Yun, Hyejeong; Lacroix, Monique; Jung, Samooel; Kim, Keehyuk; Lee, Ju Woon; Jo, Cheorun
2011-09-01
The objective of this study was to examine the effects of several food ingredients on the relative radiation sensitivity (RRS) of Escherichia coli and Listeria monocytogenes inoculated onto ground pork. Garlic, leek, onion, and ginger were prepared in 3 different forms; pressurized, freeze-dried, and 70% ethanol extracted. The prepared food ingredients were subdivided into 2 groups, non-irradiated and irradiated with 5 kGy of gamma irradiation, before addition to ground pork. The prepared food ingredients were added at concentrations of 1% and 5% (w/w) into radiation-sterilized ground pork and inoculated with E. coli and L. monocytogenes (10 6 CFU/mL). For E. coli inoculated pork, the most efficient ingredient was ethanol extracted leek (RRS=3.89), followed by freeze-dried ginger and leek (RRS=3.66 and 3.63, respectively) when used without pasteurization. However, when the food ingredients were irradiation-pasteurized, the freeze-dried ginger showed the highest RRS (4.10). When 5% natural materials were added, RRS was the highest for freeze-dried and ethanol extracted onion (4.44 and 4.65, respectively). For L. monocytogenes, the RRS was relatively lower than E. coli in general. The most efficient material was pressurized and freeze-dried onion (RRS=2.13 and 2.08, respectively) at a concentration of 1%. No increase in RRS was observed at increased concentration of food ingredients. These results suggest that the addition of particular food ingredients increased the efficiency of radiation-sterilization. However, changes in RRS were dependent on the species of microorganism as well as the form of the food ingredients.
International Nuclear Information System (INIS)
Yun, Hyejeong; Lacroix, Monique; Jung, Samooel; Kim, Keehyuk; Lee, Ju Woon; Jo, Cheorun
2011-01-01
The objective of this study was to examine the effects of several food ingredients on the relative radiation sensitivity (RRS) of Escherichia coli and Listeria monocytogenes inoculated onto ground pork. Garlic, leek, onion, and ginger were prepared in 3 different forms; pressurized, freeze-dried, and 70% ethanol extracted. The prepared food ingredients were subdivided into 2 groups, non-irradiated and irradiated with 5 kGy of gamma irradiation, before addition to ground pork. The prepared food ingredients were added at concentrations of 1% and 5% (w/w) into radiation-sterilized ground pork and inoculated with E. coli and L. monocytogenes (10 6 CFU/mL). For E. coli inoculated pork, the most efficient ingredient was ethanol extracted leek (RRS=3.89), followed by freeze-dried ginger and leek (RRS=3.66 and 3.63, respectively) when used without pasteurization. However, when the food ingredients were irradiation-pasteurized, the freeze-dried ginger showed the highest RRS (4.10). When 5% natural materials were added, RRS was the highest for freeze-dried and ethanol extracted onion (4.44 and 4.65, respectively). For L. monocytogenes, the RRS was relatively lower than E. coli in general. The most efficient material was pressurized and freeze-dried onion (RRS=2.13 and 2.08, respectively) at a concentration of 1%. No increase in RRS was observed at increased concentration of food ingredients. These results suggest that the addition of particular food ingredients increased the efficiency of radiation-sterilization. However, changes in RRS were dependent on the species of microorganism as well as the form of the food ingredients. - Highlights: → Several food ingredients increased the efficiency of irradiation sterilization. → Different forms of food ingredients may affect the efficiency. → The increase of efficiency decreased the required irradiation dose, thereby avoiding sensory impairments of food.
Energy Technology Data Exchange (ETDEWEB)
Yun, Hyejeong [Department of Animal Science and Biotechnology, Chungnam National University, Daejeon 305-764 (Korea, Republic of); Lacroix, Monique [Canadian Irradiation Center, Research Laboratory in Science Applied to Food, INRS-Institut Armand-Frappier, Qebec (Canada); Jung, Samooel [Department of Animal Science and Biotechnology, Chungnam National University, Daejeon 305-764 (Korea, Republic of); Kim, Keehyuk [Department of Culinary Nutrition, Woosong University, Daejeon 300-718 (Korea, Republic of); Lee, Ju Woon [Advanced Radiation Technology Institute, Korea Atomic Energy Research Institute, Jeongeup 580-185 (Korea, Republic of); Jo, Cheorun, E-mail: cheorun@cnu.ac.kr [Department of Animal Science and Biotechnology, Chungnam National University, Daejeon 305-764 (Korea, Republic of)
2011-09-15
The objective of this study was to examine the effects of several food ingredients on the relative radiation sensitivity (RRS) of Escherichia coli and Listeria monocytogenes inoculated onto ground pork. Garlic, leek, onion, and ginger were prepared in 3 different forms; pressurized, freeze-dried, and 70% ethanol extracted. The prepared food ingredients were subdivided into 2 groups, non-irradiated and irradiated with 5 kGy of gamma irradiation, before addition to ground pork. The prepared food ingredients were added at concentrations of 1% and 5% (w/w) into radiation-sterilized ground pork and inoculated with E. coli and L. monocytogenes (10{sup 6} CFU/mL). For E. coli inoculated pork, the most efficient ingredient was ethanol extracted leek (RRS=3.89), followed by freeze-dried ginger and leek (RRS=3.66 and 3.63, respectively) when used without pasteurization. However, when the food ingredients were irradiation-pasteurized, the freeze-dried ginger showed the highest RRS (4.10). When 5% natural materials were added, RRS was the highest for freeze-dried and ethanol extracted onion (4.44 and 4.65, respectively). For L. monocytogenes, the RRS was relatively lower than E. coli in general. The most efficient material was pressurized and freeze-dried onion (RRS=2.13 and 2.08, respectively) at a concentration of 1%. No increase in RRS was observed at increased concentration of food ingredients. These results suggest that the addition of particular food ingredients increased the efficiency of radiation-sterilization. However, changes in RRS were dependent on the species of microorganism as well as the form of the food ingredients. - Highlights: > Several food ingredients increased the efficiency of irradiation sterilization. > Different forms of food ingredients may affect the efficiency. > The increase of efficiency decreased the required irradiation dose, thereby avoiding sensory impairments of food.
Song, Hyeon-Jeong; Lee, Ji-Hye; Song, Kyung Bin
2011-11-01
To examine the effects of fumaric acid and electron beam irradiation on the inactivation of foodborne pathogens in ready-to-eat meat products, sliced ham was inoculated with Listeria monocytogenes and Salmonella typhimurium. The inoculated ham slices were treated with 0.5% fumaric acid or electron beam irradiation at 2 kGy. Fumaric acid treatment reduced the populations of L. monocytogenes and S. typhimurium by approximately 1 log CFU/g compared to control populations. In contrast, electron beam irradiation decreased the populations of S. typhimurium and L. monocytogenes by 3.78 and 2.42 log CFU/g, respectively. These results suggest that electron beam irradiation is a better and appropriate technique for improving the microbial safety of sliced ham.
Energy Technology Data Exchange (ETDEWEB)
Song, Hyeon-Jeong; Lee, Ji-Hye [Department of Food Science and Technology, Chungnam National University, Daejeon 305-764 (Korea, Republic of); Song, Kyung Bin, E-mail: kbsong@cnu.ac.kr [Department of Food Science and Technology, Chungnam National University, Daejeon 305-764 (Korea, Republic of)
2011-11-15
To examine the effects of fumaric acid and electron beam irradiation on the inactivation of foodborne pathogens in ready-to-eat meat products, sliced ham was inoculated with Listeria monocytogenes and Salmonella typhimurium. The inoculated ham slices were treated with 0.5% fumaric acid or electron beam irradiation at 2 kGy. Fumaric acid treatment reduced the populations of L. monocytogenes and S. typhimurium by approximately 1 log CFU/g compared to control populations. In contrast, electron beam irradiation decreased the populations of S. typhimurium and L. monocytogenes by 3.78 and 2.42 log CFU/g, respectively. These results suggest that electron beam irradiation is a better and appropriate technique for improving the microbial safety of sliced ham. - Highlights: > We compare irradiation and fumaric acid treatment on the inactivation of pathogens. > We examine changes in the populations of L. monocytogenes and S. typhimurium. > Irradiation at 2 kGy is more effective in sliced ham than fumaric acid treatment. > Low-dose irradiation can improve the microbial safety of sliced ham during storage.
International Nuclear Information System (INIS)
Song, Hyeon-Jeong; Lee, Ji-Hye; Song, Kyung Bin
2011-01-01
To examine the effects of fumaric acid and electron beam irradiation on the inactivation of foodborne pathogens in ready-to-eat meat products, sliced ham was inoculated with Listeria monocytogenes and Salmonella typhimurium. The inoculated ham slices were treated with 0.5% fumaric acid or electron beam irradiation at 2 kGy. Fumaric acid treatment reduced the populations of L. monocytogenes and S. typhimurium by approximately 1 log CFU/g compared to control populations. In contrast, electron beam irradiation decreased the populations of S. typhimurium and L. monocytogenes by 3.78 and 2.42 log CFU/g, respectively. These results suggest that electron beam irradiation is a better and appropriate technique for improving the microbial safety of sliced ham. - Highlights: → We compare irradiation and fumaric acid treatment on the inactivation of pathogens. → We examine changes in the populations of L. monocytogenes and S. typhimurium. → Irradiation at 2 kGy is more effective in sliced ham than fumaric acid treatment. → Low-dose irradiation can improve the microbial safety of sliced ham during storage.
Inhibitory Effect of Nisin on Listeria monocytogenes Inoculated into Surimi and Minced Meat
Directory of Open Access Journals (Sweden)
Masoud Rezaei
2012-02-01
Full Text Available Background & Objective: Listeria monocytogenes has already established as an important food born pathogen which induce listeriosis in human. Use of bacteriocins to provide food safety has been increased dramatically. Nisin has a wide spectrum inhibitory effect than the other bacteriocins and inhibits food-borne pathogens such as L. monocytogenes and many other Gram-positive spoilage microorganisms. The purpose of this study was to investigate the inhibitory effect of Nisin on population of Listeria monocytogenes and the role of changes in food components on the antilisterial properties of Nisin. Materials & Methods: The minced meat and surimi samples were inoculated by 1×104 cfu/g of L. monocytogenes. Then samples exposed to Nisin at the levels of 500 or 1000 IU/g were prepared. All treatments after packaging in plastic bags were kept for 12 days at refrigerator temperature. Samples were cultured on CHROMagarTM Listeria every 2 days and the number of listeria monocytogenes was counted. Results: two different concentrations of Nisin (500 or 1000 IU/g was not able to inhibit L. monocytogenes below the acceptable level for raw food (100 cells per g in minced meat and surimi of silver carp. But the number of bacteria reduces more in fish surimi as compared to the mince meal. Also, antilisterial activity of Nisin was reduced during the storage period. Conclusion: Inhibitory property of Nisin against L. monocytogenes in surimi significantly was higher than the minced (P<0.05. So it is possible the antilisterial properties of Nisin will increase by elimination of some enzymes during processing.
Listeria monocytogenes inhibition by defatted mustard meal-based edible films.
Lee, Hahn-Bit; Noh, Bong Soo; Min, Sea C
2012-02-01
An antimicrobial edible film was developed from defatted mustard meal (Sinapis alba) (DMM), a byproduct from the bio-fuel industry, without incorporating external antimicrobials and its antimicrobial activity against Listeria monocytogenes and physical properties were investigated. The DMM colloidal solution consisting of 184 g water, 14 g DMM, and 2g glycerol was homogenized and incubated at 37°C for 0.2, 0.5, 24 or 48 h to prepare a film-forming solution. The pH of a portion of the film-forming solution (pH 5.5) was adjusted to 2.0 or 4.0. Films were formed by drying the film-forming solutions at 23°C for 48 h. The film-forming solution incubated for 48 h inhibited L. monocytogenes in broth and on agar media. Antimicrobial effects of the film prepared from the 48 h-incubated solution increased with decrease in pH of the solution from 5.5 to 2.0. The film from the film forming solution incubated for 48 h (pH 2.0) initially inhibited more than 4.0 log CFU/g of L. monocytogenes inoculated on film-coated salmon. The film-coating retarded the growth of L. monocytogenes in smoked salmon at 5, 10, and 15°C and the antimicrobial effect during storage was more noticeable when the coating was applied before inoculation than when it was applied after inoculation. The tensile strength, percentage elongation, solubility in watercxu, and water vapor permeability of the anti microbial film were 2.44 ± 0.19 MPa, 6.40 ± 1.13%, 3.19 ± 0.90%, and 3.18 ± 0.63 gmm/kPa hm(2), respectively. The antimicrobial DMM films have demonstrated a potential to be applied to foods as wraps or coatings to control the growth of L. monocytogenes. Copyright © 2011 Elsevier B.V. All rights reserved.
Efficacy of ultraviolet light exposure against survival of Listeria monocytogenes on conveyor belts.
Morey, Amit; McKee, Shelly R; Dickson, James S; Singh, Manpreet
2010-06-01
Listeria monocytogenes has been repeatedly isolated from foods and food-processing facilities including food contact surfaces such as conveyor belts (CB). CBs are often difficult to clean and require rigorous sanitation programs for decontamination. Ultraviolet (UV) light has exhibited microbicidal properties on food contact surfaces and this study was conducted to determine the efficacy of UV against L. monocytogenes on CB made of different materials. A four-strain cocktail of L. monocytogenes (serotypes 3A, 4A, 4B, and 4C) was made to give a suspension of approximately 10(7) CFU/mL. CBs made from four different types of materials, (1) Ropanyl DM 8/2 A2 + 04 (belt 1), (2) Volta FRMW-3.0 (belt 2), (3) Volta FRMB-3.0 (belt 3), and (4) Ropanyl DM (belt 4), were inoculated with 1 mL of the four-strain cocktail (approximately 10(7) CFU/mL) of the bacterial suspension. CBs were treated with UV light (254 nm) for 1 and 3 sec at 5.53 and 5.95 mW/cm(2). Three replications of the experiments were conducted. Two-way analysis of variance of survival populations of L. monocytogenes showed that bacterial counts were significantly reduced (p belt types irrespective of UV light intensities and times of exposure. L. monocytogenes populations were reduced (p belts 1, 2, and 3 after exposure to 5.95 mW/cm(2) UV light intensity for 3 sec. L. monocytogenes-inoculated CBs that were exposed to 5.53 mW/cm(2) showed higher (p Belt 4 showed survival populations of L. monocytogenes ranging from 1.42 to 1.73 log(10) CFU/cm(2) after UV light treatment for 1 and 3 sec. UV light can be effectively used to reduce L. monocytogenes contamination on CBs.
Cabrera-Díaz, E; Martínez-Chávez, L; Sánchez-Camarena, J; Muñiz-Flores, J A; Castillo, A; Gutiérrez-González, P; Arvizu-Medrano, S M; González-Aguilar, D G; Martínez-Gonzáles, N E
2018-08-01
Simultaneous and individual enumeration of Salmonella, Shigella and Listeria monocytogenes was compared on inoculated Roma tomatoes and Serrano peppers using an Most Probable Number (MPN) technique. Samples consisting of tomatoes (4 units) or peppers (8 units) were individually inoculated with a cocktail of three strains of Salmonella, Shigella or L. monocytogenes, or by simultaneous inoculation of three strains of each pathogen, at low (1.2-1.7 log CFU/sample) and high (2.2-2.7 log CFU/sample) inocula. Samples were analyzed by an MPN technique using universal pre-enrichment (UP) broth at 35 °C for 24 ± 2 h. The UP tubes from each MPN series were transferred to enrichment and plating media following adequate conventional methods for isolating each pathogen. Data were analyzed using multifactorial analysis of variance (p simultaneous), type of bacteria (Salmonella > Shigella and L. monocytogenes), type of sample (UP broth > pepper and tomato), and inoculum level (high > low). The MPN technique was effective for Salmonella on both commodities. Shigella counts were higher on tomatoes compared to peppers, (p < 0.05), and for L. monocytogenes on peppers (p < 0.05). Copyright © 2018 Elsevier Ltd. All rights reserved.
Effect of starter cultures on survival of Listeria monocytogenes in Čajna sausage
Bošković, M.; Tadić, V.; Đorđević, J.; Glišić, M.; Lakićević, B.; Dimitrijević, M.; Baltić, M. Ž.
2017-09-01
The aim of the study was to evaluate the survival of Listeria monocytogenes during the production of Čajna sausage with short maturation time. Sausage batter was inoculated with three different serotypes 4b and serotype 1/2a of L. monocytogenes. Control sausages were without any starter culture added; the second batch was inoculated with strains of Lactobacillus sakei, Staphylococcus carnosus and Staphylococcus xylosus, and the third batch was inoculated with strains of Debaryomyces hansenii, Lactobacillus sakei, Pediococcus acidilactici, Pediococcus pentosaceus, Staphylococcus carnosus and Staphylococcus xylosus. After 18 days of ripening, L. monocytogenes was not detected in any of the sausages, but during this fermentation and drying, the numbers of this pathogen was lower in the sausages inoculated with starter cultures.
Byelashov, Oleksandr A; Kendall, Patricia A; Belk, Keith E; Scanga, John A; Sofos, John N
2008-04-01
U.S. regulations require that processors employ lethal or inhibitory antimicrobial alternatives in production of ready-to-eat meat and poultry products that support growth of Listeria monocytogenes and may be exposed to the processing environment after a lethality treatment. In this study, lactic acid (LA; 5%, vol/vol) and sodium lauryl sulfate (SLS; 0.5%, wt/vol) were evaluated individually or as a mixture (LASLS) for control of L. monocytogenes on frankfurters. Frankfurters were inoculated with a 10-strain mixture of L. monocytogenes, sprayed for 10 s (20 bar, 23 +/- 2 degrees C) with antimicrobials or distilled water (DW) before (LASLS or DW) or after (LA, SLS, LASLS, or DW) inoculation (4.8 +/- 0.1 log CFU/cm2), vacuum packaged, and stored at 4 degrees C for 90 days. Samples were analyzed for numbers of the pathogen (on PALCAM agar) and for total microbial counts (on tryptic soy agar with yeast extract) during storage. Spraying with DW, LA, or SLS after inoculation reduced numbers of L. monocytogenes by 1.3 +/- 0.2, 1.8 +/- 0.5, and 2.0 +/- 0.4 log CFU/cm2, respectively. The LASLS mixture applied before or after inoculation reduced pathogen populations by 1.8 +/- 0.4 and 2.8 +/- 0.2 log CFU/cm2, respectively. No further reduction by any treatment was observed during storage. The bacterial growth curves (fitted by the model of Baranyi and Roberts) indicated that the lag-phase duration of the bacterium on control samples (13.85 to 15.18 days) was extended by spraying with all solutions containing LA. For example, LA suppressed growth of L. monocytogenes for 39.14 to 41.01 days. Pathogen growth rates also were lower on frankfurters sprayed after inoculation with LA or LASLS compared to those sprayed with DW. Therefore, spraying frankfurters with a mixture of LA and SLS may be a useful antilisterial alternative treatment for ready-to-eat meat and poultry products.
Hwang, Cheng-An; Sheen, Shiowshuh
2011-05-01
This study examined the growth characteristics of Listeria monocytogenes as affected by a native microflora in cooked ham at refrigerated and abuse temperatures. A five-strain mixture of L. monocytogenes and a native microflora, consisting of Brochothrix spp., isolated from cooked meat were inoculated alone (monocultured) or co-inoculated (co-cultured) onto cooked ham slices. The growth characteristics, lag phase duration (LPD, h), growth rate (GR, log(10) cfu/h), and maximum population density (MPD, log(10) cfu/g), of L. monocytogenes and the native microflora in vacuum-packed ham slices stored at 4, 6, 8, 10, and 12 °C for up to 5 weeks were determined. At 4-12 °C, the LPDs of co-cultured L. monocytogenes were not significantly different from those of monocultured L. monocytogenes in ham, indicating the LPDs of L. monocytogenes at 4-12 °C were not influenced by the presence of the native microflora. At 4-8 °C, the GRs of co-cultured L. monocytogenes (0.0114-0.0130 log(10) cfu/h) were statistically but marginally lower than those of monocultured L. monocytogenes (0.0132-0.0145 log(10) cfu/h), indicating the GRs of L. monocytogenes at 4-8 °C were reduced by the presence of the native microflora. The GRs of L. monocytogenes were reduced by 8-7% with the presence of the native microflora at 4-8 °C, whereas there was less influence of the native microflora on the GRs of L. monocytogenes at 10 and 12 °C. The MPDs of L. monocytogenes at 4-8 °C were also reduced by the presence of the native microflora. Data from this study provide additional information regarding the growth suppression of L. monocytogenes by the native microflora for assessing the survival and growth of L. monocytogenes in ready-to-eat meat products. Published by Elsevier Ltd.
Gamma irradiation as a means to eliminate Listeria monocytogenes from frozen chicken meat
International Nuclear Information System (INIS)
Kamat, A.S.; Nair, M.P.
1995-01-01
Cells of Listeria monocytogenes ATCC 35152 were sensitive to gamma irradiation in phosphate buffer, pH 7.00 (D 10 , dose required for 10% survival—0.15 kGy) at 0–5°C. The cells showed higher radiation survival when irradiated under frozen condition, with a D 10 of 0.3 kGy. The protection offered by shrimp/chicken/kheema homogenates (100 g litre−1) was evidenced by even higher D 10 values (0.5 kGy) at both 0–5°C and cryogenic temperature. Boneless chicken meat samples were artificially inoculated with L monocytogenes ATCC 35152 cells at low (5 × 10 3 ) colony-forming unit (cfu) g −1 and high (5 × 10 6 cfu g −1 ) concentrations and irradiated at 1, 3, 4, 6 kGy doses under cryogenic conditions. The efficacy of the radiation process was evaluated by detecting L monocytogenes during storage at 2–4°C in the irradiated samples. These studies, when repeated with three other serotypes of L monocytogenes, clearly suggested the need for a dose of 3 kGy for elimination of 10 3 cfu cells of L monocytogenes g −1 from air-packed frozen chicken meat. (author)
DEFF Research Database (Denmark)
Bernbom, Nete; Licht, Tine Rask; Saadbye, Peter
2006-01-01
The ability of the pediocin AcH producing Lactobacillus plantarum DDEN 11007 and its non-producing plasmid-cured isogenic variant, DDEN 12305 to prevent the persistence and growth of Listeria monocytogenes EP2 in two gastrointestinal (GI) tract models was examined. In vitro studies conducted...... in a two-stage continuous flow system showed that L. plantarum DDEN 11007 inhibited L. monocytogenes EP2 under these conditions, while less effect was seen of the non-bacteriocin producing variant. The inhibitory effect was more pronounced at pH 5 than at pH 7. No effect on persistence of L. monocytogenes...... in the GI tract was seen in gnotobiotic rats colonized with either the pediocin AcH producing or the non-bacteriocin producing variant of L. plantarum when compared to rats inoculated with L. monocytogenes EP2 alone. Surprisingly, inoculation of the gnotobiotic animals with either of the L. plantarum...
To ensure the microbial safety of produce including blueberries, sanitization is a critical step. This study evaluated the efficacy of sanitizers when coupled with frozen storage, in inactivating Escherichia coli O157:H7, Salmonella Typhimurium and Listeria monocytogenes inoculated on wild blueberri...
Winkowski, K; Crandall, A D; Montville, T J
1993-01-01
The ability of Lactobacillus bavaricus, a meat isolate, to inhibit the growth of three Listeria monocytogenes strains was examined in three beef systems: beef cubes, beef cubes in gravy, and beef cubes in gravy containing glucose. The beef was minimally heat treated, inoculated with L. bavaricus at 10(5) or 10(3) CFU/g and L. monocytogenes at 10(2) CFU/g, vacuum sealed, and stored at 4 or 10 degrees C. The meat samples were monitored for microbial growth, pH, and bacteriocin production. The p...
Directory of Open Access Journals (Sweden)
Wanessa Altimiras Costa
2009-12-01
selected as a possible biological control bacterium. The population of L. monocytogenes inoculated in minimally processed kale increased 3.7 and 4.7 logarithmic cycles at 5 and 10 °C, respectively, after 20 days of storage and 4.6 logarithmic cycles at 15 °C after eight days. However, when 10(8 CFU.g-1 of P. acidilactici CCA3 was inoculated into processed product a reduction of L. monocytogenes of 2.3 logarithmic cycles under extreme temperature conditions (15 °C occurred. P. acidilactici CCA3 did not alter the titratable acidity or the kale sensorial characteristics during the shelf life period. These results suggest the potential application of biopreservatives on minimally processed kale that need to be associated with refrigeration and sanitation to assure safety.
Chen, Jianshun; Jiang, Lingli; Chen, Xueyan; Luo, Xiaokai; Chen, Yang; Yu, Ying; Tian, Guoming; Liu, Dongyou; Fang, Weihuan
2009-03-01
The genus Listeria consists of six closely related species and forms three phylogenetic groups: L. monocytogenes- L. innocua, L. ivanovii-L. seeligeri-L. welshimeri, and L. grayi. In this report, we attempted to examine the evolutionary relationship in the L. monocytogenes-L. innocua group by probing the nucleotide sequences of 23S rRNA and 16S rRNA, and the gene clusters lmo0029-lmo0042, ascBdapE, rplS-infC, and prs-ldh in L. monocytogenes serovars 1/2a, 4a, and 4b, and L. innocua. Additionally, we assessed the status of L. monocytogenes-specific inlA and inlB genes and 10 L. innocua-specific genes in these species/serovars, together with phenotypic characterization by using in vivo and in vitro procedures. The results indicate that L. monocytogenes serovar 4a strains are genetically similar to L. innocua in the lmo0035-lmo0042, ascB-dapE, and rplS-infC regions and also possess L. innocua-specific genes lin0372 and lin1073. Furthermore, both L. monocytogenes serovar 4a and L. innocua exhibit impaired intercellular spread ability and negligible pathogenicity in mouse model. On the other hand, despite resembling L. monocytogenes serovars 1/2a and 4b in having a nearly identical virulence gene cluster, and inlA and inlB genes, these serovar 4a strains differ from serovars 1/2a and 4b by harboring notably altered actA and plcB genes, displaying strong phospholipase activity and subdued in vivo and in vitro virulence. Thus, by possessing many genes common to L. monocytogenes serovars 1/2a and 4b, and sharing many similar gene deletions with L. innocua, L. monocytogenes serovar 4a represents a possible evolutionary intermediate between L. monocytogenes serovars 1/2a and 4b and L. innocua.
Directory of Open Access Journals (Sweden)
Maria da Graça F. Nascimento
1994-12-01
Full Text Available Autoclaved distilled water samples were inoculated with L. monocytogenes strain V7 and strain VPH-1, and incubated aerobically, at 30 C for 48 hours. Each strain was tested individually, and growth curves were determined at 1, 2, 3, 4, 5, 21, 24, and 48 hours. The growth or survival of L. monocytogenes was similar for both strains, with survivors at 24 hour-incubation. The microbicidal activity of one synthetic cationic peptide (NP-2 was examined against L. monocytogenes strain V7, in a water system. Antibacterial activity of NP-2 (1, 5, and 10 g/ml was best expressed at 60 minute-incubation, with 10 g/ml of peptide, at 30 C.Amostras de água destilada, autoclavadas, foram inoculadas com L. monocytogenes cepa V7 e cepa VPH-1, e incubadas, aerobicamente, a 30ºC por 48 horas. Cada cepa foi testada individualmente, e determinou-se curvas de crescimento a 1, 2, 3, 4, 5, 21, 24, e 48 horas. O crescimento ou sobrevivência das duas cepas foi semelhante e encontrou-se sobreviventes em 24 horas de incubação. Examinou-se a atividade bactericida de um dos peptídeos catiônicos sintéticos (NP-2 contra L. monocytogenes cepa V7, em sistema aquoso. A atividade antibacteriana de NP-2 (1, 5, and 10µg/ml foi melhor aos 60 minutos de incubação, com 10µg/ml de peptídeo, a 30 C.
Antimicrobial treatments to control Listeria monocytogenes in queso fresco.
Lourenço, António; Kamnetz, Mary B; Gadotti, Camila; Diez-Gonzalez, Francisco
2017-06-01
Queso fresco, is a Hispanic non-fermented cheese highly susceptible to contamination with L. monocytogenes. This research was aimed to determine the effect of GRAS antimicrobial ingredients to control L. monocytogenes. Antimicrobials included caprylic acid (CA), Nisaplin ® (N, 2.5% nisin), a mixture of sodium lactate and sodium diacetate (SL/SD), Lactococcus lactis sbp. lactis DPC 3147, monolaurin, and lactic acid (LA). Batches of queso fresco curds were inoculated with 10 4 CFU/g and stored at 4 °C for three weeks. During storage the count of L. monocytogenes reached 7 to 8 Log CFU/g in control samples. Most individual antimicrobial treatments resulted in less than 1 Log CFU/g reductions in final counts, with the exception of N (0.5 g/kg) and CA (2.9 g/kg) that caused more than 3 and 5 Log CFU/g differences with controls, respectively. Mixtures of ingredients were more effective in inhibiting L. monocytogenes growth, and treatments with N and CA consistently delivered 6 Log CFU/g less counts than controls. Supplementation of 12 g/kg LA to treatments with SL/SD (3%/0.22%) caused differences of more than 4 Log CFU/g in final Listeria populations. Samples treated with the binary mixtures of N and CA (0.5 and 0.7 g/kg, respectively) were evaluated in a consumer panel (n = 67). Panelists slightly preferred control and commercial over treated samples, but all samples were in average rated between "slightly liking" and "moderately liking." These experiments indicated that combined use of antimicrobial ingredients may be an effective way to control the population of Listeria monocytogenes in queso fresco. Copyright © 2016 Elsevier Ltd. All rights reserved.
Efficacy of chlorine dioxide against Listeria monocytogenes in brine chilling solutions.
Valderrama, W B; Mills, E W; Cutter, C N
2009-11-01
Chilled brine solutions are used by the food industry to rapidly cool ready-to-eat meat products after cooking and before packaging. Chlorine dioxide (ClO(2)) was investigated as an antimicrobial additive to eliminate Listeria monocytogenes. Several experiments were performed using brine solutions made of sodium chloride (NaCl) and calcium chloride (CaCl(2)) inoculated with L. monocytogenes and/or treated with 3 ppm of ClO(2). First, 10 and 20% CaCl(2) and NaCl solutions (pH 7.0) were inoculated with a five-strain cocktail of L. monocytogenes to obtain approximately 7 log CFU/ml and incubated 8 h at 0 degrees C. The results demonstrated that L. monocytogenes survived in 10% CaCl(2), 10 and 20% NaCl, and pure water. L. monocytogenes levels were reduced approximately 1.2 log CFU/ml in 20% CaCl(2). Second, inoculated ( approximately 7 log CFU/ml) brine solutions (10 and 20% NaCl and 10% CaCl(2)) treated with 3 ppm of ClO(2) resulted in a approximately 4-log reduction of the pathogen within 90 s. The same was not observed in a solution of 20% CaCl(2); further investigation demonstrated that high levels of divalent cations interfere with the disinfectant. Spent brine solutions from hot dog and ham chilling were treated with ClO(2) at concentrations of 3 or 30 ppm. At these concentrations, ClO(2) did not reduce L. monocytogenes. Removal of divalent cations and organic material in brine solutions prior to disinfection with ClO(2) should be investigated to improve the efficacy of the compound against L. monocytogenes. The information from this study may be useful to processing establishments and researchers who are investigating antimicrobials in chilling brine solutions.
Directory of Open Access Journals (Sweden)
Ana K. Carrascal-Camacho
2009-12-01
Full Text Available Effect of cooking time and temperature on sausages artificially inoculated with Listeria monocytogenes. Objective. To find whetherthe cooking times traditionally used by consumers are enough to inactivate Listeria monocytogenes artificially inoculated into sausages.Materials and methods. A survey asking about sausage cooking habits was completed with 50 housewives. We analyzed 60 samples ofsausages previously inoculated with 103 CFU g-1 from a pool of 5 strains of L. monocytogenes, then the cooking procedures described inthe survey were applied to the samples, and counting was done immediately after. Additionally, a complementary test was carried out byinoculating 20 samples of sausages with 103 CFU g-1 and exposing them to 72 oC and 73 oC for 30 seg. Results. The survey showed that15 minute boiling and 5 minute frying are the most frequent ways of preparing sausages by consumers. We established that the time andcooking conditions used in our assay had a statistically significant effect (p: 0.016 on the inoculated samples. In the complementary assay,statistical data (p: 0.0001 indicated that internal temperatures of 73 oC are enough to inactivate the pathogen at an industrial scale.Conclusion. Cooking by 15 minute boiling and 5 minute frying are enough to inactive concentrations of 103 g-1 of Listeria monocytogenesartificially inoculated into sausages.
Combined effect of ultrasound and essential oils to reduce Listeria monocytogenes on fresh produce.
Özcan, Gülçin; Demirel Zorba, Nükhet Nilüfer
2016-06-01
Salads prepared from contaminated fresh produce have a high risk of causing food-borne illnesses. Essential oils obtained from plants have antimicrobial activity and may provide a natural approach to reduce the pathogens on fresh produce. Additionally, ultrasound treatments have been shown to reduce the microbial counts on different foods. The objective of this study was to investigate the antimicrobial activities of cinnamon and lemon essential oils in vitro and in food applications. Mixtures of lettuce, parsley and dill were inoculated with Listeria monocytogenes and then dip-treated for 5 min in one of the following treatments: sterile tap water, chlorinated water, 1% lemon essential oil, 2% cinnamon essential oil or 2% cinnamon essential oil + ultrasound. The samples were stored at 4 ℃ and collected at d 0, 1, 3, 5, 7 and 9 post inoculation. The 1% lemon (4 log) and 2% cinnamon (2 log) essential oil washes provided partial inhibition against L. monocytogenes by d 1. The combined application of 2% cinnamon oil and ultrasound resulted in only 0.85 log inhibition by d 1; however, the number of L. monocytogenes increased during storage and became nearly equal to the control at d 9. Therefore, different combinations of essential oils with other antimicrobials or novel technologies are required. © The Author(s) 2015.
Ceylan, Erdogan; McMahon, Wendy; Garren, Donna M
2017-09-01
Thermal inactivation of Listeria monocytogenes and Salmonella was evaluated on peas, spinach, broccoli, potatoes, and carrots that were treated with hot water and steam. One gram-positive bacterium, L. monocytogenes, and one gram-negative bacterium, Salmonella, were selected as pertinent human pathogens for evaluation. Samples were inoculated with a composite of five strains each of L. monocytogenes and Salmonella to achieve approximately 10 8 to 10 9 CFU/g. Inoculated samples were treated with hot water at 85 and 87.8°C and with steam at 85 and 96.7°C for up to 3.5 min. A greater than 5-log reduction of L. monocytogenes and Salmonella was achieved on all products within 0.5 min by hot water blanching at 85 and 87.8°C. Steam blanching at 85°C reduced Salmonella populations by greater than 5 log on spinach and peas within 2 min and on carrots and broccoli within 3.5 min. Populations of Salmonella were reduced by more than 5 log within 1 min on carrot, spinach, and broccoli and within 2 min on peas by steam blanching at 96.7°C. Steam blanching at 85°C reduced L. monocytogenes populations by more than 5 log on carrots and spinach within 2 min and on broccoli and peas within 3.5 min. L. monocytogenes populations were reduced more than 5 log within 1 min on carrot, spinach, peas and broccoli by steam blanching at 96.7°C. Longer treatment times and higher temperatures were required for steam-blanched samples than for samples blanched with hot water. Results suggest that hot water and steam blanching practices commonly used by the frozen vegetable industry will achieve the desired 5-log lethality of L. monocytogenes and Salmonella and will enhance microbiological safety prior to freezing.
Fouladkhah, Aliyar; Geornaras, Ifigenia; Nychas, George-John; Sofos, John N
2013-02-01
This study evaluated growth of Listeria monocytogenes inoculated on cooked chicken meat with different marinades and survival of the pathogen as affected by microwave oven reheating. During aerobic storage at 7 °C, on days 0, 1, 2, 4, and 7, samples were reheated by microwave oven (1100 W) for 45 or 90 s and analyzed microbiologically. L. monocytogenes counts on nonmarinated (control) samples increased (P 2.4 to 5.0 (90 s) log CFU/g. With similar trends across different marinates, the high levels of L. monocytogenes survivors found after microwave reheating, especially after storage for more than 2 d, indicate that length of storage and reheating time need to be considered for safe consumption of leftover cooked chicken. © 2013 Institute of Food Technologists®
Behaviour of Listeria monocytogenes in packaged fresh mushrooms (Agaricus bisporus).
González-Fandos, E; Olarte, C; Giménez, M; Sanz, S; Simón, A
2001-11-01
The aim of this study was to evaluate the potential of Listeria monocytogenes to grow in mushrooms packaged in two different types of PVC films when stored at 4 degrees C and 10 degrees C. Mushrooms were packed in two polymeric films (perforated and nonperforated PVC) and stored at 4 degrees C and 10 degrees C. The carbon dioxide and oxygen content inside the packages, aerobic mesophiles, psychrotrophs, Pseudomonas spp., Listeria monocytogenes, faecal coliforms, Escherichia coli, anaerobic spores and major sensory factors were determined. The mushrooms packaged in nonperforated film and stored at 4 degrees C had the most desirable quality parameters (texture, development stage and absence of moulds). Listeria monocytogenes was able to grow at 4 degrees C and 10 degrees C in inoculated mushrooms packaged in perforated and nonperforated films between 1 and 2 log units during the first 48 h. After 10 d of storage, the populations of L. monocytogenes were higher in mushrooms packaged in nonperforated film and stored at 10 degrees C. MAP followed by storage at 4 degrees C or 10 degrees C extends the shelf life by maintaining an acceptable appearance, but allows the growth and survival of L. monocytogenes. According to this study additional hurdles must be studied in order to prevent the growth of L. monocytogenes.
Ruiz, A; Williams, S K; Djeri, N; Hinton, A; Rodrick, G E
2009-08-01
The objectives of this study were to determine the anti-Listeria and general antimicrobial properties of nisin, rosemary, and EDTA alone and in combination on Listeria monocytogenes inoculated on ready-to-eat vacuum-packaged diced turkey ham and to ascertain the effects of the treatments on pH and objective color. The turkey hams were cut into 0.5-cm pieces, inoculated with a L. monocytogenes cocktail containing 5 strains of the bacterium, and treated with either no treatment and no inoculum (negative control), inoculum only (positive control), 0.5% nisin, 20 mM EDTA, 1% rosemary, 0.5% nisin + 20 mM EDTA, 0.5% nisin + 1% rosemary, 0.5% nisin + 20 mM EDTA + 1% rosemary, or 20 mM EDTA + 1% rosemary. All samples were vacuum-packaged, stored for 63 d at 4 degrees C +/- 1 degrees C, and analyzed at 1-wk intervals for total aerobes, L. monocytogenes, lactic acid organisms, pH, and objective color. Nisin, nisin with rosemary, nisin with EDTA, and nisin with rosemary and EDTA treatments reduced (P hams treated with nisin. The EDTA and rosemary treatments alone and in combination were ineffective in inhibiting growth of L. monocytogenes. Although none of the treatments completely eliminated L. monocytogenes, the results indicated that ready-to-eat turkey ham can have significantly decreased L. monocytogenes when treated with nisin alone or in combination with rosemary or EDTA, or both.
Ben Hsouna, Anis; Ben Halima, Nihed; Smaoui, Slim; Hamdi, Naceur
2017-08-03
Lemon (Citrus limon) is a flowing plant belonging to the Rutaceae family. Citrus plants constitute one of the main valuable sources of essential oil used in foods and medicinal purposes. In this study, we assessed chemical composition, antioxidant and antimicrobial activities of C. limon essential oil (ClEO) with its preservative effect against Listeria monocytogenes inoculated in minced beef meat. Gas chromatography/mass spectrometry (GC-MS) was used to identify the major components of the obtained ClEO. The antioxidant activities of this ClEO were determined according to the β-carotene bleaching assay, as well as by 2.2-diphenyl-1-picrylhydrazyl (DPPH) radical scavenging activity. For antimicrobial activity, agar well diffusion method was used and the minimum inhibitory concentrations (MICs) as well as the minimum fungicidal concentrations (MFCs) were determined. The in situ effect of the ClEO was evaluated through physicochemical parameters (pH and thiobarbituric acid reactive substances (TBARS), as well as against L. monocytogenes in minced beef meat model. Twenty one components were identified in the ClEO and the two dominant compounds were limonene (39.74%) and β-Pinene (25.44%). This ClEO displayed an excellent DPPH scavenging ability with an extract concentration providing 50% inhibition (IC 50 ) of 15.056 μg/ml and a strong β-carotene bleaching inhibition after 120 min of incubation with an IC 50 of 40.147 μg/ml. The MICs varied from 0.039 to 1.25 mg/ml for Gram positive bacteria and from 0.25 to 2.5 mg/ml for Gram-negative bacteria. The meat preserving potential of ClEO was investigated against L. monocytogenes. ClEO successfully inhibited development of L. monocytogenes in minced beef meat. The application of ClEO at a 0.06 and 0.312 mg/g, may open new promising opportunities for the prevention of contamination from and growth of pathogenic bacteria, particularly L. monocytogenes, during minced beef meat storage at 4 °C. Additionally, during
Modelling the growth of Listeria monocytogenes in fresh green coconut (Cocos nucifera L.) water.
Walter, Eduardo H M; Kabuki, Dirce Y; Esper, Luciana M R; Sant'Ana, Anderson S; Kuaye, Arnaldo Y
2009-09-01
The behaviour of Listeria monocytogenes in the fresh coconut water stored at 4 degrees C, 10 degrees C and 35 degrees C was studied. The coconut water was aseptically extracted from green coconuts (Cocos nucifera L.) and samples were inoculated in triplicate with a mixture of 5 strains of L. monocytogenes with a mean population of approximately 3 log(10) CFU/mL. The kinetic parameters of the bacteria were estimated from the Baranyi model, and compared with predictions of the Pathogen Modelling Program so as to predict its behaviour in the beverage. The results demonstrated that fresh green coconut water was a beverage propitious for the survival and growth of L. monocytogenes and that refrigeration at 10 degrees C or 4 degrees C retarded, but did not inhibit, growth of this bacterium. Temperature abuse at 35 degrees C considerably reduced the lagtimes. The study shows that L. monocytogenes growth in fresh green coconut water is controlled for several days by storage at low temperature, mainly at 4 degrees C. Thus, for risk population this product should only be drunk directly from the coconut or despite the sensorial alterations should be consumed pasteurized.
Inhibition of Listeria monocytogenes by propionic acid-based ingredients in cured deli-style Turkey.
Glass, Kathleen A; McDonnell, Lindsey M; Von Tayson, Roxanne; Wanless, Brandon; Badvela, Mani
2013-12-01
Listeria monocytogenes growth can be controlled on ready-to-eat meats through the incorporation of antimicrobial ingredients into the formulation or by postlethality kill steps. However, alternate approaches are needed to provide options that reduce sodium content but maintain protection against pathogen growth in meats after slicing. The objective of this study was to determine the inhibition of L. monocytogenes by propionic acid-based ingredients in high-moisture, cured turkey stored at 4 or 7°C. Six formulations of sliced, cured (120 ppm of NaNO2 ), deli-style turkey were tested, including control without antimicrobials, 3.2% lactate-diacetate blend (LD), 0.4% of a liquid propionate-benzoate-containing ingredient, or 0.3, 0.4, and 0.5% of a liquid propionate-containing ingredient. Products were inoculated with 5 log CFU L. monocytogenes per 100-g package (3 log CFU/ml rinsate), vacuum-sealed, and stored at 4 or 7°C for up to 12 weeks; and populations were enumerated by plating on modified Oxford agar. As expected, the control without antimicrobials supported rapid growth, with >2 log average per ml rinsate increase within 4 weeks of storage at 4°C, whereas growth was observed at 6 weeks for the LD treatment. For both replicate trials, all treatments that contained liquid propionate or propionate-benzoate limited L. monocytogenes growth to an increase of 1-log increase) was observed in individual samples for all propionate-containing treatments at weeks 10, 11, and 12. As expected, L. monocytogenes grew more rapidly when products were stored at 7°C, but trends in relative inhibition were similar to those observed at 4°C. These results verify that propionate-based ingredients inhibit growth of L. monocytogenes on sliced, high-moisture, cured turkey and can be considered as an alternative to reduce sodium-based salts while maintaining food safety.
McDonnell, Lindsey M; Glass, Kathleen A; Sindelar, Jeffrey J
2013-08-01
The objective of this study was to identify ingredients that inhibit Listeria monocytogenes in natural, organic, or clean-label ready-to-eat meat and poultry products. Fourteen ingredients were screened in uncured (no-nitrate-or-nitrite-added), traditional-cured (156 ppm of purified sodium nitrite), cultured (alternative cured, natural nitrate source, and Staphylococcus carnosus), or preconverted (alternative cured, natural nitrite source) turkey slurries. Slurries were cooked, cooled, inoculated to yield 3 log CFU/ml L. monocytogenes, stored at 4°C, and tested weekly for 4 weeks. Three antimicrobial ingredients, 1.5 % vinegar-lemon-cherry powder blend, 2.5 % buffered vinegar, and 3.0 % cultured sugar-vinegar blend, were incorporated into alternative-cured ham and uncured roast beef and deli-style turkey breast. Controls included all three meat products without antimicrobial ingredients and a traditional-cured ham with 2.8 % sodium lactate-diacetate. Cooked, sliced products were inoculated with 3 log CFU/g L. monocytogenes, vacuum packed, and stored at 4 or 7°C, for up to 12 weeks. For control products without antimicrobial agents stored at 4°C, a 2-log L. monocytogenes increase was observed at 2 weeks for ham and turkey and at 4 weeks for roast beef. Growth (>1-log increase) in the sodium lactate-diacetate was delayed until week 6. Compared with the control, the addition of either vinegar-lemon-cherry powder blend or buffered vinegar delayed L. monocytogenes growth for an additional 2 weeks, while the addition of cultured sugar-vinegar blend delayed growth for an additional 4 weeks for both ham and turkey. The greatest L. monocytogenes delay was observed in roast beef containing any of the three antimicrobial ingredients, with no growth detected through 12 weeks at 4°C for all the treatments. As expected, L. monocytogenes grew substantially faster in products stored at 7°C than at 4°C. These data suggest that antimicrobial ingredients from a natural source
Morphological Change and Decreasing Transfer Rate of Biofilm-Featured Listeria monocytogenes EGDe.
Lee, Yuejia; Wang, Chinling
2017-03-01
Listeria monocytogenes , a lethal foodborne pathogen, has the ability to resist the hostile food processing environment and thus frequently contaminates ready-to-eat foods during processing. It is commonly accepted that the tendency of L. monocytogenes ' to generate biofilms on various surfaces enhances its resistance to the harshness of the food processing environment. However, the role of biofilm formation in the transferability of L. monocytogenes EGDe remains controversial. We examined the growth of Listeria biofilms on stainless steel surfaces and their effect on the transferability of L. monocytogenes EGDe. The experiments were a factorial 2 × 2 design with at least three biological replicates. Through scanning electron microscopy, a mature biofilm with intensive aggregates of cells was observed on the surface of stainless steel after 3 or 5 days of incubation, depending on the initial level of inoculation. During biofilm development, L. monocytogenes EGDe carried out binary fission vigorously before a mature biofilm was formed and subsequently changed its cellular morphology from rod shaped to sphere shaped. Furthermore, static biofilm, which was formed after 3 days of incubation at 25°C, significantly inhibited the transfer rate of L. monocytogenes EGDe from stainless steel blades to 15 bologna slices. During 7 days of storage at 4°C, however, bacterial growth rate was not significantly impacted by whether bacteria were transferred from biofilm and the initial concentrations of transferred bacteria on the slice. In conclusion, this study is the first to report a distinct change in morphology of L. monocytogenes EGDe at the late stage of biofilm formation. More importantly, once food is contaminated by L. monocytogenes EGDe, contamination proceeds independently of biofilm development and the initial level of contamination when food is stored at 4°C, even if contamination with L. monocytogenes EGDe was initially undetectable before storage.
LISTERIA MONOCYTOGENES RISK EVALUATION IN READY TO EAT DELI PRODUCTS
Directory of Open Access Journals (Sweden)
T Civera
2013-02-01
Full Text Available Listeria monocytogenes has become one of the major concerns for food safety. Its ability to survive and replicate at low temperature, pH and high salt concentration, makes the bacterium a threat, mostly for RTE products. For these reasons, the present research was aimed at detecting the ability of growth of L. monocytogenes in RTE products retrieved from one deli store. Samples were analysed for L. monocytogenes detection, then inoculated with the pathogen (105cell/ml and stored at refrigeration temperature for the duration of their shelf-life (15-60 days. In all the products L. monocytogenes was not detected before experimental contamination. The challenge test evidenced that experimentally inoculated L. monocytogenes was not able to multiply for the duration of the entire shelf-life. These results indicated that the tested products could be considered as foods which are not able to support the growth of L. monocytogenes, as indicated by E.C. Regulation 2073/05. However, in order to guarantee consumer’s safety, it needs to be emphasized the need of a correct application of the GMPs, required for lowering the risk of initial contamination.
Al-Nabulsi, Anas A; Olaimat, Amin N; Osaili, Tareq M; Ayyash, Mutamed M; Abushelaibi, Aisha; Jaradat, Ziad W; Shaker, Reyad; Al-Taani, Mahmoud; Holley, Richard A
2016-03-01
In addition to its nutritional and therapeutic properties, camel milk has the ability to suppress the growth of a wide range of foodborne pathogens, but there is a lack of information regarding the behavior of these pathogens in products such as yogurt produced from camel milk. The objective of the current study was to investigate the behavior of Listeria monocytogenes and Escherichia coli O157:H7 during manufacture and storage of camel yogurt. Camel milk inoculated with L. monocytogenes and E. coli O157:H7 was fermented at 43° C for 5h using freeze-dried lactic acid bacteria (LAB) starter cultures (Streptococcus thermophilus and Lactobacillus bulgaricus) and stored at 4 or 10 °C for 14 d. Camel milk inoculated with L. monocytogenes and E. coli O157:H7 without starter culture was also prepared. During fermentation, the numbers of L. monocytogenes and E. coli O157:H7 increased 0.3 and 1.6 log cfu/mL, respectively, in the presence of LAB, and by 0.3 and 2.7 log cfu/mL in the absence of LAB. During storage at 4 or 10 °C, L. monocytogenes increased 0.8 to 1.2 log cfu/mL by 14 d in camel milk without LAB, but in the presence of LAB, the numbers of L. monocytogenes were reduced by 1.2 to 1.7 log cfu/mL by 14 d. Further, E. coli O157:H7 numbers in camel milk were reduced by 3.4 to 3.5 log cfu/mL in the absence of LAB, but E. coli O157:H7 was not detected (6.3 log cfu/mL reduction) by 7d in camel yogurt made with LAB and stored at either temperature. Although camel milk contains high concentrations of natural antimicrobials, L. monocytogenes was able to tolerate these compounds in camel yogurt stored at refrigerator temperatures. Therefore, appropriate care should be taken during production of yogurt from camel milk to minimize the potential for postprocess contamination by this and other foodborne pathogens. Copyright © 2016 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
A Dual Microscopy-Based Assay To Assess Listeria monocytogenes Cellular Entry and Vacuolar Escape.
Quereda, Juan J; Pizarro-Cerdá, Javier; Balestrino, Damien; Bobard, Alexandre; Danckaert, Anne; Aulner, Nathalie; Shorte, Spencer; Enninga, Jost; Cossart, Pascale
2016-01-01
Listeria monocytogenes is a Gram-positive bacterium and a facultative intracellular pathogen that invades mammalian cells, disrupts its internalization vacuole, and proliferates in the host cell cytoplasm. Here, we describe a novel image-based microscopy assay that allows discrimination between cellular entry and vacuolar escape, enabling high-content screening to identify factors specifically involved in these two steps. We first generated L. monocytogenes and Listeria innocua strains expressing a β-lactamase covalently attached to the bacterial cell wall. These strains were then incubated with HeLa cells containing the Förster resonance energy transfer (FRET) probe CCF4 in their cytoplasm. The CCF4 probe was cleaved by the bacterial surface β-lactamase only in cells inoculated with L. monocytogenes but not those inoculated with L. innocua, thereby demonstrating bacterial access to the host cytoplasm. Subsequently, we performed differential immunofluorescence staining to distinguish extracellular versus total bacterial populations in samples that were also analyzed by the FRET-based assay. With this two-step analysis, bacterial entry can be distinguished from vacuolar rupture in a single experiment. Our novel approach represents a powerful tool for identifying factors that determine the intracellular niche of L. monocytogenes. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
CHALLENGE TESTS WITH LISTERIA MONOCYTOGENES IN SALAMI: PRELIMINARY RESULTS
Directory of Open Access Journals (Sweden)
R. Mioni
2013-02-01
Full Text Available Challenge tests are the preferable methodology to study the behaviour of Listeria monocytogenes on ready to eat foods, according to Regulation (EC 2073/2005. Challenge testing using L. monocytogenes in seasoned salami from different food business operators showed, after seasoning of the product, a count reduction of the inoculated organisms without any further growth of the pathogen; however differences of L. monocytogenes behaviour could be observed according to different production protocols.
Grant, I R; Patterson, M F
1995-10-01
The effect of heating alone (60, 65 or 70 degrees C), heating after irradiation (0.8 kGy) and heating after irradiation and storage for 14 days at 2-3 degrees C on the destruction of Listeria monocytogenes and Salmonella typhimurium in artifically inoculated minced cook-chill roast beef and gravy was investigated. Inoculated minced roast beef samples (5 g) were heated in Stomacher bags completely immersed in a water bath at each of the test temperatures. Survivors were enumerated and D and z values were determined for each of the pathogens. Observed thermal D values for two strains of L. monocytogenes at 60, 65 and 70 degrees C in the absence of pre-irradiation were 90.0-97.5 s, 34.0-53.0 s and 22.4-28.0 s, respectively, whereas thermal D values after pre-irradiation were 44.0-46.4 s, 15.3-16.8 s and 5.5-7.8 s at 60, 65 and 70 degrees C, respectively. This reduction in D values provides evidence for radiation-induced heat-sensitisation in L. monocytogenes. There was some evidence of heat-sensitisation of S. typhimurium at 60 degrees C, but not at either 65 or 70 degrees C. The z value also decreased as a consequence of pre-irradiation to a dose of 0.8 kGy (11.0-12.7 degrees C). The radiation-induced heat-sensitivity in L. monocytogenes was found to persist for up to 2 weeks storage at 2-3 degrees C prior to heating. As cook-chill products are intended to be reheated prior to consumption the results of the present study suggest that any L. monocytogenes present in a cook-chill product would be more easily killed during reheating if it were to be treated with a low dose of gamma radiation during manufacture.
Directory of Open Access Journals (Sweden)
Joelle K. Salazar
2018-01-01
Full Text Available This study assessed the growth of Listeria monocytogenes in milkshakes made using the process-contaminated ice cream associated with a listeriosis outbreak in comparison to milkshakes made with artificially contaminated ice cream. For all temperatures, growth kinetics including growth rates, lag phases, maximum populations, and population increases were determined for the naturally and artificially derived contaminants at 5, 10, 15, and 25°C storage for 144 h. The artificially inoculated L. monocytogenes presented lower growth rates and shorter lag phases than the naturally contaminated populations at all temperatures except for 5°C, where the reverse was observed. At 25°C, lag phases of the naturally and artificially contaminated L. monocytogenes were 11.6 and 7.8 h, respectively. The highest increase in population was observed for the artificially inoculated pathogen at 15°C after 96 h (6.16 log CFU/mL of storage. Growth models for both contamination states in milkshakes were determined. In addition, this study evaluated the antimicrobial effectiveness of flavoring agents, including strawberry, chocolate and mint, on the growth of the pathogen in milkshakes during 10°C storage. All flavor additions resulted in decreased growth rates of L. monocytogenes for both contamination states. The addition of chocolate and mint flavoring also resulted in significantly longer lag phases for both contamination states. This study provides insight into the differences in growth between naturally and artificially contaminated L. monocytogenes in a food product.
Salazar, Joelle K; Bathija, Vriddi M; Carstens, Christina K; Narula, Sartaj S; Shazer, Arlette; Stewart, Diana; Tortorello, Mary Lou
2018-01-01
This study assessed the growth of Listeria monocytogenes in milkshakes made using the process-contaminated ice cream associated with a listeriosis outbreak in comparison to milkshakes made with artificially contaminated ice cream. For all temperatures, growth kinetics including growth rates, lag phases, maximum populations, and population increases were determined for the naturally and artificially derived contaminants at 5, 10, 15, and 25°C storage for 144 h. The artificially inoculated L. monocytogenes presented lower growth rates and shorter lag phases than the naturally contaminated populations at all temperatures except for 5°C, where the reverse was observed. At 25°C, lag phases of the naturally and artificially contaminated L. monocytogenes were 11.6 and 7.8 h, respectively. The highest increase in population was observed for the artificially inoculated pathogen at 15°C after 96 h (6.16 log CFU/mL) of storage. Growth models for both contamination states in milkshakes were determined. In addition, this study evaluated the antimicrobial effectiveness of flavoring agents, including strawberry, chocolate and mint, on the growth of the pathogen in milkshakes during 10°C storage. All flavor additions resulted in decreased growth rates of L. monocytogenes for both contamination states. The addition of chocolate and mint flavoring also resulted in significantly longer lag phases for both contamination states. This study provides insight into the differences in growth between naturally and artificially contaminated L. monocytogenes in a food product.
Effect of Listeria monocytogenes inoculation, sodium acetate and ...
African Journals Online (AJOL)
Jane
2011-08-08
Aug 8, 2011 ... monocytogenes has been isolated from surface fresh waters and ... been reported that contamination of aquatic products with ..... In fish sausage treated with nisin, the peroxide value was lower in comparison with that of control (Raju et al., 2003). TBA assay is usually used as indicator for the assessment of.
Uppal, Kamaldeep K; Getty, Kelly J K; Boyle, Elizabeth A E; Harper, Nigel M; Lobaton-Sulabo, April Shayne S; Barry, Bruce
2012-01-01
The objective of our study was to determine effect of packaging method and storage time on reducing Listeria monocytogenes in shelf-stable meat snacks. Commercially available kippered beef steak strips and turkey tenders were dipped into a 5-strain L. monocytogenes cocktail, and dried at 23 °C until a water activity of 0.80 was achieved. Inoculated samples were packaged with 4 treatments: (1) vacuum, (2) nitrogen flushed with oxygen scavenger, (3) heat sealed with oxygen scavenger, and (4) heat sealed without oxygen scavenger. Samples were stored at 23 °C and evaluated for L. monocytogenes levels at 0, 24, 48, and 72 h. Initial levels (time 0) of L. monocytogenes were approximately 5.7 log CFU/cm² for steak and tenders. After 24 h of storage time, a 1 log CFU/cm² reduction of L. monocytogenes was observed for turkey tenders for all packaging treatments. After 48 h, turkey tenders showed >1 log CFU/cm² reduction of L. monocytogenes for all packaging treatments except for vacuum, where only 0.9 log CFU/cm² reduction was observed. After 72 h, reductions for all packaging treatments for turkey tenders ranged from 1.5 to 2.4 log CFU/cm². For kippered beef steak, there was no interaction between the packaging treatments and all storage times (P > 0.05) whereas, time was different (P packaging treatments and a 2.1 log CFU/ cm² L. monocytogenes reduction at 72 h of storage time. Processors of kippered beef steak and turkey tenders could use a combination of vacuum or nitrogen-flushing or heat sealed with an oxygen scavenger packaging methods and a holding time of 24 h prior to shipping to reduce potential L. monocytogenes numbers by ≥1 log. However, processors should be encouraged to hold packaged product a minimum of 72 h to enhance the margin of safety for L. monocytogenes control. © 2011 Institute of Food Technologists®
Ye, M; Neetoo, H; Chen, H
2011-10-01
Listeria monocytogenes is a major safety concern for ready-to-eat foods. The overall objective of this study was to investigate whether prior frozen storage could enhance the efficacy of edible coatings against L. monocytogenes on cold-smoked salmon during subsequent refrigerated storage. A formulation consisting of sodium lactate (SL, 1·2-2·4%) and sodium diacetate (SD, 0·125-0·25%) or 2·5% Opti.Form (a commercial formulation of SL and SD) was incorporated into each of five edible coatings: alginate, κ-carrageenan, pectin, gelatin and starch. The coatings were applied onto the surface of cold-smoked salmon slices inoculated with L. monocytogenes at a level of 500 CFU cm⁻². In the first phase, the slices were first frozen at -18°C for 6 days and stored at 22°C for 6 days. Alginate, gelatin and starch appeared to be the most effective carriers. In the second phase, cold-smoked salmon slices were inoculated with L. monocytogenes, coated with alginate, gelatin or starch with or without the antimicrobials and stored frozen at -18°C for 12 months. Every 2 months, samples were removed from the freezer and kept at 4°C for 30 days. Prior frozen storage at -18°C substantially enhanced the antilisterial efficacy of the edible coatings with or without antimicrobials during the subsequent refrigerated storage. Plain coatings with ≥ 2 months frozen storage and antimicrobial edible coatings represent an effective intervention to inhibit the growth of L. monocytogenes on cold-smoked salmon. This study demonstrates the effectiveness of the conjunct application of frozen storage and edible coatings to control the growth of L. monocytogenes to enhance the microbiological safety of cold-smoked salmon. © 2011 The Authors. Journal of Applied Microbiology © 2011 The Society for Applied Microbiology.
Olaimat, Amin N; Holley, Richard A
2016-08-01
Ready-to-eat meats are considered foods at high risk to cause life-threatening Listeria monocytogenes infections. This study screened 5 L. monocytogenes strains for their ability to hydrolyze sinigrin (a glucosinolate in Oriental mustard), which formed allyl isothiocyanate (AITC) and reduced L. monocytogenes viability on inoculated vacuum-packed, cooked, cured roast chicken slices at 4 °C. Tests involved incorporation of 25-50 μl/g AITC directly or 100-250 mg/g Oriental mustard extract in 0.5% (w/v) κ-carrageenan/2% (w/v) chitosan-based coatings prepared using 1.5% malic or acetic acid. L. monocytogenes strains hydrolyzed 33.6%-48.4% pure sinigrin in MH broth by 21 d at 25 °C. Acidified κ-carrageenan/chitosan coatings containing 25-50 μl/g AITC or 100-250 mg/g mustard reduced the viability of L. monocytogenes and aerobic bacteria on cooked, cured roast chicken slices by 4.1 to >7.0 log10 CFU/g compared to uncoated chicken stored at 4 °C for 70 d. Coatings containing malic acid were significantly more antimicrobial than those with acetic acid. During storage for 70 d, acidified κ-carrageenan/chitosan coatings containing 25-50 μl/g AITC or 250 mg/g mustard extract reduced lactic acid bacteria (LAB) numbers 3.8 to 5.4 log10 CFU/g on chicken slices compared to uncoated samples. Acidified κ-carrageenan/chitosan-based coatings containing either AITC or Oriental mustard extract at the concentrations tested had the ability to control L. monocytogenes viability and delay growth of potential spoilage bacteria on refrigerated, vacuum-packed cured roast chicken. Copyright © 2016. Published by Elsevier Ltd.
D'Amico, Dennis J; Druart, Marc J; Donnelly, Catherine W
2008-08-01
Because of renewed interest in specialty cheeses, artisan and farmstead producers are manufacturing surface-mold-ripened soft cheeses from raw milk, using the 60-day holding standard (21 CFR 133.182) to achieve safety. This study compared the growth potential of Listeria monocytogenes on cheeses manufactured from raw or pasteurized milk and held for > 60 days at 4 degrees C. Final cheeses were within federal standards of identity for soft ripened cheese, with low moisture targets to facilitate the holding period. Wheels were surface inoculated with a five-strain cocktail of L. monocytogenes at approximately 0.2 CFU/ cm2 (low level) or 2 CFU/cm2 (high level), ripened, wrapped, and held at 4 degrees C. Listeria populations began to increase by day 28 for all treatments after initial population declines. From the low initial inoculation level, populations in raw and pasteurized milk cheese reached maximums of 2.96 +/- 2.79 and 2.33 +/- 2.10 log CFU/g, respectively, after 60 days of holding. Similar growth was observed in cheese inoculated at high levels, where populations reached 4.55 +/- 4.33 and 5.29 +/- 5.11 log CFU/g for raw and pasteurized milk cheeses, respectively. No significant differences (P milk types. Independent of the milk type, cheeses held for 60 days supported growth from very low initial levels of L. monocytogenes introduced as a postprocess contaminant. The safety of cheeses of this type must be achieved through control strategies other than aging, and thus revision of current federal regulations is warranted.
International Nuclear Information System (INIS)
Harsojo; Banati, D.; Ito, H.
1997-01-01
Listeria monocytogenes were isolated in 5 lots, more than one cell in each 25-g sample of 10 lots of chicken meat, which was obtained from several different areas in Japan. From taxonomic study, the psychrotrophic type of 3 isolates grew well at 4°C on Trypticase soy agar slant, whereas 2 isolates grew poorly. Cells of all isolates were sensitive to γ-irradiation in phosphate buffer, and the D 10 values obtained were 0.16 to 0.18 kGy under aerobic irradiation conditions similar to the values of salmonellae. In the chicken meat sample, the D 10 value obtained was 0.42 kGy the same value as in phosphate buffer under anaerobic irradiation conditions, and the necessary dose for inactivation of L. monocytogenes was estimated to be 2 kGy in raw chicken meat below 10 -4 CFU (colony forming unit) per gram. In the storage study of chicken meat which was inoculated with about 3×10 3 CFU per gram of L. monocytogenes, the psychrotrophic type of the isolates grew quickly at 7 to 10°C storage. However, a dose of 1 kGy was also effective to suppress the growth of L. monocytogenes at refrigeration temperatures below 10°C
Bres, Vanessa; Yang, Hua; Hsu, Ernie; Ren, Yan; Cheng, Ying; Wisniewski, Michele; Hanhan, Maesa; Zaslavsky, Polina; Noll, Nathan; Weaver, Brett; Campbell, Paul; Reshatoff, Michael; Becker, Michael
2014-01-01
The Atlas Listeria monocytogenes LmG2 Detection Assay, developed by Roka Bioscience Inc., was compared to a reference culture method for seven food types (hot dogs, cured ham, deli turkey, chicken salad, vanilla ice cream, frozen chocolate cream pie, and frozen cheese pizza) and one surface (stainless steel, grade 316). A 125 g portion of deli turkey was tested using a 1:4 food:media dilution ratio, and a 25 g portion for all other foods was tested using 1:9 food:media dilution ratio. The enrichment time and media for Roka's method was 24 to 28 h for 25 g food samples and environmental surfaces, and 44 to 48 h for 125 g at 35 ± 2°C in PALCAM broth containing 0.02 g/L nalidixic acid. Comparison of the Atlas Listeria monocytogenes LmG2 Detection Assay to the reference method required an unpaired approach. For each matrix, 20 samples inoculated at a fractional level and five samples inoculated at a high level with a different strain of Listeria monocytogenes were tested by each method. The Atlas Listeria monocytogenes LmG2 Detection Assay was compared to the Official Methods of Analysis of AOAC INTERNATIONAL 993.12 method for dairy products, the U.S. Department of Agriculture, Food Safety and Inspection Service, Microbiology Laboratory Guidebook 8.08 method for ready-to-eat meat and environmental samples, and the U.S. Food and Drug Administration Bacteriological Analytical Manual, Chapter 10 method for frozen foods. In the method developer studies, Roka's method, at 24 h (or 44 h for 125 g food samples), had 126 positives out of 200 total inoculated samples, compared to 102 positives for the reference methods at 48 h. In the independent laboratory studies, vanilla ice cream, deli turkey and stainless steel grade 316 were evaluated. Roka's method, at 24 h (or 44 h for 125 g food samples), had 64 positives out of 75 total inoculated samples compared to 54 positives for the reference methods at 48 h. The Atlas Listeria monocytogenes LmG2 Detection Assay detected all 50
Directory of Open Access Journals (Sweden)
Boyacioglu O.
2016-06-01
Full Text Available A Listeria monocytogenes-specific bacteriophage cocktail was evaluated for its activity against a nalidixic acid-resistant L. monocytogenes (Lm-NalR isolate on fresh-cut spinach stored under modified atmosphere packaging at various temperatures. Pieces (~2 × 2 cm2 of fresh spinach inoculated with 4.5 log CFU/cm2 Lm-NalR were sprayed with the phage cocktail (6.5 log plaque-forming units [PFU]/cm2 or a control. The samples were stored at 4°C or 10°C for up to 14 d in sealed packages filled with either atmospheric air (AA or modified atmosphere (MA. At 4°C under AA, the phages significantly (P ≤ 0.05 lowered the Lm-NalR populations on spinach, compared to control-treated inoculated samples, by 1.12 and 1.51 log CFU/cm2 after 1 and 14 d, respectively. At 4°C under MA, Lm-NalR was significantly reduced by 1.95 log CFU/cm2 compared to control leaves after both 1 and 14 d. At 10°C under AA, the phages significantly reduced Lm-NalR by 1.50 and 2.51 log CFU/cm2 after 1 and 14 d compared to the control. Again at 10°C under MA, the phages significantly reduced Lm-NalR by 1.71 and 3.24 log CFU/cm2 compared to control after 1 and 14 d, respectively. The results support the potential of lytic bacteriophages in effectively reducing populations of L. monocytogenes on freshcut leafy produce, under both AA and MA conditions.
Jovanović, Gordana D; Klaus, Anita S; Nikšić, Miomir P
2016-01-01
The antibacterial activity of chitosan coatings prepared with acetic or lactic acid, as well as of composite chitosan-gelatin films prepared with essential oils, was evaluated in fresh shredded black radish samples inoculated with Listeria monocytogenes ATCC 19115 and L. monocytogenes ATCC 19112 during seven days of storage at 4°C. The chitosan coating prepared with acetic acid showed the most effective antibacterial activity. All tested formulations of chitosan films exhibited strong antimicrobial activity on the growth of L. monocytogenes on black radish, although a higher inhibition of pathogens was achieved at higher concentrations of chitosan. The antimicrobial effect of chitosan films was even more pronounced with the addition of essential oils. Chitosan-gelatin films with thyme essential oils showed the most effective antimicrobial activity. A reduction of 2.4log10CFU/g for L. monocytogenes ATCC 19115 and 2.1log10CFU/g for L. monocytogenes ATCC 19112 was achieved in the presence of 1% chitosan film containing 0.2% of thyme essential oil after 24h of storage. Copyright © 2016 Asociación Argentina de Microbiología. Publicado por Elsevier España, S.L.U. All rights reserved.
Inactivation of Listeria monocytogenes in milk by pulsed electric field.
Reina, L D; Jin, Z T; Zhang, Q H; Yousef, A E
1998-09-01
Pasteurized whole, 2%, and skim milk were inoculated with Listeria monocytogenes Scott A and treated with high-voltage pulsed electric field (PEF). The effects of milk composition (fat content) and PEF parameters (electric field strength, treatment time, and treatment temperature) on the inactivation of the bacterium were studied. No significant differences were observed in the inactivation of L. monocytogenes Scott A in three types of milk by PEF treatment. With treatment at 25 degrees C, 1- to 3-log reductions of L. monocytogenes were observed. PEF lethal effect was a function of field strength and treatment time. Higher field strength or longer treatment time resulted in a greater reduction of viable cells. A 4-log reduction of the bacterium was obtained by increasing the treatment temperature to 50 degrees C. Results indicate that the use of a high-voltage PEF is a promising technology for inactivation of foodborne pathogens.
Brar, Pardeepinder K; Proano, Lisseth G; Friedrich, Loretta M; Harris, Linda J; Danyluk, Michelle D
2015-02-01
Cocktails of lawn-collected cells were used to determine the survival of Salmonella, Escherichia coli O157:H7, and Listeria monocytogenes on the surface of raw peanut and pecan kernels. Kernels were inoculated with mixtures of four to five strains at 3 or 6 log CFU/g, dried at room temperature, and then stored at -24 ± 1, 4 ± 2, and 22 ± 1°C for 28 or 365 days. In most cases, rates of decline of the pathogens did not differ significantly between the two inoculum concentrations in the 28-day study. At 6 log CFU/g, populations of all pathogens were reduced by 0.5 to 1.6 log CFU/g during an initial 3-day drying period on both peanuts and pecans. The moisture content of peanuts and pecans remained stable at -24 ± 1 and 22 ± 1°C; at 4 ± 2°C, the moisture content increased from 3.8 to 5.6% on peanuts and from 2.6 to 3% on pecans over 365 days. Pathogen populations were stable on pecans stored under frozen and refrigerated conditions, except for L. monocytogenes, which declined at a rate of 0.03 log CFU/g/30 days at 4 ± 2°C. Salmonella populations were stable on peanuts stored at -24 ± 1 and 4 ± 2°C, but E. coli O157:H7 and L. monocytogenes declined at rates of 0.03 to 0.12 log CFU/g/30 days. At 22 ± 1°C, Salmonella, E. coli O157:H7, and L. monocytogenes declined at a rate of 0.22, 0.37, and 0.59 log CFU/g/30 days, respectively, on peanuts, and at 0.15, 0.34, and 1.17 log CFU/g/30 days, respectively, on pecans. Salmonella counts were above the limit of detection (0.30 log CFU/g) throughout the study. In most cases during storage, counts obtained from pecans were higher than from peanuts.
Directory of Open Access Journals (Sweden)
Voltaire Sant'Anna
2013-12-01
Full Text Available The antimicrobial activity of the bacteriocin-like substance (BLS P34 against Listeria monocytogenes was investigated in chicken sausage. The BLS was applied to chicken sausages (256 AU g-1 previously inoculated with a suspension of 10² cfu g-1 of L. monocytogenes. BLS P34 inhibited the indicator microorganism in situ in all incubation times for up to 10 days at 5 °C. The effectiveness of BLS P34 was increased when it was added in combination with nisin. The bacteriocin was also tested in natural eatable natural bovine wrapping (salty semi-dried tripe against the same indicator microorganism, also showing inhibitory capability in vitro. BLS P34 showed potential to control L. monocytogenes in refrigerated meat products.
Directory of Open Access Journals (Sweden)
Nariman El Abed
2014-01-01
Full Text Available The chemical composition, antioxidant and antimicrobial activities, and the preservative effect of Thymus capitata essential oil against Listeria monocytogenes inoculated in minced beef meat were evaluated. The essential oil extracted was chemically analyzed by gas chromatography-mass spectrometry. Nineteen components were identified, of which carvacrol represented (88.89% of the oil. The antioxidant activity was assessed in vitro by using both the DPPH and the ABTS assays. The findings showed that the essential oil exhibited high antioxidant activity, which was comparable to the reference standards (BHT and ascorbic acid with IC50 values of 44.16 and 0.463 μg/mL determined by the free-radical scavenging DPPH and ABTS assays, respectively. Furthermore, the essential oil was evaluated for its antimicrobial activity using disc agar diffusion and microdilution methods. The results demonstrated that the zone of inhibition varied from moderate to strong (15–80 mm and the minimum inhibition concentration values ranged from 0.32 to 20 mg/mL. In addition, essential oil evaluated in vivo against Listeria monocytogenes showed clear and strong inhibitory effect. The application of 0.25 or 1% (v/w essential oil of T. capitata to minced beef significantly reduced the L. monocytogenes population when compared to those of control samples (P-value <0.01.
Helloin, E; Bouttefroy, A; Gay, M; Phan Thanh, L
2003-02-01
The effect of preheating on the survival of L. monocytogenes in Richard's broth, which mimics the composition of Camembert cheese composition, was examined. Experiments were carried out to reproduce contamination of cheese with environmental heat-stressed cells of L. monocytogenes surviving hot-cleaning procedures. Cells in mid-log phase were heated for 30 min at 56 degrees C before being inoculated into Richard's broth. The pHs and temperatures of Richard's broth were chosen to recreate the conditions of curd dripping (pH 5, 25 degrees C), of the beginning of cheese ripening (pH 5, 12 degrees C), and of the beginning (pH 5, 4 degrees C) and the end (pH 7, 4 degrees C) of cheese storage. Immediately after heat treatment, the viability loss was especially high for strain 306715, which exhibited only 0.6% +/- 0.2% survival, compared with 22% +/- 8.7% for strain EGD. The percentages of the surviving heated cells that were injured were 93% +/- 8% for strain 306715 and 98% +/- 3% for strain EGD. The destruction of the surviving L. monocytogenes cells was accelerated when they encountered the pH and temperature conditions of Camembert cheese during manufacturing, ripening, and cold storage (pH 5 at 25, 12, and 4 degrees C, respectively). The multiplication of the surviving heated cells was retarded under favorable growth conditions similar to those of storage by the distributor and the consumer (pH 7 at 4 and 12 degrees C, respectively).
Tsiraki, Maria I; Yehia, Hany M; Elobeid, Tahra; Osaili, Tareq; Sakkas, Hercules; Savvaidis, Ioannis N
2018-02-01
The antimicrobial effect of citrus extract (at 1 mL/kg [C1] and 2 mL/kg [C2]) on naturally occurring microbiota and inoculated pathogens (E. coli O157:H7 and L. monocytogenes at ca. 6 log cfu/g) in the traditional Greek yogurt-based salad Tzatziki stored at 4, 10, or 21 °C, was examined. Lactic acid bacteria (LAB) were high (8.0-8.5 log cfu/g) and varied only minimally for both the control (untreated) and the citrus extract-treated salad samples, whereas the higher citrus extract concentration yielded the lowest yeast populations, irrespective of temperature, during the entire storage period. Populations of inoculated E. coli (6 log cfu/g) declined in both untreated and citrus extract-treated samples from day 0-70, 35, and 15 at 4, 10, and 21 °C, respectively. Citrus extract had a significant effect on the survival of the inoculated E. coli O157:H7, with reductions of 2.8-4.8 log cfu/g in the citrus extract-treated samples at the end of the storage period. Our data show that L. monocytogenes survived in both untreated and citrus extract-treated samples during the entire storage period, irrespective of the storage temperature. The higher concentration of citrus extract had a significant effect on the survival of L. monocytogenes in the treated samples, and reductions of 1.5-3.0 logs were noted on final day 70, 35 and 15 at 4, 10 and 21 °C, respectively. The results of our study demonstrated the potential of citrus extract as a natural compound that can control the growth of food-borne pathogenic bacteria, such as E. coli O157:H7 and L. monocytogenes in Tzatziki, a yogurt-based salad. Copyright © 2017 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Eleftherios H. Drosinos
2016-08-01
Full Text Available The aim of the present study was to assess the expression of key virulence genes during co-culture of L. monocytogenes with a bacteriocinogenic E. faecium strain in liquid growth medium. For that purpose, BHI broth was inoculated with 7 log CFU·mL–1 L. monocytogenes and 4, 5 or 6 log CFU·mL–1 E. faecium. Sampling took place after 8 and 24 h of incubation, corresponding to the maximum and minimum of enterocin production, respectively. The RNA was extracted, stabilized and expression of prfA, sigB, hly, plcA, plcB, inlA, inlB, inlC and inlJ, was assessed by RT-qPCR. Most of the genes were downregulated during co-culture at 5 °C. Moreover, a statistically significant effect of the inoculum level was evident in most of the cases. On the contrary, no effect on the transcription level of most of the genes was observed during co-culture at 37 °C.
The heat resistance of a cocktail of five Salmonella strains and five L. monocytogenes strains was determined in teriyaki-marinated chicken breasts. Inoculated meat, packaged in bags, were completely immersed in a circulating water bath and cooked to a final temperature of 55, 57.5 or 60C in one h...
Dreux, N; Albagnac, C; Federighi, M; Carlin, F; Morris, C E; Nguyen-the, C
2007-10-01
To investigate the presence of viable but non-culturable Listeria monocytogenes during survival on parsley leaves under low relative humidity (RH) and to evaluate the ability of L. monocytogenes to recover from VBNC to culturable state under satured humidity. Under low RH (47-69%) on parsley leaves, the initial number of L. monocytogenes populations counted on non selective media (10(9) L. monocytogenes per leaf on TSA) was reduced by 6 log10 scales in 15 days, whereas number of viable L. monocytogenes counted under the microscope was reduced by 3-4 log10 scales, indicating the presence of VBNC cells. This was demonstrated on three L. monocytogenes strains (EGDe, Bug 1995 and LmP60). Changing from low to 100% RH permitted an increase of the culturable counts of L. monocytogenes and this growth was observed only when residual culturable cells were present. Moreover, VBNC L. monocytogenes inoculated on parsley leaves did not become culturable after incubation under 100% RH. Dry conditions induced VBNC L. monocytogenes on parsley leaves but these VBNC were likely unable to recover culturability after transfer to satured humidity. Enumeration on culture media presumably under-estimates the number of viable L. monocytogenes on fresh produce after exposure to low RH.
International Nuclear Information System (INIS)
Fu, A.H.; Sebranek, J.G.; Murano, E.A.
1995-01-01
Cooked pork chops (pumped with salt/polyphosphate brine or untreated) and cured hams were inoculated with Listeria monocytogenes and Salmonella typhimurium. The samples were irradiated at low (0.75 to 0.90 kGy) or medium doses (1.8 to 2.0 kGy), and each dose was delivered at either a low (2.5 M/min conveyor speed) or high (5.4 M/min) dose rate. Low-dose irradiation reduced L. monocytogenes by more than 2 log and S. typhimurium by 1 to 3 log. Pathogen populations and total plate counts (TPC) were reduced to undetectable levels by medium doses. No meat quality attributes were affected, and no dose rate effect was observed. Nitrite reduced (P 0.05) both pathogens and TPC during 7 degrees C storage in ham, especially when combined with low-dose irradiation
Concha-Meyer, Anibal; Eifert, Joseph; Williams, Robert; Marcy, Joseph; Welbaum, Gregory
2014-05-01
Listeria monocytogenes is a foodborne pathogen that represents a high risk for consumers because it can grow under refrigeration conditions and can also develop acid tolerance. Fresh blueberries are hand-picked, packed, and transported under refrigeration without receiving a microbial inactivation treatment. The aim of this work was to study the survival of L. monocytogenes in fresh highbush blueberries stored at 4 or 12 °C under different controlled atmosphere conditions, including air (control); 5% O2, 15% CO2, 80% N2 (controlled atmosphere storage [CAS]); or ozone gas (O3), 4 ppm at 4 °C or 2.5 ppm at 12 °C, at high relative humidity (90 to 95%) for a total of 10 days. Fresh blueberries inside a plastic clamshell were spot inoculated with the bacteria and were stored at 4 or 12 °C in isolated cabinets under air, CAS, and O3 atmospheric conditions. Samples were evaluated on days 0, 1, 4, 7, and 10 for microbial growth using modified Oxford agar. CAS did not delay or inhibit L. monocytogenes growth in fresh blueberries after 10 days. O3 achieved 3- and 2-log reductions when compared with air treatment at 4 and 12 °C, respectively. Low concentrations of O3 together with proper refrigeration temperature can ensure product safety throughout transportation. O3 is a strong antimicrobial that safely decomposes to oxygen and water without leaving residues and can be used as an alternative method to prevent bacterial growth during a long transport period.
Colás-Medà, Pilar; Viñas, Inmaculada; Oliveira, Márcia; Anguera, Marina; Serrano, Jose C E; Abadias, Maribel
2017-04-01
Survival and virulence of foodborne pathogens can be influenced by environmental factors such as the intrinsic properties of food as well as the extrinsic properties that contribute to food shelf life (e.g., temperature and gas atmosphere). The direct contribution of food matrix characteristics on the survival of L. monocytogenes during fresh-cut fruit shelf life is not very well understood. In addition, the gastrointestinal tract is the primary route of listeriosis infection and penetration of the intestinal epithelial cell barrier is the first step in the infection process. Hence, the pathogenic potential of L. monocytogenes, measured as the capability for the organism to survive a simulated gastrointestinal tract and the proportion of cells able to subsequently adhere to and invade differentiated Caco-2 cells, subjected to fresh-cut pear and melon shelf life, was investigated. Samples were inoculated, stored at 10 °C for 7 days and evaluated after inoculation and again after 2 and 7 days of storage. A decrease in L. monocytogenes' capacity to survive a simulated gastrointestinal tract was observed with increasing storage time, regardless of the fruit matrix evaluated. Furthermore, L. monocytogenes placed on fresh-cut pear and melon was subjected to an attachment and invasion assay after crossing the simulated gastrointestinal tract. After inoculation, pathogen on fresh-cut pear showed 5-fold more capacity to adhere to Caco-2 cells than pathogen on fresh-cut melon. After 2 days of storage, L. monocytogenes grown on fresh-cut melon showed similar adhesive capacity (1.11%) than cells grown on pear (1.83%), but cells grown on melon had the higher invasive capacity (0.0093%). We can conclude that minimally processed melon could represent a more important hazard than pear under the studied shelf life. Copyright © 2016 Elsevier Ltd. All rights reserved.
Lloyd, T; Alvarado, C Z; Brashears, M M; Thompson, L D; McKee, S R; Berrang, M
2009-10-01
The growth of Listeria monocytogenes in further-processed meat products has become a major concern and an important food safety issue. The meat and poultry industries have incorporated interventions such as organic acids in marinades to inhibit the growth of L. monocytogenes. In this study, organic acids were utilized in the raw product and as a postcook dip to determine their inhibitory effect on the growth of L. monocytogenes in turkey deli loaves. The turkey deli loaves were processed, cooked, cooled, inoculated with streptomycin-resistant L. monocytogenes, and then dipped. Treatments were potassium lactate (PL) in the raw product with sodium lactate (SL), sodium diacetate (SD) dip, PL with SL/PL/SD dip, SL with SL/SD dip, and SL with SL/PL/SD dip. There was also a positive (inoculated) and negative (noninoculated) control, which was dipped in distilled water. Days 0, 7, 14, 21, 28, 42, and 56 were sampled for L. monocytogenes. There were no differences (P>0.05) among the organic acid treatments in the turkey deli loaves at any time points; therefore, all of the treatments increased the lag phase of L. monocytogenes, extending the shelf-life of the product. However, there was a difference between the treatments and the positive control at d 7, 14, 21, 28, 42, and 56. The growth of L. monocytogenes increased immediately in the positive control, whereas the negative control appeared to have no growth. These organic acids can provide meat processors with a useful method for extending the lag phase of L. monocytogenes in ready-to-eat meat and poultry products.
Growth of Listeria monocytogenes in Camembert and other soft cheeses at refrigeration temperatures.
Back, J P; Langford, S A; Kroll, R G
1993-08-01
Listeria monocytogenes survived and, under most conditions, multiplied when inoculated directly into the cheese milk of laboratory made Camembert cheeses. The rate and extent of growth was reduced at lower storage temperatures. Significantly higher rates of growth occurred at the surface compared with the centre of the cheeses, and these were probably associated with increased pH and proteolysis at the cheese surface due to the mould ripening process. Similar results were obtained with Camenbert cheeses surface inoculated after manufacture. There was also temperature-dependent growth of List. monocytogenes on a range of inoculated commercially manufactured soft cheeses. Significant growth occurred in Cambazola, French and English Brie, blue and white Lymeswold, French Camembert and Brie with garlic. Little if any growth occurred in blue and white Stilton, Mycella, Chaume and full fat soft cheese with garlic and herbs at the temperatures examined.
Balay, Danielle R; Dangeti, Ramana V; Kaur, Kamaljit; McMullen, Lynn M
2017-08-16
The aims of this study were to improve the method for purification of leucocin A to increase yield of peptide and to evaluate the efficacy of leucocin A and an analogue of leucocin A (leucocin N17L) to inhibit the growth of Listeria monocytogenes on wieners in the presence of spoilage organisms. Leucocin A was produced by Leuconostoc gelidum UAL187 and purified with a five-fold increase in yield; leucocin N17L was synthesized replacing asparagine at residue 17 with leucine. Five strains of L. monocytogenes associated with foodborne illness were used to assess bacteriocin efficacy in vitro and in situ. Minimum inhibitory concentrations could not be determined in broth; however, on agar the minimum inhibitory concentrations ranged from 11.7-62.5μM and 62.5->500μM for leucocin A and leucocin N17L, respectively. Leucocin N17L was less effective than the native bacteriocin at controlling the growth of L. monocytogenes. The inactivation profiles of L. monocytogenes in broth in the presence of leucocin A suggested each isolate had different levels of resistance to the bacteriocin as determined by the initial bactericidal effect. The formation of spontaneously resistance subpopulations were also observed for each strain of L. monocytogenes. In situ, wieners were inoculated with the spoilage organisms, Carnobacterium divergens and Brochothrix thermosphacta, followed by surface application of purified leucocin A, and inoculated with a cocktail of L. monocytogenes. Wieners were vacuum packaged and stored at 7°C for 16d. Leucocin A reduced the counts L. monocytogenes on wieners during storage, regardless of the presence of C. divergens. B. thermosphacta was unaffected by the presence of leucocin A on wieners over the duration of storage. This study suggests that leucocin A may be beneficial to industry as a surface application on wieners to help reduce L. monocytogenes counts due to post-processing contamination even in the presence of spoilage organisms. However, further
Incidence of Listeria monocytogenes and Other Bacteria in ...
African Journals Online (AJOL)
Prof. Ogunji
Abstract. The involvement of Listeria monocytogenes in spontaneous abortion in Jos was investigated. One hundred blood and 100 placenta samples were collected from spontaneous abortion patients in Jos. The samples were inoculated first into Listeria enrichment broth. Incubation was at 37o C, followed by cold ...
Thermal resistance of Listeria monocytogenes in sausage meat.
Farber, J M; Hughes, A; Holley, R; Brown, B
1989-01-01
The heat resistance of a mixture of 10 different strains of Listeria monocytogenes inoculated into ground meat and ground meat plus cure was examined. D-values for ground meat ranged from 1.01 min at 62 degrees C to 13.18 min at 56 degrees C. The D-values obtained for ground meat plus cure were approximately 5-8 fold times higher than those for ground meat alone. These results imply that rare meats and possibly some cooked fermented meats may not be heated adequately to inactivate Listeria.
Essential oils of thyme and Rosemary in the control of Listeria monocytogenes in raw beef
Directory of Open Access Journals (Sweden)
Maíra Maciel Mattos de Oliveira
2013-12-01
Full Text Available This study was developed in order to evaluate two alternatives for the control of Listeria monocytogenes in raw bovine meat pieces, both based on the use of Thymus vulgaris and Rosmarinus officinalis essential oils (EOs. The antilisterial activity of different concentrations of the EOs was tested in vitro using agar dilution and disk volatilization techniques. In addition, L. monocytogenes was inoculated in meat pieces, which were submerged in edible gelatin coatings containing 2% (v/v EOs or submitted to the vapor of EOs (0.74 μL.cm-3. L. monocytogenes was quantified after one, 48 and 96 hours of storage (7 °C. In the in vitro tests, the EO of T. vulgaris presented higher activity. The two options used (edible gelatin coating and vapor activity, in spite of exercising effects with differentiated behaviors, presented antibacterial activity against L. monocytogenes inoculated in raw bovine meat (p < 0.05. Greatest antibacterial activity were obtained in the experiment that used edible coatings containing EOs, at 48 hours of storage reductions in bacterial counts between 1.09 and 1.25 Log CFU.g-1 were obtained. In the vapor effect experiment, the EO of T. vulgaris caused the highest reduction in the population of bacteria inoculated in raw bovine meat (p < 0.05, 0.40 Log CFU.g-1 at 96 hours of storage. This study supplied important information regarding new and promising natural alternatives, based on the concept of active packaging, for the control of L. monocytogenes in the meat industry.
Rezende, Ana Carolina B; Igarashi, Maria Crystina; Destro, Maria Teresa; Franco, Bernadette D G M; Landgraf, Mariza
2014-10-01
This study evaluated the effects of irradiation on the reduction of Shiga toxin-producing Escherichia coli (STEC), Salmonella strains, and Listeria monocytogenes, as well as on the sensory characteristics of minimally processed spinach. Spinach samples were inoculated with a cocktail of three strains each of STEC, Salmonella strains, and L. monocytogenes, separately, and were exposed to gamma radiation doses of 0, 0.2, 0.4, 0.6, 0.8, and 1.0 kGy. Samples that were exposed to 0.0, 1.0, and 1.5 kGy and kept under refrigeration (4°C) for 12 days were submitted to sensory analysis. D10 -values ranged from 0.19 to 0.20 kGy for Salmonella and from 0.20 to 0.21 for L. monocytogenes; for STEC, the value was 0.17 kGy. Spinach showed good acceptability, even after exposure to 1.5 kGy. Because gamma radiation reduced the selected pathogens without causing significant changes in the quality of spinach leaves, it may be a useful method to improve safety in the fresh produce industry.
Incidence of Listeria monocytogenes and Other Bacteria in ...
African Journals Online (AJOL)
The involvement of Listeria monocytogenes in spontaneous abortion in Jos was investigated. One hundred blood and 100 placenta samples were collected from spontaneous abortion patients in Jos. The samples were inoculated first into Listeria enrichment broth. Incubation was at 37o C, followed by cold enrichment at ...
Gkana, E; Chorianopoulos, N; Grounta, A; Koutsoumanis, K; Nychas, G-J E
2017-04-01
The objective of the present study was to determine the factors affecting the transfer of foodborne pathogens from inoculated beef fillets to non-inoculated ones, through food processing surfaces. Three different levels of inoculation of beef fillets surface were prepared: a high one of approximately 10 7 CFU/cm 2 , a medium one of 10 5 CFU/cm 2 and a low one of 10 3 CFU/cm 2 , using mixed-strains of Listeria monocytogenes, or Salmonella enterica Typhimurium, or Escherichia coli O157:H7. The inoculated fillets were then placed on 3 different types of surfaces (stainless steel-SS, polyethylene-PE and wood-WD), for 1 or 15 min. Subsequently, these fillets were removed from the cutting boards and six sequential non-inoculated fillets were placed on the same surfaces for the same period of time. All non-inoculated fillets were contaminated with a progressive reduction trend of each pathogen's population level from the inoculated fillets to the sixth non-inoculated ones that got in contact with the surfaces, and regardless the initial inoculum, a reduction of approximately 2 log CFU/g between inoculated and 1st non-inoculated fillet was observed. S. Typhimurium was transferred at lower mean population (2.39 log CFU/g) to contaminated fillets than E. coli O157:H7 (2.93 log CFU/g), followed by L. monocytogenes (3.12 log CFU/g; P < 0.05). Wooden surfaces (2.77 log CFU/g) enhanced the transfer of bacteria to subsequent fillets compared to other materials (2.66 log CFU/g for SS and PE; P < 0.05). Cross-contamination between meat and surfaces is a multifactorial process strongly depended on the species, initial contamination level, kind of surface, contact time and the number of subsequent fillet, according to analysis of variance. Thus, quantifying the cross-contamination risk associated with various steps of meat processing and food establishments or households can provide a scientific basis for risk management of such products. Copyright © 2016 Elsevier Ltd
Caballero, Oscar; Alles, Susan; Le, Quynh-Nhi; Gray, R Lucas; Hosking, Edan; Pinkava, Lisa; Norton, Paul; Tolan, Jerry; Mozola, Mark; Rice, Jennifer; Chen, Yi; Ryser, Elliot; Odumeru, Joseph
2016-01-01
Work was conducted to validate performance of the ANSR(®) for Listeria monocytogenes method in selected food and environmental matrixes. This DNA-based assay involves amplification of nucleic acid via an isothermal reaction based on nicking enzyme amplification technology. Following single-step sample enrichment for 16-24 h for most matrixes, the assay is completed in 40 min using only simple instrumentation. When 50 distinct strains of L. monocytogenes were tested for inclusivity, 48 produced positive results, the exceptions being two strains confirmed by PCR to lack the assay target gene. Forty-seven nontarget strains (30 species), including multiple non-monocytogenes Listeria species as well as non-Listeria, Gram-positive bacteria, were tested, and all generated negative ANSR assay results. Performance of the ANSR method was compared with that of the U.S. Department of Agriculture, Food Safety and Inspection Service Microbiology Laboratory Guidebook reference culture procedure for detection of L. monocytogenes in hot dogs, pasteurized liquid egg, and sponge samples taken from an inoculated stainless steel surface. In addition, ANSR performance was measured against the U.S. Food and Drug Administration Bacteriological Analytical Manual reference method for detection of L. monocytogenes in Mexican-style cheese, cantaloupe, sprout irrigation water, and guacamole. With the single exception of pasteurized liquid egg at 16 h, ANSR method performance as quantified by the number of positives obtained was not statistically different from that of the reference methods. Robustness trials demonstrated that deliberate introduction of small deviations to the normal assay parameters did not affect ANSR method performance. Results of accelerated stability testing conducted using two manufactured lots of reagents predicts stability at the specified storage temperature of 4°C of more than 1 year.
Geornaras, Ifigenia; Skandamis, Panagiotis N; Belk, Keith E; Scanga, John A; Kendall, Patricia A; Smith, Gary C; Sofos, John N
2006-12-01
This study evaluated post-processing chemical solutions for their antilisterial effects on commercial smoked sausage formulated with or without 1.5% potassium lactate plus 0.05% sodium diacetate, and contaminated (approximately 3-4 log cfu/cm(2)) with 10-strain composite Listeria monocytogenes inocula prepared under various conditions. Inoculated samples were left untreated, or were immersed (2 min, 25 +/- 2 degrees C) in solutions of acetic acid (2.5%), lactic acid (2.5%), potassium benzoate (5%) or Nisaplin (0.5%, equivalent to 5000 IU/ml of nisin) alone, and in sequence (Nisaplin followed by acetic acid, lactic acid or potassium benzoate), before vacuum packaging and storage at 10 degrees C (48 days). Acetic acid, lactic acid or potassium benzoate applied alone reduced initial L. monocytogenes populations by 0.4-1.5 log cfu/cm(2), while treatments including Nisaplin caused reductions of 2.1-3.3 log cfu/cm(2). L. monocytogenes on untreated sausage formulated with antimicrobials had a lag phase duration of 10.2 days and maximum specific growth rate (mu(max)) of 0.089 per day, compared to no lag phase and mu(max) of 0.300 per day for L. monocytogenes on untreated product that did not contain antimicrobials in the formulation. The immersion treatments inhibited growth of the pathogen for 4.9-14.8 days on sausage formulated without potassium lactate-sodium diacetate; however, in all cases significant (P meat processors in their efforts to select required regulatory alternatives for control of post-processing contamination in meat products.
Commensal microbes provide first line defense against Listeria monocytogenes infection
Littmann, Eric R.; Kim, Sohn G.; Morjaria, Sejal M.; Ling, Lilan; Gyaltshen, Yangtsho; Taur, Ying; Leiner, Ingrid M.
2017-01-01
Listeria monocytogenes is a foodborne pathogen that causes septicemia, meningitis and chorioamnionitis and is associated with high mortality. Immunocompetent humans and animals, however, can tolerate high doses of L. monocytogenes without developing systemic disease. The intestinal microbiota provides colonization resistance against many orally acquired pathogens, and antibiotic-mediated depletion of the microbiota reduces host resistance to infection. Here we show that a diverse microbiota markedly reduces Listeria monocytogenes colonization of the gut lumen and prevents systemic dissemination. Antibiotic administration to mice before low dose oral inoculation increases L. monocytogenes growth in the intestine. In immunodeficient or chemotherapy-treated mice, the intestinal microbiota provides nonredundant defense against lethal, disseminated infection. We have assembled a consortium of commensal bacteria belonging to the Clostridiales order, which exerts in vitro antilisterial activity and confers in vivo resistance upon transfer into germ free mice. Thus, we demonstrate a defensive role of the gut microbiota against Listeria monocytogenes infection and identify intestinal commensal species that, by enhancing resistance against this pathogen, represent potential probiotics. PMID:28588016
Zhang, Lei; Yan, Zhinong; Ryser, Elliot T
2007-11-01
In the U.S. Department of Agriculture (USDA) method for Listeria detection, a 25-g composite food sample is enriched in 225 ml of University of Vermont medium (UVM), giving a detection limit of 0.04 CFU/g. However, in a recent large-scale four-state deli meat survey for L. monocytogenes, 125-g samples enriched in 1,125 ml of UVM were requested to increase the detection limit to 0.008 CFU/g. To circumvent problems associated with large volumes of UVM, the impact on L. monocytogenes growth of lower dilution ratios used for enrichment and most-probable-number (MPN) detection was compared with the results obtained using the conventional 1:10 dilution. In this study, 125-g samples of cured turkey, uncured turkey, ham, and roast beef were inoculated with a six-strain L. monocytogenes cocktail to contain approximately 1 x 10(3) CFU/g. This cocktail was then diluted 1:3, 1:5, or 1:10 in UVM, homogenized, enriched at 30 degrees C, and periodically plated on modified Oxford agar to determine generation times during 24 h of incubation. The same enrichment protocol was also assessed in a three-tube MPN assay using 125-g samples inoculated with L. monocytogenes to contain approximately 1 CFU/g. The effects of two homogenization methods, stomaching and pulsifying, on Listeria growth were compared using oven-roasted turkey breast diluted 1:3, 1:5, and 1:10 in UVM. Overall, the growth rates, generation times, and MPN values for each of the four selected deli meats were similar (P > 0.05) using UVM enrichment ratios of 1:3, 1:5, and 1:10, with no significant (P > 0.05) differences in L. monocytogenes growth rate or generation time between experiments using pulsifying and stomaching. These findings indicate that lower volumes of UVM can be used in the USDA procedure when examining deli meats without compromising Listeria recovery.
Golden, Max C; McDonnell, Lindsey M; Sheehan, Vivien; Sindelar, Jeffrey J; Glass, Kathleen A
2014-10-01
Fermentation-derived nitrite (NO2) from vegetable sources is increasingly used as a "clean label" alternative to conventional NaNO2. Previous results suggested that processed meats cured with NO2 derived from a "natural" source had lower antimicrobial activity than did meats produced with chemical NaNO2; however, the differences were likely due to NO2 concentration rather than source. The objective of this study was to compare the antilisterial properties of traditional and clean label alternative curing approaches when combined with antimicrobials in deli-style turkey. Listeria monocytogenes inhibition by NO2 from synthetic and natural sources was validated in deli-style turkey (73 to 74% moisture, 1.8% salt, pH 6.4). Products were prepared with 0, 80, or 120 mg/kg NO2 using purified NaNO2 or cultured celery powder. Additional treatments were supplemented with 3.8% lactate-diacetate blend (LD) or 1% cultured sugar-vinegar blend (DF). Sliced cooked products were surface inoculated with L. monocytogenes at 3 log CFU/g, vacuum packaged, and stored at 4°C for 12 weeks. Results revealed an average 2.4-log increase in L. monocytogenes at 3 weeks in the control without antimicrobials, a 1.3-log increase at 4 weeks for both 80 mg/kg NO2 treatments, and a 1.5-log increase at 6 weeks for the 120 mg/kg NO2 treatments. No significant difference (P > 0.05) in growth inhibition was found between NO2 sources when equivalent concentrations were added. In uncured turkey with 3.8% LD or 1% DF, growth was delayed until 6 weeks, whereas supplementation with LD or DF and 80 mg/kg NO2 from either source delayed listerial growth through 12 weeks. This study confirmed that the concentration of NO2, rather than the source, is a primary factor in enhancing the safety of ready-to-eat meats. Both conventional NO2 treatments and a clean label solution consisting of a fermentation-derived antimicrobial combined with 80 mg/kg naturally derived NO2 inhibited L. monocytogenes through 12 weeks of
Animal models for oral transmission of Listeria monocytogenes
Directory of Open Access Journals (Sweden)
Sarah E F D'Orazio
2014-02-01
Full Text Available Listeria monocytogenes has been recognized as a food borne pathogen in humans since the 1980s, but we still understand very little about oral transmission of L. monocytogenes or the host factors that determine susceptibility to gastrointestinal infection, due to the lack of an appropriate small animal model of oral listeriosis. Early feeding trials suggested that many animals were highly resistant to oral infection, and the more reproducible intravenous or intraperitoneal routes of inoculation soon came to be favored. There are a fair number of previously published studies using an oral infection route, but the work varies widely in terms of bacterial strain choice, the methods used for oral transmission, and various manipulations used to enhance infectivity. This mini review will summarize the published literature using oral routes of L. monocytogenes infection and will highlight recent technological advances that have made oral infection a more attractive model system.
Directory of Open Access Journals (Sweden)
Shahin Gaini
2015-01-01
Full Text Available A 51-year-old Caucasian woman with Listeria monocytogenes meningitis was treated and discharged after an uncomplicated course. Her medical history included immunosuppressive treatment with prednisolone and azathioprine for autoimmune hepatitis. A diagnostic work-up after the meningitis episode revealed that she had low levels of the IgG4 subclass. To our knowledge, this is the first case report describing a possible association between autoimmune hepatitis and the occurrence of Listeria monocytogenes meningitis, describing a possible association between Listeria monocytogenes meningitis and deficiency of the IgG4 subclass and finally describing a possible association between Listeria monocytogenes meningitis and immunosuppressive therapy with prednisolone and azathioprine.
DEFF Research Database (Denmark)
Gaini, Shahin
2015-01-01
A 51-year-old Caucasian woman with Listeria monocytogenes meningitis was treated and discharged after an uncomplicated course. Her medical history included immunosuppressive treatment with prednisolone and azathioprine for autoimmune hepatitis. A diagnostic work-up after the meningitis episode...... revealed that she had low levels of the IgG4 subclass. To our knowledge, this is the first case report describing a possible association between autoimmune hepatitis and the occurrence of Listeria monocytogenes meningitis, describing a possible association between Listeria monocytogenes meningitis...... and deficiency of the IgG4 subclass and finally describing a possible association between Listeria monocytogenes meningitis and immunosuppressive therapy with prednisolone and azathioprine....
Juck, Greg; Neetoo, Hudaa; Chen, Haiqiang
2010-09-01
The relatively high prevalence of Listeria monocytogenes in ready-to-eat (RTE) turkey products is of great concern. The overall objective of this study was to develop antimicrobial edible coating formulations to effectively control the growth of this pathogen. The antimicrobials studied were nisin (500IU/g), Novagard CB 1 (0.25%), Guardian NR100 (500ppm), sodium lactate (SL, 2.4%), sodium diacetate (SD, 0.25%), and potassium sorbate (PS, 0.3%). These were incorporated alone or in binary combinations into five edible coatings: alginate, kappa-carrageenan, pectin, xanthan gum, and starch. The coatings were applied onto the surface of home-style poached and processed deli turkey discs inoculated with ~3log CFU/g of L. monocytogenes. The turkey samples were then stored at 22 degrees C for 7days. For poached and processed deli turkey, the coatings were found to be equally effective, with pectin being slightly less effective than the others. The most effective poached turkey treatments seemed to be SL (2.4%)/SD (0.25%) and Nisin (500IU/g)/SL (2.4%), which yielded final populations of 3.0 and 4.9log CFU/g respectively compared to the control which was 7.9log CFU/g. For processed deli turkey, the most effective antimicrobial treatments seemed to be Nisin (500IU/g)/SD (0.25%) and Nisin (500IU/g)/SL (2.4%) with final populations of 1.5 and 1.7log CFU/g respectively compared to the control which was 6.5log CFU/g. In the second phase of the study, home-style poached and store-purchased roasted (deli) turkey inoculated with the pathogen at a level of ~3log CFU/g were coated with alginate incorporating selected antimicrobial combinations and stored for 8weeks at 4 degrees C. Alginate coatings supplemented with SL (2.4%)/PS (0.3%) delayed the growth of L. monocytogenes with final counts reaching 4.3log CFU/g (home-style poached turkey) and 6.5log CFU/g (roasted deli turkey) respectively while the counts in their untreated counterparts were significantly higher (P<0.05) reaching 9
Solar irradiance limits the long-term survival of Listeria monocytogenes in seawater.
NicAogáin, K; Magill, D; O'Donoghue, B; Conneely, A; Bennett, C; O'Byrne, C P
2018-03-01
Seafood has often been implicated in outbreaks of food-borne illness caused by Listeria monocytogenes but the source of contamination is usually not known. In this study we investigated the possibility that this pathogen could survive in seawater for an extended time period. Freshly collected seawater samples were inoculated with 1 × 10 8 CFU per ml of L. monocytogenes EGD-e and survival was monitored by plate counting for up to 25 days. When incubated in the dark, either at ambient temperatures (4-14°C) or at 16°C, >10 4 CFU per ml survivors were present after 25 days. However, when the seawater cell suspensions were exposed to ambient light (solar irradiation) and temperatures, L. monocytogenes lost viability rapidly and no survivors could be detected after the 80 h time point. Both UV-A and visible light in the blue region of the spectrum (470 nm) were found to contribute to this effect. The stress inducible sigma factor σ B was found to play a role in survival of L. monocytogenes in seawater. Together these data demonstrate that solar irradiation is a critical determinant of L. monocytogenes survival in marine environments. The data further suggest the possibility of controlling this food-borne pathogen in food-processing environments using visible light. Listeria monocytogenes is a food-borne bacterial pathogen capable of causing the life-threatening infection, listeriosis. In seafood the route of contamination from the environment is often not well understood as this pathogen is not generally thought to survive well in seawater. Here we provide evidence that L. monocytogenes is capable of surviving for long periods of time in seawater when light is excluded. Sunlight is demonstrated to have a significant effect on the survival of this pathogen in seawater, and both visible (470 nm) and UV-A light are shown to contribute to this effect. © 2017 The Society for Applied Microbiology.
Kim, Yoon-Hee; Jeong, Seul-Gi; Back, Kyeong-Hwan; Park, Ki-Hwan; Chung, Myung-Sub; Kang, Dong-Hyun
2013-09-16
The effect of various conditions on inactivation of foodborne pathogens and quality of fresh-cut lettuce during ultraviolet (254 nm, UVC) radiation was investigated. Lettuce was inoculated with a cocktail of Escherichia coli O157:H7, Salmonella Typhimurium, and Listeria monocytogenes and treated at different temperatures (4 and 25 °C), distances between sample and lamp (10 and 50 cm), type of exposure (illuminated from one or two sides), UV intensities (1.36 to 6.80 mW/cm²), and exposure times (0.5 to 10 min), sequentially. UV treatment at 25 °C for 1 min achieved 1.45-, 1.35-, and 2.12-log reductions in surface-inoculated E. coli O157:H7, S. Typhimurium, and L. monocytogenes, respectively, whereas the reduction of these pathogens at 4 °C was 0.31, 0.57, and 1.16 log, respectively. UV radiation was most effective when distance from UV lamp to the sample was minimal (10 cm) and radiation area was maximal (two-sided exposure). All UV intensities significantly (P0.05) different from those of nontreated samples up to 5 min exposure. However, these qualities significantly (Pradiation under optimized conditions could reduce foodborne pathogens without adversely affecting color quality properties of fresh-cut lettuce. © 2013 Elsevier B.V. All rights reserved.
Salazar, Joelle K.; Bathija, Vriddi M.; Carstens, Christina K.; Narula, Sartaj S.; Shazer, Arlette; Stewart, Diana; Tortorello, Mary Lou
2018-01-01
This study assessed the growth of Listeria monocytogenes in milkshakes made using the process-contaminated ice cream associated with a listeriosis outbreak in comparison to milkshakes made with artificially contaminated ice cream. For all temperatures, growth kinetics including growth rates, lag phases, maximum populations, and population increases were determined for the naturally and artificially derived contaminants at 5, 10, 15, and 25°C storage for 144 h. The artificially inoculated L. m...
Dailey, Rachel C; Welch, Lacinda J; Hitchins, Anthony D; Smiley, R Derike
2015-04-01
The presence of multiple species of Listeria in regulated food products is not uncommon and can complicate the recovery of Listeria monocytogenes particularly on a non-differentiating medium. The potential complications of Listeria seeligeri and Listeria welshimeri on the recovery of L. monocytogenes from inoculated food test samples using the U.S. Food and Drug Administration's (FDA) selective enrichment procedure was investigated. Post-enrichment enumeration, in the absence of food product, indicates that some L. seeligeri and L. monocytogenes pairings may have population differentials as great as 2.7 ± 0.1 logs with L. seeligeri being the predominant species. A similar observation was noted for L. welshimeri and L. monocytogenes pairings which resulted in population differentials as large as 3.7 ± 0.2 logs with L. welshimeri being the predominant species. Select strain pairings were used to inoculate guacamole, crab meat, broccoli, and cheese with subsequent recovery by the FDA Bacteriological Analytical Manual (BAM) method with 10 colonies per sample selected for confirmation. The presence of L. seeligeri had little effect on the recovery of L. monocytogenes. The presence of L. welshimeri resulted in the failure to recover L. monocytogenes in three out of the four food matrices. This work extends the observation that non-pathogenic species of Listeria can complicate the recovery of L. monocytogenes and that competition during selective enrichment is not limited to the presence of just Listeria innocua. Published by Elsevier Ltd.
Dailey, Rachel C.; Welch, Lacinda J.; Hitchins, Anthony D.; Smiley, R. Derike
2016-01-01
The presence of multiple species of Listeria in regulated food products is not uncommon and can complicate the recovery of Listeria monocytogenes particularly on a non-differentiating medium. The potential complications of Listeria seeligeri and Listeria welshimeri on the recovery of L. monocytogenes from inoculated food test samples using the U.S. Food and Drug Administration's (FDA) selective enrichment procedure was investigated. Post-enrichment enumeration, in the absence of food product, indicates that some L. seeligeri and L. monocytogenes pairings may have population differentials as great as 2.7 ± 0.1 logs with L. seeligeri being the predominant species. A similar observation was noted for L. welshimeri and L. monocytogenes pairings which resulted in population differentials as large as 3.7 ± 0.2 logs with L. welshimeri being the predominant species. Select strain pairings were used to inoculate guacamole, crab meat, broccoli, and cheese with subsequent recovery by the FDA Bacteriological Analytical Manual (BAM) method with 10 colonies per sample selected for confirmation. The presence of L. seeligeri had little effect on the recovery of L. monocytogenes. The presence of L. welshimeri resulted in the failure to recover L. monocytogenes in three out of the four food matrices. This work extends the observation that non-pathogenic species of Listeria can complicate the recovery of L. monocytogenes and that competition during selective enrichment is not limited to the presence of just Listeria innocua. PMID:25475325
Kapetanakou, Anastasia E; Gkerekou, Maria A; Vitzilaiou, Eirini S; Skandamis, Panagiotis N
2017-04-04
Different physicochemical and microbiological characteristics of cheeses may affect Listeria monocytogenes potential to grow, survive, or exhibit an acid adaptive response during storage and digestion. The objectives of the present study were to assess: i) the survival or growth potential of L.monocytogenes on various cheeses during storage, ii) the effect of initial indigenous microbiota on pathogen growth in comparison to expected growth curves retrieved by existing predictive models, and iii) the impact of habituation on/in cheeses surfaces on the subsequent acid resistance during simulated gastric digestion. Portions of cream (Cottage and Mascarpone), soft (Anthotyros, Camembert, Mastelo®, Manouri, Mozzarella, Ricotta), and semi-hard (Edam, Halloumi, Gouda) cheeses were inoculated with ca. 100CFU/g or cm 2 of L.monocytogenes and stored under vacuum or aerobic conditions at 7°C (n=4). The impact of varying (initial) levels of starter culture or indigenous spoilage microbiota on pathogen growth was evaluated by purchasing cheese packages on different dates in relation to production and expiration date (subsequently reflecting to different batches) mimicking a potential situation of cheese contamination with L.monocytogenes during retail display. Values of pH and a w were also monitored and used to simulate growth of L. monocytogenes by existing models and compare it with the observed data of the study. Survival in simulated gastric fluid (SGF) (pH1.5; HCl; max. 120min) was assessed at three time points during storage. Mascarpone, Ricotta, Mozzarella, Camembert, and Halloumi supported L.monocytogenes growth by 0.5-0.8logCFU/g or cm 2 per day, since low initial levels of total viable counts (TVC) (1.8-3.8logCFU/g or cm 2 ) and high pH/a w values (ca. 6.23-6.64/0.965-0.993) were recorded. On Cottage, Anthotyros, Manouri, Mastelo®, Edam, and Gouda, the pathogen survived at populations similar or lower than the inoculation level due to the high reported competition
Nastou, Aikaterini; Rhoades, Jonathan; Smirniotis, Petros; Makri, Ioanna; Kontominas, Michael; Likotrafiti, Eleni
2012-10-15
The efficacy of household decontamination methods at reducing Listeria monocytogenes on fresh lettuce (Lactuca sativa), cucumber (Cucumis sativus) and parsley (Petroselinum sativum) was studied. Inoculated vegetable pieces were immersed in washing solutions and surviving L. monocytogenes enumerated. Parameters investigated were storage temperature prior to washing, dipping water temperature, agitation, acetic acid concentration and immersion time. The results indicated that the storage temperature significantly affects the efficacy of dipping vegetables in water for the control of L. monocytogenes, as the reduction in count was greatest when products had been stored at cooler temperatures. Decontamination with acetic acid (up to 2.0% v/v) was shown to have some effect in most cases, but the highest observed decrease in count was 2.6 log cfu/g. Experiments investigating the effect of exposure time to acetic acid (0.5% and 1.0% v/v, up to 30 min immersion) indicated that immersing the vegetables for more than 10 min is of minimal benefit. The most significant factor affecting washing and decontamination efficacy was the vegetable itself: L. monocytogenes colonizing cucumber epidermis was far more resistant to removal by washing and to acid treatment than that on the leafy vegetables, and L. monocytogenes on parsley was the most susceptible. This shows that published decontamination experiments (often performed with lettuce) cannot necessarily be extrapolated to other vegetables. Copyright © 2012 Elsevier B.V. All rights reserved.
Achemchem, Fouad; Abrini, Jamal; Martínez-Bueno, Manuel; Valdivia, Eva; Maqueda, Mercedes
2006-10-01
The bacteriocinogenic Enterococcus faecium F58 strain, a natural goat's jben cheese isolate, lacks decarboxylase activity involved in most biogenic amine formation. It was also sensitive to 13 antibiotics assayed and free of virulence and vancomycin resistance genes. The F58 strain reached the stationary phase after 12 h of growth in sterile goat's milk, and the production of enterocin F-58 (Ent L50) was first detected after 48 h (400 AU/ml), thereafter remaining stable up to 5 days. The effectiveness of the F58 strain in controlling Listeria monocytogenes serovar 4b in reduced fat and whole goat's milk, and in goat's jben has been examined. Coculture experiments of F58-L. monocytogenes in both types of milk demonstrated that listeriae were not eliminated, although reductions by 1 to 4 log units were found. Nevertheless, when the F58 strain was previously inoculated in whole milk and left to grow for 12 h before contamination, the pathogen was completely eliminated after 130 h of coculture. Production of jben cheese contaminated with L. monocytogenes prior to packaging, using preparations of F58-producer strain, caused a significant decrease in the number of viable listeriae, which were undetectable after 1 week of cheese storage at 22 degrees C. Altogether, results from this study suggest that E. faecium F58 strain may be used as an adjunct culture in cheese to control contamination and growth of L. monocytogenes by in situ enterocin production, thus providing an additional hurdle to enhance control of this pathogen.
Colás-Medà, Pilar; Viñas, Inmaculada; Alegre, Isabel; Abadias, Maribel
2017-07-01
In recent years, improved detection methods and increased fresh-cut processing of produce have led to an increased number of outbreaks associated with fresh fruits and vegetables. During fruit and vegetable processing, natural protective barriers are removed and tissues are cut, causing nutrient rich exudates and providing attachment sites for microbes. Consequently, fresh-cut produce is more susceptible to microbial proliferation than whole produce. The aim of this study was to examine the impact of storage temperature on the growth and survival of Listeria monocytogenes and Salmonella enterica on a fresh-cut 'Conference' pear over an 8 day storage period. Pears were cut, dipped in antioxidant solution, artificially inoculated with L. monocytogenes and S. enterica, packed under modified atmospheric conditions simulating commercial applications and stored in properly refrigerated conditions (constant storage at 4 °C for 8 days) or in temperature abuse conditions (3 days at 4 °C plus 5 days at 8 °C). After 8 days of storage, both conditions resulted in a significant decrease of S. enterica populations on pear wedges. In contrast, when samples were stored at 4 °C for 8 days, L. monocytogenes populations increased 1.6 logarithmic units, whereas under the temperature abuse conditions, L. monocytogenes populations increased 2.2 logarithmic units. Listeria monocytogenes was able to grow on fresh-cut pears processed under the conditions described here, despite low pH, refrigeration and use of modified atmosphere. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.
Min, Sea C; Roh, Si Hyeon; Niemira, Brendan A; Sites, Joseph E; Boyd, Glenn; Lacombe, Alison
2016-11-21
The present study investigated the effects of dielectric barrier discharge atmospheric cold plasma (DACP) treatment on the inactivation of Escherichia coli O157:H7, Salmonella, Listeria monocytogenes, and Tulane virus (TV) on Romaine lettuce, assessing the influences of moisture vaporization, modified atmospheric packaging (MAP), and post-treatment storage on the inactivation of these pathogens. Romaine lettuce was inoculated with E. coli O157:H7, Salmonella, L. monocytogenes (~6logCFU/g lettuce), or TV (~2logPFU/g lettuce) and packaged in either a Petri dish (diameter: 150mm, height: 15mm) or a Nylon/polyethylene pouch (152×254mm) with and without moisture vaporization. Additionally, a subset of pouch-packaged leaves was flushed with O 2 at 5% or 10% (balance N 2 ). All of the packaged lettuce samples were treated with DACP at 34.8kV for 5min and then analyzed either immediately or following post-treatment storage for 24h at 4°C to assess the inhibition of microorganisms. DACP treatment inhibited E. coli O157:H7, Salmonella, L. monocytogenes, and TV by 1.1±0.4, 0.4±0.3, 1.0±0.5logCFU/g, and 1.3±0.1logPFU/g, respectively, without environmental modifications of moisture or gas in the packages. The inhibition of the bacteria was not significantly affected by packaging type or moisture vaporization (p>0.05) but a reduced-oxygen MAP gas composition attenuated the inhibition rates of E. coli O157:H7 and TV. L. monocytogenes continued to decline by an additional 0.6logCFU/g in post-treatment cold storage for 24h. Additionally, both rigid and flexible conventional plastic packages appear to be suitable for the in-package decontamination of lettuce with DACP. Published by Elsevier B.V.
9 CFR 430.4 - Control of Listeria monocytogenes in post-lethality exposed ready-to-eat products.
2010-01-01
... post-lethality exposed ready-to-eat products. 430.4 Section 430.4 Animals and Animal Products FOOD... Control of Listeria monocytogenes in post-lethality exposed ready-to-eat products. (a) Listeria... comes into direct contact with a food contact surface which is contaminated with L. monocytogenes. (b...
Local Outbreak of Listeria monocytogenes Serotype 4b Sequence Type 6 Due to Contaminated Meat Pâté.
Althaus, Denise; Jermini, Marco; Giannini, Petra; Martinetti, Gladys; Reinholz, Danuta; Nüesch-Inderbinen, Magdalena; Lehner, Angelika; Stephan, Roger
2017-04-01
In January and February 2016, five cases of confirmed and two cases of probable infection due to Listeria monocytogenes serotype 4b, sequence type (ST) 6 belonging to a single pulsed-field gel electrophoresis pulsotype pattern were registered in a region of southern Switzerland. L. monocytogenes was detected in blood samples (four cases) and pleural fluid (one case). Furthermore, L. monocytogenes 4b ST6 was detected in a stool sample of an asymptomatic person exposed to a common food. Forthwith, the food safety authority and a local gourmet meat producer reported L. monocytogenes contamination of meat pâté. Analysis of further food and environmental samples from the premises of the producer yielded isolates matching the clinical strains and confirmed the presence of L. monocytogenes 4b ST6 in the mincing machine as the cause of the food contamination.
Poimenidou, Sofia V; Chatzithoma, Danai-Natalia; Nychas, George-John; Skandamis, Panagiotis N
2016-01-01
Pathogens found on fresh produce may encounter low temperatures, high acidity and limited nutrient availability. The aim of this study was to evaluate the effect of habituation of Listeria monocytogenes on cherry tomatoes or lettuce leaves on its subsequent response to inhibitory levels of acid, osmotic and heat stress. Habituation was performed by inoculating lettuce coupons, whole cherry tomatoes or tryptic soy broth (TSB) with a three-strains composite of L. monocytogenes, which were further incubated at 5°C for 24 hours or 5 days. Additionally, cells grown overnight in TSB supplemented with 0.6% yeast extract (TSBYE) at 30°C were used as control cells. Following habituation, L. monocytogenes cells were harvested and exposed to: (i) pH 3.5 adjusted with lactic acid, acetic acid or hydrochloric acid (HCl), and pH 1.5 (HCl) for 6 h; (ii) 20% NaCl and (iii) 60°C for 150 s. Results showed that tomato-habituated L. monocytogenes cells were more tolerant (P lettuce, and habituation on both foods resulted in more stress resistant cells than prior growth in TSB. On the contrary, the highest resistance to heat stress (P lettuce-habituated L. monocytogenes cells followed by TSB-grown cells at 5°C for 24 h, whereas tomato-habituated cells were highly sensitized. Prolonged starvation on fresh produce (5 days vs. 24 h) increased resistance to osmotic and acid stress, but reduced thermotolerance, regardless of the pre-exposure environment (i.e., tomatoes, lettuce or TSB). These results indicate that L. monocytogenes cells habituated on fresh produce at low temperatures might acquire resistance to subsequent antimicrobial treatments raising important food safety implications.
Ha, Jae-Won; Ryu, Sang-Ryeol; Kang, Dong-Hyun
2012-09-01
This study was conducted to investigate the efficacy of near-infrared (NIR) heating to reduce Salmonella enterica serovar Typhimurium, Escherichia coli O157:H7, and Listeria monocytogenes in ready-to-eat (RTE) sliced ham compared to conventional convective heating, and the effect of NIR heating on quality was determined by measuring the color and texture change. A cocktail of three pathogens was inoculated on the exposed or protected surfaces of ham slices, followed by NIR or conventional heating at 1.8 kW. NIR heating for 50 s achieved 4.1-, 4.19-, and 3.38-log reductions in surface-inoculated S. Typhimurium, E. coli O157:H7, and L. monocytogenes, respectively, whereas convective heating needed 180 s to attain comparable reductions for each pathogen. There were no statistically significant (P > 0.05) differences in reduction between surface- and internally inoculated pathogens at the end of NIR treatment (50 s). However, when treated with conventional convective heating, significant (P 0.05) different from those of nontreated samples. These results suggest that NIR heating can be applied to control internalized pathogens as well as surface-adhering pathogens in RTE sliced meats without affecting product quality.
Rieu, A; Guzzo, J; Piveteau, P
2010-02-01
To investigate how the survival of Listeria monocytogenes on parsley leaves may affect its ability to sustain process-related harsh conditions and its virulence. Parsley seedlings were spot inoculated with stationary phase cells of L. monocytogenes EGD-e and incubated for 15 days. Each day, bacterial cells were harvested and enumerated, and their ability to survive acetic acid challenge (90 min, pH 4.0), to colonize abiotic surfaces and to grow as biofilms was assessed. After a 3-log decrease over the first 48 h, the population stabilized to about 10(6) CFU g(-1) until the sixth day. After the sixth day, L. monocytogenes was no longer detected, even after specific enrichment. Incubation on parsley leaves affected the ability of L. monocytogenes to survive acetic acid challenge (90 min, pH 4.0) and to adhere to stainless steel although the ability to grow as biofilm was preserved. To further investigate these physiological alterations, the mRNA levels of six target genes (bsh, clpC, groEL, inlA, opuC, prfA) was quantified using reverse transcription qPCR after 5 h of incubation on parsley leaves. A decrease was observed in all but one (bsh) target, including groEL and clpC which are involved in resistance to salt and acid. Moreover, the decrease in the levels of inlA, prfA and opuC transcripts after incubation on parsley suggested a repression of some genes involved in pathogenicity. In vitro assessment of mammalian cell adherence and invasion using Caco-2 cells confirmed the repression of the virulence factor InlA; however, the virulence potential in vivo in the chick embryo model was not affected. Listeria monocytogenes did undergo rapid changes to adapt its physiology to the phyllosphere. This study highlights the physiological changes undergone by L. monocytogenes during/after survival on parsley leaves.
Modeling the effect of temperature on survival rate of Listeria monocytogenes in yogurt.
Szczawiński, J; Szczawińska, M E; Łobacz, A; Jackowska-Tracz, A
2016-01-01
The aim of the study was to (i) evaluate the behavior of Listeria monocytogenes in a commercially produced yogurt, (ii) determine the survival/inactivation rates of L. monocytogenes during cold storage of yogurt and (iii) to generate primary and secondary mathematical models to predict the behavior of these bacteria during storage at different temperatures. The samples of yogurt were inoculated with the mixture of three L. monocytogenes strains and stored at 3, 6, 9, 12 and 15°C for 16 days. The number of listeriae was determined after 0, 1, 2, 3, 5, 7, 9, 12, 14 and 16 days of storage. From each sample a series of decimal dilutions were prepared and plated onto ALOA agar (agar for Listeria according to Ottaviani and Agosti). It was found that applied temperature and storage time significantly influenced the survival rate of listeriae (pbacteria was found in the samples stored at 6°C (D-10 value = 243.9 h), whereas the highest reduction in the number of the bacteria was observed in the samples stored at 15°C (D-10 value = 87.0 h). The number of L. monocytogenes was correlated with the pH value of the samples (pyogurt stored under temperature range from 3 to 15°C, however, the polynomial model gave a better fit to the experimental data.
We evaluated the fate of Listeria monocytogenes on scrapple, a regionally-popular, ready-to-eat (RTE) savory mush of pork trimmings, cornmeal, and flour. We also conducted an informal survey to address consumer practices for storing and reheating scrapple. Regarding the survey, of some 125 consumers...
Leite, Caroline Junqueira Barcellos; de Sousa, Jossana Pereira; Medeiros, José Alberto da Costa; da Conceição, Maria Lúcia; dos Santos Falcão-Silva, Vivyanne; de Souza, Evandro Leite
2016-02-01
In the present study, the efficacy of Cymbopogon citratus D.C. Stapf. essential oil (CCEO) to provoke a 5-log CFU/ml (5-log) inactivation in a mixed composite of Escherichia coli, Listeria monocytogenes, and Salmonella enterica serovar Enteritidis in pineapple (Ananas comosus (L.) Merril) juice (4°C) was assessed. Moreover, the effects of CCEO on the physicochemical and sensory quality parameters of pineapple juice were evaluated. The MIC of CCEO was 5 μl/ml against the composite mix examined. For L. monocytogenes and E. coli inoculated in juice containing CCEO (5, 2.5, and 1.25 μl/ml), a ≥5-log reduction was detected after 15 min of exposure. This same result was obtained for Salmonella Enteritidis incubated alone in pineapple juice containing CCEO at 5 and 2.5 μl/ml. Overall, Salmonella Enteritidis was the most tolerant and L. monocytogenes was the most sensitive to CCEO. The physicochemical properties (pH, titratable acidic [citric acid per 100 g], and soluble solids) of pineapple juice containing CCEO (2.5 and 1.25 μl/ml) were maintained. Juice containing CCEO (2.5 and 1.25 μl/ml) exhibited similar scores for odor, appearance, and viscosity compared with juice without CCEO. However, unsatisfactory changes in taste and aftertaste were observed in juices containing CCEO. These results suggest that CCEO could be used as an alternative antimicrobial compound to ensure the safety of pineapple juice, although CCEO at the tested concentrations negatively impacted its taste. Therefore, further studies are needed to determine the balance between microbial safety and taste acceptability of pineapple juice containing CCEO.
Chen, Jianshun; Chen, Qiaomiao; Jiang, Jianjun; Hu, Hongxia; Ye, Jiangbo; Fang, Weihuan
2010-01-01
Listeria monocytogenes, the causative organism of listeriosis, is primarily transmitted to humans through contaminated food. In this study, we examined 1275 batches of aquatic products imported from 29 countries and found that 36 batches from 8 countries were contaminated by Listeria (2.8%), with L. monocytogenes accounting for 2.6% (33/1275) and L. innocua for 0.2% (3/1275). Of the 23 selected L. monocytogenes isolates (from the 33 identified), 15 (65.2%) were of serovar 4b complex (4b, 4d, or 4e), three (13.0%) of 1/2a or 3a, four (17.4%) of 1/2b or 3b, and one (4.4%) of 1/2c or 3c. Notably, four of the 23 isolates belonged to epidemic clone I (ECI) and another four were associated with epidemic clone II (ECII), two highly clonal 4b clusters responsible for most of the documented listeriosis outbreaks. In the multilocus sequence typing scheme based on the concatenated genes gyrB-dapE-hisJ-sigB-ribC-purM-betL-gap-tuf, serovar 4b complex isolates from imported aquatic products exhibited significant genetic diversity. While the four ECI isolates were genetically related to those from Chinese diseased animals, both lacking one proline-rich repeat of ActA, the four ECII isolates were located between 1/2b or 3b strains. As the L. monocytogenes isolates from imported aquatic products possessed a nearly complete set of major infection-related genes, they demonstrated virulence potential in mouse model.
Bacteriophage biocontrol of Listeria monocytogenes on soft ripened white mold and red-smear cheeses.
Guenther, Susanne; Loessner, Martin J
2011-03-01
Soft-ripened cheeses belong to the type of food most often contaminated with Listeria monocytogenes, and they have been implicated in several outbreaks of listeriosis. Bacteriophages represent an attractive way to combat foodborne pathogens without affecting other properties of the food. We used the broad host range, virulent Listeria phage A511 for control of L. monocytogenes during the production and ripening phases of both types of soft-ripened cheeses, white mold (Camembert-type) cheese, as well as washed-rind cheese with a red-smear surface (Limburger-type). The surfaces of young, unripened cheese were inoculated with 10(1)-10(3) cfu/cm(2)L. monocytogenes strains Scott A (serovar 4b) or CNL 10(3)/2005 (serovar 1/2a). Phage was applied at defined time points thereafter, in single or repeated treatments, at 3 × 10(8) or 1 × 10(9) pfu/cm(2). With Scott A (10(3) cfu/cm(2)) and a single dose of A511 (3 × 10(8) pfu/cm(2)) on camembert-type cheese, viable counts dropped 2.5 logs at the end of the 21 day ripening period. Repeated phage application did not further inhibit the bacteria, whereas a single higher dose (1 × 10(9) pfu/cm(2)) was found to be more effective. On red-smear cheese ripened for 22 days, Listeria counts were down by more than 3 logs. Repeated application of A511 further delayed re-growth of Listeria, but did not affect bacterial counts after 22 days. With lower initial Listeria contamination (10(1)-10(2) cfu/cm(2)), viable counts dropped below the limit of detection, corresponding to more than 6 logs reduction compared to the control. Our data clearly demonstrate the potential of bacteriophage for biocontrol of L. monocytogenes in soft cheese.
Mukhopadhyay, Sudarsan; Sokorai, Kimberly; Ukuku, Dike; Fan, Xuetong; Juneja, Vijay; Sites, Joseph; Cassidy, Jennifer
2016-10-17
The objective of this research was to evaluate and develop a method for inactivation of Salmonella enterica and Listeria monocytogenes in cantaloupe puree (CP) by high hydrostatic pressure (HHP). Cantaloupe being the most netted varieties of melons presents a greater risk of pathogen transmission. Freshly prepared CP with or without 0.1% ascorbic acid (AA) was inoculated with a bacterial cocktail composed of a three serotype mixture of S. enterica (S. Poona, S. Newport H1275 and S. Stanley H0558) and a mixture of three strains of L. monocytogenes (Scott A, 43256 and 51742) to a population of ca. 10(8)CFU/g. Double sealed and double bagged inoculated CP (ca. 5g) were pressure treated at 300, 400 and 500MPa at 8°C and 15°C for 5min. Data indicated increased inactivation of both Salmonella and Listeria spp. with higher pressure. Log reduction for CP at 300MPa, 8°C for 5min was 2.4±0.2 and 1.6±0.5logCFU/g for Salmonella and Listeria, respectively. Survivability of the pathogens was significantly compromised at 400MPa and 8°C, inactivating 4.5±0.3logCFU/g of Salmonella and 3.0±0.4logCFU/g of Listeria spp. Complete inactivation of the pathogens in the puree (log reduction >6.7logCFU/g), with or without AA, was achieved when the pressure was further increased to 500MPa, except that for Listeria containing no AA at 8°C. Listeria presented higher resistance to pressure treatment compared to Salmonella spp. Initial temperatures (8 and 15°C) had no significant influence on Salmonella log reductions. Log reduction of pathogens increased but not significantly with increase of temperature. AA did not show any significant antimicrobial activity. Viable counts were about 0.2-0.4logCFU/g less in presence of 0.1% AA. These data validate that HHP can be used as an effective method for decontamination of cantaloupe puree. Published by Elsevier B.V.
Directory of Open Access Journals (Sweden)
Vinicius Moreira Dias
1958-12-01
. In the tubes with E. rhusiopathiae (figs. 1, 2, 3, 4, only a faint pink coloration was seen after 2 hours; at the end of 24 hours, the intensity of color was not equal to that observed in tubes with L. monocytogenes. 2. Petri dishes with 15 ml of plain agar with 5% horse serum, containing 0.1 ml of 1% sterilized aqueous solution of TTC, were inoculated with L. monocytogenes and E. rhusiopathiae, and incubated for 24 hours at 37ºC. Colonies of L. monocytogenes that developed presented a red color, indicative of formazan, as previously described by GRAY et al. (3, while the E. rhusiopathiae colonies did not show any coloration. 3. Disks of filter paper, previously soaked with TTC and dried were placed over the growth of L. monocytogenes in Petri dishes with plain agar plus 5% horse serum form 24 hours. No change in the color of the colonies was observed. The same negative result was obtained when the porous clay cylinder technique for measuring antibiotic activity was employed, With E. rhusiopathiae also negative results were obtained with the disk technique. 4. Wet preparations of the cultures after 1 hour of contact with TTC in the same conditions of item 1, were observed at 900X magnification. L. monocytogenes presented normal shape and dimensions, but one to three intracellular polar, bipolar and or central, red-purple granules were noted. E. rhusiopathiae bacilli were morphologically normal…
Vandera, Elpiniki; Lianou, Alexandra; Kakouri, Athanasia; Feng, Jinbo; Koukkou, Anna-Irini; Samelis, John
2017-01-01
Enterococcus faecium KE82, isolated from traditional Greek Graviera cheese, was identified in pure broth cultures in vitro as a multiple enterocin-producing bacterial strain possessing the structural entA, entB, and entP enterocin genes. E. faecium KE82 was further assessed for in situ antilisterial activity in raw milk (RM) and commercially thermized milk (TM; 63°C for 30 s) in the presence of the indigenous microbiota and in sterile raw milk (SRM; 121°C for 5 min) with or without the addition of two commercial starter culture (CSC) strains Streptococcus thermophilus and Lactococcus lactis . Growth of Listeria monocytogenes was completely inhibited in RM incubated at 37°C for 6 h, whereas the pathogen was significantly inactivated in RM+KE82 samples during further incubation at 18°C for 66 h. In contrast, L. monocytogenes levels increased by approximately 2 log CFU/ml in TM, but in TM+KE82 samples, pathogen growth was retarded during the first 6 h at 37°C followed by growth cessation and partial inactivation at 18°C. After 48 to 72 h, growth of L. monocytogenes in SRM+CSC samples decreased by 4 to 5 log CFU/ml compared with the SRM control, whereas additional 10-fold decreases in the pathogen were observed in SRM+CSC+KE82 samples. Reverse transcription PCR analysis of SRM+KE82 and SRM+CSC+KE82 samples confirmed that the entA and entB genes were transcribed, but entP gene transcription was not detected. All RM and SRM samples inoculated with E. faecium KE82 displayed strong in situ inhibitory activity against L. monocytogenes in well diffusion bioassays, whereas activity was weaker to undetectable in comparable or additional TM+KE82 samples; no milk sample without E. faecium KE82 had activity against L. monocytogenes . The findings of this study indicate that E. faecium KE82 is an antilisterial agent that could be used in traditional dairy foods because it concomitantly produces enterocins A and B in situ in milk.
Changes in gene expression during adaptation of Listeria monocytogenes to the soil environment.
Piveteau, Pascal; Depret, Géraldine; Pivato, Barbara; Garmyn, Dominique; Hartmann, Alain
2011-01-01
Listeria monocytogenes is a ubiquitous opportunistic pathogen responsible for listeriosis. In order to study the processes underlying its ability to adapt to the soil environment, whole-genome arrays were used to analyse transcriptome modifications 15 minutes, 30 minutes and 18 h after inoculation of L. monocytogenes EGD-e in soil extracts. Growth was observed within the first day of incubation and large numbers were still detected in soil extract and soil microcosms one year after the start of the experiment. Major transcriptional reprofiling was observed. Nutrient acquisition mechanisms (phosphoenolpyruvate-dependent phosphotransferase systems and ABC transporters) and enzymes involved in catabolism of specific carbohydrates (β-glucosidases; chitinases) were prevalent. This is consistent with the overrepresentation of the CodY regulon that suggests that in a nutrient depleted environment, L. monocytogenes recruits its extensive repertoire of transporters to acquire a range of substrates for energy production.
Assessment of Listeria monocytogenes virulence in the Galleria mellonella insect larvae model.
Rakic Martinez, Mira; Wiedmann, Martin; Ferguson, Martine; Datta, Atin R
2017-01-01
Several animal models have been used to understand the molecular basis of the pathogenicity, infectious dose and strain to strain variation of Listeria monocytogenes. The greater wax worm Galleria mellonella, as an alternative model, provides some useful advantages not available with other models and has already been described as suitable for the virulence assessment of various pathogens including L. monocytogenes. The objectives of this study are: 1) confirming the usefulness of this model with a wide panel of Listeria spp. including non-pathogenic L. innocua, L. seeligeri, L. welshimeri and animal pathogen L. ivanovii; 2) assessment of virulence of several isogenic in-frame deletion mutants in virulence and stress related genes of L. monocytogenes and 3) virulence assessment of paired food and clinical isolates of L. monocytogenes from 14 major listeriosis outbreaks occurred worldwide between 1980 and 2015. Larvae injected with different concentrations of Listeria were incubated at 37°C and monitored over seven days for time needed to kill 50% of larvae (LT50) and to determine change of bacterial population in G. mellonella, 2 and 24 hours post-inoculation. Non-pathogenic members of Listeria and L. ivanovii showed significantly (P monocytogenes strains. Isogenic mutants of L. monocytogenes with the deletions in prfA, plcA, hly, actA and virR genes, also showed significantly (P monocytogenes strains related to non-invasive (gastroenteritis) outbreaks of listeriosis showed significantly (P < 0.05) lower virulence than isolates of the same serotype obtained from outbreaks with invasive symptoms. The difference, however, was dose and strain- dependent. No significant differences in virulence were observed among the serotype tested in this study.
Ibarra-Sánchez, Luis A; Van Tassell, Maxwell L; Miller, Michael J
2018-06-01
Hispanic-style fresh cheeses, such as Queso Fresco (QF), have been linked to numerous listeriosis outbreaks in the United States. In this work, we have studied the antilisterial behavior and effectiveness of the Listeria phage endolysin PlyP100 in QF, as well as the potential synergy between PlyP100 and nisin. PlyP100 showed similar bacterial reduction regardless of varying L. monocytogenes inoculum size in QF, and when the inoculation size was 1 Log CFU/g, no pathogen recovery after cheese enrichment was observed. PlyP100 was stable in QF for up to 28 days of cold storage exhibiting similar antilisterial activity regardless of when contamination with L. monocytogenes occurred. PlyP100 alone exhibited a strong listeriostatic effect in QF, on the contrary, nisin alone was not effective to control the pathogen in QF during cold storage. The combination of nisin and PlyP100 showed a strong synergy in QF with non-enumerable levels of L. monocytogenes after 4 weeks of refrigerated storage. Moreover, L. monocytogenes isolates from cheeses treated with nisin, PlyP100, and their combination did not develop resistance to nisin or PlyP100. Our results support the use of PlyP100 combined with nisin as an efficient L. monocytogenes control measure in QF. Copyright © 2017 Elsevier Ltd. All rights reserved.
Listeria monocytogenes Monographic Study
Directory of Open Access Journals (Sweden)
Emil Tirziu
2010-05-01
Full Text Available Listeria monocytogenes is a ubiquitous bacteria with a remarkable resistance in discordant condition which produce listeriosis, an infectious disease that affects multiple domestic and wild animals’ species, but also humans. Receptive to listeriosis are the majority of domestic or wild mammals and birds, in the last years being registered an increase of receptivity in humans. The concept of listeriosis in human pathology, a disease caused by eating or drinking contaminated food and water, appeared for the first time in 1981, during an outbreak in Canada with seven cases in adults and 34 cases of maternalfetal listeriosis. The alimentary origin of human listeriosis can be easily explained if considered some general characteristics of the bacteria. Thus, resistance in various conditions, especially at lower temperatures, justifies its dissemination and food contamination, particularly when is conserved by refrigeration. Also, L. monocytogenes has a significant presence in alimentary products. Some studies showed that 4% of the milk products, 29% of the meat products, 5% of the vegetable products and 26% of the products obtained from fishes and shell fishes are positive for L. monocytogenes, which allows us to say that battle against these bacteria is a war against microbial contamination.
Hwang, Cheng-An; Porto-Fett, Anna C S; Juneja, Vijay K; Ingham, Steven C; Ingham, Barbara H; Luchansky, John B
2009-02-28
This study quantified and modeled the survival of Escherichia coli O157:H7, Listeria monocytogenes and Salmonella Typhimurium in soudjouk-style fermented sausage during fermentation, drying, and storage. Batter prepared from ground beef (20% fat), seasonings, starter culture, and dextrose was separately inoculated with a multi-strain mixture of each pathogen to an initial inoculum of ca. 6.5 log(10) CFU/g in the batter. The sausages were subsequently fermented at 24 degrees C with a relative humidity (RH) of 90% to 95% for 3 to 5 days to ca. pH 5.2, pH 4.9 or pH 4.6, then dried at 22 degrees C to a(w) 0.92, a(w) 0.89, or a(w) 0.86, respectively, and then stored at 4, 21, or 30 degrees C for up to 60 days. Lethality of the three pathogens was modeled as a function of pH, a(w) and/or storage temperature. During fermentation to pH 5.2 to pH 4.6, cell reductions ranged from 0 to 0.9 log(10) CFU/g for E. coli O157:H7, 0.1 to 0.5 log(10) CFU/g for L. monocytogenes, and 0 to 2.2 log(10) CFU/g for S. Typhimurium. Subsequent drying of sausages of pH 5.2 to pH 4.6 at 22 degrees C with 80% to 85% RH for 3 to 7 days to a(w) of 0.92 to a(w) 0.86 resulted in additional reductions that ranged from 0 to 3.5 log(10) CFU/g for E. coli O157:H7, 0 to 0.4 log(10) CFU/g for L. monocytogenes, and 0.3 to 2.4 log(10) CFU/g for S. Typhimurium. During storage at 4, 21, or 30 degrees C the reduction rates of the three pathogens were generally higher (pfermentation, drying, and storage. The applicability of the resulting models for fermented sausage was evaluated by comparing model predictions with published data. Pathogen reductions estimated by the models for E. coli O157:H7 and S. Typhimurium were comparable to 67% and 73% of published data, respectively. Due to limited published data for L. monocytogenes, the models for L. monocytogenes would need additional validations. Results of pathogen reductions from this study may be used as a reference to assist manufacturers of soudjouk
Prevalence and location of Listeria monocytogenes in farmed rainbow trout.
Miettinen, Hanna; Wirtanen, Gun
2005-10-15
A total of 510 rainbow trout originating from fish farms in lakes and sea areas around Finland were studied for the presence of Listeria monocytogenes. Samples were studied as pools from five fish. Gill, viscera, and skin from the pooled samples were analysed separately. The individual samples were analysed later if the pooled sample was found to be Listeria positive. The prevalence of Listeria spp. and L. monocytogenes in pooled unprocessed fresh rainbow trout was on average 35.0% and 14.6%, respectively. On the other hand, the prevalence of Listeria spp. and L. monocytogenes in individual thawed fish was found to be 14.3% and 8.8%, respectively. These numbers tend to overestimate and underestimate the real situation because not all fish in pooled samples were necessarily contaminated and in some of the Listeria positive pooled samples all individual samples turned out to be Listeria free. The prevalence of L. monocytogenes varied greatly between different fish farms from zero to 100% in pooled samples and from zero to 75% according to individually studied fish samples. Some indications of the influence of weather conditions and seasonal variations that strongly affected the Listeria contamination of fish were also noticed. The location of Listeria spp. and L. monocytogenes in different parts of the fish differed with statistical significance in rainbow trout. Up to 95.6% of the L. monocytogenes and 84.5% of Listeria spp. positive samples were gill samples. Only 4.4% (2/45) of the L. monocytogenes positive samples were obtained from skin or viscera. Closer study at one fish farm revealed that there was only one L. monocytogenes ribotype present in the contaminated fish, although water and surfaces were heavily contaminated with six other L. monocytogenes ribotypes.
Soni, Dharmendra Kumar; Singh, Durg Vijai; Dubey, Suresh Kumar
2015-09-01
Listeria monocytogenes, a life-threatening pathogen, poses severe risk during pregnancy, may cause abortion, fetal death or neonatal morbidity in terms of septicemia and meningitis. The present study aimed at characterizing L. monocytogenes isolated from pregnant women based on serotyping, antibiotic susceptibility, virulence genes, in vivo pathogenicity test and ERIC- and REP-PCR fingerprint analyses. The results revealed that out of 3700 human clinical samples, a total of 30 (0.81%) isolates [12 (0.80%) from placental bit (1500), 18 (0.81%) from vaginal swab (2200)] were positive for L. monocytogenes. All the isolates belonged to serogroup 4b, and were + ve for virulence genes tested i.e. inlA, inlC, inlJ, plcA, prfA, actA, hlyA, and iap. Based on the mice inoculation tests, 20 isolates showed 100% and 4 isolates 60% relative virulence while 6 isolates were non-pathogenic. Moreover, 2 and 10 isolates were resistant to ciprofloxacin and cefoxitin, respectively, while the rest susceptible to other antibiotics used in this study. ERIC- and REP-PCR collectively depicted that the isolates from placental bit and vaginal swab had distinct PCR fingerprints except a few isolates with identical patterns. This study demonstrates prevalence of pathogenic strains mostly resistant to cefoxitin and/or ciprofloxacin. The results indicate the importance of isolating and characterizing the pathogen from human clinical samples as the pre-requisite for accurate epidemiological investigations.
Survival of bioluminescent Listeria monocytogenes and Escherichia coli O157:H7 in soft cheeses.
Ramsaran, H; Chen, J; Brunke, B; Hill, A; Griffiths, M W
1998-07-01
Pasteurized and raw milks that had been inoculated at 10(4) cfu/ml with bioluminescent strains of Listeria monocytogenes and Escherichia coli O157:H7 were used in the manufacture of Camembert and Feta cheeses with or without nisin-producing starter culture. Survival of both organisms was determined during the manufacture and storage of Camembert and Feta cheeses at 2 +/- 1 degree C for 65 and 75 d, respectively. Bacterial bioluminescence was used as an indicator to enumerate the colonies plated on selective Listeria agar and on MacConkey agar. Escherichia coli O157:H7 survived the manufacturing process of both cheeses and was present at the end of the storage period in greater numbers than in the initial inoculum. At the end of 75 d of storage, E. coli O157:H7 was found in the brine of Feta cheese. The counts of L. monocytogenes increased as the pH of the Camembert cheese increased, and there were significant differences between the counts from samples taken from the inside and the counts from samples obtained near the surface of the cheese. The Feta cheese that contained nisin was the only cheese in which L. monocytogenes was at the level of the initial inoculum after 75 d of storage.
DEFF Research Database (Denmark)
Dalgaard, Paw; Jørgensen, Lasse Vigel
1998-01-01
with various types of seafoods. Storage trials clearly showed the growth of L. monocytogenes in naturally contaminated cold-smoked salmon to be markedly slower than growth in inoculated challenge tests. Consequently, all four models substantially overestimated growth in the naturally contaminated products...
Directory of Open Access Journals (Sweden)
Élen Silveira Nalério
2009-09-01
Full Text Available Listeria monocytogenes é uma bactéria patogênica que se tornou um grande desafio para as indústrias de alimentos, entre elas a de frangos, assim como para os órgãos de vigilância sanitária. Apesar da produção de frangos estar em expansão na região sul do Rio Grande do Sul, não há relatos sobre esse patógeno, dessa forma, objetivou-se avaliar a prevalência de L. monocytogenes e de seus sorotipos nos diversos segmentos dessa cadeia produtiva. Nos aviários isolou-se L. monocytogenes em 2,9% (1/35 das amostras de swabs cloacais, não se isolando o microrganismo em amostras provenientes das camas de aviários. No abatedouro, 11,7% (15/128 das amostras apresentaram contaminação por L. monocytogenes e nos frangos resfriados procedentes do comércio, a prevalência foi de 33,3% (15/45.Observou-se que 51,6% (16/31 das cepas de L. monocytogenes pertenciam ao sorotipo 1/2b; 22,5% (7/31 ao sorotipo 4e; 16,1% (5/31 ao sorotipo 1/2a; 6,4% (2/31 ao sorotipo 4b; e 3,2% (1/31 ao sorotipo 1/2c. Há disseminação de L. monocytogenes na cadeia produtiva de frangos da região sul do Rio Grande do Sul e a presença de sorotipos prevalentes em casos/surtos de listeriose traz preocupação à saúde pública.Listeria monocytogenes is a pathogenic bacterium which has become a huge challenge to the food industries, including the poultry industry, and to the health surveillance agencies. Although poultry production is in expansion in southern of Rio Grande do Sul, Brazil, there are not reports about this pathogen thus this study aimed at assessing the prevalence of L monocytogenes and its serotypes in the several segments of this productive chain. In the broilers flocks L. monocytogenes were isolated in 2.9% (1/35 from cloacal swabs samples. This microorganism was not isolated from broiler houses samples. In the abattoir, 11% of the samples presented L. monocytogenes contamination, and in the chilled chicken from retailers its prevalence was 33.3% (15
Hereu, A; Dalgaard, P; Garriga, M; Aymerich, T; Bover-Cid, S
2014-09-01
Various predictive models are available for high pressure inactivation of Listeria monocytogenes in food, but currently available models do not consider the growth kinetics of surviving cells during the subsequent storage of products. Therefore, we characterised the growth of L. monocytogenes in sliced cooked meat products after a pressurization treatment. Two inoculum levels (10(7) or 10(4) CFU/g) and two physiological states before pressurization (freeze-stressed or cold-adapted) were evaluated. Samples of cooked ham and mortadella were inoculated, high pressure processed (400 MPa, 5 min) and subsequently stored at 4, 8 and 12 °C. The Logistic model with delay was used to estimate lag phase (λ) and maximum specific growth rate (μmax) values from the obtained growth curves. The effect of storage temperature on μmax and λ was modelled using the Ratkowsky square root model and the relative lag time (RLT) concept. Compared with cold-adapted cells the freeze-stressed cells were more pressure-resistant and showed a much longer lag phase during growth after the pressure treatment. Interestingly, for high-pressure inactivation and subsequent growth, the time to achieve a concentration of L. monocytogenes 100-fold (2-log) higher than the cell concentration prior to the pressure treatment was similar for the two studied physiological states of the inoculum. Two secondary models were necessary to describe the different growth behaviour of L. monocytogenes on ready-to-eat cooked ham (lean product) and mortadella (fatty product). This supported the need of a product-oriented approach to assess growth after high pressure processing. The performance of the developed predictive models for the growth of L. monocytogenes in high-pressure processed cooked ham and mortadella was evaluated by comparison with available data from the literature and by using the Acceptable Simulation Zone approach. Overall, 91% of the relative errors fell into the Acceptable Simulation Zone
Yoon, Jung In; Bajpai, Vivek K; Kang, Sun Chul
2011-01-01
This study was undertaken to evaluate the effect of nisin and cone essential oil of Metasequoia glyptostroboides against Listeria monocytogenes ATCC 19116 inoculated in whole (8%), low (1%) and skim (no fat content) milks. Essential oil at the concentrations of 2% and 5% revealed strong antilisterial effect against L. monocytogenes ATCC 19116 in all categories of milks. Nisin at the concentrations of 250 and 500 IU/ml displayed a remarkable antilisterial effect as compared to the control group. Also, the synergistic combinations of cone essential oil (1% and 2%) and nisin (62.5, 125, 250 and 500 IU/ml) had a remarkable antilisterial activity in all categories of whole, low and skim milks after 14 days. Results of this study indicate that the cone essential oil of M. glyptostroboides might be a useful candidate for using in food industry to control the growth of pathogenic microorganisms. Copyright © 2010 Elsevier Ltd. All rights reserved.
Cauchon, Kaitlin E; Hitchins, Anthony D; Smiley, R Derike
2017-09-01
Three selective enrichment methods, the United States Food and Drug Administration's (FDA method), the United States Department of Agriculture Food Safety Inspection Service's (USDA method), and the EN ISO 11290-1 standard method, were assessed for their suitability for recovery of Listeria monocytogenes from spiked mung bean sprouts. Three parameters were evaluated; the enrichment L. monocytogenes population from singly-spiked sprouts, the enrichment L. monocytogenes population from doubly-spiked (L. monocytogenes and Listeria innocua) sprouts, and the population differential resulting from the enrichment of doubly-spiked sprouts. Considerable L. monocytogenes inter-strain variation was observed. The mean enrichment L. monocytogenes populations for singly-spiked sprouts were 6.1 ± 1.2, 4.9 ± 1.2, and 6.9 ± 2.3 log CFU/mL for the FDA, USDA, and EN ISO 11290-1 methods, respectively. The mean L. monocytogenes populations for doubly-spiked sprouts were 4.7 ± 1.1, 5.5 ± 1.3, and 4.6 ± 1.4 log CFU/mL for the FDA, USDA, and ISO 11290-1 enrichment methods, respectively. The corresponding mean population differentials were 2.8 ± 1.1, 3.3 ± 1.3, and 3.6 ± 1.4 Δlog CFU/mL for the same three enrichment methods, respectively. The presence of L. innocua and resident microorganisms on the sprouts negatively impacted final levels of L. monocytogenes with all three enrichment methods. Published by Elsevier Ltd.
Listeria monocytogenes serotype prevalence and biodiversity in diverse food products.
Hadjilouka, Agni; Andritsos, Nikolaos D; Paramithiotis, Spiros; Mataragas, Marios; Drosinos, Eleftherios H
2014-12-01
The aim of this study was to assess serotype prevalence and biodiversity of Listeria monocytogenes strains isolated from diverse food products, i.e., minced pork, fruits, and vegetables. Three hundred twenty-six samples previously purchased from supermarkets and street markets within the Athens area were studied for L. monocytogenes prevalence. A total of 121 strains were isolated from the 36 samples that were positive for L. monocytogenes. Serotyping was performed with multiplex PCR, and biodiversity was assessed with random amplified polymorphic DNA (RAPD) PCR analysis using M13, UBC155, and HLWL85 as primers and with repetitive element palindromic (rep) PCR analysis using (GTG)5 as the primer. The majority (17 of 22) of the contaminated minced pork samples contained strains identified as serotype 1/2a, either alone or in combination with strains belonging to serotypes 1/2b, 4a, 4c, or 4ab. However, all L. monocytogenes isolates from fruits and vegetables belonged to serotype 4b. Rep-PCR provided better differentiation of the isolates than did RAPD PCR and resulted in discrimination of the isolates into a larger number of unique profiles. Complete differentiation was achieved only with the combination of these subtyping techniques.
Directory of Open Access Journals (Sweden)
Puga eCH
2016-02-01
Full Text Available Changes in spatial organization, as observed by confocal laser scanning microscopy (CLSM, viable cell content, biovolume and substratum surface coverage of the biofilms formed on glass by Pseudomonas fluorescens resulting from co-culture with Listeria monocytogenes, were examined. Two strains of L. monocytogenes, two culture temperatures and two biofilm developmental stages were investigated. Both L. monocytogenes strains, a persistently sampled isolate (collected repeatedly along 3 years from a meat factory and Scott A, induced shrinkage in matrix volume, both at 20ºC and 4ºC, in mature or old biofilms, without loss of P. fluorescens cell count per surface unit. The nearly homogeneous pattern of surface coverage shown by mono-species P. fluorescens biofilms, turned into more irregular layouts in co-culture with L. monocytogenes. The upper layer of both mono and dual-species biofilms turned to predominantly consist of matrix, with plenty of viable cells underneath, in old biofilms cultured at 20ºC, but not in those grown at 4ºC. Between 15 and 56% of the substratum area was covered by biofilm, the extent depending on temperature, time and L. monocytogenes strain. Real biofilms in food-related surfaces may thus be very heterogeneous regarding their superficial components, i.e. those more accessible to disinfectants. It is therefore a hygienic challenge to choose an adequate agent to disrupt them.
de Oliveira, Thales Leandro Coutinho; das Graças Cardoso, Maria; de Araújo Soares, Rodrigo; Ramos, Eduardo Mendes; Piccoli, Roberta Hilsdorf; Tebaldi, Victor Maximiliano Reis
2013-01-01
This research evaluated the antimicrobial effect of the clove (Syzygium aromaticum) and lemongrass (Cymbopogon citratus (DC.) Stapf.) essential oils (EOs) against Listeria monocytogenes ATCC 19117 growth added to bovine ground meat stored under refrigeration (5 ± 2 °C) for three days. The EOs, extracted by hydrodistillation and analyzed by gas chromatography-mass spectrometry (GC-MS), were tested in vitro using an agar well diffusion methodology for determination of Minimum Inhibitory Concentration (MIC). The MIC concentrations for both essential oils on culture tested of L. monocytogenes were 1.56%. The EOs concentrations applied in contaminated ground beef were 1.56, 3.125 and 6.25% (w/v) based on MIC levels and possible activity reductions by food constituents. The bacteria populations were significantly reduced (p ≤ 0.05) after one day of storage in ground meat samples treated with clove and lemongrass EOs at concentrations of 1.56%. There were no significant counts of L. monocytogenes in samples at the other concentrations of the two oils applied after the second day of storage. The sensory acceptability evaluation of the bovine ground meat samples treated with EOs showed that the addition at concentrations higher than 1.56% promote undesirable alterations of taste, odor and characteristic color. The application of EOs at low concentrations in food products can be used in combination with other preservation methods, such as refrigeration, to control pathogens and spoilage bacteria during shelf-life; which goes according to current market trends, where consumers are requesting natural products.
Directory of Open Access Journals (Sweden)
Thales Leandro Coutinho de Oliveira
2013-01-01
Full Text Available This research evaluated the antimicrobial effect of the clove (Syzygium aromaticum and lemongrass (Cymbopogon citratus (DC. Stapf. essential oils (EOs against Listeria monocytogenes ATCC 19117 growth added to bovine ground meat stored under refrigeration (5 ± 2 °C for three days. The EOs, extracted by hydrodistillation and analyzed by gas chromatography-mass spectrometry (GC-MS, were tested in vitro using an agar well diffusion methodology for determination of Minimum Inhibitory Concentration (MIC. The MIC concentrations for both essential oils on culture tested of L. monocytogenes were 1.56%. The EOs concentrations applied in contaminated ground beef were 1.56, 3.125 and 6.25% (w/v based on MIC levels and possible activity reductions by food constituents. The bacteria populations were significantly reduced (p < 0.05 after one day of storage in ground meat samples treated with clove and lemongrass EOs at concentrations of 1.56%. There were no significant counts of L. monocytogenes in samples at the other concentrations of the two oils applied after the second day of storage. The sensory acceptability evaluation of the bovine ground meat samples treated with EOs showed that the addition at concentrations higher than 1.56% promote undesirable alterations of taste, odor and characteristic color. The application of EOs at low concentrations in food products can be used in combination with other preservation methods, such as refrigeration, to control pathogens and spoilage bacteria during shelf-life; which goes according to current market trends, where consumers are requesting natural products.
Valenzuela-Melendres, Martin; Peña-Ramos, E Aida; Juneja, Vijay K; Camou, Juan Pedro; Cumplido-Barbeitia, German
2016-07-01
D- and z-values for Listeria monocytogenes were obtained for two Mexican meat entrées: pork meat marinated in tomatillo (green tomato) sauce (PTS) and beef marinated in a red chili sauce (BRCS), with addition of 0, 200, and 800 ppm of grapefruit seed extract (GSE). Meat samples inoculated with L. monocytogenes were packaged in sterile bags, immersed in a water bath, and held at 55, 57.5, 60, and 62.5°C for different periods of time. Depending upon the temperature, D-values at 0 ppm of GSE ranged from 26.19 to 2.03 min in BRCS and 26.41 to 0.8 min in PTS. Adding 800 ppm of GSE to BRCS thermally treated at 55 and 62.5°C significantly decreased inactivation time by 35%. A reduction in time of 25.9, 10.6, and 40.1% at 55, 57.5, and 60°C, respectively, was observed in PTS with 800 ppm of GSE. The z-values of L. monocytogenes were not significantly affected by GSE addition; average z-values were 7.25 and 5.09°C for BRCS and PTS, respectively. Estimated thermal lethality for a 7-D log reduction of L. monocytogenes under commercial-size sous-vide conditions at a reference temperature of 55°C was reached at 78 and 71 min for BRCS without and with 800 ppm of GSE, respectively. For PTS, 7-D reduction was attained at 69 and 61 min without and with addition of 800 ppm of GSE, respectively. Supplementing both Mexican meat entrées (BRCS and PTS) with 800 ppm of GSE rendered L. monocytogenes cells more sensitive to the lethal effect of heat. The results of this study will assist the retail food industry in designing acceptance limits on critical control points pertaining to cooking regimes to effectively eliminate L. monocytogenes in BRCS and PTS sous-vide processed Mexican meat entrées.
Prevalence of Listeria monocytogenes in poultry production in France.
Chemaly, Marianne; Toquin, Marie-Therese; Le Nôtre, Yolene; Fravalo, Philippe
2008-10-01
This study aimed to update and create a data set from laying hens and broilers regarding contamination by Listeria monocytogenes. Two hundred laying-hen flocks were sampled, with 88 flocks reared in cages and 112 reared on the floor. One hundred forty-five broiler flocks were sampled, with 85 conventional and 60 free-range flocks. A total of 774 and 725 samples were analyzed from laying hens and broilers, respectively. L. monocytogenes was detected in 31 of 200 flocks, yielding an estimated prevalence of 15.5% in laying-hen flocks. Among positive flocks, there appeared a significant (P = 0.004) difference between caged and floor-reared hens, with a higher detection in dust samples from floor-reared hens. In positive caged hen flocks, significant (P = 0.028) differences between dust and fecal samples appeared, with a higher detection in feces than in dust samples. In broiler flocks, L. monocytogenes was isolated in 46 of 145 flocks, yielding an estimated prevalence of 32% (28% in conventional flocks versus 37% in the free-range flocks). L. monocytogenes was isolated in samples taken from conventional flocks with a lower frequency than in free-range flocks (13 versus 18%, respectively). The serotyping of L. monocytogenes strains showed that the majority belonged to type 1/2a in laying-hen flocks (74.3%) and in broiler flocks (40.5%). A significant difference (P = 0.007) between laying hens and broilers was shown for serogroup 4 and for serovar 1/2b (P = 0.007); these serogroups were more prevalent in broilers (40%) than in laying hens (5.7%).
Vongkamjan, Kitiya; Fuangpaiboon, Janejira; Turner, Matthew P; Vuddhakul, Varaporn
2016-02-01
Listeriosis outbreaks have been associated with a variety of foods. This study investigated the prevalence and diversity of Listeria monocytogenes and Listeria spp. in ready-to-eat (RTE) products and evaluated the performance of a rapid detection method, the 3M molecular detection assay for L. monocytogenes (MDA-LM), for detection of L. monocytogenes. Assay results were compared with those obtained using the U.S. Food and Drug Administration standard culture method described in the Bacteriological Analytical Manual. Products (n = 200) were purchased from retail stores: 122 aquatic products, 22 products of animal origin, 18 vegetarian products, 15 deli meat products, 13 salad and vegetable products, 4 desserts, 2 egg-based products, and 4 other products. L. monocytogenes prevalence was comparable with both methods. Overall, 15 (7.5%) of 200 samples were positive for L. monocytogenes: 3% of aquatic products, 1.5% of products of animal origin, 1% of vegetarian products, and 2% of deli meat products. Compared with the standard culture method, the sensitivity, specificity, and the accuracy of the MDA-LM were 86.7% (95% confidence interval, 58.4 to 97.7%), 98.4% (95% confidence interval, 95.0 to 99.6%), and 97.5%, respectively. Using the culture-based method, 18 (9%) of 200 samples were positive for Listeria species other than L. monocytogenes. Listeria isolates from these samples were classified into nine allelic types (ATs). The majority of isolates were classified as ATs 58 and 74, which were identified as L. monocytogenes lineages I and IV, respectively. Listeria innocua and Listeria welshimeri also were represented by isolates of multiple ATs. The MDA-LM is a rapid and reliable technique for detecting L. monocytogenes in various RTE foods. Further study is needed to develop effective control strategies to reduce L. monocytogenes contamination in RTE foods.
Evaluation of a monoclonal antibody able to detect live Listeria monocytogenes and Listeria innocua
DEFF Research Database (Denmark)
Sølve, Marianne; Boel, Jeppe; Nørrung, Birgit
2000-01-01
A monoclonal Listeria antibody, designated B4, was evaluated. The ability of the antibody to bind to viable bacteria belonging to Listeria spp, compared to bacteria of the same species killed by beat treatment, acid or base treatment, sanitizers, and irradiation was examined. The antibody was found...... to react with viable L. monocytogenes and L. innocua, but not with heat-killed (72 degrees C, 5 min) strains of these organisms. When L. monocytogenes and L. innocua were killed by methods other than heat treatment, it was ambiguous whether the antibody detected the organism or not. It was concluded...... that the B4 antibody has potential to be used in an immune capture step to capture live L, monocytogenes and L. innocua from foods prior to identification of L. monocytogenes by polymerase chain reaction (PCR)....
Inhibition of Listeria monocytogenes in Fresh Cheese Using Chitosan-Grafted Lactic Acid Packaging
Directory of Open Access Journals (Sweden)
Laura N. Sandoval
2016-04-01
Full Text Available A chitosan from biologically obtained chitin was successfully grafted with d,l-lactic acid (LA in aqueous media using p-toluenesulfonic acid as catalyst to obtain a non-toxic, biodegradable packaging material that was characterized using scanning electron microscopy, water vapor permeability, and relative humidity (RH losses. Additionally, the grafting in chitosan with LA produced films with improved mechanical properties. This material successfully extended the shelf life of fresh cheese and inhibited the growth of Listeria monocytogenes during 14 days at 4 °C and 22% RH, whereby inoculated samples with chitosan-g-LA packaging presented full bacterial inhibition. The results were compared to control samples and commercial low-density polyethylene packaging.
Directory of Open Access Journals (Sweden)
B. Pisarek
2010-04-01
Full Text Available Examining was the aim of the work: influence of the permanent temperature 1300°C ± 15°C and changing time of isothermal holding in the range 0÷50 minutes on the melting loss of aluminum in the bronze CuAl10Ni5Fe4; the quantity the slag rafining - covering Unitop BA-1 (0÷1,5% on the effectiveness of the protection of liquid bronze before the oxygenation, the quantity of the preliminary alloy - in-oculant AlBe5 (0÷1,0% on the effective compensation melting loss of aluminum and time of isothermal holding on the effect of the in-oculation of the bronze and the comparison of the effectiveness of the inoculation of the bronze in furnace and in the form. Introduced investigations resulted from the study of the new grades of the Cu-Al-Fe-Ni bronze with additions singly or simultaneously Si, Cr, Mo and/or W, to melting which necessary it is for high temperature and comparatively long time isothermal holding indispensable to the occur of the process of diffusive dissolving the high-melting of the bronze components. High temperature and lengthening the time of isothermal holding the liquid bronze in casting furnace the melting loss of Al influences the growth. Addition the slag of covering-refining Unitop BA-1 in the quantity 1,5% the bronze protects before the melting loss of aluminum by the time of isothermal holding in the temperature 1300°C about 15 minutes. Addition of the preliminary alloy AlBe5 in the quantity 0,6% it assures the effective compensation of the aluminum which melting loss undergoes for the studied parameters of the melting. The effect of the inoculation of the bronze together with diminishes the preliminary alloy AlBe5 with lengthening the time of isothermal hold-ing. Because of this, use of the method of introducing the preliminary alloy it is seems good solution on the inoculation of aluminum bronzes directly to form, unsensitive on the time of isothermal holding the bronze.
Day, J B; Basavanna, U
2015-01-01
To develop a rapid detection procedure for Listeria monocytogenes in infant formula and lettuce using a macrophage-based enrichment protocol and real-time PCR. A macrophage cell culture system was employed for the isolation and enrichment of L. monocytogenes from infant formula and lettuce for subsequent identification using real-time PCR. Macrophage monolayers were exposed to infant formula and lettuce contaminated with a serial dilution series of L. monocytogenes. As few as approx. 10 CFU ml(-1) or g(-1) of L. monocytogenes were detected in infant formula and lettuce after 16 h postinfection by real-time PCR. Internal positive PCR controls were utilized to eliminate the possibility of false-negative results. Co-inoculation with Listeria innocua did not reduce the L. monocytogenes detection sensitivity. Intracellular L. monocytogenes could also be isolated on Listeria selective media from infected macrophage lysates for subsequent confirmation. The detection method is highly sensitive and specific for L. monocytogenes in infant formula and lettuce and establishes a rapid identification time of 20 and 48 h for presumptive and confirmatory identification, respectively. The method is a promising alternative to many currently used q-PCR detection methods which employ traditional selective media for enrichment of contaminated food samples. Macrophage enrichment of L. monocytogenes eliminates PCR inhibitory food elements and contaminating food microflora which produce cleaner samples that increase the rapidity and sensitivity of detection. Published 2014. This article is a U.S. Government work and is in the public domain in the USA.
Assessment of Listeria monocytogenes virulence in the Galleria mellonella insect larvae model.
Directory of Open Access Journals (Sweden)
Mira Rakic Martinez
Full Text Available Several animal models have been used to understand the molecular basis of the pathogenicity, infectious dose and strain to strain variation of Listeria monocytogenes. The greater wax worm Galleria mellonella, as an alternative model, provides some useful advantages not available with other models and has already been described as suitable for the virulence assessment of various pathogens including L. monocytogenes. The objectives of this study are: 1 confirming the usefulness of this model with a wide panel of Listeria spp. including non-pathogenic L. innocua, L. seeligeri, L. welshimeri and animal pathogen L. ivanovii; 2 assessment of virulence of several isogenic in-frame deletion mutants in virulence and stress related genes of L. monocytogenes and 3 virulence assessment of paired food and clinical isolates of L. monocytogenes from 14 major listeriosis outbreaks occurred worldwide between 1980 and 2015. Larvae injected with different concentrations of Listeria were incubated at 37°C and monitored over seven days for time needed to kill 50% of larvae (LT50 and to determine change of bacterial population in G. mellonella, 2 and 24 hours post-inoculation. Non-pathogenic members of Listeria and L. ivanovii showed significantly (P < 0.05 higher LT50 (lower virulence than the wild type L. monocytogenes strains. Isogenic mutants of L. monocytogenes with the deletions in prfA, plcA, hly, actA and virR genes, also showed significantly (P < 0.05 higher LT50 than the wild type strain at the inoculum of 106CFU/larva. Food isolates had significantly (P < 0.05 lower virulence than the paired clinical isolates, at all three inoculum concentrations. L. monocytogenes strains related to non-invasive (gastroenteritis outbreaks of listeriosis showed significantly (P < 0.05 lower virulence than isolates of the same serotype obtained from outbreaks with invasive symptoms. The difference, however, was dose and strain- dependent. No significant differences in
Biofilm Formation of Listeria monocytogenes on Various Surfaces
Directory of Open Access Journals (Sweden)
M Mahdavi
2007-10-01
Full Text Available Introduction & Objective: Listeria monocytogenes is considered as a ubiquitous foodborne pathogen which can lead to serious infections, especially in newborns, elderly, pregnant, and immunocompromised people. The organism has been isolated from many foods and may cause meningitis, septicemia and abortion in pregnant women. Also L. monocytogenes forms biofilms on many food contact surface materials and medical devices. Development of biofilms on many surfaces is a potential source of contamination of foods that may lead to spoilage or transmission of foodborne pathogens. Materials & Methods: Biofilm formation of L. monocytogenes (RITCC 1293 serotype 4a was investigated. Hydrophobicity of L. monocytogenes was measured by MATH method. Then biofilm formation of the organism was assessed at 2, 4, 8, 16 and 20 hours on stainless steel (type 304 no 2B, polyethylene and glass by drop plate method. Results: Results indicated that L. monocytogenes with 85% of hydrophobicity formed biofilm on each of three surfaces. Biofilm formation on stainless steel surfaces was significantly more than other surfaces (p<0.05. Conclusion: The ability of biofilm formation of L. monocytogenes on medical devices and food containers is very important as far as hygiene and disease outbreaks are concerned.
Vongkamjan, Kitiya; Benjakul, Soottawat; Kim Vu, Hue Thi; Vuddhakul, Varaporn
2017-09-01
Listeria monocytogenes is a foodborne pathogen commonly found in environments of seafood processing, thus presenting a challenge for eradication from seafood processing facilities. Monitoring the prevalence and subtype diversity of L. monocytogenes together with phages that are specific to Listeria spp. ("Listeria phages") will provide knowledge on the bacteria-phage ecology in food processing plants. In this work, a total of 595 samples were collected from raw material, finished seafood products and environmental samples from different sites of a seafood processing plant during 17 sampling visits in 1.5 years of study. L. monocytogenes and Listeria spp. (non-monocytogenes) were found in 22 (3.7%) and 43 (7.2%) samples, respectively, whereas 29 Listeria phages were isolated from 9 (1.5%) phage-positive samples. DNA fingerprint analysis of L. monocytogenes isolates revealed 11 Random Amplified Polymorphic DNA (RAPD) profiles, with two subtypes were frequently observed over time. Our data reveal a presence of Listeria phages within the same seafood processing environments where a diverse set of L. monocytogenes subtypes was also found. Although serotype 4b was observed at lower frequency, data indicate that isolates from this seafood processing plant belonged to both epidemiologically important serotypes 1/2a and 4b, which may suggest a potential public health risk. Phages (all showed a unique genome size of 65 ± 2 kb) were classified into 9 host range groups, representing both broad- and narrow-host range. While most L. monocytogenes isolates from this facility were susceptible to phages, five isolates showed resistance to 12-20 phages. Variations in phage host range among Listeria phages isolated from food processing plant may affect a presence of a diverse set of L. monocytogenes isolates derived from the same processing environment in Thailand. Copyright © 2017 Elsevier Ltd. All rights reserved.
Chen, Bang-Yuan; Pyla, Rajkumar; Kim, Tae-Jo; Silva, Juan L; Jung, Yean-Sung
2010-08-01
Catfish skins, intestines, fresh fillets, processing surfaces at different production stages, chiller water and non-food contact surfaces were sampled for Listeria monocytogenes and other Listeria species. Among 315 samples, prevalence of L. monocytogenes, Listeria innocua and a group of Listeria seeligeri-Listeria welshimeri-Listeria ivanovii was 21.6, 13.0 and 29.5%, respectively. No Listeria grayi was detected in this survey. While no L. monocytogenes strains were isolated from catfish skins and intestines, the strains were found with a frequency of 76.7% in chilled fresh catfish fillets and 43.3% in unchilled fillets. L. monocytogenes and Listeria spp. were also detected in fish contact surfaces such as deheading machine, trimming board, chiller water, conveyor belts at different stages, and fillet weighing table. Among L. monocytogenes, 1/2b (47.0%), 3b (16.0%) and 4c (14%) were the predominant serotypes isolated, whereas 4b, 4e, 1/2c and 1/2a were detected at much lower frequencies. Genotype analyses of L. monocytogenes isolates using serotyping, pulsed-field gel electrophoresis (PFGE) and enterobacterial repetitive intergenic consensus (ERIC)-PCR revealed that chiller water represented an important contamination source of L. monocytogenes in the chilled catfish fillets of two processing facilities, whereas fillet weighing table significantly contributed to the catfish fillet contamination of the third facility. This study suggests that L. monocytogenes contamination in the processed catfish fillets originates from the processing environment, rather than directly from catfish. Results from this study can aid the catfish industry to develop a plant-specific proper cleaning and sanitation procedure for equipment and the processing environment designed to specifically target L. monocytogenes contamination. Copyright 2010 Elsevier Ltd. All rights reserved.
[Analysis of antibiotic susceptibility of foodborne Listeria monocytogenes in China].
Yang, Yang; Fu, Ping; Guo, Yunchang; Liu, Xiurmei
2008-03-01
To study the antibiotic susceptibility of foodborne Listeria monocytogenes in China. The susceptibilities of 476 strains of foodborne Listeria monocytogenes to antibiotics were determined in Broth Microdilution Susceptibility Testing in Clinical and Laboratory Standards Institute. The antibiotics of gentamicin, ampicillin, penicillin, tetracycline, doxycycline, imipenem, erythromycin, ciprofloxacin, levofloxacin, cephalothin, rifampin, vancomycin, chloramphenicol, Trimethoprim-sulfamethoxazole, ampicillin-sulbactam were used. The rates of antibiotic resistance in 467 is olates were 4.5%. Tetracycline resistance was most prevalent, accouting for 4.07% . The foods that the rates of antibiotic resistance were highest were vegetable (10%). Among 14 provinces, Jilin, Hubei and Hebei were the third top, the rate of which were 19.6% and 9.1% and 8%, respectively. It was suggested that antibiotic resistance exists in foodborne Listeria monocytogenes to a certain extent in China. It should pay more attention to the use of drugs in prevention and clinic treatment to reduce the antibiotic resistant strains.
Directory of Open Access Journals (Sweden)
Roberta A. Bento
2009-09-01
Full Text Available Listeria monocytogenes is widely distributed in nature and the infection listeriosis is recognized as a potential threat for human health because of its mortality rate. The objective of this study was to evaluate the growth profile and chitosan production by Mucor rouxxi UCP 064 grown in yam bean (Pachyrhizus erosus L. Urban medium. It was also to assess the anti-L. monocytogenes efficacy of the obtained chitosan. Higher values of biomass of M. rouxxi (16.9 g.L¹ and best yield of chitosan (62 mg.g-1 were found after 48 h of cultivation. Residual glucose and nitrogen in the growth media were 4.1 and 0.02 g.L¹ after 96 h, respectively. Obtained chitosan presented 85 % of degree of deacetylation and 2.60 x 10(4 g.mol-1of viscosimetric molecular weight. Minimum Inhibitory Concentration (MIC and Minimum Bactericidal Concentration (MBC values of chitosan against L. monocytogenes ATCC 7644 were, respectively, 2.5 and 5.0 mg.mL-1. At 2.5 and 5.0 mg.mL-1 chitosan caused cidal effect in a maximum time of 4 h. Bacterial count below 2 log cfu.mL-1were found from 2 h onwards and no recovery in bacterial growth was noted in the remainder period. These results show the biotechnological potential of yam bean medium for chitosan production by Mucor rouxxi and support the possible rational use of chitosan from fungi as natural antimicrobial to control L. monocytogenes.Listeria monocytogenes apresentase como um microrganismo amplamente distribuído na natureza, sendo que a infecção listeriose é reconhecida como uma potencial ameaça a saúde humana devido a sua taxa de mortalidade. O objetivo deste estudo foi avaliar o perfil de crescimento e de produção de quitosana por Mucor rouxxi UCP 064 cultivado em meio jacatupé (Pachyrhizus erosus L. Urban, bem como avaliar a eficácia anti-L. monocytogenes da quitosana produzida com vistas a uma possível aplicação em alimentos. Os mais elevados valores de biomassa de M. rouxxi (16,9 g.L¹ e o maior rendimento na
Directory of Open Access Journals (Sweden)
abazar pournajaf
2013-09-01
Full Text Available Background: Listeria monocytogenes is a facultative intracellular pathogen that causes listeriosis which has extensive clinical manifestations. Infections with L. monocytogenes are a serious threat to immunocompromised persons. The aim of this study was to determine the frequency of L. monocytogenes strains recovered from clinical and non-clinical samples using phenotypic methods and confirmed by PCR. Materials and Methods: In this study, 617 specimens were analyzed. All specimens were cultured in the specific PALCAM agar. Colonies were initially identified by routine biochemical tests. Finally, PCR assays using primers specific for inlA gene were performed. Results: In all, 46 (8.2% L. monocytogenes isolates were recovered from 617 specimens. Fourteen (8.2% strains, including 4 (7.5%, 2 (5.7%, 5 (14.2% and 3 (8.5% isolates were obtained from placental tissue, urine, vaginal and rectal swabs, respectively. In addition, 9 (7.4% strains of L. monocytogenes which were isolated from 107 different dairy products originated from cheese 5 (7.1%, cream 2 (10% and kashk 2 (11.7%, respectively. Among 11 (5.2% strains isolated from 210 different meat products, 5 (5.5%, 4 (7.2% and 2 (3% strains belonged to sausage, meat and poultry extracts, respectively. Finally, 12 (9.2% Listeria strains were recovered from 130 animal specimens that included 6 (10%, 4 (8% and 2 (10% strains from goat, sheep and cattle, respectively. Furthermore, all Listeria isolates (100% were found to be carriers of inlA gene in PCR assay. Conclusion: The present study showed that the clinical and non-clinical specimens were contaminated with L. monocytogenes. So, it seems necessary to use a simple and standard technique such as PCR for rapid detection of this organism from various sources.
[Risk assessment of Listeria monocytogenes in deli meats and vegetable salads].
Tian, Jing; Liu, Xiu-mei
2009-09-01
To analysis risk from Listeria monocytogenes in deli meats and vegetable salads. Use Risk Ranger which is a software programme developed by the University of Hobart, Australia and answer 11 questions on affecting the risk from hazards in the specific foods by combining data from national foodborne diseases surveillance network and some references to make semi-quantitative risk assessment for the specific food. Relative risk from Listeria monocytogenes in deli meats and vegetable salads is 61 and 52, respectively. Incidence of listeriosis caused by deli meats-Listeria monocytogenes pairs and vegetable salads-Listeria monocytogenes pairs is 5.4 and 0.2 cases per million people, respectively. Risk from the former is 32 times than that from the latter. By changing the selection for some risk factors in the model, it was known that the risks from two food-hazard combinations could decrease 10 times, if taking necessary actions after processing. Deli meats is a kind of high risk food for listeriosis.
International Nuclear Information System (INIS)
Todoriki, Setsuko; Bari, Latiful; Kitta, Kazumi; Ohba, Mika; Ito, Yasuhiro; Tsujimoto, Yuka; Kanamori, Norihito; Yano, Erika; Moriyama, Tatsuya; Kawamura, Yukio; Kawamoto, Shinichi
2009-01-01
The presence of Listeria monocytogenes in fresh produce is a growing concern because of the possibility of food-borne illness. Ionizing radiation is an effective non-thermal means of eliminating pathogenic bacteria in fresh produce; however, the effect of ionizing irradiation on the allergenic properties of the host commodities remains unknown. This study aimed (i) to determine the effective dose of gamma-irradiation in eliminating L. monocytogenes on whole cherry tomatoes and (ii) to evaluate the effect of gamma-irradiation on the allergenic properties of tomato proteins. Cherry tomatoes that were inoculated with a mixture of five L. monocytogenes strains were treated with gamma-rays from a 60 Co source. A 1.25 kGy dose of gamma-irradiation was found to be sufficient to eliminate L. monocytogenes on whole cherry tomatoes. The immunoblot profile of serum samples obtained from two patients with tomato allergy revealed that gamma-irradiation did not affect the allergenicity of tomato proteins for up to 7 days after irradiation when the tomatoes were stored at 20 deg. C. Additionally, the m-RNA levels of β-fructofuranosidase, polygalacturonase, pectin esterase, and superoxide dismutase, the main allergenic proteins in tomato, were not affected by the applied irradiation dose. Thus, this study demonstrated that a 1.25 kGy dose of gamma-irradiation effectively eliminates L. monocytogenes on cherry tomatoes without affecting the expression of allergenic proteins in the fruits.
Todoriki, Setsuko; Bari, Latiful; Kitta, Kazumi; Ohba, Mika; Ito, Yasuhiro; Tsujimoto, Yuka; Kanamori, Norihito; Yano, Erika; Moriyama, Tatsuya; Kawamura, Yukio; Kawamoto, Shinichi
2009-07-01
The presence of Listeria monocytogenes in fresh produce is a growing concern because of the possibility of food-borne illness. Ionizing radiation is an effective non-thermal means of eliminating pathogenic bacteria in fresh produce; however, the effect of ionizing irradiation on the allergenic properties of the host commodities remains unknown. This study aimed (i) to determine the effective dose of gamma-irradiation in eliminating L. monocytogenes on whole cherry tomatoes and (ii) to evaluate the effect of gamma-irradiation on the allergenic properties of tomato proteins. Cherry tomatoes that were inoculated with a mixture of five L. monocytogenes strains were treated with gamma-rays from a 60Co source. A 1.25 kGy dose of gamma-irradiation was found to be sufficient to eliminate L. monocytogenes on whole cherry tomatoes. The immunoblot profile of serum samples obtained from two patients with tomato allergy revealed that gamma-irradiation did not affect the allergenicity of tomato proteins for up to 7 days after irradiation when the tomatoes were stored at 20 °C. Additionally, the m-RNA levels of β-fructofuranosidase, polygalacturonase, pectin esterase, and superoxide dismutase, the main allergenic proteins in tomato, were not affected by the applied irradiation dose. Thus, this study demonstrated that a 1.25 kGy dose of gamma-irradiation effectively eliminates L. monocytogenes on cherry tomatoes without affecting the expression of allergenic proteins in the fruits.
Energy Technology Data Exchange (ETDEWEB)
Todoriki, Setsuko [National Food Research Institute, Tsukuba, Ibaraki 305-8642 (Japan)], E-mail: setsuko@affrc.go.jp; Bari, Latiful; Kitta, Kazumi; Ohba, Mika; Ito, Yasuhiro; Tsujimoto, Yuka [National Food Research Institute, Tsukuba, Ibaraki 305-8642 (Japan); Kanamori, Norihito [Japan International Research Center for Agricultural Science, Tsukuba, Ibaraki 305-8686 (Japan); Yano, Erika; Moriyama, Tatsuya; Kawamura, Yukio [School of Agriculture, Kinki University, Nara-city, Nara 631-8505 (Japan); Kawamoto, Shinichi [National Food Research Institute, Tsukuba, Ibaraki 305-8642 (Japan)
2009-07-15
The presence of Listeria monocytogenes in fresh produce is a growing concern because of the possibility of food-borne illness. Ionizing radiation is an effective non-thermal means of eliminating pathogenic bacteria in fresh produce; however, the effect of ionizing irradiation on the allergenic properties of the host commodities remains unknown. This study aimed (i) to determine the effective dose of gamma-irradiation in eliminating L. monocytogenes on whole cherry tomatoes and (ii) to evaluate the effect of gamma-irradiation on the allergenic properties of tomato proteins. Cherry tomatoes that were inoculated with a mixture of five L. monocytogenes strains were treated with gamma-rays from a {sup 60}Co source. A 1.25 kGy dose of gamma-irradiation was found to be sufficient to eliminate L. monocytogenes on whole cherry tomatoes. The immunoblot profile of serum samples obtained from two patients with tomato allergy revealed that gamma-irradiation did not affect the allergenicity of tomato proteins for up to 7 days after irradiation when the tomatoes were stored at 20 deg. C. Additionally, the m-RNA levels of {beta}-fructofuranosidase, polygalacturonase, pectin esterase, and superoxide dismutase, the main allergenic proteins in tomato, were not affected by the applied irradiation dose. Thus, this study demonstrated that a 1.25 kGy dose of gamma-irradiation effectively eliminates L. monocytogenes on cherry tomatoes without affecting the expression of allergenic proteins in the fruits.
Moon, Hyeree; Kim, Nam Hee; Kim, Soon Han; Kim, Younghoon; Ryu, Jee Hoon; Rhee, Min Suk
2017-07-01
An effective bactericidal cold-marinating method for beef products is described, exploiting the synergism between soy sauce and natural compounds (carvacrol, CV or thymol, TM) to reduce microbiological risks. Beef slices inoculated with Escherichia coli O157:H7, Listeria monocytogenes, and Salmonella Typhimurium (3.1-3.5logCFU/g) were marinated in a teriyaki sauce with or without CV and TM (0.3 and 0.5%). After 1, 3, and 7days at 4°C, indigenous microflora population, color, lipid oxidation, marinade uptake, and pH of marinated beef and leftover marinade samples were examined. Teriyaki sauce alone did not reduce or inhibit any of the target pathogens or indigenous bacteria, while 0.5% CV- or TM-containing teriyaki sauce inactivated all inocula without recovery within 7days (p0.05). Copyright © 2017 Elsevier Ltd. All rights reserved.
International Nuclear Information System (INIS)
Jeong, Jae-Hee; Bae, Ji-Eun; Kim, Yeon-Gil
2011-01-01
The crystallization of PBP4 from L. monocytogenes is reported. Penicillin-binding proteins (PBPs), which catalyze peptidoglycan synthesis, have been extensively studied as a well established target of antimicrobial agents, including β-lactam derivatives. However, remarkable resistance to β-lactams has developed among pathogenic bacteria since the clinical use of penicillin began. Recently, the glycosyltransferase (GT) domain of class A PBPs has been proposed as an attractive target for antibiotic development as moenomycin-bound GT-domain structures have been determined. In this study, a class A PBP4 from Listeria monocytogenes was overexpressed, purified and crystallized using the hanging-drop vapour-diffusion method. Diffraction data were collected to 2.1 Å resolution using synchrotron radiation. The crystal belonged to the primitive orthorhombic space group P2 1 2 1 2, with unit-cell parameters a = 84.6, b = 127.8, c = 54.9 Å. The structural information will contribute to the further development of moenomycin-derived antibiotics possessing broad-spectrum activity
Influence of Organic Material and Biofilms on Disinfectant Efficacy Against Listeria monocytogenes
Directory of Open Access Journals (Sweden)
Hilda Nyati
2012-04-01
Full Text Available The effects of organic material and biofilm formation on the efficacy of Suma Tab D4 chlorine tablets and Suma Bac D10 quaternary ammonium compound (QAC against Listeria monocytogenes was determined in suspension and on stainless steel and polystyrene surfaces according to standard disinfectant test methodology. Exposure to 200 and 740 mg L-1 QAC and to 150 mg L-1 active chlorine resulted in a > 5.0 log10 CFU mL-1 and > 5.0 log10 CFU/coupon reduction of six L. monocytogenes strains within one minute, in suspension tests, and on stainless steel surfaces, respectively. Additionally, there was a reduction by as much as 5 log10 CFU/coupon or 5 log10 CFU/well of reference strains EGDe and Scott A biofilms within five minutes on stainless steel and polystyrene surfaces. Organic material, added as bovine serum albumin at 0.3% (w/v completely prevented the inactivation of L. monocytogenes in 150 mg L-1 chlorine, while reductions of only 0.6 +- 0.1 log10 CFU mL-1 were recorded in the presence of UHT milk at 3% (v/v. In contrast, reductions of 5 log10 CFU mL-1 were recorded within one minute on exposure to 740 mg L-1 QAC in the presence of 0.3% (w/v bovine serum albumin and within two minutes in the presence of 20 % (v/v UHT milk. Although Suma D4 chlorine tablets and Suma Bac D10 QAC are effective listericidal agents at recommended concentrations, Suma Tab D4 chlorine efficacy against L. monocytogenes is impaired by the presence of low concentrations of organic material, while Suma Bac D10 QAC maintains its listericidal activity in high organic loads.
Cirkovic, Ivana; Bozic, Dragana D; Draganic, Veselin; Lozo, Jelena; Beric, Tanja; Kojic, Milan; Arsic, Biljana; Garalejic, Eliana; Djukic, Slobodanka; Stankovic, Slavisa
2016-01-01
Coagulase negative staphylococci (CoNS) and Listeria monocytogenes have important roles in pathogenesis of various genital tract infections and fatal foetomaternal infections, respectively. The aim of our study was to investigate the inhibitory effects of two novel bacteriocins on biofilms of CoNS and L. monocytogenes genital isolates. The effects of licheniocin 50.2 from Bacillus licheniformis VPS50.2 and crude extract of bacteriocins produced by Lactococcus lactis subsp. lactis biovar. diacetylactis BGBU1-4 (BGBU1-4 crude extract) were evaluated on biofilm formation and formed biofilms of eight CoNS (four S. epidermidis, two S. hominis, one S. lugdunensis and one S. haemolyticus) and 12 L. monocytogenes genital isolates. Licheniocin 50.2 and BGBU1-4 crude extract inhibited the growth of both CoNS and L. monocytogenes isolates, with MIC values in the range between 200-400 AU/ml for licheniocin 50.2 and 400-3200 AU/ml for BGBU1-4 crude extract. Subinhibitory concentrations (1/2 × and 1/4 × MIC) of licheniocin 50.2 inhibited biofilm formation by all CoNS isolates (p < 0.05, respectively), while BGBU1-4 crude extract inhibited biofilm formation by all L. monocytogenes isolates (p < 0.01 and p < 0.05, respectively). Both bacteriocins in concentrations of 100 AU/mL and 200 AU/mL reduced the amount of 24 h old CoNS and L. monocytogenes biofilms (p < 0.05, p < 0.01, p < 0.001). This study suggests that novel bacteriocins have potential to be used for genital application, to prevent biofilm formation and/or to eradicate formed biofilms, and consequently reduce genital and neonatal infections by CoNS and L. monocytogenes.
Wan, J; Harmark, K; Davidson, B E; Hillier, A J; Gordon, J B; Wilcock, A; Hickey, M W; Coventry, M J
1997-03-01
The effect of bacteriocin, piscicolin 126, on the growth of Listeria monocytogenes and cheese starter bacteria was investigated in milk and in Camembert cheese manufactured from milk challenged with 10(2) cfu ml(-1) L. monocytogenes. In milk incubated at 30 degrees C, piscicolin 126 added in the range of 512-2,048 AU ml(-1) effectively inhibited growth of L. monocytogenes for more than 20 d when challenged with approximately 10(2) cfu ml(-1) L. monocytogenes. At higher challenge levels (10(4) and 10(6) cfu ml(-1)), piscicolin 126 reduced the viable count of L. monocytogenes by 4-5 log units immediately after addition of the bacteriocin; however, growth of Listeria occurred within 24 h. The minimum inhibitory concentration (MIC) of piscicolin 126 against lactic acid cheese starter bacteria was generally greater than 204,800 AU ml(-1) , and the viable count and acid production of these starter cultures in milk were not affected by the addition of 2,048 AU ml(-1) piscicolin 126. Camembert cheeses made from milk challenged with L. monocytogenes and with added piscicolin 126 showed a viable count of L. monocytogenes 3-4 log units lower than those without piscicolin 126. Inactivation of piscicolin 126 by proteolytic enzymes from cheese starter bacteria and mould together with the emergence of piscicolin 126-resistant isolates was responsible for the recovery of L. monocytogenes in the cheeses during ripening.
Prevalence and growth of Listeria monocytogenes in naturally contaminated seafood
DEFF Research Database (Denmark)
Jørgensen, Lasse Vigel; Huss, Hans Henrik
1998-01-01
Listeria monocytogenes contamination of seafood varies with product category. The highest prevalence was found in cold- smoked fish (34-60%), while the lowest was found in heat- treated and cured seafood (4-12%). The prevalence of L. monocytogenes differed greatly in cold-smoked salmon between...... production sites, ranging from monocytogenes. The organism showed moderate growth...... in naturally contaminated cold-smoked, and 'gravad', fish while the growth appeared faster in hot smoked fish. Thus L. monocytogenes is not under control in these products. Finally, the prevalence and growth of L. monocytogenes in naturally contaminated cold-smoked salmon are discussed in relation...
Directory of Open Access Journals (Sweden)
Paul Priyesh Vijayakumar
2017-03-01
Full Text Available Bacteriocin-producing (Bac+ lactic acid bacteria (LAB comprising selected strains of Lactobacillus curvatus, Lactococcus lactis, Pediococcus acidilactici, and Enterococcus faecium and thailandicus were examined for inhibition of Listeria monocytogenes during hotdog challenge studies. The Bac+ strains, or their cell-free supernatants (CFS, were grouped according to mode-of-action (MOA as determined from prior studies. Making a mixture of as many MOAs as possible is a practical way to obtain a potent natural antimicrobial mixture to address L. monocytogenes contamination of RTE meat products (i.e., hotdogs. The heat resistance of the bacteriocins allowed the use of pasteurization to eliminate residual producer cells for use as post-process surface application or their inclusion into hotdog meat emulsion during cooking. The use of Bac+ LAB comprising 3× MOAs directly as co-inoculants on hotdogs was not effective at inhibiting L. monocytogenes. However, the use of multiple MOA Bac+ CFS mixtures in a variety of trials demonstrated the effectiveness of this approach by showing a >2-log decrease of L. monocytogenes in treatment samples and 6–7 log difference vs. controls. These data suggest that surface application of multiple mode-of-action bacteriocin mixtures can provide for an Alternative 2, and possibly Alternative 1, process category as specified by USDA-FSIS for control of L. monocytogenes on RTE meat products.
Directory of Open Access Journals (Sweden)
Rafael C.R. Martinez
2005-03-01
Full Text Available Bacteriocin-producing Lactobacillus sakei 1 was cultivated in Brain-Heart Infusion broth (24 h at 25ºC. The culture supernatant was neutralized, filter sterilized and used to test the activity of bacteriocin against Listeria monocytogenes 1/2a, at 8ºC and 15ºC. Non-bacteriocinogenic Lactobacillus sakei ATCC 15521 was used as a negative control. L. monocytogenes 1/2a was inoculated in culture supernatant medium from L. sakei 1 and L. sakei ATCC 15521 and the listerial populations were determined after 0, 5 and 10 days. The bacteriocin production was quantified as arbitrary units per mL (AU/mL using agar antagonism test. Additionally, to investigate if L. monocytogenes virulence pattern could be changed after bactericion exposure, the ability of L. monocytogenes to cause haemolysis in sheep red blood cells was determined, before and after exposure to bacteriocin at 8ºC. In the presence of the antimicrobial peptide, at 8ºC, L. monocytogenes population decreased, but growth of resistant cells was observed. At 15ºC, there was no difference between test and control. Furthermore, the haemolytic activity of L. monocytogenes 1/2a was not altered by exposure to L. sakei 1 bacteriocin, which suggests no change in its virulence pattern.Lactobacillus sakei 1 produtor de bacteriocina foi cultivado em caldo Infusão Cérebro-Coração por 24h a 25ºC. O sobrenadante da cultura foi neutralizado, esterilizado por filtração e usado para testar a atividade da bacteriocina frente a Listeria monocytogenes 1/2a, a 8ºC e 15ºC. Lactobacillus sakei ATCC 15521 não bacteriocinogênico, foi utilizado como controle negativo. L. monocytogenes 1/2a foi inoculada no sobrenadante da cultura de L.sakei 1 e L. sakei ATCC 15521 e as populações listeriais foram determinadas após 0, 5 e 10 dias. A produção de bacteriocina foi quantificada como unidades arbitrárias por mL (UA/mL, utilizando-se o teste de antagonismo em ágar. Adicionalmente, para investigar se o padr
Growth potential of Listeria monocytogenes in sliced turkey bresaola packed in modified atmosphere
Directory of Open Access Journals (Sweden)
Elena Dalzini
2014-02-01
Full Text Available According to EC Regulation No 2073/2005, for food business operators that produce ready-to-eat (RTE product, it is crucial to be able to demonstrate if the product supports the growth of Listeria monocytogenes. The objective of the study was therefore to evaluate the behaviour of L. monocytogenes in sliced RTE turkey bresaola (made by cured turkey breast 4.5% NaCl, 1% sodium lactate, sodium nitrite 150 ppm and flavouring during the shelf life of the product, simulating a contamination during the slicing operation. Considering a shelf life of 90 days, as defined by manufacturer, the packages of sliced bresaola were stored at 5°C for 7 days and at 8°C for the remaining storage time (83 days. L. monocytogenes count decreased during storage test from 1.43/1.98 log cfu/g in the three batches tested to 1.03 log cfu/g in one batch and to undetectable levels in the other two batches. The results show that the investigated product is unable to support the growth of L. monocytogenes.
Skåra, Torstein; Valdramidis, Vasilis P; Rosnes, Jan Thomas; Noriega, Estefanía; Van Impe, Jan F M
2014-12-01
Steam surface pasteurization is a promising decontamination technology for reducing pathogenic bacteria in different stages of food production. The effect of the artificial inoculation type and initial microbial load, however, has not been thoroughly assessed in the context of inactivation studies. In order to optimize the efficacy of the technology, the aim of this study was to design and validate a model system for steam surface pasteurization, assessing different inoculation methods and realistic microbial levels. More specifically, the response of Listeria innocua, a surrogate organism of Listeria monocytogenes, on a model fish product, and the effect of different inoculation levels following treatments with a steam surface pasteurization system was investigated. The variation in the resulting inoculation level on the samples was too large (77%) for the contact inoculation procedure to be further considered. In contrast, the variation of a drop inoculation procedure was 17%. Inoculation with high levels showed a rapid 1-2 log decrease after 3-5 s, and then no further inactivation beyond 20 s. A low level inoculation study was performed by analysing the treated samples using a novel contact plating approach, which can be performed without sample homogenization and dilution. Using logistic regression, results from this method were used to model the binary responses of Listeria on surfaces with realistic inoculation levels. According to this model, a treatment time of 23 s will result in a 1 log reduction (for P = 0.1). Copyright © 2014 Elsevier Ltd. All rights reserved.
Listeria monocytogenes - Danger for health safety vegetable production.
Kljujev, Igor; Raicevic, Vera; Jovicic-Petrovic, Jelena; Vujovic, Bojana; Mirkovic, Milica; Rothballer, Michael
2018-04-22
The microbiologically contaminated vegetables represent a risk for consumers, especially vegetables without thermal processing. It is known that human pathogen bacteria, such as Listeria monocytogenes, could exist on fresh vegetables. The fresh vegetables could become Listeria-contaminated if they come in touch with contaminated soil, manure, irrigation water. The aim of this work was to investigate the presence of Listeria spp. and L. monocytogenes in different kind of vegetables grown in field and greenhouse condition as well as surface and endophytic colonization plant roots of different vegetables species by L. monocytogenes in laboratory conditions. The detection of Listeria spp. and L. monocytogenes in vegetable samples was done using ISO and PCR methods. The investigation of colonization vegetable roots and detection Listeria-cells inside plant root tissue was done using Fluorescence in situ hybridization (FISH) method in combination with confocal laser scanning microscopy (CLSM). The results showed that 25.58% vegetable samples were positive for Listeria spp. and only one sample (carrot) was positive for L. monocytogenes out of 43 samples in total collected from field and greenhouse. The strain L. monocytogenes EGD-E surface and endophytic colonized carrot root in highest degree while strain L. monocytogenes SV4B was the most represented at leafy vegetable plants, such at lettuce (1.68 × 10 6 cells/mm 3 absolutely dry root) and spinach (1.39 × 10 6 cells/mm 3 absolutely dry root) root surface. The cells of L. monocytogenes SV4B were visible as single cells in interior tissue of plant roots (celery and sweet corn roots) as well as in the interior of the plant root cell at sweet corn root. The cells of L. monocytogenes EGD-E bind to the surface of the plant root and they were less commonly found out on root hair. In the inner layers of the root, those bacterial cells were inhabited intercellular spaces mainly as single cells very close to the
DEFF Research Database (Denmark)
Ojeniyi, B.; Wegener, Henrik Caspar; Jensen, N.E.
1996-01-01
Listeria monocytogenes was isolated from 11/236 (4 . 7%) caecal samples from parent flocks, providing broilers to the abattoirs investigated. Caecal samples from 2078 broilers representing 90 randomly selected broiler flocks were negative for L. monocytogenes. A total of 3080 samples from seven...... abattoirs including poultry processing line samples, and final products were also examined for L. monocytogenes. Listeria monocytogenes was isolated in 0 . 3% to 18 . 7% of the samples collected in the different abattoirs. Epidemiological typing of 247 L. monocytogenes isolates, including serotyping, phage...... isolates of L. monocytogenes since only 120/247 (48 . 6%) isolates were typable by phage typing and 230/247 (93 . 1%) L. monocytogenes belonged to serotype 01 while 6/247 (2 . 4%) belonged to 04. The discovery of a few dominating clones in each abattoir might indicate an endemic occurrence of L...
Novel Cadmium Resistance Determinant in Listeria monocytogenes.
Parsons, Cameron; Lee, Sangmi; Jayeola, Victor; Kathariou, Sophia
2017-03-01
Listeria monocytogenes is a foodborne pathogen that can cause severe disease (listeriosis) in susceptible individuals. It is ubiquitous in the environment and often exhibits resistance to heavy metals. One of the determinants that enables Listeria to tolerate exposure to cadmium is the cadAC efflux system, with CadA being a P-type ATPase. Three different cadA genes (designated cadA1 to cadA3 ) were previously characterized in L. monocytogenes A novel putative cadmium resistance gene ( cadA4 ) was recently identified through whole-genome sequencing, but experimental confirmation for its involvement in cadmium resistance is lacking. In this study, we characterized cadA4 in L. monocytogenes strain F8027, a cadmium-resistant strain of serotype 4b. By screening a mariner-based transposon library of this strain, we identified a mutant with reduced tolerance to cadmium and that harbored a single transposon insertion in cadA4 The tolerance to cadmium was restored by genetic complementation with the cadmium resistance cassette ( cadA4C ), and enhanced cadmium tolerance was conferred to two unrelated cadmium-sensitive strains via heterologous complementation with cadA4C Cadmium exposure induced cadA4 expression, even at noninhibitory levels. Virulence assessments in the Galleria mellonella model suggested that a functional cadA4 suppressed virulence, potentially promoting commensal colonization of the insect larvae. Biofilm assays suggested that cadA4 inactivation reduced biofilm formation. These data not only confirm cadA4 as a novel cadmium resistance determinant in L. monocytogenes but also provide evidence for roles in virulence and biofilm formation. IMPORTANCE Listeria monocytogenes is an intracellular foodborne pathogen causing the disease listeriosis, which is responsible for numerous hospitalizations and deaths every year. Among the adaptations that enable the survival of Listeria in the environment are the abilities to persist in biofilms, grow in the cold, and
Wang, Li; McKeith, Amanda Gipe; Shen, Cangliang; Carter, Kelsey; Huff, Alyssa; McKeith, Russell; Zhang, Xinxia; Chen, Zhengxing
2016-02-01
This study evaluated the antilisterial activity of hops beta acids (HBA) and their impact on the quality and sensory attributes of ham. Commercially cured ham slices were inoculated with unstressed- and acid-stress-adapted (ASA)-L. monocytogenes (2.2 to 2.5 log CFU/cm(2) ), followed by no dipping (control), dipping in deionized (DI) water, or dipping in a 0.11% HBA solution. This was followed by vacuum or aerobic packaging and storage (7.2 °C, 35 or 20 d). Samples were taken periodically during storage to check for pH changes and analyze the microbial populations. Color measurements were obtained by dipping noninoculated ham slices in a 0.11% HBA solution, followed by vacuum packaging and storage (4.0 °C, 42 d). Sensory evaluations were performed on ham slices treated with 0.05% to 0.23% HBA solutions, followed by vacuum packaging and storage (4.0 °C, 30 d). HBA caused immediate reductions of 1.2 to 1.5 log CFU/cm(2) (P ham slices. During storage, the unstressed-L. monocytogenes populations on HBA-treated samples were 0.5 to 2.0 log CFU/cm(2) lower (P color or sensory attributes of the ham slices stored in vacuum packages. These results are useful for helping ready-to-eat meat processors develop operational procedures for applying HBA on ham slices. © 2016 Institute of Food Technologists®
Aerosol studies with Listeria innocua and Listeria monocytogenes.
Zhang, Guodong; Ma, Li; Oyarzabal, Omar A; Doyle, Michael P
2007-08-01
Aerosol studies of Listeria monocytogenes in food processing plants have been limited by lack of a suitable surrogate microorganism. The objective of this study was to investigate the potential of using green fluorescent protein-labeled strains of Listeria innocua as a surrogate for L. monocytogenes for aerosol studies. These studies were conducted in a laboratory bioaerosol chamber and a pilot food-processing facility. Four strains of L. innocua and five strains of L. monocytogenes were used. In the laboratory chamber study, Listeria cells were released into the environment at two different cell numbers and under two airflow conditions. Trypticase soy agar (TSA) plates and oven-roasted breasts of chicken and turkey were placed in the chamber to monitor Listeria cell numbers deposited from aerosols. A similar experimental design was used in the pilot plant study; however, only L. innocua was used. Results showed that L. monocytogenes and L. innocua survived equally well on chicken and turkey breast meats and TSA plates. No-fan and continuous fan applications, which affected airflow, had no significant effect on settling rates of aerosolized L. monocytogenes and L. innocua in the bioaerosol chamber or L. innocua in the pilot plant study. Listeriae cell numbers in the air decreased rapidly during the first 1.5 h following release, with few to no listeriae detected in the air at 3 h. Aerosol particles with diameters of 1 and 2 microM correlated directly with the number of Listeria cells in the aerosol but not with particles that were 0.3, 0.5, and 5 microM in diameter. Results indicate that L. innocua can be used as a surrogate for L. monocytogenes in an aerosol study.
Ultrasonic cleaning of conveyor belt materials using Listeria monocytogenes as a model organism.
Tolvanén, Riina; Lunden, Janne; Korkeala, Hannu; Wirtanen, Gun
2007-03-01
Persistent Listeria monocytogenes contamination of food industry equipment is a difficult problem to solve. Ultrasonic cleaning offers new possibilities for cleaning conveyors and other equipment that are not easy to clean. Ultrasonic cleaning was tested on three conveyor belt materials: polypropylene, acetal, and stainless steel (cold-rolled, AISI 304). Cleaning efficiency was tested at two temperatures (30 and 45 degrees C) and two cleaning times (30 and 60 s) with two cleaning detergents (KOH, and NaOH combined with KOH). Conveyor belt materials were soiled with milk-based soil and L. monocytogenes strains V1, V3, and B9, and then incubated for 72 h to attach bacteria to surfaces. Ultrasonic cleaning treatments reduced L. monocytogenes counts on stainless steel 4.61 to 5.90 log units; on acetal, 3.37 to 5.55 log units; and on polypropylene, 2.31 to 4.40 log units. The logarithmic reduction differences were statistically analyzed by analysis of variance using Statistical Package for the Social Sciences software. The logarithmic reduction was significantly greater in stainless steel than in plastic materials (P conveyor belt materials.
Listeria Monocytogenes Persistence in Ready-to-Eat Sausages and in Processing Plants.
Mureddu, Anna; Mazza, Roberta; Fois, Federica; Meloni, Domenico; Bacciu, Roberto; Piras, Francesca; Mazzette, Rina
2014-01-21
Listeria monocytogenes is of major concern in the fermented meat products and is able to persist in their processing environments. The aim of the present work was to evaluate the virulence profile and the persistence capacity of L. monocytogenes strains isolated in Sardinian fermented sausages processing plants. Food (ground meat, sausages at the end of acidification and ripening stage) and environmental samples (a total of n. 385), collected from 4 meat processing plants located in Sardinia (Italy), were examined to detect L. monocytogenes presence. All the L. monocytogenes isolates were identified by polymerase chain reaction (PCR) method. A subset of strains was also characterised by multiplex PCR-based serogrouping, using the lmo0737 , lmo1118 , ORF2819 and ORF2110 genes. Three different multiplex PCRs were used to obtain the virulence profiles by the rrn , hlyA , actA , prfA , inlA , inlB , iap , plcA , plcB and mpl marker genes. Furthermore, in vitro biofilm forming ability and resistance to disinfectants were carried out on microtiter plate. The overall prevalence was 31.5% in food, and 68.5% in environmental samples. The prevalent serotype resulted 1/2c (43%), followed by 1/2a (40%), 4b (8.6%), and 1/2b (8.6%). The amplification products of the virulence genes were found in all the isolates with the following prevalence: 77.1% hlyA ; 100% rrn ; 100% prfA ; 97.1% iap ; 65.7% inlB ; 88.6% inlA ; 100% plcA ; 100% plcB and 74.3% mpl . As for biofilm forming ability, 37.1% of the strains were positive and resulted weak producer, but all the isolates were sensible to disinfectants showing a reduction of L. monocytogenes growth after each incubation time. More appropriate technologies and application of measures of hygienic control should be implemented to prevent the L. monocytogenes growth and cross-contamination in salsiccia sarda processing plants.
Listeria monocytogenes persistence in ready-to-eat sausages and in processing plants
Directory of Open Access Journals (Sweden)
Anna Mureddu
2014-02-01
Full Text Available Listeria monocytogenes is of major concern in the fermented meat products and is able to persist in their processing environments. The aim of the present work was to evaluate the virulence profile and the persistence capacity of L. monocytogenes strains isolated in Sardinian fermented sausages processing plants. Food (ground meat, sausages at the end of acidification and ripening stage and environmental samples (a total of n. 385, collected from 4 meat processing plants located in Sardinia (Italy, were examined to detect L. monocytogenes presence. All the L. monocytogenes isolates were identified by polymerase chain reaction (PCR method. A subset of strains was also characterised by multiplex PCR-based serogrouping, using the lmo0737, lmo1118, ORF2819 and ORF2110 genes. Three different multiplex PCRs were used to obtain the virulence profiles by the rrn, hlyA, actA, prfA, inlA, inlB, iap, plcA, plcB and mpl marker genes. Furthermore, in vitro biofilm forming ability and resistance to disinfectants were carried out on microtiter plate. The overall prevalence was 31.5% in food, and 68.5% in environmental samples. The prevalent serotype resulted 1/2c (43%, followed by 1/2a (40%, 4b (8.6%, and 1/2b (8.6%. The amplification products of the virulence genes were found in all the isolates with the following prevalence: 77.1% hlyA; 100% rrn; 100% prfA; 97.1% iap; 65.7% inlB; 88.6% inlA; 100% plcA; 100% plcB and 74.3% mpl. As for biofilm forming ability, 37.1% of the strains were positive and resulted weak producer, but all the isolates were sensible to disinfectants showing a reduction of L. monocytogenes growth after each incubation time. More appropriate technologies and application of measures of hygienic control should be implemented to prevent the L. monocytogenes growth and crosscontamination in salsiccia sarda processing plants.
Argyri, Anthoula A; Lyra, Efstathia; Panagou, Efstathios Z; Tassou, Chrysoula C
2013-10-01
The survival of Escherichia coli O157:H7, Salmonella Enteritidis and Listeria monocytogenes during the storage of fermented green table olives cv. Halkidiki in brine was studied in parallel with the evolution of lactic acid bacteria (LAB), yeasts and pH. The olives were previously fermented with a starter culture (a potential probiotic strain of Lactobacillus pentosus B281--starter process) or with the indigenous microbiota (control). After the end of fermentation, olives were placed in brine, inoculated with a cocktail of 5 strains of E. coli O157:H7, 5 strains of L. monocytogenes and 4 strains of S. Enteritidis, with a final concentration in the brine of ca. 7.0 log CFU/ml, and subsequently packaged in polyethylene pouches and stored at 20 °C. The population of E. coli O157:H7 reduced gradually and was detected in the brine until the 27th day of storage in both cases (i.e., starter and control process), and on olive fruits until the 19th and 16th days of storage in the starter and control process, respectively. S. Enteritidis population showed also a decrease and it was detected until the 21st day of storage in both brine and olive fruits in both cases. The population of L. monocytogenes declined during storage and it was detected until the 31st day of storage in both brine and olive fruits in both cases, showing a longer survival period in comparison to the other two studied pathogens. The presence of the potential probiotic starter did not affect the pathogen survival. The results demonstrated that even though the growth of the pathogenic strains was not supported, they may survive for a long period in a stressful environment of a fermented product with low pH value (4.2) and high salt concentration (6.0%). These results are a valuable contribution to risk assessment studies related to ready to eat foods in general. Copyright © 2013 Elsevier Ltd. All rights reserved.
Listeria monocytogenes endophthalmitis following keratoconjunctivitis.
Shoughy, Samir S; Tabbara, Khalid F
2014-01-01
Endophthalmitis due to endogenous or exogenous bacteria is a rare infection of the eye. We report a case of endophthalmitis following Listeria monocytogenes keratoconjunctivitis in a 27-year-old healthy white male presenting with hand motion visual acuity, right eye mucopurulent conjunctivitis, elevated intraocular pressure, and pigmented hypopyon 6 months post-keratectomy. The conjunctivitis was unresponsive to a 5-day course of topical tobramycin eye drops, and the patient developed keratitis with pain that progressed to endophthalmitis after 21 days. Diagnostic B-scan revealed vitreous exudates. Intraocular fluid specimen showed Gram-positive organisms and the aqueous culture grew penicillin-/aminoglycoside-sensitive L. monocytogenes. The patient was given intravitreal and systemic vancomycin and ceftazidime. The eye was unresponsive to intravenous penicillin and gentamicin; the anterior chamber progressively flattened and developed phthisis bulbi. L. monocytogenes keratoconjunctivitis may lead to bacterial endophthalmitis. Prompt culture and early antibiotic therapy are recommended.
Listeria monocytogenes Infection in Hairy Cell Leukemia: A Case Report and Literature Review
Directory of Open Access Journals (Sweden)
James C. Barton
2018-01-01
Full Text Available Listeria monocytogenes infections have been described in patients with diverse types of malignancy, especially leukemia. We report the case of a 65-year-old man with previously untreated hairy cell leukemia characterized by CD5 positivity and trisomy 12 (3% of blood lymphocytes who developed bacteremia due to L. monocytogenes serotype 1/2b. We summarize clinical features and treatment of this patient and five previously reported patients with hairy cell leukemia who also had L. monocytogenes infections. All six patients were men. Their mean age at infection diagnosis was 70 y. Three men had undergone splenectomy 4–11 y before they developed L. monocytogenes infection. The central nervous system was the primary site of infection in four men. Bacteremia alone occurred in two other men. At diagnosis of infection, one man was receiving antileukemia chemotherapy and another man was receiving treatment for Kaposi’s sarcoma. Two other patients had other comorbid conditions. All six men recovered from their infections.
Directory of Open Access Journals (Sweden)
N. Soultos
2014-11-01
Full Text Available Aim: In the current study, a contribution to the knowledge on the prevalence and level of contamination of Listeria monocytogenes in ready-to-eat (RTE seafood marketed in Thessaloniki (Northern Greece was provided; the serovar identity of the L. monocytogenes isolates was also determined. Materials and Methods: A total of 132 RTE seafood samples consisting of 74 smoked fish products, 18 salted fish products, 16 dried fish products, 9 raw marinated fish products, 10 cooked marinated cephalopods and 5 surimi crab stick products were analyzed. L. monocytogenes were isolated and enumerated based on ISO 11290-1/A1 and ISO 11290-2/A1 protocols, respectively, and identified using a multiplex polymerase chain reaction (PCR system utilizing genus and species specific primers. For the identification of serotypes a second multiplex PCR assay was used which clusters L. monocytogenes strains into four major serogroups. Results: Of the samples examined, 11 (8.3% proved positive for Listeria spp. with 8 (6.1% yielding L. monocytogenes. Only in one sample of smoked mackerel the level of L. monocytogenes exceeded the legal safety limit of 100 cfu/g set out in Commission Regulation (EC No. 1441/2007. Serotyping showed higher percentages of isolates belonging to PCR serogroup 3:1/2b, 3b, 7 (46.7% and serogroup 1:1/2a, 3a (40% followed by serogroup 4:4b, 4d, 4e (13.3%. Conclusion: This study demonstrated that L. monocytogenes can be isolated from processed RTE seafood products at retail in Thessaloniki (Northern Greece in low concentrations. However, the presence of this human pathogen in RTE seafood should not be overlooked, but it should be considered as having significance public health implications, particularly among the persons who are at greater risk. Therefore, RTE seafood should be produced under appropriate hygienic and technological conditions since the product does not undergo any treatment before consumption.
Listeria spp., y L. monocytogenes EN LECHE CRUDA DE CABRA
Directory of Open Access Journals (Sweden)
Yolanda Albarracín C
2008-08-01
Full Text Available Objective. To test non-pasteurized goat’s milk from the village of ‘la Garita’, Northern Santander, for Listeria monocytogenes. Material and methods. 90 samples of non-pasteurized goat’s milk were obtained over a 4 month period; pH and temperature of each sample were measured. The INVIMA technique was used to isolate L. monocytogenes; the species was confirmed by PCR. Results. The study showed that eight goat milk providers of the zone neither had refrigeration nor pasteurized the milk. The prevalence of L. monocytogenes was 3%; 15% of the samples had other species of Listeria. The milk obtained from this zone contained the pathogen that may cause listeriosis in children less than 5 years of age, pregnant women, adults and immunologically compromised patients. Conclusions. This study shows the occurrence of this pathogen in goat’s milk and identified areas of risk for those people who drink goat’s milk.
Listeria monocytogenes endophthalmitis following keratoconjunctivitis
Directory of Open Access Journals (Sweden)
Shoughy SS
2014-01-01
Full Text Available Samir S Shoughy,1 Khalid F Tabbara1–31The Eye Center and The Eye Foundation for Research in Ophthalmology, Riyadh, Saudi Arabia; 2Department of Ophthalmology, College of Medicine, King Saud University, Riyadh, Saudi Arabia; 3The Wilmer Ophthalmological Institute of The Johns Hopkins University School of Medicine, Baltimore, MD, USAAbstract: Endophthalmitis due to endogenous or exogenous bacteria is a rare infection of the eye. We report a case of endophthalmitis following Listeria monocytogenes keratoconjunctivitis in a 27-year-old healthy white male presenting with hand motion visual acuity, right eye mucopurulent conjunctivitis, elevated intraocular pressure, and pigmented hypopyon 6 months post-keratectomy. The conjunctivitis was unresponsive to a 5-day course of topical tobramycin eye drops, and the patient developed keratitis with pain that progressed to endophthalmitis after 21 days. Diagnostic B-scan revealed vitreous exudates. Intraocular fluid specimen showed Gram-positive organisms and the aqueous culture grew penicillin-/aminoglycoside-sensitive L. monocytogenes. The patient was given intravitreal and systemic vancomycin and ceftazidime. The eye was unresponsive to intravenous penicillin and gentamicin; the anterior chamber progressively flattened and developed phthisis bulbi. L. monocytogenes keratoconjunctivitis may lead to bacterial endophthalmitis. Prompt culture and early antibiotic therapy are recommended.Keywords: conjunctivitis, L. monocytogenes, endophthalmitis
Simmons, Courtenay; Stasiewicz, Matthew J; Wright, Emily; Warchocki, Steven; Roof, Sherry; Kause, Janell R; Bauer, Nathan; Ibrahim, Salam; Wiedmann, Martin; Oliver, Haley F
2014-11-01
Postprocessing contamination in processing plants has historically been a significant source of Listeria monocytogenes in ready-to-eat delicatessen meats, and therefore a major cause of human listeriosis cases and outbreaks. Recent risk assessments suggest that a majority of human listeriosis cases linked to consumption of contaminated deli meats may be due to L. monocytogenes contamination that occurs at the retail level. To better understand the ecology and transmission of Listeria spp. in retail delicatessens, food and nonfood contact surfaces were tested for L. monocytogenes and other Listeria spp. in a longitudinal study conducted in 30 retail delis in three U.S. states. In phase I of the study, seven sponge samples were collected monthly for 3 months in 15 delis (5 delis per state) prior to start of daily operation; in phase II, 28 food contact and nonfood contact sites were sampled in each of 30 delis during daily operation for 6 months. Among the 314 samples collected during phase I, 6.8% were positive for L. monocytogenes. Among 4,503 samples collected during phase II, 9.5% were positive for L. monocytogenes; 9 of 30 delis showed low L. monocytogenes prevalence (Listeria spp. isolates, including 184 Listeria innocua, 48 Listeria seeligeri, and 13 Listeria welshimeri were characterized. Pulsed-field gel electrophoresis (PFGE) was used to characterize 446 L. monocytogenes isolates. PFGE showed that for 12 of 30 delis, one or more PFGE types were isolated on at least three separate occasions, providing evidence for persistence of a given L. monocytogenes subtype in the delis. For some delis, PFGE patterns for isolates from nonfood contact surfaces were distinct from patterns for occasional food contact surface isolates, suggesting limited cross-contamination between these sites in some delis. This study provides longitudinal data on L. monocytogenes contamination patterns in retail delis, which should facilitate further development of control strategies in
Fødevarebetinget listeria monocytogenes endokarditis
DEFF Research Database (Denmark)
Frydland, Martin; Bundgaard, Henning; Moser, Claus
2014-01-01
Infection with Listeria monocytogenes is rare and mainly seen in immunosuppressed patients. Infection with L. monocytogenes has a mortality rate of 30%. We present a case report of L. monocytogenes bacteraemia and endocarditis in a 70-year-old man with several co-morbidities and following four...... major surgical procedures. This illustrates the findings and characteristics in one of the 16 patients who died in 2013 and 2014 this summer due to sausage-related L. monocytogenes infection....
Weyker, Robert E; Glass, Kathleen A; Milkowski, Andrew L; Seman, Dennis L; Sindelar, Jeffrey J
2016-03-01
Interest in natural/organic meat products has resulted in the need to validate the effectiveness of clean label antimicrobials to increase safety and shelf life of these products. A Response Surface Methodology (RSM) was used to investigate the effects of varying levels of moisture, pH, and a commercial "clean-label" antimicrobial (cultured sugar-vinegar blend; CSVB) on the growth rate of Listeria monocytogenes and Leuconostoc mesenteroides in uncured turkey stored at 4 °C for 16 wk. Twenty treatment combinations of moisture (60% to 80%), pH (5.8 to 6.4), and CSVB (2.5% to 5.0%) were evaluated during phase I to develop growth curves for both microbe types, whereas the interactive effects of pH (5.8 to 6.4) and CSVB (0.0 to 4.75) were tested in 16 treatment combinations during Phase II at a single moisture level using L. monocytogenes only. CSVB inhibited L. monocytogenes growth in 14 of the 20 treatments tested in Phase I and in 12 of the 16 treatments in Phase II through 16 and 8 wk, respectively. In contrast, CSVB had little effect on L. mesenteroides, with growth inhibited in only 4 of 20 treatments in Phase I and was therefore not tested further in Phase II. Significant interactions of the RSM design coefficients yielded a predictive model for L. mesenteroides growth rate, but due to lack of growth, no growth rate model was developed for L. monocytogenes. CSVB was found to be an effective antilisteral antimicrobial, while having little effect on a spoilage microorganism. © 2016 Institute of Food Technologists®
Directory of Open Access Journals (Sweden)
Maysa A. I. Awadallah
2014-10-01
Full Text Available Aim: This study aimed to investigate the occurrence of some virulence genes distributed in Listeria monocytogenes isolated from ready-to-eat (RTE meat products and consumers in Cairo province, Egypt. Materials and Methods: A total of 120 beef luncheon, chicken luncheon and frankfurter beef (40 samples, each were collected from 10 different local shops situated in Al-salam city, Cairo province, Egypt. Stool samples were collected from 40 people who had the habit of consuming RTE meat. The suspected L. monocytogenes isolates were subjected to a multiplex polymerase chain reaction (PCR for rapid speciation and virulence determination using primers specific for inIA, inIC, and inIJ genes. Results: Culture examination of all samples on Oxford media revealed presence of colonies characteristic to L. monocytogenes in 6 beef luncheon (15%, 4 chicken luncheon (10%, 1 frankfurter beef (2.5% and 1 human stool (2.5% samples. Species identity of L. monocytogenes was verified through the amplification of a 800 bp fragment with inIA primers in 2 out of 6 culture isolates from beef luncheon (5%, and 1 out 4 culture isolates from chicken luncheon (2.5% samples. Statistical analysis revealed no significant difference between the occurrence of L. monocytogenes in different food samples examined (p>0.05. The virulence of these strains was ascertained by the presence of 517 bp and 238 bp fragments of inIC and inIJ genes, respectively in the isolates that contained the 800 bp fragment. The culture isolates obtained from one frankfurter beef sample, and one human stool sample were found negative by multiplex PCR for the presence of L. monocytogenes and its virulence specific genes. Conclusion: It could be concluded that L. monocytogenes are circulating in beef and chicken luncheon sold in Cairo, Egypt. Multiplex PCR is reliable for confirmation of L. monocytogenes. This study suggests the implementation of hygienic measures at all levels from production to consumption
Schoder, D; Schmalwieser, A; Szakmary-Brändle, K; Stessl, B; Wagner, M
2015-05-01
The aim of this study was to determine the prevalence of Listeria spp. and Listeria monocytogenes (L. monocytogenes) in urban public lavatories and on shoe soles of facility patrons in a European capital city. More than 91% of all municipal public lavatories in Vienna close to public hubs were included in this study. Overall, 373 swab samples of public lavatories and shoes of facility patrons were enriched, according to ISO 11290-1. Listeria monocytogenes isolates were subtyped using pulsed-field gel electrophoresis. A total of 24 samples were positive for Listeria spp., yielding an overall prevalence of 6.4% (24/373). Listeria monocytogenes was found in 2.1% (8/373) of all samples. Swabs from lavatories in parks, container lavatories and lavatories at markets had the highest prevalences of 20.7% (6/29), 20% (2/10) and 12.5% (1/8) Listeria spp., respectively. These detection rates were statistically significantly higher than those associated with lavatories in shopping centres (P = 0.003, P = 0.002, P = 0.02) and at public transport locations (P = 0.0004, P = 0.005, P = 0.02). Shoes sampled at Christmas markets showed the highest Listeria spp. and L. monocytogenes prevalences of 80% (4/5) and 40% (2/5), respectively. With regard to shoe type, Listeria spp. detection rates were 14.3% (3/21; winter boots), 13.3% (2/15; hiking boots), sport shoes (5.9%; 2/34) and brogues (5.1%; 4/79). No Listeria spp. were found on shoe soles that had smooth treads (0/76), while Listeria spp. were detected on 19.5% (8/41) of medium depth tread shoe types and on 9.4% (3/32) of deep tread shoes. These data suggest that soil environment is still one of the most important reservoirs for the foodborne pathogen L. monocytogenes. © 2014 Blackwell Verlag GmbH.
Directory of Open Access Journals (Sweden)
Xiang eWang
2015-10-01
Full Text Available Ground pork meat with natural microbiota and inoculated with low initial densities (1-10 or 10-100 CFU/g of Salmonella enterica or Listeria monocytogenes was stored under abusive temperature at 10°C and thermally treated by a simulated home pan-frying procedure. The growth and inactivation characteristics were also evaluated in broth. In ground pork meat, the population of S. enterica increased by less than one log after 12-days of storage at 10°C, whereas L. monocytogenes increased by 2.3 to 2.8 log units. No unusual intrinsic heat resistance of the pathogens was noted when tested in broth at 60°C although shoulders were observed on the inactivation curves of L. monocytogenes. After growth of S. enterica and L. monocytogenes at 10°C for 5 days to levels of 1.95 log CFU/g and 3.10 log CFU/g, respectively, in ground pork meat, their inactivation in the burger subjected to a simulated home pan-frying was studied. After thermal treatment S. enterica was undetectable but L. monocytogenes was recovered in three out of six of the 25 g burger samples. Overall, the present study shows that data on growth and inactivation of broths are indicative but may underestimate as well as overestimate behavior of pathogens and thus need confirmation in food matrix conditions to assess food safety in reasonably foreseen abusive conditions of storage and usual home pan-frying of of meat burgers in Belgium.
Sensitivity of Listeria monocytogenes to irradiation
International Nuclear Information System (INIS)
Tarjan, Veronika
1990-01-01
Irradiation of Listeria monocytogenes (L.m.) was carried out in culture media and pork meat paste at room temperature with 60 Co radiation source of 6.6 kGy h -1 dose rate. The employed doses were 0, 0.5, 1, 2, 3, 4 and 6 kGy. One strain out of 3 survived as high as 4 kGy irradiation. Radiation with 2 kGy resulted 7 log cycles reduction of cell count. After lower irradiation doses the L.m. count decreased in proportion to increasing doses. It has been concluded that L.m. compared with Gram-negative pathogens, are less sensitive to irradiation. (author) 6 refs.; 4 figs
Removal of Calcium from Scheelite Leaching Solution by Addition of CaSO4 Inoculating Crystals
Liu, Wenting; Li, Yongli; Zeng, Dewen; Li, Jiangtao; Zhao, Zhongwei
2018-04-01
In this work, the solubility behaviors of gypsum and anhydrite in the H2SO4-H3PO4-H2O system were investigated over the temperature range T = 30-80°C, and the results showed that the solubility of anhydrite was considerably lower than that of gypsum. On the basis of the differential solubilities of gypsum and anhydrite, a method was developed to remove calcium from the scheelite leaching solution by adding anhydrite as an inoculating crystal. The effects of the reaction time, concentration of the CaSO4 inoculating crystals, and temperature were investigated. With an addition of CaSO4 inoculating crystals at a concentration of 60 g/L, the Ca2+ concentration of the scheelite leaching solution decreased to a low level of approximately 0.76 g/L after 10 h at 70°C.
Exendin-4 improves resistance to Listeria monocytogenes infection in diabetic db/db mice
Liu, Hsien Yueh; Chung, Chih-Yao; Yang, Wen-Chin; Liang, Chih-Lung; Wang, Chi-Young; Chang, Chih-Yu; Chang, Cicero Lee-Tian
2012-01-01
The incidence of diabetes mellitus is increasing among companion animals. This disease has similar characteristics in both humans and animals. Diabetes is frequently identified as an independent risk factor for infections associated with increased mortality. In the present study, homozygous diabetic (db/db) mice were infected with Listeria (L.) monocytogenes and then treated with the anti-diabetic drug exendin-4, a glucagon-like peptide 1 analogue. In aged db/db mice, decreased CD11b+ macroph...
Effects of irradiation on bacterial load and Listeria monocytogenes in raw chicken
International Nuclear Information System (INIS)
Varabioff, Y.; Mitchell, G.E.; Nottingham, S.M.
1992-01-01
After irradiation of chickens to a dose of 2.5 kGy, the decrease in the standard plate count (SPC) was similar in air and in vacuum-packaged chickens. During storage at 4 degrees C for 15 d, the SPC increased progressively in both types of packaged chickens. At the end of the storage period, the SPC was higher in air-packaged chicken than in vacuum-packaged chickens. In irradiated chickens, Listeria monocytogenes was only recovered from the vacuum-packaged chickens after 7 d cold storage. In unirradiated chickens, L. monocytogenes proliferated similarly in both air- and vacuum-packaged chickens
Bento, Roberta A.; Stamford, Tânia L.M.; de Campos-Takaki, Galba M.; Stamford, Thayza C.M.; de Souza, Evandro L.
2009-01-01
Listeria monocytogenes is widely distributed in nature and the infection listeriosis is recognized as a potential threat for human health because of its mortality rate. The objective of this study was to evaluate the growth profile and chitosan production by Mucor rouxxi UCP 064 grown in yam bean (Pachyrhizus erosus L. Urban) medium. It was also to assess the anti-L. monocytogenes efficacy of the obtained chitosan. Higher values of biomass of M. rouxxi (16.9 g.L-1) and best yield of chitosan (62 mg.g-1) were found after 48 h of cultivation. Residual glucose and nitrogen in the growth media were 4.1 and 0.02 g.L-1 after 96 h, respectively. Obtained chitosan presented 85 % of degree of deacetylation and 2.60 x 104 g.mol-1 of viscosimetric molecular weight. Minimum Inhibitory Concentration (MIC) and Minimum Bactericidal Concentration (MBC) values of chitosan against L. monocytogenes ATCC 7644 were, respectively, 2.5 and 5.0 mg.mL-1. At 2.5 and 5.0 mg.mL-1 chitosan caused cidal effect in a maximum time of 4 h. Bacterial count below 2 log cfu.mL-1 were found from 2 h onwards and no recovery in bacterial growth was noted in the remainder period. These results show the biotechnological potential of yam bean medium for chitosan production by Mucor rouxxi and support the possible rational use of chitosan from fungi as natural antimicrobial to control L. monocytogenes. PMID:24031403
Cui, H Y; Wu, J; Lin, L
2016-08-01
Listeria monocytogenes infection in dairy products is of mounting public concern. To inhibit bacterial growth, we engineered stimuli-responsive liposomes containing lemongrass oil for this study. The controlled release of liposome-entrapped lemongrass oil is triggered by listerolysin O, secreted by L. monocytogenes. We investigated the antibiotic activities of lemongrass oil liposomes against L. monocytogenes in cheese. We also assessed their possible effects on the quality of the cheese. Liposomes containing lemongrass oil (5.0mg/mL) presented the optimal polydispersity index (0.246), zeta-potential (-58.9mV) and entrapment efficiency (25.7%). The liposomes displayed satisfactory antibiotic activity against L. monocytogenes in cheese over the storage period at 4°C. We observed no effects on the physical and sensory properties of the cheese after the liposome treatment. Copyright © 2016 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Monitoring paneer for Listeria monocytogenes - A high risk food ...
African Journals Online (AJOL)
A multiplex polymerase chain reaction (PCR) assay was developed and applied to spiked and natural paneer samples to detect Listeria monocytogenes, a high risk food pathogen. The sensitivity of the assay on L. monocytogenes spiked paneer samples was 104 cells prior to enrichment, was improved to 103 cells after 4 h ...
Occurrence and antimicrobial resistance patterns of Listeria monocytogenes isolated from vegetables
Directory of Open Access Journals (Sweden)
Vanessa de Vasconcelos Byrne
2016-06-01
Full Text Available Abstract Although the consumption of fresh and minimally processed vegetables is considered healthy, outbreaks related to the contamination of these products are frequently reported. Among the food-borne pathogens that contaminate vegetables is Listeria monocytogenes, a ubiquitous organism that exhibits the ability to survive and multiply at refrigerated temperatures. This study aimed to evaluate the occurrence of L. monocytogenes in vegetables as well as the antimicrobial resistance of isolates. The results showed that 3.03% of samples were contaminated with L. monocytogenes, comprising 2.22% of raw vegetables and 5.56% of ready-to-eat vegetables. Multiplex PCR confirmed the virulence potential of the isolates. Antimicrobial resistance profiling showed that 50% of the isolates were susceptible to the antibiotics used. The resistance of one isolate to penicillin G, a commonly employed therapeutic agent, and the presence of serotype 4b, a serotype commonly associated with food-borne outbreaks, could be potential health hazards for consumers.
Harrison, W A; Peters, A C; Fielding, L M
2000-01-01
The growth of Listeria monocytogenes and Yersinia enterocolitica colonies was studied on solid media at 4 and 8 degrees C under modified atmospheres (MAs) of 5% O2: 10% CO2: 85% N2 (MA1), 30% CO2: 70% N2 (MA2) and air (control). Colony radius, determined using computer image analysis, allowed specific growth rates (mu) and the time taken to detect bacterial colonies to be estimated, after colonies became visible. At 4 degrees C both MAs decreased the growth rates of L. monocytogenes by 1.5- and 3.0-fold under MA1 (mu = 0.02 h(-1)) and MA2 (mu = 0.01 h(-1)), respectively, as compared with the control (mu = 0.03 h(-1)). The time to detection of bacterial colonies was increased from 15 d (control) to 24 (MA1) and 29 d (MA2). At 8 degrees C MA2 decreased the growth rate by 1.5-fold (mu = 0.04 h(-1)) as compared with the control (mu = 0.06 h(-1)) and detection of colonies increased from 7 (control) to 9 d (MA2). At 4 degrees C both MAs decreased the growth rates of Y. enterocolitica by 1.5- and 2.5-fold under MA1 (mu = 0.03 h(-1)) and MA2 (mu = 0.02 h(-1)), respectively, as compared with the control (mu = 0.05 h(-1)). At 8 degrees C identical growth rates were obtained under MA1 and the control (mu = 0.07 h(-1)) whilst a decrease in the growth rate was obtained under MA2 (mu = 0.04 h(-1)). The detection of colonies varied from 6 (8 degrees C, aerobic) to 19 d (4 degrees C, MA2). Refrigerated modified atmosphere packaged foods should be maintained at 4 degrees C and below to ensure product safety.
A case of bovine raw milk contamination with Listeria monocytogenes
Directory of Open Access Journals (Sweden)
Hunt Karen
2012-07-01
Full Text Available Abstract During routine sampling of bulk raw milk on a dairy farm, the pathogenic bacteria Listeria monocytogenes was found to be a contaminant, at numbers L. monocytogenes, indicating a possible case of excretion of the L. monocytogenes directly into the milk. Milk samples were collected from the individual cows and analysed, resulting in the identification of L. monocytogenes excretion (at 280 cfu/ml from one of the 4 mammary quarters of one dairy cow out of 180. When the infected cow was isolated from the herd, no L. monocytogenes was detected from the remaining herd. The pulsed-field gel electrophoresis pattern of the strain from the individual cow was indistinguishable from that originally isolated from the bulk milk. The infected cow did not show any clinical signs of disease, nor did the appearance of the milk have any physical abnormalities. Antibiotic treatment of the infected mammary quarter was found to be ineffective. This study shows that there can be risks associated with direct contamination of raw milk with L. monocytogenes.
Iacumin, Lucilla; Manzano, Marisa; Comi, Giuseppe
2016-01-05
The anti-listerial activity of generally recognized as safe (GRAS) bacteriophage Listex P100 (phage P100) was demonstrated in broths and on the surface of slices of dry-cured ham against 5 strains or serotypes (i.e., Scott A, 1/2a, 1/2b, and 4b) of Listeria monocytogenes. In a broth model system, phage P100 at a concentration equal to or greater than 7 log PFU/mL completely inhibited 2 log CFU/cm² or 3 log CFU/cm² of L. monocytogenes growth at 30 °C. The temperature (4, 10, 20 °C) seemed to influence P100 activity; the best results were obtained at 4 °C. On dry-cured ham slices, a P100 concentration ranging from 5 to 8 log PFU/cm² was required to obtain a significant reduction in L. monocytogenes. At 4, 10, and 20 °C, an inoculum of 8 log PFU/cm² was required to completely eliminate 2 log L. monocytogenes/cm² and to reach the absence in 25 g product according to USA food law. Conversely, it was impossible to completely eradicate L. monocytogenes with an inoculum of approximately of 3.0 and 4.0 log CFU/cm² and with a P100 inoculum ranging from 1 to 7 log PFU/cm². P100 remained stable on dry-cured ham slices over a 14-day storage period, with only a marginal loss of 0.2 log PFU/cm² from an initial phage treatment of approximately 8 log PFU/cm². Moreover, phage P100 eliminated free L. monocytogenes cells and biofilms on the machinery surfaces used for dry-cured ham production. These findings demonstrate that the GRAS bacteriophage Listex P100 at level of 8 log PFU/cm² is listericidal and useful for reducing the L. monocytogenes concentration or eradicating the bacteria from dry-cured ham.
Directory of Open Access Journals (Sweden)
Lucilla Iacumin
2016-01-01
Full Text Available The anti-listerial activity of generally recognized as safe (GRAS bacteriophage Listex P100 (phage P100 was demonstrated in broths and on the surface of slices of dry-cured ham against 5 strains or serotypes (i.e., Scott A, 1/2a, 1/2b, and 4b of Listeria monocytogenes. In a broth model system, phage P100 at a concentration equal to or greater than 7 log PFU/mL completely inhibited 2 log CFU/cm2 or 3 log CFU/cm2 of L. monocytogenes growth at 30 °C. The temperature (4, 10, 20 °C seemed to influence P100 activity; the best results were obtained at 4 °C. On dry-cured ham slices, a P100 concentration ranging from 5 to 8 log PFU/cm2 was required to obtain a significant reduction in L. monocytogenes. At 4, 10, and 20 °C, an inoculum of 8 log PFU/cm2 was required to completely eliminate 2 log L. monocytogenes/cm2 and to reach the absence in 25 g product according to USA food law. Conversely, it was impossible to completely eradicate L. monocytogenes with an inoculum of approximately of 3.0 and 4.0 log CFU/cm2 and with a P100 inoculum ranging from 1 to 7 log PFU/cm2. P100 remained stable on dry-cured ham slices over a 14-day storage period, with only a marginal loss of 0.2 log PFU/cm2 from an initial phage treatment of approximately 8 log PFU/cm2. Moreover, phage P100 eliminated free L. monocytogenes cells and biofilms on the machinery surfaces used for dry-cured ham production. These findings demonstrate that the GRAS bacteriophage Listex P100 at level of 8 log PFU/cm2 is listericidal and useful for reducing the L. monocytogenes concentration or eradicating the bacteria from dry-cured ham.
Human illness due to the foodborne bacterial pathogen Listeria monocytogenes frequently involves certain widely disseminated clonal complexes (CCs), primarily of serotype 4b. CC1, CC2 and CC6, previously also designated epidemic clone (EC) I, Ia and II, respectively, have been frequently implicate...
Inhibition of sortase A by chalcone prevents Listeria monocytogenes infection.
Li, Hongen; Chen, Yutao; Zhang, Bing; Niu, Xiaodi; Song, Meng; Luo, Zhaoqing; Lu, Gejin; Liu, Bowen; Zhao, Xiaoran; Wang, Jianfeng; Deng, Xuming
2016-04-15
The critical role of sortase A in gram-positive bacterial pathogenicity makes this protein a good potential target for antimicrobial therapy. In this study, we report for the first time the crystal structure of Listeria monocytogenes sortase A and identify the active sites that mediate its transpeptidase activity. We also used a sortase A (SrtA) enzyme activity inhibition assay, simulation, and isothermal titration calorimetry analysis to discover that chalcone, an agent with little anti-L. monocytogenes activity, could significantly inhibit sortase A activity with an IC50 of 28.41 ± 5.34 μM by occupying the active site of SrtA. The addition of chalcone to a co-culture of L. monocytogenes and Caco-2 cells significantly inhibited bacterial entry into the cells and L. monocytogenes-mediated cytotoxicity. Additionally, chalcone treatment decreased the mortality of infected mice, the bacterial burden in target organs, and the pathological damage to L. monocytogenes-infected mice. In conclusion, these findings suggest that chalcone is a promising candidate for the development of treatment against L. monocytogenes infection. Copyright © 2016 Elsevier Inc. All rights reserved.
Incidence of Listeria monocytogenes and Listeria spp. in a small-scale mushroom production facility.
Viswanath, Prema; Murugesan, Latha; Knabel, Stephen J; Verghese, Bindhu; Chikthimmah, Naveen; Laborde, Luke F
2013-04-01
Listeria monocytogenes is a foodborne pathogen of significant concern to the agricultural and food processing industry because of its ability to grow and persist in cool and moist environments and its association with listeriosis, a disease with a very high mortality rate. Although there have been no listeriosis outbreaks attributed to fresh mushrooms in the United States, retail surveys and recalls are evidence that L. monocytogenes contamination of mushrooms (Agaricus bisporus) can occur. The objective of this study was to determine the prevalence of Listeria spp., including L. monocytogenes, in a small-scale mushroom production facility on the campus of the Pennsylvania State University in the United States. Of 184 samples taken from five production zones within the facility, 29 (15.8%) samples were positive for Listeria spp. Among the Listeria spp. isolates, L. innocua was most prevalent (10.3%) followed by L. welshimeri (3.3%), L. monocytogenes (1.6%), and L. grayi (0.5%). L. monocytogenes was recovered only from the phase I raw material composting area. Isolates of L. monocytogenes were confirmed and serotyped by multiplex PCR. The epidemiological relatedness of the three L. monocytogenes isolates to those serotypes or lineages frequently encountered in listeriosis infections was determined by multi-virulence-locus sequence typing using six virulence genes, namely, prfA, inlB, inlC, dal, clpP, and lisR. The phylogenetic positions of the three isolates in the dendrogram prepared with data from other isolates of L. monocytogenes showed that all isolates were grouped with serotype 4a, lineage IIIA. To date, this serotype has rarely been reported in foodborne disease outbreaks.
Seyoum, Eyasu Tigabu; Woldetsadik, Daniel Asrat; Mekonen, Tesfu Kassa; Gezahegn, Haile Alemayehu; Gebreyes, Wondwossen Abebe
2015-11-30
Listeria monocytogenes is of major significance in human and veterinary medicine. Most human Listeria infections are foodborne and the association of contaminated milk and dairy produce consumption with human listeriosis is noteworthy. In Ethiopia, there is limited data regarding the prevalence of L. monocytogenes in raw bovine milk and dairy products. The aim of this study was, therefore, to determine the prevalence of L. monocytogenes in raw bovine milk and dairy produce. A total of 443 milk and milk product samples were microbiologically analyzed following methods recommended by the U.S. Food and Drug Administration Bacteriological Analytical Manual to isolate Listeria spp. The overall prevalence of Listeria spp. was 28.4% and specifically that of L. monocytogenes was 5.6%. Taking the prevalence of Listeria spp. into consideration, cheese was found to be highly contaminated at 60%, followed by pasteurized milk samples (40%), raw milk (18.9%) and yoghurt (5%). Considering the prevalence of Listeria monocytogenes only, raw milk had the lowest contamination while cheese had the highest, followed by pasteurized milk and yoghurt. Raw milk and milk products produced in urban and peri-urban areas of central Ethiopia were contaminated with pathogenic bacteria, L. monocytogenes. The detection of this pathogen in raw milk and milk products warrants an urgent regulatory mechanism to be put in place and also the potential role of milk processing plants in the contamination of dairy products should be investigated.
Kim, Binna; Yun, Hyejeong; Jung, Samooel; Jung, Yeonkook; Jung, Heesoo; Choe, Wonho; Jo, Cheorun
2011-02-01
Atmospheric pressure plasma (APP) is an emerging non-thermal pasteurization method for the enhancement of food safety. In this study, the effect of APP on the inactivation of pathogens inoculated onto bacon was observed. Sliced bacon was inoculated with Listeria monocytogenes (KCTC 3596), Escherichia coli (KCTC 1682), and Salmonella Typhimurium (KCTC 1925). The samples were treated with APP at 75, 100, and 125 W of input power for 60 and 90 s. Two gases, helium (10 lpm) or a mixture of helium and oxygen, (10 lpm and 10 sccm, respectively) were used for the plasma generation. Plasma with helium could only reduce the number of inoculated pathogens by about 1-2 Log cycles. On the other hand, the helium/oxygen gas mixture was able to achieve microbial reduction of about 2-3 Log cycles. The number of total aerobic bacteria showed 1.89 and 4.58 decimal reductions after plasma treatment with helium and the helium/oxygen mixture, respectively. Microscopic observation of the bacon after plasma treatment did not find any significant changes, except that the L∗-value of the bacon surface was increased. These results clearly indicate that APP treatment is effective for the inactivation of the three pathogens used in this study, although further investigation is needed for elucidating quality changes after treatment. Copyright © 2010 Elsevier Ltd. All rights reserved.
International Nuclear Information System (INIS)
Turgis, Mélanie; Stotz, Viviane; Dupont, Claude; Salmieri, Stéphane; Khan, Ruhul A.; Lacroix, Monique
2012-01-01
Two new bacteria were isolated from human feces and were designated MT 104 and MT 162. They were able to produce bacteriocins that are active against five strains of Listeria monocytogenes. Bacteriocins produced by these isolated strains had 100% and 82.35% residual activity when they were treated by gamma radiation at doses of 4 and 40 kGy, respectively. A reduction of 1.0, 1.5 and 3 log CFU/g of L. monocytogenes was observed in sausage meat when treated with bacteriocins from MT 104, MT 162, and nisin, respectively. For synergic effect, the D 10 value in presence of the bacteriocins produced by MT 104 showed a 1.08 fold increased relative sensitivity of L. monocytogenes as compared to control after 5 days. The highest synergic effect was observed in presence of nisin which led to 1.61 fold increased relative sensitivity. Combined treatments with nisin and γ-irradiation showed a synergic antimicrobial effect in meat after 24 h and 5 days of storage. A synergic effect was observed only after 5 days at 4 °C for the bacteriocin from MT 104, as compared to the bacteriocin produced by MT 162 that had only an additive antimicrobial effect in all conditions.
Turgis, Mélanie; Stotz, Viviane; Dupont, Claude; Salmieri, Stéphane; Khan, Ruhul A.; Lacroix, Monique
2012-08-01
Two new bacteria were isolated from human feces and were designated MT 104 and MT 162. They were able to produce bacteriocins that are active against five strains of Listeria monocytogenes. Bacteriocins produced by these isolated strains had 100% and 82.35% residual activity when they were treated by gamma radiation at doses of 4 and 40 kGy, respectively. A reduction of 1.0, 1.5 and 3 log CFU/g of L. monocytogenes was observed in sausage meat when treated with bacteriocins from MT 104, MT 162, and nisin, respectively. For synergic effect, the D10 value in presence of the bacteriocins produced by MT 104 showed a 1.08 fold increased relative sensitivity of L. monocytogenes as compared to control after 5 days. The highest synergic effect was observed in presence of nisin which led to 1.61 fold increased relative sensitivity. Combined treatments with nisin and γ-irradiation showed a synergic antimicrobial effect in meat after 24 h and 5 days of storage. A synergic effect was observed only after 5 days at 4 °C for the bacteriocin from MT 104, as compared to the bacteriocin produced by MT 162 that had only an additive antimicrobial effect in all conditions.
Gabriel, Alonzo A; Ostonal, Jeffrey M; Cristobal, Jannelle O; Pagal, Gladess A; Armada, John Vincent E
2018-07-20
This study determined the inactivation kinetic parameters of selected pathogens in heat, ultraviolet-C and combined heat-UV-C treated coconut liquid endosperm. Separate cocktails of Escherichia coli O157:H7, Salmonella enterica serovars, and Listeria monocytogenes strains were inoculated into coconut liquid endosperm (pH 5.15, TSS 4.4 o Bx, TA 0.062% malic acid, extinction coefficient (ε) at 254 nm of 0.0154 cm -1 ) for inactivation studies. Result showed that all organisms generally exhibited a log-linear heat inactivation behavior (R 2 0.81-0.99). The E. coli O157:H7 cocktail (D 55 = 19.75 min, D 57 = 10.79 min, D 60 = 3.38 min, and D 63 = 0.46 min) was found to be significantly more resistant (P > 0.05) than the tested cocktail of L. monocytogenes (D 55 = 11.68 min, D 57 = 4.53 min, D 60 = 1.82 min and D 63 = 0.26 min) and S. enterica cocktail (D 55 = 3.08 min, D 57 = 2.60 min, D 60 = 0.89 min and D 63 = 0.25 min). Despite the differences in D T values, computed z values for L. monocytogenes cocktail (5.12 ± 0.43 °C) and E. coli O157:H7 cocktail (4.95 ± 0.12 °C) were not significantly different (P > 0.05), but were both significantly (P C). All test organisms also exhibited a generally log-linear UV-C inactivation behavior (R 2 0.90-0.99) with E. coli O157:H7 cocktail (D UV-C = 25.26 mJ/cm 2 ) demonstrating greatest resistance to UV-C than S. enterica (D UV-C = 24.65 mJ/cm 2 ) and L. monocytogenes (D UV-C = 17.30 mJ/cm 2 ) cocktails. The D 55 values of each organism cocktail were used to calculate for the 3-log reduction heating process schedules, during which UV-C treatments were simultaneously applied. Lethal rates (F values) calculations in the combined processes revealed that within the 3-log reduction heating processes, co-exposure of UV-C resulted in 5.62 to 6.20 log reductions in the test organism populations. Heating
Jadhav, Snehal; Sevior, Danielle; Bhave, Mrinal; Palombo, Enzo A
2014-01-31
Conventional methods used for primary detection of Listeria monocytogenes from foods and subsequent confirmation of presumptive positive samples involve prolonged incubation and biochemical testing which generally require four to five days to obtain a result. In the current study, a simple and rapid proteomics-based MALDI-TOF MS approach was developed to detect L. monocytogenes directly from selective enrichment broths. Milk samples spiked with single species and multiple species cultures were incubated in a selective enrichment broth for 24h, followed by an additional 6h secondary enrichment. As few as 1 colony-forming unit (cfu) of L. monocytogenes per mL of initial selective broth culture could be detected within 30h. On applying the same approach to solid foods previously implicated in listeriosis, namely chicken pâté, cantaloupe and Camembert cheese, detection was achieved within the same time interval at inoculation levels of 10cfu/mL. Unlike the routine application of MALDI-TOF MS for identification of bacteria from solid media, this study proposes a cost-effective and time-saving detection scheme for direct identification of L. monocytogenes from broth cultures.This article is part of a Special Issue entitled: Trends in Microbial Proteomics. Globally, foodborne diseases are major causes of illness and fatalities in humans. Hence, there is a continual need for reliable and rapid means for pathogen detection from food samples. Recent applications of MALDI-TOF MS for diagnostic microbiology focused on detection of microbes from clinical specimens. However, the current study has emphasized its use as a tool for detecting the major foodborne pathogen, Listeria monocytogenes, directly from selective enrichment broths. This proof-of-concept study proposes a detection scheme that is more rapid and simple compared to conventional methods of Listeria detection. Very low levels of the pathogen could be identified from different food samples post-enrichment in
Frequency of contamination Listeria monocytogenes of raw dried cured vacuum packed sausages
Directory of Open Access Journals (Sweden)
Hristo Daskalov
2014-03-01
Full Text Available The aim of this study was to collect actual data concerning the frequency of contamination with Listeria monocytogenes of some very popular in Bulgaria raw dried cured vacuum packed sausages, produced from October 2004 till May 2008. 148 vacuum-packed samples were taken from 9 different food business operators during all seasons of the year. The samples were analyzed according to USDA method for meat foods. Ten specimens were positive for presence of Listeria monocytogenes equal to 6,75% of all tested samples. In two other raw dried cured sausages L.welshimeri and L.innocua were found, but these species are not pathogenic for consumers. In the period before the official implementation of HACCP system (01.01.2006 in Bulgaria, 52 samples were examined and 5 Listeria monocytogenes isolates were found (~10%. 2,5 years after the HACCP implementation, 96 specimens from the same meat factories were tested and 5 Listeria monocytogenes isolates (5,2% were detected. Samples taken from lots, produced in winter time were contaminated with Listeria monocytogenes more often (7 of all 10 than specimens taken during other seasons. Data were discussed through the point of view of the effectiveness of hygienic practices and HACCP system application. Also, application of ‘microbiological criterion’ set in COMMISSION REGULATION (EC No 2073/2005 for ready-to-eat foods unable to support the growth of L. monocytogenes was considered.
Performance of Isfahan North Wastewater Treatment Plant in the Removal of Listeria monocytogenes
Directory of Open Access Journals (Sweden)
nahid Navijouy
2013-08-01
Full Text Available Listeria and in particular Listeria monocytogenes is considered a ubiquitous foodborne pathogen which can lead listeriosis in human and animals. Listeriosis can be serious and may cause meningitis, septicemia and abortion in pregnant women. Although wastewater or sludge may contaminate foods of plant origin, there are no data on occurrence of Listeria spp. in wastewater and sludge in Iran. The purpose of current investigation was to study the occurrence of Listeria spp. in various samples of wastewater and sludge in Isfahan North wastewater treatment plant. Influent, effluent, raw sludge and dried sludge samples were collected from Isfahan North municipal wastewater treatment plant. L. monocytogenes were enumerated by a three–tube most probable number (MPN assay using enrichment Fraser broth. A total of 65 various samples from five step in 13 visits were collected. The presence of Listeria spp. also was determined using USDA procedure. Then, phenotypically identified L. monocytogenes were further confirmed by Polymerase Chain Reaction amplification. L. monocytogenes isolated from 76.9%, 38.5%, 84.6%, 69.2% and 46.2% of influent, effluent, raw sludge, stabilized sludge and dried sludge respectively. The efficiency of wastewater treatment processes, digester tank and drying bed in removal L. monocytogenes were 69.6%, 64.7% and 73.4% respectively. All phenotypically identified L. monocytogenes were further confirmed by Polymerase Chain Reaction. The results of present study have shown that Listeriaspp. and L. monocytogenes in particular, were present in wastewater treatment plant effluents and sludge at high level. The bacteria may spread on agriculture land and contaminate foods of plant origin. This may cause a risk of spreading disease to human and animals.
Directory of Open Access Journals (Sweden)
Catherine E Jobbings
Full Text Available Whilst mast cells participate in the immune defence against the intracellular bacterium Listeria monocytogenes, there is conflicting evidence regarding the ability of L. monocytogenes to infect mast cells. It is known that the pore-forming toxin listeriolysin (LLO is important for mast cell activation, degranulation and the release of pro-inflammatory cytokines. Mast cells, however, are a potential source of a wide range of cytokines, chemokines and other mediators including osteopontin, which contributes to the clearing of L. monocytogenes infections in vivo, although its source is unknown. We therefore aimed to resolve the controversy of mast cell infection by L. monocytogenes and investigated the extent of mediator release in response to the bacterium. In this paper we show that the infection of bone marrow-derived mast cells by L. monocytogenes is inefficient and LLO-independent. LLO, however, is required for calcium-independent mast cell degranulation as well as for the transient and selective downregulation of cell surface CD117 (c-kit on mast cells. We demonstrate that in addition to the key pro-inflammatory cytokines TNF-α and IL-6, mast cells release a wide range of other mediators in response to L. monocytogenes. Osteopontin, IL-2, IL-4, IL-13 and granulocyte macrophage colony-stimulating factor (GM-CSF, and chemokines including CCL2, CCL3, CCL4 and CCL5 are released in a MyD88-dependent manner. The wide range of mediators released by mast cells in response to L. monocytogenes may play an important role in the recruitment and activation of a variety of immune cells in vivo. The cocktail of mediators, however, is unlikely to skew the immune response to a particular effector response. We propose that mast cells provide a hitherto unreported source of osteopontin, and may provide an important role in co-ordinating the immune response during Listeria infection.
Modeling the growth of Listeria monocytogenes in soft blue-white cheese
DEFF Research Database (Denmark)
Rosshaug, Per Sand; Detmer, Ann; Ingmer, Hanne
2012-01-01
The aim of this study was to develop a predictive model simulating growth over time of the pathogenic bacterium Listeria monocytogenes in a soft blue-white cheese. The physicochemical properties in a matrix such as cheese are essential controlling factors influencing the growth of L. monocytogenes....... We developed a predictive tertiary model of the bacterial growth of L. monocytogenes as a function of temperature, pH, NaCl, and lactic acid. We measured the variations over time of the physicochemical properties in the cheese. Our predictive model was developed based on broth data produced...... production and retail conditions showed that the number of L. monocytogenes cells increases 3 to 3.5 log within the shelf life of the cheese....
Gougouli, M; Angelidis, A S; Koutsoumanis, K
2008-02-01
The kinetic behavior of Listeria monocytogenes in 2 commercial ice cream products (A and B) that were inoculated and stored under static chilling (4 to 16 degrees C), static freezing (-5 to -33 degrees C), dynamic chilling, and dynamic chilling-freezing conditions was studied, simulating conditions of the aging process and of normal or abuse conditions during distribution and storage. The ice cream products A and B had different compositions but similar pH (6.50 and 6.67, respectively) and water activity (0.957 and 0.965, respectively) values. For both chilling and freezing conditions, the kinetic behavior of the pathogen was similar in the 2 products, indicating that the pH and water activity, together with temperature, were the main factors controlling growth. Under chilling conditions, L. monocytogenes grew well at all temperatures tested. Under freezing conditions, no significant changes in the population of the pathogen were observed throughout a 90-d storage period for either of the inoculum levels tested (10(3) and 10(6) cfu/g). Growth data from chilled storage conditions were fitted to a mathematical model, and the calculated maximum specific growth rate was modeled as a function of temperature by using a square root model. The model was further validated under dynamic chilling and dynamic chilling-freezing conditions by using 4 different storage temperature scenarios. Under dynamic chilling conditions, the model accurately predicted the growth of the pathogen in both products, with 99.5% of the predictions lying within the +/- 20% relative error zone. The results from the chilling-freezing storage experiments showed that the pathogen was able to initiate growth within a very short time after a temperature upshift from freezing to chilling temperatures. This indicates that the freezing conditions did not cause a severe stress in L. monocytogenes cells capable of leading to a significant "additional" lag phase during the subsequent growth of the pathogen at
Yang, S E; Chou, C C
2000-07-01
Growth and survival of Escherichia coli O157:H7 and Listeria monocytogenes in steamed eggs and scrambled eggs held at different temperatures (5, 18, 22, 37, 55, and 60 degrees C) were investigated in the present study. Among the holding temperatures tested, both pathogens multiplied best at 37 degrees C followed by 22, 18, and 5 degrees C. In general, E. coli O157:H7 grew better in the egg products than L. monocytogenes did at all the storage temperatures tested except at 5 degrees C. E. coli O157:H7 did not grow in steamed eggs and scrambled eggs held at 5 degrees C. L. monocytogenes showed a slight population increase of approximately 0.6 to 0.9 log CFU/g in these egg products at the end of the 36-h storage period at 5 degrees C. The population of both pathogens detected in the egg products was affected by the initial population, holding temperature, and length of the holding period. It was also noted that L. monocytogenes was more susceptible than E. coli O157:H7 in steamed eggs held at 60 degrees C. After holding at 60 degrees C for 1 h, no detectable viable cells of L. monocytogenes with a population reduction of 5.4 log CFU/g was observed in steamed eggs, whereas a lower population reduction of only approximately 0.5 log CFU/ml was noted for E. coli O157:H7.
Occurrence and antimicrobial resistance patterns of Listeria monocytogenes isolated from vegetables.
de Vasconcelos Byrne, Vanessa; Hofer, Ernesto; Vallim, Deyse Christina; de Castro Almeida, Rogeria Comastri
2016-01-01
Although the consumption of fresh and minimally processed vegetables is considered healthy, outbreaks related to the contamination of these products are frequently reported. Among the food-borne pathogens that contaminate vegetables is Listeria monocytogenes, a ubiquitous organism that exhibits the ability to survive and multiply at refrigerated temperatures. This study aimed to evaluate the occurrence of L. monocytogenes in vegetables as well as the antimicrobial resistance of isolates. The results showed that 3.03% of samples were contaminated with L. monocytogenes, comprising 2.22% of raw vegetables and 5.56% of ready-to-eat vegetables. Multiplex PCR confirmed the virulence potential of the isolates. Antimicrobial resistance profiling showed that 50% of the isolates were susceptible to the antibiotics used. The resistance of one isolate to penicillin G, a commonly employed therapeutic agent, and the presence of serotype 4b, a serotype commonly associated with food-borne outbreaks, could be potential health hazards for consumers. Copyright © 2016 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.
Jeong, Seul-Gi; Kang, Dong-Hyun
2017-06-01
This study was conducted to investigate the efficacy of gamma and electron beam irradiation to inactivate foodborne pathogens in ready-to-bake cookie dough and to determine the effect on quality by measuring color and texture changes. Cookie dough inoculated with Escherichia coli O157:H7, Salmonella Typhimurium, or Listeria monocytogenes was subjected to gamma and electron beam irradiation, with doses ranging from 0 to 3 kGy. As the radiation dose increased, the inactivation effect increased among all tested pathogens. After 3.0 kGy of gamma and electron beam irradiation, numbers of inoculated pathogens were reduced to below the detection limit (1 log CFU/g). The D 10 -values of E. coli O157:H7, S. Typhimurium, and L. monocytogenes in cookie dough treated with gamma rays were 0.53, 0.51, and 0.71 kGy, respectively, which were similar to those treated by electron beam with the same dose. Based on the D 10 -value of pathogens in cookie dough, L. monocytogenes showed more resistance to both treatments than did E. coli O157:H7 and S. Typhimurium. Color values and textural characteristics of irradiated cookie dough were not significantly (P > 0.05) different from the control. These results suggest that irradiation can be applied to control pathogens in ready-to-bake cookie dough products without affecting quality. Copyright © 2016 Elsevier Ltd. All rights reserved.
Cossu, Francesca; Spanu, Carlo; Deidda, Silvia; Mura, Erica; Casti, Daniele; Pala, Carlo; Lamon, Sonia; Spanu, Vincenzo; Ibba, Michela; Marrocu, Elena; Scarano, Christian; Piana, Andrea; De Santis, Enrico Pietro Luigi
2016-04-19
Ready-to-eat (RTE) food is characterised by a long shelf-life at refrigerated temperature and can be consumed as such, without any treatment. The aim of the work was to evaluate the presence of Listeria spp. and Listeria monocytogenes in RTEs collected from refrigerated vending machines placed in hospital environment and accessible to the hospitalised patients. In 4 different sampling, 55 RTEs were collected from vending machines of six hospitals located in different areas of Sardinia region. All the samples were characterised by similar manufacturing process, such as the use of modified atmosphere packaging and belonged to 5 different producers. Listeria spp. was not countable using the enumeration method in all of the analysed samples. Using the detection method, Listeria spp. was recovered from 9 sandwich samples. Interestingly, 3 of these samples (5.5%) made by the manufacturer, were positive for L. monocytogenes contamination. The risk related to the L. monocytogenes presence in RTEs proportionally increases when food is introduced in susceptible environments , such as hospitals and consumed by susceptible people . Although the RTEs analysed showed values that complied with the European microbiological criteria for foodstuffs, the availability of these products in a susceptible environment should be carefully checked. Therefore, in order to limit the possible exposition to L. monocytogenes , more information on the risk related to RTE consumption should be provided to the hospitalised patients.
Directory of Open Access Journals (Sweden)
Francesca Cossu
2016-05-01
Full Text Available Ready-to-eat (RTE food is characterised by a long shelf-life at refrigerated temperature and can be consumed as such, without any treatment. The aim of the work was to evaluate the presence of Listeria spp. and Listeria monocytogenes in RTEs collected from refrigerated vending machines placed in hospital environment and accessible to the hospitalised patients. In 4 different sampling, 55 RTEs were collected from vending machines of six hospitals located in different areas of Sardinia region. All the samples were characterised by similar manufacturing process, such as the use of modified atmosphere packaging and belonged to 5 different producers. Listeria spp. was not countable using the enumeration method in all of the analysed samples. Using the detection method, Listeria spp. was recovered from 9 sandwich samples. Interestingly, 3 of these samples (5.5% made by the manufacturer, were positive for L. monocytogenes contamination. The risk related to the L. monocytogenes presence in RTEs proportionally increases when food is introduced in susceptible environments, such as hospitals and consumed by susceptible people. Although the RTEs analysed showed values that complied with the European microbiological criteria for foodstuffs, the availability of these products in a susceptible environment should be carefully checked. Therefore, in order to limit the possible exposition to L. monocytogenes, more information on the risk related to RTE consumption should be provided to the hospitalised patients.
Directory of Open Access Journals (Sweden)
Ok Kyung Koo
Full Text Available BACKGROUND: Listeria monocytogenes, an intracellular foodborne pathogen, infects immunocompromised hosts. The primary route of transmission is through contaminated food. In the gastrointestinal tract, it traverses the epithelial barrier through intracellular or paracellular routes. Strategies to prevent L. monocytogenes entry can potentially minimize infection in high-risk populations. Listeria adhesion protein (LAP aids L. monocytogenes in crossing epithelial barriers via the paracellular route. The use of recombinant probiotic bacteria expressing LAP would aid targeted clearance of Listeria from the gut and protect high-risk populations from infection. METHODOLOGY/PRINCIPAL FINDINGS: The objective was to investigate the ability of probiotic bacteria or LAP-expressing recombinant probiotic Lactobacillus paracasei (Lbp(LAP to prevent L. monocytogenes adhesion, invasion, and transwell-based transepithelial translocation in a Caco-2 cell culture model. Several wild type probiotic bacteria showed strong adhesion to Caco-2 cells but none effectively prevented L. monocytogenes infection. Pre-exposure to Lbp(LAP for 1, 4, 15, or 24 h significantly (P<0.05 reduced adhesion, invasion, and transepithelial translocation of L. monocytogenes in Caco-2 cells, whereas pre-exposure to parental Lb. paracasei had no significant effect. Similarly, Lbp(LAP pre-exposure reduced L. monocytogenes translocation by as much as 46% after 24 h. Lbp(LAP also prevented L. monocytogenes-mediated cell damage and compromise of tight junction integrity. Furthermore, Lbp(LAP cells reduced L. monocytogenes-mediated cell cytotoxicity by 99.8% after 1 h and 79% after 24 h. CONCLUSIONS/SIGNIFICANCE: Wild type probiotic bacteria were unable to prevent L. monocytogenes infection in vitro. In contrast, Lbp(LAP blocked adhesion, invasion, and translocation of L. monocytogenes by interacting with host cell receptor Hsp60, thereby protecting cells from infection. These data show promise
Co-inoculation of Azospirillum brasilense and Herbaspirillum seropedicae in maize
Directory of Open Access Journals (Sweden)
Janaína Dartora
2016-06-01
Full Text Available ABSTRACT Bacteria from the genera Azospirillum and Herbaspirillum have been associated with increments in maize yield. The aim of this study was to evaluate the maize yield and nutritional content in response to inoculation with A. brasilense and H. seropediceae in association with nitrogen (N fertilization. The experimental design was randomized blocks in a 4 x 5 factorial scheme, with four replicates. The treatments consisted of seed inoculation (control without N and inoculation, A. brasilense strain - AbV5, H. seropediceae strain - SMR1 and co-inoculation AbV5 + SMR1 and N doses (0, 40, 80, 120 and 160 kg ha-1. The following variables were evaluated: ear insertion height, ear length, ear diameter, number of rows per ear, number of grains per row, ear weight, yield and NPK contents in leaves and grains. There was no interaction between the factors studied. Co-inoculation with the strains promoted increments of 12% in leaf P content, compared with control, and N fertilization promoted increase in yield and leaf P content up to the maximum dose studied.
Chen, Grischa Y; McDougal, Courtney E; D'Antonio, Marc A; Portman, Jonathan L; Sauer, John-Demian
2017-03-21
Through unknown mechanisms, the host cytosol restricts bacterial colonization; therefore, only professional cytosolic pathogens are adapted to colonize this host environment. Listeria monocytogenes is a Gram-positive intracellular pathogen that is highly adapted to colonize the cytosol of both phagocytic and nonphagocytic cells. To identify L. monocytogenes determinants of cytosolic survival, we designed and executed a novel screen to isolate L. monocytogenes mutants with cytosolic survival defects. Multiple mutants identified in the screen were defective for synthesis of menaquinone (MK), an essential molecule in the electron transport chain. Analysis of an extensive set of MK biosynthesis and respiratory chain mutants revealed that cellular respiration was not required for cytosolic survival of L. monocytogenes but that, instead, synthesis of 1,4-dihydroxy-2-naphthoate (DHNA), an MK biosynthesis intermediate, was essential. Recent discoveries showed that modulation of the central metabolism of both host and pathogen can influence the outcome of host-pathogen interactions. Our results identify a potentially novel function of the MK biosynthetic intermediate DHNA and specifically highlight how L. monocytogenes metabolic adaptations promote cytosolic survival and evasion of host immunity. IMPORTANCE Cytosolic bacterial pathogens, such as Listeria monocytogenes and Francisella tularensis , are exquisitely evolved to colonize the host cytosol in a variety of cell types. Establishing an intracellular niche shields these pathogens from effectors of humoral immunity, grants access to host nutrients, and is essential for pathogenesis. Through yet-to-be-defined mechanisms, the host cytosol restricts replication of non-cytosol-adapted bacteria, likely through a combination of cell autonomous defenses (CADs) and nutritional immunity. Utilizing a novel genetic screen, we identified determinants of L. monocytogenes cytosolic survival and virulence and identified a role
Chen, Jianshun; Fang, Chun; Zheng, Tianlun; Zhu, Ningyu; Bei, Yijiang; Fang, Weihuan
2012-02-01
The ability to survive and proliferate in acidic environments is a prerequisite for the infection of Listeria monocytogenes. The glutamate decarboxylase (GAD) system is responsible for acid resistance, and three GAD homologs have been identified in L. monocytogenes: gadD1, gadD2, and gadD3. To examine whether GAD genes are specific to lineage, serovar, or certain subpopulation, we performed a systematic investigation on the prevalence of GAD genes in 164 L. monocytogenes. In contrast to gadD2 and gadD3 conserved in all L. monocytogenes strains, gadD1 was identified in 36.6% (60/164) of L. monocytogenes strains, including all serovar 1/2c and 68.5% (37/54) of serovar 1/2a strains, as well as a small fraction of serovar 1/2b (3.4%, 1/29) and lineage III (13.8%, 4/29) strains. All serovar 4b and lineage IV strains lacked this gene. According to the ascB-dapE structure, L. monocytogenes strains were classified into four subpopulations, carrying inlC2DE, inlGC2DE, inlGHE, or no internalin cluster, respectively. All L. monocytogenes strains with inlGC2DE or inlGHE pattern harbored gadD1, whereas those bearing inlC2DE or no internalin cluster between ascB and dapE lacked gadD1. In addition, other five non-monocytogenes Listeria species lacking ascB-dapE internalin cluster were gadD1-negative. Overall, the presence of gadD1 is not fully dependent on lineages or serovars but correlates with ascB-dapE internalin profiles, suggesting gadD1 might have co-evolved with the ascB-dapE internalin cluster in the primitive L. monocytogenes before divergence of serovars.
DEFF Research Database (Denmark)
Jiang, Lingli; Olesen, Inger; Andersen, Thomas
2010-01-01
-related genes after exposure to the conditions similar to those encountered in the mouth, stomach, and small intestine. None of the L. monocytogenes strains investigated could survive in the gastric juice at pH 2.5 or 3.0. Their survival increased at higher pH (3.5 and 4.0) in the gastric stress. Relative...... afterpassing through the simulated gastrointestinal tract, whereas that of the adhesion-related gene ami was downregulated. Taken together, this study revealed that L. monocytogenes strains enhanced the expression of stressrelated genes and decreased the transcription of adhesion-related gene in order...
2012-01-01
Background Immunomagnetic separation (IMS) and immunoassays are widely used for pathogen detection. However, novel technology platforms with highly selective antibodies are essential to improve detection sensitivity, specificity and performance. In this study, monoclonal antibodies (MAbs) against Internalin A (InlA) and p30 were generated and used on paramagnetic beads of varying diameters for concentration, as well as on fiber-optic sensor for detection. Results Anti-InlA MAb-2D12 (IgG2a subclass) was specific for Listeria monocytogenes and L. ivanovii, and p30-specific MAb-3F8 (IgM) was specific for the genus Listeria. At all bacterial concentrations (103–108 CFU/mL) tested in the IMS assay; the 1-μm diameter MyOne beads had significantly higher capture efficiency (P Listeria antibody (9 %). Furthermore, capture efficiency for MyOne-2D12 was highly specific for L. monocytogenes and L. ivanovii. Subsequently, we captured L. monocytogenes by MyOne-2D12 and MyOne-3F8 from hotdogs inoculated with mono- or co-cultures of L. monocytogenes and L. innocua (10–40 CFU/g), enriched for 18 h and detected by fiber-optic sensor and confirmed by plating, light-scattering, and qPCR assays. The detection limit for L. monocytogenes and L. ivanovii by the fiber-optic immunosensor was 3 × 102 CFU/mL using MAb-2D12 as capture and reporter antibody. Selective media plating, light-scattering, and qPCR assays confirmed the IMS and fiber-optic results. Conclusions IMS coupled with a fiber-optic sensor using anti-InlA MAb is highly specific for L. monocytogenes and L. ivanovii and enabled detection of these pathogens at low levels from buffer or food. PMID:23176167
Directory of Open Access Journals (Sweden)
Atefeh Taherkhani
2013-01-01
Full Text Available Aims: The objective of this study was to evaluate the prevalence of Listeria spp. in the river water before and after discharge of the effluent of the municipal wastewater treatment plant (WWTP in Isfahan, Iran. Materials and Methods: A total of 66 samples were collected bi-weekly over 4 months from eleven discrete sampling locations in Zayandehrood River, Iran. Three sampling sites were located above the discharge point and five sites were located after the discharge point of WWTP. Samples were also collected from the influent and the effluent of WWTP. Listeria spp. were isolated using a selective enrichment procedure and a subculture onto polymyxin-acriflavine-lithium chloride-ceftazidime-esculin-mannitol Agar. All isolates were subjected to standard biochemical tests. Results: L. monocytogenes was isolated from influent (83%, effluent (50% and (18.5% river water. Listeria spp. was not found before the discharge point in river water. However, L. monocytogenes was isolated in samples collected from 200 m (33%, 500 m (33%, 2 km (16.5%, 5 km (16.5% and 10 km (16.5% downstream from the WWTP. Listeria innocua (9% and Listeria seeligeri (10% were the second most frequently isolated species. Conclusion: During the wastewater treatment, Listeria spp. is not removed completely. L. monocytogenes is widely distributed in the Zayandehrood river. L. monocytogenes released into surface water demonstrates a potential risk for public health. These results indicate the need for appropriate water management in order to reduce human and animal exposure to such pathogens.
Uyttendaele, M; Busschaert, P; Valero, A; Geeraerd, A H; Vermeulen, A; Jacxsens, L; Goh, K K; De Loy, A; Van Impe, J F; Devlieghere, F
2009-07-31
Processed ready-to-eat (RTE) foods with a prolonged shelf-life under refrigeration are at risk products for listeriosis. This manuscript provides an overview of prevalence data (n=1974) and challenge tests (n=299) related to Listeria monocytogenes for three categories of RTE food i) mayonnaise-based deli-salads (1187 presence/absence tests and 182 challenge tests), ii) cooked meat products (639 presence/absence tests and 92 challenge tests), and iii) smoked fish (90 presence/absence tests and 25 challenge tests), based on data records obtained from various food business operators in Belgium in the frame of the validation and verification of their HACCP plans over the period 2005-2007. Overall, the prevalence of L. monocytogenes in these RTE foods in the present study was lower compared to former studies in Belgium. For mayonnaise-based deli-salads, in 80 out of 1187 samples (6.7%) the pathogen was detected in 25 g. L. monocytogenes positive samples were often associated with smoked fish deli-salads. Cooked meat products showed a 1.1% (n=639) prevalence of the pathogen. For both food categories, numbers per gram never exceeded 100 CFU. L. monocytogenes was detected in 27.8% (25/90) smoked fish samples, while 4/25 positive samples failed to comply to the 100 CFU/g limit set out in EU Regulation 2073/2005. Challenge testing showed growth potential in 18/182 (9.9%) deli-salads and 61/92 (66%) cooked meat products. Nevertheless, both for deli-salads and cooked meat products, appropriate product formulation and storage conditions based upon hurdle technology could guarantee no growth of L. monocytogenes throughout the shelf-life as specified by the food business operator. Challenge testing of smoked fish showed growth of L. monocytogenes in 12/25 samples stored for 3-4 weeks at 4 degrees C. Of 45 (non-inoculated) smoked fish samples (13 of which were initially positive in 25 g) which were subjected to shelf-life testing, numbers exceeded 100 CFU/g in only one sample
Prevalence of Listeria monocytogenes in poultry meat
Directory of Open Access Journals (Sweden)
Mehmet ELMALI
2015-01-01
Full Text Available AbstractThe objectives of this study were i to isolate Listeria spp. and Listeria monocytogenes in broiler wing meat samples, ii to confirm the isolates by PCR, based on prs and hly A gene sequences, iii to determine the seasonal and monthly distribution of the isolates. A total of 120 broiler wing meat samples (60 packaged pieces wrapped using strech film in styrofoam plates and 60 unpackaged pieces bought from different markets in Hatay province were analysed. Listeria spp. was isolated from 57 (47.5% out of 120 samples. Fifty-four, out of 57 Listeria spp. isolates were identified as L. monocytogenes. L. monocytogenes was isolated from the samples collected during the spring, winter, summer, and autumn at the levels of 26.6%, 40%, 53.3%, 60%, respectively. In this study, the isolation rates were found to be the highest in autumn, while the isolation rates were found to be the lowest in spring. As a consequence, high prevalence of Listeria spp. and L. monocytogenes in poultry wing meat samples may pose a risk for human health. We consider that with obeying the rules of good hygiene practices (GHP, good manufacturing practices (GMP and HACCP can minimize the contamination with Listeria spp.
Jamali, Hossein; Paydar, Mohammadjavad; Ismail, Salmah; Looi, Chung Yeng; Wong, Won Fen; Radmehr, Behrad; Abedini, Atefeh
2015-07-25
The aim of this study was to investigate the prevalence and characterization of Listeria species and Listeria monocytogenes isolated from raw fish and open-air fish market environments. Eight hundred and sixty two samples including raw fish and fish market environments (samples from workers' hands, workers' knives, containers and work surface) were collected from the open-air fish markets in the Northern region of Iran. Listeria spp. was isolated from 104/488 (21.3%) raw fish and 29/374 (7.8%) of samples from open-air fish market environment. The isolates of Listeria spp. included L. innocua (35.3%), L. monocytogenes (32.3%), L. seeligeri (18%), and L. ivanovii (14.3%). Of the 43 L. monocytogenes isolates, 31 (72.1%), 10 (23.3%) and 2 (4.7%) belonged to serovars 1/2a, 4b, and 1/2b, respectively. The inlA, inlB, inlC, inlJ, actA, hlyA, iap, plcA, and prfA virulence-associated genes were detected in almost all of the L. monocytogenes isolates. The Listeria spp. isolates showed high resistance against tetracycline (23.3%), penicillin G, and cephalothin (each 16.5%). Besides, we observed significant resistance level to tetracycline (27.9%), ampicillin (20.9%), cephalothin, penicillin G, and streptomycin (each 16.3%) in the L. monocytogenes isolates. All of the isolates were susceptible to cefotaxime, gentamicin, kanamycin, and pefloxacin. We found that tetM (25.6%), tetA (23.3%), ampC (14%), and penA (11.6%) were the most prevalent antibiotic resistance genes in the L. monocytogenes isolates. Recovery of potentially pathogenic L. monocytogenes from raw fish and environment of open-air fish market samples in this study is a convincing evidence for the zoonotic potential of listeriosis.
Wolfe, Bryce; Wiepz, Gregory J.; Schotzko, Michele; Bondarenko, Gennadiy I.; Durning, Maureen; Simmons, Heather A.; Mejia, Andres; Faith, Nancy G.; Sampene, Emmanuel; Suresh, Marulasiddappa; Kathariou, Sophia; Czuprynski, Charles J.
2017-01-01
ABSTRACT Infection with Listeria monocytogenes during pregnancy is associated with miscarriage, preterm birth, and neonatal complications, including sepsis and meningitis. While the risk of these conditions is thought to be greatest during the third trimester of pregnancy, the determinants of fetoplacental susceptibility to infection, the contribution of gestational age, and the in vivo progression of disease at the maternal-fetal interface are poorly understood. We developed a nonhuman primate model of listeriosis to better understand antecedents of adverse pregnancy outcomes in early pregnancy. Four pregnant cynomolgus macaques (Macaca fascicularis) received a single intragastric inoculation between days 36 and 46 of gestation with 107 CFU of an L. monocytogenes strain isolated from a previous cluster of human listeriosis cases that resulted in adverse pregnancy outcomes. Fecal shedding, maternal bacteremia, and fetal demise were consistently noted within 7 to 13 days. Biopsy specimens of maternal liver, spleen, and lymph node displayed variable inflammation and relatively low bacterial burden. In comparison, we observed greater bacterial burden in the decidua and placenta and the highest burden in fetal tissues. Histopathology indicated vasculitis, fibrinoid necrosis, and thrombosis of the decidual spiral arteries, acute chorioamnionitis and villitis in the placenta, and hematogenous infection of the fetus. Vascular pathology suggests early impact of L. monocytogenes infection on spiral arteries in the decidua, which we hypothesize precipitates subsequent placentitis and fetal demise. These results demonstrate that L. monocytogenes tropism for the maternal reproductive tract results in infection of the decidua, placenta, and the fetus itself during the first trimester of pregnancy. PMID:28223455
Prevalence and characteristics of Listeria monocytogenes in bovine colostrum in Japan.
Hasegawa, Megumi; Iwabuchi, Eriko; Yamamoto, Shiori; Esaki, Hidetake; Kobayashi, Kazuhiko; Ito, Masahiko; Hirai, Katsuya
2013-02-01
This study was conducted to determine the prevalence and characteristics of Listeria monocytogenes in bovine colostrum in Japan. We collected bovine colostrum samples from 210 dams from 21 dairy farms in Hokkaido prefecture (Japan) between March and June 2009. L. monocytogenes was detected in samples from 6 (28.6%) of the 21 farms. Of the 210 samples, 16 (7.6%) were positive for L. monocytogenes. We recovered 80 L. monocytogenes isolates; 44 (55%) isolates were classified as serotype 1/2b and 36 (45%) were classified as serotype 4b. The isolates were susceptible to penicillin, ampicillin, amoxicillin, gentamicin, kanamycin, streptomycin, erythromycin, vancomycin, tetracycline, chloramphenicol, ciprofloxacin, and trimethoprim-sulfamethoxazole. Pulsed-field gel electrophoresis (PFGE) characterization of the 80 isolates revealed six PFGE types. Two PFGE types corresponded to human listeriosis cases. Most L. monocytogenes isolates possessed virulence-associated genes (actA, hly, iap, inlA, inlC, mpl, plcA, plcB, opuCA, prfA, and clpC). One PFGE type isolate possessed an epidemic clone II marker. Our findings suggest that isolates from bovine colostrum have the potential to cause human and animal listeriosis. This is the first study on the prevalence and characteristics of L. monocytogenes isolated from bovine colostrum obtained from dairy farms. Our results have important implications for improving public health and elucidating the epidemiology of L. monocytogenes in bovine colostrum.
Directory of Open Access Journals (Sweden)
J.A. Khan
2013-09-01
Full Text Available Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO. A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG; R: CCTCCAGAGTGATCGATGTT complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR. PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%, followed by fish meat (4.0%, and then beef (2.5%. Among various milk and milk products, curd (2.0% showed the highest prevalence, followed by raw milk (1.3%. The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 µL and 50 µL of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro resulted positive in twenty four
International Nuclear Information System (INIS)
Suklim, Kannapha; Flick, George J.; Vichitphan, Kanit
2014-01-01
Blue swimming crab lump (backfin) meat were exposed to 2, 4, and 6 kGy doses of Co 60 irradiation and evaluated for changes in physical, sensory properties, and Listeria monocytogenes inactivation. Irradiation up to 6 kGy resulted in no textural changes (p>0.05) in maximum shear forces; however, these exposures resulted in sensory quality changes (p<0.05) as determined by a triangle overall difference test (n=50) at each irradiation level. Irradiation had no effect (p>0.05) on L ⁎ color value. Irradiation at 4 and 6 kGy resulted in listericidal reductions greater than 6.65 (Department of Medical Science, Ministry of Health, Thailand, [DMST] 1783) and 7.56 logs (DMST 4553). Irradiation doses of 1 and 2 kGy resulted in a reduction of 2.10 and 5.35 logs respectively of L. monocytogenes DMST 1783 and 1.56 and 4.19 logs respectively of L. monocytogenes DMST 4553. The D 10 values of L. monocytogenes DMST 1783 and 4553 were 0.35 and 0.45 kGy. The study indicated that low-dose gamma irradiation would increase the safety of blue swimming crab meat without unacceptable changes in texture and L ⁎ color value. - Highlights: • γ-irradiation up to 6 kGy caused no changes in fresh crab meat textural properties. • γ-irradiation increased safety of ready-to-eat product i.e. fresh crab meat. • γ-irradiation had either listericidal or listeristatic effect on L. monocytogenes. • L. monocytogenes were completely inactivated by 4 kGy and 6 kGy γ-irradiation. • 1–2 kGy lethally injured L. monocytogenes but survivors increased during storage
Growth inhibition of Listeria monocytogenes by a nonbacteriocinogenic Carnobacterium piscicola
DEFF Research Database (Denmark)
Nilsson, Lilian; Bech Hansen, T.; Garrido, P.
2005-01-01
Aims: This study elucidates the mechanisms by which a nonbacteriocinogenic Carnobacterium piscicola inhibits growth of Listeria monocytogenes. Methods and Results: Listeria monocytogenes was exposed to live cultures of a bacteriocin-negative variant of C. piscicola A9b in co-culture, in a diffusion...... chamber system, and to a cell-free supernatant. Suppression of maximum cell density (0-3.5 log units) of L. monocytogenes was proportional to initial levels of C. pisciola (10(3)-10(7) CFU ml(-1)). Cell-to-cell contact was not required to cause inhibition. The cell-free C. piscicola supernatant caused...... a decrease in L. monocytogenes maximum cell density, which was abolished by glucose addition but not by amino acid, vitamin or mineral addition. The fermentate also gave rise to a longer lag phase and a reduction in growth rate. These effects were independent of glucose and may have been caused by acetate...
International Nuclear Information System (INIS)
Grant, I.R.; Nixon, C.R.; Patterson, M.F.
1993-01-01
Specific growth rates of two strains of Listeria monocytogenes in unirradiated and irradiated (2 kGy) roast beef and gravy stored at 5° and 10°C were found to be similar. However, exponential growth of L. monocytogenes after irradiation was preceded by an extended lag period of 6–9 d at 5°C and 3–4 d at 10°C, compared with lag periods of 1–2 d and <0.1 d in unirradiated beef and gravy stored similarly
Internalization of Listeria monocytogenes in cantaloupes during dump tank washing and hydrocooling.
Macarisin, Dumitru; Wooten, Anna; De Jesus, Antonio; Hur, Minji; Bae, Seonjae; Patel, Jitendra; Evans, Peter; Brown, Eric; Hammack, Thomas; Chen, Yi
2017-09-18
Recent listeriosis outbreaks and recalls associated with cantaloupes urge for studies to understand the mechanisms of cantaloupe contamination by Listeria monocytogenes. Postharvest practices such as washing and hydrocooling were suggested to facilitate the contamination of fresh fruits by human pathogens. This study assessed the potential of L. monocytogenes internalization into cantaloupes during dump tank washing and immersion-type hydrocooling in water contaminated with L. monocytogenes. The effect of cantaloupe cultivar, water temperature, and harvesting technique on L. monocytogenes internalization was also evaluated. Full slip (cantaloupe without any residual stem) Western and Eastern cultivar cantaloupes were pre-warmed to 42°C (to imitate peak-high field temperatures of freshly harvested cantaloupes) and then immersed in water at 6°C and 18°C containing 4 and 6logCFU/ml of L. monocytogenes. Clipped (cantaloupe with short stem residues obtained by clipping the stem at harvest) Western and Eastern cantaloupes were pre-warmed to 42°C and then immersed in water at 6°C containing 6logCFU/ml of L. monocytogenes. Additionally, full slip and clipped Western cantaloupes were equilibrated to 18°C and then immersed in water at 18°C containing 6logCFU/ml of L. monocytogenes (isothermal immersion without temperature differential). Water containing L. monocytogenes infiltrated both full slip and clipped cantaloupes through the stems/stem scars and was then distributed along the vascular system in hypodermal mesocarp reaching the calyx area of the fruit. The current study demonstrated that, under experimental conditions, L. monocytogenes can internalize into cantaloupes during immersion in water contaminated by L. monocytogenes, both in the presence and absence of temperature differential, and that temperature differential moderately enhanced the internalization of L. monocytogenes. The incidence and levels of L. monocytogenes internalized in the middle
Directory of Open Access Journals (Sweden)
Daniel R. Rissi
2010-01-01
Full Text Available São descritos sete casos de doença neurológica em ovinos por Listeria monocytogenes no Rio Grande do Sul e Paraná entre 2000 e 2007. Foram afetados ovinos com idades entre 12-24 meses. Os casos ocorreram no verão e início da primavera e os índices gerais de morbidade e letalidade foram de 3,15% e 100%, respectivamente. Quando essa informação estava disponível, nenhum dos ovinos afetados era alimentado com silagem. Em três propriedades havia contato próximo dos ovinos afetados com outras espécies. A evolução do quadro clínico foi de 12 horas a três dias e os sinais clínicos foram caracterizados por decúbito (7/7, desvio da cabeça (4/7, incoordenação (3/7, depressão (3/7, andar em círculos (2/7, cegueira unilateral, emagrecimento progressivo, febre, midríase, movimentos de pedalagem, nistagmo lateral, opistótono, paralisia flácida dos membros pélvicos ou dos quatro membros, salivação excessiva e tremores (1/7 cada. Histologicamente observou-se encefalite com microabscessos, predominantemente unilateral com variáveis graus de gliose e alterações degenerativas como esferóides axonais e infiltração de células Gitter. As lesões se estendiam desde a medula oblonga até o mesencéfalo. Antígenos de Listeria monocytogenes foram detectados por imuno-histoquímica em seções de tronco encefálico de todos os ovinos afetados. O diagnóstico foi realizado com base nos achados epidemiológicos e clinico-patológicos, e confirmado pela imuno-histoquímica (IHQ utilizando anticorpo policlonal anti-L. monocytogenes.Seven cases of neurological disease in sheep caused by Listeria monocytogenes in Rio Grande do Sul and Paraná state, southern Brazil are described. The cases occurred between 2000 and 2007 and 12-24-month-old sheep were affected. Overall morbidity and lethality rates were 3.15% and 100%, respectively. Cases occurred in the summer and early spring. When this information was available, affected sheep had not been
Weller, Daniel; Wiedmann, Martin; Strawn, Laura K
2015-06-01
Environmental (i.e., meteorological and landscape) factors and management practices can affect the prevalence of foodborne pathogens in produce production environments. This study was conducted to determine the prevalence of Listeria monocytogenes, Listeria species (including L. monocytogenes), Salmonella, and Shiga toxin-producing Escherichia coli (STEC) in produce production environments and to identify environmental factors and management practices associated with their isolation. Ten produce farms in New York State were sampled during a 6-week period in 2010, and 124 georeferenced samples (80 terrestrial, 33 water, and 11 fecal) were collected. L. monocytogenes, Listeria spp., Salmonella, and STEC were detected in 16, 44, 4, and 5% of terrestrial samples, 30, 58, 12, and 3% of water samples, and 45, 45, 27, and 9% of fecal samples, respectively. Environmental factors and management practices were evaluated for their association with terrestrial samples positive for L. monocytogenes or other Listeria species by univariate logistic regression; analysis was not conducted for Salmonella or STEC because the number of samples positive for these pathogens was low. Although univariate analysis identified associations between isolation of L. monocytogenes or Listeria spp. from terrestrial samples and various water-related factors (e.g., proximity to wetlands and precipitation), multivariate analysis revealed that only irrigation within 3 days of sample collection was significantly associated with isolation of L. monocytogenes (odds ratio = 39) and Listeria spp. (odds ratio = 5) from terrestrial samples. These findings suggest that intervention at the irrigation level may reduce the risk of produce contamination.
Effect of Bio-inoculants Applied to M 5 Mulberry Under Rain-fed ...
African Journals Online (AJOL)
The present investigation was carried out at the department of sericulture, GKVK, UAS, Bangalore, India in 2007 with an objective to determine the effect of three bio-inoculants application to M5 mulberry plant on silkworm (PM x CSR2) growth, development and coocoon traits. The feeding experiment was laid-out in ...
Cho, T J; Kim, N H; Kim, S A; Song, J H; Rhee, M S
2016-12-05
Knowing the survival characteristics of foodborne pathogens in raw ready-to-eat (RTE) seafood is the key to predicting whether they pose a microbiological hazard. The present study examined the survival of Escherichia coli O157:H7, Salmonella Typhimurium, Vibrio parahaemoliticus, Listeria monocytogenes, and Staphylococcus aureus in raw RTE crab marinated in soy sauce. Inoculated crabs (initial bacterial population=4.1-4.4logCFU/g) were immersed in soy sauce and then stored at refrigeration (5°C) or room temperature (22°C) for up to 28days. At 5°C, all bacteria (except V. parahaemolyticus) survived in crab samples until Day 28 (counts of 1.4, 1.6, 3.1, 3.2 log CFU/g for E. coli O157:H7, S. Typhimurium, L. monocytogenes, and S. aureus, respectively). However, at 22°C, all tested bacteria were more susceptible to the antimicrobial effects of marination. Regardless of temperature, foodborne pathogens attached to crab samples were more resistant to marination than those suspended in soy sauce samples; however, the survival pattern for each species was different. Gram-positive bacteria were most resistant to marination conditions (high salinity, low pH), whereas V. parahaemolyticus was extremely susceptible. Marination is the only antibacterial step in the manufacturing processes; however, the results presented herein reveal that this is not sufficient to inactivate foodborne pathogens. In particular, the survival of pathogens on crabs at refrigeration temperature may pose a major hazard for the consumption of raw RTE seafood. Thus, appropriate decontamination methods and implementation of safety management practices are needed. This study provides predictive microbiological information of foodborne pathogens in raw RTE seafood with marination. Copyright © 2016 Elsevier B.V. All rights reserved.
Bouayad, Leila; Hamdi, Taha M; Naim, Malek; Leclercq, Alexandre; Lecuit, Marc
2015-07-01
Products from three broiler abattoirs were sampled for Listeria species to evaluate the changes in the prevalence and contamination rates at two stages of processing. Sampling was performed at the evisceration stage and at the end of processing after packaging and refrigerating at 4°C for 24 h. A total of 212 samples were collected; 52 were from abattoir A, and 80 samples each were collected from abattoirs B and C. Among all samples, 99 (46.7%) tested positive for Listeria, including L. monocytogenes 19 (8.9%), L. innocua 69 (32.5%), L. grayi 10 (4.7%), and L. welshimeri 1 (0.5%). The L. monocytogenes contamination rate varied from 5% to 11.5% in the 3 abattoirs. L. innocua was the most common species identified and was found in 8.8% of the samples from abattoir A and 33.7% of the samples from both abattoirs B and C. Twenty-six of the L. monocytogenes isolates obtained from positive samples were subjected to serotyping by multiplex polymerase chain reaction and characterization by the pulsed-field gel electrophoresis (PFGE) method using two cutting enzymes, ApaI and AscI. Three molecular serogroups were identified: IIa, IIb, and IVb. Serogroup IIa was common to all abattoirs, and serogroups IIb and IVb were found only in abattoir C. The 10 different obtained PFGE profiles were grouped into 7 clusters; some of these clusters were common to the 3 abattoirs, and others were specific to the abattoirs in which they were identified. This study revealed a high prevalence of Listeria spp., particularly L. monocytogenes, in raw broilers. This high incidence presents a risk to consumers due to the potential occurrence of cross-contamination with other foods in domestic refrigerators and the ability of these microorganisms to survive in undercooked products.
Directory of Open Access Journals (Sweden)
Sarah Hwa In Lee
2017-10-01
Full Text Available ABSTRACT This study aimed to investigate the effect of peracetic acid (PAA, 0.5% on adherent cells of three strains of Listeria monocytogenes strains belonging to serotypes 4b and 1/2b that had been previously isolated from the environment of a Brazilian cheese plant. The assays were conducted using polystyrene microplates and stainless steel coupons and the adhered cells were treated with PAA for 60, 120 and 180 s. On stainless steel, biofilms were partially inactivated by PAA after 60 s and almost 100% of the cells were damaged within 180 s using epifluorescence microscopy with LIVE/DEAD® staining. On polystyrene microplates, PAA decreased (P<0.05 biofilm biomass produced by the three L. monocytogenes isolates at 60 s, when compared with controls (no PAA treatment. However, PAA did not completely eliminate L. monocytogenes cells on polystyrene microplates (decreasing 1.8-2.5 log cycles after treatment with PAA for 180 s. The correct concentration and contact time of PAA is critical for eliminating biofilms formed by L. monocytogenes on stainless steel surfaces, although further studies are needed for defining efficient PAA treatments to remove adherent cells of this pathogen on plastic polymers.
Suklim, Kannapha; Flick, George J.; Vichitphan, Kanit
2014-10-01
Blue swimming crab lump (backfin) meat were exposed to 2, 4, and 6 kGy doses of Co60 irradiation and evaluated for changes in physical, sensory properties, and Listeria monocytogenes inactivation. Irradiation up to 6 kGy resulted in no textural changes (p>0.05) in maximum shear forces; however, these exposures resulted in sensory quality changes (p0.05) on L* color value. Irradiation at 4 and 6 kGy resulted in listericidal reductions greater than 6.65 (Department of Medical Science, Ministry of Health, Thailand, [DMST] 1783) and 7.56 logs (DMST 4553). Irradiation doses of 1 and 2 kGy resulted in a reduction of 2.10 and 5.35 logs respectively of L. monocytogenes DMST 1783 and 1.56 and 4.19 logs respectively of L. monocytogenes DMST 4553. The D10 values of L. monocytogenes DMST 1783 and 4553 were 0.35 and 0.45 kGy. The study indicated that low-dose gamma irradiation would increase the safety of blue swimming crab meat without unacceptable changes in texture and L* color value.
Spray method for recovery of heat-injured Salmonella Typhimurium and Listeria monocytogenes.
Back, Kyeong-Hwan; Kim, Sang-Oh; Park, Ki-Hwan; Chung, Myung-Sub; Kang, Dong-Hyun
2012-10-01
Selective agar is inadequate for supporting recovery of injured cells. During risk assessment of certain foods, both injured and noninjured cells must be enumerated. In this study, a new method (agar spray method) for recovering sublethally heat-injured microorganisms was developed and used for recovery of heat-injured Salmonella Typhimurium and Listeria monocytogenes. Molten selective agar was applied as an overlay to presolidified nonselective tryptic soy agar (TSA) by spray application. Heat-injured cells (55°C for 10 min in 0.1% peptone water or 55°C for 15 min in sterilized skim milk) were inoculated directly onto solidified TSA. After a 2-h incubation period for cell repair, selective agar was applied to the TSA surface with a sprayer, and the plates were incubated. The recovery rate for heat-injured Salmonella Typhimurium and L. monocytogenes with the spray method was compared with the corresponding rates associated with TSA alone, selective media alone, and the conventional overlay method (selective agar poured on top of resuscitated cells grown on TSA and incubated for 2 h). No significant differences (P > 0.05) were found in pathogen recovery obtained with TSA, the overlay method, and the spray method. However, a lower recovery rate (P recovery and detection of injured cells.
Prevalence and serotypes of Listeria monocytogenes contamination in Chinese beef processing plants.
Zhu, Lixian; Feng, Xiaohui; Zhang, Lihua; Zhu, Ruiliang; Luo, Xin
2012-06-01
The aim of this work was to study the epidemiology of Listeria spp., particularly Listeria monocytogenes, and to identify the serotypes present in contaminated samples from beef processing plants in China. A total of 439 samples were obtained from bovine feces, hides, and carcasses at three commercial processing plants. A standard protocol (ISO 11290-1) was followed to detect Listeria spp. and L. monocytogenes, and multiplex polymerase chain reaction was used to identify the various L. monocytogenes serotypes. The overall prevalences of Listeria spp. and L. monocytogenes were 65.6% and 26.4%, respectively, and the contamination was highest in the hide samples. The identified L. monocytogenes serotypes were 1/2c and 1/2a. The results of the current study indicate that Listeria spp. contamination is common in Chinese beef processing plants; specific measures should be taken to prevent and/or treat L. monocytogenes contamination of feces and hides in beef slaughter plants. Furthermore, because Listeria spp. contamination was found to be prevalent, it should, therefore, be studied further. The prevention of cases of sporadic listeriosis in China should also be addressed.
Stevia rebaudiana Bertoni effect on the hemolytic potential of Listeria monocytogenes.
Sansano, S; Rivas, A; Pina-Pérez, M C; Martinez, A; Rodrigo, D
2017-06-05
The effect of Stevia rebaudiana Bertoni on the hemolytic potential of Listeria monocytogenes was studied by means of the assessment of the Listeriolysin O (LLO) production. The three factors under study, stevia concentration in the range [0-2.5] % (w/v), incubation temperature (10 and 37°C), and exposure time (0-65h) significantly affected (p≤0.05) the hemolytic activity of L. monocytogenes. Results showed that at the lower incubation temperature the hemolytic potential of the bacterium was significantly reduced, from 100% at 37°C to 8% at 10°C (after 65h of incubation) in unsupplemented substrate (0% stevia). Irrespective of the temperature, 10 or 37°C, supplementation of the medium with stevia at 2.5 % (w/v) reduced the bacterium's hemolytic activity by a maximum of 100%. Furthermore, the time of exposure to 2.5 % (w/v) stevia concentration was also a significant factor reducing the hemolytic capability of L. monocytogenes. The possibility of reducing the pathogenic potential of L. monocytogenes (hemolysis) by exposure to stevia should be confirmed in real food matrices, opening a research niche with a valuable future impact on food safety. Copyright © 2017 Elsevier B.V. All rights reserved.
First Trimester Listeria monocytogenes Septicemia
Goddijn, M.; Schipper, H. G.; Spanjaard, L.; Wolf, H.
1997-01-01
Background: Little is known about fetal outcome after Listeria monocytogenes septicemia in the first trimester of pregnancy.Case: A primigravida with L. monocytogenes septicemia at 9 weeks gestation was treated with amoxicillin. At 40 weeks gestation a healthy female infant was born.Conclusion: This
Chen, Bang-Yuan; Wang, Chung-Yi; Wang, Chia-Lan; Fan, Yang-Chi; Weng, I-Ting; Chou, Chung-Hsi
2016-11-01
A 2-year study was performed at two ready-to-eat tilapia sashimi processing plants (A and B) to identify possible routes of contamination with Listeria monocytogenes during processing. Samples were collected from the aquaculture environments, transportation tanks, processing plants, and final products. Seventy-nine L. monocytogenes isolates were found in the processing environments and final products; 3.96% (50 of 1,264 samples) and 3.86% (29 of 752 samples) of the samples from plants A and B, respectively, were positive for L. monocytogenes . No L. monocytogenes was detected in the aquaculture environments or transportation tanks. The predominant L. monocytogenes serotypes were 1/2b (55.70%) and 4b (37.97%); serotypes 3b and 4e were detected at much lower percentages. At both plants, most processing sections were contaminated with L. monocytogenes before the start of processing, which indicated that the cleaning and sanitizing methods did not achieve adequate pathogen removal. Eleven seropulsotypes were revealed by pulsed-field gel electrophoresis and serotyping. Analysis of seropulsotype distribution revealed that the contamination was disseminated by the processing work; the same seropulsotypes were repeatedly found along the work flow line and in the final products. Specific seropulsotypes were persistently found during different sampling periods, which suggests that the sanitation procedures or equipment used at these plants were inadequate. Plant staff should improve the sanitation procedures and equipment to reduce the risk of L. monocytogenes cross-contamination and ensure the safety of ready-to-eat tilapia products.
Gelbícová, T; Karpísková, R
2012-04-01
Evaluation of the incidence and characteristics of L. monocytogenes in samples of raw cow's milk collected on farms (bulk tank milk samples) and from vending machines. Detection of L. monocytogenes and enumeration were carried out according to EN/ISO 11290--1, 2. Strains were characterised by serotyping and macrorestriction analysis using pulsed-field gel electrophoresis. The presence of L. monocytogenes was detected in 3,2 % (11/346) of bulk tank milk samples and 1,8 % (4/219) samples of raw cow's milk from vending machines. Findings of L. monocytogenes in raw milk were sporadic. Only on one farm strains of L. monocytogenes were detected repeatedly. Thirteen strains of L. monocytogenes belonged to serotype 1/2a, two strains to serotype 1/2b and one to serotype 4b. Macrorestriction analysis revealed considerable heterogeinity of profiles, with nine different pulsotypes being detected. Pulsotype 711 was the most frequent. This pulsotype was found on three different farms. The incidence of L. monocytogenes in raw cow's milk is relatively low in the Czech Republic. The results confirmed that some clones of L. monocytogenes from raw milk are identical with food and human strains.
Listeria monocytogenes, a down-to-earth pathogen.
Vivant, Anne-Laure; Garmyn, Dominique; Piveteau, Pascal
2013-01-01
Listeria monocytogenes is the causative agent of the food-borne life threatening disease listeriosis. This pathogenic bacterium received much attention in the endeavor of deciphering the cellular mechanisms that underlie the onset of infection and its ability to adapt to the food processing environment. Although information is available on the presence of L. monocytogenes in many environmental niches including soil, water, plants, foodstuff and animals, understanding the ecology of L. monocytogenes in outdoor environments has received less attention. Soil is an environmental niche of pivotal importance in the transmission of this bacterium to plants and animals. Soil composition, microbial communities and macrofauna are extrinsic edaphic factors that direct the fate of L. monocytogenes in the soil environment. Moreover, farming practices may further affect its incidence. The genome of L. monocytogenes presents an extensive repertoire of genes encoding transport proteins and regulators, a characteristic of the genome of ubiquitous bacteria. Postgenomic analyses bring new insights in the process of soil adaptation. In the present paper focussing on soil, we review these extrinsic and intrinsic factors that drive environmental adaptation of L. monocytogenes.
Lorenzen, Emma; Follmann, Frank; Secher, Jan O; Goericke-Pesch, Sandra; Hansen, Mette S; Zakariassen, Hannah; Olsen, Anja W; Andersen, Peter; Jungersen, Gregers; Agerholm, Jørgen S
2017-06-01
Advanced animal models, such as minipigs, are needed for the development of a globally requested human Chlamydia vaccine. Previous studies have shown that vaginal inoculation of sexually mature Göttingen minipigs with Chlamydia trachomatis resulted in an infection lasting only 3-5 days. The aim of this study was to evaluate the effect of targeting the upper porcine genital tract by transcervical and transabdominal intrauterine inoculation, compared to previously performed vaginal inoculation. Furthermore, we investigated the effect of the hormonal cycle, estrus vs. diestrus, on the establishment of a C. trachomatis infection in the minipig. Targeting the upper genital tract (transcervical inoculation) resulted in a longer lasting infection (at least 7 days) compared to vaginal inoculation (3-5 days). When comparing intrauterine inoculation during estrus and diestrus, inoculation during diestrus resulted in a longer lasting infection (at least 10 days) compared to estrus (3-5 days). Furthermore, we found a significant C. trachomatis specific IFN-γ response in pigs inoculated during estrus correlating with the accelerated clearance of infection in these pigs. These findings suggest that for implementation of an optimal model of C. trachomatis in minipigs, inoculation should bypass the cervix and preferable be performed during diestrus. Copyright © 2017 The Author(s). Published by Elsevier Masson SAS.. All rights reserved.
Directory of Open Access Journals (Sweden)
Ozbey Gokben
2006-06-01
Full Text Available Abstract Samples were taken from 100 camel sausages from the different retail markets in Aydin province in the south-west of Turkey and they were tested for the presence of Listeria spp by biochemical methods. Samples were enriched using Listeria Enrichment Broth and they were inoculated onto Listeria Selective Agar. Listeria monocytogenes was isolated from nine samples (9%, Listeria innocua from 14 samples (14% and Listeria welshimeri from two samples(2%. A 701 bp fragment of listeriolysin O sequence for L. monocytogenes was amplified using specific primers by polymerase chain reaction (PCR for confirmation of the identification. A random primer (OPA-11 was used in a random amplified polymorphic DNA (RAPD assay. This detected five different band profiles amongst the L. monocytogenes isolates, indicating a relatively large amount of genetic heterogeneity amongst the nine isolates. The study has highlighted the need for improved strategies for food safety, in particular appropriate hygienic precautions to avoid contamination of sausage during the manufacturing process and appropriate preservation techniques during storage and transport, to prevent transmission of Listeria spp to consumers at home and abroad.
Directory of Open Access Journals (Sweden)
Moutong eChen
2015-09-01
Full Text Available Listeria monocytogenes is an important foodborne pathogen that can cause serious illness in immunocompromised individuals, pregnant women, the elderly, and newborns. The aim of this study was to: (i evaluate the prevalence and contamination level (most probable number, MPN of L. monocytogenes in 567 retail raw foods (fishery products, n=154; raw/fresh meat, n=123; frozen foods, n=110; edible fungi, n=108; vegetables, n=72 collected from South China and (ii to gain further knowledge on the phenotype and genotype distributions of this important foodborne pathogen. Approximately 22% of the samples were positive for L. monocytogenes. The contamination levels were between 0.3 and 10 MPN/g in 75.0%, between 10 and 100 MPN/g in 11.0% and less than 100 MPN/g in 14.0% of the countable samples. Five serogroups were identified among the177 foodborne L. monocytogenes isolates, with1/2a-3a (42.4% and1/2b-3b (26.0% serogroups being the most dominant. Serogroup I.1 and II.2 were only found in the edible mushrooms, while serogroup III was dominant in the fishery products, suggesting that specific serogroups of L. monocytogenes may have distinct ecological niches. Ten (5.6% L. monocytogenes isolates exhibited multidrug resistance. Genetic relatedness analysis revealed the absence of distinct associations between specific food types, antibiotic resistance, serogroups, and genetic diversity. The present study provided the first baseline data on the prevalence, contamination level, and characteristics of L. monocytogenes isolated from raw foods in South China. Some multidrug resistant strains belonged to the epidemiologically important serogroups (I.1 and II.1, implying a potential public health risk. In addition, these findings also provide basic information for the Chinese food safety associated authorities to draft appropriate standards to control L. monocytogenes contamination and improve microbiological safety of raw foods.
Wellenberg, G.J.; Bruschke, C.J.M.; Wisselink, H.J.; Barkema, H.W.; Oirschot, van J.T.
2002-01-01
In this study, we examined whether an experimental bovine herpesvirus 4 (BHV4) infection can induce bovine mastitis, or can enhance bovine mastitis induced by Streptococcus uberis (S. uberis). Four lactating cows were inoculated intramammarily and intranasally with BHV4, and four lactating control
Rückerl, I; Muhterem-Uyar, M; Muri-Klinger, S; Wagner, K-H; Wagner, M; Stessl, B
2014-10-17
The aim of this study was to analyze the changing patterns of Listeria monocytogenes contamination in a cheese processing facility manufacturing a wide range of ready-to-eat products. Characterization of L. monocytogenes isolates included genotyping by pulsed-field gel electrophoresis (PFGE) and multi-locus sequence typing (MLST). Disinfectant-susceptibility tests and the assessment of L. monocytogenes survival in fresh cheese were also conducted. During the sampling period between 2010 and 2013, a total of 1284 environmental samples were investigated. Overall occurrence rates of Listeria spp. and L. monocytogenes were 21.9% and 19.5%, respectively. Identical L. monocytogenes genotypes were found in the food processing environment (FPE), raw materials and in products. Interventions after the sampling events changed contamination scenarios substantially. The high diversity of globally, widely distributed L. monocytogenes genotypes was reduced by identifying the major sources of contamination. Although susceptible to a broad range of disinfectants and cleaners, one dominant L. monocytogenes sequence type (ST) 5 could not be eradicated from drains and floors. Significantly, intense humidity and steam could be observed in all rooms and water residues were visible on floors due to increased cleaning strategies. This could explain the high L. monocytogenes contamination of the FPE (drains, shoes and floors) throughout the study (15.8%). The outcome of a challenge experiment in fresh cheese showed that L. monocytogenes could survive after 14days of storage at insufficient cooling temperatures (8 and 16°C). All efforts to reduce L. monocytogenes environmental contamination eventually led to a transition from dynamic to stable contamination scenarios. Consequently, implementation of systematic environmental monitoring via in-house systems should either aim for total avoidance of FPE colonization, or emphasize a first reduction of L. monocytogenes to sites where
Ozbey, Gokben; Ertas, Hasan Basri; Kok, Filiz
2006-01-01
Abstract Samples were taken from 100 camel sausages from the different retail markets in Aydin province in the south-west of Turkey and they were tested for the presence of Listeria spp by biochemical methods. Samples were enriched using Listeria Enrichment Broth and they were inoculated onto Listeria Selective Agar. Listeria monocytogenes was isolated from nine samples (9%), Listeria innocua from 14 samples (14%) and Listeria welshimeri from two samples(2%). A 701 bp fragment of listeriolysi...
Beauchamp, S.; Lacroix, M.
2012-08-01
The effect of gamma and UV-C irradiation on the production of cyclobutane pyrimidine dimers (CPDs) and 6-4 photoproducts (6-4 PPs) in DNA was investigated to compare the natural resistance of the genome of a Gram-positive bacterium and a Gram-negative bacterium against irradiation. Solution of pure DNA and bacterial strains Listeria monocytogenes and Escherichia coli were irradiated using gamma and UV-C rays. Extracted DNA from bacteria and pure DNA samples were then analysed by ELISA using anti-CPDs and anti-6-4 PPs monoclonal antibodies. The results show that gamma rays, as well as UV-C rays, induce the formation of CPDs and 6-4 PPs in DNA. During UV-C irradiation, the three samples showed a difference in their sensitivity against formation of CPDs (P≤0.05). Pure DNA was the most sensitive while the genome of L. monocytogenes was the most resistant. Also during UV-C irradiation, the genome of L. monocytogenes was the only one to show a significant resistance against formation of 6-4 PPs (P≤0.05). During gamma irradiation, for both types of lesion, pure DNA and the genome of E. coli did not show significant difference in their sensitivity (P>0.05) while the genome of L. monocytogenes showed a resistance against formation of CPDs and 6-4 PPs.
Penteado, Ana L; de Castro, M Fernanda P M; Rezende, Ana C B
2014-10-01
This study examined the ability of Salmonella enterica serovar Enteritidis and Listeria monocytogenes to grow or survive in mango pulp stored at -20°C, 4°C, 10°C and 25°C, as well as to cross-contaminate mangoes by means of a knife contaminated with different levels of these pathogens. At 25°C lag phase durations of 19 h and 7.2 h and generation times of 0.66 and 1.44 were obtained, respectively, for S. Enteritidis and L. monocytogenes. At 10°C only the growth of L. monocytogenes was observed. At 4°C both bacteria survived for 8 days. At -20°C S. Enteritidis was able to survive for 5 months while L. monocytogenes survived for 8 months. Cross-contamination was observed for knives contaminated with 10⁶, 10⁵ and 10⁴ CFU mL⁻¹ of S. Enteritidis and 10⁶ and 10⁵ CFU mL⁻¹ of L. monocytogenes. Both microorganisms can grow well in mango pulp at 25°C, thus lower temperatures for the maintenance of the pulps are crucial to avoid growth of these microorganisms. A refrigeration temperature of 10°C will avoid only the growth of S. Enteritidis. Thus good handling practices should be rigidly enforced to avoid any contamination as even at refrigeration and freezing temperatures survival of these pathogens may occur. © 2014 Society of Chemical Industry.
Directory of Open Access Journals (Sweden)
Jozi Fagundes de Mello
2008-03-01
Full Text Available The polymorphic region sequences in the iap gene were analyzed in 25 strains of Listeria monocytogenes isolated from cheeses in the state of Rio Grande do Sul, and compared with reference strains. This investigation distinguished two clusters of L. monocytogenes: I (20 strains and II (5 strains.A seqüência da região polimórfica do gene iap foi analisada em 25 cepas de Listeria monocytogenes isoladas de queijo no Estado do Rio Grande do Sul e comparadas com cepas referências. Esta investigação distinguiu L. monocytogenes em dois grupos: I (20 cepas e II (5 cepas.
Depletion of proton motive force by nisin in Listeria monocytogenes cells.
Bruno, M E; Kaiser, A; Montville, T J
1992-07-01
The basal proton motive force (PMF) levels and the influence of the bacteriocin nisin on the PMF were determined in Listeria monocytogenes Scott A. In the absence of nisin, the interconversion of the pH gradient (Z delta pH) and the membrane potential (delta psi) led to the maintenance of a fairly constant PMF at -160 mV over the external pH range 5.5 to 7.0. The addition of nisin at concentrations of greater than or equal to 5 micrograms/ml completely dissipated PMF in cells at external pH values of 5.5 and 7.0. With 1 microgram of nisin per ml, delta pH was completely dissipated but delta psi decreased only slightly. The action of nisin on PMF in L. monocytogenes Scott A was both time and concentration dependent. Valinomycin depleted only delta pH, whereas nigericin and carbonyl cyanide m-chlorophenylhydrazone depleted only delta psi, under conditions in which nisin depleted both. Four other L. monocytogenes strains had basal PMF parameters similar to those of strain Scott A. Nisin (2.5 micrograms/ml) also completely dissipated PMF in these strains.
Directory of Open Access Journals (Sweden)
Hurtado Ana
2009-01-01
Full Text Available Abstract Background Listeria monocytogenes is among the most important foodborne bacterial pathogens due to the high mortality rate and severity of the infection. L. monocytogenes is a ubiquitous organism occasionally present in the intestinal tract of various animal species and faecal shedding by asymptomatically infected livestock poses a risk for contamination of farm environments and raw food at the pre-harvest stages. The aim of this study was to determine the prevalence and strain diversity of L. monocytogenes in healthy ruminants and swine herds. Results Faecal samples from 30 animals per herd were collected from 343 herds (120 sheep, 124 beef cattle, 82 dairy cattle and 17 swine in the Basque Country and screened in pools by an automated enzyme-linked fluorescent immunoassay (VIDAS® to estimate the prevalence of positive herds. Positive samples were subcultured onto the selective and differential agar ALOA and biochemically confirmed. L. monocytogenes was isolated from 46.3% of dairy cattle, 30.6% beef cattle and 14.2% sheep herds, but not from swine. Within-herd prevalence investigated by individually analysing 197 sheep and 221 cattle detected 1.5% of faecal shedders in sheep and 21.3% in cattle. Serotyping of 114 isolates identified complex 4b as the most prevalent (84.2%, followed by 1/2a (13.2%, and PFGE analysis of 68 isolates showed a highly diverse L. monocytogenes population in ruminant herds. Conclusion These results suggested that cattle represent a potentially important reservoir for L. monocytogenes in the Basque Country, and highlighted the complexity of pathogen control at the farm level.
Directory of Open Access Journals (Sweden)
Christian James
2015-01-01
Full Text Available The aim of this study is to evaluate the eff ect of meat content and surface smoothness on the deactivation of Listeria monocytogenes in beef-agar food models achieved by shortwave ultraviolet (UVC light. Food models with various meat contents were made using chopped beef slices and agar solution. Prepared models together with a Listeria selective agar (LSA plate and a slice of cooked beef were inoculated with L. monocytogenes and then exposed to UVC light. Population of Listeria reduced to below the level of detection on the LSA plates. As the content of beef in the beef-agar models increased, more L. monocytogenes cells survived. Survival was greatest on the treated cooked slice of beef. To bett er understand the effect of surface irregularities, a white light interferometer was used to analyse the surface smoothness of beef-agar media and LSA plates. No correlation was observed between the surface roughness of seven out of nine types of produced beef-agar media and the degree of inactivation resulting from UVC radiation at the given dose, whereas, less bacterial cells were killed as beef content of the food models increased. The findings of the current study show that the chemical composition of the treated sample also plays an important role in pathogen resistance and survival, meaning that two samples with similar surface irregularities but diff erent chemical composition might produce very diff erent inactivation results when exposed to UVC light.
Directory of Open Access Journals (Sweden)
E. Mnyandu
2015-06-01
Full Text Available The human pathogen Listeria monocytogenes poses a serious threat to public health. A study was carried out to evaluate the effectiveness of four sanitizers, used individually or combined, against L. monocytogenes ATCC 7644. The contact times for bacteria and sanitizer were varied to 1, 3 and 5 minutes. Levulinic acid, sodium dodecyl sulphate (SDS, sodium hypochlorite solution (chlorine and a combination of SDS and levulinic acid (mixture were tested. Results revealed that 0.5% levulinic acid, when used individually, is capable of reducing the surviving colonies by 3.63 log CFU/mL, 4.05 log CFU/mL, 6.71 log CFU/mL after exposure for 1, 3 and 5 minutes respectively.SDS resulted in an 8 log CFU/mL reduction after 1, 3 and 5 minutes. A combination of 0.5% levulinic acid and 0.05% SDS caused a 3.69 log CFU /mL reduction, 4.4 log CFU/mL reduction, 7.97 log CFU/mL reduction for 1, 3 and 5 minutes respectively. Chlorine was the least effective with 2.93 log CFU/mL reduction, 3.16 log CFU/ mL reduction and 4.53 log CFU/ mL reduction respectively. When stored for up to 72 hours at 4°C, the surviving colonies remained viable and decreased in number significantly P < 0.05 = 0.001. The titratable acidity of samples treated with levulinic acid and samples treated with SDS/Lev mixture was lowered significantly compared to the control sample. No significant differences were noted in these same parameters for samples treated with chlorine or SDS. The application of SDS in the fresh produce industry as a sanitizing agent may be successful in eradicating or reducing the viability of L. monocytogenes on fresh produce, thereby replacing the routine chlorine washing.
Efficacy of Peracetic Acid in Inactivating Foodborne Pathogens on Fresh Produce Surface.
Singh, Prashant; Hung, Yen-Con; Qi, Hang
2018-02-01
Washing treatment with effective sanitizer is one of the critical steps in ensuring fresh produce safety. This study was to evaluate the efficacy of peracetic acid (PAA; VigorOx® 15 F&V), chlorine-based sanitizers (acidic electrolyzed water [AEO], near neutral electrolyzed water and bleach), lactic acid, and deionized (DI) water to reduce Escherichia coli O157:H7, Listeria monocytogenes, and Salmonella Typhimurium DT104 from fresh produce surfaces. A 5-strain cocktail of E. coli O157:H7, L. monocytogenes, and S. Typhimurium DT104 was separately prepared and used for surface inoculation on produce samples (E. coli O157:H7 on romaine lettuce, lemons, tomatoes, and blueberries; L. monocytogenes on romaine lettuce and cantaloupe; S. Typhimurium DT104 on lemons, tomatoes, cantaloupe, and blueberries). PAA at 45, 85, and 100 mg/L; AEO, NNEO, and bleach at 100 mg/L of free chlorine; lactic acid at 2%; and DI water were used for washing inoculated produce in an automated produce washer for 5 min. In general, PAA at 100 mg/L achieved the highest microbial inactivation of E. coli O157:H7 (lettuce, lemon, tomato, and blueberry at 2.2, 5.7, 5.5, and 6.7 log CFU/g, respectively), S. Typhimurium DT104 (lemon, tomato, cantaloupe, blueberry at 5.4, 6.8, 4.5, and 5.9 log CFU/g, respectively), and L. monocytogenes (lettuce and cantaloupe at 2.4 and 4.4 log CFU/g, respectively). Efficacy of sanitizers on produce with coarse surface (for example, lettuce and cantaloupe) was lower than produce with smooth texture (lemon, tomato, and blueberry). Cross-contamination of E. coli O157:H7 among romaine lettuce heads during simulated retail crisping process was greatly reduced by the application of PAA and NNEO. NNEO and PAA showed high efficacy in foodborne pathogen removal from fresh produce. Produce surface texture plays an important role in pathogen removal. NNEO and PAA effectively prevented cross-contamination during the crisping process. © 2018 Institute of Food Technologists®.
Comparison of Inoculation with the InoqulA and WASP Automated Systems with Manual Inoculation
Croxatto, Antony; Dijkstra, Klaas; Prod'hom, Guy
2015-01-01
The quality of sample inoculation is critical for achieving an optimal yield of discrete colonies in both monomicrobial and polymicrobial samples to perform identification and antibiotic susceptibility testing. Consequently, we compared the performance between the InoqulA (BD Kiestra), the WASP (Copan), and manual inoculation methods. Defined mono- and polymicrobial samples of 4 bacterial species and cloudy urine specimens were inoculated on chromogenic agar by the InoqulA, the WASP, and manual methods. Images taken with ImagA (BD Kiestra) were analyzed with the VisionLab version 3.43 image analysis software to assess the quality of growth and to prevent subjective interpretation of the data. A 3- to 10-fold higher yield of discrete colonies was observed following automated inoculation with both the InoqulA and WASP systems than that with manual inoculation. The difference in performance between automated and manual inoculation was mainly observed at concentrations of >106 bacteria/ml. Inoculation with the InoqulA system allowed us to obtain significantly more discrete colonies than the WASP system at concentrations of >107 bacteria/ml. However, the level of difference observed was bacterial species dependent. Discrete colonies of bacteria present in 100- to 1,000-fold lower concentrations than the most concentrated populations in defined polymicrobial samples were not reproducibly recovered, even with the automated systems. The analysis of cloudy urine specimens showed that InoqulA inoculation provided a statistically significantly higher number of discrete colonies than that with WASP and manual inoculation. Consequently, the automated InoqulA inoculation greatly decreased the requirement for bacterial subculture and thus resulted in a significant reduction in the time to results, laboratory workload, and laboratory costs. PMID:25972424
Prevalence and contamination levels of listeria monocytogenes in ready-to-eat foods in Tokyo, Japan.
Shimojima, Yukako; Ida, Miki; Nakama, Akiko; Nishino, Yukari; Fukui, Rie; Kuroda, Sumiyo; Hirai, Akihiko; Kai, Akemi; Sadamasu, Kenji
2016-08-01
We surveyed prevalence and contamination levels of Listeria monocytogenes in ready-to-eat foods between 2000 and 2012 in Tokyo. L. monocytogenes was isolated from 52 (1.7%) out of 2,980 samples. Comparing the prevalence in the study period, 2.2% were positive in the former period (2000-2005) and 1.2% in the latter (2006-2012). Using the most probable number (MPN) technique, 32 samples were contaminated with fewer than 0.3 L. monocytogenes/g, 10 samples with 0.3-1.0/g and 4 samples with more than 1.0/g (the maximum was 2.3/g). The most common serovar was 1/2a, followed by 1/2b, 4b and 1/2c. We revealed that ready-to-eat foods in Tokyo were contaminated with L. monocytogenes, although the contamination levels were low.
International Nuclear Information System (INIS)
Turgis, Mélanie; Millette, Mathieu; Salmieri, Stéphane; Lacroix, Monique
2012-01-01
A combined treatment of an edible coating composed of trans-cinnamaldehyde (TCN; 0.5% p/p) with γ-irradiation was investigated against Listeria inoculated in peeled mini-carrots. First, the D 10 value (γ-irradiation dose required to eliminate 90% of the bacterial population) of TCN was evaluated under air. This treatment resulted in a 3.66-fold increase in relative bacterial radiosensitivity (RBR) as compared to the control without antimicrobial coating. Secondly, the shelf life of mini-carrots during 21 day of storage at 4 °C was studied. Antimicrobial coating containing TCN was assayed in combination with two irradiation doses (0.25 and 0.5 kGy). Results suggested that the inactive coating did not have any antimicrobial effect against Listeria while the coating containing TCN resulted in a 1.29 log reduction in carrots packed under air after 21 days of storage. Hence, these observations indicated that the combination of irradiation with antimicrobial coating played an important role in enhancing the radiosensitization of Listeria to γ-irradiation. - Highlights: ► Synergistic effect of essential oils and γ-radiation against food pathogens. ► Reducing any undesirable organoleptic impact due to high concentration of EOs. ► Potential in controlling food pathogens and food spoilage bacteria in food. ► Elimination of Listeria monocytogenes in the carrots during the storage.
Gómez, Diego; Azón, Ester; Marco, Noelia; Carramiñana, Juan J; Rota, Carmina; Ariño, Agustín; Yangüela, Javier
2014-09-01
A total of 336 Listeria isolates from ready-to-eat (RTE) meat products and meat-processing environments, consisting of 206 Listeria monocytogenes, and 130 Listeria innocua isolates, were characterized by disc diffusion assay and minimum inhibitory concentration (MIC) values for antimicrobial susceptibility against twenty antimicrobials. Resistance to one or two antimicrobials was observed in 71 L. monocytogenes isolates (34.5%), and 56 L. innocua isolates (43.1%). Multidrug resistance was identified in 24 Listeria isolates, 18 belonging to L. innocua (13.9%) and 6 to L. monocytogenes (2.9%). Oxacillin resistance was the most common resistance phenotype and was identified in 100% Listeria isolates. A medium prevalence of resistance to clindamycin (39.3% isolates) and low incidence of resistance to tetracycline (3.9% isolates) were also detected. Listeria isolates from RTE meat products displayed higher overall antimicrobial resistance (31.3%) than those from the environment (13.4%). All the strains assayed were sensitive to the preferred antibiotics used to treat listeriosis. Results showed that although antimicrobial resistance in L. monocytogenes still occurs at a low prevalence, L. innocua can form a reservoir of resistance genes which may transfer between bacterial species, including transference to organisms capable of causing disease in humans. Copyright © 2014 Elsevier Ltd. All rights reserved.
Listeria monocytogenes Prevalence and Characteristics in Retail Raw Foods in China.
Wu, Shi; Wu, Qingping; Zhang, Jumei; Chen, Moutong; Yan, Ze An; Hu, Huijuan
2015-01-01
The prevalence and levels of Listeria monocytogenes in retail raw foods covering most provincial capitals in China were studied with testing of 1036 samples of vegetables, edible mushrooms, raw meat, aquatic products and quick-frozen products from September 2012 to January 2014. The total prevalence of Listeria monocytogenes was 20.0% (207/1036), and the most probable number (MPN) values of 65.7% of the positive samples ranged from 0.3 to 110 MPN/g. Geographical differences were observed in this survey, and the results of both qualitative and quantitative methods indicated that the levels in the samples from North China were higher than those in the samples from South China. A total of 248 isolates were analyzed, of which approximately half belonged to molecular serogroup 1/2a-3a (45.2%), followed by 1/2b-3b-7 (30.6%), 1/2c-3c (16.1%), 4b-4d-4e (5.2%) and 4a-4c (2.8%). Most of the isolates carried hly (100%), inlB (98.8%), inlA (99.6%), inlC (98.0%) and inlJ (99.2%), and 44.8% of the isolates were llsX-positive. Seventeen epidemic clones (ECs) were detected, with 7 strains belonging to ECI (2.8%) and 10 belonging to ECIII (4.03%). Resistance to clindamycin (46.8%) was commonly observed, and 59 strains (23.8%) were susceptible to all 14 tested antibiotics, whereas 84 (33.9%) showed an intermediate level of resistance or were resistant to two or more antibiotics, including 7 multi-resistant strains that exhibited resistance to more than 10 antibiotics. The data obtained in the present study provides useful information for assessment of the possible risk posed to Chinese consumers, and this information will have a significant public health impact in China. Furthermore, the presence of virulence markers, epidemic clones, as well as the antibiotic resistance amongst the isolates strongly implies that many of these strains might be capable of causing listeriosis, and more accurate treatment of human listeriosis with effective antibiotics should be considered. This
Listeria monocytogenes Prevalence and Characteristics in Retail Raw Foods in China.
Directory of Open Access Journals (Sweden)
Shi Wu
Full Text Available The prevalence and levels of Listeria monocytogenes in retail raw foods covering most provincial capitals in China were studied with testing of 1036 samples of vegetables, edible mushrooms, raw meat, aquatic products and quick-frozen products from September 2012 to January 2014. The total prevalence of Listeria monocytogenes was 20.0% (207/1036, and the most probable number (MPN values of 65.7% of the positive samples ranged from 0.3 to 110 MPN/g. Geographical differences were observed in this survey, and the results of both qualitative and quantitative methods indicated that the levels in the samples from North China were higher than those in the samples from South China. A total of 248 isolates were analyzed, of which approximately half belonged to molecular serogroup 1/2a-3a (45.2%, followed by 1/2b-3b-7 (30.6%, 1/2c-3c (16.1%, 4b-4d-4e (5.2% and 4a-4c (2.8%. Most of the isolates carried hly (100%, inlB (98.8%, inlA (99.6%, inlC (98.0% and inlJ (99.2%, and 44.8% of the isolates were llsX-positive. Seventeen epidemic clones (ECs were detected, with 7 strains belonging to ECI (2.8% and 10 belonging to ECIII (4.03%. Resistance to clindamycin (46.8% was commonly observed, and 59 strains (23.8% were susceptible to all 14 tested antibiotics, whereas 84 (33.9% showed an intermediate level of resistance or were resistant to two or more antibiotics, including 7 multi-resistant strains that exhibited resistance to more than 10 antibiotics. The data obtained in the present study provides useful information for assessment of the possible risk posed to Chinese consumers, and this information will have a significant public health impact in China. Furthermore, the presence of virulence markers, epidemic clones, as well as the antibiotic resistance amongst the isolates strongly implies that many of these strains might be capable of causing listeriosis, and more accurate treatment of human listeriosis with effective antibiotics should be considered. This
Listeria monocytogenes Prevalence and Characteristics in Retail Raw Foods in China
Wu, Shi; Wu, Qingping; Zhang, Jumei; Chen, Moutong; Yan, Ze′an; Hu, Huijuan
2015-01-01
The prevalence and levels of Listeria monocytogenes in retail raw foods covering most provincial capitals in China were studied with testing of 1036 samples of vegetables, edible mushrooms, raw meat, aquatic products and quick-frozen products from September 2012 to January 2014. The total prevalence of Listeria monocytogenes was 20.0% (207/1036), and the most probable number (MPN) values of 65.7% of the positive samples ranged from 0.3 to 110 MPN/g. Geographical differences were observed in this survey, and the results of both qualitative and quantitative methods indicated that the levels in the samples from North China were higher than those in the samples from South China. A total of 248 isolates were analyzed, of which approximately half belonged to molecular serogroup 1/2a-3a (45.2%), followed by 1/2b-3b-7 (30.6%), 1/2c-3c (16.1%), 4b-4d-4e (5.2%) and 4a-4c (2.8%). Most of the isolates carried hly (100%), inlB (98.8%), inlA (99.6%), inlC (98.0%) and inlJ (99.2%), and 44.8% of the isolates were llsX-positive. Seventeen epidemic clones (ECs) were detected, with 7 strains belonging to ECI (2.8%) and 10 belonging to ECIII (4.03%). Resistance to clindamycin (46.8%) was commonly observed, and 59 strains (23.8%) were susceptible to all 14 tested antibiotics, whereas 84 (33.9%) showed an intermediate level of resistance or were resistant to two or more antibiotics, including 7 multi-resistant strains that exhibited resistance to more than 10 antibiotics. The data obtained in the present study provides useful information for assessment of the possible risk posed to Chinese consumers, and this information will have a significant public health impact in China. Furthermore, the presence of virulence markers, epidemic clones, as well as the antibiotic resistance amongst the isolates strongly implies that many of these strains might be capable of causing listeriosis, and more accurate treatment of human listeriosis with effective antibiotics should be considered. This
Biological Inoculants in Forage Conservation
Directory of Open Access Journals (Sweden)
Judit Peter Szucs
2011-05-01
Full Text Available 3rd generation biological inoculants –containing lactic acid bacteria and enzymes – are prefered nowadays in order to coordinate the fermentation in such a way that they increase lactic acid production by leaps and bounds at the beginning of the fermentation and improve the quality and stability of silage during the fermentation and feeding. The quality of raw material (maturity of plant, chop lenght, spreading of inoculant uniformly and the proper filling, compacting, covering and wrapping have a great influence on the effectiveness of the inoculant. The mycotoxin content of malfermented silages is an undesirable risk factor. The authors established, that the Lactobacillus buchneri and enzymes containing inoculant protected better the carotene content of low, medium- and high wilteed lucerne haylages (P<0,05 compare to untreated ones Aerobic stability experiment by Honnig 1990 method was carried out with medium wilted (36 % DM lucerne haylage which was treatedtreated before ensilage with , the dosage of 105 CFU/g Pediococcus acidilactici, 1,5x105 CFU/g Lactobacillus buchneri and cellulase and hemicellulase enzimes (20 000 CMC /g remained stabyle, unspoiled after 9 days exposure to the air, while the untreated haylages spoiled after 2;4;or 7days on aerobic condition. The different Lactobacillus plantarum strains (50.000 CFU of Lactobacillus plantarum DSM 16568 + 50.000 CFU of Lactobacillus plantarum DSM 4784/ g FM of maize applied together were able to improve the aerobic stability of silomaize silage.
Energy Technology Data Exchange (ETDEWEB)
Kim, Hyun-Joo [Department of Food Science and Technology, Chung-Ang University, Ansung, Gyunggi-do 456-756 (Korea, Republic of); Ham, Jun-Sang [Animal Products Processing Division, National Livestock Research Institute, RDA, Suwon 441-706 (Korea, Republic of); Lee, Ju-Woon [Advanced Radiation Technology Institute, Korea Atomic Energy Research Institute, Jeongeup 580-185 (Korea, Republic of); Kim, Keehyuk [Department of Culinary Nutrition, Woosong University, Daejeon 300-718 (Korea, Republic of); Ha, Sang-Do [Department of Food Science and Technology, Chung-Ang University, Ansung, Gyunggi-do 456-756 (Korea, Republic of); Jo, Cheorun, E-mail: cheorun@cnu.ac.k [Department of Animal Science and Biotechnology, Chungnam National University, Daejeon 305-764 (Korea, Republic of)
2010-06-15
The objective of this study was to identify the efficacy of gamma and electron beam irradiation of the food-borne pathogens (Listeria monocytogenes and Staphylococcus aureus) in sliced and pizza cheeses commercially available in the Korean market. Total aerobic bacteria and yeast/mold in the cheeses ranged from 10{sup 2} to 10{sup 3} Log CFU/g. Irradiation of 1 kGy for sliced cheese and 3 kGy for pizza cheese were sufficient to lower the total aerobic bacteria to undetectable levels (10{sup 1} CFU/g). Pathogen inoculation test revealed that gamma irradiation was more effective than electron beam irradiation at the same absorbed dose, and the ranges of the D{sub 10} values were from 0.84 to 0.93 kGy for L. monocytogenes and from 0.60 to 0.63 kGy for S. aureus. Results suggest that a low dose irradiation can improve significantly the microbial quality and reduce the risk of contamination of sliced and pizza cheeses by the food-borne pathogens which can potentially occur during processing.
International Nuclear Information System (INIS)
Kim, Hyun-Joo; Ham, Jun-Sang; Lee, Ju-Woon; Kim, Keehyuk; Ha, Sang-Do; Jo, Cheorun
2010-01-01
The objective of this study was to identify the efficacy of gamma and electron beam irradiation of the food-borne pathogens (Listeria monocytogenes and Staphylococcus aureus) in sliced and pizza cheeses commercially available in the Korean market. Total aerobic bacteria and yeast/mold in the cheeses ranged from 10 2 to 10 3 Log CFU/g. Irradiation of 1 kGy for sliced cheese and 3 kGy for pizza cheese were sufficient to lower the total aerobic bacteria to undetectable levels (10 1 CFU/g). Pathogen inoculation test revealed that gamma irradiation was more effective than electron beam irradiation at the same absorbed dose, and the ranges of the D 10 values were from 0.84 to 0.93 kGy for L. monocytogenes and from 0.60 to 0.63 kGy for S. aureus. Results suggest that a low dose irradiation can improve significantly the microbial quality and reduce the risk of contamination of sliced and pizza cheeses by the food-borne pathogens which can potentially occur during processing.
Kim, Hyun-Joo; Ham, Jun-Sang; Lee, Ju-Woon; Kim, Keehyuk; Ha, Sang-Do; Jo, Cheorun
2010-06-01
The objective of this study was to identify the efficacy of gamma and electron beam irradiation of the food-borne pathogens ( Listeria monocytogenes and Staphylococcus aureus) in sliced and pizza cheeses commercially available in the Korean market. Total aerobic bacteria and yeast/mold in the cheeses ranged from 10 2 to 10 3 Log CFU/g. Irradiation of 1 kGy for sliced cheese and 3 kGy for pizza cheese were sufficient to lower the total aerobic bacteria to undetectable levels (10 1 CFU/g). Pathogen inoculation test revealed that gamma irradiation was more effective than electron beam irradiation at the same absorbed dose, and the ranges of the D 10 values were from 0.84 to 0.93 kGy for L. monocytogenes and from 0.60 to 0.63 kGy for S. aureus. Results suggest that a low dose irradiation can improve significantly the microbial quality and reduce the risk of contamination of sliced and pizza cheeses by the food-borne pathogens which can potentially occur during processing.
Lewis, H C; Little, C L; Elson, R; Greenwood, M; Grant, K A; McLauchlin, J
2006-07-01
Two recent listeriosis outbreaks involving butter prompted this first cross-sectional study on the prevalence, levels, and types of Listeria species in 3229 samples of butter from production, retail, and catering premises in the United Kingdom during May and June 2004. When the criteria of the Microbiological Guidelines were used, 99.4% of samples were found to be of satisfactory microbiological quality, 0.5% were of acceptable quality, and 0.1% were of unsatisfactory quality as a result of high levels (>100 CFU/g) of Listeria spp. The butter samples with Listeria spp. present at more than 100 CFU/g were negative for L. monocytogenes. L. monocytogenes was detected in 0.4% (n=13) of samples, all at levels of less than 10 CFU/g, and were therefore of acceptable quality. Butter was contaminated more frequently with Listeria spp., including L. monocytogenes, when packed in plastic tubs, when in pack sizes of 500 g or less, when stored or displayed above 8 degrees C, when a hazard analysis system was not in place, and when the manager had received no food hygiene training. This study demonstrates that although butter is regarded as a low-risk product, it may provide an environment for the persistence and growth of Listeria spp., including L. monocytogenes. The control of L. monocytogenes in food processing and supply systems is critical in order to minimize the potential for this bacterium to be present in foods at the point of consumption at levels hazardous to health.
Schoder, Dagmar; Melzner, Daniela; Schmalwieser, Alois; Zangana, Abdoulla; Winter, Petra; Wagner, Martin
2011-06-01
The aim of this study was to determine the transmission routs of Listeria spp. in dairy farms manufacturing fresh cheese made from ovine and caprine raw milk and to evaluate the impact of Listeria monocytogenes mastitis on raw milk contamination. Overall, 5,799 samples, including 835 environmental samples, 230 milk and milk product samples, and 4,734 aseptic half-udder foremilk samples were collected from 53 dairy farms in the dairy intensive area of Lower Austria. Farms were selected for the study because raw milk was processed to cheese that was sold directly to consumers. A total of 153 samples were positive for Listeria spp., yielding an overall prevalence of 2.6%; L. monocytogenes was found in 0.9% of the samples. Bulk tank milk, cheese, and half-udder samples were negative for Listeria spp. Because none of the sheep and goats tested positive from udder samples, L. monocytogenes mastitis was excluded as a significant source of raw milk contamination. L. monocytogenes was detected at 30.2% of all inspected farms. Swab samples from working boots and fecal samples had a significantly higher overall prevalence (P < 0.001) of L. monocytogenes (15.7 and 13.0%, respectively) than did swab samples from the milk processing environment (7.9%). A significant correlation was found between the prevalence of L. monocytogenes in the animal and in the milk processing environment and the silage feeding practices. Isolation of L. monocytogenes was three to seven times more likely from farms where silage was fed to animals throughout the year than from farms where silage was not fed to the animals.
González, David; Vitas, Ana Isabel; Díez-Leturia, María; García-Jalón, Isabel
2013-12-01
The aim of this study was to obtain data from refrigerated ready-to-eat seafood products at retail in Spain (young eels, crabstick and smoked salmon), regarding prevalence and levels of Listeria monocytogenes, storage temperatures and the impact of transport conditions (type of bag) on the temperature of the product. The one-year surveillance period was carried out according to the EC Regulation No. 2073/2005, taking 5 units/batch and analyzing 250 samples following ISO 11290-1/A1 and ISO 11290-2/A methodologies. Low prevalence of L. monocytogenes was observed in surimi products, while 4.8% of smoked salmon samples were positive for Listeria with low levels (<10 cfu/g) and uneven pathogen distribution. A single company was responsible for 80% of the positive lots. All purchased products showed values higher than 4 °C at retail and an average increase of 2.5 °C or up to 6.2 °C was recorded when isothermal or plastic shopping bags were used for transport, respectively. To avoid noncompliance of the Food Safety Objective for L. monocytogenes in seafood RTE products more efforts from all stakeholders are needed, with special attention so as to improve control and maintenance of refrigerators at retail and to enhance consumer education regarding food safety practices. Copyright © 2013 Elsevier Ltd. All rights reserved.
Park, Sang-Hyun; Kang, Dong-Hyun
2015-08-17
The objective of this study was to evaluate the antimicrobial effect of chlorine dioxide (ClO2) gas and aerosolized sanitizer, when applied alone or in combination, on the survival of Escherichia coli O157:H7, Salmonella Typhimurium, and Listeria monocytogenes inoculated onto spinach leaves and tomato surfaces. Spinach leaves and tomatoes were inoculated with a cocktail of three strains each of the three foodborne pathogens. ClO2 gas (5 or 10 ppmv) and aerosolized peracetic acid (PAA) (80 ppm) were applied alone or in combination for 20 min. Exposure to 10 ppmv of ClO2 gas for 20 min resulted in 3.4, 3.3, and 3.4 log reductions of E. coli O157:H7, S. Typhimurium, and L. monocytogenes on spinach leaves, respectively. Treatment with 80 ppm of aerosolized PAA for 20 min caused 2.3, 1.9, and 0.8 log reductions of E. coli O157:H7, S. Typhimurium, and L. monocytogenes, respectively. Combined treatment of ClO2 gas (10 ppmv) and aerosolized PAA (80 ppm) for 20 min caused 5.4, 5.1, and 4.1 log reductions of E. coli O157:H7, S. Typhimurium, and L. monocytogenes, respectively. E. coli O157:H7, S. Typhimurium, and L. monocytogenes on tomatoes experienced similar reduction patterns to those on spinach leaves. As treatment time increased, most combinations of ClO2 gas and aerosolized PAA showed additive effects in the inactivation of the three pathogens. Combined treatment of ClO2 gas and aerosolized PAA produced injured cells of three pathogens on spinach leaves while generally did not produce injured cells of these pathogens on tomatoes. Combined treatment of ClO2 gas (10 ppmv) and aerosolized PAA (80 ppm) did not significantly (p>0.05) affect the color and texture of samples during 7 days of storage. Copyright © 2015. Published by Elsevier B.V.
Meloni, Domenico; Galluzzo, Pietro; Mureddu, Anna; Piras, Francesca; Griffiths, Mansel; Mazzette, Rina
2009-02-15
The aims of the present study were: (a) to investigate the prevalence and the enumeration of Listeria monocytogenes in 200 samples of ready to eat (RTE) foods of animal and vegetal origin collected from different outlets and processing plants in Sardinia; (b) to characterize the isolates by phenotypical and molecular methods; (c) to analyze a subset of 42 L. monocytogenes by automated EcoRI ribotyping in order to predict the strain's potential virulence for humans. The strains were isolated from: smoked fish products, cooked marinated products, meat products and pre-packaged mixed vegetable salads. Of the samples tested, 22% were positive for Listeria spp. The prevalence of L. monocytogenes was 9.5%, while the level of L. monocytogenes in the positive samples was 93%), belonging to 17 different DuPont Identification Library Codes (DUP-IDs) clones. The Simpson's numerical index of discrimination was 0.911. Cluster analysis pointed out a high similarity among strains isolated from meat, fish, and vegetables of different origin. These results confirmed the existence of a widespread population of L. monocytogenes, characterized by highly related strains existing in different geographical areas. 65% of these strains belonged to lineage II (serotypes 1/2a and 1/2c), subtypes known to be associated with sporadic human listeriosis outbreaks. The remaining 35% of the isolates (serotypes 1/2b, 3b and 4b) were allocated to lineage I and belong to distinct clonal groups (DUP-ID 1038 and 1042), which again have been associated with several outbreaks of human listeriosis. Neither atypical profiles nor lineage III strains were found. EcoRI ribotyping was confirmed as a rapid and reliable method for L. monocytogenes typing, providing useful data for epidemiologic and clonality surveys of L. monocytogenes strains isolated from RTE foods.
Bradley, Derek; McNeil, Brian; Laffey, John G; Rowan, Neil J
2012-06-01
The effects of mild conventional food-processing conditions on Listeria monocytogenes survival to pulsed UV (PUV) irradiation and virulence-associated characteristics were investigated. Specifically, this study describes the inability of 10 strains representative of 3 different culture forms or morphotypes of L. monocytogenes to adapt to normally lethal levels of PUV-irradiation after exposure to sub-lethal concentrations of salt (7.5% (w/v) NaCl for 1 h), acid (pH 5.5 for 1 h), heating (48 °C for 1 h) or PUV (UV dose 0.08 μJ/cm(2)). Findings showed that the order of increasing sensitivity of L. monocytogenes of non-adapted and stressed morphotypes to low pH (pH 3.5 for 5 h, adjusted with lactic), high salt (17.5% w/v NaCl for 5 h), heating (60 °C for 1 h) and PUV-irradiation (100 pulses at 7.2 J and 12.8 J, equivalent to UV doses of 2.7 and 8.4 μJ/cm(2) respectively) was typical wild-type smooth (S/WT), atypical filamentous rough (FR) and atypical multiple-cell-chain (MCR) variants. Exposure of L. monocytogenes cells to sub-lethal acid, salt or heating conditions resulted in similar or increased susceptibility to PUV treatments. Only prior exposure to mild heat stressing significantly enhanced invasion of Caco-2 cells, whereas subjection of L. monocytogenes cells to combined sub-lethal salt, acid and heating conditions produced the greatest reduction in invasiveness. Implications of these findings are discussed. This constitutes the first study to show that pre-exposure to mild conventional food-processing stresses enhances sensitivity of different culture morphotypes of L. monocytogenes to PUV, which is growing in popularity as an alternative or complementary approach for decontamination in the food environment. Copyright © 2011 Elsevier Ltd. All rights reserved.
Using Gamma Radiation for the Improvement of Silage Inoculant
International Nuclear Information System (INIS)
Wongwicharn, Aporn; Ljinakakr, Nongpanga; Piadang, Patharakorn
2006-09-01
A total of 117 acid producing baceria were isolated from grass and silage samples. Almost all isolates, 115 isolates posses homfermentative fermentation. All isolates produced lactic acid in a range of 0.36-2.05%. From their growth and their ability in producing lactic acid, two isolates, a coccus (T3-2-02) and a rod (T3-0-01) were selected for a mixed wild type strains for silage inoculant. After irradiation the wild type strains with gama ray, 51 and 58 isolates of high acid producer were selected from T3-2-02 and T3-0-01 strains, respectively. After testing the growht characteristics and the acid productivity, a coccus strain, MC08 and a rod stain, MR4 were choosen as a mixed irradiated starter culture strains for grass silage fermentation using a 50 dats old Pangola grass (Digitaria eriantha). The experiment was divided into 6 treatments. Treatmet I was the control. Treatmment 2, 4% molasses was added ro the grass. Treatment 3, a mixed wild type strains (T3-2-02+ T3-0-01) was inoculated into the grass. Treatment 4, a mixed irradiated strains (MC08+ MR04) was used. Treatment 5, A mixed wild tpye strains was used and supplemented with 4% molasses. Treatnebt 6, A mixed irradiated strain was assed and supplemented with 4% molasses. The results showed that a qualified silage can be obtained within a week from either the treatment inoculated with starter culture together with4% molasses (T5 and T6) or the treatment supplemented with 4% molasses alone (T2). further more, Silage of the treatments that using starter culture supplemented with 4% molasses gave volatile acid in a requred quantity. Silage of the treatments that inoculated either with a wild type pr a mixed irradiated starter culture posses bether quality than the control treatment. Further more silage that used irradiated starter culture showed a faster ffermentation and higher lactic acid production tha silage that uses wild type starter culture.
Directory of Open Access Journals (Sweden)
Valeria Braga
Full Text Available ABSTRACT The aim of this work was to study the prevalence of Listeria monocytogenes in foods obtained in retail shops and food industries located in Montevideo-Uruguay, and to identify the serogroups of the obtained isolates. Three-thousand one-hundred and seventy-five food samples (frozen, deli meats, ready-to-eat and cheese were analyzed. The obtained isolates were serogrouped by multiplex PCR and serotyped by conventional procedure. Genetic comparisons were performed using pulsed-field gel electrophoresis on a sub-set of isolates belonging to the same serotype successively recovered from the same establishment. L. monocytogenes was isolated from 11.2% of samples. The highest prevalence was observed in frozen foods (38%, followed by cheese (10%. 1/2b and 4b were the most frequently identified serotypes. In six of 236 analyzed establishments we successively recovered L. monocytogenes isolates belonging to the same serotype. Most of them corresponded to serotype 1/2b. Pulsed-field gel electrophoresis profiles suggest that at least 33% of L. monocytogenes 1/2b isolates are genetically related and that may remain viable for prolonged periods. The observed prevalence of L. monocytogenes was lower than reported in neighboring countries. Our findings highlight the role that frozen foods may play in the spread of this pathogen, and the relevance of serotypes 1/2b and 4b.
Szymczak, Barbara; Dąbrowski, Waldemar
2015-05-01
The count of Listeria monocytogenes was determined, before and after heat treatment, in 200 samples of dumplings of 9 brands and with different types of stuffing. Analyses were conducted according to ISO 11290-1 standard and with real-time PCR method. The highest count of L. monocytogenes was found in meat dumplings (10(2) to 10(4) CFU/g), whereas products with white cheese-potato stuffing and vegetable-mushroom stuffing contained significantly less Listeria, 20 to 80 and 5 to 32 CFU/g, respectively. In cooled meat dumplings the extent of contamination depended significantly on the producer. In addition, a significant (P monocytogenes in meat dumplings. In contrast, the microwave heating applied for 2 min at 600 W only reduced the count of L. monocytogenes by 1 to 2 logs. Hence, the microwave heating failed to reduce the risk of infection with this pathogen below the level permissible in the EU regulation, especially in the most contaminated samples. In this case, the efficacy of microwave heating was significantly (P monocytogenes (rho = 0.626), then by meat content in the stuffing (0.476), and to the lowest extent--by the type of meat (0.415 to 0.425). However, no Listeria sp. and L. monocytogenes were isolated from cooked dumplings with fruits (strawberries or blueberries). © 2015 Institute of Food Technologists®
Occurrence of Listeria monocytogenes in smoked fish in Sokoto ...
African Journals Online (AJOL)
STORAGESEVER
2008-09-03
Sep 3, 2008 ... monocytogenes and other Listeria species are common contaminant of smoked fish, and this may pose serious public health implications. Key words: Smoked fish, Listeria monocytogenes, contamination, public health. INTRODUCTION ... L. monocytogenes belong to the recently emerging psychrotrophic ...
Gumus, Tuncay; Şukru Demirci, A.; Murat Velioglu, H.; Velioglu, Serap D.; Yilmaz, Ismail; Sagdic, Osman
2008-09-01
In this research, the effect of gamma irradiation on the inactivation of Escherichia coli O157:H7 (ATCC 33150), Staphylococcus aureus (ATCC 2392) and Salmonella typhimurium (NRRL 4463) inoculated into Tekirdag meatballs was investigated. The meatball samples were inoculated with pathogens and irradiated at the absorbed doses of 1, 2.2, 3.2, 4.5 and 5.2 kGy. E. coli O157:H7 count in 1 kGy irradiated meatballs stored in the refrigerator for 7 days was detected to be 4 log cfu/g lower than the count in nonirradiated samples ( pmeatballs. However, none of the test organisms were detected in the samples after irradiation with 4.5 kGy doses.
Directory of Open Access Journals (Sweden)
Angeliki Birmpa
2015-08-01
Full Text Available In the present study, the effectiveness of two loop-mediated isothermal amplification (LAMP assays was evaluated. Samples of romaine lettuce, strawberries, cherry tomatoes, green onions and sour berries were inoculated with known dilutions (100-108 CFU/g of produce of S. Enteritidis and L. monocytogenes. With LAMP assay, pathogens can be detected in less than 60 min. The limits of detection of S. Enteritidis and L. monocytogenes depended on the food sample tested and on the presence of enrichment step. After enrichment steps, all food samples were found positive even at low initial pathogen levels. The developed LAMP, assays, are expected to become a valuable, robust, innovative, powerful, cheap and fast monitoring tool, which can be extensively used for routine analysis, and screening of contaminated foods by the food industry and the Public Food Health Authorities.
Hu, Kai; Malla, Tejsu; Zhai, Yujia; Dong, Lili; Tang, Ru
2015-01-01
To evaluate the comparative effect of topical versus intramuscular administration of nanoparticle-carried DNA vaccine in preventing corneal herpes simplex virus type 1 (HSV-1) infection. Nanoparticle [polyethylenimine (PEI)-Fe3O4]-carried DNA vaccine (PEI-Fe3O4-pRSC-gD-IL-21) or DNA vaccine (pRSC-gD-IL-21) alone were topically versus intramuscularly inoculated into one eye each of mice on days 0, 14 and 28. Three weeks after the final immunization, the specific immune responses and clinical degrees of primary herpes simplex keratitis were evaluated. Topical inoculation of nanoparticle-carried DNA vaccine induced mice to generate similar levels of specific HSV-1-neutralizing antibody, IFN-γ and IL-4 in serum and specific killing (cytotoxicity) and proliferative activities of the splenic lymphocytes, but a significantly higher level of secretory IgA in tears compared to those of intramuscular inoculation. More importantly, the mice inoculated topically showed a significantly decreased herpes simplex keratitis severity than the mice inoculated intramuscularly after HSV-1 challenge on the corneas of the mice. Topical inoculation of nanoparticle-carried DNA vaccine elicits a stronger specific local immune response and more effectively inhibits herpes simplex keratitis as compared to intramuscular inoculation in an HSV-1 ocular challenge mouse model. Thus, topical administration may be a promising inoculating route for the nanoparticle-carried DNA vaccine to prevent corneal infections. © 2015 S. Karger AG, Basel.
Avila-Vega, Dulce E; Alvarez-Mayorga, Beatriz; Arvizu-Medrano, Sofía M; Pacheco-Aguilar, Ramiro; Martínez-Peniche, Ramón; Hernández-Iturriaga, Montserrat
2014-11-01
The aim of this study was to generate information regarding the microbiological profile, including Salmonella and Listeria monocytogenes incidence, of hydroponically grown bell peppers and materials associated with their production in greenhouses located in Mexico. Samples of coconut fiber (24), knives (30), drippers (20), conveyor belts (161), pepper transportation wagons (30), air (178), water (16), nutrient solution for plant irrigation (78), and bell pepper fruits (528) were collected during one cycle of production (2009 to 2010) for the quantification of microbial indicators (aerobic plate counts [APC], molds, coliforms, and Escherichia coli) and the detection of Salmonella and L. monocytogenes. With regard to surfaces (conveyor belts and wagons) and utensils (knives and drippers), the APC, coliform, and mold counts ranged from 3.0 to 6.0, from 1.4 to 6.3, and from 3.6 to 5.2 log CFU/100 cm(2) or per utensil, respectively. The air in the greenhouse contained low median levels of APC (1.2 to 1.4 log CFU/100 liters) and molds (2.2 to 2.5 log CFU/100 liters). The median content of APC and coliforms in water were 0.5 log CFU/ml and 0.3 log MPN/100 ml, respectively. The median content of coliforms in nutrient solution ranged from 1.8 to 2.4 log MPN/100 ml, and E. coli was detected in 18 samples (range, fruit, respectively; E. coli was detected in 5.1% of the samples (range, 0.23 to 1.4 log MPN per fruit). Salmonella was isolated from only one sample (1.6%) of conveyor belt located at the packing area and in four bell pepper samples (3%). L. monocytogenes was not detected. This information could help producers to establish effective control measures to prevent the presence of foodborne pathogens in bell peppers based on a scientific approach.
Dual-species biofilm of Listeria monocytogenes and Escherichia coli on stainless steel surface.
de Grandi, Aline Zago; Pinto, Uelinton Manoel; Destro, Maria Teresa
2018-04-12
Listeria monocytogenes is a Gram-positive bacterium commonly associated with foodborne diseases. Due its ability to survive under adverse environmental conditions and to form biofilm, this bacterium is a major concern for the food industry, since it can compromise sanitation procedures and increase the risk of post-processing contamination. Little is known about the interaction between L. monocytogenes and Gram-negative bacteria on biofilm formation. Thus, in order to evaluate this interaction, Escherichia coli and L. monocytogenes were tested for their ability to form biofilms together or in monoculture. We also aimed to evaluate the ability of L. monocytogenes 1/2a and its isogenic mutant strain (ΔprfA ΔsigB) to form biofilm in the presence of E. coli. We assessed the importance of the virulence regulators, PrfA and σ B , in this process since they are involved in many aspects of L. monocytogenes pathogenicity. Biofilm formation was assessed using stainless steel AISI 304 #4 slides immersed into brain heart infusion broth, reconstituted powder milk and E. coli preconditioned medium at 25 °C. Our results indicated that a higher amount of biofilm was formed by the wild type strain of L. monocytogenes than by its isogenic mutant, indicating that prfA and sigB are important for biofilm development, especially maturation under our experimental conditions. The presence of E. coli or its metabolites in preconditioned medium did not influence biofilm formation by L. monocytogenes. Our results confirm the possibility of concomitant biofilm formation by L. monocytogenes and E. coli, two bacteria of major significance in the food industry.
Listeria monocytogenes infection in pregnancy and neonatal sepsis
Directory of Open Access Journals (Sweden)
Francesca Pascale
2008-06-01
Full Text Available Authors report a fatal neonatal sepsis caused by Listeria monocytogenes. While the diagnostic procedure aimed to identify the microrganism is described, it is emphasized the importance to recover Streptococcus agalactiae (GBS and L. monocytogenes by means of vaginal-rectal swab culture. The intrapartum screening for L. monocytogenes, by Polymerase Chain Reaction (PCR providing results in 75 minutes is also evaluated.
Directory of Open Access Journals (Sweden)
Andrea Gamboa Marín
2012-04-01
Full Text Available Objective. To determine the prevalence of L. monocytogenes in pork carcasses, meat cuts, and meat products (“chorizo”, sausage and ham. Materials and methods. Stratified sampling was implemented in meat-processed products. We analyzed 566 (37% carcasses, 472 (31% meat cuts, and 481, (32% meat-processed products, distributed as follows: 169 (11% sausage, 163 (11% ham, and 149 (10% “chorizo”, for a total of 1519 (100% samples in a period of 18 months. The samples were processed using the ISO-17604, ISO-11290-1 and the USDA/FSIS (MLG-8.03 methods. Genus and species were confirmed by multiplex-PCR. Results. We obtained isolates of L. monocytogenes from 21 carcasses (10%, 160 (76% from meat deboning, 10 (5% from ham, 6 (3% from “chorizo”, and 13 (6% from sausage. The prevalence found was 3.7% and 33.9% in carcasses and meat deboning respectively. The prevalence in the meat-processed products was 4.03% in “chorizo”, 6.13% in ham and 7.69% in sausage. The overall prevalence of L. monocytogenes in the study was 13.82%. Conclusions. We found L. monocytogenes in different products analyzed, with particular interest in ham and sausage since both are consumed without previous heat treatment.
Recombinant phage probes for Listeria monocytogenes
Energy Technology Data Exchange (ETDEWEB)
Carnazza, S; Gioffre, G; Felici, F; Guglielmino, S [Department of Microbiological, Genetic and Molecular Sciences, University of Messina, Messina (Italy)
2007-10-03
Monitoring of food and environmental samples for biological threats, such as Listeria monocytogenes, requires probes that specifically bind biological agents and ensure their immediate and efficient detection. There is a need for robust and inexpensive affinity probes as an alternative to antibodies. These probes may be recruited from random peptide libraries displayed on filamentous phage. In this study, we selected from two phage peptide libraries phage clones displaying peptides capable of specific and strong binding to the L. monocytogenes cell surface. The ability of isolated phage clones to interact specifically with L. monocytogenes was demonstrated using enzyme-linked immunosorbent assay (ELISA) and confirmed by co-precipitation assay. We also assessed the sensitivity of phage-bacteria binding by PCR on phage-captured Listeria cells, which could be detected at a concentration of 10{sup 4} cells ml{sup -1}. In addition, as proof-of-concept, we tested the possibility of immobilizing the affinity-selected phages to a putative biosensor surface. The quality of phage deposition was monitored by ELISA and fluorescent microscopy. Phage-bacterial binding was confirmed by high power optical phase contrast microscopy. Overall, the results of this work validate the concept of affinity-selected recombinant filamentous phages as probes for detecting and monitoring bacterial agents under any conditions that warrant their recognition, including in food products.
Zhang, Cathy X. Y.; Brooks, Brian W.; Huang, Hongsheng; Pagotto, Franco
2016-01-01
ABSTRACT The Gram-positive bacterium Listeria monocytogenes causes a significant percentage of the fatalities among foodborne illnesses in humans. Surface proteins specifically expressed in a wide range of L. monocytogenes serotypes under selective enrichment culture conditions could serve as potential biomarkers for detection and isolation of this pathogen via antibody-based methods. Our study aimed to identify such biomarkers. Interrogation of the L. monocytogenes serotype 4b strain F2365 genome identified 130 putative or known surface proteins. The homologues of four surface proteins, LMOf2365_0578, LMOf2365_0581, LMOf2365_0639, and LMOf2365_2117, were assessed as biomarkers due to the presence of conserved regions among strains of L. monocytogenes which are variable among other Listeria species. Rabbit polyclonal antibodies against the four recombinant proteins revealed the expression of only LMOf2365_0639 on the surface of serotype 4b strain LI0521 cells despite PCR detection of mRNA transcripts for all four proteins in the organism. Three of 35 monoclonal antibodies (MAbs) to LMOf2365_0639, MAbs M3643, M3644, and M3651, specifically recognized 42 (91.3%) of 46 L. monocytogenes lineage I and II isolates grown in nonselective brain heart infusion medium. While M3644 and M3651 reacted with 14 to 15 (82.4 to 88.2%) of 17 L. monocytogenes lineage I and II isolates, M3643 reacted with 22 (91.7%) of 24 lineage I, II, and III isolates grown in selective enrichment media (UVM1, modified Fraser, Palcam, and UVM2 media). The three MAbs exhibited only weak reactivities (the optical densities at 414 nm were close to the cutoff value) to some other Listeria species grown in selective enrichment media. Collectively, the data indicate the potential of LMOf2365_0639 as a surface biomarker of L. monocytogenes, with the aid of specific MAbs, for pathogen detection, identification, and isolation in clinical, environmental, and food samples. IMPORTANCE L. monocytogenes is
Boscher, Evelyne; Houard, Emmanuelle; Denis, Martine
2012-05-01
This study was undertaken to acquire new data on the prevalence of Listeria monocytogenes in sows and fattening pigs in farrow-to-finish pig farms, and to analyze distribution of serotypes and genotypes of the bacterium within farms. Detection of L. monocytogenes was carried out on 730 pooled feces samples from sows in 73 pig farms and on 172 pooled feces samples from fattening pigs in 43 of these farms. Isolates were serotyped and typed by pulsed-field gel electrophoresis. For sows, 46% of the farms and 11% of the samples were positive for L. monocytogenes. A total of 124 isolates were collected and distributed in four serotypes: 1/2a (41%), 1/2b (36%), 4b (21%), and 1/2c (2%). Positive farms harbored one to three serotypes. The genetic diversity was high; 51 genetic profiles were obtained with 25, 16, 9, and 1 for the serotypes 1/2a, 1/2b, 4b, and 1/2c, respectively. Positive farms harbored 1 to 6 genetic profiles. Isolates showing similar genotypes occurred in several farms. For fattening pigs, 25% of the farms and 14.5% of the samples were positive for L. monocytogenes. The 34 isolates belonged to four serotypes: 1/2a (32%), 1/2b (41%), 4b (24%), and 1/2c (3%). They were distributed in 20 genotypes: 6 for 1/2a; 8 for 1/2b, 5 for 4b, and 1 for 1/2c. Similar serotypes and pulsotypes were recovered in sows and fattening pigs from the same farms, suggesting common sources of contamination.
Lu, Chunye; Marjanovic, Olivera; Kiang, David
2017-01-01
ABSTRACT Listeria monocytogenes is an important foodborne pathogen. Here, we present the annotated whole genome of Listeria monocytogenes strains F14M01297-C2 and F14M01297-C4, isolated from nectarines distributed by a packing facility in California during an investigation of listeriosis associated with stone fruit in 2014. PMID:28729255
Directory of Open Access Journals (Sweden)
André L. M. Oliveira
2017-09-01
Full Text Available Although Azospirillum strains used in commercial inoculant formulations presents diazotrophic activity, it has been reported that their ability to produce phytohormones plays a pivotal role in plant growth-promotion, leading to a general recommendation of its use in association with regular N-fertilizer doses. In addition, a high variability in the effectiveness of Azospirillum inoculants is still reported under field conditions, contributing to the adoption of the inoculation technology as an additional management practice rather than its use as an alternative practice to the use of chemical inputs in agriculture. To investigate whether the content of stress-resistance biopolymers would improve the viability and performance of Azospirillum inoculants when used as substitute of N-fertilizers, biomass of A. brasilense strain Ab-V5 enriched in exopolysaccharides (EPS and polyhydroxybutirate (PHB was produced using a new culture medium developed by factorial mixture design, and the effectiveness of resulting inoculants was evaluated under field conditions. The culture medium formulation extended the log phase of A. brasilense cultures, which presented higher cell counts and increased EPS and PHB contents than observed in the cultures grown in the OAB medium used as control. An inoculation trial with maize conducted under greenhouse conditions and using the biopolymers-enriched Ab-V5 cells demonstrated the importance of EPS and PHB to the long term bacterial viability in soil and to the effectiveness of inoculation. The effectiveness of liquid and peat inoculants prepared with Ab-V5 cells enriched with EPS and PHB was also evaluated under field conditions, using maize as target crop along different seasons, with the inoculants applied directly over seeds or at topdressing under limiting levels of N-fertilization. No additive effect on yield resulted from inoculation under high N fertilizer input, while inoculated plants grown under 80% reduction in
Oliveira, André L. M.; Santos, Odair J. A. P.; Marcelino, Paulo R. F.; Milani, Karina M. L.; Zuluaga, Mónica Y. A.; Zucareli, Claudemir; Gonçalves, Leandro S. A.
2017-01-01
Although Azospirillum strains used in commercial inoculant formulations presents diazotrophic activity, it has been reported that their ability to produce phytohormones plays a pivotal role in plant growth-promotion, leading to a general recommendation of its use in association with regular N-fertilizer doses. In addition, a high variability in the effectiveness of Azospirillum inoculants is still reported under field conditions, contributing to the adoption of the inoculation technology as an additional management practice rather than its use as an alternative practice to the use of chemical inputs in agriculture. To investigate whether the content of stress-resistance biopolymers would improve the viability and performance of Azospirillum inoculants when used as substitute of N-fertilizers, biomass of A. brasilense strain Ab-V5 enriched in exopolysaccharides (EPS) and polyhydroxybutirate (PHB) was produced using a new culture medium developed by factorial mixture design, and the effectiveness of resulting inoculants was evaluated under field conditions. The culture medium formulation extended the log phase of A. brasilense cultures, which presented higher cell counts and increased EPS and PHB contents than observed in the cultures grown in the OAB medium used as control. An inoculation trial with maize conducted under greenhouse conditions and using the biopolymers-enriched Ab-V5 cells demonstrated the importance of EPS and PHB to the long term bacterial viability in soil and to the effectiveness of inoculation. The effectiveness of liquid and peat inoculants prepared with Ab-V5 cells enriched with EPS and PHB was also evaluated under field conditions, using maize as target crop along different seasons, with the inoculants applied directly over seeds or at topdressing under limiting levels of N-fertilization. No additive effect on yield resulted from inoculation under high N fertilizer input, while inoculated plants grown under 80% reduction in N fertilizer
Liu, Z; Meng, R; Zhao, X; Shi, C; Zhang, X; Zhang, Y; Guo, N
2016-12-01
Listeria monocytogenes (L. monocytogenes) is a Gram-positive bacterium that causes infections in humans. In this study, the effects of tea tree oil (TTO) at subinhibitory concentrations on L. monocytogenes growth and two important exotoxin proteins secreted by L. monocytogenes were researched. Treatment with half of minimal inhibitory concentration of TTO demonstrated very little or no reduction in numbers of viable ATCC 19115 cells. Listeriolysin O (LLO) and p60, were investigated. A listeriolysin assay was used to investigate the hemolytic activities of L. monocytogenes exposed to TTO, and the secretion of LLO and p60 was detected by immunoblot analysis. Additionally, real-time RT-PCR was used to analyse the influence of TTO on the transcription of LLO and p60 encoded genes hly and iap respectively. According to our experimental results, we propose that TTO could be used as a promising natural compound against L. monocytogenes and its virulence factors. This is the first report on the influence of subinhibitory concentrations of tea tree oil (TTO) on the secretion of listeriolysin O (LLO) and p60, the critical virulence factors involved in Listeria pathogenesis. The results showed that TTO at 0·25 mg ml -1 reduced the secretion of LLO and p60 to 10 and 34·9% respectively, in addtion, the transcription of hly and iap was reduced to 10 and 4·3% at 0·5 mg ml -1 respectively. We propose that TTO could be used as a promising antimicrobial compound and virulence inhibitor against L. monocytogenes. © 2016 The Society for Applied Microbiology.
Biofilm formation by Listeria monocytogenes on stainless steel surface and biotransfer potential
Directory of Open Access Journals (Sweden)
Maíra Maciel Mattos de Oliveira
2010-03-01
Full Text Available An experimental model was proposed to study biofilm formation by Listeria monocytogenes ATCC 19117 on AISI 304 (#4 stainless steel surface and biotransfer potential during this process. In this model, biofilm formation was conducted on the surface of stainless steel coupons, set on a stainless steel base with 4 divisions, each one supporting 21 coupons. Trypic Soy Broth was used as bacterial growth substrate, with incubation at 37 ºC and stirring of 50 rpm. The number of adhered cells was determined after 3, 48, 96, 144, 192 and 240 hours of biofilm formation and biotransfer potential from 96 hours. Stainless steel coupons were submitted to Scanning Electron Microscopy (SEM after 3, 144 and 240 hours. Based on the number of adhered cells and SEM, it was observed that L. monocytogenes adhered rapidly to the stainless steel surface, with mature biofilm being formed after 240 hours. The biotransfer potential of bacterium to substrate occurred at all the stages analyzed. The rapid capacity of adhesion to surface, combined with biotransfer potential throughout the biofilm formation stages, make L. monocytogenes a potential risk to the food industry. Both the experimental model developed and the methodology used were efficient in the study of biofilm formation by L. monocytogenes on stainless steel surface and biotransfer potential.
Biofilm formation by Listeria monocytogenes on stainless steel surface and biotransfer potential.
de Oliveira, Maíra Maciel Mattos; Brugnera, Danilo Florisvaldo; Alves, Eduardo; Piccoli, Roberta Hilsdorf
2010-01-01
An experimental model was proposed to study biofilm formation by Listeria monocytogenes ATCC 19117 on AISI 304 (#4) stainless steel surface and biotransfer potential during this process. In this model, biofilm formation was conducted on the surface of stainless steel coupons, set on a stainless steel base with 4 divisions, each one supporting 21 coupons. Trypic Soy Broth was used as bacterial growth substrate, with incubation at 37 °C and stirring of 50 rpm. The number of adhered cells was determined after 3, 48, 96, 144, 192 and 240 hours of biofilm formation and biotransfer potential from 96 hours. Stainless steel coupons were submitted to Scanning Electron Microscopy (SEM) after 3, 144 and 240 hours. Based on the number of adhered cells and SEM, it was observed that L. monocytogenes adhered rapidly to the stainless steel surface, with mature biofilm being formed after 240 hours. The biotransfer potential of bacterium to substrate occurred at all the stages analyzed. The rapid capacity of adhesion to surface, combined with biotransfer potential throughout the biofilm formation stages, make L. monocytogenes a potential risk to the food industry. Both the experimental model developed and the methodology used were efficient in the study of biofilm formation by L. monocytogenes on stainless steel surface and biotransfer potential.
Inuwa, A; Lunt, A; Czuprynski, C; Miller, G; Rankin, S A
2017-10-19
Although frozen dairy desserts have a strong record of safety, recent outbreaks of foodborne disease linked to ice creams have brought new attention to this industry. There is concern that small-scale frozen dessert equipment may not comply with or be reviewed against published comprehensive design and construction sanitation specifications (National Sanitation Foundation or 3-A sanitary standards). Equipment sanitary design issues may result in reduced efficacy of cleaning and sanitation, thus increasing the likelihood of postprocess contamination with pathogenic bacteria. In this context, and given that Listeria monocytogenes outbreaks are of great concern for the frozen dessert industry, a complementary study was conducted to evaluate the fate of L. monocytogenes in ice cream mix on a stainless steel surface. Our results showed that L. monocytogenes survived for up to 6 weeks at room temperature and 9 weeks at 4°C in contaminated ice cream on a stainless steel surface. Furthermore, chlorine- and acid-based surface sanitizers had no detrimental effect on the L. monocytogenes when used at a concentration and contact time (1 min) recommended by the manufacturer; significant reduction in CFU required 5 to 20 min of contact time.
78 FR 27939 - Draft Interagency Risk Assessment-Listeria monocytogenes
2013-05-13
... Listeria (L.) monocytogenes contamination of certain ready-to-eat (RTE) foods, for example cheese, deli... Scott, V.N., Survey of Listeria monocytogenes in ready-to-eat foods. Journal of Food Protection, 2003... monocytogenes in ready-to-eat processed meat and poultry collected in four FoodNet states in International...
Presence of Listeria monocytogenes in Mediterranean-Style Dry Fermented Sausages
Directory of Open Access Journals (Sweden)
Domenico Meloni
2015-03-01
Full Text Available The morphological, physiological and epidemiological features of L. monocytogenes, together with the severity of human listeriosis infections, make L. monocytogenes of particular concern for manufacturers of cold-stored “ready to eat” (RTE foods. L. monocytogenes has been isolated from a wide variety of RTE foods and is responsible for several outbreaks associated with the consumption of RTE meat, poultry, dairy, fish and vegetable products. Although L. monocytogenes is among the most frequently-detected pathogens in dry fermented sausages, these products could be included in the category of RTE products in which the growth of L. monocytogenes is not favored and have rarely been implicated in listeriosis outbreaks. However, L. monocytogenes is highly difficult to control in fermented sausage processing environments due to its high tolerance to low pH and high salt concentration. In many Mediterranean-style dry fermented sausages, an empirical application of the hurdle technology often occurs and the frequent detection of L. monocytogenes in these products at the end of ripening highlights the need for food business operators to properly apply hurdle technology and to control the contamination routes of L. monocytogenes in the processing plants. In the following, through an up-to-date review of (personal and un- published data, the main aspects of the presence of L. monocytogenes in Mediterranean-style dry fermented sausages will be discussed.
Presence of Listeria monocytogenes in Mediterranean-Style Dry Fermented Sausages.
Meloni, Domenico
2015-03-12
The morphological, physiological and epidemiological features of L. monocytogenes , together with the severity of human listeriosis infections, make L. monocytogenes of particular concern for manufacturers of cold-stored "ready to eat" (RTE) foods. L. monocytogenes has been isolated from a wide variety of RTE foods and is responsible for several outbreaks associated with the consumption of RTE meat, poultry, dairy, fish and vegetable products. Although L. monocytogenes is among the most frequently-detected pathogens in dry fermented sausages, these products could be included in the category of RTE products in which the growth of L. monocytogenes is not favored and have rarely been implicated in listeriosis outbreaks. However, L. monocytogenes is highly difficult to control in fermented sausage processing environments due to its high tolerance to low pH and high salt concentration. In many Mediterranean-style dry fermented sausages, an empirical application of the hurdle technology often occurs and the frequent detection of L. monocytogenes in these products at the end of ripening highlights the need for food business operators to properly apply hurdle technology and to control the contamination routes of L. monocytogenes in the processing plants. In the following, through an up-to-date review of (personal and un-) published data, the main aspects of the presence of L. monocytogenes in Mediterranean-style dry fermented sausages will be discussed.
Incorporation of Listeria monocytogenes strains in raw milk biofilms.
Weiler, Christiane; Ifland, Andrea; Naumann, Annette; Kleta, Sylvia; Noll, Matthias
2013-02-01
Biofilms develop successively on devices of milk production without sufficient cleaning and originate from the microbial community of raw milk. The established biofilm matrices enable incorporation of pathogens like Listeria monocytogenes, which can cause a continuous contamination of food processing plants. L. monocytogenes is frequently found in raw milk and non-pasteurized raw milk products and as part of a biofilm community in milk meters and bulk milk tanks. The aim of this study was to analyze whether different L. monocytogenes strains are interacting with the microbial community of raw milk in terms of biofilm formation in the same manner, and to identify at which stage of biofilm formation a selected L. monocytogenes strain settles best. Bacterial community structure and composition of biofilms were analyzed by a cloning and sequencing approach and terminal restriction fragment length polymorphism analysis (T-RFLP) based on the bacterial 16S rRNA gene. The chemical composition of biofilms was analyzed by Fourier transform infrared spectroscopy (FTIR), while settled L. monocytogenes cells were quantified by fluorescence in situ hybridization (FISH). Addition of individual L. monocytogenes strains to raw milk caused significant shifts in the biofilm biomass, in the chemical as well as in the bacterial community composition. Biofilm formation and attachment of L. monocytogenes cells were not serotype but strain specific. However, the added L. monocytogenes strains were not abundant since mainly members of the genera Citrobacter and Lactococcus dominated the bacterial biofilm community. Overall, added L. monocytogenes strains led to a highly competitive interaction with the raw milk community and triggered alterations in biofilm formation. Copyright © 2012 Elsevier B.V. All rights reserved.
Listeria monocytogenes as a vector for anti-cancer therapies.
LENUS (Irish Health Repository)
Tangney, Mark
2012-01-31
The intracellular pathogen Listeria monocytogenes represents a promising therapeutic vector for the delivery of DNA, RNA or protein to cancer cells or to prime immune responses against tumour-specific antigens. A number of biological properties make L. monocytogenes a promising platform for development as a vector for either gene therapy or as an anti-cancer vaccine vector. L. monocytogenes is particularly efficient in mediating internalization into host cells. Once inside cells, the bacterium produces specific virulence factors which lyse the vaculolar membrane and allow escape into the cytoplasm. Once in the cytosol, L. monocytogenes is capable of actin-based motility and cell-to-cell spread without an extracellular phase. The cytoplasmic location of L. monocytogenes is significant as this potentiates entry of antigens into the MHC Class I antigen processing pathway leading to priming of specific CD8(+) T cell responses. The cytoplasmic location is also beneficial for the delivery of DNA (bactofection) by L. monocytogenes whilst cell-to-cell spread may facilitate access of the vector to cells throughout the tumour. Several preclinical studies have demonstrated the ability of L. monocytogenes for intracellular gene or protein delivery in vitro and in vivo, and this vector has also displayed safety and efficacy in clinical trial. Here, we review the features of the L. monocytogenes host-pathogen interaction that make this bacterium such an attractive candidate with which to induce appropriate therapeutic responses. We focus primarily upon work that has led to attenuation of the pathogen, demonstrated DNA, RNA or protein delivery to tumour cells as well as research that shows the efficacy of L. monocytogenes as a vector for tumour-specific vaccine delivery.
Zarei, Mehdi; Maktabi, Siavash; Ghorbanpour, Masoud
2012-02-01
Although several etiological agents can be transmitted through seafood consumption, Listeria monocytogenes, Vibrio parahaemolyticus, Staphylococcus aureus, and Salmonella spp. are considered among the most important pathogens in terms of public health and disease. In this study, multiplex polymerase chain reaction (PCR), as a rapid and cost-effective method, was used to determine the prevalence of these pathogens in 245 samples of raw/fresh, frozen, and ready-to-eat (RTE) seafood products marketed in Iran. The prevalence of L. monocytogenes in raw/fresh fish and shrimp samples was 1.4%, whereas 2.9% of the raw/fresh fish and 7.1% of the shrimp samples were contaminated with V. parahaemolyticus. No contamination with L. monocytogenes and V. parahaemolyticus was found in frozen and RTE seafood products. The prevalence of S. aureus was found to be higher than other investigated pathogens. S. aureus was detected in 5% of the raw/fresh samples of fish and shrimp, 17.5% of the frozen, and 12.3% of the RTE samples. Further, our findings indicate that 2.9% of the fish samples, 4.3% of the shrimp samples, and 1.5% of the RTE samples were contaminated with Salmonella spp. Owing to the potential hazard of these pathogenic bacteria, multiplex PCR can provide a rapid and cost-effective method for the surveillance of these pathogens in seafood products.
Hingston, Patricia A; Stea, Emma C; Knøchel, Susanne; Hansen, Truelstrup
2013-10-01
This study investigated the effect of initial contamination levels, biofilm maturity and presence of salt and fatty food soils on desiccation survival of Listeria monocytogenes on stainless steel (SS) coupons. L. monocytogenes cultures grown (at 15 °C for 48 h) in Tryptic Soy Broth with 1% glucose (TSB-glu) containing either 0.5 or 5% (w/v) NaCl were re-suspended in TSB-glu containing either 0.5 or 5% NaCl and used to contaminate SS coupons at levels of 3.5, 5.5, and 7.5 log CFU/cm². Desiccation (at 15 °C for 20 days, 43% RH) commenced immediately (non-biofilm) or following biofilm formation (at 15 °C for 48 h, 100% RH). To study the impact of food lipids, non-biofilm L. monocytogenes cells were suspended in TSB-glu containing either canola oil (5-10%) or lard (20-60%) and desiccated as above on SS coupons. Following desiccation for 20 days, survivors decreased by 1.4-3.7 log CFU/cm² for non-biofilm L. monocytogenes cells. The contamination level had no significant (p > 0.05) effect on survival kinetics. SEM micrographs showed mature biofilms on coupons initially contaminated with 5.5 and 7.5 log CFU/cm². Mature biofilm cells were significantly (p biofilms formed by the lowest contamination level. Besides biofilm maturity/formation, previous osmoadaptation, exposure to lard (20-60%) or salt (5%) during desiccation significantly (p biofilms and salty or fatty soils on food contact surfaces. Copyright © 2013 Elsevier Ltd. All rights reserved.
McEgan, Rachel; Danyluk, Michelle D
2015-05-01
This study evaluated the efficacy of aqueous (aQUAT) and isopropyl alcohol-based quaternary ammonium (ipQUAT) sanitizers for reducing Salmonella spp., Escherichia coli O157:H7, or Listeria monocytogenes populations on peanut and pistachio shell pieces. Inoculated nutshells were mixed with QUAT sanitizers, water, or 70% ethanol and enumerated immediately or after incubation at 30 °C for 48 h. None of the treatments had any immediate effect on Salmonella or E. coli O157:H7 populations on the peanut or pistachio shells. L. monocytogenes populations declined immediately on the peanut and pistachio shells treated with aQUAT or ipQUAT. After incubation, Salmonella and E. coli O157:H7 populations increased significantly on the water- or aQUAT-treated peanut and pistachio shells. L. monocytogenes populations also increased significantly on the water- or aQUAT-treated peanut shells, but levels did not change on the water-treated pistachio shells and levels were just above the limit of detection on the aQUAT-treated pistachio shells. After treatment with ipQUAT and 48-h incubation, Salmonella and E. coli O157:H7 populations decreased to or below the limit of detection on both shell types; L. monocytogenes populations remained at or below the limit of detection on both shell types. Copyright © 2014 Elsevier Ltd. All rights reserved.
Zhang, Xiaoguang; Tsuji, Sachiko; Kitaoka, Hayato; Kobayashi, Hiroshi; Tamai, Mitsuru; Honjoh, Ken-Ichi; Miyamoto, Takahisa
2017-10-01
Detection of foodborne pathogens at very low levels is still a challenge. A custom-built multichannel surface plasmon resonance (SPR) biosensor and simultaneous enrichment broth (SEB) were used to develop a simultaneous detection method for 3 important foodborne pathogens, Escherichia coli O157:H7 (O157:H7), Salmonella enteritidis, and Listeria monocytogenes, at a very low level. These 3 foodborne pathogens at a very low level (14, 6, and 28 CFU/25 g (mL) for O157:H7, S. enteritidis, and L. monocytogenes, respectively) were inoculated in SEB and incubated at 37 ˚C for 24 h. Sample prepared from the simultaneous enrichment culture was analyzed using the multichannel SPR biosensor and sensor chip immobilized with polyclonal antibodies specific to each of the target pathogens. O157:H7, S. enteritidis, and L. monocytogenes in chicken were detected simultaneously at an inoculum dose of 14, 6, and 28 CFU/25 g, respectively. Our method using a custom-built multichannel SPR biosensor and enrichment in SEB is expected as a rapid and simultaneous detection method for low levels of O157:H7, S. enteritidis, and L. monocytogenes in food. Our method is expected as a rapid and simultaneous detection method for pathogens at very low levels. It has great potential for safety control of food and microbiological detection applications. © 2017 Institute of Food Technologists®.
Hingston, Patricia; Chen, Jessica; Dhillon, Bhavjinder K.; Laing, Chad; Bertelli, Claire; Gannon, Victor; Tasara, Taurai; Allen, Kevin; Brinkman, Fiona S. L.; Truelstrup Hansen, Lisbeth; Wang, Siyun
2017-01-01
The human pathogen Listeria monocytogenes is a large concern in the food industry where its continuous detection in food products has caused a string of recalls in North America and Europe. Most recognized for its ability to grow in foods during refrigerated storage, L. monocytogenes can also tolerate several other food-related stresses with some strains possessing higher levels of tolerances than others. The objective of this study was to use a combination of phenotypic analyses and whole genome sequencing to elucidate potential relationships between L. monocytogenes genotypes and food-related stress tolerance phenotypes. To accomplish this, 166 L. monocytogenes isolates were sequenced and evaluated for their ability to grow in cold (4°C), salt (6% NaCl, 25°C), and acid (pH 5, 25°C) stress conditions as well as survive desiccation (33% RH, 20°C). The results revealed that the stress tolerance of L. monocytogenes is associated with serotype, clonal complex (CC), full length inlA profiles, and the presence of a plasmid which was identified in 55% of isolates. Isolates with full length inlA exhibited significantly (p monocytogenes sequence types, a new inlA PMSC, and several connections between CCs and the presence/absence or variations of specific genetic elements. A whole genome single-nucleotide-variants phylogeny revealed sporadic distribution of tolerant isolates and closely related sensitive and tolerant isolates, highlighting that minor genetic differences can influence the stress tolerance of L. monocytogenes. Specifically, a number of cold and desiccation sensitive isolates contained PMSCs in σB regulator genes (rsbS, rsbU, rsbV). Collectively, the results suggest that knowing the sequence type of an isolate in addition to screening for the presence of full-length inlA and a plasmid, could help food processors and food agency investigators determine why certain isolates might be persisting in a food processing environment. Additionally, increased
Directory of Open Access Journals (Sweden)
Berkowitz Asaf
2009-07-01
Full Text Available Abstract Background Proventricular dilatation disease (PDD is a fatal disorder of psittacine birds worldwide. The disease is characterized by lymphoplasmacytic infiltration of the central and peripheral nervous systems, leading to gastrointestinal motility and/or central nervous system dysfunction. Recently, we detected a significant association between avian bornavirus (ABV infection and clinical signs of PDD in psittacines. However, it remains unclear whether ABV infection actually causes PDD. To address this question, we examined the impact of ABV inoculation on the cockatiel (Nymphicus hollandicus. Results Five cockatiels were inoculated via multiple routes (intramuscular, intraocular, intranasal, and oral with a brain homogenate derived from either a PDD(+ avian bornavirus 4 (ABV4 (+ case (n = 3 inoculees or from a PDD(- ABV(- control (n = 2 inoculees. The control birds remained free of clinical or pathological signs of PDD, and tested ABV(- by RT-PCR and immunohistochemistry (IHC. In contrast, all three cockatiels inoculated with ABV4(+ brain homogenate developed gross and microscopic PDD lesions, and two exhibited overt clinical signs. In numerous tissues, ABV RT-PCR and sequence analysis demonstrated the presence of ABV4 RNA nearly identical to that in the inoculum. ABV was detected in the central nervous system of the three ABV-inoculees by IHC. Pyrosequencing to investigate the viral flora in the ABV4(+ inoculum uncovered 7 unique reads sharing 73–100% nucleotide sequence identity with previously identified ABV sequences and 24 reads sharing 40–89% amino acid sequence identity with viruses in the Retroviridae and Astroviridae families. Of these candidate viral species, only ABV RNA was recovered from tissues of the inoculated birds. Conclusion In this study, the clinical and pathological manifestations of PDD were induced by inoculation of cockatiels with brain homogenates containing avian bornavirus 4. By using high throughput
International Nuclear Information System (INIS)
Fu, A.H.; Sebranek, J.G.; Murano, E.A.
1995-01-01
Beef steaks and ground beef were inoculated with Listeria monocytogenes, Yersinia enterocolitica, or Escherichia coli O157:H7. Samples were packaged in air or under vacuum and irradiated at low (0.60 to 0.80 kGy) or medium (1.5 to 2.0 kGy) doses, with each dose delivered at either a low (2.8 M/min conveyor speed) or high (6.9 M/min) dose rate. Medium-dose irradiation accompanied by 7 degrees C storage resulted in no Y. enterocolitica or E. coli O157:H7 survivors being detected. There was no effect on survival of the pathogens by dose rate or storage atmosphere. No difference (P0.05) was observed in meat pH or color, but TBA values increased after 7 days storage
Directory of Open Access Journals (Sweden)
Hain Torsten
2012-04-01
Full Text Available Abstract Background Listeria monocytogenes is a food-borne pathogen that causes infections with a high-mortality rate and has served as an invaluable model for intracellular parasitism. Here, we report complete genome sequences for two L. monocytogenes strains belonging to serotype 4a (L99 and 4b (CLIP80459, and transcriptomes of representative strains from lineages I, II, and III, thereby permitting in-depth comparison of genome- and transcriptome -based data from three lineages of L. monocytogenes. Lineage III, represented by the 4a L99 genome is known to contain strains less virulent for humans. Results The genome analysis of the weakly pathogenic L99 serotype 4a provides extensive evidence of virulence gene decay, including loss of several important surface proteins. The 4b CLIP80459 genome, unlike the previously sequenced 4b F2365 genome harbours an intact inlB invasion gene. These lineage I strains are characterized by the lack of prophage genes, as they share only a single prophage locus with other L. monocytogenes genomes 1/2a EGD-e and 4a L99. Comparative transcriptome analysis during intracellular growth uncovered adaptive expression level differences in lineages I, II and III of Listeria, notable amongst which was a strong intracellular induction of flagellar genes in strain 4a L99 compared to the other lineages. Furthermore, extensive differences between strains are manifest at levels of metabolic flux control and phosphorylated sugar uptake. Intriguingly, prophage gene expression was found to be a hallmark of intracellular gene expression. Deletion mutants in the single shared prophage locus of lineage II strain EGD-e 1/2a, the lma operon, revealed severe attenuation of virulence in a murine infection model. Conclusion Comparative genomics and transcriptome analysis of L. monocytogenes strains from three lineages implicate prophage genes in intracellular adaptation and indicate that gene loss and decay may have led to the emergence
Survival of Listeria monocytogenes in mozzarella cheese and ice cream exposed to gamma irradiation
International Nuclear Information System (INIS)
Hashisaka, A.E.; Weagant, S.D.; Dong, F.M.
1989-01-01
The survival of Listeria monocytogenes preinoculated into ice cream and mozzarella cheese prior to gamma-irradiation treatment was determined. Samples were maintained at -78 degrees C and exposed to targeted doses of 2, 4, 8, 16, and 32 kGy of gamma-irradiation. The calculated D10 values were 1.4 kGy for mozzarella cheese and 2.0 kGy for ice cream. The effective level of irradiation (12D) for inactivating L. monocytogenes was 16.8 kGy for mozzarella cheese and 24.4 kGy for ice cream
Irradiation of lettuce (Lactuca sativa. L.): microbiological and sensory aspects
International Nuclear Information System (INIS)
Tsuhako, Vanessa Provenzano
2005-01-01
The increasing demand for fresh foods have stimulated the marketing of minimally processed vegetables. However, these products maintain most of their natural microbiota even after being sanitized, including pathogenic microorganisms. Refrigerated storage allows the growth of psychotropic microorganisms and among them the pathogen Listeria monocytogenes. The ingestion of food contaminated with L. monocytogenes may represent a risk to pregnant women and their fetuses and to immunocompromised people. Non-thermal alternative processes for food preservation, such as irradiation, can reduce pathogenic and spoilage microorganism populations without impairing substantial changes in sensory, physical or chemical attributes. The aims of this research were to evaluate the effect of gamma radiation on L. monocytogenes artificially inoculated on minimally processed lettuce, to evaluate its effect on lettuce leaves through acceptance sensory test and to determine the irradiated vegetable shelf life through sensory and microbiological tests. A mixture of 4 types of lettuce (Iceberg, Boston, Loose-leaf and Red loose-leaf) were artificially inoculated with L. monocytogenes (7 log UFC/g lettuce) and then exposed to 0.3; 0.6; 0.9 and 1.2 kGy, under refrigeration. The DlO values for L. monocytogenes varied fram 0.18 to 0.21 kGy. Sensory and microbiological tests indicated that the shelf life of Iceberg lettuce stored at 7 deg C was 5 and 7 days for the irradiated and non-irradiated samples, respectively, and for the irradiated and non-irradiated Loose-leaf lettuce samples were 10 days. For the non-irradiated Boston sample, the shelf life was 3 days and for the Irradiated 7 days. Red loose-leaf showed 5 and 4 days of shelf lives for the irradiated and non-irradiated, respectively. Irradiated samples presented better microbiological quality than non-irradiated ones. The irradiation is feasible process to improve quality and safety of lettuce leaves. (author)
Energy Technology Data Exchange (ETDEWEB)
Tsuhako, Vanessa Provenzano
2005-07-01
The increasing demand for fresh foods have stimulated the marketing of minimally processed vegetables. However, these products maintain most of their natural microbiota even after being sanitized, including pathogenic microorganisms. Refrigerated storage allows the growth of psychotropic microorganisms and among them the pathogen Listeria monocytogenes. The ingestion of food contaminated with L. monocytogenes may represent a risk to pregnant women and their fetuses and to immunocompromised people. Non-thermal alternative processes for food preservation, such as irradiation, can reduce pathogenic and spoilage microorganism populations without impairing substantial changes in sensory, physical or chemical attributes. The aims of this research were to evaluate the effect of gamma radiation on L. monocytogenes artificially inoculated on minimally processed lettuce, to evaluate its effect on lettuce leaves through acceptance sensory test and to determine the irradiated vegetable shelf life through sensory and microbiological tests. A mixture of 4 types of lettuce (Iceberg, Boston, Loose-leaf and Red loose-leaf) were artificially inoculated with L. monocytogenes (7 log UFC/g lettuce) and then exposed to 0.3; 0.6; 0.9 and 1.2 kGy, under refrigeration. The DlO values for L. monocytogenes varied fram 0.18 to 0.21 kGy. Sensory and microbiological tests indicated that the shelf life of Iceberg lettuce stored at 7 deg C was 5 and 7 days for the irradiated and non-irradiated samples, respectively, and for the irradiated and non-irradiated Loose-leaf lettuce samples were 10 days. For the non-irradiated Boston sample, the shelf life was 3 days and for the Irradiated 7 days. Red loose-leaf showed 5 and 4 days of shelf lives for the irradiated and non-irradiated, respectively. Irradiated samples presented better microbiological quality than non-irradiated ones. The irradiation is feasible process to improve quality and safety of lettuce leaves. (author)
Alonso-Hernando, Alicia; Capita, Rosa; Alonso-Calleja, Carlos
2012-10-01
The potential of chemical decontaminants to cause harmful effects on human health is among the causes of the rejection of antimicrobial treatments for removing surface contamination from poultry carcasses in the European Union. This study was undertaken to determine whether decontaminants might give a competitive advantage to pathogenic bacteria on poultry and involve a potential risk to consumer. A total of 144 chicken legs were co-inoculated with similar concentrations of pathogenic bacteria (Listeria monocytogenes, Staphylococcus aureus, Salmonella enterica serotype Enteritidis or Escherichia coli) and spoilage bacteria (Brochothrix thermosphacta or Pseudomonas fluorescens). Samples were dipped for 15min in solutions (w/v) of trisodium phosphate (12%; TSP), acidified sodium chlorite (1200ppm; ASC), citric acid (2%; CA), peroxyacids (220ppm; PA) or chlorine dioxide (50ppm; CD), or were left untreated (control). Microbiological analyses were carried out on day 0 and every 24h until day 7 of storage (at 10±1°C). The modified Gompertz equation was used as the primary model to fit observed data. TSP, ASC and CA were effective in extending the lag phase (L, ranging from 1.47±1.34days to 4.06±1.16days) and in decreasing the concentration of bacteria during the stationary phase (D, ranging from 2.46±0.51 log(10) cfu/cm(2) to 8.64±0.53 log(10) cfu/cm(2)), relative to the control samples (L values ranging from 0.59±0.38days and 2.52±2.28days, and D values ranging from 6.32±0.89 log(10) cfu/cm(2) to 9.39±0.39 log(10) cfu/cm(2), respectively). Both on untreated and on most decontaminated samples the overgrowth of spoilage bacteria among the species tested was observed throughout storage, suggesting that spoilage would occur prior to any noteworthy increase in the levels of pathogenic microorganisms. However, L. monocytogenes counts similar to, or higher than, those for spoilage bacteria were observed on samples treated with TSP, ASC or CA, suggesting that these
Lee, S H I; Cappato, L P; Corassin, C H; Cruz, A G; Oliveira, C A F
2016-03-01
This research investigated the removal of adherent cells of 4 strains of Staphylococcus aureus and 1 Listeria monocytogenes strain (previously isolated from dairy plants) from polystyrene microtiter plates using peracetic acid (PAA, 0.5%) for 15, 30, 60, and 120 s, and the inactivation of biofilms formed by those strains on stainless steel coupons using the same treatment times. In the microtiter plates, PAA removed all S. aureus at 15 s compared with control (no PAA treatment). However, L. monocytogenes biofilm was not affected by any PAA treatment. On the stainless steel surface, epifluorescence microscopy using LIVE/DEAD staining (BacLight, Molecular Probes/Thermo Fisher Scientific, Eugene, OR) showed that all strains were damaged within 15 s, with almost 100% of cells inactivated after 30 s. Results of this trial indicate that, although PAA was able to inactivate both S. aureus and L. monocytogenes monospecies biofilms on stainless steel, it was only able to remove adherent cells of S. aureus from polystyrene microplates. The correct use of PAA is critical for eliminating biofilms formed by S. aureus strains found in dairy plants, although further studies are necessary to determine the optimal PAA treatment for removing biofilms of L. monocytogenes. Copyright © 2016 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Michela Ibba
2013-09-01
Full Text Available Listeria monocytogenes harbouring niches established in the processing plant support post-process contamination of dairy products made from pasteurised or thermised milk. The present study investigated L. monocytogenes environmental contamination in two sheep’s milk cheese-making plants. Persistence of contamination in the area at higher risk was also investigated. During a one-year survey 7 samplings were carried out in each dairy plant, along the production lines of Pecorino Romano and ricotta salata cheese. A total of 613 environmental samples collected from food contact and non-food contact surfaces were analysed according to ISO 11290-1:2005 standard method. Identification of the isolated strains was carried out by polymerase chain reaction. L. monocytogenes prevalence was 23.2% in dairy A and 13.1% in dairy B, respectively. The higher prevalence rate was found in the following areas: salting, products washing, packaging, ricotta salata storage and Pecorino Romano ripening rooms. L. monocytogenes was never found in the cheese-making area. The probability of observing samples positive for the presence of L. monocytogenes was asso- ciated with dairy plant, sampling area and the period of cheese-making (P<0.001. The greater persistence of contamination over time was observed in the washing, salting, and Pecorino Romano ripening areas. The control of persistent environmental contamination relies on the identification of L. monocytogenes niches within the processing environment and the prevention of harborage sites formation. The importance of strict cleaning and sanitising procedure in controlling L. monocytogenes environmental contamination is confirmed by the lower level of contamination observed after these procedures were correctly implemented.
Listeria monocytogenes repellence by enzymatically modified PES surfaces
Veen, van der S.; Nady, N.; Franssen, M.C.R.; Zuilhof, H.; Boom, R.M.; Abee, T.; Schroën, C.G.P.H.
2015-01-01
: The effect of enzyme-catalyzed modification of poly(ethersulfone) (PES) on the adhesion and biofilm formation of two Listeria monocytogenes strains is evaluated under static and dynamic flow conditions. PES has been modified with gallic acid, ferulic acid and 4-hydroxybenzoic acid. The surfaces
Pagliano, Pasquale; Ascione, Tiziana; Boccia, Giovanni; De Caro, Francesco; Esposito, Silvano
2016-06-01
Listeria monocytogenes is a Gram-positive bacillus and facultative intracellular bacterium whose transmission occurs mainly through the consumption of contaminated food, L. monocytogenes invades the host cells using various protein and can escape to the human T-cell immune system by cell-to-cell spreading. If the infection is not controlled at the stage in which the bacterium is in the liver, for instance, due to a severe immunodepression, a secondary bacteraemia can be developed and L. monocytogenes reaches the preferred sites transgressing the blood-brain barrier or the placental barrier. Individuals with T-cell dysfunction, such as pregnant women, the elderly, and those receiving immunosuppressive therapy are at the highest risk of contracting the disease. Average life expectancy throughout developed countries has rapidly increased during the latter half of the 20th century and geriatric infectious diseases have become an increasingly important issue. L. monocytogenes meningitis in young previously healthy adults has been reported only in anecdotal observations. Differently, L. monocytogenes is the third most common cause of bacterial meningitis in the elderly population, after Streptococcus pneumoniae and Neisseria meningitidis. Patients with L. monocytogenes meningitis presented with signs and symptoms that were similar to those of the general population with community-acquired bacterial meningitis, but reported a longer prodromal phase. According to literature data, the prevalence of the classic triad of fever, neck stiffness, and altered mental status is 43%, and almost all patients present with at least 2 of the 4 classic symptoms of headache, fever, neck stiffness, and altered mental status. On the basis of our published data, in patients aged over 50 years, diagnosing L. monocytogenes meningitis was more challenging than pneumococcal meningitis, as demonstrated by the lower percentage of cases receiving a correct diagnosis within 48 hours from the onset
[Listeria monocytogenes nosocomial infection in the maternity ward].
Jean, D; Croize, J; Hirtz, P; Legeais, C; Pelloux, I; Favier, M; Mallaret, M R; Le Noc, P; Rambaud, P
1991-01-01
Nosocomial infection with Listeria monocytogenes 4b occurred in January 1990 in a maternity hospital in Grenoble. The 3 patients involved were born within a 24 hour-interval. The premature newborn responsible for contamination was asymptomatic. Two other newborns without any perinatal infectious risk presented with meningitis, one on the 5th day of life in the maternity hospital, the other one on the 11th day while already at home. The 3 strains of Listeria had the same serovar and lysovar. Epidemiologic investigations led to suspect a contamination in the delivery room and during the care of the children. Strict respect of hygiene orders is imperative to avoid nosocomial infections.
Møretrø, Trond; Heir, Even; Briandet, Romain; Langsrud, Solveig
2017-01-01
ABSTRACT Surfaces of food processing premises are exposed to regular cleaning and disinfection (C&D) regimes, using biocides that are highly effective against bacteria growing as planktonic cells. However, bacteria growing in surface-associated communities (biofilms) are typically more tolerant toward C&D than their individual free-cell counterparts, and survival of pathogens such as Listeria monocytogenes may be affected by interspecies interactions within biofilms. In this study, Pseudomonas and Acinetobacter were the most frequently isolated genera surviving on conveyor belts subjected to C&D in meat processing plants. In the laboratory, Pseudomonas, Acinetobacter, and L. monocytogenes dominated the community, both in suspensions and in biofilms formed on conveyor belts, when cultures were inoculated with eleven-genus cocktails of representative bacterial strains from the identified background flora. When biofilms were exposed to daily C&D cycles mimicking treatments used in food industry, the levels of Acinetobacter and Pseudomonas mandelii diminished, and biofilms were instead dominated by Pseudomonas putida (65 to 76%), Pseudomonas fluorescens (11 to 15%) and L. monocytogenes (3 to 11%). The dominance of certain species after daily C&D correlated with high planktonic growth rates at 12°C and tolerance to C&D. In single-species biofilms, L. monocytogenes developed higher tolerance to C&D over time, for both the peracetic acid and quaternary ammonium disinfectants, indicating that a broad-spectrum mechanism was involved. Survival after C&D appeared to be a common property of L. monocytogenes strains, as persistent and sporadic subtypes showed equal survival rates in complex biofilms. Biofilms established preferentially in surface irregularities of conveyor belts, potentially constituting harborage sites for persistent contamination. IMPORTANCE In the food industry, efficient production hygiene is a key measure to avoid the accumulation of spoilage bacteria and
Fagerlund, Annette; Møretrø, Trond; Heir, Even; Briandet, Romain; Langsrud, Solveig
2017-06-30
Surfaces of food processing premises are exposed to regular cleaning and disinfection (C&D) regimes, using biocides that are highly effective against bacteria growing as planktonic cells. However, bacteria growing in surface associated communities (biofilms) are typically more tolerant towards C&D than their individual free cells counterparts, and survival of pathogens such as Listeria monocytogenes may be affected by interspecies interactions within biofilms. In this study, Pseudomonas and Acinetobacter were the most frequently isolated genera surviving on conveyor belts subjected to C&D in meat processing plants. In the laboratory, Pseudomonas , Acinetobacter and L. monocytogenes dominated the community both in suspensions and in biofilms formed on conveyor belts, when cultures were inoculated with eleven-genera cocktails of representative bacterial strains from the identified background flora. When biofilms were exposed to daily C&D cycles, mimicking treatments used in food industry, the levels of Acinetobacter and Pseudomonas mandelii diminished, and biofilms were instead dominated by Pseudomonas putida (65-76%), Pseudomonas fluorescens (11-15%) and L. monocytogenes (3-11%). The dominance of certain species after daily C&D correlated with high planktonic growth rates at 12°C and tolerance to C&D. In single-species biofilms, L. monocytogenes developed higher tolerance to C&D over time, both for the peracetic acid and quaternary ammonium disinfectant, indicating that a broad-spectrum mechanism was involved. Survival after C&D appeared to be a common property of L. monocytogenes strains, as both persistent and sporadic subtypes showed equal survival in complex biofilms. Biofilms established preferentially in surface irregularities of conveyor belts, potentially constituting harborage sites for persistent contamination. IMPORTANCE In food industry, efficient production hygiene is a key measure to avoid accumulation of spoilage bacteria and eliminate pathogens
Antimicrobial food packaging film based on the release of LAE from EVOH.
Muriel-Galet, Virginia; López-Carballo, Gracia; Gavara, Rafael; Hernández-Muñoz, Pilar
2012-07-02
The aim of this work was to develop antimicrobial films for active packaging applications containing the natural antimicrobial compound LAE (lauramide arginine ethyl ester) in EVOH copolymers with different mol % ethylene contents (i.e. EVOH-29 and EVOH-44). EVOH-29 and EVOH-44 films were made by casting and incorporating 0.25%, 1%, 5%, and 10% LAE in the film forming solution (w/w with respect to polymer weight). Previously, the minimum inhibitory concentration (MIC) and the minimum bactericidal concentration (MBC) of LAE against Listeria monocytogenes, Escherichia coli, and Salmonella enterica were determined by a microdilution assay. The antimicrobial activity of the resulting films was tested in vitro against these microorganisms in liquid culture media. The activity of the films was also evaluated over time. The results showed that films containing 5% and 10% LAE produced total growth inhibition and viable counts decreased with 0.25% and 1% LAE. Finally, the effectiveness of the films was tested by applying them to an infant formula milk inoculated with L. monocytogenes and S. enterica and stored for 6 days at 4°C. The application of films with LAE to infant formula milk inoculated with L. monocytogenes reduced at the end of storage period about 4 log in case of 10% LAE and with S. enterica reduced 3.74 log and 3.95 log with EVOH 29 5% and 10%, respectively, and EVOH-44 5% and 10% LAE reduced 1 log and 3.27 log, respectively, at the end of storage. The antimicrobial capacity of EVOH-29 films was greater than that of EVOH-44 films in all the cases tested. In general, the films were more effective in inhibiting the growth of L. monocytogenes than S. enterica, this inhibition being more acute at the end of the storage time. Copyright © 2012 Elsevier B.V. All rights reserved.
Mahmoud, Barakat S M
2012-10-01
This work is a part of systematic studies of the effect of X-ray treatments on fresh produce. The main objective of this investigation was to study the effects of X-ray treatments in reducing the concentration of artificially inoculated Escherichia coli O157:H7, Listeria monocytogenes, Salmonella enterica, and Shigella flexneri, and inherent microbiota on parsley leaves. The secondary objective was to study the effects of X-ray treatments on color and texture parameters on treated parsley leaves. The Dip-inoculated method was used to inoculate parsley leaves with a mixture of two or three strains of each tested organism at 10(8) to 10(9) colony-forming unit (CFU)/mL; the inoculated parsley leaves were then air-dried and followed by treatment with different doses of X-ray (0, 0.1, 0.5, 1.0, and 1.5 kGy) at 22°C and 55-60% relative humidity. Surviving bacterial populations on parsley leaves were evaluated using a nonselective medium (tryptic soy agar) with a selective medium overlay for each bacterium: E. coli O157:H7 (CT-SMAC agar), L. monocytogenes (MOA), and S. enterica and S. flexneri (XLD). Approximately 5.8, 3.1, 5.7, and 5.2 log CFU reductions of E. coli O157:H7, L. monocytogenes, S. enterica, and Shigella flexneri were achieved by treatment with 1.0 kGy X-ray, respectively. Furthermore, the populations of E. coli O157:H7, L. monocytogenes, S. enterica, and Shigella flexneri were reduced to less than the detectable limit (1.0 log CFU/g) by treatment with 1.5 kGy X-ray. Treatment with 1.5 kGy X-ray significantly reduced the initial inherent microbiota on parsley leaves, and inherent levels were significantly (p 0.05) in color or texture of control and treated samples with 0.1-1.5 X-ray were observed. The results of investigation indicated that X-ray is an effective technology to eliminate E. coli O157:H7, L. monocytogenes, S. enterica, and Shigella flexneri, and to extend the shelf life of parsley leaves.
Directory of Open Access Journals (Sweden)
Bahador
2015-08-01
Full Text Available Background Listeria monocytogenes is a foodborne pathogen and a serious threat to the public health in the world. Consumption of traditional foods such as dairy and meat products can be a major reason for relative abundance and isolation of these bacteria. Objectives The purpose of this study was to determine the phenotypic and genotypic characteristics of L. monocytogenes strains isolated from dairy and meat products. Materials and Methods A total of 317 dairy products and meat-processed samples were collected. Antibiotic susceptibility test was performed on each sample by the disk diffusion method (Kirby Bauer. Five reference loci were used for typing of L. monocytogenes strains by MLVA (Multiple Locus VNTR Analysis Technique. Results A total of 24 L. monocytogenes isolates were collected from the dairy and meat products. Resistance of isolated L. monocytogenes strains to penicillin G were 54.54% (from dairy products and 46.15% (from processed meat. Genetic relatedness of isolates were assessed by MLVA. Out of 13 different types, type 2 with 6 strains and type 3 with 4 strains, were the most common types. Conclusions MLVA analysis showed that samples obtained from different sources could have similar genetic profile. As a result, administration of penicillin in patients with listeriosis (especially pregnant women and antibiotic susceptibility test are recommended. The fast and accurate methods such as MLVA for tracking of pollution sources of L. monocytogenes are recommended during outbreaks.
Mechanistic studies of the agmatine deiminase from Listeria monocytogenes.
Soares, Charles A; Knuckley, Bryan
2016-06-01
Listeria monocytogenes is a Gram-positive food-borne pathogen that is capable of living within extreme environments (i.e. low temperatures and pH). This ability to survive in such conditions may arise, at least in part, from agmatine catabolism via the agmatine deiminase system (AgDS). This catabolic pathway utilizes an agmatine deiminase (AgD) to hydrolyse agmatine into N-carbamoylputrescine (NCP), with concomitant release of ammonia, which increases the pH, thus mitigating the ill effects of the acidic environment. Given the potential significance of this pathway for cell survival, we set out to study the catalytic mechanism of the AgD encoded by L. monocytogenes In the present paper, we describe the catalytic mechanism employed by this enzyme based on pH profiles, pKa measurements of the active site cysteine and solvent isotope effects (SIE). In addition, we report inhibition of this enzyme by two novel AgD inhibitors, i.e. N-(4-aminobutyl)-2-fluoro-ethanimidamide (ABFA) and N-(4-aminobutyl)-2-chloro-ethanimidamide (ABCA). In contrast with other orthologues, L. monocytogenes AgD does not use the reverse protonation or substrate-assisted mechanism, which requires an active site cysteine with a high pKa and has been commonly seen in other members of the guanidinium-modifying enzyme (GME) superfamily. Instead, the L. monocytogenes AgD has a low pKa cysteine in the active site leading to an alternative mechanism of catalysis. This is the first time that this mechanism has been observed in the GME superfamily and is significant because it explains why previously developed mechanism-based inactivators of AgDs are ineffective against this orthologue. © 2016 The Author(s). published by Portland Press Limited on behalf of the Biochemical Society.
Studer, Patrick; Heller, Werner E.; Hummerjohann, Jörg
2013-01-01
Sprouts contaminated with human pathogens are able to cause food-borne diseases due to the favorable growth conditions for bacteria during germination and because of minimal processing steps prior to consumption. We have investigated the potential of hot humid air, i.e., aerated steam, to treat alfalfa and mung bean seeds which have been artificially contaminated with Escherichia coli O157:H7, Salmonella enterica subsp. enterica serovar Weltevreden, and Listeria monocytogenes Scott A. In addition, a recently collected E. coli O178:H12 isolate, characterized by a reduced heat sensitivity, was exposed to the treatment described. Populations of E. coli O157:H7 and S. enterica on alfalfa and mung bean seeds could be completely eliminated by a 300-s treatment with steam at 70 ± 1°C as revealed by enrichment studies. L. monocytogenes and E. coli O178:H12 could not be completely eliminated from artificially inoculated seeds. However, bacterial populations were reduced by more than 5 log CFU/g on alfalfa and by more than 4 log CFU/g on mung bean seeds. The germination rate of mung beans was not affected by the 300-s treatment compared to the germination rate of untreated seeds whereas that of alfalfa seeds was significantly lower by 11.9%. This chemical-free method is an effective alternative to the 20,000-ppm hypochlorite treatment presently recommended by the U.S. Food and Drug Administration (FDA). PMID:23709507
Schrama, D; Helliwell, N; Neto, L; Faleiro, M L
2013-06-01
The aim of this study was to evaluate the effect of the acid and salt adaptation in a cheese-based medium on the virulence potential of Listeria monocytogenes strains isolated from cheese and dairy processing environment using the Galleria mellonella model. Four L. monocytogenes strains were exposed to a cheese-based medium in conditions of induction of an acid tolerance response and osmotolerance response (pH 5·5 and 3·5% w/v NaCl) and injected in G. mellonella insects. The survival of insects and the L. monocytogenes growth kinetics in insects were evaluated. The gene expression of hly, actA and inlA genes was determined by real-time PCR. The adapted cells of two dairy strains showed reduced insect mortality (P 0·05) was found between adapted and nonadapted cells. The gene expression results evidenced an overexpression of virulence genes in cheese-based medium, but not in simulated insect-induced conditions. Our results suggest that adaptation to low pH and salt in a cheese-based medium can affect the virulence of L. monocytogenes, but this effect is strain dependent. In this study, the impact of adaptation to low pH and salt in a cheese-based medium on L. monocytogenes virulence was tested using the Wax Moth G. mellonella model. This model allowed the differentiation of the virulence potential between the L. monocytogenes strains. The effect of adaptation on virulence is strain dependent. The G. mellonella model revealed to be a prompt method to test food-related factors on L. monocytogenes virulence. © 2013 The Society for Applied Microbiology.
DEFF Research Database (Denmark)
Piercey, Marta J.; C. Ells, Timothy; Macintosh, Andrew J.
2017-01-01
needed to inhibit the formation of biofilm by LGI1/CC8 strains during incubation for 48 h and 6 days compared to other strains. Formation of biofilm on stainless steel was not significantly (p > 0.05) different among the strains. Analysis of genetic sequence data from desiccation and BAC sensitive (CP4 5......Listeria monocytogenes is a pathogenic foodborne microorganism noted for its ability to survive in the environment and food processing facilities. Survival may be related to the phenotype of individual strains including the ability to form biofilms and resist desiccation and/or sanitizer exposure....... The objectives of this research were to compare 14 L. monocytogenes strains isolated from blood (3), food (6) and water (5) with respect to their benzalkonium chloride (BAC) sensitivity, desiccation resistance, and ability to form biofilm. Correlations were tested between those responses, and the presence...
Directory of Open Access Journals (Sweden)
Vodnar Dan C
2012-07-01
Full Text Available Abstract Background The consumer demands for better quality and safety of food products have given rise to the development and implementation of edible films. The use of antimicrobial films can be a promising tool for controlling L. monocytogenes on ready to eat products. The aim of this study was to develop effective antimicrobial films incorporating bioactive compounds from green and black teas into chitosan, for controlling L. monocytogenes ATCC 19115 on vacuum-packaged ham steak. The effectiveness of these antimicrobial films was evaluated at room temperature (20°C for 10 days and at refrigerated temperature (4°C for 8 weeks. Results The HPLC results clearly show that relative concentrations of catechins and caffeine in green tea ranked EGCG>EGC>CAF>ECG>EC>C while in black tea extracts ranked CAF>EGCG>ECG>EGC>EC>C. The chitosan-coated plastic films incorporating green tea and black tea extracts shows specific markers identified by FTIR. Incorporating natural extracts into chitosan showed that the growth of L monocytogenes ATCC 19115 was inhibited. The efficacy of antimicrobial effect of tea extracts incorporated into chitosan-coated plastic film was dose dependent. However, chitosan-coated films without addition of tea extracts did not inhibit the growth of L. monocytogenes ATCC 19115. Chitosan-coated plastic films incorporating 4% Green tea extract was the most effective antimicrobial, reducing the initial counts from 3.2 to 2.65 log CFU/cm2 during room temperature storage and from 3.2 to 1–1.5 log CFU/cm2 during refrigerated storage. Conclusions Incorporation of tea extracts into the chitosan-coated films considerably enhanced their effectiveness against L. monocytogenes ATCC 19115. 4% Green tea incorporated into chitosan-coated plastic film had a better antilisterial effect than 2% green tea or 2% and 4% black tea. Data from this study would provide new formulation options for developing antimicrobial packaging films using tea
Schirmer, B C T; Heir, E; Møretrø, T; Skaar, I; Langsrud, S
2013-10-01
The background microbiota of 5 Norwegian small-scale cheese production sites was examined and the effect of the isolated strains on the growth and survival of Listeria monocytogenes was investigated. Samples were taken from the air, food contact surfaces (storage surfaces, cheese molds, and brine) and noncontact surfaces (floor, drains, and doors) and all isolates were identified by sequencing and morphology (mold). A total of 1,314 isolates were identified and found to belong to 55 bacterial genera, 1 species of yeast, and 6 species of mold. Lactococcus spp. (all of which were Lactococcus lactis), Staphylococcus spp., Microbacterium spp., and Psychrobacter sp. were isolated from all 5 sites and Rhodococcus spp. and Chryseobacterium spp. from 4 sites. Thirty-two genera were only found in 1 out of 5 facilities each. Great variations were observed in the microbial background flora both between the 5 producers, and also within the various production sites. The greatest diversity of bacteria was found in drains and on rubber seals of doors. The flora on cheese storage shelves and in salt brines was less varied. A total of 62 bacterial isolates and 1 yeast isolate were tested for antilisterial activity in an overlay assay and a spot-on-lawn assay, but none showed significant inhibitory effects. Listeria monocytogenes was also co-cultured on ceramic tiles with bacteria dominating in the cheese production plants: Lactococcus lactis, Pseudomonas putida, Staphylococcus equorum, Rhodococcus spp., or Psychrobacter spp. None of the tested isolates altered the survival of L. monocytogenes on ceramic tiles. The conclusion of the study was that no common background flora exists in cheese production environments. None of the tested isolates inhibited the growth of L. monocytogenes. Hence, this study does not support the hypothesis that the natural background flora in cheese production environments inhibits the growth or survival of L. monocytogenes. Copyright © 2013 American
Marwati, T.; Cahyaningrum, N.; Widodo, S.; Januarsyah, T.; Purwoko
2018-01-01
Bacteriocin is a protein compound which has bactericidal ability against pathogen bacteria. This research aims to study the inhibitory activity of bacteriocin produced from Lactobacillus SCG 1223 against Listeria monocytogenes, Salmonella thypimuruim and Escherchia coli. The bacteriocin produce from Lactobacillus SCG 1223 in the MRS broth media The experimental design used was Completely Randomized Design. The variations used in this design were percentage of inoculum (5%, 10%), medium pH (4, 6), incubation temperature (27°C, 40°C), and incubation time (4, 10, 14 hours). Result showed that bacteriocin from Lactobacillus SCG 1223 had wide spectrum toward L. monocytogenes, S. thypimuruim and E. coli. The highest bacteriocin activity toward L. monocytogenes produced by Lactobacillus SCG 1223 with 10% inoculum in media with initial pH 6, incubation temperature 27°C for 14 hour, toward S. thypimurium produced by Lactobacillus SCG 1223 with in media with initial pH 6, incubation temperature 40°C for 14 hour, and toward E. coli was 1085.81 AU/ml, produced by Lactobacillus SCG 1223 in MRS broth with initial pH 4, incubation temperature 40°C for 14 hour. This study is expected to find a new food preservative that can inhibit the growth of pathogenic bacteria and extend the shelf life of food. From the economic prospective of view, bacteriocin is very promising natural alternative biopreservatives.
DEFF Research Database (Denmark)
Mejlholm, Ole; Dalgaard, Paw
2015-01-01
. using the classical Jameson effect to model microbial interaction. Maximum population density (MPD) values of L. monocytogenes were accurately predicted in processed seafood with a known initial cell concentration of Lactobacillus spp. For these experiments, average MPD values of 4.5 and 4.3 log (cfu...
DEFF Research Database (Denmark)
Olesen, Inger; Vogensen, Finn Kvist; Jespersen, Lene
2009-01-01
transcription were observed both after exposure to shock (six genes) and after long-term adaptation to stress (18 genes). In the shock experiments, a transient induction of clpC and clpE was seen for both strains, while transient induction of sigB, inlA, and inlB was observed for strain 4140 only; actA was only...... induced in EGD-e after NaCl shock. The longterm stress experiments were included to imitate the stress conditions encountered by L. monocytogenes when present in food products. Long-term adaptation of EGD-e to acidic stress induced transcription of iap and repressed flaA, while genes related to stress......Gene transcription and virulence potential of two strains of Listeria monocytogenes, EGD-e and 4140, were compared by quantitative real-time polymerase chain reaction and in a Caco-2 in vitro model after exposure to acidic (pH 5.5) and NaCl (4.5% w=v) stress. Strain-dependent differences in gene...
Listeria monocytogenes associated kerato-conjunctivitis in four horses in Norway.
Revold, Tobias; Abayneh, Takele; Brun-Hansen, Hege; Kleppe, Signe L; Ropstad, Ernst-Otto; Hellings, Robert A; Sørum, Henning
2015-11-09
Listeria monocytogenes has been reported to cause various infectious diseases in both humans and animals. More rarely, ocular infections have been reported. To our knowledge, only two cases of Listeria keratitis have been described in horses. We report kerato-conjunctivitis in four Norwegian horses associated with L. monocytogenes. Clinically, all cases were presented with recurrent unilateral kerato-conjunctivitis. L. monocytogenes bacteria were isolated from swab samples from all cases, and cytology carried out in 3 cases was indicative of L. monocytogenes infection. The present report describes the first known cases in which L. monocytogenes has been isolated from keratitic lesions in horses in Norway. A potential risk factor may be feeding of silage or haylage, but other sources of infection cannot be ruled out. The phenotypic features including antimicrobial susceptibility and serotype of the isolates are described. Laboratory detection of L. monocytogenes demands extra caution since only low numbers of bacteria were detected in the eye-swabs, probably due to the low volume of sample material and the intracellular niche of the bacterium. A general poor response to treatment in all these cases indicates that clinicians should pay extra attention to intensity and duration of treatment if L. monocytogenes is identified in connection with equine kerato-conjunctivitis.
Yoo, S; Ghafoor, K; Kim, S; Sun, Y W; Kim, J U; Yang, K; Lee, D-U; Shahbaz, H M; Park, J
2015-09-01
The aim of this study was to study inactivation of different pathogenic bacteria on agar model surface using TiO2-UV photocatalysis (TUVP). A unified food surface model was simulated using Bacto(™) agar, a routinely used microbial medium. The foodborne pathogenic bacteria Escherichia coli K12 (as a surrogate for E. coli O157:H7), Salmonella Typhimurium, Staphylococcus aureus and Listeria monocytogenes were inoculated onto the agar surface, followed by investigation of TUVP-assisted inactivation and morphological changes in bacterial cells. The TUVP process showed higher bacterial inactivation, particularly for Gram-negative bacteria, than UVC alone and a control (dark reaction). A TUVP treatment of 17·2 mW cm(-2) (30% lower than the UVC light intensity) reduced the microbial load on the agar surface by 4·5-6·0 log CFU cm(-2). UVC treatment of 23·7 mW cm(-2) caused 3·0-5·3 log CFU cm(-2) reduction. The use of agar model surface is effective for investigation of bacterial disinfection and TUVP is a promising nonthermal technique. The results showing effects of photocatalysis and other treatments for inactivation of bacterial pathogens on model surface can be useful for applying such processes for disinfection of fruit, vegetables and other similar surfaces. © 2015 The Society for Applied Microbiology.
Casco, Gerardo; Johnson, Jennifer L; Taylor, T Matthew; Gaytán, Carlos N; Brashears, Mindy M; Alvarado, Christine Z
2015-01-01
This study evaluated the efficacy of organic acids applied singly or in combination as postlethality dips to sliced uncured turkey deli loaves to inhibit the growth of Listeria monocytogenes (Lm) Scott A. Treatments consisted of sodium lactate (SL; 3.6%), potassium lactate (PL; 3.6%), sodium citrate (SC; 0.75%), a combination of SL and sodium diacetate (SDA; 0.25%), and a combination of SL/PL/SDA, alongside appropriate negative and positive controls. Products were inoculated with 10(4)-10(5) CFU/mL streptomycin-resistant (1500 μg/mL) Lm Scott A prior to treatment. Products were then stored at ~4°C and sampled at 0, 7, 14, 21, 28, 42, and 56 d. The SL/SDA combination applied to turkey slices extended the lag phase through 21 days of refrigerated storage. Numbers of Lm Scott A rose by 0.7 log10 CFU/g through the 56 d storage period. The application of the SL/PL/SDA treatment to turkey product surfaces extended the lag phase through 42 d, with pathogen numbers declining after 21 d. Combination organic acid dips prolonged the lag phase for 2 to 6 wk on turkey product surfaces and can be useful as antimicrobial agents for Lm control on postlethality exposed sliced deli products.
Wang, Hong; Luo, Lijuan; Zhang, Zhengdong; Deng, Jianping; Wang, Yan; Miao, Yimao; Zhang, Ling; Chen, Xi; Liu, Xiang; Sun, Songsong; Xiao, Bo; Li, Qun; Ye, Changyun
2018-02-01
This study aimed to investigate the prevalence and molecular characteristics of Listeria monocytogenes in cooked products in Zigong City, China. The overall occurrence of the L. monocytogenes in the ready-to-eat (RTE) shops and mutton restaurants surveyed was 16.2% (141/873). An occurrence of 13.5% was observed in RTE pork, 6.5% in RTE vegetables, and more than 24.0% in either cooked mutton or cooked haggis. Serotype 1/2b (45.4%), 1/2a (33.3%), and 1/2c (14.2%) were the predominant types. By comparing the clonal complexes (CCs) based on multilocus sequence typing (MLST) of the L. monocytogenes from cooked foods in Zigong City and 33 listeriosis cases from different districts of China, CC87, CC9, CC8, and CC3 were showed to be prevalent in cooked products and CC87 and CC3 were the first two frequent types in the 33 clinic-source strains. All CC87 stains harbored the newly reported Listeria pathogenicity island 4 (LIPI-4) gene fragment ptsA, and all CC3 strains possessed the Listeria pathogenicity island 3 (LIPI-3) gene fragment llsX. These may increase the occurrence of the strains belonging to CC87 and CC3 in listeriosis cases in China and also underline the risk of infection owing to the consumption of the cooked products from Zigong. ST619 (serotype 1/2b) harbored both llsX and ptsA, indicating a potential hypervirulent sequence type in Zigong.
Directory of Open Access Journals (Sweden)
Ana Espinoza M
2004-04-01
Full Text Available Objetivo: Determinar la presencia de L. monocytogenes en quesos frescos de producción artesanal expendidos en los mercados de Ica durante el periodo enero - marzo de 2003. Material y Métodos: De la totalidad de los puestos que expenden queso fresco artesanal en los mercados Santo Domingo, Alejandro Toledo, San Antonio y Modelo, se evaluaron 74 muestras teniendo como unidad muestral 200 g según la Norma Técnica Peruana ISO 28329-1. El procesamiento, aislamiento e identificación se realizó de acuerdo con la metodología recomendada por el manual de bacteriología analítica de la Food and Drug Administration (FDA. Resultados: De las 74 muestras, 3 (4,05% presentaban L. monocytogenes, y de ellas, una muestra correspondió al mercado Alejandro Toledo y 2 muestras al mercado Modelo. Se logró aislar 28 cepas de las cuales 6 (21,4% correspondieron a L. monocytogenes, y 22 (78,6% a otros microorganismos como Lactococcus lactis ss lactis, Enterococcus spp. y Bacillus spp. No se logró aislar L. monocytogenes en los mercados Santo Domingo y San Antonio; sin embargo, en el mercado Alejandro Toledo se aisló una cepa y en el mercado Modelo, se aislaron 5 cepas, lo cual demuestra la presencia significativa de L. monocytogenes sólo en el mercado Modelo. Conclusiones: Existe L. monocytogenes en quesos frescos de producción artesanal, representando un riesgo potencial para la población consumidora.
Barancelli, Giovana V; Camargo, Tarsila M; Gagliardi, Natália G; Porto, Ernani; Souza, Roberto A; Campioni, Fabio; Falcão, Juliana P; Hofer, Ernesto; Cruz, Adriano G; Oliveira, Carlos A F
2014-03-03
This study aimed to evaluate the occurrence of Listeria monocytogenes in cheese and in the environment of three small-scale dairy plants (A, B, C) located in the Northern region state of São Paulo, Brazil, and to characterize the isolates using conventional serotyping and PFGE. A total of 393 samples were collected and analyzed from October 2008 to September 2009. From these, 136 came from dairy plant A, where only L. seeligeri was isolated. In dairy plant B, 136 samples were analyzed, and L. innocua, L. seeligeri and L. welshimeri were isolated together with L. monocytogenes. In dairy plant C, 121 samples were analyzed, and L. monocytogenes and L. innocua were isolated. Cheese from dairy plants B and C were contaminated with Listeria spp, with L. innocua being found in Minas frescal cheese from both dairy plants, and L. innocua and L. monocytogenes in Prato cheese from dairy plant C. A total of 85 L. monocytogenes isolates were classified in 3 serotypes: 1/2b, 1/2c, and 4b, with predominance of serotype 4b in both dairy plants. The 85 isolates found in the dairy plants were characterized by genomic macrorestriction using ApaI and AscI with Pulsed Field Gel Electrophoresis (PFGE). Macrorestriction yielded 30 different pulsotypes. The presence of indistinguishable profiles repeatedly isolated during a 12-month period indicated the persistence of L. monocytogenes in dairy plants B and C, which were more than 100 km away from each other. Brine used in dairy plant C contained more than one L. monocytogenes lineage. The routes of contamination were identified in plants B and C, and highlighted the importance of using molecular techniques and serotyping to track L. monocytogenes sources of contamination, distribution, and routes of contamination in dairy plants, and to develop improved control strategies for L. monocytogenes in dairy plants and dairy products. Copyright © 2013 Elsevier B.V. All rights reserved.
Pricope-Ciolacu, Luminita; Nicolau, Anca Ioana; Wagner, Martin; Rychli, Kathrin
2013-08-16
Nearly all cases of human listeriosis have been associated with consumption of contaminated food, therefore the investigation of the virulence of Listeria (L.) monocytogenes after exposure to environmental conditions in food matrices is critical in order to understand and control its impact on public health. As milk and dairy products have been implicated in more than half of the listeriosis outbreaks, we investigated the in vitro virulence of L. monocytogenes incubated in different milk types at various storage conditions. Incubation in pasteurized milk at refrigeration conditions (4°C) revealed a higher invasion and intracellular proliferation of four different L. monocytogenes strains compared to raw milk using human intestinal epithelial Caco-2 cells. Furthermore the period of storage, which increased L. monocytogenes cell numbers, decreased in vitro virulence. However, L. monocytogenes stored for 3weeks at 4°C in milk are still able to invade and proliferate into the host cell. Interestingly abused storage temperatures (25°C and 30°C) for a short time period (2h) revealed an attenuated impact on the in vitro virulence of L. monocytogenes compared to the storage temperature of 4°C. Regarding the major milk compounds, the level of milk fat significantly affected the in vitro virulence of L. monocytogenes. Pre-incubation in milk with high fat content (3.6%) resulted in a lower invasion capability compared to milk with low fat content. In contrast casein and lactose did not influence the invasiveness of L. monocytogenes into the host cell. In conclusion our study shows that the milk environment and different storage conditions influence the in vitro virulence of L. monocytogenes, both of which have to be considered in the risk assessment of contaminated food. Copyright © 2013 Elsevier B.V. All rights reserved.
Guerini, Michael N; Brichta-Harhay, Dayna M; Shackelford, T Steven D; Arthur, Terrance M; Bosilevac, Joseph M; Kalchayanand, Norasak; Wheeler, Tommy L; Koohmaraie, Mohammad
2007-11-01
Listeria monocytogenes, the causative agent of epidemic and sporadic listeriosis, is routinely isolated from many sources, including cattle, yet information on the prevalence of Listeria in beef processing plants in the United States is minimal. From July 2005 through April 2006, four commercial cow and bull processing plants were sampled in the United States to determine the prevalence of Listeria and the serovar diversity of L. monocytogenes. Samples were collected during the summer, fall, winter, and spring. Listeria prevalence on hides was consistently higher during cooler weather (28 to 92% of samples) than during warmer weather (6 and 77% of samples). The Listeria prevalence data collected from preevisceration carcass ranged from undetectable in some warm season samples to as high as 71% during cooler weather. Listeria on postintervention carcasses in the chill cooler was normally undetectable, with the exception of summer and spring samples from one plant where > 19% of the carcasses were positive for Listeria. On hides, L. monocytogenes serovar 1/2a was the predominant serovar observed, with serovars 1/2b and 4b present 2.5 times less often and serovar 1/2c not detected on any hides sampled. L. monocytogenes serovars 1/2a, 1/2c, and 4b were found on postintervention carcasses. This prevalence study demonstrates that Listeria species are more prevalent on hides during the winter and spring and that interventions being used in cow and bull processing plants appear to be effective in reducing or eliminating Listeria contamination on carcasses.
Resistance of Listeria monocytogenes biofilms to sanitizing agents
Listeria monocytogenes is notorious for its capacity to colonize the environment and equipment of food processing facilities and to persist in the processing plant ecosystem, sometimes for decades. Such persistence is mediated by multiple attributes of L. monocytogenes, including the pathogen’s capa...
Prevalence and populations of Listeria monocytogenes in meat products retailed in Sao Paulo, Brazil.
Ristori, Christiane Asturiano; Rowlands, Ruth Estela Gravato; Martins, Cecília Geraldes; Barbosa, Maria Luisa; Yoshida, Júlia T U; Franco, Bernadette D G de Melo
2014-12-01
This study evaluated the prevalence of the populations and serotypes of Listeria monocytogenes in 552 refrigerated samples of ground beef, chicken leg, hot dog, and pork sausage collected in supermarkets in the city of Sao Paulo, SP, Brazil, between May 2008 and July 2009. The supermarkets were selected after stratification by geographical region and by random draw. Tests for presence and enumeration of L. monocytogenes were based on ISO 11290-1:1996/Amd.1:2004 and ISO 11290-2:1998 methods, respectively. Listeria spp. were detected in 469 (85.0%) of the studied meat products. The most frequently isolated species was L. innocua (64.1%), followed by L. monocytogenes (48.7%), L. welshimeri (13.4%), L. seeligeri (7.1%), L. ivanovii (0.2%), and L. grayi subspecies murrayi (0.2%). L. monocytogenes was detected in 269 (48.7%) samples, with highest prevalence in ground beef (59.4%) followed by chicken legs (58.0%), pork sausages (39.8%), and hot dogs (37.7%). The populations were Prevalence of serotypes varied according to the type of meat product. These data are relevant for estimating the risks of listeriosis associated with consumption of meat products in Sao Paulo, and for establishing science-based intervention strategies aimed at reducing these risks, especially for pregnant women and immunocompromised individuals.
Effect of white mustard essential oil on inoculated Salmonella sp. in a sauce with particulates.
David, Jairus R D; Ekanayake, Athula; Singh, Indarpal; Farina, Brian; Meyer, Michael
2013-04-01
White mustard essential oil (WMEO), from white mustard seed (Sinapis alba L.), is obtained by solvent extraction of defatted and wetted ground mustard; endogenous myrosinase catalyzes the hydrolysis of the glucosinolate sinalbin to yield 4-hydroxybenzyl isothiocyanate (4-HBITC), the antimicrobial component of WMEO. Sauce with particulates was made by mixing sauce, which served as the carrier for WMEO, with frozen vegetable and chicken particulates inoculated with Salmonella sp. WMEO (at 250 to 750 ppm of 4-HBITC) was able to reduce inoculated Salmonella counts by 0.8 to 2.7 log (CFU/g) in a frozen sauce with particulates in a dose-dependent manner, starting from the point of formulating the sauce through the microwave cooking step. High-pressure liquid chromatography-based analytical data confirmed that 4-HBITC was present in all of the samples in the expected concentrations and was completely hydrolyzed after the recommended cooking time in microwave ovens. In another experiment simulating unintentional abuse conditions, where the WMEO containing sauce with particulates was kept at room temperature for 5 h, WMEO (at 250 to 750 ppm of 4-HBITC) was able to reduce inoculated Salmonella counts from the point of first contact and up to 5 h by 0.7 to 2.4 log (CFU/g). Despite the known hydrolytic instability of the active component 4-HBITC, particularly at close to neutral pH values, WMEO was effective in controlling deliberately inoculated Salmonella sp. in a frozen sauce with particulates.
Krak, Karol; Vosátka, Miroslav; Püschel, David; Štorchová, Helena
2017-01-01
Inoculation with arbuscular mycorrhizal fungi (AMF) may improve plant performance at disturbed sites, but inoculation may also suppress root colonization by native AMF and decrease the diversity of the root-colonizing AMF community. This has been shown for the roots of directly inoculated plants, but little is known about the stability of inoculation effects, and to which degree the inoculant and the inoculation-induced changes in AMF community composition spread into newly emerging seedlings that were not in direct contact with the introduced propagules. We addressed this topic in a greenhouse experiment based on the soil and native AMF community of a post-mining site. Plants were cultivated in compartmented pots with substrate containing the native AMF community, where AMF extraradical mycelium radiating from directly inoculated plants was allowed to inoculate neighboring plants. The abundances of the inoculated isolate and of native AMF taxa were monitored in the roots of the directly inoculated plants and the neighboring plants by quantitative real-time PCR. As expected, inoculation suppressed root colonization of the directly inoculated plants by other AMF taxa of the native AMF community and also by native genotypes of the same species as used for inoculation. In the neighboring plants, high abundance of the inoculant and the suppression of native AMF were maintained. Thus, we demonstrate that inoculation effects on native AMF propagate into plants that were not in direct contact with the introduced inoculum, and are therefore likely to persist at the site of inoculation. PMID:28738069
Directory of Open Access Journals (Sweden)
Martina Janoušková
Full Text Available Inoculation with arbuscular mycorrhizal fungi (AMF may improve plant performance at disturbed sites, but inoculation may also suppress root colonization by native AMF and decrease the diversity of the root-colonizing AMF community. This has been shown for the roots of directly inoculated plants, but little is known about the stability of inoculation effects, and to which degree the inoculant and the inoculation-induced changes in AMF community composition spread into newly emerging seedlings that were not in direct contact with the introduced propagules. We addressed this topic in a greenhouse experiment based on the soil and native AMF community of a post-mining site. Plants were cultivated in compartmented pots with substrate containing the native AMF community, where AMF extraradical mycelium radiating from directly inoculated plants was allowed to inoculate neighboring plants. The abundances of the inoculated isolate and of native AMF taxa were monitored in the roots of the directly inoculated plants and the neighboring plants by quantitative real-time PCR. As expected, inoculation suppressed root colonization of the directly inoculated plants by other AMF taxa of the native AMF community and also by native genotypes of the same species as used for inoculation. In the neighboring plants, high abundance of the inoculant and the suppression of native AMF were maintained. Thus, we demonstrate that inoculation effects on native AMF propagate into plants that were not in direct contact with the introduced inoculum, and are therefore likely to persist at the site of inoculation.
Relationship between Listeria monocytogenes and Listeria spp. in seafood processing plants.
Alali, Walid Q; Schaffner, Donald W
2013-07-01
The objective of this study was to evaluate the relationship between prevalence of Listeria monocytogenes as an outcome and Listeria spp. as an explanatory variable by food products, food contact surfaces, and nonfood contact surfaces in seafood processing plants by using peer-reviewed published data. Nine sets of prevalence data of L. monocytogenes and Listeria spp. were collected from published studies and used for the analyses. Based on our analysis, the relationship between L. monocytogenes prevalence and Listeria spp. prevalence in food products (incoming raw materials and finish products) was significant (P = 0.04) with (low) R² = 0.36. Furthermore, Listeria spp. were not a good indicator for L. monocytogenes when testing food contact surfaces (R² = 0.10). Listeria spp. were a good indicator for L. monocytogenes only on nonfood contact surfaces (R² = 0.90). On the other hand, the presence of Listeria spp. on food contact surfaces (R² = 0.002) and nonfood contact surfaces (R² = 0.03) was not a good indicator for L. monocytogenes presence in food products. In general, prevalence of Listeria spp. does not seem to be a good indicator for L. monocytogenes prevalence in seafood processing plants.
Mo, I P; Brugh, M; Fletcher, O J; Rowland, G N; Swayne, D E
1997-01-01
Pathologic changes and distribution of viral antigen as determined by immunohistochemistry were compared among 4-wk-old specific-pathogen-free chickens inoculated intratracheally with avian influenza virus (AIV) isolates of either low or high pathogenicity. Viruses of low pathogenicity, previously characterized as mildly pathogenic (MP), included A/chicken/Pennsylvania/21525/83 (H5N2) (MP-Penn) and A/chicken/Alabama/7395/75 (H4N8) (MP-Alab). Viruses of high pathogenicity included A/chicken/Pennsylvania/1370/83 (H5N2), A/chicken/Victoria/A185/85 (H7N7), and A/turkey/Ontario/7732/66 (H5N9). Extremely variable clinical signs ranging from mild respiratory distress to high mortality were present among chickens inoculated with these viruses. Chickens inoculated with highly pathogenic (HP) virus had histologic lesions of necrosis and inflammation in cloacal bursa, thymus, spleen, heart, pancreas, kidney, brain, trachea, lung, and skeletal muscle, whereas chickens inoculated with MP virus had histologic lesions most frequently in lung and trachea or lacked histologic lesions. Immunospecific staining for avian influenza viral proteins was most common in cells within heart, lung, kidney, brain, and pancreas of chicken inoculated with HP viruses, but immunospecific staining was present only and infrequently in trachea and lung of chickens inoculated with MP-Penn AIV. MP-Alab did not produce lesions nor have viral antigen in inoculated chickens but did produce serologic evidence of infection. The pattern of organ involvement and viral antigen distribution in chickens intratracheally inoculated with HP AIV isolates indicates a common capability to spread beyond the respiratory tract and confirms the pantrophic replicative, pathobiologic, and lethal nature of the viruses. However, variability in severity and lesion distribution exists between different HP AIVs. By contrast, MP viruses had the ability to replicate in respiratory or enteric tracts or both and produce lesions
Listeria monocytogenes growth limits and stress resistance mechanisms
Veen, van der S.
2008-01-01
The food-borne pathogen Listeria monocytogenes is a Gram-positive facultative anaerobic rod, which is the causative agent of listeriosis. Due to the severity of the disease and the fact that its incidence is increasing in numerous European countries, L. monocytogenes is of great public health
Directory of Open Access Journals (Sweden)
Gusman Vera
2014-01-01
Full Text Available Listeria monocytogenes is pathogenic bacterium that can contaminate food products during and after processing. As ready-to-eat food does not undergo any treatment to ensure its safety before consumption, the risk of foodborne disease must be considered if this pathogen is present in the food. As diseases caused by contaminated food are an important public health problem today, the aim of this study was to determine the prevalence of Listeria monocytogenes in different ready-to-eat food products. In the seven-month period from June 1 to December 31, 2011, a total of 1 380 food samples were examined in the Division of Sanitary Bacteriology, Center for Microbiology, Institute of Public Health of Vojvodina in Novi Sad. A total of 912 samples were analyzed for the presence of Listeria monocytogenes according to ISO 11290-2. The identity of suspected Listeria monocytogenes was confirmed using the VITEK 2 Compact system (BioMerieux, France. Out of 912 samples, Listeria monocytogenes was detected in 18 (1.97%. Listeria monocytogenes was mostly found in cooked meals (in 6 samples out of 18, sandwiches (4 samples and frozen food, such as ice-cream and frozen vegetables (4 samples. It was also found in tofu bread spreads (2 samples, cream cheese (1 sample and cakes (1 sample. The presence of Listeria monocytogenes in some ready-to-eat food could present a public health hazard, particularly to the high-risk population group, because of the high mortality rate associated with listeriosis and the widespread nature of the organism. Monitoring of listeriosis is essential to prevent foodborne outbreaks, and in assessing human health risk in ready-to-eat foods.
Combinations of nisin with salt (NaCl) to control Listeria ...
African Journals Online (AJOL)
This study evaluated the effect of combinations of nisin with salt (NaCl) to control Listeria monocytogenes on sheep natural sausage casings. Casings were inoculated with 3.0 x 105 cfu/g final inocula of L. monocytogenes, stored at 6°C in different solutions of nisin at 0, 100, 150 and 200 ìg/g. Each combined with salt at 0, 4, ...
Directory of Open Access Journals (Sweden)
Negar Hamidian
2017-07-01
Full Text Available 1-Mortazavi S, Gods rohani M, Juyande H. milk and dairy products technology. The University Ferdowsi Mashhad; 1996. p. 266. 2-Azadnia P, Ghasemi M, Abbasi M, Taarof N, Jashni M. Microbial Quality of Traditional Ice Cream Produced by Small-Scale Manufacturers in Khormoj and Its Comparison with the Iranian National Standard. Journal of Animal and Veterinary Advances 2011;10(6:742-4. 3- Ziabari Mirnezami H. What do you know about milk (Milk chemical technology: Tehran University; 1996. 4-Movassagh MH, Movassagh A, Mahmoodi H, Servatkhah F, Sourorbakhsh MR. Microbiological contamination of the traditional chocolate Ice cream sold in the Northwest Region of Iran. Global Veterinaria 2011;6(3:269-71. 5-Karim G, Razavilar V, Akhonndzade A. survey contamination of traditional ice cream to bacteria causing the infection and food poisoning[persian]. Tehran University Faculty of Veterinary 1374;50:71-8. 6-Kanbakan U, Con A, Ayar A. Determination of microbiological contamination sources during ice cream production in Denizli, Turkey. Food Control 2004;15(6:463-70. 7- Fallah AA, Saei-Dehkordi SS, Rahnama M, Tahmasby H, Mahzounieh M. Prevalence and antimicrobial resistance patterns of Listeria species isolated from poultry products marketed in Iran. Food Control 2012;28(2:327-32. 8-Farber J, Peterkin P. Listeria monocytogenes, a food-borne pathogen. Microbiological reviews 1991;55(3:476. 9-Navratilova P, Schlegelova J, Sustackova A, Napravnikova E, Lukasova J, Klimova E. Prevalence of Listeria monocytogenes in milk, meat and foodstuff of animal origin and the phenotype of antibiotic resistance of isolated strains. Veterinarni Medicina-UZPI 2004;49. 10-Williams SK, Roof S, Boyle EA, Burson D, Thippareddi H, Geornaras I, et al. Molecular ecology of Listeria monocytogenes and other Listeria species in small and very small ready-to-eat meat processing plants. J Food Prot 2011;74(1:63-77. 11-Halter E, Neuhaus K, Scherer S. Listeria weihenstephanensis sp. nov
International Nuclear Information System (INIS)
Fallah, Aziz A.; Siavash Saei-Dehkordi, S.; Rahnama, Mohammad
2010-01-01
Ready-to-cook Iranian barbecued chicken consists of cubed chicken breast, lemon juice, salt, red pepper, onion, saffron and vegetable oil with an overall pH value of about 5.5. This product is sometimes consumed under-cooked, hence it may pose health hazards to consumers when contaminated with food-borne pathogens. In this study, the effect of gamma irradiation (0, 1.5, 3 and 4.5 kGy) on the microbial quality of ready-to-cook (RTC) barbecued chicken samples stored at 4 o C for 15 days was investigated. Moreover, the effectiveness of irradiation for inactivating Listeria monocytogenes, Escherichia coli O157:H7 and Salmonella typhimurium inoculated into the samples was also studied. Irradiation of the samples resulted in dose dependent reduction in counts of aerobic mesophilic bacteria, yeasts and molds, Enterobacteriaceae and lactic acid bacteria. Among the microbial flora, yeasts and molds and Enterobacteriaceae were more sensitive to irradiation and got completely eliminated at dose of 3 kGy. D 10 values of L. monocytogenes, E. coli O157:H7 and S. typhimurium inoculated into the samples were 0.680, 0.397 and 0.601 kGy, respectively. An irradiation dose of 3 kGy reduced the counts of E. coli O157:H7 to an undetectable level in RTC barbecued chicken but was ineffective on elimination of L. monocytogenes and S. typhimurium. However, none of the food-borne pathogens were detected in the samples irradiated at 4.5 kGy. This study showed that irradiation had no undesirable effects on the initial sensory attributes of barbecued chicken. At the end of the storage period, irradiated samples were more acceptable compared to non-irradiated ones.
Fallah, Aziz A.; Siavash Saei-Dehkordi, S.; Rahnama, Mohammad
2010-10-01
Ready-to-cook Iranian barbecued chicken consists of cubed chicken breast, lemon juice, salt, red pepper, onion, saffron and vegetable oil with an overall pH value of about 5.5. This product is sometimes consumed under-cooked, hence it may pose health hazards to consumers when contaminated with food-borne pathogens. In this study, the effect of gamma irradiation (0, 1.5, 3 and 4.5 kGy) on the microbial quality of ready-to-cook (RTC) barbecued chicken samples stored at 4 °C for 15 days was investigated. Moreover, the effectiveness of irradiation for inactivating Listeria monocytogenes, Escherichia coli O157:H7 and Salmonella typhimurium inoculated into the samples was also studied. Irradiation of the samples resulted in dose dependent reduction in counts of aerobic mesophilic bacteria, yeasts and molds, Enterobacteriaceae and lactic acid bacteria. Among the microbial flora, yeasts and molds and Enterobacteriaceae were more sensitive to irradiation and got completely eliminated at dose of 3 kGy. D10 values of L. monocytogenes, E. coli O157:H7 and S. typhimurium inoculated into the samples were 0.680, 0.397 and 0.601 kGy, respectively. An irradiation dose of 3 kGy reduced the counts of E. coli O157:H7 to an undetectable level in RTC barbecued chicken but was ineffective on elimination of L. monocytogenes and S. typhimurium. However, none of the food-borne pathogens were detected in the samples irradiated at 4.5 kGy. This study showed that irradiation had no undesirable effects on the initial sensory attributes of barbecued chicken. At the end of the storage period, irradiated samples were more acceptable compared to non-irradiated ones.
Energy Technology Data Exchange (ETDEWEB)
Fallah, Aziz A., E-mail: a_a_falah@yahoo.co [Department of Food Hygiene and Quality Control, Faculty of Veterinary Medicine, Shahre-Kord University, Shahre-Kord 34141 (Iran, Islamic Republic of); Research Institute of Zoonotic Diseases, Shahre-Kord University, Shahre-Kord 34141 (Iran, Islamic Republic of); Siavash Saei-Dehkordi, S. [Department of Food Hygiene and Quality Control, Faculty of Veterinary Medicine, Shahre-Kord University, Shahre-Kord 34141 (Iran, Islamic Republic of); Research Institute of Zoonotic Diseases, Shahre-Kord University, Shahre-Kord 34141 (Iran, Islamic Republic of); Rahnama, Mohammad [Department of Food Hygiene and Quality Control, Faculty of Veterinary Medicine, University of Zabol, Zabol 98615 (Iran, Islamic Republic of)
2010-10-15
Ready-to-cook Iranian barbecued chicken consists of cubed chicken breast, lemon juice, salt, red pepper, onion, saffron and vegetable oil with an overall pH value of about 5.5. This product is sometimes consumed under-cooked, hence it may pose health hazards to consumers when contaminated with food-borne pathogens. In this study, the effect of gamma irradiation (0, 1.5, 3 and 4.5 kGy) on the microbial quality of ready-to-cook (RTC) barbecued chicken samples stored at 4 {sup o}C for 15 days was investigated. Moreover, the effectiveness of irradiation for inactivating Listeria monocytogenes, Escherichia coli O157:H7 and Salmonella typhimurium inoculated into the samples was also studied. Irradiation of the samples resulted in dose dependent reduction in counts of aerobic mesophilic bacteria, yeasts and molds, Enterobacteriaceae and lactic acid bacteria. Among the microbial flora, yeasts and molds and Enterobacteriaceae were more sensitive to irradiation and got completely eliminated at dose of 3 kGy. D{sub 10} values of L. monocytogenes, E. coli O157:H7 and S. typhimurium inoculated into the samples were 0.680, 0.397 and 0.601 kGy, respectively. An irradiation dose of 3 kGy reduced the counts of E. coli O157:H7 to an undetectable level in RTC barbecued chicken but was ineffective on elimination of L. monocytogenes and S. typhimurium. However, none of the food-borne pathogens were detected in the samples irradiated at 4.5 kGy. This study showed that irradiation had no undesirable effects on the initial sensory attributes of barbecued chicken. At the end of the storage period, irradiated samples were more acceptable compared to non-irradiated ones.
Energy Technology Data Exchange (ETDEWEB)
Liu, Gang; Yu, Haiyang [State Key Laboratory of Soil and Sustainable Agriculture, Institute of Soil Science, Chinese Academy of Sciences, No. 71 East Beijing Road, Nanjing 210008 (China); University of Chinese Academy of Sciences, Beijing 100049 (China); Ma, Jing [State Key Laboratory of Soil and Sustainable Agriculture, Institute of Soil Science, Chinese Academy of Sciences, No. 71 East Beijing Road, Nanjing 210008 (China); Xu, Hua, E-mail: hxu@issas.ac.cn [State Key Laboratory of Soil and Sustainable Agriculture, Institute of Soil Science, Chinese Academy of Sciences, No. 71 East Beijing Road, Nanjing 210008 (China); Wu, Qinyan; Yang, Jinghui; Zhuang, Yiqing [Zhenjiang Institute of Agricultural Science of Hilly Regions in Jiangsu, Jurong 212400 (China)
2015-06-15
Incorporation of straw together with microbial inoculant (a microorganism agent, accelerating straw decomposition) is being increasingly adopted in rice cultivation, thus its effect on greenhouse gas (GHG) emissions merits serious attention. A 3-year field experiment was conducted from 2010 to 2012 to investigate combined effect of straw and microbial inoculant on methane (CH{sub 4}) and nitrous oxide (N{sub 2}O) emissions, global warming potential (GWP) and greenhouse gas intensity (GHGI) in a rice field in Jurong, Jiangsu Province, China. The experiment was designed to have treatment NPK (N, P and K fertilizers only), treatment NPKS (NPK plus wheat straw), treatment NPKSR (NPKS plus Ruilaite microbial inoculant) and treatment NPKSJ (NPKS plus Jinkuizi microbial inoculant). Results show that compared to NPK, NPKS increased seasonal CH{sub 4} emission by 280–1370%, while decreasing N{sub 2}O emission by 7–13%. When compared with NPKS, NPKSR and NPKSJ increased seasonal CH{sub 4} emission by 7–13% and 6–12%, respectively, whereas reduced N{sub 2}O emission by 10–27% and 9–24%, respectively. The higher CH{sub 4} emission could be attributed to the higher soil CH{sub 4} production potential triggered by the combined application of straw and microbial inoculant, and the lower N{sub 2}O emission to the decreased inorganic N content. As a whole, the benefit of lower N{sub 2}O emission was completely offset by increased CH{sub 4} emission, resulting in a higher GWP for NPKSR (5–12%) and NPKSJ (5–11%) relative to NPKS. Due to NPKSR and NPKSJ increased rice grain yield by 3–6% and 2–4% compared to NPKS, the GHGI values for NPKS, NPKSR and NPKSJ were comparable. These findings suggest that incorporating straw together with microbial inoculant would not influence the radiative forcing of rice production in the terms of per unit of rice grain yield relative to the incorporation of straw alone. - Highlights: • This paper presents 3-year measurements of CH
Low prevalence of Listeria monocytogenes in cull sows and pork.
Wesley, Irene V; Larsen, Steven; Hurd, H Scott; McKean, James D; Griffith, Ronald; Rivera, Fernando; Nannapaneni, Ramakrishna; Cox, Mandy; Johnson, Michael; Wagner, Dean; de Martino, Mary
2008-03-01
The goal of this study was to determine the prevalence of Listeria monocytogenes in sows slaughtered at a single Midwestern plant on two occasions (trial 1, n = 179 sows; trial 2, n = 160 sows). Fecal samples collected antemortem (trial 1) as well as animal tissues, and carcass swabs collected at the abattoir (trials 1 and 2) were analyzed. Eight isolates of L. monocytogenes were recovered from five samples that represented 0.18% of the total samples (n = 2,775). In trial 1, L. monocytogenes was detected in a tonsil sample (0.6%; 1 positive of 181 tonsils), in a carcass (0.6%; 1 positive of 179 carcasses), which was sampled prior to the organic rinse, and in two chopped meat block samples (1.2%; 2 positive of 165 samples). In trial 2, L. monocytogenes was only detected in a single chopped meat block sample (0.15%; 1 positive of 688 total samples). These data indicate the low prevalence of L. monocytogenes in the cull sow.
Directory of Open Access Journals (Sweden)
Karla Sequeira Mendonça
2016-01-01
Full Text Available ABSTRACT: Listeria monocytogenes is of notable concern to the food industry, due to its ubiquitous nature and ability to grow in adverse conditions. This study aimed to determine the genotypic profile of L. monocytogenes strains isolated from refrigerated chickens marketed in the southern part of Rio Grande do Sul, Brazil. The strains of L. monocytogenes isolated were characterized by serotyping and Pulsed Field Gel Electrophoresis (PFGE. Three different serotypes (1/2a, 1/2b and 4e were evaluated by PFGE, and the macrorestriction patterns utilizing enzymes AscI and ApaI, revealed five different pulsotypes. The presence of such varied genotypic profiles demonstrates the prevalence of L. monocytogenes contamination of chicken processing environments, which combined with ineffective cleaning procedures, allowing the survival, adaptation and proliferation of these pathogens, not only in the processing environment, but also in local grocery stores.
Thønnings, S; Knudsen, J D; Schønheyder, H C; Søgaard, M; Arpi, M; Gradel, K O; Østergaard, C
2016-08-01
Invasive Listeria monocytogenes infections carry a high mortality despite antibiotic treatment. The rareness of the infection makes it difficult to improve antibiotic treatment through randomized clinical trials. This observational study investigated clinical features and outcome of invasive L. monocytogenes infections including the efficacy of empiric and definitive antibiotic therapies. Demographic, clinical and biochemical findings, antibiotic treatment and 30-day mortality for all episodes of L. monocytogenes bacteraemia and/or meningitis were collected by retrospective medical record review in the North Denmark Region and the Capital Region of Denmark (17 hospitals) from 1997 to 2012. Risk factors for 30-day all-cause mortality were assessed by logistic regression. The study comprised 229 patients (median age: 71 years), 172 patients had bacteraemia, 24 patients had meningitis and 33 patients had both. Significant risk factors for 30-day mortality were septic shock (OR 3.0, 95% CI 1.4-6.4), altered mental state (OR 3.6, 95% CI 1.7-7.6) and inadequate empiric antibiotic therapy (OR 3.8, 95% CI 1.8-8.1). Cephalosporins accounted for 90% of inadequately treated cases. Adequate definitive antibiotic treatment was administered to 195 patients who survived the early period (benzylpenicillin 72, aminopenicillin 84, meropenem 28, sulfamethoxazole/trimethoprim 6, and piperacillin/tazobactam 5). Definitive antibiotic treatment with benzylpenicillin or aminopenicillin resulted in a lower 30-day mortality in an adjusted analysis compared with meropenem (OR 0.3; 95% CI 0.1-0.8). In conclusion, inadequate empiric antibiotic therapy and definitive therapy with meropenem were both associated with significantly higher 30-day mortality. Copyright © 2016 European Society of Clinical Microbiology and Infectious Diseases. Published by Elsevier Ltd. All rights reserved.
Ottesen, Andrea; Ramachandran, Padmini; Reed, Elizabeth; White, James R; Hasan, Nur; Subramanian, Poorani; Ryan, Gina; Jarvis, Karen; Grim, Christopher; Daquiqan, Ninalynn; Hanes, Darcy; Allard, Marc; Colwell, Rita; Brown, Eric; Chen, Yi
2016-11-16
Microbiota that co-enrich during efforts to recover pathogens from foodborne outbreaks interfere with efficient detection and recovery. Here, dynamics of co-enriching microbiota during recovery of Listeria monocytogenes from naturally contaminated ice cream samples linked to an outbreak are described for three different initial enrichment formulations used by the Food and Drug Administration (FDA), the International Organization of Standardization (ISO), and the United States Department of Agriculture (USDA). Enrichment cultures were analyzed using DNA extraction and sequencing from samples taken every 4 h throughout 48 h of enrichment. Resphera Insight and CosmosID analysis tools were employed for high-resolution profiling of 16S rRNA amplicons and whole genome shotgun data, respectively. During enrichment, other bacterial taxa were identified, including Anoxybacillus, Geobacillus, Serratia, Pseudomonas, Erwinia, and Streptococcus spp. Surprisingly, incidence of L. monocytogenes was proportionally greater at hour 0 than when tested 4, 8, and 12 h later with all three enrichment schemes. The corresponding increase in Anoxybacillus and Geobacillus spp.indicated these taxa co-enriched in competition with L. monocytogenes during early enrichment hours. L. monocytogenes became dominant after 24 h in all three enrichments. DNA sequences obtained from shotgun metagenomic data of Listeria monocytogenes at 48 h were assembled to produce a consensus draft genome which appeared to have a similar tracking utility to pure culture isolates of L. monocytogenes. All three methods performed equally well for enrichment of Listeria monocytogenes. The observation of potential competitive exclusion of L. mono by Anoxybacillus and Geobacillus in early enrichment hours provided novel information that may be used to further optimize enrichment formulations. Application of Resphera Insight for high-resolution analysis of 16S amplicon sequences accurately identified L. monocytogenes
In 2002, a strain of Fusarium oxysporum f. sp. vasinfectum was found in California cotton fields and identified as race 4. Stem inoculations with isolates of the California strain (CA Fov-4) do not elicit symptoms in controlled-environmental chamber experiments, while stem inoculations with Fov rac...
SEED INOCULATION WITH Azospirillum brasilense, ASSOCIATED WITH THE USE OF BIOREGULATORS IN MAIZE
Directory of Open Access Journals (Sweden)
ALESSANDRO DE LUCCA E BRACCINI
2012-01-01
Full Text Available The inoculation of seeds with the bacterium Azospirillum has been carried out in maize culture and other grasses. The application of growth bio-regulators is another technology whose results in maize culture have yet to become more widespread. Current study evaluates the agronomic effectiveness of seed inoculation with Azospirillum brasilense in maize, associated with the use of the growth regulator Stimulate ®. Triple hybrid maize CD 304 underwent the following treatments: 1 - control without nitrogen and without Azospirillum brasilense; 2 - Treatment without nitrogen but with Azospirillum brasilense; 3 - Treatment without nitrogen but with Azospirillum brasilense + Stimulate ®; 4 - Treatment with 50% of nitrogen dose recommended for maize culture; 5 - Treatment with 50% of nitrogen dose and inoculation with Azospirillum brasilense; 6 - Same as 5 but with Stimulate ®; 7 - Total N recommended; 8 - Total N recommended + Azospirillum brasilense ; 9 - Total N recommended + Azospirillum brasilense + Stimulate ®. The inoculation of maize seeds with Azospirillum brasilense increases plant height and grain yield when compared with rates in control. The use of 50% of N dose in sowing, associated with the inoculation of maize seeds with Azospirillum brasilense at 200 mL ha-1 (mixed to the seeds and associated with Stimulate ® (in foliar application, is viable.
Directory of Open Access Journals (Sweden)
C.C. Câmara
2010-07-01
Full Text Available The objective of the present study was to describe motor behavioral changes in association with histopathological and hematological findings in Wistar rats inoculated intravenously with human T-cell lymphotropic virus type 1 (HTLV-1-infected MT2 cells. Twenty-five 4-month-old male rats were inoculated with HTLV-1-infected MT2 cells and 13 control rats were inoculated with normal human lymphocytes. The behavior of the rats was observed before and 5, 10, 15, and 20 months after inoculation during a 30-min/rat testing time for 5 consecutive days. During each of 4 periods, a subset of rats was randomly chosen to be sacrificed in order to harvest the spinal cord for histopathological analysis and to obtain blood for serological and molecular studies. Behavioral analyses of the HTLV-1-inoculated rats showed a significant decrease of climbing, walking and freezing, and an increase of scratching, sniffing, biting, licking, and resting/sleeping. Two of the 25 HTLV-1-inoculated rats (8% developed spastic paraparesis as a major behavioral change. The histopathological changes were few and mild, but in some cases there was diffuse lymphocyte infiltration. The minor and major behavioral changes occurred after 10-20 months of evolution. The long-term observation of Wistar rats inoculated with HTLV-1-infected MT2 cells showed major (spastic paraparesis and minor motor abnormalities in association with the degree of HTLV-1-induced myelopathy.
Antimicrobial resistance of Listeria monocytogenes isolated from dairy-based food products.
Harakeh, Steve; Saleh, Imane; Zouhairi, Omar; Baydoun, Elias; Barbour, Elie; Alwan, Nisreen
2009-06-15
In this study Listeria monocytogenes (L. monocytogenes) was isolated from three traditionally consumed Lebanese dairy-based food products. One hundred and sixty four samples (45 samples of Baladi cheese, 36 samples of Shankleesh and 83 of Kishk) were collected from the Bekaa Valley in the Northeast region of Lebanon. Suspected Listeria colonies were selected and initially identified by using standard biochemical tests. Initial identification of the positive L. monocytogenes colonies was confirmed at the molecular level by Polymerase Chain Reaction (n=30) and the confirmed isolates were evaluated for their susceptibility to 10 commonly used antimicrobials. All of the 30 isolates were confirmed to be L. monocytogenes yielding a PCR product of approximately 660 base pairs (bp). L. monocytogenes was detected in 26.67%, 13.89% and 7.23% of the Baladi cheese, Shankleesh and Kishk samples, respectively. The highest resistance in L. monocytogenes isolates was noted against oxacillin (93.33%) followed by penicillin (90%). The results provide an indication of the contamination levels of dairy-based foods in Lebanon and highlight the emergence of multi-drug resistant Listeria in the environment.
Growth, viability and architecture of biofilms of Listeria monocytogenes formed on abiotic surfaces
Directory of Open Access Journals (Sweden)
Fernanda Barbosa dos Reis-Teixeira
Full Text Available Abstract The pathogenic bacterium Listeria monocytogenes can persist in food processing plants for many years, even when appropriate hygienic measures are in place, with potential for contaminating ready-to-eat products and, its ability to form biofilms on abiotic surfaces certainly contributes for the environmental persistence. In this research, L. monocytogenes was grown in biofilms up 8 days attached to stainless steel and glass surfaces, contributing for advancing the knowledge on architecture of mature biofilms, since many literature studies carried out on this topic considered only early stages of cell adhesion. In this study, biofilm populations of two strains of L. monocytogenes (serotypes 1/2a and 4b on stainless steel coupons and glass were examined using regular fluorescence microscopy, confocal laser scanning microscopy and classic culture method. The biofilms formed were not very dense and microscopic observations revealed uneven biofilm structures, with presence of exopolymeric matrix surrounding single cells, small aggregates and microcolonies, in a honeycomb-like arrangement. Moreover, planktonic population of L. monocytogenes (present in broth media covering the abiotic surface remained stable throughout the incubation time, which indicates an efficient dispersal mechanism, since the culture medium was replaced daily. In conclusion, even if these strains of L. monocytogenes were not able to form thick multilayer biofilms, it was noticeable their high persistence on abiotic surfaces, reinforcing the need to focus on measures to avoid biofilm formation, instead of trying to eradicate mature biofilms.
Growth, viability and architecture of biofilms of Listeria monocytogenes formed on abiotic surfaces.
Reis-Teixeira, Fernanda Barbosa Dos; Alves, Virgínia Farias; de Martinis, Elaine Cristina Pereira
The pathogenic bacterium Listeria monocytogenes can persist in food processing plants for many years, even when appropriate hygienic measures are in place, with potential for contaminating ready-to-eat products and, its ability to form biofilms on abiotic surfaces certainly contributes for the environmental persistence. In this research, L. monocytogenes was grown in biofilms up 8 days attached to stainless steel and glass surfaces, contributing for advancing the knowledge on architecture of mature biofilms, since many literature studies carried out on this topic considered only early stages of cell adhesion. In this study, biofilm populations of two strains of L. monocytogenes (serotypes 1/2a and 4b) on stainless steel coupons and glass were examined using regular fluorescence microscopy, confocal laser scanning microscopy and classic culture method. The biofilms formed were not very dense and microscopic observations revealed uneven biofilm structures, with presence of exopolymeric matrix surrounding single cells, small aggregates and microcolonies, in a honeycomb-like arrangement. Moreover, planktonic population of L. monocytogenes (present in broth media covering the abiotic surface) remained stable throughout the incubation time, which indicates an efficient dispersal mechanism, since the culture medium was replaced daily. In conclusion, even if these strains of L. monocytogenes were not able to form thick multilayer biofilms, it was noticeable their high persistence on abiotic surfaces, reinforcing the need to focus on measures to avoid biofilm formation, instead of trying to eradicate mature biofilms. Copyright © 2017. Published by Elsevier Editora Ltda.
da Silva Fernandes, Meg; Kabuki, Dirce Yorika; Kuaye, Arnaldo Yoshiteru
2015-05-04
The formation of mono-species biofilm (Listeria monocytogenes) and multi-species biofilms (Enterococcus faecium, Enterococcus faecalis, and L. monocytogenes) was evaluated. In addition, the effectiveness of sanitation procedures for the control of the multi-species biofilm also was evaluated. The biofilms were grown on stainless steel coupons at various incubation temperatures (7, 25 and 39°C) and contact times (0, 1, 2, 4, 6 and 8 days). In all tests, at 7°C, the microbial counts were below 0.4 log CFU/cm(2) and not characteristic of biofilms. In mono-species biofilm, the counts of L. monocytogenes after 8 days of contact were 4.1 and 2.8 log CFU/cm(2) at 25 and 39°C, respectively. In the multi-species biofilms, Enterococcus spp. were present at counts of 8 log CFU/cm(2) at 25 and 39°C after 8 days of contact. However, the L. monocytogenes in multi-species biofilms was significantly affected by the presence of Enterococcus spp. and by temperature. At 25°C, the growth of L. monocytogenes biofilms was favored in multi-species cultures, with counts above 6 log CFU/cm(2) after 8 days of contact. In contrast, at 39°C, a negative effect was observed for L. monocytogenes biofilm growth in mixed cultures, with a significant reduction in counts over time and values below 0.4 log CFU/cm(2) starting at day 4. Anionic tensioactive cleaning complemented with another procedure (acid cleaning, disinfection or acid cleaning+disinfection) eliminated the multi-species biofilms under all conditions tested (counts of all micro-organismsbiofilms under all tested conditions (counts of the all microorganisms biofilms under all the test conditions. Copyright © 2015 Elsevier B.V. All rights reserved.
Locatelli, Aude; Lewis, Micah A; Rothrock, Michael J
2017-01-01
The occurrence of Listeria monocytogenes has been widely investigated in the poultry production chain from the processing plant to the final product. However, limited data are available on Listeria species, including Listeria monocytogenes , in the poultry farm environment. Therefore, fecal and soil samples from 37 pastured poultry flocks from 10 all-natural farms over 3 years were assessed to determine the prevalence and diversity of Listeria within these alternative poultry farm environments using standard cultural and molecular methods. Listeria species were isolated in 15% of poultry farm samples and included Listeria innocua (65.7%), L. monocytogenes (17.4%), and Listeria welshimeri (15.1%). Additional multiplex PCR serotyping showed group 1/2a-3a to be the most dominant L. monocytogenes serovar group. Based on these results, monoculture growth experiments were conducted on four Listeria soil isolates (three L. monocytogenes isolates representing the three recovered serovar groups and one L. innocua isolate) to determine if culture medium [tripticase soy broth (TSB) and University of Vermont modified Listeria enrichment broth (UVM)], inoculum concentration (10 2 or 10 5 CFU/ml), or incubation temperature (20, 30, and 42°C) differentially affected these Listeria species. Overall, very few significant growth differences were observed between the behavior of the three L. monocytogenes isolates (representing the three recovered serovar groups) under the growth conditions tested. Alternatively, at 30°C in UVM with the lower inoculum concentration, the L. innocua isolate had a significantly shorter lag phase than the L. monocytogenes isolates. In coculture growth studies under these same incubation conditions, the lag phase of L. innocua and L. monocytogenes was similar, but the final concentration of L. innocua was significantly higher than L. monocytogenes . However, cocultures in UVM for high inoculum concentration did not show preferential growth of L
Pal, Sukumar; Tifrea, Delia F; Zhong, Guangming; de la Maza, Luis M
2018-01-01
Chlamydia trachomatis is the leading cause of infection-induced infertility in women. Attempts to control this epidemic with screening programs and antibiotic therapy have failed. Currently, a vaccine to prevent C. trachomatis infections is not available. In order to develop an animal model for evaluating vaccine antigens that can be applied to humans, we used C. trachomatis serovar D (strain UW-3/Cx) to induce infertility in mice whose major histocompatibility complex class II antigen was replaced with the human leukocyte antigen DR4 (HLA-DR4). Transcervical inoculation of medroxyprogesterone-treated HLA-DR4 transgenic mice with 5 × 10 5 C. trachomatis D inclusion forming units (IFU) induced a significant reduction in fertility, with a mean number of embryos/mouse of 4.4 ± 1.3 compared to 7.8 ± 0.5 for the uninfected control mice ( P < 0.05). A similar fertility reduction was elicited in the wild-type (WT) C57BL/6 mice (4.3 ± 1.4 embryos/mouse) compared to the levels of the WT controls (9.1 ± 0.4 embryos/mouse) ( P < 0.05). Following infection, WT mice mounted more robust humoral and cellular immune responses than HLA-DR4 mice. As determined by vaginal shedding, HLA-DR4 mice were more susceptible to a transcervical C. trachomatis D infection than WT mice. To assess if HLA-DR4 transgenic and WT mice could be protected by vaccination, 10 4 IFU of C. trachomatis D was delivered intranasally, and mice were challenged transcervically 6 weeks later with 5 × 10 5 IFU of C. trachomatis D. As determined by severity and length of vaginal shedding, WT C57BL/6 and HLA-DR4 mice were significantly protected by vaccination. The advantages and limitations of the HLA-DR4 transgenic mouse model for evaluating human C. trachomatis vaccine antigens are discussed. Copyright © 2017 American Society for Microbiology.
New inoculants on maize silage fermentation
Directory of Open Access Journals (Sweden)
Fábia Giovana do Val de Assis
2014-08-01
Full Text Available The objective of this study was to evaluate the effect of bacterial inoculants at two inoculation rates on chemical and biological characteristics of maize silage. The treatments consisted of two inoculating rates (5 and 6 log cfu g-1 of forage for each strain of lactic acid bacteria (LAB identified as Lactobacillus buchneri, L. hilgardii, or L. plantarum. The maize was ensiled in experimental PVC silos. Samples were taken for the determination of the contents of dry matter (DM, crude protein (CP, neutral detergent fiber (NDF, water-soluble carbohydrates (WSC, organic acids and alcohols, for the evaluation of the populations of lactic acid bacteria, yeasts, filamentous fungi, and for the determination of pH values during ensilage and after 30 or 90 days of fermentation. The doses of inoculants did not promote significant differences on the evaluated characteristics. There was effect of inoculants on acetic acid, 1.2-propanediol, LAB population, filamentous fungi, and pH value. No significant influence of the treatments with inoculants was observed in the variables DM, WSC, CP, lactic acid concentrations, or ethanol. The maximum temperature, i.e., the time to achieve the maximum temperature (TMT and aerobic stability (AS, was not influencied by treatments. However, a decrease in maximum temperature, an increase in TMT, and improvement in the AS were observed after 90 days of fermentation. These results proved the advantage of microbial inoculation. The treatments influenced LAB populations and filamentous fungi, but no effect was observed on the yeast population. The best inoculation dose is 6 cfu g-1 of forage because it provides higher reduction of filamentous fungi in maize silage, thereby decreasing the aerobic deterioration by these microorganisms.
Díez, J García; Patarata, L
2013-04-01
Portuguese chouriço de vinho is made by drying coarsely minced meat and fat that has been previously marinated with wine (usually red), salt, and garlic for 1 to 2 days at a low temperature (4 to 8 °C). This procedure may improve the microbiological safety of the product. The aim of this study was to evaluate the behavior of three pathogens in this product, Salmonella spp., Listeria monocytogenes, and Staphylococcus aureus, to establish the minimum period of drying and maturation necessary to render safe products. The pathogens were inoculated in the chouriço de vinho batter. A factorial design was used to study the following variables in the fermentation process: (i) the presence or absence of an indigenous Lactobacillus sakei starter culture; (ii) the presence or absence of fermentable carbohydrates; and (iii) the salt level (1.5 or 3%). The samples were analyzed 24 h after the preparation of the batter (at stuffing); after 7, 15, and 30 days of drying; and after 30 days of storage at 4 °C under vacuum. Under all of the conditions studied, the levels of the three pathogens decreased during the drying period. In the early stages of drying, the addition of L. sakei starter culture and/or carbohydrates resulted in lower levels of gram-positive pathogens. After 15 days of drying, populations of all pathogens decreased by ca. 2 log in all samples. At that sampling time, L. monocytogenes was undetectable in the chouriço de vinho with L. sakei starter culture and carbohydrates. The mean count of S. aureus after 15 days of drying was below 1 log CFU/g. After 30 days of drying, no pathogens were detected. The drying period could be shortened to 15 days when considering only the gram-positive pathogens studied and the use of a starter culture and carbohydrates. Due to the low infective dose of Salmonella spp., the product should be considered safe after 30 days, when this pathogen became undetectable.
Chen, Jianshun; Chen, Qiaomiao; Jiang, Lingli; Cheng, Changyong; Bai, Fan; Wang, Jun; Mo, Fan; Fang, Weihuan
2010-03-31
Ecological, biochemical and genetic resemblance as well as clear differences of virulence between L. monocytogenes and L. innocua make this bacterial clade attractive as a model to examine evolution of pathogenicity. This study was attempted to examine the population structure of L. innocua and the microevolution in the L. innocua-L. monocytogenes clade via profiling of 37 internalin genes and multilocus sequence typing based on the sequences of 9 unlinked genes gyrB, sigB, dapE, hisJ, ribC, purM, gap, tuf and betL. L. innocua was genetically monophyletic compared to L. monocytogenes, and comprised four subgroups. Subgroups A and B correlated with internalin types 1 and 3 (except the strain 0063 belonging to subgroup C) and internalin types 2 and 4 respectively. The majority of L. innocua strains belonged to these two subgroups. Subgroup A harbored a whole set of L. monocytogenes-L. innocua common and L. innocua-specific internalin genes, and displayed higher recombination rates than those of subgroup B, including the relative frequency of occurrence of recombination versus mutation (rho/theta) and the relative effect of recombination versus point mutation (r/m). Subgroup A also exhibited a significantly smaller exterior/interior branch length ratio than expected under the coalescent model, suggesting a recent expansion of its population size. The phylogram based on the analysis with correction for recombination revealed that the time to the most recent common ancestor (TMRCA) of L. innocua subgroups A and B were similar. Additionally, subgroup D, which correlated with internalin type 5, branched off from the other three subgroups. All L. innocua strains lacked seventeen virulence genes found in L. monocytogenes (except for the subgroup D strain L43 harboring inlJ and two subgroup B strains bearing bsh) and were nonpathogenic to mice. L. innocua represents a young species descending from L. monocytogenes and comprises four subgroups: two major subgroups A and B
2010-01-01
Background Ecological, biochemical and genetic resemblance as well as clear differences of virulence between L. monocytogenes and L. innocua make this bacterial clade attractive as a model to examine evolution of pathogenicity. This study was attempted to examine the population structure of L. innocua and the microevolution in the L. innocua-L. monocytogenes clade via profiling of 37 internalin genes and multilocus sequence typing based on the sequences of 9 unlinked genes gyrB, sigB, dapE, hisJ, ribC, purM, gap, tuf and betL. Results L. innocua was genetically monophyletic compared to L. monocytogenes, and comprised four subgroups. Subgroups A and B correlated with internalin types 1 and 3 (except the strain 0063 belonging to subgroup C) and internalin types 2 and 4 respectively. The majority of L. innocua strains belonged to these two subgroups. Subgroup A harbored a whole set of L. monocytogenes-L. innocua common and L. innocua-specific internalin genes, and displayed higher recombination rates than those of subgroup B, including the relative frequency of occurrence of recombination versus mutation (ρ/θ) and the relative effect of recombination versus point mutation (r/m). Subgroup A also exhibited a significantly smaller exterior/interior branch length ratio than expected under the coalescent model, suggesting a recent expansion of its population size. The phylogram based on the analysis with correction for recombination revealed that the time to the most recent common ancestor (TMRCA) of L. innocua subgroups A and B were similar. Additionally, subgroup D, which correlated with internalin type 5, branched off from the other three subgroups. All L. innocua strains lacked seventeen virulence genes found in L. monocytogenes (except for the subgroup D strain L43 harboring inlJ and two subgroup B strains bearing bsh) and were nonpathogenic to mice. Conclusions L. innocua represents a young species descending from L. monocytogenes and comprises four subgroups: two
Koutsoumanis, Konstantinos; Pavlis, Athanasios; Nychas, George-John E.; Xanthiakos, Konstantinos
2010-01-01
A survey on the time-temperature conditions of pasteurized milk in Greece during transportation to retail, retail storage, and domestic storage and handling was performed. The data derived from the survey were described with appropriate probability distributions and introduced into a growth model of Listeria monocytogenes in pasteurized milk which was appropriately modified for taking into account strain variability. Based on the above components, a probabilistic model was applied to evaluate the growth of L. monocytogenes during the chill chain of pasteurized milk using a Monte Carlo simulation. The model predicted that, in 44.8% of the milk cartons released in the market, the pathogen will grow until the time of consumption. For these products the estimated mean total growth of L. monocytogenes during transportation, retail storage, and domestic storage was 0.93 log CFU, with 95th and 99th percentiles of 2.68 and 4.01 log CFU, respectively. Although based on EU regulation 2073/2005 pasteurized milk produced in Greece belongs to the category of products that do not allow the growth of L. monocytogenes due to a shelf life (defined by law) of 5 days, the above results show that this shelf life limit cannot prevent L. monocytogenes from growing under the current chill chain conditions. The predicted percentage of milk cartons—initially contaminated with 1 cell/1-liter carton—in which the pathogen exceeds the safety criterion of 100 cells/ml at the time of consumption was 0.14%. The probabilistic model was used for an importance analysis of the chill chain factors, using rank order correlation, while selected intervention and shelf life increase scenarios were evaluated. The results showed that simple interventions, such as excluding the door shelf from the domestic storage of pasteurized milk, can effectively reduce the growth of the pathogen. The door shelf was found to be the warmest position in domestic refrigerators, and it was most frequently used by the
Lotfollahi, Lida; Chaharbalesh, Ardalan; Ahangarzadeh Rezaee, Mohammad; Hasani, Alka
2017-06-01
Listeria monocytogenes is a foodborne pathogen causing listeriosis, which potentially affects all individuals, especially pregnant women and immunocompromised persons. The present study investigated the prevalence, antimicrobial susceptibility and serotypes distribution of the isolated L. monocytogenes from Iran. Twenty two (4.97%) of 442 human, food and livestock samples were found to be positive for L. monocytogenes. L. monocytogenes was identified in 8.8% of 125 human samples, 2.99% of 267 food and 6% of 50 livestock samples. The standard disk diffusion method and minimum inhibitory concentration (MIC) assay were used for antimicrobial susceptibility testing and multiplex PCR for serotyping. Among the 22 isolates tested, 6 (27.2%) displayed resistance to penicillin G, with all of the isolates and 2 (9%) of them showing intermediate susceptibility to clindamycin and rifampicin, respectively. According to the MIC assay, the rate of resistance to penicillin G was the same as that of disk diffusion method, but 16 (72.7%) of isolates showed intermediate susceptibility to clindamycin using E-test. In the multiplex PCR, 19 (86.4%) of isolates belonged to serotype 1/2c or 3c and the remaining 3 isolates were identified as (4b, 4d or 4e) and (1/2a or 3a), respectively. The occurrence of resistance to penicillin G, which can be used in the treatment of listeriosis, is very alarming and more prevalence of 1/2c serotype, in comparison to 3 other important ones (1/2a, 1/2b and 4b), in Iran has been reported for the first time. To the best of our knowledge, this is the first study showing the distribution of various serogroups of L. monocytogenes from human and livestock in Iran. Copyright © 2017 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Soghra Rabiey
2014-01-01
Full Text Available This study was conducted to evaluate the antibacterial effect of Carum copticum essential oil (Ajowan EO against Listeria monocytogenes in fish model system. Ajowan EO chemical composition was determined by gas chromatography/mass spectral analysis and the highest concentration of Carum copticum essential oil without any significant changes on sensory properties of kutum fish (Rutilus frisii kutum was assigned. Then the inhibitory effect of Ajowan EO at different concentrations in presence of salt and smoke component was tested on L. monocytogenes growth in fish peptone broth (FPB, kutum broth and cold smoked kutum broth at 4 ºC for 12 days. Ajowan EO completely decreased the number of L. monocytogenes in FPB after 12 days of storage, however, antimicrobial effect of EO significantly reduced in kutum and cold smoked kutum broth. Addition of 4% NaCl and smoke component improved the anti-listerial activity of Ajowan EO in all fish model broths.
Ingrid, Lenoir; Lounès-Hadj Sahraoui, Anissa; Frédéric, Laruelle; Yolande, Dalpé; Joël, Fontaine
2016-06-01
Very few studies reported the potential of arbuscular mycorrhizal symbiosis to dissipate hydrocarbons in aged polluted soils. The present work aims to study the efficiency of arbuscular mycorrhizal colonized wheat plants in the dissipation of alkanes and polycyclic aromatic hydrocarbons (PAHs). Our results demonstrated that the inoculation of wheat with Rhizophagus irregularis allowed a better dissipation of PAHs and alkanes after 16 weeks of culture by comparison to non-inoculated condition. These dissipations observed in the inoculated soil resulted from several processes: (i) a light adsorption on roots (0.5% for PAHs), (ii) a bioaccumulation in roots (5.7% for PAHs and 6.6% for alkanes), (iii) a transfer in shoots (0.4 for PAHs and 0.5% for alkanes) and mainly a biodegradation. Whereas PAHs and alkanes degradation rates were respectively estimated to 12 and 47% with non-inoculated wheat, their degradation rates reached 18 and 48% with inoculated wheat. The mycorrhizal inoculation induced an increase of Gram-positive and Gram-negative bacteria by 56 and 37% compared to the non-inoculated wheat. Moreover, an increase of peroxidase activity was assessed in mycorrhizal roots. Taken together, our findings suggested that mycorrhization led to a better hydrocarbon biodegradation in the aged-contaminated soil thanks to a stimulation of telluric bacteria and hydrocarbon metabolization in mycorrhizal roots. Copyright © 2016 Elsevier Ltd. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Gumus, Tuncay [Department of Food Engineering, Faculty of Agriculture, Namik Kemal University, 59030 Tekirdag (Turkey); Sukru Demirci, A; Murat Velioglu, H; Velioglu, Serap D; Yilmaz, Ismail [Department of Food Engineering, Faculty of Agriculture, Namik Kemal University, 59030 Tekirdag (Turkey); Sagdic, Osman [Department of Food Engineering, Faculty of Engineering, Erciyes University, Kayseri (Turkey)
2008-09-15
In this research, the effect of gamma irradiation on the inactivation of Escherichia coli O157:H7 (ATCC 33150), Staphylococcus aureus (ATCC 2392) and Salmonella typhimurium (NRRL 4463) inoculated into Tekirdag meatballs was investigated. The meatball samples were inoculated with pathogens and irradiated at the absorbed doses of 1, 2.2, 3.2, 4.5 and 5.2 kGy. E. coli O157:H7 count in 1 kGy irradiated meatballs stored in the refrigerator for 7 days was detected to be 4 log cfu/g lower than the count in nonirradiated samples (p<0.05). S. aureus counts were decreased to 4 log cfu/g after being exposed to irradiation at a dose of 1 kGy. Although it was ineffective on elimination of S. typhimurium, irradiation at a dose of 3.2 kGy reduced E. coli O157:H7 and S. aureus counts under detectable values in the meatballs. However, none of the test organisms were detected in the samples after irradiation with 4.5 kGy doses.
International Nuclear Information System (INIS)
Gumus, Tuncay; Sukru Demirci, A.; Murat Velioglu, H.; Velioglu, Serap D.; Yilmaz, Ismail; Sagdic, Osman
2008-01-01
In this research, the effect of gamma irradiation on the inactivation of Escherichia coli O157:H7 (ATCC 33150), Staphylococcus aureus (ATCC 2392) and Salmonella typhimurium (NRRL 4463) inoculated into Tekirdag meatballs was investigated. The meatball samples were inoculated with pathogens and irradiated at the absorbed doses of 1, 2.2, 3.2, 4.5 and 5.2 kGy. E. coli O157:H7 count in 1 kGy irradiated meatballs stored in the refrigerator for 7 days was detected to be 4 log cfu/g lower than the count in nonirradiated samples (p<0.05). S. aureus counts were decreased to 4 log cfu/g after being exposed to irradiation at a dose of 1 kGy. Although it was ineffective on elimination of S. typhimurium, irradiation at a dose of 3.2 kGy reduced E. coli O157:H7 and S. aureus counts under detectable values in the meatballs. However, none of the test organisms were detected in the samples after irradiation with 4.5 kGy doses
Listeria monocytogenes in retailed raw chicken meat in Turkey.
Siriken, Belgin; Ayaz, Naim Deniz; Erol, Irfan
2014-01-01
The objectives of this study were, to find the prevalence and antimicrobial resistance of L. monocytogenes from a total of 116 chicken meat samples including 50 carcasses and 66 meat parts marketed in Turkey between 2008 and 2009 using immunomagnetic separation (IMS) based cultivation technique, to detect the hlyA gene for the verification of the isolates by PCR, and to identify the genoserotypes of the L. monocytogenes isolates by multiplex PCR assay. In the study, 51 L. monocytogenes colonies were isolated from 34 (29.3%) chicken meat samples (eleven [22.0%] carcasses and 23 [34.8%] pieces of meat) by IMS based cultivation technique and confirmed by PCR. According to the multiplex PCR results, all the 51 isolates were identified as genoserotype IIa (1/2a or 3a). L. monocytogenes isolates were also tested for their susceptibility to eight antibiotic (gentamicin, vancomycin, chloramphenicol, streptomycin, tetracycline, ampicillin, penicillin G, erythromycin) agents using the disk diffusion method. 14 isolates (27.45%) were susceptible to all eight antimicrobials drugs tested and the remaining 37 isolates (72.54%) were resistant to gentamicin (one isolate, 1.96%), vancomycin (four isolates, 7.84%), penicillin G (six isolates, 11.76%), streptomycin (nine isolates, 17.64%; resistant or intermediate), tetracycline (seven isolates, 13.72%) and ampicillin (six isolates, 11.76%). This study showed that antimicrobial resistance is not highly prevalent in L. monocytogenes isolated from chicken carcasses and pieces of meat. The presence of L. monocytogenes in chicken samples suggests an importance of this pathogen in chicken.
Listeria monocytogenes in Fresh Produce: Outbreaks, Prevalence and Contamination Levels
Directory of Open Access Journals (Sweden)
Qi Zhu
2017-03-01
Full Text Available Listeria monocytogenes, a member of the genus Listeria, is widely distributed in agricultural environments, such as soil, manure and water. This organism is a recognized foodborne pathogenic bacterium that causes many diseases, from mild gastroenteritis to severe blood and/or central nervous system infections, as well as abortion in pregnant women. Generally, processed ready-to-eat and cold-stored meat and dairy products are considered high-risk foods for L. monocytogenes infections that cause human illness (listeriosis. However, recently, several listeriosis outbreaks have been linked to fresh produce contamination around the world. Additionally, many studies have detected L. monocytogenes in fresh produce samples and even in some minimally processed vegetables. Thus L. monocytogenes may contaminate fresh produce if present in the growing environment (soil and water. Prevention of biofilm formation is an important control measure to reduce the prevalence and survival of L. monocytogenes in growing environments and on fresh produce. This article specifically focuses on fresh produce–associated listeriosis outbreaks, prevalence in growing environments, contamination levels of fresh produce, and associated fresh produce safety challenges.
Pradhan, Abani K; Ivanek, Renata; Gröhn, Yrjö T; Bukowski, Robert; Wiedmann, Martin
2011-11-01
This study compared the relative public health impact in deli meats at retail contaminated with Listeria monocytogenes by either (i) other products or (ii) the retail environment. Modeling was performed using the risk of listeriosis-associated deaths as a public health outcome of interest and using two deli meat products (i.e., ham and turkey, both formulated without growth inhibitors) as model systems. Based on reported data, deli meats coming to retail were assumed to be contaminated at a frequency of 0.4%. Three contamination scenarios were investigated: (i) a baseline scenario, in which no additional cross-contamination occurred at retail, (ii) a scenario in which an additional 2.3% of products were cross-contaminated at retail due to transfer of L. monocytogenes cells from already contaminated ready-to-eat deli meats, and (iii) a scenario in which an additional 2.3% of products were contaminated as a result of cross-contamination from a contaminated retail environment. By using a previously reported L. monocytogenes risk assessment model that uses product-specific growth kinetic parameters, cross-contamination of deli ham and turkey was estimated to increase the relative risk of listeriosis-associated deaths by 5.9- and 6.1-fold, respectively, for contamination from other products and by 4.9- and 5.8-fold, respectively, for contamination from the retail environment. Sensitivity and scenario analyses indicated that the frequency of cross-contamination at retail from any source (other food products or environment) was the most important factor affecting the relative risk of listeriosis-associated deaths. Overall, our data indicate that retail-level cross-contamination of ready-to-eat deli meats with L. monocytogenes has the potential to considerably increase the risk of human listeriosis cases and deaths, and thus precise estimates of cross-contamination frequency are critical for accurate risk assessments.
A Meta-analysis of the Rates of Listeria monocytogenes and Enterococcus in Febrile Infants.
Leazer, Rianna; Perkins, Amy M; Shomaker, Kyrie; Fine, Bryan
2016-04-01
A change in the epidemiology of pathogens causing serious bacterial infection (SBI) has been noted since original recommendations were made for the empirical antibiotic choices for young infants with fever. To assess the prevalence of SBI caused by Listeria monocytogenes and Enterococcus species. A literature search was conducted on keywords related to SBI, L. monocytogenes, and Enterococcus spp. infections. Eligible studies were those conducted in the United States and published between January 1998 and June 2014 focusing on SBI in infants≤90 days of age. The rates of urinary tract infection, bacteremia, and meningitis for each pathogen were recorded for each study. Meta-analysis was performed to calculate the prevalence for each pathogen in a random effects model with 0.5 continuity correction added to studies with zero events. Sixteen studies were included. A total of 20,703 blood cultures were included, with weighted prevalences for L. monocytogenes and Enterococcus spp. bacteremia of 0.03% and 0.09%, respectively. A total of 13,775 cerebrospinal fluid cultures were included with event rates (unweighted prevalences) for L. monocytogenes and Enterococcus spp. meningitis of 0.02% and 0.03%, respectively. A total of 18,283 urine cultures were included, with no cases of L. monocytogenes and a weighted prevalence for Enterococcus spp. urinary tract infection of 0.28%. There may have been reporting bias or incomplete retrieval or inadvertent exclusion of relevant studies. SBI caused by L. monocytogenes and Enterococcus spp. in febrile infants is rare, and therefore clinicians may consider a change in empirical antibiotic choices. Copyright © 2016 by the American Academy of Pediatrics.
Listeria monocytogenes infection of HD11, chicken macrophage-like cells.
Jarvis, N A; Donaldson, J R; O'Bryan, C A; Ricke, S C; Crandall, P G
2017-04-01
Listeria monocytogenes can be carried by and infect poultry, although the clinical disease in birds is rare. Escape from macrophage phagocytosis is a key step in pathogenesis for L. monocytogenes. Therefore, we investigated the infection of the chicken macrophage-like cell line HD11 with 2 strains of L. monocytogenes EGD-e and Scott A. After infection, L. monocytogenes was quantified by spread plating and HD11 was quantified with trypan blue exclusion stain before enumeration. The standard macrophage killing protocols require washing the cell monolayers 3 times with PBS, which was found to negatively influence HD11 monolayers. Maximum bacterial densities within macrophages were not different between the 2 Listeria strains. HD11 required more than 11 h to effectively reduce intracellular L. monocytogenes Scott A, and Scott A was more susceptible to HD11 killing than EGD-e. It appears that Listeria infection initially causes attenuation of HD11 growth, and infected HD11 cells do not begin to lyse until at least 11 h post infection. These results suggest that there are subtle strain to strain differences in response to HD11 macrophage phagocytosis. The long lead-time required for HD11 to kill L. monocytogenes cells means that there is sufficient time available for chicken macrophages to circulate in the blood and transfer the intracellular Listeria to multiple tissues. © 2016 Poultry Science Association Inc.
Survival of Bactericidal Antibiotic Treatment by a Persister Subpopulation of Listeria monocytogenes
DEFF Research Database (Denmark)
Knudsen, Gitte Maegaard; Ng, Yin; Gram, Lone
2013-01-01
Listeria monocytogenes can cause the serious infection listeriosis, which despite antibiotic treatment has a high mortality. Understanding the response of L. monocytogenes to antibiotic exposure is therefore important to ensure treatment success. Some bacteria survive antibiotic treatment...... by formation of persisters, which are a dormant antibiotic-tolerant subpopulation. The purpose of this study was to determine whether L. monocytogenes can form persisters and how bacterial physiology affects the number of persisters in the population. A stationary-phase culture of L. monocytogenes was adjusted...... that eradication of persisters is possible. Our study adds L. monocytogenes to the list of bacterial species capable of surviving bactericidal antibiotics in a dormant stage, and this persister phenomenon should be borne in mind when developing treatment regimens....
Combination of endolysins and high pressure to inactivate Listeria monocytogenes.
van Nassau, Tomas J; Lenz, Christian A; Scherzinger, Anna S; Vogel, Rudi F
2017-12-01
Outbreaks of listeriosis are often related to the consumption of low-processed ready-to-eat food products (e.g. soft cheeses or smoked fish) contaminated with Listeria monocytogenes. Traditional preservation techniques, such as heat treatment, cannot eliminate Listeria from these products without strongly affecting the quality of the foods. We therefore investigated the use of endolysin (PlyP40, Ply511, or PlyP825) in combination with high hydrostatic pressure processing to kill L. monocytogenes in buffer. The results demonstrated a more than additive effect when both treatments were combined. For example, whereas 0.16 μg/mL PlyP825 or 300 MPa (1 min, 30 °C) applied individually reduced the cell count by 0.2 and 0.3 log cfu, respectively, a combined treatment resulted in a reduction of 5.5 log cfu. Similar results were obtained for the other endolysins combined with high pressure processing. We also showed that the synergistic inactivation of cells by endolysin and HHP is possible at a pressure level of only 200 MPa (2 min, 30 °C). Thus, the application of endolysins did not only substantially increase the bactericidal effect of high pressure, but it also enabled the inactivation of bacterial cells at much lower pressure levels. This shows the potential of using such combined processes for the inactivation of L. monocytogenes and food preservation. Copyright © 2017 Elsevier Ltd. All rights reserved.
Detection of Listeria Spp. and Listeria monocytogenes in vegetables ...
African Journals Online (AJOL)
This paper aimed to study the prevalence and antibiotic resistance pattern among Listeria monocytogenes in raw vegetables sourced from commercial farms and local farms in Terengganu. Thirteen types of vegetables investigated for the presence of L. monocytogenes using multiplex PCR and LAMP methods. Isolation of ...
Directory of Open Access Journals (Sweden)
Paolo Matteini
2012-02-01
Full Text Available The study was aimed to predict the maximum concentration of Listeria monocytogenes during the shelf life in chicken liver paté. The prediction has been performed using the integrated challenge test: a test based on the interaction between indigenous lactic flora and L. monocytogenes and their growth parameters. Two different approaches were investigated: the former is based on the time difference between the onset of the L. monocytogenes and the lactic flora stationary phases, while the latter is based on the lactic flora concentration capable to induct the stationary phase of L. monocytogenes. Three different strains of L. monocytogenes, isolated from meat products, were used to perform three challenge tests. Triplicate samples from three different batches of liver paté were inoculated with a single-strain inoculum of 1.8 Log CFU/g. Samples were then stored at 4°C, 8°C and 12°C. Lactobacillus spp. (ISO 15214:1998 and L. monocytogenes (UNI EN ISO 11290-02:2005 plate counts were performed daily on each sample until the stationary phase was reached by both populations. The challenge test results were input in the Combase software to determine the growth parameters, later used for the calculation method. Predictive data were then statically assessed against the results of two additional challenge tests using triplicate samples from two different batches, the same strains and the same single-strain inoculum. Samples from the first batch were stored for 5 days at 4°C + 5 days at 8°C + 5 days at 12°C; samples from the second batch were stored for 3 days at 4°C + 3 days at 8°C + 4 days at 12°C. The results obtained showed that both approaches provided results very close to the reality. Therefore the Integrated challenge test is useful to determine the maximum concentration of L. monocytogenes, by simply knowing the concentration of the concerned microbial populations at a given time.
Mastronicolis, Sofia K; Berberi, Anita; Diakogiannis, Ioannis; Petrova, Evanthia; Kiaki, Irene; Baltzi, Triantafillia; Xenikakis, Polydoros
2010-10-01
This study provides a first approach to observe the effects on Listeria monocytogenes of cellular exposure to acid stress at low or neutral pH, notably how phospho- or neutral lipids are involved in this mechanism, besides the fatty acid profile alteration. A thorough investigation of the composition of polar and neutral lipids from L. monocytogenes grown at pH 5.5 in presence of hydrochloric, acetic and lactic acids, or at neutral pH 7.3 in presence of benzoic acid, is described relative to cells grown in acid-free medium. The results showed that only low pH values enhance the antimicrobial activity of an acid. We suggest that, irrespective of pH, the acid adaptation response will lead to a similar alteration in fatty acid composition [decreasing the ratio of branched chain/saturated straight fatty acids of total lipids], mainly originating from the neutral lipid class of adapted cultures. Acid adaptation in L. monocytogenes was correlated with a decrease in total lipid phosphorus and, with the exception of cells adapted to benzoic acid, this change in the amount of phosphorus reflected a higher content of the neutral lipid class. Upon acetic or benzoic acid stress the lipid phosphorus proportion was analysed in the main phospholipids present: cardiolipin, phosphatidylglycerol, phosphoaminolipid and phosphatidylinositol. Interestingly only benzoic acid had a dramatic effect on the relative quantities of these four phospholipids.
Biofilm-Forming Abilities of Listeria monocytogenes Serotypes Isolated from Different Sources
Doijad, Swapnil P.; Barbuddhe, Sukhadeo B.; Garg, Sandeep; Poharkar, Krupali V.; Kalorey, Dewanand R.; Kurkure, Nitin V.; Rawool, Deepak B.; Chakraborty, Trinad
2015-01-01
A total of 98 previously characterized and serotyped L. monocytogenes strains, comprising 32 of 1/2a; 20 of 1/2b and 46 of 4b serotype, from clinical and food sources were studied for their capability to form a biofilm. The microtiter plate assay revealed 62 (63.26%) strains as weak, 27 (27.55%) strains as moderate, and 9 (9.18%) strains as strong biofilm formers. Among the strong biofilm formers, 6 strains were of serotype 1/2a and 3 strains were of serotype 1/2b. None of the strain from 4b serotype exhibited strong biofilm formation. No firm correlation (p = 0.015) was noticed between any serotype and respective biofilm formation ability. Electron microscopic studies showed that strong biofilm forming isolates could synthesize a biofilm within 24 h on surfaces important in food industries such as stainless steel, ceramic tiles, high-density polyethylene plastics, polyvinyl chloride pipes, and glass. Cell enumeration of strong, moderate, and weak biofilm was performed to determine if the number of cells correlated with the biofilm-forming capabilities of the isolates. Strong, moderate, and weak biofilm showed 570±127× 103 cells/cm2, 33±26× 103 cells/cm2, 5±3× 103 cells/cm2, respectively, indicating that the number of cells was directly proportional to the strength of the biofilm. The hydrophobicity index (HI) analysis revealed higher hydrophobicity with an increased biofilm formation. Fatty acid methyl esterase analysis revealed the amount of certain fatty acids such as iso-C15:0, anteiso-C15:0, and anteiso-C17:0 fatty acids correlated with the biofilm-forming capability of L. monocytogenes. This study showed that different strains of L. monocytogenes form biofilm of different intensities which did not completely correlate with their serotype; however, it correlated with the number of cells, hydrophobicity, and amount of certain fatty acids. PMID:26360831
Biofilm-Forming Abilities of Listeria monocytogenes Serotypes Isolated from Different Sources.
Directory of Open Access Journals (Sweden)
Swapnil P Doijad
Full Text Available A total of 98 previously characterized and serotyped L. monocytogenes strains, comprising 32 of 1/2a; 20 of 1/2b and 46 of 4b serotype, from clinical and food sources were studied for their capability to form a biofilm. The microtiter plate assay revealed 62 (63.26% strains as weak, 27 (27.55% strains as moderate, and 9 (9.18% strains as strong biofilm formers. Among the strong biofilm formers, 6 strains were of serotype 1/2a and 3 strains were of serotype 1/2b. None of the strain from 4b serotype exhibited strong biofilm formation. No firm correlation (p = 0.015 was noticed between any serotype and respective biofilm formation ability. Electron microscopic studies showed that strong biofilm forming isolates could synthesize a biofilm within 24 h on surfaces important in food industries such as stainless steel, ceramic tiles, high-density polyethylene plastics, polyvinyl chloride pipes, and glass. Cell enumeration of strong, moderate, and weak biofilm was performed to determine if the number of cells correlated with the biofilm-forming capabilities of the isolates. Strong, moderate, and weak biofilm showed 570±127× 103 cells/cm2, 33±26× 103 cells/cm2, 5±3× 103 cells/cm2, respectively, indicating that the number of cells was directly proportional to the strength of the biofilm. The hydrophobicity index (HI analysis revealed higher hydrophobicity with an increased biofilm formation. Fatty acid methyl esterase analysis revealed the amount of certain fatty acids such as iso-C15:0, anteiso-C15:0, and anteiso-C17:0 fatty acids correlated with the biofilm-forming capability of L. monocytogenes. This study showed that different strains of L. monocytogenes form biofilm of different intensities which did not completely correlate with their serotype; however, it correlated with the number of cells, hydrophobicity, and amount of certain fatty acids.
Effect of humidity and temperature on the survival of Listeria monocytogenes on surfaces.
Redfern, J; Verran, J
2017-04-01
Listeria monocytogenes is a pathogenic bacterium, with human disease and infection linked to dairy products, seafood, ready-to-eat meat and raw & undercooked meats. Stainless steel is the most common food preparation surface and therefore, it is important to understand how food storage conditions such as surface materials, temperature and relative humidity can affect survival of L. monocytogenes. In this study, survival of L. monocytogenes on stainless steel was investigated at three temperatures (4, 10 and 21°C), each approx. 11, 50 and 85% humidity. Results indicate that the lower the temperature, the more cells were recovered in all three humidity environments, while medium humidity enhances survival, irrespective of temperature. Lower humidity decreases recovery at all temperatures. These data support the guidance noted above that humidity control is important, and that lower humidity environments are less likely to support retention of viable L. monocytogenes on a stainless steel surface. Understanding survival of potential food-borne pathogens is essential for the safe production and preparation of food. While it has long been 'common knowledge' that relative humidity can affect the growth and survival of micro-organisms, this study systematically describes the survival of L. monocytogenes on stainless steel under varying humidity and temperatures for the first time. The outcomes from this paper will allow those involved with food manufacture and preparation to make informed judgement on environmental conditions relating to humidity control, which is lacking in the food standards guidelines. © 2017 The Society for Applied Microbiology.
Early trigeminal nerve involvement in Listeria monocytogenes rhombencephalitis
DEFF Research Database (Denmark)
Karlsson, William K; Harboe, Zitta Barrella; Roed, Casper
2017-01-01
dysfunction on that side. In addition, we identified another 120 cases of Listeria rhombencephalitis following a systematic review. Cranial nerves VII, V, IX, and X, respectively, medulla oblongata, cerebellum and pons, were the most frequently involved brain structures. The present clinical and radiological...... findings corroborate earlier data from animal experiments, indicating that L. monocytogenes may be capable of retrograde intra-axonal migration along the cranial nerves. We suggest that in a subset of patients with rhombencephalitis L. monocytogenes enters the cerebellopontine angle through the trigeminal......Listeria monocytogenes is associated with rhombencephalitis. However, the exact mechanisms of brainstem invasion remains poorly understood. Here, we demonstrate clinical and radiological data suggesting that Listeria may invade the brainstem via the trigeminal nerve. Three females (41, 64 and 70...
Sugiri, Yoni Darmawan; Gölz, Greta; Meeyam, Tongkorn; Baumann, Maximilian P O; Kleer, Josef; Chaisowwong, Warangkhana; Alter, Thomas
2014-08-01
This study was conducted to determine the prevalence and quantify the number of Listeria monocytogenes in fresh chicken carcasses sold in traditional markets and supermarkets in Bandung, West Java, Indonesia, and to determine the antimicrobial resistance patterns of the isolated L. monocytogenes strains. The overall prevalence of L. monocytogenes in chicken carcasses was 15.8% (29/184). When comparing samples from traditional markets and supermarkets, no significant difference in the L. monocytogenes prevalence was detectable (15.2 versus 16.3%). Of the samples, 97.3% had L. monocytogenes counts study were grouped into the molecular serogroup IIb, comprising the serovars 1/2b, 3b, and 7.
Directory of Open Access Journals (Sweden)
Danielle N. Furtado
2015-03-01
Full Text Available Listeria monocytogenes is a pathogen frequently found in dairy products. Its control in fresh cheeses is difficult, due to the psychrotrophic properties and salt tolerance. Bacteriocinogenic lactic acid bacteria (LAB with proven in vitro antilisterial activity can be an innovative technological approach but their application needs to be evaluated by means of in situ tests. In this study, a novel bacteriocinogenic Lactococcus lactis strain (Lc. lactis DF4Mi, isolated from raw goat milk, was tested for control of growth of L. monocytogenes in artificially contaminated fresh Minas type goat cheese during storage under refrigeration. A bacteriostatic effect was achieved, and counts after 10 days were 3 log lower than in control cheeses with no added LAB. However, this effect did not differ significantly from that obtained with a non-bacteriocinogenic Lc. lactis strain. Addition of nisin (12.5 mg/kg caused a rapid decrease in the number of viable L. monocytogenes in the cheeses, suggesting that further studies with the purified bacteriocin DF4Mi may open new possibilities for this strain as biopreservative in dairy products.
Directory of Open Access Journals (Sweden)
Shi eWu
2016-02-01
Full Text Available Eighty Listeria monocytogenes isolates were obtained from Chinese retail ready-to-eat (RTE food and were previously characterized with serotyping and antibiotic susceptibility tests. The aim of this study was to characterize the subtype and virulence potential of these L. monocytogenes isolates by multilocus sequence typing (MLST, virulence-associate genes, epidemic clones (ECs and sequence analysis of the important virulence factor: internalin A (inlA. The result of MLST revealed that these L. monocytogenes isolates belonged to 14 different sequence types (STs. With the exception of four new STs (ST804, ST805, ST806 and ST807, all other STs observed in this study have been associated with human listeriosis and outbreaks to varying extents. Six virulence-associate genes (inlA, inlB, inlC, inlJ, hly and llsX were selected and their presence was investigated using PCR. All strains carried inlA, inlB, inlC, inlJ, and hly, whereas 38.8% (31/80 of strains harbored the listeriolysin S genes (llsX. A multiplex PCR assay was used to evaluate the presence of markers specific to epidemic clones of L. monocytogenes and identified 26.3% (21/80 of ECI in the 4b-4d-4e strains. Further study of inlA sequencing revealed that most strains contained the full-length InlA required for host cell invasion, whereas three mutations lead to premature stop codons (PMSC within a novel PMSCs at position 326 (GAA→TAA. MLST and inlA sequence analysis results were concordant, and different virulence potentials within isolates were observed. These findings suggest that L. monocytogenes isolates from RTE food in China could be virulent and be capable of causing human illness. Furthermore, the STs and virulence profiles of L. monocytogenes isolates have significant implications for epidemiological and public health studies of this pathogen.
Wu, Shi; Wu, Qingping; Zhang, Jumei; Chen, Moutong; Guo, Weipeng
2016-01-01
Eighty Listeria monocytogenes isolates were obtained from Chinese retail ready-to-eat (RTE) food and were previously characterized with serotyping and antibiotic susceptibility tests. The aim of this study was to characterize the subtype and virulence potential of these L. monocytogenes isolates by multilocus sequence typing (MLST), virulence-associate genes, epidemic clones (ECs), and sequence analysis of the important virulence factor: internalin A (inlA). The result of MLST revealed that these L. monocytogenes isolates belonged to 14 different sequence types (STs). With the exception of four new STs (ST804, ST805, ST806, and ST807), all other STs observed in this study have been associated with human listeriosis and outbreaks to varying extents. Six virulence-associate genes (inlA, inlB, inlC, inlJ, hly, and llsX) were selected and their presence was investigated using PCR. All strains carried inlA, inlB, inlC, inlJ, and hly, whereas 38.8% (31/80) of strains harbored the listeriolysin S genes (llsX). A multiplex PCR assay was used to evaluate the presence of markers specific to epidemic clones of L. monocytogenes and identified 26.3% (21/80) of ECI in the 4b-4d-4e strains. Further study of inlA sequencing revealed that most strains contained the full-length InlA required for host cell invasion, whereas three mutations lead to premature stop codons (PMSC) within a novel PMSCs at position 326 (GAA → TAA). MLST and inlA sequence analysis results were concordant, and different virulence potentials within isolates were observed. These findings suggest that L. monocytogenes isolates from RTE food in China could be virulent and be capable of causing human illness. Furthermore, the STs and virulence profiles of L. monocytogenes isolates have significant implications for epidemiological and public health studies of this pathogen.
Prevalence of Listeria monocytogenes in European cheeses: A systematic review and meta-analysis
DEFF Research Database (Denmark)
Martinez Rios, Veronica; Dalgaard, Paw
-ripened and brined) and for cheeses produced using pasteurized or un-pasteurized milk. Data from a total of 177428 samples were analysed. The mean prevalence during 2005-2013 and estimated from scientific literature (2.3%; CI: 1.4-3.8%) was more than two times higher than results from EFSA reports (0.9%; CI: 0...... not significantly different (P > 0.05) for cheeses produced from pasteurized (1.0%; CI: 0.7-1.5%) or un-pasteurized (1.4%; CI: 0.9-2.1%) milk. Furthermore, this systematic review focused on groups/species of microorganisms suitable as indicator organisms for L. monocytogenes in cheeses to reflect the level...
Leong, Dara; NicAogáin, Kerrie; Luque-Sastre, Laura; McManamon, Oisin; Hunt, Karen; Alvarez-Ordóñez, Avelino; Scollard, Johann; Schmalenberger, Achim; Fanning, Séamus; O'Byrne, Conor; Jordan, Kieran
2017-05-16
The problem of assessing the occurrence of the food-borne pathogen Listeria monocytogenes in the food chain, and therefore the risk of exposure of the human population, is often challenging because of the limited scope of some studies. In this study the occurrence of L. monocytogenes in food from four major food groups, dairy products, meats, seafood and vegetables, and associated food processing environments in Ireland was studied over a three-year period. Fifty-four small food businesses participated in the study and sent both food and environmental samples every 2months between 2013 and 2015. L. monocytogenes was isolated using the ISO11290 standard method. Confirmation of L. monocytogenes and identification of serogroups were achieved using a multiplex PCR assay, and for some isolates serotype was determined using commercial antisera. Pulsed- field gel electrophoresis (PFGE) analysis was performed on all isolates allowing the relatedness of isolates from different food businesses to be compared nationwide. In total, 86 distinct pulsotypes were identified. The overall occurrence of L. monocytogenes in food samples was 4.2%, while in environmental samples it was 3.8%. In general, the occurrence of L. monocytogenes in food businesses decreased over the course of the study, presumably reflecting increased awareness and vigilance. The majority of the pulsotypes detected were unique to a particular food group (63/86), while only three pulsotypes were found in all four food groups investigated. The highest occurrence in food was found in the meat category (7.5%) while seafood had the lowest rate of occurrence (1.8%). Seventeen of the pulsotypes detected in the study were persistent, where persistence was defined as repeated isolation from a single facility with a minimum time interval of 6months. Using PFGE, 11 of the pulsotypes identified in this study were indistinguishable from those of 11 clinical isolates obtained from patients in Ireland over the last 4years
Occurrence of Listeria monocytogenes in smoked fish in Sokoto ...
African Journals Online (AJOL)
The present study was conducted to determine the prevalence of Listeria monocytogenes in smoked fish in Sokoto, Nigeria. A total of 115 different species of smoked fish from the various retail outlets and market places within the metropolis were analysed for the presence of L. monocytogenes using ISO culture method.
Listeria monocytogenes plays a significant role in human food-borne disease caused by eating food contaminated with the bacterium and although incidence is low it is a leading cause of life-threatening, bacterial food-borne disease in humans. L. monocytogenes serotypes 1/2a and 4b can form mixed-cu...
Effekt av ulike desinfeksjonsstrategier mot Listeria monocytogenes
Fossmo, Sabine
2013-01-01
Kontroll med bakterier som Listeria utgjør en stor utfordring for mange matprodusenter. Listeria monocytogenes er hovedsakelig et produksjonshygienisk problem, forbedret hygiene kan derfor være tiltak for å redusere overlevelse og smitteoverføring av bakterien i produksjonsmiljø. Hensikten med forsøkene i oppgaven var å undersøke effekten av ulike desinfeksjonsstrategier på drap av L. monocytogenes, både når bakteriene var i biofilm og i suspensjon. Dette inkluderte bruk av tradisjonelle desi...
Rivoal, Katell; Fablet, Aurore; Courtillon, Céline; Bougeard, Stéphanie; Chemaly, Marianne; Protais, Jocelyne
2013-08-16
Human listeriosis, caused by Listeria monocytogenes, is a severe bacterial infection that can lead to meningitis, cerebromeningitis, bacteremia or septicemia, with acute lethality and potentially leading to death. A study has shown that 29.5% of the caged laying hens in France are contaminated by L. monocytogenes (Chemaly et al., 2008). However, very little information regarding egg and egg product contamination is currently available. The objective of this study is to determine the sanitary status of egg products and egg breaking plants in France regarding Listeria spp. and L. monocytogenes contaminations. The sampling scheme performed in five egg breaking plants in Western France during one year have revealed that 8.5% of raw egg products were contaminated by L. monocytogenes. No pasteurized egg products have been shown to be contaminated by L. monocytogenes. However, a high level of contamination by Listeria spp., and particularly by L. innocua, has been shown with 26.2% and 1.8% of raw and pasteurized egg products contaminated, respectively. This work has also revealed the presence of Listeria spp. and L. monocytogenes in the environment of egg breaking plants with 65.1% and 8.0% of contaminated samples, respectively. The typing of 253 isolates of L. monocytogenes by PFGE using ApaI and AscI enzymes has revealed a high diversity with 46 different pulsotypes and has shown that the raw material is a source of contamination of egg breaking plants. One L. monocytogenes cluster was dominant in the 5 egg-breaking plants during the four seasons studied. The issue of which strains are better adapted to egg products must be considered and studied in depth by comparing them to pulsotypes from strains of other chains. However, the traceability of L. monocytogenes in plants during the various seasons has also made it possible to highlight the presence of strains that are specific to egg breaking plants. The study of cleaning and disinfection methods in these plants as well
Infectious Dose of Listeria monocytogenes in Outbreak Linked to Ice Cream, United States, 2015.
Pouillot, Régis; Klontz, Karl C; Chen, Yi; Burall, Laurel S; Macarisin, Dumitru; Doyle, Matthew; Bally, Kären M; Strain, Errol; Datta, Atin R; Hammack, Thomas S; Van Doren, Jane M
2016-12-01
The relationship between the number of ingested Listeria monocytogenes cells in food and the likelihood of developing listeriosis is not well understood. Data from an outbreak of listeriosis linked to milkshakes made from ice cream produced in 1 factory showed that contaminated products were distributed widely to the public without any reported cases, except for 4 cases of severe illness in persons who were highly susceptible. The ingestion of high doses of L. monocytogenes by these patients infected through milkshakes was unlikely if possible additional contamination associated with the preparation of the milkshake is ruled out. This outbreak illustrated that the vast majority of the population did not become ill after ingesting a low level of L. monocytogenes but raises the question of listeriosis cases in highly susceptible persons after distribution of low-level contaminated products that did not support the growth of this pathogen.
Prevalence of Listeria monocytogenes in European cheeses
DEFF Research Database (Denmark)
Martinez Rios, Veronica; Dalgaard, Paw
2017-01-01
, respectively, pasteurized or un-pasteurized milk. Data from a total of 130,604 samples were analysed. Mean prevalence for presence during 2005-2015 estimated from scientific literature (2.3% with confidence interval (CI): 1.4-3.8%) was more than three times higher than results from EFSA reports (0.7%; CI: 0.......05) for cheeses produced from pasteurized (0.9%; CI: 0.4-1.9%) or un-pasteurized (1.0%; CI: 0.4-2.2%) milk. For cheese samples reported by EFSA 0.2% CI: 0.1-0.4% had concentration of L. monocytogenes above the critical European limits of 100 cfu/g. In addition, this systematic review focused on groups...
Directory of Open Access Journals (Sweden)
Oluwatosin Ademola Ijabadeniyi
2017-04-01
Full Text Available The effectiveness of sodium dodecyl sulphate (SDS, sodium hypochlorite solution and levulinic acid in reducing the survival of heat adapted and chlorine adapted Listeria monocytogenes ATCC 7644 was evaluated. The results against heat adapted L. monocytognes revealed that sodium hypochlorite solution was the least effective, achieving log reduction of 2.75, 2.94 and 3.97 log colony forming unit (CFU/mL for 1, 3 and 5 minutes, respectively. SDS was able to achieve 8 log reduction for both heat adapted and chlorine adapted bacteria. When used against chlorine adapted L. monocytogenes sodium hypochlorite solution achieved log reduction of 2.76, 2.93 and 3.65 log CFU/mL for 1, 3 and 5 minutes, respectively. Using levulinic acid on heat adapted bacteria achieved log reduction of 3.07, 2.78 and 4.97 log CFU/mL for 1, 3, 5 minutes, respectively. On chlorine adapted bacteria levulinic acid achieved log reduction of 2.77, 3.07 and 5.21 log CFU/mL for 1, 3 and 5 minutes, respectively. Using a mixture of 0.05% SDS and 0.5% levulinic acid on heat adapted bacteria achieved log reduction of 3.13, 3.32 and 4.79 log CFU/mL for 1, 3 and 5 minutes while on chlorine adapted bacteria it achieved 3.20, 3.33 and 5.66 log CFU/mL, respectively. Increasing contact time also increased log reduction for both test pathogens. A storage period of up to 72 hours resulted in progressive log reduction for both test pathogens. Results also revealed that there was a significant difference (P≤0.05 among contact times, storage times and sanitizers. Findings from this study can be used to select suitable sanitizers and contact times for heat and chlorine adapted L. monocytogenes in the fresh produce industry.
Directory of Open Access Journals (Sweden)
Wang Jun
2010-03-01
Full Text Available Abstract Background Ecological, biochemical and genetic resemblance as well as clear differences of virulence between L. monocytogenes and L. innocua make this bacterial clade attractive as a model to examine evolution of pathogenicity. This study was attempted to examine the population structure of L. innocua and the microevolution in the L. innocua-L. monocytogenes clade via profiling of 37 internalin genes and multilocus sequence typing based on the sequences of 9 unlinked genes gyrB, sigB, dapE, hisJ, ribC, purM, gap, tuf and betL. Results L. innocua was genetically monophyletic compared to L. monocytogenes, and comprised four subgroups. Subgroups A and B correlated with internalin types 1 and 3 (except the strain 0063 belonging to subgroup C and internalin types 2 and 4 respectively. The majority of L. innocua strains belonged to these two subgroups. Subgroup A harbored a whole set of L. monocytogenes-L. innocua common and L. innocua-specific internalin genes, and displayed higher recombination rates than those of subgroup B, including the relative frequency of occurrence of recombination versus mutation (ρ/θ and the relative effect of recombination versus point mutation (r/m. Subgroup A also exhibited a significantly smaller exterior/interior branch length ratio than expected under the coalescent model, suggesting a recent expansion of its population size. The phylogram based on the analysis with correction for recombination revealed that the time to the most recent common ancestor (TMRCA of L. innocua subgroups A and B were similar. Additionally, subgroup D, which correlated with internalin type 5, branched off from the other three subgroups. All L. innocua strains lacked seventeen virulence genes found in L. monocytogenes (except for the subgroup D strain L43 harboring inlJ and two subgroup B strains bearing bsh and were nonpathogenic to mice. Conclusions L. innocua represents a young species descending from L. monocytogenes and
Genome sequences of Listeria monocytogenes strains with resistance to arsenic
Listeria monocytogenes frequently exhibits resistance to arsenic. We report here the draft genome sequences of eight genetically diverse arsenic-resistant L. monocytogenes strains from human listeriosis and food-associated environments. Availability of these genomes would help to elucidate the role ...
Effects of prebiotics on the infective potential of Listeria monocytogenes
DEFF Research Database (Denmark)
Ebersbach, Tine
% xylooligosaccharides (XOS), galactooligosaccharides (GOS), inulin, apple pectin or polydextrose for three weeks before oral challenge with L. monocytogenes. XOS and GOS significantly improved resistance of guinea pigs to L. monocytogenes, while inulin and apple pectin decreased the resistance. No significant effect...
DEFF Research Database (Denmark)
Vogel, Birte Fonnesbech; Huss, Hans Henrik; Ojeniyi, B.
2001-01-01
and environment could not be excluded. Contamination of the product occurred in specific areas (the brining and slicing areas). In plant I, the same RAPD type (RAPD type 12) was found over a 4-year period, indicating that an established in-house flora persisted and was not eliminated by routine hygienic......, monocytogenes). A total of 429 strains of L. monocytogenes were subsequently compared by random amplified polymorphic DNA (RAPD) profiling, and 55 different RAPD types were found. The RAPD types detected on the products were identical to types found on the processing equipment and in the processing environment...... procedures. In plant II, where the prevalence of L, monocytogenes was much tower, no RAPD type persisted over long periods of time, and several different L, monocytogenes RAPD types were isolated. This indicates that persistent strains may be avoided by rigorous cleaning and sanitation; however, due...
Restraining reactive oxygen species in Listeria monocytogenes promotes the apoptosis of glial cells.
Li, Sen; Li, Yixuan; Chen, Guowei; Zhang, Jingchen; Xu, Fei; Wu, Man
2017-07-01
Listeria monocytogenes is a facultative anaerobic foodborne pathogen that can traverse the blood-brain barrier and cause brain infection. L. monocytogenes infection induces host cell apoptosis in several cell types. In this study, we investigated the apoptosis of human glioma cell line U251 invaded by L. monocytogenes and evaluated the function of bacterial reactive oxygen species (ROS) during infection. Bacterial ROS level was reduced by carrying out treatment with N-acetyl cysteine (NAC) and diphenyleneiodonium chloride (DPI). After infection, the apoptosis of U251 cells was examined by flow cytometry assay and propidium iodide staining. DPI and NAC efficiently decreased ROS level in L. monocytogenes without affecting bacterial growth. Moreover, the apoptosis of glial cells was enhanced upon invasion of DPI- and NAC-pretreated L. monocytogenes. Results indicate that the apoptosis of glial cells can be induced by L. monocytogenes, and that the inhibition of bacterial ROS increases the apoptosis of host cells.
Forney, Charles F; Fan, Lihua; Bezanson, Gregory S; Ells, Timothy C; LeBlanc, Denyse I; Fillmore, Sherry
2018-04-01
Rapid methods to detect bacterial pathogens on food and strategies to control them are needed to mitigate consumer risk. This study assessed volatile emissions from whole cantaloupe melons (Cucumis melo) as an indicator of Listeria contamination and in response to steam vapor decontamination. Cantaloupe were inoculated with Listeria innocua, a nonpathogenic surrogate for L. monocytogenes, then exposed to 85 °C steam for 240 s (4 min) followed by rapid chilling and storage for 0, 7, 10, or 14 days at 4, 7, or 10 °C. Volatile emissions from whole melons were collected on Carbopack B/Carboxen 1000 headspace collection tubes and analyzed by gas chromatography-mass spectroscopy following thermal desorption. Introduction of L. innocua to cantaloupe rind resulted in a reduction of aromatic compound emission. However, this response was not unique to Listeria contamination in that steam vapor treatment also reduced emission of these compounds. As well, steam vapor treatment diminished the number of viable Listeria and indigenous microflora while causing physiological injury to melon rind. Heat treatment had no significant effects on flesh firmness, color, titratable acidity, or soluble solids, but the production of typical aroma volatiles during postharvest ripening was inhibited. No unique volatile compounds were detected in Listeria contaminated melons. While changes in volatile emissions were associated with Listeria inoculation, they could not be differentiated from heat treatment effects. Results indicate that volatile emissions cannot be used as a diagnostic tool to identify Listeria contamination in whole cantaloupe melons. The detection of pathogen contamination on fresh produce is a continuing challenge. Using a nondestructive screening method, the presence of surrogate Listeria innocua on fresh whole cantaloupes was shown to alter the emissions of aromatic volatiles from whole cantaloupes. However, these altered emissions were not found to be unique to Listeria
el-Komy, H M; Saad, O A; Hetta, A M
2003-01-01
The effect of Herbaspirillum seropedicae inoculation and/or maize straw (0, 5 and 10 Mg/hm2) amendment on the growth and N2 fixation of wheat was determined in pot experiments using 15N-dilution method. Inoculation resulted in accumulation of fixed nitrogen, and % N from atmosphere being 24.6 and 26.5% in wheat shoot and grain, respectively. Straw amendment reduced % Natm to 16.1 and 20.2% at high straw level (10 Mg/hm2). Rational nitrogen fertilization (180 kg N/hm2) completely inhibited N2 fixation by H. seropedicae inoculation. Bacterial inoculation increased dry shoot and grain yield up to 23 and 31%, respectively. The highest levels of shoot and grain dry mass (46.5 and 42.4%) were obtained by N-fertilization in both inoculated and uninoculated plants. Total shoot and grain N-yield increased irrespective of organic matter amendment by inoculation up to 9 and 25%, respectively. N-fertilized plants recorded a maximum increase in N-yield (57 and 51%). H. seropedicae was reisolated from inoculated wheat histosphere after harvesting (90 d from sowing). Neither organic matter nor mineral nitrogen applications had any marked effect on bacterial total counts colonizing wheat histosphere. Moreover, no symptoms of mottled stripe disease were observed on leaves and stems of inoculated plants.
International Nuclear Information System (INIS)
Ingrid, Lenoir; Lounès-Hadj Sahraoui, Anissa; Frédéric, Laruelle; Yolande, Dalpé; Joël, Fontaine
2016-01-01
Very few studies reported the potential of arbuscular mycorrhizal symbiosis to dissipate hydrocarbons in aged polluted soils. The present work aims to study the efficiency of arbuscular mycorrhizal colonized wheat plants in the dissipation of alkanes and polycyclic aromatic hydrocarbons (PAHs). Our results demonstrated that the inoculation of wheat with Rhizophagus irregularis allowed a better dissipation of PAHs and alkanes after 16 weeks of culture by comparison to non-inoculated condition. These dissipations observed in the inoculated soil resulted from several processes: (i) a light adsorption on roots (0.5% for PAHs), (ii) a bioaccumulation in roots (5.7% for PAHs and 6.6% for alkanes), (iii) a transfer in shoots (0.4 for PAHs and 0.5% for alkanes) and mainly a biodegradation. Whereas PAHs and alkanes degradation rates were respectively estimated to 12 and 47% with non-inoculated wheat, their degradation rates reached 18 and 48% with inoculated wheat. The mycorrhizal inoculation induced an increase of Gram-positive and Gram-negative bacteria by 56 and 37% compared to the non-inoculated wheat. Moreover, an increase of peroxidase activity was assessed in mycorrhizal roots. Taken together, our findings suggested that mycorrhization led to a better hydrocarbon biodegradation in the aged-contaminated soil thanks to a stimulation of telluric bacteria and hydrocarbon metabolization in mycorrhizal roots. - Highlights: • Phytoremediation of aged-hydrocarbon polluted soils may be improved using arbuscular mycorrhizal fungi. • Inoculation of wheat with R. irregularis improved dissipation of PAH and alkanes. • Dissipation resulted from adsorption and bioaccumulation in wheat and mainly from biodegradation in soil. • Biodegradation was due to a stimulation of rhizosphere bacteria and an induction of root peroxidase. - Inoculation of wheat by an arbuscular mycorrhizal fungus improves biodegradation of alkanes and polycyclic aromatic hydrocarbons in an aged
Listeria monocytogenes internalizes in Romaine Lettuce grown in greenhouse conditions
Listeria monocytogenes has been implicated in a number of outbreaks involving fresh produce, including an outbreak in 2016 resulting from contaminated packaged salads. The persistence and internalization potential of L. monocytogenes in romaine lettuce was evaluated, and the persistence of two L. mo...
DEFF Research Database (Denmark)
Lorenzen, Emma; Follmann, Frank; Secher, Jan O
2017-01-01
Advanced animal models, such as minipigs, are needed for the development of a globally requested human Chlamydia vaccine. Previous studies have shown that vaginal inoculation of sexually mature Göttingen minipigs with Chlamydia trachomatis resulted in an infection lasting only 3-5 days. The aim...... resulted in a longer lasting infection (at least 10 days) compared to estrus (3-5 days). Furthermore, we found a significant C. trachomatis specific IFN-γ response in pigs inoculated during estrus correlating with the accelerated clearance of infection in these pigs. These findings suggest...
Stea, Emma C; Purdue, Laura M; Jamieson, Rob C; Yost, Chris K; Truelstrup Hansen, Lisbeth
2015-06-01
Foods and related processing environments are commonly contaminated with the pathogenic Listeria monocytogenes. To investigate potential environmental reservoirs of Listeria spp. and L. monocytogenes, surface water and point source pollution samples from an urban and a rural municipal water supply watershed in Nova Scotia, Canada, were examined over 18 months. Presumptive Listeria spp. were cultured from 72 and 35% of rural and urban water samples, respectively, with 24% of the positive samples containing two or three different Listeria spp. The L. innocua (56%) and L. welshimeri (43%) groups were predominant in the rural and urban watersheds, respectively. Analysis by the TaqMan assay showed a significantly (P monocytogenes of 62% versus 17% by the culture-based method. Both methods revealed higher prevalences in the rural watershed and during the fall and winter seasons. Elevated Escherichia coli (≥ 100 CFU/100 ml) levels were not associated with the pathogen regardless of the detection method. Isolation of Listeria spp. were associated with 70 times higher odds of isolating L. monocytogenes (odds ratio = 70; P monocytogenes isolates, followed by IVb (16.1%), IIb (15.8%), and IIc (0.4%). L. monocytogenes was detected in cow feces and raw sewage but not in septic tank samples. Pulsotyping of representative water (n = 54) and local human (n = 19) isolates suggested genetic similarities among some environmental and human L. monocytogenes isolates. In conclusion, temperate surface waters contain a diverse Listeria species population and could be a potential reservoir for L. monocytogenes, especially in rural agricultural watersheds. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Survival strategies of Listeria monocytogenes - roles of regulators and transporters
Wemekamp-Kamphuis, H.H.
2003-01-01
Outbreaks of the food-borne pathogen Listeria monocytogenes are mainly associated with ready-to-eatfoods. Survival strategies of L. monocytogenes in relation to minimally processed foods were studied.
Little, C L; Taylor, F C; Sagoo, S K; Gillespie, I A; Grant, K; McLauchlin, J
2007-01-01
As part of the European Commission (EC) co-ordinated programme for 2005, a study of pre-packaged ready-to-eat (RTE) mixed salads containing meat or seafood ingredients from retail premises was undertaken in the UK to determine the frequency and level of Listeria monocytogenes in these products. Almost all (99.8%; 2682/2686) samples were of satisfactory/acceptable microbiological quality. Two (0.1%) samples exceeded EC legal food safety criteria due to the presence of L. monocytogenes in excess of 100 cfu g(-1) (1.7 x 10(2), 9.9 x 10(2)cfu g(-1)) while another two (0.1%) were unsatisfactory due to L. welshimeri levels over 100 cfu g(-1) (1.2 x 10(3), 6.0 x 10(3) cfu g(-1)). Overall contamination of Listeria spp. and L. monocytogenes found in samples of mixed salads in the UK was 10.8% and 4.8%, respectively. Almost twice as many salad samples with meat ingredients were contaminated with Listeria spp. and L. monocytogenes (14.7% and 6.0%, respectively) compared to samples with seafood ingredients (7.4% and 3.8%, respectively). Pre-packaged mixed salads were contaminated with Listeria spp. and L. monocytogenes more frequently when: collected from sandwich shops; not packaged on the premises; stored or displayed above 8 degrees C. This study demonstrates that the control of L. monocytogenes in food manufacturing and at retail sale is essential in order to minimize the potential for this bacterium to be present in mixed salads at the point of consumption at levels hazardous to health.
DEFF Research Database (Denmark)
Nørrung, Birgit
2000-01-01
This paper shortly summarizes data related to risk assessment of Listeria monocytogenes. From available data on risk assessment, it is concluded that the levels of L. monocytogenes consumed is an important factor affecting the incidence of listeriosis. Foods that do not support the growth of L....... monocytogenes are unlikely to be a source of listeriosis, whereas foods that support the growth to high levels, should be the target of risk management efforts. Based on current epidemiological information from several countries, a concentration of L. monocytogenes not exceeding 100/g of food at the time...... of L. monocytogenes in the food during prevailing storage and distribution conditions is needed....
Prevalence of Listeria monocytogenes in raw milk in North Lebanon
International Nuclear Information System (INIS)
Al Kassaa, I; El Omari, Kh.; Esmail, B.; Hamze, M; Saati, M.
2016-01-01
Listeriosis, although a zoonosis, is an invasive disease that can affect newborns, pregnant women and immunocompromised adults. Clinical manifestations can be expressedby febrile gastroenteritis, invasive forms including severe sepsis, meningitis, rhombencephalitis, prenatal infections and abortions. Species of Listeria bacteria are ubiquitous and adaptableto the environment in animal and plant foods. This study aimed to determine the prevalence of Listeria monocytogenes in 100 samples of fresh cow milk collected from different areas of North Lebanon. Listeria monocytogenes was detected by using the Grand VIDAS technique (Biomérieux France). The results obtained revealed the absence of Listeria monocytogenes inall analyzed samples. (Author)
Prebiotic Oligosaccharides Potentiate Host Protective Responses against L. Monocytogenes Infection
Directory of Open Access Journals (Sweden)
Poyin Chen
2017-12-01
Full Text Available Prebiotic oligosaccharides are used to modulate enteric pathogens and reduce pathogen shedding. The interactions with prebiotics that alter Listeria monocytogenes infection are not yet clearly delineated. L. monocytogenes cellular invasion requires a concerted manipulation of host epithelial cell membrane receptors to initiate internalization and infection often via receptor glycosylation. Bacterial interactions with host glycans are intimately involved in modulating cellular responses through signaling cascades at the membrane and in intracellular compartments. Characterizing the mechanisms underpinning these modulations is essential for predictive use of dietary prebiotics to diminish pathogen association. We demonstrated that human milk oligosaccharide (HMO pretreatment of colonic epithelial cells (Caco-2 led to a 50% decrease in Listeria association, while Biomos pretreatment increased host association by 150%. L. monocytogenes-induced gene expression changes due to oligosaccharide pretreatment revealed global alterations in host signaling pathways that resulted in differential subcellular localization of L. monocytogenes during early infection. Ultimately, HMO pretreatment led to bacterial clearance in Caco-2 cells via induction of the unfolded protein response and eIF2 signaling, while Biomos pretreatment resulted in the induction of host autophagy and L. monocytogenes vacuolar escape earlier in the infection progression. This study demonstrates the capacity of prebiotic oligosaccharides to minimize infection through induction of host-intrinsic protective responses.
Deciphering the landscape of host barriers to Listeria monocytogenes infection.
Zhang, Ting; Abel, Sören; Abel Zur Wiesch, Pia; Sasabe, Jumpei; Davis, Brigid M; Higgins, Darren E; Waldor, Matthew K
2017-06-13
Listeria monocytogenes is a common food-borne pathogen that can disseminate from the intestine and infect multiple organs. Here, we used sequence tag-based analysis of microbial populations (STAMP) to investigate L monocytogenes population dynamics during infection. We created a genetically barcoded library of murinized L monocytogenes and then used deep sequencing to track the pathogen's dissemination routes and quantify its founding population ( N b ) sizes in different organs. We found that the pathogen disseminates from the gastrointestinal tract to distal sites through multiple independent routes and that N b sizes vary greatly among tissues, indicative of diverse host barriers to infection. Unexpectedly, comparative analyses of sequence tags revealed that fecally excreted organisms are largely derived from the very small number of L. monocytogenes cells that colonize the gallbladder. Immune depletion studies suggest that distinct innate immune cells restrict the pathogen's capacity to establish replicative niches in the spleen and liver. Finally, studies in germ-free mice suggest that the microbiota plays a critical role in the development of the splenic, but not the hepatic, barriers that prevent L. monocytogenes from seeding these organs. Collectively, these observations illustrate the potency of the STAMP approach to decipher the impact of host factors on population dynamics of pathogens during infection.
Activity of daptomycin against Listeria monocytogenes isolates from cerebrospinal fluid
Spanjaard, Lodewijk; Vandenbroucke-Grauls, Christina M. J. E.
2008-01-01
We tested the activity of daptomycin against 76 Listeria monocytogenes isolates from cerebrospinal fluid by broth dilution and Etest methods. For the broth dilution method, the MIC range was 1.0 to 8.0 and the MIC at which 90% of the isolates tested were inhibited (MIC(90)) was 4.0 mg/liter. For the
Directory of Open Access Journals (Sweden)
Hayat Ennaji
2008-09-01
Full Text Available Hayat Ennaji1,2, Mohammed Timinouni2, My Mustapha Ennaji3, Mohammed Hassar1, Nozha Cohen11Laboratoire de Microbiologie et Hygiène des Aliments et de l’Environnement, Institut Pasteur du Maroc., Casablanca, Morocco; 2Laboratoire de Microbiologie et Biologie Moléculaire, Institut Pasteur du Maroc., Casablanca, Morocco; 3Laboratoire de Virologie et Hygiène and Microbiologie., Faculté des Sciences et Techniques - Mohammedia, Université Hassan II, Mohammedia, MoroccoAbstract: This study was carried out on 426 samples of raw meats collected from butcheries and supermarkets in Casablanca, Morocco. The samples were examined for the occurrence of Listeria species. Strains of Listeria monocytogenes were characterized by several biochemical tests and confirmed by polymerase chain reaction (PCR. β-hemolytic cultures and nonhemolytic isolates were tested for biochemical properties with the Listeria API test. Among the 43 Listeria species isolates; we identified 10 strains for L. monocytogenes (23.3%, 31 strains for L. innocua (72.1% and 2 strains for L. welshimeri (4.6%. Strains of L. monocytogenes were separated by multiplex PCR; two serogroups IIb and IVb were thus differentiated. Antibiotic susceptibility of L. monocytogenes to 21 antibiotics was determined by the disk diffusion method. All isolates were susceptible to a wide range of the tested antibiotics with the exception of nalidixic acid, colistine and cephalosporins second and third generation for which they were all resistant.Keywords: antibiotic susceptibility, Listeria monocytogenes, meat, PCR
Listeria monocytogenes: diagnostic problems
Beumer, R.R.; Hazeleger, W.C.
2003-01-01
The first isolation methods for the detection of Listeria spp. were generally based on the direct culture of samples on simple agar media, but isolation of the pathogenic Listeria monocytogenes was difficult. In time, new techniques were developed, based on a variety of selective and elective agents
Zittermann, Sandra I; Stanghini, Brenda; See, Ryan Soo; Melano, Roberto G; Boleszczuk, Peter; Murphy, Allana; Maki, Anne; Mallo, Gustavo V
2016-01-01
Detection of Listeria monocytogenes in food is currently based on enrichment methods. When L. monocytogenes is present with other Listeria species in food, the species compete during the enrichment process. Overgrowth competition of the nonpathogenic Listeria species might result in false-negative results obtained with the current reference methods. This potential issue was noted when 50 food samples artificially spiked with L. monocytogenes were tested with a real-time PCR assay and Canada's current reference method, MFHPB-30. Eleven of the samples studied were from foods naturally contaminated with Listeria species other than those used for spiking. The real-time PCR assay detected L. monocytogenes in all 11 of these samples; however, only 6 of these samples were positive by the MFHPB-30 method. To determine whether L. monocytogenes detection can be affected by other species of the same genus due to competition, an L. monocytogenes strain and a Listeria innocua strain with a faster rate of growth in the enrichment broth were artificially coinoculated at different ratios into ground pork meat samples and cultured according to the MFHPB-30 method. L. monocytogenes was detected only by the MFHPB-30 method when L. monocytogenes/L. innocua ratios were 6.0 or higher. In contrast, using the same enrichments, the real-time PCR assay detected L. monocytogenes at ratios as low as 0.6. Taken together, these findings support the hypothesis that L. monocytogenes can be outcompeted by L. innocua during the MFHPB-30 enrichment phase. However, more reliable detection of L. monocytogenes in this situation can be achieved by a PCR-based method mainly because of its sensitivity.
Wu, Shan; Zhang, Xiaofeng; Shuai, Jiangbing; Li, Ke; Yu, Huizhen; Jin, Chenchen
2016-07-04
To simplify the PNA-FISH (Peptide nucleic acid-fluorescence in situ hybridization) test, molecular beacon based PNA probe combined with fluorescence scanning detection technology was applied to replace the original microscope observation to detect Listeria monocytogenes The 5′ end and 3′ end of the L. monocytogenes specific PNA probes were labeled with the fluorescent group and the quenching group respectively, to form a molecular beacon based PNA probe. When PNA probe used for fluorescence scanning and N1 treatment as the control, the false positive rate was 11.4%, and the false negative rate was 0; when N2 treatment as the control, the false positive rate decreased to 4.3%, but the false negative rate rose to 18.6%. When beacon based PNA probe used for fluorescence scanning, taken N1 treatment as blank control, the false positive rate was 8.6%, and the false negative rate was 1.4%; taken N2 treatment as blank control, the false positive rate was 5.7%, and the false negative rate was 1.4%. Compared with PNA probe, molecular beacon based PNA probe can effectively reduce false positives and false negatives. The success rates of hybridization of the two PNA probes were 83.3% and 95.2% respectively; and the rates of the two beacon based PNA probes were 91.7% and 90.5% respectively, which indicated that labeling the both ends of the PNA probe dose not decrease the hybridization rate with the target bacteria. The combination of liquid phase PNA-FISH and fluorescence scanning method, can significantly improve the detection efficiency.
DEFF Research Database (Denmark)
Martinez Rios, Veronica; Østergaard Jørgensen, Marie; Koukou, Ioulia
Absence of L. monocytogenes growth in ready-to-eat foods at the consumer phase is estimated to reduce listeriosis cases per year by 37% (EFSA, 16, 1-173, 2018). Spreadable cheeses are ready-to-eat foods with products characteristics including pH of 5.6-6.4 and NaCl of 0.7-1.6% w/w that may support...
Rocha, Cláudia E; Mol, Juliana P S; Garcia, Luize N N; Costa, Luciana F; Santos, Renato L; Paixão, Tatiane A
2017-01-01
Listeria monocytogenes is a Gram-positive, facultative intracellular and invasive bacterium that has tropism to the placenta, and causes fetal morbidity and mortality in several mammalian species. While infection with L. monocytogenes and L. ivanovii are known as important causes of abortion and reproductive failure in cattle, the pathogenesis of maternal-fetal listeriosis in this species is poorly known. This study used the bovine chorioallantoic membrane explant model to investigate the kinetics of L. monocytogenes, L. ivanovii, and L. innocua infections in bovine trophoblastic cells for up to 8 h post infection. L. monocytogenes and L. ivanovii were able to invade and multiply in trophoblastic cells without causing cell death or inducing expression of pro-inflammatory genes. Although L. innocua was unable to multiply in bovine trophoblastic cells, it induced transcription of the pro-inflammatory mediator CXCL6. This study demonstrated for the first time the susceptibility of bovine trophoblastic cells to L. monocytogenes and L. ivanovii infection.
Directory of Open Access Journals (Sweden)
Marcela Ribeiro Gasparini
Full Text Available Despite our current knowledge of the immunology, pathology, and genetics of Anaplasma marginale, prevention in cattle is currently based on old standbys, including live attenuated vaccines, antibiotic treatment, and maintaining enzootic stability in cattle herds. In the present study, we evaluated the use of an immunostimulant complex (ISCOMATRIX adjuvant, associated with a pool of recombinant major surface proteins (rMSP1a, rMSP1b, rMSP4 and rMSP5 to improve the humoral immune response triggered in calves mainly by IgG2. Ten calves were divided in three groups: 4 calves were inoculated with the ISCOMATRIX/rMSPs (G1; 2 calves were inoculated with ISCOMATRIX adjuvant (G2; and 4 calves received saline (G3. Three inoculations were administered at 21-day intervals. In G1, the calves showed significant increases in total IgG, IgG1 and IgG2 levels 21 days after the second inoculation, compared to the control group (p < 0.05, and G1 calves remained above the cut-off value 28 days after the third inoculation (p < 0.05. The post-immunized sera from calves in G1 reacted specifically for each of the rMSPs used. In conclusion, the ISCOMATRIX/rMSPs induced antigen-specific seroconversion in calves. Therefore, additional testing to explore the protection induced by rMSPs, both alone and in conjunction with proteins previously identified as subdominant epitopes, is warranted.
Directory of Open Access Journals (Sweden)
Ke Feng
Full Text Available Fresh-cut cantaloupe is particularly susceptible to contamination with pathogenic bacteria, such as Escherichia coli O157:H7, Listeria monocytogenes, and Staphylococcus aureus. Therefore, development of rapid, yet accurate detection techniques is necessary to ensure food safety. In this study, a multiplex PCR system and propidium monoazide (PMA concentration were optimized to detect all viable pathogens in a single tube. A dual filtration system utilized a filtration membrane with different pore sizes to enrich pathogens found on fresh-cut cantaloupe. The results revealed that an optimized multiplex PCR system has the ability to effectively detect three pathogens in the same tube. The viable pathogens were simultaneously detected for PMA concentrations above 10 μg/ml. The combination of a nylon membrane (15 μm and a micro pore filtration membrane (0.22 μm formed the dual filtration system used to enrich pathogens. The achieved sensitivity of PMA-mPCR based on this dual filtration system was 2.6 × 103 cfu/g for L. monocytogenes, 4.3 × 10 cfu/g for E. coli O157:H7, and 3.1 × 102 cfu/g for S. aureus. Fresh-cut cantaloupe was inoculated with the three target pathogens using concentrations of 103, 102, 10, and 1 cfu/g. After 6-h of enrichment culture, assay sensitivity increased to 1 cfu/g for each of these pathogens. Thus, this technique represents an efficient and rapid detection tool for implementation on fresh-cut cantaloupe.
Sanitizer efficacy in preventing cross-contamination of heads of lettuce during retail crisping.
Jung, Yangjin; Jang, Hyein; Guo, Mengqi; Gao, Jingwen; Matthews, Karl R
2017-06-01
This study was conducted to provide information regarding mitigation of cross-contamination through the use of sanitizer during crisping at retail outlets. Seven non-inoculated heads and one inoculated head (≈5 log CFU/g) of lettuce were placed into commercial sink filled with 76 L of tap water (TW), electrolyzed water (EW, free chlorine: 43 ± 6 ppm), lactic acid and phosphoric acid-based sanitizer (LPA, pH 2.89), or citric acid-based sanitizer (CA, pH 2.78) and soaked for 5 min. Two subsequent batches (eight non-inoculated heads per batch) were soaked in the same solution. Soaking with EW significantly reduced the population of S. enterica (2.8 ± 1.5 log CFU/g), E. coli O157:H7 (3.4 ± 1.1 log CFU/g), and L. monocytogenes (2.6 ± 0.7 log CFU/g) inoculated on Romaine lettuce compared to TW, LPA, and CA (p lettuce, EW significantly reduced populations of S. enterica and E. coli O157:H7, but not L. monocytogenes compared to other treatments. No significant difference was noted between TW, LPA, and CA in reducing foodborne pathogens (p > 0.05) or preventing cross-contamination. Soaking with EW prevented cross-contamination among lettuce heads and controlled bacterial populations in crisping water for three consecutive batches. EW may be an effective option as a sanitizer to minimizing the cross-contamination of leafy greens during the retail crisping. Copyright © 2017 Elsevier Ltd. All rights reserved.
Incidence and control of Listeria monocytogenes in foods in Denmark
DEFF Research Database (Denmark)
Nørrung, Birgit; Andersen, Jens Kirk; Schlundt, Jørgen
1999-01-01
The Danish regulatory policy on Listeria monocytogenes in foods is based on the principles of HACCP and was developed using a health risk assessment approach. The Danish policy focuses examinations and criteria for L. monocytogenes in ready-to-eat foods and is based on a combination of inspection...
DEFF Research Database (Denmark)
Zhu, Xinna; Long, Fei; Chen, Yonghui
2008-01-01
Listeria monocytogenes may persist for long periods in food processing environments. In some instances, this may be due to aggregation or biofilm formation. To investigate the mechanism controlling biofilm formation in the food-borne pathogen L. monocytogenes, we characterized LM-49, a mutant...... with enhanced ability of biofilm-formation generated via transposon Tn917 mutagenesis of L. monocytogenes 4b G. In this mutant, a Tn917 insertion has disrupted the coding region of the gene encoding a putative ATP binding cassette (ABC) transporter permease identical to Lmof2365_1771 (a putative ABC...... the same amount of biofilm biomass as the wild-type strain. Furthermore, transcription of the downstream lm.G_1770 was not influenced by the upstream Tn917 insertion, and the presence of Tn917 has no effect on biofilm formation. These results suggest that lm.G_1771 was solely responsible for the negative...
Skowron, Krzysztof; Kwiecińska-Piróg, Joanna; Grudlewska, Katarzyna; Świeca, Agnieszka; Paluszak, Zbigniew; Bauza-Kaszewska, Justyna; Wałecka-Zacharska, Ewa; Gospodarek-Komkowska, Eugenia
2018-06-13
The aim of this research was to investigate the occurrence of Listeria monocytogenes in fish and fish processing plant and to determine their transmission, virulence and antibiotic resistance. L. monocytogenes was isolated according to the ISO 11290-1. The identification of L. monocytogenes was confirmed by multiplex PCR method. Genetic similarity of L. monocytogenes strains was determined with the Pulsed-Filed Gene Electrophoresis (PFGE) method. The multiplex PCR was used for identification of L. monocytogenes serogroups and detection of selected virulence genes (actA, fbpA, hlyA, iap, inlA, inlB, mpl, plcA, plcB, prfA). The L. monocytogens isolates susceptibility to penicillin, ampicillin, meropenem, erythromycin, trimethoprim/sulfamethoxazole was evaluated with disc diffusion method according to EUCAST v. 7.1. The presence of 237 L. monocytogenes isolates (before genetic similarity assessment) in 614 examined samples was confirmed. After strain differentiation by PFGE techniques the presence of 161 genetically different strains were confirmed. The genetic similarity of the examined isolates suggested that the source of the L. monocytogenes strains were fishes originating from farms. All tested strains possessed all detected virulence genes. Among examined strains, the most (26, 38.6%) belonged to the group 1/2a-3a. The most of tested strains were resistant to erythromycin (47.1%) and trimethoprim/sulfamethoxazole (47.1%). Copyright © 2018. Published by Elsevier B.V.
Spontaneous Loss of Virulence in Natural Populations of Listeria monocytogenes.
Maury, Mylène M; Chenal-Francisque, Viviane; Bracq-Dieye, Hélène; Han, Lei; Leclercq, Alexandre; Vales, Guillaume; Moura, Alexandra; Gouin, Edith; Scortti, Mariela; Disson, Olivier; Vázquez-Boland, José A; Lecuit, Marc
2017-11-01
The pathogenesis of Listeria monocytogenes depends on the ability of this bacterium to escape from the phagosome of the host cells via the action of the pore-forming toxin listeriolysin O (LLO). Expression of the LLO-encoding gene ( hly ) requires the transcriptional activator PrfA, and both hly and prfA genes are essential for L. monocytogenes virulence. Here, we used the hemolytic activity of LLO as a phenotypic marker to screen for spontaneous virulence-attenuating mutations in L. monocytogenes Sixty nonhemolytic isolates were identified among a collection of 57,820 confirmed L. monocytogenes strains isolated from a variety of sources (0.1%). In most cases (56/60; 93.3%), the nonhemolytic phenotype resulted from nonsense, missense, or frameshift mutations in prfA Five strains carried hly mutations leading to a single amino acid substitution (G299V) or a premature stop codon causing strong virulence attenuation in mice. In one strain, both hly and gshF (encoding a glutathione synthase required for full PrfA activity) were missing due to genomic rearrangements likely caused by a transposable element. The PrfA/LLO loss-of-function (PrfA - /LLO - ) mutants belonged to phylogenetically diverse clades of L. monocytogenes , and most were identified among nonclinical strains (57/60). Consistent with the rare occurrence of loss-of-virulence mutations, we show that prfA and hly are under purifying selection. Although occurring at a low frequency, PrfA - /LLO - mutational events in L. monocytogenes lead to niche restriction and open an evolutionary path for obligate saprophytism in this facultative intracellular pathogen. Copyright © 2017 Maury et al.
Møretrø, Trond; Schirmer, Bjørn C T; Heir, Even; Fagerlund, Annette; Hjemli, Pernille; Langsrud, Solveig
2017-01-16
The antibacterial effect of disinfectants is crucial for the control of Listeria monocytogenes in food processing environments. Tolerance of L. monocytogenes to sublethal levels of disinfectants based on quaternary ammonium compounds (QAC) is conferred by the resistance determinants qacH and bcrABC. The presence and distribution of these genes have been anticipated to have a role in the survival and growth of L. monocytogenes in food processing environments where QAC based disinfectants are in common use. In this study, a panel of 680 L. monocytogenes from nine Norwegian meat- and salmon processing plants were grouped into 36 MLVA profiles. The presence of qacH and bcrABC was determined in 101 isolates from the 26 most common MLVA profiles. Five MLVA profiles contained qacH and two contained bcrABC. Isolates with qacH and bcrABC showed increased tolerance to the QAC Benzalkonium chloride (BC), with minimal inhibitory concentrations (MICs) of 5-12, 10-13 and 100ppm). A sample with lower BC concentrations (14ppm of chain length C-12 and 2.7ppm of chain length C-14) inhibited growth of L. monocytogenes not containing bcrABC or qacH, compared to strains with these genes. The study has shown that L. monocytogenes harbouring the QAC resistance genes qacH and bcrABC are prevalent in the food industry and that residuals of QAC may be present in concentrations after sanitation in the industry that result in a growth advantage for bacteria with such resistance genes. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.
Survival of Listeria monocytogenes in Soil Requires AgrA-Mediated Regulation.
Vivant, Anne-Laure; Garmyn, Dominique; Gal, Laurent; Hartmann, Alain; Piveteau, Pascal
2015-08-01
In a recent paper, we demonstrated that inactivation of the Agr system affects the patterns of survival of Listeria monocytogenes (A.-L. Vivant, D. Garmyn, L. Gal, and P. Piveteau, Front Cell Infect Microbiol 4:160, http://dx.doi.org/10.3389/fcimb.2014.00160). In this study, we investigated whether the Agr-mediated response is triggered during adaptation in soil, and we compared survival patterns in a set of 10 soils. The fate of the parental strain L. monocytogenes L9 (a rifampin-resistant mutant of L. monocytogenes EGD-e) and that of a ΔagrA deletion mutant were compared in a collection of 10 soil microcosms. The ΔagrA mutant displayed significantly reduced survival in these biotic soil microcosms, and differential transcriptome analyses showed large alterations of the transcriptome when AgrA was not functional, while the variations in the transcriptomes between the wild type and the ΔagrA deletion mutant were modest under abiotic conditions. Indeed, in biotic soil environments, 578 protein-coding genes and an extensive repertoire of noncoding RNAs (ncRNAs) were differentially transcribed. The transcription of genes coding for proteins involved in cell envelope and cellular processes, including the phosphotransferase system and ABC transporters, and proteins involved in resistance to antimicrobial peptides was affected. Under sterilized soil conditions, the differences were limited to 86 genes and 29 ncRNAs. These results suggest that the response regulator AgrA of the Agr communication system plays important roles during the saprophytic life of L. monocytogenes in soil. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Magalhães, R; Ferreira, V; Brandão, T R S; Palencia, R Casquete; Almeida, G; Teixeira, P
2016-08-01
This study aimed to investigate the effect of different conditions, including temperature (37 °C, 22 °C, and 4 °C), NaCl concentrations (2.5%, 4%, and 8%), and acidity (pH = 5), on the growth response of persistent and non-persistent isolates of Listeria monocytogenes. The resistance to two common sanitizers (benzalkonium chloride and hydrogen peroxide) was also investigated. A selected group of 41 persistent and non-persistent L. monocytogenes isolates recovered from three cheese processing plants during a previous longitudinal study was assembled. Average lag time was similar for persistent and non-persistent isolates grown at 37 °C, 22 °C and 4 °C but significantly shorter (p < 0.05) for persistent isolates grown at 2.5%, 4% and 8% NaCl, and at pH 5. Average growth rates were significantly higher (p < 0.05) for persistent than for non-persistent isolates when grown at 22 °C, 2.5%, 4% and 8% NaCl, and at pH 5. These results suggest that persistent strains may be better adapted to grow under stressful conditions frequently encountered in food processing environments than non-persistent strains. No relation between persistence and resistance to the tested sanitizers was found. Copyright © 2016 Elsevier Ltd. All rights reserved.
Sharma, Sanjita; Sharma, Vishnu; Dahiya, Dinesh Kumar; Khan, Aarif; Mathur, Manisha; Sharma, Amit
2017-03-01
Listeriosis is a serious foodborne disease of a global concern, and can effectively be controlled by a continuous surveillance of the virulent and multidrug-resistant strains of Listeria monocytogenes. This study was planned to investigate prevalence of L. monocytogenes in bovine raw milk samples. A total of 457 raw milk samples collected from 15 major cities in Rajasthan, India, were analyzed for the presence of L. monocytogenes by using standard microbiological and molecular methods. Five of the 457 samples screen tested positive for L. monocytogenes. Multiplex serotyping showed that 3/5 strains belonged to serotype 4b followed by one strain each to 1/2a and to 1/2c. Further virulence potential assessment indicated that all strains possessed inlA and inlC internalins, and, in addition, two strains also possessed the gene for inlB. All strains were positive for Listeriolysin O (LLO) and showed phosphatidylinositol-specific phospholipase C (PI-PLC) activity on an in vitro agar medium with variations in production levels among the strains. A good correlation between the in vitro pathogenicity test and the chick embryo test was observed, as the strains showing higher LLO and PI-PLC activity were found to be lethal to fertilized chick embryos. All strains were resistant to the majority of antibiotics and were designated as multidrug-resistant strains. However, these strains were susceptible to 9 of the 22 tested antibiotics. The maximum zone of inhibition (mm) and acceptable minimum inhibitory concentration were observed with azithromycin, and thus it could be the first choice of a treatment. Overall, the presence of multidrug-resistant L. monocytogenes strains in the raw milk of Rajasthan region is an indicator of public health hazard and highlighting the need of consumer awareness in place and implementation of stricter food safety regulations at all levels of milk production.
Review of Prosthetic Joint Infection from Listeria monocytogenes.
Bader, Gilbert; Al-Tarawneh, Mohammed; Myers, James
2016-12-01
Prosthetic joint infection from Listeria monocytogenes is rare. We decided to shed light on this illness and review the reported cases to better understand its characteristics. We conducted a comprehensive review of the English literature using PubMed. We also included one case that we had managed. We found 25 cases of prosthetic joint infection from L. monocytogenes reported individually and a retrospective study of 43 cases of joint and bone listerial infection, including 34 with prosthetic joint infection, conducted in France. We have described their clinical and para-clinical features and tried to elaborate on the pathophysiology, treatment, and prevention. Prosthetic joint infection from L. monocytogenes is mainly late. Systemic inflammation may be absent. Although rare, it must be suspected in patients at high risk for both prosthetic joint and listerial infections. In addition, those patients must be instructed on appropriate preventive measures.
Directory of Open Access Journals (Sweden)
Roberta Ortenzi
2015-09-01
Full Text Available In the present study, a microbiological challenge test in artificially contaminated raw milk Pecorino Umbro cheese during cheese-making was carried out. Raw ewe milk was contaminated by a suspension of particular Listeria monocytogenes strains. The number of L. monocytogenes and L. monocytogenes dynamic growth were evaluated during cheese-making and storage. A significant decrease of the viable count of L. monocytogenes was observed during ripening and L. monocytogenes viable count was below the limit of quantification during storage. The results show that the product is unable to support the growth of the pathogen.
Patel, P J
1981-01-01
Age-related changes in resistance of mice to infection with Listeria monocytogenes were investigated. One-month-old mice exhibited the least resistance, and the resistance level increased over the first few months to reach a maximum by 8 months. Increase in age thereafter was accompanied by a slow but progressive decrease in resistance. Thus, 50% lethal doses for 1-, 8-, and 24-month-old mice were 10(4.2), 10(6.6), and 10(5.2), respectively. In spite of differences in resistance, the growth o...
Directory of Open Access Journals (Sweden)
V. López
2006-12-01
Full Text Available Listeria monocytogenes es un patógeno humano que se transmite a través de los alimentos y que causa infecciones graves, con una alta tasa de mortalidad. A pesar de la ubicuidad del microorganismo, la tasa real de la enfermedad es bastante baja y se asocia casi siempre a condiciones predisponentes. Tradicionalmente se consideraba que los aislamientos presentes en los alimentos y en el ambiente tenían la misma capacidad patogénica que los aislamientos de origen clínico. Pero el análisis de mutaciones en los genes de determinados factores de virulencia (internalina, hemolisina, fosfolipasas, proteína de superficie ActA y proteína reguladora PrfA, los estudios cuantitativos realizados con cultivos celulares y la genética de poblaciones, están replanteando la discusión sobre la variabilidad de la virulencia de L. monocytogenes. A pesar de todos estos avances, no existe un único marcador que permita comprobar la virulencia de los aislamientos naturales de esta especie. Probablemente en el futuro, la combinación de diferentes marcadores moleculares permitirá detectar los alimentos contaminados sólo por los clones virulentos de L. monocytogenes, con lo que se mejorará la prevención de la listeriosis humana transmitida por alimentos.Listeria monocytogenes is a foodborne human pathogen responsible for invasive infections presenting overall a high mortality. Despite the ubiquity of the microorganism, the actual disease rate is quite low and the disease is most often associated with an underlying predisposition. Foodborne and environmental isolates were traditionally considered of similar pathogenicity compared to clinical isolates. But the analysis of mutations in the genes encoding specific virulence factors (internalin, hemolysin, phospholipases, surface protein ActA and regulator protein PrfA, quantitative studies with cell cultures and population genetics have raised considerable concerns about virulence differences among L
Sakaridis, Ioannis; Ganopoulos, Ioannis; Madesis, Panagiotis; Tsaftaris, Athanasios; Argiriou, Anagnostis
2014-01-02
An outbreak situation of human listeriosis requires a fast and accurate protocol for typing Listeria monocytogenes . Existing techniques are either characterized by low discriminatory power or are laborious and require several days to give a final result. Polymerase chain reaction (PCR) coupled with high resolution melting (HRM) analysis was investigated in this study as an alternative tool for a rapid and precise genotyping of L. monocytogenes isolates. Fifty-five isolates of L. monocytogenes isolated from poultry carcasses and the environment of four slaughterhouses were typed by HRM analysis using two specific markers, internalin B and ssrA genes. The analysis of genotype confidence percentage of L. monocytogenes isolates produced by HRM analysis generated dendrograms with two major groups and several subgroups. Furthermore, the analysis of the HRM curves revealed that all L. monocytogenes isolates could easily be distinguished. In conclusion, HRM was proven to be a fast and powerful tool for genotyping isolates of L. monocytogenes .
Barbosa, Ana Andréa Teixeira; Silva de Araújo, Hyrla Grazielle; Matos, Patrícia Nogueira; Carnelossi, Marcelo Augusto Guitierrez; Almeida de Castro, Alessandra
2013-06-17
The aim of this study is to examine the effects of nisin-incorporated cellulose films on the physicochemical and microbiological qualities of minimally processed mangoes. The use of antimicrobial films did not affect the physicochemical characteristics of mangoes and showed antimicrobial activity against Staphylococcus aureus, Listeria monocytogenes, Alicyclobacillus acidoterrestris and Bacillus cereus. The mango slices were inoculated with S. aureus and L. monocytogenes (10(7)CFU/g), and the viable cell numbers remained at 10(5) and 10(6)CFU/g, respectively, after 12days. In samples packed with antimicrobial films, the viable number of L. monocytogenes cells was reduced below the detection level after 4days. After 6days, a reduction of six log units was observed for S. aureus. In conclusion, nisin showed antimicrobial activity in mangoes without interfering with the organoleptic characteristics of the fruit. This result suggests that nisin could potentially be used in active packing to improve the safety of minimally processed mangoes. Copyright © 2013 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Gursel, B.; Gurakan, G.C.
1997-01-01
Gamma irradiation sensitivity of a strain of Listeria monocytogenes was determined in trypticase soy broth supplemented with yeast extract (TSB-YE), in a slurry of chicken breast meat and in raw ground beef. D10 values in these different media were 0.364, 0.599, and 0.699 kGy, respectively. This organism appeared most sensitive in TSB-YE, more resistant in minced fresh chicken breast meat, and most resistant in fresh minced beef. It was found that irradiation at 2.5 kGy prior to refrigeration is an efficient way for the preservation of meat products contaminated at 10(3) to 10(4) per gram initial load of L. monocytogenes for about 7 d. However, with this initial load, the injured cells might repair themselves and cause a health hazard during storage at 4 C in the presence of air after 7 d
SABIL, SYAHRIANA
2015-01-01
2015 SYAHRIANA SABIL (I 111 11 273). Pasteurisasi High Temperature Short Time (HTST) Susu terhadap Listeria monocytogenes pada Penyimpanan Refrigerator. Dibimbing oleh RATMAWATI MALAKA dan FARIDA NUR YULIATI. Pasteurisasi High Temperature Short Time (HTST) merupakan proses pemanasan susu di bawah titik didih yang diharapkan dapat membunuh Listeria monocytogenes (L. monocytogenes) karena bersifat patogen dan mengakibatkan listeriosis yang merupakan penyakit zoonosis. Tu...
Johnsen, Bjørn Odd; Lingaas, Egil; Torfoss, Dag; Strøm, Erik H; Nordøy, Ingvild
2010-12-01
Listeria monocytogenes is a foodborne pathogen with a high mortality rate. We report a large, nosocomial outbreak of Listeria monocytogenes infection. Patients with L. monocytogenes isolated from a sterile site, or from faeces when diarrhoea and fever were present, were included. Clinical data were collected from the patient records. The incubation period was calculated as the time between exposure and start of symptoms. Seventeen patients (11 women, median age 64 years) were infected of whom 15 patients were at increased risk for listeriosis. Eleven patients received empiric antibiotic treatment, eight of them with cephalosporins. Three patients died with a resulting mortality rate of 18%. The source of the outbreak was a Camembert cheese made from pasteurised milk containing up to 360 million colony forming units per portion. The median incubation period was 3-4 days. The incubation period in this outbreak was significantly shorter than previously reported, a fact that may be due to the high number of ingested bacteria. Furthermore, food restrictions in hospitals seem warranted, as do treatment with antibiotics effective against L. monocytogenes in at-risk populations. Copyright © 2010 The British Infection Association. Published by Elsevier Ltd. All rights reserved.
Juck, Gregory; Gonzalez, Verapaz; Allen, Ann-Christine Olsson; Sutzko, Meredith; Seward, Kody; Muldoon, Mark T
2018-04-27
The Romer Labs RapidChek ® Listeria monocytogenes test system (Performance Tested Method ℠ 011805) was validated against the U.S. Department of Agriculture-Food Safety and Inspection Service Microbiology Laboratory Guidebook (USDA-FSIS/MLG), U.S. Food and Drug Association Bacteriological Analytical Manual (FDA/BAM), and AOAC Official Methods of Analysis ℠ (AOAC/OMA) cultural reference methods for the detection of L. monocytogenes on selected foods including hot dogs, frozen cooked breaded chicken, frozen cooked shrimp, cured ham, and ice cream, and environmental surfaces including stainless steel and plastic in an unpaired study design. The RapidChek method uses a proprietary enrichment media system, a 44-48 h enrichment at 30 ± 1°C, and detects L. monocytogenes on an immunochromatographic lateral flow device within 10 min. Different L. monocytogenes strains were used to spike each of the matrixes. Samples were confirmed based on the reference method confirmations and an alternate confirmation method. A total of 140 low-level spiked samples were tested by the RapidChek method after enrichment for 44-48 h in parallel with the cultural reference method. There were 88 RapidChek presumptive positives. One of the presumptive positives was not confirmed culturally. Additionally, one of the culturally confirmed samples did not exhibit a presumptive positive. No difference between the alternate confirmation method and reference confirmation method was observed. The respective cultural reference methods (USDA-FSIS/MLG, FDA/BAM, and AOAC/OMA) produced a total of 63 confirmed positive results. Nonspiked samples from all foods were reported as negative for L. monocytogenes by all methods. Probability of detection analysis demonstrated no significant differences in the number of positive samples detected by the RapidChek method and the respective cultural reference method.
Recombinant phage probes for Listeria monocytogenes
Carnazza, S.; Gioffrè, G.; Felici, F.; Guglielmino, S.
2007-10-01
Monitoring of food and environmental samples for biological threats, such as Listeria monocytogenes, requires probes that specifically bind biological agents and ensure their immediate and efficient detection. There is a need for robust and inexpensive affinity probes as an alternative to antibodies. These probes may be recruited from random peptide libraries displayed on filamentous phage. In this study, we selected from two phage peptide libraries phage clones displaying peptides capable of specific and strong binding to the L. monocytogenes cell surface. The ability of isolated phage clones to interact specifically with L. monocytogenes was demonstrated using enzyme-linked immunosorbent assay (ELISA) and confirmed by co-precipitation assay. We also assessed the sensitivity of phage-bacteria binding by PCR on phage-captured Listeria cells, which could be detected at a concentration of 104 cells ml-1. In addition, as proof-of-concept, we tested the possibility of immobilizing the affinity-selected phages to a putative biosensor surface. The quality of phage deposition was monitored by ELISA and fluorescent microscopy. Phage-bacterial binding was confirmed by high power optical phase contrast microscopy. Overall, the results of this work validate the concept of affinity-selected recombinant filamentous phages as probes for detecting and monitoring bacterial agents under any conditions that warrant their recognition, including in food products.
Verheyen, Davy; Bolívar, Araceli; Pérez-Rodríguez, Fernando; Baka, Maria; Skåra, Torstein; Van Impe, Jan F
2018-06-01
Traditionally, predictive growth models for food pathogens are developed based on experiments in broth media, resulting in models which do not incorporate the influence of food microstructure. The use of model systems with various microstructures is a promising concept to get more insight into the influence of food microstructure on microbial dynamics. By means of minimal variation of compositional and physicochemical factors, these model systems can be used to study the isolated effect of certain microstructural aspects on microbial growth, survival and inactivation. In this study, the isolated effect on microbial growth dynamics of Listeria monocytogenes of two food microstructural aspects and one aspect influenced by food microstructure were investigated, i.e., the nature of the food matrix, the presence of fat droplets, and microorganism growth morphology, respectively. To this extent, fish-based model systems with various microstructures were used, i.e., a liquid, a second more viscous liquid system containing xanthan gum, an emulsion, an aqueous gel, and a gelled emulsion. Growth experiments were conducted at 4 and 10 °C, both using homogeneous and surface inoculation (only for the gelled systems). Results regarding the influence of the growth morphology indicated that the lag phase of planktonic cells in the liquid system was similar to the lag phase of submerged colonies in the xanthan system. The lag phase of submerged colonies in each gelled system was considerably longer than the lag phase of surface colonies on these respective systems. The maximum specific growth rate of planktonic cells in the liquid system was significantly lower than for submerged colonies in the xanthan system at 10 °C, while no significant differences were observed at 4 °C. The maximum cell density was higher for submerged colonies than for surface colonies. The nature of the food matrix only exerted an influence on the maximum specific growth rate, which was
Listeria spp. E Listeria monocytogenes NA PRODUÇÃO DE SALSICHAS TIPO HOT DOG
Directory of Open Access Journals (Sweden)
ALESSANDRA PARO RODRIGUES CESAR
2011-06-01
Full Text Available Listeria monocytogenes is widely distributed in the environment and it has been isolated from food that were associated to outbreaks of high lethality in many countries. Thus, this bacterium represents an important pathogen to the public health. Ready-to-eat products, likecooked stuffed food, within them, frankfurters, are associated to human listeriosis in many countries. Taking into consideration the importance of the subject and the need of more data about it, the occurrence of Listeria spp. and L. monocytogenes in industrial plants, in meat raw materials, in slurry and frankfurters was investigated.These samples were collected in two production plants with SIF (Federal Inspection Service; in one of them GMP, HACCP and SOP were implemented. The results of the 1 06 microbiological analysis were submitted to the program @Risk to obtain the risk analysis; the meanvalues results showed that 7 to 9% of the frankfurters in the market may have L. monocytogenes. The analysis indicated that 88 strains of L. monocytogenes were obtained from 1 06 samples; among them, 76 werecollected in the industrial plants that participate in the experiment, and 30 were collected in the market. In serological typification, 95% of these strains were classified as serotypes 4b, 1 /2a and 1 /2b. Besides the presence of the bacterium in frankfurthers consumed inBrazil and the risk factors associated to this pathogen, the situation concerns because of the lack of epidemiological data, absence of patterns and the deficient information given to the consumer, specially information related to the presence of L. monocytogenes, particularly important to the groups at risk, as well as information related to the importance of heating the product
Williams, Shanna K; Roof, Sherry; Boyle, Elizabeth A; Burson, Dennis; Thippareddi, Harshavardhan; Geornaras, Ifigenia; Sofos, John N; Wiedmann, Martin; Nightingale, Kendra
2011-01-01
A longitudinal study was conducted to track Listeria contamination patterns in ready-to-eat meats from six small or very small meat processing plants located in three states over 1 year. A total of 688 environmental sponge samples were collected from nonfood contact surfaces during bimonthly visits to each plant. Overall, L. monocytogenes was isolated from 42 (6.1%) environmental samples, and its prevalence ranged from 1.7 to 10.8% across different plants. Listeria spp., other than L. monocytogenes, were isolated from 9.5% of samples overall, with the prevalence ranging from 1.5 to 18.3% across different plants. The prevalence of L. monocytogenes correlated well with that of other Listeria spp. for some but not all plants. One L. monocytogenes isolate representing each positive sample was characterized by molecular serotyping, EcoRI ribotyping, and pulsed-field gel electrophoresis typing. Seven sample sites tested positive for L. monocytogenes on more than one occasion, and the same ribotype was detected more than once at five of these sites. Partial sigB sequencing was used to speciate other Listeria spp. isolates and assign an allelic type to each isolate. Other Listeria spp. were isolated more than once from 14 sample sites, and the same sigB allelic type was recovered at least twice from seven of these sites. One plant was colonized by an atypical hemolytic L. innocua strain. Our findings indicate that small and very small meat processing plants that produce ready-to-eat meat products are characterized by a varied prevalence of Listeria, inconsistent correlation between contamination by L. monocytogenes and other Listeria spp., and a unique Listeria molecular ecology.
Heir, Even; Møretrø, Trond; Simensen, Andreas; Langsrud, Solveig
2018-06-20
Interactions and competition between resident bacteria in food processing environments could affect their ability to survive, grow and persist in microhabitats and niches in the food industry. In this study, the competitive ability of L. monocytogenes strains grown together in separate culture mixes with other L. monocytogenes (L. mono mix), L. innocua (Listeria mix), Gram-negative bacteria (Gram- mix) and with a multigenera mix (Listeria + Gram- mix) was investigated in biofilms on stainless steel and in suspensions at 12 °C. The mixed cultures included resident bacteria from processing surfaces in meat and salmon industry represented by L. monocytogenes (n = 6), L. innocua (n = 5) and Gram-negative bacteria (n = 6; Acinetobacter sp., Pseudomonas fragi, Pseudomonas fluorescens, Serratia liquefaciens, Stenotrophomonas maltophilia). Despite hampered in growth in mixed cultures, L. monocytogenes established in biofilms with counts at day nine between 7.3 and 9.0 log per coupon with the lowest counts in the Listeria + G- mix that was dominated by Pseudomonas. Specific L. innocua inhibited growth of L. monocytogenes strains differently; inhibition that was further enhanced by the background Gram-negative microbiota. In these multispecies and multibacteria cultures, the growth competitive effects lead to the dominance of a strong competitor L. monocytogenes strain that was only slightly inhibited by L. innocua and showed strong competitive abilities in mixed cultures with resident Gram-negative bacteria. The results indicates complex patterns of bacterial interactions and L. monocytogenes inhibition in the multibacteria cultures that only partially depend on cell contact and likely involve various antagonistic and bacterial tolerance mechanisms. The study indicates large variations among L. monocytogenes in their competitiveness under multibacterial culture conditions that should be considered in further studies towards understanding of L
Effect of pulmonary irradiation from inhaled 90Y on immunity to Listeria monocytogenes in mice
International Nuclear Information System (INIS)
Sanchez, A.; Lundgren, D.L.; McClellan, R.O.
1976-01-01
The immunological response of mice subjected to irradiation from particles deposited in the lungs and challenged with Listeria monocytogenes was investigated. Mice, exposed by inhalation to 90 Y (a beta-emitting radionuclide) in relatively insoluble fused aluminosilicate particles, were immunized with L. monocytogenes either before or after exposure. Two additional groups of mice were either immunized or irradiated only. A group of control mice received no irradiation or immunization. The beta radiation dose absorbed by the lungs of each mouse at time of challenge averaged 10,000 rads. Fourteen days after immunization, all mice were challenged with 2 LD 50 doses of L. monocytogenes via the respiratory route. Survival of all immunized mice either with or without exposure to 90 Y varied from 90 to 100% as compared to 10 to 20% for the mice irradiated only and for control mice through 14 days after challenge. Pulmonary clearance of inhaled L. monocytogenes during the first 4 hr after challenge was suppressed in the mice irradiated only but not in those immunized only, or in the immunized and irradiated groups, and control mice. There appeared to be a suppression of proliferation of L. monocytogenes in lungs and spleen in the immunized groups 72 hr after challenge, whereas the lungs and spleens of the mice irradiated only and the control mice had extensive bacterial invasion. It was concluded that the 10,000 rads of beta radiation absorbed by the lungs did not suppress the immune mechanisms of the immunized mice
Age-Dependent Differences in Systemic and Cell-Autonomous Immunity to L. monocytogenes
Directory of Open Access Journals (Sweden)
Ashley M. Sherrid
2013-01-01
Full Text Available Host defense against infection can broadly be categorized into systemic immunity and cell-autonomous immunity. Systemic immunity is crucial for all multicellular organisms, increasing in importance with increasing cellular complexity of the host. The systemic immune response to Listeria monocytogenes has been studied extensively in murine models; however, the clinical applicability of these findings to the human newborn remains incompletely understood. Furthermore, the ability to control infection at the level of an individual cell, known as “cell-autonomous immunity,” appears most relevant following infection with L. monocytogenes; as the main target, the monocyte is centrally important to innate as well as adaptive systemic immunity to listeriosis. We thus suggest that the overall increased risk to suffer and die from L. monocytogenes infection in the newborn period is a direct consequence of age-dependent differences in cell-autonomous immunity of the monocyte to L. monocytogenes. We here review what is known about age-dependent differences in systemic innate and adaptive as well as cell-autonomous immunity to infection with Listeria monocytogenes.
A novel suicide plasmid for efficient gene mutation in Listeria monocytogenes
Although several plasmids have been used in Listeria monocytogenes for generating mutants by allelic exchange, construction of L. monocytogenes mutants has been inefficient due to lack of effective selection markers for first and second recombination events. To address this problem, we have develope...
Yang, Hua; Kendall, Patricia A; Medeiros, Lydia; Sofos, John N
2009-06-01
Solutions of selected household products were tested for their effectiveness against Listeria monocytogenes, Escherichia coli O157:H7, and Salmonella Typhimurium. Hydrogen peroxide (1.5 and 3%), vinegar (2.5 and 5% acetic acid), baking soda (11, 33, and 50% sodium bicarbonate), household bleach (0.0314, 0.0933, and 0.670% sodium hypochlorite), 5% acetic acid (prepared from glacial acetic acid), and 5% citric acid solutions were tested against the three pathogens individually (five-strain composites of each, 10(8) CFU/ml) by using a modified AOAC International suspension test at initial temperatures of 25 and 55degrees C for 1 and 10 min. All bleach solutions (pH 8.36 to 10.14) produced a >5-log reduction of all pathogens tested after 1 min at 25 degrees C, whereas all baking soda solutions (pH 7.32 to 7.55) were ineffective (5-log reduction of both Salmonella Typhimurium and E. coli O157:H7, whereas undiluted vinegar (pH 2.58) had a similar effect only against Salmonella Typhimurium. Compared with 1 min at 25 degrees C, greater reductions of L. monocytogenes (P 3% hydrogen peroxide > undiluted vinegar and 5% acetic acid > 5% citric acid > baking soda (50% sodium bicarbonate). The sensitivity of the tested pathogens to all tested household compounds followed the sequence of Salmonella Typhimurium > E. coli O157: H7 > L. monocytogenes.
Arriola, K G; Queiroz, O C M; Romero, J J; Casper, D; Muniz, E; Hamie, J; Adesogan, A T
2015-01-01
The objective of this study was to compare the efficacy of using 4 commercially available microbial inoculants to improve the fermentation and aerobic stability of bermudagrass haylage. We hypothesized that the microbial inoculants would increase the fermentation and aerobic stability of the haylages. Bermudagrass (4-wk regrowth) was harvested and treated with (1) deionized water (control); (2) Buchneri 500 (B500; Lallemand Animal Nutrition, Milwaukee, WI) containing 1×10(5) of Pediococcus pentosaceus and 4×10(5) of Lactobacillus buchneri 40788; (3) Biotal Plus II (BPII; Lallemand Animal Nutrition) containing 1.2×10(5) of P. pentosaceus and Propionibacteria freudenreichii; (4) Silage Inoculant II (SI; AgriKing Inc., Fulton, IL) containing 1×10(5) of Lactobacillus plantarum and P. pentosaceus; and (5) Silo King (SK; AgriKing Inc.), containing 1×10(5) of L. plantarum, Enterococcus faecium, and P. pentosaceus, respectively. Forty round bales (8 per treatment; 441±26kg; 1.2×1.2 m diameter) were made and each was wrapped with 7 layers of plastic. Twenty bales were stored for 112 d and the remaining 20 were stored for 30 d and sampled by coring after intermediary storage periods of 0, 3, 7, and 30 d. The pH of control and inoculated haylages sampled on d 3 did not differ. However, B500 and BPII had lower pH (5.77±0.04 vs. 6.16±0.04; 5.06±0.13 vs. 5.52±0.13) than other treatments by d 7 and 30, respectively. At final bale opening on d 112, all treatments had lower pH than the control haylage (4.77±0.07 vs. 5.37±0.07). The B500, BPII, and SI haylages had greater lactic acid and lactic-to-acetic acid ratios than SK and control haylages. No differences were detected in neutral detergent fiber digestibility, dry matter losses, dry matter, lactic and acetic acid concentrations, and yeast and coliform counts. The SK haylage had lower clostridia counts compared with the control (1.19±0.23 vs. 1.99±0.23 cfu/g). Treatments B500, BPII, SI, and SK tended to reduce
Directory of Open Access Journals (Sweden)
Giovanni Terrosu
2015-09-01
Full Text Available Listeria (L. monocytogenes is frequently isolated from food production environment and often persists in dairy plants despite vigorous sanitation regimes. In recent years several alert notifications were sent to Rapid Alert System for Food Products system as a consequence of Listeria monocytogenes contamination of ricotta cheese. After the alert of 2012, competent authority (Local Health Unit of Sassari Province organised an environmental monitoring plan with the partnership of the Institute for Experimental Veterinary Medicine of Sardinia to verify analysis of dairy plants own-check according to Regulation (EC N° 2073/05 and further modifications. In 2014 n. 665 processing areas samples of n. 50 dairy plants of Sassari Province were examined. UNI EN ISO 11290-1:2005 for detection of L. monocytogenes was used. Non-compliance in n. 5 diary plants are observed (n. 8 positive samples. Post-non-compliance environmental sanitisation was efficient and own-check plans included appropriate corrective actions.
Pereira-Defilippi, L; Pereira, E M; Silva, F M; Moro, G V
2017-05-31
The relative quantitative real-time expression of two expressed sequence tags (ESTs) codifying for key enzymes in nitrogen metabolism in maize, nitrate reductase (ZmNR), and glutamine synthetase (ZmGln1-3) was performed for genotypes inoculated with Azospirillum brasilense. Two commercial single-cross hybrids (AG7098 and 2B707) and two experimental synthetic varieties (V2 and V4) were raised under controlled greenhouse conditions, in six treatment groups corresponding to different forms of inoculation and different levels of nitrogen application by top-dressing. The genotypes presented distinct responses to inoculation with A. brasilense. Increases in the expression of ZmNR were observed for the hybrids, while V4 only displayed a greater level of expression when the plants received nitrogenous fertilization by top-dressing and there was no inoculation. The expression of the ZmGln1-3EST was induced by A. brasilense in the hybrids and the variety V4. In contrast, the variety V2 did not respond to inoculation.
Effect of eugenol on growth and listeriolysin o production by Listeria monocytogenes
Directory of Open Access Journals (Sweden)
Cristina Tostes Filgueiras
2006-05-01
Full Text Available The inhibitory effect of eugenol, a naturally occurring compound mainly present in the essential oil fraction of cloves, was studied on the growth and listeriolysin O (LLO production by Listeria monocytogenes. Potassium efflux from cells promoted by eugenol was also determined after 24 h incubation in phosphate buffered saline. Eugenol promoted a delay on the growth of L. monocytogenes at concentrations of 100, 300 and 500 µg mL-1and above 800 µg mL-1 the effect was bactericidal. Production of LLO by L. monocytogenes in the presence of eugenol was reduced 80-100%. An accumulation of external K+ was observed above 300 µg mL-1 of eugenol which indicated that the cell membrane was affected. The results showed the effectiveness of eugenol in controlling growth and LLO production of L. monocytogenes cells.O efeito inibitório do eugenol, o principal constituinte do óleo essencial de cravo, foi avaliado sobre o crescimento e produção de listeriolisina O (LLO por Listeria monocytogenes. O efluxo de íons potássio das células também foi determinado após 24 h de incubação em solução tampão, contendo eugenol. Concentrações de 100, 300 e 500 µg mL-1 de eugenol promoveram a inibição do crescimento de L. monocytogenes e, em concentrações acima de 800 µg mL-1, constatou-se um efeito bactericida. O crescimento de L. monocytogenes na presença de eugenol resultou na inibição de 80 a 100% da produção de LLO. O efluxo de K+ promovido pelo eugenol indicou que a membrana celular foi afetada. Estes resultados indicam a efetividade do eugenol para o controle do crescimento e da produção de LLO por L. monocytogenes.
Epidemiologia molecular de Listeria monocytogenes isoladas de diferentes fontes no Brasil
Directory of Open Access Journals (Sweden)
Andrea Micke Moreno
2013-04-01
Full Text Available Listeria monocytogenes é um importante patógeno de origem alimentar que afeta principalmente grávidas, neonatos, idosos e indivíduos imunocomprometidos, e pode causar abortamento, septicemia e meningite. Dos 13 grupos capsulares descritos, os sorotipos 4b, 1/2b e 1/2a são os mais relacionados à infecção humana. Por esta razão, a sorotipagem possui valor limitado como ferramenta epidemiológica e, dessa forma, métodos mais discriminatórios são necessários para melhorar o conhecimento sobre a contaminação e a infecção por L. monocytogenes. O objetivo deste estudo foi caracterizar a diversidade genética de isolados de L. monocytogenes da indústria de processamento de carne suína no Estado de São Paulo, Brasil, e compará-los a isolados de casos de infecção humana através do ERIC-PCR e AFLP com uma única enzima. Os sorotipos 1/2c e 4b foram frequentes em carne suína e ambientes de abatedouros e mercados, enquanto os sorotipos 4b e 1/2a foram observados nos isolados de humanos. ERIC-PCR e AFLP resultaram em 34 e 31 perfis distintos, respectivamente, com uma tendência a separar de acordo com o sorogrupo e a origem do isolado. Os perfis genéticos de ambiente dos abatedouros e mercados sugerem a possibilidade de diferentes origens de contaminação por Listeria nos ambientes estudados, porém, em alguns casos, é possível que ocorra a persistência de cepas clonais causando contaminação contínua.
Energy Technology Data Exchange (ETDEWEB)
Beaufort, A. [AFSSA Lerqap, 23 avenue du General de Gaulle, FR-94706 Maisons-Alfort Cedex (France); Cardinal, M. [IFREMER, STAM, rue de l' Ile d' Yeu, FR- 44311 Nantes Cedex 3 (France); Le-Bail, A. [ENITIAA, UMR GEPEA, CNRS 6144, rue de la Geraudiere, BP 82225, FR-44322 Nantes (France); Midelet-Bourdin, G. [AFSSA Lerppe, boulevard du Bassin Napoleon, FR-62200 Boulogne-sur-Mer (France)
2009-11-15
The aim of this study was to investigate the impact of superchilling (-2 C) on the evolution of Listeria monocytogenes and organoleptic characteristics of cold-smoked salmon samples. An Hadamard matrix experimental design was carried out on artificially inoculated samples stored at +4 C for 10 d and at +8 C for 18 d to know the influence of four factors: salt content, strain, cold stiffening and superchilling time, on the level of L.monocytogenes in cold-smoked salmon. The growth of L. monocytogenes in naturally contaminated cold-smoked salmon and the organoleptic properties were investigated under superchilling conditions. Superchilling (-2 C for 28 d) had a limited impact on some of the organoleptic properties but the level of L. monocytogenes at the end of the shelf-life (4 C for 10 d and 8 C for 18 d) could exceed the microbiological criterion set by the European legislation. (author)
Gamma radiation effect on Bacillus cereus spores inoculated in black pepper
International Nuclear Information System (INIS)
Froehlich, Angela; Axeredo, Raquel M.C.; Vanetti, Maria Cristina D.
2000-01-01
It had been analyzed 37 samples of worn out black pepper and in 85% of these samples was observed the presence of Bacillus cereus in numbers of up to 4,6 x 10 4 UFC/g. The population of aerobic mesofilis bacteria varied of 2,8 x 10 5 the 1,9 x 10 8 UFC/g. The black pepper used during the experiment was evaluated, evidencing the aerobic presence of one aerobic mesofilis microbiota of, approximately, 2,6 x 10 6 UFC/g, consisting, mainly, for species of the Bacillus sort. It was observed that the absence of B. cereus, coliforms, filamentous fungus and leavenings. The evaluation of the irradiation of the black pepper inoculated with 10 6 UFC/g of B. cereus spores of with doses of gamma radiation varying between 2 and 10 kGy evidenced that doses up to 5 kGy had been enough to reduce the counting of, approximately, 10 6 UFC/g of aerobic mesofilis organisms and 10 4 UFC/g of B. cereus spores the not detectable numbers by the used methodology. The dose of reduction decimal (D 10 ) for the inoculated B. cereus spores in black pepper was of 1,78 kGy
Larsen, Marianne Halberg; Koch, Anette Granly; Ingmer, Hanne
2010-09-01
The objective of this study was to investigate how various growth conditions influence the virulence of Listeria monocytogenes monitored by its ability to invade the epithelial cell lines Caco-2 and INT-407. The growth conditions examined were modified atmosphere-packaged deli meat and brain heart infusion broth (BHI) with and without salt. Five strains of L. monocytogenes were selected to investigate their invasiveness and all strains invaded Caco-2 cells at higher levels than INT-407 cells. Further, the clinical strains (3443 and 3734) were more invasive (p 0.05) in invasiveness after 7 days at 10 degrees C in BHI broth or on sausage, whereas a slight increase (p < 0.05) was observed after incubation on ham for 2 and 4 weeks compared to that in BHI broth. Most importantly, our results show that L. monocytogenes efficiently invade Caco-2 cells even after 4 weeks of storage at chilled temperature. This is highly relevant for safety assessment of this organism in food as these conditions reflect storage of ready-to-eat food products in domestic refrigerators.
Firouzi, R; Shekarforoush, S S; Nazer, A H K; Borumand, Z; Jooyandeh, A R
2007-11-01
The in vitro effects of plant essential oils (EOs) against pathogenic bacteria are well known, yet few studies have addressed the effects of these compounds against pathogens associated with ready-to-cook foods. Experiments were conducted to determine the effectiveness of oregano and nutmeg EOs on the growth and survival of Yersinia enterocolitica and Listeria monocytogenes in broth culture and in Iranian barbecued chicken. Ready-to-cook Iranian barbecued chicken was prepared according to the common practice with 1, 2, and 3 microl/g of oregano and nutmeg EOs. The test and control (without EOs) samples were inoculated with Y. enterocolitica and L. monocytogenes to a final concentration of 6 to 7 log CFU/g and stored at 3, 8, and 20 degrees C. Microorganisms were counted just before and at 24, 48, and 72 h after storage based on growth on Yersinia selective agar supplemented with cefsulodine, igrasan, and novobiocin and on Listeria selective agar supplemented with nalidixic acid and acriflavin. In the broth culture system, the nutmeg EO had a greater effect on L. monocytogenes (MIC = 0.20 nicrol/ml) than did the oregano EO (MIC = 0.26 microl/ml). However, the oregano EO had a greater effect on Y. enterocolitica (MIC = 0.16 microl/ml) than did the nutmeg EO (MIC = 0.25 microl/ml). In ready-to-cook Iranian barbecued chicken, the log CFU per gram of both bacteria after up to 72 h of incubation was not decreased significantly by various combinations of oregano and nutmeg EOs (1, 2, and 3 microl/g) and storage temperatures (3, 8, and 20 degrees C) when compared with control samples (without EOs). Although examination of spices in culture media can yield accurate microbiological data, without complementary tests in foods these data are of limited value for assessing food safety.
A multiplex PCR for detection of Listeria monocytogenes and its lineages.
Rawool, Deepak B; Doijad, Swapnil P; Poharkar, Krupali V; Negi, Mamta; Kale, Satyajit B; Malik, S V S; Kurkure, Nitin V; Chakraborty, Trinad; Barbuddhe, Sukhadeo B
2016-11-01
A novel multiplex PCR assay was developed to identify genus Listeria, and discriminate Listeria monocytogenes and its major lineages (LI, LII, LIII). This assay is a rapid and inexpensive subtyping method for screening and characterization of L. monocytogenes. Copyright © 2016 Elsevier B.V. All rights reserved.
DEFF Research Database (Denmark)
Kastbjerg, Vicky Gaedt; Gram, Lone
2012-01-01
or tolerance would evolve in L. monocytogenes under continued selection in three industrial disinfectants. L. monocytogenes EGD was exposed to Desinfect CL (hypochlorite) and Incimaxx DES (peracedic acid and hydrogen peroxide) for several hundred generations. This caused no increase in the minimal inhibitory......, and that the disinfectants are still efficient for controlling microorganisms such as L. monocytogenes....
Osaili, Tareq M; Al-Nabulsi, Anas A; Shaker, Reyad R; Jaradat, Ziad W; Taha, Mohammad; Al-Kherasha, Mohammed; Meherat, Mervet; Holley, Richard
2014-01-01
The presence of Salmonella, Listeria monocytogenes, and Escherichia coli O157:H7 in ready-to-eat (RTE) meat products is considered a major concern for food control authorities worldwide. The aims of this study were to determine (i) the prevalence of Salmonella, L. monocytogenes, and E. coli O157:H7 in Mediterranean RTE chicken and beef (CB) products sold in Jordanian restaurants and (ii) the susceptibility of the isolates to antibiotics. A total of 1,028 samples of various types of RTE CB products (550 RTE chicken and 478 RTE beef products) were analyzed by methods described by the International Organization for Standardization followed by molecular confirmation of the isolates. The VITEK2 automated system was used for testing antibiotic susceptibility of the isolates. The overall prevalence of Salmonella serovars in RTE CB products was 0.5%, with 0.8 and 0.2% in RTE chicken and RTE beef, respectively. The overall prevalence of L. monocytogenes in RTE CB products was 2%, with 2.7 and 1.5% in RTE chicken and RTE beef products, respectively. E. coli O157:H7 was not isolated from any of the tested samples. Multidrug-resistant Salmonella and L. monocytogenes isolates were found. The majority of Salmonella isolates were sensitive to most of the tested antibiotics, and all of the isolates were resistant to more than one antibiotic. Similarly, more than 85% of L. monocytogenes isolates were sensitive to nine antibiotics, and the majority of L. monocytogenes isolates were resistant to fosfomycin and oxacillin.
Metabolic responses of primary and transformed cells to intracellular Listeria monocytogenes.
Directory of Open Access Journals (Sweden)
Nadine Gillmaier
Full Text Available The metabolic response of host cells, in particular of primary mammalian cells, to bacterial infections is poorly understood. Here, we compare the carbon metabolism of primary mouse macrophages and of established J774A.1 cells upon Listeria monocytogenes infection using (13C-labelled glucose or glutamine as carbon tracers. The (13C-profiles of protein-derived amino acids from labelled host cells and intracellular L. monocytogenes identified active metabolic pathways in the different cell types. In the primary cells, infection with live L. monocytogenes increased glycolytic activity and enhanced flux of pyruvate into the TCA cycle via pyruvate dehydrogenase and pyruvate carboxylase, while in J774A.1 cells the already high glycolytic and glutaminolytic activities hardly changed upon infection. The carbon metabolism of intracellular L. monocytogenes was similar in both host cells. Taken together, the data suggest that efficient listerial replication in the cytosol of the host cells mainly depends on the glycolytic activity of the hosts.
Nitrogen translocation in wheat inoculated with Azospirillum and fertilized with nitrogen
Directory of Open Access Journals (Sweden)
RODRIGUES OSMAR
2000-01-01
Full Text Available The productivity and the translocation of assimilates and nitrogen (N were compared after inoculation of wheat (Triticum aestivum L., cv. BR-23 seeds with two strains of Azospirillum brasilense (strains 245 and JA 04 under field conditions. The inoculation of wheat seeds was done with a peat inoculant at sowing time. Plant material for evaluations were collected at anthesis and maturity. No differences in grain yield and in the translocation of assimilates resulting from inoculation were detected. Differences were observed in relation to N rates (0, 15, and 60 kg ha-1. N content in the grain increased significantly in the bacteria-inoculated treatments in which N was not added. This increase in N content in the grain with inoculation was probably due to higher N uptake after anthesis without any significant contribution on the grain yield. Such increment was of 8.4 kg ha-1 of N representing 66% more N than in no inoculated treatment. Regardless of the inoculation and the rate of N applied, it was observed that about 70% of the N accumulated at anthesis was translocated from vegetative parts to the grain.
DEFF Research Database (Denmark)
Mejlholm, Ole; Dalgaard, Paw
2009-01-01
and their interactive effects. The new model predicted growth rates (mu(max) values) of L. monocytogenes accurately with bias and accuracy factors of 1.0 and 1.5, respectively, for 16 batches of brined shrimp with benzoic, citric, and sorbic acids. Corresponding values of 0.9 and 1.2, respectively, were obtained...... for five batches of brined shrimp with acetic and lactic acids. Growth and no-growth responses of L. monocytogenes were also appropriately predicted with 88% correct prediction for 26 experiments with brined shrimp. The new model performed better than existing L. monocytogenes models with a comparable...
[Design of SCM inoculation device].
Qian, Mingli; Xie, Haiyuan
2014-01-01
The first step of bacilli culture is inoculation bacteria on culture medium. Designing a device to increase efficiency of inoculation is significative. The new device is controlled by SCM. The stepper motor can drive the culture medium rotating, accelerating, decelerating, overturn and suspending. The device is high practicability and efficient, let inoculation easy for operator.
Suppression of Listeria monocytogenes by the Native Micro-Flora in Teewurst Sausage.
Austin-Watson, Clytrice; Grant, Ar'Quette; Brice, Michline
2013-10-21
Modern consumers are interested in the use of non-chemical methods to control pathogens when heat sterilization is not an option. Such is the case with teewurst sausage, a raw spreadable sausage and a popular German commodity. Although Listeria was not found in teewurst, the optimal microbial growing conditions of teewurst coupled with the ubiquity of L. monocytogenes in nature, makes the possibility of contamination of products very possible. This pilot study was conducted to examine teewurst's native micro-flora's ability to suppress the outgrowth of L. monocytogenes at 10 °C using standard plate counts and PCR-DGGE. Traditional plating methods showed L. monocytogenes growth significantly decreased when in competition with the teewurst's native micro-flora ( p flora of the teewurst suppressed the overall growth of L. monocytogenes by an average of two logs, under these conditions. Denaturing Gradient Gel Electrophoresis (DGGE) amplicons with unique banding patterns were extracted from DGGE gel for identification. Brochothrix thermosphacta and Lactobacillus curvatus were identified as a part of the teewurst's native micro-flora. Although the native micro-flora did not decrease L. monocytogenes to below limits of detection, it was enough of a decrease to warrant further investigation.
Hadjilouka, Agni; Polychronopoulou, Melissanthi; Paramithiotis, Spiros; Tzamalis, Periklis; Drosinos, Eleftherios H.
2015-01-01
The aim of the present study was to examine the effect of lemongrass essential oil vapors on the dynamics of surface microbiota and L. monocytogenes growth on rocket and melon under different packaging conditions and storage temperature. For that purpose, rocket and melon were placed on Expanded Polystyrene (EPS) trays, sprayed with L. monocytogenes to a population of 4.5–5.0 log CFU·g−1, packaged using microperforated Oriented Polypropylene (OPP) film in either air or Microperforated Active Modified Atmosphere (MAMA) (initial atmosphere 5% O2, 10% CO2) including a Whatman paper containing the essential oil, without contact with the product, and stored at 0, 5, 10, and 15 °C. Application of lemongrass exhibited a bactericidal effect on enterococci and a fungistatic effect on yeast-mould populations but only during air storage of rocket. The former took place at all temperatures and the latter only at 10 and 15 °C. No effect on shelf life of both products was recorded. However, an important effect on the sensorial properties was observed; during the first 4–5 days of storage both products were organoleptically unacceptable. Regarding MAMA packaging, it affected only Pseudomonas spp. population resulting in a reduction of 1–2 log CFU·g−1 in both products. PMID:27682104
An insight into the isolation, enumeration and molecular detection of Listeria monocytogenes in food
Directory of Open Access Journals (Sweden)
Jodi Woan-Fei Law
2015-11-01
Full Text Available Listeria monocytogenes, a foodborne pathogen that can cause listeriosis through the consumption of food contaminated with this pathogen. The ability of L. monocytogenes to survive in extreme conditions and cause food contaminations have become a major concern. Hence, routine microbiological food testing is necessary to prevent food contamination and outbreaks of foodborne illness. This review provides insight into the methods for cultural detection, enumeration and molecular identification of L. monocytogenes in various food samples. There are a number of enrichment and plating media that can be used for the isolation of L. monocytogenes from food samples. Enrichment media such as buffered Listeria Enrichment Broth (BLEB, Fraser broth and University of Vermont Medium (UVM Listeria enrichment broth are recommended by regulatory agencies such as FDA-BAM, USDA-FSIS and ISO. Many plating media are available for the isolation of L. monocytogenes, for instance, PALCAM, Oxford and other chromogenic media. Besides, reference methods like FDA-BAM, ISO 11290 method and USDA-FSIS method are usually applied for the cultural detection or enumeration of L. monocytogenes. MPN technique is applied for the enumeration of L. monocytogenes in the case of low level contamination. Molecular methods including polymerase chain reaction (PCR, multiplex polymerase chain reaction (mPCR, real-time/quantitative polymerase chain reaction (qPCR, nucleic acid sequence-based amplification (NASBA, loop-mediated isothermal amplification (LAMP, DNA microarray and Next Generation Sequencing (NGS technology for the detection and identification of L. monocytogenes are discussed in this review. Overall, molecular methods are rapid, sensitive, specific, time- and labour-saving. In future, there are chances for the development of new techniques for the detection and identification of foodborne with improved features.
Augustin, Jean-Christophe; Kalmokoff, Martin; Ells, Timothy; Favret, Sandra; Desreumaux, Jennifer; Decourseulles Brasseur, Emilie; Gnanou Besse, Nathalie
2016-12-01
A stochastic model describing the growth of Listeria monocytogenes during enrichment in half Fraser was developed for the purpose of estimating the effects of modifications to the first enrichment step of the EN ISO 11290-1 detection method. Information pertaining to the variability of growth rates, physiological state of the cell, and the behavior of individual cells contaminating the food were obtained from previously published studies. We used this model to investigate the impact of pooling enrichment broths (wet pooling) on the performance of the standard method. For validation of the model, the numbers of L. monocytogenes occurring in 88 naturally contaminated foods following pre-enrichment were compared to model-simulated microbial counts. The model was then used to perform simulations representative of the natural contamination observed for smoked salmon in the European baseline survey of 2010-2011. The model-estimated L. monocytogenes levels following individual enrichment or following the pooling of five broths where only one would be contaminated were compared. The model indicated a 10% loss of method sensitivity resulting from wet pooling. The model also predicted a 5% decrease in the sensitivity of the method when the duration of the enrichment was reduced from 24 to 22 h. Copyright © 2016 Elsevier Ltd. All rights reserved.
An ecological perspective of Listeria monocytogenes biofilms in food processing facilities.
Valderrama, Wladir B; Cutter, Catherine N
2013-01-01
Listeria monocytogenes can enter the food chain at virtually any point. However, food processing environments seem to be of particular importance. From an ecological point of view, food processing facilities are microbial habitats that are constantly disturbed by cleaning and sanitizing procedures. Although L. monocytogenes is considered ubiquitous in nature, it is important to recognize that not all L. monocytogenes strains appear to be equally distributed; the distribution of the organism seems to be related to certain habitats. Currently, no direct evidence exists that L. monocytogenes-associated biofilms have played a role in food contamination or foodborne outbreaks, likely because biofilm isolation and identification are not part of an outbreak investigation, or the definition of biofilm is unclear. Because L. monocytogenes is known to colonize surfaces, we suggest that contamination patterns may be studied in the context of how biofilm formation is influenced by the environment within food processing facilities. In this review, direct and indirect epidemiological and phenotypic evidence of lineage-related biofilm formation capacity to specific ecological niches will be discussed. A critical view on the development of the biofilm concept, focused on the practical implications, strengths, and weaknesses of the current definitions also is discussed. The idea that biofilm formation may be an alternative surrogate for microbial fitness is proposed. Furthermore, current research on the influence of environmental factors on biofilm formation is discussed.
Directory of Open Access Journals (Sweden)
Renato G. Zanoni
2012-01-01
Full Text Available The direct sale by farmers of raw milk for human consumption has been allowed in Italy since 2004. The aim of this study was to evaluate the behaviour of selected foodborne pathogens in raw milk sold in vending machines, in field handling conditions, and during shelf-life from production to consumption. Temperature of storage of raw milk in 33 farms authorized to produce and sell raw milk were investigated from farm to vending machine delivery, together with consumer habits in one province of the Emilia-Romagna region of northern Italy. Failure to maintain appropriate low temperatures during shelf-life was recorded and 43% of consumers did not boil milk before consumption. Listeria monocytogenes, Escherichia coli O157:H7, Salmonella Typhimurium and Campylobacter jejuni strains were inoculated into raw milk samples, and the best (4°C as established by law and worst temperature storage conditions detected (variable temperature were simulated. Boiling tests were performed for each pathogen considered at high and low levels of contamination. Results showed an increase in L. monocytogenes in milk stored at 4°C and at variable temperatures recorded in shelf-life monitoring, an increase in E. coli O157:H7 and S. Typhimurium at variable temperatures but not at 4°C, and a decrease in C. jejuni in all storage conditions. Boiling milk is effective in making it safe for consumers. This study provides evidence that appropriate handling of raw milk, maintaining low temperatures, together with consumer education concerning boiling raw milk before consumption are key factors in preventing foodborne infections linked to raw milk consumption, and helps assess the risk of foodborne infection linked to raw milk consumption.
RNA- and protein-mediated control of Listeria monocytogenes virulence gene expression
Lebreton, Alice; Cossart, Pascale
2017-01-01
ABSTRACT The model opportunistic pathogen Listeria monocytogenes has been the object of extensive research, aiming at understanding its ability to colonize diverse environmental niches and animal hosts. Bacterial transcriptomes in various conditions reflect this efficient adaptability. We review here our current knowledge of the mechanisms allowing L. monocytogenes to respond to environmental changes and trigger pathogenicity, with a special focus on RNA-mediated control of gene expression. We highlight how these studies have brought novel concepts in prokaryotic gene regulation, such as the ‘excludon’ where the 5′-UTR of a messenger also acts as an antisense regulator of an operon transcribed in opposite orientation, or the notion that riboswitches can regulate non-coding RNAs to integrate complex metabolic stimuli into regulatory networks. Overall, the Listeria model exemplifies that fine RNA tuners act together with master regulatory proteins to orchestrate appropriate transcriptional programmes. PMID:27217337
An outbreak of febrile gastroenteritis associated with corn contaminated by Listeria monocytogenes.
Aureli, P; Fiorucci, G C; Caroli, D; Marchiaro, G; Novara, O; Leone, L; Salmaso, S
2000-04-27
On May 21, 1997, numerous cases of febrile gastrointestinal illness were reported among the students and staff of two primary schools in northern Italy, all of whom had eaten at cafeterias served by the same caterer. We interviewed people who ate at the cafeterias about symptoms and foods consumed on May 20. There were no samples of foods left at the cafeterias, but we tested routine samples taken on May 20 by the caterer and environmental specimens at the catering plant. The hospitalized patients were tested for common enteropathogens and toxins. Of the 2189 persons interviewed (82 percent of those exposed), 1566 (72 percent) reported symptoms; of these, 292 (19 percent) were hospitalized. Among samples obtained from hospitalized patients, all but two of the stool specimens and all blood specimens were negative for common enteropathogens. Listeria monocytogenes was isolated from one blood specimen and from 123 of the 141 stool specimens. Consumption of a cold salad of corn and tuna was associated with the development of symptoms (relative risk, 6.19; 95 percent confidence interval, 4.81 to 7.98; Pcaterer's sample of the salad and from environmental specimens collected from the catering plant. All listeria isolates were serotype 4b and were found to be identical on DNA analysis. Experimental contamination of sterile samples of the implicated foods showed that L. monocytogenes grew on corn when kept for at least 10 hours at 25 degrees C. Food-borne infection with L. monocytogenes can cause febrile illness with gastroenteritis in immunocompetent persons.
Directory of Open Access Journals (Sweden)
YANG Zhen-ya
2016-07-01
Full Text Available The correlations of glomalin contents and removal of phenanthrene and pyrene as representative polycyclic aromatic hydrocarbons (PAHs in soils with inoculation of arbuscular mycorrhizal fungi(AMF were investigated. The test AMF included Glomus etunicatum(Ge, Glomus mosseae(Gm, and Glomus lamellosum(Gla, and the host plant was alfalfa(Medicago sativa L.. The AMF hyphal density and contents of easily extractable glomalin and total glomalin in AMF-inoculated soils were observed to increase with cultivation time from 35 d to 75 d. Comparing with the control treatment(CK without AMF inoculation, the contents of easily extractable glomalin in soil increased 48.58%, 55.99% and 50.23%, and total glomalin contents increased 38.75%, 50.95% and 46.12% with Ge, Gm and Gla inoculation after 75 d, respectively. AMF inoculation promoted the removal of test PAHs in soils. The removal rates of phenanthrene and pyrene in soils with AMF enhanced in 35~75 d. 83.4%~92.7%, 82.1%~93.8% and 86.9%~93.4% of phenanthrene and 42.2%~63.5%, 43.7%~69.2% and 44.6%~66.4% of pyrene in soils with Ge, Gm, Gla were removed in 75 d respectively. AMF hyphal density and total glomalin contents were observed to be significantly positively correlated with the removal rates of PAHs in soils, indicating that the colonization of AMF enhanced hyphal density and total glomalin contents and thus promoted the degradation of PAHs in the soil environments.
Vojkovska, H; Kubikova, I; Kralik, P
2015-03-01
Epidemiological data indicate that raw vegetables are associated with outbreaks of Listeria monocytogenes. Therefore, there is a demand for the availability of rapid and sensitive methods, such as PCR assays, for the detection and accurate discrimination of L. monocytogenes. However, the efficiency of PCR methods can be negatively affected by inhibitory compounds commonly found in vegetable matrices that may cause false-negative results. Therefore, the sample processing and DNA isolation steps must be carefully evaluated prior to the introduction of such methods into routine practice. In this study, we compared the ability of three column-based and four magnetic bead-based commercial DNA isolation kits to extract DNA of the model micro-organism L. monocytogenes from raw vegetables. The DNA isolation efficiency of all isolation kits was determined using a triplex real-time qPCR assay designed to specifically detect L. monocytogenes. The kit with best performance, the PowerSoil(™) Microbial DNA Isolation Kit, is suitable for the extraction of amplifiable DNA from L. monocytogenes cells in vegetable with efficiencies ranging between 29.6 and 70.3%. Coupled with the triplex real-time qPCR assay, this DNA isolation kit is applicable to the samples with bacterial loads of 10(3) bacterial cells per gram of L. monocytogenes. Several recent outbreaks of Listeria monocytogenes have been associated with the consumption of fruits and vegetables. Real-time PCR assays allow fast detection and accurate quantification of microbes. However, the success of real-time PCR is dependent on the success with which template DNA can be extracted. The results of this study suggest that the PowerSoil(™) Microbial DNA Isolation Kit can be used for the extraction of amplifiable DNA from L. monocytogenes cells in vegetable with efficiencies ranging between 29.6 and 70.3%. This method is applicable to samples with bacterial loads of 10(3) bacterial cells per gram of L. monocytogenes. © 2014
Di Ciccio, Pierluigi; Meloni, Domenico; Festino, Anna Rita; Conter, Mauro; Zanardi, Emanuela; Ghidini, Sergio; Vergara, Alberto; Mazzette, Rina; Ianieri, Adriana
2012-08-01
The aim of the present study was to investigate the sources of Listeria monocytogenes contamination in a cold smoked salmon processing environment over a period of six years (2003-2008). A total of 170 samples of raw material, semi-processed, final product and processing surfaces at different production stages were tested for the presence of L. monocytogenes. The L. monocytogenes isolates were characterized by multiplex PCR for the analysis of virulence factors and for serogrouping. The routes of contamination over the six year period were traced by PFGE. L. monocytogenes was isolated from 24% of the raw salmon samples, 14% of the semi-processed products and 12% of the final products. Among the environmental samples, 16% were positive for L. monocytogenes. Serotyping yielded three serovars: 1/2a, 1/2b, 4b, with the majority belonging to serovars 1/2a (46%) and 1/2b (39%). PFGE yielded 14 profiles: two of them were repeatedly isolated in 2005-2006 and in 2007-2008 mainly from the processing environment and final products but also from raw materials. The results of this longitudinal study highlighted that contamination of smoked salmon occurs mainly during processing rather than originating from raw materials, even if raw fish can be a contamination source of the working environment. Molecular subtyping is critical for the identification of the contamination routes of L. monocytogenes and its niches into the production plant when control strategies must be implemented with the aim to reduce its prevalence during manufacturing. Copyright © 2012 Elsevier B.V. All rights reserved.
Legan, J D; Seman, D L; Milkowski, A L; Hirschey, J A; Vandeven, M H
2004-10-01
A central composite response surface design was used to determine the time to growth of Listeria monocytogenes as a function of four continuous variables: added sodium chloride (0.8 to 3.6%), sodium diacetate (0 to 0.2%), potassium lactate syrup (60% [wt/wt]; 0.25 to 9.25%), and finished-product moisture (45.5 to 83.5%) in ready-to-eat cured meat products. The design was repeated for ready-to-eat uncured meat products giving a fifth categorical variable for cure status. Products were stored at 4 degrees C. The results were modeled using a generalized regression approach. All five main effects, six two-factor interactions, and two quadratic terms were statistically significant. The model was used to show the boundary between growth and no-growth conditions at 4 degrees C using contour plots of time to growth. It was validated using independent challenge studies of cured and uncured products. Generally, the model predicted well, particularly for cured products, where it will be useful for establishing conditions that prevent the growth of L. monocytogenes. For uncured products, there was good agreement overall between predicted and observed times to growth, but the model is less thoroughly validated than for cured products. The model should initially only be used for screening of formulations likely to prevent growth of Listeria monocytogenes in uncured products, with recommendations subject to confirmation by challenge studies.
Naik, Milind Mohan; Bhangui, Purva; Bhat, Chinmay
2017-12-01
Listeria monocytogenes are Gram-positive well-known emerging food-borne pathogens causing listeriosis in humans. In the present study, we have isolated biofilm-forming Listeria sp. from utensils used by a local milk collection dairy society at Usgao Goa, which collects milk for Goa dairy. Through biochemical tests and 16S rRNA sequence analysis, the bacterium was confirmed to be L. monocytogenes and designated as strain BN3, having GenBank accession number MF095110. We report for the first time Gram-positive L. monocytogenes strain BN3 producing iron-chelating siderophores by chrome azurol S (CAS) agar test. Also, this is a first report which reveals that L. monocytogenes strain BN3 responds to N-hexanoyl-homoserine lactone molecule (C 6 -HSL) by gradual increase in their biofilm-forming potential with a gradual increase in AHL (C 6 -HSL) concentration (250, 500 nM-1 μM) as compared to control revealed by crystal violet assay (CV) in microtiter plate. These results were further confirmed by scanning electron microscopy (SEM). A significant decrease in biofilm formation was observed when L. monocytogenes strain BN3 was treated with 10 µg/ml (R)-2-(2-hydroxynaphthalen-1-yl)thiazolidine-4-carboxylic acid, but when 250 and 500 nM AHL molecules were added, biofilm formation in strain BN3 was found to be enhanced as compared to control even in the presence of antibacterial compound, (R)-2-(2-hydroxynaphthalen-1-yl)thiazolidine-4-carboxylic acid. These results revealed that AHL molecules nullify the effect of antimicrobial compound and promote biofilm formation in L. monocytogenes strain BN3.
Bajor, Anna; Luhr, Anke; Brockmann, Dorothee; Suerbaum, Sebastian; Framme, Carsten; Sedlacek, Ludwig
2016-07-16
The majority of cases of endophthalmitis are caused by exogenous pathogens; only 5-10 % are of endogenous origin. One cause of these rare cases of endogenous endophthalmitis is Listeria monocytogenes. Twenty-six cases of endophthalmitis due to this pathogen have been published over the last twenty years. The aim of this review is to summarize the main risk factors and common clinical findings of endogenous endophthalmitis due to Listeria monocytogenes. We report on a 62-year-old female presenting with a sterile hypopyon iritis with secondary glaucoma and an underlying rheumatoid disease. In microbiological analysis we identified Listeria monocytogenes. Further we searched through all published cases for typical signs, risk factors, details of medical and surgical treatment and outcome of endogenous endophthalmitis due to this rare pathogen. Ocular symptoms in almost all of these published cases included pain, redness of the eye, and decreased vision. Main clinical features included elevated intraocular pressure and fibrinous anterior chamber reaction, as well as a dark hypopyon. While the infection is typically spread endogenously, neither an exogenous nor endogenous source of infection could be identified in most cases. Immunocompromised patients are at higher risk of being infected than immunocompetent patients. The clinical course of endophthalmitis caused by Listeria monocytogenes had different visual outcomes. In some cases, the infection led to enucleation, blindness, or strong visual loss, whereas most patients showed a tendency of visual improvement during therapy. Early diagnosis and treatment initiation are crucial factors in the outcome of endogenous endophthalmitis caused by Listeria monocytogenes. This possible differential diagnosis should be kept in mind while treating patients with presumable sterile hypopyon and anterior uveitis having a high intraocular pressure. A bacterial source should be considered with a prompt initiation of systemic
Sakaridis, I; Soultos, N; Iossifidou, E; Papa, A; Ambrosiadis, I; Koidis, P
2011-06-01
This study was conducted to determine the prevalence and antimicrobial resistance of Listeria monocytogenes recovered from chicken carcasses in slaughterhouses in Northern Greece. A total of 100 poultry samples (300 carcasses) were examined for Listeria spp. The samples were neck skin taken from four different slaughterhouses in Northern Greece. Forty samples were also taken from the environment of the slaughterhouses. Identification of L. monocytogenes was carried out by PCR and fingerprinting of the isolates by random amplified polymorphic DNA. L. monocytogenes strains isolated from chicken carcasses and from the environment of the slaughterhouses were also examined for antibiotic resistance. Fifty-five isolates of L. monocytogenes were tested for susceptibility to 20 antibiotics using the disk diffusion method. Listeria spp. were present in 99 of the poultry samples tested (99%), and 38 yielded L monocytogenes (38%). L. monocytogenes was also isolated in 80% of samples from the environment of a certain slaughterhouse, while the other slaughterhouses were found to be contaminated only with Listeria spp. All isolates were resistant to nalidixic acid and oxolinic acid, the majority of them to clindamycin, and only a few to tetracycline and oxytetracycline, whereas they were found to be susceptible to all other antimicrobials. The results of this study demonstrate a high prevalence of L. monocytogenes contamination in chicken carcasses, and all isolates were found to be sensitive to the antimicrobials most commonly used to treat human listeriosis.
Camargo, Anderson Carlos; Woodward, Joshua John; Call, Douglas Ruben; Nero, Luís Augusto
2017-11-01
Listeria monocytogenes is a foodborne pathogen that contaminates food-processing environments and persists within biofilms on equipment, utensils, floors, and drains, ultimately reaching final products by cross-contamination. This pathogen grows even under high salt conditions or refrigeration temperatures, remaining viable in various food products until the end of their shelf life. While the estimated incidence of listeriosis is lower than other enteric illnesses, infections caused by L. monocytogenes are more likely to lead to hospitalizations and fatalities. Despite the description of L. monocytogenes occurrence in Brazilian food-processing facilities and foods, there is a lack of consistent data regarding listeriosis cases and outbreaks directly associated with food consumption. Listeriosis requires rapid treatment with antibiotics and most drugs suitable for Gram-positive bacteria are effective against L. monocytogenes. Only a minority of clinical antibiotic-resistant L. monocytogenes strains have been described so far; whereas many strains recovered from food-processing facilities and foods exhibited resistance to antimicrobials not suitable against listeriosis. L. monocytogenes control in food industries is a challenge, demanding proper cleaning and application of sanitization procedures to eliminate this foodborne pathogen from the food-processing environment and ensure food safety. This review focuses on presenting the L. monocytogenes distribution in food-processing environment, food contamination, and control in the food industry, as well as the consequences of listeriosis to human health, providing a comparison of the current Brazilian situation with the international scenario.
Listeria monocytogenes response regulators important for stress tolerance and pathogenesis
DEFF Research Database (Denmark)
Kallipolitis, B H; Ingmer, H
2001-01-01
Environmental sensing by two-component signal transduction systems is likely to play a role for growth and survival of Listeria monocytogenes both during transmission in food products and within a host organism. Two-component systems typically consist of a membrane-associated sensor histidine...... kinase and a gene regulatory protein, the response regulator (RR). We have identified seven putative RR genes in L. monocytogenes LO28 by PCR using degenerate oligonucleotide primers. By insertional inactivation we obtained data suggesting that three of the putative RRs contribute to the pathogenicity...... of L. monocytogenes in mice. Strikingly, the mutants that were attenuated in virulence also had a decreased ability to grow in the presence of various stress conditions potentially encountered in an infection process. Thus, our data point to a connection between the ability of the putative two...
Mechanism of Nisin, Pediocin 34, and Enterocin FH99 Resistance in Listeria monocytogenes.
Kaur, Gurpreet; Singh, Tejinder Pal; Malik, Ravinder Kumar; Bhardwaj, Arun
2012-03-01
Nisin-, pediocin 34-, and enterocin FH99-resistant variants of Listeria monocytogenes ATCC 53135 were developed. In an attempt to clarify the possible mechanisms underlying bacteriocin resistance in L. monocytogenes ATCC 53135, sensitivity of the resistant strains of L. monocytogenes ATCC 53135 to nisin, pediocin 34, and enterocin FH99 in the absence and presence of different divalent cations was assessed, and the results showed that the addition of divalent cations significantly reduced the inhibitory activity of nisin, pediocin 34, and enterocin FH99 against resistant variants of L. monocytogenes ATCC 53135. The addition of EDTA, however, restored this activity suggesting that the divalent cations seem to affect the initial electrostatic interaction between the positively charged bacteriocin and the negatively charged phospholipids of the membrane. Nisin-, pediocin 34-, and enterocin-resistant variants of L. monocytogenes ATCC 53135 were more resistant to lysozyme as compared to the wild-type strain both in the presence as well as absence of nisin, pediocin 34, and enterocin FH99. Ultra structural profiles of bacteriocin-sensitive L. monocytogenes and its bacteriocin-resistant counterparts revealed that the cells of wild-type strain of L. monocytogenes were maximally in pairs or short chains, whereas, its nisin-, pediocin 34-, and enterocin FH99-resistant variants tend to form aggregates. Results indicated that without a cell wall, the acquired nisin, pediocin 34, and enterocin FH99 resistance of the variants was lost. Although the bacteriocin-resistant variants appeared to lose their acquired resistance toward nisin, pediocin 34, and enterocin FH99, the protoplasts of the resistant variants appeared to be more resistant to bacteriocins than the protoplasts of their wild-type counterparts.
Novel Biocontrol Methods for Listeria monocytogenes Biofilms in Food Production Facilities.
Gray, Jessica A; Chandry, P Scott; Kaur, Mandeep; Kocharunchitt, Chawalit; Bowman, John P; Fox, Edward M
2018-01-01
High mortality and hospitalization rates have seen Listeria monocytogenes as a foodborne pathogen of public health importance for many years and of particular concern for high-risk population groups. Food manufactures face an ongoing challenge in preventing the entry of L. monocytogenes into food production environments (FPEs) due to its ubiquitous nature. In addition to this, the capacity of L. monocytogenes strains to colonize FPEs can lead to repeated identification of L. monocytogenes in FPE surveillance. The contamination of food products requiring product recall presents large economic burden to industry and is further exacerbated by damage to the brand. Poor equipment design, facility layout, and worn or damaged equipment can result in Listeria hotspots and biofilms where traditional cleaning and disinfecting procedures may be inadequate. Novel biocontrol methods may offer FPEs effective means to help improve control of L. monocytogenes and decrease cross contamination of food. Bacteriophages have been used as a medical treatment for many years for their ability to infect and lyse specific bacteria. Endolysins, the hydrolytic enzymes of bacteriophages responsible for breaking the cell wall of Gram-positive bacteria, are being explored as a biocontrol method for food preservation and in nanotechnology and medical applications. Antibacterial proteins known as bacteriocins have been used as alternatives to antibiotics for biopreservation and food product shelf life extension. Essential oils are natural antimicrobials formed by plants and have been used as food additives and preservatives for many years and more recently as a method to prevent food spoilage by microorganisms. Competitive exclusion occurs naturally among bacteria in the environment. However, intentionally selecting and applying bacteria to effect competitive exclusion of food borne pathogens has potential as a biocontrol application. This review discusses these novel biocontrol methods and their
DEFF Research Database (Denmark)
Wessels, Stephen Wallace; Huss, Hans Henrik
1996-01-01
This study is part of strategy to control the human pathogen Listeria monocytogenes in lightly preserved fish products by using food-grade lactic acid bacteria. When the nisin-producing Lactococcus lactis subsp lactis ATCC 11454 was cultured in the same vessel as L-monocytogenes Scott A in brain......-heart infusion broth (BHI) at 30-degrees C, the pathogen declined from 5x10(5) to fewer than 5 cfu ml(-1) within 31 h. The effect was not due to lactic acid inhibition. Growth and nisin production by L- lactis ATCC 11454 were investigated under the conditions of temperature and salt used for light preservation...... and no detectable nisin. On slices of commercial cold-smoked salmon at 10-degrees C, no net propagation pf L-lactis ATCC 11454 could be detected within 21 days. However, when salmon slices were inoculated with L- mycocytogenes at 10(4) cfu g(-1) and a 300-fold excess of washed lactococcus cells, the pathogen...
A dynamical systems approach to actin-based motility in Listeria monocytogenes
Hotton, S.
2010-11-01
A simple kinematic model for the trajectories of Listeria monocytogenes is generalized to a dynamical system rich enough to exhibit the resonant Hopf bifurcation structure of excitable media and simple enough to be studied geometrically. It is shown how L. monocytogenes trajectories and meandering spiral waves are organized by the same type of attracting set.
Hasegawa, Megumi; Iwabuchi, Eriko; Yamamoto, Shiori; Muramatsu, Masatake; Takashima, Ikuo; Hirai, Katsuya
2014-02-01
This study was conducted to determine the prevalence and characteristics of Listeria monocytogenes in the feces of black beef cattle reared in geographically distant areas in Japan. We surveyed 130 farms in the following three areas: northern (Hokkaido prefecture), central (Gifu and Mie prefectures), and southern (Oita, Miyazaki, and Kagoshima prefectures) areas and collected 1738 fecal samples. Our data showed the following isolation rate for each area: northern, 11.4% of 651; central, 2.8% of 572; and southern, 2.9% of 515, indicating that the isolation rate in the northern area was significantly higher than that in the central or southern areas (pprevalent serotype (40.5%), followed by 1/2a (36.9%), 4b (21.6%), and 4ab (1.0%). In the northern area, multiple serotypes were isolated from 60% of L. monocytogenes-positive farms. In addition, multiple serotypes were isolated from individual fecal samples from 18 cattle. Pulsed-field gel electrophoresis (PFGE) characterization of 239 isolates detected 48 different PFGE types. We found that isolates from northern farms were genetically diverse compared to those from central and southern farms. Five isolates from human clinical cases and three isolates from animal clinical cases were identical to isolates from black beef cattle. Furthermore, the isolates from northern and central farms were characterized to possess epidemic clone II or III markers. We next showed that the isolates were susceptible to penicillin, ampicillin, amoxicillin, gentamicin, kanamycin, streptomycin, erythromycin, vancomycin, tetracycline, chloramphenicol, ciprofloxacin, and trimethoprim/sulfamethoxazole. Taken together, our survey provides crucial data regarding the prevalence and characteristics of L. monocytogenes in black beef cattle farms throughout Japan.
Gómez, Natacha Caballero; Abriouel, Hikmate; Grande, M A José; Pulido, Rubén Pérez; Gálvez, Antonio
2012-05-01
Enterocin AS-48 was tested on a cocktail of Listeria monocytogenes strains in planktonic and sessile states, singly or in combination with biocides benzalkonium chloride, cetrimide, hexadecylpyridinium chloride, didecyldimethylammonium bromide, triclosan, poly-(hexamethylen guanidinium) hydrochloride, chlorhexidine, hexachlorophene, and the commercial sanitizers P3 oxonia and P3 topax 66. Combinations of sub-inhibitory bacteriocin concentrations and biocide concentrations 4 to 10-fold lower than their minimum inhibitory concentrations (MIC) completely inhibited growth of the planktonic listeriae. Inactivation of Listeria in biofilms formed on polystyrene microtiter plates required concentrations of enterocin AS-48 greater than 50 μg/ml, and biocide concentrations ten to 100-fold higher. In combination with enterocin AS-48 (25 or 50 μg/ml), microbial inactivation increased remarkably for all biocides except P3 oxonia and P3 topax 66 solutions. Polystyrene microtiter plates conditioned with enterocin solutions (0.5-25 μg/ml) decreased the adherence and biofilm formation of the L. monocytogenes cell cocktail, avoiding biofilm formation for at least 24 h at a bacteriocin concentration of 25 μg/ml. Copyright © 2011 Elsevier Ltd. All rights reserved.
Thermal Inactivation of Salmonella Enteritidis Inoculated to Cake and Chicken
Directory of Open Access Journals (Sweden)
Ceyda Dadalı
2018-04-01
Full Text Available In this study, thermal inactivation of Salmonella Enteritidis inoculated to the cake dough and a whole raw chicken was investigated. The cake dough was inoculated with 6.15 log-cfu/g S. Enteritidis then, thermal treatment was applied at 160°C top-bottom fan cooking mode. The initial count of S. Enteritidis showed reductions 1.49 log-cfu/g, 2.06 log-cfu/g and 4.29 log-cfu/g in the samples from the cold point location from the geometric center of the cake at 5, 7 and 10 minutes of thermal treatment, respectively. Although S. Enteritidis is not detected at the end of 15 minutes of heat treatment, the center of the cake temperature has reached 85.69°C and the cake sample is uncooked and its sensory properties are not acceptable. The cake that is safe and favorable with the sensory properties to the consumers was obtained by heat treatment for 30 minutes. After the cold point of a whole raw chicken was inoculated with 7.29 log-cfu/g S. Enteritidis, thermal treatment was applied at 220°C top-bottom fan cooking mode. The temperature at the cold point of 35 and 45 minutes heat-treated chickens reached 59.33 and 74.08°C, respectively, and 1.93 log-cfu/g and 5.33 log-cfu /g S. Enteritidis reduction caused in the samples respectively. S. Enteritidis cells were not detected in the whole chicken heat treated at 220°C for 60 minutes. The cakes, heat treated at 160°C top-bottom fan cooking mode for 30 minutes, were stored at two different storage temperatures as 4°C and 25°C for 72 hours. The whole chicken, heat treated at 220°C top-bottom fan cooking mode for 60 minutes, was stored at 4°C for 72 hours. S. Enteritidis cells were not detected in the cake and the whole chicken samples after the storage period.
Escolar, Cristina; Gómez, Diego; Del Carmen Rota García, María; Conchello, Pilar; Herrera, Antonio
2017-06-01
The objective of this work was to investigate the antimicrobial resistance in Listeria spp. isolated from food of animal origin. A total of 50 Listeria strains isolated from meat and dairy products, consisting of 7 Listeria monocytogenes and 43 Listeria innocua strains, were characterized for antimicrobial susceptibility against nine antimicrobials. The strains were screened by real-time PCR for the presence of antimicrobial resistance genes: tet M, tet L, mef A, msr A, erm A, erm B, lnu A, and lnu B. Multidrug resistance was identified in 27 Listeria strains, 4 belonging to L. monocytogenes. Resistance to clindamycin was the most common resistance phenotype and was identified in 45 Listeria strains; the mechanisms of resistance are still unknown. A medium prevalence of resistance to tetracycline (15 and 9 resistant and intermediate strains) and ciprofloxacin (13 resistant strains) was also found. Tet M was detected in Listeria strains with reduced susceptibility to tetracycline, providing evidence that both L. innocua and L. monocytogenes displayed acquired resistance. The presence of antimicrobial resistance genes in L. innocua and L. monocytogenes indicates that these genes may be transferred to commensal and pathogenic bacteria via the food chain; besides this, antibiotic resistance in L. monocytogenes could compromise the effective treatment of listeriosis in humans.
Nyarko, Esmond; Donnelly, Catherine
2015-03-01
Fourier transform infrared (FT-IR) spectroscopy was used to differentiate mixed strains of Listeria monocytogenes and mixed strains of L. monocytogenes and Listeria innocua. FT-IR spectroscopy was also applied to investigate the hypothesis that heat-injured and acid-injured cells would return to their original physiological integrity following repair. Thin smears of cells on infrared slides were prepared from cultures for mixed strains of L. monocytogenes, mixed strains of L. monocytogenes and L. innocua, and each individual strain. Heat-injured and acid-injured cells were prepared by exposing harvested cells of L. monocytogenes strain R2-764 to a temperature of 56 ± 0.2°C for 10 min or lactic acid at pH 3 for 60 min, respectively. Cellular repair involved incubating aliquots of acid-injured and heat-injured cells separately in Trypticase soy broth supplemented with 0.6% yeast extract for 22 to 24 h; bacterial thin smears on infrared slides were prepared for each treatment. Spectral collection was done using 250 scans at a resolution of 4 cm(-1) in the mid-infrared wavelength region. Application of multivariate discriminant analysis to the wavelength region from 1,800 to 900 cm(-1) separated the individual L. monocytogenes strains. Mixed strains of L. monocytogenes and L. monocytogenes cocultured with L. innocua were successfully differentiated from the individual strains when the discriminant analysis was applied. Different mixed strains of L. monocytogenes were also successfully separated when the discriminant analysis was applied. A data set for injury and repair analysis resulted in the separation of acid-injured, heat-injured, and intact cells; repaired cells clustered closer to intact cells when the discriminant analysis (1,800 to 600 cm(-1)) was applied. FT-IR spectroscopy can be used for the rapid source tracking of L. monocytogenes strains because it can differentiate between different mixed strains and individual strains of the pathogen.
International Nuclear Information System (INIS)
Negi, Mahima; Tilak, K.V.B.R.; Sachdev, M.S.
1991-01-01
Response of barley (Hordeum vulgare L.) in a sandy-loam soil under potted conditions revealed that application of nitrogen and phosphorus increased the population of Azospirillium in the barley rhizosphere. A two fold increase was observed in the Azospirillium population at 80 days compared to that at 40 days of plant growth. The unsterilized inoculated roots had more population than the surface sterilized inoculated roots. Increased drymatter production of barley was obtained in A. brasilense inoculated N 0 P 1 (0 kg N and 30 kg P 2 O 5 ha -1 ) treatment than uninoculated control. Also N and P uptake was higher in A. brasilense inoculated plants in the presence of both N and P fertilizers. The 15 N data revealed that at harvest nearly 36 per cent of the total N uptake was from the nitrogen fixed by A. brasilense irrespective of P treatment. (author). 16 refs., 4 tabs
Lopez-Valladares, Gloria; Danielsson-Tham, Marie-Louise; Goering, Richard V; Tham, Wilhelm
2017-01-01
Among 504 clinical lineage II isolates of Listeria monocytogenes isolated during 1958-2010 in Sweden, 119 pulsed-field gel electrophoresis (PFGE) types (AscI) have been identified based on the number and distribution of all banding patterns in each DNA profile. In this study, these types were further divided into PFGE groups based on the configuration of small bands with sizes kb. The 504 isolates included 483 serovar 1/2a isolates distributed into 114 PFGE types and 21 serovar 1/2c isolates distributed into 9 PFGE types; these were further divided into 21 PFGE groups. PFGE group, that is, configuration of small bands below 145.5 kb, and serovars were correlated. L. monocytogenes isolates belonging to PFGE groups A, B, C, E, F, H, K, L, M, S, V, W, Y, and Ö-6 to Ö-12 shared serovar 1/2a, with one exception. PFGE group E also included two PFGE types sharing serovar 1/2c and four PFGE types belonging to either serovar 1/2a or 1/2c. Isolates belonging to PFGE group N shared serovar 1/2c. In contrast to lineage I isolates, small fragments kb were visible in all L. monocytogenes isolates belonging to lineage II. In the results from both the present and previous studies, the genomic region of small bands was genetically more conservative than in large bands. The distribution of these small bands established the relatedness of strains and defined a genetic marker for both lineages I and II, while also establishing their serogroup. The division of L. monocytogenes PFGE types into PFGE groups is advantageous as the profile of every new isolate can be identified easily and quickly through first studying the PFGE group affiliation of the isolate based on the smaller band patterns kb, and then identifying the PFGE type based on the band patterns >145.5 kb.
Law, Jodi Woan-Fei; Ab Mutalib, Nurul-Syakima; Chan, Kok-Gan; Lee, Learn-Han
2015-01-01
Listeria monocytogenes, a foodborne pathogen that can cause listeriosis through the consumption of food contaminated with this pathogen. The ability of L. monocytogenes to survive in extreme conditions and cause food contaminations have become a major concern. Hence, routine microbiological food testing is necessary to prevent food contamination and outbreaks of foodborne illness. This review provides insight into the methods for cultural detection, enumeration, and molecular identification of L. monocytogenes in various food samples. There are a number of enrichment and plating media that can be used for the isolation of L. monocytogenes from food samples. Enrichment media such as buffered Listeria enrichment broth, Fraser broth, and University of Vermont Medium (UVM) Listeria enrichment broth are recommended by regulatory agencies such as Food and Drug Administration-bacteriological and analytical method (FDA-BAM), US Department of Agriculture-Food and Safety (USDA-FSIS), and International Organization for Standardization (ISO). Many plating media are available for the isolation of L. monocytogenes, for instance, polymyxin acriflavin lithium-chloride ceftazidime aesculin mannitol, Oxford, and other chromogenic media. Besides, reference methods like FDA-BAM, ISO 11290 method, and USDA-FSIS method are usually applied for the cultural detection or enumeration of L. monocytogenes. most probable number technique is applied for the enumeration of L. monocytogenes in the case of low level contamination. Molecular methods including polymerase chain reaction, multiplex polymerase chain reaction, real-time/quantitative polymerase chain reaction, nucleic acid sequence-based amplification, loop-mediated isothermal amplification, DNA microarray, and next generation sequencing technology for the detection and identification of L. monocytogenes are discussed in this review. Overall, molecular methods are rapid, sensitive, specific, time- and labor-saving. In future, there are
Directory of Open Access Journals (Sweden)
Chong-Tao Du
2018-03-01
Full Text Available The gut microbiota and microRNAs play important roles in the defense against infection. However, the role of miR-146a in L. monocytogenes infection and gut microbiota remains unclear. We tried to determine whether miR-146a controlled L. monocytogenes infection by regulating the gut microbiota. Wild-type and miR-146a-deficient mice or macrophages were used to characterize the impact of miR-146a on animal survival, cell death, bacterial clearance, and gut microbiota following L. monocytogenes challenge. We found that L. monocytogenes infection induced miR-146a expression both in vitro and in vivo. When compared to wild-type mice, miR-146a-deficient mice were more resistant to L. monocytogenes infection. MiR-146a deficiency in macrophages resulted in reduced invasion and intracellular survival of L. monocytogenes. High-throughput sequencing of 16S rRNA revealed that the gut microbiota composition differed between miR-146a-deficient and wild-type mice. Relative to wild-type mice, miR-146a-deficient mice had decreased levels of the Proteobacteria phylum, Prevotellaceae family, and Parasutterella genus, and significantly increased short-chain fatty acid producing bacteria, including the genera Alistipes, Blautia, Coprococcus_1, and Ruminococcus_1. Wild-type mice co-housed with miR-146a-deficient mice had increased resistance to L. monocytogenes, indicating that miR-146a deficiency guides the gut microbiota to alleviate infection. Together, these results suggest that miR-146a deficiency protects against L. monocytogenes infection by regulating the gut microbiota.
Du, Chong-Tao; Gao, Wei; Ma, Ke; Yu, Shui-Xing; Li, Na; Yan, Shi-Qing; Zhou, Feng-Hua; Liu, Zhen-Zhen; Chen, Wei; Lei, Lian-Cheng; Yang, Yong-Jun; Han, Wen-Yu
2018-03-26
The gut microbiota and microRNAs play important roles in the defense against infection. However, the role of miR-146a in L. monocytogenes infection and gut microbiota remains unclear. We tried to determine whether miR-146a controlled L. monocytogenes infection by regulating the gut microbiota. Wild-type and miR-146a-deficient mice or macrophages were used to characterize the impact of miR-146a on animal survival, cell death, bacterial clearance, and gut microbiota following L. monocytogenes challenge. We found that L. monocytogenes infection induced miR-146a expression both in vitro and in vivo. When compared to wild-type mice, miR-146a-deficient mice were more resistant to L. monocytogenes infection. MiR-146a deficiency in macrophages resulted in reduced invasion and intracellular survival of L. monocytogenes . High-throughput sequencing of 16S rRNA revealed that the gut microbiota composition differed between miR-146a-deficient and wild-type mice. Relative to wild-type mice, miR-146a-deficient mice had decreased levels of the Proteobacteria phylum, Prevotellaceae family, and Parasutterella genus, and significantly increased short-chain fatty acid producing bacteria, including the genera Alistipes , Blautia , Coprococcus_1, and Ruminococcus_1 . Wild-type mice co-housed with miR-146a-deficient mice had increased resistance to L. monocytogenes , indicating that miR-146a deficiency guides the gut microbiota to alleviate infection. Together, these results suggest that miR-146a deficiency protects against L. monocytogenes infection by regulating the gut microbiota.
Suppression of Listeria monocytogenes by the Native Micro-Flora in Teewurst Sausage
Directory of Open Access Journals (Sweden)
Michline Brice
2013-10-01
Full Text Available Modern consumers are interested in the use of non-chemical methods to control pathogens when heat sterilization is not an option. Such is the case with teewurst sausage, a raw spreadable sausage and a popular German commodity. Although Listeria was not found in teewurst, the optimal microbial growing conditions of teewurst coupled with the ubiquity of L. monocytogenes in nature, makes the possibility of contamination of products very possible. This pilot study was conducted to examine teewurst’s native micro-flora’s ability to suppress the outgrowth of L. monocytogenes at 10 °C using standard plate counts and PCR-DGGE. Traditional plating methods showed L. monocytogenes growth significantly decreased when in competition with the teewurst’s native micro-flora (p < 0.05. The native micro-flora of the teewurst suppressed the overall growth of L. monocytogenes by an average of two logs, under these conditions. Denaturing Gradient Gel Electrophoresis (DGGE amplicons with unique banding patterns were extracted from DGGE gel for identification. Brochothrix thermosphacta and Lactobacillus curvatus were identified as a part of the teewurst’s native micro-flora. Although the native micro-flora did not decrease L. monocytogenes to below limits of detection, it was enough of a decrease to warrant further investigation.
Antibiotic treatment and mortality in patients with Listeria monocytogenes meningitis or bacteraemia
DEFF Research Database (Denmark)
Thønnings, S; Knudsen, J D; Schønheyder, H C
2016-01-01
. monocytogenes infections including the efficacy of empiric and definitive antibiotic therapies. Demographic, clinical and biochemical findings, antibiotic treatment and 30-day mortality for all episodes of L. monocytogenes bacteraemia and/or meningitis were collected by retrospective medical record review...... in the North Denmark Region and the Capital Region of Denmark (17 hospitals) from 1997 to 2012. Risk factors for 30-day all-cause mortality were assessed by logistic regression. The study comprised 229 patients (median age: 71 years), 172 patients had bacteraemia, 24 patients had meningitis and 33 patients had...... both. Significant risk factors for 30-day mortality were septic shock (OR 3.0, 95% CI 1.4-6.4), altered mental state (OR 3.6, 95% CI 1.7-7.6) and inadequate empiric antibiotic therapy (OR 3.8, 95% CI 1.8-8.1). Cephalosporins accounted for 90% of inadequately treated cases. Adequate definitive...
Directory of Open Access Journals (Sweden)
Cathy C. Webb
2015-04-01
Full Text Available Listeria monocytogenes contamination of cantaloupes has become a serious concern as contaminated cantaloupes led to a deadly outbreak in the United States in 2011. To reduce cross-contamination between cantaloupes and to reduce resident populations on contaminated melons, application of sanitizers in packing shed wash water is recommended. The sanitizing agent of 5% levulinic acid and 2% sodium dodecyl sulfate (SDS applied as a single hurdle in either a simulated dump or dip treatment significantly reduced L. monocytogenes to lower levels at the stem scar compared to a simulated dump treatment employing 200 ppm chlorine; however pathogen reductions on the rind tissue were not significantly different. Double hurdle approaches employing two sequential packing plant treatments with different sanitizers revealed decreased reduction of L. monocytogenes at the stem scar. In contrast, application of sanitizers both in the field and at the packing plant led to greater L. monocytogenes population reductions than if sanitizers were only applied at the packing plant.
Pöntinen, Anna; Lindström, Miia; Skurnik, Mikael; Korkeala, Hannu
2017-08-01
To study the role of each two-component system (TCS) histidine kinase (HK) in stress tolerance of Listeria monocytogenes EGD-e, we monitored the growth of individual HK deletion mutant strains under heat (42.5 °C), acid (pH 5.6), alkali (pH 9.4), osmotic (6% NaCl), ethanol (3.5 vol%), and oxidative (5 mM H 2 O 2 ) stresses. The growth of ΔliaS (Δlmo1021) strain was impaired under each stress, with the most notable decrease under heat and osmotic stresses. The ΔvirS (Δlmo1741) strain showed nearly completely restricted growth at high temperature and impaired growth in ethanol. The growth of ΔagrC (Δlmo0050) strain was impaired under osmotic stress and slightly under oxidative stress. We successfully complemented the HK mutations using a novel allelic exchange based approach. This approach avoided the copy-number problems associated with in trans complementation from a plasmid. The mutant phenotypes were restored to the wild-type level in the complemented strains. This study reveals novel knowledge on the HKs needed for growth of L. monocytogenes EGD-e under abovementioned stress conditions, with LiaS playing multiple roles in stress tolerance of L. monocytogenes EGD-e. Copyright © 2017 Elsevier Ltd. All rights reserved.
Short-term genome evolution of Listeria monocytogenes in a non-controlled environment
Directory of Open Access Journals (Sweden)
Ivy Reid A
2008-11-01
Full Text Available Abstract Background While increasing data on bacterial evolution in controlled environments are available, our understanding of bacterial genome evolution in natural environments is limited. We thus performed full genome analyses on four Listeria monocytogenes, including human and food isolates from both a 1988 case of sporadic listeriosis and a 2000 listeriosis outbreak, which had been linked to contaminated food from a single processing facility. All four isolates had been shown to have identical subtypes, suggesting that a specific L. monocytogenes strain persisted in this processing plant over at least 12 years. While a genome sequence for the 1988 food isolate has been reported, we sequenced the genomes of the 1988 human isolate as well as a human and a food isolate from the 2000 outbreak to allow for comparative genome analyses. Results The two L. monocytogenes isolates from 1988 and the two isolates from 2000 had highly similar genome backbone sequences with very few single nucleotide (nt polymorphisms (1 – 8 SNPs/isolate; confirmed by re-sequencing. While no genome rearrangements were identified in the backbone genome of the four isolates, a 42 kb prophage inserted in the chromosomal comK gene showed evidence for major genome rearrangements. The human-food isolate pair from each 1988 and 2000 had identical prophage sequence; however, there were significant differences in the prophage sequences between the 1988 and 2000 isolates. Diversification of this prophage appears to have been caused by multiple homologous recombination events or possibly prophage replacement. In addition, only the 2000 human isolate contained a plasmid, suggesting plasmid loss or acquisition events. Surprisingly, besides the polymorphisms found in the comK prophage, a single SNP in the tRNA Thr-4 prophage represents the only SNP that differentiates the 1988 isolates from the 2000 isolates. Conclusion Our data support the hypothesis that the 2000 human listeriosis
Directory of Open Access Journals (Sweden)
Nilma Cintra Lea
2013-09-01
Full Text Available Background: In Brazil, listeriosis is not a notifiable disease; thus, the incidence of Brazilian cases remains unknown. Listeria monocytogenes is not always included in automated systems, and its detection depends on the high skill level of microbiology laboratory professionals. This paper describes the characteristics of L. monocytogenes isolates fortuitously obtained from an endocarditis case in Recife, PE, Brazil. Methods: Six bacterial isolates obtained from six blood cultures from a 28-year-old male bearing a prosthetic mitral heart valve were analyzed by PCR using primers specific of L. monocytogenes to confirm a presumptive identification, determine the serotype and presence of the virulence genes (inlA, inlB, inlC, inlJ, hly, plcA, actA, prfA in an attempt to determine the Listeria genotype by PCR-ribotyping. Results: The samples were identified as L. monocytogenes 4b. All investigated virulence genes were amplified by PCR, and the identity of the amplified segments was confirmed by sequencing. A deletion of 105 base pairs was detected in the actA gene. All of the samples generated the same PCR-ribotype pattern, clustered into a single ribotype, and were considered a single strain. Conclusion: L. monocytogenes infection should be considered in endocarditis differential diagnoses, especially among high-risk groups, due to its high pathogenicity and the environmental ubiquity.
Haubert, L; Mendonça, M; Lopes, G V; de Itapema Cardoso, M R; da Silva, W P
2016-01-01
Listeria monocytogenes is a foodborne pathogen that has become an important cause of human and animal diseases worldwide. The purpose of this study was to evaluate the serotypes, virulence potential, antimicrobial resistance profile, and genetic relationships of 50 L. monocytogenes isolates from food and food environment in southern Brazil. In this study, the majority of L. monocytogenes isolates belonged to the serotypes 1/2b (42%) and 4b (26%), which are the main serotypes associated with human listeriosis. In addition, all isolates harboured internalin genes (inlA, inlC, inlJ), indicating a virulence potential. The isolates were sensitive to most of the antimicrobial compounds analysed, and five isolates (10%) were multi-resistant. Two isolates harboured antimicrobial resistance genes (tetM and ermB) and in one of them, the gene was present in the plasmid. Moreover, according to the pulsed field gel electrophoresis assay, two multi-resistant isolates were a single clone isolated from food and the processing plant. The isolates were susceptible to the most frequently used antibiotics for listeriosis treatment. However, the presence of multidrug-resistant isolates and antimicrobial resistance genes including in the plasmid could even be transferred between bacterial species, suggesting a potential health risk to consumers and a potential risk of spreading multi-resistance genes to other bacteria. Listeria monocytogenes is an important agent of foodborne diseases. The results of this study suggest a potential capacity of L. monocytogenes isolates from food and food environment to cause human infections. Antimicrobial multi-resistance profiles were detected in 10%, and two isolates harboured tetM and ermB resistance genes. Moreover, the present research can help to build up a better knowledge about antimicrobial resistance of L. monocytogenes. Additionally, we found one isolate carrying tetM resistance gene in a plasmid, that suggests a possible transmission
DEFF Research Database (Denmark)
Thomsen, L. E.; Gottlieb, Caroline Trebbien; Gottschalk, S.
2010-01-01
. However, in S. aureus, four mutants with insertion in the heme response regulator (hssR) were 2-4 fold more resistant to plectasin as compared to the wild type. The hssR mutation also enhanced resistance to the plectasin-like defensin eurocin, but not to other classes of HDPs or to other stressors tested...... is incompletely understood and such knowledge is required to evaluate their potential as antimicrobial therapeutics. Plectasin is a recently discovered HDP active against Gram-positive bacteria with the human pathogen, Staphylococcus aureus (S. aureus) being highly susceptible and the food borne pathogen...... constructed bacterial transposon mutant libraries of S. aureus NCTC8325-4 and L. monocytogenes 4446 and screened for increased resistance to the peptide. No resistant mutants arose when L. monocytogenes was screened on plates containing 5 and 10 fold Minimal Inhibitory Concentration (MIC) of plectasin...
International Nuclear Information System (INIS)
Thayer, D.W.; Boyd, G.; Kim, A.; Fox, J.B. Jr.; Farrell, H.M. Jr.
1998-01-01
The radiation resistance and ability of Listeria monocytogenes ATCC 7644, 15313, 43256, and 49594 to multiply on irradiated, air-packed, refrigerated raw or cooked turkey breast meat nuggets (ca. 25 g) and ground turkey breast meat was investigated. Gamma-radiation D values for L. monocytogenes were significantly different on raw and cooked nuggets, 0.56 +/- 0.03 kGy and 0.69 +/- 0.03 kGy, respectively; but they were not significantly different (P less than or equal to 0.05) on raw and cooked ground turkey meat. High populations (approximately 10(9) CFU/g) of L. monocytogenes declined during 14 days of storage at 4 degrees C in both irradiated and nonirradiated samples of raw but not of cooked ground turkey breast meat. A moderate inoculum (approximately 10(3) CFU/g) did not survive a radiation dose of 3 kGy. The population increased in cooked but not in raw samples of irradiated ground turkey meat stored at either 2 or 7 degrees C for 21 days. The D value changed significantly from 0.70 +/- 0.04 to 0.60 +/- 0.02 kGy when the product was cooked to an internal temperature of 80 degrees C before irradiation. Growth on either raw or cooked turkey meat did not alter the radiation resistance of L. monocytogenes. Analyses were performed for pH, a(w), moisture, and reducing potential of raw and cooked turkey meat and for pH, amino acid profile, thiamine, and riboflavin contents of aqueous extracts of raw and cooked turkey meats without identifying the factor or factors involved in differences in the survival and multiplication of L. monocytogenes on raw and cooked meat