 Elsevier B.V. All rights reserved.

Listeria monocytogenes as a vector for anti-cancer therapies.

LENUS (Irish Health Repository)

Tangney, Mark

2012-01-31

The intracellular pathogen Listeria monocytogenes represents a promising therapeutic vector for the delivery of DNA, RNA or protein to cancer cells or to prime immune responses against tumour-specific antigens. A number of biological properties make L. monocytogenes a promising platform for development as a vector for either gene therapy or as an anti-cancer vaccine vector. L. monocytogenes is particularly efficient in mediating internalization into host cells. Once inside cells, the bacterium produces specific virulence factors which lyse the vaculolar membrane and allow escape into the cytoplasm. Once in the cytosol, L. monocytogenes is capable of actin-based motility and cell-to-cell spread without an extracellular phase. The cytoplasmic location of L. monocytogenes is significant as this potentiates entry of antigens into the MHC Class I antigen processing pathway leading to priming of specific CD8(+) T cell responses. The cytoplasmic location is also beneficial for the delivery of DNA (bactofection) by L. monocytogenes whilst cell-to-cell spread may facilitate access of the vector to cells throughout the tumour. Several preclinical studies have demonstrated the ability of L. monocytogenes for intracellular gene or protein delivery in vitro and in vivo, and this vector has also displayed safety and efficacy in clinical trial. Here, we review the features of the L. monocytogenes host-pathogen interaction that make this bacterium such an attractive candidate with which to induce appropriate therapeutic responses. We focus primarily upon work that has led to attenuation of the pathogen, demonstrated DNA, RNA or protein delivery to tumour cells as well as research that shows the efficacy of L. monocytogenes as a vector for tumour-specific vaccine delivery.

Survival of Salmonella, Escherichia coli O157:H7, and Listeria monocytogenes on raw peanut and pecan kernels stored at -24, 4, and 22°C.

Science.gov (United States)

Brar, Pardeepinder K; Proano, Lisseth G; Friedrich, Loretta M; Harris, Linda J; Danyluk, Michelle D

2015-02-01

Cocktails of lawn-collected cells were used to determine the survival of Salmonella, Escherichia coli O157:H7, and Listeria monocytogenes on the surface of raw peanut and pecan kernels. Kernels were inoculated with mixtures of four to five strains at 3 or 6 log CFU/g, dried at room temperature, and then stored at -24 ± 1, 4 ± 2, and 22 ± 1°C for 28 or 365 days. In most cases, rates of decline of the pathogens did not differ significantly between the two inoculum concentrations in the 28-day study. At 6 log CFU/g, populations of all pathogens were reduced by 0.5 to 1.6 log CFU/g during an initial 3-day drying period on both peanuts and pecans. The moisture content of peanuts and pecans remained stable at -24 ± 1 and 22 ± 1°C; at 4 ± 2°C, the moisture content increased from 3.8 to 5.6% on peanuts and from 2.6 to 3% on pecans over 365 days. Pathogen populations were stable on pecans stored under frozen and refrigerated conditions, except for L. monocytogenes, which declined at a rate of 0.03 log CFU/g/30 days at 4 ± 2°C. Salmonella populations were stable on peanuts stored at -24 ± 1 and 4 ± 2°C, but E. coli O157:H7 and L. monocytogenes declined at rates of 0.03 to 0.12 log CFU/g/30 days. At 22 ± 1°C, Salmonella, E. coli O157:H7, and L. monocytogenes declined at a rate of 0.22, 0.37, and 0.59 log CFU/g/30 days, respectively, on peanuts, and at 0.15, 0.34, and 1.17 log CFU/g/30 days, respectively, on pecans. Salmonella counts were above the limit of detection (0.30 log CFU/g) throughout the study. In most cases during storage, counts obtained from pecans were higher than from peanuts.

Molecular Characterization and Phylogenetic Analysis of Listeria monocytogenes Isolated from Milk and Milk Products in Kaduna, Nigeria

Directory of Open Access Journals (Sweden)

U. B. Usman

2016-01-01

Full Text Available In this study, Listeria (L. monocytogenes isolated from milk and milk products in Kaduna, Nigeria, were subjected to a multiplex PCR assay to identify virulence-associated genes (such as prf A, inl A, hly A, act A, and iap. Of the 36 isolates, 9 (25% were positive for one or two virulence-associated genes. Based on the sample type, 6 (16.9% of the isolates that possessed virulence-associated genes were obtained from raw milk, 2 (3.2% from “Manshanu,” and 1 (2.8% from “Kindrimo.” Sequence and phylogenetic analysis based on the 16S rRNA revealed that Nigerian L. monocytogenes isolates (NGA 34A, NGA 35A, NGA 41A, and NGA 38A, when compared with reference L. monocytogenes, were grouped into two distinct clusters, A and B, with sequence (NGA 34A, NGA 35A, and NGA 41A phylogenetically closer to J1776; N1-011A; R2-502; J1816; and J2-031, whereas L. monocytogenes isolate (NGA 38A clustered with EDG; J1-220; J1926; J1817; and J2-1091. The separation of the Nigerian L. monocytogenes isolates into linage A (responsible for epidemic listeriosis and lineage B (responsible for sporadic cases of listeriosis is of public health concern and that local isolates might have potentials for human food borne listeriosis based on the virulence factors so far identified.

Prevalence and growth of Listeria monocytogenes in naturally contaminated seafood

DEFF Research Database (Denmark)

Jørgensen, Lasse Vigel; Huss, Hans Henrik

1998-01-01

Listeria monocytogenes contamination of seafood varies with product category. The highest prevalence was found in cold- smoked fish (34-60%), while the lowest was found in heat- treated and cured seafood (4-12%). The prevalence of L. monocytogenes differed greatly in cold-smoked salmon between...... production sites, ranging from monocytogenes. The organism showed moderate growth...... in naturally contaminated cold-smoked, and 'gravad', fish while the growth appeared faster in hot smoked fish. Thus L. monocytogenes is not under control in these products. Finally, the prevalence and growth of L. monocytogenes in naturally contaminated cold-smoked salmon are discussed in relation...

Listeria monocytogenes endophthalmitis following keratoconjunctivitis

Directory of Open Access Journals (Sweden)

Shoughy SS

2014-01-01

Full Text Available Samir S Shoughy,1 Khalid F Tabbara1–31The Eye Center and The Eye Foundation for Research in Ophthalmology, Riyadh, Saudi Arabia; 2Department of Ophthalmology, College of Medicine, King Saud University, Riyadh, Saudi Arabia; 3The Wilmer Ophthalmological Institute of The Johns Hopkins University School of Medicine, Baltimore, MD, USAAbstract: Endophthalmitis due to endogenous or exogenous bacteria is a rare infection of the eye. We report a case of endophthalmitis following Listeria monocytogenes keratoconjunctivitis in a 27-year-old healthy white male presenting with hand motion visual acuity, right eye mucopurulent conjunctivitis, elevated intraocular pressure, and pigmented hypopyon 6 months post-keratectomy. The conjunctivitis was unresponsive to a 5-day course of topical tobramycin eye drops, and the patient developed keratitis with pain that progressed to endophthalmitis after 21 days. Diagnostic B-scan revealed vitreous exudates. Intraocular fluid specimen showed Gram-positive organisms and the aqueous culture grew penicillin-/aminoglycoside-sensitive L. monocytogenes. The patient was given intravitreal and systemic vancomycin and ceftazidime. The eye was unresponsive to intravenous penicillin and gentamicin; the anterior chamber progressively flattened and developed phthisis bulbi. L. monocytogenes keratoconjunctivitis may lead to bacterial endophthalmitis. Prompt culture and early antibiotic therapy are recommended.Keywords: conjunctivitis, L. monocytogenes, endophthalmitis

Listeria monocytogenes Prevalence and Characteristics in Retail Raw Foods in China.

Science.gov (United States)

Wu, Shi; Wu, Qingping; Zhang, Jumei; Chen, Moutong; Yan, Ze An; Hu, Huijuan

2015-01-01

The prevalence and levels of Listeria monocytogenes in retail raw foods covering most provincial capitals in China were studied with testing of 1036 samples of vegetables, edible mushrooms, raw meat, aquatic products and quick-frozen products from September 2012 to January 2014. The total prevalence of Listeria monocytogenes was 20.0% (207/1036), and the most probable number (MPN) values of 65.7% of the positive samples ranged from 0.3 to 110 MPN/g. Geographical differences were observed in this survey, and the results of both qualitative and quantitative methods indicated that the levels in the samples from North China were higher than those in the samples from South China. A total of 248 isolates were analyzed, of which approximately half belonged to molecular serogroup 1/2a-3a (45.2%), followed by 1/2b-3b-7 (30.6%), 1/2c-3c (16.1%), 4b-4d-4e (5.2%) and 4a-4c (2.8%). Most of the isolates carried hly (100%), inlB (98.8%), inlA (99.6%), inlC (98.0%) and inlJ (99.2%), and 44.8% of the isolates were llsX-positive. Seventeen epidemic clones (ECs) were detected, with 7 strains belonging to ECI (2.8%) and 10 belonging to ECIII (4.03%). Resistance to clindamycin (46.8%) was commonly observed, and 59 strains (23.8%) were susceptible to all 14 tested antibiotics, whereas 84 (33.9%) showed an intermediate level of resistance or were resistant to two or more antibiotics, including 7 multi-resistant strains that exhibited resistance to more than 10 antibiotics. The data obtained in the present study provides useful information for assessment of the possible risk posed to Chinese consumers, and this information will have a significant public health impact in China. Furthermore, the presence of virulence markers, epidemic clones, as well as the antibiotic resistance amongst the isolates strongly implies that many of these strains might be capable of causing listeriosis, and more accurate treatment of human listeriosis with effective antibiotics should be considered. This

Listeria monocytogenes Prevalence and Characteristics in Retail Raw Foods in China.

Directory of Open Access Journals (Sweden)

Shi Wu

Full Text Available The prevalence and levels of Listeria monocytogenes in retail raw foods covering most provincial capitals in China were studied with testing of 1036 samples of vegetables, edible mushrooms, raw meat, aquatic products and quick-frozen products from September 2012 to January 2014. The total prevalence of Listeria monocytogenes was 20.0% (207/1036, and the most probable number (MPN values of 65.7% of the positive samples ranged from 0.3 to 110 MPN/g. Geographical differences were observed in this survey, and the results of both qualitative and quantitative methods indicated that the levels in the samples from North China were higher than those in the samples from South China. A total of 248 isolates were analyzed, of which approximately half belonged to molecular serogroup 1/2a-3a (45.2%, followed by 1/2b-3b-7 (30.6%, 1/2c-3c (16.1%, 4b-4d-4e (5.2% and 4a-4c (2.8%. Most of the isolates carried hly (100%, inlB (98.8%, inlA (99.6%, inlC (98.0% and inlJ (99.2%, and 44.8% of the isolates were llsX-positive. Seventeen epidemic clones (ECs were detected, with 7 strains belonging to ECI (2.8% and 10 belonging to ECIII (4.03%. Resistance to clindamycin (46.8% was commonly observed, and 59 strains (23.8% were susceptible to all 14 tested antibiotics, whereas 84 (33.9% showed an intermediate level of resistance or were resistant to two or more antibiotics, including 7 multi-resistant strains that exhibited resistance to more than 10 antibiotics. The data obtained in the present study provides useful information for assessment of the possible risk posed to Chinese consumers, and this information will have a significant public health impact in China. Furthermore, the presence of virulence markers, epidemic clones, as well as the antibiotic resistance amongst the isolates strongly implies that many of these strains might be capable of causing listeriosis, and more accurate treatment of human listeriosis with effective antibiotics should be considered. This

Listeria monocytogenes Prevalence and Characteristics in Retail Raw Foods in China

Science.gov (United States)

Wu, Shi; Wu, Qingping; Zhang, Jumei; Chen, Moutong; Yan, Ze′an; Hu, Huijuan

2015-01-01

The prevalence and levels of Listeria monocytogenes in retail raw foods covering most provincial capitals in China were studied with testing of 1036 samples of vegetables, edible mushrooms, raw meat, aquatic products and quick-frozen products from September 2012 to January 2014. The total prevalence of Listeria monocytogenes was 20.0% (207/1036), and the most probable number (MPN) values of 65.7% of the positive samples ranged from 0.3 to 110 MPN/g. Geographical differences were observed in this survey, and the results of both qualitative and quantitative methods indicated that the levels in the samples from North China were higher than those in the samples from South China. A total of 248 isolates were analyzed, of which approximately half belonged to molecular serogroup 1/2a-3a (45.2%), followed by 1/2b-3b-7 (30.6%), 1/2c-3c (16.1%), 4b-4d-4e (5.2%) and 4a-4c (2.8%). Most of the isolates carried hly (100%), inlB (98.8%), inlA (99.6%), inlC (98.0%) and inlJ (99.2%), and 44.8% of the isolates were llsX-positive. Seventeen epidemic clones (ECs) were detected, with 7 strains belonging to ECI (2.8%) and 10 belonging to ECIII (4.03%). Resistance to clindamycin (46.8%) was commonly observed, and 59 strains (23.8%) were susceptible to all 14 tested antibiotics, whereas 84 (33.9%) showed an intermediate level of resistance or were resistant to two or more antibiotics, including 7 multi-resistant strains that exhibited resistance to more than 10 antibiotics. The data obtained in the present study provides useful information for assessment of the possible risk posed to Chinese consumers, and this information will have a significant public health impact in China. Furthermore, the presence of virulence markers, epidemic clones, as well as the antibiotic resistance amongst the isolates strongly implies that many of these strains might be capable of causing listeriosis, and more accurate treatment of human listeriosis with effective antibiotics should be considered. This

The Efficiency of UVC Radiation in the Inactivation of Listeria monocytogenes on Beef-Agar Food Models

Directory of Open Access Journals (Sweden)

Christian James

2015-01-01

Full Text Available The aim of this study is to evaluate the eff ect of meat content and surface smoothness on the deactivation of Listeria monocytogenes in beef-agar food models achieved by shortwave ultraviolet (UVC light. Food models with various meat contents were made using chopped beef slices and agar solution. Prepared models together with a Listeria selective agar (LSA plate and a slice of cooked beef were inoculated with L. monocytogenes and then exposed to UVC light. Population of Listeria reduced to below the level of detection on the LSA plates. As the content of beef in the beef-agar models increased, more L. monocytogenes cells survived. Survival was greatest on the treated cooked slice of beef. To bett er understand the effect of surface irregularities, a white light interferometer was used to analyse the surface smoothness of beef-agar media and LSA plates. No correlation was observed between the surface roughness of seven out of nine types of produced beef-agar media and the degree of inactivation resulting from UVC radiation at the given dose, whereas, less bacterial cells were killed as beef content of the food models increased. The findings of the current study show that the chemical composition of the treated sample also plays an important role in pathogen resistance and survival, meaning that two samples with similar surface irregularities but diff erent chemical composition might produce very diff erent inactivation results when exposed to UVC light.

BIOCHEMICAL AND MOLECULAR CHARACTERISTICS OF LISTERIA MONOCYTOGENES ISOLATES FROM A PROSTHETIC MITRAL HEART VALVE-BEARING PATIENT´S BLOOD CULTURES

Directory of Open Access Journals (Sweden)

Nilma Cintra Lea

2013-09-01

Full Text Available Background: In Brazil, listeriosis is not a notifiable disease; thus, the incidence of Brazilian cases remains unknown. Listeria monocytogenes is not always included in automated systems, and its detection depends on the high skill level of microbiology laboratory professionals. This paper describes the characteristics of L. monocytogenes isolates fortuitously obtained from an endocarditis case in Recife, PE, Brazil. Methods: Six bacterial isolates obtained from six blood cultures from a 28-year-old male bearing a prosthetic mitral heart valve were analyzed by PCR using primers specific of L. monocytogenes to confirm a presumptive identification, determine the serotype and presence of the virulence genes (inlA, inlB, inlC, inlJ, hly, plcA, actA, prfA in an attempt to determine the Listeria genotype by PCR-ribotyping. Results: The samples were identified as L. monocytogenes 4b. All investigated virulence genes were amplified by PCR, and the identity of the amplified segments was confirmed by sequencing. A deletion of 105 base pairs was detected in the actA gene. All of the samples generated the same PCR-ribotype pattern, clustered into a single ribotype, and were considered a single strain. Conclusion: L. monocytogenes infection should be considered in endocarditis differential diagnoses, especially among high-risk groups, due to its high pathogenicity and the environmental ubiquity.

Listeria monocytogenes alters mast cell phenotype, mediator and osteopontin secretion in a listeriolysin-dependent manner.

Directory of Open Access Journals (Sweden)

Catherine E Jobbings

Full Text Available Whilst mast cells participate in the immune defence against the intracellular bacterium Listeria monocytogenes, there is conflicting evidence regarding the ability of L. monocytogenes to infect mast cells. It is known that the pore-forming toxin listeriolysin (LLO is important for mast cell activation, degranulation and the release of pro-inflammatory cytokines. Mast cells, however, are a potential source of a wide range of cytokines, chemokines and other mediators including osteopontin, which contributes to the clearing of L. monocytogenes infections in vivo, although its source is unknown. We therefore aimed to resolve the controversy of mast cell infection by L. monocytogenes and investigated the extent of mediator release in response to the bacterium. In this paper we show that the infection of bone marrow-derived mast cells by L. monocytogenes is inefficient and LLO-independent. LLO, however, is required for calcium-independent mast cell degranulation as well as for the transient and selective downregulation of cell surface CD117 (c-kit on mast cells. We demonstrate that in addition to the key pro-inflammatory cytokines TNF-α and IL-6, mast cells release a wide range of other mediators in response to L. monocytogenes. Osteopontin, IL-2, IL-4, IL-13 and granulocyte macrophage colony-stimulating factor (GM-CSF, and chemokines including CCL2, CCL3, CCL4 and CCL5 are released in a MyD88-dependent manner. The wide range of mediators released by mast cells in response to L. monocytogenes may play an important role in the recruitment and activation of a variety of immune cells in vivo. The cocktail of mediators, however, is unlikely to skew the immune response to a particular effector response. We propose that mast cells provide a hitherto unreported source of osteopontin, and may provide an important role in co-ordinating the immune response during Listeria infection.

Listeria monocytogenes endophthalmitis following keratoconjunctivitis.

Science.gov (United States)

Shoughy, Samir S; Tabbara, Khalid F

2014-01-01

Endophthalmitis due to endogenous or exogenous bacteria is a rare infection of the eye. We report a case of endophthalmitis following Listeria monocytogenes keratoconjunctivitis in a 27-year-old healthy white male presenting with hand motion visual acuity, right eye mucopurulent conjunctivitis, elevated intraocular pressure, and pigmented hypopyon 6 months post-keratectomy. The conjunctivitis was unresponsive to a 5-day course of topical tobramycin eye drops, and the patient developed keratitis with pain that progressed to endophthalmitis after 21 days. Diagnostic B-scan revealed vitreous exudates. Intraocular fluid specimen showed Gram-positive organisms and the aqueous culture grew penicillin-/aminoglycoside-sensitive L. monocytogenes. The patient was given intravitreal and systemic vancomycin and ceftazidime. The eye was unresponsive to intravenous penicillin and gentamicin; the anterior chamber progressively flattened and developed phthisis bulbi. L. monocytogenes keratoconjunctivitis may lead to bacterial endophthalmitis. Prompt culture and early antibiotic therapy are recommended.

Draft Genome Sequence of Lactobacillus salivarius L28 Isolated from Ground Beef.

Science.gov (United States)

Ayala, Diana I; Cook, Peter W; Campos, David L; Brashears, Mindy M; den Bakker, Henk; Nightingale, Kendra K

2017-09-28

In this report, we describe the draft genome sequence of a newly discovered probiotic strain, Lactobacillus salivarius L28. L. salivarius L28 demonstrates antagonistic effects against human foodborne pathogens, including Escherichia coli O157:H7, Salmonella spp., and Listeria monocytogenes , in coculture experiments and food matrices. Copyright © 2017 Ayala et al.

Listeria monocytogenes Monographic Study

Directory of Open Access Journals (Sweden)

Emil Tirziu

2010-05-01

Full Text Available Listeria monocytogenes is a ubiquitous bacteria with a remarkable resistance in discordant condition which produce listeriosis, an infectious disease that affects multiple domestic and wild animals’ species, but also humans. Receptive to listeriosis are the majority of domestic or wild mammals and birds, in the last years being registered an increase of receptivity in humans. The concept of listeriosis in human pathology, a disease caused by eating or drinking contaminated food and water, appeared for the first time in 1981, during an outbreak in Canada with seven cases in adults and 34 cases of maternalfetal listeriosis. The alimentary origin of human listeriosis can be easily explained if considered some general characteristics of the bacteria. Thus, resistance in various conditions, especially at lower temperatures, justifies its dissemination and food contamination, particularly when is conserved by refrigeration. Also, L. monocytogenes has a significant presence in alimentary products. Some studies showed that 4% of the milk products, 29% of the meat products, 5% of the vegetable products and 26% of the products obtained from fishes and shell fishes are positive for L. monocytogenes, which allows us to say that battle against these bacteria is a war against microbial contamination.

Antimicrobial behavior of phage endolysin PlyP100 and its synergy with nisin to control Listeria monocytogenes in Queso Fresco.

Science.gov (United States)

Ibarra-Sánchez, Luis A; Van Tassell, Maxwell L; Miller, Michael J

2018-06-01

Hispanic-style fresh cheeses, such as Queso Fresco (QF), have been linked to numerous listeriosis outbreaks in the United States. In this work, we have studied the antilisterial behavior and effectiveness of the Listeria phage endolysin PlyP100 in QF, as well as the potential synergy between PlyP100 and nisin. PlyP100 showed similar bacterial reduction regardless of varying L. monocytogenes inoculum size in QF, and when the inoculation size was 1 Log CFU/g, no pathogen recovery after cheese enrichment was observed. PlyP100 was stable in QF for up to 28 days of cold storage exhibiting similar antilisterial activity regardless of when contamination with L. monocytogenes occurred. PlyP100 alone exhibited a strong listeriostatic effect in QF, on the contrary, nisin alone was not effective to control the pathogen in QF during cold storage. The combination of nisin and PlyP100 showed a strong synergy in QF with non-enumerable levels of L. monocytogenes after 4 weeks of refrigerated storage. Moreover, L. monocytogenes isolates from cheeses treated with nisin, PlyP100, and their combination did not develop resistance to nisin or PlyP100. Our results support the use of PlyP100 combined with nisin as an efficient L. monocytogenes control measure in QF. Copyright © 2017 Elsevier Ltd. All rights reserved.

Biochemical and molecular characteristics of Listeria monocytogenes isolates from a prosthetic mitral heart valve-bearing patient´s blood cultures

Directory of Open Access Journals (Sweden)

Nilma Cintra Leal

2013-09-01

Full Text Available Background: In Brazil, listeriosis is not a notifiable disease; thus, the incidence of Brazilian cases remains unknown. Listeria monocytogenes is not always included in automated systems, and its detection depends on the high skill level of microbiology laboratory professionals. This paper describes the characteristics of L. monocytogenes isolates fortuitously obtained from an endocarditis case in Recife, PE, Brazil. Methods: Six bacterial isolates obtained from six blood cultures from a 28-year-old male bearing a prosthetic mitral heart valve were analyzed by PCR using primers specific of L. monocytogenes to confirm a presumptive identification, determine the serotype and presence of the virulence genes (inlA, inlB, inlC, inlJ, hly, plcA, actA, prfA in an attempt to determine the Listeria genotype by PCR-ribotyping. Results: The samples were identified as L. monocytogenes 4b. All investigated virulence genes were amplified by PCR, and the identity of the amplified segments was confirmed by sequencing. A deletion of 105 base pairs was detected in the actA gene. All of the samples generated the same PCR-ribotype pattern, clustered into a single ribotype, and were considered a single strain. Conclusion: L. monocytogenes infection should be considered in endocarditis differential diagnoses, especially among high-risk groups, due to its high pathogenicity and the environmental ubiquity.

A Dual Microscopy-Based Assay To Assess Listeria monocytogenes Cellular Entry and Vacuolar Escape.

Science.gov (United States)

Quereda, Juan J; Pizarro-Cerdá, Javier; Balestrino, Damien; Bobard, Alexandre; Danckaert, Anne; Aulner, Nathalie; Shorte, Spencer; Enninga, Jost; Cossart, Pascale

2016-01-01

Listeria monocytogenes is a Gram-positive bacterium and a facultative intracellular pathogen that invades mammalian cells, disrupts its internalization vacuole, and proliferates in the host cell cytoplasm. Here, we describe a novel image-based microscopy assay that allows discrimination between cellular entry and vacuolar escape, enabling high-content screening to identify factors specifically involved in these two steps. We first generated L. monocytogenes and Listeria innocua strains expressing a β-lactamase covalently attached to the bacterial cell wall. These strains were then incubated with HeLa cells containing the Förster resonance energy transfer (FRET) probe CCF4 in their cytoplasm. The CCF4 probe was cleaved by the bacterial surface β-lactamase only in cells inoculated with L. monocytogenes but not those inoculated with L. innocua, thereby demonstrating bacterial access to the host cytoplasm. Subsequently, we performed differential immunofluorescence staining to distinguish extracellular versus total bacterial populations in samples that were also analyzed by the FRET-based assay. With this two-step analysis, bacterial entry can be distinguished from vacuolar rupture in a single experiment. Our novel approach represents a powerful tool for identifying factors that determine the intracellular niche of L. monocytogenes. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Listeria monocytogenes associated kerato-conjunctivitis in four horses in Norway.

Science.gov (United States)

Revold, Tobias; Abayneh, Takele; Brun-Hansen, Hege; Kleppe, Signe L; Ropstad, Ernst-Otto; Hellings, Robert A; Sørum, Henning

2015-11-09

Listeria monocytogenes has been reported to cause various infectious diseases in both humans and animals. More rarely, ocular infections have been reported. To our knowledge, only two cases of Listeria keratitis have been described in horses. We report kerato-conjunctivitis in four Norwegian horses associated with L. monocytogenes. Clinically, all cases were presented with recurrent unilateral kerato-conjunctivitis. L. monocytogenes bacteria were isolated from swab samples from all cases, and cytology carried out in 3 cases was indicative of L. monocytogenes infection. The present report describes the first known cases in which L. monocytogenes has been isolated from keratitic lesions in horses in Norway. A potential risk factor may be feeding of silage or haylage, but other sources of infection cannot be ruled out. The phenotypic features including antimicrobial susceptibility and serotype of the isolates are described. Laboratory detection of L. monocytogenes demands extra caution since only low numbers of bacteria were detected in the eye-swabs, probably due to the low volume of sample material and the intracellular niche of the bacterium. A general poor response to treatment in all these cases indicates that clinicians should pay extra attention to intensity and duration of treatment if L. monocytogenes is identified in connection with equine kerato-conjunctivitis.

Ultrasonic cleaning of conveyor belt materials using Listeria monocytogenes as a model organism.

Science.gov (United States)

Tolvanén, Riina; Lunden, Janne; Korkeala, Hannu; Wirtanen, Gun

2007-03-01

Persistent Listeria monocytogenes contamination of food industry equipment is a difficult problem to solve. Ultrasonic cleaning offers new possibilities for cleaning conveyors and other equipment that are not easy to clean. Ultrasonic cleaning was tested on three conveyor belt materials: polypropylene, acetal, and stainless steel (cold-rolled, AISI 304). Cleaning efficiency was tested at two temperatures (30 and 45 degrees C) and two cleaning times (30 and 60 s) with two cleaning detergents (KOH, and NaOH combined with KOH). Conveyor belt materials were soiled with milk-based soil and L. monocytogenes strains V1, V3, and B9, and then incubated for 72 h to attach bacteria to surfaces. Ultrasonic cleaning treatments reduced L. monocytogenes counts on stainless steel 4.61 to 5.90 log units; on acetal, 3.37 to 5.55 log units; and on polypropylene, 2.31 to 4.40 log units. The logarithmic reduction differences were statistically analyzed by analysis of variance using Statistical Package for the Social Sciences software. The logarithmic reduction was significantly greater in stainless steel than in plastic materials (P conveyor belt materials.

Recombinant probiotic expressing Listeria adhesion protein attenuates Listeria monocytogenes virulence in vitro.

Directory of Open Access Journals (Sweden)

Ok Kyung Koo

Full Text Available BACKGROUND: Listeria monocytogenes, an intracellular foodborne pathogen, infects immunocompromised hosts. The primary route of transmission is through contaminated food. In the gastrointestinal tract, it traverses the epithelial barrier through intracellular or paracellular routes. Strategies to prevent L. monocytogenes entry can potentially minimize infection in high-risk populations. Listeria adhesion protein (LAP aids L. monocytogenes in crossing epithelial barriers via the paracellular route. The use of recombinant probiotic bacteria expressing LAP would aid targeted clearance of Listeria from the gut and protect high-risk populations from infection. METHODOLOGY/PRINCIPAL FINDINGS: The objective was to investigate the ability of probiotic bacteria or LAP-expressing recombinant probiotic Lactobacillus paracasei (Lbp(LAP to prevent L. monocytogenes adhesion, invasion, and transwell-based transepithelial translocation in a Caco-2 cell culture model. Several wild type probiotic bacteria showed strong adhesion to Caco-2 cells but none effectively prevented L. monocytogenes infection. Pre-exposure to Lbp(LAP for 1, 4, 15, or 24 h significantly (P<0.05 reduced adhesion, invasion, and transepithelial translocation of L. monocytogenes in Caco-2 cells, whereas pre-exposure to parental Lb. paracasei had no significant effect. Similarly, Lbp(LAP pre-exposure reduced L. monocytogenes translocation by as much as 46% after 24 h. Lbp(LAP also prevented L. monocytogenes-mediated cell damage and compromise of tight junction integrity. Furthermore, Lbp(LAP cells reduced L. monocytogenes-mediated cell cytotoxicity by 99.8% after 1 h and 79% after 24 h. CONCLUSIONS/SIGNIFICANCE: Wild type probiotic bacteria were unable to prevent L. monocytogenes infection in vitro. In contrast, Lbp(LAP blocked adhesion, invasion, and translocation of L. monocytogenes by interacting with host cell receptor Hsp60, thereby protecting cells from infection. These data show promise

A case of bovine raw milk contamination with Listeria monocytogenes

Directory of Open Access Journals (Sweden)

Hunt Karen

2012-07-01

Full Text Available Abstract During routine sampling of bulk raw milk on a dairy farm, the pathogenic bacteria Listeria monocytogenes was found to be a contaminant, at numbers L. monocytogenes, indicating a possible case of excretion of the L. monocytogenes directly into the milk. Milk samples were collected from the individual cows and analysed, resulting in the identification of L. monocytogenes excretion (at 280 cfu/ml from one of the 4 mammary quarters of one dairy cow out of 180. When the infected cow was isolated from the herd, no L. monocytogenes was detected from the remaining herd. The pulsed-field gel electrophoresis pattern of the strain from the individual cow was indistinguishable from that originally isolated from the bulk milk. The infected cow did not show any clinical signs of disease, nor did the appearance of the milk have any physical abnormalities. Antibiotic treatment of the infected mammary quarter was found to be ineffective. This study shows that there can be risks associated with direct contamination of raw milk with L. monocytogenes.

CHALLENGE TESTS WITH LISTERIA MONOCYTOGENES IN SALAMI: PRELIMINARY RESULTS

Directory of Open Access Journals (Sweden)

R. Mioni

2013-02-01

Full Text Available Challenge tests are the preferable methodology to study the behaviour of Listeria monocytogenes on ready to eat foods, according to Regulation (EC 2073/2005. Challenge testing using L. monocytogenes in seasoned salami from different food business operators showed, after seasoning of the product, a count reduction of the inoculated organisms without any further growth of the pathogen; however differences of L. monocytogenes behaviour could be observed according to different production protocols.

Kinetics of biofilm formation and desiccation survival of Listeria monocytogenes in single and dual species biofilms with Pseudomonas fluorescens, Serratia proteamaculans or Shewanella baltica on food-grade stainless steel surfaces.

Science.gov (United States)

Daneshvar Alavi, Hessam Edin; Truelstrup Hansen, Lisbeth

2013-01-01

This study investigated the dynamics of static biofilm formation (100% RH, 15 °C, 48-72 h) and desiccation survival (43% RH, 15 °C, 21 days) of Listeria monocytogenes, in dual species biofilms with the common spoilage bacteria, Pseudomonas fluorescens, Serratia proteamaculans and Shewanella baltica, on the surface of food grade stainless steel. The Gram-negative bacteria reduced the maximum biofilm population of L. monocytogenes in dual species biofilms and increased its inactivation during desiccation. However, due to the higher desiccation resistance of Listeria relative to P. fluorescens and S. baltica, the pathogen survived in greater final numbers. In contrast, S. proteamaculans outcompeted the pathogen during the biofilm formation and exhibited similar desiccation survival, causing the N21 days of Serratia to be ca 3 Log10(CFU cm(-2)) greater than that of Listeria in the dual species biofilm. Microscopy revealed biofilm morphologies with variable amounts of exopolymeric substance and the presence of separate microcolonies. Under these simulated food plant conditions, the fate of L. monocytogenes during formation of mixed biofilms and desiccation depended on the implicit characteristics of the co-cultured bacterium.

Phage Inactivation of Listeria monocytogenes on San Daniele Dry-Cured Ham and Elimination of Biofilms from Equipment and Working Environments.

Science.gov (United States)

Iacumin, Lucilla; Manzano, Marisa; Comi, Giuseppe

2016-01-05

The anti-listerial activity of generally recognized as safe (GRAS) bacteriophage Listex P100 (phage P100) was demonstrated in broths and on the surface of slices of dry-cured ham against 5 strains or serotypes (i.e., Scott A, 1/2a, 1/2b, and 4b) of Listeria monocytogenes. In a broth model system, phage P100 at a concentration equal to or greater than 7 log PFU/mL completely inhibited 2 log CFU/cm² or 3 log CFU/cm² of L. monocytogenes growth at 30 °C. The temperature (4, 10, 20 °C) seemed to influence P100 activity; the best results were obtained at 4 °C. On dry-cured ham slices, a P100 concentration ranging from 5 to 8 log PFU/cm² was required to obtain a significant reduction in L. monocytogenes. At 4, 10, and 20 °C, an inoculum of 8 log PFU/cm² was required to completely eliminate 2 log L. monocytogenes/cm² and to reach the absence in 25 g product according to USA food law. Conversely, it was impossible to completely eradicate L. monocytogenes with an inoculum of approximately of 3.0 and 4.0 log CFU/cm² and with a P100 inoculum ranging from 1 to 7 log PFU/cm². P100 remained stable on dry-cured ham slices over a 14-day storage period, with only a marginal loss of 0.2 log PFU/cm² from an initial phage treatment of approximately 8 log PFU/cm². Moreover, phage P100 eliminated free L. monocytogenes cells and biofilms on the machinery surfaces used for dry-cured ham production. These findings demonstrate that the GRAS bacteriophage Listex P100 at level of 8 log PFU/cm² is listericidal and useful for reducing the L. monocytogenes concentration or eradicating the bacteria from dry-cured ham.

Phage Inactivation of Listeria monocytogenes on San Daniele Dry-Cured Ham and Elimination of Biofilms from Equipment and Working Environments

Directory of Open Access Journals (Sweden)

Lucilla Iacumin

2016-01-01

Full Text Available The anti-listerial activity of generally recognized as safe (GRAS bacteriophage Listex P100 (phage P100 was demonstrated in broths and on the surface of slices of dry-cured ham against 5 strains or serotypes (i.e., Scott A, 1/2a, 1/2b, and 4b of Listeria monocytogenes. In a broth model system, phage P100 at a concentration equal to or greater than 7 log PFU/mL completely inhibited 2 log CFU/cm2 or 3 log CFU/cm2 of L. monocytogenes growth at 30 °C. The temperature (4, 10, 20 °C seemed to influence P100 activity; the best results were obtained at 4 °C. On dry-cured ham slices, a P100 concentration ranging from 5 to 8 log PFU/cm2 was required to obtain a significant reduction in L. monocytogenes. At 4, 10, and 20 °C, an inoculum of 8 log PFU/cm2 was required to completely eliminate 2 log L. monocytogenes/cm2 and to reach the absence in 25 g product according to USA food law. Conversely, it was impossible to completely eradicate L. monocytogenes with an inoculum of approximately of 3.0 and 4.0 log CFU/cm2 and with a P100 inoculum ranging from 1 to 7 log PFU/cm2. P100 remained stable on dry-cured ham slices over a 14-day storage period, with only a marginal loss of 0.2 log PFU/cm2 from an initial phage treatment of approximately 8 log PFU/cm2. Moreover, phage P100 eliminated free L. monocytogenes cells and biofilms on the machinery surfaces used for dry-cured ham production. These findings demonstrate that the GRAS bacteriophage Listex P100 at level of 8 log PFU/cm2 is listericidal and useful for reducing the L. monocytogenes concentration or eradicating the bacteria from dry-cured ham.

Resistance of Listeria monocytogenes biofilms to sanitizing agents

Science.gov (United States)

Listeria monocytogenes is notorious for its capacity to colonize the environment and equipment of food processing facilities and to persist in the processing plant ecosystem, sometimes for decades. Such persistence is mediated by multiple attributes of L. monocytogenes, including the pathogen’s capa...

Growth and biofilm formation by Listeria monocytogenes in catfish mucus extract on four food-contact surfaces at 22°C and 10°C and their reduction by commercial disinfectants

Science.gov (United States)

The objective of this study was to determine the effect of strain and temperature on growth and biofilm formation by Listeria monocytogenes (Lm) in high and low concentrations of catfish mucus extract on different food-contact surfaces at 10°C and 22°C. The second objective of this study was to eval...

Serovar 4b complex predominates among Listeria monocytogenes isolates from imported aquatic products in China.

Science.gov (United States)

Chen, Jianshun; Chen, Qiaomiao; Jiang, Jianjun; Hu, Hongxia; Ye, Jiangbo; Fang, Weihuan

2010-01-01

Listeria monocytogenes, the causative organism of listeriosis, is primarily transmitted to humans through contaminated food. In this study, we examined 1275 batches of aquatic products imported from 29 countries and found that 36 batches from 8 countries were contaminated by Listeria (2.8%), with L. monocytogenes accounting for 2.6% (33/1275) and L. innocua for 0.2% (3/1275). Of the 23 selected L. monocytogenes isolates (from the 33 identified), 15 (65.2%) were of serovar 4b complex (4b, 4d, or 4e), three (13.0%) of 1/2a or 3a, four (17.4%) of 1/2b or 3b, and one (4.4%) of 1/2c or 3c. Notably, four of the 23 isolates belonged to epidemic clone I (ECI) and another four were associated with epidemic clone II (ECII), two highly clonal 4b clusters responsible for most of the documented listeriosis outbreaks. In the multilocus sequence typing scheme based on the concatenated genes gyrB-dapE-hisJ-sigB-ribC-purM-betL-gap-tuf, serovar 4b complex isolates from imported aquatic products exhibited significant genetic diversity. While the four ECI isolates were genetically related to those from Chinese diseased animals, both lacking one proline-rich repeat of ActA, the four ECII isolates were located between 1/2b or 3b strains. As the L. monocytogenes isolates from imported aquatic products possessed a nearly complete set of major infection-related genes, they demonstrated virulence potential in mouse model.

Prevalence, antimicrobial susceptibility and virulotyping of Listeria species and Listeria monocytogenes isolated from open-air fish markets.

Science.gov (United States)

Jamali, Hossein; Paydar, Mohammadjavad; Ismail, Salmah; Looi, Chung Yeng; Wong, Won Fen; Radmehr, Behrad; Abedini, Atefeh

2015-07-25

The aim of this study was to investigate the prevalence and characterization of Listeria species and Listeria monocytogenes isolated from raw fish and open-air fish market environments. Eight hundred and sixty two samples including raw fish and fish market environments (samples from workers' hands, workers' knives, containers and work surface) were collected from the open-air fish markets in the Northern region of Iran. Listeria spp. was isolated from 104/488 (21.3%) raw fish and 29/374 (7.8%) of samples from open-air fish market environment. The isolates of Listeria spp. included L. innocua (35.3%), L. monocytogenes (32.3%), L. seeligeri (18%), and L. ivanovii (14.3%). Of the 43 L. monocytogenes isolates, 31 (72.1%), 10 (23.3%) and 2 (4.7%) belonged to serovars 1/2a, 4b, and 1/2b, respectively. The inlA, inlB, inlC, inlJ, actA, hlyA, iap, plcA, and prfA virulence-associated genes were detected in almost all of the L. monocytogenes isolates. The Listeria spp. isolates showed high resistance against tetracycline (23.3%), penicillin G, and cephalothin (each 16.5%). Besides, we observed significant resistance level to tetracycline (27.9%), ampicillin (20.9%), cephalothin, penicillin G, and streptomycin (each 16.3%) in the L. monocytogenes isolates. All of the isolates were susceptible to cefotaxime, gentamicin, kanamycin, and pefloxacin. We found that tetM (25.6%), tetA (23.3%), ampC (14%), and penA (11.6%) were the most prevalent antibiotic resistance genes in the L. monocytogenes isolates. Recovery of potentially pathogenic L. monocytogenes from raw fish and environment of open-air fish market samples in this study is a convincing evidence for the zoonotic potential of listeriosis.

Bacteriophage biocontrol of Listeria monocytogenes on soft ripened white mold and red-smear cheeses.

Science.gov (United States)

Guenther, Susanne; Loessner, Martin J

2011-03-01

Soft-ripened cheeses belong to the type of food most often contaminated with Listeria monocytogenes, and they have been implicated in several outbreaks of listeriosis. Bacteriophages represent an attractive way to combat foodborne pathogens without affecting other properties of the food. We used the broad host range, virulent Listeria phage A511 for control of L. monocytogenes during the production and ripening phases of both types of soft-ripened cheeses, white mold (Camembert-type) cheese, as well as washed-rind cheese with a red-smear surface (Limburger-type). The surfaces of young, unripened cheese were inoculated with 10(1)-10(3) cfu/cm(2)L. monocytogenes strains Scott A (serovar 4b) or CNL 10(3)/2005 (serovar 1/2a). Phage was applied at defined time points thereafter, in single or repeated treatments, at 3 × 10(8) or 1 × 10(9) pfu/cm(2). With Scott A (10(3) cfu/cm(2)) and a single dose of A511 (3 × 10(8) pfu/cm(2)) on camembert-type cheese, viable counts dropped 2.5 logs at the end of the 21 day ripening period. Repeated phage application did not further inhibit the bacteria, whereas a single higher dose (1 × 10(9) pfu/cm(2)) was found to be more effective. On red-smear cheese ripened for 22 days, Listeria counts were down by more than 3 logs. Repeated application of A511 further delayed re-growth of Listeria, but did not affect bacterial counts after 22 days. With lower initial Listeria contamination (10(1)-10(2) cfu/cm(2)), viable counts dropped below the limit of detection, corresponding to more than 6 logs reduction compared to the control. Our data clearly demonstrate the potential of bacteriophage for biocontrol of L. monocytogenes in soft cheese.

LISTERIA MONOCYTOGENES RISK EVALUATION IN READY TO EAT DELI PRODUCTS

Directory of Open Access Journals (Sweden)

T Civera

2013-02-01

Full Text Available Listeria monocytogenes has become one of the major concerns for food safety. Its ability to survive and replicate at low temperature, pH and high salt concentration, makes the bacterium a threat, mostly for RTE products. For these reasons, the present research was aimed at detecting the ability of growth of L. monocytogenes in RTE products retrieved from one deli store. Samples were analysed for L. monocytogenes detection, then inoculated with the pathogen (105cell/ml and stored at refrigeration temperature for the duration of their shelf-life (15-60 days. In all the products L. monocytogenes was not detected before experimental contamination. The challenge test evidenced that experimentally inoculated L. monocytogenes was not able to multiply for the duration of the entire shelf-life. These results indicated that the tested products could be considered as foods which are not able to support the growth of L. monocytogenes, as indicated by E.C. Regulation 2073/05. However, in order to guarantee consumer’s safety, it needs to be emphasized the need of a correct application of the GMPs, required for lowering the risk of initial contamination.

Internalization of Listeria monocytogenes in cantaloupes during dump tank washing and hydrocooling.

Science.gov (United States)

Macarisin, Dumitru; Wooten, Anna; De Jesus, Antonio; Hur, Minji; Bae, Seonjae; Patel, Jitendra; Evans, Peter; Brown, Eric; Hammack, Thomas; Chen, Yi

2017-09-18

Recent listeriosis outbreaks and recalls associated with cantaloupes urge for studies to understand the mechanisms of cantaloupe contamination by Listeria monocytogenes. Postharvest practices such as washing and hydrocooling were suggested to facilitate the contamination of fresh fruits by human pathogens. This study assessed the potential of L. monocytogenes internalization into cantaloupes during dump tank washing and immersion-type hydrocooling in water contaminated with L. monocytogenes. The effect of cantaloupe cultivar, water temperature, and harvesting technique on L. monocytogenes internalization was also evaluated. Full slip (cantaloupe without any residual stem) Western and Eastern cultivar cantaloupes were pre-warmed to 42°C (to imitate peak-high field temperatures of freshly harvested cantaloupes) and then immersed in water at 6°C and 18°C containing 4 and 6logCFU/ml of L. monocytogenes. Clipped (cantaloupe with short stem residues obtained by clipping the stem at harvest) Western and Eastern cantaloupes were pre-warmed to 42°C and then immersed in water at 6°C containing 6logCFU/ml of L. monocytogenes. Additionally, full slip and clipped Western cantaloupes were equilibrated to 18°C and then immersed in water at 18°C containing 6logCFU/ml of L. monocytogenes (isothermal immersion without temperature differential). Water containing L. monocytogenes infiltrated both full slip and clipped cantaloupes through the stems/stem scars and was then distributed along the vascular system in hypodermal mesocarp reaching the calyx area of the fruit. The current study demonstrated that, under experimental conditions, L. monocytogenes can internalize into cantaloupes during immersion in water contaminated by L. monocytogenes, both in the presence and absence of temperature differential, and that temperature differential moderately enhanced the internalization of L. monocytogenes. The incidence and levels of L. monocytogenes internalized in the middle

Listeria monocytogenes growth limits and stress resistance mechanisms

NARCIS (Netherlands)

Veen, van der S.

2008-01-01

The food-borne pathogen Listeria monocytogenes is a Gram-positive facultative anaerobic rod, which is the causative agent of listeriosis. Due to the severity of the disease and the fact that its incidence is increasing in numerous European countries, L. monocytogenes is of great public health

Pilot-scale continuous ultrasonic cleaning equipment reduces Listeria monocytogenes levels on conveyor belts.

Science.gov (United States)

Tolvanen, Riina; Lundén, Janne; Hörman, Ari; Korkeala, Hannu

2009-02-01

Ultrasonic cleaning of a conveyor belt was studied by building a pilot-scale conveyor with an ultrasonic cleaning bath. A piece of the stainless steel conveyor belt was contaminated with meat-based soil and Listeria monocytogenes strains (V1, V3, and B9) and incubated for 72 h to allow bacteria to attach to the conveyor belt surfaces. The effect of ultrasound with a potassium hydroxide-based cleaning detergent was determined by using the cleaning bath at 45 and 50 degrees C for 30 s with and without ultrasound. The detachment of L. monocytogenes from the conveyor belt caused by the ultrasonic treatment was significantly greater at 45 degrees C (independent samples t test, P conveyor belt is effective even with short treatment times.

Processing-Dependent and Clonal Contamination Patterns of Listeria monocytogenes in the Cured Ham Food Chain Revealed by Genetic Analysis.

Science.gov (United States)

Morganti, Marina; Scaltriti, Erika; Cozzolino, Paolo; Bolzoni, Luca; Casadei, Gabriele; Pierantoni, Marco; Foni, Emanuela; Pongolini, Stefano

2016-02-01

The quantitative and qualitative patterns of environmental contamination by Listeria monocytogenes were investigated in the production chain of dry-cured Parma ham. Standard arrays of surfaces were sampled in processing facilities during a single visit per plant in the three compartments of the food chain, i.e., ham production (19 plants) and postproduction, which was divided into deboning (43 plants) and slicing (25 plants) steps. The numbers of sampled surfaces were 384 in ham production, with 25 positive for L. monocytogenes, and 1,084 in postproduction, with 83 positives. Statistical analysis of the prevalence of contaminated surfaces showed that in ham production, contamination was higher at the beginning of processing and declined significantly toward the end, while in postproduction, prevalence rose toward the end of processing. Prevalence was higher in the deboning facilities than in slicing facilities and was dependent on the type of surface (floor/drainage > clothing > equipment). The qualitative pattern of contamination was investigated through an analysis of the survey isolates and a set of isolates derived from routine monitoring, including longitudinal isolations. Pulsed-field gel electrophoresis (PFGE) and whole-genome single-nucleotide polymorphism (SNP) analysis revealed a remarkable clonality of L. monocytogenes within plants, with the detection of 16 plant-specific clones out of 17 establishments with multiple isolates. Repeated detections of clonal isolates >6 months apart were also observed. Six was the maximum number of between-isolate differences in core SNPs observed within these clones. Based on the same six-SNP threshold, three clusters of clonal isolates, shared by six establishments, were also identified. The spread of L. monocytogenes within and between plants, as indicated by its clonal behavior, is a matter of concern for the hygienic management of establishments. Copyright © 2016, American Society for Microbiology. All Rights

Listeria monocytogenes in poultry and poultry products: Epidemiological investigations in seven Danish abattoirs

DEFF Research Database (Denmark)

Ojeniyi, B.; Wegener, Henrik Caspar; Jensen, N.E.

1996-01-01

Listeria monocytogenes was isolated from 11/236 (4 . 7%) caecal samples from parent flocks, providing broilers to the abattoirs investigated. Caecal samples from 2078 broilers representing 90 randomly selected broiler flocks were negative for L. monocytogenes. A total of 3080 samples from seven...... abattoirs including poultry processing line samples, and final products were also examined for L. monocytogenes. Listeria monocytogenes was isolated in 0 . 3% to 18 . 7% of the samples collected in the different abattoirs. Epidemiological typing of 247 L. monocytogenes isolates, including serotyping, phage...... isolates of L. monocytogenes since only 120/247 (48 . 6%) isolates were typable by phage typing and 230/247 (93 . 1%) L. monocytogenes belonged to serotype 01 while 6/247 (2 . 4%) belonged to 04. The discovery of a few dominating clones in each abattoir might indicate an endemic occurrence of L...

Aerosol studies with Listeria innocua and Listeria monocytogenes.

Science.gov (United States)

Zhang, Guodong; Ma, Li; Oyarzabal, Omar A; Doyle, Michael P

2007-08-01

Aerosol studies of Listeria monocytogenes in food processing plants have been limited by lack of a suitable surrogate microorganism. The objective of this study was to investigate the potential of using green fluorescent protein-labeled strains of Listeria innocua as a surrogate for L. monocytogenes for aerosol studies. These studies were conducted in a laboratory bioaerosol chamber and a pilot food-processing facility. Four strains of L. innocua and five strains of L. monocytogenes were used. In the laboratory chamber study, Listeria cells were released into the environment at two different cell numbers and under two airflow conditions. Trypticase soy agar (TSA) plates and oven-roasted breasts of chicken and turkey were placed in the chamber to monitor Listeria cell numbers deposited from aerosols. A similar experimental design was used in the pilot plant study; however, only L. innocua was used. Results showed that L. monocytogenes and L. innocua survived equally well on chicken and turkey breast meats and TSA plates. No-fan and continuous fan applications, which affected airflow, had no significant effect on settling rates of aerosolized L. monocytogenes and L. innocua in the bioaerosol chamber or L. innocua in the pilot plant study. Listeriae cell numbers in the air decreased rapidly during the first 1.5 h following release, with few to no listeriae detected in the air at 3 h. Aerosol particles with diameters of 1 and 2 microM correlated directly with the number of Listeria cells in the aerosol but not with particles that were 0.3, 0.5, and 5 microM in diameter. Results indicate that L. innocua can be used as a surrogate for L. monocytogenes in an aerosol study.

Low prevalence of Listeria monocytogenes in cull sows and pork.

Science.gov (United States)

Wesley, Irene V; Larsen, Steven; Hurd, H Scott; McKean, James D; Griffith, Ronald; Rivera, Fernando; Nannapaneni, Ramakrishna; Cox, Mandy; Johnson, Michael; Wagner, Dean; de Martino, Mary

2008-03-01

The goal of this study was to determine the prevalence of Listeria monocytogenes in sows slaughtered at a single Midwestern plant on two occasions (trial 1, n = 179 sows; trial 2, n = 160 sows). Fecal samples collected antemortem (trial 1) as well as animal tissues, and carcass swabs collected at the abattoir (trials 1 and 2) were analyzed. Eight isolates of L. monocytogenes were recovered from five samples that represented 0.18% of the total samples (n = 2,775). In trial 1, L. monocytogenes was detected in a tonsil sample (0.6%; 1 positive of 181 tonsils), in a carcass (0.6%; 1 positive of 179 carcasses), which was sampled prior to the organic rinse, and in two chopped meat block samples (1.2%; 2 positive of 165 samples). In trial 2, L. monocytogenes was only detected in a single chopped meat block sample (0.15%; 1 positive of 688 total samples). These data indicate the low prevalence of L. monocytogenes in the cull sow.

Listeria monocytogenes strains show large variations in competitive growth in mixed culture biofilms and suspensions with bacteria from food processing environments.

Science.gov (United States)

Heir, Even; Møretrø, Trond; Simensen, Andreas; Langsrud, Solveig

2018-06-20

Interactions and competition between resident bacteria in food processing environments could affect their ability to survive, grow and persist in microhabitats and niches in the food industry. In this study, the competitive ability of L. monocytogenes strains grown together in separate culture mixes with other L. monocytogenes (L. mono mix), L. innocua (Listeria mix), Gram-negative bacteria (Gram- mix) and with a multigenera mix (Listeria + Gram- mix) was investigated in biofilms on stainless steel and in suspensions at 12 °C. The mixed cultures included resident bacteria from processing surfaces in meat and salmon industry represented by L. monocytogenes (n = 6), L. innocua (n = 5) and Gram-negative bacteria (n = 6; Acinetobacter sp., Pseudomonas fragi, Pseudomonas fluorescens, Serratia liquefaciens, Stenotrophomonas maltophilia). Despite hampered in growth in mixed cultures, L. monocytogenes established in biofilms with counts at day nine between 7.3 and 9.0 log per coupon with the lowest counts in the Listeria + G- mix that was dominated by Pseudomonas. Specific L. innocua inhibited growth of L. monocytogenes strains differently; inhibition that was further enhanced by the background Gram-negative microbiota. In these multispecies and multibacteria cultures, the growth competitive effects lead to the dominance of a strong competitor L. monocytogenes strain that was only slightly inhibited by L. innocua and showed strong competitive abilities in mixed cultures with resident Gram-negative bacteria. The results indicates complex patterns of bacterial interactions and L. monocytogenes inhibition in the multibacteria cultures that only partially depend on cell contact and likely involve various antagonistic and bacterial tolerance mechanisms. The study indicates large variations among L. monocytogenes in their competitiveness under multibacterial culture conditions that should be considered in further studies towards understanding of L

An Internalin A Probe-Based Genosensor for Listeria monocytogenes Detection and Differentiation

Directory of Open Access Journals (Sweden)

Laura Bifulco

2013-01-01

Full Text Available Internalin A (InlA, a protein required for Listeria monocytogenes virulence, is encoded by the inlA gene, which is only found in pathogenic strains of this genus. One of the best ways to detect and confirm the pathogenicity of the strain is the detection of one of the virulence factors produced by the microorganism. This paper focuses on the design of an electrochemical genosensor used to detect the inlA gene in Listeria strains without labelling the target DNA. The electrochemical sensor was obtained by immobilising an inlA gene probe (single-stranded oligonucleotide on the surfaces of screen-printed gold electrodes (Au-SPEs by means of a mercaptan-activated self-assembled monolayer (SAM. The hybridisation reaction occurring on the electrode surface was electrochemically transduced by differential pulse voltammetry (DPV using methylene blue (MB as an indicator. The covalently immobilised single-stranded DNA was able to selectively hybridise to its complementary DNA sequences in solution to form double-stranded DNA on the gold surface. A significant decrease of the peak current of the voltammogram (DPV upon hybridisation of immobilised ssDNA was recorded. Whole DNA samples of L. monocytogenes strains could be discriminated from other nonpathogenic Listeria species DNA with the inlA gene DNA probe genosensor.

Antimicrobial resistance of Listeria monocytogenes isolated from dairy-based food products.

Science.gov (United States)

Harakeh, Steve; Saleh, Imane; Zouhairi, Omar; Baydoun, Elias; Barbour, Elie; Alwan, Nisreen

2009-06-15

In this study Listeria monocytogenes (L. monocytogenes) was isolated from three traditionally consumed Lebanese dairy-based food products. One hundred and sixty four samples (45 samples of Baladi cheese, 36 samples of Shankleesh and 83 of Kishk) were collected from the Bekaa Valley in the Northeast region of Lebanon. Suspected Listeria colonies were selected and initially identified by using standard biochemical tests. Initial identification of the positive L. monocytogenes colonies was confirmed at the molecular level by Polymerase Chain Reaction (n=30) and the confirmed isolates were evaluated for their susceptibility to 10 commonly used antimicrobials. All of the 30 isolates were confirmed to be L. monocytogenes yielding a PCR product of approximately 660 base pairs (bp). L. monocytogenes was detected in 26.67%, 13.89% and 7.23% of the Baladi cheese, Shankleesh and Kishk samples, respectively. The highest resistance in L. monocytogenes isolates was noted against oxacillin (93.33%) followed by penicillin (90%). The results provide an indication of the contamination levels of dairy-based foods in Lebanon and highlight the emergence of multi-drug resistant Listeria in the environment.

Behaviour of Listeria monocytogenes in packaged fresh mushrooms (Agaricus bisporus).

Science.gov (United States)

González-Fandos, E; Olarte, C; Giménez, M; Sanz, S; Simón, A

2001-11-01

The aim of this study was to evaluate the potential of Listeria monocytogenes to grow in mushrooms packaged in two different types of PVC films when stored at 4 degrees C and 10 degrees C. Mushrooms were packed in two polymeric films (perforated and nonperforated PVC) and stored at 4 degrees C and 10 degrees C. The carbon dioxide and oxygen content inside the packages, aerobic mesophiles, psychrotrophs, Pseudomonas spp., Listeria monocytogenes, faecal coliforms, Escherichia coli, anaerobic spores and major sensory factors were determined. The mushrooms packaged in nonperforated film and stored at 4 degrees C had the most desirable quality parameters (texture, development stage and absence of moulds). Listeria monocytogenes was able to grow at 4 degrees C and 10 degrees C in inoculated mushrooms packaged in perforated and nonperforated films between 1 and 2 log units during the first 48 h. After 10 d of storage, the populations of L. monocytogenes were higher in mushrooms packaged in nonperforated film and stored at 10 degrees C. MAP followed by storage at 4 degrees C or 10 degrees C extends the shelf life by maintaining an acceptable appearance, but allows the growth and survival of L. monocytogenes. According to this study additional hurdles must be studied in order to prevent the growth of L. monocytogenes.

Prevalence and relative risk of Cronobacter spp., Salmonella spp., and Listeria monocytogenes associated with the body surfaces and guts of individual filth flies.

Science.gov (United States)

Pava-Ripoll, Monica; Pearson, Rachel E Goeriz; Miller, Amy K; Ziobro, George C

2012-11-01

Although flies are important vectors of food-borne pathogens, there is little information to accurately assess the food-related health risk of the presence of individual flies, especially in urban areas. This study quantifies the prevalence and the relative risk of food-borne pathogens associated with the body surfaces and guts of individual wild flies. One hundred flies were collected from the dumpsters of 10 randomly selected urban restaurants. Flies were identified using taxonomic keys before being individually dissected. Cronobacter spp., Salmonella spp., and Listeria monocytogenes were detected using the PCR-based BAX system Q7. Positive samples were confirmed by culture on specific media and through PCR amplification and sequencing or ribotyping. Among collected flies were the housefly, Musca domestica (47%), the blowflies, Lucilia cuprina (33%) and Lucilia sericata (14%), and others (6%). Cronobacter species were detected in 14% of flies, including C. sakazakii, C. turicensis, and C. universalis, leading to the proposal of flies as a natural reservoir of this food-borne pathogen. Six percent of flies carried Salmonella enterica, including the serovars Poona, Hadar, Schwarzengrund, Senftenberg, and Brackenridge. L. monocytogenes was detected in 3% of flies. Overall, the prevalence of food-borne pathogens was three times greater in the guts than on the body surfaces of the flies. The relative risk of flies carrying any of the three pathogens was associated with the type of pathogen, the body part of the fly, and the ambient temperature. These data enhance the ability to predict the microbiological risk associated with the presence of individual flies in food and food facilities.

Behavior of Listeria monocytogenes in a multi-species biofilm with Enterococcus faecalis and Enterococcus faecium and control through sanitation procedures.

Science.gov (United States)

da Silva Fernandes, Meg; Kabuki, Dirce Yorika; Kuaye, Arnaldo Yoshiteru

2015-05-04

The formation of mono-species biofilm (Listeria monocytogenes) and multi-species biofilms (Enterococcus faecium, Enterococcus faecalis, and L. monocytogenes) was evaluated. In addition, the effectiveness of sanitation procedures for the control of the multi-species biofilm also was evaluated. The biofilms were grown on stainless steel coupons at various incubation temperatures (7, 25 and 39°C) and contact times (0, 1, 2, 4, 6 and 8 days). In all tests, at 7°C, the microbial counts were below 0.4 log CFU/cm(2) and not characteristic of biofilms. In mono-species biofilm, the counts of L. monocytogenes after 8 days of contact were 4.1 and 2.8 log CFU/cm(2) at 25 and 39°C, respectively. In the multi-species biofilms, Enterococcus spp. were present at counts of 8 log CFU/cm(2) at 25 and 39°C after 8 days of contact. However, the L. monocytogenes in multi-species biofilms was significantly affected by the presence of Enterococcus spp. and by temperature. At 25°C, the growth of L. monocytogenes biofilms was favored in multi-species cultures, with counts above 6 log CFU/cm(2) after 8 days of contact. In contrast, at 39°C, a negative effect was observed for L. monocytogenes biofilm growth in mixed cultures, with a significant reduction in counts over time and values below 0.4 log CFU/cm(2) starting at day 4. Anionic tensioactive cleaning complemented with another procedure (acid cleaning, disinfection or acid cleaning+disinfection) eliminated the multi-species biofilms under all conditions tested (counts of all micro-organismsbiofilms under all tested conditions (counts of the all microorganisms biofilms under all the test conditions. Copyright © 2015 Elsevier B.V. All rights reserved.

Listeria monocytogenes-carrying consortia in food industry. Composition, subtyping and numerical characterisation of mono-species biofilm dynamics on stainless steel.

Science.gov (United States)

Rodríguez-López, Pedro; Saá-Ibusquiza, Paula; Mosquera-Fernández, Maruxa; López-Cabo, Marta

2015-08-03

In order to find out how real Listeria monocytogenes-carrying biofilms are in industrial settings, a total of 270 environmental samples belonging to work surfaces from fish (n = 123), meat (n = 75) and dairy industries (n = 72) were analysed in order to detect L. monocytogenes. 12 samples were positive for L. monocytogenes and a total of 18 different species were identified as accompanying microbiota in fish and meat industry. No L. monocytogenes was found in samples from dairy industry. Molecular characterisation combining results of AscI and ApaI macrorestriction PFGE assays yielded 7 different subtypes of L. monocytogenes sharing in 71.43% of cases the same serogroup (1/2a-3a). Results from dynamic numerical characterisation between L. monocytogenes monospecies biofilms on stainless steel (SS) using MATLAB-based tool BIOFILMDIVER demonstrated that except in isolate A1, in which a significant increase in the percentage of covered area (CA), average diffusion distance (ADD) and maximum diffusion distance (MDD) was observed after 120 h of culture, no significant differences were observed in the dynamics of the rest of the L. monocytogenes isolates. Quantitative dual-species biofilm association experiments performed on SS indicated that L. monocytogenes cell counts presented lower values in mixed-species cultures with certain species at 24 and 48 h compared with mono-species culture. However, they remained unaltered after 72 h except when co-cultured with Serratia fonticola which presented differences in all sampling times and was also the dominant species within the dual-species biofilm. When considering frequency of appearance of accompanying species, an ecological distribution was demonstrated as Escherichia coli appeared to be the most abundant in fish industry and Carnobacterium spp. in meat industry. Copyright © 2015 Elsevier B.V. All rights reserved.

Inactivation of Listeria monocytogenes by disinfectants and bacteriophages in suspension and stainless steel carrier tests

NARCIS (Netherlands)

Chaitiemwong, N.; Hazeleger, W.C.; Beumer, R.R.

2014-01-01

To simulate food contact surfaces with pits or cracks, stainless steel plates with grooves (depths between 0.2 and 5 mm) were constructed. These plates were artificially contaminated with Listeria monocytogenes in clean conditions, with organic soiling, or after 14 days of biofilm formation after

Prevalence of Listeria monocytogenes in poultry meat

Directory of Open Access Journals (Sweden)

Mehmet ELMALI

2015-01-01

Full Text Available AbstractThe objectives of this study were i to isolate Listeria spp. and Listeria monocytogenes in broiler wing meat samples, ii to confirm the isolates by PCR, based on prs and hly A gene sequences, iii to determine the seasonal and monthly distribution of the isolates. A total of 120 broiler wing meat samples (60 packaged pieces wrapped using strech film in styrofoam plates and 60 unpackaged pieces bought from different markets in Hatay province were analysed. Listeria spp. was isolated from 57 (47.5% out of 120 samples. Fifty-four, out of 57 Listeria spp. isolates were identified as L. monocytogenes. L. monocytogenes was isolated from the samples collected during the spring, winter, summer, and autumn at the levels of 26.6%, 40%, 53.3%, 60%, respectively. In this study, the isolation rates were found to be the highest in autumn, while the isolation rates were found to be the lowest in spring. As a consequence, high prevalence of Listeria spp. and L. monocytogenes in poultry wing meat samples may pose a risk for human health. We consider that with obeying the rules of good hygiene practices (GHP, good manufacturing practices (GMP and HACCP can minimize the contamination with Listeria spp.

Biocontrole de Listeria monocytogenes por Pediococcus acidilactici em couve minimamente processada Biocontrol of Listeria monocytogenes by Pediococcus acidilactici in fresh-cut kale

Directory of Open Access Journals (Sweden)

Wanessa Altimiras Costa

2009-12-01

Full Text Available Este estudo avaliou um sistema de biocontrole para inibição de Listeria monocytogenes em couve minimamente processada, objetivando sua segurança durante estocagem sob refrigeração e em condições de abuso de temperatura. O potencial inibitório de bactérias láticas tolerantes ao sal e psicrotróficas contaminantes naturais da couve e Lactobacillus plantarum, Lactobacillus delbrueckii ATCC 9649 e Lactobacillus casei CCT 1465 foram avaliadas contra L. monocytogenes. O isolado de couve identificado como P. acidilactici CCA3 inibiu L. monocytogenes a 10 e 15 °C em ágar MRS e foi selecionado como possível agente de biocontrole. O número de L. monocytogenes na couve minimamente processada aumentou 3,7 e 4,7 ciclos logarítmicos a 5 e 10 °C, respectivamente, após 20 dias de armazenamento e 4,6 ciclos logarítmicos após oito dias a 15 °C. Entretanto, quando 10(8 UFC.g-1 de P. acidilactici CCA3 foram inoculados no produto processado, o crescimento de L. monocytogenes reduziu 2,3 ciclos logarítmicos sob temperatura abusiva de 15 °C. A acidez titulável e as características sensoriais da couve não foram alteradas pela presença de CCA3 ao longo do período de vida útil. Estes resultados sugerem o potencial de aplicação dos bioconservantes na couve minimamente processada, que necessitam estar associados à refrigeração e sanitização para garantir segurança.This study evaluated a biological control system for the inhibition of Listeria monocytogenes in minimally processed kale focusing on its freshness under refrigeration and extreme temperatures. The inhibitory potential of salt and cold tolerant lactic bacteria from natural microflora of kale, Lactobacillus delbrueckii ATCC 9649, Lactobacillus plantarum, and Lactobacillus casei CCT 1465 strains were evaluated against L. monocytogenes. Pediococcus acidilactici CCA3 isolated from kale exhibited a large inhibition zone of L. monocytogenes at 10 and 15 °C in MRS agar and was

Listeria monocytogenes in retailed raw chicken meat in Turkey.

Science.gov (United States)

Siriken, Belgin; Ayaz, Naim Deniz; Erol, Irfan

2014-01-01

The objectives of this study were, to find the prevalence and antimicrobial resistance of L. monocytogenes from a total of 116 chicken meat samples including 50 carcasses and 66 meat parts marketed in Turkey between 2008 and 2009 using immunomagnetic separation (IMS) based cultivation technique, to detect the hlyA gene for the verification of the isolates by PCR, and to identify the genoserotypes of the L. monocytogenes isolates by multiplex PCR assay. In the study, 51 L. monocytogenes colonies were isolated from 34 (29.3%) chicken meat samples (eleven [22.0%] carcasses and 23 [34.8%] pieces of meat) by IMS based cultivation technique and confirmed by PCR. According to the multiplex PCR results, all the 51 isolates were identified as genoserotype IIa (1/2a or 3a). L. monocytogenes isolates were also tested for their susceptibility to eight antibiotic (gentamicin, vancomycin, chloramphenicol, streptomycin, tetracycline, ampicillin, penicillin G, erythromycin) agents using the disk diffusion method. 14 isolates (27.45%) were susceptible to all eight antimicrobials drugs tested and the remaining 37 isolates (72.54%) were resistant to gentamicin (one isolate, 1.96%), vancomycin (four isolates, 7.84%), penicillin G (six isolates, 11.76%), streptomycin (nine isolates, 17.64%; resistant or intermediate), tetracycline (seven isolates, 13.72%) and ampicillin (six isolates, 11.76%). This study showed that antimicrobial resistance is not highly prevalent in L. monocytogenes isolated from chicken carcasses and pieces of meat. The presence of L. monocytogenes in chicken samples suggests an importance of this pathogen in chicken.

Listeria monocytogenes in Fresh Produce: Outbreaks, Prevalence and Contamination Levels

Directory of Open Access Journals (Sweden)

Qi Zhu

2017-03-01

Full Text Available Listeria monocytogenes, a member of the genus Listeria, is widely distributed in agricultural environments, such as soil, manure and water. This organism is a recognized foodborne pathogenic bacterium that causes many diseases, from mild gastroenteritis to severe blood and/or central nervous system infections, as well as abortion in pregnant women. Generally, processed ready-to-eat and cold-stored meat and dairy products are considered high-risk foods for L. monocytogenes infections that cause human illness (listeriosis. However, recently, several listeriosis outbreaks have been linked to fresh produce contamination around the world. Additionally, many studies have detected L. monocytogenes in fresh produce samples and even in some minimally processed vegetables. Thus L. monocytogenes may contaminate fresh produce if present in the growing environment (soil and water. Prevention of biofilm formation is an important control measure to reduce the prevalence and survival of L. monocytogenes in growing environments and on fresh produce. This article specifically focuses on fresh produce–associated listeriosis outbreaks, prevalence in growing environments, contamination levels of fresh produce, and associated fresh produce safety challenges.

Commensal microbes provide first line defense against Listeria monocytogenes infection

Science.gov (United States)

Littmann, Eric R.; Kim, Sohn G.; Morjaria, Sejal M.; Ling, Lilan; Gyaltshen, Yangtsho; Taur, Ying; Leiner, Ingrid M.

2017-01-01

Listeria monocytogenes is a foodborne pathogen that causes septicemia, meningitis and chorioamnionitis and is associated with high mortality. Immunocompetent humans and animals, however, can tolerate high doses of L. monocytogenes without developing systemic disease. The intestinal microbiota provides colonization resistance against many orally acquired pathogens, and antibiotic-mediated depletion of the microbiota reduces host resistance to infection. Here we show that a diverse microbiota markedly reduces Listeria monocytogenes colonization of the gut lumen and prevents systemic dissemination. Antibiotic administration to mice before low dose oral inoculation increases L. monocytogenes growth in the intestine. In immunodeficient or chemotherapy-treated mice, the intestinal microbiota provides nonredundant defense against lethal, disseminated infection. We have assembled a consortium of commensal bacteria belonging to the Clostridiales order, which exerts in vitro antilisterial activity and confers in vivo resistance upon transfer into germ free mice. Thus, we demonstrate a defensive role of the gut microbiota against Listeria monocytogenes infection and identify intestinal commensal species that, by enhancing resistance against this pathogen, represent potential probiotics. PMID:28588016

Meningoencefalite por Listeria monocytogenes em ovinos Meningoencephalitis in sheep caused by Listeria monocytogenes

Directory of Open Access Journals (Sweden)

Daniel R. Rissi

2010-01-01

Full Text Available São descritos sete casos de doença neurológica em ovinos por Listeria monocytogenes no Rio Grande do Sul e Paraná entre 2000 e 2007. Foram afetados ovinos com idades entre 12-24 meses. Os casos ocorreram no verão e início da primavera e os índices gerais de morbidade e letalidade foram de 3,15% e 100%, respectivamente. Quando essa informação estava disponível, nenhum dos ovinos afetados era alimentado com silagem. Em três propriedades havia contato próximo dos ovinos afetados com outras espécies. A evolução do quadro clínico foi de 12 horas a três dias e os sinais clínicos foram caracterizados por decúbito (7/7, desvio da cabeça (4/7, incoordenação (3/7, depressão (3/7, andar em círculos (2/7, cegueira unilateral, emagrecimento progressivo, febre, midríase, movimentos de pedalagem, nistagmo lateral, opistótono, paralisia flácida dos membros pélvicos ou dos quatro membros, salivação excessiva e tremores (1/7 cada. Histologicamente observou-se encefalite com microabscessos, predominantemente unilateral com variáveis graus de gliose e alterações degenerativas como esferóides axonais e infiltração de células Gitter. As lesões se estendiam desde a medula oblonga até o mesencéfalo. Antígenos de Listeria monocytogenes foram detectados por imuno-histoquímica em seções de tronco encefálico de todos os ovinos afetados. O diagnóstico foi realizado com base nos achados epidemiológicos e clinico-patológicos, e confirmado pela imuno-histoquímica (IHQ utilizando anticorpo policlonal anti-L. monocytogenes.Seven cases of neurological disease in sheep caused by Listeria monocytogenes in Rio Grande do Sul and Paraná state, southern Brazil are described. The cases occurred between 2000 and 2007 and 12-24-month-old sheep were affected. Overall morbidity and lethality rates were 3.15% and 100%, respectively. Cases occurred in the summer and early spring. When this information was available, affected sheep had not been

Listeria monocytogenes infection of HD11, chicken macrophage-like cells.

Science.gov (United States)

Jarvis, N A; Donaldson, J R; O'Bryan, C A; Ricke, S C; Crandall, P G

2017-04-01

Listeria monocytogenes can be carried by and infect poultry, although the clinical disease in birds is rare. Escape from macrophage phagocytosis is a key step in pathogenesis for L. monocytogenes. Therefore, we investigated the infection of the chicken macrophage-like cell line HD11 with 2 strains of L. monocytogenes EGD-e and Scott A. After infection, L. monocytogenes was quantified by spread plating and HD11 was quantified with trypan blue exclusion stain before enumeration. The standard macrophage killing protocols require washing the cell monolayers 3 times with PBS, which was found to negatively influence HD11 monolayers. Maximum bacterial densities within macrophages were not different between the 2 Listeria strains. HD11 required more than 11 h to effectively reduce intracellular L. monocytogenes Scott A, and Scott A was more susceptible to HD11 killing than EGD-e. It appears that Listeria infection initially causes attenuation of HD11 growth, and infected HD11 cells do not begin to lyse until at least 11 h post infection. These results suggest that there are subtle strain to strain differences in response to HD11 macrophage phagocytosis. The long lead-time required for HD11 to kill L. monocytogenes cells means that there is sufficient time available for chicken macrophages to circulate in the blood and transfer the intracellular Listeria to multiple tissues. © 2016 Poultry Science Association Inc.

Survival of Bactericidal Antibiotic Treatment by a Persister Subpopulation of Listeria monocytogenes

DEFF Research Database (Denmark)

Knudsen, Gitte Maegaard; Ng, Yin; Gram, Lone

2013-01-01

Listeria monocytogenes can cause the serious infection listeriosis, which despite antibiotic treatment has a high mortality. Understanding the response of L. monocytogenes to antibiotic exposure is therefore important to ensure treatment success. Some bacteria survive antibiotic treatment...... by formation of persisters, which are a dormant antibiotic-tolerant subpopulation. The purpose of this study was to determine whether L. monocytogenes can form persisters and how bacterial physiology affects the number of persisters in the population. A stationary-phase culture of L. monocytogenes was adjusted...... that eradication of persisters is possible. Our study adds L. monocytogenes to the list of bacterial species capable of surviving bactericidal antibiotics in a dormant stage, and this persister phenomenon should be borne in mind when developing treatment regimens....

Effect of peracetic acid on biofilms formed by Listeria monocytogenes strains isolated from a Brazilian cheese processing plant

Directory of Open Access Journals (Sweden)

Sarah Hwa In Lee

2017-10-01

Full Text Available ABSTRACT This study aimed to investigate the effect of peracetic acid (PAA, 0.5% on adherent cells of three strains of Listeria monocytogenes strains belonging to serotypes 4b and 1/2b that had been previously isolated from the environment of a Brazilian cheese plant. The assays were conducted using polystyrene microplates and stainless steel coupons and the adhered cells were treated with PAA for 60, 120 and 180 s. On stainless steel, biofilms were partially inactivated by PAA after 60 s and almost 100% of the cells were damaged within 180 s using epifluorescence microscopy with LIVE/DEAD® staining. On polystyrene microplates, PAA decreased (P<0.05 biofilm biomass produced by the three L. monocytogenes isolates at 60 s, when compared with controls (no PAA treatment. However, PAA did not completely eliminate L. monocytogenes cells on polystyrene microplates (decreasing 1.8-2.5 log cycles after treatment with PAA for 180 s. The correct concentration and contact time of PAA is critical for eliminating biofilms formed by L. monocytogenes on stainless steel surfaces, although further studies are needed for defining efficient PAA treatments to remove adherent cells of this pathogen on plastic polymers.

Detection of Listeria Spp. and Listeria monocytogenes in vegetables ...

African Journals Online (AJOL)

This paper aimed to study the prevalence and antibiotic resistance pattern among Listeria monocytogenes in raw vegetables sourced from commercial farms and local farms in Terengganu. Thirteen types of vegetables investigated for the presence of L. monocytogenes using multiplex PCR and LAMP methods. Isolation of ...

Cellular and molecular investigations of the adhesion and mechanics of Listeria monocytogenes

Science.gov (United States)

Eskhan, Asma Omar

Atomic force microscopy has been used to quantify the adherence and mechanical properties of an array of L. monocytogenes strains and their surface biopolymers. First, eight L. monocytogenes strains that represented the two major lineages of the species were compared for their adherence and mechanics at cellular and molecular levels. Our results indicated that strains of lineage' II were characterized by higher adhesion and Young's moduli, longer and more rigid surface biopolymers and lower specific and nonspecific forces when compared to lineage' I strains. Additionally, adherence and mechanical properties of eight L. monocytogenes epidemic and environmental strains were probed. Our results pointed to that environmental and epidemic strains representative of a given lineage were similar in their adherence and mechanical properties when investigated at a cellular level. However, when the molecular properties of the strains were considered, epidemic strains were characterized by higher specific and nonspecific forces, shorter, denser and more flexible biopolymers compared to environmental strains. Second, the role of environmental pH conditions of growth on the adhesion and mechanics of a pathogenic L. monocytogenes EGDe was investigated. Our results pointed to a transition in the adhesion energies for cells cultured at pH 7. In addition, when the types of molecular forces that govern the adhesion were quantified using Poisson statistical approach and using a new proposed method, specific hydrogen-bond energies dominated the bacterial adhesion process. Such a finding is instrumental to researchers designing methods to control bacterial adhesion. Similarly, bacterial cells underwent a transition in their mechanical properties. We have shown that cells cultured at pH 7 were the most rigid compared to those cultured in lower or higher pH conditions of growth. Due to transitions observed in adherence and mechanics when cells were cultured at pH 7, we hypothesized that

Longitudinal study on the sources of Listeria monocytogenes contamination in cold-smoked salmon and its processing environment in Italy.

Science.gov (United States)

Di Ciccio, Pierluigi; Meloni, Domenico; Festino, Anna Rita; Conter, Mauro; Zanardi, Emanuela; Ghidini, Sergio; Vergara, Alberto; Mazzette, Rina; Ianieri, Adriana

2012-08-01

The aim of the present study was to investigate the sources of Listeria monocytogenes contamination in a cold smoked salmon processing environment over a period of six years (2003-2008). A total of 170 samples of raw material, semi-processed, final product and processing surfaces at different production stages were tested for the presence of L. monocytogenes. The L. monocytogenes isolates were characterized by multiplex PCR for the analysis of virulence factors and for serogrouping. The routes of contamination over the six year period were traced by PFGE. L. monocytogenes was isolated from 24% of the raw salmon samples, 14% of the semi-processed products and 12% of the final products. Among the environmental samples, 16% were positive for L. monocytogenes. Serotyping yielded three serovars: 1/2a, 1/2b, 4b, with the majority belonging to serovars 1/2a (46%) and 1/2b (39%). PFGE yielded 14 profiles: two of them were repeatedly isolated in 2005-2006 and in 2007-2008 mainly from the processing environment and final products but also from raw materials. The results of this longitudinal study highlighted that contamination of smoked salmon occurs mainly during processing rather than originating from raw materials, even if raw fish can be a contamination source of the working environment. Molecular subtyping is critical for the identification of the contamination routes of L. monocytogenes and its niches into the production plant when control strategies must be implemented with the aim to reduce its prevalence during manufacturing. Copyright © 2012 Elsevier B.V. All rights reserved.

Early trigeminal nerve involvement in Listeria monocytogenes rhombencephalitis

DEFF Research Database (Denmark)

Karlsson, William K; Harboe, Zitta Barrella; Roed, Casper

2017-01-01

dysfunction on that side. In addition, we identified another 120 cases of Listeria rhombencephalitis following a systematic review. Cranial nerves VII, V, IX, and X, respectively, medulla oblongata, cerebellum and pons, were the most frequently involved brain structures. The present clinical and radiological...... findings corroborate earlier data from animal experiments, indicating that L. monocytogenes may be capable of retrograde intra-axonal migration along the cranial nerves. We suggest that in a subset of patients with rhombencephalitis L. monocytogenes enters the cerebellopontine angle through the trigeminal......Listeria monocytogenes is associated with rhombencephalitis. However, the exact mechanisms of brainstem invasion remains poorly understood. Here, we demonstrate clinical and radiological data suggesting that Listeria may invade the brainstem via the trigeminal nerve. Three females (41, 64 and 70...

Prevalence and antimicrobial susceptibility of Listeria monocytogenes on chicken carcasses in Bandung, Indonesia.

Science.gov (United States)

Sugiri, Yoni Darmawan; Gölz, Greta; Meeyam, Tongkorn; Baumann, Maximilian P O; Kleer, Josef; Chaisowwong, Warangkhana; Alter, Thomas

2014-08-01

This study was conducted to determine the prevalence and quantify the number of Listeria monocytogenes in fresh chicken carcasses sold in traditional markets and supermarkets in Bandung, West Java, Indonesia, and to determine the antimicrobial resistance patterns of the isolated L. monocytogenes strains. The overall prevalence of L. monocytogenes in chicken carcasses was 15.8% (29/184). When comparing samples from traditional markets and supermarkets, no significant difference in the L. monocytogenes prevalence was detectable (15.2 versus 16.3%). Of the samples, 97.3% had L. monocytogenes counts study were grouped into the molecular serogroup IIb, comprising the serovars 1/2b, 3b, and 7.

Transfer of microorganisms, including Listeria monocytogenes, from various materials to beef.

Science.gov (United States)

Midelet, Graziella; Carpentier, Brigitte

2002-08-01

The quantity of microorganisms that may be transferred to a food that comes into contact with a contaminated surface depends on the density of microorganisms on the surface and on the attachment strengths of the microorganisms on the materials. We made repeated contacts between pieces of meat and various surfaces (stainless steel and conveyor belt materials [polyvinyl chloride and polyurethane]), which were conditioned with meat exudate and then were contaminated with Listeria monocytogenes, Staphylococcus sciuri, Pseudomonas putida, or Comamonas sp. Attachment strengths were assessed by the slopes of the two-phase curves obtained by plotting the logarithm of the number of microorganisms transferred against the order number of the contact. These curves were also used to estimate the microbial population on the surface by using the equation of A. Veulemans, E. Jacqmain, and D. Jacqmain (Rev. Ferment. Ind. Aliment. 25:58-65, 1970). The biofilms were characterized according to their physicochemical surface properties and structures. Their exopolysaccharide-producing capacities were assessed from biofilms grown on polystyrene. The L. monocytogenes biofilms attached more strongly to polymers than did the other strains, and attachment strength proved to be weaker on stainless steel than on the two polymers. However, in most cases, it was the population of the biofilms that had the strongest influence on the total number of CFU detached. Although attachment strengths were weaker on stainless steel, this material, carrying a smaller population of bacteria, had a weaker contaminating capacity. In most cases the equation of Veulemans et al. revealed more bacteria than did swabbing the biofilms, and it provided a better assessment of the contaminating potential of the polymeric materials studied here.

Attached and planktonic Listeria monocytogenes global proteomic responses and associated influence of strain genetics and temperature.

Science.gov (United States)

Mata, Marcia M; da Silva, Wladimir P; Wilson, Richard; Lowe, Edwin; Bowman, John P

2015-02-06

Contamination of industrial and domestic food usage environments by the attachement of bacterial food-borne pathogen Listeria monocytogenes has public health and economic implications. Comprehensive proteomics experiments using label-free liquid chromatography/tandem mass spectrometry were used to compare the proteomes of two different L. monocytogenes strains (Siliken_1/2c and F2365_4b), which show very different capacities to attach to surfaces. Growth temperature and strain type were highly influential on the proteomes in both attached and planktonic cells. On the basis of the proteomic data, it is highly unlikely that specific surface proteins play a direct role in adherence to inanimate surfaces. Instead, strain-dependent responses related to cell envelope polymer biosynthesis and stress response regulation likely contribute to a different ability to attach and also to survive external stressors. Collectively, the divergent proteome-level responses observed define strain- and growth-temperature-dependent differences relevant to attachment efficacy, highlight relevant proteins involved in stress protection in attached cells, and suggest that strain differences and growth conditions are important in relation to environmental persistence.

Effect of peracetic acid on biofilms formed by Staphylococcus aureus and Listeria monocytogenes isolated from dairy plants.

Science.gov (United States)

Lee, S H I; Cappato, L P; Corassin, C H; Cruz, A G; Oliveira, C A F

2016-03-01

This research investigated the removal of adherent cells of 4 strains of Staphylococcus aureus and 1 Listeria monocytogenes strain (previously isolated from dairy plants) from polystyrene microtiter plates using peracetic acid (PAA, 0.5%) for 15, 30, 60, and 120 s, and the inactivation of biofilms formed by those strains on stainless steel coupons using the same treatment times. In the microtiter plates, PAA removed all S. aureus at 15 s compared with control (no PAA treatment). However, L. monocytogenes biofilm was not affected by any PAA treatment. On the stainless steel surface, epifluorescence microscopy using LIVE/DEAD staining (BacLight, Molecular Probes/Thermo Fisher Scientific, Eugene, OR) showed that all strains were damaged within 15 s, with almost 100% of cells inactivated after 30 s. Results of this trial indicate that, although PAA was able to inactivate both S. aureus and L. monocytogenes monospecies biofilms on stainless steel, it was only able to remove adherent cells of S. aureus from polystyrene microplates. The correct use of PAA is critical for eliminating biofilms formed by S. aureus strains found in dairy plants, although further studies are necessary to determine the optimal PAA treatment for removing biofilms of L. monocytogenes. Copyright © 2016 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

Modeling the growth of Listeria monocytogenes in soft blue-white cheese

DEFF Research Database (Denmark)

Rosshaug, Per Sand; Detmer, Ann; Ingmer, Hanne

2012-01-01

The aim of this study was to develop a predictive model simulating growth over time of the pathogenic bacterium Listeria monocytogenes in a soft blue-white cheese. The physicochemical properties in a matrix such as cheese are essential controlling factors influencing the growth of L. monocytogenes....... We developed a predictive tertiary model of the bacterial growth of L. monocytogenes as a function of temperature, pH, NaCl, and lactic acid. We measured the variations over time of the physicochemical properties in the cheese. Our predictive model was developed based on broth data produced...... production and retail conditions showed that the number of L. monocytogenes cells increases 3 to 3.5 log within the shelf life of the cheese....

Evolution of Starspots on LO Pegasi

Science.gov (United States)

Harmon, Robert; Bloodgood, Felise; Martin, Alec; Pellegrin, Kyle

2018-01-01

LO Pegasi is a young solar analog, a K main-sequence star that rotates with a period of 10.1538 hr. The rapid rotation yields a strong stellar dynamo associated with large starspots on the surface, which are regions where the magnetic field inhibits the convective transport of energy from below, so that the spots are cooler and thus darker than the surrounding photosphere. The star thus exhibits rotational modulation of its light curve as the starspots are carried into and out of view of Earth. CCD images of LO Peg were acquired at Perkins Observatory in Delaware, OH through standard B, V, R, and I photometric filters from 2017 June 1 to July 20. After subtracting dark frames and flat fielding the images, differential aperture photometry was performed to yield light curves through each of the four filters. The resulting light curves that were then analyzed via the Light-curve Inversion program created by one of us (Harmon) to produce surface maps. Our observations indicated that LO Pegasi’s light curve changed in both amplitude and shape between 2017 June and July, while its maximum brightness did not change. We present maps corresponding to these two distinct light curves, along with maps for data acquired from 2006-2016.

Occurrence of Listeria monocytogenes in smoked fish in Sokoto ...

African Journals Online (AJOL)

The present study was conducted to determine the prevalence of Listeria monocytogenes in smoked fish in Sokoto, Nigeria. A total of 115 different species of smoked fish from the various retail outlets and market places within the metropolis were analysed for the presence of L. monocytogenes using ISO culture method.

Effect of the vitamin B12-binding protein haptocorrin present in human milk on a panel of commensal and pathogenic bacteria

DEFF Research Database (Denmark)

Roager, Henrik Munch; Laursen, Martin Frederik; Lildballe, Dorte L.

2011-01-01

commensal and pathogenic bacteria to which infants are likely to be exposed. Well-diffusion assays addressing antibacterial effects were performed with human milk, haptocorrin-free human milk, porcine holo-haptocorrin (saturated with B-12) and human apo-haptocorrin (unsaturated). Human milk inhibited...... properties of this protein may exert a general defense against pathogens and/or affect the composition of the developing microbiota in the gastrointestinal tracts of breastfed infants. Findings: The present work was the first systematic study of the effect of haptocorrin on bacterial growth, and included 34...... the growth of S. thermophilus and the pathogenic strains L. monocytogenes LO28, L. monocytogenes 4446 and L. monocytogenes 7291, but the inhibition could not be ascribed to haptocorrin. Human apo-haptocorrin inhibited the growth of only a single bacterial strain (Bifidobacterium breve), while porcine holo...

Effekt av ulike desinfeksjonsstrategier mot Listeria monocytogenes

OpenAIRE

Fossmo, Sabine

2013-01-01

Kontroll med bakterier som Listeria utgjør en stor utfordring for mange matprodusenter. Listeria monocytogenes er hovedsakelig et produksjonshygienisk problem, forbedret hygiene kan derfor være tiltak for å redusere overlevelse og smitteoverføring av bakterien i produksjonsmiljø. Hensikten med forsøkene i oppgaven var å undersøke effekten av ulike desinfeksjonsstrategier på drap av L. monocytogenes, både når bakteriene var i biofilm og i suspensjon. Dette inkluderte bruk av tradisjonelle desi...

Monitoring paneer for Listeria monocytogenes - A high risk food ...

African Journals Online (AJOL)

A multiplex polymerase chain reaction (PCR) assay was developed and applied to spiked and natural paneer samples to detect Listeria monocytogenes, a high risk food pathogen. The sensitivity of the assay on L. monocytogenes spiked paneer samples was 104 cells prior to enrichment, was improved to 103 cells after 4 h ...

Genome sequences of Listeria monocytogenes strains with resistance to arsenic

Science.gov (United States)

Listeria monocytogenes frequently exhibits resistance to arsenic. We report here the draft genome sequences of eight genetically diverse arsenic-resistant L. monocytogenes strains from human listeriosis and food-associated environments. Availability of these genomes would help to elucidate the role ...

Effects of prebiotics on the infective potential of Listeria monocytogenes

DEFF Research Database (Denmark)

Ebersbach, Tine

% xylooligosaccharides (XOS), galactooligosaccharides (GOS), inulin, apple pectin or polydextrose for three weeks before oral challenge with L. monocytogenes. XOS and GOS significantly improved resistance of guinea pigs to L. monocytogenes, while inulin and apple pectin decreased the resistance. No significant effect...

Restraining reactive oxygen species in Listeria monocytogenes promotes the apoptosis of glial cells.

Science.gov (United States)

Li, Sen; Li, Yixuan; Chen, Guowei; Zhang, Jingchen; Xu, Fei; Wu, Man

2017-07-01

Listeria monocytogenes is a facultative anaerobic foodborne pathogen that can traverse the blood-brain barrier and cause brain infection. L. monocytogenes infection induces host cell apoptosis in several cell types. In this study, we investigated the apoptosis of human glioma cell line U251 invaded by L. monocytogenes and evaluated the function of bacterial reactive oxygen species (ROS) during infection. Bacterial ROS level was reduced by carrying out treatment with N-acetyl cysteine (NAC) and diphenyleneiodonium chloride (DPI). After infection, the apoptosis of U251 cells was examined by flow cytometry assay and propidium iodide staining. DPI and NAC efficiently decreased ROS level in L. monocytogenes without affecting bacterial growth. Moreover, the apoptosis of glial cells was enhanced upon invasion of DPI- and NAC-pretreated L. monocytogenes. Results indicate that the apoptosis of glial cells can be induced by L. monocytogenes, and that the inhibition of bacterial ROS increases the apoptosis of host cells.

Listeria monocytogenes internalizes in Romaine Lettuce grown in greenhouse conditions

Science.gov (United States)

Listeria monocytogenes has been implicated in a number of outbreaks involving fresh produce, including an outbreak in 2016 resulting from contaminated packaged salads. The persistence and internalization potential of L. monocytogenes in romaine lettuce was evaluated, and the persistence of two L. mo...

Growth inhibition of Listeria monocytogenes by a nonbacteriocinogenic Carnobacterium piscicola

DEFF Research Database (Denmark)

Nilsson, Lilian; Bech Hansen, T.; Garrido, P.

2005-01-01

Aims: This study elucidates the mechanisms by which a nonbacteriocinogenic Carnobacterium piscicola inhibits growth of Listeria monocytogenes. Methods and Results: Listeria monocytogenes was exposed to live cultures of a bacteriocin-negative variant of C. piscicola A9b in co-culture, in a diffusion...... chamber system, and to a cell-free supernatant. Suppression of maximum cell density (0-3.5 log units) of L. monocytogenes was proportional to initial levels of C. pisciola (10(3)-10(7) CFU ml(-1)). Cell-to-cell contact was not required to cause inhibition. The cell-free C. piscicola supernatant caused...... a decrease in L. monocytogenes maximum cell density, which was abolished by glucose addition but not by amino acid, vitamin or mineral addition. The fermentate also gave rise to a longer lag phase and a reduction in growth rate. These effects were independent of glucose and may have been caused by acetate...

Prevalence and serotypes of Listeria monocytogenes contamination in Chinese beef processing plants.

Science.gov (United States)

Zhu, Lixian; Feng, Xiaohui; Zhang, Lihua; Zhu, Ruiliang; Luo, Xin

2012-06-01

The aim of this work was to study the epidemiology of Listeria spp., particularly Listeria monocytogenes, and to identify the serotypes present in contaminated samples from beef processing plants in China. A total of 439 samples were obtained from bovine feces, hides, and carcasses at three commercial processing plants. A standard protocol (ISO 11290-1) was followed to detect Listeria spp. and L. monocytogenes, and multiplex polymerase chain reaction was used to identify the various L. monocytogenes serotypes. The overall prevalences of Listeria spp. and L. monocytogenes were 65.6% and 26.4%, respectively, and the contamination was highest in the hide samples. The identified L. monocytogenes serotypes were 1/2c and 1/2a. The results of the current study indicate that Listeria spp. contamination is common in Chinese beef processing plants; specific measures should be taken to prevent and/or treat L. monocytogenes contamination of feces and hides in beef slaughter plants. Furthermore, because Listeria spp. contamination was found to be prevalent, it should, therefore, be studied further. The prevention of cases of sporadic listeriosis in China should also be addressed.

Listeria prevalence and Listeria monocytogenes serovar diversity at cull cow and bull processing plants in the United States.

Science.gov (United States)

Guerini, Michael N; Brichta-Harhay, Dayna M; Shackelford, T Steven D; Arthur, Terrance M; Bosilevac, Joseph M; Kalchayanand, Norasak; Wheeler, Tommy L; Koohmaraie, Mohammad

2007-11-01

Listeria monocytogenes, the causative agent of epidemic and sporadic listeriosis, is routinely isolated from many sources, including cattle, yet information on the prevalence of Listeria in beef processing plants in the United States is minimal. From July 2005 through April 2006, four commercial cow and bull processing plants were sampled in the United States to determine the prevalence of Listeria and the serovar diversity of L. monocytogenes. Samples were collected during the summer, fall, winter, and spring. Listeria prevalence on hides was consistently higher during cooler weather (28 to 92% of samples) than during warmer weather (6 and 77% of samples). The Listeria prevalence data collected from preevisceration carcass ranged from undetectable in some warm season samples to as high as 71% during cooler weather. Listeria on postintervention carcasses in the chill cooler was normally undetectable, with the exception of summer and spring samples from one plant where > 19% of the carcasses were positive for Listeria. On hides, L. monocytogenes serovar 1/2a was the predominant serovar observed, with serovars 1/2b and 4b present 2.5 times less often and serovar 1/2c not detected on any hides sampled. L. monocytogenes serovars 1/2a, 1/2c, and 4b were found on postintervention carcasses. This prevalence study demonstrates that Listeria species are more prevalent on hides during the winter and spring and that interventions being used in cow and bull processing plants appear to be effective in reducing or eliminating Listeria contamination on carcasses.

Survival strategies of Listeria monocytogenes - roles of regulators and transporters

NARCIS (Netherlands)

Wemekamp-Kamphuis, H.H.

2003-01-01

Outbreaks of the food-borne pathogen Listeria monocytogenes are mainly associated with ready-to-eatfoods. Survival strategies of L. monocytogenes in relation to minimally processed foods were studied.

Microbiological criteria for Listeria monocytogenes in foods under special consideration of risk assessment approaches

DEFF Research Database (Denmark)

Nørrung, Birgit

2000-01-01

This paper shortly summarizes data related to risk assessment of Listeria monocytogenes. From available data on risk assessment, it is concluded that the levels of L. monocytogenes consumed is an important factor affecting the incidence of listeriosis. Foods that do not support the growth of L....... monocytogenes are unlikely to be a source of listeriosis, whereas foods that support the growth to high levels, should be the target of risk management efforts. Based on current epidemiological information from several countries, a concentration of L. monocytogenes not exceeding 100/g of food at the time...... of L. monocytogenes in the food during prevailing storage and distribution conditions is needed....

Prevalence of Listeria monocytogenes in raw milk in North Lebanon

International Nuclear Information System (INIS)

Al Kassaa, I; El Omari, Kh.; Esmail, B.; Hamze, M; Saati, M.

2016-01-01

Listeriosis, although a zoonosis, is an invasive disease that can affect newborns, pregnant women and immunocompromised adults. Clinical manifestations can be expressedby febrile gastroenteritis, invasive forms including severe sepsis, meningitis, rhombencephalitis, prenatal infections and abortions. Species of Listeria bacteria are ubiquitous and adaptableto the environment in animal and plant foods. This study aimed to determine the prevalence of Listeria monocytogenes in 100 samples of fresh cow milk collected from different areas of North Lebanon. Listeria monocytogenes was detected by using the Grand VIDAS technique (Biomérieux France). The results obtained revealed the absence of Listeria monocytogenes inall analyzed samples. (Author)

Prebiotic Oligosaccharides Potentiate Host Protective Responses against L. Monocytogenes Infection

Directory of Open Access Journals (Sweden)

Poyin Chen

2017-12-01

Full Text Available Prebiotic oligosaccharides are used to modulate enteric pathogens and reduce pathogen shedding. The interactions with prebiotics that alter Listeria monocytogenes infection are not yet clearly delineated. L. monocytogenes cellular invasion requires a concerted manipulation of host epithelial cell membrane receptors to initiate internalization and infection often via receptor glycosylation. Bacterial interactions with host glycans are intimately involved in modulating cellular responses through signaling cascades at the membrane and in intracellular compartments. Characterizing the mechanisms underpinning these modulations is essential for predictive use of dietary prebiotics to diminish pathogen association. We demonstrated that human milk oligosaccharide (HMO pretreatment of colonic epithelial cells (Caco-2 led to a 50% decrease in Listeria association, while Biomos pretreatment increased host association by 150%. L. monocytogenes-induced gene expression changes due to oligosaccharide pretreatment revealed global alterations in host signaling pathways that resulted in differential subcellular localization of L. monocytogenes during early infection. Ultimately, HMO pretreatment led to bacterial clearance in Caco-2 cells via induction of the unfolded protein response and eIF2 signaling, while Biomos pretreatment resulted in the induction of host autophagy and L. monocytogenes vacuolar escape earlier in the infection progression. This study demonstrates the capacity of prebiotic oligosaccharides to minimize infection through induction of host-intrinsic protective responses.

Deciphering the landscape of host barriers to Listeria monocytogenes infection.

Science.gov (United States)

Zhang, Ting; Abel, Sören; Abel Zur Wiesch, Pia; Sasabe, Jumpei; Davis, Brigid M; Higgins, Darren E; Waldor, Matthew K

2017-06-13

Listeria monocytogenes is a common food-borne pathogen that can disseminate from the intestine and infect multiple organs. Here, we used sequence tag-based analysis of microbial populations (STAMP) to investigate L monocytogenes population dynamics during infection. We created a genetically barcoded library of murinized L monocytogenes and then used deep sequencing to track the pathogen's dissemination routes and quantify its founding population ( N b ) sizes in different organs. We found that the pathogen disseminates from the gastrointestinal tract to distal sites through multiple independent routes and that N b sizes vary greatly among tissues, indicative of diverse host barriers to infection. Unexpectedly, comparative analyses of sequence tags revealed that fecally excreted organisms are largely derived from the very small number of L. monocytogenes cells that colonize the gallbladder. Immune depletion studies suggest that distinct innate immune cells restrict the pathogen's capacity to establish replicative niches in the spleen and liver. Finally, studies in germ-free mice suggest that the microbiota plays a critical role in the development of the splenic, but not the hepatic, barriers that prevent L. monocytogenes from seeding these organs. Collectively, these observations illustrate the potency of the STAMP approach to decipher the impact of host factors on population dynamics of pathogens during infection.

Listeria monocytogenes: diagnostic problems

NARCIS (Netherlands)

Beumer, R.R.; Hazeleger, W.C.

2003-01-01

The first isolation methods for the detection of Listeria spp. were generally based on the direct culture of samples on simple agar media, but isolation of the pathogenic Listeria monocytogenes was difficult. In time, new techniques were developed, based on a variety of selective and elective agents

Assessment of Listeria sp. Interference Using a Molecular Assay To Detect Listeria monocytogenes in Food.

Science.gov (United States)

Zittermann, Sandra I; Stanghini, Brenda; See, Ryan Soo; Melano, Roberto G; Boleszczuk, Peter; Murphy, Allana; Maki, Anne; Mallo, Gustavo V

2016-01-01

Detection of Listeria monocytogenes in food is currently based on enrichment methods. When L. monocytogenes is present with other Listeria species in food, the species compete during the enrichment process. Overgrowth competition of the nonpathogenic Listeria species might result in false-negative results obtained with the current reference methods. This potential issue was noted when 50 food samples artificially spiked with L. monocytogenes were tested with a real-time PCR assay and Canada's current reference method, MFHPB-30. Eleven of the samples studied were from foods naturally contaminated with Listeria species other than those used for spiking. The real-time PCR assay detected L. monocytogenes in all 11 of these samples; however, only 6 of these samples were positive by the MFHPB-30 method. To determine whether L. monocytogenes detection can be affected by other species of the same genus due to competition, an L. monocytogenes strain and a Listeria innocua strain with a faster rate of growth in the enrichment broth were artificially coinoculated at different ratios into ground pork meat samples and cultured according to the MFHPB-30 method. L. monocytogenes was detected only by the MFHPB-30 method when L. monocytogenes/L. innocua ratios were 6.0 or higher. In contrast, using the same enrichments, the real-time PCR assay detected L. monocytogenes at ratios as low as 0.6. Taken together, these findings support the hypothesis that L. monocytogenes can be outcompeted by L. innocua during the MFHPB-30 enrichment phase. However, more reliable detection of L. monocytogenes in this situation can be achieved by a PCR-based method mainly because of its sensitivity.

Transfer of antibiotic resistance from Enterococcus faecium of fermented meat origin to Listeria monocytogenes and Listeria innocua.

Science.gov (United States)

Jahan, M; Holley, R A

2016-04-01

Listeria monocytogenes is an important foodborne pathogen that can cause infection in children, pregnant women, the immunocompromised and the elderly. Antibiotic resistance in this species would represent a significant public health problem since the organism has a high fatality/case ratio and resistance may contribute to failure of therapeutic treatment. This study was designed to explore whether the in vitro transferability of antibiotic resistance from enterococci to Listeria spp. could occur. It was found that 2/8 Listeria strains were able to acquire tetracycline resistance from Enterococcus faecium. Listeria monocytogenes GLM-2 acquired the resistance determinant tet(M) and additional streptomycin resistance through in vitro mating with Ent. faecium S27 isolated from commercial fermented dry sausage. Similarly, Listeria innocua became more resistant to tetracycline, but the genetic basis for this change was not confirmed. It has been suggested that enterococci may transfer antibiotic resistance genes via transposons to Listeria spp., and this may explain, in part, the origin of their antibiotic resistance. Thus, the presence of enterococci in food should not be ignored since they may actively contribute to enhanced antibiotic resistance of L. monocytogenes and other pathogens. Acquisition of antibiotic resistance by pathogenic bacteria in the absence of antibiotic pressure represents an unquantified threat to human health. In the present work resistance to tetracycline and streptomycin were transferred by nonplasmid-based conjugation from Enterococcus faecium isolated from fermented sausage to Listeria monocytogenes and Listeria innocua. Thus, natural transfer of antibiotic resistance to Listeria strains may occur in the future which reinforces the concern about the safety of enterococcal strains present in foods. © 2016 The Society for Applied Microbiology.

Comparative experimental infection of Listeria monocytogenes and Listeria ivanovii in bovine trophoblasts.

Science.gov (United States)

Rocha, Cláudia E; Mol, Juliana P S; Garcia, Luize N N; Costa, Luciana F; Santos, Renato L; Paixão, Tatiane A

2017-01-01

Listeria monocytogenes is a Gram-positive, facultative intracellular and invasive bacterium that has tropism to the placenta, and causes fetal morbidity and mortality in several mammalian species. While infection with L. monocytogenes and L. ivanovii are known as important causes of abortion and reproductive failure in cattle, the pathogenesis of maternal-fetal listeriosis in this species is poorly known. This study used the bovine chorioallantoic membrane explant model to investigate the kinetics of L. monocytogenes, L. ivanovii, and L. innocua infections in bovine trophoblastic cells for up to 8 h post infection. L. monocytogenes and L. ivanovii were able to invade and multiply in trophoblastic cells without causing cell death or inducing expression of pro-inflammatory genes. Although L. innocua was unable to multiply in bovine trophoblastic cells, it induced transcription of the pro-inflammatory mediator CXCL6. This study demonstrated for the first time the susceptibility of bovine trophoblastic cells to L. monocytogenes and L. ivanovii infection.

LoWMob: Intra-PAN Mobility Support Schemes for 6LoWPAN.

Science.gov (United States)

Bag, Gargi; Raza, Muhammad Taqi; Kim, Ki-Hyung; Yoo, Seung-Wha

2009-01-01

Mobility in 6LoWPAN (IPv6 over Low Power Personal Area Networks) is being utilized in realizing many applications where sensor nodes, while moving, sense and transmit the gathered data to a monitoring server. By employing IEEE802.15.4 as a baseline for the link layer technology, 6LoWPAN implies low data rate and low power consumption with periodic sleep and wakeups for sensor nodes, without requiring them to incorporate complex hardware. Also enabling sensor nodes with IPv6 ensures that the sensor data can be accessed anytime and anywhere from the world. Several existing mobility-related schemes like HMIPv6, MIPv6, HAWAII, and Cellular IP require active participation of mobile nodes in the mobility signaling, thus leading to the mobility-related changes in the protocol stack of mobile nodes. In this paper, we present LoWMob, which is a network-based mobility scheme for mobile 6LoWPAN nodes in which the mobility of 6LoWPAN nodes is handled at the network-side. LoWMob ensures multi-hop communication between gateways and mobile nodes with the help of the static nodes within a 6LoWPAN. In order to reduce the signaling overhead of static nodes for supporting mobile nodes, LoWMob proposes a mobility support packet format at the adaptation layer of 6LoWPAN. Also we present a distributed version of LoWMob, named as DLoWMob (or Distributed LoWMob), which employs Mobility Support Points (MSPs) to distribute the traffic concentration at the gateways and to optimize the multi-hop routing path between source and destination nodes in a 6LoWPAN. Moreover, we have also discussed the security considerations for our proposed mobility schemes. The performance of our proposed schemes is evaluated in terms of mobility signaling costs, end-to-end delay, and packet success ratio.

LoWMob: Intra-PAN Mobility Support Schemes for 6LoWPAN

Directory of Open Access Journals (Sweden)

Seung-Wha Yoo

2009-07-01

Full Text Available Mobility in 6LoWPAN (IPv6 over Low Power Personal Area Networks is being utilized in realizing many applications where sensor nodes, while moving, sense and transmit the gathered data to a monitoring server. By employing IEEE802.15.4 as a baseline for the link layer technology, 6LoWPAN implies low data rate and low power consumption with periodic sleep and wakeups for sensor nodes, without requiring them to incorporate complex hardware. Also enabling sensor nodes with IPv6 ensures that the sensor data can be accessed anytime and anywhere from the world. Several existing mobility-related schemes like HMIPv6, MIPv6, HAWAII, and Cellular IP require active participation of mobile nodes in the mobility signaling, thus leading to the mobility-related changes in the protocol stack of mobile nodes. In this paper, we present LoWMob, which is a network-based mobility scheme for mobile 6LoWPAN nodes in which the mobility of 6LoWPAN nodes is handled at the network-side. LoWMob ensures multi-hop communication between gateways and mobile nodes with the help of the static nodes within a 6LoWPAN. In order to reduce the signaling overhead of static nodes for supporting mobile nodes, LoWMob proposes a mobility support packet format at the adaptation layer of 6LoWPAN. Also we present a distributed version of LoWMob, named as DLoWMob (or Distributed LoWMob, which employs Mobility Support Points (MSPs to distribute the traffic concentration at the gateways and to optimize the multi-hop routing path between source and destination nodes in a 6LoWPAN. Moreover, we have also discussed the security considerations for our proposed mobility schemes. The performance of our proposed schemes is evaluated in terms of mobility signaling costs, end-to-end delay, and packet success ratio.

Comparative genomics and transcriptomics of lineages I, II, and III strains of Listeria monocytogenes

Directory of Open Access Journals (Sweden)

Hain Torsten

2012-04-01

Full Text Available Abstract Background Listeria monocytogenes is a food-borne pathogen that causes infections with a high-mortality rate and has served as an invaluable model for intracellular parasitism. Here, we report complete genome sequences for two L. monocytogenes strains belonging to serotype 4a (L99 and 4b (CLIP80459, and transcriptomes of representative strains from lineages I, II, and III, thereby permitting in-depth comparison of genome- and transcriptome -based data from three lineages of L. monocytogenes. Lineage III, represented by the 4a L99 genome is known to contain strains less virulent for humans. Results The genome analysis of the weakly pathogenic L99 serotype 4a provides extensive evidence of virulence gene decay, including loss of several important surface proteins. The 4b CLIP80459 genome, unlike the previously sequenced 4b F2365 genome harbours an intact inlB invasion gene. These lineage I strains are characterized by the lack of prophage genes, as they share only a single prophage locus with other L. monocytogenes genomes 1/2a EGD-e and 4a L99. Comparative transcriptome analysis during intracellular growth uncovered adaptive expression level differences in lineages I, II and III of Listeria, notable amongst which was a strong intracellular induction of flagellar genes in strain 4a L99 compared to the other lineages. Furthermore, extensive differences between strains are manifest at levels of metabolic flux control and phosphorylated sugar uptake. Intriguingly, prophage gene expression was found to be a hallmark of intracellular gene expression. Deletion mutants in the single shared prophage locus of lineage II strain EGD-e 1/2a, the lma operon, revealed severe attenuation of virulence in a murine infection model. Conclusion Comparative genomics and transcriptome analysis of L. monocytogenes strains from three lineages implicate prophage genes in intracellular adaptation and indicate that gene loss and decay may have led to the emergence

Incidence and control of Listeria monocytogenes in foods in Denmark

DEFF Research Database (Denmark)

Nørrung, Birgit; Andersen, Jens Kirk; Schlundt, Jørgen

1999-01-01

The Danish regulatory policy on Listeria monocytogenes in foods is based on the principles of HACCP and was developed using a health risk assessment approach. The Danish policy focuses examinations and criteria for L. monocytogenes in ready-to-eat foods and is based on a combination of inspection...

The occurrence, transmission, virulence and antibiotic resistance of Listeria monocytogenes in fish processing plant.

Science.gov (United States)

Skowron, Krzysztof; Kwiecińska-Piróg, Joanna; Grudlewska, Katarzyna; Świeca, Agnieszka; Paluszak, Zbigniew; Bauza-Kaszewska, Justyna; Wałecka-Zacharska, Ewa; Gospodarek-Komkowska, Eugenia

2018-06-13

The aim of this research was to investigate the occurrence of Listeria monocytogenes in fish and fish processing plant and to determine their transmission, virulence and antibiotic resistance. L. monocytogenes was isolated according to the ISO 11290-1. The identification of L. monocytogenes was confirmed by multiplex PCR method. Genetic similarity of L. monocytogenes strains was determined with the Pulsed-Filed Gene Electrophoresis (PFGE) method. The multiplex PCR was used for identification of L. monocytogenes serogroups and detection of selected virulence genes (actA, fbpA, hlyA, iap, inlA, inlB, mpl, plcA, plcB, prfA). The L. monocytogens isolates susceptibility to penicillin, ampicillin, meropenem, erythromycin, trimethoprim/sulfamethoxazole was evaluated with disc diffusion method according to EUCAST v. 7.1. The presence of 237 L. monocytogenes isolates (before genetic similarity assessment) in 614 examined samples was confirmed. After strain differentiation by PFGE techniques the presence of 161 genetically different strains were confirmed. The genetic similarity of the examined isolates suggested that the source of the L. monocytogenes strains were fishes originating from farms. All tested strains possessed all detected virulence genes. Among examined strains, the most (26, 38.6%) belonged to the group 1/2a-3a. The most of tested strains were resistant to erythromycin (47.1%) and trimethoprim/sulfamethoxazole (47.1%). Copyright © 2018. Published by Elsevier B.V.

Spontaneous Loss of Virulence in Natural Populations of Listeria monocytogenes.

Science.gov (United States)

Maury, Mylène M; Chenal-Francisque, Viviane; Bracq-Dieye, Hélène; Han, Lei; Leclercq, Alexandre; Vales, Guillaume; Moura, Alexandra; Gouin, Edith; Scortti, Mariela; Disson, Olivier; Vázquez-Boland, José A; Lecuit, Marc

2017-11-01

The pathogenesis of Listeria monocytogenes depends on the ability of this bacterium to escape from the phagosome of the host cells via the action of the pore-forming toxin listeriolysin O (LLO). Expression of the LLO-encoding gene ( hly ) requires the transcriptional activator PrfA, and both hly and prfA genes are essential for L. monocytogenes virulence. Here, we used the hemolytic activity of LLO as a phenotypic marker to screen for spontaneous virulence-attenuating mutations in L. monocytogenes Sixty nonhemolytic isolates were identified among a collection of 57,820 confirmed L. monocytogenes strains isolated from a variety of sources (0.1%). In most cases (56/60; 93.3%), the nonhemolytic phenotype resulted from nonsense, missense, or frameshift mutations in prfA Five strains carried hly mutations leading to a single amino acid substitution (G299V) or a premature stop codon causing strong virulence attenuation in mice. In one strain, both hly and gshF (encoding a glutathione synthase required for full PrfA activity) were missing due to genomic rearrangements likely caused by a transposable element. The PrfA/LLO loss-of-function (PrfA - /LLO - ) mutants belonged to phylogenetically diverse clades of L. monocytogenes , and most were identified among nonclinical strains (57/60). Consistent with the rare occurrence of loss-of-virulence mutations, we show that prfA and hly are under purifying selection. Although occurring at a low frequency, PrfA - /LLO - mutational events in L. monocytogenes lead to niche restriction and open an evolutionary path for obligate saprophytism in this facultative intracellular pathogen. Copyright © 2017 Maury et al.

Identifying ingredients that delay outgrowth of Listeria monocytogenes in natural, organic, and clean-label ready-to-eat meat and poultry products.

Science.gov (United States)

McDonnell, Lindsey M; Glass, Kathleen A; Sindelar, Jeffrey J

2013-08-01

The objective of this study was to identify ingredients that inhibit Listeria monocytogenes in natural, organic, or clean-label ready-to-eat meat and poultry products. Fourteen ingredients were screened in uncured (no-nitrate-or-nitrite-added), traditional-cured (156 ppm of purified sodium nitrite), cultured (alternative cured, natural nitrate source, and Staphylococcus carnosus), or preconverted (alternative cured, natural nitrite source) turkey slurries. Slurries were cooked, cooled, inoculated to yield 3 log CFU/ml L. monocytogenes, stored at 4°C, and tested weekly for 4 weeks. Three antimicrobial ingredients, 1.5 % vinegar-lemon-cherry powder blend, 2.5 % buffered vinegar, and 3.0 % cultured sugar-vinegar blend, were incorporated into alternative-cured ham and uncured roast beef and deli-style turkey breast. Controls included all three meat products without antimicrobial ingredients and a traditional-cured ham with 2.8 % sodium lactate-diacetate. Cooked, sliced products were inoculated with 3 log CFU/g L. monocytogenes, vacuum packed, and stored at 4 or 7°C, for up to 12 weeks. For control products without antimicrobial agents stored at 4°C, a 2-log L. monocytogenes increase was observed at 2 weeks for ham and turkey and at 4 weeks for roast beef. Growth (>1-log increase) in the sodium lactate-diacetate was delayed until week 6. Compared with the control, the addition of either vinegar-lemon-cherry powder blend or buffered vinegar delayed L. monocytogenes growth for an additional 2 weeks, while the addition of cultured sugar-vinegar blend delayed growth for an additional 4 weeks for both ham and turkey. The greatest L. monocytogenes delay was observed in roast beef containing any of the three antimicrobial ingredients, with no growth detected through 12 weeks at 4°C for all the treatments. As expected, L. monocytogenes grew substantially faster in products stored at 7°C than at 4°C. These data suggest that antimicrobial ingredients from a natural source

Efficacy of chlorine dioxide against Listeria monocytogenes in brine chilling solutions.

Science.gov (United States)

Valderrama, W B; Mills, E W; Cutter, C N

2009-11-01

Chilled brine solutions are used by the food industry to rapidly cool ready-to-eat meat products after cooking and before packaging. Chlorine dioxide (ClO(2)) was investigated as an antimicrobial additive to eliminate Listeria monocytogenes. Several experiments were performed using brine solutions made of sodium chloride (NaCl) and calcium chloride (CaCl(2)) inoculated with L. monocytogenes and/or treated with 3 ppm of ClO(2). First, 10 and 20% CaCl(2) and NaCl solutions (pH 7.0) were inoculated with a five-strain cocktail of L. monocytogenes to obtain approximately 7 log CFU/ml and incubated 8 h at 0 degrees C. The results demonstrated that L. monocytogenes survived in 10% CaCl(2), 10 and 20% NaCl, and pure water. L. monocytogenes levels were reduced approximately 1.2 log CFU/ml in 20% CaCl(2). Second, inoculated ( approximately 7 log CFU/ml) brine solutions (10 and 20% NaCl and 10% CaCl(2)) treated with 3 ppm of ClO(2) resulted in a approximately 4-log reduction of the pathogen within 90 s. The same was not observed in a solution of 20% CaCl(2); further investigation demonstrated that high levels of divalent cations interfere with the disinfectant. Spent brine solutions from hot dog and ham chilling were treated with ClO(2) at concentrations of 3 or 30 ppm. At these concentrations, ClO(2) did not reduce L. monocytogenes. Removal of divalent cations and organic material in brine solutions prior to disinfection with ClO(2) should be investigated to improve the efficacy of the compound against L. monocytogenes. The information from this study may be useful to processing establishments and researchers who are investigating antimicrobials in chilling brine solutions.

Review of Prosthetic Joint Infection from Listeria monocytogenes.

Science.gov (United States)

Bader, Gilbert; Al-Tarawneh, Mohammed; Myers, James

2016-12-01

Prosthetic joint infection from Listeria monocytogenes is rare. We decided to shed light on this illness and review the reported cases to better understand its characteristics. We conducted a comprehensive review of the English literature using PubMed. We also included one case that we had managed. We found 25 cases of prosthetic joint infection from L. monocytogenes reported individually and a retrospective study of 43 cases of joint and bone listerial infection, including 34 with prosthetic joint infection, conducted in France. We have described their clinical and para-clinical features and tried to elaborate on the pathophysiology, treatment, and prevention. Prosthetic joint infection from L. monocytogenes is mainly late. Systemic inflammation may be absent. Although rare, it must be suspected in patients at high risk for both prosthetic joint and listerial infections. In addition, those patients must be instructed on appropriate preventive measures.

Animal models for oral transmission of Listeria monocytogenes

Directory of Open Access Journals (Sweden)

Sarah E F D'Orazio

2014-02-01

Full Text Available Listeria monocytogenes has been recognized as a food borne pathogen in humans since the 1980s, but we still understand very little about oral transmission of L. monocytogenes or the host factors that determine susceptibility to gastrointestinal infection, due to the lack of an appropriate small animal model of oral listeriosis. Early feeding trials suggested that many animals were highly resistant to oral infection, and the more reproducible intravenous or intraperitoneal routes of inoculation soon came to be favored. There are a fair number of previously published studies using an oral infection route, but the work varies widely in terms of bacterial strain choice, the methods used for oral transmission, and various manipulations used to enhance infectivity. This mini review will summarize the published literature using oral routes of L. monocytogenes infection and will highlight recent technological advances that have made oral infection a more attractive model system.

Behaviour of Listeria monocytogenes in artisanal raw milk Pecorino Umbro cheese: a microbiological challenge test

Directory of Open Access Journals (Sweden)

Roberta Ortenzi

2015-09-01

Full Text Available In the present study, a microbiological challenge test in artificially contaminated raw milk Pecorino Umbro cheese during cheese-making was carried out. Raw ewe milk was contaminated by a suspension of particular Listeria monocytogenes strains. The number of L. monocytogenes and L. monocytogenes dynamic growth were evaluated during cheese-making and storage. A significant decrease of the viable count of L. monocytogenes was observed during ripening and L. monocytogenes viable count was below the limit of quantification during storage. The results show that the product is unable to support the growth of the pathogen.

Molecular ecology of Listeria monocytogenes and other Listeria species in small and very small ready-to-eat meat processing plants.

Science.gov (United States)

Williams, Shanna K; Roof, Sherry; Boyle, Elizabeth A; Burson, Dennis; Thippareddi, Harshavardhan; Geornaras, Ifigenia; Sofos, John N; Wiedmann, Martin; Nightingale, Kendra

2011-01-01

A longitudinal study was conducted to track Listeria contamination patterns in ready-to-eat meats from six small or very small meat processing plants located in three states over 1 year. A total of 688 environmental sponge samples were collected from nonfood contact surfaces during bimonthly visits to each plant. Overall, L. monocytogenes was isolated from 42 (6.1%) environmental samples, and its prevalence ranged from 1.7 to 10.8% across different plants. Listeria spp., other than L. monocytogenes, were isolated from 9.5% of samples overall, with the prevalence ranging from 1.5 to 18.3% across different plants. The prevalence of L. monocytogenes correlated well with that of other Listeria spp. for some but not all plants. One L. monocytogenes isolate representing each positive sample was characterized by molecular serotyping, EcoRI ribotyping, and pulsed-field gel electrophoresis typing. Seven sample sites tested positive for L. monocytogenes on more than one occasion, and the same ribotype was detected more than once at five of these sites. Partial sigB sequencing was used to speciate other Listeria spp. isolates and assign an allelic type to each isolate. Other Listeria spp. were isolated more than once from 14 sample sites, and the same sigB allelic type was recovered at least twice from seven of these sites. One plant was colonized by an atypical hemolytic L. innocua strain. Our findings indicate that small and very small meat processing plants that produce ready-to-eat meat products are characterized by a varied prevalence of Listeria, inconsistent correlation between contamination by L. monocytogenes and other Listeria spp., and a unique Listeria molecular ecology.

Lo público, lo estatal y la democracia

Directory of Open Access Journals (Sweden)

Osvaldo Iazzetta

2008-09-01

Full Text Available La calidad de lo público no resulta indistinta para juzgar la calidad de una democracia, pues la vitalidad y diversidad de aquel espacio delimita sus posibilidades de despliegue y profundización. Sin embargo, lo público se nutre tanto de la energía proveniente de la asociatividad, participación, deliberación y auto-organización de la sociedad civil, como de la universalidad que el Estado debe asegurar para tornar efectiva la promesa democrática. En esa zona confluyen por consiguiente, energías provenientes de lo público-social como de lo público-estatal. Sin desconocer esa complejidad, en este trabajo nos centraremos en este último aspecto, entendiendo esta elección como una vía de entrada –entre otras posibles– para reflexionar sobre algunas tareas democráticas pendientes.

Genotyping of Listeria monocytogenes isolates from poultry carcasses using high resolution melting (HRM) analysis.

Science.gov (United States)

Sakaridis, Ioannis; Ganopoulos, Ioannis; Madesis, Panagiotis; Tsaftaris, Athanasios; Argiriou, Anagnostis

2014-01-02

An outbreak situation of human listeriosis requires a fast and accurate protocol for typing Listeria monocytogenes . Existing techniques are either characterized by low discriminatory power or are laborious and require several days to give a final result. Polymerase chain reaction (PCR) coupled with high resolution melting (HRM) analysis was investigated in this study as an alternative tool for a rapid and precise genotyping of L. monocytogenes isolates. Fifty-five isolates of L. monocytogenes isolated from poultry carcasses and the environment of four slaughterhouses were typed by HRM analysis using two specific markers, internalin B and ssrA genes. The analysis of genotype confidence percentage of L. monocytogenes isolates produced by HRM analysis generated dendrograms with two major groups and several subgroups. Furthermore, the analysis of the HRM curves revealed that all L. monocytogenes isolates could easily be distinguished. In conclusion, HRM was proven to be a fast and powerful tool for genotyping isolates of L. monocytogenes .

Prevalence of Listeria monocytogenes in the river receiving the effluent of municipal wastewater treatment plant

Directory of Open Access Journals (Sweden)

Atefeh Taherkhani

2013-01-01

Full Text Available Aims: The objective of this study was to evaluate the prevalence of Listeria spp. in the river water before and after discharge of the effluent of the municipal wastewater treatment plant (WWTP in Isfahan, Iran. Materials and Methods: A total of 66 samples were collected bi-weekly over 4 months from eleven discrete sampling locations in Zayandehrood River, Iran. Three sampling sites were located above the discharge point and five sites were located after the discharge point of WWTP. Samples were also collected from the influent and the effluent of WWTP. Listeria spp. were isolated using a selective enrichment procedure and a subculture onto polymyxin-acriflavine-lithium chloride-ceftazidime-esculin-mannitol Agar. All isolates were subjected to standard biochemical tests. Results: L. monocytogenes was isolated from influent (83%, effluent (50% and (18.5% river water. Listeria spp. was not found before the discharge point in river water. However, L. monocytogenes was isolated in samples collected from 200 m (33%, 500 m (33%, 2 km (16.5%, 5 km (16.5% and 10 km (16.5% downstream from the WWTP. Listeria innocua (9% and Listeria seeligeri (10% were the second most frequently isolated species. Conclusion: During the wastewater treatment, Listeria spp. is not removed completely. L. monocytogenes is widely distributed in the Zayandehrood river. L. monocytogenes released into surface water demonstrates a potential risk for public health. These results indicate the need for appropriate water management in order to reduce human and animal exposure to such pathogens.

Antibiotic treatment and mortality in patients with Listeria monocytogenes meningitis or bacteraemia.

Science.gov (United States)

Thønnings, S; Knudsen, J D; Schønheyder, H C; Søgaard, M; Arpi, M; Gradel, K O; Østergaard, C

2016-08-01

Invasive Listeria monocytogenes infections carry a high mortality despite antibiotic treatment. The rareness of the infection makes it difficult to improve antibiotic treatment through randomized clinical trials. This observational study investigated clinical features and outcome of invasive L. monocytogenes infections including the efficacy of empiric and definitive antibiotic therapies. Demographic, clinical and biochemical findings, antibiotic treatment and 30-day mortality for all episodes of L. monocytogenes bacteraemia and/or meningitis were collected by retrospective medical record review in the North Denmark Region and the Capital Region of Denmark (17 hospitals) from 1997 to 2012. Risk factors for 30-day all-cause mortality were assessed by logistic regression. The study comprised 229 patients (median age: 71 years), 172 patients had bacteraemia, 24 patients had meningitis and 33 patients had both. Significant risk factors for 30-day mortality were septic shock (OR 3.0, 95% CI 1.4-6.4), altered mental state (OR 3.6, 95% CI 1.7-7.6) and inadequate empiric antibiotic therapy (OR 3.8, 95% CI 1.8-8.1). Cephalosporins accounted for 90% of inadequately treated cases. Adequate definitive antibiotic treatment was administered to 195 patients who survived the early period (benzylpenicillin 72, aminopenicillin 84, meropenem 28, sulfamethoxazole/trimethoprim 6, and piperacillin/tazobactam 5). Definitive antibiotic treatment with benzylpenicillin or aminopenicillin resulted in a lower 30-day mortality in an adjusted analysis compared with meropenem (OR 0.3; 95% CI 0.1-0.8). In conclusion, inadequate empiric antibiotic therapy and definitive therapy with meropenem were both associated with significantly higher 30-day mortality. Copyright © 2016 European Society of Clinical Microbiology and Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

PASTEURISASI HIGH TEMPERATURE SHORT TIME (HTST) SUSU TERHADAP Listeria monocytogenes PADA PENYIMPANAN REFRIGERATOR

OpenAIRE

SABIL, SYAHRIANA

2015-01-01

2015 SYAHRIANA SABIL (I 111 11 273). Pasteurisasi High Temperature Short Time (HTST) Susu terhadap Listeria monocytogenes pada Penyimpanan Refrigerator. Dibimbing oleh RATMAWATI MALAKA dan FARIDA NUR YULIATI. Pasteurisasi High Temperature Short Time (HTST) merupakan proses pemanasan susu di bawah titik didih yang diharapkan dapat membunuh Listeria monocytogenes (L. monocytogenes) karena bersifat patogen dan mengakibatkan listeriosis yang merupakan penyakit zoonosis. Tu...

Novel Cadmium Resistance Determinant in Listeria monocytogenes.

Science.gov (United States)

Parsons, Cameron; Lee, Sangmi; Jayeola, Victor; Kathariou, Sophia

2017-03-01

Listeria monocytogenes is a foodborne pathogen that can cause severe disease (listeriosis) in susceptible individuals. It is ubiquitous in the environment and often exhibits resistance to heavy metals. One of the determinants that enables Listeria to tolerate exposure to cadmium is the cadAC efflux system, with CadA being a P-type ATPase. Three different cadA genes (designated cadA1 to cadA3 ) were previously characterized in L. monocytogenes A novel putative cadmium resistance gene ( cadA4 ) was recently identified through whole-genome sequencing, but experimental confirmation for its involvement in cadmium resistance is lacking. In this study, we characterized cadA4 in L. monocytogenes strain F8027, a cadmium-resistant strain of serotype 4b. By screening a mariner-based transposon library of this strain, we identified a mutant with reduced tolerance to cadmium and that harbored a single transposon insertion in cadA4 The tolerance to cadmium was restored by genetic complementation with the cadmium resistance cassette ( cadA4C ), and enhanced cadmium tolerance was conferred to two unrelated cadmium-sensitive strains via heterologous complementation with cadA4C Cadmium exposure induced cadA4 expression, even at noninhibitory levels. Virulence assessments in the Galleria mellonella model suggested that a functional cadA4 suppressed virulence, potentially promoting commensal colonization of the insect larvae. Biofilm assays suggested that cadA4 inactivation reduced biofilm formation. These data not only confirm cadA4 as a novel cadmium resistance determinant in L. monocytogenes but also provide evidence for roles in virulence and biofilm formation. IMPORTANCE Listeria monocytogenes is an intracellular foodborne pathogen causing the disease listeriosis, which is responsible for numerous hospitalizations and deaths every year. Among the adaptations that enable the survival of Listeria in the environment are the abilities to persist in biofilms, grow in the cold, and

Microbial control of food-related surfaces: Na-Chlorophyllin-based photosensitization.

Science.gov (United States)

Luksiene, Zivile; Paskeviciute, Egle

2011-10-05

The aim of this study was to evaluate efficiency of photosensitization as surface sanitation alternative using model systems when food pathogens, their spores and biofilms were attached to the food-related surface (polyolefine). In addition it was important to compare antibacterial efficiency of Na-Chlorophyllin (Na-Chl)-based photosensitization with conventional sanitizers. Obtained results indicate that Bacilluscereus ATCC 12826 and Listeriamonocytogenes ATCC 7644 as well as their thermoresistant strains B.cereus SV90 and L.monocytogenes 56LY were effectively inactivated (7 log) by Na-Chl-based photosensitization in vitro. Inactivation rate of thermoresistant strains was slower. The number of attached to the surface B.cereus ATCC 12826 and L.monocytogenes ATCC 7644 was reduced from 4-4.5 log to 0 log after photosensitization treatment. To achieve adequate inactivation of thermoresistant strains the higher Na-Chl concentration and longer illumination times had to be used. Comparison of different surface decontamination treatments reveal that photosensitization is much more effective against all surface-attached B.cereus and L.monocytogenes strains than washing with water or 200 ppm Na-hypochlorite. It is important to note, that surface-attached B.cereus spores and L.monocytogenes biofilms can be eliminated from it by photosensitization as well. Our data support the idea that Na-Chlorophyllin-based photosensitization has high antibacterial potential which may serve in the future for the development of human and environment friendly, non-thermal surface decontamination technique. Copyright © 2011 Elsevier B.V. All rights reserved.

Viable but non-culturable Listeria monocytogenes on parsley leaves and absence of recovery to a culturable state.

Science.gov (United States)

Dreux, N; Albagnac, C; Federighi, M; Carlin, F; Morris, C E; Nguyen-the, C

2007-10-01

To investigate the presence of viable but non-culturable Listeria monocytogenes during survival on parsley leaves under low relative humidity (RH) and to evaluate the ability of L. monocytogenes to recover from VBNC to culturable state under satured humidity. Under low RH (47-69%) on parsley leaves, the initial number of L. monocytogenes populations counted on non selective media (10(9) L. monocytogenes per leaf on TSA) was reduced by 6 log10 scales in 15 days, whereas number of viable L. monocytogenes counted under the microscope was reduced by 3-4 log10 scales, indicating the presence of VBNC cells. This was demonstrated on three L. monocytogenes strains (EGDe, Bug 1995 and LmP60). Changing from low to 100% RH permitted an increase of the culturable counts of L. monocytogenes and this growth was observed only when residual culturable cells were present. Moreover, VBNC L. monocytogenes inoculated on parsley leaves did not become culturable after incubation under 100% RH. Dry conditions induced VBNC L. monocytogenes on parsley leaves but these VBNC were likely unable to recover culturability after transfer to satured humidity. Enumeration on culture media presumably under-estimates the number of viable L. monocytogenes on fresh produce after exposure to low RH.

Age-Dependent Differences in Systemic and Cell-Autonomous Immunity to L. monocytogenes

Directory of Open Access Journals (Sweden)

Ashley M. Sherrid

2013-01-01

Full Text Available Host defense against infection can broadly be categorized into systemic immunity and cell-autonomous immunity. Systemic immunity is crucial for all multicellular organisms, increasing in importance with increasing cellular complexity of the host. The systemic immune response to Listeria monocytogenes has been studied extensively in murine models; however, the clinical applicability of these findings to the human newborn remains incompletely understood. Furthermore, the ability to control infection at the level of an individual cell, known as “cell-autonomous immunity,” appears most relevant following infection with L. monocytogenes; as the main target, the monocyte is centrally important to innate as well as adaptive systemic immunity to listeriosis. We thus suggest that the overall increased risk to suffer and die from L. monocytogenes infection in the newborn period is a direct consequence of age-dependent differences in cell-autonomous immunity of the monocyte to L. monocytogenes. We here review what is known about age-dependent differences in systemic innate and adaptive as well as cell-autonomous immunity to infection with Listeria monocytogenes.

A novel suicide plasmid for efficient gene mutation in Listeria monocytogenes

Science.gov (United States)

Although several plasmids have been used in Listeria monocytogenes for generating mutants by allelic exchange, construction of L. monocytogenes mutants has been inefficient due to lack of effective selection markers for first and second recombination events. To address this problem, we have develope...

Targeting and crossing of the human maternofetal barrier by Listeria monocytogenes: role of internalin interaction with trophoblast E-cadherin.

Science.gov (United States)

Lecuit, Marc; Nelson, D Michael; Smith, Steve D; Khun, Huot; Huerre, Michel; Vacher-Lavenu, Marie-Cécile; Gordon, Jeffrey I; Cossart, Pascale

2004-04-20

Listeria monocytogenes produces severe fetoplacental infections in humans. How it targets and crosses the maternofetal barrier is unknown. We used immunohistochemistry to examine the location of L. monocytogenes in placental and amniotic tissue samples obtained from women with fetoplacental listeriosis. The results raised the possibility that L. monocytogenes crosses the maternofetal barrier through the villous syncytiotrophoblast, with secondary infection occurring via the amniotic epithelium. Because epidemiological studies indicate that the bacterial surface protein, internalin (InlA), may play a role in human fetoplacental listeriosis, we investigated the cellular patterns of expression of its host receptor, E-cadherin, at the maternofetal interface. E-cadherin was found on the basal and apical plasma membranes of syncytiotrophoblasts and in villous cytotrophoblasts. Established trophoblastic cell lines, primary trophoblast cultures, and placental villous explants were each exposed to isogenic InlA+ or InlA- strains of L. monocytogenes, and to L. innocua expressing or not InlA. Quantitative assays of cellular invasion demonstrated that bacterial entry into syncytiotrophoblasts occurs via the apical membrane in an InlA-E-cadherin dependent manner. In human placental villous explants, bacterial invasion of the syncytiotrophoblast barrier and underlying villous tissue and subsequent replication produces histopathological lesions that mimic those seen in placentas of women with listeriosis. Thus, the InlA-E-cadherin interaction that plays a key role in the crossing of the intestinal barrier in humans is also exploited by L. monocytogenes to target and cross the placental barrier. Such a ligand-receptor interaction allowing a pathogen to specifically cross the placental villous trophoblast barrier has not been reported previously.

Assessment of Listeria monocytogenes virulence in the Galleria mellonella insect larvae model.

Science.gov (United States)

Rakic Martinez, Mira; Wiedmann, Martin; Ferguson, Martine; Datta, Atin R

2017-01-01

Several animal models have been used to understand the molecular basis of the pathogenicity, infectious dose and strain to strain variation of Listeria monocytogenes. The greater wax worm Galleria mellonella, as an alternative model, provides some useful advantages not available with other models and has already been described as suitable for the virulence assessment of various pathogens including L. monocytogenes. The objectives of this study are: 1) confirming the usefulness of this model with a wide panel of Listeria spp. including non-pathogenic L. innocua, L. seeligeri, L. welshimeri and animal pathogen L. ivanovii; 2) assessment of virulence of several isogenic in-frame deletion mutants in virulence and stress related genes of L. monocytogenes and 3) virulence assessment of paired food and clinical isolates of L. monocytogenes from 14 major listeriosis outbreaks occurred worldwide between 1980 and 2015. Larvae injected with different concentrations of Listeria were incubated at 37°C and monitored over seven days for time needed to kill 50% of larvae (LT50) and to determine change of bacterial population in G. mellonella, 2 and 24 hours post-inoculation. Non-pathogenic members of Listeria and L. ivanovii showed significantly (P monocytogenes strains. Isogenic mutants of L. monocytogenes with the deletions in prfA, plcA, hly, actA and virR genes, also showed significantly (P monocytogenes strains related to non-invasive (gastroenteritis) outbreaks of listeriosis showed significantly (P < 0.05) lower virulence than isolates of the same serotype obtained from outbreaks with invasive symptoms. The difference, however, was dose and strain- dependent. No significant differences in virulence were observed among the serotype tested in this study.

Lactobacillus plantarum inhibits growth of Listeria monocytogenes in an in vitro continuous flow gut model, but promotes invasion of L. monocytogenes in the gut of gnotobiotic rats

DEFF Research Database (Denmark)

Bernbom, Nete; Licht, Tine Rask; Saadbye, Peter

2006-01-01

The ability of the pediocin AcH producing Lactobacillus plantarum DDEN 11007 and its non-producing plasmid-cured isogenic variant, DDEN 12305 to prevent the persistence and growth of Listeria monocytogenes EP2 in two gastrointestinal (GI) tract models was examined. In vitro studies conducted...... in a two-stage continuous flow system showed that L. plantarum DDEN 11007 inhibited L. monocytogenes EP2 under these conditions, while less effect was seen of the non-bacteriocin producing variant. The inhibitory effect was more pronounced at pH 5 than at pH 7. No effect on persistence of L. monocytogenes...... in the GI tract was seen in gnotobiotic rats colonized with either the pediocin AcH producing or the non-bacteriocin producing variant of L. plantarum when compared to rats inoculated with L. monocytogenes EP2 alone. Surprisingly, inoculation of the gnotobiotic animals with either of the L. plantarum...

Listeria monocytogenes persistence and transfer to cantaloupes in the packing environment is affected by equipment surface type and cleanliness

Science.gov (United States)

Cantaloupes have frequently been contaminated with bacterial pathogens and caused several high profile outbreaks over the years. In 2011, Rocky Ford cantaloupes contaminated with Listeria monocytogenes sickened 147 people and resulted in 33 fatalities, making it the deadliest foodborne outbreak in t...

Effect of eugenol on growth and listeriolysin o production by Listeria monocytogenes

Directory of Open Access Journals (Sweden)

Cristina Tostes Filgueiras

2006-05-01

Full Text Available The inhibitory effect of eugenol, a naturally occurring compound mainly present in the essential oil fraction of cloves, was studied on the growth and listeriolysin O (LLO production by Listeria monocytogenes. Potassium efflux from cells promoted by eugenol was also determined after 24 h incubation in phosphate buffered saline. Eugenol promoted a delay on the growth of L. monocytogenes at concentrations of 100, 300 and 500 µg mL-1and above 800 µg mL-1 the effect was bactericidal. Production of LLO by L. monocytogenes in the presence of eugenol was reduced 80-100%. An accumulation of external K+ was observed above 300 µg mL-1 of eugenol which indicated that the cell membrane was affected. The results showed the effectiveness of eugenol in controlling growth and LLO production of L. monocytogenes cells.O efeito inibitório do eugenol, o principal constituinte do óleo essencial de cravo, foi avaliado sobre o crescimento e produção de listeriolisina O (LLO por Listeria monocytogenes. O efluxo de íons potássio das células também foi determinado após 24 h de incubação em solução tampão, contendo eugenol. Concentrações de 100, 300 e 500 µg mL-1 de eugenol promoveram a inibição do crescimento de L. monocytogenes e, em concentrações acima de 800 µg mL-1, constatou-se um efeito bactericida. O crescimento de L. monocytogenes na presença de eugenol resultou na inibição de 80 a 100% da produção de LLO. O efluxo de K+ promovido pelo eugenol indicou que a membrana celular foi afetada. Estes resultados indicam a efetividade do eugenol para o controle do crescimento e da produção de LLO por L. monocytogenes.

Survival of bioluminescent Listeria monocytogenes and Escherichia coli O157:H7 in soft cheeses.

Science.gov (United States)

Ramsaran, H; Chen, J; Brunke, B; Hill, A; Griffiths, M W

1998-07-01

Pasteurized and raw milks that had been inoculated at 10(4) cfu/ml with bioluminescent strains of Listeria monocytogenes and Escherichia coli O157:H7 were used in the manufacture of Camembert and Feta cheeses with or without nisin-producing starter culture. Survival of both organisms was determined during the manufacture and storage of Camembert and Feta cheeses at 2 +/- 1 degree C for 65 and 75 d, respectively. Bacterial bioluminescence was used as an indicator to enumerate the colonies plated on selective Listeria agar and on MacConkey agar. Escherichia coli O157:H7 survived the manufacturing process of both cheeses and was present at the end of the storage period in greater numbers than in the initial inoculum. At the end of 75 d of storage, E. coli O157:H7 was found in the brine of Feta cheese. The counts of L. monocytogenes increased as the pH of the Camembert cheese increased, and there were significant differences between the counts from samples taken from the inside and the counts from samples obtained near the surface of the cheese. The Feta cheese that contained nisin was the only cheese in which L. monocytogenes was at the level of the initial inoculum after 75 d of storage.

DE LO INERME A LO VIVO, DE LO VIRTUAL A LO VIRTUOSO: LAS REDES COMUNICACIONALES ENTRE CIENTÍFICOS

Directory of Open Access Journals (Sweden)

Juan José Plata Cavides

2002-08-01

Full Text Available El tema que quiero abordar es la comunicación entre científicos, algo que es esencial al ethos del investigador, pero que hoy por hoy tiende a suplirse por quimeras técnicas y mediáticas. Quiero poner a consideración de hecho evidente a partir de la experiencia vivida que señala como solamente a partir de la participación en redes comunicacionales vivas es que emerge la posibilidad de generar conocimiento nuevo en cualquier dominio Las reglas del juego de con validación de conocimientos excluyen argumentos tales como la autoridad o el poder o similares, sin dejar de lado las múltiples evidencias sobre las dificultades y errores que emergen en los procesos comunicacionales. En una pregunta ¿Cuál es nuestra capacidad para comunicarnos y comunicar? Tres son los retos que quiero formular: El reto de pasar de la VISIÓN de los objetos a La COMPRENSIÓN de los procesos (contextos de sentido El reto de pasar de la MIRADA a las partes a la INTERACCIÓN entre las partes y las características emergentes del sistema de relaciones. (recursividad, auto-organización El reto de pasar de la CONTEMPLACIÓN de la palabra y la gramática a la PRAXIS de las redes conversacionales vivas. En suma el reto que propongo es el reto de pasar de lo inerte a lo vivo, de lo virtual a lo virtuoso, de la red conversacional muerta a la red conversacional viva, de la robótica y el cyborg a lo distintivamente humano. Pues, el conocimiento se juega como estrategia adaptativa al entorno, se juega localmente, y en su vivencia es más que el simple hecho de almacenar o hacer circular información.

A multiplex PCR for detection of Listeria monocytogenes and its lineages.

Science.gov (United States)

Rawool, Deepak B; Doijad, Swapnil P; Poharkar, Krupali V; Negi, Mamta; Kale, Satyajit B; Malik, S V S; Kurkure, Nitin V; Chakraborty, Trinad; Barbuddhe, Sukhadeo B

2016-11-01

A novel multiplex PCR assay was developed to identify genus Listeria, and discriminate Listeria monocytogenes and its major lineages (LI, LII, LIII). This assay is a rapid and inexpensive subtyping method for screening and characterization of L. monocytogenes. Copyright © 2016 Elsevier B.V. All rights reserved.

Prior frozen storage enhances the effect of edible coatings against Listeria monocytogenes on cold-smoked salmon during subsequent refrigerated storage.

Science.gov (United States)

Ye, M; Neetoo, H; Chen, H

2011-10-01

Listeria monocytogenes is a major safety concern for ready-to-eat foods. The overall objective of this study was to investigate whether prior frozen storage could enhance the efficacy of edible coatings against L. monocytogenes on cold-smoked salmon during subsequent refrigerated storage. A formulation consisting of sodium lactate (SL, 1·2-2·4%) and sodium diacetate (SD, 0·125-0·25%) or 2·5% Opti.Form (a commercial formulation of SL and SD) was incorporated into each of five edible coatings: alginate, κ-carrageenan, pectin, gelatin and starch. The coatings were applied onto the surface of cold-smoked salmon slices inoculated with L. monocytogenes at a level of 500 CFU cm⁻². In the first phase, the slices were first frozen at -18°C for 6 days and stored at 22°C for 6 days. Alginate, gelatin and starch appeared to be the most effective carriers. In the second phase, cold-smoked salmon slices were inoculated with L. monocytogenes, coated with alginate, gelatin or starch with or without the antimicrobials and stored frozen at -18°C for 12 months. Every 2 months, samples were removed from the freezer and kept at 4°C for 30 days. Prior frozen storage at -18°C substantially enhanced the antilisterial efficacy of the edible coatings with or without antimicrobials during the subsequent refrigerated storage. Plain coatings with ≥ 2 months frozen storage and antimicrobial edible coatings represent an effective intervention to inhibit the growth of L. monocytogenes on cold-smoked salmon. This study demonstrates the effectiveness of the conjunct application of frozen storage and edible coatings to control the growth of L. monocytogenes to enhance the microbiological safety of cold-smoked salmon. © 2011 The Authors. Journal of Applied Microbiology © 2011 The Society for Applied Microbiology.

Industrial disinfectants do not select for resistance in Listeria monocytogenes following long term exposure

DEFF Research Database (Denmark)

Kastbjerg, Vicky Gaedt; Gram, Lone

2012-01-01

or tolerance would evolve in L. monocytogenes under continued selection in three industrial disinfectants. L. monocytogenes EGD was exposed to Desinfect CL (hypochlorite) and Incimaxx DES (peracedic acid and hydrogen peroxide) for several hundred generations. This caused no increase in the minimal inhibitory......, and that the disinfectants are still efficient for controlling microorganisms such as L. monocytogenes....

Use of E-beam radiation to eliminate Listeria monocytogenes from surface mould cheese.

Science.gov (United States)

Velasco, Raquel; Ordóñez, Juan A; Cambero, M Isabel; Cabeza, M Concepción

2015-03-01

Camembert and Brie soft cheese varieties were subjected to E-beam irradiation as a sanitation treatment. The effects of treatments on microbiota and selected physicochemical properties were also studied. The absorbed doses required to meet the food safety objective (FSO) according to EU and USDA criteria for Listeria monocytogenes were 1.27 and 2.59 kGy, respectively. The bacterial load, mainly lactic acid bacteria, was reduced by the treatment but injured cells were recovered during storage at 14°C. The radiation treatment gave rise to negligible changes in the pH and water activity at doses required to achieve microbial safety. Copyright© by the Spanish Society for Microbiology and Institute for Catalan Studies.

Metabolic responses of primary and transformed cells to intracellular Listeria monocytogenes.

Directory of Open Access Journals (Sweden)

Nadine Gillmaier

Full Text Available The metabolic response of host cells, in particular of primary mammalian cells, to bacterial infections is poorly understood. Here, we compare the carbon metabolism of primary mouse macrophages and of established J774A.1 cells upon Listeria monocytogenes infection using (13C-labelled glucose or glutamine as carbon tracers. The (13C-profiles of protein-derived amino acids from labelled host cells and intracellular L. monocytogenes identified active metabolic pathways in the different cell types. In the primary cells, infection with live L. monocytogenes increased glycolytic activity and enhanced flux of pyruvate into the TCA cycle via pyruvate dehydrogenase and pyruvate carboxylase, while in J774A.1 cells the already high glycolytic and glutaminolytic activities hardly changed upon infection. The carbon metabolism of intracellular L. monocytogenes was similar in both host cells. Taken together, the data suggest that efficient listerial replication in the cytosol of the host cells mainly depends on the glycolytic activity of the hosts.

[Risk assessment of Listeria monocytogenes in deli meats and vegetable salads].

Science.gov (United States)

Tian, Jing; Liu, Xiu-mei

2009-09-01

To analysis risk from Listeria monocytogenes in deli meats and vegetable salads. Use Risk Ranger which is a software programme developed by the University of Hobart, Australia and answer 11 questions on affecting the risk from hazards in the specific foods by combining data from national foodborne diseases surveillance network and some references to make semi-quantitative risk assessment for the specific food. Relative risk from Listeria monocytogenes in deli meats and vegetable salads is 61 and 52, respectively. Incidence of listeriosis caused by deli meats-Listeria monocytogenes pairs and vegetable salads-Listeria monocytogenes pairs is 5.4 and 0.2 cases per million people, respectively. Risk from the former is 32 times than that from the latter. By changing the selection for some risk factors in the model, it was known that the risks from two food-hazard combinations could decrease 10 times, if taking necessary actions after processing. Deli meats is a kind of high risk food for listeriosis.

Tracking Listeria monocytogenes contamination and virulence-associated characteristics in the ready-to-eat meat-based food products industry according to the hygiene level.

Science.gov (United States)

Henriques, A R; Gama, L T; Fraqueza, M J

2017-02-02

Listeria monocytogenes isolates collected from final products and food contact surfaces of 10 ready-to-eat meat-based food products (RTEMP) producing industries were analyzed to relate their virulence-associated characteristics and genetic profiles with the hygiene assessment of those industries. Together with sample collection, an audit was performed to evaluate the implemented food safety management system and to investigate the specific audit requisites more associated to the occurrence of those L. monocytogenes serogroups frequently related with human disease. L. monocytogenes was present in 18% of the samples. The isolates (n=62) were serogrouped and detection of virulence-associated genes inlA, inlB, inlC and inlJ, and also plcA, hlyA, actA and iap was done by multiplex PCR. After this initial characterization, selected isolates (n=31) were submitted to antibiotic resistance testing by the disk diffusion method for the currently most used human and veterinary antibiotics and resistance was low. These isolates were also subtyped by pulsed-field gel electrophoresis. Genotyping and serogrouping of L. monocytogenes isolates revealed a genetically diverse population. Our data indicate that contamination of final products does not seem to be uniquely related to the sampled food surfaces. The occurrence of those L. monocytogenes serogroups more commonly associated with human disease in industries with a high hygienic audit classification could be the result of a previous identification of the pathogen, with an enforcement of the hygiene program without recognizing the real source of contamination. This reinforces the importance of a conjoined diagnosis using audit data and microbiological testing. Food safety management systems of those industries need improvement, particularly in cleaning and sanitizing operations, analytical control, preventive maintenance, personal hygiene and root cause analysis. Copyright © 2016. Published by Elsevier B.V.

Listeria monocytogenes meningitis in the elderly: epidemiological, clinical and therapeutic findings.

Science.gov (United States)

Pagliano, Pasquale; Ascione, Tiziana; Boccia, Giovanni; De Caro, Francesco; Esposito, Silvano

2016-06-01

Listeria monocytogenes is a Gram-positive bacillus and facultative intracellular bacterium whose transmission occurs mainly through the consumption of contaminated food, L. monocytogenes invades the host cells using various protein and can escape to the human T-cell immune system by cell-to-cell spreading. If the infection is not controlled at the stage in which the bacterium is in the liver, for instance, due to a severe immunodepression, a secondary bacteraemia can be developed and L. monocytogenes reaches the preferred sites transgressing the blood-brain barrier or the placental barrier. Individuals with T-cell dysfunction, such as pregnant women, the elderly, and those receiving immunosuppressive therapy are at the highest risk of contracting the disease. Average life expectancy throughout developed countries has rapidly increased during the latter half of the 20th century and geriatric infectious diseases have become an increasingly important issue. L. monocytogenes meningitis in young previously healthy adults has been reported only in anecdotal observations. Differently, L. monocytogenes is the third most common cause of bacterial meningitis in the elderly population, after Streptococcus pneumoniae and Neisseria meningitidis. Patients with L. monocytogenes meningitis presented with signs and symptoms that were similar to those of the general population with community-acquired bacterial meningitis, but reported a longer prodromal phase. According to literature data, the prevalence of the classic triad of fever, neck stiffness, and altered mental status is 43%, and almost all patients present with at least 2 of the 4 classic symptoms of headache, fever, neck stiffness, and altered mental status. On the basis of our published data, in patients aged over 50 years, diagnosing L. monocytogenes meningitis was more challenging than pneumococcal meningitis, as demonstrated by the lower percentage of cases receiving a correct diagnosis within 48 hours from the onset

Evaluation of the Thermo Scientific SureTect Listeria monocytogenes Assay.

Science.gov (United States)

Cloke, Jonathan; Leon-Velarde, Carlos; Larson, Nathan; Dave, Keron; Evans, Katharine; Crabtree, David; Hughes, Annette; Hopper, Craig; Simpson, Helen; Withey, Sophie; Oleksiuk, Milena; Holopainen, Jani; Wickstrand, Nina; Kauppinen, Mikko

2014-01-01

The Thermo Scientific SureTect Listeria monocytogenes Assay is a new real-time PCR assay for the detection of Listeria monocytogenes in food and environmental samples. This assay was validated using the AOAC Research Institute (AOAC-RI) Performance Tested Methods program in comparison to the reference method detailed in International Organization for Standardization 11290-1:1996, including Amendment 1:2004 with the following foods and food contact surfaces: smoked salmon, processed cheese, fresh bagged spinach, fresh cantaloupe, cooked prawns (chilled product), cooked sliced turkey meat (chilled product), ice cream, pork frankfurters, salami, ground raw beef meat (12% fat), plastic, and stainless steel. All matrixes were tested by Thermo Fisher Scientific, Microbiology Division, Basingstoke, UK. In addition, three matrixes (pork frankfurters, bagged lettuce, and stainless steel) were analyzed independently as part of the AOAC-RI controlled laboratory study by the University of Guelph, Canada. Using probability of detection (POD) statistical analysis, a significant difference was demonstrated between the candidate and reference methods for salami, cooked sliced turkey and ice cream in favor of the SureTect assay. For all other matrixes, no significant difference by POD was seen between the two methods during the study. Inclusivity and exclusivity testing was also conducted with 53 and 30 isolates, respectively, which demonstrated that the SureTect assay was able to detect all serotypes of L. monocytogenes. None of the exclusivity isolates analyzed were detected by the SureTect assay. Ruggedness testing was conducted to evaluate the performance of the assay with specific method deviations outside the recommended parameters open to variation, i.e., enrichment time and temperature and lysis temperature, which demonstrated that the assay gave reliable performance. Accelerated stability testing was also conducted, validating the assay shelf life.

Detección de Listeria monocytogenes en distintos productos alimenticios y en muestras ambientales de una amplia cadena de supermercados de la ciudad de Bahía Blanca (Argentina Listeria monocytogenes detection in different food products and environmental samples of supermarkets of Bahía Blanca city (Argentine

Directory of Open Access Journals (Sweden)

M.A. Marzocca

2004-12-01

Full Text Available En el período comprendido entre enero de 2002 y julio de 2003 se realizó este trabajo que consistió en la detección de Listeria monocytogenes en diferentes alimentos: 90 muestras de fiambres cocidos, fraccionados y envasados con diferentes metodologías y 132 muestras de queso de pasta blanda. Estos productos fueron analizados utilizando el criterio presencia-ausencia en 25 g de alimento. L. monocytogenes no se halló ni en los fiambres feteados en las ventas personalizadas ni en las muestras de queso analizadas. Por el contrario, se determinó su presencia en el 10% de los fiambres feteados envasados al vacío y en el 5% de los fiambres trozados envasados al vacío. Estos resultados nos llevaron a incluir la investigación de la presencia de este patógeno en diferentes muestras medioambientales. Para ello se hisoparon 115 puntos incluyendo las líneas de procesamiento, materias primas, utensilios, heladeras. L. monocytogenes se halló en el 13,2% de las muestras analizadas: 5% correspondieron a la sala de fraccionamiento de fiambres y lácteos, 6,7% al frigorífico y 1,5% a los sitios de venta personalizada. Estos resultados indicaron la posible existencia de sitios problemáticos donde el microorganismo tendría probabilidad de formar reservorios, por lo que se extremaron las medidas rutinarias de higiene y desinfección.This work on Listeria monocytogenes detection in different foods was carried out between January 2002 and July 2003. Ninety cold-served cooked meats, sliced and packaged by different methods and 132 pieces of soft cheeses were studied. These products were analyzed using the presence/ausence in 25 g criterion. L. monocytogenes was not found either in foods sliced over the counter or in controlled cheeses, but it was found in 10% of sliced cold-served foods and 5% of cut and cold-served meats vacuum packaged. These results led us to investigate the presence of these pathogen bacteria in different environmental samples. A

Frequency of contamination Listeria monocytogenes of raw dried cured vacuum packed sausages

Directory of Open Access Journals (Sweden)

Hristo Daskalov

2014-03-01

Full Text Available The aim of this study was to collect actual data concerning the frequency of contamination with Listeria monocytogenes of some very popular in Bulgaria raw dried cured vacuum packed sausages, produced from October 2004 till May 2008. 148 vacuum-packed samples were taken from 9 different food business operators during all seasons of the year. The samples were analyzed according to USDA method for meat foods. Ten specimens were positive for presence of Listeria monocytogenes equal to 6,75% of all tested samples. In two other raw dried cured sausages L.welshimeri and L.innocua were found, but these species are not pathogenic for consumers. In the period before the official implementation of HACCP system (01.01.2006 in Bulgaria, 52 samples were examined and 5 Listeria monocytogenes isolates were found (~10%. 2,5 years after the HACCP implementation, 96 specimens from the same meat factories were tested and 5 Listeria monocytogenes isolates (5,2% were detected. Samples taken from lots, produced in winter time were contaminated with Listeria monocytogenes more often (7 of all 10 than specimens taken during other seasons. Data were discussed through the point of view of the effectiveness of hygienic practices and HACCP system application. Also, application of ‘microbiological criterion’ set in COMMISSION REGULATION (EC No 2073/2005 for ready-to-eat foods unable to support the growth of L. monocytogenes was considered.

Suppression of Listeria monocytogenes by the Native Micro-Flora in Teewurst Sausage.

Science.gov (United States)

Austin-Watson, Clytrice; Grant, Ar'Quette; Brice, Michline

2013-10-21

Modern consumers are interested in the use of non-chemical methods to control pathogens when heat sterilization is not an option. Such is the case with teewurst sausage, a raw spreadable sausage and a popular German commodity. Although Listeria was not found in teewurst, the optimal microbial growing conditions of teewurst coupled with the ubiquity of L. monocytogenes in nature, makes the possibility of contamination of products very possible. This pilot study was conducted to examine teewurst's native micro-flora's ability to suppress the outgrowth of L. monocytogenes at 10 °C using standard plate counts and PCR-DGGE. Traditional plating methods showed L. monocytogenes growth significantly decreased when in competition with the teewurst's native micro-flora ( p flora of the teewurst suppressed the overall growth of L. monocytogenes by an average of two logs, under these conditions. Denaturing Gradient Gel Electrophoresis (DGGE) amplicons with unique banding patterns were extracted from DGGE gel for identification. Brochothrix thermosphacta and Lactobacillus curvatus were identified as a part of the teewurst's native micro-flora. Although the native micro-flora did not decrease L. monocytogenes to below limits of detection, it was enough of a decrease to warrant further investigation.

Inhibitory Effect of Nisin on Listeria monocytogenes Inoculated into Surimi and Minced Meat

Directory of Open Access Journals (Sweden)

Masoud Rezaei

2012-02-01

Full Text Available Background & Objective: Listeria monocytogenes has already established as an important food born pathogen which induce listeriosis in human. Use of bacteriocins to provide food safety has been increased dramatically. Nisin has a wide spectrum inhibitory effect than the other bacteriocins and inhibits food-borne pathogens such as L. monocytogenes and many other Gram-positive spoilage microorganisms. The purpose of this study was to investigate the inhibitory effect of Nisin on population of Listeria monocytogenes and the role of changes in food components on the antilisterial properties of Nisin. Materials & Methods: The minced meat and surimi samples were inoculated by 1×104 cfu/g of L. monocytogenes. Then samples exposed to Nisin at the levels of 500 or 1000 IU/g were prepared. All treatments after packaging in plastic bags were kept for 12 days at refrigerator temperature. Samples were cultured on CHROMagarTM Listeria every 2 days and the number of listeria monocytogenes was counted. Results: two different concentrations of Nisin (500 or 1000 IU/g was not able to inhibit L. monocytogenes below the acceptable level for raw food (100 cells per g in minced meat and surimi of silver carp. But the number of bacteria reduces more in fish surimi as compared to the mince meal. Also, antilisterial activity of Nisin was reduced during the storage period. Conclusion: Inhibitory property of Nisin against L. monocytogenes in surimi significantly was higher than the minced (P<0.05. So it is possible the antilisterial properties of Nisin will increase by elimination of some enzymes during processing.

An insight into the isolation, enumeration and molecular detection of Listeria monocytogenes in food

Directory of Open Access Journals (Sweden)

Jodi Woan-Fei Law

2015-11-01

Full Text Available Listeria monocytogenes, a foodborne pathogen that can cause listeriosis through the consumption of food contaminated with this pathogen. The ability of L. monocytogenes to survive in extreme conditions and cause food contaminations have become a major concern. Hence, routine microbiological food testing is necessary to prevent food contamination and outbreaks of foodborne illness. This review provides insight into the methods for cultural detection, enumeration and molecular identification of L. monocytogenes in various food samples. There are a number of enrichment and plating media that can be used for the isolation of L. monocytogenes from food samples. Enrichment media such as buffered Listeria Enrichment Broth (BLEB, Fraser broth and University of Vermont Medium (UVM Listeria enrichment broth are recommended by regulatory agencies such as FDA-BAM, USDA-FSIS and ISO. Many plating media are available for the isolation of L. monocytogenes, for instance, PALCAM, Oxford and other chromogenic media. Besides, reference methods like FDA-BAM, ISO 11290 method and USDA-FSIS method are usually applied for the cultural detection or enumeration of L. monocytogenes. MPN technique is applied for the enumeration of L. monocytogenes in the case of low level contamination. Molecular methods including polymerase chain reaction (PCR, multiplex polymerase chain reaction (mPCR, real-time/quantitative polymerase chain reaction (qPCR, nucleic acid sequence-based amplification (NASBA, loop-mediated isothermal amplification (LAMP, DNA microarray and Next Generation Sequencing (NGS technology for the detection and identification of L. monocytogenes are discussed in this review. Overall, molecular methods are rapid, sensitive, specific, time- and labour-saving. In future, there are chances for the development of new techniques for the detection and identification of foodborne with improved features.

Incidence of Listeria monocytogenes and Listeria spp. in a small-scale mushroom production facility.

Science.gov (United States)

Viswanath, Prema; Murugesan, Latha; Knabel, Stephen J; Verghese, Bindhu; Chikthimmah, Naveen; Laborde, Luke F

2013-04-01

Listeria monocytogenes is a foodborne pathogen of significant concern to the agricultural and food processing industry because of its ability to grow and persist in cool and moist environments and its association with listeriosis, a disease with a very high mortality rate. Although there have been no listeriosis outbreaks attributed to fresh mushrooms in the United States, retail surveys and recalls are evidence that L. monocytogenes contamination of mushrooms (Agaricus bisporus) can occur. The objective of this study was to determine the prevalence of Listeria spp., including L. monocytogenes, in a small-scale mushroom production facility on the campus of the Pennsylvania State University in the United States. Of 184 samples taken from five production zones within the facility, 29 (15.8%) samples were positive for Listeria spp. Among the Listeria spp. isolates, L. innocua was most prevalent (10.3%) followed by L. welshimeri (3.3%), L. monocytogenes (1.6%), and L. grayi (0.5%). L. monocytogenes was recovered only from the phase I raw material composting area. Isolates of L. monocytogenes were confirmed and serotyped by multiplex PCR. The epidemiological relatedness of the three L. monocytogenes isolates to those serotypes or lineages frequently encountered in listeriosis infections was determined by multi-virulence-locus sequence typing using six virulence genes, namely, prfA, inlB, inlC, dal, clpP, and lisR. The phylogenetic positions of the three isolates in the dendrogram prepared with data from other isolates of L. monocytogenes showed that all isolates were grouped with serotype 4a, lineage IIIA. To date, this serotype has rarely been reported in foodborne disease outbreaks.

Lo irreductible social y lo irreductible psíquico

Directory of Open Access Journals (Sweden)

Vincent Gaulejac, de

2017-06-01

Full Text Available Con base en la reconstrucción de las polaridades explicativas -lo irreductible social y lo irreductible psíquico-que atraviesan a las ciencias sociales, este texto propone trascender los modelos antagónicos y excluyentes. El objetivo es instaurar en el centro de la reflexión la idea de la dialktica existencial que restituye al sujeto tanto el contexto socio-histórico en el cual está localizado como el deseo y la singularidad que lo constituyen en productor de la afirmación de su individualidad y su historicidad.

Generation of Food-Grade Lactococcal Starters Which Produce the Lantibiotics Lacticin 3147 and Lacticin 481

Science.gov (United States)

O'Sullivan, Lisa; Ryan, Maire P.; Ross, R. Paul; Hill, Colin

2003-01-01

Transconjugant lactococcal starters which produce both lantibiotics lacticin 3147 and lacticin 481 were generated via conjugation of large bacteriocin-encoding plasmids. A representative of one of the resultant strains proved more effective at killing Lactobacillus fermentum and inhibiting the growth of Listeria monocytogenes LO28H than either of the single bacteriocin-producing parental strains, demonstrating the potential of these transconjugants as protection cultures for food safety applications. PMID:12788782

Antimicrobial treatments to control Listeria monocytogenes in queso fresco.

Science.gov (United States)

Lourenço, António; Kamnetz, Mary B; Gadotti, Camila; Diez-Gonzalez, Francisco

2017-06-01

Queso fresco, is a Hispanic non-fermented cheese highly susceptible to contamination with L. monocytogenes. This research was aimed to determine the effect of GRAS antimicrobial ingredients to control L. monocytogenes. Antimicrobials included caprylic acid (CA), Nisaplin ® (N, 2.5% nisin), a mixture of sodium lactate and sodium diacetate (SL/SD), Lactococcus lactis sbp. lactis DPC 3147, monolaurin, and lactic acid (LA). Batches of queso fresco curds were inoculated with 10 4  CFU/g and stored at 4 °C for three weeks. During storage the count of L. monocytogenes reached 7 to 8 Log CFU/g in control samples. Most individual antimicrobial treatments resulted in less than 1 Log CFU/g reductions in final counts, with the exception of N (0.5 g/kg) and CA (2.9 g/kg) that caused more than 3 and 5 Log CFU/g differences with controls, respectively. Mixtures of ingredients were more effective in inhibiting L. monocytogenes growth, and treatments with N and CA consistently delivered 6 Log CFU/g less counts than controls. Supplementation of 12 g/kg LA to treatments with SL/SD (3%/0.22%) caused differences of more than 4 Log CFU/g in final Listeria populations. Samples treated with the binary mixtures of N and CA (0.5 and 0.7 g/kg, respectively) were evaluated in a consumer panel (n = 67). Panelists slightly preferred control and commercial over treated samples, but all samples were in average rated between "slightly liking" and "moderately liking." These experiments indicated that combined use of antimicrobial ingredients may be an effective way to control the population of Listeria monocytogenes in queso fresco. Copyright © 2016 Elsevier Ltd. All rights reserved.

Evaluation of DNA extraction methods for PCR-based detection of Listeria monocytogenes from vegetables.

Science.gov (United States)

Vojkovska, H; Kubikova, I; Kralik, P

2015-03-01

Epidemiological data indicate that raw vegetables are associated with outbreaks of Listeria monocytogenes. Therefore, there is a demand for the availability of rapid and sensitive methods, such as PCR assays, for the detection and accurate discrimination of L. monocytogenes. However, the efficiency of PCR methods can be negatively affected by inhibitory compounds commonly found in vegetable matrices that may cause false-negative results. Therefore, the sample processing and DNA isolation steps must be carefully evaluated prior to the introduction of such methods into routine practice. In this study, we compared the ability of three column-based and four magnetic bead-based commercial DNA isolation kits to extract DNA of the model micro-organism L. monocytogenes from raw vegetables. The DNA isolation efficiency of all isolation kits was determined using a triplex real-time qPCR assay designed to specifically detect L. monocytogenes. The kit with best performance, the PowerSoil(™) Microbial DNA Isolation Kit, is suitable for the extraction of amplifiable DNA from L. monocytogenes cells in vegetable with efficiencies ranging between 29.6 and 70.3%. Coupled with the triplex real-time qPCR assay, this DNA isolation kit is applicable to the samples with bacterial loads of 10(3) bacterial cells per gram of L. monocytogenes. Several recent outbreaks of Listeria monocytogenes have been associated with the consumption of fruits and vegetables. Real-time PCR assays allow fast detection and accurate quantification of microbes. However, the success of real-time PCR is dependent on the success with which template DNA can be extracted. The results of this study suggest that the PowerSoil(™) Microbial DNA Isolation Kit can be used for the extraction of amplifiable DNA from L. monocytogenes cells in vegetable with efficiencies ranging between 29.6 and 70.3%. This method is applicable to samples with bacterial loads of 10(3) bacterial cells per gram of L. monocytogenes. © 2014

Leer lo estético desde lo político

Directory of Open Access Journals (Sweden)

Verónica Peñafiel

2013-06-01

Full Text Available En el Ecuador, y específicamente en la vida política del país, el teatro ha jugado un papel más importante del que se le ha reconocido. Pensar lo estético relacionado con lo político, puede ser una interesante clave de lectura para el teatro quiteño y, me arriesgo a afirmar, para el teatro a secas. Este análisis no se lo hará desde el teatro político, se pretende, más bien, analizar la dimensión política del mismo y de la relación entre teatro y política. Dicha dimensión política ha tomado diversas caras. Con los matices posibles, ha pasado de las salas a la calle, del costumbrismo a lo grotesco, de las compañías a los grupos. Comprender estos matices con la óptica de lo político puede dar pistas para articular una lógica estética del teatro quiteño

In vitro activity of naturally occurring peptides (defensins against Listeria monocytogenes Ação in vitro de peptídeos naturais (defensinas sobre Listeria monocytogenes

Directory of Open Access Journals (Sweden)

Maria da Graça F. Nascimento

1994-12-01

Full Text Available Autoclaved distilled water samples were inoculated with L. monocytogenes strain V7 and strain VPH-1, and incubated aerobically, at 30 C for 48 hours. Each strain was tested individually, and growth curves were determined at 1, 2, 3, 4, 5, 21, 24, and 48 hours. The growth or survival of L. monocytogenes was similar for both strains, with survivors at 24 hour-incubation. The microbicidal activity of one synthetic cationic peptide (NP-2 was examined against L. monocytogenes strain V7, in a water system. Antibacterial activity of NP-2 (1, 5, and 10 g/ml was best expressed at 60 minute-incubation, with 10 g/ml of peptide, at 30 C.Amostras de água destilada, autoclavadas, foram inoculadas com L. monocytogenes cepa V7 e cepa VPH-1, e incubadas, aerobicamente, a 30ºC por 48 horas. Cada cepa foi testada individualmente, e determinou-se curvas de crescimento a 1, 2, 3, 4, 5, 21, 24, e 48 horas. O crescimento ou sobrevivência das duas cepas foi semelhante e encontrou-se sobreviventes em 24 horas de incubação. Examinou-se a atividade bactericida de um dos peptídeos catiônicos sintéticos (NP-2 contra L. monocytogenes cepa V7, em sistema aquoso. A atividade antibacteriana de NP-2 (1, 5, and 10µg/ml foi melhor aos 60 minutos de incubação, com 10µg/ml de peptídeo, a 30 C.

Prevalence and Persistence of Listeria monocytogenes in Ready-to-Eat Tilapia Sashimi Processing Plants.

Science.gov (United States)

Chen, Bang-Yuan; Wang, Chung-Yi; Wang, Chia-Lan; Fan, Yang-Chi; Weng, I-Ting; Chou, Chung-Hsi

2016-11-01

A 2-year study was performed at two ready-to-eat tilapia sashimi processing plants (A and B) to identify possible routes of contamination with Listeria monocytogenes during processing. Samples were collected from the aquaculture environments, transportation tanks, processing plants, and final products. Seventy-nine L. monocytogenes isolates were found in the processing environments and final products; 3.96% (50 of 1,264 samples) and 3.86% (29 of 752 samples) of the samples from plants A and B, respectively, were positive for L. monocytogenes . No L. monocytogenes was detected in the aquaculture environments or transportation tanks. The predominant L. monocytogenes serotypes were 1/2b (55.70%) and 4b (37.97%); serotypes 3b and 4e were detected at much lower percentages. At both plants, most processing sections were contaminated with L. monocytogenes before the start of processing, which indicated that the cleaning and sanitizing methods did not achieve adequate pathogen removal. Eleven seropulsotypes were revealed by pulsed-field gel electrophoresis and serotyping. Analysis of seropulsotype distribution revealed that the contamination was disseminated by the processing work; the same seropulsotypes were repeatedly found along the work flow line and in the final products. Specific seropulsotypes were persistently found during different sampling periods, which suggests that the sanitation procedures or equipment used at these plants were inadequate. Plant staff should improve the sanitation procedures and equipment to reduce the risk of L. monocytogenes cross-contamination and ensure the safety of ready-to-eat tilapia products.

Prevalence and antimicrobial resistance of Listeria monocytogenes isolated in chicken slaughterhouses in Northern Greece.

Science.gov (United States)

Sakaridis, I; Soultos, N; Iossifidou, E; Papa, A; Ambrosiadis, I; Koidis, P

2011-06-01

This study was conducted to determine the prevalence and antimicrobial resistance of Listeria monocytogenes recovered from chicken carcasses in slaughterhouses in Northern Greece. A total of 100 poultry samples (300 carcasses) were examined for Listeria spp. The samples were neck skin taken from four different slaughterhouses in Northern Greece. Forty samples were also taken from the environment of the slaughterhouses. Identification of L. monocytogenes was carried out by PCR and fingerprinting of the isolates by random amplified polymorphic DNA. L. monocytogenes strains isolated from chicken carcasses and from the environment of the slaughterhouses were also examined for antibiotic resistance. Fifty-five isolates of L. monocytogenes were tested for susceptibility to 20 antibiotics using the disk diffusion method. Listeria spp. were present in 99 of the poultry samples tested (99%), and 38 yielded L monocytogenes (38%). L. monocytogenes was also isolated in 80% of samples from the environment of a certain slaughterhouse, while the other slaughterhouses were found to be contaminated only with Listeria spp. All isolates were resistant to nalidixic acid and oxolinic acid, the majority of them to clindamycin, and only a few to tetracycline and oxytetracycline, whereas they were found to be susceptible to all other antimicrobials. The results of this study demonstrate a high prevalence of L. monocytogenes contamination in chicken carcasses, and all isolates were found to be sensitive to the antimicrobials most commonly used to treat human listeriosis.

Listeria monocytogenes in Food-Processing Facilities, Food Contamination, and Human Listeriosis: The Brazilian Scenario.

Science.gov (United States)

Camargo, Anderson Carlos; Woodward, Joshua John; Call, Douglas Ruben; Nero, Luís Augusto

2017-11-01

Listeria monocytogenes is a foodborne pathogen that contaminates food-processing environments and persists within biofilms on equipment, utensils, floors, and drains, ultimately reaching final products by cross-contamination. This pathogen grows even under high salt conditions or refrigeration temperatures, remaining viable in various food products until the end of their shelf life. While the estimated incidence of listeriosis is lower than other enteric illnesses, infections caused by L. monocytogenes are more likely to lead to hospitalizations and fatalities. Despite the description of L. monocytogenes occurrence in Brazilian food-processing facilities and foods, there is a lack of consistent data regarding listeriosis cases and outbreaks directly associated with food consumption. Listeriosis requires rapid treatment with antibiotics and most drugs suitable for Gram-positive bacteria are effective against L. monocytogenes. Only a minority of clinical antibiotic-resistant L. monocytogenes strains have been described so far; whereas many strains recovered from food-processing facilities and foods exhibited resistance to antimicrobials not suitable against listeriosis. L. monocytogenes control in food industries is a challenge, demanding proper cleaning and application of sanitization procedures to eliminate this foodborne pathogen from the food-processing environment and ensure food safety. This review focuses on presenting the L. monocytogenes distribution in food-processing environment, food contamination, and control in the food industry, as well as the consequences of listeriosis to human health, providing a comparison of the current Brazilian situation with the international scenario.

Lo público y lo privado en Educación

Directory of Open Access Journals (Sweden)

J. Félix ANGULO RASCO

2016-01-01

Full Text Available El presente trabajo pretende delinear qué se entiende por escuela pública o, dicho de otra manera, qué hace pública a una escuela. Para ello, se apoya en tres ejes básicos: el sentido estructural, el sentido político y el sentido pedagógico. El sentido estructural pregunta por la pertenencia de la escuela. La pertenencia privada de un centro escolar lo inhabilita para ser un centro público. Lo privado en este caso estaría por encima de lo público y lo común. Por el contrario, la pertenencia pública no ha de asimilarse a la pertenencia estatal. Lo público ha de hacer referencia a lo común. El sentido político indica que una escuela pública sirve al bien común y, especialmente, a los más necesitados. La escuela pública en ese sentido es un espacio de encuentro de la sociedad y además el único espacio educativo para aquellos sectores que no tendrían otra posibilidad. Por último, el sentido pedagógico es el que, al fin y al cabo, da sentido pleno a la escuela pública, en cuanto que supone colmar el derecho de las generaciones y la ciudadanía a la cultura y al conocimiento.

Magnetic bead based immuno-detection of Listeria monocytogenes and Listeria ivanovii from infant formula and leafy green vegetables using the Bio-Plex suspension array system.

Science.gov (United States)

Day, J B; Basavanna, U

2015-04-01

Listeriosis, a disease contracted via the consumption of foods contaminated with pathogenic Listeria species, can produce severe symptoms and high mortality in susceptible people and animals. The development of molecular methods and immuno-based techniques for detection of pathogenic Listeria in foods has been challenging due to the presence of assay inhibiting food components. In this study, we utilize a macrophage cell culture system for the isolation and enrichment of Listeria monocytogenes and Listeria ivanovii from infant formula and leafy green vegetables for subsequent identification using the Luminex xMAP technique. Macrophage monolayers were exposed to infant formula, lettuce and celery contaminated with L. monocytogenes or L. ivanovii. Magnetic microspheres conjugated to Listeria specific antibody were used to capture Listeria from infected macrophages and then analyzed using the Bio-Plex 200 analyzer. As few as 10 CFU/mL or g of L. monocytogenes was detected in all foods tested. The detection limit for L. ivanovii was 10 CFU/mL in infant formula and 100 CFU/g in leafy greens. Microsphere bound Listeria obtained from infected macrophage lysates could also be isolated on selective media for subsequent confirmatory identification. This method presumptively identifies L. monocytogenes and L. ivanovii from infant formula, lettuce and celery in less than 28 h with confirmatory identifications completed in less than 48 h. Published by Elsevier Ltd.

Mechanism of Nisin, Pediocin 34, and Enterocin FH99 Resistance in Listeria monocytogenes.

Science.gov (United States)

Kaur, Gurpreet; Singh, Tejinder Pal; Malik, Ravinder Kumar; Bhardwaj, Arun

2012-03-01

Nisin-, pediocin 34-, and enterocin FH99-resistant variants of Listeria monocytogenes ATCC 53135 were developed. In an attempt to clarify the possible mechanisms underlying bacteriocin resistance in L. monocytogenes ATCC 53135, sensitivity of the resistant strains of L. monocytogenes ATCC 53135 to nisin, pediocin 34, and enterocin FH99 in the absence and presence of different divalent cations was assessed, and the results showed that the addition of divalent cations significantly reduced the inhibitory activity of nisin, pediocin 34, and enterocin FH99 against resistant variants of L. monocytogenes ATCC 53135. The addition of EDTA, however, restored this activity suggesting that the divalent cations seem to affect the initial electrostatic interaction between the positively charged bacteriocin and the negatively charged phospholipids of the membrane. Nisin-, pediocin 34-, and enterocin-resistant variants of L. monocytogenes ATCC 53135 were more resistant to lysozyme as compared to the wild-type strain both in the presence as well as absence of nisin, pediocin 34, and enterocin FH99. Ultra structural profiles of bacteriocin-sensitive L. monocytogenes and its bacteriocin-resistant counterparts revealed that the cells of wild-type strain of L. monocytogenes were maximally in pairs or short chains, whereas, its nisin-, pediocin 34-, and enterocin FH99-resistant variants tend to form aggregates. Results indicated that without a cell wall, the acquired nisin, pediocin 34, and enterocin FH99 resistance of the variants was lost. Although the bacteriocin-resistant variants appeared to lose their acquired resistance toward nisin, pediocin 34, and enterocin FH99, the protoplasts of the resistant variants appeared to be more resistant to bacteriocins than the protoplasts of their wild-type counterparts.

Performance of Isfahan North Wastewater Treatment Plant in the Removal of Listeria monocytogenes

Directory of Open Access Journals (Sweden)

nahid Navijouy

2013-08-01

Full Text Available Listeria and in particular Listeria monocytogenes is considered a ubiquitous foodborne pathogen which can lead listeriosis in human and animals. Listeriosis can be serious and may cause meningitis, septicemia and abortion in pregnant women. Although wastewater or sludge may contaminate foods of plant origin, there are no data on occurrence of Listeria spp. in wastewater and sludge in Iran. The purpose of current investigation was to study the occurrence of Listeria spp. in various samples of wastewater and sludge in Isfahan North wastewater treatment plant. Influent, effluent, raw sludge and dried sludge samples were collected from Isfahan North municipal wastewater treatment plant. L. monocytogenes were enumerated by a three–tube most probable number (MPN assay using enrichment Fraser broth. A total of 65 various samples from five step in 13 visits were collected. The presence of Listeria spp. also was determined using USDA procedure. Then, phenotypically identified L. monocytogenes were further confirmed by Polymerase Chain Reaction amplification. L. monocytogenes isolated from 76.9%, 38.5%, 84.6%, 69.2% and 46.2% of influent, effluent, raw sludge, stabilized sludge and dried sludge respectively. The efficiency of wastewater treatment processes, digester tank and drying bed in removal L. monocytogenes were 69.6%, 64.7% and 73.4% respectively. All phenotypically identified L. monocytogenes were further confirmed by Polymerase Chain Reaction. The results of present study have shown that Listeriaspp. and L. monocytogenes in particular, were present in wastewater treatment plant effluents and sludge at high level. The bacteria may spread on agriculture land and contaminate foods of plant origin. This may cause a risk of spreading disease to human and animals.

Novel Biocontrol Methods for Listeria monocytogenes Biofilms in Food Production Facilities.

Science.gov (United States)

Gray, Jessica A; Chandry, P Scott; Kaur, Mandeep; Kocharunchitt, Chawalit; Bowman, John P; Fox, Edward M

2018-01-01

High mortality and hospitalization rates have seen Listeria monocytogenes as a foodborne pathogen of public health importance for many years and of particular concern for high-risk population groups. Food manufactures face an ongoing challenge in preventing the entry of L. monocytogenes into food production environments (FPEs) due to its ubiquitous nature. In addition to this, the capacity of L. monocytogenes strains to colonize FPEs can lead to repeated identification of L. monocytogenes in FPE surveillance. The contamination of food products requiring product recall presents large economic burden to industry and is further exacerbated by damage to the brand. Poor equipment design, facility layout, and worn or damaged equipment can result in Listeria hotspots and biofilms where traditional cleaning and disinfecting procedures may be inadequate. Novel biocontrol methods may offer FPEs effective means to help improve control of L. monocytogenes and decrease cross contamination of food. Bacteriophages have been used as a medical treatment for many years for their ability to infect and lyse specific bacteria. Endolysins, the hydrolytic enzymes of bacteriophages responsible for breaking the cell wall of Gram-positive bacteria, are being explored as a biocontrol method for food preservation and in nanotechnology and medical applications. Antibacterial proteins known as bacteriocins have been used as alternatives to antibiotics for biopreservation and food product shelf life extension. Essential oils are natural antimicrobials formed by plants and have been used as food additives and preservatives for many years and more recently as a method to prevent food spoilage by microorganisms. Competitive exclusion occurs naturally among bacteria in the environment. However, intentionally selecting and applying bacteria to effect competitive exclusion of food borne pathogens has potential as a biocontrol application. This review discusses these novel biocontrol methods and their

A dynamical systems approach to actin-based motility in Listeria monocytogenes

Science.gov (United States)

Hotton, S.

2010-11-01

A simple kinematic model for the trajectories of Listeria monocytogenes is generalized to a dynamical system rich enough to exhibit the resonant Hopf bifurcation structure of excitable media and simple enough to be studied geometrically. It is shown how L. monocytogenes trajectories and meandering spiral waves are organized by the same type of attracting set.

¿Es posible combinar lo tradicional y lo moderno?

Directory of Open Access Journals (Sweden)

Hugo Celso Felipe Mansilla

2001-01-01

Full Text Available En contra de las actuales tendencias posmodérnicas, el autor postula una simbiosis entre los elementos positivos de lo premoderno y los correspondientes de la modernidad. Cree posible rescatar las llamadas tradiciones razonable, y combinarlas con lo positivo de la modernidad. Estos factores positivos de la tradicionalidad serían la religión en cuanto fuente de sentido y consuelo, la monarquía y la aristocracia hereditarias como modelos institucionales que nos unen con la historia, y la concepción del arte y la literatura como una estética fundamentada en lo bello. Esfuerzos sincretistas similares constituyen gran parte de la historia universal.

Longitudinal monitoring of Listeria monocytogenes and Listeria phages in seafood processing environments in Thailand.

Science.gov (United States)

Vongkamjan, Kitiya; Benjakul, Soottawat; Kim Vu, Hue Thi; Vuddhakul, Varaporn

2017-09-01

Listeria monocytogenes is a foodborne pathogen commonly found in environments of seafood processing, thus presenting a challenge for eradication from seafood processing facilities. Monitoring the prevalence and subtype diversity of L. monocytogenes together with phages that are specific to Listeria spp. ("Listeria phages") will provide knowledge on the bacteria-phage ecology in food processing plants. In this work, a total of 595 samples were collected from raw material, finished seafood products and environmental samples from different sites of a seafood processing plant during 17 sampling visits in 1.5 years of study. L. monocytogenes and Listeria spp. (non-monocytogenes) were found in 22 (3.7%) and 43 (7.2%) samples, respectively, whereas 29 Listeria phages were isolated from 9 (1.5%) phage-positive samples. DNA fingerprint analysis of L. monocytogenes isolates revealed 11 Random Amplified Polymorphic DNA (RAPD) profiles, with two subtypes were frequently observed over time. Our data reveal a presence of Listeria phages within the same seafood processing environments where a diverse set of L. monocytogenes subtypes was also found. Although serotype 4b was observed at lower frequency, data indicate that isolates from this seafood processing plant belonged to both epidemiologically important serotypes 1/2a and 4b, which may suggest a potential public health risk. Phages (all showed a unique genome size of 65 ± 2 kb) were classified into 9 host range groups, representing both broad- and narrow-host range. While most L. monocytogenes isolates from this facility were susceptible to phages, five isolates showed resistance to 12-20 phages. Variations in phage host range among Listeria phages isolated from food processing plant may affect a presence of a diverse set of L. monocytogenes isolates derived from the same processing environment in Thailand. Copyright © 2017 Elsevier Ltd. All rights reserved.

An insight into the isolation, enumeration, and molecular detection of Listeria monocytogenes in food

Science.gov (United States)

Law, Jodi Woan-Fei; Ab Mutalib, Nurul-Syakima; Chan, Kok-Gan; Lee, Learn-Han

2015-01-01

Listeria monocytogenes, a foodborne pathogen that can cause listeriosis through the consumption of food contaminated with this pathogen. The ability of L. monocytogenes to survive in extreme conditions and cause food contaminations have become a major concern. Hence, routine microbiological food testing is necessary to prevent food contamination and outbreaks of foodborne illness. This review provides insight into the methods for cultural detection, enumeration, and molecular identification of L. monocytogenes in various food samples. There are a number of enrichment and plating media that can be used for the isolation of L. monocytogenes from food samples. Enrichment media such as buffered Listeria enrichment broth, Fraser broth, and University of Vermont Medium (UVM) Listeria enrichment broth are recommended by regulatory agencies such as Food and Drug Administration-bacteriological and analytical method (FDA-BAM), US Department of Agriculture-Food and Safety (USDA-FSIS), and International Organization for Standardization (ISO). Many plating media are available for the isolation of L. monocytogenes, for instance, polymyxin acriflavin lithium-chloride ceftazidime aesculin mannitol, Oxford, and other chromogenic media. Besides, reference methods like FDA-BAM, ISO 11290 method, and USDA-FSIS method are usually applied for the cultural detection or enumeration of L. monocytogenes. most probable number technique is applied for the enumeration of L. monocytogenes in the case of low level contamination. Molecular methods including polymerase chain reaction, multiplex polymerase chain reaction, real-time/quantitative polymerase chain reaction, nucleic acid sequence-based amplification, loop-mediated isothermal amplification, DNA microarray, and next generation sequencing technology for the detection and identification of L. monocytogenes are discussed in this review. Overall, molecular methods are rapid, sensitive, specific, time- and labor-saving. In future, there are

MicroRNA-146a Deficiency Protects against Listeria monocytogenes Infection by Modulating the Gut Microbiota

Directory of Open Access Journals (Sweden)

Chong-Tao Du

2018-03-01

Full Text Available The gut microbiota and microRNAs play important roles in the defense against infection. However, the role of miR-146a in L. monocytogenes infection and gut microbiota remains unclear. We tried to determine whether miR-146a controlled L. monocytogenes infection by regulating the gut microbiota. Wild-type and miR-146a-deficient mice or macrophages were used to characterize the impact of miR-146a on animal survival, cell death, bacterial clearance, and gut microbiota following L. monocytogenes challenge. We found that L. monocytogenes infection induced miR-146a expression both in vitro and in vivo. When compared to wild-type mice, miR-146a-deficient mice were more resistant to L. monocytogenes infection. MiR-146a deficiency in macrophages resulted in reduced invasion and intracellular survival of L. monocytogenes. High-throughput sequencing of 16S rRNA revealed that the gut microbiota composition differed between miR-146a-deficient and wild-type mice. Relative to wild-type mice, miR-146a-deficient mice had decreased levels of the Proteobacteria phylum, Prevotellaceae family, and Parasutterella genus, and significantly increased short-chain fatty acid producing bacteria, including the genera Alistipes, Blautia, Coprococcus_1, and Ruminococcus_1. Wild-type mice co-housed with miR-146a-deficient mice had increased resistance to L. monocytogenes, indicating that miR-146a deficiency guides the gut microbiota to alleviate infection. Together, these results suggest that miR-146a deficiency protects against L. monocytogenes infection by regulating the gut microbiota.

MicroRNA-146a Deficiency Protects against Listeria monocytogenes Infection by Modulating the Gut Microbiota.

Science.gov (United States)

Du, Chong-Tao; Gao, Wei; Ma, Ke; Yu, Shui-Xing; Li, Na; Yan, Shi-Qing; Zhou, Feng-Hua; Liu, Zhen-Zhen; Chen, Wei; Lei, Lian-Cheng; Yang, Yong-Jun; Han, Wen-Yu

2018-03-26

The gut microbiota and microRNAs play important roles in the defense against infection. However, the role of miR-146a in L. monocytogenes infection and gut microbiota remains unclear. We tried to determine whether miR-146a controlled L. monocytogenes infection by regulating the gut microbiota. Wild-type and miR-146a-deficient mice or macrophages were used to characterize the impact of miR-146a on animal survival, cell death, bacterial clearance, and gut microbiota following L. monocytogenes challenge. We found that L. monocytogenes infection induced miR-146a expression both in vitro and in vivo. When compared to wild-type mice, miR-146a-deficient mice were more resistant to L. monocytogenes infection. MiR-146a deficiency in macrophages resulted in reduced invasion and intracellular survival of L. monocytogenes . High-throughput sequencing of 16S rRNA revealed that the gut microbiota composition differed between miR-146a-deficient and wild-type mice. Relative to wild-type mice, miR-146a-deficient mice had decreased levels of the Proteobacteria phylum, Prevotellaceae family, and Parasutterella genus, and significantly increased short-chain fatty acid producing bacteria, including the genera Alistipes , Blautia , Coprococcus_1, and Ruminococcus_1 . Wild-type mice co-housed with miR-146a-deficient mice had increased resistance to L. monocytogenes , indicating that miR-146a deficiency guides the gut microbiota to alleviate infection. Together, these results suggest that miR-146a deficiency protects against L. monocytogenes infection by regulating the gut microbiota.

Control of Listeria monocytogenes on vacuum-packaged frankfurters sprayed with lactic acid alone or in combination with sodium lauryl sulfate.

Science.gov (United States)

Byelashov, Oleksandr A; Kendall, Patricia A; Belk, Keith E; Scanga, John A; Sofos, John N

2008-04-01

U.S. regulations require that processors employ lethal or inhibitory antimicrobial alternatives in production of ready-to-eat meat and poultry products that support growth of Listeria monocytogenes and may be exposed to the processing environment after a lethality treatment. In this study, lactic acid (LA; 5%, vol/vol) and sodium lauryl sulfate (SLS; 0.5%, wt/vol) were evaluated individually or as a mixture (LASLS) for control of L. monocytogenes on frankfurters. Frankfurters were inoculated with a 10-strain mixture of L. monocytogenes, sprayed for 10 s (20 bar, 23 +/- 2 degrees C) with antimicrobials or distilled water (DW) before (LASLS or DW) or after (LA, SLS, LASLS, or DW) inoculation (4.8 +/- 0.1 log CFU/cm2), vacuum packaged, and stored at 4 degrees C for 90 days. Samples were analyzed for numbers of the pathogen (on PALCAM agar) and for total microbial counts (on tryptic soy agar with yeast extract) during storage. Spraying with DW, LA, or SLS after inoculation reduced numbers of L. monocytogenes by 1.3 +/- 0.2, 1.8 +/- 0.5, and 2.0 +/- 0.4 log CFU/cm2, respectively. The LASLS mixture applied before or after inoculation reduced pathogen populations by 1.8 +/- 0.4 and 2.8 +/- 0.2 log CFU/cm2, respectively. No further reduction by any treatment was observed during storage. The bacterial growth curves (fitted by the model of Baranyi and Roberts) indicated that the lag-phase duration of the bacterium on control samples (13.85 to 15.18 days) was extended by spraying with all solutions containing LA. For example, LA suppressed growth of L. monocytogenes for 39.14 to 41.01 days. Pathogen growth rates also were lower on frankfurters sprayed after inoculation with LA or LASLS compared to those sprayed with DW. Therefore, spraying frankfurters with a mixture of LA and SLS may be a useful antilisterial alternative treatment for ready-to-eat meat and poultry products.

Suppression of Listeria monocytogenes by the Native Micro-Flora in Teewurst Sausage

Directory of Open Access Journals (Sweden)

Michline Brice

2013-10-01

Full Text Available Modern consumers are interested in the use of non-chemical methods to control pathogens when heat sterilization is not an option. Such is the case with teewurst sausage, a raw spreadable sausage and a popular German commodity. Although Listeria was not found in teewurst, the optimal microbial growing conditions of teewurst coupled with the ubiquity of L. monocytogenes in nature, makes the possibility of contamination of products very possible. This pilot study was conducted to examine teewurst’s native micro-flora’s ability to suppress the outgrowth of L. monocytogenes at 10 °C using standard plate counts and PCR-DGGE. Traditional plating methods showed L. monocytogenes growth significantly decreased when in competition with the teewurst’s native micro-flora (p < 0.05. The native micro-flora of the teewurst suppressed the overall growth of L. monocytogenes by an average of two logs, under these conditions. Denaturing Gradient Gel Electrophoresis (DGGE amplicons with unique banding patterns were extracted from DGGE gel for identification. Brochothrix thermosphacta and Lactobacillus curvatus were identified as a part of the teewurst’s native micro-flora. Although the native micro-flora did not decrease L. monocytogenes to below limits of detection, it was enough of a decrease to warrant further investigation.

Combined effect of gamma radiation and heating on the destruction of Listeria monocytogenes and Salmonella typhimurium in cook-chill roast beef and gravy.

Science.gov (United States)

Grant, I R; Patterson, M F

1995-10-01

The effect of heating alone (60, 65 or 70 degrees C), heating after irradiation (0.8 kGy) and heating after irradiation and storage for 14 days at 2-3 degrees C on the destruction of Listeria monocytogenes and Salmonella typhimurium in artifically inoculated minced cook-chill roast beef and gravy was investigated. Inoculated minced roast beef samples (5 g) were heated in Stomacher bags completely immersed in a water bath at each of the test temperatures. Survivors were enumerated and D and z values were determined for each of the pathogens. Observed thermal D values for two strains of L. monocytogenes at 60, 65 and 70 degrees C in the absence of pre-irradiation were 90.0-97.5 s, 34.0-53.0 s and 22.4-28.0 s, respectively, whereas thermal D values after pre-irradiation were 44.0-46.4 s, 15.3-16.8 s and 5.5-7.8 s at 60, 65 and 70 degrees C, respectively. This reduction in D values provides evidence for radiation-induced heat-sensitisation in L. monocytogenes. There was some evidence of heat-sensitisation of S. typhimurium at 60 degrees C, but not at either 65 or 70 degrees C. The z value also decreased as a consequence of pre-irradiation to a dose of 0.8 kGy (11.0-12.7 degrees C). The radiation-induced heat-sensitivity in L. monocytogenes was found to persist for up to 2 weeks storage at 2-3 degrees C prior to heating. As cook-chill products are intended to be reheated prior to consumption the results of the present study suggest that any L. monocytogenes present in a cook-chill product would be more easily killed during reheating if it were to be treated with a low dose of gamma radiation during manufacture.

Effect of surface roughness and stainless steel finish on Listeria monocytogenes attachment and biofilm formation.

Science.gov (United States)

Rodriguez, Andres; Autio, Wesley R; McLandsborough, Lynne A

2008-01-01

The purpose of this study was to evaluate the effect of surface roughness (Ra) and finish of mechanically polished stainless steel (Ra = 0.26 +/- 0.05, 0.49 +/- 0.10, and 0.69 +/- 0.05 microm) and electropolished stainless steel (Ra = 0.16 +/- 0.06, 0.40 +/- 0.003, and 0.67 +/- 0.02 microm) on Listeria adhesion and biofilm formation. A four-strain cocktail of Listeria monocytogenes was used. Each strain (0.1%) was added to 200 ml of tryptic soy broth (TSB), and coupons were inserted to the mixture for 5 min. For biofilm formation, coupons with adhesive cells were incubated in 1:20 diluted TSB at 32 degrees C for 48 h. The experiment was performed by a randomized block design. Our results show that the level of Listeria present after 48 h of incubation (mean = 7 log CFU/cm2) was significantly higher than after 5 min (mean = 6.0 log CFU/cm2) (P stainless steel (mean = 6.7 log CFU/cm2) (P > 0.05). Listeria initial adhesion (values ranged from 5.9 to 6.1 log CFU/cm2) or biofilm formation (values ranged from 6.9 to 7.2 log CFU/cm2) was not significantly correlated with Ra values (P > 0.05). Image analysis with an atomic force microscope showed that bacteria did not colonize the complete surface after 48 h but were individual cells or grouped in microcolonies that ranged from 5 to 10 microm in diameter and one to three cell layers in thickness. Exopolymeric substances were observed to be associated with the colonies. According to our results, electropolishing stainless steel does not pose a significant advantage for food sanitation over mechanically finished stainless steel.

Characterisation of InlA truncation in Listeria monocytogenes isolates from farm animals and human cases in the province of Quebec

Science.gov (United States)

Fravalo, Philippe; Cherifi, Tamazight; Neira Feliciano, Kersti Dina; Letellier, Ann; Fairbrother, Julie-Hélène; Bekal, Sadjia

2017-01-01

The introduction of Listeria monocytogenes into the food production chain is a concern, with numerous grouped cases of listeriosis associated with milk-derived or pork-derived products have been documented. Management of this zoonotic pathogen considers all strains as an equal risk. Recently, a new perspective for characterisation of strain virulence was introduced with the discovery of the unaltered sequence of InlA as a determinant of strain virulence; this has also been reported as an infrequent finding among so-called environmental strains, that is, strains isolated from food or from surfaces in food industries. The aim of this study was to differentiate L monocytogenes strains isolated from animal cases versus those from human cases and to differentiate clinical strains from environmental ones using a Caenorhabditis elegans virulence testing model. In Quebec in 2013/2014, the surveillance of L monocytogenes clinical isolates registered a total of 20 strains of animal origin and 16 pulsed-field gel electrophoresis types isolated from human cases. The mixed PCR multiplex agglutination protocol used for geno-serotyping clearly discriminated genogroup IVB strains from bovine and human origins. The presence of a premature stop codon single nucleotide polymorphism in the inlA gene sequence in clinical strains and the identical behaviour of particular strains in the C elegans model are discussed in this paper from the perspective of industrial management of L monocytogenes risk. PMID:28761668

Solar irradiance limits the long-term survival of Listeria monocytogenes in seawater.

Science.gov (United States)

NicAogáin, K; Magill, D; O'Donoghue, B; Conneely, A; Bennett, C; O'Byrne, C P

2018-03-01

Seafood has often been implicated in outbreaks of food-borne illness caused by Listeria monocytogenes but the source of contamination is usually not known. In this study we investigated the possibility that this pathogen could survive in seawater for an extended time period. Freshly collected seawater samples were inoculated with 1 × 10 8  CFU per ml of L. monocytogenes EGD-e and survival was monitored by plate counting for up to 25 days. When incubated in the dark, either at ambient temperatures (4-14°C) or at 16°C, >10 4  CFU per ml survivors were present after 25 days. However, when the seawater cell suspensions were exposed to ambient light (solar irradiation) and temperatures, L. monocytogenes lost viability rapidly and no survivors could be detected after the 80 h time point. Both UV-A and visible light in the blue region of the spectrum (470 nm) were found to contribute to this effect. The stress inducible sigma factor σ B was found to play a role in survival of L. monocytogenes in seawater. Together these data demonstrate that solar irradiation is a critical determinant of L. monocytogenes survival in marine environments. The data further suggest the possibility of controlling this food-borne pathogen in food-processing environments using visible light. Listeria monocytogenes is a food-borne bacterial pathogen capable of causing the life-threatening infection, listeriosis. In seafood the route of contamination from the environment is often not well understood as this pathogen is not generally thought to survive well in seawater. Here we provide evidence that L. monocytogenes is capable of surviving for long periods of time in seawater when light is excluded. Sunlight is demonstrated to have a significant effect on the survival of this pathogen in seawater, and both visible (470 nm) and UV-A light are shown to contribute to this effect. © 2017 The Society for Applied Microbiology.

Assessment of Listeria monocytogenes virulence in the Galleria mellonella insect larvae model.

Directory of Open Access Journals (Sweden)

Mira Rakic Martinez

Full Text Available Several animal models have been used to understand the molecular basis of the pathogenicity, infectious dose and strain to strain variation of Listeria monocytogenes. The greater wax worm Galleria mellonella, as an alternative model, provides some useful advantages not available with other models and has already been described as suitable for the virulence assessment of various pathogens including L. monocytogenes. The objectives of this study are: 1 confirming the usefulness of this model with a wide panel of Listeria spp. including non-pathogenic L. innocua, L. seeligeri, L. welshimeri and animal pathogen L. ivanovii; 2 assessment of virulence of several isogenic in-frame deletion mutants in virulence and stress related genes of L. monocytogenes and 3 virulence assessment of paired food and clinical isolates of L. monocytogenes from 14 major listeriosis outbreaks occurred worldwide between 1980 and 2015. Larvae injected with different concentrations of Listeria were incubated at 37°C and monitored over seven days for time needed to kill 50% of larvae (LT50 and to determine change of bacterial population in G. mellonella, 2 and 24 hours post-inoculation. Non-pathogenic members of Listeria and L. ivanovii showed significantly (P < 0.05 higher LT50 (lower virulence than the wild type L. monocytogenes strains. Isogenic mutants of L. monocytogenes with the deletions in prfA, plcA, hly, actA and virR genes, also showed significantly (P < 0.05 higher LT50 than the wild type strain at the inoculum of 106CFU/larva. Food isolates had significantly (P < 0.05 lower virulence than the paired clinical isolates, at all three inoculum concentrations. L. monocytogenes strains related to non-invasive (gastroenteritis outbreaks of listeriosis showed significantly (P < 0.05 lower virulence than isolates of the same serotype obtained from outbreaks with invasive symptoms. The difference, however, was dose and strain- dependent. No significant differences in

Listeria monocytogenes serotype prevalence and biodiversity in diverse food products.

Science.gov (United States)

Hadjilouka, Agni; Andritsos, Nikolaos D; Paramithiotis, Spiros; Mataragas, Marios; Drosinos, Eleftherios H

2014-12-01

The aim of this study was to assess serotype prevalence and biodiversity of Listeria monocytogenes strains isolated from diverse food products, i.e., minced pork, fruits, and vegetables. Three hundred twenty-six samples previously purchased from supermarkets and street markets within the Athens area were studied for L. monocytogenes prevalence. A total of 121 strains were isolated from the 36 samples that were positive for L. monocytogenes. Serotyping was performed with multiplex PCR, and biodiversity was assessed with random amplified polymorphic DNA (RAPD) PCR analysis using M13, UBC155, and HLWL85 as primers and with repetitive element palindromic (rep) PCR analysis using (GTG)5 as the primer. The majority (17 of 22) of the contaminated minced pork samples contained strains identified as serotype 1/2a, either alone or in combination with strains belonging to serotypes 1/2b, 4a, 4c, or 4ab. However, all L. monocytogenes isolates from fruits and vegetables belonged to serotype 4b. Rep-PCR provided better differentiation of the isolates than did RAPD PCR and resulted in discrimination of the isolates into a larger number of unique profiles. Complete differentiation was achieved only with the combination of these subtyping techniques.

COMPARISON OF TWO METHODS FOR THE DETECTION OF LISTERIA MONOCYTOGENES

Directory of Open Access Journals (Sweden)

G. Tantillo

2013-02-01

Full Text Available The aim of this study was to compare the performance of the conventional methods for detection of Listeria monocytogenes in food using media Oxford and ALOA (Agar Listeria acc. to Ottaviani & Agosti in according to the ISO 11290-1 to a new chromogenic medium “CHROMagar Listeria” standardized in 2005 AFNOR ( CHR – 21/1-12/01. A total of 40 pre-packed ready-to-eat food samples were examined. Using two methods six samples were found positive for Listeria monocytogenes but the medium “CHROMagar Listeria” was more selective in comparison with the others. In conclusion this study has demonstrated that isolation medium able to target specifically the detection of L. monocytogenes such as “CHROMagar Listeria” is highly recommendable because of that detection time is significantly reduced and the analysis cost is less expensive.

Phenotypic and Genotypic Characteristics of Listeria monocytogenes Isolated From Dairy and Meat Products

Directory of Open Access Journals (Sweden)

Bahador

2015-08-01

Full Text Available Background Listeria monocytogenes is a foodborne pathogen and a serious threat to the public health in the world. Consumption of traditional foods such as dairy and meat products can be a major reason for relative abundance and isolation of these bacteria. Objectives The purpose of this study was to determine the phenotypic and genotypic characteristics of L. monocytogenes strains isolated from dairy and meat products. Materials and Methods A total of 317 dairy products and meat-processed samples were collected. Antibiotic susceptibility test was performed on each sample by the disk diffusion method (Kirby Bauer. Five reference loci were used for typing of L. monocytogenes strains by MLVA (Multiple Locus VNTR Analysis Technique. Results A total of 24 L. monocytogenes isolates were collected from the dairy and meat products. Resistance of isolated L. monocytogenes strains to penicillin G were 54.54% (from dairy products and 46.15% (from processed meat. Genetic relatedness of isolates were assessed by MLVA. Out of 13 different types, type 2 with 6 strains and type 3 with 4 strains, were the most common types. Conclusions MLVA analysis showed that samples obtained from different sources could have similar genetic profile. As a result, administration of penicillin in patients with listeriosis (especially pregnant women and antibiotic susceptibility test are recommended. The fast and accurate methods such as MLVA for tracking of pollution sources of L. monocytogenes are recommended during outbreaks.

Growth and inactivation of Salmonella enterica and Listeria monocytogenes in broth and validation in ground pork meat during simulated home storage abusive temperature and home pan-frying

Directory of Open Access Journals (Sweden)

Xiang eWang

2015-10-01

Full Text Available Ground pork meat with natural microbiota and inoculated with low initial densities (1-10 or 10-100 CFU/g of Salmonella enterica or Listeria monocytogenes was stored under abusive temperature at 10°C and thermally treated by a simulated home pan-frying procedure. The growth and inactivation characteristics were also evaluated in broth. In ground pork meat, the population of S. enterica increased by less than one log after 12-days of storage at 10°C, whereas L. monocytogenes increased by 2.3 to 2.8 log units. No unusual intrinsic heat resistance of the pathogens was noted when tested in broth at 60°C although shoulders were observed on the inactivation curves of L. monocytogenes. After growth of S. enterica and L. monocytogenes at 10°C for 5 days to levels of 1.95 log CFU/g and 3.10 log CFU/g, respectively, in ground pork meat, their inactivation in the burger subjected to a simulated home pan-frying was studied. After thermal treatment S. enterica was undetectable but L. monocytogenes was recovered in three out of six of the 25 g burger samples. Overall, the present study shows that data on growth and inactivation of broths are indicative but may underestimate as well as overestimate behavior of pathogens and thus need confirmation in food matrix conditions to assess food safety in reasonably foreseen abusive conditions of storage and usual home pan-frying of of meat burgers in Belgium.

Co-Culture with Listeria monocytogenes within a Dual-Species Biofilm Community Strongly Increases Resistance of Pseudomonas putida to Benzalkonium Chloride

Science.gov (United States)

Giaouris, Efstathios; Chorianopoulos, Nikos; Doulgeraki, Agapi; Nychas, George-John

2013-01-01

Biofilm formation is a phenomenon occurring almost wherever microorganisms and surfaces exist in close proximity. This study aimed to evaluate the possible influence of bacterial interactions on the ability of Listeria monocytogenes and Pseudomonas putida to develop a dual-species biofilm community on stainless steel (SS), as well as on the subsequent resistance of their sessile cells to benzalkonium chloride (BC) used in inadequate (sub-lethal) concentration (50 ppm). The possible progressive adaptability of mixed-culture biofilms to BC was also investigated. To accomplish these, 3 strains per species were left to develop mixed-culture biofilms on SS coupons, incubated in daily renewable growth medium for a total period of 10 days, under either mono- or dual-species conditions. Each day, biofilm cells were exposed to disinfection treatment. Results revealed that the simultaneous presence of L. monocytogenes strongly increased the resistance of P. putida biofilm cells to BC, while culture conditions (mono-/dual-species) did not seem to significantly influence the resistance of L. monocytogenes biofilm cells. BC mainly killed L. monocytogenes cells when this was applied against the dual-species sessile community during the whole incubation period, despite the fact that from the 2nd day this community was mainly composed (>90%) of P. putida cells. No obvious adaptation to BC was observed in either L. monocytogenes or P. putida biofilm cells. Pulsed field gel electrophoresis (PFGE) analysis showed that the different strains behaved differently with regard to biofilm formation and antimicrobial resistance. Such knowledge on the physiological behavior of mixed-culture biofilms could provide the information necessary to control their formation. PMID:24130873

Co-culture with Listeria monocytogenes within a dual-species biofilm community strongly increases resistance of Pseudomonas putida to benzalkonium chloride.

Directory of Open Access Journals (Sweden)

Efstathios Giaouris

Full Text Available Biofilm formation is a phenomenon occurring almost wherever microorganisms and surfaces exist in close proximity. This study aimed to evaluate the possible influence of bacterial interactions on the ability of Listeria monocytogenes and Pseudomonas putida to develop a dual-species biofilm community on stainless steel (SS, as well as on the subsequent resistance of their sessile cells to benzalkonium chloride (BC used in inadequate (sub-lethal concentration (50 ppm. The possible progressive adaptability of mixed-culture biofilms to BC was also investigated. To accomplish these, 3 strains per species were left to develop mixed-culture biofilms on SS coupons, incubated in daily renewable growth medium for a total period of 10 days, under either mono- or dual-species conditions. Each day, biofilm cells were exposed to disinfection treatment. Results revealed that the simultaneous presence of L. monocytogenes strongly increased the resistance of P. putida biofilm cells to BC, while culture conditions (mono-/dual-species did not seem to significantly influence the resistance of L. monocytogenes biofilm cells. BC mainly killed L. monocytogenes cells when this was applied against the dual-species sessile community during the whole incubation period, despite the fact that from the 2nd day this community was mainly composed (>90% of P. putida cells. No obvious adaptation to BC was observed in either L. monocytogenes or P. putida biofilm cells. Pulsed field gel electrophoresis (PFGE analysis showed that the different strains behaved differently with regard to biofilm formation and antimicrobial resistance. Such knowledge on the physiological behavior of mixed-culture biofilms could provide the information necessary to control their formation.

Antimicrobial activity of chitosan coatings and films against Listeria monocytogenes on black radish.

Science.gov (United States)

Jovanović, Gordana D; Klaus, Anita S; Nikšić, Miomir P

2016-01-01

The antibacterial activity of chitosan coatings prepared with acetic or lactic acid, as well as of composite chitosan-gelatin films prepared with essential oils, was evaluated in fresh shredded black radish samples inoculated with Listeria monocytogenes ATCC 19115 and L. monocytogenes ATCC 19112 during seven days of storage at 4°C. The chitosan coating prepared with acetic acid showed the most effective antibacterial activity. All tested formulations of chitosan films exhibited strong antimicrobial activity on the growth of L. monocytogenes on black radish, although a higher inhibition of pathogens was achieved at higher concentrations of chitosan. The antimicrobial effect of chitosan films was even more pronounced with the addition of essential oils. Chitosan-gelatin films with thyme essential oils showed the most effective antimicrobial activity. A reduction of 2.4log10CFU/g for L. monocytogenes ATCC 19115 and 2.1log10CFU/g for L. monocytogenes ATCC 19112 was achieved in the presence of 1% chitosan film containing 0.2% of thyme essential oil after 24h of storage. Copyright © 2016 Asociación Argentina de Microbiología. Publicado por Elsevier España, S.L.U. All rights reserved.

Lineage specific recombination rates and microevolution in Listeria monocytogenes

Directory of Open Access Journals (Sweden)

Nightingale Kendra K

2008-10-01

Full Text Available Abstract Background The bacterium Listeria monocytogenes is a saprotroph as well as an opportunistic human foodborne pathogen, which has previously been shown to consist of at least two widespread lineages (termed lineages I and II and an uncommon lineage (lineage III. While some L. monocytogenes strains show evidence for considerable diversification by homologous recombination, our understanding of the contribution of recombination to L. monocytogenes evolution is still limited. We therefore used STRUCTURE and ClonalFrame, two programs that model the effect of recombination, to make inferences about the population structure and different aspects of the recombination process in L. monocytogenes. Analyses were performed using sequences for seven loci (including the house-keeping genes gap, prs, purM and ribC, the stress response gene sigB, and the virulence genes actA and inlA for 195 L. monocytogenes isolates. Results Sequence analyses with ClonalFrame and the Sawyer's test showed that recombination is more prevalent in lineage II than lineage I and is most frequent in two house-keeping genes (ribC and purM and the two virulence genes (actA and inlA. The relative occurrence of recombination versus point mutation is about six times higher in lineage II than in lineage I, which causes a higher genetic variability in lineage II. Unlike lineage I, lineage II represents a genetically heterogeneous population with a relatively high proportion (30% average of genetic material imported from external sources. Phylograms, constructed with correcting for recombination, as well as Tajima's D data suggest that both lineages I and II have suffered a population bottleneck. Conclusion Our study shows that evolutionary lineages within a single bacterial species can differ considerably in the relative contributions of recombination to genetic diversification. Accounting for recombination in phylogenetic studies is critical, and new evolutionary models that

Genes involved in Listeria monocytogenes biofilm formation at a simulated food processing plant temperature of 15 °C.

Science.gov (United States)

Piercey, Marta J; Hingston, Patricia A; Truelstrup Hansen, Lisbeth

2016-04-16

Listeria monocytogenes is a pathogenic foodborne bacterium whose persistence in food processing environments is in part attributed to its biofilm formation. Most biofilm studies have been carried out at 30-37 °C rather than at temperatures found in the food processing plants (i.e., 10-20 °C). The objective of the present study was to mine for novel genes that contribute to L. monocytogenes biofilm formation at 15 °C using the random insertional mutagenesis approach. A library of 11,024 L. monocytogenes 568 (serotype 1/2a) Himar1 insertional mutants was created. Mutants with reduced or enhanced biofilm formation at 15 °C were detected in microtiter plate assays with crystal violet and safranin staining. Fourteen mutants expressed enhanced biofilm phenotypes, and harbored transposon insertions in genes encoding cell wall biosynthesis, motility, metabolism, stress response, and cell surface associated proteins. Deficient mutants (n=5) contained interruptions in genes related to peptidoglycan, teichoic acid, or lipoproteins. Enhanced mutants produced significantly (pbiofilm formed on stainless steel (SS) coupons at 15 °C (48 h) than deficient mutants, which were also more sensitive to benzalkonium chloride. All biofilm deficient mutants and four enhanced mutants in the microtiter plate assay (flaA, cheR, lmo2563 and lmo2488) formed no biofilm in a peg lid assay (Calgary biofilm device) while insertions in lmo1224 and lmo0543 led to excess biofilm in all assays. Two enhanced biofilm formers were more resistant to enzymatic removal with DNase, proteinase K or pectinase than the parent strain. Scanning electron microscopy of individual biofilms made by five mutants and the parent on SS surfaces showed formation of heterogeneous biofilm with dense zones by immotile mutants, while deficient mutants exhibited sparse growth. In conclusion, interruptions of 9 genes not previously linked to biofilm formation in L. monocytogenes (lmo2572, lmo2488 (uvrA), lmo1224, lmo0434

[Occurrence and typing of Listeria monocytogenes isolated from raw cow's milk collected on farms and from vending machines].

Science.gov (United States)

Gelbícová, T; Karpísková, R

2012-04-01

Evaluation of the incidence and characteristics of L. monocytogenes in samples of raw cow's milk collected on farms (bulk tank milk samples) and from vending machines. Detection of L. monocytogenes and enumeration were carried out according to EN/ISO 11290--1, 2. Strains were characterised by serotyping and macrorestriction analysis using pulsed-field gel electrophoresis. The presence of L. monocytogenes was detected in 3,2 % (11/346) of bulk tank milk samples and 1,8 % (4/219) samples of raw cow's milk from vending machines. Findings of L. monocytogenes in raw milk were sporadic. Only on one farm strains of L. monocytogenes were detected repeatedly. Thirteen strains of L. monocytogenes belonged to serotype 1/2a, two strains to serotype 1/2b and one to serotype 4b. Macrorestriction analysis revealed considerable heterogeinity of profiles, with nine different pulsotypes being detected. Pulsotype 711 was the most frequent. This pulsotype was found on three different farms. The incidence of L. monocytogenes in raw cow's milk is relatively low in the Czech Republic. The results confirmed that some clones of L. monocytogenes from raw milk are identical with food and human strains.

In vitro detection of pathogenic Listeria monocytogenes from food sources by conventional, molecular and cell culture method

Directory of Open Access Journals (Sweden)

J.A. Khan

2013-09-01

Full Text Available Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO. A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG; R: CCTCCAGAGTGATCGATGTT complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR. PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%, followed by fish meat (4.0%, and then beef (2.5%. Among various milk and milk products, curd (2.0% showed the highest prevalence, followed by raw milk (1.3%. The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 µL and 50 µL of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro resulted positive in twenty four

Directed evolution and targeted mutagenesis to murinize Listeria monocytogenes Internalin A for enhanced infectivity in the murine oral infection model

LENUS (Irish Health Repository)

Monk, Ian R

2010-12-13

Abstract Background Internalin A (InlA) is a critical virulence factor which mediates the initiation of Listeria monocytogenes infection by the oral route in permissive hosts. The interaction of InlA with the host cell ligand E-cadherin efficiently stimulates L. monocytogenes entry into human enterocytes, but has only a limited interaction with murine cells. Results We have created a surface display library of randomly mutated InlA in a non-invasive heterologous host Lactococcus lactis in order to create and screen novel variants of this invasion factor. After sequential passage through a murine cell line (CT-26), multiple clones with enhanced invasion characteristics were identified. Competitive index experiments were conducted in mice using selected mutations introduced into L. monocytogenes EGD-e background. A novel single amino acid change was identified which enhanced virulence by the oral route in the murine model and will form the basis of further engineering approaches. As a control a previously described EGD-InlAm murinized strain was also re-created as part of this study with minor modifications and designated EGD-e InlA m*. The strain was created using a procedure that minimizes the likelihood of secondary mutations and incorporates Listeria-optimized codons encoding the altered amino acids. L. monocytogenes EGD-e InlA m* yielded consistently higher level murine infections by the oral route when compared to EGD-e, but did not display the two-fold increased invasion into a human cell line that was previously described for the EGD-InlAm strain. Conclusions We have used both site-directed mutagenesis and directed evolution to create variants of InlA which may inform future structure-function analyses of this protein. During the course of the study we engineered a murinized strain of L. monocytogenes EGD-e which shows reproducibly higher infectivity in the intragastric murine infection model than the wild type, but does not display enhanced entry into human

Directed evolution and targeted mutagenesis to murinize listeria monocytogenes internalin A for enhanced infectivity in the murine oral infection model

Directory of Open Access Journals (Sweden)

Hill Colin

2010-12-01

Full Text Available Abstract Background Internalin A (InlA is a critical virulence factor which mediates the initiation of Listeria monocytogenes infection by the oral route in permissive hosts. The interaction of InlA with the host cell ligand E-cadherin efficiently stimulates L. monocytogenes entry into human enterocytes, but has only a limited interaction with murine cells. Results We have created a surface display library of randomly mutated InlA in a non-invasive heterologous host Lactococcus lactis in order to create and screen novel variants of this invasion factor. After sequential passage through a murine cell line (CT-26, multiple clones with enhanced invasion characteristics were identified. Competitive index experiments were conducted in mice using selected mutations introduced into L. monocytogenes EGD-e background. A novel single amino acid change was identified which enhanced virulence by the oral route in the murine model and will form the basis of further engineering approaches. As a control a previously described EGD-InlAm murinized strain was also re-created as part of this study with minor modifications and designated EGD-e InlAm*. The strain was created using a procedure that minimizes the likelihood of secondary mutations and incorporates Listeria-optimized codons encoding the altered amino acids. L. monocytogenes EGD-e InlAm* yielded consistently higher level murine infections by the oral route when compared to EGD-e, but did not display the two-fold increased invasion into a human cell line that was previously described for the EGD-InlAm strain. Conclusions We have used both site-directed mutagenesis and directed evolution to create variants of InlA which may inform future structure-function analyses of this protein. During the course of the study we engineered a murinized strain of L. monocytogenes EGD-e which shows reproducibly higher infectivity in the intragastric murine infection model than the wild type, but does not display enhanced

Growth potential of Salmonella spp. and Listeria monocytogenes in nine types of ready-to-eat vegetables stored at variable temperature conditions during shelf-life.

Science.gov (United States)

Sant'Ana, Anderson S; Barbosa, Matheus S; Destro, Maria Teresa; Landgraf, Mariza; Franco, Bernadette D G M

2012-06-15

Growth potential (δ) is defined as the difference between the population of a microorganism at the end of shelf-life of specific food and its initial population. The determination of δ of Salmonella and Listeria monocytogenes in RTE vegetables can be very useful to determine likely threats to food safety. However, little is known on the behavior of these microorganisms in several RTE vegetables. Therefore, the aim of this study was to determine the δ of both pathogens in nine different types of RTE vegetables (escarole, collard green, spinach, watercress, arugula, grated carrot, green salad, and mix for yakisoba) stored at refrigeration (7°C) and abuse temperature (15°C). The population of aerobic microorganisms and lactic acid bacteria, including those showing antimicrobial activity has been also determined. Results indicated that L. monocytogenes was able to grow (δ≥0.5 log(10)) in more storage conditions and vegetables than Salmonella. Both microorganisms were inhibited in carrots, although a more pronounced effect has been observed against L. monocytogenes. The highest δ values were obtained when the RTE vegetables were stored 15°C/6days in collard greens (δ=3.3) and arugula (δ=3.2) (L. monocytogenes) and arugula (δ=4.1) and escarole (δ=2.8) (Salmonella). In most vegetables and storage conditions studied, the counts of total aerobic microorganisms raised significantly independent of the temperature of storage (pvegetables partially or fully stored at abuse temperature with recovery of isolates showing antimicrobial activity. In conclusion, the results of this study show that Salmonella and L. monocytogenes may grow and reach high populations in RTE vegetables depending on storage conditions and the definition of effective intervention strategies are needed to control their growth in these products. Copyright © 2012 Elsevier B.V. All rights reserved.

LACTIC FLORA-LISTERIA MONOCYTOGENES INTERACTION

Directory of Open Access Journals (Sweden)

S. Colombo

2012-08-01

Full Text Available The EC Regulation 2073/2005 (1 requires that food processors evaluate the capability of ready-to-use (RTE products to support the development of Listeria monocytogenes when their pH and aW values are favourable to the growth of this microorganism. It is renown that the lactic flora plays an important role in many different foods, both from a technological and a food safety standpoint. This study was aimed to observe the behaviour and the potential anti-Listeria effect of some natural lactic flora present in Italian liver patè crostini (chicken heart and liver, anchovies, onions, capers, starch, no added preservatives through the Combase Predictor – Max Growth Rate predictive software. The natural lactic flora of the crostini demonstrated a variable capability to inhibit the growth of Listeria monocytogenes which depends upon : the concentration of the lactic flora at the beginning of the shelf life period and the subsequent lag phase, the possible release of anti-Listeria substances, and the maximum growth rate.

An outbreak of an unusual strain of Listeria monocytogenes infection in North-East Scotland

Directory of Open Access Journals (Sweden)

Emmanuel Okpo

2015-11-01

Full Text Available Summary: Listeria monocytogenes infection is an important cause of illness and hospitalization in vulnerable individuals. In the present study, we describe a community outbreak of Listeria monocytogenes in the North-East region of Scotland, which was epidemiologically, environmentally and microbiologically linked to a local meat product and ready-to-eat product manufacturer. Infected individuals were interviewed, and an environmental investigation was conducted. Clinical and environmental samples were tested by culture, and isolates were typed by fluorescent amplified fragment length polymorphism (fAFLP. Three cases of Listeria monocytogenes were linked geographically, had the same serotype (1/2a and were indistinguishable by fAFLP type XII.6. The human, food and environmental isolates were of the same serotype and were indistinguishable by molecular typing.This is the first community outbreak of L. monocytogenes reported in Scotland since the current outbreak surveillance was established in 1996. Epidemiological and laboratory evidence indicated poor hand hygiene, unhygienic practices and cross-contamination throughout the manufacturing process of ready-to-eat foods as a possible cause of the outbreak. More stringent control of commercial food establishments that provide ready-to-eat food and the need to advise specifically vulnerable groups, e.g., pregnant women, of the risk of L. monocytogenes in ready-to-eat food is urgently needed. Keywords: Listeria monocytogenes, Outbreak, Foodborne, Community acquired infection, Listeriosis

The combination of energy-dependent internal adaptation mechanisms and external factors enables Listeria monocytogenes to express a strong starvation survival response during multiple-nutrient starvation.

Science.gov (United States)

Lungu, Bwalya; Saldivar, Joshua C; Story, Robert; Ricke, Steven C; Johnson, Michael G

2010-05-01

The goal of this study was to characterize the starvation survival response (SSR) of a wild-type Listeria monocytogenes 10403S and an isogenic DeltasigB mutant strain during multiple-nutrient starvation conditions over 28 days. This study examined the effects of inhibitors of protein synthesis, the proton motive force, substrate level phosphorylation, and oxidative phosphorylation on the SSR of L. monocytogenes 10403S and a DeltasigB mutant during multiple-nutrient starvation. The effects of starvation buffer changes on viability were also examined. During multiple-nutrient starvation, both strains expressed a strong SSR, suggesting that L. monocytogenes possesses SigB-independent mechanism(s) for survival during multiple-nutrient starvation. Neither strain was able to express an SSR following starvation buffer changes, indicating that the nutrients/factors present in the starvation buffer could be a source of energy for cell maintenance and survival. Neither the wild-type nor the DeltasigB mutant strain was able to elicit an SSR when exposed to the protein synthesis inhibitor chloramphenicol within the first 4 h of starvation. However, both strains expressed an SSR when exposed to chloramphenicol after 6 h or more of starvation, suggesting that the majority of proteins required to elicit an effective SSR in L. monocytogenes are likely produced somewhere between 4 and 6 h of starvation. The varying SSRs of both strains to the different metabolic inhibitors under aerobic or anaerobic conditions suggested that (1) energy derived from the proton motive force is important for an effective SSR, (2) L. monocytogenes utilizes an anaerobic electron transport during multiple-nutrient starvation conditions, and (3) the glycolytic pathway is an important energy source during multiple-nutrient starvation when oxygen is available, and less important under anaerobic conditions. Collectively, the data suggest that the combination of energy-dependent internal adaptation mechanisms

Inactivation of Listeria monocytogenes in milk by pulsed electric field.

Science.gov (United States)

Reina, L D; Jin, Z T; Zhang, Q H; Yousef, A E

1998-09-01

Pasteurized whole, 2%, and skim milk were inoculated with Listeria monocytogenes Scott A and treated with high-voltage pulsed electric field (PEF). The effects of milk composition (fat content) and PEF parameters (electric field strength, treatment time, and treatment temperature) on the inactivation of the bacterium were studied. No significant differences were observed in the inactivation of L. monocytogenes Scott A in three types of milk by PEF treatment. With treatment at 25 degrees C, 1- to 3-log reductions of L. monocytogenes were observed. PEF lethal effect was a function of field strength and treatment time. Higher field strength or longer treatment time resulted in a greater reduction of viable cells. A 4-log reduction of the bacterium was obtained by increasing the treatment temperature to 50 degrees C. Results indicate that the use of a high-voltage PEF is a promising technology for inactivation of foodborne pathogens.

Listeria monocytogenes inhibition by defatted mustard meal-based edible films.

Science.gov (United States)

Lee, Hahn-Bit; Noh, Bong Soo; Min, Sea C

2012-02-01

An antimicrobial edible film was developed from defatted mustard meal (Sinapis alba) (DMM), a byproduct from the bio-fuel industry, without incorporating external antimicrobials and its antimicrobial activity against Listeria monocytogenes and physical properties were investigated. The DMM colloidal solution consisting of 184 g water, 14 g DMM, and 2g glycerol was homogenized and incubated at 37°C for 0.2, 0.5, 24 or 48 h to prepare a film-forming solution. The pH of a portion of the film-forming solution (pH 5.5) was adjusted to 2.0 or 4.0. Films were formed by drying the film-forming solutions at 23°C for 48 h. The film-forming solution incubated for 48 h inhibited L. monocytogenes in broth and on agar media. Antimicrobial effects of the film prepared from the 48 h-incubated solution increased with decrease in pH of the solution from 5.5 to 2.0. The film from the film forming solution incubated for 48 h (pH 2.0) initially inhibited more than 4.0 log CFU/g of L. monocytogenes inoculated on film-coated salmon. The film-coating retarded the growth of L. monocytogenes in smoked salmon at 5, 10, and 15°C and the antimicrobial effect during storage was more noticeable when the coating was applied before inoculation than when it was applied after inoculation. The tensile strength, percentage elongation, solubility in watercxu, and water vapor permeability of the anti microbial film were 2.44 ± 0.19 MPa, 6.40 ± 1.13%, 3.19 ± 0.90%, and 3.18 ± 0.63 gmm/kPa hm(2), respectively. The antimicrobial DMM films have demonstrated a potential to be applied to foods as wraps or coatings to control the growth of L. monocytogenes. Copyright © 2011 Elsevier B.V. All rights reserved.

Food contact surfaces coated with nitrogen-doped titanium dioxide: effect on Listeria monocytogenes survival under different light sources

International Nuclear Information System (INIS)

Rodrigues, D.; Teixeira, P.; Tavares, C.J.; Azeredo, J.

2013-01-01

Improvement of food safety is a very important issue, and is on the basis of production and application of new/modified food contact surfaces. Titanium dioxide (TiO 2 ) and, more recently, nitrogen-doped titanium dioxide (N-TiO 2 ) coatings are among the possible forms to enhance food contact surfaces performance in terms of higher hygiene and easier sanitation. In this context, the present work aimed at evaluating the bactericidal activity of an N-TiO 2 coating on glass and stainless steel under two different sources of visible light – fluorescent and incandescent – and ultraviolet (UV) irradiation. Listeria monocytogenes was chosen as representative of major foodborne pathogens and its survival was tested on N-TiO 2 coated coupons. In terms of survival percentage, good results were obtained after exposure of coated surfaces to all light types since, apart from the value obtained after exposing glass to fluorescent light (56.3%), survival rates were always below 50%. However, no effective disinfection was obtained, given that for a disinfectant or sanitizing agent to be claimed as effective it needs to be able to promote at least a 3-log reduction of the microbial load, which was not observed for any of the experimental conditions assessed. Even so, UV irradiation was the most successful on eliminating cells on coated surfaces, since the amount of bacteria was reduced to 1.49 × 10 6 CFU/ml on glass and 2.37 × 10 7 on stainless steel. In contrast, both visible light sources had only slightly decreased the amount of viable cells, which remained in the range of 8 log CFU/ml. Hence, although some bactericidal effect was accomplished under visible light, UV was the most effective light source on promoting photocatalytic reactions on N-TiO 2 coated coupons and none of the experimental conditions have reached a satisfactory disinfection level. Thus, this surface coating needs further research and improvement in order to become truly effective against foodborne

Food contact surfaces coated with nitrogen-doped titanium dioxide: effect on Listeria monocytogenes survival under different light sources

Science.gov (United States)

Rodrigues, D.; Teixeira, P.; Tavares, C. J.; Azeredo, J.

2013-04-01

Improvement of food safety is a very important issue, and is on the basis of production and application of new/modified food contact surfaces. Titanium dioxide (TiO2) and, more recently, nitrogen-doped titanium dioxide (N-TiO2) coatings are among the possible forms to enhance food contact surfaces performance in terms of higher hygiene and easier sanitation. In this context, the present work aimed at evaluating the bactericidal activity of an N-TiO2 coating on glass and stainless steel under two different sources of visible light - fluorescent and incandescent - and ultraviolet (UV) irradiation. Listeria monocytogenes was chosen as representative of major foodborne pathogens and its survival was tested on N-TiO2 coated coupons. In terms of survival percentage, good results were obtained after exposure of coated surfaces to all light types since, apart from the value obtained after exposing glass to fluorescent light (56.3%), survival rates were always below 50%. However, no effective disinfection was obtained, given that for a disinfectant or sanitizing agent to be claimed as effective it needs to be able to promote at least a 3-log reduction of the microbial load, which was not observed for any of the experimental conditions assessed. Even so, UV irradiation was the most successful on eliminating cells on coated surfaces, since the amount of bacteria was reduced to 1.49 × 106 CFU/ml on glass and 2.37 × 107 on stainless steel. In contrast, both visible light sources had only slightly decreased the amount of viable cells, which remained in the range of 8 log CFU/ml. Hence, although some bactericidal effect was accomplished under visible light, UV was the most effective light source on promoting photocatalytic reactions on N-TiO2 coated coupons and none of the experimental conditions have reached a satisfactory disinfection level. Thus, this surface coating needs further research and improvement in order to become truly effective against foodborne pathogens and

Novel Biocontrol Methods for Listeria monocytogenes Biofilms in Food Production Facilities

Directory of Open Access Journals (Sweden)

Jessica A. Gray

2018-04-01

Full Text Available High mortality and hospitalization rates have seen Listeria monocytogenes as a foodborne pathogen of public health importance for many years and of particular concern for high-risk population groups. Food manufactures face an ongoing challenge in preventing the entry of L. monocytogenes into food production environments (FPEs due to its ubiquitous nature. In addition to this, the capacity of L. monocytogenes strains to colonize FPEs can lead to repeated identification of L. monocytogenes in FPE surveillance. The contamination of food products requiring product recall presents large economic burden to industry and is further exacerbated by damage to the brand. Poor equipment design, facility layout, and worn or damaged equipment can result in Listeria hotspots and biofilms where traditional cleaning and disinfecting procedures may be inadequate. Novel biocontrol methods may offer FPEs effective means to help improve control of L. monocytogenes and decrease cross contamination of food. Bacteriophages have been used as a medical treatment for many years for their ability to infect and lyse specific bacteria. Endolysins, the hydrolytic enzymes of bacteriophages responsible for breaking the cell wall of Gram-positive bacteria, are being explored as a biocontrol method for food preservation and in nanotechnology and medical applications. Antibacterial proteins known as bacteriocins have been used as alternatives to antibiotics for biopreservation and food product shelf life extension. Essential oils are natural antimicrobials formed by plants and have been used as food additives and preservatives for many years and more recently as a method to prevent food spoilage by microorganisms. Competitive exclusion occurs naturally among bacteria in the environment. However, intentionally selecting and applying bacteria to effect competitive exclusion of food borne pathogens has potential as a biocontrol application. This review discusses these novel biocontrol

Novel Biocontrol Methods for Listeria monocytogenes Biofilms in Food Production Facilities

Science.gov (United States)

Gray, Jessica A.; Chandry, P. Scott; Kaur, Mandeep; Kocharunchitt, Chawalit; Bowman, John P.; Fox, Edward M.

2018-01-01

High mortality and hospitalization rates have seen Listeria monocytogenes as a foodborne pathogen of public health importance for many years and of particular concern for high-risk population groups. Food manufactures face an ongoing challenge in preventing the entry of L. monocytogenes into food production environments (FPEs) due to its ubiquitous nature. In addition to this, the capacity of L. monocytogenes strains to colonize FPEs can lead to repeated identification of L. monocytogenes in FPE surveillance. The contamination of food products requiring product recall presents large economic burden to industry and is further exacerbated by damage to the brand. Poor equipment design, facility layout, and worn or damaged equipment can result in Listeria hotspots and biofilms where traditional cleaning and disinfecting procedures may be inadequate. Novel biocontrol methods may offer FPEs effective means to help improve control of L. monocytogenes and decrease cross contamination of food. Bacteriophages have been used as a medical treatment for many years for their ability to infect and lyse specific bacteria. Endolysins, the hydrolytic enzymes of bacteriophages responsible for breaking the cell wall of Gram-positive bacteria, are being explored as a biocontrol method for food preservation and in nanotechnology and medical applications. Antibacterial proteins known as bacteriocins have been used as alternatives to antibiotics for biopreservation and food product shelf life extension. Essential oils are natural antimicrobials formed by plants and have been used as food additives and preservatives for many years and more recently as a method to prevent food spoilage by microorganisms. Competitive exclusion occurs naturally among bacteria in the environment. However, intentionally selecting and applying bacteria to effect competitive exclusion of food borne pathogens has potential as a biocontrol application. This review discusses these novel biocontrol methods and their

Evaluation of a monoclonal antibody able to detect live Listeria monocytogenes and Listeria innocua

DEFF Research Database (Denmark)

Sølve, Marianne; Boel, Jeppe; Nørrung, Birgit

2000-01-01

A monoclonal Listeria antibody, designated B4, was evaluated. The ability of the antibody to bind to viable bacteria belonging to Listeria spp, compared to bacteria of the same species killed by beat treatment, acid or base treatment, sanitizers, and irradiation was examined. The antibody was found...... to react with viable L. monocytogenes and L. innocua, but not with heat-killed (72 degrees C, 5 min) strains of these organisms. When L. monocytogenes and L. innocua were killed by methods other than heat treatment, it was ambiguous whether the antibody detected the organism or not. It was concluded...... that the B4 antibody has potential to be used in an immune capture step to capture live L, monocytogenes and L. innocua from foods prior to identification of L. monocytogenes by polymerase chain reaction (PCR)....

Listeria monocytogenes : nog steeds een probleem?

NARCIS (Netherlands)

Beumer, R.R.

2011-01-01

Listeria monocytogenes is net als vele andere bacteriële voedselpathogenen al tientallen jaren bekend. De meeste grondstoffen voor voedingsmiddelen komen uit de akker- en tuinbouw, de veehouderij en de visserij. Besmetting vindt daar plaats met micro-organismen afkomstig uit grond, fecaliën, water,

Lo privado de lo público para jóvenes universitarios en Colombia

Directory of Open Access Journals (Sweden)

Victoria Eugenia Pinilla Sepúlveda

2008-01-01

un afrontamiento manipulador. Lo público se caracteriza por una tensión constante, entre fuerzas instituidas en los ámbitos familiar, educativo y social, que imponen formas de comportamiento, normas y valores que conforman un orden establecido, y las posibilidades de cambio que se van fraguando y que generan movimiento frente a lo instituido. En medio de esta coexistencia de fuerzas que conviven y se contraponen, aparecen los jóvenes dando prioridad al "sí mismo", a lo subjetivo sobre lo colectivo, en una urgente búsqueda de autodeterminación como un reclamo directo por su reconocimiento en un ámbito de lo público que los relega a la periferia.

Controlling Listeria monocytogenes and Leuconostoc mesenteroides in Uncured Deli-style Turkey Breast Using a Clean Label Antimicrobial.

Science.gov (United States)

Weyker, Robert E; Glass, Kathleen A; Milkowski, Andrew L; Seman, Dennis L; Sindelar, Jeffrey J

2016-03-01

Interest in natural/organic meat products has resulted in the need to validate the effectiveness of clean label antimicrobials to increase safety and shelf life of these products. A Response Surface Methodology (RSM) was used to investigate the effects of varying levels of moisture, pH, and a commercial "clean-label" antimicrobial (cultured sugar-vinegar blend; CSVB) on the growth rate of Listeria monocytogenes and Leuconostoc mesenteroides in uncured turkey stored at 4 °C for 16 wk. Twenty treatment combinations of moisture (60% to 80%), pH (5.8 to 6.4), and CSVB (2.5% to 5.0%) were evaluated during phase I to develop growth curves for both microbe types, whereas the interactive effects of pH (5.8 to 6.4) and CSVB (0.0 to 4.75) were tested in 16 treatment combinations during Phase II at a single moisture level using L. monocytogenes only. CSVB inhibited L. monocytogenes growth in 14 of the 20 treatments tested in Phase I and in 12 of the 16 treatments in Phase II through 16 and 8 wk, respectively. In contrast, CSVB had little effect on L. mesenteroides, with growth inhibited in only 4 of 20 treatments in Phase I and was therefore not tested further in Phase II. Significant interactions of the RSM design coefficients yielded a predictive model for L. mesenteroides growth rate, but due to lack of growth, no growth rate model was developed for L. monocytogenes. CSVB was found to be an effective antilisteral antimicrobial, while having little effect on a spoilage microorganism. © 2016 Institute of Food Technologists®

Recruitment of the major vault protein by InlK: a Listeria monocytogenes strategy to avoid autophagy.

Directory of Open Access Journals (Sweden)

Laurent Dortet

2011-08-01

Full Text Available L. monocytogenes is a facultative intracellular bacterium responsible for listeriosis. It is able to invade, survive and replicate in phagocytic and non-phagocytic cells. The infectious process at the cellular level has been extensively studied and many virulence factors have been identified. Yet, the role of InlK, a member of the internalin family specific to L. monocytogenes, remains unknown. Here, we first show using deletion analysis and in vivo infection, that InlK is a bona fide virulence factor, poorly expressed in vitro and well expressed in vivo, and that it is anchored to the bacterial surface by sortase A. We then demonstrate by a yeast two hybrid screen using InlK as a bait, validated by pulldown experiments and immunofluorescence analysis that intracytosolic bacteria via an interaction with the protein InlK interact with the Major Vault Protein (MVP, the main component of cytoplasmic ribonucleoproteic particules named vaults. Although vaults have been implicated in several cellular processes, their role has remained elusive. Our analysis demonstrates that MVP recruitment disguises intracytosolic bacteria from autophagic recognition, leading to an increased survival rate of InlK over-expressing bacteria compared to InlK(- bacteria. Together these results reveal that MVP is hijacked by L. monocytogenes in order to counteract the autophagy process, a finding that could have major implications in deciphering the cellular role of vault particles.

Growth characteristics of Listeria monocytogenes as affected by a native microflora in cooked ham under refrigerated and temperature abuse conditions.

Science.gov (United States)

Hwang, Cheng-An; Sheen, Shiowshuh

2011-05-01

This study examined the growth characteristics of Listeria monocytogenes as affected by a native microflora in cooked ham at refrigerated and abuse temperatures. A five-strain mixture of L. monocytogenes and a native microflora, consisting of Brochothrix spp., isolated from cooked meat were inoculated alone (monocultured) or co-inoculated (co-cultured) onto cooked ham slices. The growth characteristics, lag phase duration (LPD, h), growth rate (GR, log(10) cfu/h), and maximum population density (MPD, log(10) cfu/g), of L. monocytogenes and the native microflora in vacuum-packed ham slices stored at 4, 6, 8, 10, and 12 °C for up to 5 weeks were determined. At 4-12 °C, the LPDs of co-cultured L. monocytogenes were not significantly different from those of monocultured L. monocytogenes in ham, indicating the LPDs of L. monocytogenes at 4-12 °C were not influenced by the presence of the native microflora. At 4-8 °C, the GRs of co-cultured L. monocytogenes (0.0114-0.0130 log(10) cfu/h) were statistically but marginally lower than those of monocultured L. monocytogenes (0.0132-0.0145 log(10) cfu/h), indicating the GRs of L. monocytogenes at 4-8 °C were reduced by the presence of the native microflora. The GRs of L. monocytogenes were reduced by 8-7% with the presence of the native microflora at 4-8 °C, whereas there was less influence of the native microflora on the GRs of L. monocytogenes at 10 and 12 °C. The MPDs of L. monocytogenes at 4-8 °C were also reduced by the presence of the native microflora. Data from this study provide additional information regarding the growth suppression of L. monocytogenes by the native microflora for assessing the survival and growth of L. monocytogenes in ready-to-eat meat products. Published by Elsevier Ltd.

Surface integrity in tangential turning of hybrid MMC A359/B4C/Al2O3by abrasive waterjet

Czech Academy of Sciences Publication Activity Database

Srivastava, A. K.; Naga, A.; Dixita, A. R.; Tiwaric, S.; Ščučka, Jiří; Zeleňák, Michal; Hloch, Sergej; Hlaváček, Petr

2017-01-01

Roč. 28, č. 28 (2017), s. 11-20 ISSN 1526-6125 R&D Projects: GA MŠk(CZ) LO1406; GA MŠk ED2.1.00/03.0082 Institutional support: RVO:68145535 Keywords : metal matrix composite * abrasive waterjet turning * surface topography * surface roughness * residual stresses Subject RIV: JQ - Machines ; Tools OBOR OECD: Mechanical engineering Impact factor: 2.322, year: 2016 http://www.sciencedirect.com/science/article/pii/S1526612517301287

Gamma irradiation as a means to eliminate Listeria monocytogenes from frozen chicken meat

International Nuclear Information System (INIS)

Kamat, A.S.; Nair, M.P.

1995-01-01

Cells of Listeria monocytogenes ATCC 35152 were sensitive to gamma irradiation in phosphate buffer, pH 7.00 (D 10 , dose required for 10% survival—0.15 kGy) at 0–5°C. The cells showed higher radiation survival when irradiated under frozen condition, with a D 10 of 0.3 kGy. The protection offered by shrimp/chicken/kheema homogenates (100 g litre−1) was evidenced by even higher D 10 values (0.5 kGy) at both 0–5°C and cryogenic temperature. Boneless chicken meat samples were artificially inoculated with L monocytogenes ATCC 35152 cells at low (5 × 10 3 ) colony-forming unit (cfu) g −1 and high (5 × 10 6 cfu g −1 ) concentrations and irradiated at 1, 3, 4, 6 kGy doses under cryogenic conditions. The efficacy of the radiation process was evaluated by detecting L monocytogenes during storage at 2–4°C in the irradiated samples. These studies, when repeated with three other serotypes of L monocytogenes, clearly suggested the need for a dose of 3 kGy for elimination of 10 3 cfu cells of L monocytogenes g −1 from air-packed frozen chicken meat. (author)

Inhibition of Listeria monocytogenes by piscicolin 126 in milk and Camembert cheese manufactured with a thermophilic starter.

Science.gov (United States)

Wan, J; Harmark, K; Davidson, B E; Hillier, A J; Gordon, J B; Wilcock, A; Hickey, M W; Coventry, M J

1997-03-01

The effect of bacteriocin, piscicolin 126, on the growth of Listeria monocytogenes and cheese starter bacteria was investigated in milk and in Camembert cheese manufactured from milk challenged with 10(2) cfu ml(-1) L. monocytogenes. In milk incubated at 30 degrees C, piscicolin 126 added in the range of 512-2,048 AU ml(-1) effectively inhibited growth of L. monocytogenes for more than 20 d when challenged with approximately 10(2) cfu ml(-1) L. monocytogenes. At higher challenge levels (10(4) and 10(6) cfu ml(-1)), piscicolin 126 reduced the viable count of L. monocytogenes by 4-5 log units immediately after addition of the bacteriocin; however, growth of Listeria occurred within 24 h. The minimum inhibitory concentration (MIC) of piscicolin 126 against lactic acid cheese starter bacteria was generally greater than 204,800 AU ml(-1) , and the viable count and acid production of these starter cultures in milk were not affected by the addition of 2,048 AU ml(-1) piscicolin 126. Camembert cheeses made from milk challenged with L. monocytogenes and with added piscicolin 126 showed a viable count of L. monocytogenes 3-4 log units lower than those without piscicolin 126. Inactivation of piscicolin 126 by proteolytic enzymes from cheese starter bacteria and mould together with the emergence of piscicolin 126-resistant isolates was responsible for the recovery of L. monocytogenes in the cheeses during ripening.

Occurrence and antimicrobial resistance patterns of Listeria monocytogenes isolated from vegetables

OpenAIRE

Byrne,Vanessa de Vasconcelos; Hofer,Ernesto; Vallim,Deyse Christina; Almeida,Rogeria Comastri de Castro

2016-01-01

Abstract Although the consumption of fresh and minimally processed vegetables is considered healthy, outbreaks related to the contamination of these products are frequently reported. Among the food-borne pathogens that contaminate vegetables is Listeria monocytogenes, a ubiquitous organism that exhibits the ability to survive and multiply at refrigerated temperatures. This study aimed to evaluate the occurrence of L. monocytogenes in vegetables as well as the antimicrobial resistance of isola...

Listeria monocytogenes Infection in Hairy Cell Leukemia: A Case Report and Literature Review

Directory of Open Access Journals (Sweden)

James C. Barton

2018-01-01

Full Text Available Listeria monocytogenes infections have been described in patients with diverse types of malignancy, especially leukemia. We report the case of a 65-year-old man with previously untreated hairy cell leukemia characterized by CD5 positivity and trisomy 12 (3% of blood lymphocytes who developed bacteremia due to L. monocytogenes serotype 1/2b. We summarize clinical features and treatment of this patient and five previously reported patients with hairy cell leukemia who also had L. monocytogenes infections. All six patients were men. Their mean age at infection diagnosis was 70 y. Three men had undergone splenectomy 4–11 y before they developed L. monocytogenes infection. The central nervous system was the primary site of infection in four men. Bacteremia alone occurred in two other men. At diagnosis of infection, one man was receiving antileukemia chemotherapy and another man was receiving treatment for Kaposi’s sarcoma. Two other patients had other comorbid conditions. All six men recovered from their infections.

Thermal Inactivation of Listeria monocytogenes and Salmonella during Water and Steam Blanching of Vegetables.

Science.gov (United States)

Ceylan, Erdogan; McMahon, Wendy; Garren, Donna M

2017-09-01

Thermal inactivation of Listeria monocytogenes and Salmonella was evaluated on peas, spinach, broccoli, potatoes, and carrots that were treated with hot water and steam. One gram-positive bacterium, L. monocytogenes, and one gram-negative bacterium, Salmonella, were selected as pertinent human pathogens for evaluation. Samples were inoculated with a composite of five strains each of L. monocytogenes and Salmonella to achieve approximately 10 8 to 10 9 CFU/g. Inoculated samples were treated with hot water at 85 and 87.8°C and with steam at 85 and 96.7°C for up to 3.5 min. A greater than 5-log reduction of L. monocytogenes and Salmonella was achieved on all products within 0.5 min by hot water blanching at 85 and 87.8°C. Steam blanching at 85°C reduced Salmonella populations by greater than 5 log on spinach and peas within 2 min and on carrots and broccoli within 3.5 min. Populations of Salmonella were reduced by more than 5 log within 1 min on carrot, spinach, and broccoli and within 2 min on peas by steam blanching at 96.7°C. Steam blanching at 85°C reduced L. monocytogenes populations by more than 5 log on carrots and spinach within 2 min and on broccoli and peas within 3.5 min. L. monocytogenes populations were reduced more than 5 log within 1 min on carrot, spinach, peas and broccoli by steam blanching at 96.7°C. Longer treatment times and higher temperatures were required for steam-blanched samples than for samples blanched with hot water. Results suggest that hot water and steam blanching practices commonly used by the frozen vegetable industry will achieve the desired 5-log lethality of L. monocytogenes and Salmonella and will enhance microbiological safety prior to freezing.

Listeria spp., y L. monocytogenes EN LECHE CRUDA DE CABRA

Directory of Open Access Journals (Sweden)

Yolanda Albarracín C

2008-08-01

Full Text Available Objective. To test non-pasteurized goat’s milk from the village of ‘la Garita’, Northern Santander, for Listeria monocytogenes. Material and methods. 90 samples of non-pasteurized goat’s milk were obtained over a 4 month period; pH and temperature of each sample were measured. The INVIMA technique was used to isolate L. monocytogenes; the species was confirmed by PCR. Results. The study showed that eight goat milk providers of the zone neither had refrigeration nor pasteurized the milk. The prevalence of L. monocytogenes was 3%; 15% of the samples had other species of Listeria. The milk obtained from this zone contained the pathogen that may cause listeriosis in children less than 5 years of age, pregnant women, adults and immunologically compromised patients. Conclusions. This study shows the occurrence of this pathogen in goat’s milk and identified areas of risk for those people who drink goat’s milk.

[Analysis of antibiotic susceptibility of foodborne Listeria monocytogenes in China].

Science.gov (United States)

Yang, Yang; Fu, Ping; Guo, Yunchang; Liu, Xiurmei

2008-03-01

To study the antibiotic susceptibility of foodborne Listeria monocytogenes in China. The susceptibilities of 476 strains of foodborne Listeria monocytogenes to antibiotics were determined in Broth Microdilution Susceptibility Testing in Clinical and Laboratory Standards Institute. The antibiotics of gentamicin, ampicillin, penicillin, tetracycline, doxycycline, imipenem, erythromycin, ciprofloxacin, levofloxacin, cephalothin, rifampin, vancomycin, chloramphenicol, Trimethoprim-sulfamethoxazole, ampicillin-sulbactam were used. The rates of antibiotic resistance in 467 is olates were 4.5%. Tetracycline resistance was most prevalent, accouting for 4.07% . The foods that the rates of antibiotic resistance were highest were vegetable (10%). Among 14 provinces, Jilin, Hubei and Hebei were the third top, the rate of which were 19.6% and 9.1% and 8%, respectively. It was suggested that antibiotic resistance exists in foodborne Listeria monocytogenes to a certain extent in China. It should pay more attention to the use of drugs in prevention and clinic treatment to reduce the antibiotic resistant strains.

Silver as antibacterial towards Listeria monocytogenes

Directory of Open Access Journals (Sweden)

Simone eBelluco

2016-03-01

Full Text Available Listeria monocytogenes is a serious foodborne pathogen that can contaminate food during processing and can grow during food shelf-life. New types of safe and effective food contact materials embedding antimicrobial agents, like silver, can play an important role in the food industry. The present work aimed at evaluating the in vitro growth kinetics of different strains of L. monocytogenes in the presence of silver, both in its ionic and nano form. The antimicrobial effect was determined by assaying the number of culturable bacterial cells, which formed colonies after incubation in the presence of silver nanoparticles (AgNPs or silver nitrate (AgNO3. Ionic release experiments were performed in parallel. A different reduction of bacterial viability between silver ionic and nano forms was observed, with a time delayed effect exerted by AgNPs. An association between antimicrobial activity and ions concentration was shown by both silver chemical forms, suggesting the major role of ions in the antimicrobial mode of action.

REALIS: Postgenomic Analysis of Listeria Monocytogenes

Directory of Open Access Journals (Sweden)

The REALIS Consortium

2006-04-01

Full Text Available Listeria monocytogenes is a remarkably successful food-borne pathogen. It is capable a of surviving and proliferating under conditions that exist within the food chain, such as at low temperatures, high salt and low pH and b of colonizing animal host tissues after ingestion of contaminated food, causing opportunistic infections mainly, but not exclusively, in immunocompromised hosts. The ultimate goals of REALIS are two fold: Firstly, it aims to completely decipher all genes required for survival in and adaptation of Listeria monocytogenes to two very different environments, ie., the infected host and the external environment. Secondly, using genomics and postgenomic tools, REALIS seeks to precisely address fundamental questions regarding evolutionary relationships between pathogenic and non-pathogenic Listeria and to define qualities of particularly successful clonal pathovariants in causing disease. This project will provide both industry and health care managers with rational approaches to curbing food-borne contamination, minimising risks of infection and providing novel pharmacological approaches for halting the fulminant course of infection.

Lo real y lo virtual en las redes electrónicas

Directory of Open Access Journals (Sweden)

Francisco Ficarra

2015-01-01

Full Text Available Se ha considerado que la expansión de las redes electrónicas produciría una igualdad económica entre los seres humanos, sin embargo esto es solo una utopía. El autor comenta lo ocurrido en lo real y lo virtual desde los años 60. La posibilidad de alcanzar un equilibrio entre ofertas de nuevos servicios y necesidades auténticas de la sociedad es una tarea difícil, pero el esfuerzo vale la pena para no caer en una especie de miniserie civilizada.

Listeriolysin O Regulates the Expression of Optineurin, an Autophagy Adaptor That Inhibits the Growth of Listeria monocytogenes.

Science.gov (United States)

Puri, Madhu; La Pietra, Luigi; Mraheil, Mobarak Abu; Lucas, Rudolf; Chakraborty, Trinad; Pillich, Helena

2017-09-05

Autophagy, a well-established defense mechanism, enables the elimination of intracellular pathogens including Listeria monocytogenes . Host cell recognition results in ubiquitination of L . monocytogenes and interaction with autophagy adaptors p62/SQSTM1 and NDP52, which target bacteria to autophagosomes by binding to microtubule-associated protein 1 light chain 3 (LC3). Although studies have indicated that L . monocytogenes induces autophagy, the significance of this process in the infectious cycle and the mechanisms involved remain poorly understood. Here, we examined the role of the autophagy adaptor optineurin (OPTN), the phosphorylation of which by the TANK binding kinase 1 (TBK1) enhances its affinity for LC3 and promotes autophagosomal degradation, during L . monocytogenes infection. In LC3- and OPTN-depleted host cells, intracellular replicating L . monocytogenes increased, an effect not seen with a mutant lacking the pore-forming toxin listeriolysin O (LLO). LLO induced the production of OPTN. In host cells expressing an inactive TBK1, bacterial replication was also inhibited. Our studies have uncovered an OPTN-dependent pathway in which L . monocytogenes uses LLO to restrict bacterial growth. Hence, manipulation of autophagy by L . monocytogenes , either through induction or evasion, represents a key event in its intracellular life style and could lead to either cytosolic growth or persistence in intracellular vacuolar structures.

PRÉVALENCE DE LISTERIA MONOCYTOGENES DANS LE LAIT CRU DE VACHE AU LIBAN NORD

Directory of Open Access Journals (Sweden)

Imad al Kassaa

2016-06-01

Full Text Available Al Kassaa Imad, Khaled el Omari, Marwa Saati, Bachar Ismail and Monzer Hamze. 2016. Prevalence of Listeria monocytogenes in raw cow milk in north Lebanon. Lebanese Science Journal, 17(1: 39-45. Listeriosis, although a zoonosis, is an invasive disease that can affect newborns, pregnant women and immunocompromised adults. Clinical manifestations can be expressed by febrile gastroenteritis, invasive forms including severe sepsis, meningitis, rhombencephalitis, prenatal infections and abortions. Species of Listeria bacteria are ubiquitous and adaptable to the environment in animal and plant foods. This study aimed to determine the prevalence of Listeria monocytogenes in 100 samples of fresh cow milk collected from different areas of North Lebanon. Listeria monocytogenes was detected by using the Grand VIDAS technique (Biomérieux France. The results obtained revealed the absence of Listeria monocytogenes in all analyzed samples.

Listeria monocytogenes Meningitis in an Immunosuppressed Patient with Autoimmune Hepatitis and IgG4 Subclass Deficiency

Directory of Open Access Journals (Sweden)

Shahin Gaini

2015-01-01

Full Text Available A 51-year-old Caucasian woman with Listeria monocytogenes meningitis was treated and discharged after an uncomplicated course. Her medical history included immunosuppressive treatment with prednisolone and azathioprine for autoimmune hepatitis. A diagnostic work-up after the meningitis episode revealed that she had low levels of the IgG4 subclass. To our knowledge, this is the first case report describing a possible association between autoimmune hepatitis and the occurrence of Listeria monocytogenes meningitis, describing a possible association between Listeria monocytogenes meningitis and deficiency of the IgG4 subclass and finally describing a possible association between Listeria monocytogenes meningitis and immunosuppressive therapy with prednisolone and azathioprine.

Listeria monocytogenes Meningitis in an Immunosuppressed Patient with Autoimmune Hepatitis and IgG4 Subclass Deficiency

DEFF Research Database (Denmark)

Gaini, Shahin

2015-01-01

A 51-year-old Caucasian woman with Listeria monocytogenes meningitis was treated and discharged after an uncomplicated course. Her medical history included immunosuppressive treatment with prednisolone and azathioprine for autoimmune hepatitis. A diagnostic work-up after the meningitis episode...... revealed that she had low levels of the IgG4 subclass. To our knowledge, this is the first case report describing a possible association between autoimmune hepatitis and the occurrence of Listeria monocytogenes meningitis, describing a possible association between Listeria monocytogenes meningitis...... and deficiency of the IgG4 subclass and finally describing a possible association between Listeria monocytogenes meningitis and immunosuppressive therapy with prednisolone and azathioprine....

Inactivation of Listeria monocytogenes in raw fruits by enterocin AS-48.

Science.gov (United States)

Molinos, Antonio Cobo; Abriouel, Hikmate; Ben Omar, Nabil; Lucas, Rosario; Valdivia, Eva; Gálvez, Antonio

2008-12-01

The purpose of this study was to determine the effect of enterocin AS-48 on Listeria monocytogenes CECT 4032 in fruits and fruit juice. Fruits were contaminated with a L. monocytogenes cell suspension, washed with enterocin AS-48 (25 microg/ml) or with sterile distilled water as control, and stored at different temperatures (-20, 6, 15, 22 degrees C). Washing treatments significantly inhibited or completely inactivated L. monocytogenes in strawberries, raspberries, and blackberries stored at 15 and 22 degrees C for up to 2 days and in blackberries and strawberries at 6 degrees C for up to 7 days. Washing treatments with enterocin AS-48 also reduced viable counts in sliced melon, watermelon, pear, and kiwi but did not avoid proliferation of survivors during storage at 15 and 22 degrees C. Added enterocin (25 microg/ml) completely inactivated L. monocytogenes in watermelon juice within 24 h. To enhance the antilisterial activity of treatments, enterocin AS-48 was tested in combination with other antimicrobial substances on sliced melon stored at 22 degrees C. The combinations of enterocin AS-48 and trisodium trimetaphosphate, sodium lactate, lactic acid, polyphosphoric acid, carvacrol, hydrocinnamic acid, p-hydroxybenzoic acid, n-propyl p-hydroxybenzoate, or 2-nitropropanol showed increased antilisterial activities compared with each antimicrobial tested separately. Washing treatments with enterocin AS-48 in combination with 12 mM carvacrol, as well as with 100 mM n-propyl p-hydroxybenzoate, avoided regrowth of Listeria during storage at 22 degrees C. Results from this study indicate that enterocin AS-48 alone or in combination with other preservatives could serve as an additional hurdle against L. monocytogenes in fruits and fruit juices.

Stevia rebaudiana Bertoni effect on the hemolytic potential of Listeria monocytogenes.

Science.gov (United States)

Sansano, S; Rivas, A; Pina-Pérez, M C; Martinez, A; Rodrigo, D

2017-06-05

The effect of Stevia rebaudiana Bertoni on the hemolytic potential of Listeria monocytogenes was studied by means of the assessment of the Listeriolysin O (LLO) production. The three factors under study, stevia concentration in the range [0-2.5] % (w/v), incubation temperature (10 and 37°C), and exposure time (0-65h) significantly affected (p≤0.05) the hemolytic activity of L. monocytogenes. Results showed that at the lower incubation temperature the hemolytic potential of the bacterium was significantly reduced, from 100% at 37°C to 8% at 10°C (after 65h of incubation) in unsupplemented substrate (0% stevia). Irrespective of the temperature, 10 or 37°C, supplementation of the medium with stevia at 2.5 % (w/v) reduced the bacterium's hemolytic activity by a maximum of 100%. Furthermore, the time of exposure to 2.5 % (w/v) stevia concentration was also a significant factor reducing the hemolytic capability of L. monocytogenes. The possibility of reducing the pathogenic potential of L. monocytogenes (hemolysis) by exposure to stevia should be confirmed in real food matrices, opening a research niche with a valuable future impact on food safety. Copyright © 2017 Elsevier B.V. All rights reserved.

Symptomatic hydrocephalus in a newborn infected with listeria monocytogenes Hidrocefalia sintomática em um recém-nascido infectado com Listeria monocytogenes

Directory of Open Access Journals (Sweden)

Analía L. Laciar

2000-03-01

Full Text Available Central nervous system infections caused by Listeria monocytogenes produce a wide range of clinical symptoms which include cerebral abscesses, meningitis and nonmeningitic parenchymal cerebritis. A case study is presented of early listeriosis with signs of meningitis accompanied with septicemia and complicated with severe hydrocephalus.As infecções do sistema nervoso central produzidas por Listeria monocytogenes provocam una grande variedade de sintomas clínicos que incluem abscessos cerebrais, meningites e cerebrites parenquimáticas não meningíticas. Apresenta-se um caso de listeriose precoce com sinais de meningite acompanhada de septicemia e agravado com hidrocefalia grave.

Prevalence and serotype distribution of Listeria monocytogenes isolated from foods in Montevideo-Uruguay

Directory of Open Access Journals (Sweden)

Valeria Braga

Full Text Available ABSTRACT The aim of this work was to study the prevalence of Listeria monocytogenes in foods obtained in retail shops and food industries located in Montevideo-Uruguay, and to identify the serogroups of the obtained isolates. Three-thousand one-hundred and seventy-five food samples (frozen, deli meats, ready-to-eat and cheese were analyzed. The obtained isolates were serogrouped by multiplex PCR and serotyped by conventional procedure. Genetic comparisons were performed using pulsed-field gel electrophoresis on a sub-set of isolates belonging to the same serotype successively recovered from the same establishment. L. monocytogenes was isolated from 11.2% of samples. The highest prevalence was observed in frozen foods (38%, followed by cheese (10%. 1/2b and 4b were the most frequently identified serotypes. In six of 236 analyzed establishments we successively recovered L. monocytogenes isolates belonging to the same serotype. Most of them corresponded to serotype 1/2b. Pulsed-field gel electrophoresis profiles suggest that at least 33% of L. monocytogenes 1/2b isolates are genetically related and that may remain viable for prolonged periods. The observed prevalence of L. monocytogenes was lower than reported in neighboring countries. Our findings highlight the role that frozen foods may play in the spread of this pathogen, and the relevance of serotypes 1/2b and 4b.

Listeria monocytogenes: monitoramento desse perigo biológico na cadeia produtiva de frangos do sul do Rio Grande do Sul Listeria monocytogenes: assessing this microbiological hazard in a poultry productive chain in southern Rio Grande do Sul

Directory of Open Access Journals (Sweden)

Élen Silveira Nalério

2009-09-01

Full Text Available Listeria monocytogenes é uma bactéria patogênica que se tornou um grande desafio para as indústrias de alimentos, entre elas a de frangos, assim como para os órgãos de vigilância sanitária. Apesar da produção de frangos estar em expansão na região sul do Rio Grande do Sul, não há relatos sobre esse patógeno, dessa forma, objetivou-se avaliar a prevalência de L. monocytogenes e de seus sorotipos nos diversos segmentos dessa cadeia produtiva. Nos aviários isolou-se L. monocytogenes em 2,9% (1/35 das amostras de swabs cloacais, não se isolando o microrganismo em amostras provenientes das camas de aviários. No abatedouro, 11,7% (15/128 das amostras apresentaram contaminação por L. monocytogenes e nos frangos resfriados procedentes do comércio, a prevalência foi de 33,3% (15/45.Observou-se que 51,6% (16/31 das cepas de L. monocytogenes pertenciam ao sorotipo 1/2b; 22,5% (7/31 ao sorotipo 4e; 16,1% (5/31 ao sorotipo 1/2a; 6,4% (2/31 ao sorotipo 4b; e 3,2% (1/31 ao sorotipo 1/2c. Há disseminação de L. monocytogenes na cadeia produtiva de frangos da região sul do Rio Grande do Sul e a presença de sorotipos prevalentes em casos/surtos de listeriose traz preocupação à saúde pública.Listeria monocytogenes is a pathogenic bacterium which has become a huge challenge to the food industries, including the poultry industry, and to the health surveillance agencies. Although poultry production is in expansion in southern of Rio Grande do Sul, Brazil, there are not reports about this pathogen thus this study aimed at assessing the prevalence of L monocytogenes and its serotypes in the several segments of this productive chain. In the broilers flocks L. monocytogenes were isolated in 2.9% (1/35 from cloacal swabs samples. This microorganism was not isolated from broiler houses samples. In the abattoir, 11% of the samples presented L. monocytogenes contamination, and in the chilled chicken from retailers its prevalence was 33.3% (15

Fluorescence-Free Biosensor Methods in Detection of Food Pathogens with a Special Focus on Listeria monocytogenes

Directory of Open Access Journals (Sweden)

Rajeswaran Radhakrishnan

2017-12-01

Full Text Available Food pathogens contaminate food products that allow their growth on the shelf and also under refrigerated conditions. Therefore, it is of utmost importance to lower the limit of detection (LOD of the method used and to obtain the results within hours to few days. Biosensor methods exploit the available technologies to individuate and provide an approximate quantification of the bacteria present in a sample. The main bottleneck of these methods depends on the aspecific binding to the surfaces and on a change in sensitivity when bacteria are in a complex food matrix with respect to bacteria in a liquid food sample. In this review, we introduce surface plasmon resonance (SPR, new advancements in SPR techniques, and electrochemical impedance spectroscopy (EIS, as fluorescence-free biosensing technologies for detection of L. monocytogenes in foods. The application of the two methods has facilitated L. monocytogenes detection with LOD of 1 log CFU/mL. Further advancements are envisaged through the combination of biosensor methods with immunoseparation of bacteria from larger volumes, application of lab-on-chip technologies, and EIS sensing methods for multiplex pathogen detection. Validation efforts are being conducted to demonstrate the robustness of detection, reproducibility and variability in multi-site installations.

Prevalence and methodologies for detection, characterization and subtyping of Listeria monocytogenes and L. ivanovii in foods and environmental sources

Directory of Open Access Journals (Sweden)

Jin-Qiang Chen

2017-09-01

Full Text Available Listeria monocytogenes, one of the most important foodborne pathogens, can cause listeriosis, a lethal disease for humans. L. ivanovii, which is closely related to L. monocytogenes, is also widely distributed in nature and infects mainly warm-blooded ruminants, causing economic loss. Thus, there are high priority needs for methodologies for rapid, specific, cost-effective and accurate detection, characterization and subtyping of L. monocytogenes and L. ivanovii in foods and environmental sources. In this review, we (A described L. monocytogenes and L. ivanovii, world-wide incidence of listeriosis, and prevalence of various L. monocytogenes strains in food and environmental sources; (B comprehensively reviewed different types of traditional and newly developed methodologies, including culture-based, antigen/antibody-based, LOOP-mediated isothermal amplification, matrix-assisted laser desorption ionization-time of flight-mass spectrometry, DNA microarray, and genomic sequencing for detection and characterization of L. monocytogenes in foods and environmental sources; (C comprehensively summarized different subtyping methodologies, including pulsed-field gel electrophoresis, multi-locus sequence typing, ribotyping, and phage-typing, and whole genomic sequencing etc. for subtyping of L. monocytogenes strains from food and environmental sources; and (D described the applications of these methodologies in detection and subtyping of L. monocytogenes in foods and food processing facilities.

Comparative Genomics Reveals the Diversity of Restriction-Modification Systems and DNA Methylation Sites in Listeria monocytogenes.

Science.gov (United States)

Chen, Poyin; den Bakker, Henk C; Korlach, Jonas; Kong, Nguyet; Storey, Dylan B; Paxinos, Ellen E; Ashby, Meredith; Clark, Tyson; Luong, Khai; Wiedmann, Martin; Weimer, Bart C

2017-02-01

Listeria monocytogenes is a bacterial pathogen that is found in a wide variety of anthropogenic and natural environments. Genome sequencing technologies are rapidly becoming a powerful tool in facilitating our understanding of how genotype, classification phenotypes, and virulence phenotypes interact to predict the health risks of individual bacterial isolates. Currently, 57 closed L. monocytogenes genomes are publicly available, representing three of the four phylogenetic lineages, and they suggest that L. monocytogenes has high genomic synteny. This study contributes an additional 15 closed L. monocytogenes genomes that were used to determine the associations between the genome and methylome with host invasion magnitude. In contrast to previous findings, large chromosomal inversions and rearrangements were detected in five isolates at the chromosome terminus and within rRNA genes, including a previously undescribed inversion within rRNA-encoding regions. Each isolate's epigenome contained highly diverse methyltransferase recognition sites, even within the same serotype and methylation pattern. Eleven strains contained a single chromosomally encoded methyltransferase, one strain contained two methylation systems (one system on a plasmid), and three strains exhibited no methylation, despite the occurrence of methyltransferase genes. In three isolates a new, unknown DNA modification was observed in addition to diverse methylation patterns, accompanied by a novel methylation system. Neither chromosome rearrangement nor strain-specific patterns of epigenome modification observed within virulence genes were correlated with serotype designation, clonal complex, or in vitro infectivity. These data suggest that genome diversity is larger than previously considered in L. monocytogenes and that as more genomes are sequenced, additional structure and methylation novelty will be observed in this organism. Listeria monocytogenes is the causative agent of listeriosis, a disease

Tracking of Listeria monocytogenes in meat establishment using Whole Genome Sequencing as a food safety management tool: A proof of concept.

Science.gov (United States)

Nastasijevic, Ivan; Milanov, Dubravka; Velebit, Branko; Djordjevic, Vesna; Swift, Craig; Painset, Anais; Lakicevic, Brankica

2017-09-18

and dispatch) originated from the slaughter line. Further, all eight L. monocytogenes isolates were confirmed to be biofilm producers on glass and stainless steel surfaces. The identification of the main entry routes of L. monocytogenes into meat establishments and tracking the routes for spread of the pathogen are of essential importance to define appropriate risk mitigation strategies for L. monocytogenes in meat production environment. The routine use of WGS for bacterial characterization, as a strong support of food safety management system in meat establishments, will require the cost-effective approach. It may encompass in-house sequencing when sequencing equipment is used for multiple applications (e.g. WGS of pathogens, starter cultures and spoilage organisms). Copyright © 2017 Elsevier B.V. All rights reserved.

Characterization of Listeria monocytogenes isolated from a fresh mixed sausage processing line in Pelotas-RS by PFGE

Science.gov (United States)

von Laer, Ana Eucares; de Lima, Andréia Saldanha; Trindade, Paula dos Santos; Andriguetto, Cristiano; Destro, Maria Teresa; da Silva, Wladimir Padilha

2009-01-01

Listeria monocytogenes is a bacterium capable to adhere to the surfaces of equipment and utensils and subsequently form biofilms. It can to persist in the food processing environmental for extended periods of time being able to contaminate the final product. The aim of this study was to trace the contamination route of L. monocytogenes on a fresh mixed sausage processing line, from raw material to the final product. The isolates obtained were characterized by serotyping and molecular typing by pulsed-field gel electrophoresis (PFGE) using the restriction enzymes ApaI and AscI. L. monocytogenes was detected in 25% of the samples. The samples of raw material were not contaminated, however, the microorganism was detected in 21% of the environmental samples (food contact and non-food contact), 20.8% of the equipments, 20% of the food worker’s hands, 40% of the mass ready to packaging and in all the final products samples, demonstrating that the contamination of final product occurred during the processing and the importance of cross contamination. PFGE yielded 22 pulsotypes wich formed 7 clusters, and serotyping yielded 3 serotypes and 1 serogroup, however, the presence of serotypes 4b and 1/2b in the final product is of great concern for public health. The tracing of contamination showed that some strains are adapted and persisted in the processing environment in this industry. PMID:24031402

Prevalence and quantification of Listeria monocytogenes in beef offal at retail level in Selangor, Malaysia.

Science.gov (United States)

Kuan, Chee Hao; Wong, Woan Chwen; Pui, Chai Fung; Mahyudin, Nor Ainy; Tang, John Yew Huat; Nishibuchi, Mitsuaki; Radu, Son

2013-12-01

A total of 63 beef offal samples (beef liver = 16; beef lung = 14; beef intestine = 9; beef tripe = 15; beef spleen = 9) from three wet markets (A, B, and C) in Selangor, Malaysia were examined for the prevalence and microbial load of Listeria monocytogenes. A combination of the most probable number and polymerase chain reaction (MPN-PCR) method was employed in this study. It was found that L. monocytogenes detected in 33.33% of the beef offal samples. The prevalence of L. monocytogenes in beef offal purchased from wet markets A, B, and C were 22.73%, 37.50% and 41.18% respectively. The density of L. monocytogenes in all the samples ranged from 2,400 MPN/g. The findings in this study indicate that beef offal can be a potential vehicle of foodborne listeriosis.

Variations in virulence between different electrophoretic types of Listeria monocytogenes

DEFF Research Database (Denmark)

Nørrung, Birgit; Andersen, Jens Kirk

2000-01-01

A total of 245 strains of Listeria monocytogenes, representing 33 different electrophoretic types (ETs), were examined quantitatively for haemolytic activity. No significant difference was observed in the mean haemolytic activity between different ETs. Eighty four out of 91 strains examined were...... compared with 3.64 among food isolates). The explanation for this may be that more virulent strains are more prone to cause human infection. It is, however, also possible that strains oft. monocytogenes may become more virulent while multiplying in a living organism compared with multiplying in foods....

Fluxes of Ca2+ and K+ are required for the listeriolysin O-dependent internalization pathway of Listeria monocytogenes.

Science.gov (United States)

Vadia, Stephen; Seveau, Stephanie

2014-03-01

Listeria monocytogenes is responsible for the life-threatening food-borne disease listeriosis. This disease mainly affects elderly and immunocompromised individuals, causing bacteremia and meningoencephalitis. In pregnant women, L. monocytogenes infection leads to abortion and severe infection of the fetus or newborn. The L. monocytogenes intracellular life cycle is critical for pathogenesis. Previous studies have established that the major virulence factor of L. monocytogenes, the pore-forming toxin listeriolysin O (LLO), is sufficient to induce L. monocytogenes internalization into human epithelial cell lines. This internalization pathway strictly requires the formation of LLO pores in the plasma membrane and can be stimulated by the heterologous pore-forming toxin pneumolysin, suggesting that LLO acts nonspecifically by forming transmembrane pores. The present work tested the hypothesis that Ca2+ and K+ fluxes subsequent to perforation by LLO control L. monocytogenes internalization. We report that L. monocytogenes perforates the host cell plasma membrane in an LLO-dependent fashion at the early stage of invasion. In response to perforation, host cells undergo Ca2+ -dependent but K+ -independent resealing of their plasma membrane. In contrast to the plasma membrane resealing process, LLO-induced L. monocytogenes internalization requires both Ca2+ and K+ fluxes. Further linking ion fluxes to bacterial internalization, treating cells with a combination of Ca2+ and K+ ionophores but not with individual ionophores is sufficient to induce efficient internalization of large cargoes, such as 1-μm polystyrene beads and bacteria. We propose that LLO-induced L. monocytogenes internalization requires a Ca2+ - and K+ -dependent internalization pathway that is mechanistically distinct from the process of plasma membrane resealing.

Multifaceted Activity of Listeriolysin O, the Cholesterol-Dependent Cytolysin of Listeria monocytogenes

Science.gov (United States)

2014-01-01

The cholesterol-dependent cytolysins (CDCs) are a large family of pore-forming toxins that are produced by numerous Gram-positive bacterial pathogens. These toxins are released in the extracellular environment as water-soluble monomers or dimers that bind to cholesterol-rich membranes and assemble into large pore complexes. Depending upon their concentration, the nature of the host cell and membrane (cytoplasmic or intracellular) they target, the CDCs can elicit many different cellular responses. Among the CDCs, listeriolysin O (LLO), which is a major virulence factor of the facultative intracellular pathogen Listeria monocytogenes, is involved in several stages of the intracellular lifecycle of the bacterium and displays unique characteristics. It has long been known that following L. monocytogenes internalization into host cells, LLO disrupts the internalization vacuole, enabling the bacterium to replicate into the host cell cytosol. LLO is then used by cytosolic bacteria to spread from cell to cell, avoiding bacterial exposure to the extracellular environment. Although LLO is continuously produced during the intracellular lifecycle of L. monocytogenes, several processes limit its toxicity to ensure the survival of infected cells. It was previously thought that LLO activity was limited to mediating vacuolar escape during bacterial entry and cell to cell spreading. This concept has been challenged by compelling evidence suggesting that LLO secreted by extracellular L. monocytogenes perforates the host cell plasma membrane, triggering important host cell responses. This chapter provides an overview of the well-established intracellular activity of LLO and the multiple roles attributed to LLO secreted by extracellular L. monocytogenes. PMID:24798012

Packaging properties and control of Listeria monocytogenes in bologna by cellulosic films incorporated with pediocin

Directory of Open Access Journals (Sweden)

Paula Judith Pérez Espitia

2013-09-01

surfaces. Hence, active cellulosic films made with 50 % pediocin in the form of commercially available concentrated ALTA™ 2341 have the potential of being used in a system of hurdle technologies as a final obstacle for L. monocytogenes control in bologna preservation.

Spray method for recovery of heat-injured Salmonella Typhimurium and Listeria monocytogenes.

Science.gov (United States)

Back, Kyeong-Hwan; Kim, Sang-Oh; Park, Ki-Hwan; Chung, Myung-Sub; Kang, Dong-Hyun

2012-10-01

Selective agar is inadequate for supporting recovery of injured cells. During risk assessment of certain foods, both injured and noninjured cells must be enumerated. In this study, a new method (agar spray method) for recovering sublethally heat-injured microorganisms was developed and used for recovery of heat-injured Salmonella Typhimurium and Listeria monocytogenes. Molten selective agar was applied as an overlay to presolidified nonselective tryptic soy agar (TSA) by spray application. Heat-injured cells (55°C for 10 min in 0.1% peptone water or 55°C for 15 min in sterilized skim milk) were inoculated directly onto solidified TSA. After a 2-h incubation period for cell repair, selective agar was applied to the TSA surface with a sprayer, and the plates were incubated. The recovery rate for heat-injured Salmonella Typhimurium and L. monocytogenes with the spray method was compared with the corresponding rates associated with TSA alone, selective media alone, and the conventional overlay method (selective agar poured on top of resuscitated cells grown on TSA and incubated for 2 h). No significant differences (P > 0.05) were found in pathogen recovery obtained with TSA, the overlay method, and the spray method. However, a lower recovery rate (P recovery and detection of injured cells.

Listeria Monocytogenes Persistence in Ready-to-Eat Sausages and in Processing Plants.

Science.gov (United States)

Mureddu, Anna; Mazza, Roberta; Fois, Federica; Meloni, Domenico; Bacciu, Roberto; Piras, Francesca; Mazzette, Rina

2014-01-21

Listeria monocytogenes is of major concern in the fermented meat products and is able to persist in their processing environments. The aim of the present work was to evaluate the virulence profile and the persistence capacity of L. monocytogenes strains isolated in Sardinian fermented sausages processing plants. Food (ground meat, sausages at the end of acidification and ripening stage) and environmental samples (a total of n. 385), collected from 4 meat processing plants located in Sardinia (Italy), were examined to detect L. monocytogenes presence. All the L. monocytogenes isolates were identified by polymerase chain reaction (PCR) method. A subset of strains was also characterised by multiplex PCR-based serogrouping, using the lmo0737 , lmo1118 , ORF2819 and ORF2110 genes. Three different multiplex PCRs were used to obtain the virulence profiles by the rrn , hlyA , actA , prfA , inlA , inlB , iap , plcA , plcB and mpl marker genes. Furthermore, in vitro biofilm forming ability and resistance to disinfectants were carried out on microtiter plate. The overall prevalence was 31.5% in food, and 68.5% in environmental samples. The prevalent serotype resulted 1/2c (43%), followed by 1/2a (40%), 4b (8.6%), and 1/2b (8.6%). The amplification products of the virulence genes were found in all the isolates with the following prevalence: 77.1% hlyA ; 100% rrn ; 100% prfA ; 97.1% iap ; 65.7% inlB ; 88.6% inlA ; 100% plcA ; 100% plcB and 74.3% mpl . As for biofilm forming ability, 37.1% of the strains were positive and resulted weak producer, but all the isolates were sensible to disinfectants showing a reduction of L. monocytogenes growth after each incubation time. More appropriate technologies and application of measures of hygienic control should be implemented to prevent the L. monocytogenes growth and cross-contamination in salsiccia sarda processing plants.

Listeria monocytogenes persistence in ready-to-eat sausages and in processing plants

Directory of Open Access Journals (Sweden)

Anna Mureddu

2014-02-01

Full Text Available Listeria monocytogenes is of major concern in the fermented meat products and is able to persist in their processing environments. The aim of the present work was to evaluate the virulence profile and the persistence capacity of L. monocytogenes strains isolated in Sardinian fermented sausages processing plants. Food (ground meat, sausages at the end of acidification and ripening stage and environmental samples (a total of n. 385, collected from 4 meat processing plants located in Sardinia (Italy, were examined to detect L. monocytogenes presence. All the L. monocytogenes isolates were identified by polymerase chain reaction (PCR method. A subset of strains was also characterised by multiplex PCR-based serogrouping, using the lmo0737, lmo1118, ORF2819 and ORF2110 genes. Three different multiplex PCRs were used to obtain the virulence profiles by the rrn, hlyA, actA, prfA, inlA, inlB, iap, plcA, plcB and mpl marker genes. Furthermore, in vitro biofilm forming ability and resistance to disinfectants were carried out on microtiter plate. The overall prevalence was 31.5% in food, and 68.5% in environmental samples. The prevalent serotype resulted 1/2c (43%, followed by 1/2a (40%, 4b (8.6%, and 1/2b (8.6%. The amplification products of the virulence genes were found in all the isolates with the following prevalence: 77.1% hlyA; 100% rrn; 100% prfA; 97.1% iap; 65.7% inlB; 88.6% inlA; 100% plcA; 100% plcB and 74.3% mpl. As for biofilm forming ability, 37.1% of the strains were positive and resulted weak producer, but all the isolates were sensible to disinfectants showing a reduction of L. monocytogenes growth after each incubation time. More appropriate technologies and application of measures of hygienic control should be implemented to prevent the L. monocytogenes growth and crosscontamination in salsiccia sarda processing plants.

REAL-TIME PCR DETECTION OF LISTERIA MONOCYTOGENES IN FOOD SAMPLES OF ANIMAL ORIGIN

Directory of Open Access Journals (Sweden)

Jaroslav Pochop

2013-02-01

Full Text Available The aim of this study was to follow the contamination of food with Listeria monocytogenes by using Step One real time polymerase chain reaction (PCR. We used the PrepSEQ Rapid Spin Sample Preparation Kit for isolation of DNA and SensiFAST SYBR Hi-ROX Kit for the real-time PCR performance. In 24 samples of food of animal origin without incubation were detected strains of Listeria monocytogenes in 15 samples (swabs. Nine samples were negative. Our results indicated that the real-time PCR assay developed in this study could sensitively detect Listeria monocytogenes in food of animal origin without incubation. This could prevent infection caused by Listeria monocytogenes, and also could benefit food manufacturing companies by extending their product’s shelf-life as well as saving the cost of warehousing their food products while awaiting pathogen testing results. The rapid real-time PCR-based method performed very well compared to the conventional method. It is a fast, simple, specific and sensitive way to detect nucleic acids, which could be used in clinical diagnostic tests in the future.

Listeria monocytogenes Identification in Food of Animal Origin Used with Real Time PCR

Directory of Open Access Journals (Sweden)

Jaroslav Pochop

2013-10-01

Full Text Available The aim of this study was to follow the contamination of food with Listeria monocytogenes by using Step One real time polymerase chain reaction (RT PCR. We used the PrepSEQ Rapid Spin Sample Preparation Kit for isolation of DNA and SensiFAST SYBR Hi-ROX Kit for the real-time PCR performance. In 20 samples of food of animal origin with incubation were detected strains of Listeria monocytogenes in 9 samples (swabs. Eleven samples were negative. Our results indicated that the real-time PCR assay developed in this study could sensitively detect Listeria monocytogenes in food of animal origin without incubation. This could prevent infection caused by Listeria monocytogenes, and also could benefit food manufacturing companies by extending their product’s shelf-life as well as saving the cost of warehousing their food products while awaiting pathogen testing results. The rapid real-time PCR-based method performed very well compared to the conventional method. It is a fast, simple, specific and sensitive way to detect nucleic acids, which could be used in clinical diagnostic tests in the future.

Growth potential of Listeria monocytogenes in sliced turkey bresaola packed in modified atmosphere

Directory of Open Access Journals (Sweden)

Elena Dalzini

2014-02-01

Full Text Available According to EC Regulation No 2073/2005, for food business operators that produce ready-to-eat (RTE product, it is crucial to be able to demonstrate if the product supports the growth of Listeria monocytogenes. The objective of the study was therefore to evaluate the behaviour of L. monocytogenes in sliced RTE turkey bresaola (made by cured turkey breast 4.5% NaCl, 1% sodium lactate, sodium nitrite 150 ppm and flavouring during the shelf life of the product, simulating a contamination during the slicing operation. Considering a shelf life of 90 days, as defined by manufacturer, the packages of sliced bresaola were stored at 5°C for 7 days and at 8°C for the remaining storage time (83 days. L. monocytogenes count decreased during storage test from 1.43/1.98 log cfu/g in the three batches tested to 1.03 log cfu/g in one batch and to undetectable levels in the other two batches. The results show that the investigated product is unable to support the growth of L. monocytogenes.

An Assessment of Different Genomic Approaches for Inferring Phylogeny of Listeria monocytogenes

DEFF Research Database (Denmark)

Henri, Clementine; Leekitcharoenphon, Pimlapas; Carleton, Heather A.

2017-01-01

Background/objectives: Whole genome sequencing (WGS) has proven to be a powerful subtyping tool for foodborne pathogenic bacteria like L. monocytogenes. The interests of genome-scale analysis for national surveillance, outbreak detection or source tracking has been largely documented. The genomic......MLPPST) or pan genome (wgMLPPST). Currently, there are little comparisons studies of these different analytical approaches. Our objective was to assess and compare different genomic methods that can be implemented in order to cluster isolates of L monocytogenes.Methods: The clustering methods were evaluated...... on a collection of 207 L. monocytogenes genomes of food origin representative of the genetic diversity of the Anses collection. The trees were then compared using robust statistical analyses.Results: The backward comparability between conventional typing methods and genomic methods revealed a near...

Exploring the diversity of Listeria monocytogenes biofilm architecture by high-throughput confocal laser scanning microscopy and the predominance of the honeycomb-like morphotype.

Science.gov (United States)

Guilbaud, Morgan; Piveteau, Pascal; Desvaux, Mickaël; Brisse, Sylvain; Briandet, Romain

2015-03-01

Listeria monocytogenes is involved in food-borne illness with a high mortality rate. The persistence of the pathogen along the food chain can be associated with its ability to form biofilms on inert surfaces. While most of the phenotypes associated with biofilms are related to their spatial organization, most published data comparing biofilm formation by L. monocytogenes isolates are based on the quantitative crystal violet assay, which does not give access to structural information. Using a high-throughput confocal-imaging approach, the aim of this work was to decipher the structural diversity of biofilms formed by 96 L. monocytogenes strains isolated from various environments. Prior to large-scale analysis, an experimental design was created to improve L. monocytogenes biofilm formation in microscopic-grade microplates, with special emphasis on the growth medium composition. Microscopic analysis of biofilms formed under the selected conditions by the 96 isolates revealed only weak correlation between the genetic lineages of the isolates and the structural properties of the biofilms. However, a gradient in their geometric descriptors (biovolume, mean thickness, and roughness), ranging from flat multilayers to complex honeycomb-like structures, was shown. The dominant honeycomb-like morphotype was characterized by hollow voids hosting free-swimming cells and localized pockets containing mixtures of dead cells and extracellular DNA (eDNA). Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Biofilm-Forming Abilities of Listeria monocytogenes Serotypes Isolated from Different Sources

Science.gov (United States)

Doijad, Swapnil P.; Barbuddhe, Sukhadeo B.; Garg, Sandeep; Poharkar, Krupali V.; Kalorey, Dewanand R.; Kurkure, Nitin V.; Rawool, Deepak B.; Chakraborty, Trinad

2015-01-01

A total of 98 previously characterized and serotyped L. monocytogenes strains, comprising 32 of 1/2a; 20 of 1/2b and 46 of 4b serotype, from clinical and food sources were studied for their capability to form a biofilm. The microtiter plate assay revealed 62 (63.26%) strains as weak, 27 (27.55%) strains as moderate, and 9 (9.18%) strains as strong biofilm formers. Among the strong biofilm formers, 6 strains were of serotype 1/2a and 3 strains were of serotype 1/2b. None of the strain from 4b serotype exhibited strong biofilm formation. No firm correlation (p = 0.015) was noticed between any serotype and respective biofilm formation ability. Electron microscopic studies showed that strong biofilm forming isolates could synthesize a biofilm within 24 h on surfaces important in food industries such as stainless steel, ceramic tiles, high-density polyethylene plastics, polyvinyl chloride pipes, and glass. Cell enumeration of strong, moderate, and weak biofilm was performed to determine if the number of cells correlated with the biofilm-forming capabilities of the isolates. Strong, moderate, and weak biofilm showed 570±127× 103 cells/cm2, 33±26× 103 cells/cm2, 5±3× 103 cells/cm2, respectively, indicating that the number of cells was directly proportional to the strength of the biofilm. The hydrophobicity index (HI) analysis revealed higher hydrophobicity with an increased biofilm formation. Fatty acid methyl esterase analysis revealed the amount of certain fatty acids such as iso-C15:0, anteiso-C15:0, and anteiso-C17:0 fatty acids correlated with the biofilm-forming capability of L. monocytogenes. This study showed that different strains of L. monocytogenes form biofilm of different intensities which did not completely correlate with their serotype; however, it correlated with the number of cells, hydrophobicity, and amount of certain fatty acids. PMID:26360831

Biofilm-Forming Abilities of Listeria monocytogenes Serotypes Isolated from Different Sources.

Directory of Open Access Journals (Sweden)

Swapnil P Doijad

Full Text Available A total of 98 previously characterized and serotyped L. monocytogenes strains, comprising 32 of 1/2a; 20 of 1/2b and 46 of 4b serotype, from clinical and food sources were studied for their capability to form a biofilm. The microtiter plate assay revealed 62 (63.26% strains as weak, 27 (27.55% strains as moderate, and 9 (9.18% strains as strong biofilm formers. Among the strong biofilm formers, 6 strains were of serotype 1/2a and 3 strains were of serotype 1/2b. None of the strain from 4b serotype exhibited strong biofilm formation. No firm correlation (p = 0.015 was noticed between any serotype and respective biofilm formation ability. Electron microscopic studies showed that strong biofilm forming isolates could synthesize a biofilm within 24 h on surfaces important in food industries such as stainless steel, ceramic tiles, high-density polyethylene plastics, polyvinyl chloride pipes, and glass. Cell enumeration of strong, moderate, and weak biofilm was performed to determine if the number of cells correlated with the biofilm-forming capabilities of the isolates. Strong, moderate, and weak biofilm showed 570±127× 103 cells/cm2, 33±26× 103 cells/cm2, 5±3× 103 cells/cm2, respectively, indicating that the number of cells was directly proportional to the strength of the biofilm. The hydrophobicity index (HI analysis revealed higher hydrophobicity with an increased biofilm formation. Fatty acid methyl esterase analysis revealed the amount of certain fatty acids such as iso-C15:0, anteiso-C15:0, and anteiso-C17:0 fatty acids correlated with the biofilm-forming capability of L. monocytogenes. This study showed that different strains of L. monocytogenes form biofilm of different intensities which did not completely correlate with their serotype; however, it correlated with the number of cells, hydrophobicity, and amount of certain fatty acids.

G‐LoSA: An efficient computational tool for local structure‐centric biological studies and drug design

Science.gov (United States)

2016-01-01

Abstract Molecular recognition by protein mostly occurs in a local region on the protein surface. Thus, an efficient computational method for accurate characterization of protein local structural conservation is necessary to better understand biology and drug design. We present a novel local structure alignment tool, G‐LoSA. G‐LoSA aligns protein local structures in a sequence order independent way and provides a GA‐score, a chemical feature‐based and size‐independent structure similarity score. Our benchmark validation shows the robust performance of G‐LoSA to the local structures of diverse sizes and characteristics, demonstrating its universal applicability to local structure‐centric comparative biology studies. In particular, G‐LoSA is highly effective in detecting conserved local regions on the entire surface of a given protein. In addition, the applications of G‐LoSA to identifying template ligands and predicting ligand and protein binding sites illustrate its strong potential for computer‐aided drug design. We hope that G‐LoSA can be a useful computational method for exploring interesting biological problems through large‐scale comparison of protein local structures and facilitating drug discovery research and development. G‐LoSA is freely available to academic users at http://im.compbio.ku.edu/GLoSA/. PMID:26813336

G-LoSA: An efficient computational tool for local structure-centric biological studies and drug design.

Science.gov (United States)

Lee, Hui Sun; Im, Wonpil

2016-04-01

Molecular recognition by protein mostly occurs in a local region on the protein surface. Thus, an efficient computational method for accurate characterization of protein local structural conservation is necessary to better understand biology and drug design. We present a novel local structure alignment tool, G-LoSA. G-LoSA aligns protein local structures in a sequence order independent way and provides a GA-score, a chemical feature-based and size-independent structure similarity score. Our benchmark validation shows the robust performance of G-LoSA to the local structures of diverse sizes and characteristics, demonstrating its universal applicability to local structure-centric comparative biology studies. In particular, G-LoSA is highly effective in detecting conserved local regions on the entire surface of a given protein. In addition, the applications of G-LoSA to identifying template ligands and predicting ligand and protein binding sites illustrate its strong potential for computer-aided drug design. We hope that G-LoSA can be a useful computational method for exploring interesting biological problems through large-scale comparison of protein local structures and facilitating drug discovery research and development. G-LoSA is freely available to academic users at http://im.compbio.ku.edu/GLoSA/. © 2016 The Protein Society.

Control options for Listeria monocytogenes in seafoods

DEFF Research Database (Denmark)

Huss, Hans Henrik; Jørgensen, Lasse Vigel; Vogel, Birte Fonnesbech

2000-01-01

At least three outbreaks of listeriosis associated with seafood have been reported. Listeria monocytogenes is widely distributed in the general environment including fresh water, coastal water and live fish from these areas. Contamination or recontamination of seafood may also take place during...

Prevalence of Listeria monocytogenes in ready-to-eat seafood marketed in Thessaloniki (Northern Greece

Directory of Open Access Journals (Sweden)

N. Soultos

2014-11-01

Full Text Available Aim: In the current study, a contribution to the knowledge on the prevalence and level of contamination of Listeria monocytogenes in ready-to-eat (RTE seafood marketed in Thessaloniki (Northern Greece was provided; the serovar identity of the L. monocytogenes isolates was also determined. Materials and Methods: A total of 132 RTE seafood samples consisting of 74 smoked fish products, 18 salted fish products, 16 dried fish products, 9 raw marinated fish products, 10 cooked marinated cephalopods and 5 surimi crab stick products were analyzed. L. monocytogenes were isolated and enumerated based on ISO 11290-1/A1 and ISO 11290-2/A1 protocols, respectively, and identified using a multiplex polymerase chain reaction (PCR system utilizing genus and species specific primers. For the identification of serotypes a second multiplex PCR assay was used which clusters L. monocytogenes strains into four major serogroups. Results: Of the samples examined, 11 (8.3% proved positive for Listeria spp. with 8 (6.1% yielding L. monocytogenes. Only in one sample of smoked mackerel the level of L. monocytogenes exceeded the legal safety limit of 100 cfu/g set out in Commission Regulation (EC No. 1441/2007. Serotyping showed higher percentages of isolates belonging to PCR serogroup 3:1/2b, 3b, 7 (46.7% and serogroup 1:1/2a, 3a (40% followed by serogroup 4:4b, 4d, 4e (13.3%. Conclusion: This study demonstrated that L. monocytogenes can be isolated from processed RTE seafood products at retail in Thessaloniki (Northern Greece in low concentrations. However, the presence of this human pathogen in RTE seafood should not be overlooked, but it should be considered as having significance public health implications, particularly among the persons who are at greater risk. Therefore, RTE seafood should be produced under appropriate hygienic and technological conditions since the product does not undergo any treatment before consumption.

Lo privado de lo público para jóvenes universitarios en Colombia

Directory of Open Access Journals (Sweden)

Victoria Eugenia Pinilla Sepúlveda

2008-10-01

Full Text Available La investigación busca comprender los significados que tienen “lo público” y las relaciones adulto-joven para un grupo de jóvenes universitarios en sus acciones cotidianas y a partir de las narrativas de sus experiencias. Es un estudio hermenéutico que analiza las narrativas en el contexto de la dialéctica de la comprensión y la explicación propuesta por Ricoeur. Aborda lo generacional, las relaciones adulto-joven y lo público, desde algunos aportes de la sociología y la teoría política como los de Mannheim, Martin Criado, Corsten, Arendt, Habermas y Fraser. Así mismo despliega la fundamentación teórica de la narrativa como opción que posibilita el acercamiento a los significados de un grupo de jóvenes universitarios. La categoría relaciones adulto-joven muestra, más que encuentros, desencuentros entre ambas generaciones, caracterizados por un control al que los jóvenes reaccionan con una subordinación pasiva, o con un afrontamiento manipulador. Lo público se caracteriza por una tensión constante, entre fuerzas instituidas en los ámbitos familiar, educativo y social, que imponen formas de comportamiento, normas y valores que conforman un orden establecido, y las posibilidades de cambio que se van fraguando y que generan movimiento frente a lo instituido. En medio de esta coexistencia de fuerzas que conviven y se contraponen, aparecen los jóvenes dando prioridad al “sí mismo”, a lo subjetivo sobre lo colectivo, en una urgente búsqueda de autodeterminación como un reclamo directo por su reconocimiento en un ámbito de lo público que los relega a la periferia.

Prevalence and contamination levels of listeria monocytogenes in ready-to-eat foods in Tokyo, Japan.

Science.gov (United States)

Shimojima, Yukako; Ida, Miki; Nakama, Akiko; Nishino, Yukari; Fukui, Rie; Kuroda, Sumiyo; Hirai, Akihiko; Kai, Akemi; Sadamasu, Kenji

2016-08-01

We surveyed prevalence and contamination levels of Listeria monocytogenes in ready-to-eat foods between 2000 and 2012 in Tokyo. L. monocytogenes was isolated from 52 (1.7%) out of 2,980 samples. Comparing the prevalence in the study period, 2.2% were positive in the former period (2000-2005) and 1.2% in the latter (2006-2012). Using the most probable number (MPN) technique, 32 samples were contaminated with fewer than 0.3 L. monocytogenes/g, 10 samples with 0.3-1.0/g and 4 samples with more than 1.0/g (the maximum was 2.3/g). The most common serovar was 1/2a, followed by 1/2b, 4b and 1/2c. We revealed that ready-to-eat foods in Tokyo were contaminated with L. monocytogenes, although the contamination levels were low.

Prevalence and quantification of Listeria monocytogenes in beef offal at retail level in Selangor, Malaysia

Science.gov (United States)

Kuan, Chee Hao; Wong, Woan Chwen; Pui, Chai Fung; Mahyudin, Nor Ainy; Tang, John Yew Huat; Nishibuchi, Mitsuaki; Radu, Son

2013-01-01

A total of 63 beef offal samples (beef liver = 16; beef lung = 14; beef intestine = 9; beef tripe = 15; beef spleen = 9) from three wet markets (A, B, and C) in Selangor, Malaysia were examined for the prevalence and microbial load of Listeria monocytogenes. A combination of the most probable number and polymerase chain reaction (MPN-PCR) method was employed in this study. It was found that L. monocytogenes detected in 33.33% of the beef offal samples. The prevalence of L. monocytogenes in beef offal purchased from wet markets A, B, and C were 22.73%, 37.50% and 41.18% respectively. The density of L. monocytogenes in all the samples ranged from 2,400 MPN/g. The findings in this study indicate that beef offal can be a potential vehicle of foodborne listeriosis. PMID:24688507

Prevalence and quantification of Listeria monocytogenes in beef offal at retail level in Selangor, Malaysia

Directory of Open Access Journals (Sweden)

Chee Hao Kuan

2013-12-01

Full Text Available A total of 63 beef offal samples (beef liver = 16; beef lung = 14; beef intestine = 9; beef tripe = 15; beef spleen = 9 from three wet markets (A, B, and C in Selangor, Malaysia were examined for the prevalence and microbial load of Listeria monocytogenes. A combination of the most probable number and polymerase chain reaction (MPN-PCR method was employed in this study. It was found that L. monocytogenes detected in 33.33% of the beef offal samples. The prevalence of L. monocytogenes in beef offal purchased from wet markets A, B, and C were 22.73%, 37.50% and 41.18% respectively. The density of L. monocytogenes in all the samples ranged from 2,400 MPN/g. The findings in this study indicate that beef offal can be a potential vehicle of foodborne listeriosis.

Variability of Listeria monocytogenes strains in biofilm formation on stainless steel and polystyrene materials and resistance to peracetic acid and quaternary ammonium compounds.

Science.gov (United States)

Poimenidou, Sofia V; Chrysadakou, Marilena; Tzakoniati, Aikaterini; Bikouli, Vasiliki C; Nychas, George-John; Skandamis, Panagiotis N

2016-11-21

Listeria monocytogenes is a foodborne pathogen able to tolerate adverse conditions by forming biofilms or by deploying stress resistant mechanisms, and thus manages to survive for long periods in food processing plants. This study sought to investigate the correlation between biofilm forming ability, tolerance to disinfectants and cell surface characteristics of twelve L. monocytogenes strains. The following attributes were evaluated: (i) biofilm formation by crystal violet staining method on polystyrene, and by standard cell enumeration on stainless steel and polystyrene; (ii) hydrophobicity assay using solvents; (iii) minimum inhibitory concentration (MIC) and biofilm eradication concentration (BEC) of peracetic acid (PAA) and quaternary ammonium compounds (QACs), and (iv) resistance to sanitizers (PAA 2000ppm; QACs 500ppm) of biofilms on polystyrene and stainless steel. After 72h of incubation, higher biofilm levels were formed in TSB at 20°C, followed by TSB at 37°C (P=0.087) and diluted TSB 1/10 at both 20 (P=0.005) and 37°C (P=0.004). Cells grown at 30°C to the stationary phase had significant electron donating nature and a low hydrophobicity, while no significant correlation of cell surface properties to biofilm formation was observed. Strains differed in MIC PAA and BEC PAA by 24- and 15-fold, respectively, while a positive correlation between MIC PAA and BEC PAA was observed (P=0.02). The MIC QACs was positively correlated with the biofilm-forming ability on stainless steel (P=0.03). Regarding the impact of surface type, higher biofilm populations were enumerated on polystyrene than on stainless steel, which were also more tolerant to disinfectants. Among all strains, the greatest biofilm producer was a persistent strain with significant tolerance to QACs. These results may contribute to better understanding of L. monocytogenes behavior and survival on food processing surfaces. Copyright © 2016 Elsevier B.V. All rights reserved.

Molecular analysis of the iap gene of Listeria monocytogenes isolated from cheeses in Rio Grande do Sul, Brazil Análise molecular do gene iap de Listeria monocytogenes isoladas de queijos no Estado do Rio Grande do Sul, Brasil

Directory of Open Access Journals (Sweden)

Jozi Fagundes de Mello

2008-03-01

Full Text Available The polymorphic region sequences in the iap gene were analyzed in 25 strains of Listeria monocytogenes isolated from cheeses in the state of Rio Grande do Sul, and compared with reference strains. This investigation distinguished two clusters of L. monocytogenes: I (20 strains and II (5 strains.A seqüência da região polimórfica do gene iap foi analisada em 25 cepas de Listeria monocytogenes isoladas de queijo no Estado do Rio Grande do Sul e comparadas com cepas referências. Esta investigação distinguiu L. monocytogenes em dois grupos: I (20 cepas e II (5 cepas.

Phloretin Attenuates Listeria monocytogenes Virulence Both In vitro and In vivo by Simultaneously Targeting Listeriolysin O and Sortase A.

Science.gov (United States)

Wang, Jianfeng; Liu, Bowen; Teng, Zihao; Zhou, Xuan; Wang, Xiyan; Zhang, Bing; Lu, Gejin; Niu, Xiaodi; Yang, Yongjun; Deng, Xuming

2017-01-01

The critical roles of sortase A (SrtA) and listeriolysin O (LLO) in Listeria monocytogenes pathogenicity render these two virulence factors as ideal targets for the development of anti-virulence agents against L. monocytogenes infection. Additionally, the structures of SrtA and LLO are highly conserved among the members of sortase enzyme family and cholesterol dependent toxin family. Here, phloretin, a natural polyphenolic compound derived from apples and pears that has little anti- L. monocytogenes activity, was identified to simultaneously inhibit LLO expression and neutralize SrtA catalytic activity. Phloretin neutralized SrtA activity by causing a conformational change in the protein's active pocket, which prevented engagement with its substrate. Treatment with phloretin simultaneously reduced L. monocytogenes invasion into host cells and blocked the escape of vacuole-entrapped L. monocytogenes into cytoplasm. Further, L. monocytogenes -infected mice that received phloretin showed lower mortality, decreased bacterial burden and reduced pathological injury. Our results demonstrate that phloretin is a promising anti-infective therapeutic for infections caused by L. monocytogenes due to its simultaneous targeting of SrtA and LLO, which may result in fewer side effects than those caused by other antibiotics.

Diversity Assessment of Heat Resistance of Listeria monocytogenes Strains in a Continuous-Flow Heating System

NARCIS (Netherlands)

Veen, van der S.; Wagendorp, A.; Abee, T.; Wells-Bennik, M.H.J.

2009-01-01

Listeria monocytogenes is a foodborne pathogen that has the ability to survive relatively high temperatures compared with other nonsporulating foodborne pathogens. This study was performed to determine whether L. monocytogenes strains with relatively high heat resistances are adequately inactivated

Prevalence of Listeria monocytogenes in traditional ice cream, Yazd, IRAN (1394 and compared to other studies in different parts of Iran

Directory of Open Access Journals (Sweden)

Negar Hamidian

2017-07-01

Full Text Available 1-Mortazavi S, Gods rohani M, Juyande H. milk and dairy products technology. The University Ferdowsi Mashhad; 1996. p. 266. 2-Azadnia P, Ghasemi M, Abbasi M, Taarof N, Jashni M. Microbial Quality of Traditional Ice Cream Produced by Small-Scale Manufacturers in Khormoj and Its Comparison with the Iranian National Standard. Journal of Animal and Veterinary Advances 2011;10(6:742-4. 3- Ziabari Mirnezami H. What do you know about milk (Milk chemical technology: Tehran University; 1996. 4-Movassagh MH, Movassagh A, Mahmoodi H, Servatkhah F, Sourorbakhsh MR. Microbiological contamination of the traditional chocolate Ice cream sold in the Northwest Region of Iran. Global Veterinaria 2011;6(3:269-71. 5-Karim G, Razavilar V, Akhonndzade A. survey contamination of traditional ice cream to bacteria causing the infection and food poisoning[persian]. Tehran University Faculty of Veterinary 1374;50:71-8. 6-Kanbakan U, Con A, Ayar A. Determination of microbiological contamination sources during ice cream production in Denizli, Turkey. Food Control 2004;15(6:463-70. 7- Fallah AA, Saei-Dehkordi SS, Rahnama M, Tahmasby H, Mahzounieh M. Prevalence and antimicrobial resistance patterns of  Listeria  species isolated from poultry products marketed in Iran. Food Control 2012;28(2:327-32. 8-Farber J, Peterkin P. Listeria monocytogenes, a food-borne pathogen. Microbiological reviews 1991;55(3:476. 9-Navratilova P, Schlegelova J, Sustackova A, Napravnikova E, Lukasova J, Klimova E. Prevalence of Listeria monocytogenes in milk, meat and foodstuff of animal origin and the phenotype of antibiotic resistance of isolated strains. Veterinarni Medicina-UZPI 2004;49. 10-Williams SK, Roof S, Boyle EA, Burson D, Thippareddi H, Geornaras I, et al. Molecular ecology of Listeria monocytogenes and other Listeria species in small and very small ready-to-eat meat processing plants. J Food Prot 2011;74(1:63-77. 11-Halter E, Neuhaus K, Scherer S. Listeria weihenstephanensis sp. nov

Real-time PCR detection of Listeria monocytogenes in infant formula and lettuce following macrophage-based isolation and enrichment.

Science.gov (United States)

Day, J B; Basavanna, U

2015-01-01

To develop a rapid detection procedure for Listeria monocytogenes in infant formula and lettuce using a macrophage-based enrichment protocol and real-time PCR. A macrophage cell culture system was employed for the isolation and enrichment of L. monocytogenes from infant formula and lettuce for subsequent identification using real-time PCR. Macrophage monolayers were exposed to infant formula and lettuce contaminated with a serial dilution series of L. monocytogenes. As few as approx. 10 CFU ml(-1) or g(-1) of L. monocytogenes were detected in infant formula and lettuce after 16 h postinfection by real-time PCR. Internal positive PCR controls were utilized to eliminate the possibility of false-negative results. Co-inoculation with Listeria innocua did not reduce the L. monocytogenes detection sensitivity. Intracellular L. monocytogenes could also be isolated on Listeria selective media from infected macrophage lysates for subsequent confirmation. The detection method is highly sensitive and specific for L. monocytogenes in infant formula and lettuce and establishes a rapid identification time of 20 and 48 h for presumptive and confirmatory identification, respectively. The method is a promising alternative to many currently used q-PCR detection methods which employ traditional selective media for enrichment of contaminated food samples. Macrophage enrichment of L. monocytogenes eliminates PCR inhibitory food elements and contaminating food microflora which produce cleaner samples that increase the rapidity and sensitivity of detection. Published 2014. This article is a U.S. Government work and is in the public domain in the USA.

Food contact surfaces coated with nitrogen-doped titanium dioxide: effect on Listeria monocytogenes survival under different light sources

Energy Technology Data Exchange (ETDEWEB)

Rodrigues, D.; Teixeira, P. [Institute for Biotechnology and Bioengineering, Centre of Biological Engineering, University of Minho, Campus de Gualtar, 4710-057 Braga (Portugal); Tavares, C.J. [Center of Physics, University of Minho, Campus de Azurém, 4800-058 Guimarães (Portugal); Azeredo, J., E-mail: jazeredo@deb.uminho.pt [Institute for Biotechnology and Bioengineering, Centre of Biological Engineering, University of Minho, Campus de Gualtar, 4710-057 Braga (Portugal)

2013-04-01

Improvement of food safety is a very important issue, and is on the basis of production and application of new/modified food contact surfaces. Titanium dioxide (TiO{sub 2}) and, more recently, nitrogen-doped titanium dioxide (N-TiO{sub 2}) coatings are among the possible forms to enhance food contact surfaces performance in terms of higher hygiene and easier sanitation. In this context, the present work aimed at evaluating the bactericidal activity of an N-TiO{sub 2} coating on glass and stainless steel under two different sources of visible light – fluorescent and incandescent – and ultraviolet (UV) irradiation. Listeria monocytogenes was chosen as representative of major foodborne pathogens and its survival was tested on N-TiO{sub 2} coated coupons. In terms of survival percentage, good results were obtained after exposure of coated surfaces to all light types since, apart from the value obtained after exposing glass to fluorescent light (56.3%), survival rates were always below 50%. However, no effective disinfection was obtained, given that for a disinfectant or sanitizing agent to be claimed as effective it needs to be able to promote at least a 3-log reduction of the microbial load, which was not observed for any of the experimental conditions assessed. Even so, UV irradiation was the most successful on eliminating cells on coated surfaces, since the amount of bacteria was reduced to 1.49 × 10{sup 6} CFU/ml on glass and 2.37 × 10{sup 7} on stainless steel. In contrast, both visible light sources had only slightly decreased the amount of viable cells, which remained in the range of 8 log CFU/ml. Hence, although some bactericidal effect was accomplished under visible light, UV was the most effective light source on promoting photocatalytic reactions on N-TiO{sub 2} coated coupons and none of the experimental conditions have reached a satisfactory disinfection level. Thus, this surface coating needs further research and improvement in order to become truly

Occurrence and antimicrobial resistance patterns of Listeria monocytogenes isolated from vegetables

Directory of Open Access Journals (Sweden)

Vanessa de Vasconcelos Byrne

2016-06-01

Full Text Available Abstract Although the consumption of fresh and minimally processed vegetables is considered healthy, outbreaks related to the contamination of these products are frequently reported. Among the food-borne pathogens that contaminate vegetables is Listeria monocytogenes, a ubiquitous organism that exhibits the ability to survive and multiply at refrigerated temperatures. This study aimed to evaluate the occurrence of L. monocytogenes in vegetables as well as the antimicrobial resistance of isolates. The results showed that 3.03% of samples were contaminated with L. monocytogenes, comprising 2.22% of raw vegetables and 5.56% of ready-to-eat vegetables. Multiplex PCR confirmed the virulence potential of the isolates. Antimicrobial resistance profiling showed that 50% of the isolates were susceptible to the antibiotics used. The resistance of one isolate to penicillin G, a commonly employed therapeutic agent, and the presence of serotype 4b, a serotype commonly associated with food-borne outbreaks, could be potential health hazards for consumers.

Mechanistic studies of the agmatine deiminase from Listeria monocytogenes.

Science.gov (United States)

Soares, Charles A; Knuckley, Bryan

2016-06-01

Listeria monocytogenes is a Gram-positive food-borne pathogen that is capable of living within extreme environments (i.e. low temperatures and pH). This ability to survive in such conditions may arise, at least in part, from agmatine catabolism via the agmatine deiminase system (AgDS). This catabolic pathway utilizes an agmatine deiminase (AgD) to hydrolyse agmatine into N-carbamoylputrescine (NCP), with concomitant release of ammonia, which increases the pH, thus mitigating the ill effects of the acidic environment. Given the potential significance of this pathway for cell survival, we set out to study the catalytic mechanism of the AgD encoded by L. monocytogenes In the present paper, we describe the catalytic mechanism employed by this enzyme based on pH profiles, pKa measurements of the active site cysteine and solvent isotope effects (SIE). In addition, we report inhibition of this enzyme by two novel AgD inhibitors, i.e. N-(4-aminobutyl)-2-fluoro-ethanimidamide (ABFA) and N-(4-aminobutyl)-2-chloro-ethanimidamide (ABCA). In contrast with other orthologues, L. monocytogenes AgD does not use the reverse protonation or substrate-assisted mechanism, which requires an active site cysteine with a high pKa and has been commonly seen in other members of the guanidinium-modifying enzyme (GME) superfamily. Instead, the L. monocytogenes AgD has a low pKa cysteine in the active site leading to an alternative mechanism of catalysis. This is the first time that this mechanism has been observed in the GME superfamily and is significant because it explains why previously developed mechanism-based inactivators of AgDs are ineffective against this orthologue. © 2016 The Author(s). published by Portland Press Limited on behalf of the Biochemical Society.

Viability of Listeria monocytogenes surface inoculated onto slices of pork scrapple during storage at 4 Degrees, 10 Degrees, and 21 Degrees C

Science.gov (United States)

We evaluated the fate of Listeria monocytogenes on scrapple, a regionally-popular, ready-to-eat (RTE) savory mush of pork trimmings, cornmeal, and flour. We also conducted an informal survey to address consumer practices for storing and reheating scrapple. Regarding the survey, of some 125 consumers...

Lo que uno pretende que sea

OpenAIRE

Da Pieve, Enzo

2017-01-01

Si bien la escritura es, de manera teórica, una manifestación de la actividad lingüística humana que posee ciertos rasgos de intencionalidad y contextualidad de lo verbal, es necesario obstinarse en una búsqueda más profunda de la importancia de la escritura. Es fundamental hacer un análisis minucioso, tanto de lo formal como de lo emocional, lo contextual, lo social, lo artístico. La escritura es un mundo por descubrir. Centro de Investigación en Lectura y Escritura (CILE)

Prevalence, enumeration and pheno- and genotypic characteristics of Listeria monocytogenes isolated from raw foods in South China

Directory of Open Access Journals (Sweden)

Moutong eChen

2015-09-01

Full Text Available Listeria monocytogenes is an important foodborne pathogen that can cause serious illness in immunocompromised individuals, pregnant women, the elderly, and newborns. The aim of this study was to: (i evaluate the prevalence and contamination level (most probable number, MPN of L. monocytogenes in 567 retail raw foods (fishery products, n=154; raw/fresh meat, n=123; frozen foods, n=110; edible fungi, n=108; vegetables, n=72 collected from South China and (ii to gain further knowledge on the phenotype and genotype distributions of this important foodborne pathogen. Approximately 22% of the samples were positive for L. monocytogenes. The contamination levels were between 0.3 and 10 MPN/g in 75.0%, between 10 and 100 MPN/g in 11.0% and less than 100 MPN/g in 14.0% of the countable samples. Five serogroups were identified among the177 foodborne L. monocytogenes isolates, with1/2a-3a (42.4% and1/2b-3b (26.0% serogroups being the most dominant. Serogroup I.1 and II.2 were only found in the edible mushrooms, while serogroup III was dominant in the fishery products, suggesting that specific serogroups of L. monocytogenes may have distinct ecological niches. Ten (5.6% L. monocytogenes isolates exhibited multidrug resistance. Genetic relatedness analysis revealed the absence of distinct associations between specific food types, antibiotic resistance, serogroups, and genetic diversity. The present study provided the first baseline data on the prevalence, contamination level, and characteristics of L. monocytogenes isolated from raw foods in South China. Some multidrug resistant strains belonged to the epidemiologically important serogroups (I.1 and II.1, implying a potential public health risk. In addition, these findings also provide basic information for the Chinese food safety associated authorities to draft appropriate standards to control L. monocytogenes contamination and improve microbiological safety of raw foods.

Local Outbreak of Listeria monocytogenes Serotype 4b Sequence Type 6 Due to Contaminated Meat Pâté.

Science.gov (United States)

Althaus, Denise; Jermini, Marco; Giannini, Petra; Martinetti, Gladys; Reinholz, Danuta; Nüesch-Inderbinen, Magdalena; Lehner, Angelika; Stephan, Roger

2017-04-01

In January and February 2016, five cases of confirmed and two cases of probable infection due to Listeria monocytogenes serotype 4b, sequence type (ST) 6 belonging to a single pulsed-field gel electrophoresis pulsotype pattern were registered in a region of southern Switzerland. L. monocytogenes was detected in blood samples (four cases) and pleural fluid (one case). Furthermore, L. monocytogenes 4b ST6 was detected in a stool sample of an asymptomatic person exposed to a common food. Forthwith, the food safety authority and a local gourmet meat producer reported L. monocytogenes contamination of meat pâté. Analysis of further food and environmental samples from the premises of the producer yielded isolates matching the clinical strains and confirmed the presence of L. monocytogenes 4b ST6 in the mincing machine as the cause of the food contamination.

Triclosan-Induced Aminoglycoside-Tolerant Listeria monocytogenes Isolates Can Appear as Small-Colony Variants

DEFF Research Database (Denmark)

Kastbjerg, Vicky Gaedt; Hein-Kristensen, Line; Gram, Lone

2014-01-01

Exposure of the human food-borne pathogen Listeria monocytogenes to sublethal concentrations of triclosan can cause resistance to several aminoglycosides. Aminoglycoside-resistant isolates exhibit two colony morphologies: normal-size and pinpoint colonies. The purposes of the present study were...... to characterize the small colonies of L. monocytogenes and to determine if specific genetic changes could explain the triclosan-induced aminoglycoside resistance in both pinpoint and normal-size isolates. Isolates from the pinpoint colonies grew poorly under aerated conditions, but growth was restored by addition......I and that exposure to triclosan can cause resistance to antibiotics that enters the cell via active transport. Further studies are needed to elucidate if L. monocytogenes pinpoint isolates could have any clinical impact, e.g., in persistent infections....

Effect of starter cultures on survival of Listeria monocytogenes in Čajna sausage

Science.gov (United States)

Bošković, M.; Tadić, V.; Đorđević, J.; Glišić, M.; Lakićević, B.; Dimitrijević, M.; Baltić, M. Ž.

2017-09-01

The aim of the study was to evaluate the survival of Listeria monocytogenes during the production of Čajna sausage with short maturation time. Sausage batter was inoculated with three different serotypes 4b and serotype 1/2a of L. monocytogenes. Control sausages were without any starter culture added; the second batch was inoculated with strains of Lactobacillus sakei, Staphylococcus carnosus and Staphylococcus xylosus, and the third batch was inoculated with strains of Debaryomyces hansenii, Lactobacillus sakei, Pediococcus acidilactici, Pediococcus pentosaceus, Staphylococcus carnosus and Staphylococcus xylosus. After 18 days of ripening, L. monocytogenes was not detected in any of the sausages, but during this fermentation and drying, the numbers of this pathogen was lower in the sausages inoculated with starter cultures.

Factors associated with Listeria monocytogenes contamination of cold-smoked pork products produced in Latvia and Lithuania.

OpenAIRE

Berzins,-A; Horman,-A; Lunden,-J; Korkeala,-H

2007-01-01

A total of 312 samples of sliced, vacuum packaged, cold-smoked pork from 15 meat processing plants in Latvia and Lithuania, obtained over a 15-month period from 2003 until 2004, were analyzed for the presence of Listeria monocytogenes at the end of their shelf-life. Overall, 120 samples (38%) tested positive for L. monocytogenes. Despite the long storing period, the levels of L. monocytogenes in cold-smoked pork products were low. Manufacturing processes were studied at seven meat processing ...

An outbreak of an unusual strain of Listeria monocytogenes infection in North-East Scotland.

Science.gov (United States)

Okpo, Emmanuel; Leith, Jayne; Smith-Palmer, Alison; Bell, John; Parks, Duncan; Browning, Fiona; Byers, Lynn; Corrigan, Helen; Webster, Diana; Karcher, Anne M; Murray, Andrew; Storey, Tom

2015-01-01

Listeria monocytogenes infection is an important cause of illness and hospitalization in vulnerable individuals. In the present study, we describe a community outbreak of Listeria monocytogenes in the North-East region of Scotland, which was epidemiologically, environmentally and microbiologically linked to a local meat product and ready-to-eat product manufacturer. Infected individuals were interviewed, and an environmental investigation was conducted. Clinical and environmental samples were tested by culture, and isolates were typed by fluorescent amplified fragment length polymorphism (fAFLP). Three cases of Listeria monocytogenes were linked geographically, had the same serotype (1/2a) and were indistinguishable by fAFLP type XII.6. The human, food and environmental isolates were of the same serotype and were indistinguishable by molecular typing. This is the first community outbreak of L. monocytogenes reported in Scotland since the current outbreak surveillance was established in 1996. Epidemiological and laboratory evidence indicated poor hand hygiene, unhygienic practices and cross-contamination throughout the manufacturing process of ready-to-eat foods as a possible cause of the outbreak. More stringent control of commercial food establishments that provide ready-to-eat food and the need to advise specifically vulnerable groups, e.g., pregnant women, of the risk of L. monocytogenes in ready-to-eat food is urgently needed. Copyright © 2015 King Saud Bin Abdulaziz University for Health Sciences. Published by Elsevier Ltd. All rights reserved.

Identification of a Peptide-Pheromone that Enhances Listeria monocytogenes Escape from Host Cell Vacuoles

Science.gov (United States)

Xayarath, Bobbi; Alonzo, Francis; Freitag, Nancy E.

2015-01-01

Listeria monocytogenes is a Gram-positive facultative intracellular bacterial pathogen that invades mammalian cells and escapes from membrane-bound vacuoles to replicate within the host cell cytosol. Gene products required for intracellular bacterial growth and bacterial spread to adjacent cells are regulated by a transcriptional activator known as PrfA. PrfA becomes activated following L. monocytogenes entry into host cells, however the signal that stimulates PrfA activation has not yet been defined. Here we provide evidence for L. monocytogenes secretion of a small peptide pheromone, pPplA, which enhances the escape of L. monocytogenes from host cell vacuoles and may facilitate PrfA activation. The pPplA pheromone is generated via the proteolytic processing of the PplA lipoprotein secretion signal peptide. While the PplA lipoprotein is dispensable for pathogenesis, bacteria lacking the pPplA pheromone are significantly attenuated for virulence in mice and have a reduced efficiency of bacterial escape from the vacuoles of nonprofessional phagocytic cells. Mutational activation of PrfA restores virulence and eliminates the need for pPplA-dependent signaling. Experimental evidence suggests that the pPplA peptide may help signal to L. monocytogenes its presence within the confines of the host cell vacuole, stimulating the expression of gene products that contribute to vacuole escape and facilitating PrfA activation to promote bacterial growth within the cytosol. PMID:25822753

Listeria monocytogenes incidence changes and diversity in some Brazilian dairy industries and retail products.

Science.gov (United States)

Oxaran, Virginie; Lee, Sarah Hwa In; Chaul, Luíza Toubas; Corassin, Carlos Humberto; Barancelli, Giovana Verginia; Alves, Virgínia Farias; de Oliveira, Carlos Augusto Fernandes; Gram, Lone; De Martinis, Elaine Cristina Pereira

2017-12-01

Listeria monocytogenes can cause listeriosis, a severe foodborne disease. In Brazil, despite very few reported cases of listeriosis, the pathogen has been repeatedly isolated from dairies. This has led the government to implement specific legislation to reduce the hazard. Here, we determined the incidence of L. monocytogenes in five dairies and retail products in the Southeast and Midwest regions of Brazil over eight months. Of 437 samples, three samples (0.7%) from retail and only one sample (0.2%) from the dairies were positive for L. monocytogenes. Thus, the contamination rate was significantly reduced as compared to previous studies. MultiLocus Sequence Typing (MLST) was used to determine if contamination was caused by new or persistent clones leading to the first MLST profile of L. monocytogenes from the Brazilian dairy industry. The processing environment isolate is of concern being a sequence-type (ST) 2, belonging to the lineage I responsible for the majority of listeriosis outbreaks. Also, ST3 and ST8 found in commercialized cheese have previously been reported in outbreaks. Despite the lower incidence, dairy products still pose a potential health risk and the occurrence of L. monocytogenes in dairies and retail products emphasize the need for continuous surveillance of this pathogen in the Brazilian dairy industry. Copyright © 2017 Elsevier Ltd. All rights reserved.

Efficacy of household washing treatments for the control of Listeria monocytogenes on salad vegetables.

Science.gov (United States)

Nastou, Aikaterini; Rhoades, Jonathan; Smirniotis, Petros; Makri, Ioanna; Kontominas, Michael; Likotrafiti, Eleni

2012-10-15

The efficacy of household decontamination methods at reducing Listeria monocytogenes on fresh lettuce (Lactuca sativa), cucumber (Cucumis sativus) and parsley (Petroselinum sativum) was studied. Inoculated vegetable pieces were immersed in washing solutions and surviving L. monocytogenes enumerated. Parameters investigated were storage temperature prior to washing, dipping water temperature, agitation, acetic acid concentration and immersion time. The results indicated that the storage temperature significantly affects the efficacy of dipping vegetables in water for the control of L. monocytogenes, as the reduction in count was greatest when products had been stored at cooler temperatures. Decontamination with acetic acid (up to 2.0% v/v) was shown to have some effect in most cases, but the highest observed decrease in count was 2.6 log cfu/g. Experiments investigating the effect of exposure time to acetic acid (0.5% and 1.0% v/v, up to 30 min immersion) indicated that immersing the vegetables for more than 10 min is of minimal benefit. The most significant factor affecting washing and decontamination efficacy was the vegetable itself: L. monocytogenes colonizing cucumber epidermis was far more resistant to removal by washing and to acid treatment than that on the leafy vegetables, and L. monocytogenes on parsley was the most susceptible. This shows that published decontamination experiments (often performed with lettuce) cannot necessarily be extrapolated to other vegetables. Copyright © 2012 Elsevier B.V. All rights reserved.

Detection of Listeria monocytogenes in ready-to-eat food by Step One real-time polymerase chain reaction.

Science.gov (United States)

Pochop, Jaroslav; Kačániová, Miroslava; Hleba, Lukáš; Lopasovský, L'ubomír; Bobková, Alica; Zeleňáková, Lucia; Stričík, Michal

2012-01-01

The aim of this study was to follow contamination of ready-to-eat food with Listeria monocytogenes by using the Step One real time polymerase chain reaction (PCR). We used the PrepSEQ Rapid Spin Sample Preparation Kit for isolation of DNA and MicroSEQ® Listeria monocytogenes Detection Kit for the real-time PCR performance. In 30 samples of ready-to-eat milk and meat products without incubation we detected strains of Listeria monocytogenes in five samples (swabs). Internal positive control (IPC) was positive in all samples. Our results indicated that the real-time PCR assay developed in this study could sensitively detect Listeria monocytogenes in ready-to-eat food without incubation.

The challenge of setting risk-based microbiological criteria for Listeria monocytogenes

DEFF Research Database (Denmark)

Andersen, Jens Kirk; Nørrung, Birgit

2011-01-01

After more than 20 years of work with discussing the setting of microbiological criteria for Listeria monocytogenes in foods, Codex Alimentarius on Food Hygiene has finalised a proposal that was recently adopted by the Codex Alimentarius Commission. The effort of developing procedures for making...... the microbiological criteria risk-based to the greatest extent possible has challenged scientists and managers during this long time period. Yet, the establishment of microbiological criteria for L. monocytogenes is still being discussed and several approaches are possible. Setting of microbiological criteria...

LO íntimo, lo doméstico y lo público: representaciones sociales y estilos de vida en la España ilustrada

Directory of Open Access Journals (Sweden)

Mónica BOLUFER PERUGA

2009-12-01

Full Text Available RESUMEN: A partir de los textos autobiográficos, correspondencia y otros escritos de diversos personajes vinculados al reformismo ilustrado en la España del siglo xviii, este trabajo estudia los modos en que en sus representaciones de la sociedad y sus imágenes de sí mismos se articulaban los ámbitos de lo íntimo, lo doméstico y lo público, poniendo de relieve las diferencias que este engarce presentaba para hombres y mujeres, tanto en lo social como en lo personal, así como la significativa evolución experimentada a lo largo de los últimos decenios del siglo xvín y en los primeros años del xix.ABSTRACT: Based on autobiographical writings, correspondence and other works of men and women linked to enlightened reformism in eighteenth-century Spain, this paper studies how they played with the notions of intimacy, domesticity and public life when representing models of social organization and building self images. Differences between men and women experiences and languages are underlined, as well as changes during the last decades of the eighteenth century and the beginning of the nineteenth century.

Listeria monocytogenes presence during fermentation, drying and storage of Petrovská klobása sausage

Science.gov (United States)

Janković, V.; Mitrović, R.; Lakićević, B.; Velebit, B.; Baltić, T.

2017-09-01

The majority of human listeriosis cases appear to be caused by consumption of ready-to-eat (RTE) foods contaminated at the time of consumption with high levels of Listeria monocytogenes. Although strategies to prevent growth of L. monocytogenes in RTE products are critical for reducing the incidence of human listeriosis, this pathogen is highly difficult to control in fermented sausage processing environments due to its high tolerance to low pH and high salt concentration. The aims of the present study were to investigate the occurrence, presence and elimination of L. monocytogenes in Petrovská klobása sausage during processing, fermentation, drying and storage. L. monocytogenes, which was detected at the beginning of the production cycle, disappeared before day 30. The pathogen decline was much faster in those sausages which were dried in controlled, industrial conditions than in those dried applying the traditional, household technique.

Inhibitory effect of liposome-entrapped lemongrass oil on the growth of Listeria monocytogenes in cheese.

Science.gov (United States)

Cui, H Y; Wu, J; Lin, L

2016-08-01

Listeria monocytogenes infection in dairy products is of mounting public concern. To inhibit bacterial growth, we engineered stimuli-responsive liposomes containing lemongrass oil for this study. The controlled release of liposome-entrapped lemongrass oil is triggered by listerolysin O, secreted by L. monocytogenes. We investigated the antibiotic activities of lemongrass oil liposomes against L. monocytogenes in cheese. We also assessed their possible effects on the quality of the cheese. Liposomes containing lemongrass oil (5.0mg/mL) presented the optimal polydispersity index (0.246), zeta-potential (-58.9mV) and entrapment efficiency (25.7%). The liposomes displayed satisfactory antibiotic activity against L. monocytogenes in cheese over the storage period at 4°C. We observed no effects on the physical and sensory properties of the cheese after the liposome treatment. Copyright © 2016 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

Spatial and Temporal Factors Associated with an Increased Prevalence of Listeria monocytogenes in Spinach Fields in New York State

Science.gov (United States)

Weller, Daniel; Wiedmann, Martin

2015-01-01

While rain and irrigation events have been associated with an increased prevalence of foodborne pathogens in produce production environments, quantitative data are needed to determine the effects of various spatial and temporal factors on the risk of produce contamination following these events. This study was performed to quantify these effects and to determine the impact of rain and irrigation events on the detection frequency and diversity of Listeria species (including L. monocytogenes) and L. monocytogenes in produce fields. Two spinach fields, with high and low predicted risks of L. monocytogenes isolation, were sampled 24, 48, 72, and 144 to 192 h following irrigation and rain events. Predicted risk was a function of the field's proximity to water and roads. Factors were evaluated for their association with Listeria species and L. monocytogenes isolation by using generalized linear mixed models (GLMMs). In total, 1,492 (1,092 soil, 334 leaf, 14 fecal, and 52 water) samples were collected. According to the GLMM, the likelihood of Listeria species and L. monocytogenes isolation from soil samples was highest during the 24 h immediately following an event (odds ratios [ORs] of 7.7 and 25, respectively). Additionally, Listeria species and L. monocytogenes isolates associated with irrigation events showed significantly lower sigB allele type diversity than did isolates associated with precipitation events (P = monocytogenes contamination. Small changes in management practices (e.g., not irrigating fields before harvest) may therefore reduce the risk of L. monocytogenes contamination of fresh produce. PMID:26116668

Diversity assessment of Listeria monocytogenes biofilm formation: Impact of growth condition, serotype and strain origin

NARCIS (Netherlands)

Kadam, S.R.; Besten, den H.M.W.; Veen, van der S.; Zwietering, M.H.; Moezelaar, R.; Abee, T.

2013-01-01

The foodborne pathogen Listeria monocytogenes has the ability to produce biofilms in food-processing environments and then contaminate food products, which is a major concern for food safety. The biofilm forming behavior of 143 L. monocytogenes strains was determined in four different media that

Isolation and characterization of an atypical Listeria monocytogenes associated with a canine urinary tract infection

Science.gov (United States)

Listeria monocytogenes, a well-described cause of encephalitis and abortion in ruminants and of food-borne illness in humans, is rarely associated with disease in companion animals. A case of urinary tract infection associated with an atypical, weakly hemolytic L. monocytogenes strain is described i...

Prevalence and quantification of Listeria monocytogenes in chicken offal at the retail level in Malaysia.

Science.gov (United States)

Kuan, C H; Goh, S G; Loo, Y Y; Chang, W S; Lye, Y L; Puspanadan, S; Tang, J Y H; Nakaguchi, Y; Nishibuchi, M; Mahyudin, N A; Radu, S

2013-06-01

A total of 216 chicken offal samples (chicken liver = 72; chicken heart = 72; chicken gizzard = 72) from wet markets and hypermarkets in Selangor, Malaysia, were examined for the presence and density of Listeria monocytogenes by using a combination of the most probable number and PCR method. The prevalence of L. monocytogenes in 216 chicken offal samples examined was 26.39%, and among the positive samples, the chicken gizzard showed the highest percentage at 33.33% compared with chicken liver (25.00%) and chicken heart (20.83%). The microbial load of L. monocytogenes in chicken offal samples ranged from Malaysia.

Inhibition of Listeria monocytogenes by propionic acid-based ingredients in cured deli-style Turkey.

Science.gov (United States)

Glass, Kathleen A; McDonnell, Lindsey M; Von Tayson, Roxanne; Wanless, Brandon; Badvela, Mani

2013-12-01

Listeria monocytogenes growth can be controlled on ready-to-eat meats through the incorporation of antimicrobial ingredients into the formulation or by postlethality kill steps. However, alternate approaches are needed to provide options that reduce sodium content but maintain protection against pathogen growth in meats after slicing. The objective of this study was to determine the inhibition of L. monocytogenes by propionic acid-based ingredients in high-moisture, cured turkey stored at 4 or 7°C. Six formulations of sliced, cured (120 ppm of NaNO2 ), deli-style turkey were tested, including control without antimicrobials, 3.2% lactate-diacetate blend (LD), 0.4% of a liquid propionate-benzoate-containing ingredient, or 0.3, 0.4, and 0.5% of a liquid propionate-containing ingredient. Products were inoculated with 5 log CFU L. monocytogenes per 100-g package (3 log CFU/ml rinsate), vacuum-sealed, and stored at 4 or 7°C for up to 12 weeks; and populations were enumerated by plating on modified Oxford agar. As expected, the control without antimicrobials supported rapid growth, with >2 log average per ml rinsate increase within 4 weeks of storage at 4°C, whereas growth was observed at 6 weeks for the LD treatment. For both replicate trials, all treatments that contained liquid propionate or propionate-benzoate limited L. monocytogenes growth to an increase of 1-log increase) was observed in individual samples for all propionate-containing treatments at weeks 10, 11, and 12. As expected, L. monocytogenes grew more rapidly when products were stored at 7°C, but trends in relative inhibition were similar to those observed at 4°C. These results verify that propionate-based ingredients inhibit growth of L. monocytogenes on sliced, high-moisture, cured turkey and can be considered as an alternative to reduce sodium-based salts while maintaining food safety.

Genome Sequences of Two Listeria monocytogenes Strains from Nectarines Associated with Listeriosis in 2014

Science.gov (United States)

Lu, Chunye; Marjanovic, Olivera; Kiang, David

2017-01-01

ABSTRACT Listeria monocytogenes is an important foodborne pathogen. Here, we present the annotated whole genome of Listeria monocytogenes strains F14M01297-C2 and F14M01297-C4, isolated from nectarines distributed by a packing facility in California during an investigation of listeriosis associated with stone fruit in 2014. PMID:28729255

Phenotypic and Genotypic Characteristics of Listeria monocytogenes Isolated From Dairy and Meat Products

OpenAIRE

Bahador; Sadeghi Kalani; Valian; Irajian; Lotfollahi

2015-01-01

Background Listeria monocytogenes is a foodborne pathogen and a serious threat to the public health in the world. Consumption of traditional foods such as dairy and meat products can be a major reason for relative abundance and isolation of these bacteria. Objectives The purpose of this study was to determine the phenotypic and genotypic characteristics of L. monocytogenes strains isolated from dairy and meat products. ...

Assessing the capacity of growth, survival, and acid adaptive response of Listeria monocytogenes during storage of various cheeses and subsequent simulated gastric digestion.

Science.gov (United States)

Kapetanakou, Anastasia E; Gkerekou, Maria A; Vitzilaiou, Eirini S; Skandamis, Panagiotis N

2017-04-04

Different physicochemical and microbiological characteristics of cheeses may affect Listeria monocytogenes potential to grow, survive, or exhibit an acid adaptive response during storage and digestion. The objectives of the present study were to assess: i) the survival or growth potential of L.monocytogenes on various cheeses during storage, ii) the effect of initial indigenous microbiota on pathogen growth in comparison to expected growth curves retrieved by existing predictive models, and iii) the impact of habituation on/in cheeses surfaces on the subsequent acid resistance during simulated gastric digestion. Portions of cream (Cottage and Mascarpone), soft (Anthotyros, Camembert, Mastelo®, Manouri, Mozzarella, Ricotta), and semi-hard (Edam, Halloumi, Gouda) cheeses were inoculated with ca. 100CFU/g or cm 2 of L.monocytogenes and stored under vacuum or aerobic conditions at 7°C (n=4). The impact of varying (initial) levels of starter culture or indigenous spoilage microbiota on pathogen growth was evaluated by purchasing cheese packages on different dates in relation to production and expiration date (subsequently reflecting to different batches) mimicking a potential situation of cheese contamination with L.monocytogenes during retail display. Values of pH and a w were also monitored and used to simulate growth of L. monocytogenes by existing models and compare it with the observed data of the study. Survival in simulated gastric fluid (SGF) (pH1.5; HCl; max. 120min) was assessed at three time points during storage. Mascarpone, Ricotta, Mozzarella, Camembert, and Halloumi supported L.monocytogenes growth by 0.5-0.8logCFU/g or cm 2 per day, since low initial levels of total viable counts (TVC) (1.8-3.8logCFU/g or cm 2 ) and high pH/a w values (ca. 6.23-6.64/0.965-0.993) were recorded. On Cottage, Anthotyros, Manouri, Mastelo®, Edam, and Gouda, the pathogen survived at populations similar or lower than the inoculation level due to the high reported competition

Various Ready-to-Eat Products from Retail Stores Linked to Occurrence of Diverse Listeria monocytogenes and Listeria spp. Isolates.

Science.gov (United States)

Vongkamjan, Kitiya; Fuangpaiboon, Janejira; Turner, Matthew P; Vuddhakul, Varaporn

2016-02-01

Listeriosis outbreaks have been associated with a variety of foods. This study investigated the prevalence and diversity of Listeria monocytogenes and Listeria spp. in ready-to-eat (RTE) products and evaluated the performance of a rapid detection method, the 3M molecular detection assay for L. monocytogenes (MDA-LM), for detection of L. monocytogenes. Assay results were compared with those obtained using the U.S. Food and Drug Administration standard culture method described in the Bacteriological Analytical Manual. Products (n = 200) were purchased from retail stores: 122 aquatic products, 22 products of animal origin, 18 vegetarian products, 15 deli meat products, 13 salad and vegetable products, 4 desserts, 2 egg-based products, and 4 other products. L. monocytogenes prevalence was comparable with both methods. Overall, 15 (7.5%) of 200 samples were positive for L. monocytogenes: 3% of aquatic products, 1.5% of products of animal origin, 1% of vegetarian products, and 2% of deli meat products. Compared with the standard culture method, the sensitivity, specificity, and the accuracy of the MDA-LM were 86.7% (95% confidence interval, 58.4 to 97.7%), 98.4% (95% confidence interval, 95.0 to 99.6%), and 97.5%, respectively. Using the culture-based method, 18 (9%) of 200 samples were positive for Listeria species other than L. monocytogenes. Listeria isolates from these samples were classified into nine allelic types (ATs). The majority of isolates were classified as ATs 58 and 74, which were identified as L. monocytogenes lineages I and IV, respectively. Listeria innocua and Listeria welshimeri also were represented by isolates of multiple ATs. The MDA-LM is a rapid and reliable technique for detecting L. monocytogenes in various RTE foods. Further study is needed to develop effective control strategies to reduce L. monocytogenes contamination in RTE foods.

Effect of packaging and storage time on survival of Listeria monocytogenes on kippered beef steak and turkey tenders.

Science.gov (United States)

Uppal, Kamaldeep K; Getty, Kelly J K; Boyle, Elizabeth A E; Harper, Nigel M; Lobaton-Sulabo, April Shayne S; Barry, Bruce

2012-01-01

The objective of our study was to determine effect of packaging method and storage time on reducing Listeria monocytogenes in shelf-stable meat snacks. Commercially available kippered beef steak strips and turkey tenders were dipped into a 5-strain L. monocytogenes cocktail, and dried at 23 °C until a water activity of 0.80 was achieved. Inoculated samples were packaged with 4 treatments: (1) vacuum, (2) nitrogen flushed with oxygen scavenger, (3) heat sealed with oxygen scavenger, and (4) heat sealed without oxygen scavenger. Samples were stored at 23 °C and evaluated for L. monocytogenes levels at 0, 24, 48, and 72 h. Initial levels (time 0) of L. monocytogenes were approximately 5.7 log CFU/cm² for steak and tenders. After 24 h of storage time, a 1 log CFU/cm² reduction of L. monocytogenes was observed for turkey tenders for all packaging treatments. After 48 h, turkey tenders showed >1 log CFU/cm² reduction of L. monocytogenes for all packaging treatments except for vacuum, where only 0.9 log CFU/cm² reduction was observed. After 72 h, reductions for all packaging treatments for turkey tenders ranged from 1.5 to 2.4 log CFU/cm². For kippered beef steak, there was no interaction between the packaging treatments and all storage times (P > 0.05) whereas, time was different (P packaging treatments and a 2.1 log CFU/ cm² L. monocytogenes reduction at 72 h of storage time. Processors of kippered beef steak and turkey tenders could use a combination of vacuum or nitrogen-flushing or heat sealed with an oxygen scavenger packaging methods and a holding time of 24 h prior to shipping to reduce potential L. monocytogenes numbers by ≥1 log. However, processors should be encouraged to hold packaged product a minimum of 72 h to enhance the margin of safety for L. monocytogenes control. © 2011 Institute of Food Technologists®

Pulsed-Field Gel Electrophoresis characterization of Listeria monocytogenes isolates from cheese manufacturing plants in São Paulo, Brazil.

Science.gov (United States)

Barancelli, Giovana V; Camargo, Tarsila M; Gagliardi, Natália G; Porto, Ernani; Souza, Roberto A; Campioni, Fabio; Falcão, Juliana P; Hofer, Ernesto; Cruz, Adriano G; Oliveira, Carlos A F

2014-03-03

This study aimed to evaluate the occurrence of Listeria monocytogenes in cheese and in the environment of three small-scale dairy plants (A, B, C) located in the Northern region state of São Paulo, Brazil, and to characterize the isolates using conventional serotyping and PFGE. A total of 393 samples were collected and analyzed from October 2008 to September 2009. From these, 136 came from dairy plant A, where only L. seeligeri was isolated. In dairy plant B, 136 samples were analyzed, and L. innocua, L. seeligeri and L. welshimeri were isolated together with L. monocytogenes. In dairy plant C, 121 samples were analyzed, and L. monocytogenes and L. innocua were isolated. Cheese from dairy plants B and C were contaminated with Listeria spp, with L. innocua being found in Minas frescal cheese from both dairy plants, and L. innocua and L. monocytogenes in Prato cheese from dairy plant C. A total of 85 L. monocytogenes isolates were classified in 3 serotypes: 1/2b, 1/2c, and 4b, with predominance of serotype 4b in both dairy plants. The 85 isolates found in the dairy plants were characterized by genomic macrorestriction using ApaI and AscI with Pulsed Field Gel Electrophoresis (PFGE). Macrorestriction yielded 30 different pulsotypes. The presence of indistinguishable profiles repeatedly isolated during a 12-month period indicated the persistence of L. monocytogenes in dairy plants B and C, which were more than 100 km away from each other. Brine used in dairy plant C contained more than one L. monocytogenes lineage. The routes of contamination were identified in plants B and C, and highlighted the importance of using molecular techniques and serotyping to track L. monocytogenes sources of contamination, distribution, and routes of contamination in dairy plants, and to develop improved control strategies for L. monocytogenes in dairy plants and dairy products. Copyright © 2013 Elsevier B.V. All rights reserved.

Bacterial biofilm formation in different surfaces of food industries

Directory of Open Access Journals (Sweden)

Karine Angélica Dalla Costa

2017-06-01

Full Text Available The term biofilm describes the sessile microbial life form, characterized by microorganism adhesion to any surface and with the production of extracellular polymeric substances. In food industries, the formation of biofilms results in serious problems, since it can be a contamination source of the food product, compromising the final product quality and consumer health. The aim of this study was to verify the adhesion of biofilms (sessile cells of pathogenic and/or deteriorating bacteria against surfaces of the food industry. The bacterial species tested were Pseudomonas aeruginosa ATCC 27853, Staphylococcus aureus ATCC 29213, Listeria monocytogenes ATCC 19117 and Salmonella Typhimurium ATCC 14028. It was used stainless steel and polypropylene coupons as contact surfaces. The results demonstrated that P. aeruginosa and S. Typhimurium showed higher biofilm formation capacity. Statistically, there was no difference in count of P. aeruginosa and S. Typhimurium (p > 0.05 cells. The same occurred between L. monocytogenes and S. aureus. However, the counts of P. aeruginosa and S. Typhimurium cells were statistically higher than S. aureus and L. monocytogenes (p < 0.05. By means of scanning electron microscopy it was also found increased adhesion of P. aeruginosa. The results revealed that P. aeruginosa was the bacterial species with higher biofilm formation capacity among the others.

Optically Sectioned Imaging of Microvasculature of In-Vivo and Ex-Vivo Thick Tissue Models with Speckle-illumination HiLo Microscopy and HiLo Image Processing Implementation in MATLAB Architecture

Science.gov (United States)

Suen, Ricky Wai

The work described in this thesis covers the conversion of HiLo image processing into MATLAB architecture and the use of speckle-illumination HiLo microscopy for use of ex-vivo and in-vivo imaging of thick tissue models. HiLo microscopy is a wide-field fluorescence imaging technique and has been demonstrated to produce optically sectioned images comparable to confocal in thin samples. The imaging technique was developed by Jerome Mertz and the Boston University Biomicroscopy Lab and has been implemented in our lab as a stand-alone optical setup and a modification to a conventional fluorescence microscope. Speckle-illumination HiLo microscopy combines two images taken under speckle-illumination and standard uniform-illumination to generate an optically sectioned image that reject out-of-focus fluorescence. The evaluated speckle contrast in the images is used as a weighting function where elements that move out-of-focus have a speckle contrast that decays to zero. The experiments shown here demonstrate the capability of our HiLo microscopes to produce optically-sectioned images of the microvasculature of ex-vivo and in-vivo thick tissue models. The HiLo microscope were used to image the microvasculature of ex-vivo mouse heart sections prepared for optical histology and the microvasculature of in-vivo rodent dorsal window chamber models. Studies in label-free surface profiling with HiLo microscopy is also presented.

Listeria monocytogenes Growth Kinetics in Milkshakes Made from Naturally and Artificially Contaminated Ice Cream

Directory of Open Access Journals (Sweden)

Joelle K. Salazar

2018-01-01

Full Text Available This study assessed the growth of Listeria monocytogenes in milkshakes made using the process-contaminated ice cream associated with a listeriosis outbreak in comparison to milkshakes made with artificially contaminated ice cream. For all temperatures, growth kinetics including growth rates, lag phases, maximum populations, and population increases were determined for the naturally and artificially derived contaminants at 5, 10, 15, and 25°C storage for 144 h. The artificially inoculated L. monocytogenes presented lower growth rates and shorter lag phases than the naturally contaminated populations at all temperatures except for 5°C, where the reverse was observed. At 25°C, lag phases of the naturally and artificially contaminated L. monocytogenes were 11.6 and 7.8 h, respectively. The highest increase in population was observed for the artificially inoculated pathogen at 15°C after 96 h (6.16 log CFU/mL of storage. Growth models for both contamination states in milkshakes were determined. In addition, this study evaluated the antimicrobial effectiveness of flavoring agents, including strawberry, chocolate and mint, on the growth of the pathogen in milkshakes during 10°C storage. All flavor additions resulted in decreased growth rates of L. monocytogenes for both contamination states. The addition of chocolate and mint flavoring also resulted in significantly longer lag phases for both contamination states. This study provides insight into the differences in growth between naturally and artificially contaminated L. monocytogenes in a food product.

Listeria monocytogenes Growth Kinetics in Milkshakes Made from Naturally and Artificially Contaminated Ice Cream.

Science.gov (United States)

Salazar, Joelle K; Bathija, Vriddi M; Carstens, Christina K; Narula, Sartaj S; Shazer, Arlette; Stewart, Diana; Tortorello, Mary Lou

2018-01-01

This study assessed the growth of Listeria monocytogenes in milkshakes made using the process-contaminated ice cream associated with a listeriosis outbreak in comparison to milkshakes made with artificially contaminated ice cream. For all temperatures, growth kinetics including growth rates, lag phases, maximum populations, and population increases were determined for the naturally and artificially derived contaminants at 5, 10, 15, and 25°C storage for 144 h. The artificially inoculated L. monocytogenes presented lower growth rates and shorter lag phases than the naturally contaminated populations at all temperatures except for 5°C, where the reverse was observed. At 25°C, lag phases of the naturally and artificially contaminated L. monocytogenes were 11.6 and 7.8 h, respectively. The highest increase in population was observed for the artificially inoculated pathogen at 15°C after 96 h (6.16 log CFU/mL) of storage. Growth models for both contamination states in milkshakes were determined. In addition, this study evaluated the antimicrobial effectiveness of flavoring agents, including strawberry, chocolate and mint, on the growth of the pathogen in milkshakes during 10°C storage. All flavor additions resulted in decreased growth rates of L. monocytogenes for both contamination states. The addition of chocolate and mint flavoring also resulted in significantly longer lag phases for both contamination states. This study provides insight into the differences in growth between naturally and artificially contaminated L. monocytogenes in a food product.

Enoyl-Acyl Carrier Protein Reductase I (FabI) Is Essential for the Intracellular Growth of Listeria monocytogenes

Science.gov (United States)

Ericson, Megan E.; Frank, Matthew W.

2016-01-01

Enoyl-acyl carrier protein reductase catalyzes the last step in each elongation cycle of type II bacterial fatty acid synthesis and is a key regulatory protein in bacterial fatty acid synthesis. Genes of the facultative intracellular pathogen Listeria monocytogenes encode two functional enoyl-acyl carrier protein isoforms based on their ability to complement the temperature-sensitive growth phenotype of Escherichia coli strain JP1111 [fabI(Ts)]. The FabI isoform was inactivated by the FabI selective inhibitor AFN-1252, but the FabK isoform was not affected by the drug, as expected. Inhibition of FabI by AFN-1252 decreased endogenous fatty acid synthesis by 80% and lowered the growth rate of L. monocytogenes in laboratory medium. Robust exogenous fatty acid incorporation was not detected in L. monocytogenes unless the pathway was partially inactivated by AFN-1252 treatment. However, supplementation with exogenous fatty acids did not restore normal growth in the presence of AFN-1252. FabI inactivation prevented the intracellular growth of L. monocytogenes, showing that neither FabK nor the incorporation of host cellular fatty acids was sufficient to support the intracellular growth of L. monocytogenes. Our results show that FabI is the primary enoyl-acyl carrier protein reductase of type II bacterial fatty acid synthesis and is essential for the intracellular growth of L. monocytogenes. PMID:27736774

Occurrence and antimicrobial resistance patterns of Listeria monocytogenes isolated from vegetables.

Science.gov (United States)

de Vasconcelos Byrne, Vanessa; Hofer, Ernesto; Vallim, Deyse Christina; de Castro Almeida, Rogeria Comastri

2016-01-01

Although the consumption of fresh and minimally processed vegetables is considered healthy, outbreaks related to the contamination of these products are frequently reported. Among the food-borne pathogens that contaminate vegetables is Listeria monocytogenes, a ubiquitous organism that exhibits the ability to survive and multiply at refrigerated temperatures. This study aimed to evaluate the occurrence of L. monocytogenes in vegetables as well as the antimicrobial resistance of isolates. The results showed that 3.03% of samples were contaminated with L. monocytogenes, comprising 2.22% of raw vegetables and 5.56% of ready-to-eat vegetables. Multiplex PCR confirmed the virulence potential of the isolates. Antimicrobial resistance profiling showed that 50% of the isolates were susceptible to the antibiotics used. The resistance of one isolate to penicillin G, a commonly employed therapeutic agent, and the presence of serotype 4b, a serotype commonly associated with food-borne outbreaks, could be potential health hazards for consumers. Copyright © 2016 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.

Leucocins 4010 from Leuconostoc carnosum cause a matrix related decrease in intracellular pH of Listeria monocytogenes

DEFF Research Database (Denmark)

Fang, Weihuan; Budde, Birgitte Bjørn; Siegumfeldt, Henrik

2006-01-01

A mixed culture of single cells of Listeria monocytogenes and the bacteriocin producing Leuconostoc carnosum 4010 showed growth inhibition of L. monocytogenes, although the intracellular pH (pHi) of L. monocytogenes followed by fluorescence ratio imaging microscopy was not affected. Furthermore, L...

Evaluation of near-infrared pasteurization in controlling Escherichia coli O157:H7, Salmonella enterica serovar typhimurium, and Listeria monocytogenes in ready-to-eat sliced ham.

Science.gov (United States)

Ha, Jae-Won; Ryu, Sang-Ryeol; Kang, Dong-Hyun

2012-09-01

This study was conducted to investigate the efficacy of near-infrared (NIR) heating to reduce Salmonella enterica serovar Typhimurium, Escherichia coli O157:H7, and Listeria monocytogenes in ready-to-eat (RTE) sliced ham compared to conventional convective heating, and the effect of NIR heating on quality was determined by measuring the color and texture change. A cocktail of three pathogens was inoculated on the exposed or protected surfaces of ham slices, followed by NIR or conventional heating at 1.8 kW. NIR heating for 50 s achieved 4.1-, 4.19-, and 3.38-log reductions in surface-inoculated S. Typhimurium, E. coli O157:H7, and L. monocytogenes, respectively, whereas convective heating needed 180 s to attain comparable reductions for each pathogen. There were no statistically significant (P > 0.05) differences in reduction between surface- and internally inoculated pathogens at the end of NIR treatment (50 s). However, when treated with conventional convective heating, significant (P 0.05) different from those of nontreated samples. These results suggest that NIR heating can be applied to control internalized pathogens as well as surface-adhering pathogens in RTE sliced meats without affecting product quality.

Listeria monocytogenes cross-contamination of cheese: risk throughout the food supply chain.

Science.gov (United States)

Sauders, B D; D'Amico, D J

2016-10-01

Listeria monocytogenes has been the most common microbial cause of cheese-related recalls in both the United States and Canada in recent years. Since L. monocytogenes is inactivated by pasteurization, the majority of these cases have been linked to environmental and cross-contamination of fresh-soft, soft-ripened, and semi-soft cheeses. Cross-contamination of foods with L. monocytogenes is a continuous risk throughout the food supply chain and presents unique challenges for subsequent illness and outbreak investigations. Reports on outbreaks of listeriosis attributed to cross-contamination downstream from primary processing help highlight the critical role of epidemiological investigation coupled with coordinated molecular subtyping and surveillance in the recognition and investigation of complex foodborne outbreaks. Despite their complexity, environmental sampling throughout the supply chain coupled with improved genotyping approaches and concomitant analysis of foodborne illness epidemiological exposure data are needed to help resolve these and similar cases more rapidly and with greater confidence.

Genotypic profile of Listeria monocytogenes isolated in refrigerated chickens in southern Rio Grande do Sul, Brazil

Directory of Open Access Journals (Sweden)

Karla Sequeira Mendonça

2016-01-01

Full Text Available ABSTRACT: Listeria monocytogenes is of notable concern to the food industry, due to its ubiquitous nature and ability to grow in adverse conditions. This study aimed to determine the genotypic profile of L. monocytogenes strains isolated from refrigerated chickens marketed in the southern part of Rio Grande do Sul, Brazil. The strains of L. monocytogenes isolated were characterized by serotyping and Pulsed Field Gel Electrophoresis (PFGE. Three different serotypes (1/2a, 1/2b and 4e were evaluated by PFGE, and the macrorestriction patterns utilizing enzymes AscI and ApaI, revealed five different pulsotypes. The presence of such varied genotypic profiles demonstrates the prevalence of L. monocytogenes contamination of chicken processing environments, which combined with ineffective cleaning procedures, allowing the survival, adaptation and proliferation of these pathogens, not only in the processing environment, but also in local grocery stores.

New perspectives on the gastrointestinal mode of transmission in invasive Listeria monocytogenes infection

Energy Technology Data Exchange (ETDEWEB)

Schlech, W.F. III

1984-01-01

The route or mechanism of transmission of Listeria monocytogenes from its rural veterinary reservoir to newborn and older human populations has been obscure. Anecdotal reports of milk-borne infection from cows with Listeria mastitis have been published, but intensive investigations of small outbreaks of L. monocytogenes infections in humans have not supported a gastrointestinal mode of infection. Several recent studies, however, strongly suggest this possibility, and case-control studies of epidemic listeriosis in the Canadian Maritime provinces in 1981 documented an association between ingestion of uncooked vegetables and the development of illness (p = 0.02). In that study, coleslaw from a regional producer which was distributed throughout the Maritimes was considered to be the vehicle of transmission. Cabbage, the raw product in the production of coleslaw, was contaminated at a farm prior to arrival at the plant. Contamination occurred through fertilization with raw manure from a flock of sheep known to harbor L. monocytogenes. Therefore, an indirect link was established between Listeria monocytogenes infection of sheep on a cabbage farm and subsequent development of invasive listeriosis in humans. This study supports findings from other epidemiologic studies of human listeriosis and is consistent with results of investigations into the mode of transmission of natural and laboratory-acquired listeriosis in animals. 34 references.

The use of Listeria monocytogenes as a DNA delivery vector for cancer gene therapy.

LENUS (Irish Health Repository)

Tangney, Mark

2012-01-31

Listeria monocytogenes is an intracellular pathogen that lyses the phagosomal vacuole of infected cells, proliferates in the host cell cytoplasm and can actively enter adjacent cells. The pathogen is therefore well suited to exploitation as a vector for the delivery of DNA to target cells as the lifecycle favors cellular targeting with vector amplification and the potential for cell-to-cell spread. We have recently demonstrated DNA transfer by L. monocytogenes in growing tumors in murine models. Our approach exploited an ampicillin sensitive stain of L. monocytogenes which can be lysed through systemic administration of ampicillin to facilitate release of plasmid DNA for expression by infected mammalian cells. Here, we discuss the implications of this technology and the potential for future improvements of the system.

Antibacterial activity of bacteriocin-like substance P34 on Listeria monocytogenes in chicken sausage

Directory of Open Access Journals (Sweden)

Voltaire Sant'Anna

2013-12-01

Full Text Available The antimicrobial activity of the bacteriocin-like substance (BLS P34 against Listeria monocytogenes was investigated in chicken sausage. The BLS was applied to chicken sausages (256 AU g-1 previously inoculated with a suspension of 10² cfu g-1 of L. monocytogenes. BLS P34 inhibited the indicator microorganism in situ in all incubation times for up to 10 days at 5 °C. The effectiveness of BLS P34 was increased when it was added in combination with nisin. The bacteriocin was also tested in natural eatable natural bovine wrapping (salty semi-dried tripe against the same indicator microorganism, also showing inhibitory capability in vitro. BLS P34 showed potential to control L. monocytogenes in refrigerated meat products.

Prevalence of Listeria monocytogenes in retailed meat in the Tokyo metropolitan area.

Science.gov (United States)

Ochiai, Yoshitsugu; Yamada, Fumiya; Batmunkh, Otgonchimeg; Mochizuki, Mariko; Takano, Takashi; Hondo, Ryo; Ueda, Fukiko

2010-09-01

This study was conducted to determine the prevalence of Listeria monocytogenes in retailed meats, comprising beef, chicken, and pork, in the Tokyo metropolitan area. A total of 379 samples of retailed meat were collected from 1998 to 2003, most of which were obtained by simultaneously purchasing the three classes of meat from a shop and then making another simultaneous purchase of meat from the same shop a few weeks later. The prevalence of L. monocytogenes was 28.0%, and the serotypes isolated were mainly 1/2a, 1/2b, 1/2c, and 4b. Comparison of the prevalence of each serotype among the classes of meat showed a predominant distribution of serotypes 1/2a, 1/2b, and 4b in chicken, while serotype 1/2c was dominant in pork. A total of nine cases considered to be due to persistence and/or cross-contamination were found. Most of the strains involved in persistence and/or cross-contamination were of serotypes 1/2c or 4b. These results suggest that contamination in retailed meat in Japan is at almost the same level as in other countries and that chicken has the highest potential as a source of contamination and infection. In addition, we suggest that the ecological niche of serotype 1/2c is distinct from those of 1/2a, 1/2b, and 4b, which may explain why human hosts have less opportunity to be exposed to serotype 1/2c and why there is a lower rate of isolation of this serotype from cases of human listeriosis.

Enrichment dynamics of Listeria monocytogenes and the associated microbiome from naturally contaminated ice cream linked to a listeriosis outbreak.

Science.gov (United States)

Ottesen, Andrea; Ramachandran, Padmini; Reed, Elizabeth; White, James R; Hasan, Nur; Subramanian, Poorani; Ryan, Gina; Jarvis, Karen; Grim, Christopher; Daquiqan, Ninalynn; Hanes, Darcy; Allard, Marc; Colwell, Rita; Brown, Eric; Chen, Yi

2016-11-16

Microbiota that co-enrich during efforts to recover pathogens from foodborne outbreaks interfere with efficient detection and recovery. Here, dynamics of co-enriching microbiota during recovery of Listeria monocytogenes from naturally contaminated ice cream samples linked to an outbreak are described for three different initial enrichment formulations used by the Food and Drug Administration (FDA), the International Organization of Standardization (ISO), and the United States Department of Agriculture (USDA). Enrichment cultures were analyzed using DNA extraction and sequencing from samples taken every 4 h throughout 48 h of enrichment. Resphera Insight and CosmosID analysis tools were employed for high-resolution profiling of 16S rRNA amplicons and whole genome shotgun data, respectively. During enrichment, other bacterial taxa were identified, including Anoxybacillus, Geobacillus, Serratia, Pseudomonas, Erwinia, and Streptococcus spp. Surprisingly, incidence of L. monocytogenes was proportionally greater at hour 0 than when tested 4, 8, and 12 h later with all three enrichment schemes. The corresponding increase in Anoxybacillus and Geobacillus spp.indicated these taxa co-enriched in competition with L. monocytogenes during early enrichment hours. L. monocytogenes became dominant after 24 h in all three enrichments. DNA sequences obtained from shotgun metagenomic data of Listeria monocytogenes at 48 h were assembled to produce a consensus draft genome which appeared to have a similar tracking utility to pure culture isolates of L. monocytogenes. All three methods performed equally well for enrichment of Listeria monocytogenes. The observation of potential competitive exclusion of L. mono by Anoxybacillus and Geobacillus in early enrichment hours provided novel information that may be used to further optimize enrichment formulations. Application of Resphera Insight for high-resolution analysis of 16S amplicon sequences accurately identified L. monocytogenes

Spatial and Temporal Factors Associated with an Increased Prevalence of Listeria monocytogenes in Spinach Fields in New York State.

Science.gov (United States)

Weller, Daniel; Wiedmann, Martin; Strawn, Laura K

2015-09-01

While rain and irrigation events have been associated with an increased prevalence of foodborne pathogens in produce production environments, quantitative data are needed to determine the effects of various spatial and temporal factors on the risk of produce contamination following these events. This study was performed to quantify these effects and to determine the impact of rain and irrigation events on the detection frequency and diversity of Listeria species (including L. monocytogenes) and L. monocytogenes in produce fields. Two spinach fields, with high and low predicted risks of L. monocytogenes isolation, were sampled 24, 48, 72, and 144 to 192 h following irrigation and rain events. Predicted risk was a function of the field's proximity to water and roads. Factors were evaluated for their association with Listeria species and L. monocytogenes isolation by using generalized linear mixed models (GLMMs). In total, 1,492 (1,092 soil, 334 leaf, 14 fecal, and 52 water) samples were collected. According to the GLMM, the likelihood of Listeria species and L. monocytogenes isolation from soil samples was highest during the 24 h immediately following an event (odds ratios [ORs] of 7.7 and 25, respectively). Additionally, Listeria species and L. monocytogenes isolates associated with irrigation events showed significantly lower sigB allele type diversity than did isolates associated with precipitation events (P = <0.001), suggesting that irrigation water may be a point source of L. monocytogenes contamination. Small changes in management practices (e.g., not irrigating fields before harvest) may therefore reduce the risk of L. monocytogenes contamination of fresh produce. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Faecal shedding and strain diversity of Listeria monocytogenes in healthy ruminants and swine in Northern Spain

Directory of Open Access Journals (Sweden)

Hurtado Ana

2009-01-01

Full Text Available Abstract Background Listeria monocytogenes is among the most important foodborne bacterial pathogens due to the high mortality rate and severity of the infection. L. monocytogenes is a ubiquitous organism occasionally present in the intestinal tract of various animal species and faecal shedding by asymptomatically infected livestock poses a risk for contamination of farm environments and raw food at the pre-harvest stages. The aim of this study was to determine the prevalence and strain diversity of L. monocytogenes in healthy ruminants and swine herds. Results Faecal samples from 30 animals per herd were collected from 343 herds (120 sheep, 124 beef cattle, 82 dairy cattle and 17 swine in the Basque Country and screened in pools by an automated enzyme-linked fluorescent immunoassay (VIDAS® to estimate the prevalence of positive herds. Positive samples were subcultured onto the selective and differential agar ALOA and biochemically confirmed. L. monocytogenes was isolated from 46.3% of dairy cattle, 30.6% beef cattle and 14.2% sheep herds, but not from swine. Within-herd prevalence investigated by individually analysing 197 sheep and 221 cattle detected 1.5% of faecal shedders in sheep and 21.3% in cattle. Serotyping of 114 isolates identified complex 4b as the most prevalent (84.2%, followed by 1/2a (13.2%, and PFGE analysis of 68 isolates showed a highly diverse L. monocytogenes population in ruminant herds. Conclusion These results suggested that cattle represent a potentially important reservoir for L. monocytogenes in the Basque Country, and highlighted the complexity of pathogen control at the farm level.

Effect of citral and carvacrol on the susceptibility of Listeria monocytogenes and Listeria innocua to antibiotics.

Science.gov (United States)

Zanini, S F; Silva-Angulo, A B; Rosenthal, A; Rodrigo, D; Martínez, A

2014-05-01

The aim of this study was to evaluate the antibiotic susceptibility of Listeria innocua (L. innocua) and Listeria monocytogenes (L. monocytogenes) cells in the presence of citral and carvacrol at sublethal concentrations in an agar medium. The presence of terpenes in the L. monocytogenes and L. innocua culture medium provided a reduction in the minimal inhibitory concentration (MIC) of all the antibiotics tested. These effects were dependent on the concentration of terpenes present in the culture medium. The combination of citral and carvacrol potentiated antibiotic activity by reducing the MIC values of bacitracin and colistin from 32.0 and 128.0 μg ml⁻¹ to 1.0 and 2.0 μg ml⁻¹, respectively. Thus, both Listeria species became more susceptible to these drugs. In this way, the colistin and bacitracin resistance of L. monocytogenes and L. innocua was reversed in the presence of terpenes. Results obtained in this study show that the phytochemicals citral and carvacrol potentiate antibiotic activity, reducing the MIC values of cultured L. monocytogenes and L. innocua. Phytochemicals citral and carvacrol potentiate antibiotic activity of erythromycin, bacitracin and colistin by reducing the MIC values of cultured Listeria monocytogenes and Listeria innocua. This effect in reducing the MIC values of the antibiotics tested in both micro-organisms was increased when natural antimicrobials were combined. This finding indicated that the combination among terpenes and antibiotic may contribute in reducing the required dosage of antibiotics due to the possible effect of terpenes on permeation barrier of the micro-organism cell membrane. © 2014 The Society for Applied Microbiology.

Sensitive enumeration of Listeria monocytogenes and other Listeria species in various naturally contaminated matrices using a membrane filtration method.

Science.gov (United States)

Barre, Léna; Brasseur, Emilie; Doux, Camille; Lombard, Bertrand; Besse, Nathalie Gnanou

2015-06-01

For the enumeration of Listeria monocytogenes (L. monocytogenes) in food, a sensitive enumeration method has been recently developed. This method is based on a membrane filtration of the food suspension followed by transfer of the filter on a selective medium to enumerate L. monocytogenes. An evaluation of this method was performed with several categories of foods naturally contaminated with L. monocytogenes. The results obtained with this technique were compared with those obtained from the modified reference EN ISO 11290-2 method for the enumeration of L. monocytogenes in food, and are found to provide more precise results. In most cases, the filtration method enabled to examine a greater quantity of food thus greatly improving the sensitivity of the enumeration. However, it was hardly applicable to some food categories because of filtration problems and background microbiota interference. Copyright © 2014 Elsevier Ltd. All rights reserved.

77 FR 50185 - LoCorr Fund Management, LLC and LoCorr Investment Trust; Notice of Application

Science.gov (United States)

2012-08-20

... Fund Management, LLC and LoCorr Investment Trust; Notice of Application August 14, 2012. AGENCY.... Applicants: LoCorr Fund Management, LLC (``LFM'' or the ``Adviser'') and LoCorr Investment Trust (the ``Trust... Mary Kay Frech, Branch Chief, at (202) 551-6821 (Division of Investment Management, Office of...

Modelling the growth of Listeria monocytogenes in fresh green coconut (Cocos nucifera L.) water.

Science.gov (United States)

Walter, Eduardo H M; Kabuki, Dirce Y; Esper, Luciana M R; Sant'Ana, Anderson S; Kuaye, Arnaldo Y

2009-09-01

The behaviour of Listeria monocytogenes in the fresh coconut water stored at 4 degrees C, 10 degrees C and 35 degrees C was studied. The coconut water was aseptically extracted from green coconuts (Cocos nucifera L.) and samples were inoculated in triplicate with a mixture of 5 strains of L. monocytogenes with a mean population of approximately 3 log(10) CFU/mL. The kinetic parameters of the bacteria were estimated from the Baranyi model, and compared with predictions of the Pathogen Modelling Program so as to predict its behaviour in the beverage. The results demonstrated that fresh green coconut water was a beverage propitious for the survival and growth of L. monocytogenes and that refrigeration at 10 degrees C or 4 degrees C retarded, but did not inhibit, growth of this bacterium. Temperature abuse at 35 degrees C considerably reduced the lagtimes. The study shows that L. monocytogenes growth in fresh green coconut water is controlled for several days by storage at low temperature, mainly at 4 degrees C. Thus, for risk population this product should only be drunk directly from the coconut or despite the sensorial alterations should be consumed pasteurized.

Poe y lo grotesco moderno

Directory of Open Access Journals (Sweden)

David Roas

2014-10-01

Full Text Available Lo grotesco es una categoría estética que combina el humor y lo terrible (en sus muy diversas acepciones. Desde su primera manifestación carnavalesca, en la que la risa tiene un claro matiz festivo, lo grotesco ha ido evolucionando hacia posiciones donde, sin perder su dimensión humorística, se ha potenciado el componente siniestro, macabro, incluso terrorífico. Algunos cuentos de Edgar Allan Poe nos ofrecen una interesante encarnación de esa visión moderna de lo grotesco, con objetivos y formas variadas, que van desde la parodia y la sátira, a la manifestación más absurda y delirante de dicha categoría. Su análisis y comentario servirá también para alejar esos relatos de la órbita de lo fantástico, donde algunos críticos, equivocadamente, los han situado.

Listeria monocytogenes in RTE foods marketed in Italy: prevalence and automated EcoRI ribotyping of the isolates.

Science.gov (United States)

Meloni, Domenico; Galluzzo, Pietro; Mureddu, Anna; Piras, Francesca; Griffiths, Mansel; Mazzette, Rina

2009-02-15

The aims of the present study were: (a) to investigate the prevalence and the enumeration of Listeria monocytogenes in 200 samples of ready to eat (RTE) foods of animal and vegetal origin collected from different outlets and processing plants in Sardinia; (b) to characterize the isolates by phenotypical and molecular methods; (c) to analyze a subset of 42 L. monocytogenes by automated EcoRI ribotyping in order to predict the strain's potential virulence for humans. The strains were isolated from: smoked fish products, cooked marinated products, meat products and pre-packaged mixed vegetable salads. Of the samples tested, 22% were positive for Listeria spp. The prevalence of L. monocytogenes was 9.5%, while the level of L. monocytogenes in the positive samples was 93%), belonging to 17 different DuPont Identification Library Codes (DUP-IDs) clones. The Simpson's numerical index of discrimination was 0.911. Cluster analysis pointed out a high similarity among strains isolated from meat, fish, and vegetables of different origin. These results confirmed the existence of a widespread population of L. monocytogenes, characterized by highly related strains existing in different geographical areas. 65% of these strains belonged to lineage II (serotypes 1/2a and 1/2c), subtypes known to be associated with sporadic human listeriosis outbreaks. The remaining 35% of the isolates (serotypes 1/2b, 3b and 4b) were allocated to lineage I and belong to distinct clonal groups (DUP-ID 1038 and 1042), which again have been associated with several outbreaks of human listeriosis. Neither atypical profiles nor lineage III strains were found. EcoRI ribotyping was confirmed as a rapid and reliable method for L. monocytogenes typing, providing useful data for epidemiologic and clonality surveys of L. monocytogenes strains isolated from RTE foods.

Differential gene expression and filamentation of Listeria monocytogenes 08-5923 exposed to sodium lactate and sodium diacetate.

Science.gov (United States)

Liu, Xiaoji; Basu, Urmila; Miller, Petr; McMullen, Lynn M

2017-05-01

This study reports the gene expression and filamentation in Listeria monocytogenes 08-5923 following exposure to food preservatives sodium lactate (NaL) and sodium diacetate (SD). L. monocytogenes 08-5923 was challenged with a mixture of NaL/SD, NaL or sodium acetate at 37 °C in tryptic soy broth. In the initial study, L. monocytogenes 08-5923 was exposed to NaL/SD for 24 h. The transcriptome was investigated by RNA sequencing. A stress response network was discovered in L. monocytogenes 08-5923, which is mediated by genes encoding two-component systems (hisJ, lisK, OmpR family gene, resE) and RNA polymerase factors (sigC, sigH). NaL/SD resulted in the down-regulation of genes in glycolysis (pykA, eno, fbaA, pgm) and up-regulation of genes in DNA repair (radC), cell division (ftsE) and cell structure synthesis (flagella synthesis: flgK, fliF, fliD). Filamentation was monitored by flow cytometry. NaL/SD mixture resulted in filamentation in L. monocytogenes 08-5923. Longer exposure was required to induce filamentation in L. monocytogenes for SD (24 h) than for NaL (8 h) when cells were exposed to individual salt. The quantitative real time PCR analysis revealed the down-regulation of ftsE in filamented cells of Listeria exposed to NaL or sodium acetate. Copyright © 2016 Elsevier Ltd. All rights reserved.

Development of multiple strain competitive index assays for Listeria monocytogenes using pIMC; a new site-specific integrative vector

Directory of Open Access Journals (Sweden)

Cronin Michael

2008-06-01

Full Text Available Abstract Background The foodborne, gram-positive pathogen, Listeria monocytogenes, is capable of causing lethal infections in compromised individuals. In the post genomic era of L. monocytogenes research, techniques are required to identify and validate genes involved in the pathogenicity and environmental biology of the organism. The aim here was to develop a widely applicable method to tag L. monocytogenes strains, with a particular emphasis on the development of multiple strain competitive index assays. Results We have constructed a new site-specific integrative vector, pIMC, based on pPL2, for the selection of L. monocytogenes from complex samples. The pIMC vector was further modified through the incorporation of IPTG inducible markers (antibiotic and phenotypic to produce a suite of four vectors which allowed the discrimination of multiple strains from a single sample. We were able to perform murine infection studies with up to four EGDe isolates within a single mouse and showed that the tags did not impact upon growth rate or virulence. The system also allowed the identification of subtle differences in virulence between strains of L. monocytogenes commonly used in laboratory studies. Conclusion This study has developed a competitive index assay that can be broadly applied to all L. monocytogenes strains. Improved statistical robustness of the data was observed, resulting in fewer mice being required for virulence assays. The competitive index assays provide a powerful method to analyse the virulence or fitness of L. monocytogenes in complex biological samples.

Effect of Listeria seeligeri or Listeria welshimeri on Listeria monocytogenes detection in and recovery from buffered Listeria enrichment broth.

Science.gov (United States)

Dailey, Rachel C; Welch, Lacinda J; Hitchins, Anthony D; Smiley, R Derike

2015-04-01

The presence of multiple species of Listeria in regulated food products is not uncommon and can complicate the recovery of Listeria monocytogenes particularly on a non-differentiating medium. The potential complications of Listeria seeligeri and Listeria welshimeri on the recovery of L. monocytogenes from inoculated food test samples using the U.S. Food and Drug Administration's (FDA) selective enrichment procedure was investigated. Post-enrichment enumeration, in the absence of food product, indicates that some L. seeligeri and L. monocytogenes pairings may have population differentials as great as 2.7 ± 0.1 logs with L. seeligeri being the predominant species. A similar observation was noted for L. welshimeri and L. monocytogenes pairings which resulted in population differentials as large as 3.7 ± 0.2 logs with L. welshimeri being the predominant species. Select strain pairings were used to inoculate guacamole, crab meat, broccoli, and cheese with subsequent recovery by the FDA Bacteriological Analytical Manual (BAM) method with 10 colonies per sample selected for confirmation. The presence of L. seeligeri had little effect on the recovery of L. monocytogenes. The presence of L. welshimeri resulted in the failure to recover L. monocytogenes in three out of the four food matrices. This work extends the observation that non-pathogenic species of Listeria can complicate the recovery of L. monocytogenes and that competition during selective enrichment is not limited to the presence of just Listeria innocua. Published by Elsevier Ltd.

Effect of Listeria seeligeri or Listeria welshimeri on Listeria monocytogenes detection in and recovery from buffered Listeria enrichment broth☆

Science.gov (United States)

Dailey, Rachel C.; Welch, Lacinda J.; Hitchins, Anthony D.; Smiley, R. Derike

2016-01-01

The presence of multiple species of Listeria in regulated food products is not uncommon and can complicate the recovery of Listeria monocytogenes particularly on a non-differentiating medium. The potential complications of Listeria seeligeri and Listeria welshimeri on the recovery of L. monocytogenes from inoculated food test samples using the U.S. Food and Drug Administration's (FDA) selective enrichment procedure was investigated. Post-enrichment enumeration, in the absence of food product, indicates that some L. seeligeri and L. monocytogenes pairings may have population differentials as great as 2.7 ± 0.1 logs with L. seeligeri being the predominant species. A similar observation was noted for L. welshimeri and L. monocytogenes pairings which resulted in population differentials as large as 3.7 ± 0.2 logs with L. welshimeri being the predominant species. Select strain pairings were used to inoculate guacamole, crab meat, broccoli, and cheese with subsequent recovery by the FDA Bacteriological Analytical Manual (BAM) method with 10 colonies per sample selected for confirmation. The presence of L. seeligeri had little effect on the recovery of L. monocytogenes. The presence of L. welshimeri resulted in the failure to recover L. monocytogenes in three out of the four food matrices. This work extends the observation that non-pathogenic species of Listeria can complicate the recovery of L. monocytogenes and that competition during selective enrichment is not limited to the presence of just Listeria innocua. PMID:25475325

Modelling and predicting the simultaneous growth of Listeria monocytogenes and spoilage micro-organisms in cold-smoked salmon

DEFF Research Database (Denmark)

Gimenez, B.; Dalgaard, Paw

2004-01-01

Aims: To evaluate and model the simultaneous growth of Listeria monocytogenes and spoilage micro-organisms in cold-smoked salmon.Methods and Results: Growth kinetics of L. monocytogenes, lactic acid bacteria (LAB), Enterobacteriaceae, enterococci and Photobacterium phosphoreum were determined...

Self-contained chlorine dioxide generation and delivery pods for controlling Listeria monocytogenes in model floor drains.

Science.gov (United States)

Listeria monocytogenes is a foodborne pathogen that has been associated with poultry products. This organism is ubiquitous in nature and has been found to enter poultry further processing plants on incoming raw product. Once in the plant, L. monocytogenes can become a long term persistent colonize...

Survival of Listeria monocytogenes in low acid italian sausage produced under brazilian conditions Sobrevivência de Listeria monocytogenes em salame tipo italiano de baixa acidez, produzido sob condições brasileiras de fabricação

Directory of Open Access Journals (Sweden)

Roberto Degenhardt

2007-06-01

Full Text Available Dry sausages have been considered ready-to-eat products with low risk of causing listeriosis due to the hurdles created during the manufacturing process such as low pH and a w, high salt concentration and presence of lactic acid bacteria (LAB. However, several studies have detected survival of Listeria monocytogenes in these products and also shown that process parameters, LAB and L. monocytogenes strains directly influence the results. In this work, survival of the pathogen in sausages prepared with three different formulations (one standard formulation, one formulation added of Lactobacillus plantarum and one added of 2% sodium lactate, using the manufacturing process usually employed in Brazil, was evaluated. Naturally contaminated sausages presented a small increase in the counts of L. monocytogenes in the first days of the process, followed by a gradual decrease until the end of the process. In experimentally contaminated samples containing L. plantarum, the reduction of counts of L. monocytogenes during processing was considerable, but there wasn´t significant differences between the treatments.Salames têm sido considerados produtos prontos para o consumo com baixo risco de provocar listeriose devido aos obstáculos criados no processo de fabricação e suas características de pH e atividade água baixos, alta concentração de sal e presença de bactérias lácticas. Entretanto, a sobrevivência de Listeria monocytogenes nesta classe de produtos é verificada e estudos de processo visando à redução da contaminação por este patógeno, têm demonstrado que particularidades como variação dos parâmetros de processo, cepas de bactérias lácticas e de L. monocytogenes influenciam diretamente os resultados. Neste estudo três formulações foram avaliadas (uma padrão, uma com inoculação da cultura Lactobacillus plantarum e outra com adição 2% de lactato de sódio empregando parâmetros de processo comumente praticados no Brasil

Evaluation of bacteriocin-producing Lactobacillus sakei 1 against Listeria monocytogenes 1/2a growth and haemolytic activity Avaliação de Lactobacillus sakei 1 produtor de bacteriocina frente a Listeria monocytogenes 1/2a e sua atividade hemolítica

Directory of Open Access Journals (Sweden)

Rafael C.R. Martinez

2005-03-01

Full Text Available Bacteriocin-producing Lactobacillus sakei 1 was cultivated in Brain-Heart Infusion broth (24 h at 25ºC. The culture supernatant was neutralized, filter sterilized and used to test the activity of bacteriocin against Listeria monocytogenes 1/2a, at 8ºC and 15ºC. Non-bacteriocinogenic Lactobacillus sakei ATCC 15521 was used as a negative control. L. monocytogenes 1/2a was inoculated in culture supernatant medium from L. sakei 1 and L. sakei ATCC 15521 and the listerial populations were determined after 0, 5 and 10 days. The bacteriocin production was quantified as arbitrary units per mL (AU/mL using agar antagonism test. Additionally, to investigate if L. monocytogenes virulence pattern could be changed after bactericion exposure, the ability of L. monocytogenes to cause haemolysis in sheep red blood cells was determined, before and after exposure to bacteriocin at 8ºC. In the presence of the antimicrobial peptide, at 8ºC, L. monocytogenes population decreased, but growth of resistant cells was observed. At 15ºC, there was no difference between test and control. Furthermore, the haemolytic activity of L. monocytogenes 1/2a was not altered by exposure to L. sakei 1 bacteriocin, which suggests no change in its virulence pattern.Lactobacillus sakei 1 produtor de bacteriocina foi cultivado em caldo Infusão Cérebro-Coração por 24h a 25ºC. O sobrenadante da cultura foi neutralizado, esterilizado por filtração e usado para testar a atividade da bacteriocina frente a Listeria monocytogenes 1/2a, a 8ºC e 15ºC. Lactobacillus sakei ATCC 15521 não bacteriocinogênico, foi utilizado como controle negativo. L. monocytogenes 1/2a foi inoculada no sobrenadante da cultura de L.sakei 1 e L. sakei ATCC 15521 e as populações listeriais foram determinadas após 0, 5 e 10 dias. A produção de bacteriocina foi quantificada como unidades arbitrárias por mL (UA/mL, utilizando-se o teste de antagonismo em ágar. Adicionalmente, para investigar se o padr

Modeling and predicting the growth boundary of Listeria monocytogenes in lightly preserved seafood

DEFF Research Database (Denmark)

Mejlholm, Ole; Dalgaard, Paw

2007-01-01

The antimicrobial effect of diacetate and lactate against Listeria monocytogenes was evaluated in challenge tests with vacuum-packaged or modified atmosphere packaged (MAP) cold-smoked salmon, marinated salmon, cold-smoked Greenland halibut, marinated Greenland halibut, and gravad salmon. MAP col...... characteristics required to prevent the growth of L. monocytogenes, thereby making it possible to identify critical control points, and is useful for compliance with the new European Union regulation on ready-to-eat foods (EC 2073/2005)....

Exoproteome analysis reveals higher abundance of proteins linked to alkaline stress in persistent Listeria monocytogenes strains.

Science.gov (United States)

Rychli, Kathrin; Grunert, Tom; Ciolacu, Luminita; Zaiser, Andreas; Razzazi-Fazeli, Ebrahim; Schmitz-Esser, Stephan; Ehling-Schulz, Monika; Wagner, Martin

2016-02-02

surface virulence associated protein SvpA. Furthermore proteins involved in cell wall modification, such as the lipoteichonic acid primase LtaP and the N-acetylmuramoyl-l-alanine amidase (Lmo2591) are more abundant in EGDe than in the persistent strains and could indirectly contribute to virulence. In conclusion this study provides information about a set of proteins that could potentially support survival of L. monocytogenes in abiotic niches in food processing environments. Based on these data, a more detailed analysis of the role of the identified proteins under stresses mimicking conditions in food producing environment is essential for further elucidate the mechanism of the phenomenon of persistence of L. monocytogenes. Copyright © 2015 Elsevier B.V. All rights reserved.

Changes in gene expression during adaptation of Listeria monocytogenes to the soil environment.

Science.gov (United States)

Piveteau, Pascal; Depret, Géraldine; Pivato, Barbara; Garmyn, Dominique; Hartmann, Alain

2011-01-01

Listeria monocytogenes is a ubiquitous opportunistic pathogen responsible for listeriosis. In order to study the processes underlying its ability to adapt to the soil environment, whole-genome arrays were used to analyse transcriptome modifications 15 minutes, 30 minutes and 18 h after inoculation of L. monocytogenes EGD-e in soil extracts. Growth was observed within the first day of incubation and large numbers were still detected in soil extract and soil microcosms one year after the start of the experiment. Major transcriptional reprofiling was observed. Nutrient acquisition mechanisms (phosphoenolpyruvate-dependent phosphotransferase systems and ABC transporters) and enzymes involved in catabolism of specific carbohydrates (β-glucosidases; chitinases) were prevalent. This is consistent with the overrepresentation of the CodY regulon that suggests that in a nutrient depleted environment, L. monocytogenes recruits its extensive repertoire of transporters to acquire a range of substrates for energy production.

Lo Strategic Management Accounting

OpenAIRE

G. INVERNIZZI

2005-01-01

Il saggio indaga gli aggregati informativi e gli elementi che compongono lo strategic management accounting. Sono quindi analizzate le funzioni svolte nei diversi stadi del processo di gestione strategica osservando il suo ruolo all’interno del management accounting. Infine sono approfonditi i rapporti fra i livelli della gestione strategica e lo strategic management accounting.

Visualization of gold and platinum nanoparticles interacting with Salmonella Enteritidis and Listeria monocytogenes

Directory of Open Access Journals (Sweden)

Ewa Sawosz

2010-08-01

Full Text Available Ewa Sawosz1, André Chwalibog2, Jacek Szeliga3, Filip Sawosz2, Marta Grodzik1, Marlena Rupiewicz1, Tomasz Niemiec1, Katarzyna Kacprzyk11Division of Biotechnology and Biochemistry of Nutrition, Warsaw University of Life Sciences, Warsaw, Poland; 2Department of Basic Animal and Veterinary Sciences, University of Copenhagen, Copenhagen, Denmark; 3Division of Microbiology of Analytical Centre, Warsaw University of Life Sciences, Warsaw, PolandPurpose: Rapid development of nanotechnology has recently brought significant attention to the extraordinary biological features of nanomaterials. The objective of the present ­investigation was to evaluate morphological characteristics of the assembles of gold and platinum nanoparticles (nano-Au and nano-Pt respectively, with Salmonella Enteritidis (Gram-negative and Listeria monocytogenes (Gram-positive, to reveal possibilities of constructing bacteria-nanoparticle vehicles.Methods: Hydrocolloids of nano-Au or nano-Pt were added to two bacteria suspensions in the following order: nano-Au + Salmonella Enteritidis; nano-Au + Listeria monocytogenes; nano-Pt + Salmonella Enteritidis; nano-Pt + Listeria monocytogenes. Samples were inspected by transmission electron microscope.Results: Visualization of morphological interaction between nano-Au and Salmonella Enteritidis and Listeria monocytogenes, showed that nano-Au were aggregated within flagella or biofilm network and did not penetrate the bacterial cell. The analysis of morphological effects of interaction of nano-Pt with bacteria revealed that nano-Pt entered cells of Listeria monocytogenes and were removed from the cells. In the case of Salmonella Enteritidis, nano-Pt were seen inside bacteria cells, probably bound to DNA and partly left bacterial cells. After washing and centrifugation, some of the nano-Pt-DNA complexes were observed within Salmonella Enteritidis.Conclusion: The results indicate that the bacteria could be used as a vehicle to deliver nano

Prevalence and characteristics of Listeria monocytogenes in feces of black beef cattle reared in three geographically distant areas in Japan.

Science.gov (United States)

Hasegawa, Megumi; Iwabuchi, Eriko; Yamamoto, Shiori; Muramatsu, Masatake; Takashima, Ikuo; Hirai, Katsuya

2014-02-01

This study was conducted to determine the prevalence and characteristics of Listeria monocytogenes in the feces of black beef cattle reared in geographically distant areas in Japan. We surveyed 130 farms in the following three areas: northern (Hokkaido prefecture), central (Gifu and Mie prefectures), and southern (Oita, Miyazaki, and Kagoshima prefectures) areas and collected 1738 fecal samples. Our data showed the following isolation rate for each area: northern, 11.4% of 651; central, 2.8% of 572; and southern, 2.9% of 515, indicating that the isolation rate in the northern area was significantly higher than that in the central or southern areas (pprevalent serotype (40.5%), followed by 1/2a (36.9%), 4b (21.6%), and 4ab (1.0%). In the northern area, multiple serotypes were isolated from 60% of L. monocytogenes-positive farms. In addition, multiple serotypes were isolated from individual fecal samples from 18 cattle. Pulsed-field gel electrophoresis (PFGE) characterization of 239 isolates detected 48 different PFGE types. We found that isolates from northern farms were genetically diverse compared to those from central and southern farms. Five isolates from human clinical cases and three isolates from animal clinical cases were identical to isolates from black beef cattle. Furthermore, the isolates from northern and central farms were characterized to possess epidemic clone II or III markers. We next showed that the isolates were susceptible to penicillin, ampicillin, amoxicillin, gentamicin, kanamycin, streptomycin, erythromycin, vancomycin, tetracycline, chloramphenicol, ciprofloxacin, and trimethoprim/sulfamethoxazole. Taken together, our survey provides crucial data regarding the prevalence and characteristics of L. monocytogenes in black beef cattle farms throughout Japan.

Tamoxifen-loaded lecithin organogel (LO) for topical application: Development, optimization and characterization.

Science.gov (United States)

Bhatia, Amit; Singh, Bhupinder; Raza, Kaisar; Wadhwa, Sheetu; Katare, Om Prakash

2013-02-28

Lecithin organogels (LOs) are semi-solid systems with immobilized organic liquid phase in 3-D network of self-assembled gelators. This paper attempts to study the various attributes of LOs, starting from selection of materials, optimization of influential components to LO specific characterization. After screening of various components (type of gelators, organic and aqueous phase) and construction of phase diagrams, a D-optimal mixture design was employed for the systematic optimization of the LO composition. The response surface plots were constructed for various response variables, viz. viscosity, gel strength, spreadability and consistency index. The optimized LO composition was searched employing overlay plots. Subsequent validation of the optimization study employing check-point formulations, located using grid search, indicated high degree of prognostic ability of the experimental design. The optimized formulation was characterized for morphology, drug content, rheology, spreadability, pH, phase transition temperatures, and physical and chemical stability. The outcomes of the study were interesting showing high dependence of LO attributes on the type and amount of phospholipid, Poloxamer™, auxillary gelators and organic solvent. The optimized LO was found to be quite stable, easily applicable and biocompatible. The findings of the study can be utilized for the development of LO systems of other drugs for the safer and effective topical delivery. Crown Copyright © 2013. Published by Elsevier B.V. All rights reserved.

Important vectors for Listeria monocytogenes transmission at farm dairies manufacturing fresh sheep and goat cheese from raw milk.

Science.gov (United States)

Schoder, Dagmar; Melzner, Daniela; Schmalwieser, Alois; Zangana, Abdoulla; Winter, Petra; Wagner, Martin

2011-06-01

The aim of this study was to determine the transmission routs of Listeria spp. in dairy farms manufacturing fresh cheese made from ovine and caprine raw milk and to evaluate the impact of Listeria monocytogenes mastitis on raw milk contamination. Overall, 5,799 samples, including 835 environmental samples, 230 milk and milk product samples, and 4,734 aseptic half-udder foremilk samples were collected from 53 dairy farms in the dairy intensive area of Lower Austria. Farms were selected for the study because raw milk was processed to cheese that was sold directly to consumers. A total of 153 samples were positive for Listeria spp., yielding an overall prevalence of 2.6%; L. monocytogenes was found in 0.9% of the samples. Bulk tank milk, cheese, and half-udder samples were negative for Listeria spp. Because none of the sheep and goats tested positive from udder samples, L. monocytogenes mastitis was excluded as a significant source of raw milk contamination. L. monocytogenes was detected at 30.2% of all inspected farms. Swab samples from working boots and fecal samples had a significantly higher overall prevalence (P < 0.001) of L. monocytogenes (15.7 and 13.0%, respectively) than did swab samples from the milk processing environment (7.9%). A significant correlation was found between the prevalence of L. monocytogenes in the animal and in the milk processing environment and the silage feeding practices. Isolation of L. monocytogenes was three to seven times more likely from farms where silage was fed to animals throughout the year than from farms where silage was not fed to the animals.

Adaptation of Listeria monocytogenes in a simulated cheese medium: effects on virulence using the Galleria mellonella infection model.

Science.gov (United States)

Schrama, D; Helliwell, N; Neto, L; Faleiro, M L

2013-06-01

The aim of this study was to evaluate the effect of the acid and salt adaptation in a cheese-based medium on the virulence potential of Listeria monocytogenes strains isolated from cheese and dairy processing environment using the Galleria mellonella model. Four L. monocytogenes strains were exposed to a cheese-based medium in conditions of induction of an acid tolerance response and osmotolerance response (pH 5·5 and 3·5% w/v NaCl) and injected in G. mellonella insects. The survival of insects and the L. monocytogenes growth kinetics in insects were evaluated. The gene expression of hly, actA and inlA genes was determined by real-time PCR. The adapted cells of two dairy strains showed reduced insect mortality (P 0·05) was found between adapted and nonadapted cells. The gene expression results evidenced an overexpression of virulence genes in cheese-based medium, but not in simulated insect-induced conditions. Our results suggest that adaptation to low pH and salt in a cheese-based medium can affect the virulence of L. monocytogenes, but this effect is strain dependent. In this study, the impact of adaptation to low pH and salt in a cheese-based medium on L. monocytogenes virulence was tested using the Wax Moth G. mellonella model. This model allowed the differentiation of the virulence potential between the L. monocytogenes strains. The effect of adaptation on virulence is strain dependent. The G. mellonella model revealed to be a prompt method to test food-related factors on L. monocytogenes virulence. © 2013 The Society for Applied Microbiology.

Listeria monocytogenes isolated in ready-to-eat food in South Bačka region of Vojvodina province, Serbia

Directory of Open Access Journals (Sweden)

Gusman Vera

2014-01-01

Full Text Available Listeria monocytogenes is pathogenic bacterium that can contaminate food products during and after processing. As ready-to-eat food does not undergo any treatment to ensure its safety before consumption, the risk of foodborne disease must be considered if this pathogen is present in the food. As diseases caused by contaminated food are an important public health problem today, the aim of this study was to determine the prevalence of Listeria monocytogenes in different ready-to-eat food products. In the seven-month period from June 1 to December 31, 2011, a total of 1 380 food samples were examined in the Division of Sanitary Bacteriology, Center for Microbiology, Institute of Public Health of Vojvodina in Novi Sad. A total of 912 samples were analyzed for the presence of Listeria monocytogenes according to ISO 11290-2. The identity of suspected Listeria monocytogenes was confirmed using the VITEK 2 Compact system (BioMerieux, France. Out of 912 samples, Listeria monocytogenes was detected in 18 (1.97%. Listeria monocytogenes was mostly found in cooked meals (in 6 samples out of 18, sandwiches (4 samples and frozen food, such as ice-cream and frozen vegetables (4 samples. It was also found in tofu bread spreads (2 samples, cream cheese (1 sample and cakes (1 sample. The presence of Listeria monocytogenes in some ready-to-eat food could present a public health hazard, particularly to the high-risk population group, because of the high mortality rate associated with listeriosis and the widespread nature of the organism. Monitoring of listeriosis is essential to prevent foodborne outbreaks, and in assessing human health risk in ready-to-eat foods.

Tolerance to quaternary ammonium compound disinfectants may enhance growth of Listeria monocytogenes in the food industry.

Science.gov (United States)

Møretrø, Trond; Schirmer, Bjørn C T; Heir, Even; Fagerlund, Annette; Hjemli, Pernille; Langsrud, Solveig

2017-01-16

The antibacterial effect of disinfectants is crucial for the control of Listeria monocytogenes in food processing environments. Tolerance of L. monocytogenes to sublethal levels of disinfectants based on quaternary ammonium compounds (QAC) is conferred by the resistance determinants qacH and bcrABC. The presence and distribution of these genes have been anticipated to have a role in the survival and growth of L. monocytogenes in food processing environments where QAC based disinfectants are in common use. In this study, a panel of 680 L. monocytogenes from nine Norwegian meat- and salmon processing plants were grouped into 36 MLVA profiles. The presence of qacH and bcrABC was determined in 101 isolates from the 26 most common MLVA profiles. Five MLVA profiles contained qacH and two contained bcrABC. Isolates with qacH and bcrABC showed increased tolerance to the QAC Benzalkonium chloride (BC), with minimal inhibitory concentrations (MICs) of 5-12, 10-13 and 100ppm). A sample with lower BC concentrations (14ppm of chain length C-12 and 2.7ppm of chain length C-14) inhibited growth of L. monocytogenes not containing bcrABC or qacH, compared to strains with these genes. The study has shown that L. monocytogenes harbouring the QAC resistance genes qacH and bcrABC are prevalent in the food industry and that residuals of QAC may be present in concentrations after sanitation in the industry that result in a growth advantage for bacteria with such resistance genes. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

Characterization and antibiotic susceptibility of Listeria monocytogenes isolated from poultry and red meat in Morocco

Directory of Open Access Journals (Sweden)

Hayat Ennaji

2008-09-01

Full Text Available Hayat Ennaji1,2, Mohammed Timinouni2, My Mustapha Ennaji3, Mohammed Hassar1, Nozha Cohen11Laboratoire de Microbiologie et Hygiène des Aliments et de l’Environnement, Institut Pasteur du Maroc., Casablanca, Morocco; 2Laboratoire de Microbiologie et Biologie Moléculaire, Institut Pasteur du Maroc., Casablanca, Morocco; 3Laboratoire de Virologie et Hygiène and Microbiologie., Faculté des Sciences et Techniques - Mohammedia, Université Hassan II, Mohammedia, MoroccoAbstract: This study was carried out on 426 samples of raw meats collected from butcheries and supermarkets in Casablanca, Morocco. The samples were examined for the occurrence of Listeria species. Strains of Listeria monocytogenes were characterized by several biochemical tests and confirmed by polymerase chain reaction (PCR. β-hemolytic cultures and nonhemolytic isolates were tested for biochemical properties with the Listeria API test. Among the 43 Listeria species isolates; we identified 10 strains for L. monocytogenes (23.3%, 31 strains for L. innocua (72.1% and 2 strains for L. welshimeri (4.6%. Strains of L. monocytogenes were separated by multiplex PCR; two serogroups IIb and IVb were thus differentiated. Antibiotic susceptibility of L. monocytogenes to 21 antibiotics was determined by the disk diffusion method. All isolates were susceptible to a wide range of the tested antibiotics with the exception of nalidixic acid, colistine and cephalosporins second and third generation for which they were all resistant.Keywords: antibiotic susceptibility, Listeria monocytogenes, meat, PCR

Effect of gamma-irradiation on the survival of Listeria monocytogenes and allergenicity of cherry tomatoes

International Nuclear Information System (INIS)

Todoriki, Setsuko; Bari, Latiful; Kitta, Kazumi; Ohba, Mika; Ito, Yasuhiro; Tsujimoto, Yuka; Kanamori, Norihito; Yano, Erika; Moriyama, Tatsuya; Kawamura, Yukio; Kawamoto, Shinichi

2009-01-01

The presence of Listeria monocytogenes in fresh produce is a growing concern because of the possibility of food-borne illness. Ionizing radiation is an effective non-thermal means of eliminating pathogenic bacteria in fresh produce; however, the effect of ionizing irradiation on the allergenic properties of the host commodities remains unknown. This study aimed (i) to determine the effective dose of gamma-irradiation in eliminating L. monocytogenes on whole cherry tomatoes and (ii) to evaluate the effect of gamma-irradiation on the allergenic properties of tomato proteins. Cherry tomatoes that were inoculated with a mixture of five L. monocytogenes strains were treated with gamma-rays from a 60 Co source. A 1.25 kGy dose of gamma-irradiation was found to be sufficient to eliminate L. monocytogenes on whole cherry tomatoes. The immunoblot profile of serum samples obtained from two patients with tomato allergy revealed that gamma-irradiation did not affect the allergenicity of tomato proteins for up to 7 days after irradiation when the tomatoes were stored at 20 deg. C. Additionally, the m-RNA levels of β-fructofuranosidase, polygalacturonase, pectin esterase, and superoxide dismutase, the main allergenic proteins in tomato, were not affected by the applied irradiation dose. Thus, this study demonstrated that a 1.25 kGy dose of gamma-irradiation effectively eliminates L. monocytogenes on cherry tomatoes without affecting the expression of allergenic proteins in the fruits.

Effect of gamma-irradiation on the survival of Listeria monocytogenes and allergenicity of cherry tomatoes

Science.gov (United States)

Todoriki, Setsuko; Bari, Latiful; Kitta, Kazumi; Ohba, Mika; Ito, Yasuhiro; Tsujimoto, Yuka; Kanamori, Norihito; Yano, Erika; Moriyama, Tatsuya; Kawamura, Yukio; Kawamoto, Shinichi

2009-07-01

The presence of Listeria monocytogenes in fresh produce is a growing concern because of the possibility of food-borne illness. Ionizing radiation is an effective non-thermal means of eliminating pathogenic bacteria in fresh produce; however, the effect of ionizing irradiation on the allergenic properties of the host commodities remains unknown. This study aimed (i) to determine the effective dose of gamma-irradiation in eliminating L. monocytogenes on whole cherry tomatoes and (ii) to evaluate the effect of gamma-irradiation on the allergenic properties of tomato proteins. Cherry tomatoes that were inoculated with a mixture of five L. monocytogenes strains were treated with gamma-rays from a 60Co source. A 1.25 kGy dose of gamma-irradiation was found to be sufficient to eliminate L. monocytogenes on whole cherry tomatoes. The immunoblot profile of serum samples obtained from two patients with tomato allergy revealed that gamma-irradiation did not affect the allergenicity of tomato proteins for up to 7 days after irradiation when the tomatoes were stored at 20 °C. Additionally, the m-RNA levels of β-fructofuranosidase, polygalacturonase, pectin esterase, and superoxide dismutase, the main allergenic proteins in tomato, were not affected by the applied irradiation dose. Thus, this study demonstrated that a 1.25 kGy dose of gamma-irradiation effectively eliminates L. monocytogenes on cherry tomatoes without affecting the expression of allergenic proteins in the fruits.

Effect of gamma-irradiation on the survival of Listeria monocytogenes and allergenicity of cherry tomatoes

Energy Technology Data Exchange (ETDEWEB)

Todoriki, Setsuko [National Food Research Institute, Tsukuba, Ibaraki 305-8642 (Japan)], E-mail: setsuko@affrc.go.jp; Bari, Latiful; Kitta, Kazumi; Ohba, Mika; Ito, Yasuhiro; Tsujimoto, Yuka [National Food Research Institute, Tsukuba, Ibaraki 305-8642 (Japan); Kanamori, Norihito [Japan International Research Center for Agricultural Science, Tsukuba, Ibaraki 305-8686 (Japan); Yano, Erika; Moriyama, Tatsuya; Kawamura, Yukio [School of Agriculture, Kinki University, Nara-city, Nara 631-8505 (Japan); Kawamoto, Shinichi [National Food Research Institute, Tsukuba, Ibaraki 305-8642 (Japan)

2009-07-15

The presence of Listeria monocytogenes in fresh produce is a growing concern because of the possibility of food-borne illness. Ionizing radiation is an effective non-thermal means of eliminating pathogenic bacteria in fresh produce; however, the effect of ionizing irradiation on the allergenic properties of the host commodities remains unknown. This study aimed (i) to determine the effective dose of gamma-irradiation in eliminating L. monocytogenes on whole cherry tomatoes and (ii) to evaluate the effect of gamma-irradiation on the allergenic properties of tomato proteins. Cherry tomatoes that were inoculated with a mixture of five L. monocytogenes strains were treated with gamma-rays from a {sup 60}Co source. A 1.25 kGy dose of gamma-irradiation was found to be sufficient to eliminate L. monocytogenes on whole cherry tomatoes. The immunoblot profile of serum samples obtained from two patients with tomato allergy revealed that gamma-irradiation did not affect the allergenicity of tomato proteins for up to 7 days after irradiation when the tomatoes were stored at 20 deg. C. Additionally, the m-RNA levels of {beta}-fructofuranosidase, polygalacturonase, pectin esterase, and superoxide dismutase, the main allergenic proteins in tomato, were not affected by the applied irradiation dose. Thus, this study demonstrated that a 1.25 kGy dose of gamma-irradiation effectively eliminates L. monocytogenes on cherry tomatoes without affecting the expression of allergenic proteins in the fruits.

Overlevingsstrategieën Listeria monocytogenes bij lage temperatuur

NARCIS (Netherlands)

Wemekamp-Kamphuis, H.H.; Abee, T.

2004-01-01

Listeria monocytogenes is an important food-borne pathogen that may cause severe infections in humans. Many outbreaks caused by this organism have been associated with ready-to-eat foods wich may have undergone some form of minimal processing, or have been contaminated after processing. Ready-to-eat

Incidence of Listeria monocytogenes and Other Bacteria in ...

African Journals Online (AJOL)

Prof. Ogunji

Abstract. The involvement of Listeria monocytogenes in spontaneous abortion in Jos was investigated. One hundred blood and 100 placenta samples were collected from spontaneous abortion patients in Jos. The samples were inoculated first into Listeria enrichment broth. Incubation was at 37o C, followed by cold ...

Genotypes Associated with Listeria monocytogenes Isolates Displaying Impaired or Enhanced Tolerances to Cold, Salt, Acid, or Desiccation Stress

Science.gov (United States)

Hingston, Patricia; Chen, Jessica; Dhillon, Bhavjinder K.; Laing, Chad; Bertelli, Claire; Gannon, Victor; Tasara, Taurai; Allen, Kevin; Brinkman, Fiona S. L.; Truelstrup Hansen, Lisbeth; Wang, Siyun

2017-01-01

The human pathogen Listeria monocytogenes is a large concern in the food industry where its continuous detection in food products has caused a string of recalls in North America and Europe. Most recognized for its ability to grow in foods during refrigerated storage, L. monocytogenes can also tolerate several other food-related stresses with some strains possessing higher levels of tolerances than others. The objective of this study was to use a combination of phenotypic analyses and whole genome sequencing to elucidate potential relationships between L. monocytogenes genotypes and food-related stress tolerance phenotypes. To accomplish this, 166 L. monocytogenes isolates were sequenced and evaluated for their ability to grow in cold (4°C), salt (6% NaCl, 25°C), and acid (pH 5, 25°C) stress conditions as well as survive desiccation (33% RH, 20°C). The results revealed that the stress tolerance of L. monocytogenes is associated with serotype, clonal complex (CC), full length inlA profiles, and the presence of a plasmid which was identified in 55% of isolates. Isolates with full length inlA exhibited significantly (p monocytogenes sequence types, a new inlA PMSC, and several connections between CCs and the presence/absence or variations of specific genetic elements. A whole genome single-nucleotide-variants phylogeny revealed sporadic distribution of tolerant isolates and closely related sensitive and tolerant isolates, highlighting that minor genetic differences can influence the stress tolerance of L. monocytogenes. Specifically, a number of cold and desiccation sensitive isolates contained PMSCs in σB regulator genes (rsbS, rsbU, rsbV). Collectively, the results suggest that knowing the sequence type of an isolate in addition to screening for the presence of full-length inlA and a plasmid, could help food processors and food agency investigators determine why certain isolates might be persisting in a food processing environment. Additionally, increased

Estimation of Microbial Contamination of Food from Prevalence and Concentration Data: Application to Listeria monocytogenes in Fresh Vegetables▿

Science.gov (United States)

Crépet, Amélie; Albert, Isabelle; Dervin, Catherine; Carlin, Frédéric

2007-01-01

A normal distribution and a mixture model of two normal distributions in a Bayesian approach using prevalence and concentration data were used to establish the distribution of contamination of the food-borne pathogenic bacteria Listeria monocytogenes in unprocessed and minimally processed fresh vegetables. A total of 165 prevalence studies, including 15 studies with concentration data, were taken from the scientific literature and from technical reports and used for statistical analysis. The predicted mean of the normal distribution of the logarithms of viable L. monocytogenes per gram of fresh vegetables was −2.63 log viable L. monocytogenes organisms/g, and its standard deviation was 1.48 log viable L. monocytogenes organisms/g. These values were determined by considering one contaminated sample in prevalence studies in which samples are in fact negative. This deliberate overestimation is necessary to complete calculations. With the mixture model, the predicted mean of the distribution of the logarithm of viable L. monocytogenes per gram of fresh vegetables was −3.38 log viable L. monocytogenes organisms/g and its standard deviation was 1.46 log viable L. monocytogenes organisms/g. The probabilities of fresh unprocessed and minimally processed vegetables being contaminated with concentrations higher than 1, 2, and 3 log viable L. monocytogenes organisms/g were 1.44, 0.63, and 0.17%, respectively. Introducing a sensitivity rate of 80 or 95% in the mixture model had a small effect on the estimation of the contamination. In contrast, introducing a low sensitivity rate (40%) resulted in marked differences, especially for high percentiles. There was a significantly lower estimation of contamination in the papers and reports of 2000 to 2005 than in those of 1988 to 1999 and a lower estimation of contamination of leafy salads than that of sprouts and other vegetables. The interest of the mixture model for the estimation of microbial contamination is discussed. PMID

Genetic Separation of Listeria monocytogenes Causing Central Nervous System Infections in Animals

Directory of Open Access Journals (Sweden)

Lisandra Aguilar-Bultet

2018-02-01

Full Text Available Listeria monocytogenes is a foodborne pathogen that causes abortion, septicemia, gastroenteritis and central nervous system (CNS infections in ruminants and humans. L. monocytogenes strains mainly belong to two distinct phylogenetic groups, named lineages I and II. In general, clinical cases in humans and animals, in particular CNS infections, are caused by lineage I strains, while most of the environmental and food strains belong to lineage II. Little is known about why lineage I is more virulent than lineage II, even though various molecular factors and mechanisms associated with pathogenesis are known. In this study, we have used a variety of whole genome sequence analyses and comparative genomic tools in order to find characteristics that distinguish lineage I from lineage II strains and CNS infection strains from non-CNS strains. We analyzed 225 strains and identified single nucleotide variants between lineages I and II, as well as differences in the gene content. Using a novel approach based on Reads Per Kilobase per Million Mapped (RPKM, we identified 167 genes predominantly absent in lineage II but present in lineage I. These genes are mostly encoding for membrane-associated proteins. Additionally, we found 77 genes that are largely absent in the non-CNS associated strains, while 39 genes are especially lacking in our defined “non-clinical” group. Based on the RPKM analysis and the metadata linked to the L. monocytogenes strains, we identified 6 genes potentially associated with CNS cases, which include a transcriptional regulator, an ABC transporter and a non-coding RNA. Although there is not a clear separation between pathogenic and non-pathogenic strains based on phylogenetic lineages, the presence of the genes identified in our study reveals potential pathogenesis traits in ruminant L. monocytogenes strains. Ultimately, the differences that we have found in our study will help steer future studies in understanding the virulence

Genetic Separation of Listeria monocytogenes Causing Central Nervous System Infections in Animals

Science.gov (United States)

Aguilar-Bultet, Lisandra; Nicholson, Pamela; Rychener, Lorenz; Dreyer, Margaux; Gözel, Bulent; Origgi, Francesco C.; Oevermann, Anna; Frey, Joachim; Falquet, Laurent

2018-01-01

Listeria monocytogenes is a foodborne pathogen that causes abortion, septicemia, gastroenteritis and central nervous system (CNS) infections in ruminants and humans. L. monocytogenes strains mainly belong to two distinct phylogenetic groups, named lineages I and II. In general, clinical cases in humans and animals, in particular CNS infections, are caused by lineage I strains, while most of the environmental and food strains belong to lineage II. Little is known about why lineage I is more virulent than lineage II, even though various molecular factors and mechanisms associated with pathogenesis are known. In this study, we have used a variety of whole genome sequence analyses and comparative genomic tools in order to find characteristics that distinguish lineage I from lineage II strains and CNS infection strains from non-CNS strains. We analyzed 225 strains and identified single nucleotide variants between lineages I and II, as well as differences in the gene content. Using a novel approach based on Reads Per Kilobase per Million Mapped (RPKM), we identified 167 genes predominantly absent in lineage II but present in lineage I. These genes are mostly encoding for membrane-associated proteins. Additionally, we found 77 genes that are largely absent in the non-CNS associated strains, while 39 genes are especially lacking in our defined “non-clinical” group. Based on the RPKM analysis and the metadata linked to the L. monocytogenes strains, we identified 6 genes potentially associated with CNS cases, which include a transcriptional regulator, an ABC transporter and a non-coding RNA. Although there is not a clear separation between pathogenic and non-pathogenic strains based on phylogenetic lineages, the presence of the genes identified in our study reveals potential pathogenesis traits in ruminant L. monocytogenes strains. Ultimately, the differences that we have found in our study will help steer future studies in understanding the virulence mechanisms of the

Survival of Listeria monocytogenes in Soil Requires AgrA-Mediated Regulation.

Science.gov (United States)

Vivant, Anne-Laure; Garmyn, Dominique; Gal, Laurent; Hartmann, Alain; Piveteau, Pascal

2015-08-01

In a recent paper, we demonstrated that inactivation of the Agr system affects the patterns of survival of Listeria monocytogenes (A.-L. Vivant, D. Garmyn, L. Gal, and P. Piveteau, Front Cell Infect Microbiol 4:160, http://dx.doi.org/10.3389/fcimb.2014.00160). In this study, we investigated whether the Agr-mediated response is triggered during adaptation in soil, and we compared survival patterns in a set of 10 soils. The fate of the parental strain L. monocytogenes L9 (a rifampin-resistant mutant of L. monocytogenes EGD-e) and that of a ΔagrA deletion mutant were compared in a collection of 10 soil microcosms. The ΔagrA mutant displayed significantly reduced survival in these biotic soil microcosms, and differential transcriptome analyses showed large alterations of the transcriptome when AgrA was not functional, while the variations in the transcriptomes between the wild type and the ΔagrA deletion mutant were modest under abiotic conditions. Indeed, in biotic soil environments, 578 protein-coding genes and an extensive repertoire of noncoding RNAs (ncRNAs) were differentially transcribed. The transcription of genes coding for proteins involved in cell envelope and cellular processes, including the phosphotransferase system and ABC transporters, and proteins involved in resistance to antimicrobial peptides was affected. Under sterilized soil conditions, the differences were limited to 86 genes and 29 ncRNAs. These results suggest that the response regulator AgrA of the Agr communication system plays important roles during the saprophytic life of L. monocytogenes in soil. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Uncovering Listeria monocytogenes hypervirulence by harnessing its biodiversity

Science.gov (United States)

Charlier, Caroline; Touchon, Marie; Chenal-Francisque, Viviane; Leclercq, Alexandre; Criscuolo, Alexis; Gaultier, Charlotte; Roussel, Sophie; Brisabois, Anne; Disson, Olivier; Rocha, Eduardo P. C.; Brisse, Sylvain; Lecuit, Marc

2016-01-01

Microbial pathogenesis studies are typically performed with reference strains, thereby overlooking microbial intra-species virulence heterogeneity. Here we integrated human epidemiological and clinical data with bacterial population genomics to harness the biodiversity of the model foodborne pathogen Listeria monocytogenes and decipher the basis of its neural and placental tropisms. Taking advantage of the clonal structure of this bacterial species, we identify clones epidemiologically associated with either food or human central nervous system (CNS) and maternal-neonatal (MN) listeriosis. The latter are also most prevalent in patients without immunosuppressive comorbidities. Strikingly, CNS and MN clones are hypervirulent in a humanized mouse model of listeriosis. By integrating epidemiological data and comparative genomics, we uncovered multiple novel putative virulence factors and demonstrated experimentally the contribution of the first gene cluster mediating Listeria monocytogenes neural and placental tropisms. This study illustrates the exceptional power of harnessing microbial biodiversity to identify clinically relevant microbial virulence attributes. PMID:26829754

Depletion of proton motive force by nisin in Listeria monocytogenes cells.

Science.gov (United States)

Bruno, M E; Kaiser, A; Montville, T J

1992-07-01

The basal proton motive force (PMF) levels and the influence of the bacteriocin nisin on the PMF were determined in Listeria monocytogenes Scott A. In the absence of nisin, the interconversion of the pH gradient (Z delta pH) and the membrane potential (delta psi) led to the maintenance of a fairly constant PMF at -160 mV over the external pH range 5.5 to 7.0. The addition of nisin at concentrations of greater than or equal to 5 micrograms/ml completely dissipated PMF in cells at external pH values of 5.5 and 7.0. With 1 microgram of nisin per ml, delta pH was completely dissipated but delta psi decreased only slightly. The action of nisin on PMF in L. monocytogenes Scott A was both time and concentration dependent. Valinomycin depleted only delta pH, whereas nigericin and carbonyl cyanide m-chlorophenylhydrazone depleted only delta psi, under conditions in which nisin depleted both. Four other L. monocytogenes strains had basal PMF parameters similar to those of strain Scott A. Nisin (2.5 micrograms/ml) also completely dissipated PMF in these strains.

Efflux pump-mediated benzalkonium chloride resistance in Listeria monocytogenes isolated from retail food.

Science.gov (United States)

Jiang, Xiaobing; Yu, Tao; Liang, Yu; Ji, Shengdong; Guo, Xiaowei; Ma, Jianmin; Zhou, Lijun

2016-01-18

In this study, efflux pump-mediated benzalkonium chloride (BC) resistance, including plasmid-encoded (Qac protein family and BcrABC) and chromosome-borne efflux pumps, was investigated in Listeria monocytogenes from retail food in China. Among the 59 L. monocytogenes strains, 13 (22.0%) strains were resistant to BC. The PCR results showed that bcrABC was harbored by 2 of 13 BC resistant strains. However, none of the qac genes were detected among the 59 strains. The bcrABC was absent in both of the plasmid cured strains, indicating that this BC resistance determinant was plasmid-encoded in the two bcrABC-positive strains. In the presence of reserpine, most of the bcrABC-negative strains had decreases in the MICs of BC, suggesting the existence of other efflux pumps and their role in BC resistance. After exposed to reserpine, the reduction in BC MICs was observed in the two cured strains, indicating that efflux pumps located on chromosome was also involved in BC resistance. Our findings suggest that food products may act as reservoirs for BC resistant isolates of L. monocytogenes and plasmid- and chromosome-encoded efflux pumps could mediate the BC resistance of L. monocytogenes, which is especially relevant to the adaption of this organism in food-related environments with frequent BC use. Copyright © 2015 Elsevier B.V. All rights reserved.

Modeling the effect of temperature on survival rate of Listeria monocytogenes in yogurt.

Science.gov (United States)

Szczawiński, J; Szczawińska, M E; Łobacz, A; Jackowska-Tracz, A

2016-01-01

The aim of the study was to (i) evaluate the behavior of Listeria monocytogenes in a commercially produced yogurt, (ii) determine the survival/inactivation rates of L. monocytogenes during cold storage of yogurt and (iii) to generate primary and secondary mathematical models to predict the behavior of these bacteria during storage at different temperatures. The samples of yogurt were inoculated with the mixture of three L. monocytogenes strains and stored at 3, 6, 9, 12 and 15°C for 16 days. The number of listeriae was determined after 0, 1, 2, 3, 5, 7, 9, 12, 14 and 16 days of storage. From each sample a series of decimal dilutions were prepared and plated onto ALOA agar (agar for Listeria according to Ottaviani and Agosti). It was found that applied temperature and storage time significantly influenced the survival rate of listeriae (pbacteria was found in the samples stored at 6°C (D-10 value = 243.9 h), whereas the highest reduction in the number of the bacteria was observed in the samples stored at 15°C (D-10 value = 87.0 h). The number of L. monocytogenes was correlated with the pH value of the samples (pyogurt stored under temperature range from 3 to 15°C, however, the polynomial model gave a better fit to the experimental data.

Genotypes Associated with Listeria monocytogenes Isolates Displaying Impaired or Enhanced Tolerances to Cold, Salt, Acid, or Desiccation Stress

DEFF Research Database (Denmark)

Hingston, Patricia A.; Chen, Jessica; Dhillon, Bhavjinder K

2017-01-01

elements. A whole genome single-nucleotide-variants phylogeny revealed sporadic distribution of tolerant isolates and closely related sensitive and tolerant isolates, highlighting that minor genetic differences can influence the stress tolerance of L. monocytogenes. Specifically, a number of cold......The human pathogen Listeria monocytogenes is a large concern in the food industry where its continuous detection in food products has caused a string of recalls in North America and Europe. Most recognized for its ability to grow in foods during refrigerated storage, L. monocytogenes can also...... tolerate several other food-related stresses with some strains possessing higher levels of tolerances than others. The objective of this study was to use a combination of phenotypic analyses and whole genome sequencing to elucidate potential relationships between L. monocytogenes genotypes and food...

Complete genome sequence of Listeria monocytogenes strain MR310, isolated from a pastured-flock poultry farm system

Science.gov (United States)

Investigation of Listeria monocytogenes transmission from environmental sources associated with pasture-raised chickens to poultry products is needed to determine ways to prevent potential foodborne illness. Here, we report the complete genome sequence of Listeria monocytogenes MR310, one of the iso...

LO PÚBLICO O LO PRIVADO: UN PRESUPUESTO DE VIRTUD EN ARISTÓTELES

Directory of Open Access Journals (Sweden)

Iván Cadavid

2010-01-01

Full Text Available Uno de los temas coyunturales de toda la teoría política del estagirita es el de lo público versus lo privado, desde el cual puede catalogarse la virtud o el vicio de un gobierno. Pero, entiéndase bien, para Aristóteles no puede existir una política buena o mala, que no devenga de una ética que la determine.De este modo, el tema de la virtud ética del gobernante, que es quienestá llamado a elegir entre lo público y lo privado, determina no solo su virtud sino también el futuro de una comunidad política. Pero aquí surge el problema, pues puede pensarse que si se privilegia al individuo se descuida a la sociedad, y a contrario sensu, si se privilegia la sociedad, se descuida al individuo. ¿Cómo sortear este problema? Ésta y otras cuestiones parecidas son las que se pretenden resolver en este artículo.

Viable-but-Nonculturable Listeria monocytogenes and Salmonella enterica Serovar Thompson Induced by Chlorine Stress Remain Infectious

Directory of Open Access Journals (Sweden)

Callum J. Highmore

2018-04-01

Full Text Available The microbiological safety of fresh produce is monitored almost exclusively by culture-based detection methods. However, bacterial food-borne pathogens are known to enter a viable-but-nonculturable (VBNC state in response to environmental stresses such as chlorine, which is commonly used for fresh produce decontamination. Here, complete VBNC induction of green fluorescent protein-tagged Listeria monocytogenes and Salmonella enterica serovar Thompson was achieved by exposure to 12 and 3 ppm chlorine, respectively. The pathogens were subjected to chlorine washing following incubation on spinach leaves. Culture data revealed that total viable L. monocytogenes and Salmonella Thompson populations became VBNC by 50 and 100 ppm chlorine, respectively, while enumeration by direct viable counting found that chlorine caused a <1-log reduction in viability. The pathogenicity of chlorine-induced VBNC L. monocytogenes and Salmonella Thompson was assessed by using Caenorhabditis elegans. Ingestion of VBNC pathogens by C. elegans resulted in a significant life span reduction (P = 0.0064 and P < 0.0001, and no significant difference between the life span reductions caused by the VBNC and culturable L. monocytogenes treatments was observed. L. monocytogenes was visualized beyond the nematode intestinal lumen, indicating resuscitation and cell invasion. These data emphasize the risk that VBNC food-borne pathogens could pose to public health should they continue to go undetected.

Redes sociales, lo público y lo político en construcción

Directory of Open Access Journals (Sweden)

Mauricio Velasco

2013-03-01

Full Text Available Si reconocemos que las transformaciones políticas conducen a las transformaciones en los espacios mediáticos y tecnológicos –y no al contrario, en una deificación tecnológica- las redes sociales serían una manifestación del surgimiento de los nuevos actores del siglo XXI, que tienen una forma diferente de organización -y expresión- política. Son actores que, además, responden a la irrupción de lo cultural en lo político o que plantean la ‘lucha’ cultural como una dimensión política. Lo cultural incluye aquello que se expresa fuertemente en las redes sociales: género, derechos, ambiente e incluso arte, pero también una postura ya no solo nacional, sino global y mundial con respecto a lo político.

Pathogenic potential of Listeria monocytogenes isolated from cattle ...

African Journals Online (AJOL)

Listeria monocytogenes is an opportunistic food-borne pathogen causing listeriosis especially among immune-compromised persons. Its high rate of morbidity and mortality has classed the organism among the top watch list in foods. It is known to produce several virulence factors which aid its survival in harsh conditions ...

Incidence of Listeria monocytogenes and Other Bacteria in ...

African Journals Online (AJOL)

The involvement of Listeria monocytogenes in spontaneous abortion in Jos was investigated. One hundred blood and 100 placenta samples were collected from spontaneous abortion patients in Jos. The samples were inoculated first into Listeria enrichment broth. Incubation was at 37o C, followed by cold enrichment at ...

Prevalence and antibiotic susceptibility of Listeria monocytogenes in ...

African Journals Online (AJOL)

One hundred and ninety two raw milk samples were collected from lactating cows identified in Fulani herds and small scale dairy farms within Sokoto metropolis in order to investigate the presence and determine the antibiotic susceptibility of Listeria monocytogenes in the milk. Selective culture and identification method ...

Listeria monocytogenes meningitis in the Netherlands, 1985-2014: A nationwide surveillance study.

Science.gov (United States)

Koopmans, Merel M; Bijlsma, Merijn W; Brouwer, Matthijs C; van de Beek, Diederik; van der Ende, Arie

2017-07-01

Listeria monocytogenes can cause sepsis and meningitis. We report national surveillance data on L. monocytogenes meningitis in the Netherlands, describing incidence changes, genetic epidemiology and fatality rate. We analyzed data from the Netherlands Reference Laboratory of Bacterial Meningitis for cases of L. monocytogenes meningitis. Strains were assessed by serotyping and bacterial population structure by multi-locus sequence typing. A total of 375 cases of Listeria meningitis were identified between 1985 and 2014. Peak incidence rates were observed in neonates (0.61 per 100,000 live births) and older adults (peak at 87 year; 0.53 cases per 100,000 population of the same age). Neonatal listerial meningitis decreased 17-fold from 1.95 per 100,000 live births between 1985 and 1989, to 0.11 per 100,000 live births between 2010 and 2014. Overall case fatality rate was 31%, in a multivariate analysis older age and concomitant bacteremia were associated with mortality (both p listeria meningitis has remained high. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

Listeria spp. E Listeria monocytogenes NA PRODUÇÃO DE SALSICHAS TIPO HOT DOG

Directory of Open Access Journals (Sweden)

ALESSANDRA PARO RODRIGUES CESAR

2011-06-01

Full Text Available Listeria monocytogenes is widely distributed in the environment and it has been isolated from food that were associated to outbreaks of high lethality in many countries. Thus, this bacterium represents an important pathogen to the public health. Ready-to-eat products, likecooked stuffed food, within them, frankfurters, are associated to human listeriosis in many countries. Taking into consideration the importance of the subject and the need of more data about it, the occurrence of Listeria spp. and L. monocytogenes in industrial plants, in meat raw materials, in slurry and frankfurters was investigated.These samples were collected in two production plants with SIF (Federal Inspection Service; in one of them GMP, HACCP and SOP were implemented. The results of the 1 06 microbiological analysis were submitted to the program @Risk to obtain the risk analysis; the meanvalues results showed that 7 to 9% of the frankfurters in the market may have L. monocytogenes. The analysis indicated that 88 strains of L. monocytogenes were obtained from 1 06 samples; among them, 76 werecollected in the industrial plants that participate in the experiment, and 30 were collected in the market. In serological typification, 95% of these strains were classified as serotypes 4b, 1 /2a and 1 /2b. Besides the presence of the bacterium in frankfurthers consumed inBrazil and the risk factors associated to this pathogen, the situation concerns because of the lack of epidemiological data, absence of patterns and the deficient information given to the consumer, specially information related to the presence of L. monocytogenes, particularly important to the groups at risk, as well as information related to the importance of heating the product

El dolor y lo sagrado

Directory of Open Access Journals (Sweden)

Tornos Cubillo, Andrés

2002-04-01

Full Text Available Not available

En este trabajo no se trata del dolor mismo, sino de cómo se ha planteado el problema del dolor en relación con la experiencia de lo sagrado, entre personas y grupos que sufrían. Se recuerdan primero algunos hechos que tienen que ver con esta relación y luego se desarrolla lo que estos hechos sugieren: el dolor es un destino que nos sitúa en la perspectiva de nuestra mortalidad y finitud, y solamente en la elaboración libre de este límite se da la verdadera aceptación del mundo de Dios. En relación con lo sagrado el dolor marca sagradamente y crea un destino. Esto es lo importante.

Prevalence and populations of Listeria monocytogenes in meat products retailed in Sao Paulo, Brazil.

Science.gov (United States)

Ristori, Christiane Asturiano; Rowlands, Ruth Estela Gravato; Martins, Cecília Geraldes; Barbosa, Maria Luisa; Yoshida, Júlia T U; Franco, Bernadette D G de Melo

2014-12-01

This study evaluated the prevalence of the populations and serotypes of Listeria monocytogenes in 552 refrigerated samples of ground beef, chicken leg, hot dog, and pork sausage collected in supermarkets in the city of Sao Paulo, SP, Brazil, between May 2008 and July 2009. The supermarkets were selected after stratification by geographical region and by random draw. Tests for presence and enumeration of L. monocytogenes were based on ISO 11290-1:1996/Amd.1:2004 and ISO 11290-2:1998 methods, respectively. Listeria spp. were detected in 469 (85.0%) of the studied meat products. The most frequently isolated species was L. innocua (64.1%), followed by L. monocytogenes (48.7%), L. welshimeri (13.4%), L. seeligeri (7.1%), L. ivanovii (0.2%), and L. grayi subspecies murrayi (0.2%). L. monocytogenes was detected in 269 (48.7%) samples, with highest prevalence in ground beef (59.4%) followed by chicken legs (58.0%), pork sausages (39.8%), and hot dogs (37.7%). The populations were Prevalence of serotypes varied according to the type of meat product. These data are relevant for estimating the risks of listeriosis associated with consumption of meat products in Sao Paulo, and for establishing science-based intervention strategies aimed at reducing these risks, especially for pregnant women and immunocompromised individuals.

Sublethal injury and virulence changes in Listeria monocytogenes and Listeria innocua treated with antimicrobials carvacrol and citral.

Science.gov (United States)

Silva, A; Genovés, S; Martorell, P; Zanini, S F; Rodrigo, D; Martinez, A

2015-09-01

The aim of this study was to evaluate the effect of two antimicrobial substances, carvacrol and citral, on Listeria monocytogenes and Listeria innocua cells, as well as possible virulence changes in injured cells, using Caenorhabditis elegans as a model test. The results indicated that the percentage of sublethal damage was higher in L. monocytogenes than in L. innocua. The results of the study carried out by using C. elegans indicated that C. elegans fed in a lawn of L. monocytogenes previously treated with carvacrol showed a loss in life span (p ≤ 0.05) as compared with L. monocytogenes treated with citral, Escherichia coli OP50 as a negative control, and treated and untreated L. innocua. Egg laying was also affected: worms fed in a lawn of treated and untreated L. monocytogenes laid fewer eggs than those fed in a lawn of treated and untreated L. innocua or fed with OP50 as a negative control. Worms fed in a lawn of treated and untreated L. innocua also laid fewer eggs than those fed with OP50 as a negative control. A phenotype named bag of worms and an undescribed new one, "vulva inflammation", were also observed. Copyright © 2015 Elsevier Ltd. All rights reserved.

Polarization dependent behavior of CdS around the first and second LO-phonon modes

International Nuclear Information System (INIS)

Frausto-Reyes, C.; Molina-Contreras, J.R.; Lopez-Alvarez, Y.F.; Medel-Ruiz, C.I.; Perez Ladron de Guevara, H.; Ortiz-Morales, M.

2010-01-01

The present work report studies on resonant Raman experimental line shape for CdS around the first and second LO-phonon modes. The application of our method to the study of LO-phonon modes of CdS suggests that the scattered intensity is dominated by the surface and dependent on polarization. Results showed that the Raman spectra for CdS, roughly fall into three groups: a broad line-wing with apparent maxima around 194 cm -1 in the range of 140 and 240 cm -1 which can be ascribed to overtone scattering from acoustic phonons; a band near the 1LO phonon mode which can be attributed to a combination of one-phonon scattering and peak acoustic phonon and finally, a band near the 2LO phonon mode which can be attributed to a combination of two-phonon scattering and peak acoustic phonon.

Isolation and detection of Listeria monocytogenes in poultry meat by standard culture methods and PCR

Science.gov (United States)

Kureljušić, J.; Rokvić, N.; Jezdimirović, N.; Kureljušić, B.; Pisinov, B.; Karabasil, N.

2017-09-01

Listeria is the genus of a bacteria found in soil and water and some animals, including poultry and cattle. It can be present in raw milk and food made from raw milk. It can also live in food processing plants and contaminate a variety of processed meats. Microscopically, Listeria species appear as small, Gram-positive rods, which are sometimes arranged in short chains. In direct smears, they can be coccoid, so they can be mistaken for streptococci. Longer cells can resemble corynebacteria. Flagella are produced at room temperature but not at 37°C. Haemolytic activity on blood agar has been used as a marker to distinguish Listeria monocytogenes among other Listeria species, but it is not an absolutely definitive criterion. Further biochemical characterization is necessary to distinguish between the different Listeria species. The objective of this study was to detect, isolate and identify Listeria monocytogenes from poultry meat. Within a period of six months from January to June 2017, a total of 15 samples were collected. Three samples were positive for the presence of Listeria monocytogenes. Biochemical and microbiological tests as well as PCR technique using specific primers were used to confirm L. Monocytogenes in the samples.

Phenotypic and Genotypic Characterization of Atypical Listeria monocytogenes and Listeria innocua Isolated from Swine Slaughterhouses and Meat Markets

Directory of Open Access Journals (Sweden)

Luisa Zanolli Moreno

2014-01-01

Full Text Available In the last decade, atypical Listeria monocytogenes and L. innocua strains have been detected in food and the environment. Because of mutations in the major virulence genes, these strains have different virulence intensities in eukaryotic cells. In this study, we performed phenotypic and genotypic characterization of atypical L. monocytogenes and L. innocua isolates obtained from swine slaughterhouses and meat markets. Forty strains were studied, including isolates of L. monocytogenes and L. innocua with low-hemolytic activity. The isolates were characterized using conventional phenotypic Listeria identification tests and by the detection and analysis of L. monocytogenes-specific genes. Analysis of 16S rRNA was used for the molecular identification of the Listeria species. The L. monocytogenes isolates were positive for all of the virulence genes studied. The atypical L. innocua strains were positive for hly, plcA, and inlC. Mutations in the InlC, InlB, InlA, PI-PLC, PC-PLC, and PrfA proteins were detected in the atypical isolates. Further in vitro and transcriptomic studies are being developed to confirm the role of these mutations in Listeria virulence.

Different transcriptional responses from slow and fast growth rate strains of Listeria monocytogenes adapted to low temperature

Directory of Open Access Journals (Sweden)

Ninoska eCordero

2016-03-01

Full Text Available Listeria monocytogenes has become one of the principal foodborne pathogens worldwide. The capacity of this bacterium to grow at low temperatures has opened an interesting field of study in terms of the identification and classification of new strains of L. monocytogenes with different growth capacities at low temperatures. We determined the growth rate at 8 ºC of 110 strains of L. monocytogenes isolated from different food matrices. We identified a group of slow and fast strains according to their growth rate at 8 °C and performed a global transcriptomic assay in strains previously adapted to low temperature. We then identified shared and specific transcriptional mechanisms, metabolic and cellular processes of both groups; bacterial motility was the principal process capable of differentiating the adaptation capacity of L. monocytogenes strains with different ranges of tolerance to low temperatures. Strains belonging to the fast group were less motile, which may allow these strains to achieve a greater rate of proliferation at low temperature.

Effects of irradiation on bacterial load and Listeria monocytogenes in raw chicken

International Nuclear Information System (INIS)

Varabioff, Y.; Mitchell, G.E.; Nottingham, S.M.

1992-01-01

After irradiation of chickens to a dose of 2.5 kGy, the decrease in the standard plate count (SPC) was similar in air and in vacuum-packaged chickens. During storage at 4 degrees C for 15 d, the SPC increased progressively in both types of packaged chickens. At the end of the storage period, the SPC was higher in air-packaged chicken than in vacuum-packaged chickens. In irradiated chickens, Listeria monocytogenes was only recovered from the vacuum-packaged chickens after 7 d cold storage. In unirradiated chickens, L. monocytogenes proliferated similarly in both air- and vacuum-packaged chickens

Comparison of the effect of saturated and superheated steam on the inactivation of Escherichia coli O157:H7, Salmonella Typhimurium and Listeria monocytogenes on cantaloupe and watermelon surfaces.

Science.gov (United States)

Kwon, Sun-Ah; Song, Won-Jae; Kang, Dong-Hyun

2018-06-01

The purpose of this study was evaluation of the effectiveness of superheated steam (SHS) on inactivation of foodborne pathogens on cantaloupes and watermelons. Saturated steam (SS) treatment was performed at 100 °C and that of SHS at 150 and 200 °C. Escherichia coli O157:H7, Salmonella Typhimurium and Listeria monocytogenes-inoculated cantaloupes and watermelons were exposed for a maximum of 30 s and 10 s, respectively. Populations of the three pathogens on cantaloupes and watermelons were reduced by more than 5 log after 200 °C steam treatment for 30 s and 10 s, respectively. After SHS treatment of cantaloupes and watermelons for each maximum treatment time, color and maximum load values were not significantly different from those of untreated controls. By using a noncontact 3D surface profiler, we found that surface characteristics, especially surface roughness, is the main reason for differences in microbial inactivation between cantaloupes and watermelons. The results of this study suggest that SHS treatment can be used as an antimicrobial intervention for cantaloupes and watermelons without inducing quality deterioration. Copyright © 2017 Elsevier Ltd. All rights reserved.

Effect of pulmonary irradiation from inhaled 90Y on immunity to Listeria monocytogenes in mice