Effect of aggregation form on bioavailability of zeaxanthin in humans: a randomised cross-over study.

Science.gov (United States)

Hempel, Judith; Fischer, Anja; Fischer, Monique; Högel, Josef; Bosy-Westphal, Anja; Carle, Reinhold; Schweiggert, Ralf M

2017-11-01

Carotenoid bioavailability from plant and animal food is highly variable depending on numerous factors such as the physical deposition form of carotenoids. As the carotenoid zeaxanthin is believed to play an important role in eye and brain health, we sought to compare the human bioavailability of an H-aggregated with that of a J-aggregated deposition form of zeaxanthin encapsulated into identical formulation matrices. A randomised two-way cross-over study with sixteen participants was designed to compare the post-prandial bioavailability of an H-aggregated zeaxanthin and a J-aggregated zeaxanthin dipalmitate formulation, both delivering 10 mg of free zeaxanthin. Carotenoid levels in TAG-rich lipoprotein fractions were analysed over 9·5 h after test meal consumption. Bioavailability from the J-aggregated formulation (AUC=55·9 nmol h/l) was 23 % higher than from the H-aggregated one (AUC=45·5 nmol h/l), although being only marginally significant (P=0·064). Furthermore, the same formulations were subjected to an internationally recognised in vitro digestion protocol to reveal potential strengths and weaknesses of simulated digestions. In agreement with our human study, liberation of zeaxanthin from the J-aggregated formulation into the simulated duodenal fluids was superior to that from the H-aggregated form. However, micellization rate (bioaccessibility) of the J-aggregated zeaxanthin dipalmitate was lower than that of the H-aggregated zeaxanthin, being contradictory to our in vivo results. An insufficient ester cleavage during simulated digestion was suggested to be the root cause for these observations. In brief, combining our in vitro and in vivo observations, the effect of the different aggregation forms on human bioavailability was lower than expected.

Fluxes of Ca2+ and K+ are required for the listeriolysin O-dependent internalization pathway of Listeria monocytogenes.

Science.gov (United States)

Vadia, Stephen; Seveau, Stephanie

2014-03-01

Listeria monocytogenes is responsible for the life-threatening food-borne disease listeriosis. This disease mainly affects elderly and immunocompromised individuals, causing bacteremia and meningoencephalitis. In pregnant women, L. monocytogenes infection leads to abortion and severe infection of the fetus or newborn. The L. monocytogenes intracellular life cycle is critical for pathogenesis. Previous studies have established that the major virulence factor of L. monocytogenes, the pore-forming toxin listeriolysin O (LLO), is sufficient to induce L. monocytogenes internalization into human epithelial cell lines. This internalization pathway strictly requires the formation of LLO pores in the plasma membrane and can be stimulated by the heterologous pore-forming toxin pneumolysin, suggesting that LLO acts nonspecifically by forming transmembrane pores. The present work tested the hypothesis that Ca2+ and K+ fluxes subsequent to perforation by LLO control L. monocytogenes internalization. We report that L. monocytogenes perforates the host cell plasma membrane in an LLO-dependent fashion at the early stage of invasion. In response to perforation, host cells undergo Ca2+ -dependent but K+ -independent resealing of their plasma membrane. In contrast to the plasma membrane resealing process, LLO-induced L. monocytogenes internalization requires both Ca2+ and K+ fluxes. Further linking ion fluxes to bacterial internalization, treating cells with a combination of Ca2+ and K+ ionophores but not with individual ionophores is sufficient to induce efficient internalization of large cargoes, such as 1-μm polystyrene beads and bacteria. We propose that LLO-induced L. monocytogenes internalization requires a Ca2+ - and K+ -dependent internalization pathway that is mechanistically distinct from the process of plasma membrane resealing.

Diversity assessment of Listeria monocytogenes biofilm formation: Impact of growth condition, serotype and strain origin

NARCIS (Netherlands)

Kadam, S.R.; Besten, den H.M.W.; Veen, van der S.; Zwietering, M.H.; Moezelaar, R.; Abee, T.

2013-01-01

The foodborne pathogen Listeria monocytogenes has the ability to produce biofilms in food-processing environments and then contaminate food products, which is a major concern for food safety. The biofilm forming behavior of 143 L. monocytogenes strains was determined in four different media that

Visualization of gold and platinum nanoparticles interacting with Salmonella Enteritidis and Listeria monocytogenes

Directory of Open Access Journals (Sweden)

Ewa Sawosz

2010-08-01

Full Text Available Ewa Sawosz1, André Chwalibog2, Jacek Szeliga3, Filip Sawosz2, Marta Grodzik1, Marlena Rupiewicz1, Tomasz Niemiec1, Katarzyna Kacprzyk11Division of Biotechnology and Biochemistry of Nutrition, Warsaw University of Life Sciences, Warsaw, Poland; 2Department of Basic Animal and Veterinary Sciences, University of Copenhagen, Copenhagen, Denmark; 3Division of Microbiology of Analytical Centre, Warsaw University of Life Sciences, Warsaw, PolandPurpose: Rapid development of nanotechnology has recently brought significant attention to the extraordinary biological features of nanomaterials. The objective of the present ­investigation was to evaluate morphological characteristics of the assembles of gold and platinum nanoparticles (nano-Au and nano-Pt respectively, with Salmonella Enteritidis (Gram-negative and Listeria monocytogenes (Gram-positive, to reveal possibilities of constructing bacteria-nanoparticle vehicles.Methods: Hydrocolloids of nano-Au or nano-Pt were added to two bacteria suspensions in the following order: nano-Au + Salmonella Enteritidis; nano-Au + Listeria monocytogenes; nano-Pt + Salmonella Enteritidis; nano-Pt + Listeria monocytogenes. Samples were inspected by transmission electron microscope.Results: Visualization of morphological interaction between nano-Au and Salmonella Enteritidis and Listeria monocytogenes, showed that nano-Au were aggregated within flagella or biofilm network and did not penetrate the bacterial cell. The analysis of morphological effects of interaction of nano-Pt with bacteria revealed that nano-Pt entered cells of Listeria monocytogenes and were removed from the cells. In the case of Salmonella Enteritidis, nano-Pt were seen inside bacteria cells, probably bound to DNA and partly left bacterial cells. After washing and centrifugation, some of the nano-Pt-DNA complexes were observed within Salmonella Enteritidis.Conclusion: The results indicate that the bacteria could be used as a vehicle to deliver nano

Role of Extracellular DNA during Biofilm Formation by Listeria monocytogenes

DEFF Research Database (Denmark)

Harmsen, Morten; Lappann, Martin; Knøchel, S

2010-01-01

(eDNA) may be the only central component of the biofilm matrix and that it is necessary for both initial attachment and early biofilm formation for 41 L. monocytogenes strains that were tested. DNase I treatment resulted in dispersal of biofilms, not only in microtiter tray assays but also in flow......Listeria monocytogenes is a food-borne pathogen that is capable of living in harsh environments. It is believed to do this by forming biofilms, which are surface-associated multicellular structures encased in a self-produced matrix. In this paper we show that in L. monocytogenes extracellular DNA...... cell biofilm assays. However, it was also demonstrated that in a culture without eDNA, neither Listeria genomic DNA nor salmon sperm DNA by itself could restore the capacity to adhere. A search for additional necessary components revealed that peptidoglycan (PG), specifically N-acetylglucosamine (NAG...

Overlevingsstrategieën Listeria monocytogenes bij lage temperatuur

NARCIS (Netherlands)

Wemekamp-Kamphuis, H.H.; Abee, T.

2004-01-01

Listeria monocytogenes is an important food-borne pathogen that may cause severe infections in humans. Many outbreaks caused by this organism have been associated with ready-to-eat foods wich may have undergone some form of minimal processing, or have been contaminated after processing. Ready-to-eat

Spontaneous Loss of Virulence in Natural Populations of Listeria monocytogenes.

Science.gov (United States)

Maury, Mylène M; Chenal-Francisque, Viviane; Bracq-Dieye, Hélène; Han, Lei; Leclercq, Alexandre; Vales, Guillaume; Moura, Alexandra; Gouin, Edith; Scortti, Mariela; Disson, Olivier; Vázquez-Boland, José A; Lecuit, Marc

2017-11-01

The pathogenesis of Listeria monocytogenes depends on the ability of this bacterium to escape from the phagosome of the host cells via the action of the pore-forming toxin listeriolysin O (LLO). Expression of the LLO-encoding gene ( hly ) requires the transcriptional activator PrfA, and both hly and prfA genes are essential for L. monocytogenes virulence. Here, we used the hemolytic activity of LLO as a phenotypic marker to screen for spontaneous virulence-attenuating mutations in L. monocytogenes Sixty nonhemolytic isolates were identified among a collection of 57,820 confirmed L. monocytogenes strains isolated from a variety of sources (0.1%). In most cases (56/60; 93.3%), the nonhemolytic phenotype resulted from nonsense, missense, or frameshift mutations in prfA Five strains carried hly mutations leading to a single amino acid substitution (G299V) or a premature stop codon causing strong virulence attenuation in mice. In one strain, both hly and gshF (encoding a glutathione synthase required for full PrfA activity) were missing due to genomic rearrangements likely caused by a transposable element. The PrfA/LLO loss-of-function (PrfA - /LLO - ) mutants belonged to phylogenetically diverse clades of L. monocytogenes , and most were identified among nonclinical strains (57/60). Consistent with the rare occurrence of loss-of-virulence mutations, we show that prfA and hly are under purifying selection. Although occurring at a low frequency, PrfA - /LLO - mutational events in L. monocytogenes lead to niche restriction and open an evolutionary path for obligate saprophytism in this facultative intracellular pathogen. Copyright © 2017 Maury et al.

PRÉVALENCE DE LISTERIA MONOCYTOGENES DANS LE LAIT CRU DE VACHE AU LIBAN NORD

Directory of Open Access Journals (Sweden)

Imad al Kassaa

2016-06-01

Full Text Available Al Kassaa Imad, Khaled el Omari, Marwa Saati, Bachar Ismail and Monzer Hamze. 2016. Prevalence of Listeria monocytogenes in raw cow milk in north Lebanon. Lebanese Science Journal, 17(1: 39-45. Listeriosis, although a zoonosis, is an invasive disease that can affect newborns, pregnant women and immunocompromised adults. Clinical manifestations can be expressed by febrile gastroenteritis, invasive forms including severe sepsis, meningitis, rhombencephalitis, prenatal infections and abortions. Species of Listeria bacteria are ubiquitous and adaptable to the environment in animal and plant foods. This study aimed to determine the prevalence of Listeria monocytogenes in 100 samples of fresh cow milk collected from different areas of North Lebanon. Listeria monocytogenes was detected by using the Grand VIDAS technique (Biomérieux France. The results obtained revealed the absence of Listeria monocytogenes in all analyzed samples.

The Absence of a Mature Cell Wall Sacculus in Stable Listeria monocytogenes L-Form Cells Is Independent of Peptidoglycan Synthesis.

Science.gov (United States)

Studer, Patrick; Borisova, Marina; Schneider, Alexander; Ayala, Juan A; Mayer, Christoph; Schuppler, Markus; Loessner, Martin J; Briers, Yves

2016-01-01

L-forms are cell wall-deficient variants of otherwise walled bacteria that maintain the ability to survive and proliferate in absence of the surrounding peptidoglycan sacculus. While transient or unstable L-forms can revert to the walled state and may still rely on residual peptidoglycan synthesis for multiplication, stable L-forms cannot revert to the walled form and are believed to propagate in the complete absence of peptidoglycan. L-forms are increasingly studied as a fundamental biological model system for cell wall synthesis. Here, we show that a stable L-form of the intracellular pathogen Listeria monocytogenes features a surprisingly intact peptidoglycan synthesis pathway including glycosyl transfer, in spite of the accumulation of multiple mutations during prolonged passage in the cell wall-deficient state. Microscopic and biochemical analysis revealed the presence of peptidoglycan precursors and functional glycosyl transferases, resulting in the formation of peptidoglycan polymers but without the synthesis of a mature cell wall sacculus. In conclusion, we found that stable, non-reverting L-forms, which do not require active PG synthesis for proliferation, may still continue to produce aberrant peptidoglycan.

Listeria Monocytogenes Persistence in Ready-to-Eat Sausages and in Processing Plants.

Science.gov (United States)

Mureddu, Anna; Mazza, Roberta; Fois, Federica; Meloni, Domenico; Bacciu, Roberto; Piras, Francesca; Mazzette, Rina

2014-01-21

Listeria monocytogenes is of major concern in the fermented meat products and is able to persist in their processing environments. The aim of the present work was to evaluate the virulence profile and the persistence capacity of L. monocytogenes strains isolated in Sardinian fermented sausages processing plants. Food (ground meat, sausages at the end of acidification and ripening stage) and environmental samples (a total of n. 385), collected from 4 meat processing plants located in Sardinia (Italy), were examined to detect L. monocytogenes presence. All the L. monocytogenes isolates were identified by polymerase chain reaction (PCR) method. A subset of strains was also characterised by multiplex PCR-based serogrouping, using the lmo0737 , lmo1118 , ORF2819 and ORF2110 genes. Three different multiplex PCRs were used to obtain the virulence profiles by the rrn , hlyA , actA , prfA , inlA , inlB , iap , plcA , plcB and mpl marker genes. Furthermore, in vitro biofilm forming ability and resistance to disinfectants were carried out on microtiter plate. The overall prevalence was 31.5% in food, and 68.5% in environmental samples. The prevalent serotype resulted 1/2c (43%), followed by 1/2a (40%), 4b (8.6%), and 1/2b (8.6%). The amplification products of the virulence genes were found in all the isolates with the following prevalence: 77.1% hlyA ; 100% rrn ; 100% prfA ; 97.1% iap ; 65.7% inlB ; 88.6% inlA ; 100% plcA ; 100% plcB and 74.3% mpl . As for biofilm forming ability, 37.1% of the strains were positive and resulted weak producer, but all the isolates were sensible to disinfectants showing a reduction of L. monocytogenes growth after each incubation time. More appropriate technologies and application of measures of hygienic control should be implemented to prevent the L. monocytogenes growth and cross-contamination in salsiccia sarda processing plants.

Listeria monocytogenes persistence in ready-to-eat sausages and in processing plants

Directory of Open Access Journals (Sweden)

Anna Mureddu

2014-02-01

Full Text Available Listeria monocytogenes is of major concern in the fermented meat products and is able to persist in their processing environments. The aim of the present work was to evaluate the virulence profile and the persistence capacity of L. monocytogenes strains isolated in Sardinian fermented sausages processing plants. Food (ground meat, sausages at the end of acidification and ripening stage and environmental samples (a total of n. 385, collected from 4 meat processing plants located in Sardinia (Italy, were examined to detect L. monocytogenes presence. All the L. monocytogenes isolates were identified by polymerase chain reaction (PCR method. A subset of strains was also characterised by multiplex PCR-based serogrouping, using the lmo0737, lmo1118, ORF2819 and ORF2110 genes. Three different multiplex PCRs were used to obtain the virulence profiles by the rrn, hlyA, actA, prfA, inlA, inlB, iap, plcA, plcB and mpl marker genes. Furthermore, in vitro biofilm forming ability and resistance to disinfectants were carried out on microtiter plate. The overall prevalence was 31.5% in food, and 68.5% in environmental samples. The prevalent serotype resulted 1/2c (43%, followed by 1/2a (40%, 4b (8.6%, and 1/2b (8.6%. The amplification products of the virulence genes were found in all the isolates with the following prevalence: 77.1% hlyA; 100% rrn; 100% prfA; 97.1% iap; 65.7% inlB; 88.6% inlA; 100% plcA; 100% plcB and 74.3% mpl. As for biofilm forming ability, 37.1% of the strains were positive and resulted weak producer, but all the isolates were sensible to disinfectants showing a reduction of L. monocytogenes growth after each incubation time. More appropriate technologies and application of measures of hygienic control should be implemented to prevent the L. monocytogenes growth and crosscontamination in salsiccia sarda processing plants.

First Trimester Listeria monocytogenes Septicemia

NARCIS (Netherlands)

Goddijn, M.; Schipper, H. G.; Spanjaard, L.; Wolf, H.

1997-01-01

Background: Little is known about fetal outcome after Listeria monocytogenes septicemia in the first trimester of pregnancy.Case: A primigravida with L. monocytogenes septicemia at 9 weeks gestation was treated with amoxicillin. At 40 weeks gestation a healthy female infant was born.Conclusion: This

Listeria monocytogenes, a down-to-earth pathogen.

Science.gov (United States)

Vivant, Anne-Laure; Garmyn, Dominique; Piveteau, Pascal

2013-01-01

Listeria monocytogenes is the causative agent of the food-borne life threatening disease listeriosis. This pathogenic bacterium received much attention in the endeavor of deciphering the cellular mechanisms that underlie the onset of infection and its ability to adapt to the food processing environment. Although information is available on the presence of L. monocytogenes in many environmental niches including soil, water, plants, foodstuff and animals, understanding the ecology of L. monocytogenes in outdoor environments has received less attention. Soil is an environmental niche of pivotal importance in the transmission of this bacterium to plants and animals. Soil composition, microbial communities and macrofauna are extrinsic edaphic factors that direct the fate of L. monocytogenes in the soil environment. Moreover, farming practices may further affect its incidence. The genome of L. monocytogenes presents an extensive repertoire of genes encoding transport proteins and regulators, a characteristic of the genome of ubiquitous bacteria. Postgenomic analyses bring new insights in the process of soil adaptation. In the present paper focussing on soil, we review these extrinsic and intrinsic factors that drive environmental adaptation of L. monocytogenes.

Gamma irradiation as a means to eliminate Listeria monocytogenes from frozen chicken meat

International Nuclear Information System (INIS)

Kamat, A.S.; Nair, M.P.

1995-01-01

Cells of Listeria monocytogenes ATCC 35152 were sensitive to gamma irradiation in phosphate buffer, pH 7.00 (D 10 , dose required for 10% survival—0.15 kGy) at 0–5°C. The cells showed higher radiation survival when irradiated under frozen condition, with a D 10 of 0.3 kGy. The protection offered by shrimp/chicken/kheema homogenates (100 g litre−1) was evidenced by even higher D 10 values (0.5 kGy) at both 0–5°C and cryogenic temperature. Boneless chicken meat samples were artificially inoculated with L monocytogenes ATCC 35152 cells at low (5 × 10 3 ) colony-forming unit (cfu) g −1 and high (5 × 10 6 cfu g −1 ) concentrations and irradiated at 1, 3, 4, 6 kGy doses under cryogenic conditions. The efficacy of the radiation process was evaluated by detecting L monocytogenes during storage at 2–4°C in the irradiated samples. These studies, when repeated with three other serotypes of L monocytogenes, clearly suggested the need for a dose of 3 kGy for elimination of 10 3 cfu cells of L monocytogenes g −1 from air-packed frozen chicken meat. (author)

Novel Biocontrol Methods for Listeria monocytogenes Biofilms in Food Production Facilities.

Science.gov (United States)

Gray, Jessica A; Chandry, P Scott; Kaur, Mandeep; Kocharunchitt, Chawalit; Bowman, John P; Fox, Edward M

2018-01-01

High mortality and hospitalization rates have seen Listeria monocytogenes as a foodborne pathogen of public health importance for many years and of particular concern for high-risk population groups. Food manufactures face an ongoing challenge in preventing the entry of L. monocytogenes into food production environments (FPEs) due to its ubiquitous nature. In addition to this, the capacity of L. monocytogenes strains to colonize FPEs can lead to repeated identification of L. monocytogenes in FPE surveillance. The contamination of food products requiring product recall presents large economic burden to industry and is further exacerbated by damage to the brand. Poor equipment design, facility layout, and worn or damaged equipment can result in Listeria hotspots and biofilms where traditional cleaning and disinfecting procedures may be inadequate. Novel biocontrol methods may offer FPEs effective means to help improve control of L. monocytogenes and decrease cross contamination of food. Bacteriophages have been used as a medical treatment for many years for their ability to infect and lyse specific bacteria. Endolysins, the hydrolytic enzymes of bacteriophages responsible for breaking the cell wall of Gram-positive bacteria, are being explored as a biocontrol method for food preservation and in nanotechnology and medical applications. Antibacterial proteins known as bacteriocins have been used as alternatives to antibiotics for biopreservation and food product shelf life extension. Essential oils are natural antimicrobials formed by plants and have been used as food additives and preservatives for many years and more recently as a method to prevent food spoilage by microorganisms. Competitive exclusion occurs naturally among bacteria in the environment. However, intentionally selecting and applying bacteria to effect competitive exclusion of food borne pathogens has potential as a biocontrol application. This review discusses these novel biocontrol methods and their

Listeriolysin O Regulates the Expression of Optineurin, an Autophagy Adaptor That Inhibits the Growth of Listeria monocytogenes.

Science.gov (United States)

Puri, Madhu; La Pietra, Luigi; Mraheil, Mobarak Abu; Lucas, Rudolf; Chakraborty, Trinad; Pillich, Helena

2017-09-05

Autophagy, a well-established defense mechanism, enables the elimination of intracellular pathogens including Listeria monocytogenes . Host cell recognition results in ubiquitination of L . monocytogenes and interaction with autophagy adaptors p62/SQSTM1 and NDP52, which target bacteria to autophagosomes by binding to microtubule-associated protein 1 light chain 3 (LC3). Although studies have indicated that L . monocytogenes induces autophagy, the significance of this process in the infectious cycle and the mechanisms involved remain poorly understood. Here, we examined the role of the autophagy adaptor optineurin (OPTN), the phosphorylation of which by the TANK binding kinase 1 (TBK1) enhances its affinity for LC3 and promotes autophagosomal degradation, during L . monocytogenes infection. In LC3- and OPTN-depleted host cells, intracellular replicating L . monocytogenes increased, an effect not seen with a mutant lacking the pore-forming toxin listeriolysin O (LLO). LLO induced the production of OPTN. In host cells expressing an inactive TBK1, bacterial replication was also inhibited. Our studies have uncovered an OPTN-dependent pathway in which L . monocytogenes uses LLO to restrict bacterial growth. Hence, manipulation of autophagy by L . monocytogenes , either through induction or evasion, represents a key event in its intracellular life style and could lead to either cytosolic growth or persistence in intracellular vacuolar structures.

HrcA and DnaK are important for static and continuous flow biofilm formation and disinfectant resistance in Listeria monocytogenes

NARCIS (Netherlands)

Veen, van der S.; Abee, T.

2010-01-01

The food-borne pathogen Listeria monocytogenes is able to form biofilms in food processing environments. Since biofilms are generally difficult to eradicate during clean-up procedures, they pose a major risk for the food industry. Stress resistance mechanisms involved in L. monocytogenes biofilm

The virulence regulator PrfA promotes biofilm formation by Listeria monocytogenes.

Science.gov (United States)

Lemon, Katherine P; Freitag, Nancy E; Kolter, Roberto

2010-08-01

Listeria monocytogenes is a food-borne facultative intracellular pathogen. It is widespread in the environment and has several distinct life-styles. The key transcriptional activator PrfA positively regulates L. monocytogenes virulence genes to mediate the transition from extracellular, flagellum-propelled cell to intracellular pathogen. Here we report the first evidence that PrfA also has a significant positive impact on extracellular biofilm formation. Mutants lacking prfA were defective in surface-adhered biofilm formation. The DeltaprfA mutant exhibited wild-type flagellar motility, and its biofilm defect occurred after initial surface adhesion. We also observed that mutations that led to the constitutive expression of PrfA-dependent virulence genes had a minimal impact on biofilm formation. Furthermore, biofilm development was enhanced in a mutant encoding a PrfA protein variant unable to fully transition from the extracellular form to the virulent, intracellular activity conformation. These results indicate that PrfA positively regulates biofilm formation and suggest that PrfA has a global role in modulating the life-style of L. monocytogenes. The requirement of PrfA for optimal biofilm formation may provide selective pressure to maintain this critical virulence regulator when L. monocytogenes is outside host cells in the environment.

Novel Cadmium Resistance Determinant in Listeria monocytogenes.

Science.gov (United States)

Parsons, Cameron; Lee, Sangmi; Jayeola, Victor; Kathariou, Sophia

2017-03-01

tolerate toxic compounds, such as heavy metals. Here, we characterized a novel determinant that was recently identified on a larger mobile genetic island through whole-genome sequencing. This gene ( cadA4 ) was found to be responsible for cadmium detoxification and to be a divergent member of the Cad family of cadmium efflux pumps. Virulence assessments in a Galleria mellonella model suggested that cadA4 may suppress virulence. Additionally, cadA4 may be involved in the ability of Listeria to form biofilms. Beyond the role in cadmium detoxification, the involvement of cadA4 in other cellular functions potentially explains its retention and wide distribution in L. monocytogenes . Copyright © 2017 American Society for Microbiology.

Aggregation activity of blood formed elements in patients with type 1 and type 2 diabetes mellitus

Directory of Open Access Journals (Sweden)

Boris Il'ich Kuznik

2012-06-01

Full Text Available Aims. To assess differences in blood formed elements aggregation activity in patients with type 1 (T1 and type 2 (T2 diabetes mellitus(DM. Materials and methods. We studied blood samples from 88 patients with T1 and T2 DM. Platelet aggregation activity was assessed bymeans of ?Biola? aggregometer; we also determined platelet-lymphocyte and leucocyte-erythrocyte adhesion intensity. Results. We show that spontaneous platelet aggregation is markedly increased in patients with T1DM but remains normal or slightlyelevated in case of T2DM. In blood from patients with T2DM platelet aggregation in response to ADP, epinephrine, ristomycineand contact with collagen was generally increased, whereas in T1DM we often observed its secondary reduction. Data on plateletlymphocyteadhesion in T1DM is controversial, but in T2DM this process seems to be significantly suppressed. Quantity of leucocyteerythrocyteaggregates was sharply increased in both T1DM and T2DM. Conclusion. We've determined significant difference in blood formed elements aggregation activity between patients with T1 and T2 DM.

Glycerol metabolism induces Listeria monocytogenes biofilm formation at the air-liquid interface.

Science.gov (United States)

Crespo Tapia, Natalia; den Besten, Heidy M W; Abee, Tjakko

2018-05-20

Listeria monocytogenes is a food-borne pathogen that can grow as a biofilm on surfaces. Biofilm formation in food-processing environments is a big concern for food safety, as it can cause product contamination through the food-processing line. Although motile aerobic bacteria have been described to form biofilms at the air-liquid interface of cell cultures, to our knowledge, this type of biofilm has not been described in L. monocytogenes before. In this study we report L. monocytogenes biofilm formation at the air-liquid interface of aerobically grown cultures, and that this phenotype is specifically induced when the media is supplemented with glycerol as a carbon and energy source. Planktonic growth, metabolic activity assays and HPLC measurements of glycerol consumption over time showed that glycerol utilization in L. monocytogenes is restricted to growth under aerobic conditions. Gene expression analysis showed that genes encoding the glycerol transporter GlpF, the glycerol kinase GlpK and the glycerol 3-phosphate dehydrogenase GlpD were upregulated in the presence of oxygen, and downregulated in absence of oxygen. Additionally, motility assays revealed the induction of aerotaxis in the presence of glycerol. Our results demonstrate that the formation of biofilms at the air-liquid interface is dependent on glycerol-induced aerotaxis towards the surface of the culture, where L. monocytogenes has access to higher concentrations of oxygen, and is therefore able to utilize this compound as a carbon source. Copyright © 2018 Elsevier B.V. All rights reserved.

On Hesitant Fuzzy Reducible Weighted Bonferroni Mean and Its Generalized Form for Multicriteria Aggregation

Directory of Open Access Journals (Sweden)

Wei Zhou

2014-01-01

Full Text Available Due to convenience and powerfulness in dealing with vagueness and uncertainty of real situation, hesitant fuzzy set has received more and more attention and has been a hot research topic recently. To differently process and effectively aggregate hesitant fuzzy information and capture their interrelationship, in this paper, we propose the hesitant fuzzy reducible weighted Bonferroni mean (HFRWBM and present its four prominent characteristics, namely, reductibility, monotonicity, boundedness, and idempotency. Then, we further investigate its generalized form, that is, the generalized hesitant fuzzy reducible weighted Bonferroni mean (GHFRWBM. Based on the discussion of model parameters, some special cases of the HFRWBM and GHFRWBM are studied in detail. In addition, to deal with the situation that multicriteria have connections in hesitant fuzzy information aggregation, a three-step aggregation approach has been proposed on the basis of the HFRWBM and GHFRWBM. In the end, we apply the proposed aggregation operators to multicriteria aggregation and give an example to illustrate our results.

Occurrence of Listeria monocytogenes in smoked fish in Sokoto ...

African Journals Online (AJOL)

STORAGESEVER

2008-09-03

Sep 3, 2008 ... monocytogenes and other Listeria species are common contaminant of smoked fish, and this may pose serious public health implications. Key words: Smoked fish, Listeria monocytogenes, contamination, public health. INTRODUCTION ... L. monocytogenes belong to the recently emerging psychrotrophic ...

Listeria monocytogenes infection in pregnancy and neonatal sepsis

Directory of Open Access Journals (Sweden)

Francesca Pascale

2008-06-01

Full Text Available Authors report a fatal neonatal sepsis caused by Listeria monocytogenes. While the diagnostic procedure aimed to identify the microrganism is described, it is emphasized the importance to recover Streptococcus agalactiae (GBS and L. monocytogenes by means of vaginal-rectal swab culture. The intrapartum screening for L. monocytogenes, by Polymerase Chain Reaction (PCR providing results in 75 minutes is also evaluated.

Listeria monocytogenes - Danger for health safety vegetable production.

Science.gov (United States)

Kljujev, Igor; Raicevic, Vera; Jovicic-Petrovic, Jelena; Vujovic, Bojana; Mirkovic, Milica; Rothballer, Michael

2018-04-22

The microbiologically contaminated vegetables represent a risk for consumers, especially vegetables without thermal processing. It is known that human pathogen bacteria, such as Listeria monocytogenes, could exist on fresh vegetables. The fresh vegetables could become Listeria-contaminated if they come in touch with contaminated soil, manure, irrigation water. The aim of this work was to investigate the presence of Listeria spp. and L. monocytogenes in different kind of vegetables grown in field and greenhouse condition as well as surface and endophytic colonization plant roots of different vegetables species by L. monocytogenes in laboratory conditions. The detection of Listeria spp. and L. monocytogenes in vegetable samples was done using ISO and PCR methods. The investigation of colonization vegetable roots and detection Listeria-cells inside plant root tissue was done using Fluorescence in situ hybridization (FISH) method in combination with confocal laser scanning microscopy (CLSM). The results showed that 25.58% vegetable samples were positive for Listeria spp. and only one sample (carrot) was positive for L. monocytogenes out of 43 samples in total collected from field and greenhouse. The strain L. monocytogenes EGD-E surface and endophytic colonized carrot root in highest degree while strain L. monocytogenes SV4B was the most represented at leafy vegetable plants, such at lettuce (1.68 × 10 6  cells/mm 3 absolutely dry root) and spinach (1.39 × 10 6  cells/mm 3 absolutely dry root) root surface. The cells of L. monocytogenes SV4B were visible as single cells in interior tissue of plant roots (celery and sweet corn roots) as well as in the interior of the plant root cell at sweet corn root. The cells of L. monocytogenes EGD-E bind to the surface of the plant root and they were less commonly found out on root hair. In the inner layers of the root, those bacterial cells were inhabited intercellular spaces mainly as single cells very close to the

Diarrhea-associated biofilm formed by enteroaggregative Escherichia coli and aggregative Citrobacter freundii: a consortium mediated by putative F pili

Directory of Open Access Journals (Sweden)

Araújo Ana CG

2010-02-01

Full Text Available Abstract Background Enteroaggregative Escherichia coli (EAEC are enteropathogenic strains identified by the aggregative adhesion (AA pattern that share the capability to form biofilms. Citrobacter freundii is classically considered as an indigenous intestinal species that is sporadically associated with diarrhea. Results During an epidemiologic study focusing on infantile diarrhea, aggregative C. freundii (EACF and EAEC strains were concomitantly recovered from a severe case of mucous diarrhea. Thereby, the occurrence of synergic events involving these strains was investigated. Coinfection of HeLa cells with EACF and EAEC strains showed an 8-fold increase in the overall bacterial adhesion compared with single infections (P traA were capable of forming bacterial aggregates only in the presence of EACF. Scanning electronic microscopy analyses revealed that bacterial aggregates as well as enhanced biofilms formed by EACF and traA-positive EAEC were mediated by non-bundle forming, flexible pili. Moreover, mixed biofilms formed by EACF and traA-positive EAEC strains were significantly reduced using nonlethal concentration of zinc, a specific inhibitor of F pili. In addition, EAEC strains isolated from diarrheic children frequently produced single biofilms sensitive to zinc. Conclusions Putative F pili expressed by EAEC strains boosted mixed biofilm formation when in the presence of aggregative C. freundii.

Biofilm formation by Listeria monocytogenes on stainless steel surface and biotransfer potential

Directory of Open Access Journals (Sweden)

Maíra Maciel Mattos de Oliveira

2010-03-01

Full Text Available An experimental model was proposed to study biofilm formation by Listeria monocytogenes ATCC 19117 on AISI 304 (#4 stainless steel surface and biotransfer potential during this process. In this model, biofilm formation was conducted on the surface of stainless steel coupons, set on a stainless steel base with 4 divisions, each one supporting 21 coupons. Trypic Soy Broth was used as bacterial growth substrate, with incubation at 37 ºC and stirring of 50 rpm. The number of adhered cells was determined after 3, 48, 96, 144, 192 and 240 hours of biofilm formation and biotransfer potential from 96 hours. Stainless steel coupons were submitted to Scanning Electron Microscopy (SEM after 3, 144 and 240 hours. Based on the number of adhered cells and SEM, it was observed that L. monocytogenes adhered rapidly to the stainless steel surface, with mature biofilm being formed after 240 hours. The biotransfer potential of bacterium to substrate occurred at all the stages analyzed. The rapid capacity of adhesion to surface, combined with biotransfer potential throughout the biofilm formation stages, make L. monocytogenes a potential risk to the food industry. Both the experimental model developed and the methodology used were efficient in the study of biofilm formation by L. monocytogenes on stainless steel surface and biotransfer potential.

Biofilm formation by Listeria monocytogenes on stainless steel surface and biotransfer potential.

Science.gov (United States)

de Oliveira, Maíra Maciel Mattos; Brugnera, Danilo Florisvaldo; Alves, Eduardo; Piccoli, Roberta Hilsdorf

2010-01-01

An experimental model was proposed to study biofilm formation by Listeria monocytogenes ATCC 19117 on AISI 304 (#4) stainless steel surface and biotransfer potential during this process. In this model, biofilm formation was conducted on the surface of stainless steel coupons, set on a stainless steel base with 4 divisions, each one supporting 21 coupons. Trypic Soy Broth was used as bacterial growth substrate, with incubation at 37 °C and stirring of 50 rpm. The number of adhered cells was determined after 3, 48, 96, 144, 192 and 240 hours of biofilm formation and biotransfer potential from 96 hours. Stainless steel coupons were submitted to Scanning Electron Microscopy (SEM) after 3, 144 and 240 hours. Based on the number of adhered cells and SEM, it was observed that L. monocytogenes adhered rapidly to the stainless steel surface, with mature biofilm being formed after 240 hours. The biotransfer potential of bacterium to substrate occurred at all the stages analyzed. The rapid capacity of adhesion to surface, combined with biotransfer potential throughout the biofilm formation stages, make L. monocytogenes a potential risk to the food industry. Both the experimental model developed and the methodology used were efficient in the study of biofilm formation by L. monocytogenes on stainless steel surface and biotransfer potential.

Aggregation activity of blood formed elements in patients with type 1 and type 2 diabetes mellitus

OpenAIRE

Boris Il'ich Kuznik; Yuriy Antonovich Vitkovskiy; Marina Yur'evna Zakharova; Natal'ya Nikolaevna Klyuchereva; Ol'ga Sergeevna Rodnina; Aleksey Vladimirovich Solpov

2012-01-01

Aims. To assess differences in blood formed elements aggregation activity in patients with type 1 (T1) and type 2 (T2) diabetes mellitus (DM). Materials and methods. We studied blood samples from 88 patients with T1 and T2 DM. Platelet aggregation activity was assessed by means of «Biola» aggregometer; we also determined platelet-lymphocyte and leucocyte-erythrocyte adhesion intensity. Results. We show that spontaneous platelet aggregation is markedly increased in patients with T1...

78 FR 27939 - Draft Interagency Risk Assessment-Listeria monocytogenes

Science.gov (United States)

2013-05-13

... Listeria (L.) monocytogenes contamination of certain ready-to-eat (RTE) foods, for example cheese, deli... Scott, V.N., Survey of Listeria monocytogenes in ready-to-eat foods. Journal of Food Protection, 2003... monocytogenes in ready-to-eat processed meat and poultry collected in four FoodNet states in International...

Presence of Listeria monocytogenes in Mediterranean-Style Dry Fermented Sausages

Directory of Open Access Journals (Sweden)

Domenico Meloni

2015-03-01

Full Text Available The morphological, physiological and epidemiological features of L. monocytogenes, together with the severity of human listeriosis infections, make L. monocytogenes of particular concern for manufacturers of cold-stored “ready to eat” (RTE foods. L. monocytogenes has been isolated from a wide variety of RTE foods and is responsible for several outbreaks associated with the consumption of RTE meat, poultry, dairy, fish and vegetable products. Although L. monocytogenes is among the most frequently-detected pathogens in dry fermented sausages, these products could be included in the category of RTE products in which the growth of L. monocytogenes is not favored and have rarely been implicated in listeriosis outbreaks. However, L. monocytogenes is highly difficult to control in fermented sausage processing environments due to its high tolerance to low pH and high salt concentration. In many Mediterranean-style dry fermented sausages, an empirical application of the hurdle technology often occurs and the frequent detection of L. monocytogenes in these products at the end of ripening highlights the need for food business operators to properly apply hurdle technology and to control the contamination routes of L. monocytogenes in the processing plants. In the following, through an up-to-date review of (personal and un- published data, the main aspects of the presence of L. monocytogenes in Mediterranean-style dry fermented sausages will be discussed.

Presence of Listeria monocytogenes in Mediterranean-Style Dry Fermented Sausages.

Science.gov (United States)

Meloni, Domenico

2015-03-12

The morphological, physiological and epidemiological features of L. monocytogenes , together with the severity of human listeriosis infections, make L. monocytogenes of particular concern for manufacturers of cold-stored "ready to eat" (RTE) foods. L. monocytogenes has been isolated from a wide variety of RTE foods and is responsible for several outbreaks associated with the consumption of RTE meat, poultry, dairy, fish and vegetable products. Although L. monocytogenes is among the most frequently-detected pathogens in dry fermented sausages, these products could be included in the category of RTE products in which the growth of L. monocytogenes is not favored and have rarely been implicated in listeriosis outbreaks. However, L. monocytogenes is highly difficult to control in fermented sausage processing environments due to its high tolerance to low pH and high salt concentration. In many Mediterranean-style dry fermented sausages, an empirical application of the hurdle technology often occurs and the frequent detection of L. monocytogenes in these products at the end of ripening highlights the need for food business operators to properly apply hurdle technology and to control the contamination routes of L. monocytogenes in the processing plants. In the following, through an up-to-date review of (personal and un-) published data, the main aspects of the presence of L. monocytogenes in Mediterranean-style dry fermented sausages will be discussed.

Recombinant Expression of a Genome-encoded N-acetylmuramoyl-L-alanine Amidase that Synergistically Lyses Listeria monocytogenes Biofilms with a Protease

Science.gov (United States)

Listeria monocytogenes plays a significant role in human food-borne disease caused by eating food contaminated with the bacterium and although incidence is low it is a leading cause of life-threatening, bacterial food-borne disease in humans. L. monocytogenes serotypes 1/2a and 4b can form mixed-cu...

Incorporation of Listeria monocytogenes strains in raw milk biofilms.

Science.gov (United States)

Weiler, Christiane; Ifland, Andrea; Naumann, Annette; Kleta, Sylvia; Noll, Matthias

2013-02-01

Biofilms develop successively on devices of milk production without sufficient cleaning and originate from the microbial community of raw milk. The established biofilm matrices enable incorporation of pathogens like Listeria monocytogenes, which can cause a continuous contamination of food processing plants. L. monocytogenes is frequently found in raw milk and non-pasteurized raw milk products and as part of a biofilm community in milk meters and bulk milk tanks. The aim of this study was to analyze whether different L. monocytogenes strains are interacting with the microbial community of raw milk in terms of biofilm formation in the same manner, and to identify at which stage of biofilm formation a selected L. monocytogenes strain settles best. Bacterial community structure and composition of biofilms were analyzed by a cloning and sequencing approach and terminal restriction fragment length polymorphism analysis (T-RFLP) based on the bacterial 16S rRNA gene. The chemical composition of biofilms was analyzed by Fourier transform infrared spectroscopy (FTIR), while settled L. monocytogenes cells were quantified by fluorescence in situ hybridization (FISH). Addition of individual L. monocytogenes strains to raw milk caused significant shifts in the biofilm biomass, in the chemical as well as in the bacterial community composition. Biofilm formation and attachment of L. monocytogenes cells were not serotype but strain specific. However, the added L. monocytogenes strains were not abundant since mainly members of the genera Citrobacter and Lactococcus dominated the bacterial biofilm community. Overall, added L. monocytogenes strains led to a highly competitive interaction with the raw milk community and triggered alterations in biofilm formation. Copyright © 2012 Elsevier B.V. All rights reserved.

Listeria monocytogenes as a vector for anti-cancer therapies.

LENUS (Irish Health Repository)

Tangney, Mark

2012-01-31

The intracellular pathogen Listeria monocytogenes represents a promising therapeutic vector for the delivery of DNA, RNA or protein to cancer cells or to prime immune responses against tumour-specific antigens. A number of biological properties make L. monocytogenes a promising platform for development as a vector for either gene therapy or as an anti-cancer vaccine vector. L. monocytogenes is particularly efficient in mediating internalization into host cells. Once inside cells, the bacterium produces specific virulence factors which lyse the vaculolar membrane and allow escape into the cytoplasm. Once in the cytosol, L. monocytogenes is capable of actin-based motility and cell-to-cell spread without an extracellular phase. The cytoplasmic location of L. monocytogenes is significant as this potentiates entry of antigens into the MHC Class I antigen processing pathway leading to priming of specific CD8(+) T cell responses. The cytoplasmic location is also beneficial for the delivery of DNA (bactofection) by L. monocytogenes whilst cell-to-cell spread may facilitate access of the vector to cells throughout the tumour. Several preclinical studies have demonstrated the ability of L. monocytogenes for intracellular gene or protein delivery in vitro and in vivo, and this vector has also displayed safety and efficacy in clinical trial. Here, we review the features of the L. monocytogenes host-pathogen interaction that make this bacterium such an attractive candidate with which to induce appropriate therapeutic responses. We focus primarily upon work that has led to attenuation of the pathogen, demonstrated DNA, RNA or protein delivery to tumour cells as well as research that shows the efficacy of L. monocytogenes as a vector for tumour-specific vaccine delivery.

Prevalence and growth of Listeria monocytogenes in naturally contaminated seafood

DEFF Research Database (Denmark)

Jørgensen, Lasse Vigel; Huss, Hans Henrik

1998-01-01

Listeria monocytogenes contamination of seafood varies with product category. The highest prevalence was found in cold- smoked fish (34-60%), while the lowest was found in heat- treated and cured seafood (4-12%). The prevalence of L. monocytogenes differed greatly in cold-smoked salmon between...... production sites, ranging from monocytogenes. The organism showed moderate growth...... in naturally contaminated cold-smoked, and 'gravad', fish while the growth appeared faster in hot smoked fish. Thus L. monocytogenes is not under control in these products. Finally, the prevalence and growth of L. monocytogenes in naturally contaminated cold-smoked salmon are discussed in relation...

Listeria monocytogenes endophthalmitis following keratoconjunctivitis

Directory of Open Access Journals (Sweden)

Shoughy SS

2014-01-01

Full Text Available Samir S Shoughy,1 Khalid F Tabbara1–31The Eye Center and The Eye Foundation for Research in Ophthalmology, Riyadh, Saudi Arabia; 2Department of Ophthalmology, College of Medicine, King Saud University, Riyadh, Saudi Arabia; 3The Wilmer Ophthalmological Institute of The Johns Hopkins University School of Medicine, Baltimore, MD, USAAbstract: Endophthalmitis due to endogenous or exogenous bacteria is a rare infection of the eye. We report a case of endophthalmitis following Listeria monocytogenes keratoconjunctivitis in a 27-year-old healthy white male presenting with hand motion visual acuity, right eye mucopurulent conjunctivitis, elevated intraocular pressure, and pigmented hypopyon 6 months post-keratectomy. The conjunctivitis was unresponsive to a 5-day course of topical tobramycin eye drops, and the patient developed keratitis with pain that progressed to endophthalmitis after 21 days. Diagnostic B-scan revealed vitreous exudates. Intraocular fluid specimen showed Gram-positive organisms and the aqueous culture grew penicillin-/aminoglycoside-sensitive L. monocytogenes. The patient was given intravitreal and systemic vancomycin and ceftazidime. The eye was unresponsive to intravenous penicillin and gentamicin; the anterior chamber progressively flattened and developed phthisis bulbi. L. monocytogenes keratoconjunctivitis may lead to bacterial endophthalmitis. Prompt culture and early antibiotic therapy are recommended.Keywords: conjunctivitis, L. monocytogenes, endophthalmitis

Novel Biocontrol Methods for Listeria monocytogenes Biofilms in Food Production Facilities

Directory of Open Access Journals (Sweden)

Jessica A. Gray

2018-04-01

Full Text Available High mortality and hospitalization rates have seen Listeria monocytogenes as a foodborne pathogen of public health importance for many years and of particular concern for high-risk population groups. Food manufactures face an ongoing challenge in preventing the entry of L. monocytogenes into food production environments (FPEs due to its ubiquitous nature. In addition to this, the capacity of L. monocytogenes strains to colonize FPEs can lead to repeated identification of L. monocytogenes in FPE surveillance. The contamination of food products requiring product recall presents large economic burden to industry and is further exacerbated by damage to the brand. Poor equipment design, facility layout, and worn or damaged equipment can result in Listeria hotspots and biofilms where traditional cleaning and disinfecting procedures may be inadequate. Novel biocontrol methods may offer FPEs effective means to help improve control of L. monocytogenes and decrease cross contamination of food. Bacteriophages have been used as a medical treatment for many years for their ability to infect and lyse specific bacteria. Endolysins, the hydrolytic enzymes of bacteriophages responsible for breaking the cell wall of Gram-positive bacteria, are being explored as a biocontrol method for food preservation and in nanotechnology and medical applications. Antibacterial proteins known as bacteriocins have been used as alternatives to antibiotics for biopreservation and food product shelf life extension. Essential oils are natural antimicrobials formed by plants and have been used as food additives and preservatives for many years and more recently as a method to prevent food spoilage by microorganisms. Competitive exclusion occurs naturally among bacteria in the environment. However, intentionally selecting and applying bacteria to effect competitive exclusion of food borne pathogens has potential as a biocontrol application. This review discusses these novel biocontrol

Novel Biocontrol Methods for Listeria monocytogenes Biofilms in Food Production Facilities

Science.gov (United States)

Gray, Jessica A.; Chandry, P. Scott; Kaur, Mandeep; Kocharunchitt, Chawalit; Bowman, John P.; Fox, Edward M.

2018-01-01

High mortality and hospitalization rates have seen Listeria monocytogenes as a foodborne pathogen of public health importance for many years and of particular concern for high-risk population groups. Food manufactures face an ongoing challenge in preventing the entry of L. monocytogenes into food production environments (FPEs) due to its ubiquitous nature. In addition to this, the capacity of L. monocytogenes strains to colonize FPEs can lead to repeated identification of L. monocytogenes in FPE surveillance. The contamination of food products requiring product recall presents large economic burden to industry and is further exacerbated by damage to the brand. Poor equipment design, facility layout, and worn or damaged equipment can result in Listeria hotspots and biofilms where traditional cleaning and disinfecting procedures may be inadequate. Novel biocontrol methods may offer FPEs effective means to help improve control of L. monocytogenes and decrease cross contamination of food. Bacteriophages have been used as a medical treatment for many years for their ability to infect and lyse specific bacteria. Endolysins, the hydrolytic enzymes of bacteriophages responsible for breaking the cell wall of Gram-positive bacteria, are being explored as a biocontrol method for food preservation and in nanotechnology and medical applications. Antibacterial proteins known as bacteriocins have been used as alternatives to antibiotics for biopreservation and food product shelf life extension. Essential oils are natural antimicrobials formed by plants and have been used as food additives and preservatives for many years and more recently as a method to prevent food spoilage by microorganisms. Competitive exclusion occurs naturally among bacteria in the environment. However, intentionally selecting and applying bacteria to effect competitive exclusion of food borne pathogens has potential as a biocontrol application. This review discusses these novel biocontrol methods and their

Multifaceted Activity of Listeriolysin O, the Cholesterol-Dependent Cytolysin of Listeria monocytogenes

Science.gov (United States)

2014-01-01

The cholesterol-dependent cytolysins (CDCs) are a large family of pore-forming toxins that are produced by numerous Gram-positive bacterial pathogens. These toxins are released in the extracellular environment as water-soluble monomers or dimers that bind to cholesterol-rich membranes and assemble into large pore complexes. Depending upon their concentration, the nature of the host cell and membrane (cytoplasmic or intracellular) they target, the CDCs can elicit many different cellular responses. Among the CDCs, listeriolysin O (LLO), which is a major virulence factor of the facultative intracellular pathogen Listeria monocytogenes, is involved in several stages of the intracellular lifecycle of the bacterium and displays unique characteristics. It has long been known that following L. monocytogenes internalization into host cells, LLO disrupts the internalization vacuole, enabling the bacterium to replicate into the host cell cytosol. LLO is then used by cytosolic bacteria to spread from cell to cell, avoiding bacterial exposure to the extracellular environment. Although LLO is continuously produced during the intracellular lifecycle of L. monocytogenes, several processes limit its toxicity to ensure the survival of infected cells. It was previously thought that LLO activity was limited to mediating vacuolar escape during bacterial entry and cell to cell spreading. This concept has been challenged by compelling evidence suggesting that LLO secreted by extracellular L. monocytogenes perforates the host cell plasma membrane, triggering important host cell responses. This chapter provides an overview of the well-established intracellular activity of LLO and the multiple roles attributed to LLO secreted by extracellular L. monocytogenes. PMID:24798012

Listeria monocytogenes contamination in dairy plants: evaluation of Listeria monocytogenes environmental contamination in two cheese-making plants using sheeps milk

Directory of Open Access Journals (Sweden)

Michela Ibba

2013-09-01

Full Text Available Listeria monocytogenes harbouring niches established in the processing plant support post-process contamination of dairy products made from pasteurised or thermised milk. The present study investigated L. monocytogenes environmental contamination in two sheep’s milk cheese-making plants. Persistence of contamination in the area at higher risk was also investigated. During a one-year survey 7 samplings were carried out in each dairy plant, along the production lines of Pecorino Romano and ricotta salata cheese. A total of 613 environmental samples collected from food contact and non-food contact surfaces were analysed according to ISO 11290-1:2005 standard method. Identification of the isolated strains was carried out by polymerase chain reaction. L. monocytogenes prevalence was 23.2% in dairy A and 13.1% in dairy B, respectively. The higher prevalence rate was found in the following areas: salting, products washing, packaging, ricotta salata storage and Pecorino Romano ripening rooms. L. monocytogenes was never found in the cheese-making area. The probability of observing samples positive for the presence of L. monocytogenes was asso- ciated with dairy plant, sampling area and the period of cheese-making (P<0.001. The greater persistence of contamination over time was observed in the washing, salting, and Pecorino Romano ripening areas. The control of persistent environmental contamination relies on the identification of L. monocytogenes niches within the processing environment and the prevention of harborage sites formation. The importance of strict cleaning and sanitising procedure in controlling L. monocytogenes environmental contamination is confirmed by the lower level of contamination observed after these procedures were correctly implemented.

Listeria monocytogenes endophthalmitis following keratoconjunctivitis.

Science.gov (United States)

Shoughy, Samir S; Tabbara, Khalid F

2014-01-01

Endophthalmitis due to endogenous or exogenous bacteria is a rare infection of the eye. We report a case of endophthalmitis following Listeria monocytogenes keratoconjunctivitis in a 27-year-old healthy white male presenting with hand motion visual acuity, right eye mucopurulent conjunctivitis, elevated intraocular pressure, and pigmented hypopyon 6 months post-keratectomy. The conjunctivitis was unresponsive to a 5-day course of topical tobramycin eye drops, and the patient developed keratitis with pain that progressed to endophthalmitis after 21 days. Diagnostic B-scan revealed vitreous exudates. Intraocular fluid specimen showed Gram-positive organisms and the aqueous culture grew penicillin-/aminoglycoside-sensitive L. monocytogenes. The patient was given intravitreal and systemic vancomycin and ceftazidime. The eye was unresponsive to intravenous penicillin and gentamicin; the anterior chamber progressively flattened and developed phthisis bulbi. L. monocytogenes keratoconjunctivitis may lead to bacterial endophthalmitis. Prompt culture and early antibiotic therapy are recommended.

Changes in growth, rRNA content, and cell morphology of Listeria monocytogenes induced by CO2 up- and downshift

DEFF Research Database (Denmark)

Jydegaard-Axelsen, A.M.; Aaes-Jorgensen, A.; Koch, A.G.

2005-01-01

Cell morphology, rRNA content, and growth were examined for Listeria monocytogenes LO28 and EGD, respectively, grown in brain-heart infusion (BHI) and on slices of sausage at 10degreesC in 100% CO2, 100% N-2, and air. In CO2, filamentous cells were formed by both strains on sausage slices and by L...... units under circumstances where filamentation may occur. Furthermore, the study illustrates the lack of residual inhibitory effect of CO2 in this type of products after opening....... in air and CO2.. Septation and cell division were induced in the filaments after a CO2 downshift (i.e., exposure to air). In BHI, the number of colony forming units increased rapidly when L. monocytogenes EGD grown in CO2 was exposed to air whereas the number of L. monocytogenes LO28 remained almost...

Listeria monocytogenes alters mast cell phenotype, mediator and osteopontin secretion in a listeriolysin-dependent manner.

Directory of Open Access Journals (Sweden)

Catherine E Jobbings

Full Text Available Whilst mast cells participate in the immune defence against the intracellular bacterium Listeria monocytogenes, there is conflicting evidence regarding the ability of L. monocytogenes to infect mast cells. It is known that the pore-forming toxin listeriolysin (LLO is important for mast cell activation, degranulation and the release of pro-inflammatory cytokines. Mast cells, however, are a potential source of a wide range of cytokines, chemokines and other mediators including osteopontin, which contributes to the clearing of L. monocytogenes infections in vivo, although its source is unknown. We therefore aimed to resolve the controversy of mast cell infection by L. monocytogenes and investigated the extent of mediator release in response to the bacterium. In this paper we show that the infection of bone marrow-derived mast cells by L. monocytogenes is inefficient and LLO-independent. LLO, however, is required for calcium-independent mast cell degranulation as well as for the transient and selective downregulation of cell surface CD117 (c-kit on mast cells. We demonstrate that in addition to the key pro-inflammatory cytokines TNF-α and IL-6, mast cells release a wide range of other mediators in response to L. monocytogenes. Osteopontin, IL-2, IL-4, IL-13 and granulocyte macrophage colony-stimulating factor (GM-CSF, and chemokines including CCL2, CCL3, CCL4 and CCL5 are released in a MyD88-dependent manner. The wide range of mediators released by mast cells in response to L. monocytogenes may play an important role in the recruitment and activation of a variety of immune cells in vivo. The cocktail of mediators, however, is unlikely to skew the immune response to a particular effector response. We propose that mast cells provide a hitherto unreported source of osteopontin, and may provide an important role in co-ordinating the immune response during Listeria infection.

Listeria monocytogenes Monographic Study

Directory of Open Access Journals (Sweden)

Emil Tirziu

2010-05-01

Full Text Available Listeria monocytogenes is a ubiquitous bacteria with a remarkable resistance in discordant condition which produce listeriosis, an infectious disease that affects multiple domestic and wild animals’ species, but also humans. Receptive to listeriosis are the majority of domestic or wild mammals and birds, in the last years being registered an increase of receptivity in humans. The concept of listeriosis in human pathology, a disease caused by eating or drinking contaminated food and water, appeared for the first time in 1981, during an outbreak in Canada with seven cases in adults and 34 cases of maternalfetal listeriosis. The alimentary origin of human listeriosis can be easily explained if considered some general characteristics of the bacteria. Thus, resistance in various conditions, especially at lower temperatures, justifies its dissemination and food contamination, particularly when is conserved by refrigeration. Also, L. monocytogenes has a significant presence in alimentary products. Some studies showed that 4% of the milk products, 29% of the meat products, 5% of the vegetable products and 26% of the products obtained from fishes and shell fishes are positive for L. monocytogenes, which allows us to say that battle against these bacteria is a war against microbial contamination.

Listeria monocytogenes associated kerato-conjunctivitis in four horses in Norway.

Science.gov (United States)

Revold, Tobias; Abayneh, Takele; Brun-Hansen, Hege; Kleppe, Signe L; Ropstad, Ernst-Otto; Hellings, Robert A; Sørum, Henning

2015-11-09

Listeria monocytogenes has been reported to cause various infectious diseases in both humans and animals. More rarely, ocular infections have been reported. To our knowledge, only two cases of Listeria keratitis have been described in horses. We report kerato-conjunctivitis in four Norwegian horses associated with L. monocytogenes. Clinically, all cases were presented with recurrent unilateral kerato-conjunctivitis. L. monocytogenes bacteria were isolated from swab samples from all cases, and cytology carried out in 3 cases was indicative of L. monocytogenes infection. The present report describes the first known cases in which L. monocytogenes has been isolated from keratitic lesions in horses in Norway. A potential risk factor may be feeding of silage or haylage, but other sources of infection cannot be ruled out. The phenotypic features including antimicrobial susceptibility and serotype of the isolates are described. Laboratory detection of L. monocytogenes demands extra caution since only low numbers of bacteria were detected in the eye-swabs, probably due to the low volume of sample material and the intracellular niche of the bacterium. A general poor response to treatment in all these cases indicates that clinicians should pay extra attention to intensity and duration of treatment if L. monocytogenes is identified in connection with equine kerato-conjunctivitis.

Recombinant probiotic expressing Listeria adhesion protein attenuates Listeria monocytogenes virulence in vitro.

Directory of Open Access Journals (Sweden)

Ok Kyung Koo

Full Text Available BACKGROUND: Listeria monocytogenes, an intracellular foodborne pathogen, infects immunocompromised hosts. The primary route of transmission is through contaminated food. In the gastrointestinal tract, it traverses the epithelial barrier through intracellular or paracellular routes. Strategies to prevent L. monocytogenes entry can potentially minimize infection in high-risk populations. Listeria adhesion protein (LAP aids L. monocytogenes in crossing epithelial barriers via the paracellular route. The use of recombinant probiotic bacteria expressing LAP would aid targeted clearance of Listeria from the gut and protect high-risk populations from infection. METHODOLOGY/PRINCIPAL FINDINGS: The objective was to investigate the ability of probiotic bacteria or LAP-expressing recombinant probiotic Lactobacillus paracasei (Lbp(LAP to prevent L. monocytogenes adhesion, invasion, and transwell-based transepithelial translocation in a Caco-2 cell culture model. Several wild type probiotic bacteria showed strong adhesion to Caco-2 cells but none effectively prevented L. monocytogenes infection. Pre-exposure to Lbp(LAP for 1, 4, 15, or 24 h significantly (P<0.05 reduced adhesion, invasion, and transepithelial translocation of L. monocytogenes in Caco-2 cells, whereas pre-exposure to parental Lb. paracasei had no significant effect. Similarly, Lbp(LAP pre-exposure reduced L. monocytogenes translocation by as much as 46% after 24 h. Lbp(LAP also prevented L. monocytogenes-mediated cell damage and compromise of tight junction integrity. Furthermore, Lbp(LAP cells reduced L. monocytogenes-mediated cell cytotoxicity by 99.8% after 1 h and 79% after 24 h. CONCLUSIONS/SIGNIFICANCE: Wild type probiotic bacteria were unable to prevent L. monocytogenes infection in vitro. In contrast, Lbp(LAP blocked adhesion, invasion, and translocation of L. monocytogenes by interacting with host cell receptor Hsp60, thereby protecting cells from infection. These data show promise

Prevalence and location of Listeria monocytogenes in farmed rainbow trout.

Science.gov (United States)

Miettinen, Hanna; Wirtanen, Gun

2005-10-15

A total of 510 rainbow trout originating from fish farms in lakes and sea areas around Finland were studied for the presence of Listeria monocytogenes. Samples were studied as pools from five fish. Gill, viscera, and skin from the pooled samples were analysed separately. The individual samples were analysed later if the pooled sample was found to be Listeria positive. The prevalence of Listeria spp. and L. monocytogenes in pooled unprocessed fresh rainbow trout was on average 35.0% and 14.6%, respectively. On the other hand, the prevalence of Listeria spp. and L. monocytogenes in individual thawed fish was found to be 14.3% and 8.8%, respectively. These numbers tend to overestimate and underestimate the real situation because not all fish in pooled samples were necessarily contaminated and in some of the Listeria positive pooled samples all individual samples turned out to be Listeria free. The prevalence of L. monocytogenes varied greatly between different fish farms from zero to 100% in pooled samples and from zero to 75% according to individually studied fish samples. Some indications of the influence of weather conditions and seasonal variations that strongly affected the Listeria contamination of fish were also noticed. The location of Listeria spp. and L. monocytogenes in different parts of the fish differed with statistical significance in rainbow trout. Up to 95.6% of the L. monocytogenes and 84.5% of Listeria spp. positive samples were gill samples. Only 4.4% (2/45) of the L. monocytogenes positive samples were obtained from skin or viscera. Closer study at one fish farm revealed that there was only one L. monocytogenes ribotype present in the contaminated fish, although water and surfaces were heavily contaminated with six other L. monocytogenes ribotypes.

A case of bovine raw milk contamination with Listeria monocytogenes

Directory of Open Access Journals (Sweden)

Hunt Karen

2012-07-01

Full Text Available Abstract During routine sampling of bulk raw milk on a dairy farm, the pathogenic bacteria Listeria monocytogenes was found to be a contaminant, at numbers L. monocytogenes, indicating a possible case of excretion of the L. monocytogenes directly into the milk. Milk samples were collected from the individual cows and analysed, resulting in the identification of L. monocytogenes excretion (at 280 cfu/ml from one of the 4 mammary quarters of one dairy cow out of 180. When the infected cow was isolated from the herd, no L. monocytogenes was detected from the remaining herd. The pulsed-field gel electrophoresis pattern of the strain from the individual cow was indistinguishable from that originally isolated from the bulk milk. The infected cow did not show any clinical signs of disease, nor did the appearance of the milk have any physical abnormalities. Antibiotic treatment of the infected mammary quarter was found to be ineffective. This study shows that there can be risks associated with direct contamination of raw milk with L. monocytogenes.

Inhibition of sortase A by chalcone prevents Listeria monocytogenes infection.

Science.gov (United States)

Li, Hongen; Chen, Yutao; Zhang, Bing; Niu, Xiaodi; Song, Meng; Luo, Zhaoqing; Lu, Gejin; Liu, Bowen; Zhao, Xiaoran; Wang, Jianfeng; Deng, Xuming

2016-04-15

The critical role of sortase A in gram-positive bacterial pathogenicity makes this protein a good potential target for antimicrobial therapy. In this study, we report for the first time the crystal structure of Listeria monocytogenes sortase A and identify the active sites that mediate its transpeptidase activity. We also used a sortase A (SrtA) enzyme activity inhibition assay, simulation, and isothermal titration calorimetry analysis to discover that chalcone, an agent with little anti-L. monocytogenes activity, could significantly inhibit sortase A activity with an IC50 of 28.41 ± 5.34 μM by occupying the active site of SrtA. The addition of chalcone to a co-culture of L. monocytogenes and Caco-2 cells significantly inhibited bacterial entry into the cells and L. monocytogenes-mediated cytotoxicity. Additionally, chalcone treatment decreased the mortality of infected mice, the bacterial burden in target organs, and the pathological damage to L. monocytogenes-infected mice. In conclusion, these findings suggest that chalcone is a promising candidate for the development of treatment against L. monocytogenes infection. Copyright © 2016 Elsevier Inc. All rights reserved.

CHALLENGE TESTS WITH LISTERIA MONOCYTOGENES IN SALAMI: PRELIMINARY RESULTS

Directory of Open Access Journals (Sweden)

R. Mioni

2013-02-01

Full Text Available Challenge tests are the preferable methodology to study the behaviour of Listeria monocytogenes on ready to eat foods, according to Regulation (EC 2073/2005. Challenge testing using L. monocytogenes in seasoned salami from different food business operators showed, after seasoning of the product, a count reduction of the inoculated organisms without any further growth of the pathogen; however differences of L. monocytogenes behaviour could be observed according to different production protocols.

Flagellar motility is critical for Listeria monocytogenes biofilm formation.

Science.gov (United States)

Lemon, Katherine P; Higgins, Darren E; Kolter, Roberto

2007-06-01

The food-borne pathogen Listeria monocytogenes attaches to environmental surfaces and forms biofilms that can be a source of food contamination, yet little is known about the molecular mechanisms of its biofilm development. We observed that nonmotile mutants were defective in biofilm formation. To investigate how flagella might function during biofilm formation, we compared the wild type with flagellum-minus and paralyzed-flagellum mutants. Both nonmotile mutants were defective in biofilm development, presumably at an early stage, as they were also defective in attachment to glass during the first few hours of surface exposure. This attachment defect could be significantly overcome by providing exogenous movement toward the surface via centrifugation. However, this centrifugation did not restore mature biofilm formation. Our results indicate that it is flagellum-mediated motility that is critical for both initial surface attachment and subsequent biofilm formation. Also, any role for L. monocytogenes flagella as adhesins on abiotic surfaces appears to be either minimal or motility dependent under the conditions we examined.

Resistance of Listeria monocytogenes biofilms to sanitizing agents

Science.gov (United States)

Listeria monocytogenes is notorious for its capacity to colonize the environment and equipment of food processing facilities and to persist in the processing plant ecosystem, sometimes for decades. Such persistence is mediated by multiple attributes of L. monocytogenes, including the pathogen’s capa...

Aggregated forms of bull seminal plasma proteins and their heparin-binding activity

Czech Academy of Sciences Publication Activity Database

Jelínková, Petra; Ryšlavá, H.; Liberda, J.; Jonáková, Věra; Tichá, M.

2004-01-01

Roč. 69, - (2004), s. 616-630 ISSN 0010-0765 R&D Projects: GA ČR GA303/02/0433; GA ČR GP303/02/P069; GA MZd NJ7463 Institutional research plan: CEZ:AV0Z5052915; CEZ:MSM 113100001 Keywords : bull seminal plasma proteins * heparin-binding proteins * aggregated forms of proteins Subject RIV: CE - Biochemistry Impact factor: 1.062, year: 2004

Exploring the early steps of aggregation of amyloid-forming peptide KFFE

International Nuclear Information System (INIS)

Wei Guanghong; Mousseau, Normand; Derreumaux, Philippe

2004-01-01

It has been shown recently that even a tetrapeptide can form amyloid fibrils sharing all the characteristics of amyloid fibrils built from large proteins. Recent experimental studies also suggest that the toxicity observed in several neurodegenerative diseases, such as Alzheimer's disease and Creutzfeldt-Jakob disease, is not only related to the mature fibrils themselves, but also to the soluble oligomers formed early in the process of fibrillogenesis. This raises the interest in studying the early steps of the aggregation process. Although fibril formation follows the nucleation-condensation process, characterized by the presence of lag phase, the exact pathways remain to be determined. In this study, we used the activation-relaxation technique and a generic energy model to explore the process of self-assembly and the structures of the resulting aggregates of eight KFFE peptides. Our simulations show, starting from different states with a preformed antiparallel dimer, that eight chains can self-assemble to adopt, with various orientations, four possible distant oligomeric well-aligned structures of similar energy. Two of these structures show a double-layer β-sheet organization, in agreement with the structure of amyloid fibrils as observed by x-ray diffraction; another two are mixtures of dimers and trimers. Our results also suggest that octamers are likely to be below the critical size for nucleation of amyloid fibrils for small peptides

Exploring the early steps of aggregation of amyloid-forming peptide KFFE

Energy Technology Data Exchange (ETDEWEB)

Wei Guanghong [Departement de Physique and Regroupement Quebecois sur les Materiaux de Pointe, Universite de Montreal, CP 6128, succursale centre-ville, Montreal, QC, H3C 3J7 (Canada); Mousseau, Normand [Departement de Physique and Regroupement Quebecois sur les Materiaux de Pointe, Universite de Montreal, CP 6128, succursale centre-ville, Montreal, QC, H3C 3J7 (Canada); Derreumaux, Philippe [Laboratoire de Biochimie, Theorique, UPR 9080 CNRS, IBPC, Universite Paris 7 Denis-Diderot, 13 rue Pierre et Marie Curie, 75005 Paris (France)

2004-11-10

It has been shown recently that even a tetrapeptide can form amyloid fibrils sharing all the characteristics of amyloid fibrils built from large proteins. Recent experimental studies also suggest that the toxicity observed in several neurodegenerative diseases, such as Alzheimer's disease and Creutzfeldt-Jakob disease, is not only related to the mature fibrils themselves, but also to the soluble oligomers formed early in the process of fibrillogenesis. This raises the interest in studying the early steps of the aggregation process. Although fibril formation follows the nucleation-condensation process, characterized by the presence of lag phase, the exact pathways remain to be determined. In this study, we used the activation-relaxation technique and a generic energy model to explore the process of self-assembly and the structures of the resulting aggregates of eight KFFE peptides. Our simulations show, starting from different states with a preformed antiparallel dimer, that eight chains can self-assemble to adopt, with various orientations, four possible distant oligomeric well-aligned structures of similar energy. Two of these structures show a double-layer {beta}-sheet organization, in agreement with the structure of amyloid fibrils as observed by x-ray diffraction; another two are mixtures of dimers and trimers. Our results also suggest that octamers are likely to be below the critical size for nucleation of amyloid fibrils for small peptides.

Enhanced biofilm formation in dual-species culture of Listeria monocytogenes and Ralstonia insidiosa

Directory of Open Access Journals (Sweden)

Yunfeng Xu

2017-09-01

Full Text Available In the natural environments microorganisms coexist in communities as biofilms. Since foodborne pathogens have varying abilities to form biofilms, investigation of bacterial interactions in biofilm formation may enhance our understanding of the persistence of these foodborne pathogens in the environment. Thus the objective of this study was to investigate the interactions between Listeria monocytogenes and Ralstonia insidiosa in dual species biofilms. Biofilm development after 24 h was measured using crystal violet in 96-well microtiter plate. Scanning electron microscopy and cell enumeration were employed after growth on stainless steel coupons. When compared with their single species counterparts, the dual species biofilms exhibited a significant increase in biofilm biomass. The number of L. monocytogenes in co-culture biofilms on stainless steel also increased significantly. However, there was no effect on the biofilm formation of L. monocytogenes when cultured with R. insidiosa separated by a semi-permeable membrane-linked compartment or cultured in R. insidiosa cell-free supernatant, indicating that direct cell-cell contact is critical for this interaction.

Relationship between Listeria monocytogenes and Listeria spp. in seafood processing plants.

Science.gov (United States)

Alali, Walid Q; Schaffner, Donald W

2013-07-01

The objective of this study was to evaluate the relationship between prevalence of Listeria monocytogenes as an outcome and Listeria spp. as an explanatory variable by food products, food contact surfaces, and nonfood contact surfaces in seafood processing plants by using peer-reviewed published data. Nine sets of prevalence data of L. monocytogenes and Listeria spp. were collected from published studies and used for the analyses. Based on our analysis, the relationship between L. monocytogenes prevalence and Listeria spp. prevalence in food products (incoming raw materials and finish products) was significant (P = 0.04) with (low) R² = 0.36. Furthermore, Listeria spp. were not a good indicator for L. monocytogenes when testing food contact surfaces (R² = 0.10). Listeria spp. were a good indicator for L. monocytogenes only on nonfood contact surfaces (R² = 0.90). On the other hand, the presence of Listeria spp. on food contact surfaces (R² = 0.002) and nonfood contact surfaces (R² = 0.03) was not a good indicator for L. monocytogenes presence in food products. In general, prevalence of Listeria spp. does not seem to be a good indicator for L. monocytogenes prevalence in seafood processing plants.

LISTERIA MONOCYTOGENES RISK EVALUATION IN READY TO EAT DELI PRODUCTS

Directory of Open Access Journals (Sweden)

T Civera

2013-02-01

Full Text Available Listeria monocytogenes has become one of the major concerns for food safety. Its ability to survive and replicate at low temperature, pH and high salt concentration, makes the bacterium a threat, mostly for RTE products. For these reasons, the present research was aimed at detecting the ability of growth of L. monocytogenes in RTE products retrieved from one deli store. Samples were analysed for L. monocytogenes detection, then inoculated with the pathogen (105cell/ml and stored at refrigeration temperature for the duration of their shelf-life (15-60 days. In all the products L. monocytogenes was not detected before experimental contamination. The challenge test evidenced that experimentally inoculated L. monocytogenes was not able to multiply for the duration of the entire shelf-life. These results indicated that the tested products could be considered as foods which are not able to support the growth of L. monocytogenes, as indicated by E.C. Regulation 2073/05. However, in order to guarantee consumer’s safety, it needs to be emphasized the need of a correct application of the GMPs, required for lowering the risk of initial contamination.

Internalization of Listeria monocytogenes in cantaloupes during dump tank washing and hydrocooling.

Science.gov (United States)

Macarisin, Dumitru; Wooten, Anna; De Jesus, Antonio; Hur, Minji; Bae, Seonjae; Patel, Jitendra; Evans, Peter; Brown, Eric; Hammack, Thomas; Chen, Yi

2017-09-18

Recent listeriosis outbreaks and recalls associated with cantaloupes urge for studies to understand the mechanisms of cantaloupe contamination by Listeria monocytogenes. Postharvest practices such as washing and hydrocooling were suggested to facilitate the contamination of fresh fruits by human pathogens. This study assessed the potential of L. monocytogenes internalization into cantaloupes during dump tank washing and immersion-type hydrocooling in water contaminated with L. monocytogenes. The effect of cantaloupe cultivar, water temperature, and harvesting technique on L. monocytogenes internalization was also evaluated. Full slip (cantaloupe without any residual stem) Western and Eastern cultivar cantaloupes were pre-warmed to 42°C (to imitate peak-high field temperatures of freshly harvested cantaloupes) and then immersed in water at 6°C and 18°C containing 4 and 6logCFU/ml of L. monocytogenes. Clipped (cantaloupe with short stem residues obtained by clipping the stem at harvest) Western and Eastern cantaloupes were pre-warmed to 42°C and then immersed in water at 6°C containing 6logCFU/ml of L. monocytogenes. Additionally, full slip and clipped Western cantaloupes were equilibrated to 18°C and then immersed in water at 18°C containing 6logCFU/ml of L. monocytogenes (isothermal immersion without temperature differential). Water containing L. monocytogenes infiltrated both full slip and clipped cantaloupes through the stems/stem scars and was then distributed along the vascular system in hypodermal mesocarp reaching the calyx area of the fruit. The current study demonstrated that, under experimental conditions, L. monocytogenes can internalize into cantaloupes during immersion in water contaminated by L. monocytogenes, both in the presence and absence of temperature differential, and that temperature differential moderately enhanced the internalization of L. monocytogenes. The incidence and levels of L. monocytogenes internalized in the middle

Listeria monocytogenes growth limits and stress resistance mechanisms

NARCIS (Netherlands)

Veen, van der S.

2008-01-01

The food-borne pathogen Listeria monocytogenes is a Gram-positive facultative anaerobic rod, which is the causative agent of listeriosis. Due to the severity of the disease and the fact that its incidence is increasing in numerous European countries, L. monocytogenes is of great public health

Potential Impact of the Resistance to Quaternary Ammonium Disinfectants on the Persistence of Listeria monocytogenes in Food Processing Environments.

Science.gov (United States)

Martínez-Suárez, Joaquín V; Ortiz, Sagrario; López-Alonso, Victoria

2016-01-01

The persistence of certain strains of Listeria monocytogenes, even after the food processing environment has been cleaned and disinfected, suggests that this may be related to phenomena that reduce the concentration of the disinfectants to subinhibitory levels. This includes (i) the existence of environmental niches or reservoirs that are difficult for disinfectants to reach, (ii) microorganisms that form biofilms and create microenvironments in which adequate concentrations of disinfectants cannot be attained, and (iii) the acquisition of resistance mechanisms in L. monocytogenes, including those that lead to a reduction in the intracellular concentration of the disinfectants. The only available data with regard to the resistance of L. monocytogenes to disinfectants applied in food production environments refer to genotypic resistance to quaternary ammonium compounds (QACs). Although there are several well-characterized efflux pumps that confer resistance to QACs, it is a low-level resistance that does not generate resistance to QACs at the concentrations applied in the food industry. However, dilution in the environment and biodegradation result in QAC concentration gradients. As a result, the microorganisms are frequently exposed to subinhibitory concentrations of QACs. Therefore, the low-level resistance to QACs in L. monocytogenes may contribute to its environmental adaptation and persistence. In fact, in certain cases, the relationship between low-level resistance and the environmental persistence of L. monocytogenes in different food production chains has been previously established. The resistant strains would have survival advantages in these environments over sensitive strains, such as the ability to form biofilms in the presence of increased biocide concentrations.

A large outbreak of Listeria monocytogenes infection with short incubation period in a tertiary care hospital.

Science.gov (United States)

Johnsen, Bjørn Odd; Lingaas, Egil; Torfoss, Dag; Strøm, Erik H; Nordøy, Ingvild

2010-12-01

Listeria monocytogenes is a foodborne pathogen with a high mortality rate. We report a large, nosocomial outbreak of Listeria monocytogenes infection. Patients with L. monocytogenes isolated from a sterile site, or from faeces when diarrhoea and fever were present, were included. Clinical data were collected from the patient records. The incubation period was calculated as the time between exposure and start of symptoms. Seventeen patients (11 women, median age 64 years) were infected of whom 15 patients were at increased risk for listeriosis. Eleven patients received empiric antibiotic treatment, eight of them with cephalosporins. Three patients died with a resulting mortality rate of 18%. The source of the outbreak was a Camembert cheese made from pasteurised milk containing up to 360 million colony forming units per portion. The median incubation period was 3-4 days. The incubation period in this outbreak was significantly shorter than previously reported, a fact that may be due to the high number of ingested bacteria. Furthermore, food restrictions in hospitals seem warranted, as do treatment with antibiotics effective against L. monocytogenes in at-risk populations. Copyright © 2010 The British Infection Association. Published by Elsevier Ltd. All rights reserved.

Impact of Nutrient Restriction on the Structure of Listeria monocytogenes Biofilm Grown in a Microfluidic System

Science.gov (United States)

Cherifi, Tamazight; Jacques, Mario; Quessy, Sylvain; Fravalo, Philippe

2017-01-01

Biofilm formation by the pathogen Listeria monocytogenes is a major concern in food industries. The aim of this work was to elucidate the effect of nutrient limitation on both biofilm architecture and on the viability of the bacteria in microfluidic growth conditions. Biofilm formation by two L. monocytogenes strains was performed in a rich medium (BHI) and in a 10-fold diluted BHI (BHI/10) at 30°C for 24 h by using both static conditions and the microfluidic system Bioflux. In dynamic conditions, biofilms grown in rich and poor medium showed significant differences as well in structure and in the resulting biovolume. In BHI/10, biofilm was organized in a knitted network where cells formed long chains, whereas in the rich medium, the observed structure was homogeneous cellular multilayers. Biofilm biovolume production in BHI/10 was significantly higher than in BHI in these dynamic conditions. Interestingly, biovolume of dead cells in biofilms formed under limited nutrient conditions (BHI/10) was significantly higher than in biofilms formed in the BHI medium. In the other hand, in static conditions, biofilm is organized in a multilayer cells and dispersed cells in a rich medium BHI and poor medium BHI/10 respectively. There was significantly more biomass in the rich medium compared to BHI/10 but no difference was noted in the dead/damaged subpopulation showing how L. monocytogenes biofilm could be affected by the growth conditions. This work demonstrated that nutrient concentration affects biofilm structure and the proportion of dead cells in biofilms under microfluidic condition. Our study also showed that limited nutrients play an important role in the structural stability of L. monocytogenes biofilm by enhancing cell death and liberating extracellular DNA. PMID:28567031

Impact of Nutrient Restriction on the Structure of Listeria monocytogenes Biofilm Grown in a Microfluidic System

Directory of Open Access Journals (Sweden)

Tamazight Cherifi

2017-05-01

Full Text Available Biofilm formation by the pathogen Listeria monocytogenes is a major concern in food industries. The aim of this work was to elucidate the effect of nutrient limitation on both biofilm architecture and on the viability of the bacteria in microfluidic growth conditions. Biofilm formation by two L. monocytogenes strains was performed in a rich medium (BHI and in a 10-fold diluted BHI (BHI/10 at 30°C for 24 h by using both static conditions and the microfluidic system Bioflux. In dynamic conditions, biofilms grown in rich and poor medium showed significant differences as well in structure and in the resulting biovolume. In BHI/10, biofilm was organized in a knitted network where cells formed long chains, whereas in the rich medium, the observed structure was homogeneous cellular multilayers. Biofilm biovolume production in BHI/10 was significantly higher than in BHI in these dynamic conditions. Interestingly, biovolume of dead cells in biofilms formed under limited nutrient conditions (BHI/10 was significantly higher than in biofilms formed in the BHI medium. In the other hand, in static conditions, biofilm is organized in a multilayer cells and dispersed cells in a rich medium BHI and poor medium BHI/10 respectively. There was significantly more biomass in the rich medium compared to BHI/10 but no difference was noted in the dead/damaged subpopulation showing how L. monocytogenes biofilm could be affected by the growth conditions. This work demonstrated that nutrient concentration affects biofilm structure and the proportion of dead cells in biofilms under microfluidic condition. Our study also showed that limited nutrients play an important role in the structural stability of L. monocytogenes biofilm by enhancing cell death and liberating extracellular DNA.

Listeria monocytogenes in poultry and poultry products: Epidemiological investigations in seven Danish abattoirs

DEFF Research Database (Denmark)

Ojeniyi, B.; Wegener, Henrik Caspar; Jensen, N.E.

1996-01-01

Listeria monocytogenes was isolated from 11/236 (4 . 7%) caecal samples from parent flocks, providing broilers to the abattoirs investigated. Caecal samples from 2078 broilers representing 90 randomly selected broiler flocks were negative for L. monocytogenes. A total of 3080 samples from seven...... abattoirs including poultry processing line samples, and final products were also examined for L. monocytogenes. Listeria monocytogenes was isolated in 0 . 3% to 18 . 7% of the samples collected in the different abattoirs. Epidemiological typing of 247 L. monocytogenes isolates, including serotyping, phage...... isolates of L. monocytogenes since only 120/247 (48 . 6%) isolates were typable by phage typing and 230/247 (93 . 1%) L. monocytogenes belonged to serotype 01 while 6/247 (2 . 4%) belonged to 04. The discovery of a few dominating clones in each abattoir might indicate an endemic occurrence of L...

Aerosol studies with Listeria innocua and Listeria monocytogenes.

Science.gov (United States)

Zhang, Guodong; Ma, Li; Oyarzabal, Omar A; Doyle, Michael P

2007-08-01

Aerosol studies of Listeria monocytogenes in food processing plants have been limited by lack of a suitable surrogate microorganism. The objective of this study was to investigate the potential of using green fluorescent protein-labeled strains of Listeria innocua as a surrogate for L. monocytogenes for aerosol studies. These studies were conducted in a laboratory bioaerosol chamber and a pilot food-processing facility. Four strains of L. innocua and five strains of L. monocytogenes were used. In the laboratory chamber study, Listeria cells were released into the environment at two different cell numbers and under two airflow conditions. Trypticase soy agar (TSA) plates and oven-roasted breasts of chicken and turkey were placed in the chamber to monitor Listeria cell numbers deposited from aerosols. A similar experimental design was used in the pilot plant study; however, only L. innocua was used. Results showed that L. monocytogenes and L. innocua survived equally well on chicken and turkey breast meats and TSA plates. No-fan and continuous fan applications, which affected airflow, had no significant effect on settling rates of aerosolized L. monocytogenes and L. innocua in the bioaerosol chamber or L. innocua in the pilot plant study. Listeriae cell numbers in the air decreased rapidly during the first 1.5 h following release, with few to no listeriae detected in the air at 3 h. Aerosol particles with diameters of 1 and 2 microM correlated directly with the number of Listeria cells in the aerosol but not with particles that were 0.3, 0.5, and 5 microM in diameter. Results indicate that L. innocua can be used as a surrogate for L. monocytogenes in an aerosol study.

Low prevalence of Listeria monocytogenes in cull sows and pork.

Science.gov (United States)

Wesley, Irene V; Larsen, Steven; Hurd, H Scott; McKean, James D; Griffith, Ronald; Rivera, Fernando; Nannapaneni, Ramakrishna; Cox, Mandy; Johnson, Michael; Wagner, Dean; de Martino, Mary

2008-03-01

The goal of this study was to determine the prevalence of Listeria monocytogenes in sows slaughtered at a single Midwestern plant on two occasions (trial 1, n = 179 sows; trial 2, n = 160 sows). Fecal samples collected antemortem (trial 1) as well as animal tissues, and carcass swabs collected at the abattoir (trials 1 and 2) were analyzed. Eight isolates of L. monocytogenes were recovered from five samples that represented 0.18% of the total samples (n = 2,775). In trial 1, L. monocytogenes was detected in a tonsil sample (0.6%; 1 positive of 181 tonsils), in a carcass (0.6%; 1 positive of 179 carcasses), which was sampled prior to the organic rinse, and in two chopped meat block samples (1.2%; 2 positive of 165 samples). In trial 2, L. monocytogenes was only detected in a single chopped meat block sample (0.15%; 1 positive of 688 total samples). These data indicate the low prevalence of L. monocytogenes in the cull sow.

Radiation sensitivities of Listeria monocytogenes isolated from chicken meat and their growth at refrigeration temperatures

International Nuclear Information System (INIS)

Harsojo; Banati, D.; Ito, H.

1997-01-01

Listeria monocytogenes were isolated in 5 lots, more than one cell in each 25-g sample of 10 lots of chicken meat, which was obtained from several different areas in Japan. From taxonomic study, the psychrotrophic type of 3 isolates grew well at 4°C on Trypticase soy agar slant, whereas 2 isolates grew poorly. Cells of all isolates were sensitive to γ-irradiation in phosphate buffer, and the D 10 values obtained were 0.16 to 0.18 kGy under aerobic irradiation conditions similar to the values of salmonellae. In the chicken meat sample, the D 10 value obtained was 0.42 kGy the same value as in phosphate buffer under anaerobic irradiation conditions, and the necessary dose for inactivation of L. monocytogenes was estimated to be 2 kGy in raw chicken meat below 10 -4 CFU (colony forming unit) per gram. In the storage study of chicken meat which was inoculated with about 3×10 3 CFU per gram of L. monocytogenes, the psychrotrophic type of the isolates grew quickly at 7 to 10°C storage. However, a dose of 1 kGy was also effective to suppress the growth of L. monocytogenes at refrigeration temperatures below 10°C

Antimicrobial resistance of Listeria monocytogenes and Listeria innocua from meat products and meat-processing environment.

Science.gov (United States)

Gómez, Diego; Azón, Ester; Marco, Noelia; Carramiñana, Juan J; Rota, Carmina; Ariño, Agustín; Yangüela, Javier

2014-09-01

A total of 336 Listeria isolates from ready-to-eat (RTE) meat products and meat-processing environments, consisting of 206 Listeria monocytogenes, and 130 Listeria innocua isolates, were characterized by disc diffusion assay and minimum inhibitory concentration (MIC) values for antimicrobial susceptibility against twenty antimicrobials. Resistance to one or two antimicrobials was observed in 71 L. monocytogenes isolates (34.5%), and 56 L. innocua isolates (43.1%). Multidrug resistance was identified in 24 Listeria isolates, 18 belonging to L. innocua (13.9%) and 6 to L. monocytogenes (2.9%). Oxacillin resistance was the most common resistance phenotype and was identified in 100% Listeria isolates. A medium prevalence of resistance to clindamycin (39.3% isolates) and low incidence of resistance to tetracycline (3.9% isolates) were also detected. Listeria isolates from RTE meat products displayed higher overall antimicrobial resistance (31.3%) than those from the environment (13.4%). All the strains assayed were sensitive to the preferred antibiotics used to treat listeriosis. Results showed that although antimicrobial resistance in L. monocytogenes still occurs at a low prevalence, L. innocua can form a reservoir of resistance genes which may transfer between bacterial species, including transference to organisms capable of causing disease in humans. Copyright © 2014 Elsevier Ltd. All rights reserved.

Antimicrobial resistance of Listeria monocytogenes isolated from dairy-based food products.

Science.gov (United States)

Harakeh, Steve; Saleh, Imane; Zouhairi, Omar; Baydoun, Elias; Barbour, Elie; Alwan, Nisreen

2009-06-15

In this study Listeria monocytogenes (L. monocytogenes) was isolated from three traditionally consumed Lebanese dairy-based food products. One hundred and sixty four samples (45 samples of Baladi cheese, 36 samples of Shankleesh and 83 of Kishk) were collected from the Bekaa Valley in the Northeast region of Lebanon. Suspected Listeria colonies were selected and initially identified by using standard biochemical tests. Initial identification of the positive L. monocytogenes colonies was confirmed at the molecular level by Polymerase Chain Reaction (n=30) and the confirmed isolates were evaluated for their susceptibility to 10 commonly used antimicrobials. All of the 30 isolates were confirmed to be L. monocytogenes yielding a PCR product of approximately 660 base pairs (bp). L. monocytogenes was detected in 26.67%, 13.89% and 7.23% of the Baladi cheese, Shankleesh and Kishk samples, respectively. The highest resistance in L. monocytogenes isolates was noted against oxacillin (93.33%) followed by penicillin (90%). The results provide an indication of the contamination levels of dairy-based foods in Lebanon and highlight the emergence of multi-drug resistant Listeria in the environment.

Behaviour of Listeria monocytogenes in packaged fresh mushrooms (Agaricus bisporus).

Science.gov (United States)

González-Fandos, E; Olarte, C; Giménez, M; Sanz, S; Simón, A

2001-11-01

The aim of this study was to evaluate the potential of Listeria monocytogenes to grow in mushrooms packaged in two different types of PVC films when stored at 4 degrees C and 10 degrees C. Mushrooms were packed in two polymeric films (perforated and nonperforated PVC) and stored at 4 degrees C and 10 degrees C. The carbon dioxide and oxygen content inside the packages, aerobic mesophiles, psychrotrophs, Pseudomonas spp., Listeria monocytogenes, faecal coliforms, Escherichia coli, anaerobic spores and major sensory factors were determined. The mushrooms packaged in nonperforated film and stored at 4 degrees C had the most desirable quality parameters (texture, development stage and absence of moulds). Listeria monocytogenes was able to grow at 4 degrees C and 10 degrees C in inoculated mushrooms packaged in perforated and nonperforated films between 1 and 2 log units during the first 48 h. After 10 d of storage, the populations of L. monocytogenes were higher in mushrooms packaged in nonperforated film and stored at 10 degrees C. MAP followed by storage at 4 degrees C or 10 degrees C extends the shelf life by maintaining an acceptable appearance, but allows the growth and survival of L. monocytogenes. According to this study additional hurdles must be studied in order to prevent the growth of L. monocytogenes.

Radio sensibility of listeria monocytogenes in pure culture and frozen contaminated shrimps and stored them at -18 deg C

International Nuclear Information System (INIS)

Rubio M V, T.; Espinoza, J.; L Sanchez, M.V.

1997-01-01

Full text: Listeria monocytogenes has been recognized for a number of years as a food pathogen bacteria. Ionizing radiation is a new technology and an excellent method to eliminate this microorganism form frozen food. The sensitivity of Listeria monocytogenes serotype 01 and 04 to irradiation, in pure culture and frozen shrimps was investigated. The D 10 values were of 0,26-0,37 kGy in pure culture and frozen shrimps, respectively. The D 10 founded were similar to those reported by the literature under similar conditions. Doses of 6 kGy were enough to eliminate a contamination of 10 6 -10 7 ufc/ml of L. Monocytogenes in frozen shrimps and storage them during 200 days at 18 deg C

Influence of velocity gradient on optimisation of the aggregation process and properties of formed aggregates. Part 2. Quantification of the influence of agitation intensity and time on the properties of formed aggregates

Czech Academy of Sciences Publication Activity Database

Polášek, Pavel

2011-01-01

Roč. 59, č. 3 (2011), s. 196-205 ISSN 0042-790X R&D Projects: GA ČR GA103/07/1016 Institutional research plan: CEZ:AV0Z20600510 Keywords : inline high density suspension (IHDS) formation process * aggregation phases * aggregate properties * compactness * relative density of aggregates Subject RIV: BK - Fluid Dynamics Impact factor: 0.340, year: 2011

Prevalence and characteristics of Listeria monocytogenes in bovine colostrum in Japan.

Science.gov (United States)

Hasegawa, Megumi; Iwabuchi, Eriko; Yamamoto, Shiori; Esaki, Hidetake; Kobayashi, Kazuhiko; Ito, Masahiko; Hirai, Katsuya

2013-02-01

This study was conducted to determine the prevalence and characteristics of Listeria monocytogenes in bovine colostrum in Japan. We collected bovine colostrum samples from 210 dams from 21 dairy farms in Hokkaido prefecture (Japan) between March and June 2009. L. monocytogenes was detected in samples from 6 (28.6%) of the 21 farms. Of the 210 samples, 16 (7.6%) were positive for L. monocytogenes. We recovered 80 L. monocytogenes isolates; 44 (55%) isolates were classified as serotype 1/2b and 36 (45%) were classified as serotype 4b. The isolates were susceptible to penicillin, ampicillin, amoxicillin, gentamicin, kanamycin, streptomycin, erythromycin, vancomycin, tetracycline, chloramphenicol, ciprofloxacin, and trimethoprim-sulfamethoxazole. Pulsed-field gel electrophoresis (PFGE) characterization of the 80 isolates revealed six PFGE types. Two PFGE types corresponded to human listeriosis cases. Most L. monocytogenes isolates possessed virulence-associated genes (actA, hly, iap, inlA, inlC, mpl, plcA, plcB, opuCA, prfA, and clpC). One PFGE type isolate possessed an epidemic clone II marker. Our findings suggest that isolates from bovine colostrum have the potential to cause human and animal listeriosis. This is the first study on the prevalence and characteristics of L. monocytogenes isolated from bovine colostrum obtained from dairy farms. Our results have important implications for improving public health and elucidating the epidemiology of L. monocytogenes in bovine colostrum.

Primary and Aggregate Size Distributions of PM in Tail Pipe Emissions form Diesel Engines

Science.gov (United States)

Arai, Masataka; Amagai, Kenji; Nakaji, Takayuki; Hayashi, Shinji

Particulate matter (PM) emission exhausted from diesel engine should be reduced to keep the clean air environment. PM emission was considered that it consisted of coarse and aggregate particles, and nuclei-mode particles of which diameter was less than 50nm. However the detail characteristics about these particles of the PM were still unknown and they were needed for more physically accurate measurement and more effective reduction of exhaust PM emission. In this study, the size distributions of solid particles in PM emission were reported. PMs in the tail-pipe emission were sampled from three type diesel engines. Sampled PM was chemically treated to separate the solid carbon fraction from other fractions such as soluble organic fraction (SOF). The electron microscopic and optical-manual size measurement procedures were used to determine the size distribution of primary particles those were formed through coagulation process from nuclei-mode particles and consisted in aggregate particles. The centrifugal sedimentation method was applied to measure the Stokes diameter of dry-soot. Aerodynamic diameters of nano and aggregate particles were measured with scanning mobility particle sizer (SMPS). The peak aggregate diameters detected by SMPS were fallen in the same size regime as the Stokes diameter of dry-soot. Both of primary and Stokes diameters of dry-soot decreased with increases of engine speed and excess air ratio. Also, the effects of fuel properties and engine types on primary and aggregate particle diameters were discussed.

The first report on Listeria monocytogenes producing siderophores and responds positively to N-acyl homoserine lactone (AHL) molecules by enhanced biofilm formation.

Science.gov (United States)

Naik, Milind Mohan; Bhangui, Purva; Bhat, Chinmay

2017-12-01

Listeria monocytogenes are Gram-positive well-known emerging food-borne pathogens causing listeriosis in humans. In the present study, we have isolated biofilm-forming Listeria sp. from utensils used by a local milk collection dairy society at Usgao Goa, which collects milk for Goa dairy. Through biochemical tests and 16S rRNA sequence analysis, the bacterium was confirmed to be L. monocytogenes and designated as strain BN3, having GenBank accession number MF095110. We report for the first time Gram-positive L. monocytogenes strain BN3 producing iron-chelating siderophores by chrome azurol S (CAS) agar test. Also, this is a first report which reveals that L. monocytogenes strain BN3 responds to N-hexanoyl-homoserine lactone molecule (C 6 -HSL) by gradual increase in their biofilm-forming potential with a gradual increase in AHL (C 6 -HSL) concentration (250, 500 nM-1 μM) as compared to control revealed by crystal violet assay (CV) in microtiter plate. These results were further confirmed by scanning electron microscopy (SEM). A significant decrease in biofilm formation was observed when L. monocytogenes strain BN3 was treated with 10 µg/ml (R)-2-(2-hydroxynaphthalen-1-yl)thiazolidine-4-carboxylic acid, but when 250 and 500 nM AHL molecules were added, biofilm formation in strain BN3 was found to be enhanced as compared to control even in the presence of antibacterial compound, (R)-2-(2-hydroxynaphthalen-1-yl)thiazolidine-4-carboxylic acid. These results revealed that AHL molecules nullify the effect of antimicrobial compound and promote biofilm formation in L. monocytogenes strain BN3.

Prevalence of Listeria monocytogenes in poultry meat

Directory of Open Access Journals (Sweden)

Mehmet ELMALI

2015-01-01

Full Text Available AbstractThe objectives of this study were i to isolate Listeria spp. and Listeria monocytogenes in broiler wing meat samples, ii to confirm the isolates by PCR, based on prs and hly A gene sequences, iii to determine the seasonal and monthly distribution of the isolates. A total of 120 broiler wing meat samples (60 packaged pieces wrapped using strech film in styrofoam plates and 60 unpackaged pieces bought from different markets in Hatay province were analysed. Listeria spp. was isolated from 57 (47.5% out of 120 samples. Fifty-four, out of 57 Listeria spp. isolates were identified as L. monocytogenes. L. monocytogenes was isolated from the samples collected during the spring, winter, summer, and autumn at the levels of 26.6%, 40%, 53.3%, 60%, respectively. In this study, the isolation rates were found to be the highest in autumn, while the isolation rates were found to be the lowest in spring. As a consequence, high prevalence of Listeria spp. and L. monocytogenes in poultry wing meat samples may pose a risk for human health. We consider that with obeying the rules of good hygiene practices (GHP, good manufacturing practices (GMP and HACCP can minimize the contamination with Listeria spp.

Biocontrole de Listeria monocytogenes por Pediococcus acidilactici em couve minimamente processada Biocontrol of Listeria monocytogenes by Pediococcus acidilactici in fresh-cut kale

Directory of Open Access Journals (Sweden)

Wanessa Altimiras Costa

2009-12-01

Full Text Available Este estudo avaliou um sistema de biocontrole para inibição de Listeria monocytogenes em couve minimamente processada, objetivando sua segurança durante estocagem sob refrigeração e em condições de abuso de temperatura. O potencial inibitório de bactérias láticas tolerantes ao sal e psicrotróficas contaminantes naturais da couve e Lactobacillus plantarum, Lactobacillus delbrueckii ATCC 9649 e Lactobacillus casei CCT 1465 foram avaliadas contra L. monocytogenes. O isolado de couve identificado como P. acidilactici CCA3 inibiu L. monocytogenes a 10 e 15 °C em ágar MRS e foi selecionado como possível agente de biocontrole. O número de L. monocytogenes na couve minimamente processada aumentou 3,7 e 4,7 ciclos logarítmicos a 5 e 10 °C, respectivamente, após 20 dias de armazenamento e 4,6 ciclos logarítmicos após oito dias a 15 °C. Entretanto, quando 10(8 UFC.g-1 de P. acidilactici CCA3 foram inoculados no produto processado, o crescimento de L. monocytogenes reduziu 2,3 ciclos logarítmicos sob temperatura abusiva de 15 °C. A acidez titulável e as características sensoriais da couve não foram alteradas pela presença de CCA3 ao longo do período de vida útil. Estes resultados sugerem o potencial de aplicação dos bioconservantes na couve minimamente processada, que necessitam estar associados à refrigeração e sanitização para garantir segurança.This study evaluated a biological control system for the inhibition of Listeria monocytogenes in minimally processed kale focusing on its freshness under refrigeration and extreme temperatures. The inhibitory potential of salt and cold tolerant lactic bacteria from natural microflora of kale, Lactobacillus delbrueckii ATCC 9649, Lactobacillus plantarum, and Lactobacillus casei CCT 1465 strains were evaluated against L. monocytogenes. Pediococcus acidilactici CCA3 isolated from kale exhibited a large inhibition zone of L. monocytogenes at 10 and 15 °C in MRS agar and was

ASSESSMENT OF ACTION OF DISINFECTANTS AGAINST LISTERIA MONOCYTOGENES BIOFILMS

Directory of Open Access Journals (Sweden)

T. K. CABEÇA

2008-12-01

Full Text Available

The purpose of this study was to assess the action of various disinfectants used in food industry against biofilm cells of Listeria monocytogenes formed on stainless steel surfaces during 24, 72 and 120 hours. Numbers of viable biofilm cells decreased after treatment with all the tested disinfectants (iodine, biguanide, quaternary ammonium compounds, peracetic acid and sodium hypochlorite. Sodium hypochlorite was the most effective disinfectant against the biofilm cells, while biguanide and iodine were the least. Scanning electron microscopy observations demonstrated attached cells on stainless steel surfaces after treatment with all the disinfectants. These observations showed that microorganisms were not completely removed from stainless steel surfaces after treatment with the disinfectants, however, the attachment did not means the viability of remaining cells. The biofilm age in hours (24, 72 and 120 had no apparent influence on resistance of microbiological cells to the disinfectants under study. In conclusion biofilm cells of L. monocytogenes can withstand disinfectants action.

Listeria monocytogenes in retailed raw chicken meat in Turkey.

Science.gov (United States)

Siriken, Belgin; Ayaz, Naim Deniz; Erol, Irfan

2014-01-01

The objectives of this study were, to find the prevalence and antimicrobial resistance of L. monocytogenes from a total of 116 chicken meat samples including 50 carcasses and 66 meat parts marketed in Turkey between 2008 and 2009 using immunomagnetic separation (IMS) based cultivation technique, to detect the hlyA gene for the verification of the isolates by PCR, and to identify the genoserotypes of the L. monocytogenes isolates by multiplex PCR assay. In the study, 51 L. monocytogenes colonies were isolated from 34 (29.3%) chicken meat samples (eleven [22.0%] carcasses and 23 [34.8%] pieces of meat) by IMS based cultivation technique and confirmed by PCR. According to the multiplex PCR results, all the 51 isolates were identified as genoserotype IIa (1/2a or 3a). L. monocytogenes isolates were also tested for their susceptibility to eight antibiotic (gentamicin, vancomycin, chloramphenicol, streptomycin, tetracycline, ampicillin, penicillin G, erythromycin) agents using the disk diffusion method. 14 isolates (27.45%) were susceptible to all eight antimicrobials drugs tested and the remaining 37 isolates (72.54%) were resistant to gentamicin (one isolate, 1.96%), vancomycin (four isolates, 7.84%), penicillin G (six isolates, 11.76%), streptomycin (nine isolates, 17.64%; resistant or intermediate), tetracycline (seven isolates, 13.72%) and ampicillin (six isolates, 11.76%). This study showed that antimicrobial resistance is not highly prevalent in L. monocytogenes isolated from chicken carcasses and pieces of meat. The presence of L. monocytogenes in chicken samples suggests an importance of this pathogen in chicken.

Listeria monocytogenes in Fresh Produce: Outbreaks, Prevalence and Contamination Levels

Directory of Open Access Journals (Sweden)

Qi Zhu

2017-03-01

Full Text Available Listeria monocytogenes, a member of the genus Listeria, is widely distributed in agricultural environments, such as soil, manure and water. This organism is a recognized foodborne pathogenic bacterium that causes many diseases, from mild gastroenteritis to severe blood and/or central nervous system infections, as well as abortion in pregnant women. Generally, processed ready-to-eat and cold-stored meat and dairy products are considered high-risk foods for L. monocytogenes infections that cause human illness (listeriosis. However, recently, several listeriosis outbreaks have been linked to fresh produce contamination around the world. Additionally, many studies have detected L. monocytogenes in fresh produce samples and even in some minimally processed vegetables. Thus L. monocytogenes may contaminate fresh produce if present in the growing environment (soil and water. Prevention of biofilm formation is an important control measure to reduce the prevalence and survival of L. monocytogenes in growing environments and on fresh produce. This article specifically focuses on fresh produce–associated listeriosis outbreaks, prevalence in growing environments, contamination levels of fresh produce, and associated fresh produce safety challenges.

Commensal microbes provide first line defense against Listeria monocytogenes infection

Science.gov (United States)

Littmann, Eric R.; Kim, Sohn G.; Morjaria, Sejal M.; Ling, Lilan; Gyaltshen, Yangtsho; Taur, Ying; Leiner, Ingrid M.

2017-01-01

Listeria monocytogenes is a foodborne pathogen that causes septicemia, meningitis and chorioamnionitis and is associated with high mortality. Immunocompetent humans and animals, however, can tolerate high doses of L. monocytogenes without developing systemic disease. The intestinal microbiota provides colonization resistance against many orally acquired pathogens, and antibiotic-mediated depletion of the microbiota reduces host resistance to infection. Here we show that a diverse microbiota markedly reduces Listeria monocytogenes colonization of the gut lumen and prevents systemic dissemination. Antibiotic administration to mice before low dose oral inoculation increases L. monocytogenes growth in the intestine. In immunodeficient or chemotherapy-treated mice, the intestinal microbiota provides nonredundant defense against lethal, disseminated infection. We have assembled a consortium of commensal bacteria belonging to the Clostridiales order, which exerts in vitro antilisterial activity and confers in vivo resistance upon transfer into germ free mice. Thus, we demonstrate a defensive role of the gut microbiota against Listeria monocytogenes infection and identify intestinal commensal species that, by enhancing resistance against this pathogen, represent potential probiotics. PMID:28588016

Meningoencefalite por Listeria monocytogenes em ovinos Meningoencephalitis in sheep caused by Listeria monocytogenes

Directory of Open Access Journals (Sweden)

Daniel R. Rissi

2010-01-01

Full Text Available São descritos sete casos de doença neurológica em ovinos por Listeria monocytogenes no Rio Grande do Sul e Paraná entre 2000 e 2007. Foram afetados ovinos com idades entre 12-24 meses. Os casos ocorreram no verão e início da primavera e os índices gerais de morbidade e letalidade foram de 3,15% e 100%, respectivamente. Quando essa informação estava disponível, nenhum dos ovinos afetados era alimentado com silagem. Em três propriedades havia contato próximo dos ovinos afetados com outras espécies. A evolução do quadro clínico foi de 12 horas a três dias e os sinais clínicos foram caracterizados por decúbito (7/7, desvio da cabeça (4/7, incoordenação (3/7, depressão (3/7, andar em círculos (2/7, cegueira unilateral, emagrecimento progressivo, febre, midríase, movimentos de pedalagem, nistagmo lateral, opistótono, paralisia flácida dos membros pélvicos ou dos quatro membros, salivação excessiva e tremores (1/7 cada. Histologicamente observou-se encefalite com microabscessos, predominantemente unilateral com variáveis graus de gliose e alterações degenerativas como esferóides axonais e infiltração de células Gitter. As lesões se estendiam desde a medula oblonga até o mesencéfalo. Antígenos de Listeria monocytogenes foram detectados por imuno-histoquímica em seções de tronco encefálico de todos os ovinos afetados. O diagnóstico foi realizado com base nos achados epidemiológicos e clinico-patológicos, e confirmado pela imuno-histoquímica (IHQ utilizando anticorpo policlonal anti-L. monocytogenes.Seven cases of neurological disease in sheep caused by Listeria monocytogenes in Rio Grande do Sul and Paraná state, southern Brazil are described. The cases occurred between 2000 and 2007 and 12-24-month-old sheep were affected. Overall morbidity and lethality rates were 3.15% and 100%, respectively. Cases occurred in the summer and early spring. When this information was available, affected sheep had not been

Listeria monocytogenes infection of HD11, chicken macrophage-like cells.

Science.gov (United States)

Jarvis, N A; Donaldson, J R; O'Bryan, C A; Ricke, S C; Crandall, P G

2017-04-01

Listeria monocytogenes can be carried by and infect poultry, although the clinical disease in birds is rare. Escape from macrophage phagocytosis is a key step in pathogenesis for L. monocytogenes. Therefore, we investigated the infection of the chicken macrophage-like cell line HD11 with 2 strains of L. monocytogenes EGD-e and Scott A. After infection, L. monocytogenes was quantified by spread plating and HD11 was quantified with trypan blue exclusion stain before enumeration. The standard macrophage killing protocols require washing the cell monolayers 3 times with PBS, which was found to negatively influence HD11 monolayers. Maximum bacterial densities within macrophages were not different between the 2 Listeria strains. HD11 required more than 11 h to effectively reduce intracellular L. monocytogenes Scott A, and Scott A was more susceptible to HD11 killing than EGD-e. It appears that Listeria infection initially causes attenuation of HD11 growth, and infected HD11 cells do not begin to lyse until at least 11 h post infection. These results suggest that there are subtle strain to strain differences in response to HD11 macrophage phagocytosis. The long lead-time required for HD11 to kill L. monocytogenes cells means that there is sufficient time available for chicken macrophages to circulate in the blood and transfer the intracellular Listeria to multiple tissues. © 2016 Poultry Science Association Inc.

RNAi screen reveals host cell kinases specifically involved in Listeria monocytogenes spread from cell to cell.

Directory of Open Access Journals (Sweden)

Ryan Chong

Full Text Available Intracellular bacterial pathogens, such as Listeria monocytogenes and Rickettsia conorii display actin-based motility in the cytosol of infected cells and spread from cell to cell through the formation of membrane protrusions at the cell cortex. Whereas the mechanisms supporting cytosolic actin-based motility are fairly well understood, it is unclear whether specific host factors may be required for supporting the formation and resolution of membrane protrusions. To address this gap in knowledge, we have developed high-throughput fluorescence microscopy and computer-assisted image analysis procedures to quantify pathogen spread in human epithelial cells. We used the approach to screen a siRNA library covering the human kinome and identified 7 candidate kinases whose depletion led to severe spreading defects in cells infected with L. monocytogenes. We conducted systematic validation procedures with redundant silencing reagents and confirmed the involvement of the serine/threonine kinases, CSNK1A1 and CSNK2B. We conducted secondary assays showing that, in contrast with the situation observed in CSNK2B-depleted cells, L. monocytogenes formed wild-type cytosolic tails and displayed wild-type actin-based motility in the cytosol of CSNK1A1-depleted cells. Furthermore, we developed a protrusion formation assay and showed that the spreading defect observed in CSNK1A1-depleted cells correlated with the formation of protrusion that did not resolve into double-membrane vacuoles. Moreover, we developed sending and receiving cell-specific RNAi procedures and showed that CSNK1A was required in the sending cells, but was dispensable in the receiving cells, for protrusion resolution. Finally, we showed that the observed defects were specific to Listeria monocytogenes, as Rickettsia conorii displayed wild-type cell-to-cell spread in CSNK1A1- and CSNK2B-depleted cells. We conclude that, in addition to the specific host factors supporting cytosolic actin

Purification of leucocin A for use on wieners to inhibit Listeria monocytogenes in the presence of spoilage organisms.

Science.gov (United States)

Balay, Danielle R; Dangeti, Ramana V; Kaur, Kamaljit; McMullen, Lynn M

2017-08-16

investigation on the ability of L. monocytogenes to form spontaneous resistance to class II bacteriocins on food matrices during prolonged storage is warranted. Copyright © 2017 Elsevier B.V. All rights reserved.

Listeria monocytogenes behaviour in presence of non-UV-irradiated titanium dioxide nanoparticles.

Directory of Open Access Journals (Sweden)

Maria Grazia Ammendolia

Full Text Available Listeria monocytogenes is the agent of listeriosis, a food-borne disease. It represents a serious problem for the food industry because of its environmental persistence mainly due to its ability to form biofilm on a variety of surfaces. Microrganisms attached on the surfaces are a potential source of contamination for environment and animals and humans. Titanium dioxide nanoparticles (TiO2 NPs are used in food industry in a variety of products and it was reported that daily exposure to these nanomaterials is very high. Anti-listerial activity of TiO2 NPs was investigated only with UV-irradiated nanomaterials, based on generation of reactive oxigen species (ROS with antibacterial effect after UV exposure. Since both Listeria monocytogenes and TiO2 NPs are veicolated with foods, this study explores the interaction between Listeria monocytogenes and non UV-irradiated TiO2 NPs, with special focus on biofilm formation and intestinal cell interaction. Scanning electron microscopy and quantitative measurements of biofilm mass indicate that NPs influence both production and structural architecture of listerial biofilm. Moreover, TiO2 NPs show to interfere with bacterial interaction to intestinal cells. Increased biofilm production due to TiO2 NPs exposure may favour bacterial survival in environment and its transmission to animal and human hosts.

Detection of Listeria Spp. and Listeria monocytogenes in vegetables ...

African Journals Online (AJOL)

This paper aimed to study the prevalence and antibiotic resistance pattern among Listeria monocytogenes in raw vegetables sourced from commercial farms and local farms in Terengganu. Thirteen types of vegetables investigated for the presence of L. monocytogenes using multiplex PCR and LAMP methods. Isolation of ...

Listeria monocytogenes impact on mature or old Pseudomonas fluorescens biofilms during growth at 4 and 20ºC

Directory of Open Access Journals (Sweden)

Puga eCH

2016-02-01

Full Text Available Changes in spatial organization, as observed by confocal laser scanning microscopy (CLSM, viable cell content, biovolume and substratum surface coverage of the biofilms formed on glass by Pseudomonas fluorescens resulting from co-culture with Listeria monocytogenes, were examined. Two strains of L. monocytogenes, two culture temperatures and two biofilm developmental stages were investigated. Both L. monocytogenes strains, a persistently sampled isolate (collected repeatedly along 3 years from a meat factory and Scott A, induced shrinkage in matrix volume, both at 20ºC and 4ºC, in mature or old biofilms, without loss of P. fluorescens cell count per surface unit. The nearly homogeneous pattern of surface coverage shown by mono-species P. fluorescens biofilms, turned into more irregular layouts in co-culture with L. monocytogenes. The upper layer of both mono and dual-species biofilms turned to predominantly consist of matrix, with plenty of viable cells underneath, in old biofilms cultured at 20ºC, but not in those grown at 4ºC. Between 15 and 56% of the substratum area was covered by biofilm, the extent depending on temperature, time and L. monocytogenes strain. Real biofilms in food-related surfaces may thus be very heterogeneous regarding their superficial components, i.e. those more accessible to disinfectants. It is therefore a hygienic challenge to choose an adequate agent to disrupt them.

Exploring the diversity of Listeria monocytogenes biofilm architecture by high-throughput confocal laser scanning microscopy and the predominance of the honeycomb-like morphotype.

Science.gov (United States)

Guilbaud, Morgan; Piveteau, Pascal; Desvaux, Mickaël; Brisse, Sylvain; Briandet, Romain

2015-03-01

Listeria monocytogenes is involved in food-borne illness with a high mortality rate. The persistence of the pathogen along the food chain can be associated with its ability to form biofilms on inert surfaces. While most of the phenotypes associated with biofilms are related to their spatial organization, most published data comparing biofilm formation by L. monocytogenes isolates are based on the quantitative crystal violet assay, which does not give access to structural information. Using a high-throughput confocal-imaging approach, the aim of this work was to decipher the structural diversity of biofilms formed by 96 L. monocytogenes strains isolated from various environments. Prior to large-scale analysis, an experimental design was created to improve L. monocytogenes biofilm formation in microscopic-grade microplates, with special emphasis on the growth medium composition. Microscopic analysis of biofilms formed under the selected conditions by the 96 isolates revealed only weak correlation between the genetic lineages of the isolates and the structural properties of the biofilms. However, a gradient in their geometric descriptors (biovolume, mean thickness, and roughness), ranging from flat multilayers to complex honeycomb-like structures, was shown. The dominant honeycomb-like morphotype was characterized by hollow voids hosting free-swimming cells and localized pockets containing mixtures of dead cells and extracellular DNA (eDNA). Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Early trigeminal nerve involvement in Listeria monocytogenes rhombencephalitis

DEFF Research Database (Denmark)

Karlsson, William K; Harboe, Zitta Barrella; Roed, Casper

2017-01-01

dysfunction on that side. In addition, we identified another 120 cases of Listeria rhombencephalitis following a systematic review. Cranial nerves VII, V, IX, and X, respectively, medulla oblongata, cerebellum and pons, were the most frequently involved brain structures. The present clinical and radiological...... findings corroborate earlier data from animal experiments, indicating that L. monocytogenes may be capable of retrograde intra-axonal migration along the cranial nerves. We suggest that in a subset of patients with rhombencephalitis L. monocytogenes enters the cerebellopontine angle through the trigeminal......Listeria monocytogenes is associated with rhombencephalitis. However, the exact mechanisms of brainstem invasion remains poorly understood. Here, we demonstrate clinical and radiological data suggesting that Listeria may invade the brainstem via the trigeminal nerve. Three females (41, 64 and 70...

Prevalence and antimicrobial susceptibility of Listeria monocytogenes on chicken carcasses in Bandung, Indonesia.

Science.gov (United States)

Sugiri, Yoni Darmawan; Gölz, Greta; Meeyam, Tongkorn; Baumann, Maximilian P O; Kleer, Josef; Chaisowwong, Warangkhana; Alter, Thomas

2014-08-01

This study was conducted to determine the prevalence and quantify the number of Listeria monocytogenes in fresh chicken carcasses sold in traditional markets and supermarkets in Bandung, West Java, Indonesia, and to determine the antimicrobial resistance patterns of the isolated L. monocytogenes strains. The overall prevalence of L. monocytogenes in chicken carcasses was 15.8% (29/184). When comparing samples from traditional markets and supermarkets, no significant difference in the L. monocytogenes prevalence was detectable (15.2 versus 16.3%). Of the samples, 97.3% had L. monocytogenes counts study were grouped into the molecular serogroup IIb, comprising the serovars 1/2b, 3b, and 7.

Licheniocin 50.2 and Bacteriocins from Lactococcus lactis subsp. lactis biovar. diacetylactis BGBU1-4 Inhibit Biofilms of Coagulase Negative Staphylococci and Listeria monocytogenes Clinical Isolates.

Science.gov (United States)

Cirkovic, Ivana; Bozic, Dragana D; Draganic, Veselin; Lozo, Jelena; Beric, Tanja; Kojic, Milan; Arsic, Biljana; Garalejic, Eliana; Djukic, Slobodanka; Stankovic, Slavisa

2016-01-01

Coagulase negative staphylococci (CoNS) and Listeria monocytogenes have important roles in pathogenesis of various genital tract infections and fatal foetomaternal infections, respectively. The aim of our study was to investigate the inhibitory effects of two novel bacteriocins on biofilms of CoNS and L. monocytogenes genital isolates. The effects of licheniocin 50.2 from Bacillus licheniformis VPS50.2 and crude extract of bacteriocins produced by Lactococcus lactis subsp. lactis biovar. diacetylactis BGBU1-4 (BGBU1-4 crude extract) were evaluated on biofilm formation and formed biofilms of eight CoNS (four S. epidermidis, two S. hominis, one S. lugdunensis and one S. haemolyticus) and 12 L. monocytogenes genital isolates. Licheniocin 50.2 and BGBU1-4 crude extract inhibited the growth of both CoNS and L. monocytogenes isolates, with MIC values in the range between 200-400 AU/ml for licheniocin 50.2 and 400-3200 AU/ml for BGBU1-4 crude extract. Subinhibitory concentrations (1/2 × and 1/4 × MIC) of licheniocin 50.2 inhibited biofilm formation by all CoNS isolates (p < 0.05, respectively), while BGBU1-4 crude extract inhibited biofilm formation by all L. monocytogenes isolates (p < 0.01 and p < 0.05, respectively). Both bacteriocins in concentrations of 100 AU/mL and 200 AU/mL reduced the amount of 24 h old CoNS and L. monocytogenes biofilms (p < 0.05, p < 0.01, p < 0.001). This study suggests that novel bacteriocins have potential to be used for genital application, to prevent biofilm formation and/or to eradicate formed biofilms, and consequently reduce genital and neonatal infections by CoNS and L. monocytogenes.

Heating of Porous Icy Dust Aggregates

Energy Technology Data Exchange (ETDEWEB)

Sirono, Sin-iti [Earth and Environmental Sciences, Nagoya University, Tikusa-ku, Furo-cho, Nagoya 464-8601 (Japan)

2017-06-10

At the beginning of planetary formation, highly porous dust aggregates are formed through coagulation of dust grains. Outside the snowline, the main component of an aggregate is H{sub 2}O ice. Because H{sub 2}O ice is formed in amorphous form, its thermal conductivity is extremely small. Therefore, the thermal conductivity of an icy dust aggregate is low. There is a possibility of heating inside an aggregate owing to the decay of radionuclides. It is shown that the temperature increases substantially inside an aggregate, leading to crystallization of amorphous ice. During the crystallization, the temperature further increases sufficiently to continue sintering. The mechanical properties of icy dust aggregates change, and the collisional evolution of dust aggregates is affected by the sintering.

Modeling the growth of Listeria monocytogenes in soft blue-white cheese

DEFF Research Database (Denmark)

Rosshaug, Per Sand; Detmer, Ann; Ingmer, Hanne

2012-01-01

The aim of this study was to develop a predictive model simulating growth over time of the pathogenic bacterium Listeria monocytogenes in a soft blue-white cheese. The physicochemical properties in a matrix such as cheese are essential controlling factors influencing the growth of L. monocytogenes....... We developed a predictive tertiary model of the bacterial growth of L. monocytogenes as a function of temperature, pH, NaCl, and lactic acid. We measured the variations over time of the physicochemical properties in the cheese. Our predictive model was developed based on broth data produced...... production and retail conditions showed that the number of L. monocytogenes cells increases 3 to 3.5 log within the shelf life of the cheese....

Validation of the ANSR(®) Listeria monocytogenes Method for Detection of Listeria monocytogenes in Selected Food and Environmental Samples.

Science.gov (United States)

Caballero, Oscar; Alles, Susan; Le, Quynh-Nhi; Gray, R Lucas; Hosking, Edan; Pinkava, Lisa; Norton, Paul; Tolan, Jerry; Mozola, Mark; Rice, Jennifer; Chen, Yi; Ryser, Elliot; Odumeru, Joseph

2016-01-01

Work was conducted to validate performance of the ANSR(®) for Listeria monocytogenes method in selected food and environmental matrixes. This DNA-based assay involves amplification of nucleic acid via an isothermal reaction based on nicking enzyme amplification technology. Following single-step sample enrichment for 16-24 h for most matrixes, the assay is completed in 40 min using only simple instrumentation. When 50 distinct strains of L. monocytogenes were tested for inclusivity, 48 produced positive results, the exceptions being two strains confirmed by PCR to lack the assay target gene. Forty-seven nontarget strains (30 species), including multiple non-monocytogenes Listeria species as well as non-Listeria, Gram-positive bacteria, were tested, and all generated negative ANSR assay results. Performance of the ANSR method was compared with that of the U.S. Department of Agriculture, Food Safety and Inspection Service Microbiology Laboratory Guidebook reference culture procedure for detection of L. monocytogenes in hot dogs, pasteurized liquid egg, and sponge samples taken from an inoculated stainless steel surface. In addition, ANSR performance was measured against the U.S. Food and Drug Administration Bacteriological Analytical Manual reference method for detection of L. monocytogenes in Mexican-style cheese, cantaloupe, sprout irrigation water, and guacamole. With the single exception of pasteurized liquid egg at 16 h, ANSR method performance as quantified by the number of positives obtained was not statistically different from that of the reference methods. Robustness trials demonstrated that deliberate introduction of small deviations to the normal assay parameters did not affect ANSR method performance. Results of accelerated stability testing conducted using two manufactured lots of reagents predicts stability at the specified storage temperature of 4°C of more than 1 year.

Occurrence of Listeria monocytogenes in smoked fish in Sokoto ...

African Journals Online (AJOL)

The present study was conducted to determine the prevalence of Listeria monocytogenes in smoked fish in Sokoto, Nigeria. A total of 115 different species of smoked fish from the various retail outlets and market places within the metropolis were analysed for the presence of L. monocytogenes using ISO culture method.

Effekt av ulike desinfeksjonsstrategier mot Listeria monocytogenes

OpenAIRE

Fossmo, Sabine

2013-01-01

Kontroll med bakterier som Listeria utgjør en stor utfordring for mange matprodusenter. Listeria monocytogenes er hovedsakelig et produksjonshygienisk problem, forbedret hygiene kan derfor være tiltak for å redusere overlevelse og smitteoverføring av bakterien i produksjonsmiljø. Hensikten med forsøkene i oppgaven var å undersøke effekten av ulike desinfeksjonsstrategier på drap av L. monocytogenes, både når bakteriene var i biofilm og i suspensjon. Dette inkluderte bruk av tradisjonelle desi...

Monitoring paneer for Listeria monocytogenes - A high risk food ...

African Journals Online (AJOL)

A multiplex polymerase chain reaction (PCR) assay was developed and applied to spiked and natural paneer samples to detect Listeria monocytogenes, a high risk food pathogen. The sensitivity of the assay on L. monocytogenes spiked paneer samples was 104 cells prior to enrichment, was improved to 103 cells after 4 h ...

Genome sequences of Listeria monocytogenes strains with resistance to arsenic

Science.gov (United States)

Listeria monocytogenes frequently exhibits resistance to arsenic. We report here the draft genome sequences of eight genetically diverse arsenic-resistant L. monocytogenes strains from human listeriosis and food-associated environments. Availability of these genomes would help to elucidate the role ...

Effects of prebiotics on the infective potential of Listeria monocytogenes

DEFF Research Database (Denmark)

Ebersbach, Tine

% xylooligosaccharides (XOS), galactooligosaccharides (GOS), inulin, apple pectin or polydextrose for three weeks before oral challenge with L. monocytogenes. XOS and GOS significantly improved resistance of guinea pigs to L. monocytogenes, while inulin and apple pectin decreased the resistance. No significant effect...

Restraining reactive oxygen species in Listeria monocytogenes promotes the apoptosis of glial cells.

Science.gov (United States)

Li, Sen; Li, Yixuan; Chen, Guowei; Zhang, Jingchen; Xu, Fei; Wu, Man

2017-07-01

Listeria monocytogenes is a facultative anaerobic foodborne pathogen that can traverse the blood-brain barrier and cause brain infection. L. monocytogenes infection induces host cell apoptosis in several cell types. In this study, we investigated the apoptosis of human glioma cell line U251 invaded by L. monocytogenes and evaluated the function of bacterial reactive oxygen species (ROS) during infection. Bacterial ROS level was reduced by carrying out treatment with N-acetyl cysteine (NAC) and diphenyleneiodonium chloride (DPI). After infection, the apoptosis of U251 cells was examined by flow cytometry assay and propidium iodide staining. DPI and NAC efficiently decreased ROS level in L. monocytogenes without affecting bacterial growth. Moreover, the apoptosis of glial cells was enhanced upon invasion of DPI- and NAC-pretreated L. monocytogenes. Results indicate that the apoptosis of glial cells can be induced by L. monocytogenes, and that the inhibition of bacterial ROS increases the apoptosis of host cells.

Genes involved in Listeria monocytogenes biofilm formation at a simulated food processing plant temperature of 15 °C

DEFF Research Database (Denmark)

Piercey, Marta J.; Hingston, Patricia A.; Hansen, Lisbeth Truelstrup

2016-01-01

proteins. Deficient mutants (n=5) contained interruptions in genes related to peptidoglycan,teichoic acid, or lipoproteins. Enhanced mutants produced significantly (p b 0.05) higher cell densities in biofilm formed on stainless steel (SS) coupons at 15 °C (48 h) than deficient mutants, which were also more......Listeria monocytogenes is a pathogenic foodborne bacterium whose persistence in food processing environments is in part attributed to its biofilm formation. Most biofilm studies have been carried out at 30–37 °C rather than at temperatures found in the food processing plants (i.e., 10–20 °C......). The objective of the present study was to mine for novel genes that contribute to L. monocytogenes biofilm formation at 15 °C using the random insertional mutagenesisapproach. A library of 11,024 L. monocytogenes 568 (serotype 1/2a) Himar1 insertional mutants wascreated. Mutants with reduced or enhanced biofilm...

Listeria monocytogenes internalizes in Romaine Lettuce grown in greenhouse conditions

Science.gov (United States)

Listeria monocytogenes has been implicated in a number of outbreaks involving fresh produce, including an outbreak in 2016 resulting from contaminated packaged salads. The persistence and internalization potential of L. monocytogenes in romaine lettuce was evaluated, and the persistence of two L. mo...

Use of Potential Probiotic Lactic Acid Bacteria (LAB) Biofilms for the Control of Listeria monocytogenes, Salmonella Typhimurium, and Escherichia coli O157:H7 Biofilms Formation.

Science.gov (United States)

Gómez, Natacha C; Ramiro, Juan M P; Quecan, Beatriz X V; de Melo Franco, Bernadette D G

2016-01-01

Use of probiotic biofilms can be an alternative approach for reducing the formation of pathogenic biofilms in food industries. The aims of this study were (i) to evaluate the probiotic properties of bacteriocinogenic (Lactococcus lactis VB69, L. lactis VB94, Lactobacillus sakei MBSa1, and Lactobacillus curvatus MBSa3) and non-bacteriocinogenic (L. lactis 368, Lactobacillus helveticus 354, Lactobacillus casei 40, and Weissela viridescens 113) lactic acid bacteria (LAB) isolated from Brazilian's foods and (ii) to develop protective biofilms with these strains and test them for exclusion of Listeria monocytogenes, Escherichia coli O157:H7, and Salmonella Typhimurium. LAB were tested for survival in acid and bile salt conditions, surface properties, biosurfactant production, β-galactosidase and gelatinase activity, antibiotic resistance and presence of virulence genes. Most strains survived exposure to pH 2 and 4% bile salts. The highest percentages of auto-aggregation were obtained after 24 h of incubation. Sixty-seven percentage auto-aggregation value was observed in W. viridescens 113 and Lactobacillus curvatus MBSa3 exhibited the highest co-aggregation (69% with Listeria monocytogenes and 74.6% with E. coli O157:H7), while the lowest co-aggregation was exhibited by W. viridescens 113 (53.4% with Listeria monocytogenes and 38% with E. coli O157:H7). Tests for hemolytic activity, bacterial cell adherence with xylene, and drop collapse confirmed the biosurfactant-producing ability of most strains. Only one strain (L. lactis 368) produced β-galactosidase. All strains were negative for virulence genes cob, ccf, cylLL, cylLs, cyllM, cylB, cylA and efaAfs and gelatinase production. The antibiotic susceptibility tests indicated that the MIC for ciprofloxacin, clindamycin, gentamicin, kanamycin, and streptomycin did not exceed the epidemiological cut-off suggested by the European Food Safety Authority. Some strains were resistant to one or more antibiotics and resistance

Detection of Listeria monocytogenes from selective enrichment broth using MALDI-TOF Mass Spectrometry.

Science.gov (United States)

Jadhav, Snehal; Sevior, Danielle; Bhave, Mrinal; Palombo, Enzo A

2014-01-31

Conventional methods used for primary detection of Listeria monocytogenes from foods and subsequent confirmation of presumptive positive samples involve prolonged incubation and biochemical testing which generally require four to five days to obtain a result. In the current study, a simple and rapid proteomics-based MALDI-TOF MS approach was developed to detect L. monocytogenes directly from selective enrichment broths. Milk samples spiked with single species and multiple species cultures were incubated in a selective enrichment broth for 24h, followed by an additional 6h secondary enrichment. As few as 1 colony-forming unit (cfu) of L. monocytogenes per mL of initial selective broth culture could be detected within 30h. On applying the same approach to solid foods previously implicated in listeriosis, namely chicken pâté, cantaloupe and Camembert cheese, detection was achieved within the same time interval at inoculation levels of 10cfu/mL. Unlike the routine application of MALDI-TOF MS for identification of bacteria from solid media, this study proposes a cost-effective and time-saving detection scheme for direct identification of L. monocytogenes from broth cultures.This article is part of a Special Issue entitled: Trends in Microbial Proteomics. Globally, foodborne diseases are major causes of illness and fatalities in humans. Hence, there is a continual need for reliable and rapid means for pathogen detection from food samples. Recent applications of MALDI-TOF MS for diagnostic microbiology focused on detection of microbes from clinical specimens. However, the current study has emphasized its use as a tool for detecting the major foodborne pathogen, Listeria monocytogenes, directly from selective enrichment broths. This proof-of-concept study proposes a detection scheme that is more rapid and simple compared to conventional methods of Listeria detection. Very low levels of the pathogen could be identified from different food samples post-enrichment in

Growth inhibition of Listeria monocytogenes by a nonbacteriocinogenic Carnobacterium piscicola

DEFF Research Database (Denmark)

Nilsson, Lilian; Bech Hansen, T.; Garrido, P.

2005-01-01

Aims: This study elucidates the mechanisms by which a nonbacteriocinogenic Carnobacterium piscicola inhibits growth of Listeria monocytogenes. Methods and Results: Listeria monocytogenes was exposed to live cultures of a bacteriocin-negative variant of C. piscicola A9b in co-culture, in a diffusion...... chamber system, and to a cell-free supernatant. Suppression of maximum cell density (0-3.5 log units) of L. monocytogenes was proportional to initial levels of C. pisciola (10(3)-10(7) CFU ml(-1)). Cell-to-cell contact was not required to cause inhibition. The cell-free C. piscicola supernatant caused...... a decrease in L. monocytogenes maximum cell density, which was abolished by glucose addition but not by amino acid, vitamin or mineral addition. The fermentate also gave rise to a longer lag phase and a reduction in growth rate. These effects were independent of glucose and may have been caused by acetate...

Kinetic Behaviors of Catalysis-Driven Growth of Three-Species Aggregates on Base of Exchange-Driven Aggregations

International Nuclear Information System (INIS)

Sun Yunfei; Chen Dan; Lin Zhenquan; Ke Jianhong

2009-01-01

We propose a solvable aggregation model to mimic the evolution of population A, asset B, and the quantifiable resource C in a society. In this system, the population and asset aggregates themselves grow through self-exchanges with the rate kernels K 1 (k, j) = K 1 kj and K 2 (k, j) = K 2 kj, respectively. The actions of the population and asset aggregations on the aggregation evolution of resource aggregates are described by the population-catalyzed monomer death of resource aggregates and asset-catalyzed monomer birth of resource aggregates with the rate kernels J 1 (k, j) = J 1 k and J 2 (k, j) = J 2 k, respectively. Meanwhile, the asset and resource aggregates conjunctly catalyze the monomer birth of population aggregates with the rate kernel I 1 (k, i, j) = I 1 ki μ j η , and population and resource aggregates conjunctly catalyze the monomer birth of asset aggregates with the rate kernel I 2 (k, i, j) = I 2 ki v j η . The kinetic behaviors of species A, B, and C are investigated by means of the mean-field rate equation approach. The effects of the population-catalyzed death and asset-catalyzed birth on the evolution of resource aggregates based on the self-exchanges of population and asset appear in effective forms. The coefficients of the effective population-catalyzed death and the asset-catalyzed birth are expressed as J 1e = J 1 /K 1 and J 2e = J 2 /K 2 , respectively. The aggregate size distribution of C species is found to be crucially dominated by the competition between the effective death and the effective birth. It satisfies the conventional scaling form, generalized scaling form, and modified scaling form in the cases of J 1e 2e , J 1e = J 2e , and J 1e > J 2e , respectively. Meanwhile, we also find the aggregate size distributions of populations and assets both fall into two distinct categories for different parameters μ, ν, and η: (i) When μ = ν = η = 0 and μ = ν = 0, η = 1, the population and asset aggregates obey the generalized

GENERAL: Kinetic Behaviors of Catalysis-Driven Growth of Three-Species Aggregates on Base of Exchange-Driven Aggregations

Science.gov (United States)

Sun, Yun-Fei; Chen, Dan; Lin, Zhen-Quan; Ke, Jian-Hong

2009-06-01

We propose a solvable aggregation model to mimic the evolution of population A, asset B, and the quantifiable resource C in a society. In this system, the population and asset aggregates themselves grow through self-exchanges with the rate kernels K1(k, j) = K1kj and K2(k, j) = K2kj, respectively. The actions of the population and asset aggregations on the aggregation evolution of resource aggregates are described by the population-catalyzed monomer death of resource aggregates and asset-catalyzed monomer birth of resource aggregates with the rate kernels J1(k, j) = J1k and J2(k, j) = J2k, respectively. Meanwhile, the asset and resource aggregates conjunctly catalyze the monomer birth of population aggregates with the rate kernel I1(k, i, j) = I1kiμjη, and population and resource aggregates conjunctly catalyze the monomer birth of asset aggregates with the rate kernel I2(k, i, j) = I2kivjη. The kinetic behaviors of species A, B, and C are investigated by means of the mean-field rate equation approach. The effects of the population-catalyzed death and asset-catalyzed birth on the evolution of resource aggregates based on the self-exchanges of population and asset appear in effective forms. The coefficients of the effective population-catalyzed death and the asset-catalyzed birth are expressed as J1e = J1/K1 and J2e = J2/K2, respectively. The aggregate size distribution of C species is found to be crucially dominated by the competition between the effective death and the effective birth. It satisfies the conventional scaling form, generalized scaling form, and modified scaling form in the cases of J1e J2e, respectively. Meanwhile, we also find the aggregate size distributions of populations and assets both fall into two distinct categories for different parameters μ, ν, and η: (i) When μ = ν = η = 0 and μ = ν = 0, η = 1, the population and asset aggregates obey the generalized scaling forms; and (ii) When μ = ν = 1, η = 0, and μ = ν = η = 1, the

Prevalence and serotypes of Listeria monocytogenes contamination in Chinese beef processing plants.

Science.gov (United States)

Zhu, Lixian; Feng, Xiaohui; Zhang, Lihua; Zhu, Ruiliang; Luo, Xin

2012-06-01

The aim of this work was to study the epidemiology of Listeria spp., particularly Listeria monocytogenes, and to identify the serotypes present in contaminated samples from beef processing plants in China. A total of 439 samples were obtained from bovine feces, hides, and carcasses at three commercial processing plants. A standard protocol (ISO 11290-1) was followed to detect Listeria spp. and L. monocytogenes, and multiplex polymerase chain reaction was used to identify the various L. monocytogenes serotypes. The overall prevalences of Listeria spp. and L. monocytogenes were 65.6% and 26.4%, respectively, and the contamination was highest in the hide samples. The identified L. monocytogenes serotypes were 1/2c and 1/2a. The results of the current study indicate that Listeria spp. contamination is common in Chinese beef processing plants; specific measures should be taken to prevent and/or treat L. monocytogenes contamination of feces and hides in beef slaughter plants. Furthermore, because Listeria spp. contamination was found to be prevalent, it should, therefore, be studied further. The prevention of cases of sporadic listeriosis in China should also be addressed.

CAG Expansions Are Genetically Stable and Form Nontoxic Aggregates in Cells Lacking Endogenous Polyglutamine Proteins

Directory of Open Access Journals (Sweden)

Ashley A. Zurawel

2016-09-01

Full Text Available Proteins containing polyglutamine (polyQ regions are found in almost all eukaryotes, albeit with various frequencies. In humans, proteins such as huntingtin (Htt with abnormally expanded polyQ regions cause neurodegenerative diseases such as Huntington’s disease (HD. To study how the presence of endogenous polyQ aggregation modulates polyQ aggregation and toxicity, we expressed polyQ expanded Htt fragments (polyQ Htt in Schizosaccharomyces pombe. In stark contrast to other unicellular fungi, such as Saccharomyces cerevisiae, S. pombe is uniquely devoid of proteins with more than 10 Q repeats. We found that polyQ Htt forms aggregates within S. pombe cells only with exceedingly long polyQ expansions. Surprisingly, despite the presence of polyQ Htt aggregates in both the cytoplasm and nucleus, no significant growth defect was observed in S. pombe cells. Further, PCR analysis showed that the repetitive polyQ-encoding DNA region remained constant following transformation and after multiple divisions in S. pombe, in contrast to the genetic instability of polyQ DNA sequences in other organisms. These results demonstrate that cells with a low content of polyQ or other aggregation-prone proteins can show a striking resilience with respect to polyQ toxicity and that genetic instability of repetitive DNA sequences may have played an important role in the evolutionary emergence and exclusion of polyQ expansion proteins in different organisms.

Variations in biofilm formation, desiccation resistance and Benzalkonium chloride susceptibility among Listeria monocytogenes strains isolated in Canada

DEFF Research Database (Denmark)

Piercey, Marta J.; C. Ells, Timothy; Macintosh, Andrew J.

2017-01-01

needed to inhibit the formation of biofilm by LGI1/CC8 strains during incubation for 48 h and 6 days compared to other strains. Formation of biofilm on stainless steel was not significantly (p > 0.05) different among the strains. Analysis of genetic sequence data from desiccation and BAC sensitive (CP4 5......Listeria monocytogenes is a pathogenic foodborne microorganism noted for its ability to survive in the environment and food processing facilities. Survival may be related to the phenotype of individual strains including the ability to form biofilms and resist desiccation and/or sanitizer exposure....... The objectives of this research were to compare 14 L. monocytogenes strains isolated from blood (3), food (6) and water (5) with respect to their benzalkonium chloride (BAC) sensitivity, desiccation resistance, and ability to form biofilm. Correlations were tested between those responses, and the presence...

Survival strategies of Listeria monocytogenes - roles of regulators and transporters

NARCIS (Netherlands)

Wemekamp-Kamphuis, H.H.

2003-01-01

Outbreaks of the food-borne pathogen Listeria monocytogenes are mainly associated with ready-to-eatfoods. Survival strategies of L. monocytogenes in relation to minimally processed foods were studied.

Microbiological criteria for Listeria monocytogenes in foods under special consideration of risk assessment approaches

DEFF Research Database (Denmark)

Nørrung, Birgit

2000-01-01

This paper shortly summarizes data related to risk assessment of Listeria monocytogenes. From available data on risk assessment, it is concluded that the levels of L. monocytogenes consumed is an important factor affecting the incidence of listeriosis. Foods that do not support the growth of L....... monocytogenes are unlikely to be a source of listeriosis, whereas foods that support the growth to high levels, should be the target of risk management efforts. Based on current epidemiological information from several countries, a concentration of L. monocytogenes not exceeding 100/g of food at the time...... of L. monocytogenes in the food during prevailing storage and distribution conditions is needed....

Prebiotic Oligosaccharides Potentiate Host Protective Responses against L. Monocytogenes Infection

Directory of Open Access Journals (Sweden)

Poyin Chen

2017-12-01

Full Text Available Prebiotic oligosaccharides are used to modulate enteric pathogens and reduce pathogen shedding. The interactions with prebiotics that alter Listeria monocytogenes infection are not yet clearly delineated. L. monocytogenes cellular invasion requires a concerted manipulation of host epithelial cell membrane receptors to initiate internalization and infection often via receptor glycosylation. Bacterial interactions with host glycans are intimately involved in modulating cellular responses through signaling cascades at the membrane and in intracellular compartments. Characterizing the mechanisms underpinning these modulations is essential for predictive use of dietary prebiotics to diminish pathogen association. We demonstrated that human milk oligosaccharide (HMO pretreatment of colonic epithelial cells (Caco-2 led to a 50% decrease in Listeria association, while Biomos pretreatment increased host association by 150%. L. monocytogenes-induced gene expression changes due to oligosaccharide pretreatment revealed global alterations in host signaling pathways that resulted in differential subcellular localization of L. monocytogenes during early infection. Ultimately, HMO pretreatment led to bacterial clearance in Caco-2 cells via induction of the unfolded protein response and eIF2 signaling, while Biomos pretreatment resulted in the induction of host autophagy and L. monocytogenes vacuolar escape earlier in the infection progression. This study demonstrates the capacity of prebiotic oligosaccharides to minimize infection through induction of host-intrinsic protective responses.

Deciphering the landscape of host barriers to Listeria monocytogenes infection.

Science.gov (United States)

Zhang, Ting; Abel, Sören; Abel Zur Wiesch, Pia; Sasabe, Jumpei; Davis, Brigid M; Higgins, Darren E; Waldor, Matthew K

2017-06-13

Listeria monocytogenes is a common food-borne pathogen that can disseminate from the intestine and infect multiple organs. Here, we used sequence tag-based analysis of microbial populations (STAMP) to investigate L monocytogenes population dynamics during infection. We created a genetically barcoded library of murinized L monocytogenes and then used deep sequencing to track the pathogen's dissemination routes and quantify its founding population ( N b ) sizes in different organs. We found that the pathogen disseminates from the gastrointestinal tract to distal sites through multiple independent routes and that N b sizes vary greatly among tissues, indicative of diverse host barriers to infection. Unexpectedly, comparative analyses of sequence tags revealed that fecally excreted organisms are largely derived from the very small number of L. monocytogenes cells that colonize the gallbladder. Immune depletion studies suggest that distinct innate immune cells restrict the pathogen's capacity to establish replicative niches in the spleen and liver. Finally, studies in germ-free mice suggest that the microbiota plays a critical role in the development of the splenic, but not the hepatic, barriers that prevent L. monocytogenes from seeding these organs. Collectively, these observations illustrate the potency of the STAMP approach to decipher the impact of host factors on population dynamics of pathogens during infection.

Listeria monocytogenes: diagnostic problems

NARCIS (Netherlands)

Beumer, R.R.; Hazeleger, W.C.

2003-01-01

The first isolation methods for the detection of Listeria spp. were generally based on the direct culture of samples on simple agar media, but isolation of the pathogenic Listeria monocytogenes was difficult. In time, new techniques were developed, based on a variety of selective and elective agents

Current Knowledge on Listeria monocytogenes Biofilms in Food-Related Environments: Incidence, Resistance to Biocides, Ecology and Biocontrol

Directory of Open Access Journals (Sweden)

Pedro Rodríguez-López

2018-06-01

Full Text Available Although many efforts have been made to control Listeria monocytogenes in the food industry, growing pervasiveness amongst the population over the last decades has made this bacterium considered to be one of the most hazardous foodborne pathogens. Its outstanding biocide tolerance capacity and ability to promiscuously associate with other bacterial species forming multispecies communities have permitted this microorganism to survive and persist within the industrial environment. This review is designed to give the reader an overall picture of the current state-of-the-art in L. monocytogenes sessile communities in terms of food safety and legislation, ecological aspects and biocontrol strategies.

Assessment of Listeria sp. Interference Using a Molecular Assay To Detect Listeria monocytogenes in Food.

Science.gov (United States)

Zittermann, Sandra I; Stanghini, Brenda; See, Ryan Soo; Melano, Roberto G; Boleszczuk, Peter; Murphy, Allana; Maki, Anne; Mallo, Gustavo V

2016-01-01

Detection of Listeria monocytogenes in food is currently based on enrichment methods. When L. monocytogenes is present with other Listeria species in food, the species compete during the enrichment process. Overgrowth competition of the nonpathogenic Listeria species might result in false-negative results obtained with the current reference methods. This potential issue was noted when 50 food samples artificially spiked with L. monocytogenes were tested with a real-time PCR assay and Canada's current reference method, MFHPB-30. Eleven of the samples studied were from foods naturally contaminated with Listeria species other than those used for spiking. The real-time PCR assay detected L. monocytogenes in all 11 of these samples; however, only 6 of these samples were positive by the MFHPB-30 method. To determine whether L. monocytogenes detection can be affected by other species of the same genus due to competition, an L. monocytogenes strain and a Listeria innocua strain with a faster rate of growth in the enrichment broth were artificially coinoculated at different ratios into ground pork meat samples and cultured according to the MFHPB-30 method. L. monocytogenes was detected only by the MFHPB-30 method when L. monocytogenes/L. innocua ratios were 6.0 or higher. In contrast, using the same enrichments, the real-time PCR assay detected L. monocytogenes at ratios as low as 0.6. Taken together, these findings support the hypothesis that L. monocytogenes can be outcompeted by L. innocua during the MFHPB-30 enrichment phase. However, more reliable detection of L. monocytogenes in this situation can be achieved by a PCR-based method mainly because of its sensitivity.

Importance of SigB for Listeria monocytogenes static and continuous flow biofilm formation and disinfectant resistance

NARCIS (Netherlands)

Veen, van der S.; Abee, T.

2010-01-01

Listeria monocytogenes is a food-borne pathogen that is able to form biofilms in food processing facilities. Biofilms are generally more resistant to antimicrobial agents, making it difficult to eradicate them during cleanup procedures. So far, little is known about the function of stress resistance

Comparative experimental infection of Listeria monocytogenes and Listeria ivanovii in bovine trophoblasts.

Science.gov (United States)

Rocha, Cláudia E; Mol, Juliana P S; Garcia, Luize N N; Costa, Luciana F; Santos, Renato L; Paixão, Tatiane A

2017-01-01

Listeria monocytogenes is a Gram-positive, facultative intracellular and invasive bacterium that has tropism to the placenta, and causes fetal morbidity and mortality in several mammalian species. While infection with L. monocytogenes and L. ivanovii are known as important causes of abortion and reproductive failure in cattle, the pathogenesis of maternal-fetal listeriosis in this species is poorly known. This study used the bovine chorioallantoic membrane explant model to investigate the kinetics of L. monocytogenes, L. ivanovii, and L. innocua infections in bovine trophoblastic cells for up to 8 h post infection. L. monocytogenes and L. ivanovii were able to invade and multiply in trophoblastic cells without causing cell death or inducing expression of pro-inflammatory genes. Although L. innocua was unable to multiply in bovine trophoblastic cells, it induced transcription of the pro-inflammatory mediator CXCL6. This study demonstrated for the first time the susceptibility of bovine trophoblastic cells to L. monocytogenes and L. ivanovii infection.

PrP aggregation can be seeded by pre-formed recombinant PrP amyloid fibrils without the replication of infectious prions.

Science.gov (United States)

Barron, Rona M; King, Declan; Jeffrey, Martin; McGovern, Gillian; Agarwal, Sonya; Gill, Andrew C; Piccardo, Pedro

2016-10-01

Mammalian prions are unusual infectious agents, as they are thought to consist solely of aggregates of misfolded prion protein (PrP). Generation of synthetic prions, composed of recombinant PrP (recPrP) refolded into fibrils, has been utilised to address whether PrP aggregates are, indeed, infectious prions. In several reports, neurological disease similar to transmissible spongiform encephalopathy (TSE) has been described following inoculation and passage of various forms of fibrils in transgenic mice and hamsters. However, in studies described here, we show that inoculation of recPrP fibrils does not cause TSE disease, but, instead, seeds the formation of PrP amyloid plaques in PrP-P101L knock-in transgenic mice (101LL). Importantly, both WT-recPrP fibrils and 101L-recPrP fibrils can seed plaque formation, indicating that the fibrillar conformation, and not the primary sequence of PrP in the inoculum, is important in initiating seeding. No replication of infectious prions or TSE disease was observed following both primary inoculation and subsequent subpassage. These data, therefore, argue against recPrP fibrils being infectious prions and, instead, indicate that these pre-formed seeds are acting to accelerate the formation of PrP amyloid plaques in 101LL Tg mice. In addition, these data reproduce a phenotype which was previously observed in 101LL mice following inoculation with brain extract containing in vivo-generated PrP amyloid fibrils, which has not been shown for other synthetic prion models. These data are reminiscent of the "prion-like" spread of aggregated forms of the beta-amyloid peptide (Aβ), α-synuclein and tau observed following inoculation of transgenic mice with pre-formed seeds of each misfolded protein. Hence, even when the protein is PrP, misfolding and aggregation do not reproduce the full clinicopathological phenotype of disease. The initiation and spread of protein aggregation in transgenic mouse lines following inoculation with pre-formed

Incidence and control of Listeria monocytogenes in foods in Denmark

DEFF Research Database (Denmark)

Nørrung, Birgit; Andersen, Jens Kirk; Schlundt, Jørgen

1999-01-01

The Danish regulatory policy on Listeria monocytogenes in foods is based on the principles of HACCP and was developed using a health risk assessment approach. The Danish policy focuses examinations and criteria for L. monocytogenes in ready-to-eat foods and is based on a combination of inspection...

The occurrence, transmission, virulence and antibiotic resistance of Listeria monocytogenes in fish processing plant.

Science.gov (United States)

Skowron, Krzysztof; Kwiecińska-Piróg, Joanna; Grudlewska, Katarzyna; Świeca, Agnieszka; Paluszak, Zbigniew; Bauza-Kaszewska, Justyna; Wałecka-Zacharska, Ewa; Gospodarek-Komkowska, Eugenia

2018-06-13

The aim of this research was to investigate the occurrence of Listeria monocytogenes in fish and fish processing plant and to determine their transmission, virulence and antibiotic resistance. L. monocytogenes was isolated according to the ISO 11290-1. The identification of L. monocytogenes was confirmed by multiplex PCR method. Genetic similarity of L. monocytogenes strains was determined with the Pulsed-Filed Gene Electrophoresis (PFGE) method. The multiplex PCR was used for identification of L. monocytogenes serogroups and detection of selected virulence genes (actA, fbpA, hlyA, iap, inlA, inlB, mpl, plcA, plcB, prfA). The L. monocytogens isolates susceptibility to penicillin, ampicillin, meropenem, erythromycin, trimethoprim/sulfamethoxazole was evaluated with disc diffusion method according to EUCAST v. 7.1. The presence of 237 L. monocytogenes isolates (before genetic similarity assessment) in 614 examined samples was confirmed. After strain differentiation by PFGE techniques the presence of 161 genetically different strains were confirmed. The genetic similarity of the examined isolates suggested that the source of the L. monocytogenes strains were fishes originating from farms. All tested strains possessed all detected virulence genes. Among examined strains, the most (26, 38.6%) belonged to the group 1/2a-3a. The most of tested strains were resistant to erythromycin (47.1%) and trimethoprim/sulfamethoxazole (47.1%). Copyright © 2018. Published by Elsevier B.V.

Efficacy of chlorine dioxide against Listeria monocytogenes in brine chilling solutions.

Science.gov (United States)

Valderrama, W B; Mills, E W; Cutter, C N

2009-11-01

Chilled brine solutions are used by the food industry to rapidly cool ready-to-eat meat products after cooking and before packaging. Chlorine dioxide (ClO(2)) was investigated as an antimicrobial additive to eliminate Listeria monocytogenes. Several experiments were performed using brine solutions made of sodium chloride (NaCl) and calcium chloride (CaCl(2)) inoculated with L. monocytogenes and/or treated with 3 ppm of ClO(2). First, 10 and 20% CaCl(2) and NaCl solutions (pH 7.0) were inoculated with a five-strain cocktail of L. monocytogenes to obtain approximately 7 log CFU/ml and incubated 8 h at 0 degrees C. The results demonstrated that L. monocytogenes survived in 10% CaCl(2), 10 and 20% NaCl, and pure water. L. monocytogenes levels were reduced approximately 1.2 log CFU/ml in 20% CaCl(2). Second, inoculated ( approximately 7 log CFU/ml) brine solutions (10 and 20% NaCl and 10% CaCl(2)) treated with 3 ppm of ClO(2) resulted in a approximately 4-log reduction of the pathogen within 90 s. The same was not observed in a solution of 20% CaCl(2); further investigation demonstrated that high levels of divalent cations interfere with the disinfectant. Spent brine solutions from hot dog and ham chilling were treated with ClO(2) at concentrations of 3 or 30 ppm. At these concentrations, ClO(2) did not reduce L. monocytogenes. Removal of divalent cations and organic material in brine solutions prior to disinfection with ClO(2) should be investigated to improve the efficacy of the compound against L. monocytogenes. The information from this study may be useful to processing establishments and researchers who are investigating antimicrobials in chilling brine solutions.

Review of Prosthetic Joint Infection from Listeria monocytogenes.

Science.gov (United States)

Bader, Gilbert; Al-Tarawneh, Mohammed; Myers, James

2016-12-01

Prosthetic joint infection from Listeria monocytogenes is rare. We decided to shed light on this illness and review the reported cases to better understand its characteristics. We conducted a comprehensive review of the English literature using PubMed. We also included one case that we had managed. We found 25 cases of prosthetic joint infection from L. monocytogenes reported individually and a retrospective study of 43 cases of joint and bone listerial infection, including 34 with prosthetic joint infection, conducted in France. We have described their clinical and para-clinical features and tried to elaborate on the pathophysiology, treatment, and prevention. Prosthetic joint infection from L. monocytogenes is mainly late. Systemic inflammation may be absent. Although rare, it must be suspected in patients at high risk for both prosthetic joint and listerial infections. In addition, those patients must be instructed on appropriate preventive measures.

Animal models for oral transmission of Listeria monocytogenes

Directory of Open Access Journals (Sweden)

Sarah E F D'Orazio

2014-02-01

Full Text Available Listeria monocytogenes has been recognized as a food borne pathogen in humans since the 1980s, but we still understand very little about oral transmission of L. monocytogenes or the host factors that determine susceptibility to gastrointestinal infection, due to the lack of an appropriate small animal model of oral listeriosis. Early feeding trials suggested that many animals were highly resistant to oral infection, and the more reproducible intravenous or intraperitoneal routes of inoculation soon came to be favored. There are a fair number of previously published studies using an oral infection route, but the work varies widely in terms of bacterial strain choice, the methods used for oral transmission, and various manipulations used to enhance infectivity. This mini review will summarize the published literature using oral routes of L. monocytogenes infection and will highlight recent technological advances that have made oral infection a more attractive model system.

Behaviour of Listeria monocytogenes in artisanal raw milk Pecorino Umbro cheese: a microbiological challenge test

Directory of Open Access Journals (Sweden)

Roberta Ortenzi

2015-09-01

Full Text Available In the present study, a microbiological challenge test in artificially contaminated raw milk Pecorino Umbro cheese during cheese-making was carried out. Raw ewe milk was contaminated by a suspension of particular Listeria monocytogenes strains. The number of L. monocytogenes and L. monocytogenes dynamic growth were evaluated during cheese-making and storage. A significant decrease of the viable count of L. monocytogenes was observed during ripening and L. monocytogenes viable count was below the limit of quantification during storage. The results show that the product is unable to support the growth of the pathogen.

Listeria monocytogenes en alimentos: ¿son todos los aislamientos igual de virulentos? Foodborne Listeria monocytogenes: are all the isolates equally virulent?

Directory of Open Access Journals (Sweden)

V. López

2006-12-01

Full Text Available Listeria monocytogenes es un patógeno humano que se transmite a través de los alimentos y que causa infecciones graves, con una alta tasa de mortalidad. A pesar de la ubicuidad del microorganismo, la tasa real de la enfermedad es bastante baja y se asocia casi siempre a condiciones predisponentes. Tradicionalmente se consideraba que los aislamientos presentes en los alimentos y en el ambiente tenían la misma capacidad patogénica que los aislamientos de origen clínico. Pero el análisis de mutaciones en los genes de determinados factores de virulencia (internalina, hemolisina, fosfolipasas, proteína de superficie ActA y proteína reguladora PrfA, los estudios cuantitativos realizados con cultivos celulares y la genética de poblaciones, están replanteando la discusión sobre la variabilidad de la virulencia de L. monocytogenes. A pesar de todos estos avances, no existe un único marcador que permita comprobar la virulencia de los aislamientos naturales de esta especie. Probablemente en el futuro, la combinación de diferentes marcadores moleculares permitirá detectar los alimentos contaminados sólo por los clones virulentos de L. monocytogenes, con lo que se mejorará la prevención de la listeriosis humana transmitida por alimentos.Listeria monocytogenes is a foodborne human pathogen responsible for invasive infections presenting overall a high mortality. Despite the ubiquity of the microorganism, the actual disease rate is quite low and the disease is most often associated with an underlying predisposition. Foodborne and environmental isolates were traditionally considered of similar pathogenicity compared to clinical isolates. But the analysis of mutations in the genes encoding specific virulence factors (internalin, hemolysin, phospholipases, surface protein ActA and regulator protein PrfA, quantitative studies with cell cultures and population genetics have raised considerable concerns about virulence differences among L

Genotyping of Listeria monocytogenes isolates from poultry carcasses using high resolution melting (HRM) analysis.

Science.gov (United States)

Sakaridis, Ioannis; Ganopoulos, Ioannis; Madesis, Panagiotis; Tsaftaris, Athanasios; Argiriou, Anagnostis

2014-01-02

An outbreak situation of human listeriosis requires a fast and accurate protocol for typing Listeria monocytogenes . Existing techniques are either characterized by low discriminatory power or are laborious and require several days to give a final result. Polymerase chain reaction (PCR) coupled with high resolution melting (HRM) analysis was investigated in this study as an alternative tool for a rapid and precise genotyping of L. monocytogenes isolates. Fifty-five isolates of L. monocytogenes isolated from poultry carcasses and the environment of four slaughterhouses were typed by HRM analysis using two specific markers, internalin B and ssrA genes. The analysis of genotype confidence percentage of L. monocytogenes isolates produced by HRM analysis generated dendrograms with two major groups and several subgroups. Furthermore, the analysis of the HRM curves revealed that all L. monocytogenes isolates could easily be distinguished. In conclusion, HRM was proven to be a fast and powerful tool for genotyping isolates of L. monocytogenes .

Cleaning and Disinfection of Biofilms Composed of Listeria monocytogenes and Background Microbiota from Meat Processing Surfaces

Science.gov (United States)

Møretrø, Trond; Heir, Even; Briandet, Romain; Langsrud, Solveig

2017-01-01

ABSTRACT Surfaces of food processing premises are exposed to regular cleaning and disinfection (C&D) regimes, using biocides that are highly effective against bacteria growing as planktonic cells. However, bacteria growing in surface-associated communities (biofilms) are typically more tolerant toward C&D than their individual free-cell counterparts, and survival of pathogens such as Listeria monocytogenes may be affected by interspecies interactions within biofilms. In this study, Pseudomonas and Acinetobacter were the most frequently isolated genera surviving on conveyor belts subjected to C&D in meat processing plants. In the laboratory, Pseudomonas, Acinetobacter, and L. monocytogenes dominated the community, both in suspensions and in biofilms formed on conveyor belts, when cultures were inoculated with eleven-genus cocktails of representative bacterial strains from the identified background flora. When biofilms were exposed to daily C&D cycles mimicking treatments used in food industry, the levels of Acinetobacter and Pseudomonas mandelii diminished, and biofilms were instead dominated by Pseudomonas putida (65 to 76%), Pseudomonas fluorescens (11 to 15%) and L. monocytogenes (3 to 11%). The dominance of certain species after daily C&D correlated with high planktonic growth rates at 12°C and tolerance to C&D. In single-species biofilms, L. monocytogenes developed higher tolerance to C&D over time, for both the peracetic acid and quaternary ammonium disinfectants, indicating that a broad-spectrum mechanism was involved. Survival after C&D appeared to be a common property of L. monocytogenes strains, as persistent and sporadic subtypes showed equal survival rates in complex biofilms. Biofilms established preferentially in surface irregularities of conveyor belts, potentially constituting harborage sites for persistent contamination. IMPORTANCE In the food industry, efficient production hygiene is a key measure to avoid the accumulation of spoilage bacteria and

Cleaning and disinfection of biofilms composed of Listeria monocytogenes and background microbiota from meat processing surfaces.

Science.gov (United States)

Fagerlund, Annette; Møretrø, Trond; Heir, Even; Briandet, Romain; Langsrud, Solveig

2017-06-30

Surfaces of food processing premises are exposed to regular cleaning and disinfection (C&D) regimes, using biocides that are highly effective against bacteria growing as planktonic cells. However, bacteria growing in surface associated communities (biofilms) are typically more tolerant towards C&D than their individual free cells counterparts, and survival of pathogens such as Listeria monocytogenes may be affected by interspecies interactions within biofilms. In this study, Pseudomonas and Acinetobacter were the most frequently isolated genera surviving on conveyor belts subjected to C&D in meat processing plants. In the laboratory, Pseudomonas , Acinetobacter and L. monocytogenes dominated the community both in suspensions and in biofilms formed on conveyor belts, when cultures were inoculated with eleven-genera cocktails of representative bacterial strains from the identified background flora. When biofilms were exposed to daily C&D cycles, mimicking treatments used in food industry, the levels of Acinetobacter and Pseudomonas mandelii diminished, and biofilms were instead dominated by Pseudomonas putida (65-76%), Pseudomonas fluorescens (11-15%) and L. monocytogenes (3-11%). The dominance of certain species after daily C&D correlated with high planktonic growth rates at 12°C and tolerance to C&D. In single-species biofilms, L. monocytogenes developed higher tolerance to C&D over time, both for the peracetic acid and quaternary ammonium disinfectant, indicating that a broad-spectrum mechanism was involved. Survival after C&D appeared to be a common property of L. monocytogenes strains, as both persistent and sporadic subtypes showed equal survival in complex biofilms. Biofilms established preferentially in surface irregularities of conveyor belts, potentially constituting harborage sites for persistent contamination. IMPORTANCE In food industry, efficient production hygiene is a key measure to avoid accumulation of spoilage bacteria and eliminate pathogens

Prevalence of Listeria monocytogenes in poultry production in France.

Science.gov (United States)

Chemaly, Marianne; Toquin, Marie-Therese; Le Nôtre, Yolene; Fravalo, Philippe

2008-10-01

This study aimed to update and create a data set from laying hens and broilers regarding contamination by Listeria monocytogenes. Two hundred laying-hen flocks were sampled, with 88 flocks reared in cages and 112 reared on the floor. One hundred forty-five broiler flocks were sampled, with 85 conventional and 60 free-range flocks. A total of 774 and 725 samples were analyzed from laying hens and broilers, respectively. L. monocytogenes was detected in 31 of 200 flocks, yielding an estimated prevalence of 15.5% in laying-hen flocks. Among positive flocks, there appeared a significant (P = 0.004) difference between caged and floor-reared hens, with a higher detection in dust samples from floor-reared hens. In positive caged hen flocks, significant (P = 0.028) differences between dust and fecal samples appeared, with a higher detection in feces than in dust samples. In broiler flocks, L. monocytogenes was isolated in 46 of 145 flocks, yielding an estimated prevalence of 32% (28% in conventional flocks versus 37% in the free-range flocks). L. monocytogenes was isolated in samples taken from conventional flocks with a lower frequency than in free-range flocks (13 versus 18%, respectively). The serotyping of L. monocytogenes strains showed that the majority belonged to type 1/2a in laying-hen flocks (74.3%) and in broiler flocks (40.5%). A significant difference (P = 0.007) between laying hens and broilers was shown for serogroup 4 and for serovar 1/2b (P = 0.007); these serogroups were more prevalent in broilers (40%) than in laying hens (5.7%).

PASTEURISASI HIGH TEMPERATURE SHORT TIME (HTST) SUSU TERHADAP Listeria monocytogenes PADA PENYIMPANAN REFRIGERATOR

OpenAIRE

SABIL, SYAHRIANA

2015-01-01

2015 SYAHRIANA SABIL (I 111 11 273). Pasteurisasi High Temperature Short Time (HTST) Susu terhadap Listeria monocytogenes pada Penyimpanan Refrigerator. Dibimbing oleh RATMAWATI MALAKA dan FARIDA NUR YULIATI. Pasteurisasi High Temperature Short Time (HTST) merupakan proses pemanasan susu di bawah titik didih yang diharapkan dapat membunuh Listeria monocytogenes (L. monocytogenes) karena bersifat patogen dan mengakibatkan listeriosis yang merupakan penyakit zoonosis. Tu...

Protein aggregate turbidity: Simulation of turbidity profiles for mixed-aggregation reactions.

Science.gov (United States)

Hall, Damien; Zhao, Ran; Dehlsen, Ian; Bloomfield, Nathaniel; Williams, Steven R; Arisaka, Fumio; Goto, Yuji; Carver, John A

2016-04-01

Due to their colloidal nature, all protein aggregates scatter light in the visible wavelength region when formed in aqueous solution. This phenomenon makes solution turbidity, a quantity proportional to the relative loss in forward intensity of scattered light, a convenient method for monitoring protein aggregation in biochemical assays. Although turbidity is often taken to be a linear descriptor of the progress of aggregation reactions, this assumption is usually made without performing the necessary checks to provide it with a firm underlying basis. In this article, we outline utilitarian methods for simulating the turbidity generated by homogeneous and mixed-protein aggregation reactions containing fibrous, amorphous, and crystalline structures. The approach is based on a combination of Rayleigh-Gans-Debye theory and approximate forms of the Mie scattering equations. Crown Copyright © 2015. Published by Elsevier Inc. All rights reserved.

Romer Labs RapidChek®Listeria monocytogenes Test System for the Detection of L. monocytogenes on Selected Foods and Environmental Surfaces.

Science.gov (United States)

Juck, Gregory; Gonzalez, Verapaz; Allen, Ann-Christine Olsson; Sutzko, Meredith; Seward, Kody; Muldoon, Mark T

2018-04-27

The Romer Labs RapidChek ® Listeria monocytogenes test system (Performance Tested Method ℠ 011805) was validated against the U.S. Department of Agriculture-Food Safety and Inspection Service Microbiology Laboratory Guidebook (USDA-FSIS/MLG), U.S. Food and Drug Association Bacteriological Analytical Manual (FDA/BAM), and AOAC Official Methods of Analysis ℠ (AOAC/OMA) cultural reference methods for the detection of L. monocytogenes on selected foods including hot dogs, frozen cooked breaded chicken, frozen cooked shrimp, cured ham, and ice cream, and environmental surfaces including stainless steel and plastic in an unpaired study design. The RapidChek method uses a proprietary enrichment media system, a 44-48 h enrichment at 30 ± 1°C, and detects L. monocytogenes on an immunochromatographic lateral flow device within 10 min. Different L. monocytogenes strains were used to spike each of the matrixes. Samples were confirmed based on the reference method confirmations and an alternate confirmation method. A total of 140 low-level spiked samples were tested by the RapidChek method after enrichment for 44-48 h in parallel with the cultural reference method. There were 88 RapidChek presumptive positives. One of the presumptive positives was not confirmed culturally. Additionally, one of the culturally confirmed samples did not exhibit a presumptive positive. No difference between the alternate confirmation method and reference confirmation method was observed. The respective cultural reference methods (USDA-FSIS/MLG, FDA/BAM, and AOAC/OMA) produced a total of 63 confirmed positive results. Nonspiked samples from all foods were reported as negative for L. monocytogenes by all methods. Probability of detection analysis demonstrated no significant differences in the number of positive samples detected by the RapidChek method and the respective cultural reference method.

Recombinant phage probes for Listeria monocytogenes

Science.gov (United States)

Carnazza, S.; Gioffrè, G.; Felici, F.; Guglielmino, S.

2007-10-01

Monitoring of food and environmental samples for biological threats, such as Listeria monocytogenes, requires probes that specifically bind biological agents and ensure their immediate and efficient detection. There is a need for robust and inexpensive affinity probes as an alternative to antibodies. These probes may be recruited from random peptide libraries displayed on filamentous phage. In this study, we selected from two phage peptide libraries phage clones displaying peptides capable of specific and strong binding to the L. monocytogenes cell surface. The ability of isolated phage clones to interact specifically with L. monocytogenes was demonstrated using enzyme-linked immunosorbent assay (ELISA) and confirmed by co-precipitation assay. We also assessed the sensitivity of phage-bacteria binding by PCR on phage-captured Listeria cells, which could be detected at a concentration of 104 cells ml-1. In addition, as proof-of-concept, we tested the possibility of immobilizing the affinity-selected phages to a putative biosensor surface. The quality of phage deposition was monitored by ELISA and fluorescent microscopy. Phage-bacterial binding was confirmed by high power optical phase contrast microscopy. Overall, the results of this work validate the concept of affinity-selected recombinant filamentous phages as probes for detecting and monitoring bacterial agents under any conditions that warrant their recognition, including in food products.

Marine Synechococcus Aggregation

Science.gov (United States)

Neuer, S.; Deng, W.; Cruz, B. N.; Monks, L.

2016-02-01

Cyanobacteria are considered to play an important role in the oceanic biological carbon pump, especially in oligotrophic regions. But as single cells are too small to sink, their carbon export has to be mediated by aggregate formation and possible consumption by zooplankton producing sinking fecal pellets. Here we report results on the aggregation of the ubiquitous marine pico-cyanobacterium Synechococcus as a model organism. We first investigated the mechanism behind such aggregation by studying the potential role of transparent exopolymeric particles (TEP) and the effects of nutrient (nitrogen or phosphorus) limitation on the TEP production and aggregate formation of these pico-cyanobacteria. We further studied the aggregation and subsequent settling in roller tanks and investigated the effects of the clays kaolinite and bentonite in a series of concentrations. Our results show that despite of the lowered growth rates, Synechococcus in nutrient limited cultures had larger cell-normalized TEP production, formed a greater volume of aggregates, and resulted in higher settling velocities compared to results from replete cultures. In addition, we found that despite their small size and lack of natural ballasting minerals, Synechococcus cells could still form aggregates and sink at measureable velocities in seawater. Clay minerals increased the number and reduced the size of aggregates, and their ballasting effects increased the sinking velocity and carbon export potential of aggregates. In comparison with the Synechococcus, we will also present results of the aggregation of the pico-cyanobacterium Prochlorococcus in roller tanks. These results contribute to our understanding in the physiology of marine Synechococcus as well as their role in the ecology and biogeochemistry in oligotrophic oceans.

Characterization of Listeria monocytogenes isolated from a fresh mixed sausage processing line in Pelotas-RS by PFGE

Science.gov (United States)

von Laer, Ana Eucares; de Lima, Andréia Saldanha; Trindade, Paula dos Santos; Andriguetto, Cristiano; Destro, Maria Teresa; da Silva, Wladimir Padilha

2009-01-01

Listeria monocytogenes is a bacterium capable to adhere to the surfaces of equipment and utensils and subsequently form biofilms. It can to persist in the food processing environmental for extended periods of time being able to contaminate the final product. The aim of this study was to trace the contamination route of L. monocytogenes on a fresh mixed sausage processing line, from raw material to the final product. The isolates obtained were characterized by serotyping and molecular typing by pulsed-field gel electrophoresis (PFGE) using the restriction enzymes ApaI and AscI. L. monocytogenes was detected in 25% of the samples. The samples of raw material were not contaminated, however, the microorganism was detected in 21% of the environmental samples (food contact and non-food contact), 20.8% of the equipments, 20% of the food worker’s hands, 40% of the mass ready to packaging and in all the final products samples, demonstrating that the contamination of final product occurred during the processing and the importance of cross contamination. PFGE yielded 22 pulsotypes wich formed 7 clusters, and serotyping yielded 3 serotypes and 1 serogroup, however, the presence of serotypes 4b and 1/2b in the final product is of great concern for public health. The tracing of contamination showed that some strains are adapted and persisted in the processing environment in this industry. PMID:24031402

Patterns of [PSI+] aggregation allow insights into cellular organization of yeast prion aggregates

Science.gov (United States)

Tyedmers, Jens

2012-01-01

The yeast prion phenomenon is very widespread and mounting evidence suggests that it has an impact on cellular regulatory mechanisms related to phenotypic responses to changing environments. Studying the aggregation patterns of prion amyloids during different stages of the prion life cycle is a first key step to understand major principles of how and where cells generate, organize and turn-over prion aggregates. The induction of the [PSI+] state involves the actin cytoskeleton and quality control compartments such as the Insoluble Protein Deposit (IPOD). An initially unstable transitional induction state can be visualized by overexpression of the prion determinant and displays characteristic large ring- and ribbon-shaped aggregates consisting of poorly fragmented bundles of very long prion fibrils. In the mature prion state, the aggregation pattern is characterized by highly fragmented, shorter prion fibrils that form aggregates, which can be visualized through tagging with fluorescent proteins. The number of aggregates formed varies, ranging from a single large aggregate at the IPOD to multiple smaller ones, depending on several parameters discussed. Aggregate units below the resolution of light microscopy that are detectable by fluorescence correlation spectroscopy are in equilibrium with larger aggregates in this stage and can mediate faithful inheritance of the prion state. Loss of the prion state is often characterized by reduced fragmentation of prion fibrils and fewer, larger aggregates. PMID:22449721

Viable but non-culturable Listeria monocytogenes on parsley leaves and absence of recovery to a culturable state.

Science.gov (United States)

Dreux, N; Albagnac, C; Federighi, M; Carlin, F; Morris, C E; Nguyen-the, C

2007-10-01

To investigate the presence of viable but non-culturable Listeria monocytogenes during survival on parsley leaves under low relative humidity (RH) and to evaluate the ability of L. monocytogenes to recover from VBNC to culturable state under satured humidity. Under low RH (47-69%) on parsley leaves, the initial number of L. monocytogenes populations counted on non selective media (10(9) L. monocytogenes per leaf on TSA) was reduced by 6 log10 scales in 15 days, whereas number of viable L. monocytogenes counted under the microscope was reduced by 3-4 log10 scales, indicating the presence of VBNC cells. This was demonstrated on three L. monocytogenes strains (EGDe, Bug 1995 and LmP60). Changing from low to 100% RH permitted an increase of the culturable counts of L. monocytogenes and this growth was observed only when residual culturable cells were present. Moreover, VBNC L. monocytogenes inoculated on parsley leaves did not become culturable after incubation under 100% RH. Dry conditions induced VBNC L. monocytogenes on parsley leaves but these VBNC were likely unable to recover culturability after transfer to satured humidity. Enumeration on culture media presumably under-estimates the number of viable L. monocytogenes on fresh produce after exposure to low RH.

Age-Dependent Differences in Systemic and Cell-Autonomous Immunity to L. monocytogenes

Directory of Open Access Journals (Sweden)

Ashley M. Sherrid

2013-01-01

Full Text Available Host defense against infection can broadly be categorized into systemic immunity and cell-autonomous immunity. Systemic immunity is crucial for all multicellular organisms, increasing in importance with increasing cellular complexity of the host. The systemic immune response to Listeria monocytogenes has been studied extensively in murine models; however, the clinical applicability of these findings to the human newborn remains incompletely understood. Furthermore, the ability to control infection at the level of an individual cell, known as “cell-autonomous immunity,” appears most relevant following infection with L. monocytogenes; as the main target, the monocyte is centrally important to innate as well as adaptive systemic immunity to listeriosis. We thus suggest that the overall increased risk to suffer and die from L. monocytogenes infection in the newborn period is a direct consequence of age-dependent differences in cell-autonomous immunity of the monocyte to L. monocytogenes. We here review what is known about age-dependent differences in systemic innate and adaptive as well as cell-autonomous immunity to infection with Listeria monocytogenes.

A novel suicide plasmid for efficient gene mutation in Listeria monocytogenes

Science.gov (United States)

Although several plasmids have been used in Listeria monocytogenes for generating mutants by allelic exchange, construction of L. monocytogenes mutants has been inefficient due to lack of effective selection markers for first and second recombination events. To address this problem, we have develope...

Assessment of Listeria monocytogenes virulence in the Galleria mellonella insect larvae model.

Science.gov (United States)

Rakic Martinez, Mira; Wiedmann, Martin; Ferguson, Martine; Datta, Atin R

2017-01-01

Several animal models have been used to understand the molecular basis of the pathogenicity, infectious dose and strain to strain variation of Listeria monocytogenes. The greater wax worm Galleria mellonella, as an alternative model, provides some useful advantages not available with other models and has already been described as suitable for the virulence assessment of various pathogens including L. monocytogenes. The objectives of this study are: 1) confirming the usefulness of this model with a wide panel of Listeria spp. including non-pathogenic L. innocua, L. seeligeri, L. welshimeri and animal pathogen L. ivanovii; 2) assessment of virulence of several isogenic in-frame deletion mutants in virulence and stress related genes of L. monocytogenes and 3) virulence assessment of paired food and clinical isolates of L. monocytogenes from 14 major listeriosis outbreaks occurred worldwide between 1980 and 2015. Larvae injected with different concentrations of Listeria were incubated at 37°C and monitored over seven days for time needed to kill 50% of larvae (LT50) and to determine change of bacterial population in G. mellonella, 2 and 24 hours post-inoculation. Non-pathogenic members of Listeria and L. ivanovii showed significantly (P monocytogenes strains. Isogenic mutants of L. monocytogenes with the deletions in prfA, plcA, hly, actA and virR genes, also showed significantly (P monocytogenes strains related to non-invasive (gastroenteritis) outbreaks of listeriosis showed significantly (P < 0.05) lower virulence than isolates of the same serotype obtained from outbreaks with invasive symptoms. The difference, however, was dose and strain- dependent. No significant differences in virulence were observed among the serotype tested in this study.

Lactobacillus plantarum inhibits growth of Listeria monocytogenes in an in vitro continuous flow gut model, but promotes invasion of L. monocytogenes in the gut of gnotobiotic rats

DEFF Research Database (Denmark)

Bernbom, Nete; Licht, Tine Rask; Saadbye, Peter

2006-01-01

The ability of the pediocin AcH producing Lactobacillus plantarum DDEN 11007 and its non-producing plasmid-cured isogenic variant, DDEN 12305 to prevent the persistence and growth of Listeria monocytogenes EP2 in two gastrointestinal (GI) tract models was examined. In vitro studies conducted...... in a two-stage continuous flow system showed that L. plantarum DDEN 11007 inhibited L. monocytogenes EP2 under these conditions, while less effect was seen of the non-bacteriocin producing variant. The inhibitory effect was more pronounced at pH 5 than at pH 7. No effect on persistence of L. monocytogenes...... in the GI tract was seen in gnotobiotic rats colonized with either the pediocin AcH producing or the non-bacteriocin producing variant of L. plantarum when compared to rats inoculated with L. monocytogenes EP2 alone. Surprisingly, inoculation of the gnotobiotic animals with either of the L. plantarum...

2-deoxy-D-glucose-induced metabolic stress enhances resistance to Listeria monocytogenes infection in mice

Science.gov (United States)

Miller, E. S.; Bates, R. A.; Koebel, D. A.; Fuchs, B. B.; Sonnenfeld, G.

1998-01-01

Exposure to different forms of psychological and physiological stress can elicit a host stress response, which alters normal parameters of neuroendocrine homeostasis. The present study evaluated the influence of the metabolic stressor 2-deoxy-D-glucose (2-DG; a glucose analog, which when administered to rodents, induces acute periods of metabolic stress) on the capacity of mice to resist infection with the facultative intracellular bacterial pathogen Listeria monocytogenes. Female BDF1 mice were injected with 2-DG (500 mg/kg b. wt.) once every 48 h prior to, concurrent with, or after the onset of a sublethal dose of virulent L. monocytogenes. Kinetics of bacterial growth in mice were not altered if 2-DG was applied concurrently or after the start of the infection. In contrast, mice exposed to 2-DG prior to infection demonstrated an enhanced resistance to the listeria challenge. The enhanced bacterial clearance in vivo could not be explained by 2-DG exerting a toxic effect on the listeria, based on the results of two experiments. First, 2-DG did not inhibit listeria replication in trypticase soy broth. Second, replication of L. monocytogenes was not inhibited in bone marrow-derived macrophage cultures exposed to 2-DG. Production of neopterin and lysozyme, indicators of macrophage activation, were enhanced following exposure to 2-DG, which correlated with the increased resistance to L. monocytogenes. These results support the contention that the host response to 2-DG-induced metabolic stress can influence the capacity of the immune system to resist infection by certain classes of microbial pathogens.

Single cell swimming dynamics of Listeria monocytogenes using a nanoporous microfluidic platform

Energy Technology Data Exchange (ETDEWEB)

Wright, Evan [University of Guelph, Canada; Neethirajan, Suresh [University of Guelph; Warriner, Keith [University of Guelph; Retterer, Scott T [ORNL; Srijanto, Bernadeta R [ORNL

2014-01-01

Listeria monocytogenes remains a significant foodborne pathogen due to its virulence and ability to become established in food processing facilities. The pathogen is characterized by its ability to grow over a wide temperature range and withstand a broad range of stresses. The following reports on the chemotaxis and motility of the L. monocytogenes when exposed to relatively small concentrations of acetic acid. Using the developed nanoporous microfluidic device to precisely modulate the cellular environment, we exposed the individual Listeria cells to acetic acid and, in real time and with high resolution, observed how the cells reacted to the change in their surroundings. Our results showed that concentrations of acetic acid below 10 mM had very little, if any, effect on the motility. However, when exposed to 100 mM acetic acid, the cells exhibited a sharp drop in velocity and displayed a more random pattern of motion. These results indicate that at appropriate concentrations, acetic acid has the ability to disable the flagellum of the cells, thus impairing their motility. This drop in motility has numerous effects on the cell; its main effects being the obstruction of the cell's ability to properly form biofilms and a reduction in the overall infectivity of the cells. Since these characteristics are especially useful in controlling the proliferation of L. monocytogenes, acetic acid shows potential for application in the food industry as an active compound in designing a food packaging environment and as an antimicrobial agent.

Effect of eugenol on growth and listeriolysin o production by Listeria monocytogenes

Directory of Open Access Journals (Sweden)

Cristina Tostes Filgueiras

2006-05-01

Full Text Available The inhibitory effect of eugenol, a naturally occurring compound mainly present in the essential oil fraction of cloves, was studied on the growth and listeriolysin O (LLO production by Listeria monocytogenes. Potassium efflux from cells promoted by eugenol was also determined after 24 h incubation in phosphate buffered saline. Eugenol promoted a delay on the growth of L. monocytogenes at concentrations of 100, 300 and 500 µg mL-1and above 800 µg mL-1 the effect was bactericidal. Production of LLO by L. monocytogenes in the presence of eugenol was reduced 80-100%. An accumulation of external K+ was observed above 300 µg mL-1 of eugenol which indicated that the cell membrane was affected. The results showed the effectiveness of eugenol in controlling growth and LLO production of L. monocytogenes cells.O efeito inibitório do eugenol, o principal constituinte do óleo essencial de cravo, foi avaliado sobre o crescimento e produção de listeriolisina O (LLO por Listeria monocytogenes. O efluxo de íons potássio das células também foi determinado após 24 h de incubação em solução tampão, contendo eugenol. Concentrações de 100, 300 e 500 µg mL-1 de eugenol promoveram a inibição do crescimento de L. monocytogenes e, em concentrações acima de 800 µg mL-1, constatou-se um efeito bactericida. O crescimento de L. monocytogenes na presença de eugenol resultou na inibição de 80 a 100% da produção de LLO. O efluxo de K+ promovido pelo eugenol indicou que a membrana celular foi afetada. Estes resultados indicam a efetividade do eugenol para o controle do crescimento e da produção de LLO por L. monocytogenes.

Prevalence and contamination patterns of Listeria monocytogenes in catfish processing environment and fresh fillets.

Science.gov (United States)

Chen, Bang-Yuan; Pyla, Rajkumar; Kim, Tae-Jo; Silva, Juan L; Jung, Yean-Sung

2010-08-01

Catfish skins, intestines, fresh fillets, processing surfaces at different production stages, chiller water and non-food contact surfaces were sampled for Listeria monocytogenes and other Listeria species. Among 315 samples, prevalence of L. monocytogenes, Listeria innocua and a group of Listeria seeligeri-Listeria welshimeri-Listeria ivanovii was 21.6, 13.0 and 29.5%, respectively. No Listeria grayi was detected in this survey. While no L. monocytogenes strains were isolated from catfish skins and intestines, the strains were found with a frequency of 76.7% in chilled fresh catfish fillets and 43.3% in unchilled fillets. L. monocytogenes and Listeria spp. were also detected in fish contact surfaces such as deheading machine, trimming board, chiller water, conveyor belts at different stages, and fillet weighing table. Among L. monocytogenes, 1/2b (47.0%), 3b (16.0%) and 4c (14%) were the predominant serotypes isolated, whereas 4b, 4e, 1/2c and 1/2a were detected at much lower frequencies. Genotype analyses of L. monocytogenes isolates using serotyping, pulsed-field gel electrophoresis (PFGE) and enterobacterial repetitive intergenic consensus (ERIC)-PCR revealed that chiller water represented an important contamination source of L. monocytogenes in the chilled catfish fillets of two processing facilities, whereas fillet weighing table significantly contributed to the catfish fillet contamination of the third facility. This study suggests that L. monocytogenes contamination in the processed catfish fillets originates from the processing environment, rather than directly from catfish. Results from this study can aid the catfish industry to develop a plant-specific proper cleaning and sanitation procedure for equipment and the processing environment designed to specifically target L. monocytogenes contamination. Copyright 2010 Elsevier Ltd. All rights reserved.

Efficacy of ultraviolet light exposure against survival of Listeria monocytogenes on conveyor belts.

Science.gov (United States)

Morey, Amit; McKee, Shelly R; Dickson, James S; Singh, Manpreet

2010-06-01

Listeria monocytogenes has been repeatedly isolated from foods and food-processing facilities including food contact surfaces such as conveyor belts (CB). CBs are often difficult to clean and require rigorous sanitation programs for decontamination. Ultraviolet (UV) light has exhibited microbicidal properties on food contact surfaces and this study was conducted to determine the efficacy of UV against L. monocytogenes on CB made of different materials. A four-strain cocktail of L. monocytogenes (serotypes 3A, 4A, 4B, and 4C) was made to give a suspension of approximately 10(7) CFU/mL. CBs made from four different types of materials, (1) Ropanyl DM 8/2 A2 + 04 (belt 1), (2) Volta FRMW-3.0 (belt 2), (3) Volta FRMB-3.0 (belt 3), and (4) Ropanyl DM (belt 4), were inoculated with 1 mL of the four-strain cocktail (approximately 10(7) CFU/mL) of the bacterial suspension. CBs were treated with UV light (254 nm) for 1 and 3 sec at 5.53 and 5.95 mW/cm(2). Three replications of the experiments were conducted. Two-way analysis of variance of survival populations of L. monocytogenes showed that bacterial counts were significantly reduced (p belt types irrespective of UV light intensities and times of exposure. L. monocytogenes populations were reduced (p belts 1, 2, and 3 after exposure to 5.95 mW/cm(2) UV light intensity for 3 sec. L. monocytogenes-inoculated CBs that were exposed to 5.53 mW/cm(2) showed higher (p Belt 4 showed survival populations of L. monocytogenes ranging from 1.42 to 1.73 log(10) CFU/cm(2) after UV light treatment for 1 and 3 sec. UV light can be effectively used to reduce L. monocytogenes contamination on CBs.

A multiplex PCR for detection of Listeria monocytogenes and its lineages.

Science.gov (United States)

Rawool, Deepak B; Doijad, Swapnil P; Poharkar, Krupali V; Negi, Mamta; Kale, Satyajit B; Malik, S V S; Kurkure, Nitin V; Chakraborty, Trinad; Barbuddhe, Sukhadeo B

2016-11-01

A novel multiplex PCR assay was developed to identify genus Listeria, and discriminate Listeria monocytogenes and its major lineages (LI, LII, LIII). This assay is a rapid and inexpensive subtyping method for screening and characterization of L. monocytogenes. Copyright © 2016 Elsevier B.V. All rights reserved.

Industrial disinfectants do not select for resistance in Listeria monocytogenes following long term exposure

DEFF Research Database (Denmark)

Kastbjerg, Vicky Gaedt; Gram, Lone

2012-01-01

or tolerance would evolve in L. monocytogenes under continued selection in three industrial disinfectants. L. monocytogenes EGD was exposed to Desinfect CL (hypochlorite) and Incimaxx DES (peracedic acid and hydrogen peroxide) for several hundred generations. This caused no increase in the minimal inhibitory......, and that the disinfectants are still efficient for controlling microorganisms such as L. monocytogenes....

Control of Listeria monocytogenes in turkey deli loaves using organic acids as formulation ingredients.

Science.gov (United States)

Lloyd, T; Alvarado, C Z; Brashears, M M; Thompson, L D; McKee, S R; Berrang, M

2009-10-01

The growth of Listeria monocytogenes in further-processed meat products has become a major concern and an important food safety issue. The meat and poultry industries have incorporated interventions such as organic acids in marinades to inhibit the growth of L. monocytogenes. In this study, organic acids were utilized in the raw product and as a postcook dip to determine their inhibitory effect on the growth of L. monocytogenes in turkey deli loaves. The turkey deli loaves were processed, cooked, cooled, inoculated with streptomycin-resistant L. monocytogenes, and then dipped. Treatments were potassium lactate (PL) in the raw product with sodium lactate (SL), sodium diacetate (SD) dip, PL with SL/PL/SD dip, SL with SL/SD dip, and SL with SL/PL/SD dip. There was also a positive (inoculated) and negative (noninoculated) control, which was dipped in distilled water. Days 0, 7, 14, 21, 28, 42, and 56 were sampled for L. monocytogenes. There were no differences (P>0.05) among the organic acid treatments in the turkey deli loaves at any time points; therefore, all of the treatments increased the lag phase of L. monocytogenes, extending the shelf-life of the product. However, there was a difference between the treatments and the positive control at d 7, 14, 21, 28, 42, and 56. The growth of L. monocytogenes increased immediately in the positive control, whereas the negative control appeared to have no growth. These organic acids can provide meat processors with a useful method for extending the lag phase of L. monocytogenes in ready-to-eat meat and poultry products.

L. monocytogenes in a cheese processing facility: Learning from contamination scenarios over three years of sampling.

Science.gov (United States)

Rückerl, I; Muhterem-Uyar, M; Muri-Klinger, S; Wagner, K-H; Wagner, M; Stessl, B

2014-10-17

The aim of this study was to analyze the changing patterns of Listeria monocytogenes contamination in a cheese processing facility manufacturing a wide range of ready-to-eat products. Characterization of L. monocytogenes isolates included genotyping by pulsed-field gel electrophoresis (PFGE) and multi-locus sequence typing (MLST). Disinfectant-susceptibility tests and the assessment of L. monocytogenes survival in fresh cheese were also conducted. During the sampling period between 2010 and 2013, a total of 1284 environmental samples were investigated. Overall occurrence rates of Listeria spp. and L. monocytogenes were 21.9% and 19.5%, respectively. Identical L. monocytogenes genotypes were found in the food processing environment (FPE), raw materials and in products. Interventions after the sampling events changed contamination scenarios substantially. The high diversity of globally, widely distributed L. monocytogenes genotypes was reduced by identifying the major sources of contamination. Although susceptible to a broad range of disinfectants and cleaners, one dominant L. monocytogenes sequence type (ST) 5 could not be eradicated from drains and floors. Significantly, intense humidity and steam could be observed in all rooms and water residues were visible on floors due to increased cleaning strategies. This could explain the high L. monocytogenes contamination of the FPE (drains, shoes and floors) throughout the study (15.8%). The outcome of a challenge experiment in fresh cheese showed that L. monocytogenes could survive after 14days of storage at insufficient cooling temperatures (8 and 16°C). All efforts to reduce L. monocytogenes environmental contamination eventually led to a transition from dynamic to stable contamination scenarios. Consequently, implementation of systematic environmental monitoring via in-house systems should either aim for total avoidance of FPE colonization, or emphasize a first reduction of L. monocytogenes to sites where

Native aggregation as a cause of origin of temporary cellular structures needed for all forms of cellular activity, signaling and transformations.

Science.gov (United States)

Matveev, Vladimir V

2010-06-09

According to the hypothesis explored in this paper, native aggregation is genetically controlled (programmed) reversible aggregation that occurs when interacting proteins form new temporary structures through highly specific interactions. It is assumed that Anfinsen's dogma may be extended to protein aggregation: composition and amino acid sequence determine not only the secondary and tertiary structure of single protein, but also the structure of protein aggregates (associates). Cell function is considered as a transition between two states (two states model), the resting state and state of activity (this applies to the cell as a whole and to its individual structures). In the resting state, the key proteins are found in the following inactive forms: natively unfolded and globular. When the cell is activated, secondary structures appear in natively unfolded proteins (including unfolded regions in other proteins), and globular proteins begin to melt and their secondary structures become available for interaction with the secondary structures of other proteins. These temporary secondary structures provide a means for highly specific interactions between proteins. As a result, native aggregation creates temporary structures necessary for cell activity."One of the principal objects of theoretical research in any department of knowledge is to find the point of view from which the subject appears in its greatest simplicity."Josiah Willard Gibbs (1839-1903).

Metabolic responses of primary and transformed cells to intracellular Listeria monocytogenes.

Directory of Open Access Journals (Sweden)

Nadine Gillmaier

Full Text Available The metabolic response of host cells, in particular of primary mammalian cells, to bacterial infections is poorly understood. Here, we compare the carbon metabolism of primary mouse macrophages and of established J774A.1 cells upon Listeria monocytogenes infection using (13C-labelled glucose or glutamine as carbon tracers. The (13C-profiles of protein-derived amino acids from labelled host cells and intracellular L. monocytogenes identified active metabolic pathways in the different cell types. In the primary cells, infection with live L. monocytogenes increased glycolytic activity and enhanced flux of pyruvate into the TCA cycle via pyruvate dehydrogenase and pyruvate carboxylase, while in J774A.1 cells the already high glycolytic and glutaminolytic activities hardly changed upon infection. The carbon metabolism of intracellular L. monocytogenes was similar in both host cells. Taken together, the data suggest that efficient listerial replication in the cytosol of the host cells mainly depends on the glycolytic activity of the hosts.

[Risk assessment of Listeria monocytogenes in deli meats and vegetable salads].

Science.gov (United States)

Tian, Jing; Liu, Xiu-mei

2009-09-01

To analysis risk from Listeria monocytogenes in deli meats and vegetable salads. Use Risk Ranger which is a software programme developed by the University of Hobart, Australia and answer 11 questions on affecting the risk from hazards in the specific foods by combining data from national foodborne diseases surveillance network and some references to make semi-quantitative risk assessment for the specific food. Relative risk from Listeria monocytogenes in deli meats and vegetable salads is 61 and 52, respectively. Incidence of listeriosis caused by deli meats-Listeria monocytogenes pairs and vegetable salads-Listeria monocytogenes pairs is 5.4 and 0.2 cases per million people, respectively. Risk from the former is 32 times than that from the latter. By changing the selection for some risk factors in the model, it was known that the risks from two food-hazard combinations could decrease 10 times, if taking necessary actions after processing. Deli meats is a kind of high risk food for listeriosis.

Listeria monocytogenes meningitis in the elderly: epidemiological, clinical and therapeutic findings.

Science.gov (United States)

Pagliano, Pasquale; Ascione, Tiziana; Boccia, Giovanni; De Caro, Francesco; Esposito, Silvano

2016-06-01

Listeria monocytogenes is a Gram-positive bacillus and facultative intracellular bacterium whose transmission occurs mainly through the consumption of contaminated food, L. monocytogenes invades the host cells using various protein and can escape to the human T-cell immune system by cell-to-cell spreading. If the infection is not controlled at the stage in which the bacterium is in the liver, for instance, due to a severe immunodepression, a secondary bacteraemia can be developed and L. monocytogenes reaches the preferred sites transgressing the blood-brain barrier or the placental barrier. Individuals with T-cell dysfunction, such as pregnant women, the elderly, and those receiving immunosuppressive therapy are at the highest risk of contracting the disease. Average life expectancy throughout developed countries has rapidly increased during the latter half of the 20th century and geriatric infectious diseases have become an increasingly important issue. L. monocytogenes meningitis in young previously healthy adults has been reported only in anecdotal observations. Differently, L. monocytogenes is the third most common cause of bacterial meningitis in the elderly population, after Streptococcus pneumoniae and Neisseria meningitidis. Patients with L. monocytogenes meningitis presented with signs and symptoms that were similar to those of the general population with community-acquired bacterial meningitis, but reported a longer prodromal phase. According to literature data, the prevalence of the classic triad of fever, neck stiffness, and altered mental status is 43%, and almost all patients present with at least 2 of the 4 classic symptoms of headache, fever, neck stiffness, and altered mental status. On the basis of our published data, in patients aged over 50 years, diagnosing L. monocytogenes meningitis was more challenging than pneumococcal meningitis, as demonstrated by the lower percentage of cases receiving a correct diagnosis within 48 hours from the onset

Roles of a novel Crp/Fnr family transcription factor Lmo0753 in soil survival, biofilm production and surface attachment to fresh produce of Listeria monocytogenes.

Directory of Open Access Journals (Sweden)

Joelle K Salazar

Full Text Available Listeria monocytogenes is a foodborne bacterial pathogen and the causative agent of an infectious disease, listeriosis. L. monocytogenes is ubiquitous in nature and has the ability to persist in food processing environments for extended periods of time by forming biofilms and resisting industrial sanitization. Human listeriosis outbreaks are commonly linked to contaminated dairy products, ready-to-eat meats, and in recent years, fresh produce such as lettuce and cantaloupes. We identified a putative Crp/Fnr family transcription factor Lmo0753 that is highly specific to human-associated genetic lineages of L. monocytogenes. Lmo0753 possesses two conserved functional domains similar to the major virulence regulator PrfA in L. monocytogenes. To determine if Lmo0753 is involved in environmental persistence-related mechanisms, we compared lmo0753 deletion mutants with respective wild type and complementation mutants of two fully sequenced L. monocytogenes genetic lineage II strains 10403S and EGDe for the relative ability of growth under different nutrient availability and temperatures, soil survival, biofilm productivity and attachment to select fresh produce surfaces including romaine lettuce leaves and cantaloupe rinds. Our results collectively suggested that Lmo0753 plays an important role in L. monocytogenes biofilm production and attachment to fresh produce, which may contribute to the environmental persistence and recent emergence of this pathogen in human listeriosis outbreaks linked to fresh produce.

Recombinant phage probes for Listeria monocytogenes

Energy Technology Data Exchange (ETDEWEB)

Carnazza, S; Gioffre, G; Felici, F; Guglielmino, S [Department of Microbiological, Genetic and Molecular Sciences, University of Messina, Messina (Italy)

2007-10-03

Monitoring of food and environmental samples for biological threats, such as Listeria monocytogenes, requires probes that specifically bind biological agents and ensure their immediate and efficient detection. There is a need for robust and inexpensive affinity probes as an alternative to antibodies. These probes may be recruited from random peptide libraries displayed on filamentous phage. In this study, we selected from two phage peptide libraries phage clones displaying peptides capable of specific and strong binding to the L. monocytogenes cell surface. The ability of isolated phage clones to interact specifically with L. monocytogenes was demonstrated using enzyme-linked immunosorbent assay (ELISA) and confirmed by co-precipitation assay. We also assessed the sensitivity of phage-bacteria binding by PCR on phage-captured Listeria cells, which could be detected at a concentration of 10{sup 4} cells ml{sup -1}. In addition, as proof-of-concept, we tested the possibility of immobilizing the affinity-selected phages to a putative biosensor surface. The quality of phage deposition was monitored by ELISA and fluorescent microscopy. Phage-bacterial binding was confirmed by high power optical phase contrast microscopy. Overall, the results of this work validate the concept of affinity-selected recombinant filamentous phages as probes for detecting and monitoring bacterial agents under any conditions that warrant their recognition, including in food products.

Frequency of contamination Listeria monocytogenes of raw dried cured vacuum packed sausages

Directory of Open Access Journals (Sweden)

Hristo Daskalov

2014-03-01

Full Text Available The aim of this study was to collect actual data concerning the frequency of contamination with Listeria monocytogenes of some very popular in Bulgaria raw dried cured vacuum packed sausages, produced from October 2004 till May 2008. 148 vacuum-packed samples were taken from 9 different food business operators during all seasons of the year. The samples were analyzed according to USDA method for meat foods. Ten specimens were positive for presence of Listeria monocytogenes equal to 6,75% of all tested samples. In two other raw dried cured sausages L.welshimeri and L.innocua were found, but these species are not pathogenic for consumers. In the period before the official implementation of HACCP system (01.01.2006 in Bulgaria, 52 samples were examined and 5 Listeria monocytogenes isolates were found (~10%. 2,5 years after the HACCP implementation, 96 specimens from the same meat factories were tested and 5 Listeria monocytogenes isolates (5,2% were detected. Samples taken from lots, produced in winter time were contaminated with Listeria monocytogenes more often (7 of all 10 than specimens taken during other seasons. Data were discussed through the point of view of the effectiveness of hygienic practices and HACCP system application. Also, application of ‘microbiological criterion’ set in COMMISSION REGULATION (EC No 2073/2005 for ready-to-eat foods unable to support the growth of L. monocytogenes was considered.

Suppression of Listeria monocytogenes by the Native Micro-Flora in Teewurst Sausage.

Science.gov (United States)

Austin-Watson, Clytrice; Grant, Ar'Quette; Brice, Michline

2013-10-21

Modern consumers are interested in the use of non-chemical methods to control pathogens when heat sterilization is not an option. Such is the case with teewurst sausage, a raw spreadable sausage and a popular German commodity. Although Listeria was not found in teewurst, the optimal microbial growing conditions of teewurst coupled with the ubiquity of L. monocytogenes in nature, makes the possibility of contamination of products very possible. This pilot study was conducted to examine teewurst's native micro-flora's ability to suppress the outgrowth of L. monocytogenes at 10 °C using standard plate counts and PCR-DGGE. Traditional plating methods showed L. monocytogenes growth significantly decreased when in competition with the teewurst's native micro-flora ( p flora of the teewurst suppressed the overall growth of L. monocytogenes by an average of two logs, under these conditions. Denaturing Gradient Gel Electrophoresis (DGGE) amplicons with unique banding patterns were extracted from DGGE gel for identification. Brochothrix thermosphacta and Lactobacillus curvatus were identified as a part of the teewurst's native micro-flora. Although the native micro-flora did not decrease L. monocytogenes to below limits of detection, it was enough of a decrease to warrant further investigation.

Inhibitory Effect of Nisin on Listeria monocytogenes Inoculated into Surimi and Minced Meat

Directory of Open Access Journals (Sweden)

Masoud Rezaei

2012-02-01

Full Text Available Background & Objective: Listeria monocytogenes has already established as an important food born pathogen which induce listeriosis in human. Use of bacteriocins to provide food safety has been increased dramatically. Nisin has a wide spectrum inhibitory effect than the other bacteriocins and inhibits food-borne pathogens such as L. monocytogenes and many other Gram-positive spoilage microorganisms. The purpose of this study was to investigate the inhibitory effect of Nisin on population of Listeria monocytogenes and the role of changes in food components on the antilisterial properties of Nisin. Materials & Methods: The minced meat and surimi samples were inoculated by 1×104 cfu/g of L. monocytogenes. Then samples exposed to Nisin at the levels of 500 or 1000 IU/g were prepared. All treatments after packaging in plastic bags were kept for 12 days at refrigerator temperature. Samples were cultured on CHROMagarTM Listeria every 2 days and the number of listeria monocytogenes was counted. Results: two different concentrations of Nisin (500 or 1000 IU/g was not able to inhibit L. monocytogenes below the acceptable level for raw food (100 cells per g in minced meat and surimi of silver carp. But the number of bacteria reduces more in fish surimi as compared to the mince meal. Also, antilisterial activity of Nisin was reduced during the storage period. Conclusion: Inhibitory property of Nisin against L. monocytogenes in surimi significantly was higher than the minced (P<0.05. So it is possible the antilisterial properties of Nisin will increase by elimination of some enzymes during processing.

Prevalence of the lmo0036-0043 gene cluster encoding arginine deiminase and agmatine deiminase systems in Listeria monocytogenes.

Science.gov (United States)

Chen, Jianshun; Chen, Fan; Cheng, Changyong; Fang, Weihuan

2013-04-01

Arginine deiminase and agmatine deiminase systems are involved in acid tolerance, and their encoding genes form the cluster lmo0036-0043 in Listeria monocytogenes. While lmo0042 and lmo0043 were conserved in all L. monocytogenes strains, the lmo0036-0041 region of this cluster was identified in all lineages I and II, and the majority of lineage IV (83.3%) strains, but absent in all lineage III and a small fraction of lineage IV (16.7%) strains, suggesting that the presence of the complete lmo0036-0043 cluster is dependent on lineages. lmo0036-0043-complete and -deficient lineage IV strains exhibit specific ascB-dapE profiles, which might represent two subpopulations with distinct genetic characteristics.

An insight into the isolation, enumeration and molecular detection of Listeria monocytogenes in food

Directory of Open Access Journals (Sweden)

Jodi Woan-Fei Law

2015-11-01

Full Text Available Listeria monocytogenes, a foodborne pathogen that can cause listeriosis through the consumption of food contaminated with this pathogen. The ability of L. monocytogenes to survive in extreme conditions and cause food contaminations have become a major concern. Hence, routine microbiological food testing is necessary to prevent food contamination and outbreaks of foodborne illness. This review provides insight into the methods for cultural detection, enumeration and molecular identification of L. monocytogenes in various food samples. There are a number of enrichment and plating media that can be used for the isolation of L. monocytogenes from food samples. Enrichment media such as buffered Listeria Enrichment Broth (BLEB, Fraser broth and University of Vermont Medium (UVM Listeria enrichment broth are recommended by regulatory agencies such as FDA-BAM, USDA-FSIS and ISO. Many plating media are available for the isolation of L. monocytogenes, for instance, PALCAM, Oxford and other chromogenic media. Besides, reference methods like FDA-BAM, ISO 11290 method and USDA-FSIS method are usually applied for the cultural detection or enumeration of L. monocytogenes. MPN technique is applied for the enumeration of L. monocytogenes in the case of low level contamination. Molecular methods including polymerase chain reaction (PCR, multiplex polymerase chain reaction (mPCR, real-time/quantitative polymerase chain reaction (qPCR, nucleic acid sequence-based amplification (NASBA, loop-mediated isothermal amplification (LAMP, DNA microarray and Next Generation Sequencing (NGS technology for the detection and identification of L. monocytogenes are discussed in this review. Overall, molecular methods are rapid, sensitive, specific, time- and labour-saving. In future, there are chances for the development of new techniques for the detection and identification of foodborne with improved features.

Incidence of Listeria monocytogenes and Listeria spp. in a small-scale mushroom production facility.

Science.gov (United States)

Viswanath, Prema; Murugesan, Latha; Knabel, Stephen J; Verghese, Bindhu; Chikthimmah, Naveen; Laborde, Luke F

2013-04-01

Listeria monocytogenes is a foodborne pathogen of significant concern to the agricultural and food processing industry because of its ability to grow and persist in cool and moist environments and its association with listeriosis, a disease with a very high mortality rate. Although there have been no listeriosis outbreaks attributed to fresh mushrooms in the United States, retail surveys and recalls are evidence that L. monocytogenes contamination of mushrooms (Agaricus bisporus) can occur. The objective of this study was to determine the prevalence of Listeria spp., including L. monocytogenes, in a small-scale mushroom production facility on the campus of the Pennsylvania State University in the United States. Of 184 samples taken from five production zones within the facility, 29 (15.8%) samples were positive for Listeria spp. Among the Listeria spp. isolates, L. innocua was most prevalent (10.3%) followed by L. welshimeri (3.3%), L. monocytogenes (1.6%), and L. grayi (0.5%). L. monocytogenes was recovered only from the phase I raw material composting area. Isolates of L. monocytogenes were confirmed and serotyped by multiplex PCR. The epidemiological relatedness of the three L. monocytogenes isolates to those serotypes or lineages frequently encountered in listeriosis infections was determined by multi-virulence-locus sequence typing using six virulence genes, namely, prfA, inlB, inlC, dal, clpP, and lisR. The phylogenetic positions of the three isolates in the dendrogram prepared with data from other isolates of L. monocytogenes showed that all isolates were grouped with serotype 4a, lineage IIIA. To date, this serotype has rarely been reported in foodborne disease outbreaks.

Inhibition of Listeria monocytogenes on cooked cured chicken breasts by acidified coating containing allyl isothiocyanate or deodorized Oriental mustard extract.

Science.gov (United States)

Olaimat, Amin N; Holley, Richard A

2016-08-01

Ready-to-eat meats are considered foods at high risk to cause life-threatening Listeria monocytogenes infections. This study screened 5 L. monocytogenes strains for their ability to hydrolyze sinigrin (a glucosinolate in Oriental mustard), which formed allyl isothiocyanate (AITC) and reduced L. monocytogenes viability on inoculated vacuum-packed, cooked, cured roast chicken slices at 4 °C. Tests involved incorporation of 25-50 μl/g AITC directly or 100-250 mg/g Oriental mustard extract in 0.5% (w/v) κ-carrageenan/2% (w/v) chitosan-based coatings prepared using 1.5% malic or acetic acid. L. monocytogenes strains hydrolyzed 33.6%-48.4% pure sinigrin in MH broth by 21 d at 25 °C. Acidified κ-carrageenan/chitosan coatings containing 25-50 μl/g AITC or 100-250 mg/g mustard reduced the viability of L. monocytogenes and aerobic bacteria on cooked, cured roast chicken slices by 4.1 to >7.0 log10 CFU/g compared to uncoated chicken stored at 4 °C for 70 d. Coatings containing malic acid were significantly more antimicrobial than those with acetic acid. During storage for 70 d, acidified κ-carrageenan/chitosan coatings containing 25-50 μl/g AITC or 250 mg/g mustard extract reduced lactic acid bacteria (LAB) numbers 3.8 to 5.4 log10 CFU/g on chicken slices compared to uncoated samples. Acidified κ-carrageenan/chitosan-based coatings containing either AITC or Oriental mustard extract at the concentrations tested had the ability to control L. monocytogenes viability and delay growth of potential spoilage bacteria on refrigerated, vacuum-packed cured roast chicken. Copyright © 2016. Published by Elsevier Ltd.

Prior frozen storage enhances the effect of edible coatings against Listeria monocytogenes on cold-smoked salmon during subsequent refrigerated storage.

Science.gov (United States)

Ye, M; Neetoo, H; Chen, H

2011-10-01

Listeria monocytogenes is a major safety concern for ready-to-eat foods. The overall objective of this study was to investigate whether prior frozen storage could enhance the efficacy of edible coatings against L. monocytogenes on cold-smoked salmon during subsequent refrigerated storage. A formulation consisting of sodium lactate (SL, 1·2-2·4%) and sodium diacetate (SD, 0·125-0·25%) or 2·5% Opti.Form (a commercial formulation of SL and SD) was incorporated into each of five edible coatings: alginate, κ-carrageenan, pectin, gelatin and starch. The coatings were applied onto the surface of cold-smoked salmon slices inoculated with L. monocytogenes at a level of 500 CFU cm⁻². In the first phase, the slices were first frozen at -18°C for 6 days and stored at 22°C for 6 days. Alginate, gelatin and starch appeared to be the most effective carriers. In the second phase, cold-smoked salmon slices were inoculated with L. monocytogenes, coated with alginate, gelatin or starch with or without the antimicrobials and stored frozen at -18°C for 12 months. Every 2 months, samples were removed from the freezer and kept at 4°C for 30 days. Prior frozen storage at -18°C substantially enhanced the antilisterial efficacy of the edible coatings with or without antimicrobials during the subsequent refrigerated storage. Plain coatings with ≥ 2 months frozen storage and antimicrobial edible coatings represent an effective intervention to inhibit the growth of L. monocytogenes on cold-smoked salmon. This study demonstrates the effectiveness of the conjunct application of frozen storage and edible coatings to control the growth of L. monocytogenes to enhance the microbiological safety of cold-smoked salmon. © 2011 The Authors. Journal of Applied Microbiology © 2011 The Society for Applied Microbiology.

An ecological perspective of Listeria monocytogenes biofilms in food processing facilities.

Science.gov (United States)

Valderrama, Wladir B; Cutter, Catherine N

2013-01-01

Listeria monocytogenes can enter the food chain at virtually any point. However, food processing environments seem to be of particular importance. From an ecological point of view, food processing facilities are microbial habitats that are constantly disturbed by cleaning and sanitizing procedures. Although L. monocytogenes is considered ubiquitous in nature, it is important to recognize that not all L. monocytogenes strains appear to be equally distributed; the distribution of the organism seems to be related to certain habitats. Currently, no direct evidence exists that L. monocytogenes-associated biofilms have played a role in food contamination or foodborne outbreaks, likely because biofilm isolation and identification are not part of an outbreak investigation, or the definition of biofilm is unclear. Because L. monocytogenes is known to colonize surfaces, we suggest that contamination patterns may be studied in the context of how biofilm formation is influenced by the environment within food processing facilities. In this review, direct and indirect epidemiological and phenotypic evidence of lineage-related biofilm formation capacity to specific ecological niches will be discussed. A critical view on the development of the biofilm concept, focused on the practical implications, strengths, and weaknesses of the current definitions also is discussed. The idea that biofilm formation may be an alternative surrogate for microbial fitness is proposed. Furthermore, current research on the influence of environmental factors on biofilm formation is discussed.

Antimicrobial treatments to control Listeria monocytogenes in queso fresco.

Science.gov (United States)

Lourenço, António; Kamnetz, Mary B; Gadotti, Camila; Diez-Gonzalez, Francisco

2017-06-01

Queso fresco, is a Hispanic non-fermented cheese highly susceptible to contamination with L. monocytogenes. This research was aimed to determine the effect of GRAS antimicrobial ingredients to control L. monocytogenes. Antimicrobials included caprylic acid (CA), Nisaplin ® (N, 2.5% nisin), a mixture of sodium lactate and sodium diacetate (SL/SD), Lactococcus lactis sbp. lactis DPC 3147, monolaurin, and lactic acid (LA). Batches of queso fresco curds were inoculated with 10 4  CFU/g and stored at 4 °C for three weeks. During storage the count of L. monocytogenes reached 7 to 8 Log CFU/g in control samples. Most individual antimicrobial treatments resulted in less than 1 Log CFU/g reductions in final counts, with the exception of N (0.5 g/kg) and CA (2.9 g/kg) that caused more than 3 and 5 Log CFU/g differences with controls, respectively. Mixtures of ingredients were more effective in inhibiting L. monocytogenes growth, and treatments with N and CA consistently delivered 6 Log CFU/g less counts than controls. Supplementation of 12 g/kg LA to treatments with SL/SD (3%/0.22%) caused differences of more than 4 Log CFU/g in final Listeria populations. Samples treated with the binary mixtures of N and CA (0.5 and 0.7 g/kg, respectively) were evaluated in a consumer panel (n = 67). Panelists slightly preferred control and commercial over treated samples, but all samples were in average rated between "slightly liking" and "moderately liking." These experiments indicated that combined use of antimicrobial ingredients may be an effective way to control the population of Listeria monocytogenes in queso fresco. Copyright © 2016 Elsevier Ltd. All rights reserved.

Kinetics of aggregation with choice.

Science.gov (United States)

Ben-Naim, E; Krapivsky, P L

2016-12-01

We generalize the ordinary aggregation process to allow for choice. In ordinary aggregation, two random clusters merge and form a larger aggregate. In our implementation of choice, a target cluster and two candidate clusters are randomly selected and the target cluster merges with the larger of the two candidate clusters. We study the long-time asymptotic behavior and find that as in ordinary aggregation, the size density adheres to the standard scaling form. However, aggregation with choice exhibits a number of different features. First, the density of the smallest clusters exhibits anomalous scaling. Second, both the small-size and the large-size tails of the density are overpopulated, at the expense of the density of moderate-size clusters. We also study the complementary case where the smaller candidate cluster participates in the aggregation process and find an abundance of moderate clusters at the expense of small and large clusters. Additionally, we investigate aggregation processes with choice among multiple candidate clusters and a symmetric implementation where the choice is between two pairs of clusters.

Evaluation of DNA extraction methods for PCR-based detection of Listeria monocytogenes from vegetables.

Science.gov (United States)

Vojkovska, H; Kubikova, I; Kralik, P

2015-03-01

Epidemiological data indicate that raw vegetables are associated with outbreaks of Listeria monocytogenes. Therefore, there is a demand for the availability of rapid and sensitive methods, such as PCR assays, for the detection and accurate discrimination of L. monocytogenes. However, the efficiency of PCR methods can be negatively affected by inhibitory compounds commonly found in vegetable matrices that may cause false-negative results. Therefore, the sample processing and DNA isolation steps must be carefully evaluated prior to the introduction of such methods into routine practice. In this study, we compared the ability of three column-based and four magnetic bead-based commercial DNA isolation kits to extract DNA of the model micro-organism L. monocytogenes from raw vegetables. The DNA isolation efficiency of all isolation kits was determined using a triplex real-time qPCR assay designed to specifically detect L. monocytogenes. The kit with best performance, the PowerSoil(™) Microbial DNA Isolation Kit, is suitable for the extraction of amplifiable DNA from L. monocytogenes cells in vegetable with efficiencies ranging between 29.6 and 70.3%. Coupled with the triplex real-time qPCR assay, this DNA isolation kit is applicable to the samples with bacterial loads of 10(3) bacterial cells per gram of L. monocytogenes. Several recent outbreaks of Listeria monocytogenes have been associated with the consumption of fruits and vegetables. Real-time PCR assays allow fast detection and accurate quantification of microbes. However, the success of real-time PCR is dependent on the success with which template DNA can be extracted. The results of this study suggest that the PowerSoil(™) Microbial DNA Isolation Kit can be used for the extraction of amplifiable DNA from L. monocytogenes cells in vegetable with efficiencies ranging between 29.6 and 70.3%. This method is applicable to samples with bacterial loads of 10(3) bacterial cells per gram of L. monocytogenes. © 2014

In vitro activity of naturally occurring peptides (defensins against Listeria monocytogenes Ação in vitro de peptídeos naturais (defensinas sobre Listeria monocytogenes

Directory of Open Access Journals (Sweden)

Maria da Graça F. Nascimento

1994-12-01

Full Text Available Autoclaved distilled water samples were inoculated with L. monocytogenes strain V7 and strain VPH-1, and incubated aerobically, at 30 C for 48 hours. Each strain was tested individually, and growth curves were determined at 1, 2, 3, 4, 5, 21, 24, and 48 hours. The growth or survival of L. monocytogenes was similar for both strains, with survivors at 24 hour-incubation. The microbicidal activity of one synthetic cationic peptide (NP-2 was examined against L. monocytogenes strain V7, in a water system. Antibacterial activity of NP-2 (1, 5, and 10 g/ml was best expressed at 60 minute-incubation, with 10 g/ml of peptide, at 30 C.Amostras de água destilada, autoclavadas, foram inoculadas com L. monocytogenes cepa V7 e cepa VPH-1, e incubadas, aerobicamente, a 30ºC por 48 horas. Cada cepa foi testada individualmente, e determinou-se curvas de crescimento a 1, 2, 3, 4, 5, 21, 24, e 48 horas. O crescimento ou sobrevivência das duas cepas foi semelhante e encontrou-se sobreviventes em 24 horas de incubação. Examinou-se a atividade bactericida de um dos peptídeos catiônicos sintéticos (NP-2 contra L. monocytogenes cepa V7, em sistema aquoso. A atividade antibacteriana de NP-2 (1, 5, and 10µg/ml foi melhor aos 60 minutos de incubação, com 10µg/ml de peptídeo, a 30 C.

Prevalence and Persistence of Listeria monocytogenes in Ready-to-Eat Tilapia Sashimi Processing Plants.

Science.gov (United States)

Chen, Bang-Yuan; Wang, Chung-Yi; Wang, Chia-Lan; Fan, Yang-Chi; Weng, I-Ting; Chou, Chung-Hsi

2016-11-01

A 2-year study was performed at two ready-to-eat tilapia sashimi processing plants (A and B) to identify possible routes of contamination with Listeria monocytogenes during processing. Samples were collected from the aquaculture environments, transportation tanks, processing plants, and final products. Seventy-nine L. monocytogenes isolates were found in the processing environments and final products; 3.96% (50 of 1,264 samples) and 3.86% (29 of 752 samples) of the samples from plants A and B, respectively, were positive for L. monocytogenes . No L. monocytogenes was detected in the aquaculture environments or transportation tanks. The predominant L. monocytogenes serotypes were 1/2b (55.70%) and 4b (37.97%); serotypes 3b and 4e were detected at much lower percentages. At both plants, most processing sections were contaminated with L. monocytogenes before the start of processing, which indicated that the cleaning and sanitizing methods did not achieve adequate pathogen removal. Eleven seropulsotypes were revealed by pulsed-field gel electrophoresis and serotyping. Analysis of seropulsotype distribution revealed that the contamination was disseminated by the processing work; the same seropulsotypes were repeatedly found along the work flow line and in the final products. Specific seropulsotypes were persistently found during different sampling periods, which suggests that the sanitation procedures or equipment used at these plants were inadequate. Plant staff should improve the sanitation procedures and equipment to reduce the risk of L. monocytogenes cross-contamination and ensure the safety of ready-to-eat tilapia products.

Prevalence and antimicrobial resistance of Listeria monocytogenes isolated in chicken slaughterhouses in Northern Greece.

Science.gov (United States)

Sakaridis, I; Soultos, N; Iossifidou, E; Papa, A; Ambrosiadis, I; Koidis, P

2011-06-01

This study was conducted to determine the prevalence and antimicrobial resistance of Listeria monocytogenes recovered from chicken carcasses in slaughterhouses in Northern Greece. A total of 100 poultry samples (300 carcasses) were examined for Listeria spp. The samples were neck skin taken from four different slaughterhouses in Northern Greece. Forty samples were also taken from the environment of the slaughterhouses. Identification of L. monocytogenes was carried out by PCR and fingerprinting of the isolates by random amplified polymorphic DNA. L. monocytogenes strains isolated from chicken carcasses and from the environment of the slaughterhouses were also examined for antibiotic resistance. Fifty-five isolates of L. monocytogenes were tested for susceptibility to 20 antibiotics using the disk diffusion method. Listeria spp. were present in 99 of the poultry samples tested (99%), and 38 yielded L monocytogenes (38%). L. monocytogenes was also isolated in 80% of samples from the environment of a certain slaughterhouse, while the other slaughterhouses were found to be contaminated only with Listeria spp. All isolates were resistant to nalidixic acid and oxolinic acid, the majority of them to clindamycin, and only a few to tetracycline and oxytetracycline, whereas they were found to be susceptible to all other antimicrobials. The results of this study demonstrate a high prevalence of L. monocytogenes contamination in chicken carcasses, and all isolates were found to be sensitive to the antimicrobials most commonly used to treat human listeriosis.

Listeria monocytogenes in Food-Processing Facilities, Food Contamination, and Human Listeriosis: The Brazilian Scenario.

Science.gov (United States)

Camargo, Anderson Carlos; Woodward, Joshua John; Call, Douglas Ruben; Nero, Luís Augusto

2017-11-01

Listeria monocytogenes is a foodborne pathogen that contaminates food-processing environments and persists within biofilms on equipment, utensils, floors, and drains, ultimately reaching final products by cross-contamination. This pathogen grows even under high salt conditions or refrigeration temperatures, remaining viable in various food products until the end of their shelf life. While the estimated incidence of listeriosis is lower than other enteric illnesses, infections caused by L. monocytogenes are more likely to lead to hospitalizations and fatalities. Despite the description of L. monocytogenes occurrence in Brazilian food-processing facilities and foods, there is a lack of consistent data regarding listeriosis cases and outbreaks directly associated with food consumption. Listeriosis requires rapid treatment with antibiotics and most drugs suitable for Gram-positive bacteria are effective against L. monocytogenes. Only a minority of clinical antibiotic-resistant L. monocytogenes strains have been described so far; whereas many strains recovered from food-processing facilities and foods exhibited resistance to antimicrobials not suitable against listeriosis. L. monocytogenes control in food industries is a challenge, demanding proper cleaning and application of sanitization procedures to eliminate this foodborne pathogen from the food-processing environment and ensure food safety. This review focuses on presenting the L. monocytogenes distribution in food-processing environment, food contamination, and control in the food industry, as well as the consequences of listeriosis to human health, providing a comparison of the current Brazilian situation with the international scenario.

Listeria monocytogenes response regulators important for stress tolerance and pathogenesis

DEFF Research Database (Denmark)

Kallipolitis, B H; Ingmer, H

2001-01-01

Environmental sensing by two-component signal transduction systems is likely to play a role for growth and survival of Listeria monocytogenes both during transmission in food products and within a host organism. Two-component systems typically consist of a membrane-associated sensor histidine...... kinase and a gene regulatory protein, the response regulator (RR). We have identified seven putative RR genes in L. monocytogenes LO28 by PCR using degenerate oligonucleotide primers. By insertional inactivation we obtained data suggesting that three of the putative RRs contribute to the pathogenicity...... of L. monocytogenes in mice. Strikingly, the mutants that were attenuated in virulence also had a decreased ability to grow in the presence of various stress conditions potentially encountered in an infection process. Thus, our data point to a connection between the ability of the putative two...

Native aggregation as a cause of origin of temporary cellular structures needed for all forms of cellular activity, signaling and transformations

Directory of Open Access Journals (Sweden)

Matveev Vladimir V

2010-06-01

Full Text Available Abstract According to the hypothesis explored in this paper, native aggregation is genetically controlled (programmed reversible aggregation that occurs when interacting proteins form new temporary structures through highly specific interactions. It is assumed that Anfinsen's dogma may be extended to protein aggregation: composition and amino acid sequence determine not only the secondary and tertiary structure of single protein, but also the structure of protein aggregates (associates. Cell function is considered as a transition between two states (two states model, the resting state and state of activity (this applies to the cell as a whole and to its individual structures. In the resting state, the key proteins are found in the following inactive forms: natively unfolded and globular. When the cell is activated, secondary structures appear in natively unfolded proteins (including unfolded regions in other proteins, and globular proteins begin to melt and their secondary structures become available for interaction with the secondary structures of other proteins. These temporary secondary structures provide a means for highly specific interactions between proteins. As a result, native aggregation creates temporary structures necessary for cell activity. "One of the principal objects of theoretical research in any department of knowledge is to find the point of view from which the subject appears in its greatest simplicity." Josiah Willard Gibbs (1839-1903

Performance of Isfahan North Wastewater Treatment Plant in the Removal of Listeria monocytogenes

Directory of Open Access Journals (Sweden)

nahid Navijouy

2013-08-01

Full Text Available Listeria and in particular Listeria monocytogenes is considered a ubiquitous foodborne pathogen which can lead listeriosis in human and animals. Listeriosis can be serious and may cause meningitis, septicemia and abortion in pregnant women. Although wastewater or sludge may contaminate foods of plant origin, there are no data on occurrence of Listeria spp. in wastewater and sludge in Iran. The purpose of current investigation was to study the occurrence of Listeria spp. in various samples of wastewater and sludge in Isfahan North wastewater treatment plant. Influent, effluent, raw sludge and dried sludge samples were collected from Isfahan North municipal wastewater treatment plant. L. monocytogenes were enumerated by a three–tube most probable number (MPN assay using enrichment Fraser broth. A total of 65 various samples from five step in 13 visits were collected. The presence of Listeria spp. also was determined using USDA procedure. Then, phenotypically identified L. monocytogenes were further confirmed by Polymerase Chain Reaction amplification. L. monocytogenes isolated from 76.9%, 38.5%, 84.6%, 69.2% and 46.2% of influent, effluent, raw sludge, stabilized sludge and dried sludge respectively. The efficiency of wastewater treatment processes, digester tank and drying bed in removal L. monocytogenes were 69.6%, 64.7% and 73.4% respectively. All phenotypically identified L. monocytogenes were further confirmed by Polymerase Chain Reaction. The results of present study have shown that Listeriaspp. and L. monocytogenes in particular, were present in wastewater treatment plant effluents and sludge at high level. The bacteria may spread on agriculture land and contaminate foods of plant origin. This may cause a risk of spreading disease to human and animals.

A dynamical systems approach to actin-based motility in Listeria monocytogenes

Science.gov (United States)

Hotton, S.

2010-11-01

A simple kinematic model for the trajectories of Listeria monocytogenes is generalized to a dynamical system rich enough to exhibit the resonant Hopf bifurcation structure of excitable media and simple enough to be studied geometrically. It is shown how L. monocytogenes trajectories and meandering spiral waves are organized by the same type of attracting set.

Longitudinal monitoring of Listeria monocytogenes and Listeria phages in seafood processing environments in Thailand.

Science.gov (United States)

Vongkamjan, Kitiya; Benjakul, Soottawat; Kim Vu, Hue Thi; Vuddhakul, Varaporn

2017-09-01

Listeria monocytogenes is a foodborne pathogen commonly found in environments of seafood processing, thus presenting a challenge for eradication from seafood processing facilities. Monitoring the prevalence and subtype diversity of L. monocytogenes together with phages that are specific to Listeria spp. ("Listeria phages") will provide knowledge on the bacteria-phage ecology in food processing plants. In this work, a total of 595 samples were collected from raw material, finished seafood products and environmental samples from different sites of a seafood processing plant during 17 sampling visits in 1.5 years of study. L. monocytogenes and Listeria spp. (non-monocytogenes) were found in 22 (3.7%) and 43 (7.2%) samples, respectively, whereas 29 Listeria phages were isolated from 9 (1.5%) phage-positive samples. DNA fingerprint analysis of L. monocytogenes isolates revealed 11 Random Amplified Polymorphic DNA (RAPD) profiles, with two subtypes were frequently observed over time. Our data reveal a presence of Listeria phages within the same seafood processing environments where a diverse set of L. monocytogenes subtypes was also found. Although serotype 4b was observed at lower frequency, data indicate that isolates from this seafood processing plant belonged to both epidemiologically important serotypes 1/2a and 4b, which may suggest a potential public health risk. Phages (all showed a unique genome size of 65 ± 2 kb) were classified into 9 host range groups, representing both broad- and narrow-host range. While most L. monocytogenes isolates from this facility were susceptible to phages, five isolates showed resistance to 12-20 phages. Variations in phage host range among Listeria phages isolated from food processing plant may affect a presence of a diverse set of L. monocytogenes isolates derived from the same processing environment in Thailand. Copyright © 2017 Elsevier Ltd. All rights reserved.

An insight into the isolation, enumeration, and molecular detection of Listeria monocytogenes in food

Science.gov (United States)

Law, Jodi Woan-Fei; Ab Mutalib, Nurul-Syakima; Chan, Kok-Gan; Lee, Learn-Han

2015-01-01

Listeria monocytogenes, a foodborne pathogen that can cause listeriosis through the consumption of food contaminated with this pathogen. The ability of L. monocytogenes to survive in extreme conditions and cause food contaminations have become a major concern. Hence, routine microbiological food testing is necessary to prevent food contamination and outbreaks of foodborne illness. This review provides insight into the methods for cultural detection, enumeration, and molecular identification of L. monocytogenes in various food samples. There are a number of enrichment and plating media that can be used for the isolation of L. monocytogenes from food samples. Enrichment media such as buffered Listeria enrichment broth, Fraser broth, and University of Vermont Medium (UVM) Listeria enrichment broth are recommended by regulatory agencies such as Food and Drug Administration-bacteriological and analytical method (FDA-BAM), US Department of Agriculture-Food and Safety (USDA-FSIS), and International Organization for Standardization (ISO). Many plating media are available for the isolation of L. monocytogenes, for instance, polymyxin acriflavin lithium-chloride ceftazidime aesculin mannitol, Oxford, and other chromogenic media. Besides, reference methods like FDA-BAM, ISO 11290 method, and USDA-FSIS method are usually applied for the cultural detection or enumeration of L. monocytogenes. most probable number technique is applied for the enumeration of L. monocytogenes in the case of low level contamination. Molecular methods including polymerase chain reaction, multiplex polymerase chain reaction, real-time/quantitative polymerase chain reaction, nucleic acid sequence-based amplification, loop-mediated isothermal amplification, DNA microarray, and next generation sequencing technology for the detection and identification of L. monocytogenes are discussed in this review. Overall, molecular methods are rapid, sensitive, specific, time- and labor-saving. In future, there are

MicroRNA-146a Deficiency Protects against Listeria monocytogenes Infection by Modulating the Gut Microbiota

Directory of Open Access Journals (Sweden)

Chong-Tao Du

2018-03-01

Full Text Available The gut microbiota and microRNAs play important roles in the defense against infection. However, the role of miR-146a in L. monocytogenes infection and gut microbiota remains unclear. We tried to determine whether miR-146a controlled L. monocytogenes infection by regulating the gut microbiota. Wild-type and miR-146a-deficient mice or macrophages were used to characterize the impact of miR-146a on animal survival, cell death, bacterial clearance, and gut microbiota following L. monocytogenes challenge. We found that L. monocytogenes infection induced miR-146a expression both in vitro and in vivo. When compared to wild-type mice, miR-146a-deficient mice were more resistant to L. monocytogenes infection. MiR-146a deficiency in macrophages resulted in reduced invasion and intracellular survival of L. monocytogenes. High-throughput sequencing of 16S rRNA revealed that the gut microbiota composition differed between miR-146a-deficient and wild-type mice. Relative to wild-type mice, miR-146a-deficient mice had decreased levels of the Proteobacteria phylum, Prevotellaceae family, and Parasutterella genus, and significantly increased short-chain fatty acid producing bacteria, including the genera Alistipes, Blautia, Coprococcus_1, and Ruminococcus_1. Wild-type mice co-housed with miR-146a-deficient mice had increased resistance to L. monocytogenes, indicating that miR-146a deficiency guides the gut microbiota to alleviate infection. Together, these results suggest that miR-146a deficiency protects against L. monocytogenes infection by regulating the gut microbiota.

MicroRNA-146a Deficiency Protects against Listeria monocytogenes Infection by Modulating the Gut Microbiota.

Science.gov (United States)

Du, Chong-Tao; Gao, Wei; Ma, Ke; Yu, Shui-Xing; Li, Na; Yan, Shi-Qing; Zhou, Feng-Hua; Liu, Zhen-Zhen; Chen, Wei; Lei, Lian-Cheng; Yang, Yong-Jun; Han, Wen-Yu

2018-03-26

The gut microbiota and microRNAs play important roles in the defense against infection. However, the role of miR-146a in L. monocytogenes infection and gut microbiota remains unclear. We tried to determine whether miR-146a controlled L. monocytogenes infection by regulating the gut microbiota. Wild-type and miR-146a-deficient mice or macrophages were used to characterize the impact of miR-146a on animal survival, cell death, bacterial clearance, and gut microbiota following L. monocytogenes challenge. We found that L. monocytogenes infection induced miR-146a expression both in vitro and in vivo. When compared to wild-type mice, miR-146a-deficient mice were more resistant to L. monocytogenes infection. MiR-146a deficiency in macrophages resulted in reduced invasion and intracellular survival of L. monocytogenes . High-throughput sequencing of 16S rRNA revealed that the gut microbiota composition differed between miR-146a-deficient and wild-type mice. Relative to wild-type mice, miR-146a-deficient mice had decreased levels of the Proteobacteria phylum, Prevotellaceae family, and Parasutterella genus, and significantly increased short-chain fatty acid producing bacteria, including the genera Alistipes , Blautia , Coprococcus_1, and Ruminococcus_1 . Wild-type mice co-housed with miR-146a-deficient mice had increased resistance to L. monocytogenes , indicating that miR-146a deficiency guides the gut microbiota to alleviate infection. Together, these results suggest that miR-146a deficiency protects against L. monocytogenes infection by regulating the gut microbiota.

Suppression of Listeria monocytogenes by the Native Micro-Flora in Teewurst Sausage

Directory of Open Access Journals (Sweden)

Michline Brice

2013-10-01

Full Text Available Modern consumers are interested in the use of non-chemical methods to control pathogens when heat sterilization is not an option. Such is the case with teewurst sausage, a raw spreadable sausage and a popular German commodity. Although Listeria was not found in teewurst, the optimal microbial growing conditions of teewurst coupled with the ubiquity of L. monocytogenes in nature, makes the possibility of contamination of products very possible. This pilot study was conducted to examine teewurst’s native micro-flora’s ability to suppress the outgrowth of L. monocytogenes at 10 °C using standard plate counts and PCR-DGGE. Traditional plating methods showed L. monocytogenes growth significantly decreased when in competition with the teewurst’s native micro-flora (p < 0.05. The native micro-flora of the teewurst suppressed the overall growth of L. monocytogenes by an average of two logs, under these conditions. Denaturing Gradient Gel Electrophoresis (DGGE amplicons with unique banding patterns were extracted from DGGE gel for identification. Brochothrix thermosphacta and Lactobacillus curvatus were identified as a part of the teewurst’s native micro-flora. Although the native micro-flora did not decrease L. monocytogenes to below limits of detection, it was enough of a decrease to warrant further investigation.

A Novel Role of Listeria monocytogenes Membrane Vesicles in Inhibition of Autophagy and Cell Death.

Science.gov (United States)

Vdovikova, Svitlana; Luhr, Morten; Szalai, Paula; Nygård Skalman, Lars; Francis, Monika K; Lundmark, Richard; Engedal, Nikolai; Johansson, Jörgen; Wai, Sun N

2017-01-01

Bacterial membrane vesicle (MV) production has been mainly studied in Gram-negative species. In this study, we show that Listeria monocytogenes , a Gram-positive pathogen that causes the food-borne illness listeriosis, produces MVs both in vitro and in vivo . We found that a major virulence factor, the pore-forming hemolysin listeriolysin O (LLO), is tightly associated with the MVs, where it resides in an oxidized, inactive state. Previous studies have shown that LLO may induce cell death and autophagy. To monitor possible effects of LLO and MVs on autophagy, we performed assays for LC3 lipidation and LDH sequestration as well as analysis by confocal microscopy of HEK293 cells expressing GFP-LC3. The results revealed that MVs alone did not affect autophagy whereas they effectively abrogated autophagy induced by pure LLO or by another pore-forming toxin from Vibrio cholerae , VCC. Moreover, Listeria monocytogenes MVs significantly decreased Torin1-stimulated macroautophagy. In addition, MVs protected against necrosis of HEK293 cells caused by the lytic action of LLO. We explored the mechanisms of LLO-induced autophagy and cell death and demonstrated that the protective effect of MVs involves an inhibition of LLO-induced pore formation resulting in inhibition of autophagy and the lytic action on eukaryotic cells. Further, we determined that these MVs help bacteria to survive inside eukaryotic cells (mouse embryonic fibroblasts). Taken together, these findings suggest that intracellular release of MVs from L. monocytogenes may represent a bacterial strategy to survive inside host cells, by its control of LLO activity and by avoidance of destruction from the autophagy system during infection.

A Novel Role of Listeria monocytogenes Membrane Vesicles in Inhibition of Autophagy and Cell Death

Directory of Open Access Journals (Sweden)

Svitlana Vdovikova

2017-05-01

Full Text Available Bacterial membrane vesicle (MV production has been mainly studied in Gram-negative species. In this study, we show that Listeria monocytogenes, a Gram-positive pathogen that causes the food-borne illness listeriosis, produces MVs both in vitro and in vivo. We found that a major virulence factor, the pore-forming hemolysin listeriolysin O (LLO, is tightly associated with the MVs, where it resides in an oxidized, inactive state. Previous studies have shown that LLO may induce cell death and autophagy. To monitor possible effects of LLO and MVs on autophagy, we performed assays for LC3 lipidation and LDH sequestration as well as analysis by confocal microscopy of HEK293 cells expressing GFP-LC3. The results revealed that MVs alone did not affect autophagy whereas they effectively abrogated autophagy induced by pure LLO or by another pore-forming toxin from Vibrio cholerae, VCC. Moreover, Listeria monocytogenes MVs significantly decreased Torin1-stimulated macroautophagy. In addition, MVs protected against necrosis of HEK293 cells caused by the lytic action of LLO. We explored the mechanisms of LLO-induced autophagy and cell death and demonstrated that the protective effect of MVs involves an inhibition of LLO-induced pore formation resulting in inhibition of autophagy and the lytic action on eukaryotic cells. Further, we determined that these MVs help bacteria to survive inside eukaryotic cells (mouse embryonic fibroblasts. Taken together, these findings suggest that intracellular release of MVs from L. monocytogenes may represent a bacterial strategy to survive inside host cells, by its control of LLO activity and by avoidance of destruction from the autophagy system during infection.

CPAD, Curated Protein Aggregation Database: A Repository of Manually Curated Experimental Data on Protein and Peptide Aggregation.

Science.gov (United States)

Thangakani, A Mary; Nagarajan, R; Kumar, Sandeep; Sakthivel, R; Velmurugan, D; Gromiha, M Michael

2016-01-01

Accurate distinction between peptide sequences that can form amyloid-fibrils or amorphous β-aggregates, identification of potential aggregation prone regions in proteins, and prediction of change in aggregation rate of a protein upon mutation(s) are critical to research on protein misfolding diseases, such as Alzheimer's and Parkinson's, as well as biotechnological production of protein based therapeutics. We have developed a Curated Protein Aggregation Database (CPAD), which has collected results from experimental studies performed by scientific community aimed at understanding protein/peptide aggregation. CPAD contains more than 2300 experimentally observed aggregation rates upon mutations in known amyloidogenic proteins. Each entry includes numerical values for the following parameters: change in rate of aggregation as measured by fluorescence intensity or turbidity, name and source of the protein, Uniprot and Protein Data Bank codes, single point as well as multiple mutations, and literature citation. The data in CPAD has been supplemented with five different types of additional information: (i) Amyloid fibril forming hexa-peptides, (ii) Amorphous β-aggregating hexa-peptides, (iii) Amyloid fibril forming peptides of different lengths, (iv) Amyloid fibril forming hexa-peptides whose crystal structures are available in the Protein Data Bank (PDB) and (v) Experimentally validated aggregation prone regions found in amyloidogenic proteins. Furthermore, CPAD is linked to other related databases and resources, such as Uniprot, Protein Data Bank, PUBMED, GAP, TANGO, WALTZ etc. We have set up a web interface with different search and display options so that users have the ability to get the data in multiple ways. CPAD is freely available at http://www.iitm.ac.in/bioinfo/CPAD/. The potential applications of CPAD have also been discussed.

Light-induced aggregation of microbial exopolymeric substances.

Science.gov (United States)

Sun, Luni; Xu, Chen; Zhang, Saijin; Lin, Peng; Schwehr, Kathleen A; Quigg, Antonietta; Chiu, Meng-Hsuen; Chin, Wei-Chun; Santschi, Peter H

2017-08-01

Sunlight can inhibit or disrupt the aggregation process of marine colloids via cleavage of high molecular weight compounds into smaller, less stable fragments. In contrast, some biomolecules, such as proteins excreted from bacteria can form aggregates via cross-linking due to photo-oxidation. To examine whether light-induced aggregation can occur in the marine environment, we conducted irradiation experiments on a well-characterized protein-containing exopolymeric substance (EPS) from the marine bacterium Sagitulla stellata. Our results show that after 1 h sunlight irradiation, the turbidity level of soluble EPS was 60% higher than in the dark control. Flow cytometry also confirmed that more particles of larger sized were formed by sunlight. In addition, we determined a higher mass of aggregates collected on filter in the irradiated samples. This suggests light can induce aggregation of this bacterial EPS. Reactive oxygen species hydroxyl radical and peroxide played critical roles in the photo-oxidation process, and salts assisted the aggregation process. The observation that Sagitulla stellata EPS with relatively high protein content promoted aggregation, was in contrast to the case where no significant differences were found in the aggregation of a non-protein containing phytoplankton EPS between the dark and light conditions. This, together with the evidence that protein-to-carbohydrate ratio of aggregates formed under light condition is significantly higher than that formed under dark condition suggest that proteins are likely the important component for aggregate formation. Light-induced aggregation provides new insights into polymer assembly, marine snow formation, and the fate/transport of organic carbon and nitrogen in the ocean. Copyright © 2017 Elsevier Ltd. All rights reserved.

Persistent and transient Listeria monocytogenes strains from retail deli environments vary in their ability to adhere and form biofilms and rarely have inlA premature stop codons.

Science.gov (United States)

Wang, Jingjin; Ray, Andrea J; Hammons, Susan R; Oliver, Haley F

2015-02-01

Based on recent risk assessments, up to 83% of listeriosis cases from deli meat in the United States are predicted to be from ready-to-eat deli meats contaminated during processing at retail grocery stores. Listeria monocytogenes is known to use sanitizer tolerance and biofilm formation to survive, but interplay of these mechanisms along with virulence potential and persistence mechanisms specific to deli environments had yet to be elucidated. In this study, 442 isolates from food and nonfood contact surfaces in 30 retail delis over 9 months were tested for inlA premature stop codons (PMSCs); inlA encodes InlA, which is necessary to cause listeriosis. A total of 96 isolates, composed of 23 persistent and 73 transient strains, were tested for adhesion and biofilm-forming ability and sanitizer tolerance. Only 10/442 isolates had inlA PMSCs (pdelis with other persistent strains. Most (7/10) PMSC-containing isolates were collected from food contact surfaces (pdelis (p<0.05). Persistent strains had enhanced adhesion on day 1 of a 5-day adhesion-biofilm formation assay. However, there was no significant difference in sanitizer tolerance between persistent and transient strains. Results suggest that foods contaminated with persistent L. monocytogenes strains from the retail environment are (1) likely to have wild-type virulence potential and (2) may persist due to increased adhesion and biofilm formation capacity rather than sanitizer tolerance, thus posing a significant public health risk.

Self-aggregation of magnetic semiconductor EuS nanocrystals

International Nuclear Information System (INIS)

Tanaka, Atsushi; Hasegawa, Yasuchika; Kamikubo, Hironari; Kataoka, Mikio; Kawai, Tsuyoshi

2009-01-01

Controlled formation of aggregates having organized structure of cube-shaped EuS nanocrystals is reported. The EuS aggregates in liquid media (methanol) were obtained by means of van der Waals interaction between EuS nanocrystals. The packing structure of the EuS aggregates is characterized with transmission electron microscopy (TEM) and small angle X-ray scattering measurements (SAXS). TEM image indicates the EuS nanocrystals form self-aggregated 2D orthogonal lattice structure. The diffraction peak of (111) of SAXS profile shows that the cube-shaped EuS form 3D cubic superlattice. We successfully demonstrated that the aggregates of cube-shaped EuS nanocrystals formed cubic stacking structure.

Solar irradiance limits the long-term survival of Listeria monocytogenes in seawater.

Science.gov (United States)

NicAogáin, K; Magill, D; O'Donoghue, B; Conneely, A; Bennett, C; O'Byrne, C P

2018-03-01

Seafood has often been implicated in outbreaks of food-borne illness caused by Listeria monocytogenes but the source of contamination is usually not known. In this study we investigated the possibility that this pathogen could survive in seawater for an extended time period. Freshly collected seawater samples were inoculated with 1 × 10 8  CFU per ml of L. monocytogenes EGD-e and survival was monitored by plate counting for up to 25 days. When incubated in the dark, either at ambient temperatures (4-14°C) or at 16°C, >10 4  CFU per ml survivors were present after 25 days. However, when the seawater cell suspensions were exposed to ambient light (solar irradiation) and temperatures, L. monocytogenes lost viability rapidly and no survivors could be detected after the 80 h time point. Both UV-A and visible light in the blue region of the spectrum (470 nm) were found to contribute to this effect. The stress inducible sigma factor σ B was found to play a role in survival of L. monocytogenes in seawater. Together these data demonstrate that solar irradiation is a critical determinant of L. monocytogenes survival in marine environments. The data further suggest the possibility of controlling this food-borne pathogen in food-processing environments using visible light. Listeria monocytogenes is a food-borne bacterial pathogen capable of causing the life-threatening infection, listeriosis. In seafood the route of contamination from the environment is often not well understood as this pathogen is not generally thought to survive well in seawater. Here we provide evidence that L. monocytogenes is capable of surviving for long periods of time in seawater when light is excluded. Sunlight is demonstrated to have a significant effect on the survival of this pathogen in seawater, and both visible (470 nm) and UV-A light are shown to contribute to this effect. © 2017 The Society for Applied Microbiology.

Assessment of Listeria monocytogenes virulence in the Galleria mellonella insect larvae model.

Directory of Open Access Journals (Sweden)

Mira Rakic Martinez

Full Text Available Several animal models have been used to understand the molecular basis of the pathogenicity, infectious dose and strain to strain variation of Listeria monocytogenes. The greater wax worm Galleria mellonella, as an alternative model, provides some useful advantages not available with other models and has already been described as suitable for the virulence assessment of various pathogens including L. monocytogenes. The objectives of this study are: 1 confirming the usefulness of this model with a wide panel of Listeria spp. including non-pathogenic L. innocua, L. seeligeri, L. welshimeri and animal pathogen L. ivanovii; 2 assessment of virulence of several isogenic in-frame deletion mutants in virulence and stress related genes of L. monocytogenes and 3 virulence assessment of paired food and clinical isolates of L. monocytogenes from 14 major listeriosis outbreaks occurred worldwide between 1980 and 2015. Larvae injected with different concentrations of Listeria were incubated at 37°C and monitored over seven days for time needed to kill 50% of larvae (LT50 and to determine change of bacterial population in G. mellonella, 2 and 24 hours post-inoculation. Non-pathogenic members of Listeria and L. ivanovii showed significantly (P < 0.05 higher LT50 (lower virulence than the wild type L. monocytogenes strains. Isogenic mutants of L. monocytogenes with the deletions in prfA, plcA, hly, actA and virR genes, also showed significantly (P < 0.05 higher LT50 than the wild type strain at the inoculum of 106CFU/larva. Food isolates had significantly (P < 0.05 lower virulence than the paired clinical isolates, at all three inoculum concentrations. L. monocytogenes strains related to non-invasive (gastroenteritis outbreaks of listeriosis showed significantly (P < 0.05 lower virulence than isolates of the same serotype obtained from outbreaks with invasive symptoms. The difference, however, was dose and strain- dependent. No significant differences in

Listeria monocytogenes serotype prevalence and biodiversity in diverse food products.

Science.gov (United States)

Hadjilouka, Agni; Andritsos, Nikolaos D; Paramithiotis, Spiros; Mataragas, Marios; Drosinos, Eleftherios H

2014-12-01

The aim of this study was to assess serotype prevalence and biodiversity of Listeria monocytogenes strains isolated from diverse food products, i.e., minced pork, fruits, and vegetables. Three hundred twenty-six samples previously purchased from supermarkets and street markets within the Athens area were studied for L. monocytogenes prevalence. A total of 121 strains were isolated from the 36 samples that were positive for L. monocytogenes. Serotyping was performed with multiplex PCR, and biodiversity was assessed with random amplified polymorphic DNA (RAPD) PCR analysis using M13, UBC155, and HLWL85 as primers and with repetitive element palindromic (rep) PCR analysis using (GTG)5 as the primer. The majority (17 of 22) of the contaminated minced pork samples contained strains identified as serotype 1/2a, either alone or in combination with strains belonging to serotypes 1/2b, 4a, 4c, or 4ab. However, all L. monocytogenes isolates from fruits and vegetables belonged to serotype 4b. Rep-PCR provided better differentiation of the isolates than did RAPD PCR and resulted in discrimination of the isolates into a larger number of unique profiles. Complete differentiation was achieved only with the combination of these subtyping techniques.

Monitoring occurrence and persistence of Listeria monocytogenes in foods and food processing environments in the Republic of Ireland

Directory of Open Access Journals (Sweden)

Dara eLeong

2014-08-01

Full Text Available Although rates of listeriosis are low in comparison to other foodborne pathogenic illnesses, listeriosis poses a significant risk to human health as the invasive form can have a mortality rate as high as 30%. Food processors, especially those who produce ready-to-eat products, need to be vigilant against Listeria monocytogenes, the causative pathogen of listeriosis, and as such, the occurrence of L. monocytogenes in food and in the food processing environment needs to be carefully monitored. To examine the prevalence and patterns of contamination in food processing facilities in Ireland, 48 food processors submitted 8 samples every 2 months from March 2013 to March 2014 to be analyzed for L. monocytogenes. No positive samples were detected for 38% of the processing facilities tested. Isolates found at the remaining 62% of facilities were characterized by serotyping and Pulsed Field Gel Electrophoresis (PFGE. A general L. monocytogenes prevalence of 4.6% was seen in all samples analyzed with similar rates seen in food and environmental samples. Differences in prevalence were seen across different food processors, food sectors, sampling months etc. and PFGE analysis allowed for the examination of contamination patterns and for the identification of several persistent strains. Seven of the food processing facilities tested showed contamination with persistent strains and evidence of bacterial transfer from the processing environment to food (the same pulsotype found in both was seen in four of the food processing facilities tested.

Monitoring occurrence and persistence of Listeria monocytogenes in foods and food processing environments in the Republic of Ireland.

Science.gov (United States)

Leong, Dara; Alvarez-Ordóñez, Avelino; Jordan, Kieran

2014-01-01

Although rates of listeriosis are low in comparison to other foodborne pathogenic illness, listeriosis poses a significant risk to human health as the invasive form can have a mortality rate as high as 30%. Food processors, especially those who produce ready-to-eat (RTE) products, need to be vigilant against Listeria monocytogenes, the causative pathogen of listeriosis, and as such, the occurrence of L. monocytogenes in food and in the food processing environment needs to be carefully monitored. To examine the prevalence and patterns of contamination in food processing facilities in Ireland, 48 food processors submitted 8 samples every 2 months from March 2013 to March 2014 to be analyzed for L. monocytogenes. No positive samples were detected at 38% of the processing facilities tested. Isolates found at the remaining 62% of facilities were characterized by serotyping and Pulsed Field Gel Electrophoresis (PFGE). A general L. monocytogenes prevalence of 4.6% was seen in all samples analyzed with similar rates seen in food and environmental samples. Differences in prevalence were seen across different food processors, food sectors, sampling months etc. and PFGE analysis allowed for the examination of contamination patterns and for the identification of several persistent strains. Seven of the food processing facilities tested showed contamination with persistent strains and evidence of bacterial transfer from the processing environment to food (the same pulsotype found in both) was seen in four of the food processing facilities tested.

COMPARISON OF TWO METHODS FOR THE DETECTION OF LISTERIA MONOCYTOGENES

Directory of Open Access Journals (Sweden)

G. Tantillo

2013-02-01

Full Text Available The aim of this study was to compare the performance of the conventional methods for detection of Listeria monocytogenes in food using media Oxford and ALOA (Agar Listeria acc. to Ottaviani & Agosti in according to the ISO 11290-1 to a new chromogenic medium “CHROMagar Listeria” standardized in 2005 AFNOR ( CHR – 21/1-12/01. A total of 40 pre-packed ready-to-eat food samples were examined. Using two methods six samples were found positive for Listeria monocytogenes but the medium “CHROMagar Listeria” was more selective in comparison with the others. In conclusion this study has demonstrated that isolation medium able to target specifically the detection of L. monocytogenes such as “CHROMagar Listeria” is highly recommendable because of that detection time is significantly reduced and the analysis cost is less expensive.

Phenotypic and Genotypic Characteristics of Listeria monocytogenes Isolated From Dairy and Meat Products

Directory of Open Access Journals (Sweden)

Bahador

2015-08-01

Full Text Available Background Listeria monocytogenes is a foodborne pathogen and a serious threat to the public health in the world. Consumption of traditional foods such as dairy and meat products can be a major reason for relative abundance and isolation of these bacteria. Objectives The purpose of this study was to determine the phenotypic and genotypic characteristics of L. monocytogenes strains isolated from dairy and meat products. Materials and Methods A total of 317 dairy products and meat-processed samples were collected. Antibiotic susceptibility test was performed on each sample by the disk diffusion method (Kirby Bauer. Five reference loci were used for typing of L. monocytogenes strains by MLVA (Multiple Locus VNTR Analysis Technique. Results A total of 24 L. monocytogenes isolates were collected from the dairy and meat products. Resistance of isolated L. monocytogenes strains to penicillin G were 54.54% (from dairy products and 46.15% (from processed meat. Genetic relatedness of isolates were assessed by MLVA. Out of 13 different types, type 2 with 6 strains and type 3 with 4 strains, were the most common types. Conclusions MLVA analysis showed that samples obtained from different sources could have similar genetic profile. As a result, administration of penicillin in patients with listeriosis (especially pregnant women and antibiotic susceptibility test are recommended. The fast and accurate methods such as MLVA for tracking of pollution sources of L. monocytogenes are recommended during outbreaks.

Antimicrobial activity of chitosan coatings and films against Listeria monocytogenes on black radish.

Science.gov (United States)

Jovanović, Gordana D; Klaus, Anita S; Nikšić, Miomir P

2016-01-01

The antibacterial activity of chitosan coatings prepared with acetic or lactic acid, as well as of composite chitosan-gelatin films prepared with essential oils, was evaluated in fresh shredded black radish samples inoculated with Listeria monocytogenes ATCC 19115 and L. monocytogenes ATCC 19112 during seven days of storage at 4°C. The chitosan coating prepared with acetic acid showed the most effective antibacterial activity. All tested formulations of chitosan films exhibited strong antimicrobial activity on the growth of L. monocytogenes on black radish, although a higher inhibition of pathogens was achieved at higher concentrations of chitosan. The antimicrobial effect of chitosan films was even more pronounced with the addition of essential oils. Chitosan-gelatin films with thyme essential oils showed the most effective antimicrobial activity. A reduction of 2.4log10CFU/g for L. monocytogenes ATCC 19115 and 2.1log10CFU/g for L. monocytogenes ATCC 19112 was achieved in the presence of 1% chitosan film containing 0.2% of thyme essential oil after 24h of storage. Copyright © 2016 Asociación Argentina de Microbiología. Publicado por Elsevier España, S.L.U. All rights reserved.

Lineage specific recombination rates and microevolution in Listeria monocytogenes

Directory of Open Access Journals (Sweden)

Nightingale Kendra K

2008-10-01

Full Text Available Abstract Background The bacterium Listeria monocytogenes is a saprotroph as well as an opportunistic human foodborne pathogen, which has previously been shown to consist of at least two widespread lineages (termed lineages I and II and an uncommon lineage (lineage III. While some L. monocytogenes strains show evidence for considerable diversification by homologous recombination, our understanding of the contribution of recombination to L. monocytogenes evolution is still limited. We therefore used STRUCTURE and ClonalFrame, two programs that model the effect of recombination, to make inferences about the population structure and different aspects of the recombination process in L. monocytogenes. Analyses were performed using sequences for seven loci (including the house-keeping genes gap, prs, purM and ribC, the stress response gene sigB, and the virulence genes actA and inlA for 195 L. monocytogenes isolates. Results Sequence analyses with ClonalFrame and the Sawyer's test showed that recombination is more prevalent in lineage II than lineage I and is most frequent in two house-keeping genes (ribC and purM and the two virulence genes (actA and inlA. The relative occurrence of recombination versus point mutation is about six times higher in lineage II than in lineage I, which causes a higher genetic variability in lineage II. Unlike lineage I, lineage II represents a genetically heterogeneous population with a relatively high proportion (30% average of genetic material imported from external sources. Phylograms, constructed with correcting for recombination, as well as Tajima's D data suggest that both lineages I and II have suffered a population bottleneck. Conclusion Our study shows that evolutionary lineages within a single bacterial species can differ considerably in the relative contributions of recombination to genetic diversification. Accounting for recombination in phylogenetic studies is critical, and new evolutionary models that

Viral Aggregation: Impact on Virus Behavior in the Environment.

Science.gov (United States)

Gerba, Charles P; Betancourt, Walter Q

2017-07-05

Aggregates of viruses can have a significant impact on quantification and behavior of viruses in the environment. Viral aggregates may be formed in numerous ways. Viruses may form crystal like structures and aggregates in the host cell during replication or may form due to changes in environmental conditions after virus particles are released from the host cells. Aggregates tend to form near the isoelectric point of the virus, under the influence of certain salts and salt concentrations in solution, cationic polymers, and suspended organic matter. The given conditions under which aggregates form in the environment are highly dependent on the type of virus, type of salts in solution (cation, anion. monovalent, divalent) and pH. However, virus type greatly influences the conditions when aggregation/disaggregation will occur, making predictions difficult under any given set of water quality conditions. Most studies have shown that viral aggregates increase the survival of viruses in the environment and resistance to disinfectants, especially with more reactive disinfectants. The presence of viral aggregates may also result in overestimation of removal by filtration processes. Virus aggregation-disaggregation is a complex process and predicting the behavior of any individual virus is difficult under a given set of environmental circumstances without actual experimental data.

Rapid colorimetric assay for detection of Listeria monocytogenes in food samples using LAMP formation of DNA concatemers and gold nanoparticle-DNA probe complex

Science.gov (United States)

Wachiralurpan, Sirirat; Sriyapai, Thayat; Areekit, Supatra; Sriyapai, Pichapak; Augkarawaritsawong, Suphitcha; Santiwatanakul, Somchai; Chansiri, Kosum

2018-04-01

ABSTRACT Listeria monocytogenes is a major foodborne pathogen of global health concern. Herein, the rapid diagnosis of L. monocytogenes has been achieved using loop-mediated isothermal amplification (LAMP) based on the phosphatidylcholine-phospholipase C gene (plcB). Colorimetric detection was then performed through the formation of DNA concatemers and a gold nanoparticle/DNA probe complex (GNP/DNA probe). The overall detection process was accomplished within approximately 1 h with no need for complicated equipment. The limits of detection for L. monocytogenes in the forms of purified genomic DNA and pure culture were 800 fg and 2.82 CFU mL-1, respectively. No cross reactions were observed from closely related bacteria species. The LAMP-GNP/DNA probe assay was applied to the detection of 200 raw chicken meat samples and compared to routine standard methods. The data revealed that the specificity, sensitivity and accuracy were 100%, 90.20% and 97.50%, respectively. The present assay was 100% in conformity with LAMP-agarose gel electrophoresis assay. Five samples that were negative by both assays appeared to have the pathogen at below the level of detection. The assay can be applied as a rapid direct screening method for L. monocytogenes.

[Occurrence and typing of Listeria monocytogenes isolated from raw cow's milk collected on farms and from vending machines].

Science.gov (United States)

Gelbícová, T; Karpísková, R

2012-04-01

Evaluation of the incidence and characteristics of L. monocytogenes in samples of raw cow's milk collected on farms (bulk tank milk samples) and from vending machines. Detection of L. monocytogenes and enumeration were carried out according to EN/ISO 11290--1, 2. Strains were characterised by serotyping and macrorestriction analysis using pulsed-field gel electrophoresis. The presence of L. monocytogenes was detected in 3,2 % (11/346) of bulk tank milk samples and 1,8 % (4/219) samples of raw cow's milk from vending machines. Findings of L. monocytogenes in raw milk were sporadic. Only on one farm strains of L. monocytogenes were detected repeatedly. Thirteen strains of L. monocytogenes belonged to serotype 1/2a, two strains to serotype 1/2b and one to serotype 4b. Macrorestriction analysis revealed considerable heterogeinity of profiles, with nine different pulsotypes being detected. Pulsotype 711 was the most frequent. This pulsotype was found on three different farms. The incidence of L. monocytogenes in raw cow's milk is relatively low in the Czech Republic. The results confirmed that some clones of L. monocytogenes from raw milk are identical with food and human strains.

An exact approach for aggregated formulations

DEFF Research Database (Denmark)

Gamst, Mette; Spoorendonk, Simon; Røpke, Stefan

Aggregating formulations is a powerful approach for problems to take on tractable forms. Aggregation may lead to loss of information, i.e. the aggregated formulation may be an approximation of the original problem. In branch-and-bound context, aggregation can also complicate branching, e.g. when...... optimality cannot be guaranteed by branching on aggregated variables. We present a generic exact solution method to remedy the drawbacks of aggregation. It combines the original and aggregated formulations and applies Benders' decomposition. We apply the method to the Split Delivery Vehicle Routing Problem....

In vitro detection of pathogenic Listeria monocytogenes from food sources by conventional, molecular and cell culture method

Directory of Open Access Journals (Sweden)

J.A. Khan

2013-09-01

Full Text Available Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO. A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG; R: CCTCCAGAGTGATCGATGTT complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR. PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%, followed by fish meat (4.0%, and then beef (2.5%. Among various milk and milk products, curd (2.0% showed the highest prevalence, followed by raw milk (1.3%. The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 µL and 50 µL of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro resulted positive in twenty four

Gram-positive bacteria persisting in the food production environment

DEFF Research Database (Denmark)

Knøchel, Susanne; Harmsen, Morten; Knudsen, Bettina

2008-01-01

Many gram-positive bacteria are able to form aggregates or biofilms and resist external stress factors and some gram-positive pathogenic bacteria such as Listeria monocytogenes and Bacillus cereus may persist in the food production environment for extended periods. Most research has focussed...

Listeria monocytogenes and Listeria spp. contamination patterns in retail delicatessen establishments in three U.S. states.

Science.gov (United States)

Simmons, Courtenay; Stasiewicz, Matthew J; Wright, Emily; Warchocki, Steven; Roof, Sherry; Kause, Janell R; Bauer, Nathan; Ibrahim, Salam; Wiedmann, Martin; Oliver, Haley F

2014-11-01

Postprocessing contamination in processing plants has historically been a significant source of Listeria monocytogenes in ready-to-eat delicatessen meats, and therefore a major cause of human listeriosis cases and outbreaks. Recent risk assessments suggest that a majority of human listeriosis cases linked to consumption of contaminated deli meats may be due to L. monocytogenes contamination that occurs at the retail level. To better understand the ecology and transmission of Listeria spp. in retail delicatessens, food and nonfood contact surfaces were tested for L. monocytogenes and other Listeria spp. in a longitudinal study conducted in 30 retail delis in three U.S. states. In phase I of the study, seven sponge samples were collected monthly for 3 months in 15 delis (5 delis per state) prior to start of daily operation; in phase II, 28 food contact and nonfood contact sites were sampled in each of 30 delis during daily operation for 6 months. Among the 314 samples collected during phase I, 6.8% were positive for L. monocytogenes. Among 4,503 samples collected during phase II, 9.5% were positive for L. monocytogenes; 9 of 30 delis showed low L. monocytogenes prevalence (Listeria spp. isolates, including 184 Listeria innocua, 48 Listeria seeligeri, and 13 Listeria welshimeri were characterized. Pulsed-field gel electrophoresis (PFGE) was used to characterize 446 L. monocytogenes isolates. PFGE showed that for 12 of 30 delis, one or more PFGE types were isolated on at least three separate occasions, providing evidence for persistence of a given L. monocytogenes subtype in the delis. For some delis, PFGE patterns for isolates from nonfood contact surfaces were distinct from patterns for occasional food contact surface isolates, suggesting limited cross-contamination between these sites in some delis. This study provides longitudinal data on L. monocytogenes contamination patterns in retail delis, which should facilitate further development of control strategies in

LACTIC FLORA-LISTERIA MONOCYTOGENES INTERACTION

Directory of Open Access Journals (Sweden)

S. Colombo

2012-08-01

Full Text Available The EC Regulation 2073/2005 (1 requires that food processors evaluate the capability of ready-to-use (RTE products to support the development of Listeria monocytogenes when their pH and aW values are favourable to the growth of this microorganism. It is renown that the lactic flora plays an important role in many different foods, both from a technological and a food safety standpoint. This study was aimed to observe the behaviour and the potential anti-Listeria effect of some natural lactic flora present in Italian liver patè crostini (chicken heart and liver, anchovies, onions, capers, starch, no added preservatives through the Combase Predictor – Max Growth Rate predictive software. The natural lactic flora of the crostini demonstrated a variable capability to inhibit the growth of Listeria monocytogenes which depends upon : the concentration of the lactic flora at the beginning of the shelf life period and the subsequent lag phase, the possible release of anti-Listeria substances, and the maximum growth rate.

Bifidobacterium breve C50 secretes lipoprotein with CHAP domain recognized in aggregated form by TLR2.

Science.gov (United States)

Scuotto, Angelo; Djorie, Serge; Colavizza, Michel; Romond, Pierre-Charles; Romond, Marie-Bénédicte

2014-12-01

Extracellular components secreted by Bifidobacterium breve C50 can induce maturation, high IL-10 production and prolonged survival of dendritic cells via a TLR2 pathway. In this study, the components were isolated from the supernatant by gel filtration chromatography. Antibodies raised against the major compounds with molecular weight above 600 kDa (Bb C50BC) also recognized compounds of lower molecular weight (200–600 kDa). TLR2 and TLR6 bound to the components already recognized by the antibodies. Trypsin digestion of Bb C50BC released three major peptides whose sequences displayed close similarities to a putative secreted protein with a CHAP amidase domain from B. breve. The 1300-bp genomic region corresponding to the hypothetical protein was amplified by PCR. The deduced polypeptide started with an N-terminal signal sequence of 45 amino acids, containing the lipobox motif (LAAC) with the cysteine in position 25, and 2 positively charged residues within the first 14 residues of the signal sequence. Lipid detection in Bb C50BC by GC/MS further supported the implication of a lipoprotein. Sugars were also detected in Bb C50BC. Close similarity with the glucan-binding protein B from Bifidobacterium animalis of two released peptides from Bb C50BC protein suggested that glucose moieties, possibly in glucan form, could be bound to the lipoprotein. Finally, heating at 100 °C for 5 min led to the breakdown of Bb C50BC in compounds of molecular weight below 67 kDa, which suggested that Bb C50BC was an aggregate. One might assume that a basic unit was formed by the lipoprotein bound putatively to glucan. Besides the other sugars and hexosamines recognized by galectin 1 were localized at the surface of the Bb C50BC aggregate. In conclusion, the extracellular components secreted by B. breve C50 were constituted of a lipoprotein putatively associated with glucose moieties and acting in an aggregating form as an agonist of TLR2/TLR6.

An outbreak of an unusual strain of Listeria monocytogenes infection in North-East Scotland

Directory of Open Access Journals (Sweden)

Emmanuel Okpo

2015-11-01

Full Text Available Summary: Listeria monocytogenes infection is an important cause of illness and hospitalization in vulnerable individuals. In the present study, we describe a community outbreak of Listeria monocytogenes in the North-East region of Scotland, which was epidemiologically, environmentally and microbiologically linked to a local meat product and ready-to-eat product manufacturer. Infected individuals were interviewed, and an environmental investigation was conducted. Clinical and environmental samples were tested by culture, and isolates were typed by fluorescent amplified fragment length polymorphism (fAFLP. Three cases of Listeria monocytogenes were linked geographically, had the same serotype (1/2a and were indistinguishable by fAFLP type XII.6. The human, food and environmental isolates were of the same serotype and were indistinguishable by molecular typing.This is the first community outbreak of L. monocytogenes reported in Scotland since the current outbreak surveillance was established in 1996. Epidemiological and laboratory evidence indicated poor hand hygiene, unhygienic practices and cross-contamination throughout the manufacturing process of ready-to-eat foods as a possible cause of the outbreak. More stringent control of commercial food establishments that provide ready-to-eat food and the need to advise specifically vulnerable groups, e.g., pregnant women, of the risk of L. monocytogenes in ready-to-eat food is urgently needed. Keywords: Listeria monocytogenes, Outbreak, Foodborne, Community acquired infection, Listeriosis

Inactivation of Listeria monocytogenes in milk by pulsed electric field.

Science.gov (United States)

Reina, L D; Jin, Z T; Zhang, Q H; Yousef, A E

1998-09-01

Pasteurized whole, 2%, and skim milk were inoculated with Listeria monocytogenes Scott A and treated with high-voltage pulsed electric field (PEF). The effects of milk composition (fat content) and PEF parameters (electric field strength, treatment time, and treatment temperature) on the inactivation of the bacterium were studied. No significant differences were observed in the inactivation of L. monocytogenes Scott A in three types of milk by PEF treatment. With treatment at 25 degrees C, 1- to 3-log reductions of L. monocytogenes were observed. PEF lethal effect was a function of field strength and treatment time. Higher field strength or longer treatment time resulted in a greater reduction of viable cells. A 4-log reduction of the bacterium was obtained by increasing the treatment temperature to 50 degrees C. Results indicate that the use of a high-voltage PEF is a promising technology for inactivation of foodborne pathogens.

Prevalence, populations and pheno- and genotypic characteristics of Listeria monocytogenes isolated from ready-to-eat vegetables marketed in São Paulo, Brazil.

Science.gov (United States)

Sant'Ana, Anderson S; Igarashi, Maria Crystina; Landgraf, Mariza; Destro, Maria Teresa; Franco, Bernadette D G M

2012-04-02

Listeria monocytogenes is a foodborne pathogen of great concern due to the high fatality rates of listeriosis. The consumption of RTE vegetables has increased in Brazil over the last two decades, but little is known about the risks associated to the consumption of these products. This study evaluated the prevalence and counts of L. monocytogenes in 512 packages of ready-to-eat vegetables marketed in São Paulo. The isolates were characterized for their serotypes, ribotypes, positivity for virulence genes inlA, inlC and inlJ, resistance to chlorine, growth rate variability and capability to form biofilm on stainless steel (AISI 304, #4) coupons. L. monocytogenes was detected in 3.1% of the samples. Only five samples presented countable levels, with counts between 1.0×10(1) and 2.6×10(2)CFU/g. Isolates belonged to serotypes 1/2b or 4b and most were positive for genes inlC and inlJ. Ribotypable isolates were grouped into four groups: 1038 (69.4%), 19175 (11.3%), 19191 (17.7%) and 18604 (one isolate). Most isolates survived to exposure to 125 ppm of a chlorine-based disinfectant for 3 min. All isolates were capable to attach to the coupons, reaching counts above 4 log(10) CFU/cm(2) and the growth rate (μ) at 25°C of the majority of the isolates varied between 0.1 and 0.2 log OD/h, but for few strains the μ was as high as 0.26 log OD/h. Results of this survey indicate that RTE vegetables may be vehicles of L. monocytogenes strains with limited variation in serotype, ribotype and virulence factors but varying significantly in resistance to chlorine disinfectants, capability of forming biofilm and growth rate. Data obtained is of foremost importance to serve as baseline for the development of scientific-based policies to control the incidence of L. monocytogenes in RTE vegetables in Brazil. Copyright © 2012 Elsevier B.V. All rights reserved.

Genotypic and virulence characteristics of Listeria monocytogenes recovered from food items in Lebanon.

Science.gov (United States)

Haidar-Ahmad, Nathaline; Kissoyan, Kohar Annie B; Fadlallah, Sukayna M; El-Hajj, Rima; Saleh, Majd; Ghosn, Nada; Matar, Ghassan M

2016-08-02

Listeria monocytogenes is the agent of listeriosis, a life threatening foodborne disease for immunocompromised patients and pregnant women. This bacterium is not routinely screened for in Lebanon and there is lack of data about the prevalent strains and their potential pathogenicity. To that purpose, this study was undertaken to characterize L. monocytogenes from various food products, by assessing the in vitro biofilm forming ability, detecting their virulence potential, and characterizing them at the strain level. Fifty-nine isolates were obtained from the Lebanese Agriculture Research Institute (LARI). They were collected in 2012-2013 from local and imported food products in the Lebanese market. Biofilm formation was measured using the Microtiter Plate Assay. PCR amplification was performed for three main virulence genes; hly, actA, and inlB. Pulsed field gel electrophoresis (PFGE) and BIONUMERICS analysis were carried out. Lebanese isolates from cheese and raw meat showed higher biofilm formation than imported and Lebanese seafood isolates. A total of 100% of the isolates were PCR positive for hly and actA genes and 98.3% for inlB gene. PFGE analysis demonstrated the prevalence of 13 different subtypes with 100% similarity. Detected subtypes were grouped into 6 clusters of 90% genomic similarity. Clustered subtypes were particular to the country of origin. This study highlights the presence of L. monocytogenes in the Lebanese food market with high pathogenic potential and stresses the importance of enhanced surveillance and the implementation of strict regulations on local and imported food. Future investigations may be conducted on a larger food selection.

Evaluation of a monoclonal antibody able to detect live Listeria monocytogenes and Listeria innocua

DEFF Research Database (Denmark)

Sølve, Marianne; Boel, Jeppe; Nørrung, Birgit

2000-01-01

A monoclonal Listeria antibody, designated B4, was evaluated. The ability of the antibody to bind to viable bacteria belonging to Listeria spp, compared to bacteria of the same species killed by beat treatment, acid or base treatment, sanitizers, and irradiation was examined. The antibody was found...... to react with viable L. monocytogenes and L. innocua, but not with heat-killed (72 degrees C, 5 min) strains of these organisms. When L. monocytogenes and L. innocua were killed by methods other than heat treatment, it was ambiguous whether the antibody detected the organism or not. It was concluded...... that the B4 antibody has potential to be used in an immune capture step to capture live L, monocytogenes and L. innocua from foods prior to identification of L. monocytogenes by polymerase chain reaction (PCR)....

Listeria monocytogenes : nog steeds een probleem?

NARCIS (Netherlands)

Beumer, R.R.

2011-01-01

Listeria monocytogenes is net als vele andere bacteriële voedselpathogenen al tientallen jaren bekend. De meeste grondstoffen voor voedingsmiddelen komen uit de akker- en tuinbouw, de veehouderij en de visserij. Besmetting vindt daar plaats met micro-organismen afkomstig uit grond, fecaliën, water,

Growth characteristics of Listeria monocytogenes as affected by a native microflora in cooked ham under refrigerated and temperature abuse conditions.

Science.gov (United States)

Hwang, Cheng-An; Sheen, Shiowshuh

2011-05-01

This study examined the growth characteristics of Listeria monocytogenes as affected by a native microflora in cooked ham at refrigerated and abuse temperatures. A five-strain mixture of L. monocytogenes and a native microflora, consisting of Brochothrix spp., isolated from cooked meat were inoculated alone (monocultured) or co-inoculated (co-cultured) onto cooked ham slices. The growth characteristics, lag phase duration (LPD, h), growth rate (GR, log(10) cfu/h), and maximum population density (MPD, log(10) cfu/g), of L. monocytogenes and the native microflora in vacuum-packed ham slices stored at 4, 6, 8, 10, and 12 °C for up to 5 weeks were determined. At 4-12 °C, the LPDs of co-cultured L. monocytogenes were not significantly different from those of monocultured L. monocytogenes in ham, indicating the LPDs of L. monocytogenes at 4-12 °C were not influenced by the presence of the native microflora. At 4-8 °C, the GRs of co-cultured L. monocytogenes (0.0114-0.0130 log(10) cfu/h) were statistically but marginally lower than those of monocultured L. monocytogenes (0.0132-0.0145 log(10) cfu/h), indicating the GRs of L. monocytogenes at 4-8 °C were reduced by the presence of the native microflora. The GRs of L. monocytogenes were reduced by 8-7% with the presence of the native microflora at 4-8 °C, whereas there was less influence of the native microflora on the GRs of L. monocytogenes at 10 and 12 °C. The MPDs of L. monocytogenes at 4-8 °C were also reduced by the presence of the native microflora. Data from this study provide additional information regarding the growth suppression of L. monocytogenes by the native microflora for assessing the survival and growth of L. monocytogenes in ready-to-eat meat products. Published by Elsevier Ltd.

Directed evolution and targeted mutagenesis to murinize Listeria monocytogenes Internalin A for enhanced infectivity in the murine oral infection model

LENUS (Irish Health Repository)

Monk, Ian R

2010-12-13

Abstract Background Internalin A (InlA) is a critical virulence factor which mediates the initiation of Listeria monocytogenes infection by the oral route in permissive hosts. The interaction of InlA with the host cell ligand E-cadherin efficiently stimulates L. monocytogenes entry into human enterocytes, but has only a limited interaction with murine cells. Results We have created a surface display library of randomly mutated InlA in a non-invasive heterologous host Lactococcus lactis in order to create and screen novel variants of this invasion factor. After sequential passage through a murine cell line (CT-26), multiple clones with enhanced invasion characteristics were identified. Competitive index experiments were conducted in mice using selected mutations introduced into L. monocytogenes EGD-e background. A novel single amino acid change was identified which enhanced virulence by the oral route in the murine model and will form the basis of further engineering approaches. As a control a previously described EGD-InlAm murinized strain was also re-created as part of this study with minor modifications and designated EGD-e InlA m*. The strain was created using a procedure that minimizes the likelihood of secondary mutations and incorporates Listeria-optimized codons encoding the altered amino acids. L. monocytogenes EGD-e InlA m* yielded consistently higher level murine infections by the oral route when compared to EGD-e, but did not display the two-fold increased invasion into a human cell line that was previously described for the EGD-InlAm strain. Conclusions We have used both site-directed mutagenesis and directed evolution to create variants of InlA which may inform future structure-function analyses of this protein. During the course of the study we engineered a murinized strain of L. monocytogenes EGD-e which shows reproducibly higher infectivity in the intragastric murine infection model than the wild type, but does not display enhanced entry into human

Directed evolution and targeted mutagenesis to murinize listeria monocytogenes internalin A for enhanced infectivity in the murine oral infection model

Directory of Open Access Journals (Sweden)

Hill Colin

2010-12-01

Full Text Available Abstract Background Internalin A (InlA is a critical virulence factor which mediates the initiation of Listeria monocytogenes infection by the oral route in permissive hosts. The interaction of InlA with the host cell ligand E-cadherin efficiently stimulates L. monocytogenes entry into human enterocytes, but has only a limited interaction with murine cells. Results We have created a surface display library of randomly mutated InlA in a non-invasive heterologous host Lactococcus lactis in order to create and screen novel variants of this invasion factor. After sequential passage through a murine cell line (CT-26, multiple clones with enhanced invasion characteristics were identified. Competitive index experiments were conducted in mice using selected mutations introduced into L. monocytogenes EGD-e background. A novel single amino acid change was identified which enhanced virulence by the oral route in the murine model and will form the basis of further engineering approaches. As a control a previously described EGD-InlAm murinized strain was also re-created as part of this study with minor modifications and designated EGD-e InlAm*. The strain was created using a procedure that minimizes the likelihood of secondary mutations and incorporates Listeria-optimized codons encoding the altered amino acids. L. monocytogenes EGD-e InlAm* yielded consistently higher level murine infections by the oral route when compared to EGD-e, but did not display the two-fold increased invasion into a human cell line that was previously described for the EGD-InlAm strain. Conclusions We have used both site-directed mutagenesis and directed evolution to create variants of InlA which may inform future structure-function analyses of this protein. During the course of the study we engineered a murinized strain of L. monocytogenes EGD-e which shows reproducibly higher infectivity in the intragastric murine infection model than the wild type, but does not display enhanced

Genes involved in Listeria monocytogenes biofilm formation at a simulated food processing plant temperature of 15 °C.

Science.gov (United States)

Piercey, Marta J; Hingston, Patricia A; Truelstrup Hansen, Lisbeth

2016-04-16

Listeria monocytogenes is a pathogenic foodborne bacterium whose persistence in food processing environments is in part attributed to its biofilm formation. Most biofilm studies have been carried out at 30-37 °C rather than at temperatures found in the food processing plants (i.e., 10-20 °C). The objective of the present study was to mine for novel genes that contribute to L. monocytogenes biofilm formation at 15 °C using the random insertional mutagenesis approach. A library of 11,024 L. monocytogenes 568 (serotype 1/2a) Himar1 insertional mutants was created. Mutants with reduced or enhanced biofilm formation at 15 °C were detected in microtiter plate assays with crystal violet and safranin staining. Fourteen mutants expressed enhanced biofilm phenotypes, and harbored transposon insertions in genes encoding cell wall biosynthesis, motility, metabolism, stress response, and cell surface associated proteins. Deficient mutants (n=5) contained interruptions in genes related to peptidoglycan, teichoic acid, or lipoproteins. Enhanced mutants produced significantly (pbiofilm formed on stainless steel (SS) coupons at 15 °C (48 h) than deficient mutants, which were also more sensitive to benzalkonium chloride. All biofilm deficient mutants and four enhanced mutants in the microtiter plate assay (flaA, cheR, lmo2563 and lmo2488) formed no biofilm in a peg lid assay (Calgary biofilm device) while insertions in lmo1224 and lmo0543 led to excess biofilm in all assays. Two enhanced biofilm formers were more resistant to enzymatic removal with DNase, proteinase K or pectinase than the parent strain. Scanning electron microscopy of individual biofilms made by five mutants and the parent on SS surfaces showed formation of heterogeneous biofilm with dense zones by immotile mutants, while deficient mutants exhibited sparse growth. In conclusion, interruptions of 9 genes not previously linked to biofilm formation in L. monocytogenes (lmo2572, lmo2488 (uvrA), lmo1224, lmo0434

How Listeria monocytogenes organizes its surface for virulence

Science.gov (United States)

Carvalho, Filipe; Sousa, Sandra; Cabanes, Didier

2014-01-01

Listeria monocytogenes is a Gram-positive pathogen responsible for the manifestation of human listeriosis, an opportunistic foodborne disease with an associated high mortality rate. The key to the pathogenesis of listeriosis is the capacity of this bacterium to trigger its internalization by non-phagocytic cells and to survive and even replicate within phagocytes. The arsenal of virulence proteins deployed by L. monocytogenes to successfully promote the invasion and infection of host cells has been progressively unveiled over the past decades. A large majority of them is located at the cell envelope, which provides an interface for the establishment of close interactions between these bacterial factors and their host targets. Along the multistep pathways carrying these virulence proteins from the inner side of the cytoplasmic membrane to their cell envelope destination, a multiplicity of auxiliary proteins must act on the immature polypeptides to ensure that they not only maturate into fully functional effectors but also are placed or guided to their correct position in the bacterial surface. As the major scaffold for surface proteins, the cell wall and its metabolism are critical elements in listerial virulence. Conversely, the crucial physical support and protection provided by this structure make it an ideal target for the host immune system. Therefore, mechanisms involving fine modifications of cell envelope components are activated by L. monocytogenes to render it less recognizable by the innate immunity sensors or more resistant to the activity of antimicrobial effectors. This review provides a state-of-the-art compilation of the mechanisms used by L. monocytogenes to organize its surface for virulence, with special focus on those proteins that work “behind the frontline”, either supporting virulence effectors or ensuring the survival of the bacterium within its host. PMID:24809022

Encefalitis del tallo cerebral y mielitis por Listeria monocytogenes

Directory of Open Access Journals (Sweden)

Aracelly Castro

2013-09-01

Full Text Available La romboencefalitis por Listeria monocytogenes es una presentación poco común de la listeriosis del sistema nervioso central; sin embargo, es la presentación más común en personas inmunocompetentes. Aun más rara es la combinación de romboencefalitis con mielitis causada por L. monocytogenes; no obstante, en este artículo se reporta un caso de encefalitis del tallo y mielitis grave en un paciente sin compromiso del sistema inmunitario. Se presenta un paciente de 21 años de edad, sin deficiencias del sistema inmunitario, que consumió productos lácteos no pasteurizados y, posteriormente, presentó un cuadro de cefalea, vómito, deterioro de su estado general y, finalmente, alteración del estado de conciencia y muerte. Consultó al Instituto Neurológico de Colombia y se hizo diagnóstico de encefalitis del tallo y mielitis por L. monocytogenes. Se discuten las diferencias entre el caso presentado y los reportados en la literatura científica. Ante un paciente con signos de compromiso del tallo cerebral, de posible origen infeccioso, es prudente iniciar tratamiento antibiótico para L. monocytogenes y, en caso de poca respuesta, escalar rápidamente en dicho tratamiento. También lo es extender el estudio radiológico hacia la columna vertebral, con el fin de descartar compromiso de la médula espinal.   doi: http://dx.doi.org/10.7705/biomedica.v33i3.1482

Inhibition of Listeria monocytogenes by piscicolin 126 in milk and Camembert cheese manufactured with a thermophilic starter.

Science.gov (United States)

Wan, J; Harmark, K; Davidson, B E; Hillier, A J; Gordon, J B; Wilcock, A; Hickey, M W; Coventry, M J

1997-03-01

The effect of bacteriocin, piscicolin 126, on the growth of Listeria monocytogenes and cheese starter bacteria was investigated in milk and in Camembert cheese manufactured from milk challenged with 10(2) cfu ml(-1) L. monocytogenes. In milk incubated at 30 degrees C, piscicolin 126 added in the range of 512-2,048 AU ml(-1) effectively inhibited growth of L. monocytogenes for more than 20 d when challenged with approximately 10(2) cfu ml(-1) L. monocytogenes. At higher challenge levels (10(4) and 10(6) cfu ml(-1)), piscicolin 126 reduced the viable count of L. monocytogenes by 4-5 log units immediately after addition of the bacteriocin; however, growth of Listeria occurred within 24 h. The minimum inhibitory concentration (MIC) of piscicolin 126 against lactic acid cheese starter bacteria was generally greater than 204,800 AU ml(-1) , and the viable count and acid production of these starter cultures in milk were not affected by the addition of 2,048 AU ml(-1) piscicolin 126. Camembert cheeses made from milk challenged with L. monocytogenes and with added piscicolin 126 showed a viable count of L. monocytogenes 3-4 log units lower than those without piscicolin 126. Inactivation of piscicolin 126 by proteolytic enzymes from cheese starter bacteria and mould together with the emergence of piscicolin 126-resistant isolates was responsible for the recovery of L. monocytogenes in the cheeses during ripening.

Mechanical Dissociation of Platelet Aggregates in Blood Stream

Science.gov (United States)

Hoore, Masoud; Fedosov, Dmitry A.; Gompper, Gerhard; Complex; Biological Fluids Group Team

2017-11-01

von Willebrand factor (VWF) and platelet aggregation is a key phenomenon in blood clotting. These aggregates form critically in high shear rates and dissolve reversibly in low shear rates. The emergence of a critical shear rate, beyond which aggregates form and below which they dissolve, has an interesting impact on aggregation in blood flow. As red blood cells (RBCs) migrate to the center of the vessel in blood flow, a RBC free layer (RBC-FL) is left close to the walls into which the platelets and VWFs are pushed back from the bulk flow. This margination process provides maximal VWF-platelet aggregation probability in the RBC-FL. Using mesoscale hydrodynamic simulations of aggregate dynamics in blood flow, it is shown that the aggregates form and grow in RBC-FL wherein shear rate is high for VWF stretching. By growing, the aggregates penetrate to the bulk flow and get under order of magnitude lower shear rates. Consequently, they dissolve and get back into the RBC-FL. This mechanical limitation for aggregates prohibits undesired thrombosis and vessel blockage by aggregates, while letting the VWFs and platelets to aggregate close to the walls where they are actually needed. The support by the DFG Research Unit FOR 1543 SHENC and CPU time Grant by the Julich Supercomputing Center are acknowledged.

Occurrence and antimicrobial resistance patterns of Listeria monocytogenes isolated from vegetables

OpenAIRE

Byrne,Vanessa de Vasconcelos; Hofer,Ernesto; Vallim,Deyse Christina; Almeida,Rogeria Comastri de Castro

2016-01-01

Abstract Although the consumption of fresh and minimally processed vegetables is considered healthy, outbreaks related to the contamination of these products are frequently reported. Among the food-borne pathogens that contaminate vegetables is Listeria monocytogenes, a ubiquitous organism that exhibits the ability to survive and multiply at refrigerated temperatures. This study aimed to evaluate the occurrence of L. monocytogenes in vegetables as well as the antimicrobial resistance of isola...

Listeria monocytogenes Infection in Hairy Cell Leukemia: A Case Report and Literature Review

Directory of Open Access Journals (Sweden)

James C. Barton

2018-01-01

Full Text Available Listeria monocytogenes infections have been described in patients with diverse types of malignancy, especially leukemia. We report the case of a 65-year-old man with previously untreated hairy cell leukemia characterized by CD5 positivity and trisomy 12 (3% of blood lymphocytes who developed bacteremia due to L. monocytogenes serotype 1/2b. We summarize clinical features and treatment of this patient and five previously reported patients with hairy cell leukemia who also had L. monocytogenes infections. All six patients were men. Their mean age at infection diagnosis was 70 y. Three men had undergone splenectomy 4–11 y before they developed L. monocytogenes infection. The central nervous system was the primary site of infection in four men. Bacteremia alone occurred in two other men. At diagnosis of infection, one man was receiving antileukemia chemotherapy and another man was receiving treatment for Kaposi’s sarcoma. Two other patients had other comorbid conditions. All six men recovered from their infections.

Effect of several food ingredients on radiation inactivation of Escherichia coli and Listeria monocytogenes inoculated into ground pork

International Nuclear Information System (INIS)

Yun, Hyejeong; Lacroix, Monique; Jung, Samooel; Kim, Keehyuk; Lee, Ju Woon; Jo, Cheorun

2011-01-01

The objective of this study was to examine the effects of several food ingredients on the relative radiation sensitivity (RRS) of Escherichia coli and Listeria monocytogenes inoculated onto ground pork. Garlic, leek, onion, and ginger were prepared in 3 different forms; pressurized, freeze-dried, and 70% ethanol extracted. The prepared food ingredients were subdivided into 2 groups, non-irradiated and irradiated with 5 kGy of gamma irradiation, before addition to ground pork. The prepared food ingredients were added at concentrations of 1% and 5% (w/w) into radiation-sterilized ground pork and inoculated with E. coli and L. monocytogenes (10 6 CFU/mL). For E. coli inoculated pork, the most efficient ingredient was ethanol extracted leek (RRS=3.89), followed by freeze-dried ginger and leek (RRS=3.66 and 3.63, respectively) when used without pasteurization. However, when the food ingredients were irradiation-pasteurized, the freeze-dried ginger showed the highest RRS (4.10). When 5% natural materials were added, RRS was the highest for freeze-dried and ethanol extracted onion (4.44 and 4.65, respectively). For L. monocytogenes, the RRS was relatively lower than E. coli in general. The most efficient material was pressurized and freeze-dried onion (RRS=2.13 and 2.08, respectively) at a concentration of 1%. No increase in RRS was observed at increased concentration of food ingredients. These results suggest that the addition of particular food ingredients increased the efficiency of radiation-sterilization. However, changes in RRS were dependent on the species of microorganism as well as the form of the food ingredients. - Highlights: → Several food ingredients increased the efficiency of irradiation sterilization. → Different forms of food ingredients may affect the efficiency. → The increase of efficiency decreased the required irradiation dose, thereby avoiding sensory impairments of food.

Effect of several food ingredients on radiation inactivation of Escherichia coli and Listeria monocytogenes inoculated into ground pork

Energy Technology Data Exchange (ETDEWEB)

Yun, Hyejeong [Department of Animal Science and Biotechnology, Chungnam National University, Daejeon 305-764 (Korea, Republic of); Lacroix, Monique [Canadian Irradiation Center, Research Laboratory in Science Applied to Food, INRS-Institut Armand-Frappier, Qebec (Canada); Jung, Samooel [Department of Animal Science and Biotechnology, Chungnam National University, Daejeon 305-764 (Korea, Republic of); Kim, Keehyuk [Department of Culinary Nutrition, Woosong University, Daejeon 300-718 (Korea, Republic of); Lee, Ju Woon [Advanced Radiation Technology Institute, Korea Atomic Energy Research Institute, Jeongeup 580-185 (Korea, Republic of); Jo, Cheorun, E-mail: cheorun@cnu.ac.kr [Department of Animal Science and Biotechnology, Chungnam National University, Daejeon 305-764 (Korea, Republic of)

2011-09-15

The objective of this study was to examine the effects of several food ingredients on the relative radiation sensitivity (RRS) of Escherichia coli and Listeria monocytogenes inoculated onto ground pork. Garlic, leek, onion, and ginger were prepared in 3 different forms; pressurized, freeze-dried, and 70% ethanol extracted. The prepared food ingredients were subdivided into 2 groups, non-irradiated and irradiated with 5 kGy of gamma irradiation, before addition to ground pork. The prepared food ingredients were added at concentrations of 1% and 5% (w/w) into radiation-sterilized ground pork and inoculated with E. coli and L. monocytogenes (10{sup 6} CFU/mL). For E. coli inoculated pork, the most efficient ingredient was ethanol extracted leek (RRS=3.89), followed by freeze-dried ginger and leek (RRS=3.66 and 3.63, respectively) when used without pasteurization. However, when the food ingredients were irradiation-pasteurized, the freeze-dried ginger showed the highest RRS (4.10). When 5% natural materials were added, RRS was the highest for freeze-dried and ethanol extracted onion (4.44 and 4.65, respectively). For L. monocytogenes, the RRS was relatively lower than E. coli in general. The most efficient material was pressurized and freeze-dried onion (RRS=2.13 and 2.08, respectively) at a concentration of 1%. No increase in RRS was observed at increased concentration of food ingredients. These results suggest that the addition of particular food ingredients increased the efficiency of radiation-sterilization. However, changes in RRS were dependent on the species of microorganism as well as the form of the food ingredients. - Highlights: > Several food ingredients increased the efficiency of irradiation sterilization. > Different forms of food ingredients may affect the efficiency. > The increase of efficiency decreased the required irradiation dose, thereby avoiding sensory impairments of food.

Thermal Inactivation of Listeria monocytogenes and Salmonella during Water and Steam Blanching of Vegetables.

Science.gov (United States)

Ceylan, Erdogan; McMahon, Wendy; Garren, Donna M

2017-09-01

Thermal inactivation of Listeria monocytogenes and Salmonella was evaluated on peas, spinach, broccoli, potatoes, and carrots that were treated with hot water and steam. One gram-positive bacterium, L. monocytogenes, and one gram-negative bacterium, Salmonella, were selected as pertinent human pathogens for evaluation. Samples were inoculated with a composite of five strains each of L. monocytogenes and Salmonella to achieve approximately 10 8 to 10 9 CFU/g. Inoculated samples were treated with hot water at 85 and 87.8°C and with steam at 85 and 96.7°C for up to 3.5 min. A greater than 5-log reduction of L. monocytogenes and Salmonella was achieved on all products within 0.5 min by hot water blanching at 85 and 87.8°C. Steam blanching at 85°C reduced Salmonella populations by greater than 5 log on spinach and peas within 2 min and on carrots and broccoli within 3.5 min. Populations of Salmonella were reduced by more than 5 log within 1 min on carrot, spinach, and broccoli and within 2 min on peas by steam blanching at 96.7°C. Steam blanching at 85°C reduced L. monocytogenes populations by more than 5 log on carrots and spinach within 2 min and on broccoli and peas within 3.5 min. L. monocytogenes populations were reduced more than 5 log within 1 min on carrot, spinach, peas and broccoli by steam blanching at 96.7°C. Longer treatment times and higher temperatures were required for steam-blanched samples than for samples blanched with hot water. Results suggest that hot water and steam blanching practices commonly used by the frozen vegetable industry will achieve the desired 5-log lethality of L. monocytogenes and Salmonella and will enhance microbiological safety prior to freezing.

Listeria spp., y L. monocytogenes EN LECHE CRUDA DE CABRA

Directory of Open Access Journals (Sweden)

Yolanda Albarracín C

2008-08-01

Full Text Available Objective. To test non-pasteurized goat’s milk from the village of ‘la Garita’, Northern Santander, for Listeria monocytogenes. Material and methods. 90 samples of non-pasteurized goat’s milk were obtained over a 4 month period; pH and temperature of each sample were measured. The INVIMA technique was used to isolate L. monocytogenes; the species was confirmed by PCR. Results. The study showed that eight goat milk providers of the zone neither had refrigeration nor pasteurized the milk. The prevalence of L. monocytogenes was 3%; 15% of the samples had other species of Listeria. The milk obtained from this zone contained the pathogen that may cause listeriosis in children less than 5 years of age, pregnant women, adults and immunologically compromised patients. Conclusions. This study shows the occurrence of this pathogen in goat’s milk and identified areas of risk for those people who drink goat’s milk.

[Analysis of antibiotic susceptibility of foodborne Listeria monocytogenes in China].

Science.gov (United States)

Yang, Yang; Fu, Ping; Guo, Yunchang; Liu, Xiurmei

2008-03-01

To study the antibiotic susceptibility of foodborne Listeria monocytogenes in China. The susceptibilities of 476 strains of foodborne Listeria monocytogenes to antibiotics were determined in Broth Microdilution Susceptibility Testing in Clinical and Laboratory Standards Institute. The antibiotics of gentamicin, ampicillin, penicillin, tetracycline, doxycycline, imipenem, erythromycin, ciprofloxacin, levofloxacin, cephalothin, rifampin, vancomycin, chloramphenicol, Trimethoprim-sulfamethoxazole, ampicillin-sulbactam were used. The rates of antibiotic resistance in 467 is olates were 4.5%. Tetracycline resistance was most prevalent, accouting for 4.07% . The foods that the rates of antibiotic resistance were highest were vegetable (10%). Among 14 provinces, Jilin, Hubei and Hebei were the third top, the rate of which were 19.6% and 9.1% and 8%, respectively. It was suggested that antibiotic resistance exists in foodborne Listeria monocytogenes to a certain extent in China. It should pay more attention to the use of drugs in prevention and clinic treatment to reduce the antibiotic resistant strains.

REALIS: Postgenomic Analysis of Listeria Monocytogenes

Directory of Open Access Journals (Sweden)

The REALIS Consortium

2006-04-01

Full Text Available Listeria monocytogenes is a remarkably successful food-borne pathogen. It is capable a of surviving and proliferating under conditions that exist within the food chain, such as at low temperatures, high salt and low pH and b of colonizing animal host tissues after ingestion of contaminated food, causing opportunistic infections mainly, but not exclusively, in immunocompromised hosts. The ultimate goals of REALIS are two fold: Firstly, it aims to completely decipher all genes required for survival in and adaptation of Listeria monocytogenes to two very different environments, ie., the infected host and the external environment. Secondly, using genomics and postgenomic tools, REALIS seeks to precisely address fundamental questions regarding evolutionary relationships between pathogenic and non-pathogenic Listeria and to define qualities of particularly successful clonal pathovariants in causing disease. This project will provide both industry and health care managers with rational approaches to curbing food-borne contamination, minimising risks of infection and providing novel pharmacological approaches for halting the fulminant course of infection.

Listeriolysin S: A bacteriocin from epidemic Listeria monocytogenes strains that targets the gut microbiota.

Science.gov (United States)

Quereda, Juan J; Meza-Torres, Jazmín; Cossart, Pascale; Pizarro-Cerdá, Javier

2017-07-04

Listeria monocytogenes is a Gram-positive food-borne pathogen that in humans may traverse the intestinal, placental and blood/brain barriers, causing gastroenteritis, abortions and meningitis. Crossing of these barriers is dependent on the bacterial ability to enter host cells, and several L. monocytogenes surface and secreted virulence factors are known to facilitate entry and the intracellular lifecycle. The study of L. monocytogenes strains associated to human listeriosis epidemics has revealed the presence of novel virulence factors. One such factor is Listeriolysin S, a thiazole/oxazole modified microcin that displays bactericidal activity and modifies the host microbiota during infection. Our recent results therefore highlight the interaction of L. monocytogenes with gut microbes as a crucial step in epidemic listeriosis. In this article, we will discuss novel implications for this family of toxins in the pathogenesis of diverse medically relevant microorganisms.

Environmental prevalence and persistence of Listeria monocytogenes in cold-smoked trout processing plants

Science.gov (United States)

The presence of Listeria monocytogenes on the surfaces of equipment and workers' hands during different production stages, as well as on fish skin and meat during processing and storage of cold-smoked trout, was investigated. Listeria monocytogenes was recovered from 10 (6.06%) of a total 165 cotto...

Listeria monocytogenes Meningitis in an Immunosuppressed Patient with Autoimmune Hepatitis and IgG4 Subclass Deficiency

Directory of Open Access Journals (Sweden)

Shahin Gaini

2015-01-01

Full Text Available A 51-year-old Caucasian woman with Listeria monocytogenes meningitis was treated and discharged after an uncomplicated course. Her medical history included immunosuppressive treatment with prednisolone and azathioprine for autoimmune hepatitis. A diagnostic work-up after the meningitis episode revealed that she had low levels of the IgG4 subclass. To our knowledge, this is the first case report describing a possible association between autoimmune hepatitis and the occurrence of Listeria monocytogenes meningitis, describing a possible association between Listeria monocytogenes meningitis and deficiency of the IgG4 subclass and finally describing a possible association between Listeria monocytogenes meningitis and immunosuppressive therapy with prednisolone and azathioprine.

Listeria monocytogenes Meningitis in an Immunosuppressed Patient with Autoimmune Hepatitis and IgG4 Subclass Deficiency

DEFF Research Database (Denmark)

Gaini, Shahin

2015-01-01

A 51-year-old Caucasian woman with Listeria monocytogenes meningitis was treated and discharged after an uncomplicated course. Her medical history included immunosuppressive treatment with prednisolone and azathioprine for autoimmune hepatitis. A diagnostic work-up after the meningitis episode...... revealed that she had low levels of the IgG4 subclass. To our knowledge, this is the first case report describing a possible association between autoimmune hepatitis and the occurrence of Listeria monocytogenes meningitis, describing a possible association between Listeria monocytogenes meningitis...... and deficiency of the IgG4 subclass and finally describing a possible association between Listeria monocytogenes meningitis and immunosuppressive therapy with prednisolone and azathioprine....

Inactivation of Listeria monocytogenes in raw fruits by enterocin AS-48.

Science.gov (United States)

Molinos, Antonio Cobo; Abriouel, Hikmate; Ben Omar, Nabil; Lucas, Rosario; Valdivia, Eva; Gálvez, Antonio

2008-12-01

The purpose of this study was to determine the effect of enterocin AS-48 on Listeria monocytogenes CECT 4032 in fruits and fruit juice. Fruits were contaminated with a L. monocytogenes cell suspension, washed with enterocin AS-48 (25 microg/ml) or with sterile distilled water as control, and stored at different temperatures (-20, 6, 15, 22 degrees C). Washing treatments significantly inhibited or completely inactivated L. monocytogenes in strawberries, raspberries, and blackberries stored at 15 and 22 degrees C for up to 2 days and in blackberries and strawberries at 6 degrees C for up to 7 days. Washing treatments with enterocin AS-48 also reduced viable counts in sliced melon, watermelon, pear, and kiwi but did not avoid proliferation of survivors during storage at 15 and 22 degrees C. Added enterocin (25 microg/ml) completely inactivated L. monocytogenes in watermelon juice within 24 h. To enhance the antilisterial activity of treatments, enterocin AS-48 was tested in combination with other antimicrobial substances on sliced melon stored at 22 degrees C. The combinations of enterocin AS-48 and trisodium trimetaphosphate, sodium lactate, lactic acid, polyphosphoric acid, carvacrol, hydrocinnamic acid, p-hydroxybenzoic acid, n-propyl p-hydroxybenzoate, or 2-nitropropanol showed increased antilisterial activities compared with each antimicrobial tested separately. Washing treatments with enterocin AS-48 in combination with 12 mM carvacrol, as well as with 100 mM n-propyl p-hydroxybenzoate, avoided regrowth of Listeria during storage at 22 degrees C. Results from this study indicate that enterocin AS-48 alone or in combination with other preservatives could serve as an additional hurdle against L. monocytogenes in fruits and fruit juices.

Silt-clay aggregates on Mars

International Nuclear Information System (INIS)

Greeley, R.

1979-01-01

Viking observations suggest abundant silt and clay particles on Mars. It is proposed that some of these particles agglomerate to form sand size aggregates that are redeposited as sandlike features such as drifts and dunes. Although the binding for the aggregates could include salt cementation or other mechanisms, electrostatic bonding is considered to be a primary force holding the aggregates together. Various laboratory experiments conducted since the 19th century, and as reported here for simulated Martian conditions, show that both the magnitude and sign of electrical charges on windblown particles are functions of particle velocity, shape and composition, atmospheric pressure, atmospheric composition, and other factors. Electrical charges have been measured for saltating particles in the wind tunnel and in the field, on the surfaces of sand dunes, and within dust clouds on earth. Similar, and perhaps even greater, charges are proposed to occur on Mars, which could form aggregates of silt and clay size particles. Electrification is proposed to occur within Martian dust clouds, generating silt-clay aggregates which would settle to the surface where they may be deposited in the form of sandlike structures. By analog, silt-clay dunes are known in many parts of the earth where silt-clay aggregated were transported by saltation and deposited as 'sand.' In these structures the binding forces were later destroyed, and the particles reassumed the physical properties of silt and clay, but the sandlike bedding structure within the 'dunes' was preserved. The bedding observed in drifts at the Viking landing site is suggested to result from a similar process involving silt-clay aggregates on Mars

Stevia rebaudiana Bertoni effect on the hemolytic potential of Listeria monocytogenes.

Science.gov (United States)

Sansano, S; Rivas, A; Pina-Pérez, M C; Martinez, A; Rodrigo, D

2017-06-05

The effect of Stevia rebaudiana Bertoni on the hemolytic potential of Listeria monocytogenes was studied by means of the assessment of the Listeriolysin O (LLO) production. The three factors under study, stevia concentration in the range [0-2.5] % (w/v), incubation temperature (10 and 37°C), and exposure time (0-65h) significantly affected (p≤0.05) the hemolytic activity of L. monocytogenes. Results showed that at the lower incubation temperature the hemolytic potential of the bacterium was significantly reduced, from 100% at 37°C to 8% at 10°C (after 65h of incubation) in unsupplemented substrate (0% stevia). Irrespective of the temperature, 10 or 37°C, supplementation of the medium with stevia at 2.5 % (w/v) reduced the bacterium's hemolytic activity by a maximum of 100%. Furthermore, the time of exposure to 2.5 % (w/v) stevia concentration was also a significant factor reducing the hemolytic capability of L. monocytogenes. The possibility of reducing the pathogenic potential of L. monocytogenes (hemolysis) by exposure to stevia should be confirmed in real food matrices, opening a research niche with a valuable future impact on food safety. Copyright © 2017 Elsevier B.V. All rights reserved.

Effect of several food ingredients on radiation inactivation of Escherichia coli and Listeria monocytogenes inoculated into ground pork

Science.gov (United States)

Yun, Hyejeong; Lacroix, Monique; Jung, Samooel; Kim, Keehyuk; Lee, Ju Woon; Jo, Cheorun

2011-09-01

The objective of this study was to examine the effects of several food ingredients on the relative radiation sensitivity (RRS) of Escherichia coli and Listeria monocytogenes inoculated onto ground pork. Garlic, leek, onion, and ginger were prepared in 3 different forms; pressurized, freeze-dried, and 70% ethanol extracted. The prepared food ingredients were subdivided into 2 groups, non-irradiated and irradiated with 5 kGy of gamma irradiation, before addition to ground pork. The prepared food ingredients were added at concentrations of 1% and 5% (w/w) into radiation-sterilized ground pork and inoculated with E. coli and L. monocytogenes (10 6 CFU/mL). For E. coli inoculated pork, the most efficient ingredient was ethanol extracted leek (RRS=3.89), followed by freeze-dried ginger and leek (RRS=3.66 and 3.63, respectively) when used without pasteurization. However, when the food ingredients were irradiation-pasteurized, the freeze-dried ginger showed the highest RRS (4.10). When 5% natural materials were added, RRS was the highest for freeze-dried and ethanol extracted onion (4.44 and 4.65, respectively). For L. monocytogenes, the RRS was relatively lower than E. coli in general. The most efficient material was pressurized and freeze-dried onion (RRS=2.13 and 2.08, respectively) at a concentration of 1%. No increase in RRS was observed at increased concentration of food ingredients. These results suggest that the addition of particular food ingredients increased the efficiency of radiation-sterilization. However, changes in RRS were dependent on the species of microorganism as well as the form of the food ingredients.

Symptomatic hydrocephalus in a newborn infected with listeria monocytogenes Hidrocefalia sintomática em um recém-nascido infectado com Listeria monocytogenes

Directory of Open Access Journals (Sweden)

Analía L. Laciar

2000-03-01

Full Text Available Central nervous system infections caused by Listeria monocytogenes produce a wide range of clinical symptoms which include cerebral abscesses, meningitis and nonmeningitic parenchymal cerebritis. A case study is presented of early listeriosis with signs of meningitis accompanied with septicemia and complicated with severe hydrocephalus.As infecções do sistema nervoso central produzidas por Listeria monocytogenes provocam una grande variedade de sintomas clínicos que incluem abscessos cerebrais, meningites e cerebrites parenquimáticas não meningíticas. Apresenta-se um caso de listeriose precoce com sinais de meningite acompanhada de septicemia e agravado com hidrocefalia grave.

Cooperative structural transitions in amyloid-like aggregation

Science.gov (United States)

Steckmann, Timothy; Bhandari, Yuba R.; Chapagain, Prem P.; Gerstman, Bernard S.

2017-04-01

Amyloid fibril aggregation is associated with several horrific diseases such as Alzheimer's, Creutzfeld-Jacob, diabetes, Parkinson's, and others. Although proteins that undergo aggregation vary widely in their primary structure, they all produce a cross-β motif with the proteins in β-strand conformations perpendicular to the fibril axis. The process of amyloid aggregation involves forming myriad different metastable intermediate aggregates. To better understand the molecular basis of the protein structural transitions and aggregation, we report on molecular dynamics (MD) computational studies on the formation of amyloid protofibrillar structures in the small model protein ccβ, which undergoes many of the structural transitions of the larger, naturally occurring amyloid forming proteins. Two different structural transition processes involving hydrogen bonds are observed for aggregation into fibrils: the breaking of intrachain hydrogen bonds to allow β-hairpin proteins to straighten, and the subsequent formation of interchain H-bonds during aggregation into amyloid fibrils. For our MD simulations, we found that the temperature dependence of these two different structural transition processes results in the existence of a temperature window that the ccβ protein experiences during the process of forming protofibrillar structures. This temperature dependence allows us to investigate the dynamics on a molecular level. We report on the thermodynamics and cooperativity of the transformations. The structural transitions that occurred in a specific temperature window for ccβ in our investigations may also occur in other amyloid forming proteins but with biochemical parameters controlling the dynamics rather than temperature.

Enterocin CRL35 inhibits Listeria monocytogenes in a murine model.

Science.gov (United States)

Salvucci, Emiliano; Saavedra, Lucila; Hebert, Elvira Maria; Haro, Cecilia; Sesma, Fernando

2012-01-01

Listeria monocytogenes is a foodborne pathogen causative of opportunistic infections. Listeriosis is associated with severe infections in pregnant women causing abortion or neonatal listeriosis. An alternative to antibiotics are safe novel bacteriocins peptides such as enterocin CRL35 with strong antilisterial activity produced by Enterococcus mundtii CRL35. In the present paper, our goal is to study the effectiveness of this peptide and the producer strain in a murine model of pregnancy-associated listeriosis. A single dose of 5×10(9) colony-forming unit of L. monocytogenes FBUNT (Faculty of Biochemistry-University of Tucumán) resulted in translocation of pathogen to liver and spleen of BALB/c pregnant mice. The maximum level of Listeria was observed on day 3 postinfection. Interestingly, the intragastric administration of enterocin CRL35 significantly reduced the translocation of the pathogen to vital organs. On the other hand, the preadministration of E. mundtii CRL35 slightly inhibited this translocation. Listeria infection caused a significant increase in polymorphonuclear leukocytes at day 3 postinfection compared to the noninfected group. This value was reduced after the administration of enterocin CRL35. No significant changes were observed in either white blood cells or lymphocytes counts. Based on the data presented in the present work enterocin CRL35 would be a promising alternative for the prevention of Listeria infections.

Prevalence and serotype distribution of Listeria monocytogenes isolated from foods in Montevideo-Uruguay

Directory of Open Access Journals (Sweden)

Valeria Braga

Full Text Available ABSTRACT The aim of this work was to study the prevalence of Listeria monocytogenes in foods obtained in retail shops and food industries located in Montevideo-Uruguay, and to identify the serogroups of the obtained isolates. Three-thousand one-hundred and seventy-five food samples (frozen, deli meats, ready-to-eat and cheese were analyzed. The obtained isolates were serogrouped by multiplex PCR and serotyped by conventional procedure. Genetic comparisons were performed using pulsed-field gel electrophoresis on a sub-set of isolates belonging to the same serotype successively recovered from the same establishment. L. monocytogenes was isolated from 11.2% of samples. The highest prevalence was observed in frozen foods (38%, followed by cheese (10%. 1/2b and 4b were the most frequently identified serotypes. In six of 236 analyzed establishments we successively recovered L. monocytogenes isolates belonging to the same serotype. Most of them corresponded to serotype 1/2b. Pulsed-field gel electrophoresis profiles suggest that at least 33% of L. monocytogenes 1/2b isolates are genetically related and that may remain viable for prolonged periods. The observed prevalence of L. monocytogenes was lower than reported in neighboring countries. Our findings highlight the role that frozen foods may play in the spread of this pathogen, and the relevance of serotypes 1/2b and 4b.

Listeria monocytogenes: monitoramento desse perigo biológico na cadeia produtiva de frangos do sul do Rio Grande do Sul Listeria monocytogenes: assessing this microbiological hazard in a poultry productive chain in southern Rio Grande do Sul

Directory of Open Access Journals (Sweden)

Élen Silveira Nalério

2009-09-01

Full Text Available Listeria monocytogenes é uma bactéria patogênica que se tornou um grande desafio para as indústrias de alimentos, entre elas a de frangos, assim como para os órgãos de vigilância sanitária. Apesar da produção de frangos estar em expansão na região sul do Rio Grande do Sul, não há relatos sobre esse patógeno, dessa forma, objetivou-se avaliar a prevalência de L. monocytogenes e de seus sorotipos nos diversos segmentos dessa cadeia produtiva. Nos aviários isolou-se L. monocytogenes em 2,9% (1/35 das amostras de swabs cloacais, não se isolando o microrganismo em amostras provenientes das camas de aviários. No abatedouro, 11,7% (15/128 das amostras apresentaram contaminação por L. monocytogenes e nos frangos resfriados procedentes do comércio, a prevalência foi de 33,3% (15/45.Observou-se que 51,6% (16/31 das cepas de L. monocytogenes pertenciam ao sorotipo 1/2b; 22,5% (7/31 ao sorotipo 4e; 16,1% (5/31 ao sorotipo 1/2a; 6,4% (2/31 ao sorotipo 4b; e 3,2% (1/31 ao sorotipo 1/2c. Há disseminação de L. monocytogenes na cadeia produtiva de frangos da região sul do Rio Grande do Sul e a presença de sorotipos prevalentes em casos/surtos de listeriose traz preocupação à saúde pública.Listeria monocytogenes is a pathogenic bacterium which has become a huge challenge to the food industries, including the poultry industry, and to the health surveillance agencies. Although poultry production is in expansion in southern of Rio Grande do Sul, Brazil, there are not reports about this pathogen thus this study aimed at assessing the prevalence of L monocytogenes and its serotypes in the several segments of this productive chain. In the broilers flocks L. monocytogenes were isolated in 2.9% (1/35 from cloacal swabs samples. This microorganism was not isolated from broiler houses samples. In the abattoir, 11% of the samples presented L. monocytogenes contamination, and in the chilled chicken from retailers its prevalence was 33.3% (15

Prevalence and methodologies for detection, characterization and subtyping of Listeria monocytogenes and L. ivanovii in foods and environmental sources

Directory of Open Access Journals (Sweden)

Jin-Qiang Chen

2017-09-01

Full Text Available Listeria monocytogenes, one of the most important foodborne pathogens, can cause listeriosis, a lethal disease for humans. L. ivanovii, which is closely related to L. monocytogenes, is also widely distributed in nature and infects mainly warm-blooded ruminants, causing economic loss. Thus, there are high priority needs for methodologies for rapid, specific, cost-effective and accurate detection, characterization and subtyping of L. monocytogenes and L. ivanovii in foods and environmental sources. In this review, we (A described L. monocytogenes and L. ivanovii, world-wide incidence of listeriosis, and prevalence of various L. monocytogenes strains in food and environmental sources; (B comprehensively reviewed different types of traditional and newly developed methodologies, including culture-based, antigen/antibody-based, LOOP-mediated isothermal amplification, matrix-assisted laser desorption ionization-time of flight-mass spectrometry, DNA microarray, and genomic sequencing for detection and characterization of L. monocytogenes in foods and environmental sources; (C comprehensively summarized different subtyping methodologies, including pulsed-field gel electrophoresis, multi-locus sequence typing, ribotyping, and phage-typing, and whole genomic sequencing etc. for subtyping of L. monocytogenes strains from food and environmental sources; and (D described the applications of these methodologies in detection and subtyping of L. monocytogenes in foods and food processing facilities.

Comparative Genomics Reveals the Diversity of Restriction-Modification Systems and DNA Methylation Sites in Listeria monocytogenes.

Science.gov (United States)

Chen, Poyin; den Bakker, Henk C; Korlach, Jonas; Kong, Nguyet; Storey, Dylan B; Paxinos, Ellen E; Ashby, Meredith; Clark, Tyson; Luong, Khai; Wiedmann, Martin; Weimer, Bart C

2017-02-01

Listeria monocytogenes is a bacterial pathogen that is found in a wide variety of anthropogenic and natural environments. Genome sequencing technologies are rapidly becoming a powerful tool in facilitating our understanding of how genotype, classification phenotypes, and virulence phenotypes interact to predict the health risks of individual bacterial isolates. Currently, 57 closed L. monocytogenes genomes are publicly available, representing three of the four phylogenetic lineages, and they suggest that L. monocytogenes has high genomic synteny. This study contributes an additional 15 closed L. monocytogenes genomes that were used to determine the associations between the genome and methylome with host invasion magnitude. In contrast to previous findings, large chromosomal inversions and rearrangements were detected in five isolates at the chromosome terminus and within rRNA genes, including a previously undescribed inversion within rRNA-encoding regions. Each isolate's epigenome contained highly diverse methyltransferase recognition sites, even within the same serotype and methylation pattern. Eleven strains contained a single chromosomally encoded methyltransferase, one strain contained two methylation systems (one system on a plasmid), and three strains exhibited no methylation, despite the occurrence of methyltransferase genes. In three isolates a new, unknown DNA modification was observed in addition to diverse methylation patterns, accompanied by a novel methylation system. Neither chromosome rearrangement nor strain-specific patterns of epigenome modification observed within virulence genes were correlated with serotype designation, clonal complex, or in vitro infectivity. These data suggest that genome diversity is larger than previously considered in L. monocytogenes and that as more genomes are sequenced, additional structure and methylation novelty will be observed in this organism. Listeria monocytogenes is the causative agent of listeriosis, a disease

Atlas(®) Listeria monocytogenes LmG2 Detection Assay Using Transcription Mediated Amplification to Detect Listeria monocytogenes in Selected Foods and Stainless Steel Surface.

Science.gov (United States)

Bres, Vanessa; Yang, Hua; Hsu, Ernie; Ren, Yan; Cheng, Ying; Wisniewski, Michele; Hanhan, Maesa; Zaslavsky, Polina; Noll, Nathan; Weaver, Brett; Campbell, Paul; Reshatoff, Michael; Becker, Michael

2014-01-01

The Atlas Listeria monocytogenes LmG2 Detection Assay, developed by Roka Bioscience Inc., was compared to a reference culture method for seven food types (hot dogs, cured ham, deli turkey, chicken salad, vanilla ice cream, frozen chocolate cream pie, and frozen cheese pizza) and one surface (stainless steel, grade 316). A 125 g portion of deli turkey was tested using a 1:4 food:media dilution ratio, and a 25 g portion for all other foods was tested using 1:9 food:media dilution ratio. The enrichment time and media for Roka's method was 24 to 28 h for 25 g food samples and environmental surfaces, and 44 to 48 h for 125 g at 35 ± 2°C in PALCAM broth containing 0.02 g/L nalidixic acid. Comparison of the Atlas Listeria monocytogenes LmG2 Detection Assay to the reference method required an unpaired approach. For each matrix, 20 samples inoculated at a fractional level and five samples inoculated at a high level with a different strain of Listeria monocytogenes were tested by each method. The Atlas Listeria monocytogenes LmG2 Detection Assay was compared to the Official Methods of Analysis of AOAC INTERNATIONAL 993.12 method for dairy products, the U.S. Department of Agriculture, Food Safety and Inspection Service, Microbiology Laboratory Guidebook 8.08 method for ready-to-eat meat and environmental samples, and the U.S. Food and Drug Administration Bacteriological Analytical Manual, Chapter 10 method for frozen foods. In the method developer studies, Roka's method, at 24 h (or 44 h for 125 g food samples), had 126 positives out of 200 total inoculated samples, compared to 102 positives for the reference methods at 48 h. In the independent laboratory studies, vanilla ice cream, deli turkey and stainless steel grade 316 were evaluated. Roka's method, at 24 h (or 44 h for 125 g food samples), had 64 positives out of 75 total inoculated samples compared to 54 positives for the reference methods at 48 h. The Atlas Listeria monocytogenes LmG2 Detection Assay detected all 50

Listeria monocytogenes Circulating in Rabbit Meat Products and Slaughterhouses in Italy: Prevalence Data and Comparison Among Typing Results.

Science.gov (United States)

De Cesare, Alessandra; Parisi, Antonio; Mioni, Renzo; Comin, Damiano; Lucchi, Alex; Manfreda, Gerardo

2017-03-01

Rabbit meat has outstanding dietetic and nutritional properties. However, few data on microbiological hazards associated with rabbit productions are available. In this study, the presence of Listeria monocytogenes was determined in 430 rabbit carcasses, 256 rabbit meat cuts and products, and 599 environmental sponges collected from four Italian rabbit slaughterhouses over a period of 1 year. Prevalence of L. monocytogenes among the 1285 rabbit meat and environmental samples was 11%, with statistically significant differences between slaughterhouses. The highest prevalence (33.6%) was observed in rabbit meat cuts and products; the majority of positive environmental samples were collected from conveyor belts. Overall, 27.9% and 14.3% of rabbit cuts and carcasses, respectively, had L. monocytogenes counts higher than 1 colony-forming unit (CFU)/10 g. A selection of 123 isolates from positive samples was genotyped and serotyped to determine genetic profiles and diversity among L. monocytogenes isolates contaminating different slaughterhouses and classes of products investigated. Discriminatory power and concordance among the results obtained using multilocus variable-number tandem-repeat analysis (MLVA), multilocus sequence typing (MLST), pulsed-field gel electrophoresis (PFGE), automated EcoRI ribotyping, and serotyping were assessed. The isolates selected for typing were classified into serotypes 1/2a (52.8%), 1/2c (32.5%), and 1/2b (14.6%). The majority of the isolates were classified as ST14 (34.1%), ST9 (35.5%), ST121 (17.9%), and ST224 (14.6%). The greatest discriminatory power was observed with the MLVA typing, followed by MLST, PFGE, and ribotyping. The best bidirectional concordance was achieved between PFGE and MLST. There was 100% correlation between both MLST and MLVA with serotype. Moreover, a high unidirectional correspondence was observed between MLVA and both MLST and PFGE, as well as between PFGE and both MLST and serotyping. The results of this

Prevalence and quantification of Listeria monocytogenes in beef offal at retail level in Selangor, Malaysia.

Science.gov (United States)

Kuan, Chee Hao; Wong, Woan Chwen; Pui, Chai Fung; Mahyudin, Nor Ainy; Tang, John Yew Huat; Nishibuchi, Mitsuaki; Radu, Son

2013-12-01

A total of 63 beef offal samples (beef liver = 16; beef lung = 14; beef intestine = 9; beef tripe = 15; beef spleen = 9) from three wet markets (A, B, and C) in Selangor, Malaysia were examined for the prevalence and microbial load of Listeria monocytogenes. A combination of the most probable number and polymerase chain reaction (MPN-PCR) method was employed in this study. It was found that L. monocytogenes detected in 33.33% of the beef offal samples. The prevalence of L. monocytogenes in beef offal purchased from wet markets A, B, and C were 22.73%, 37.50% and 41.18% respectively. The density of L. monocytogenes in all the samples ranged from 2,400 MPN/g. The findings in this study indicate that beef offal can be a potential vehicle of foodborne listeriosis.

Variations in virulence between different electrophoretic types of Listeria monocytogenes

DEFF Research Database (Denmark)

Nørrung, Birgit; Andersen, Jens Kirk

2000-01-01

A total of 245 strains of Listeria monocytogenes, representing 33 different electrophoretic types (ETs), were examined quantitatively for haemolytic activity. No significant difference was observed in the mean haemolytic activity between different ETs. Eighty four out of 91 strains examined were...... compared with 3.64 among food isolates). The explanation for this may be that more virulent strains are more prone to cause human infection. It is, however, also possible that strains oft. monocytogenes may become more virulent while multiplying in a living organism compared with multiplying in foods....

Dynamics of biofilm formation by Listeria monocytogenes on stainless steel under mono-species and mixed-culture simulated fish processing conditions and chemical disinfection challenges.

Science.gov (United States)

Papaioannou, Eleni; Giaouris, Efstathios D; Berillis, Panagiotis; Boziaris, Ioannis S

2018-02-21

The progressive ability of a six-strains L. monocytogenes cocktail to form biofilm on stainless steel (SS), under fish-processing simulated conditions, was investigated, together with the biocide tolerance of the developed sessile communities. To do this, the pathogenic bacteria were left to form biofilms on SS coupons incubated at 15°C, for up to 240h, in periodically renewable model fish juice substrate, prepared by aquatic extraction of sea bream flesh, under both mono-species and mixed-culture conditions. In the latter case, L. monocytogenes cells were left to produce biofilms together with either a five-strains cocktail of four Pseudomonas species (fragi, savastanoi, putida and fluorescens), or whole fish indigenous microflora. The biofilm populations of L. monocytogenes, Pseudomonas spp., Enterobacteriaceae, H 2 S producing and aerobic plate count (APC) bacteria, both before and after disinfection, were enumerated by selective agar plating, following their removal from surfaces through bead vortexing. Scanning electron microscopy was also applied to monitor biofilm formation dynamics and anti-biofilm biocidal actions. Results revealed the clear dominance of Pseudomonas spp. bacteria in all the mixed-culture sessile communities throughout the whole incubation period, with the in parallel sole presence of L. monocytogenes cells to further increase (ca. 10-fold) their sessile growth. With respect to L. monocytogenes and under mono-species conditions, its maximum biofilm population (ca. 6logCFU/cm 2 ) was reached at 192h of incubation, whereas when solely Pseudomonas spp. cells were also present, its biofilm formation was either slightly hindered or favored, depending on the incubation day. However, when all the fish indigenous microflora was present, biofilm formation by the pathogen was greatly hampered and never exceeded 3logCFU/cm 2 , while under the same conditions, APC biofilm counts had already surpassed 7logCFU/cm 2 by the end of the first 96h of

REAL-TIME PCR DETECTION OF LISTERIA MONOCYTOGENES IN FOOD SAMPLES OF ANIMAL ORIGIN

Directory of Open Access Journals (Sweden)

Jaroslav Pochop

2013-02-01

Full Text Available The aim of this study was to follow the contamination of food with Listeria monocytogenes by using Step One real time polymerase chain reaction (PCR. We used the PrepSEQ Rapid Spin Sample Preparation Kit for isolation of DNA and SensiFAST SYBR Hi-ROX Kit for the real-time PCR performance. In 24 samples of food of animal origin without incubation were detected strains of Listeria monocytogenes in 15 samples (swabs. Nine samples were negative. Our results indicated that the real-time PCR assay developed in this study could sensitively detect Listeria monocytogenes in food of animal origin without incubation. This could prevent infection caused by Listeria monocytogenes, and also could benefit food manufacturing companies by extending their product’s shelf-life as well as saving the cost of warehousing their food products while awaiting pathogen testing results. The rapid real-time PCR-based method performed very well compared to the conventional method. It is a fast, simple, specific and sensitive way to detect nucleic acids, which could be used in clinical diagnostic tests in the future.

Listeria monocytogenes Identification in Food of Animal Origin Used with Real Time PCR

Directory of Open Access Journals (Sweden)

Jaroslav Pochop

2013-10-01

Full Text Available The aim of this study was to follow the contamination of food with Listeria monocytogenes by using Step One real time polymerase chain reaction (RT PCR. We used the PrepSEQ Rapid Spin Sample Preparation Kit for isolation of DNA and SensiFAST SYBR Hi-ROX Kit for the real-time PCR performance. In 20 samples of food of animal origin with incubation were detected strains of Listeria monocytogenes in 9 samples (swabs. Eleven samples were negative. Our results indicated that the real-time PCR assay developed in this study could sensitively detect Listeria monocytogenes in food of animal origin without incubation. This could prevent infection caused by Listeria monocytogenes, and also could benefit food manufacturing companies by extending their product’s shelf-life as well as saving the cost of warehousing their food products while awaiting pathogen testing results. The rapid real-time PCR-based method performed very well compared to the conventional method. It is a fast, simple, specific and sensitive way to detect nucleic acids, which could be used in clinical diagnostic tests in the future.

Growth potential of Listeria monocytogenes in sliced turkey bresaola packed in modified atmosphere

Directory of Open Access Journals (Sweden)

Elena Dalzini

2014-02-01

Full Text Available According to EC Regulation No 2073/2005, for food business operators that produce ready-to-eat (RTE product, it is crucial to be able to demonstrate if the product supports the growth of Listeria monocytogenes. The objective of the study was therefore to evaluate the behaviour of L. monocytogenes in sliced RTE turkey bresaola (made by cured turkey breast 4.5% NaCl, 1% sodium lactate, sodium nitrite 150 ppm and flavouring during the shelf life of the product, simulating a contamination during the slicing operation. Considering a shelf life of 90 days, as defined by manufacturer, the packages of sliced bresaola were stored at 5°C for 7 days and at 8°C for the remaining storage time (83 days. L. monocytogenes count decreased during storage test from 1.43/1.98 log cfu/g in the three batches tested to 1.03 log cfu/g in one batch and to undetectable levels in the other two batches. The results show that the investigated product is unable to support the growth of L. monocytogenes.

An Assessment of Different Genomic Approaches for Inferring Phylogeny of Listeria monocytogenes

DEFF Research Database (Denmark)

Henri, Clementine; Leekitcharoenphon, Pimlapas; Carleton, Heather A.

2017-01-01

Background/objectives: Whole genome sequencing (WGS) has proven to be a powerful subtyping tool for foodborne pathogenic bacteria like L. monocytogenes. The interests of genome-scale analysis for national surveillance, outbreak detection or source tracking has been largely documented. The genomic......MLPPST) or pan genome (wgMLPPST). Currently, there are little comparisons studies of these different analytical approaches. Our objective was to assess and compare different genomic methods that can be implemented in order to cluster isolates of L monocytogenes.Methods: The clustering methods were evaluated...... on a collection of 207 L. monocytogenes genomes of food origin representative of the genetic diversity of the Anses collection. The trees were then compared using robust statistical analyses.Results: The backward comparability between conventional typing methods and genomic methods revealed a near...

Epidemiologia molecolare di Listeria monocytogenes per l'implementazione della sorveglianza e della valutazione del rischio infettivo

OpenAIRE

Tamburro, Manuela

2010-01-01

Listeria monocytogenes è un patogeno umano a trasmissione alimentare, ampiamente distribuito nell’ambiente, che causa la listeriosi, un importante problema per la Sanità Pubblica per l’elevato tasso di letalità (20-30%). Sia i casi sporadici sia quelli epidemici sono soprattutto associati al consumo di alimenti contaminati. Le manifestazioni cliniche vanno da gastroenteriti febbrili fino a forme invasive negli individui suscettibili (immunocompromessi, anziani, donne in gravidanza e neonati),...

Information Aggregation and Investment Decisions

OpenAIRE

Christian Hellwig; Aleh Tsyvinski; Elias Albagli

2010-01-01

This paper studies an environment in which information aggregation interacts with investment decisions. The first contribution of the paper is to develop a tractable model of such interactions. The second contribution is to solve the model in closed form and derive a series of implications that result from the interplay between information aggregation and the value of market information for the firms' decision problem. We show that the model generates an information aggregation wedge between ...

Identification of Surface Protein Biomarkers of Listeria monocytogenes via Bioinformatics and Antibody-Based Protein Detection Tools

Science.gov (United States)

Zhang, Cathy X. Y.; Brooks, Brian W.; Huang, Hongsheng; Pagotto, Franco

2016-01-01

ABSTRACT The Gram-positive bacterium Listeria monocytogenes causes a significant percentage of the fatalities among foodborne illnesses in humans. Surface proteins specifically expressed in a wide range of L. monocytogenes serotypes under selective enrichment culture conditions could serve as potential biomarkers for detection and isolation of this pathogen via antibody-based methods. Our study aimed to identify such biomarkers. Interrogation of the L. monocytogenes serotype 4b strain F2365 genome identified 130 putative or known surface proteins. The homologues of four surface proteins, LMOf2365_0578, LMOf2365_0581, LMOf2365_0639, and LMOf2365_2117, were assessed as biomarkers due to the presence of conserved regions among strains of L. monocytogenes which are variable among other Listeria species. Rabbit polyclonal antibodies against the four recombinant proteins revealed the expression of only LMOf2365_0639 on the surface of serotype 4b strain LI0521 cells despite PCR detection of mRNA transcripts for all four proteins in the organism. Three of 35 monoclonal antibodies (MAbs) to LMOf2365_0639, MAbs M3643, M3644, and M3651, specifically recognized 42 (91.3%) of 46 L. monocytogenes lineage I and II isolates grown in nonselective brain heart infusion medium. While M3644 and M3651 reacted with 14 to 15 (82.4 to 88.2%) of 17 L. monocytogenes lineage I and II isolates, M3643 reacted with 22 (91.7%) of 24 lineage I, II, and III isolates grown in selective enrichment media (UVM1, modified Fraser, Palcam, and UVM2 media). The three MAbs exhibited only weak reactivities (the optical densities at 414 nm were close to the cutoff value) to some other Listeria species grown in selective enrichment media. Collectively, the data indicate the potential of LMOf2365_0639 as a surface biomarker of L. monocytogenes, with the aid of specific MAbs, for pathogen detection, identification, and isolation in clinical, environmental, and food samples. IMPORTANCE L. monocytogenes is

Fat and fibre interfere with the dramatic effect that nanoemulsified d-limonene has on the heat resistance of Listeria monocytogenes.

Science.gov (United States)

Maté, Javier; Periago, Paula M; Ros-Chumillas, María; Grullón, Coralin; Huertas, Juan Pablo; Palop, Alfredo

2017-04-01

The application of d-limonene in form of nanoemulsion has been proved to reduce dramatically the thermal resistance of Listeria monocytogenes in culture media. The present research shows very promising results on the application in food products. The thermal resistance of L. monocytogenes was reduced 90 times when 0.5 mM nanoemulsified d-limonene was added to apple juice. This is the biggest reduction in the heat resistance of a microorganism caused by an antimicrobial described ever. However, no effect was found in carrot juice. A carrot juice system was prepared in an attempt to unravel which juice constituents were responsible for the lack of effect. When fat and fibre were not included in the carrot juice system formulation, the thermal resistance of L. monocytogenes was, again, dramatically reduced in presence of nanoemulsified d-limonene, so these components were shown to interfere with the effect. Once this interaction with food constituents becomes solved, the addition of nanoemulsified antimicrobials would allow to reduce greatly the intensity of the thermal treatments currently applied in the food processing industry. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

Control options for Listeria monocytogenes in seafoods

DEFF Research Database (Denmark)

Huss, Hans Henrik; Jørgensen, Lasse Vigel; Vogel, Birte Fonnesbech

2000-01-01

At least three outbreaks of listeriosis associated with seafood have been reported. Listeria monocytogenes is widely distributed in the general environment including fresh water, coastal water and live fish from these areas. Contamination or recontamination of seafood may also take place during...

Prevalence of Listeria monocytogenes in ready-to-eat seafood marketed in Thessaloniki (Northern Greece

Directory of Open Access Journals (Sweden)

N. Soultos

2014-11-01

Full Text Available Aim: In the current study, a contribution to the knowledge on the prevalence and level of contamination of Listeria monocytogenes in ready-to-eat (RTE seafood marketed in Thessaloniki (Northern Greece was provided; the serovar identity of the L. monocytogenes isolates was also determined. Materials and Methods: A total of 132 RTE seafood samples consisting of 74 smoked fish products, 18 salted fish products, 16 dried fish products, 9 raw marinated fish products, 10 cooked marinated cephalopods and 5 surimi crab stick products were analyzed. L. monocytogenes were isolated and enumerated based on ISO 11290-1/A1 and ISO 11290-2/A1 protocols, respectively, and identified using a multiplex polymerase chain reaction (PCR system utilizing genus and species specific primers. For the identification of serotypes a second multiplex PCR assay was used which clusters L. monocytogenes strains into four major serogroups. Results: Of the samples examined, 11 (8.3% proved positive for Listeria spp. with 8 (6.1% yielding L. monocytogenes. Only in one sample of smoked mackerel the level of L. monocytogenes exceeded the legal safety limit of 100 cfu/g set out in Commission Regulation (EC No. 1441/2007. Serotyping showed higher percentages of isolates belonging to PCR serogroup 3:1/2b, 3b, 7 (46.7% and serogroup 1:1/2a, 3a (40% followed by serogroup 4:4b, 4d, 4e (13.3%. Conclusion: This study demonstrated that L. monocytogenes can be isolated from processed RTE seafood products at retail in Thessaloniki (Northern Greece in low concentrations. However, the presence of this human pathogen in RTE seafood should not be overlooked, but it should be considered as having significance public health implications, particularly among the persons who are at greater risk. Therefore, RTE seafood should be produced under appropriate hygienic and technological conditions since the product does not undergo any treatment before consumption.

Prevalence and contamination levels of listeria monocytogenes in ready-to-eat foods in Tokyo, Japan.

Science.gov (United States)

Shimojima, Yukako; Ida, Miki; Nakama, Akiko; Nishino, Yukari; Fukui, Rie; Kuroda, Sumiyo; Hirai, Akihiko; Kai, Akemi; Sadamasu, Kenji

2016-08-01

We surveyed prevalence and contamination levels of Listeria monocytogenes in ready-to-eat foods between 2000 and 2012 in Tokyo. L. monocytogenes was isolated from 52 (1.7%) out of 2,980 samples. Comparing the prevalence in the study period, 2.2% were positive in the former period (2000-2005) and 1.2% in the latter (2006-2012). Using the most probable number (MPN) technique, 32 samples were contaminated with fewer than 0.3 L. monocytogenes/g, 10 samples with 0.3-1.0/g and 4 samples with more than 1.0/g (the maximum was 2.3/g). The most common serovar was 1/2a, followed by 1/2b, 4b and 1/2c. We revealed that ready-to-eat foods in Tokyo were contaminated with L. monocytogenes, although the contamination levels were low.

Prevalence and quantification of Listeria monocytogenes in beef offal at retail level in Selangor, Malaysia

Science.gov (United States)

Kuan, Chee Hao; Wong, Woan Chwen; Pui, Chai Fung; Mahyudin, Nor Ainy; Tang, John Yew Huat; Nishibuchi, Mitsuaki; Radu, Son

2013-01-01

A total of 63 beef offal samples (beef liver = 16; beef lung = 14; beef intestine = 9; beef tripe = 15; beef spleen = 9) from three wet markets (A, B, and C) in Selangor, Malaysia were examined for the prevalence and microbial load of Listeria monocytogenes. A combination of the most probable number and polymerase chain reaction (MPN-PCR) method was employed in this study. It was found that L. monocytogenes detected in 33.33% of the beef offal samples. The prevalence of L. monocytogenes in beef offal purchased from wet markets A, B, and C were 22.73%, 37.50% and 41.18% respectively. The density of L. monocytogenes in all the samples ranged from 2,400 MPN/g. The findings in this study indicate that beef offal can be a potential vehicle of foodborne listeriosis. PMID:24688507

Prevalence and quantification of Listeria monocytogenes in beef offal at retail level in Selangor, Malaysia

Directory of Open Access Journals (Sweden)

Chee Hao Kuan

2013-12-01

Full Text Available A total of 63 beef offal samples (beef liver = 16; beef lung = 14; beef intestine = 9; beef tripe = 15; beef spleen = 9 from three wet markets (A, B, and C in Selangor, Malaysia were examined for the prevalence and microbial load of Listeria monocytogenes. A combination of the most probable number and polymerase chain reaction (MPN-PCR method was employed in this study. It was found that L. monocytogenes detected in 33.33% of the beef offal samples. The prevalence of L. monocytogenes in beef offal purchased from wet markets A, B, and C were 22.73%, 37.50% and 41.18% respectively. The density of L. monocytogenes in all the samples ranged from 2,400 MPN/g. The findings in this study indicate that beef offal can be a potential vehicle of foodborne listeriosis.

Molecular analysis of the iap gene of Listeria monocytogenes isolated from cheeses in Rio Grande do Sul, Brazil Análise molecular do gene iap de Listeria monocytogenes isoladas de queijos no Estado do Rio Grande do Sul, Brasil

Directory of Open Access Journals (Sweden)

Jozi Fagundes de Mello

2008-03-01

Full Text Available The polymorphic region sequences in the iap gene were analyzed in 25 strains of Listeria monocytogenes isolated from cheeses in the state of Rio Grande do Sul, and compared with reference strains. This investigation distinguished two clusters of L. monocytogenes: I (20 strains and II (5 strains.A seqüência da região polimórfica do gene iap foi analisada em 25 cepas de Listeria monocytogenes isoladas de queijo no Estado do Rio Grande do Sul e comparadas com cepas referências. Esta investigação distinguiu L. monocytogenes em dois grupos: I (20 cepas e II (5 cepas.

Phloretin Attenuates Listeria monocytogenes Virulence Both In vitro and In vivo by Simultaneously Targeting Listeriolysin O and Sortase A.

Science.gov (United States)

Wang, Jianfeng; Liu, Bowen; Teng, Zihao; Zhou, Xuan; Wang, Xiyan; Zhang, Bing; Lu, Gejin; Niu, Xiaodi; Yang, Yongjun; Deng, Xuming

2017-01-01

The critical roles of sortase A (SrtA) and listeriolysin O (LLO) in Listeria monocytogenes pathogenicity render these two virulence factors as ideal targets for the development of anti-virulence agents against L. monocytogenes infection. Additionally, the structures of SrtA and LLO are highly conserved among the members of sortase enzyme family and cholesterol dependent toxin family. Here, phloretin, a natural polyphenolic compound derived from apples and pears that has little anti- L. monocytogenes activity, was identified to simultaneously inhibit LLO expression and neutralize SrtA catalytic activity. Phloretin neutralized SrtA activity by causing a conformational change in the protein's active pocket, which prevented engagement with its substrate. Treatment with phloretin simultaneously reduced L. monocytogenes invasion into host cells and blocked the escape of vacuole-entrapped L. monocytogenes into cytoplasm. Further, L. monocytogenes -infected mice that received phloretin showed lower mortality, decreased bacterial burden and reduced pathological injury. Our results demonstrate that phloretin is a promising anti-infective therapeutic for infections caused by L. monocytogenes due to its simultaneous targeting of SrtA and LLO, which may result in fewer side effects than those caused by other antibiotics.

Diversity Assessment of Heat Resistance of Listeria monocytogenes Strains in a Continuous-Flow Heating System

NARCIS (Netherlands)

Veen, van der S.; Wagendorp, A.; Abee, T.; Wells-Bennik, M.H.J.

2009-01-01

Listeria monocytogenes is a foodborne pathogen that has the ability to survive relatively high temperatures compared with other nonsporulating foodborne pathogens. This study was performed to determine whether L. monocytogenes strains with relatively high heat resistances are adequately inactivated

Packaging properties and control of Listeria monocytogenes in bologna by cellulosic films incorporated with pediocin

Directory of Open Access Journals (Sweden)

Paula Judith Pérez Espitia

2013-09-01

surfaces. Hence, active cellulosic films made with 50 % pediocin in the form of commercially available concentrated ALTA™ 2341 have the potential of being used in a system of hurdle technologies as a final obstacle for L. monocytogenes control in bologna preservation.

Liver tissue engineering based on aggregate assembly: efficient formation of endothelialized rat hepatocyte aggregates and their immobilization with biodegradable fibres

International Nuclear Information System (INIS)

Pang, Y; Shinohara, M; Komori, K; Sakai, Y; Montagne, K

2012-01-01

To realize long-term in vitro culture of hepatocytes at a high density while maintaining a high hepatic function for aggregate-based liver tissue engineering, we report here a novel culture method whereby endothelialized rat hepatocyte aggregates were formed using a PDMS microwell device and cultured in a perfusion bioreactor by introducing spacers between aggregates to improve oxygen and nutrient supply. Primary rat hepatocyte aggregates around 100 µm in diameter coated with human umbilical vein endothelial cells were spontaneously and quickly formed after 12 h of incubation, thanks to the continuous supply of oxygen by diffusion through the PDMS honeycomb microwell device. Then, the recovered endothelialized rat hepatocyte aggregates were mixed with biodegradable poly-l-lactic acid fibres in suspension and packed into a PDMS-based bioreactor. Perfusion culture of 7 days was successfully achieved with more than 73.8% cells retained in the bioreactor. As expected, the fibres acted as spacers between aggregates, which was evidenced from the enhanced albumin production and more spherical morphology compared with fibre-free packing. In summary, this study shows the advantages of using PDMS-based microwells to form heterotypic aggregates and also demonstrates the feasibility of spacing tissue elements for improving oxygen and nutrient supply to tissue engineering based on modular assembly. (paper)

A Meta-analysis of the Rates of Listeria monocytogenes and Enterococcus in Febrile Infants.

Science.gov (United States)

Leazer, Rianna; Perkins, Amy M; Shomaker, Kyrie; Fine, Bryan

2016-04-01

A change in the epidemiology of pathogens causing serious bacterial infection (SBI) has been noted since original recommendations were made for the empirical antibiotic choices for young infants with fever. To assess the prevalence of SBI caused by Listeria monocytogenes and Enterococcus species. A literature search was conducted on keywords related to SBI, L. monocytogenes, and Enterococcus spp. infections. Eligible studies were those conducted in the United States and published between January 1998 and June 2014 focusing on SBI in infants≤90 days of age. The rates of urinary tract infection, bacteremia, and meningitis for each pathogen were recorded for each study. Meta-analysis was performed to calculate the prevalence for each pathogen in a random effects model with 0.5 continuity correction added to studies with zero events. Sixteen studies were included. A total of 20,703 blood cultures were included, with weighted prevalences for L. monocytogenes and Enterococcus spp. bacteremia of 0.03% and 0.09%, respectively. A total of 13,775 cerebrospinal fluid cultures were included with event rates (unweighted prevalences) for L. monocytogenes and Enterococcus spp. meningitis of 0.02% and 0.03%, respectively. A total of 18,283 urine cultures were included, with no cases of L. monocytogenes and a weighted prevalence for Enterococcus spp. urinary tract infection of 0.28%. There may have been reporting bias or incomplete retrieval or inadvertent exclusion of relevant studies. SBI caused by L. monocytogenes and Enterococcus spp. in febrile infants is rare, and therefore clinicians may consider a change in empirical antibiotic choices. Copyright © 2016 by the American Academy of Pediatrics.

Comparison of Listeria monocytogenes recoveries from spiked mung bean sprouts by the enrichment methods of three regulatory agencies.

Science.gov (United States)

Cauchon, Kaitlin E; Hitchins, Anthony D; Smiley, R Derike

2017-09-01

Three selective enrichment methods, the United States Food and Drug Administration's (FDA method), the United States Department of Agriculture Food Safety Inspection Service's (USDA method), and the EN ISO 11290-1 standard method, were assessed for their suitability for recovery of Listeria monocytogenes from spiked mung bean sprouts. Three parameters were evaluated; the enrichment L. monocytogenes population from singly-spiked sprouts, the enrichment L. monocytogenes population from doubly-spiked (L. monocytogenes and Listeria innocua) sprouts, and the population differential resulting from the enrichment of doubly-spiked sprouts. Considerable L. monocytogenes inter-strain variation was observed. The mean enrichment L. monocytogenes populations for singly-spiked sprouts were 6.1 ± 1.2, 4.9 ± 1.2, and 6.9 ± 2.3 log CFU/mL for the FDA, USDA, and EN ISO 11290-1 methods, respectively. The mean L. monocytogenes populations for doubly-spiked sprouts were 4.7 ± 1.1, 5.5 ± 1.3, and 4.6 ± 1.4 log CFU/mL for the FDA, USDA, and ISO 11290-1 enrichment methods, respectively. The corresponding mean population differentials were 2.8 ± 1.1, 3.3 ± 1.3, and 3.6 ± 1.4 Δlog CFU/mL for the same three enrichment methods, respectively. The presence of L. innocua and resident microorganisms on the sprouts negatively impacted final levels of L. monocytogenes with all three enrichment methods. Published by Elsevier Ltd.

Real-time PCR detection of Listeria monocytogenes in infant formula and lettuce following macrophage-based isolation and enrichment.

Science.gov (United States)

Day, J B; Basavanna, U

2015-01-01

To develop a rapid detection procedure for Listeria monocytogenes in infant formula and lettuce using a macrophage-based enrichment protocol and real-time PCR. A macrophage cell culture system was employed for the isolation and enrichment of L. monocytogenes from infant formula and lettuce for subsequent identification using real-time PCR. Macrophage monolayers were exposed to infant formula and lettuce contaminated with a serial dilution series of L. monocytogenes. As few as approx. 10 CFU ml(-1) or g(-1) of L. monocytogenes were detected in infant formula and lettuce after 16 h postinfection by real-time PCR. Internal positive PCR controls were utilized to eliminate the possibility of false-negative results. Co-inoculation with Listeria innocua did not reduce the L. monocytogenes detection sensitivity. Intracellular L. monocytogenes could also be isolated on Listeria selective media from infected macrophage lysates for subsequent confirmation. The detection method is highly sensitive and specific for L. monocytogenes in infant formula and lettuce and establishes a rapid identification time of 20 and 48 h for presumptive and confirmatory identification, respectively. The method is a promising alternative to many currently used q-PCR detection methods which employ traditional selective media for enrichment of contaminated food samples. Macrophage enrichment of L. monocytogenes eliminates PCR inhibitory food elements and contaminating food microflora which produce cleaner samples that increase the rapidity and sensitivity of detection. Published 2014. This article is a U.S. Government work and is in the public domain in the USA.

Occurrence and antimicrobial resistance patterns of Listeria monocytogenes isolated from vegetables

Directory of Open Access Journals (Sweden)

Vanessa de Vasconcelos Byrne

2016-06-01

Full Text Available Abstract Although the consumption of fresh and minimally processed vegetables is considered healthy, outbreaks related to the contamination of these products are frequently reported. Among the food-borne pathogens that contaminate vegetables is Listeria monocytogenes, a ubiquitous organism that exhibits the ability to survive and multiply at refrigerated temperatures. This study aimed to evaluate the occurrence of L. monocytogenes in vegetables as well as the antimicrobial resistance of isolates. The results showed that 3.03% of samples were contaminated with L. monocytogenes, comprising 2.22% of raw vegetables and 5.56% of ready-to-eat vegetables. Multiplex PCR confirmed the virulence potential of the isolates. Antimicrobial resistance profiling showed that 50% of the isolates were susceptible to the antibiotics used. The resistance of one isolate to penicillin G, a commonly employed therapeutic agent, and the presence of serotype 4b, a serotype commonly associated with food-borne outbreaks, could be potential health hazards for consumers.

Mechanistic studies of the agmatine deiminase from Listeria monocytogenes.

Science.gov (United States)

Soares, Charles A; Knuckley, Bryan

2016-06-01

Listeria monocytogenes is a Gram-positive food-borne pathogen that is capable of living within extreme environments (i.e. low temperatures and pH). This ability to survive in such conditions may arise, at least in part, from agmatine catabolism via the agmatine deiminase system (AgDS). This catabolic pathway utilizes an agmatine deiminase (AgD) to hydrolyse agmatine into N-carbamoylputrescine (NCP), with concomitant release of ammonia, which increases the pH, thus mitigating the ill effects of the acidic environment. Given the potential significance of this pathway for cell survival, we set out to study the catalytic mechanism of the AgD encoded by L. monocytogenes In the present paper, we describe the catalytic mechanism employed by this enzyme based on pH profiles, pKa measurements of the active site cysteine and solvent isotope effects (SIE). In addition, we report inhibition of this enzyme by two novel AgD inhibitors, i.e. N-(4-aminobutyl)-2-fluoro-ethanimidamide (ABFA) and N-(4-aminobutyl)-2-chloro-ethanimidamide (ABCA). In contrast with other orthologues, L. monocytogenes AgD does not use the reverse protonation or substrate-assisted mechanism, which requires an active site cysteine with a high pKa and has been commonly seen in other members of the guanidinium-modifying enzyme (GME) superfamily. Instead, the L. monocytogenes AgD has a low pKa cysteine in the active site leading to an alternative mechanism of catalysis. This is the first time that this mechanism has been observed in the GME superfamily and is significant because it explains why previously developed mechanism-based inactivators of AgDs are ineffective against this orthologue. © 2016 The Author(s). published by Portland Press Limited on behalf of the Biochemical Society.

An Internalin A Probe-Based Genosensor for Listeria monocytogenes Detection and Differentiation

Directory of Open Access Journals (Sweden)

Laura Bifulco

2013-01-01

Full Text Available Internalin A (InlA, a protein required for Listeria monocytogenes virulence, is encoded by the inlA gene, which is only found in pathogenic strains of this genus. One of the best ways to detect and confirm the pathogenicity of the strain is the detection of one of the virulence factors produced by the microorganism. This paper focuses on the design of an electrochemical genosensor used to detect the inlA gene in Listeria strains without labelling the target DNA. The electrochemical sensor was obtained by immobilising an inlA gene probe (single-stranded oligonucleotide on the surfaces of screen-printed gold electrodes (Au-SPEs by means of a mercaptan-activated self-assembled monolayer (SAM. The hybridisation reaction occurring on the electrode surface was electrochemically transduced by differential pulse voltammetry (DPV using methylene blue (MB as an indicator. The covalently immobilised single-stranded DNA was able to selectively hybridise to its complementary DNA sequences in solution to form double-stranded DNA on the gold surface. A significant decrease of the peak current of the voltammogram (DPV upon hybridisation of immobilised ssDNA was recorded. Whole DNA samples of L. monocytogenes strains could be discriminated from other nonpathogenic Listeria species DNA with the inlA gene DNA probe genosensor.

Fluorescent determination of poly(hexamethylene guanidine) via the aggregates it forms with quantum dots and magnetic nanoparticles

International Nuclear Information System (INIS)

Likhachev, Konstantin V.; Beklemishev, Mikhail K.; Ovcharenko, Elena O.; Dityuk, Alexander I.; Efimov, Konstantin M.; Abramchuk, Sergei S.

2016-01-01

The authors report that the cationic polymer-oligomer poly(hexamethylene guanidine) (PHMG) in the form of its hydrochloride induces the formation of mixed aggregates composed of anionic magnetic nanoparticles (magNPs), PHMG and anionic quantum dots (QDs). The magNPs consisted of polymer-coated magnetite nanoparticles, and the QDs consisted of polymer-coated CdSe-CdS/ZnS nanoparticles with an emission maximum at 617 nm. This finding is exploited in a semi-quantitative method for the determination of PHMG. The protocol includes magnetic separation of the mixed aggregates (magNPs/PHMG/QDs) from the sample and excess QDs, redispersion of the aggregates in water, and measurement of fluorescence intensity. The signal is proportional to the concentration of PHMG in the 0.05 to 0.2 mg L"−"1 concentration range, with intra-day RSDs of up to 27 %. The limit of detection (LOD) of PHMG in spiked run-off waters, swimming pool water and wastewater is 23 μg L"−"1. This PHMG assay is selective in that high concentrations of surfactants and inorganic salts are tolerated. Polyethyleneimine and poly(diallyldimethylammonium chloride) also cause the formation of mixed aggregates but only at higher concentrations. Both a fluorometer and a digital camera (using a 365-nm LED as a light source) were used to measure fluorescence. In case of using a digital camera, the LOD is 40 μg L"−"1 and the intraday RSDs are up to 23 %. The method is sensitive, fairly selective and rather simple. (author)

Prevalence, enumeration and pheno- and genotypic characteristics of Listeria monocytogenes isolated from raw foods in South China

Directory of Open Access Journals (Sweden)

Moutong eChen

2015-09-01

Full Text Available Listeria monocytogenes is an important foodborne pathogen that can cause serious illness in immunocompromised individuals, pregnant women, the elderly, and newborns. The aim of this study was to: (i evaluate the prevalence and contamination level (most probable number, MPN of L. monocytogenes in 567 retail raw foods (fishery products, n=154; raw/fresh meat, n=123; frozen foods, n=110; edible fungi, n=108; vegetables, n=72 collected from South China and (ii to gain further knowledge on the phenotype and genotype distributions of this important foodborne pathogen. Approximately 22% of the samples were positive for L. monocytogenes. The contamination levels were between 0.3 and 10 MPN/g in 75.0%, between 10 and 100 MPN/g in 11.0% and less than 100 MPN/g in 14.0% of the countable samples. Five serogroups were identified among the177 foodborne L. monocytogenes isolates, with1/2a-3a (42.4% and1/2b-3b (26.0% serogroups being the most dominant. Serogroup I.1 and II.2 were only found in the edible mushrooms, while serogroup III was dominant in the fishery products, suggesting that specific serogroups of L. monocytogenes may have distinct ecological niches. Ten (5.6% L. monocytogenes isolates exhibited multidrug resistance. Genetic relatedness analysis revealed the absence of distinct associations between specific food types, antibiotic resistance, serogroups, and genetic diversity. The present study provided the first baseline data on the prevalence, contamination level, and characteristics of L. monocytogenes isolated from raw foods in South China. Some multidrug resistant strains belonged to the epidemiologically important serogroups (I.1 and II.1, implying a potential public health risk. In addition, these findings also provide basic information for the Chinese food safety associated authorities to draft appropriate standards to control L. monocytogenes contamination and improve microbiological safety of raw foods.

Local Outbreak of Listeria monocytogenes Serotype 4b Sequence Type 6 Due to Contaminated Meat Pâté.

Science.gov (United States)

Althaus, Denise; Jermini, Marco; Giannini, Petra; Martinetti, Gladys; Reinholz, Danuta; Nüesch-Inderbinen, Magdalena; Lehner, Angelika; Stephan, Roger

2017-04-01

In January and February 2016, five cases of confirmed and two cases of probable infection due to Listeria monocytogenes serotype 4b, sequence type (ST) 6 belonging to a single pulsed-field gel electrophoresis pulsotype pattern were registered in a region of southern Switzerland. L. monocytogenes was detected in blood samples (four cases) and pleural fluid (one case). Furthermore, L. monocytogenes 4b ST6 was detected in a stool sample of an asymptomatic person exposed to a common food. Forthwith, the food safety authority and a local gourmet meat producer reported L. monocytogenes contamination of meat pâté. Analysis of further food and environmental samples from the premises of the producer yielded isolates matching the clinical strains and confirmed the presence of L. monocytogenes 4b ST6 in the mincing machine as the cause of the food contamination.

Triclosan-Induced Aminoglycoside-Tolerant Listeria monocytogenes Isolates Can Appear as Small-Colony Variants

DEFF Research Database (Denmark)

Kastbjerg, Vicky Gaedt; Hein-Kristensen, Line; Gram, Lone

2014-01-01

Exposure of the human food-borne pathogen Listeria monocytogenes to sublethal concentrations of triclosan can cause resistance to several aminoglycosides. Aminoglycoside-resistant isolates exhibit two colony morphologies: normal-size and pinpoint colonies. The purposes of the present study were...... to characterize the small colonies of L. monocytogenes and to determine if specific genetic changes could explain the triclosan-induced aminoglycoside resistance in both pinpoint and normal-size isolates. Isolates from the pinpoint colonies grew poorly under aerated conditions, but growth was restored by addition......I and that exposure to triclosan can cause resistance to antibiotics that enters the cell via active transport. Further studies are needed to elucidate if L. monocytogenes pinpoint isolates could have any clinical impact, e.g., in persistent infections....

Effect of starter cultures on survival of Listeria monocytogenes in Čajna sausage

Science.gov (United States)

Bošković, M.; Tadić, V.; Đorđević, J.; Glišić, M.; Lakićević, B.; Dimitrijević, M.; Baltić, M. Ž.

2017-09-01

The aim of the study was to evaluate the survival of Listeria monocytogenes during the production of Čajna sausage with short maturation time. Sausage batter was inoculated with three different serotypes 4b and serotype 1/2a of L. monocytogenes. Control sausages were without any starter culture added; the second batch was inoculated with strains of Lactobacillus sakei, Staphylococcus carnosus and Staphylococcus xylosus, and the third batch was inoculated with strains of Debaryomyces hansenii, Lactobacillus sakei, Pediococcus acidilactici, Pediococcus pentosaceus, Staphylococcus carnosus and Staphylococcus xylosus. After 18 days of ripening, L. monocytogenes was not detected in any of the sausages, but during this fermentation and drying, the numbers of this pathogen was lower in the sausages inoculated with starter cultures.

Factors associated with Listeria monocytogenes contamination of cold-smoked pork products produced in Latvia and Lithuania.

OpenAIRE

Berzins,-A; Horman,-A; Lunden,-J; Korkeala,-H

2007-01-01

A total of 312 samples of sliced, vacuum packaged, cold-smoked pork from 15 meat processing plants in Latvia and Lithuania, obtained over a 15-month period from 2003 until 2004, were analyzed for the presence of Listeria monocytogenes at the end of their shelf-life. Overall, 120 samples (38%) tested positive for L. monocytogenes. Despite the long storing period, the levels of L. monocytogenes in cold-smoked pork products were low. Manufacturing processes were studied at seven meat processing ...

An outbreak of an unusual strain of Listeria monocytogenes infection in North-East Scotland.

Science.gov (United States)

Okpo, Emmanuel; Leith, Jayne; Smith-Palmer, Alison; Bell, John; Parks, Duncan; Browning, Fiona; Byers, Lynn; Corrigan, Helen; Webster, Diana; Karcher, Anne M; Murray, Andrew; Storey, Tom

2015-01-01

Listeria monocytogenes infection is an important cause of illness and hospitalization in vulnerable individuals. In the present study, we describe a community outbreak of Listeria monocytogenes in the North-East region of Scotland, which was epidemiologically, environmentally and microbiologically linked to a local meat product and ready-to-eat product manufacturer. Infected individuals were interviewed, and an environmental investigation was conducted. Clinical and environmental samples were tested by culture, and isolates were typed by fluorescent amplified fragment length polymorphism (fAFLP). Three cases of Listeria monocytogenes were linked geographically, had the same serotype (1/2a) and were indistinguishable by fAFLP type XII.6. The human, food and environmental isolates were of the same serotype and were indistinguishable by molecular typing. This is the first community outbreak of L. monocytogenes reported in Scotland since the current outbreak surveillance was established in 1996. Epidemiological and laboratory evidence indicated poor hand hygiene, unhygienic practices and cross-contamination throughout the manufacturing process of ready-to-eat foods as a possible cause of the outbreak. More stringent control of commercial food establishments that provide ready-to-eat food and the need to advise specifically vulnerable groups, e.g., pregnant women, of the risk of L. monocytogenes in ready-to-eat food is urgently needed. Copyright © 2015 King Saud Bin Abdulaziz University for Health Sciences. Published by Elsevier Ltd. All rights reserved.

Identification of a Peptide-Pheromone that Enhances Listeria monocytogenes Escape from Host Cell Vacuoles

Science.gov (United States)

Xayarath, Bobbi; Alonzo, Francis; Freitag, Nancy E.

2015-01-01

Listeria monocytogenes is a Gram-positive facultative intracellular bacterial pathogen that invades mammalian cells and escapes from membrane-bound vacuoles to replicate within the host cell cytosol. Gene products required for intracellular bacterial growth and bacterial spread to adjacent cells are regulated by a transcriptional activator known as PrfA. PrfA becomes activated following L. monocytogenes entry into host cells, however the signal that stimulates PrfA activation has not yet been defined. Here we provide evidence for L. monocytogenes secretion of a small peptide pheromone, pPplA, which enhances the escape of L. monocytogenes from host cell vacuoles and may facilitate PrfA activation. The pPplA pheromone is generated via the proteolytic processing of the PplA lipoprotein secretion signal peptide. While the PplA lipoprotein is dispensable for pathogenesis, bacteria lacking the pPplA pheromone are significantly attenuated for virulence in mice and have a reduced efficiency of bacterial escape from the vacuoles of nonprofessional phagocytic cells. Mutational activation of PrfA restores virulence and eliminates the need for pPplA-dependent signaling. Experimental evidence suggests that the pPplA peptide may help signal to L. monocytogenes its presence within the confines of the host cell vacuole, stimulating the expression of gene products that contribute to vacuole escape and facilitating PrfA activation to promote bacterial growth within the cytosol. PMID:25822753

Listeria monocytogenes incidence changes and diversity in some Brazilian dairy industries and retail products.

Science.gov (United States)

Oxaran, Virginie; Lee, Sarah Hwa In; Chaul, Luíza Toubas; Corassin, Carlos Humberto; Barancelli, Giovana Verginia; Alves, Virgínia Farias; de Oliveira, Carlos Augusto Fernandes; Gram, Lone; De Martinis, Elaine Cristina Pereira

2017-12-01

Listeria monocytogenes can cause listeriosis, a severe foodborne disease. In Brazil, despite very few reported cases of listeriosis, the pathogen has been repeatedly isolated from dairies. This has led the government to implement specific legislation to reduce the hazard. Here, we determined the incidence of L. monocytogenes in five dairies and retail products in the Southeast and Midwest regions of Brazil over eight months. Of 437 samples, three samples (0.7%) from retail and only one sample (0.2%) from the dairies were positive for L. monocytogenes. Thus, the contamination rate was significantly reduced as compared to previous studies. MultiLocus Sequence Typing (MLST) was used to determine if contamination was caused by new or persistent clones leading to the first MLST profile of L. monocytogenes from the Brazilian dairy industry. The processing environment isolate is of concern being a sequence-type (ST) 2, belonging to the lineage I responsible for the majority of listeriosis outbreaks. Also, ST3 and ST8 found in commercialized cheese have previously been reported in outbreaks. Despite the lower incidence, dairy products still pose a potential health risk and the occurrence of L. monocytogenes in dairies and retail products emphasize the need for continuous surveillance of this pathogen in the Brazilian dairy industry. Copyright © 2017 Elsevier Ltd. All rights reserved.

Efficacy of household washing treatments for the control of Listeria monocytogenes on salad vegetables.

Science.gov (United States)

Nastou, Aikaterini; Rhoades, Jonathan; Smirniotis, Petros; Makri, Ioanna; Kontominas, Michael; Likotrafiti, Eleni

2012-10-15

The efficacy of household decontamination methods at reducing Listeria monocytogenes on fresh lettuce (Lactuca sativa), cucumber (Cucumis sativus) and parsley (Petroselinum sativum) was studied. Inoculated vegetable pieces were immersed in washing solutions and surviving L. monocytogenes enumerated. Parameters investigated were storage temperature prior to washing, dipping water temperature, agitation, acetic acid concentration and immersion time. The results indicated that the storage temperature significantly affects the efficacy of dipping vegetables in water for the control of L. monocytogenes, as the reduction in count was greatest when products had been stored at cooler temperatures. Decontamination with acetic acid (up to 2.0% v/v) was shown to have some effect in most cases, but the highest observed decrease in count was 2.6 log cfu/g. Experiments investigating the effect of exposure time to acetic acid (0.5% and 1.0% v/v, up to 30 min immersion) indicated that immersing the vegetables for more than 10 min is of minimal benefit. The most significant factor affecting washing and decontamination efficacy was the vegetable itself: L. monocytogenes colonizing cucumber epidermis was far more resistant to removal by washing and to acid treatment than that on the leafy vegetables, and L. monocytogenes on parsley was the most susceptible. This shows that published decontamination experiments (often performed with lettuce) cannot necessarily be extrapolated to other vegetables. Copyright © 2012 Elsevier B.V. All rights reserved.

Detection of Listeria monocytogenes in ready-to-eat food by Step One real-time polymerase chain reaction.

Science.gov (United States)

Pochop, Jaroslav; Kačániová, Miroslava; Hleba, Lukáš; Lopasovský, L'ubomír; Bobková, Alica; Zeleňáková, Lucia; Stričík, Michal

2012-01-01

The aim of this study was to follow contamination of ready-to-eat food with Listeria monocytogenes by using the Step One real time polymerase chain reaction (PCR). We used the PrepSEQ Rapid Spin Sample Preparation Kit for isolation of DNA and MicroSEQ® Listeria monocytogenes Detection Kit for the real-time PCR performance. In 30 samples of ready-to-eat milk and meat products without incubation we detected strains of Listeria monocytogenes in five samples (swabs). Internal positive control (IPC) was positive in all samples. Our results indicated that the real-time PCR assay developed in this study could sensitively detect Listeria monocytogenes in ready-to-eat food without incubation.

The challenge of setting risk-based microbiological criteria for Listeria monocytogenes

DEFF Research Database (Denmark)

Andersen, Jens Kirk; Nørrung, Birgit

2011-01-01

After more than 20 years of work with discussing the setting of microbiological criteria for Listeria monocytogenes in foods, Codex Alimentarius on Food Hygiene has finalised a proposal that was recently adopted by the Codex Alimentarius Commission. The effort of developing procedures for making...... the microbiological criteria risk-based to the greatest extent possible has challenged scientists and managers during this long time period. Yet, the establishment of microbiological criteria for L. monocytogenes is still being discussed and several approaches are possible. Setting of microbiological criteria...

Listeria monocytogenes presence during fermentation, drying and storage of Petrovská klobása sausage

Science.gov (United States)

Janković, V.; Mitrović, R.; Lakićević, B.; Velebit, B.; Baltić, T.

2017-09-01

The majority of human listeriosis cases appear to be caused by consumption of ready-to-eat (RTE) foods contaminated at the time of consumption with high levels of Listeria monocytogenes. Although strategies to prevent growth of L. monocytogenes in RTE products are critical for reducing the incidence of human listeriosis, this pathogen is highly difficult to control in fermented sausage processing environments due to its high tolerance to low pH and high salt concentration. The aims of the present study were to investigate the occurrence, presence and elimination of L. monocytogenes in Petrovská klobása sausage during processing, fermentation, drying and storage. L. monocytogenes, which was detected at the beginning of the production cycle, disappeared before day 30. The pathogen decline was much faster in those sausages which were dried in controlled, industrial conditions than in those dried applying the traditional, household technique.

Inhibitory effect of liposome-entrapped lemongrass oil on the growth of Listeria monocytogenes in cheese.

Science.gov (United States)

Cui, H Y; Wu, J; Lin, L

2016-08-01

Listeria monocytogenes infection in dairy products is of mounting public concern. To inhibit bacterial growth, we engineered stimuli-responsive liposomes containing lemongrass oil for this study. The controlled release of liposome-entrapped lemongrass oil is triggered by listerolysin O, secreted by L. monocytogenes. We investigated the antibiotic activities of lemongrass oil liposomes against L. monocytogenes in cheese. We also assessed their possible effects on the quality of the cheese. Liposomes containing lemongrass oil (5.0mg/mL) presented the optimal polydispersity index (0.246), zeta-potential (-58.9mV) and entrapment efficiency (25.7%). The liposomes displayed satisfactory antibiotic activity against L. monocytogenes in cheese over the storage period at 4°C. We observed no effects on the physical and sensory properties of the cheese after the liposome treatment. Copyright © 2016 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

Spatial and Temporal Factors Associated with an Increased Prevalence of Listeria monocytogenes in Spinach Fields in New York State

Science.gov (United States)

Weller, Daniel; Wiedmann, Martin

2015-01-01

While rain and irrigation events have been associated with an increased prevalence of foodborne pathogens in produce production environments, quantitative data are needed to determine the effects of various spatial and temporal factors on the risk of produce contamination following these events. This study was performed to quantify these effects and to determine the impact of rain and irrigation events on the detection frequency and diversity of Listeria species (including L. monocytogenes) and L. monocytogenes in produce fields. Two spinach fields, with high and low predicted risks of L. monocytogenes isolation, were sampled 24, 48, 72, and 144 to 192 h following irrigation and rain events. Predicted risk was a function of the field's proximity to water and roads. Factors were evaluated for their association with Listeria species and L. monocytogenes isolation by using generalized linear mixed models (GLMMs). In total, 1,492 (1,092 soil, 334 leaf, 14 fecal, and 52 water) samples were collected. According to the GLMM, the likelihood of Listeria species and L. monocytogenes isolation from soil samples was highest during the 24 h immediately following an event (odds ratios [ORs] of 7.7 and 25, respectively). Additionally, Listeria species and L. monocytogenes isolates associated with irrigation events showed significantly lower sigB allele type diversity than did isolates associated with precipitation events (P = monocytogenes contamination. Small changes in management practices (e.g., not irrigating fields before harvest) may therefore reduce the risk of L. monocytogenes contamination of fresh produce. PMID:26116668

Isolation and characterization of an atypical Listeria monocytogenes associated with a canine urinary tract infection

Science.gov (United States)

Listeria monocytogenes, a well-described cause of encephalitis and abortion in ruminants and of food-borne illness in humans, is rarely associated with disease in companion animals. A case of urinary tract infection associated with an atypical, weakly hemolytic L. monocytogenes strain is described i...

Prevalence and quantification of Listeria monocytogenes in chicken offal at the retail level in Malaysia.

Science.gov (United States)

Kuan, C H; Goh, S G; Loo, Y Y; Chang, W S; Lye, Y L; Puspanadan, S; Tang, J Y H; Nakaguchi, Y; Nishibuchi, M; Mahyudin, N A; Radu, S

2013-06-01

A total of 216 chicken offal samples (chicken liver = 72; chicken heart = 72; chicken gizzard = 72) from wet markets and hypermarkets in Selangor, Malaysia, were examined for the presence and density of Listeria monocytogenes by using a combination of the most probable number and PCR method. The prevalence of L. monocytogenes in 216 chicken offal samples examined was 26.39%, and among the positive samples, the chicken gizzard showed the highest percentage at 33.33% compared with chicken liver (25.00%) and chicken heart (20.83%). The microbial load of L. monocytogenes in chicken offal samples ranged from Malaysia.

Effect of humidity and temperature on the survival of Listeria monocytogenes on surfaces.

Science.gov (United States)

Redfern, J; Verran, J

2017-04-01

Listeria monocytogenes is a pathogenic bacterium, with human disease and infection linked to dairy products, seafood, ready-to-eat meat and raw & undercooked meats. Stainless steel is the most common food preparation surface and therefore, it is important to understand how food storage conditions such as surface materials, temperature and relative humidity can affect survival of L. monocytogenes. In this study, survival of L. monocytogenes on stainless steel was investigated at three temperatures (4, 10 and 21°C), each approx. 11, 50 and 85% humidity. Results indicate that the lower the temperature, the more cells were recovered in all three humidity environments, while medium humidity enhances survival, irrespective of temperature. Lower humidity decreases recovery at all temperatures. These data support the guidance noted above that humidity control is important, and that lower humidity environments are less likely to support retention of viable L. monocytogenes on a stainless steel surface. Understanding survival of potential food-borne pathogens is essential for the safe production and preparation of food. While it has long been 'common knowledge' that relative humidity can affect the growth and survival of micro-organisms, this study systematically describes the survival of L. monocytogenes on stainless steel under varying humidity and temperatures for the first time. The outcomes from this paper will allow those involved with food manufacture and preparation to make informed judgement on environmental conditions relating to humidity control, which is lacking in the food standards guidelines. © 2017 The Society for Applied Microbiology.

Inhibition of Listeria monocytogenes by propionic acid-based ingredients in cured deli-style Turkey.

Science.gov (United States)

Glass, Kathleen A; McDonnell, Lindsey M; Von Tayson, Roxanne; Wanless, Brandon; Badvela, Mani

2013-12-01

Listeria monocytogenes growth can be controlled on ready-to-eat meats through the incorporation of antimicrobial ingredients into the formulation or by postlethality kill steps. However, alternate approaches are needed to provide options that reduce sodium content but maintain protection against pathogen growth in meats after slicing. The objective of this study was to determine the inhibition of L. monocytogenes by propionic acid-based ingredients in high-moisture, cured turkey stored at 4 or 7°C. Six formulations of sliced, cured (120 ppm of NaNO2 ), deli-style turkey were tested, including control without antimicrobials, 3.2% lactate-diacetate blend (LD), 0.4% of a liquid propionate-benzoate-containing ingredient, or 0.3, 0.4, and 0.5% of a liquid propionate-containing ingredient. Products were inoculated with 5 log CFU L. monocytogenes per 100-g package (3 log CFU/ml rinsate), vacuum-sealed, and stored at 4 or 7°C for up to 12 weeks; and populations were enumerated by plating on modified Oxford agar. As expected, the control without antimicrobials supported rapid growth, with >2 log average per ml rinsate increase within 4 weeks of storage at 4°C, whereas growth was observed at 6 weeks for the LD treatment. For both replicate trials, all treatments that contained liquid propionate or propionate-benzoate limited L. monocytogenes growth to an increase of 1-log increase) was observed in individual samples for all propionate-containing treatments at weeks 10, 11, and 12. As expected, L. monocytogenes grew more rapidly when products were stored at 7°C, but trends in relative inhibition were similar to those observed at 4°C. These results verify that propionate-based ingredients inhibit growth of L. monocytogenes on sliced, high-moisture, cured turkey and can be considered as an alternative to reduce sodium-based salts while maintaining food safety.

Genome Sequences of Two Listeria monocytogenes Strains from Nectarines Associated with Listeriosis in 2014

Science.gov (United States)

Lu, Chunye; Marjanovic, Olivera; Kiang, David

2017-01-01

ABSTRACT Listeria monocytogenes is an important foodborne pathogen. Here, we present the annotated whole genome of Listeria monocytogenes strains F14M01297-C2 and F14M01297-C4, isolated from nectarines distributed by a packing facility in California during an investigation of listeriosis associated with stone fruit in 2014. PMID:28729255

Phenotypic and Genotypic Characteristics of Listeria monocytogenes Isolated From Dairy and Meat Products

OpenAIRE

Bahador; Sadeghi Kalani; Valian; Irajian; Lotfollahi

2015-01-01

Background Listeria monocytogenes is a foodborne pathogen and a serious threat to the public health in the world. Consumption of traditional foods such as dairy and meat products can be a major reason for relative abundance and isolation of these bacteria. Objectives The purpose of this study was to determine the phenotypic and genotypic characteristics of L. monocytogenes strains isolated from dairy and meat products. ...

Various Ready-to-Eat Products from Retail Stores Linked to Occurrence of Diverse Listeria monocytogenes and Listeria spp. Isolates.

Science.gov (United States)

Vongkamjan, Kitiya; Fuangpaiboon, Janejira; Turner, Matthew P; Vuddhakul, Varaporn

2016-02-01

Listeriosis outbreaks have been associated with a variety of foods. This study investigated the prevalence and diversity of Listeria monocytogenes and Listeria spp. in ready-to-eat (RTE) products and evaluated the performance of a rapid detection method, the 3M molecular detection assay for L. monocytogenes (MDA-LM), for detection of L. monocytogenes. Assay results were compared with those obtained using the U.S. Food and Drug Administration standard culture method described in the Bacteriological Analytical Manual. Products (n = 200) were purchased from retail stores: 122 aquatic products, 22 products of animal origin, 18 vegetarian products, 15 deli meat products, 13 salad and vegetable products, 4 desserts, 2 egg-based products, and 4 other products. L. monocytogenes prevalence was comparable with both methods. Overall, 15 (7.5%) of 200 samples were positive for L. monocytogenes: 3% of aquatic products, 1.5% of products of animal origin, 1% of vegetarian products, and 2% of deli meat products. Compared with the standard culture method, the sensitivity, specificity, and the accuracy of the MDA-LM were 86.7% (95% confidence interval, 58.4 to 97.7%), 98.4% (95% confidence interval, 95.0 to 99.6%), and 97.5%, respectively. Using the culture-based method, 18 (9%) of 200 samples were positive for Listeria species other than L. monocytogenes. Listeria isolates from these samples were classified into nine allelic types (ATs). The majority of isolates were classified as ATs 58 and 74, which were identified as L. monocytogenes lineages I and IV, respectively. Listeria innocua and Listeria welshimeri also were represented by isolates of multiple ATs. The MDA-LM is a rapid and reliable technique for detecting L. monocytogenes in various RTE foods. Further study is needed to develop effective control strategies to reduce L. monocytogenes contamination in RTE foods.

Prevalence of Listeria monocytogenes in raw bovine milk and milk products from central highlands of Ethiopia.

Science.gov (United States)

Seyoum, Eyasu Tigabu; Woldetsadik, Daniel Asrat; Mekonen, Tesfu Kassa; Gezahegn, Haile Alemayehu; Gebreyes, Wondwossen Abebe

2015-11-30

Listeria monocytogenes is of major significance in human and veterinary medicine. Most human Listeria infections are foodborne and the association of contaminated milk and dairy produce consumption with human listeriosis is noteworthy. In Ethiopia, there is limited data regarding the prevalence of L. monocytogenes in raw bovine milk and dairy products. The aim of this study was, therefore, to determine the prevalence of L. monocytogenes in raw bovine milk and dairy produce. A total of 443 milk and milk product samples were microbiologically analyzed following methods recommended by the U.S. Food and Drug Administration Bacteriological Analytical Manual to isolate Listeria spp. The overall prevalence of Listeria spp. was 28.4% and specifically that of L. monocytogenes was 5.6%. Taking the prevalence of Listeria spp. into consideration, cheese was found to be highly contaminated at 60%, followed by pasteurized milk samples (40%), raw milk (18.9%) and yoghurt (5%). Considering the prevalence of Listeria monocytogenes only, raw milk had the lowest contamination while cheese had the highest, followed by pasteurized milk and yoghurt. Raw milk and milk products produced in urban and peri-urban areas of central Ethiopia were contaminated with pathogenic bacteria, L. monocytogenes. The detection of this pathogen in raw milk and milk products warrants an urgent regulatory mechanism to be put in place and also the potential role of milk processing plants in the contamination of dairy products should be investigated.

Effect of packaging and storage time on survival of Listeria monocytogenes on kippered beef steak and turkey tenders.

Science.gov (United States)

Uppal, Kamaldeep K; Getty, Kelly J K; Boyle, Elizabeth A E; Harper, Nigel M; Lobaton-Sulabo, April Shayne S; Barry, Bruce

2012-01-01

The objective of our study was to determine effect of packaging method and storage time on reducing Listeria monocytogenes in shelf-stable meat snacks. Commercially available kippered beef steak strips and turkey tenders were dipped into a 5-strain L. monocytogenes cocktail, and dried at 23 °C until a water activity of 0.80 was achieved. Inoculated samples were packaged with 4 treatments: (1) vacuum, (2) nitrogen flushed with oxygen scavenger, (3) heat sealed with oxygen scavenger, and (4) heat sealed without oxygen scavenger. Samples were stored at 23 °C and evaluated for L. monocytogenes levels at 0, 24, 48, and 72 h. Initial levels (time 0) of L. monocytogenes were approximately 5.7 log CFU/cm² for steak and tenders. After 24 h of storage time, a 1 log CFU/cm² reduction of L. monocytogenes was observed for turkey tenders for all packaging treatments. After 48 h, turkey tenders showed >1 log CFU/cm² reduction of L. monocytogenes for all packaging treatments except for vacuum, where only 0.9 log CFU/cm² reduction was observed. After 72 h, reductions for all packaging treatments for turkey tenders ranged from 1.5 to 2.4 log CFU/cm². For kippered beef steak, there was no interaction between the packaging treatments and all storage times (P > 0.05) whereas, time was different (P packaging treatments and a 2.1 log CFU/ cm² L. monocytogenes reduction at 72 h of storage time. Processors of kippered beef steak and turkey tenders could use a combination of vacuum or nitrogen-flushing or heat sealed with an oxygen scavenger packaging methods and a holding time of 24 h prior to shipping to reduce potential L. monocytogenes numbers by ≥1 log. However, processors should be encouraged to hold packaged product a minimum of 72 h to enhance the margin of safety for L. monocytogenes control. © 2011 Institute of Food Technologists®

Pulsed-Field Gel Electrophoresis characterization of Listeria monocytogenes isolates from cheese manufacturing plants in São Paulo, Brazil.

Science.gov (United States)

Barancelli, Giovana V; Camargo, Tarsila M; Gagliardi, Natália G; Porto, Ernani; Souza, Roberto A; Campioni, Fabio; Falcão, Juliana P; Hofer, Ernesto; Cruz, Adriano G; Oliveira, Carlos A F

2014-03-03

This study aimed to evaluate the occurrence of Listeria monocytogenes in cheese and in the environment of three small-scale dairy plants (A, B, C) located in the Northern region state of São Paulo, Brazil, and to characterize the isolates using conventional serotyping and PFGE. A total of 393 samples were collected and analyzed from October 2008 to September 2009. From these, 136 came from dairy plant A, where only L. seeligeri was isolated. In dairy plant B, 136 samples were analyzed, and L. innocua, L. seeligeri and L. welshimeri were isolated together with L. monocytogenes. In dairy plant C, 121 samples were analyzed, and L. monocytogenes and L. innocua were isolated. Cheese from dairy plants B and C were contaminated with Listeria spp, with L. innocua being found in Minas frescal cheese from both dairy plants, and L. innocua and L. monocytogenes in Prato cheese from dairy plant C. A total of 85 L. monocytogenes isolates were classified in 3 serotypes: 1/2b, 1/2c, and 4b, with predominance of serotype 4b in both dairy plants. The 85 isolates found in the dairy plants were characterized by genomic macrorestriction using ApaI and AscI with Pulsed Field Gel Electrophoresis (PFGE). Macrorestriction yielded 30 different pulsotypes. The presence of indistinguishable profiles repeatedly isolated during a 12-month period indicated the persistence of L. monocytogenes in dairy plants B and C, which were more than 100 km away from each other. Brine used in dairy plant C contained more than one L. monocytogenes lineage. The routes of contamination were identified in plants B and C, and highlighted the importance of using molecular techniques and serotyping to track L. monocytogenes sources of contamination, distribution, and routes of contamination in dairy plants, and to develop improved control strategies for L. monocytogenes in dairy plants and dairy products. Copyright © 2013 Elsevier B.V. All rights reserved.

Adhesion to the host cell surface is sufficient to mediate Listeria monocytogenes entry into epithelial cells

Science.gov (United States)

Ortega, Fabian E.; Rengarajan, Michelle; Chavez, Natalie; Radhakrishnan, Prathima; Gloerich, Martijn; Bianchini, Julie; Siemers, Kathleen; Luckett, William S.; Lauer, Peter; Nelson, W. James; Theriot, Julie A.

2017-01-01

The intestinal epithelium is the first physiological barrier breached by the Gram-positive facultative pathogen Listeria monocytogenes during an in vivo infection. Listeria monocytogenes binds to the epithelial host cell receptor E-cadherin, which mediates a physical link between the bacterium and filamentous actin (F-actin). However, the importance of anchoring the bacterium to F-actin through E-cadherin for bacterial invasion has not been tested directly in epithelial cells. Here we demonstrate that depleting αE-catenin, which indirectly links E-cadherin to F-actin, did not decrease L. monocytogenes invasion of epithelial cells in tissue culture. Instead, invasion increased due to increased bacterial adhesion to epithelial monolayers with compromised cell–cell junctions. Furthermore, expression of a mutant E-cadherin lacking the intracellular domain was sufficient for efficient L. monocytogenes invasion of epithelial cells. Importantly, direct biotin-mediated binding of bacteria to surface lipids in the plasma membrane of host epithelial cells was sufficient for uptake. Our results indicate that the only requirement for L. monocytogenes invasion of epithelial cells is adhesion to the host cell surface, and that E-cadherin–mediated coupling of the bacterium to F-actin is not required. PMID:28877987

Variability of Listeria monocytogenes strains in biofilm formation on stainless steel and polystyrene materials and resistance to peracetic acid and quaternary ammonium compounds.

Science.gov (United States)

Poimenidou, Sofia V; Chrysadakou, Marilena; Tzakoniati, Aikaterini; Bikouli, Vasiliki C; Nychas, George-John; Skandamis, Panagiotis N

2016-11-21

Listeria monocytogenes is a foodborne pathogen able to tolerate adverse conditions by forming biofilms or by deploying stress resistant mechanisms, and thus manages to survive for long periods in food processing plants. This study sought to investigate the correlation between biofilm forming ability, tolerance to disinfectants and cell surface characteristics of twelve L. monocytogenes strains. The following attributes were evaluated: (i) biofilm formation by crystal violet staining method on polystyrene, and by standard cell enumeration on stainless steel and polystyrene; (ii) hydrophobicity assay using solvents; (iii) minimum inhibitory concentration (MIC) and biofilm eradication concentration (BEC) of peracetic acid (PAA) and quaternary ammonium compounds (QACs), and (iv) resistance to sanitizers (PAA 2000ppm; QACs 500ppm) of biofilms on polystyrene and stainless steel. After 72h of incubation, higher biofilm levels were formed in TSB at 20°C, followed by TSB at 37°C (P=0.087) and diluted TSB 1/10 at both 20 (P=0.005) and 37°C (P=0.004). Cells grown at 30°C to the stationary phase had significant electron donating nature and a low hydrophobicity, while no significant correlation of cell surface properties to biofilm formation was observed. Strains differed in MIC PAA and BEC PAA by 24- and 15-fold, respectively, while a positive correlation between MIC PAA and BEC PAA was observed (P=0.02). The MIC QACs was positively correlated with the biofilm-forming ability on stainless steel (P=0.03). Regarding the impact of surface type, higher biofilm populations were enumerated on polystyrene than on stainless steel, which were also more tolerant to disinfectants. Among all strains, the greatest biofilm producer was a persistent strain with significant tolerance to QACs. These results may contribute to better understanding of L. monocytogenes behavior and survival on food processing surfaces. Copyright © 2016 Elsevier B.V. All rights reserved.

Listeria monocytogenes Growth Kinetics in Milkshakes Made from Naturally and Artificially Contaminated Ice Cream

Directory of Open Access Journals (Sweden)

Joelle K. Salazar

2018-01-01

Full Text Available This study assessed the growth of Listeria monocytogenes in milkshakes made using the process-contaminated ice cream associated with a listeriosis outbreak in comparison to milkshakes made with artificially contaminated ice cream. For all temperatures, growth kinetics including growth rates, lag phases, maximum populations, and population increases were determined for the naturally and artificially derived contaminants at 5, 10, 15, and 25°C storage for 144 h. The artificially inoculated L. monocytogenes presented lower growth rates and shorter lag phases than the naturally contaminated populations at all temperatures except for 5°C, where the reverse was observed. At 25°C, lag phases of the naturally and artificially contaminated L. monocytogenes were 11.6 and 7.8 h, respectively. The highest increase in population was observed for the artificially inoculated pathogen at 15°C after 96 h (6.16 log CFU/mL of storage. Growth models for both contamination states in milkshakes were determined. In addition, this study evaluated the antimicrobial effectiveness of flavoring agents, including strawberry, chocolate and mint, on the growth of the pathogen in milkshakes during 10°C storage. All flavor additions resulted in decreased growth rates of L. monocytogenes for both contamination states. The addition of chocolate and mint flavoring also resulted in significantly longer lag phases for both contamination states. This study provides insight into the differences in growth between naturally and artificially contaminated L. monocytogenes in a food product.

Listeria monocytogenes Growth Kinetics in Milkshakes Made from Naturally and Artificially Contaminated Ice Cream.

Science.gov (United States)

Salazar, Joelle K; Bathija, Vriddi M; Carstens, Christina K; Narula, Sartaj S; Shazer, Arlette; Stewart, Diana; Tortorello, Mary Lou

2018-01-01

This study assessed the growth of Listeria monocytogenes in milkshakes made using the process-contaminated ice cream associated with a listeriosis outbreak in comparison to milkshakes made with artificially contaminated ice cream. For all temperatures, growth kinetics including growth rates, lag phases, maximum populations, and population increases were determined for the naturally and artificially derived contaminants at 5, 10, 15, and 25°C storage for 144 h. The artificially inoculated L. monocytogenes presented lower growth rates and shorter lag phases than the naturally contaminated populations at all temperatures except for 5°C, where the reverse was observed. At 25°C, lag phases of the naturally and artificially contaminated L. monocytogenes were 11.6 and 7.8 h, respectively. The highest increase in population was observed for the artificially inoculated pathogen at 15°C after 96 h (6.16 log CFU/mL) of storage. Growth models for both contamination states in milkshakes were determined. In addition, this study evaluated the antimicrobial effectiveness of flavoring agents, including strawberry, chocolate and mint, on the growth of the pathogen in milkshakes during 10°C storage. All flavor additions resulted in decreased growth rates of L. monocytogenes for both contamination states. The addition of chocolate and mint flavoring also resulted in significantly longer lag phases for both contamination states. This study provides insight into the differences in growth between naturally and artificially contaminated L. monocytogenes in a food product.

Enoyl-Acyl Carrier Protein Reductase I (FabI) Is Essential for the Intracellular Growth of Listeria monocytogenes

Science.gov (United States)

Ericson, Megan E.; Frank, Matthew W.

2016-01-01

Enoyl-acyl carrier protein reductase catalyzes the last step in each elongation cycle of type II bacterial fatty acid synthesis and is a key regulatory protein in bacterial fatty acid synthesis. Genes of the facultative intracellular pathogen Listeria monocytogenes encode two functional enoyl-acyl carrier protein isoforms based on their ability to complement the temperature-sensitive growth phenotype of Escherichia coli strain JP1111 [fabI(Ts)]. The FabI isoform was inactivated by the FabI selective inhibitor AFN-1252, but the FabK isoform was not affected by the drug, as expected. Inhibition of FabI by AFN-1252 decreased endogenous fatty acid synthesis by 80% and lowered the growth rate of L. monocytogenes in laboratory medium. Robust exogenous fatty acid incorporation was not detected in L. monocytogenes unless the pathway was partially inactivated by AFN-1252 treatment. However, supplementation with exogenous fatty acids did not restore normal growth in the presence of AFN-1252. FabI inactivation prevented the intracellular growth of L. monocytogenes, showing that neither FabK nor the incorporation of host cellular fatty acids was sufficient to support the intracellular growth of L. monocytogenes. Our results show that FabI is the primary enoyl-acyl carrier protein reductase of type II bacterial fatty acid synthesis and is essential for the intracellular growth of L. monocytogenes. PMID:27736774

Occurrence and antimicrobial resistance patterns of Listeria monocytogenes isolated from vegetables.

Science.gov (United States)

de Vasconcelos Byrne, Vanessa; Hofer, Ernesto; Vallim, Deyse Christina; de Castro Almeida, Rogeria Comastri

2016-01-01

Although the consumption of fresh and minimally processed vegetables is considered healthy, outbreaks related to the contamination of these products are frequently reported. Among the food-borne pathogens that contaminate vegetables is Listeria monocytogenes, a ubiquitous organism that exhibits the ability to survive and multiply at refrigerated temperatures. This study aimed to evaluate the occurrence of L. monocytogenes in vegetables as well as the antimicrobial resistance of isolates. The results showed that 3.03% of samples were contaminated with L. monocytogenes, comprising 2.22% of raw vegetables and 5.56% of ready-to-eat vegetables. Multiplex PCR confirmed the virulence potential of the isolates. Antimicrobial resistance profiling showed that 50% of the isolates were susceptible to the antibiotics used. The resistance of one isolate to penicillin G, a commonly employed therapeutic agent, and the presence of serotype 4b, a serotype commonly associated with food-borne outbreaks, could be potential health hazards for consumers. Copyright © 2016 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.

Influence of granitic aggregates from Northeast Brazil on the alkali-aggregate reaction

Energy Technology Data Exchange (ETDEWEB)

Gomes Neto, David de Paiva; Santana, Rodrigo Soares de; Barreto, Ledjane Silva, E-mail: pvgomes@uol.com.br [Universidade Federal de Sergipe (UFS), Sao Cristovao, SE (Brazil). Dept. de Ciencias dos Materiais e Engenharia; Conceicao, Herbert; Lisboa, Vinicios Anselmo Carvalho [Universidade Federal de Sergipe (UFS), Sao Cristovao, SE (Brazil). Dept. de Geologia

2014-08-15

The alkali-aggregate reaction (AAR) in concrete structures is a problem that has concerned engineers and researchers for decades. This reaction occurs when silicates in the aggregates react with the alkalis, forming an expanded gel that can cause cracks in the concrete and reduce its lifespan. The aim of this study was to characterize three coarse granitic aggregates employed in concrete production in northeastern Brazil, correlating petrographic analysis with the kinetics of silica dissolution and the evolution of expansions in mortar bars, assisted by SEM/EDS, XRD, and EDX. The presence of grains showing recrystallization into individual microcrystalline quartz subgrains was associated with faster dissolution of silica and greater expansion in mortar bars. Aggregates showing substantial deformation, such as stretched grains of quartz with strong undulatory extinction, experienced slower dissolution, with reaction and expansion occurring over longer periods that could not be detected using accelerated tests with mortar bars. (author)

Leucocins 4010 from Leuconostoc carnosum cause a matrix related decrease in intracellular pH of Listeria monocytogenes

DEFF Research Database (Denmark)

Fang, Weihuan; Budde, Birgitte Bjørn; Siegumfeldt, Henrik

2006-01-01

A mixed culture of single cells of Listeria monocytogenes and the bacteriocin producing Leuconostoc carnosum 4010 showed growth inhibition of L. monocytogenes, although the intracellular pH (pHi) of L. monocytogenes followed by fluorescence ratio imaging microscopy was not affected. Furthermore, L...

Microbial properties of soil aggregates created by earthworms and other factors: spherical and prismatic soil aggregates from unreclaimed post-mining sites

Energy Technology Data Exchange (ETDEWEB)

Frouz, J.; Kristufek, V.; Liveckova, M.; van Loo, D.; Jacobs, P.; Van Hoorebeke, L. [Charles University of Prague, Prague (Czech Republic). Inst. of Environmental Studies

2011-01-15

Soil aggregates between 2 and 5 mm from 35- and 45-year-old unreclaimed post-mining sites near Sokolov (Czech Republic) were divided into two groups: spherical and prismatic. X-ray tomography indicated that prismatic aggregates consisted of fragments of claystone bonded together by amorphous clay and roots while spherical aggregates consisted of a clay matrix and organic fragments of various sizes. Prismatic aggregates were presumed to be formed by plant roots and physical processes during weathering of Tertiary mudstone, while earthworms were presumed to contribute to the formation of spherical aggregates. The effects of drying and rewetting and glucose addition on microbial respiration, microbial biomass, and counts of bacteria in these aggregates were determined. Spherical aggregates contained a greater percentage of C and N and a higher C-to-N ratio than prismatic ones. The C content of the particulate organic matter was also higher in the spherical than in the prismatic aggregates. Although spherical aggregates had a higher microbial respiration and biomass, the growth of microbial biomass in spherical aggregates was negatively correlated with initial microbial biomass, indicating competition between bacteria. Specific respiration was negatively correlated with microbial biomass. Direct counts of bacteria were higher in spherical than in prismatic aggregates. Bacterial numbers were more stable in the center than in the surface layers of the aggregates. Transmission electron microscopy indicated that bacteria often occurred as individual cells in prismatic aggregates but as small clusters of cells in spherical aggregates. Ratios of colony forming units (cultivatable bacteria) to direct counts were higher in spherical than in prismatic aggregates. Spherical aggregates also contained faster growing bacteria.

Listeria monocytogenes in five Sardinian swine slaughterhouses: prevalence, serotype, and genotype characterization.

Science.gov (United States)

Meloni, Domenico; Piras, Francesca; Mureddu, Anna; Fois, Federica; Consolati, Simonetta Gianna; Lamon, Sonia; Mazzette, Rina

2013-11-01

In a 3-year study (2008 to 2011) to estimate the prevalence and the contamination sources of Listeria monocytogenes in pork meat in Sardinia, Italy, 211 samples were collected from five Sardinian swine slaughterhouses: 171 samples from slaughtered pigs and 40 from the slaughterhouse environment. Fifty L. monocytogenes isolates were characterized by PCR-based serotyping, presence of virulence-associated genes, and pulsed-field gel electrophoresis restriction analysis. The overall prevalence of L. monocytogenes was 33% in swine carcasses, 7% in cecal material, 23% on meat contact surfaces, and 25% on noncontact surfaces. Only two serotypes were detected: 1/2c (78%) and 1/2a (22%). In all, based on the presence of virulence-associated genes, eight pathogenic profiles were detected. Only 42% of all isolates carried the full complement of virulence-associated genes and were allotted to profile 1. Six pulsed-field gel electrophoresis profiles persisted in the slaughterhouses; restriction profiles appeared to be specific to each plant.

Listeria monocytogenes cross-contamination of cheese: risk throughout the food supply chain.

Science.gov (United States)

Sauders, B D; D'Amico, D J

2016-10-01

Listeria monocytogenes has been the most common microbial cause of cheese-related recalls in both the United States and Canada in recent years. Since L. monocytogenes is inactivated by pasteurization, the majority of these cases have been linked to environmental and cross-contamination of fresh-soft, soft-ripened, and semi-soft cheeses. Cross-contamination of foods with L. monocytogenes is a continuous risk throughout the food supply chain and presents unique challenges for subsequent illness and outbreak investigations. Reports on outbreaks of listeriosis attributed to cross-contamination downstream from primary processing help highlight the critical role of epidemiological investigation coupled with coordinated molecular subtyping and surveillance in the recognition and investigation of complex foodborne outbreaks. Despite their complexity, environmental sampling throughout the supply chain coupled with improved genotyping approaches and concomitant analysis of foodborne illness epidemiological exposure data are needed to help resolve these and similar cases more rapidly and with greater confidence.

Genotypic profile of Listeria monocytogenes isolated in refrigerated chickens in southern Rio Grande do Sul, Brazil

Directory of Open Access Journals (Sweden)

Karla Sequeira Mendonça

2016-01-01

Full Text Available ABSTRACT: Listeria monocytogenes is of notable concern to the food industry, due to its ubiquitous nature and ability to grow in adverse conditions. This study aimed to determine the genotypic profile of L. monocytogenes strains isolated from refrigerated chickens marketed in the southern part of Rio Grande do Sul, Brazil. The strains of L. monocytogenes isolated were characterized by serotyping and Pulsed Field Gel Electrophoresis (PFGE. Three different serotypes (1/2a, 1/2b and 4e were evaluated by PFGE, and the macrorestriction patterns utilizing enzymes AscI and ApaI, revealed five different pulsotypes. The presence of such varied genotypic profiles demonstrates the prevalence of L. monocytogenes contamination of chicken processing environments, which combined with ineffective cleaning procedures, allowing the survival, adaptation and proliferation of these pathogens, not only in the processing environment, but also in local grocery stores.

New perspectives on the gastrointestinal mode of transmission in invasive Listeria monocytogenes infection

Energy Technology Data Exchange (ETDEWEB)

Schlech, W.F. III

1984-01-01

The route or mechanism of transmission of Listeria monocytogenes from its rural veterinary reservoir to newborn and older human populations has been obscure. Anecdotal reports of milk-borne infection from cows with Listeria mastitis have been published, but intensive investigations of small outbreaks of L. monocytogenes infections in humans have not supported a gastrointestinal mode of infection. Several recent studies, however, strongly suggest this possibility, and case-control studies of epidemic listeriosis in the Canadian Maritime provinces in 1981 documented an association between ingestion of uncooked vegetables and the development of illness (p = 0.02). In that study, coleslaw from a regional producer which was distributed throughout the Maritimes was considered to be the vehicle of transmission. Cabbage, the raw product in the production of coleslaw, was contaminated at a farm prior to arrival at the plant. Contamination occurred through fertilization with raw manure from a flock of sheep known to harbor L. monocytogenes. Therefore, an indirect link was established between Listeria monocytogenes infection of sheep on a cabbage farm and subsequent development of invasive listeriosis in humans. This study supports findings from other epidemiologic studies of human listeriosis and is consistent with results of investigations into the mode of transmission of natural and laboratory-acquired listeriosis in animals. 34 references.

The use of Listeria monocytogenes as a DNA delivery vector for cancer gene therapy.

LENUS (Irish Health Repository)

Tangney, Mark

2012-01-31

Listeria monocytogenes is an intracellular pathogen that lyses the phagosomal vacuole of infected cells, proliferates in the host cell cytoplasm and can actively enter adjacent cells. The pathogen is therefore well suited to exploitation as a vector for the delivery of DNA to target cells as the lifecycle favors cellular targeting with vector amplification and the potential for cell-to-cell spread. We have recently demonstrated DNA transfer by L. monocytogenes in growing tumors in murine models. Our approach exploited an ampicillin sensitive stain of L. monocytogenes which can be lysed through systemic administration of ampicillin to facilitate release of plasmid DNA for expression by infected mammalian cells. Here, we discuss the implications of this technology and the potential for future improvements of the system.

Antibacterial activity of bacteriocin-like substance P34 on Listeria monocytogenes in chicken sausage

Directory of Open Access Journals (Sweden)

Voltaire Sant'Anna

2013-12-01

Full Text Available The antimicrobial activity of the bacteriocin-like substance (BLS P34 against Listeria monocytogenes was investigated in chicken sausage. The BLS was applied to chicken sausages (256 AU g-1 previously inoculated with a suspension of 10² cfu g-1 of L. monocytogenes. BLS P34 inhibited the indicator microorganism in situ in all incubation times for up to 10 days at 5 °C. The effectiveness of BLS P34 was increased when it was added in combination with nisin. The bacteriocin was also tested in natural eatable natural bovine wrapping (salty semi-dried tripe against the same indicator microorganism, also showing inhibitory capability in vitro. BLS P34 showed potential to control L. monocytogenes in refrigerated meat products.

Enrichment dynamics of Listeria monocytogenes and the associated microbiome from naturally contaminated ice cream linked to a listeriosis outbreak.

Science.gov (United States)

Ottesen, Andrea; Ramachandran, Padmini; Reed, Elizabeth; White, James R; Hasan, Nur; Subramanian, Poorani; Ryan, Gina; Jarvis, Karen; Grim, Christopher; Daquiqan, Ninalynn; Hanes, Darcy; Allard, Marc; Colwell, Rita; Brown, Eric; Chen, Yi

2016-11-16

Microbiota that co-enrich during efforts to recover pathogens from foodborne outbreaks interfere with efficient detection and recovery. Here, dynamics of co-enriching microbiota during recovery of Listeria monocytogenes from naturally contaminated ice cream samples linked to an outbreak are described for three different initial enrichment formulations used by the Food and Drug Administration (FDA), the International Organization of Standardization (ISO), and the United States Department of Agriculture (USDA). Enrichment cultures were analyzed using DNA extraction and sequencing from samples taken every 4 h throughout 48 h of enrichment. Resphera Insight and CosmosID analysis tools were employed for high-resolution profiling of 16S rRNA amplicons and whole genome shotgun data, respectively. During enrichment, other bacterial taxa were identified, including Anoxybacillus, Geobacillus, Serratia, Pseudomonas, Erwinia, and Streptococcus spp. Surprisingly, incidence of L. monocytogenes was proportionally greater at hour 0 than when tested 4, 8, and 12 h later with all three enrichment schemes. The corresponding increase in Anoxybacillus and Geobacillus spp.indicated these taxa co-enriched in competition with L. monocytogenes during early enrichment hours. L. monocytogenes became dominant after 24 h in all three enrichments. DNA sequences obtained from shotgun metagenomic data of Listeria monocytogenes at 48 h were assembled to produce a consensus draft genome which appeared to have a similar tracking utility to pure culture isolates of L. monocytogenes. All three methods performed equally well for enrichment of Listeria monocytogenes. The observation of potential competitive exclusion of L. mono by Anoxybacillus and Geobacillus in early enrichment hours provided novel information that may be used to further optimize enrichment formulations. Application of Resphera Insight for high-resolution analysis of 16S amplicon sequences accurately identified L. monocytogenes

Spatial and Temporal Factors Associated with an Increased Prevalence of Listeria monocytogenes in Spinach Fields in New York State.

Science.gov (United States)

Weller, Daniel; Wiedmann, Martin; Strawn, Laura K

2015-09-01

While rain and irrigation events have been associated with an increased prevalence of foodborne pathogens in produce production environments, quantitative data are needed to determine the effects of various spatial and temporal factors on the risk of produce contamination following these events. This study was performed to quantify these effects and to determine the impact of rain and irrigation events on the detection frequency and diversity of Listeria species (including L. monocytogenes) and L. monocytogenes in produce fields. Two spinach fields, with high and low predicted risks of L. monocytogenes isolation, were sampled 24, 48, 72, and 144 to 192 h following irrigation and rain events. Predicted risk was a function of the field's proximity to water and roads. Factors were evaluated for their association with Listeria species and L. monocytogenes isolation by using generalized linear mixed models (GLMMs). In total, 1,492 (1,092 soil, 334 leaf, 14 fecal, and 52 water) samples were collected. According to the GLMM, the likelihood of Listeria species and L. monocytogenes isolation from soil samples was highest during the 24 h immediately following an event (odds ratios [ORs] of 7.7 and 25, respectively). Additionally, Listeria species and L. monocytogenes isolates associated with irrigation events showed significantly lower sigB allele type diversity than did isolates associated with precipitation events (P = <0.001), suggesting that irrigation water may be a point source of L. monocytogenes contamination. Small changes in management practices (e.g., not irrigating fields before harvest) may therefore reduce the risk of L. monocytogenes contamination of fresh produce. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Faecal shedding and strain diversity of Listeria monocytogenes in healthy ruminants and swine in Northern Spain

Directory of Open Access Journals (Sweden)

Hurtado Ana

2009-01-01

Full Text Available Abstract Background Listeria monocytogenes is among the most important foodborne bacterial pathogens due to the high mortality rate and severity of the infection. L. monocytogenes is a ubiquitous organism occasionally present in the intestinal tract of various animal species and faecal shedding by asymptomatically infected livestock poses a risk for contamination of farm environments and raw food at the pre-harvest stages. The aim of this study was to determine the prevalence and strain diversity of L. monocytogenes in healthy ruminants and swine herds. Results Faecal samples from 30 animals per herd were collected from 343 herds (120 sheep, 124 beef cattle, 82 dairy cattle and 17 swine in the Basque Country and screened in pools by an automated enzyme-linked fluorescent immunoassay (VIDAS® to estimate the prevalence of positive herds. Positive samples were subcultured onto the selective and differential agar ALOA and biochemically confirmed. L. monocytogenes was isolated from 46.3% of dairy cattle, 30.6% beef cattle and 14.2% sheep herds, but not from swine. Within-herd prevalence investigated by individually analysing 197 sheep and 221 cattle detected 1.5% of faecal shedders in sheep and 21.3% in cattle. Serotyping of 114 isolates identified complex 4b as the most prevalent (84.2%, followed by 1/2a (13.2%, and PFGE analysis of 68 isolates showed a highly diverse L. monocytogenes population in ruminant herds. Conclusion These results suggested that cattle represent a potentially important reservoir for L. monocytogenes in the Basque Country, and highlighted the complexity of pathogen control at the farm level.

Effect of citral and carvacrol on the susceptibility of Listeria monocytogenes and Listeria innocua to antibiotics.

Science.gov (United States)

Zanini, S F; Silva-Angulo, A B; Rosenthal, A; Rodrigo, D; Martínez, A

2014-05-01

The aim of this study was to evaluate the antibiotic susceptibility of Listeria innocua (L. innocua) and Listeria monocytogenes (L. monocytogenes) cells in the presence of citral and carvacrol at sublethal concentrations in an agar medium. The presence of terpenes in the L. monocytogenes and L. innocua culture medium provided a reduction in the minimal inhibitory concentration (MIC) of all the antibiotics tested. These effects were dependent on the concentration of terpenes present in the culture medium. The combination of citral and carvacrol potentiated antibiotic activity by reducing the MIC values of bacitracin and colistin from 32.0 and 128.0 μg ml⁻¹ to 1.0 and 2.0 μg ml⁻¹, respectively. Thus, both Listeria species became more susceptible to these drugs. In this way, the colistin and bacitracin resistance of L. monocytogenes and L. innocua was reversed in the presence of terpenes. Results obtained in this study show that the phytochemicals citral and carvacrol potentiate antibiotic activity, reducing the MIC values of cultured L. monocytogenes and L. innocua. Phytochemicals citral and carvacrol potentiate antibiotic activity of erythromycin, bacitracin and colistin by reducing the MIC values of cultured Listeria monocytogenes and Listeria innocua. This effect in reducing the MIC values of the antibiotics tested in both micro-organisms was increased when natural antimicrobials were combined. This finding indicated that the combination among terpenes and antibiotic may contribute in reducing the required dosage of antibiotics due to the possible effect of terpenes on permeation barrier of the micro-organism cell membrane. © 2014 The Society for Applied Microbiology.

Aggregated nanoplatelets: optical properties and optically induced deaggregation

International Nuclear Information System (INIS)

Jayabalan, J; Singh, Asha; Chari, Rama; Srivastava, Himanshu; Srivastava, A K; Mukhopadhyay, P K; Oak, S M

2008-01-01

A study of aggregation and laser-induced deaggregation of silver nanospheres and nanoplatelets in colloidal form is presented. Changes in the extinction spectrum caused by aggregation are explained using a two-particle approximation. In the case of platelets, controlled laser irradiation is shown to reverse the aggregation process.

Aggregated nanoplatelets: optical properties and optically induced deaggregation

Energy Technology Data Exchange (ETDEWEB)

Jayabalan, J; Singh, Asha; Chari, Rama [Laser Physics Application Division, Raja Ramanna Centre for Advanced Technology, Indore 452013 (India); Srivastava, Himanshu; Srivastava, A K [Indus Synchrotrons Utilization Division, Raja Ramanna Centre for Advanced Technology, Indore 452013 (India); Mukhopadhyay, P K; Oak, S M [Solid State Laser Division, Raja Ramanna Centre for Advanced Technology, Indore 452013 (India)], E-mail: jjaya@cat.ernet.in

2008-11-05

A study of aggregation and laser-induced deaggregation of silver nanospheres and nanoplatelets in colloidal form is presented. Changes in the extinction spectrum caused by aggregation are explained using a two-particle approximation. In the case of platelets, controlled laser irradiation is shown to reverse the aggregation process.

Sensitive enumeration of Listeria monocytogenes and other Listeria species in various naturally contaminated matrices using a membrane filtration method.

Science.gov (United States)

Barre, Léna; Brasseur, Emilie; Doux, Camille; Lombard, Bertrand; Besse, Nathalie Gnanou

2015-06-01

For the enumeration of Listeria monocytogenes (L. monocytogenes) in food, a sensitive enumeration method has been recently developed. This method is based on a membrane filtration of the food suspension followed by transfer of the filter on a selective medium to enumerate L. monocytogenes. An evaluation of this method was performed with several categories of foods naturally contaminated with L. monocytogenes. The results obtained with this technique were compared with those obtained from the modified reference EN ISO 11290-2 method for the enumeration of L. monocytogenes in food, and are found to provide more precise results. In most cases, the filtration method enabled to examine a greater quantity of food thus greatly improving the sensitivity of the enumeration. However, it was hardly applicable to some food categories because of filtration problems and background microbiota interference. Copyright © 2014 Elsevier Ltd. All rights reserved.

Sequence dependent aggregation of peptides and fibril formation

Science.gov (United States)

Hung, Nguyen Ba; Le, Duy-Manh; Hoang, Trinh X.

2017-09-01

Deciphering the links between amino acid sequence and amyloid fibril formation is key for understanding protein misfolding diseases. Here we use Monte Carlo simulations to study the aggregation of short peptides in a coarse-grained model with hydrophobic-polar (HP) amino acid sequences and correlated side chain orientations for hydrophobic contacts. A significant heterogeneity is observed in the aggregate structures and in the thermodynamics of aggregation for systems of different HP sequences and different numbers of peptides. Fibril-like ordered aggregates are found for several sequences that contain the common HPH pattern, while other sequences may form helix bundles or disordered aggregates. A wide variation of the aggregation transition temperatures among sequences, even among those of the same hydrophobic fraction, indicates that not all sequences undergo aggregation at a presumable physiological temperature. The transition is found to be the most cooperative for sequences forming fibril-like structures. For a fibril-prone sequence, it is shown that fibril formation follows the nucleation and growth mechanism. Interestingly, a binary mixture of peptides of an aggregation-prone and a non-aggregation-prone sequence shows the association and conversion of the latter to the fibrillar structure. Our study highlights the role of a sequence in selecting fibril-like aggregates and also the impact of a structural template on fibril formation by peptides of unrelated sequences.

Modelling the growth of Listeria monocytogenes in fresh green coconut (Cocos nucifera L.) water.

Science.gov (United States)

Walter, Eduardo H M; Kabuki, Dirce Y; Esper, Luciana M R; Sant'Ana, Anderson S; Kuaye, Arnaldo Y

2009-09-01

The behaviour of Listeria monocytogenes in the fresh coconut water stored at 4 degrees C, 10 degrees C and 35 degrees C was studied. The coconut water was aseptically extracted from green coconuts (Cocos nucifera L.) and samples were inoculated in triplicate with a mixture of 5 strains of L. monocytogenes with a mean population of approximately 3 log(10) CFU/mL. The kinetic parameters of the bacteria were estimated from the Baranyi model, and compared with predictions of the Pathogen Modelling Program so as to predict its behaviour in the beverage. The results demonstrated that fresh green coconut water was a beverage propitious for the survival and growth of L. monocytogenes and that refrigeration at 10 degrees C or 4 degrees C retarded, but did not inhibit, growth of this bacterium. Temperature abuse at 35 degrees C considerably reduced the lagtimes. The study shows that L. monocytogenes growth in fresh green coconut water is controlled for several days by storage at low temperature, mainly at 4 degrees C. Thus, for risk population this product should only be drunk directly from the coconut or despite the sensorial alterations should be consumed pasteurized.

Acanthamoeba feature a unique backpacking strategy to trap and feed on Listeria monocytogenes and other motile bacteria

DEFF Research Database (Denmark)

Doyscher, Dominik; Fieseler, Lars; Dons, Lone Elisabet

2013-01-01

Despite its prominent role as an intracellular human pathogen, Listeria monocytogenes normally features a saprophytic lifestyle, and shares many environmental habitats with predatory protozoa. Earlier studies claimed that Acanthamoeba may act as environmental reservoirs for L.?monocytogenes, wher......Despite its prominent role as an intracellular human pathogen, Listeria monocytogenes normally features a saprophytic lifestyle, and shares many environmental habitats with predatory protozoa. Earlier studies claimed that Acanthamoeba may act as environmental reservoirs for L.......?monocytogenes, whereas others failed to confirm this hypothesis. Our findings support the latter and provide clear evidence that L.?monocytogenes is unable to persist in Acanthamoeba castellanii and A.?polyphaga. Instead, external Listeria cells are rapidly immobilized on the surface of Acanthamoeba trophozoites......-lapse microscopy revealed that shortly after the bacteria are collected, the amoeba can change direction of movement, phagocytose the backpack and continue to repeat the process. The phenomenon was also observed with avirulent L.?monocytogenes mutants, non-pathogenic Listeria, and other motile bacteria, indicating...

Electrostatics promotes molecular crowding and selects the aggregation pathway in fibril-forming protein solutions

International Nuclear Information System (INIS)

Raccosta, S.; Martorana, V.; Manno, M.; Blanco, M.; Roberts, C.J.

2016-01-01

The role of intermolecular interaction in fibril-forming protein solutions and its relation with molecular conformation are crucial aspects for the control and inhibition of amyloid structures. Here, we study the fibril formation and the protein-protein interactions for two proteins at acidic ph, lysozyme and α-chymotrypsinogen. By using light scattering experiments and the Kirkwood-Buff integral approach, we show how concentration fluctuations are damped even at moderate protein concentrations by the dominant long-ranged electrostatic repulsion, which determines an effective crowded environment. In denaturing conditions, electrostatic repulsion keeps the monomeric solution in a thermodynamically metastable state, which is escaped through kinetically populated conformational sub-states. This explains how electrostatics acts as a gatekeeper in selecting a specific aggregation pathway.

Comparison of the Prevalences and Diversities of Listeria Species and Listeria monocytogenes in an Urban and a Rural Agricultural Watershed.

Science.gov (United States)

Stea, Emma C; Purdue, Laura M; Jamieson, Rob C; Yost, Chris K; Truelstrup Hansen, Lisbeth

2015-06-01

Foods and related processing environments are commonly contaminated with the pathogenic Listeria monocytogenes. To investigate potential environmental reservoirs of Listeria spp. and L. monocytogenes, surface water and point source pollution samples from an urban and a rural municipal water supply watershed in Nova Scotia, Canada, were examined over 18 months. Presumptive Listeria spp. were cultured from 72 and 35% of rural and urban water samples, respectively, with 24% of the positive samples containing two or three different Listeria spp. The L. innocua (56%) and L. welshimeri (43%) groups were predominant in the rural and urban watersheds, respectively. Analysis by the TaqMan assay showed a significantly (P monocytogenes of 62% versus 17% by the culture-based method. Both methods revealed higher prevalences in the rural watershed and during the fall and winter seasons. Elevated Escherichia coli (≥ 100 CFU/100 ml) levels were not associated with the pathogen regardless of the detection method. Isolation of Listeria spp. were associated with 70 times higher odds of isolating L. monocytogenes (odds ratio = 70; P monocytogenes isolates, followed by IVb (16.1%), IIb (15.8%), and IIc (0.4%). L. monocytogenes was detected in cow feces and raw sewage but not in septic tank samples. Pulsotyping of representative water (n = 54) and local human (n = 19) isolates suggested genetic similarities among some environmental and human L. monocytogenes isolates. In conclusion, temperate surface waters contain a diverse Listeria species population and could be a potential reservoir for L. monocytogenes, especially in rural agricultural watersheds. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Listeria monocytogenes in RTE foods marketed in Italy: prevalence and automated EcoRI ribotyping of the isolates.

Science.gov (United States)

Meloni, Domenico; Galluzzo, Pietro; Mureddu, Anna; Piras, Francesca; Griffiths, Mansel; Mazzette, Rina

2009-02-15

The aims of the present study were: (a) to investigate the prevalence and the enumeration of Listeria monocytogenes in 200 samples of ready to eat (RTE) foods of animal and vegetal origin collected from different outlets and processing plants in Sardinia; (b) to characterize the isolates by phenotypical and molecular methods; (c) to analyze a subset of 42 L. monocytogenes by automated EcoRI ribotyping in order to predict the strain's potential virulence for humans. The strains were isolated from: smoked fish products, cooked marinated products, meat products and pre-packaged mixed vegetable salads. Of the samples tested, 22% were positive for Listeria spp. The prevalence of L. monocytogenes was 9.5%, while the level of L. monocytogenes in the positive samples was 93%), belonging to 17 different DuPont Identification Library Codes (DUP-IDs) clones. The Simpson's numerical index of discrimination was 0.911. Cluster analysis pointed out a high similarity among strains isolated from meat, fish, and vegetables of different origin. These results confirmed the existence of a widespread population of L. monocytogenes, characterized by highly related strains existing in different geographical areas. 65% of these strains belonged to lineage II (serotypes 1/2a and 1/2c), subtypes known to be associated with sporadic human listeriosis outbreaks. The remaining 35% of the isolates (serotypes 1/2b, 3b and 4b) were allocated to lineage I and belong to distinct clonal groups (DUP-ID 1038 and 1042), which again have been associated with several outbreaks of human listeriosis. Neither atypical profiles nor lineage III strains were found. EcoRI ribotyping was confirmed as a rapid and reliable method for L. monocytogenes typing, providing useful data for epidemiologic and clonality surveys of L. monocytogenes strains isolated from RTE foods.

Prevalence, antimicrobial susceptibility and virulotyping of Listeria species and Listeria monocytogenes isolated from open-air fish markets.

Science.gov (United States)

Jamali, Hossein; Paydar, Mohammadjavad; Ismail, Salmah; Looi, Chung Yeng; Wong, Won Fen; Radmehr, Behrad; Abedini, Atefeh

2015-07-25

The aim of this study was to investigate the prevalence and characterization of Listeria species and Listeria monocytogenes isolated from raw fish and open-air fish market environments. Eight hundred and sixty two samples including raw fish and fish market environments (samples from workers' hands, workers' knives, containers and work surface) were collected from the open-air fish markets in the Northern region of Iran. Listeria spp. was isolated from 104/488 (21.3%) raw fish and 29/374 (7.8%) of samples from open-air fish market environment. The isolates of Listeria spp. included L. innocua (35.3%), L. monocytogenes (32.3%), L. seeligeri (18%), and L. ivanovii (14.3%). Of the 43 L. monocytogenes isolates, 31 (72.1%), 10 (23.3%) and 2 (4.7%) belonged to serovars 1/2a, 4b, and 1/2b, respectively. The inlA, inlB, inlC, inlJ, actA, hlyA, iap, plcA, and prfA virulence-associated genes were detected in almost all of the L. monocytogenes isolates. The Listeria spp. isolates showed high resistance against tetracycline (23.3%), penicillin G, and cephalothin (each 16.5%). Besides, we observed significant resistance level to tetracycline (27.9%), ampicillin (20.9%), cephalothin, penicillin G, and streptomycin (each 16.3%) in the L. monocytogenes isolates. All of the isolates were susceptible to cefotaxime, gentamicin, kanamycin, and pefloxacin. We found that tetM (25.6%), tetA (23.3%), ampC (14%), and penA (11.6%) were the most prevalent antibiotic resistance genes in the L. monocytogenes isolates. Recovery of potentially pathogenic L. monocytogenes from raw fish and environment of open-air fish market samples in this study is a convincing evidence for the zoonotic potential of listeriosis.

Differential gene expression and filamentation of Listeria monocytogenes 08-5923 exposed to sodium lactate and sodium diacetate.

Science.gov (United States)

Liu, Xiaoji; Basu, Urmila; Miller, Petr; McMullen, Lynn M

2017-05-01

This study reports the gene expression and filamentation in Listeria monocytogenes 08-5923 following exposure to food preservatives sodium lactate (NaL) and sodium diacetate (SD). L. monocytogenes 08-5923 was challenged with a mixture of NaL/SD, NaL or sodium acetate at 37 °C in tryptic soy broth. In the initial study, L. monocytogenes 08-5923 was exposed to NaL/SD for 24 h. The transcriptome was investigated by RNA sequencing. A stress response network was discovered in L. monocytogenes 08-5923, which is mediated by genes encoding two-component systems (hisJ, lisK, OmpR family gene, resE) and RNA polymerase factors (sigC, sigH). NaL/SD resulted in the down-regulation of genes in glycolysis (pykA, eno, fbaA, pgm) and up-regulation of genes in DNA repair (radC), cell division (ftsE) and cell structure synthesis (flagella synthesis: flgK, fliF, fliD). Filamentation was monitored by flow cytometry. NaL/SD mixture resulted in filamentation in L. monocytogenes 08-5923. Longer exposure was required to induce filamentation in L. monocytogenes for SD (24 h) than for NaL (8 h) when cells were exposed to individual salt. The quantitative real time PCR analysis revealed the down-regulation of ftsE in filamented cells of Listeria exposed to NaL or sodium acetate. Copyright © 2016 Elsevier Ltd. All rights reserved.

Development of multiple strain competitive index assays for Listeria monocytogenes using pIMC; a new site-specific integrative vector

Directory of Open Access Journals (Sweden)

Cronin Michael

2008-06-01

Full Text Available Abstract Background The foodborne, gram-positive pathogen, Listeria monocytogenes, is capable of causing lethal infections in compromised individuals. In the post genomic era of L. monocytogenes research, techniques are required to identify and validate genes involved in the pathogenicity and environmental biology of the organism. The aim here was to develop a widely applicable method to tag L. monocytogenes strains, with a particular emphasis on the development of multiple strain competitive index assays. Results We have constructed a new site-specific integrative vector, pIMC, based on pPL2, for the selection of L. monocytogenes from complex samples. The pIMC vector was further modified through the incorporation of IPTG inducible markers (antibiotic and phenotypic to produce a suite of four vectors which allowed the discrimination of multiple strains from a single sample. We were able to perform murine infection studies with up to four EGDe isolates within a single mouse and showed that the tags did not impact upon growth rate or virulence. The system also allowed the identification of subtle differences in virulence between strains of L. monocytogenes commonly used in laboratory studies. Conclusion This study has developed a competitive index assay that can be broadly applied to all L. monocytogenes strains. Improved statistical robustness of the data was observed, resulting in fewer mice being required for virulence assays. The competitive index assays provide a powerful method to analyse the virulence or fitness of L. monocytogenes in complex biological samples.

Effect of Listeria seeligeri or Listeria welshimeri on Listeria monocytogenes detection in and recovery from buffered Listeria enrichment broth.

Science.gov (United States)

Dailey, Rachel C; Welch, Lacinda J; Hitchins, Anthony D; Smiley, R Derike

2015-04-01

The presence of multiple species of Listeria in regulated food products is not uncommon and can complicate the recovery of Listeria monocytogenes particularly on a non-differentiating medium. The potential complications of Listeria seeligeri and Listeria welshimeri on the recovery of L. monocytogenes from inoculated food test samples using the U.S. Food and Drug Administration's (FDA) selective enrichment procedure was investigated. Post-enrichment enumeration, in the absence of food product, indicates that some L. seeligeri and L. monocytogenes pairings may have population differentials as great as 2.7 ± 0.1 logs with L. seeligeri being the predominant species. A similar observation was noted for L. welshimeri and L. monocytogenes pairings which resulted in population differentials as large as 3.7 ± 0.2 logs with L. welshimeri being the predominant species. Select strain pairings were used to inoculate guacamole, crab meat, broccoli, and cheese with subsequent recovery by the FDA Bacteriological Analytical Manual (BAM) method with 10 colonies per sample selected for confirmation. The presence of L. seeligeri had little effect on the recovery of L. monocytogenes. The presence of L. welshimeri resulted in the failure to recover L. monocytogenes in three out of the four food matrices. This work extends the observation that non-pathogenic species of Listeria can complicate the recovery of L. monocytogenes and that competition during selective enrichment is not limited to the presence of just Listeria innocua. Published by Elsevier Ltd.

Effect of Listeria seeligeri or Listeria welshimeri on Listeria monocytogenes detection in and recovery from buffered Listeria enrichment broth☆

Science.gov (United States)

Dailey, Rachel C.; Welch, Lacinda J.; Hitchins, Anthony D.; Smiley, R. Derike

2016-01-01

The presence of multiple species of Listeria in regulated food products is not uncommon and can complicate the recovery of Listeria monocytogenes particularly on a non-differentiating medium. The potential complications of Listeria seeligeri and Listeria welshimeri on the recovery of L. monocytogenes from inoculated food test samples using the U.S. Food and Drug Administration's (FDA) selective enrichment procedure was investigated. Post-enrichment enumeration, in the absence of food product, indicates that some L. seeligeri and L. monocytogenes pairings may have population differentials as great as 2.7 ± 0.1 logs with L. seeligeri being the predominant species. A similar observation was noted for L. welshimeri and L. monocytogenes pairings which resulted in population differentials as large as 3.7 ± 0.2 logs with L. welshimeri being the predominant species. Select strain pairings were used to inoculate guacamole, crab meat, broccoli, and cheese with subsequent recovery by the FDA Bacteriological Analytical Manual (BAM) method with 10 colonies per sample selected for confirmation. The presence of L. seeligeri had little effect on the recovery of L. monocytogenes. The presence of L. welshimeri resulted in the failure to recover L. monocytogenes in three out of the four food matrices. This work extends the observation that non-pathogenic species of Listeria can complicate the recovery of L. monocytogenes and that competition during selective enrichment is not limited to the presence of just Listeria innocua. PMID:25475325

Modelling and predicting the simultaneous growth of Listeria monocytogenes and spoilage micro-organisms in cold-smoked salmon

DEFF Research Database (Denmark)

Gimenez, B.; Dalgaard, Paw

2004-01-01

Aims: To evaluate and model the simultaneous growth of Listeria monocytogenes and spoilage micro-organisms in cold-smoked salmon.Methods and Results: Growth kinetics of L. monocytogenes, lactic acid bacteria (LAB), Enterobacteriaceae, enterococci and Photobacterium phosphoreum were determined...

Listeria monocytogenes repellence by enzymatically modified PES surfaces

NARCIS (Netherlands)

Veen, van der S.; Nady, N.; Franssen, M.C.R.; Zuilhof, H.; Boom, R.M.; Abee, T.; Schroën, C.G.P.H.

2015-01-01

: The effect of enzyme-catalyzed modification of poly(ethersulfone) (PES) on the adhesion and biofilm formation of two Listeria monocytogenes strains is evaluated under static and dynamic flow conditions. PES has been modified with gallic acid, ferulic acid and 4-hydroxybenzoic acid. The surfaces

9 CFR 430.4 - Control of Listeria monocytogenes in post-lethality exposed ready-to-eat products.

Science.gov (United States)

2010-01-01

... post-lethality exposed ready-to-eat products. 430.4 Section 430.4 Animals and Animal Products FOOD... Control of Listeria monocytogenes in post-lethality exposed ready-to-eat products. (a) Listeria... comes into direct contact with a food contact surface which is contaminated with L. monocytogenes. (b...

Self-contained chlorine dioxide generation and delivery pods for controlling Listeria monocytogenes in model floor drains.

Science.gov (United States)

Listeria monocytogenes is a foodborne pathogen that has been associated with poultry products. This organism is ubiquitous in nature and has been found to enter poultry further processing plants on incoming raw product. Once in the plant, L. monocytogenes can become a long term persistent colonize...

Effects of Land Use on Concentrations and Chemical Forms of Phosphorus in Different-Size Aggregates

Science.gov (United States)

Ahmad, E. H.; Demisie, W.; Zhang, M.

2017-12-01

Land use has been recognized as an important driver of environmental change on all spatial and temporal scales. This study was conducted to determine the effects of land uses on phosphorus concentration in bulk soil and in water-stable aggregates in different soils. The study was conducted on three soil types (Ferrosols, Cambosols, and Primosols), which were collected from three different locations from southeast China and under three land uses (Uncultivated, Vegetable and forest land) the region is characterized as a hill and plain area. Accordingly, a total of 24 soil samples were collected. The results showed that average contents of total P were 0.55-1.55 g/kg, 0.28-1.03 g/kg and 0.14-0.8 g/kg for the soils: Cambosols, Ferrosols and Primosols respectively. Vegetable and forest land led to higher total phosphorus contents in these soils than in the uncultivated land. An aggregate fraction of >2 mm under forest land made up the largest percentage (30 up to 70%), whereas the size fraction phosphorus, organic phosphorus and Olsen P and phosphorus forms in the soils. It implies that the conversion of natural ecosystem to vegetable land increased the phosphorus proportion in the soils, which could have negative impact on the environmental quality.

Effect of natural antioxidants on the aggregation and disaggregation ...

African Journals Online (AJOL)

Conclusion: High antioxidant activities were positively correlated with the inhibition of Aβ aggregation, although not with the disaggregation of pre-formed Aβ aggregates. Nevertheless, potent antioxidants may be helpful in treating Alzheimer's disease. Keywords: Alzheimer's disease, β-Amyloid, Aggregation, Disaggregation ...

Survival of Listeria monocytogenes in low acid italian sausage produced under brazilian conditions Sobrevivência de Listeria monocytogenes em salame tipo italiano de baixa acidez, produzido sob condições brasileiras de fabricação

Directory of Open Access Journals (Sweden)

Roberto Degenhardt

2007-06-01

Full Text Available Dry sausages have been considered ready-to-eat products with low risk of causing listeriosis due to the hurdles created during the manufacturing process such as low pH and a w, high salt concentration and presence of lactic acid bacteria (LAB. However, several studies have detected survival of Listeria monocytogenes in these products and also shown that process parameters, LAB and L. monocytogenes strains directly influence the results. In this work, survival of the pathogen in sausages prepared with three different formulations (one standard formulation, one formulation added of Lactobacillus plantarum and one added of 2% sodium lactate, using the manufacturing process usually employed in Brazil, was evaluated. Naturally contaminated sausages presented a small increase in the counts of L. monocytogenes in the first days of the process, followed by a gradual decrease until the end of the process. In experimentally contaminated samples containing L. plantarum, the reduction of counts of L. monocytogenes during processing was considerable, but there wasn´t significant differences between the treatments.Salames têm sido considerados produtos prontos para o consumo com baixo risco de provocar listeriose devido aos obstáculos criados no processo de fabricação e suas características de pH e atividade água baixos, alta concentração de sal e presença de bactérias lácticas. Entretanto, a sobrevivência de Listeria monocytogenes nesta classe de produtos é verificada e estudos de processo visando à redução da contaminação por este patógeno, têm demonstrado que particularidades como variação dos parâmetros de processo, cepas de bactérias lácticas e de L. monocytogenes influenciam diretamente os resultados. Neste estudo três formulações foram avaliadas (uma padrão, uma com inoculação da cultura Lactobacillus plantarum e outra com adição 2% de lactato de sódio empregando parâmetros de processo comumente praticados no Brasil

Sequential transition of the injury phenotype, temperature-dependent survival and transcriptional response in Listeria monocytogenes following lethal H2O2 exposure.

Science.gov (United States)

Ochiai, Yoshitsugu; Yamada, Fumiya; Yoshikawa, Yuko; Mochizuki, Mariko; Takano, Takashi; Hondo, Ryo; Ueda, Fukiko

2017-10-16

The food-borne pathogen Listeria monocytogenes is present persistently in food processing environments, where this bacterium is exposed to various stress factors, including oxidative stress. This study aimed to elucidate the temperature-dependent response of L. monocytogenes to H 2 O 2 exposure and the phenotypic changes in colony formation by H 2 O 2 -treated bacteria. Survival curves indicated an increase in the resistance to H 2 O 2 in L. monocytogenes as the temperature decreased during the stress exposure procedure. Transcriptional induction of genes with key roles in response to H 2 O 2 , including sigB and kat, was observed at 37°C, but not at 20°C, whereas other stress response genes were induced at both temperatures. Following H 2 O 2 exposure, L. monocytogenes produced small colony phenotypes and the colony size decreased in a stress exposure duration-dependent manner. Resuscitated cells with no ability to form colonies in the absence of sodium pyruvate were also found. Our findings show the possibility that a sequential transition in the injury phenotype from small colony phenotype to resuscitated cells occurred during the course of exposure to H 2 O 2 . The higher H 2 O 2 resistance at 20°C than 37°C suggests further investigation of the response to H 2 O 2 exposure under the lower temperatures, including refrigeration temperature, which may contribute to elucidation of bacterial survival over extended time periods in food-processing environments. Copyright © 2017 Elsevier B.V. All rights reserved.

Evaluation of bacteriocin-producing Lactobacillus sakei 1 against Listeria monocytogenes 1/2a growth and haemolytic activity Avaliação de Lactobacillus sakei 1 produtor de bacteriocina frente a Listeria monocytogenes 1/2a e sua atividade hemolítica

Directory of Open Access Journals (Sweden)

Rafael C.R. Martinez

2005-03-01

Full Text Available Bacteriocin-producing Lactobacillus sakei 1 was cultivated in Brain-Heart Infusion broth (24 h at 25ºC. The culture supernatant was neutralized, filter sterilized and used to test the activity of bacteriocin against Listeria monocytogenes 1/2a, at 8ºC and 15ºC. Non-bacteriocinogenic Lactobacillus sakei ATCC 15521 was used as a negative control. L. monocytogenes 1/2a was inoculated in culture supernatant medium from L. sakei 1 and L. sakei ATCC 15521 and the listerial populations were determined after 0, 5 and 10 days. The bacteriocin production was quantified as arbitrary units per mL (AU/mL using agar antagonism test. Additionally, to investigate if L. monocytogenes virulence pattern could be changed after bactericion exposure, the ability of L. monocytogenes to cause haemolysis in sheep red blood cells was determined, before and after exposure to bacteriocin at 8ºC. In the presence of the antimicrobial peptide, at 8ºC, L. monocytogenes population decreased, but growth of resistant cells was observed. At 15ºC, there was no difference between test and control. Furthermore, the haemolytic activity of L. monocytogenes 1/2a was not altered by exposure to L. sakei 1 bacteriocin, which suggests no change in its virulence pattern.Lactobacillus sakei 1 produtor de bacteriocina foi cultivado em caldo Infusão Cérebro-Coração por 24h a 25ºC. O sobrenadante da cultura foi neutralizado, esterilizado por filtração e usado para testar a atividade da bacteriocina frente a Listeria monocytogenes 1/2a, a 8ºC e 15ºC. Lactobacillus sakei ATCC 15521 não bacteriocinogênico, foi utilizado como controle negativo. L. monocytogenes 1/2a foi inoculada no sobrenadante da cultura de L.sakei 1 e L. sakei ATCC 15521 e as populações listeriais foram determinadas após 0, 5 e 10 dias. A produção de bacteriocina foi quantificada como unidades arbitrárias por mL (UA/mL, utilizando-se o teste de antagonismo em ágar. Adicionalmente, para investigar se o padr

What favors convective aggregation and why?

Science.gov (United States)

Muller, Caroline; Bony, Sandrine

2015-07-01

The organization of convection is ubiquitous, but its physical understanding remains limited. One particular type of organization is the spatial self-aggregation of convection, taking the form of cloud clusters, or tropical cyclones in the presence of rotation. We show that several physical processes can give rise to self-aggregation and highlight the key features responsible for it, using idealized simulations. Longwave radiative feedbacks yield a "radiative aggregation." In that case, sufficient spatial variability of radiative cooling rates yields a low-level circulation, which induces the upgradient energy transport and radiative-convective instability. Not only do vertically integrated radiative budgets matter but the vertical profile of cooling is also crucial. Convective aggregation is facilitated when downdrafts below clouds are weak ("moisture-memory aggregation"), and this is sufficient to trigger aggregation in the absence of longwave radiative feedbacks. These results shed some light on the sensitivity of self-aggregation to various parameters, including resolution or domain size.

Thioredoxin A Is Essential for Motility and Contributes to Host Infection of Listeria monocytogenes via Redox Interactions

Directory of Open Access Journals (Sweden)

Changyong Cheng

2017-06-01

Full Text Available Microbes employ the thioredoxin system to defend against oxidative stress and ensure correct disulfide bonding to maintain protein function. Listeria monocytogenes has been shown to encode a putative thioredoxin, TrxA, but its biological roles and underlying mechanisms remain unknown. Here, we showed that expression of L. monocytogenes TrxA is significantly induced in bacteria treated with the thiol-specific oxidizing agent, diamide. Deletion of trxA markedly compromised tolerance of the pathogen to diamide, and mainly impaired early stages of infection in human intestinal epithelial Caco-2 cells. In addition, most trxA mutant bacteria were not associated with polymerized actin, and the rare bacteria that were associated with polymerized actin displayed very short tails or clouds during infection. Deletion or constitutive overexpression of TrxA, which was regulated by SigH, severely attenuated the virulence of the pathogen. Transcriptome analysis of L. monocytogenes revealed over 270 genes that were differentially transcribed in the ΔtrxA mutant compared to the wild-type, especially for the virulence-associated genes plcA, mpl, hly, actA, and plcB. Particularly, deletion of TrxA completely reduced LLO expression, and thereby led to a thoroughly impaired hemolytic activity. Expression of these virulence factors are positively regulated by the master regulator PrfA that was found here to use TrxA to maintain its reduced forms for activation. Interestingly, the trxA deletion mutant completely lacked flagella and was non-motile. We further confirmed that this deficiency is attributable to TrxA in maintaining the reduced intracellular monomer status of MogR, the key regulator for flagellar formation, to ensure correct dimerization. In summary, we demonstrated for the first time that L. monocytogenes thioredoxin A as a vital cellular reductase is essential for maintaining a highly reducing environment in the bacterial cytosol, which provides a

Thioredoxin A Is Essential for Motility and Contributes to Host Infection of Listeria monocytogenes via Redox Interactions.

Science.gov (United States)

Cheng, Changyong; Dong, Zhimei; Han, Xiao; Wang, Hang; Jiang, Li; Sun, Jing; Yang, Yongchun; Ma, Tiantian; Shao, Chunyan; Wang, Xiaodu; Chen, Zhongwei; Fang, Weihuan; Freitag, Nancy E; Huang, Huarong; Song, Houhui

2017-01-01

Microbes employ the thioredoxin system to defend against oxidative stress and ensure correct disulfide bonding to maintain protein function. Listeria monocytogenes has been shown to encode a putative thioredoxin, TrxA, but its biological roles and underlying mechanisms remain unknown. Here, we showed that expression of L. monocytogenes TrxA is significantly induced in bacteria treated with the thiol-specific oxidizing agent, diamide. Deletion of trxA markedly compromised tolerance of the pathogen to diamide, and mainly impaired early stages of infection in human intestinal epithelial Caco-2 cells. In addition, most trxA mutant bacteria were not associated with polymerized actin, and the rare bacteria that were associated with polymerized actin displayed very short tails or clouds during infection. Deletion or constitutive overexpression of TrxA, which was regulated by SigH, severely attenuated the virulence of the pathogen. Transcriptome analysis of L. monocytogenes revealed over 270 genes that were differentially transcribed in the Δ trxA mutant compared to the wild-type, especially for the virulence-associated genes plcA, mpl, hly, actA , and plcB . Particularly, deletion of TrxA completely reduced LLO expression, and thereby led to a thoroughly impaired hemolytic activity. Expression of these virulence factors are positively regulated by the master regulator PrfA that was found here to use TrxA to maintain its reduced forms for activation. Interestingly, the trxA deletion mutant completely lacked flagella and was non-motile. We further confirmed that this deficiency is attributable to TrxA in maintaining the reduced intracellular monomer status of MogR, the key regulator for flagellar formation, to ensure correct dimerization. In summary, we demonstrated for the first time that L. monocytogenes thioredoxin A as a vital cellular reductase is essential for maintaining a highly reducing environment in the bacterial cytosol, which provides a favorable condition for

Modeling and predicting the growth boundary of Listeria monocytogenes in lightly preserved seafood

DEFF Research Database (Denmark)

Mejlholm, Ole; Dalgaard, Paw

2007-01-01

The antimicrobial effect of diacetate and lactate against Listeria monocytogenes was evaluated in challenge tests with vacuum-packaged or modified atmosphere packaged (MAP) cold-smoked salmon, marinated salmon, cold-smoked Greenland halibut, marinated Greenland halibut, and gravad salmon. MAP col...... characteristics required to prevent the growth of L. monocytogenes, thereby making it possible to identify critical control points, and is useful for compliance with the new European Union regulation on ready-to-eat foods (EC 2073/2005)....

Changes in gene expression during adaptation of Listeria monocytogenes to the soil environment.

Science.gov (United States)

Piveteau, Pascal; Depret, Géraldine; Pivato, Barbara; Garmyn, Dominique; Hartmann, Alain

2011-01-01

Listeria monocytogenes is a ubiquitous opportunistic pathogen responsible for listeriosis. In order to study the processes underlying its ability to adapt to the soil environment, whole-genome arrays were used to analyse transcriptome modifications 15 minutes, 30 minutes and 18 h after inoculation of L. monocytogenes EGD-e in soil extracts. Growth was observed within the first day of incubation and large numbers were still detected in soil extract and soil microcosms one year after the start of the experiment. Major transcriptional reprofiling was observed. Nutrient acquisition mechanisms (phosphoenolpyruvate-dependent phosphotransferase systems and ABC transporters) and enzymes involved in catabolism of specific carbohydrates (β-glucosidases; chitinases) were prevalent. This is consistent with the overrepresentation of the CodY regulon that suggests that in a nutrient depleted environment, L. monocytogenes recruits its extensive repertoire of transporters to acquire a range of substrates for energy production.

Effect of enterocin AS-48 in combination with biocides on planktonic and sessile Listeria monocytogenes.

Science.gov (United States)

Gómez, Natacha Caballero; Abriouel, Hikmate; Grande, M A José; Pulido, Rubén Pérez; Gálvez, Antonio

2012-05-01

Enterocin AS-48 was tested on a cocktail of Listeria monocytogenes strains in planktonic and sessile states, singly or in combination with biocides benzalkonium chloride, cetrimide, hexadecylpyridinium chloride, didecyldimethylammonium bromide, triclosan, poly-(hexamethylen guanidinium) hydrochloride, chlorhexidine, hexachlorophene, and the commercial sanitizers P3 oxonia and P3 topax 66. Combinations of sub-inhibitory bacteriocin concentrations and biocide concentrations 4 to 10-fold lower than their minimum inhibitory concentrations (MIC) completely inhibited growth of the planktonic listeriae. Inactivation of Listeria in biofilms formed on polystyrene microtiter plates required concentrations of enterocin AS-48 greater than 50 μg/ml, and biocide concentrations ten to 100-fold higher. In combination with enterocin AS-48 (25 or 50 μg/ml), microbial inactivation increased remarkably for all biocides except P3 oxonia and P3 topax 66 solutions. Polystyrene microtiter plates conditioned with enterocin solutions (0.5-25 μg/ml) decreased the adherence and biofilm formation of the L. monocytogenes cell cocktail, avoiding biofilm formation for at least 24 h at a bacteriocin concentration of 25 μg/ml. Copyright © 2011 Elsevier Ltd. All rights reserved.

An exact approach for aggregated formulations

DEFF Research Database (Denmark)

Gamst, Mette; Spoorendonk, Simon

Aggregating formulations is a powerful approach for transforming problems into taking more tractable forms. Aggregated formulations can, though, have drawbacks: some information may get lost in the aggregation and { put in a branch-and-bound context { branching may become very di_cult and even....... The paper includes general considerations on types of problems for which the method is of particular interest. Furthermore, we prove the correctness of the procedure and consider how to include extensions such as cutting planes and advanced branching strategies....

Important vectors for Listeria monocytogenes transmission at farm dairies manufacturing fresh sheep and goat cheese from raw milk.

Science.gov (United States)

Schoder, Dagmar; Melzner, Daniela; Schmalwieser, Alois; Zangana, Abdoulla; Winter, Petra; Wagner, Martin

2011-06-01

The aim of this study was to determine the transmission routs of Listeria spp. in dairy farms manufacturing fresh cheese made from ovine and caprine raw milk and to evaluate the impact of Listeria monocytogenes mastitis on raw milk contamination. Overall, 5,799 samples, including 835 environmental samples, 230 milk and milk product samples, and 4,734 aseptic half-udder foremilk samples were collected from 53 dairy farms in the dairy intensive area of Lower Austria. Farms were selected for the study because raw milk was processed to cheese that was sold directly to consumers. A total of 153 samples were positive for Listeria spp., yielding an overall prevalence of 2.6%; L. monocytogenes was found in 0.9% of the samples. Bulk tank milk, cheese, and half-udder samples were negative for Listeria spp. Because none of the sheep and goats tested positive from udder samples, L. monocytogenes mastitis was excluded as a significant source of raw milk contamination. L. monocytogenes was detected at 30.2% of all inspected farms. Swab samples from working boots and fecal samples had a significantly higher overall prevalence (P < 0.001) of L. monocytogenes (15.7 and 13.0%, respectively) than did swab samples from the milk processing environment (7.9%). A significant correlation was found between the prevalence of L. monocytogenes in the animal and in the milk processing environment and the silage feeding practices. Isolation of L. monocytogenes was three to seven times more likely from farms where silage was fed to animals throughout the year than from farms where silage was not fed to the animals.

Adaptation of Listeria monocytogenes in a simulated cheese medium: effects on virulence using the Galleria mellonella infection model.

Science.gov (United States)

Schrama, D; Helliwell, N; Neto, L; Faleiro, M L

2013-06-01

The aim of this study was to evaluate the effect of the acid and salt adaptation in a cheese-based medium on the virulence potential of Listeria monocytogenes strains isolated from cheese and dairy processing environment using the Galleria mellonella model. Four L. monocytogenes strains were exposed to a cheese-based medium in conditions of induction of an acid tolerance response and osmotolerance response (pH 5·5 and 3·5% w/v NaCl) and injected in G. mellonella insects. The survival of insects and the L. monocytogenes growth kinetics in insects were evaluated. The gene expression of hly, actA and inlA genes was determined by real-time PCR. The adapted cells of two dairy strains showed reduced insect mortality (P 0·05) was found between adapted and nonadapted cells. The gene expression results evidenced an overexpression of virulence genes in cheese-based medium, but not in simulated insect-induced conditions. Our results suggest that adaptation to low pH and salt in a cheese-based medium can affect the virulence of L. monocytogenes, but this effect is strain dependent. In this study, the impact of adaptation to low pH and salt in a cheese-based medium on L. monocytogenes virulence was tested using the Wax Moth G. mellonella model. This model allowed the differentiation of the virulence potential between the L. monocytogenes strains. The effect of adaptation on virulence is strain dependent. The G. mellonella model revealed to be a prompt method to test food-related factors on L. monocytogenes virulence. © 2013 The Society for Applied Microbiology.

Listeria monocytogenes isolated in ready-to-eat food in South Bačka region of Vojvodina province, Serbia

Directory of Open Access Journals (Sweden)

Gusman Vera

2014-01-01

Full Text Available Listeria monocytogenes is pathogenic bacterium that can contaminate food products during and after processing. As ready-to-eat food does not undergo any treatment to ensure its safety before consumption, the risk of foodborne disease must be considered if this pathogen is present in the food. As diseases caused by contaminated food are an important public health problem today, the aim of this study was to determine the prevalence of Listeria monocytogenes in different ready-to-eat food products. In the seven-month period from June 1 to December 31, 2011, a total of 1 380 food samples were examined in the Division of Sanitary Bacteriology, Center for Microbiology, Institute of Public Health of Vojvodina in Novi Sad. A total of 912 samples were analyzed for the presence of Listeria monocytogenes according to ISO 11290-2. The identity of suspected Listeria monocytogenes was confirmed using the VITEK 2 Compact system (BioMerieux, France. Out of 912 samples, Listeria monocytogenes was detected in 18 (1.97%. Listeria monocytogenes was mostly found in cooked meals (in 6 samples out of 18, sandwiches (4 samples and frozen food, such as ice-cream and frozen vegetables (4 samples. It was also found in tofu bread spreads (2 samples, cream cheese (1 sample and cakes (1 sample. The presence of Listeria monocytogenes in some ready-to-eat food could present a public health hazard, particularly to the high-risk population group, because of the high mortality rate associated with listeriosis and the widespread nature of the organism. Monitoring of listeriosis is essential to prevent foodborne outbreaks, and in assessing human health risk in ready-to-eat foods.

Tolerance to quaternary ammonium compound disinfectants may enhance growth of Listeria monocytogenes in the food industry.

Science.gov (United States)

Møretrø, Trond; Schirmer, Bjørn C T; Heir, Even; Fagerlund, Annette; Hjemli, Pernille; Langsrud, Solveig

2017-01-16

The antibacterial effect of disinfectants is crucial for the control of Listeria monocytogenes in food processing environments. Tolerance of L. monocytogenes to sublethal levels of disinfectants based on quaternary ammonium compounds (QAC) is conferred by the resistance determinants qacH and bcrABC. The presence and distribution of these genes have been anticipated to have a role in the survival and growth of L. monocytogenes in food processing environments where QAC based disinfectants are in common use. In this study, a panel of 680 L. monocytogenes from nine Norwegian meat- and salmon processing plants were grouped into 36 MLVA profiles. The presence of qacH and bcrABC was determined in 101 isolates from the 26 most common MLVA profiles. Five MLVA profiles contained qacH and two contained bcrABC. Isolates with qacH and bcrABC showed increased tolerance to the QAC Benzalkonium chloride (BC), with minimal inhibitory concentrations (MICs) of 5-12, 10-13 and 100ppm). A sample with lower BC concentrations (14ppm of chain length C-12 and 2.7ppm of chain length C-14) inhibited growth of L. monocytogenes not containing bcrABC or qacH, compared to strains with these genes. The study has shown that L. monocytogenes harbouring the QAC resistance genes qacH and bcrABC are prevalent in the food industry and that residuals of QAC may be present in concentrations after sanitation in the industry that result in a growth advantage for bacteria with such resistance genes. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

Characterization and antibiotic susceptibility of Listeria monocytogenes isolated from poultry and red meat in Morocco

Directory of Open Access Journals (Sweden)

Hayat Ennaji

2008-09-01

Full Text Available Hayat Ennaji1,2, Mohammed Timinouni2, My Mustapha Ennaji3, Mohammed Hassar1, Nozha Cohen11Laboratoire de Microbiologie et Hygiène des Aliments et de l’Environnement, Institut Pasteur du Maroc., Casablanca, Morocco; 2Laboratoire de Microbiologie et Biologie Moléculaire, Institut Pasteur du Maroc., Casablanca, Morocco; 3Laboratoire de Virologie et Hygiène and Microbiologie., Faculté des Sciences et Techniques - Mohammedia, Université Hassan II, Mohammedia, MoroccoAbstract: This study was carried out on 426 samples of raw meats collected from butcheries and supermarkets in Casablanca, Morocco. The samples were examined for the occurrence of Listeria species. Strains of Listeria monocytogenes were characterized by several biochemical tests and confirmed by polymerase chain reaction (PCR. β-hemolytic cultures and nonhemolytic isolates were tested for biochemical properties with the Listeria API test. Among the 43 Listeria species isolates; we identified 10 strains for L. monocytogenes (23.3%, 31 strains for L. innocua (72.1% and 2 strains for L. welshimeri (4.6%. Strains of L. monocytogenes were separated by multiplex PCR; two serogroups IIb and IVb were thus differentiated. Antibiotic susceptibility of L. monocytogenes to 21 antibiotics was determined by the disk diffusion method. All isolates were susceptible to a wide range of the tested antibiotics with the exception of nalidixic acid, colistine and cephalosporins second and third generation for which they were all resistant.Keywords: antibiotic susceptibility, Listeria monocytogenes, meat, PCR

Effect of gamma-irradiation on the survival of Listeria monocytogenes and allergenicity of cherry tomatoes

International Nuclear Information System (INIS)

Todoriki, Setsuko; Bari, Latiful; Kitta, Kazumi; Ohba, Mika; Ito, Yasuhiro; Tsujimoto, Yuka; Kanamori, Norihito; Yano, Erika; Moriyama, Tatsuya; Kawamura, Yukio; Kawamoto, Shinichi

2009-01-01

The presence of Listeria monocytogenes in fresh produce is a growing concern because of the possibility of food-borne illness. Ionizing radiation is an effective non-thermal means of eliminating pathogenic bacteria in fresh produce; however, the effect of ionizing irradiation on the allergenic properties of the host commodities remains unknown. This study aimed (i) to determine the effective dose of gamma-irradiation in eliminating L. monocytogenes on whole cherry tomatoes and (ii) to evaluate the effect of gamma-irradiation on the allergenic properties of tomato proteins. Cherry tomatoes that were inoculated with a mixture of five L. monocytogenes strains were treated with gamma-rays from a 60 Co source. A 1.25 kGy dose of gamma-irradiation was found to be sufficient to eliminate L. monocytogenes on whole cherry tomatoes. The immunoblot profile of serum samples obtained from two patients with tomato allergy revealed that gamma-irradiation did not affect the allergenicity of tomato proteins for up to 7 days after irradiation when the tomatoes were stored at 20 deg. C. Additionally, the m-RNA levels of β-fructofuranosidase, polygalacturonase, pectin esterase, and superoxide dismutase, the main allergenic proteins in tomato, were not affected by the applied irradiation dose. Thus, this study demonstrated that a 1.25 kGy dose of gamma-irradiation effectively eliminates L. monocytogenes on cherry tomatoes without affecting the expression of allergenic proteins in the fruits.

Effect of gamma-irradiation on the survival of Listeria monocytogenes and allergenicity of cherry tomatoes

Science.gov (United States)

Todoriki, Setsuko; Bari, Latiful; Kitta, Kazumi; Ohba, Mika; Ito, Yasuhiro; Tsujimoto, Yuka; Kanamori, Norihito; Yano, Erika; Moriyama, Tatsuya; Kawamura, Yukio; Kawamoto, Shinichi

2009-07-01

The presence of Listeria monocytogenes in fresh produce is a growing concern because of the possibility of food-borne illness. Ionizing radiation is an effective non-thermal means of eliminating pathogenic bacteria in fresh produce; however, the effect of ionizing irradiation on the allergenic properties of the host commodities remains unknown. This study aimed (i) to determine the effective dose of gamma-irradiation in eliminating L. monocytogenes on whole cherry tomatoes and (ii) to evaluate the effect of gamma-irradiation on the allergenic properties of tomato proteins. Cherry tomatoes that were inoculated with a mixture of five L. monocytogenes strains were treated with gamma-rays from a 60Co source. A 1.25 kGy dose of gamma-irradiation was found to be sufficient to eliminate L. monocytogenes on whole cherry tomatoes. The immunoblot profile of serum samples obtained from two patients with tomato allergy revealed that gamma-irradiation did not affect the allergenicity of tomato proteins for up to 7 days after irradiation when the tomatoes were stored at 20 °C. Additionally, the m-RNA levels of β-fructofuranosidase, polygalacturonase, pectin esterase, and superoxide dismutase, the main allergenic proteins in tomato, were not affected by the applied irradiation dose. Thus, this study demonstrated that a 1.25 kGy dose of gamma-irradiation effectively eliminates L. monocytogenes on cherry tomatoes without affecting the expression of allergenic proteins in the fruits.

Effect of gamma-irradiation on the survival of Listeria monocytogenes and allergenicity of cherry tomatoes

Energy Technology Data Exchange (ETDEWEB)

Todoriki, Setsuko [National Food Research Institute, Tsukuba, Ibaraki 305-8642 (Japan)], E-mail: setsuko@affrc.go.jp; Bari, Latiful; Kitta, Kazumi; Ohba, Mika; Ito, Yasuhiro; Tsujimoto, Yuka [National Food Research Institute, Tsukuba, Ibaraki 305-8642 (Japan); Kanamori, Norihito [Japan International Research Center for Agricultural Science, Tsukuba, Ibaraki 305-8686 (Japan); Yano, Erika; Moriyama, Tatsuya; Kawamura, Yukio [School of Agriculture, Kinki University, Nara-city, Nara 631-8505 (Japan); Kawamoto, Shinichi [National Food Research Institute, Tsukuba, Ibaraki 305-8642 (Japan)

2009-07-15

The presence of Listeria monocytogenes in fresh produce is a growing concern because of the possibility of food-borne illness. Ionizing radiation is an effective non-thermal means of eliminating pathogenic bacteria in fresh produce; however, the effect of ionizing irradiation on the allergenic properties of the host commodities remains unknown. This study aimed (i) to determine the effective dose of gamma-irradiation in eliminating L. monocytogenes on whole cherry tomatoes and (ii) to evaluate the effect of gamma-irradiation on the allergenic properties of tomato proteins. Cherry tomatoes that were inoculated with a mixture of five L. monocytogenes strains were treated with gamma-rays from a {sup 60}Co source. A 1.25 kGy dose of gamma-irradiation was found to be sufficient to eliminate L. monocytogenes on whole cherry tomatoes. The immunoblot profile of serum samples obtained from two patients with tomato allergy revealed that gamma-irradiation did not affect the allergenicity of tomato proteins for up to 7 days after irradiation when the tomatoes were stored at 20 deg. C. Additionally, the m-RNA levels of {beta}-fructofuranosidase, polygalacturonase, pectin esterase, and superoxide dismutase, the main allergenic proteins in tomato, were not affected by the applied irradiation dose. Thus, this study demonstrated that a 1.25 kGy dose of gamma-irradiation effectively eliminates L. monocytogenes on cherry tomatoes without affecting the expression of allergenic proteins in the fruits.

Rapid detection of Listeria monocytogenes in milk using confocal micro-Raman spectroscopy and chemometric analysis.

Science.gov (United States)

Wang, Junping; Xie, Xinfang; Feng, Jinsong; Chen, Jessica C; Du, Xin-jun; Luo, Jiangzhao; Lu, Xiaonan; Wang, Shuo

2015-07-02

Listeria monocytogenes is a facultatively anaerobic, Gram-positive, rod-shape foodborne bacterium causing invasive infection, listeriosis, in susceptible populations. Rapid and high-throughput detection of this pathogen in dairy products is critical as milk and other dairy products have been implicated as food vehicles in several outbreaks. Here we evaluated confocal micro-Raman spectroscopy (785 nm laser) coupled with chemometric analysis to distinguish six closely related Listeria species, including L. monocytogenes, in both liquid media and milk. Raman spectra of different Listeria species and other bacteria (i.e., Staphylococcus aureus, Salmonella enterica and Escherichia coli) were collected to create two independent databases for detection in media and milk, respectively. Unsupervised chemometric models including principal component analysis and hierarchical cluster analysis were applied to differentiate L. monocytogenes from Listeria and other bacteria. To further evaluate the performance and reliability of unsupervised chemometric analyses, supervised chemometrics were performed, including two discriminant analyses (DA) and soft independent modeling of class analogies (SIMCA). By analyzing Raman spectra via two DA-based chemometric models, average identification accuracies of 97.78% and 98.33% for L. monocytogenes in media, and 95.28% and 96.11% in milk were obtained, respectively. SIMCA analysis also resulted in satisfied average classification accuracies (over 93% in both media and milk). This Raman spectroscopic-based detection of L. monocytogenes in media and milk can be finished within a few hours and requires no extensive sample preparation. Copyright © 2015 Elsevier B.V. All rights reserved.

Incidence of Listeria monocytogenes and Other Bacteria in ...

African Journals Online (AJOL)

Prof. Ogunji

Abstract. The involvement of Listeria monocytogenes in spontaneous abortion in Jos was investigated. One hundred blood and 100 placenta samples were collected from spontaneous abortion patients in Jos. The samples were inoculated first into Listeria enrichment broth. Incubation was at 37o C, followed by cold ...

Genotypes Associated with Listeria monocytogenes Isolates Displaying Impaired or Enhanced Tolerances to Cold, Salt, Acid, or Desiccation Stress

Science.gov (United States)

Hingston, Patricia; Chen, Jessica; Dhillon, Bhavjinder K.; Laing, Chad; Bertelli, Claire; Gannon, Victor; Tasara, Taurai; Allen, Kevin; Brinkman, Fiona S. L.; Truelstrup Hansen, Lisbeth; Wang, Siyun

2017-01-01

The human pathogen Listeria monocytogenes is a large concern in the food industry where its continuous detection in food products has caused a string of recalls in North America and Europe. Most recognized for its ability to grow in foods during refrigerated storage, L. monocytogenes can also tolerate several other food-related stresses with some strains possessing higher levels of tolerances than others. The objective of this study was to use a combination of phenotypic analyses and whole genome sequencing to elucidate potential relationships between L. monocytogenes genotypes and food-related stress tolerance phenotypes. To accomplish this, 166 L. monocytogenes isolates were sequenced and evaluated for their ability to grow in cold (4°C), salt (6% NaCl, 25°C), and acid (pH 5, 25°C) stress conditions as well as survive desiccation (33% RH, 20°C). The results revealed that the stress tolerance of L. monocytogenes is associated with serotype, clonal complex (CC), full length inlA profiles, and the presence of a plasmid which was identified in 55% of isolates. Isolates with full length inlA exhibited significantly (p monocytogenes sequence types, a new inlA PMSC, and several connections between CCs and the presence/absence or variations of specific genetic elements. A whole genome single-nucleotide-variants phylogeny revealed sporadic distribution of tolerant isolates and closely related sensitive and tolerant isolates, highlighting that minor genetic differences can influence the stress tolerance of L. monocytogenes. Specifically, a number of cold and desiccation sensitive isolates contained PMSCs in σB regulator genes (rsbS, rsbU, rsbV). Collectively, the results suggest that knowing the sequence type of an isolate in addition to screening for the presence of full-length inlA and a plasmid, could help food processors and food agency investigators determine why certain isolates might be persisting in a food processing environment. Additionally, increased

Estimation of Microbial Contamination of Food from Prevalence and Concentration Data: Application to Listeria monocytogenes in Fresh Vegetables▿

Science.gov (United States)

Crépet, Amélie; Albert, Isabelle; Dervin, Catherine; Carlin, Frédéric

2007-01-01

A normal distribution and a mixture model of two normal distributions in a Bayesian approach using prevalence and concentration data were used to establish the distribution of contamination of the food-borne pathogenic bacteria Listeria monocytogenes in unprocessed and minimally processed fresh vegetables. A total of 165 prevalence studies, including 15 studies with concentration data, were taken from the scientific literature and from technical reports and used for statistical analysis. The predicted mean of the normal distribution of the logarithms of viable L. monocytogenes per gram of fresh vegetables was −2.63 log viable L. monocytogenes organisms/g, and its standard deviation was 1.48 log viable L. monocytogenes organisms/g. These values were determined by considering one contaminated sample in prevalence studies in which samples are in fact negative. This deliberate overestimation is necessary to complete calculations. With the mixture model, the predicted mean of the distribution of the logarithm of viable L. monocytogenes per gram of fresh vegetables was −3.38 log viable L. monocytogenes organisms/g and its standard deviation was 1.46 log viable L. monocytogenes organisms/g. The probabilities of fresh unprocessed and minimally processed vegetables being contaminated with concentrations higher than 1, 2, and 3 log viable L. monocytogenes organisms/g were 1.44, 0.63, and 0.17%, respectively. Introducing a sensitivity rate of 80 or 95% in the mixture model had a small effect on the estimation of the contamination. In contrast, introducing a low sensitivity rate (40%) resulted in marked differences, especially for high percentiles. There was a significantly lower estimation of contamination in the papers and reports of 2000 to 2005 than in those of 1988 to 1999 and a lower estimation of contamination of leafy salads than that of sprouts and other vegetables. The interest of the mixture model for the estimation of microbial contamination is discussed. PMID

Genetic Separation of Listeria monocytogenes Causing Central Nervous System Infections in Animals

Directory of Open Access Journals (Sweden)

Lisandra Aguilar-Bultet

2018-02-01

Full Text Available Listeria monocytogenes is a foodborne pathogen that causes abortion, septicemia, gastroenteritis and central nervous system (CNS infections in ruminants and humans. L. monocytogenes strains mainly belong to two distinct phylogenetic groups, named lineages I and II. In general, clinical cases in humans and animals, in particular CNS infections, are caused by lineage I strains, while most of the environmental and food strains belong to lineage II. Little is known about why lineage I is more virulent than lineage II, even though various molecular factors and mechanisms associated with pathogenesis are known. In this study, we have used a variety of whole genome sequence analyses and comparative genomic tools in order to find characteristics that distinguish lineage I from lineage II strains and CNS infection strains from non-CNS strains. We analyzed 225 strains and identified single nucleotide variants between lineages I and II, as well as differences in the gene content. Using a novel approach based on Reads Per Kilobase per Million Mapped (RPKM, we identified 167 genes predominantly absent in lineage II but present in lineage I. These genes are mostly encoding for membrane-associated proteins. Additionally, we found 77 genes that are largely absent in the non-CNS associated strains, while 39 genes are especially lacking in our defined “non-clinical” group. Based on the RPKM analysis and the metadata linked to the L. monocytogenes strains, we identified 6 genes potentially associated with CNS cases, which include a transcriptional regulator, an ABC transporter and a non-coding RNA. Although there is not a clear separation between pathogenic and non-pathogenic strains based on phylogenetic lineages, the presence of the genes identified in our study reveals potential pathogenesis traits in ruminant L. monocytogenes strains. Ultimately, the differences that we have found in our study will help steer future studies in understanding the virulence

Genetic Separation of Listeria monocytogenes Causing Central Nervous System Infections in Animals

Science.gov (United States)

Aguilar-Bultet, Lisandra; Nicholson, Pamela; Rychener, Lorenz; Dreyer, Margaux; Gözel, Bulent; Origgi, Francesco C.; Oevermann, Anna; Frey, Joachim; Falquet, Laurent

2018-01-01

Listeria monocytogenes is a foodborne pathogen that causes abortion, septicemia, gastroenteritis and central nervous system (CNS) infections in ruminants and humans. L. monocytogenes strains mainly belong to two distinct phylogenetic groups, named lineages I and II. In general, clinical cases in humans and animals, in particular CNS infections, are caused by lineage I strains, while most of the environmental and food strains belong to lineage II. Little is known about why lineage I is more virulent than lineage II, even though various molecular factors and mechanisms associated with pathogenesis are known. In this study, we have used a variety of whole genome sequence analyses and comparative genomic tools in order to find characteristics that distinguish lineage I from lineage II strains and CNS infection strains from non-CNS strains. We analyzed 225 strains and identified single nucleotide variants between lineages I and II, as well as differences in the gene content. Using a novel approach based on Reads Per Kilobase per Million Mapped (RPKM), we identified 167 genes predominantly absent in lineage II but present in lineage I. These genes are mostly encoding for membrane-associated proteins. Additionally, we found 77 genes that are largely absent in the non-CNS associated strains, while 39 genes are especially lacking in our defined “non-clinical” group. Based on the RPKM analysis and the metadata linked to the L. monocytogenes strains, we identified 6 genes potentially associated with CNS cases, which include a transcriptional regulator, an ABC transporter and a non-coding RNA. Although there is not a clear separation between pathogenic and non-pathogenic strains based on phylogenetic lineages, the presence of the genes identified in our study reveals potential pathogenesis traits in ruminant L. monocytogenes strains. Ultimately, the differences that we have found in our study will help steer future studies in understanding the virulence mechanisms of the

Survival of Listeria monocytogenes in Soil Requires AgrA-Mediated Regulation.

Science.gov (United States)

Vivant, Anne-Laure; Garmyn, Dominique; Gal, Laurent; Hartmann, Alain; Piveteau, Pascal

2015-08-01

In a recent paper, we demonstrated that inactivation of the Agr system affects the patterns of survival of Listeria monocytogenes (A.-L. Vivant, D. Garmyn, L. Gal, and P. Piveteau, Front Cell Infect Microbiol 4:160, http://dx.doi.org/10.3389/fcimb.2014.00160). In this study, we investigated whether the Agr-mediated response is triggered during adaptation in soil, and we compared survival patterns in a set of 10 soils. The fate of the parental strain L. monocytogenes L9 (a rifampin-resistant mutant of L. monocytogenes EGD-e) and that of a ΔagrA deletion mutant were compared in a collection of 10 soil microcosms. The ΔagrA mutant displayed significantly reduced survival in these biotic soil microcosms, and differential transcriptome analyses showed large alterations of the transcriptome when AgrA was not functional, while the variations in the transcriptomes between the wild type and the ΔagrA deletion mutant were modest under abiotic conditions. Indeed, in biotic soil environments, 578 protein-coding genes and an extensive repertoire of noncoding RNAs (ncRNAs) were differentially transcribed. The transcription of genes coding for proteins involved in cell envelope and cellular processes, including the phosphotransferase system and ABC transporters, and proteins involved in resistance to antimicrobial peptides was affected. Under sterilized soil conditions, the differences were limited to 86 genes and 29 ncRNAs. These results suggest that the response regulator AgrA of the Agr communication system plays important roles during the saprophytic life of L. monocytogenes in soil. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Uncovering Listeria monocytogenes hypervirulence by harnessing its biodiversity

Science.gov (United States)

Charlier, Caroline; Touchon, Marie; Chenal-Francisque, Viviane; Leclercq, Alexandre; Criscuolo, Alexis; Gaultier, Charlotte; Roussel, Sophie; Brisabois, Anne; Disson, Olivier; Rocha, Eduardo P. C.; Brisse, Sylvain; Lecuit, Marc

2016-01-01

Microbial pathogenesis studies are typically performed with reference strains, thereby overlooking microbial intra-species virulence heterogeneity. Here we integrated human epidemiological and clinical data with bacterial population genomics to harness the biodiversity of the model foodborne pathogen Listeria monocytogenes and decipher the basis of its neural and placental tropisms. Taking advantage of the clonal structure of this bacterial species, we identify clones epidemiologically associated with either food or human central nervous system (CNS) and maternal-neonatal (MN) listeriosis. The latter are also most prevalent in patients without immunosuppressive comorbidities. Strikingly, CNS and MN clones are hypervirulent in a humanized mouse model of listeriosis. By integrating epidemiological data and comparative genomics, we uncovered multiple novel putative virulence factors and demonstrated experimentally the contribution of the first gene cluster mediating Listeria monocytogenes neural and placental tropisms. This study illustrates the exceptional power of harnessing microbial biodiversity to identify clinically relevant microbial virulence attributes. PMID:26829754

Depletion of proton motive force by nisin in Listeria monocytogenes cells.

Science.gov (United States)

Bruno, M E; Kaiser, A; Montville, T J

1992-07-01

The basal proton motive force (PMF) levels and the influence of the bacteriocin nisin on the PMF were determined in Listeria monocytogenes Scott A. In the absence of nisin, the interconversion of the pH gradient (Z delta pH) and the membrane potential (delta psi) led to the maintenance of a fairly constant PMF at -160 mV over the external pH range 5.5 to 7.0. The addition of nisin at concentrations of greater than or equal to 5 micrograms/ml completely dissipated PMF in cells at external pH values of 5.5 and 7.0. With 1 microgram of nisin per ml, delta pH was completely dissipated but delta psi decreased only slightly. The action of nisin on PMF in L. monocytogenes Scott A was both time and concentration dependent. Valinomycin depleted only delta pH, whereas nigericin and carbonyl cyanide m-chlorophenylhydrazone depleted only delta psi, under conditions in which nisin depleted both. Four other L. monocytogenes strains had basal PMF parameters similar to those of strain Scott A. Nisin (2.5 micrograms/ml) also completely dissipated PMF in these strains.

Efflux pump-mediated benzalkonium chloride resistance in Listeria monocytogenes isolated from retail food.

Science.gov (United States)

Jiang, Xiaobing; Yu, Tao; Liang, Yu; Ji, Shengdong; Guo, Xiaowei; Ma, Jianmin; Zhou, Lijun

2016-01-18

In this study, efflux pump-mediated benzalkonium chloride (BC) resistance, including plasmid-encoded (Qac protein family and BcrABC) and chromosome-borne efflux pumps, was investigated in Listeria monocytogenes from retail food in China. Among the 59 L. monocytogenes strains, 13 (22.0%) strains were resistant to BC. The PCR results showed that bcrABC was harbored by 2 of 13 BC resistant strains. However, none of the qac genes were detected among the 59 strains. The bcrABC was absent in both of the plasmid cured strains, indicating that this BC resistance determinant was plasmid-encoded in the two bcrABC-positive strains. In the presence of reserpine, most of the bcrABC-negative strains had decreases in the MICs of BC, suggesting the existence of other efflux pumps and their role in BC resistance. After exposed to reserpine, the reduction in BC MICs was observed in the two cured strains, indicating that efflux pumps located on chromosome was also involved in BC resistance. Our findings suggest that food products may act as reservoirs for BC resistant isolates of L. monocytogenes and plasmid- and chromosome-encoded efflux pumps could mediate the BC resistance of L. monocytogenes, which is especially relevant to the adaption of this organism in food-related environments with frequent BC use. Copyright © 2015 Elsevier B.V. All rights reserved.

Modeling the effect of temperature on survival rate of Listeria monocytogenes in yogurt.

Science.gov (United States)

Szczawiński, J; Szczawińska, M E; Łobacz, A; Jackowska-Tracz, A

2016-01-01

The aim of the study was to (i) evaluate the behavior of Listeria monocytogenes in a commercially produced yogurt, (ii) determine the survival/inactivation rates of L. monocytogenes during cold storage of yogurt and (iii) to generate primary and secondary mathematical models to predict the behavior of these bacteria during storage at different temperatures. The samples of yogurt were inoculated with the mixture of three L. monocytogenes strains and stored at 3, 6, 9, 12 and 15°C for 16 days. The number of listeriae was determined after 0, 1, 2, 3, 5, 7, 9, 12, 14 and 16 days of storage. From each sample a series of decimal dilutions were prepared and plated onto ALOA agar (agar for Listeria according to Ottaviani and Agosti). It was found that applied temperature and storage time significantly influenced the survival rate of listeriae (pbacteria was found in the samples stored at 6°C (D-10 value = 243.9 h), whereas the highest reduction in the number of the bacteria was observed in the samples stored at 15°C (D-10 value = 87.0 h). The number of L. monocytogenes was correlated with the pH value of the samples (pyogurt stored under temperature range from 3 to 15°C, however, the polynomial model gave a better fit to the experimental data.

Genotypes Associated with Listeria monocytogenes Isolates Displaying Impaired or Enhanced Tolerances to Cold, Salt, Acid, or Desiccation Stress

DEFF Research Database (Denmark)

Hingston, Patricia A.; Chen, Jessica; Dhillon, Bhavjinder K

2017-01-01

elements. A whole genome single-nucleotide-variants phylogeny revealed sporadic distribution of tolerant isolates and closely related sensitive and tolerant isolates, highlighting that minor genetic differences can influence the stress tolerance of L. monocytogenes. Specifically, a number of cold......The human pathogen Listeria monocytogenes is a large concern in the food industry where its continuous detection in food products has caused a string of recalls in North America and Europe. Most recognized for its ability to grow in foods during refrigerated storage, L. monocytogenes can also...... tolerate several other food-related stresses with some strains possessing higher levels of tolerances than others. The objective of this study was to use a combination of phenotypic analyses and whole genome sequencing to elucidate potential relationships between L. monocytogenes genotypes and food...

Complete genome sequence of Listeria monocytogenes strain MR310, isolated from a pastured-flock poultry farm system

Science.gov (United States)

Investigation of Listeria monocytogenes transmission from environmental sources associated with pasture-raised chickens to poultry products is needed to determine ways to prevent potential foodborne illness. Here, we report the complete genome sequence of Listeria monocytogenes MR310, one of the iso...

Stress Survival Islet 2, Predominantly Present in Listeria monocytogenes Strains of Sequence Type 121, Is Involved in the Alkaline and Oxidative Stress Responses.

Science.gov (United States)

Harter, Eva; Wagner, Eva Maria; Zaiser, Andreas; Halecker, Sabrina; Wagner, Martin; Rychli, Kathrin

2017-08-15

The foodborne pathogen Listeria monocytogenes is able to survive a variety of stress conditions leading to the colonization of different niches like the food processing environment. This study focuses on the hypervariable genetic hot spot lmo0443 to lmo0449 haboring three inserts: the stress survival islet 1 (SSI-1), the single-gene insert LMOf2365_0481 , and two homologous genes of the nonpathogenic species Listeria innocua : lin0464 , coding for a putative transcriptional regulator, and lin0465 , encoding an intracellular PfpI protease. Our prevalence study revealed a different distribution of the inserts between human and food-associated isolates. The lin0464-lin0465 insert was predominantly found in food-associated strains of sequence type 121 (ST121). Functional characterization of this insert showed that the putative PfpI protease Lin0465 is involved in alkaline and oxidative stress responses but not in acidic, gastric, heat, cold, osmotic, and antibiotic stresses. In parallel, deletion of lin0464 decreased survival under alkaline and oxidative stresses. The expression of both genes increased significantly under oxidative stress conditions independently of the alternative sigma factor σ B Furthermore, we showed that the expression of the protease gene lin0465 is regulated by the transcription factor lin0464 under stress conditions, suggesting that lin0464 and lin0465 form a functional unit. In conclusion, we identified a novel stress survival islet 2 (SSI-2), predominantly present in L. monocytogenes ST121 strains, beneficial for survival under alkaline and oxidative stresses, potentially supporting adaptation and persistence of L. monocytogenes in food processing environments. IMPORTANCE Listeria monocytogenes strains of ST121 are known to persist for months and even years in food processing environments, thereby increasing the risk of food contamination and listeriosis. However, the molecular mechanism underlying this remarkable niche-specific adaptation

Listeria monocytogenes strains show large variations in competitive growth in mixed culture biofilms and suspensions with bacteria from food processing environments.

Science.gov (United States)

Heir, Even; Møretrø, Trond; Simensen, Andreas; Langsrud, Solveig

2018-06-20

Interactions and competition between resident bacteria in food processing environments could affect their ability to survive, grow and persist in microhabitats and niches in the food industry. In this study, the competitive ability of L. monocytogenes strains grown together in separate culture mixes with other L. monocytogenes (L. mono mix), L. innocua (Listeria mix), Gram-negative bacteria (Gram- mix) and with a multigenera mix (Listeria + Gram- mix) was investigated in biofilms on stainless steel and in suspensions at 12 °C. The mixed cultures included resident bacteria from processing surfaces in meat and salmon industry represented by L. monocytogenes (n = 6), L. innocua (n = 5) and Gram-negative bacteria (n = 6; Acinetobacter sp., Pseudomonas fragi, Pseudomonas fluorescens, Serratia liquefaciens, Stenotrophomonas maltophilia). Despite hampered in growth in mixed cultures, L. monocytogenes established in biofilms with counts at day nine between 7.3 and 9.0 log per coupon with the lowest counts in the Listeria + G- mix that was dominated by Pseudomonas. Specific L. innocua inhibited growth of L. monocytogenes strains differently; inhibition that was further enhanced by the background Gram-negative microbiota. In these multispecies and multibacteria cultures, the growth competitive effects lead to the dominance of a strong competitor L. monocytogenes strain that was only slightly inhibited by L. innocua and showed strong competitive abilities in mixed cultures with resident Gram-negative bacteria. The results indicates complex patterns of bacterial interactions and L. monocytogenes inhibition in the multibacteria cultures that only partially depend on cell contact and likely involve various antagonistic and bacterial tolerance mechanisms. The study indicates large variations among L. monocytogenes in their competitiveness under multibacterial culture conditions that should be considered in further studies towards understanding of L

Viable-but-Nonculturable Listeria monocytogenes and Salmonella enterica Serovar Thompson Induced by Chlorine Stress Remain Infectious

Directory of Open Access Journals (Sweden)

Callum J. Highmore

2018-04-01

Full Text Available The microbiological safety of fresh produce is monitored almost exclusively by culture-based detection methods. However, bacterial food-borne pathogens are known to enter a viable-but-nonculturable (VBNC state in response to environmental stresses such as chlorine, which is commonly used for fresh produce decontamination. Here, complete VBNC induction of green fluorescent protein-tagged Listeria monocytogenes and Salmonella enterica serovar Thompson was achieved by exposure to 12 and 3 ppm chlorine, respectively. The pathogens were subjected to chlorine washing following incubation on spinach leaves. Culture data revealed that total viable L. monocytogenes and Salmonella Thompson populations became VBNC by 50 and 100 ppm chlorine, respectively, while enumeration by direct viable counting found that chlorine caused a <1-log reduction in viability. The pathogenicity of chlorine-induced VBNC L. monocytogenes and Salmonella Thompson was assessed by using Caenorhabditis elegans. Ingestion of VBNC pathogens by C. elegans resulted in a significant life span reduction (P = 0.0064 and P < 0.0001, and no significant difference between the life span reductions caused by the VBNC and culturable L. monocytogenes treatments was observed. L. monocytogenes was visualized beyond the nematode intestinal lumen, indicating resuscitation and cell invasion. These data emphasize the risk that VBNC food-borne pathogens could pose to public health should they continue to go undetected.

Aggregated particles caused by instrument artifact

Science.gov (United States)

Pierce, Ashley M.; Loría-Salazar, S. Marcela; Arnott, W. Patrick; Edwards, Grant C.; Miller, Matthieu B.; Gustin, Mae S.

2018-04-01

Previous studies have indicated that superaggregates, clusters of aggregates of soot primary particles, can be formed in large-scale turbulent fires. Due to lower effective densities, higher porosity, and lower aerodynamic diameters, superaggregates may pass through inlets designed to remove particles 2.5 µm in aerodynamic diameter were collected on 36 out of 158 sample days. On preliminary analysis, it was thought that these aggregated particles were superaggregates, depositing past PM10 (particles wind speeds, as well as the use of generators on site. Samples with aggregated particles, referred to as aggregates, were analyzed using a scanning electron microscope for size and shape and energy dispersive X-ray spectroscopy was used for elemental analysis. It was determined, based on the high amounts of aluminum present in the aggregate samples, that a sampling artifact associated with the sample inlet and prolonged, high wind events was the probable reason for the observed aggregates.

Product Aggregation Bias as a Specification Error in Demand Systems

OpenAIRE

George C. Davis

1997-01-01

Inherent in all demand studies is some form of product aggregation which can lead to product aggregation bias. This article develops a simple procedure for incorporating product aggregation bias in demand systems that permits testing of product aggregation bias with a standard likelihood ratio test. An empirical illustration of the procedure demonstrates the importance of proper product aggregation. Copyright 1997, Oxford University Press.

Pathogenic potential of Listeria monocytogenes isolated from cattle ...

African Journals Online (AJOL)

Listeria monocytogenes is an opportunistic food-borne pathogen causing listeriosis especially among immune-compromised persons. Its high rate of morbidity and mortality has classed the organism among the top watch list in foods. It is known to produce several virulence factors which aid its survival in harsh conditions ...

Incidence of Listeria monocytogenes and Other Bacteria in ...

African Journals Online (AJOL)

The involvement of Listeria monocytogenes in spontaneous abortion in Jos was investigated. One hundred blood and 100 placenta samples were collected from spontaneous abortion patients in Jos. The samples were inoculated first into Listeria enrichment broth. Incubation was at 37o C, followed by cold enrichment at ...

Prevalence and antibiotic susceptibility of Listeria monocytogenes in ...

African Journals Online (AJOL)

One hundred and ninety two raw milk samples were collected from lactating cows identified in Fulani herds and small scale dairy farms within Sokoto metropolis in order to investigate the presence and determine the antibiotic susceptibility of Listeria monocytogenes in the milk. Selective culture and identification method ...

Listeria monocytogenes meningitis in the Netherlands, 1985-2014: A nationwide surveillance study.

Science.gov (United States)

Koopmans, Merel M; Bijlsma, Merijn W; Brouwer, Matthijs C; van de Beek, Diederik; van der Ende, Arie

2017-07-01

Listeria monocytogenes can cause sepsis and meningitis. We report national surveillance data on L. monocytogenes meningitis in the Netherlands, describing incidence changes, genetic epidemiology and fatality rate. We analyzed data from the Netherlands Reference Laboratory of Bacterial Meningitis for cases of L. monocytogenes meningitis. Strains were assessed by serotyping and bacterial population structure by multi-locus sequence typing. A total of 375 cases of Listeria meningitis were identified between 1985 and 2014. Peak incidence rates were observed in neonates (0.61 per 100,000 live births) and older adults (peak at 87 year; 0.53 cases per 100,000 population of the same age). Neonatal listerial meningitis decreased 17-fold from 1.95 per 100,000 live births between 1985 and 1989, to 0.11 per 100,000 live births between 2010 and 2014. Overall case fatality rate was 31%, in a multivariate analysis older age and concomitant bacteremia were associated with mortality (both p listeria meningitis has remained high. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

Listeria spp. E Listeria monocytogenes NA PRODUÇÃO DE SALSICHAS TIPO HOT DOG

Directory of Open Access Journals (Sweden)

ALESSANDRA PARO RODRIGUES CESAR

2011-06-01

Full Text Available Listeria monocytogenes is widely distributed in the environment and it has been isolated from food that were associated to outbreaks of high lethality in many countries. Thus, this bacterium represents an important pathogen to the public health. Ready-to-eat products, likecooked stuffed food, within them, frankfurters, are associated to human listeriosis in many countries. Taking into consideration the importance of the subject and the need of more data about it, the occurrence of Listeria spp. and L. monocytogenes in industrial plants, in meat raw materials, in slurry and frankfurters was investigated.These samples were collected in two production plants with SIF (Federal Inspection Service; in one of them GMP, HACCP and SOP were implemented. The results of the 1 06 microbiological analysis were submitted to the program @Risk to obtain the risk analysis; the meanvalues results showed that 7 to 9% of the frankfurters in the market may have L. monocytogenes. The analysis indicated that 88 strains of L. monocytogenes were obtained from 1 06 samples; among them, 76 werecollected in the industrial plants that participate in the experiment, and 30 were collected in the market. In serological typification, 95% of these strains were classified as serotypes 4b, 1 /2a and 1 /2b. Besides the presence of the bacterium in frankfurthers consumed inBrazil and the risk factors associated to this pathogen, the situation concerns because of the lack of epidemiological data, absence of patterns and the deficient information given to the consumer, specially information related to the presence of L. monocytogenes, particularly important to the groups at risk, as well as information related to the importance of heating the product

Prevalence and populations of Listeria monocytogenes in meat products retailed in Sao Paulo, Brazil.

Science.gov (United States)

Ristori, Christiane Asturiano; Rowlands, Ruth Estela Gravato; Martins, Cecília Geraldes; Barbosa, Maria Luisa; Yoshida, Júlia T U; Franco, Bernadette D G de Melo

2014-12-01

This study evaluated the prevalence of the populations and serotypes of Listeria monocytogenes in 552 refrigerated samples of ground beef, chicken leg, hot dog, and pork sausage collected in supermarkets in the city of Sao Paulo, SP, Brazil, between May 2008 and July 2009. The supermarkets were selected after stratification by geographical region and by random draw. Tests for presence and enumeration of L. monocytogenes were based on ISO 11290-1:1996/Amd.1:2004 and ISO 11290-2:1998 methods, respectively. Listeria spp. were detected in 469 (85.0%) of the studied meat products. The most frequently isolated species was L. innocua (64.1%), followed by L. monocytogenes (48.7%), L. welshimeri (13.4%), L. seeligeri (7.1%), L. ivanovii (0.2%), and L. grayi subspecies murrayi (0.2%). L. monocytogenes was detected in 269 (48.7%) samples, with highest prevalence in ground beef (59.4%) followed by chicken legs (58.0%), pork sausages (39.8%), and hot dogs (37.7%). The populations were Prevalence of serotypes varied according to the type of meat product. These data are relevant for estimating the risks of listeriosis associated with consumption of meat products in Sao Paulo, and for establishing science-based intervention strategies aimed at reducing these risks, especially for pregnant women and immunocompromised individuals.

A Dual Microscopy-Based Assay To Assess Listeria monocytogenes Cellular Entry and Vacuolar Escape.

Science.gov (United States)

Quereda, Juan J; Pizarro-Cerdá, Javier; Balestrino, Damien; Bobard, Alexandre; Danckaert, Anne; Aulner, Nathalie; Shorte, Spencer; Enninga, Jost; Cossart, Pascale

2016-01-01

Listeria monocytogenes is a Gram-positive bacterium and a facultative intracellular pathogen that invades mammalian cells, disrupts its internalization vacuole, and proliferates in the host cell cytoplasm. Here, we describe a novel image-based microscopy assay that allows discrimination between cellular entry and vacuolar escape, enabling high-content screening to identify factors specifically involved in these two steps. We first generated L. monocytogenes and Listeria innocua strains expressing a β-lactamase covalently attached to the bacterial cell wall. These strains were then incubated with HeLa cells containing the Förster resonance energy transfer (FRET) probe CCF4 in their cytoplasm. The CCF4 probe was cleaved by the bacterial surface β-lactamase only in cells inoculated with L. monocytogenes but not those inoculated with L. innocua, thereby demonstrating bacterial access to the host cytoplasm. Subsequently, we performed differential immunofluorescence staining to distinguish extracellular versus total bacterial populations in samples that were also analyzed by the FRET-based assay. With this two-step analysis, bacterial entry can be distinguished from vacuolar rupture in a single experiment. Our novel approach represents a powerful tool for identifying factors that determine the intracellular niche of L. monocytogenes. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Sublethal injury and virulence changes in Listeria monocytogenes and Listeria innocua treated with antimicrobials carvacrol and citral.

Science.gov (United States)

Silva, A; Genovés, S; Martorell, P; Zanini, S F; Rodrigo, D; Martinez, A

2015-09-01

The aim of this study was to evaluate the effect of two antimicrobial substances, carvacrol and citral, on Listeria monocytogenes and Listeria innocua cells, as well as possible virulence changes in injured cells, using Caenorhabditis elegans as a model test. The results indicated that the percentage of sublethal damage was higher in L. monocytogenes than in L. innocua. The results of the study carried out by using C. elegans indicated that C. elegans fed in a lawn of L. monocytogenes previously treated with carvacrol showed a loss in life span (p ≤ 0.05) as compared with L. monocytogenes treated with citral, Escherichia coli OP50 as a negative control, and treated and untreated L. innocua. Egg laying was also affected: worms fed in a lawn of treated and untreated L. monocytogenes laid fewer eggs than those fed in a lawn of treated and untreated L. innocua or fed with OP50 as a negative control. Worms fed in a lawn of treated and untreated L. innocua also laid fewer eggs than those fed with OP50 as a negative control. A phenotype named bag of worms and an undescribed new one, "vulva inflammation", were also observed. Copyright © 2015 Elsevier Ltd. All rights reserved.

Growth hormone aggregates in the rat adenohypophysis

Science.gov (United States)

Farrington, M.; Hymer, W. C.

1990-01-01

Although it has been known for some time that GH aggregates are contained within the rat anterior pituitary gland, the role that they might play in pituitary function is unknown. The present study examines this issue using the technique of Western blotting, which permitted visualization of 11 GH variants with apparent mol wt ranging from 14-88K. Electroelution of the higher mol wt variants from gels followed by their chemical reduction with beta-mercaptoethanol increased GH immunoassayability by about 5-fold. With the blot procedure we found 1) that GH aggregates greater than 44K were associated with a 40,000 x g sedimentable fraction; 2) that GH aggregates were not present in glands from thyroidectomized rats, but were in glands from the thyroidectomized rats injected with T4; 3) that GH aggregates were uniquely associated with a heavily granulated somatotroph subpopulation isolated by density gradient centrifugation; and 4) that high mol wt GH forms were released from the dense somatotrophs in culture, since treatment of the culture medium with beta-mercaptoethanol increased GH immunoassayability by about 5-fold. Taken together, the results show that high mol wt GH aggregates are contained in secretory granules of certain somatotrophs and are also released in aggregate form from these cells in vitro.

Characterization of fine aggregates in concrete by different experimental approaches

OpenAIRE

He, Huan; Courard, Luc; Pirard, Eric; Michel, Frédéric

2011-01-01

Being its major component, aggregate can occupy up to three-quarter of the volume of concrete. The structure of aggregate formed in hardened state impacts largely on mechanical and durability properties of concrete. On another hand, physical characteristics of aggregate are primarily assumed to be relevant to granular behavior of aggregate. Therefore, characterization of aggregate is of high relevance to concrete studies. In this study, different types of fine aggregate used in concrete, name...

Role of initial contamination levels, biofilm maturity and presence of salt and fat on desiccation survival of Listeria monocytogenes on stainless steel surfaces.

Science.gov (United States)

Hingston, Patricia A; Stea, Emma C; Knøchel, Susanne; Hansen, Truelstrup

2013-10-01

This study investigated the effect of initial contamination levels, biofilm maturity and presence of salt and fatty food soils on desiccation survival of Listeria monocytogenes on stainless steel (SS) coupons. L. monocytogenes cultures grown (at 15 °C for 48 h) in Tryptic Soy Broth with 1% glucose (TSB-glu) containing either 0.5 or 5% (w/v) NaCl were re-suspended in TSB-glu containing either 0.5 or 5% NaCl and used to contaminate SS coupons at levels of 3.5, 5.5, and 7.5 log CFU/cm². Desiccation (at 15 °C for 20 days, 43% RH) commenced immediately (non-biofilm) or following biofilm formation (at 15 °C for 48 h, 100% RH). To study the impact of food lipids, non-biofilm L. monocytogenes cells were suspended in TSB-glu containing either canola oil (5-10%) or lard (20-60%) and desiccated as above on SS coupons. Following desiccation for 20 days, survivors decreased by 1.4-3.7 log CFU/cm² for non-biofilm L. monocytogenes cells. The contamination level had no significant (p > 0.05) effect on survival kinetics. SEM micrographs showed mature biofilms on coupons initially contaminated with 5.5 and 7.5 log CFU/cm². Mature biofilm cells were significantly (p biofilms formed by the lowest contamination level. Besides biofilm maturity/formation, previous osmoadaptation, exposure to lard (20-60%) or salt (5%) during desiccation significantly (p biofilms and salty or fatty soils on food contact surfaces. Copyright © 2013 Elsevier Ltd. All rights reserved.

The capacity of Listeria monocytogenes mutants with in-frame deletions in putative ATP-binding cassette transporters to form biofilms and comparison with the wild type

Directory of Open Access Journals (Sweden)

Marina Ceruso

2014-02-01

Full Text Available Listeria monocytogenes (Lm is a food-borne pathogen responsible for human listeriosis, an invasive infection with high mortality rates. Lm has developed efficient strategies for survival under stress conditions such as starvation and wide variations in temperature, pH, and osmolarity. Therefore, Lm can survive in food under multiple stress conditions. Detailed studies to determine the mode of action of this pathogen for survival under stress conditions are important to control Lm in food. It has been shown that genes encoding for ATP-binding cassette (ABC transporters are induced in Lm in food, in particular under stress conditions. Previous studies showed that these genes are involved in sensitivity to nisin, acids, and salt. The aim of this study was to determine the involvement of some ABC transporters in biofilm formation. Therefore, deletion mutants of ABC transporter genes (LMOf2365_1875 and LMOf2365_1877 were created in Lm F2365, and then were compared to the wild type for their capacity to form biofilms. Lm strain F2365 was chosen as reference since the genome is fully sequenced and furthermore this strain is particularly involved in food-borne outbreaks of listeriosis. Our results showed that DLMOf2365_1875 had an increased capacity to form biofilms compared to the wild type, indicating that LMOf2365_1875 negatively regulates biofilm formation. A deeper knowledge on the ability to form biofilms in these mutants may help in the development of intervention strategies to control Lm in food and in the environment.

Isolation and detection of Listeria monocytogenes in poultry meat by standard culture methods and PCR

Science.gov (United States)

Kureljušić, J.; Rokvić, N.; Jezdimirović, N.; Kureljušić, B.; Pisinov, B.; Karabasil, N.

2017-09-01

Listeria is the genus of a bacteria found in soil and water and some animals, including poultry and cattle. It can be present in raw milk and food made from raw milk. It can also live in food processing plants and contaminate a variety of processed meats. Microscopically, Listeria species appear as small, Gram-positive rods, which are sometimes arranged in short chains. In direct smears, they can be coccoid, so they can be mistaken for streptococci. Longer cells can resemble corynebacteria. Flagella are produced at room temperature but not at 37°C. Haemolytic activity on blood agar has been used as a marker to distinguish Listeria monocytogenes among other Listeria species, but it is not an absolutely definitive criterion. Further biochemical characterization is necessary to distinguish between the different Listeria species. The objective of this study was to detect, isolate and identify Listeria monocytogenes from poultry meat. Within a period of six months from January to June 2017, a total of 15 samples were collected. Three samples were positive for the presence of Listeria monocytogenes. Biochemical and microbiological tests as well as PCR technique using specific primers were used to confirm L. Monocytogenes in the samples.

Phenotypic and Genotypic Characterization of Atypical Listeria monocytogenes and Listeria innocua Isolated from Swine Slaughterhouses and Meat Markets

Directory of Open Access Journals (Sweden)

Luisa Zanolli Moreno

2014-01-01

Full Text Available In the last decade, atypical Listeria monocytogenes and L. innocua strains have been detected in food and the environment. Because of mutations in the major virulence genes, these strains have different virulence intensities in eukaryotic cells. In this study, we performed phenotypic and genotypic characterization of atypical L. monocytogenes and L. innocua isolates obtained from swine slaughterhouses and meat markets. Forty strains were studied, including isolates of L. monocytogenes and L. innocua with low-hemolytic activity. The isolates were characterized using conventional phenotypic Listeria identification tests and by the detection and analysis of L. monocytogenes-specific genes. Analysis of 16S rRNA was used for the molecular identification of the Listeria species. The L. monocytogenes isolates were positive for all of the virulence genes studied. The atypical L. innocua strains were positive for hly, plcA, and inlC. Mutations in the InlC, InlB, InlA, PI-PLC, PC-PLC, and PrfA proteins were detected in the atypical isolates. Further in vitro and transcriptomic studies are being developed to confirm the role of these mutations in Listeria virulence.

Listeria monocytogenes-carrying consortia in food industry. Composition, subtyping and numerical characterisation of mono-species biofilm dynamics on stainless steel.

Science.gov (United States)

Rodríguez-López, Pedro; Saá-Ibusquiza, Paula; Mosquera-Fernández, Maruxa; López-Cabo, Marta

2015-08-03

In order to find out how real Listeria monocytogenes-carrying biofilms are in industrial settings, a total of 270 environmental samples belonging to work surfaces from fish (n = 123), meat (n = 75) and dairy industries (n = 72) were analysed in order to detect L. monocytogenes. 12 samples were positive for L. monocytogenes and a total of 18 different species were identified as accompanying microbiota in fish and meat industry. No L. monocytogenes was found in samples from dairy industry. Molecular characterisation combining results of AscI and ApaI macrorestriction PFGE assays yielded 7 different subtypes of L. monocytogenes sharing in 71.43% of cases the same serogroup (1/2a-3a). Results from dynamic numerical characterisation between L. monocytogenes monospecies biofilms on stainless steel (SS) using MATLAB-based tool BIOFILMDIVER demonstrated that except in isolate A1, in which a significant increase in the percentage of covered area (CA), average diffusion distance (ADD) and maximum diffusion distance (MDD) was observed after 120 h of culture, no significant differences were observed in the dynamics of the rest of the L. monocytogenes isolates. Quantitative dual-species biofilm association experiments performed on SS indicated that L. monocytogenes cell counts presented lower values in mixed-species cultures with certain species at 24 and 48 h compared with mono-species culture. However, they remained unaltered after 72 h except when co-cultured with Serratia fonticola which presented differences in all sampling times and was also the dominant species within the dual-species biofilm. When considering frequency of appearance of accompanying species, an ecological distribution was demonstrated as Escherichia coli appeared to be the most abundant in fish industry and Carnobacterium spp. in meat industry. Copyright © 2015 Elsevier B.V. All rights reserved.

Different transcriptional responses from slow and fast growth rate strains of Listeria monocytogenes adapted to low temperature

Directory of Open Access Journals (Sweden)

Ninoska eCordero

2016-03-01

Full Text Available Listeria monocytogenes has become one of the principal foodborne pathogens worldwide. The capacity of this bacterium to grow at low temperatures has opened an interesting field of study in terms of the identification and classification of new strains of L. monocytogenes with different growth capacities at low temperatures. We determined the growth rate at 8 ºC of 110 strains of L. monocytogenes isolated from different food matrices. We identified a group of slow and fast strains according to their growth rate at 8 °C and performed a global transcriptomic assay in strains previously adapted to low temperature. We then identified shared and specific transcriptional mechanisms, metabolic and cellular processes of both groups; bacterial motility was the principal process capable of differentiating the adaptation capacity of L. monocytogenes strains with different ranges of tolerance to low temperatures. Strains belonging to the fast group were less motile, which may allow these strains to achieve a greater rate of proliferation at low temperature.

Effects of irradiation on bacterial load and Listeria monocytogenes in raw chicken

International Nuclear Information System (INIS)

Varabioff, Y.; Mitchell, G.E.; Nottingham, S.M.

1992-01-01

After irradiation of chickens to a dose of 2.5 kGy, the decrease in the standard plate count (SPC) was similar in air and in vacuum-packaged chickens. During storage at 4 degrees C for 15 d, the SPC increased progressively in both types of packaged chickens. At the end of the storage period, the SPC was higher in air-packaged chicken than in vacuum-packaged chickens. In irradiated chickens, Listeria monocytogenes was only recovered from the vacuum-packaged chickens after 7 d cold storage. In unirradiated chickens, L. monocytogenes proliferated similarly in both air- and vacuum-packaged chickens

Effect of pulmonary irradiation from inhaled 90Y on immunity to Listeria monocytogenes in mice

International Nuclear Information System (INIS)

Sanchez, A.; Lundgren, D.L.; McClellan, R.O.

1976-01-01

The immunological response of mice subjected to irradiation from particles deposited in the lungs and challenged with Listeria monocytogenes was investigated. Mice, exposed by inhalation to 90 Y (a beta-emitting radionuclide) in relatively insoluble fused aluminosilicate particles, were immunized with L. monocytogenes either before or after exposure. Two additional groups of mice were either immunized or irradiated only. A group of control mice received no irradiation or immunization. The beta radiation dose absorbed by the lungs of each mouse at time of challenge averaged 10,000 rads. Fourteen days after immunization, all mice were challenged with 2 LD 50 doses of L. monocytogenes via the respiratory route. Survival of all immunized mice either with or without exposure to 90 Y varied from 90 to 100% as compared to 10 to 20% for the mice irradiated only and for control mice through 14 days after challenge. Pulmonary clearance of inhaled L. monocytogenes during the first 4 hr after challenge was suppressed in the mice irradiated only but not in those immunized only, or in the immunized and irradiated groups, and control mice. There appeared to be a suppression of proliferation of L. monocytogenes in lungs and spleen in the immunized groups 72 hr after challenge, whereas the lungs and spleens of the mice irradiated only and the control mice had extensive bacterial invasion. It was concluded that the 10,000 rads of beta radiation absorbed by the lungs did not suppress the immune mechanisms of the immunized mice

Essential oils of thyme and Rosemary in the control of Listeria monocytogenes in raw beef

Directory of Open Access Journals (Sweden)

Maíra Maciel Mattos de Oliveira

2013-12-01

Full Text Available This study was developed in order to evaluate two alternatives for the control of Listeria monocytogenes in raw bovine meat pieces, both based on the use of Thymus vulgaris and Rosmarinus officinalis essential oils (EOs. The antilisterial activity of different concentrations of the EOs was tested in vitro using agar dilution and disk volatilization techniques. In addition, L. monocytogenes was inoculated in meat pieces, which were submerged in edible gelatin coatings containing 2% (v/v EOs or submitted to the vapor of EOs (0.74 μL.cm-3. L. monocytogenes was quantified after one, 48 and 96 hours of storage (7 °C. In the in vitro tests, the EO of T. vulgaris presented higher activity. The two options used (edible gelatin coating and vapor activity, in spite of exercising effects with differentiated behaviors, presented antibacterial activity against L. monocytogenes inoculated in raw bovine meat (p < 0.05. Greatest antibacterial activity were obtained in the experiment that used edible coatings containing EOs, at 48 hours of storage reductions in bacterial counts between 1.09 and 1.25 Log CFU.g-1 were obtained. In the vapor effect experiment, the EO of T. vulgaris caused the highest reduction in the population of bacteria inoculated in raw bovine meat (p < 0.05, 0.40 Log CFU.g-1 at 96 hours of storage. This study supplied important information regarding new and promising natural alternatives, based on the concept of active packaging, for the control of L. monocytogenes in the meat industry.

Microbial diversity and structure are drivers of the biological barrier effect against Listeria monocytogenes in soil.

Science.gov (United States)

Vivant, Anne-Laure; Garmyn, Dominique; Maron, Pierre-Alain; Nowak, Virginie; Piveteau, Pascal

2013-01-01

Understanding the ecology of pathogenic organisms is important in order to monitor their transmission in the environment and the related health hazards. We investigated the relationship between soil microbial diversity and the barrier effect against Listeria monocytogenes invasion. By using a dilution-to-extinction approach, we analysed the consequence of eroding microbial diversity on L. monocytogenes population dynamics under standardised conditions of abiotic parameters and microbial abundance in soil microcosms. We demonstrated that highly diverse soil microbial communities act as a biological barrier against L. monocytogenes invasion and that phylogenetic composition of the community also has to be considered. This suggests that erosion of diversity may have damaging effects regarding circulation of pathogenic microorganisms in the environment.

Use of results of microbiological analyses for risk-based control of Listeria monocytogenes in marinated broiler legs.

Science.gov (United States)

Aarnisalo, Kaarina; Vihavainen, Elina; Rantala, Leila; Maijala, Riitta; Suihko, Maija-Liisa; Hielm, Sebastian; Tuominen, Pirkko; Ranta, Jukka; Raaska, Laura

2008-02-10

Microbial risk assessment provides a means of estimating consumer risks associated with food products. The methods can also be applied at the plant level. In this study results of microbiological analyses were used to develop a robust single plant level risk assessment. Furthermore, the prevalence and numbers of Listeria monocytogenes in marinated broiler legs in Finland were estimated. These estimates were based on information on the prevalence, numbers and genotypes of L. monocytogenes in 186 marinated broiler legs from 41 retail stores. The products were from three main Finnish producers, which produce 90% of all marinated broiler legs sold in Finland. The prevalence and numbers of L. monocytogenes were estimated by Monte Carlo simulation using WinBUGS, but the model is applicable to any software featuring standard probability distributions. The estimated mean annual number of L. monocytogenes-positive broiler legs sold in Finland was 7.2x10(6) with a 95% credible interval (CI) 6.7x10(6)-7.7x10(6). That would be 34%+/-1% of the marinated broiler legs sold in Finland. The mean number of L. monocytogenes in marinated broiler legs estimated at the sell-by-date was 2 CFU/g, with a 95% CI of 0-14 CFU/g. Producer-specific L. monocytogenes strains were recovered from the products throughout the year, which emphasizes the importance of characterizing the isolates and identifying strains that may cause problems as part of risk assessment studies. As the levels of L. monocytogenes were low, the risk of acquiring listeriosis from these products proved to be insignificant. Consequently there was no need for a thorough national level risk assessment. However, an approach using worst-case and average point estimates was applied to produce an example of single producer level risk assessment based on limited data. This assessment also indicated that the risk from these products was low. The risk-based approach presented in this work can provide estimation of public health risk

Discrete stochastic charging of aggregate grains

Science.gov (United States)

Matthews, Lorin S.; Shotorban, Babak; Hyde, Truell W.

2018-05-01

Dust particles immersed in a plasma environment become charged through the collection of electrons and ions at random times, causing the dust charge to fluctuate about an equilibrium value. Small grains (with radii less than 1 μm) or grains in a tenuous plasma environment are sensitive to single additions of electrons or ions. Here we present a numerical model that allows examination of discrete stochastic charge fluctuations on the surface of aggregate grains and determines the effect of these fluctuations on the dynamics of grain aggregation. We show that the mean and standard deviation of charge on aggregate grains follow the same trends as those predicted for spheres having an equivalent radius, though aggregates exhibit larger variations from the predicted values. In some plasma environments, these charge fluctuations occur on timescales which are relevant for dynamics of aggregate growth. Coupled dynamics and charging models show that charge fluctuations tend to produce aggregates which are much more linear or filamentary than aggregates formed in an environment where the charge is stationary.

Inhibition effect of tea tree oil on Listeria monocytogenes growth and exotoxin proteins listeriolysin O and p60 secretion.

Science.gov (United States)

Liu, Z; Meng, R; Zhao, X; Shi, C; Zhang, X; Zhang, Y; Guo, N

2016-12-01

Listeria monocytogenes (L. monocytogenes) is a Gram-positive bacterium that causes infections in humans. In this study, the effects of tea tree oil (TTO) at subinhibitory concentrations on L. monocytogenes growth and two important exotoxin proteins secreted by L. monocytogenes were researched. Treatment with half of minimal inhibitory concentration of TTO demonstrated very little or no reduction in numbers of viable ATCC 19115 cells. Listeriolysin O (LLO) and p60, were investigated. A listeriolysin assay was used to investigate the hemolytic activities of L. monocytogenes exposed to TTO, and the secretion of LLO and p60 was detected by immunoblot analysis. Additionally, real-time RT-PCR was used to analyse the influence of TTO on the transcription of LLO and p60 encoded genes hly and iap respectively. According to our experimental results, we propose that TTO could be used as a promising natural compound against L. monocytogenes and its virulence factors. This is the first report on the influence of subinhibitory concentrations of tea tree oil (TTO) on the secretion of listeriolysin O (LLO) and p60, the critical virulence factors involved in Listeria pathogenesis. The results showed that TTO at 0·25 mg ml -1 reduced the secretion of LLO and p60 to 10 and 34·9% respectively, in addtion, the transcription of hly and iap was reduced to 10 and 4·3% at 0·5 mg ml -1 respectively. We propose that TTO could be used as a promising antimicrobial compound and virulence inhibitor against L. monocytogenes. © 2016 The Society for Applied Microbiology.

Genomic presence of gadD1 glutamate decarboxylase correlates with the organization of ascB-dapE internalin cluster in Listeria monocytogenes.

Science.gov (United States)

Chen, Jianshun; Fang, Chun; Zheng, Tianlun; Zhu, Ningyu; Bei, Yijiang; Fang, Weihuan

2012-02-01

The ability to survive and proliferate in acidic environments is a prerequisite for the infection of Listeria monocytogenes. The glutamate decarboxylase (GAD) system is responsible for acid resistance, and three GAD homologs have been identified in L. monocytogenes: gadD1, gadD2, and gadD3. To examine whether GAD genes are specific to lineage, serovar, or certain subpopulation, we performed a systematic investigation on the prevalence of GAD genes in 164 L. monocytogenes. In contrast to gadD2 and gadD3 conserved in all L. monocytogenes strains, gadD1 was identified in 36.6% (60/164) of L. monocytogenes strains, including all serovar 1/2c and 68.5% (37/54) of serovar 1/2a strains, as well as a small fraction of serovar 1/2b (3.4%, 1/29) and lineage III (13.8%, 4/29) strains. All serovar 4b and lineage IV strains lacked this gene. According to the ascB-dapE structure, L. monocytogenes strains were classified into four subpopulations, carrying inlC2DE, inlGC2DE, inlGHE, or no internalin cluster, respectively. All L. monocytogenes strains with inlGC2DE or inlGHE pattern harbored gadD1, whereas those bearing inlC2DE or no internalin cluster between ascB and dapE lacked gadD1. In addition, other five non-monocytogenes Listeria species lacking ascB-dapE internalin cluster were gadD1-negative. Overall, the presence of gadD1 is not fully dependent on lineages or serovars but correlates with ascB-dapE internalin profiles, suggesting gadD1 might have co-evolved with the ascB-dapE internalin cluster in the primitive L. monocytogenes before divergence of serovars.

The effect of milk components and storage conditions on the virulence of Listeria monocytogenes as determined by a Caco-2 cell assay.

Science.gov (United States)

Pricope-Ciolacu, Luminita; Nicolau, Anca Ioana; Wagner, Martin; Rychli, Kathrin

2013-08-16

Nearly all cases of human listeriosis have been associated with consumption of contaminated food, therefore the investigation of the virulence of Listeria (L.) monocytogenes after exposure to environmental conditions in food matrices is critical in order to understand and control its impact on public health. As milk and dairy products have been implicated in more than half of the listeriosis outbreaks, we investigated the in vitro virulence of L. monocytogenes incubated in different milk types at various storage conditions. Incubation in pasteurized milk at refrigeration conditions (4°C) revealed a higher invasion and intracellular proliferation of four different L. monocytogenes strains compared to raw milk using human intestinal epithelial Caco-2 cells. Furthermore the period of storage, which increased L. monocytogenes cell numbers, decreased in vitro virulence. However, L. monocytogenes stored for 3weeks at 4°C in milk are still able to invade and proliferate into the host cell. Interestingly abused storage temperatures (25°C and 30°C) for a short time period (2h) revealed an attenuated impact on the in vitro virulence of L. monocytogenes compared to the storage temperature of 4°C. Regarding the major milk compounds, the level of milk fat significantly affected the in vitro virulence of L. monocytogenes. Pre-incubation in milk with high fat content (3.6%) resulted in a lower invasion capability compared to milk with low fat content. In contrast casein and lactose did not influence the invasiveness of L. monocytogenes into the host cell. In conclusion our study shows that the milk environment and different storage conditions influence the in vitro virulence of L. monocytogenes, both of which have to be considered in the risk assessment of contaminated food. Copyright © 2013 Elsevier B.V. All rights reserved.

Effect of Listeria monocytogenes inoculation, sodium acetate and ...

African Journals Online (AJOL)

Jane

2011-08-08

Aug 8, 2011 ... monocytogenes has been isolated from surface fresh waters and ... been reported that contamination of aquatic products with ..... In fish sausage treated with nisin, the peroxide value was lower in comparison with that of control (Raju et al., 2003). TBA assay is usually used as indicator for the assessment of.

Listeria monocytogenes CadC Regulates Cadmium Efflux and Fine-tunes Lipoprotein Localization to Escape the Host Immune Response and Promote Infection.

Science.gov (United States)

Pombinho, Rita; Camejo, Ana; Vieira, Ana; Reis, Olga; Carvalho, Filipe; Almeida, Maria Teresa; Pinheiro, Jorge Campos; Sousa, Sandra; Cabanes, Didier

2017-05-01

Listeria monocytogenes is a major intracellular human foodborne bacterial pathogen. We previously revealed L. monocytogenes cadC as highly expressed during mouse infection. Here we show that L. monocytogenes CadC is a sequence-specific, DNA-binding and cadmium-dependent regulator of CadA, an efflux pump conferring cadmium resistance. CadC but not CadA is required for L. monocytogenes infection in vivo. Interestingly, CadC also directly represses lspB, a gene encoding a lipoprotein signal peptidase whose expression appears detrimental for infection. lspB overexpression promotes the release of the LpeA lipoprotein to the extracellular medium, inducing tumor necrosis factor α and interleukin 6 expression, thus impairing L. monocytogenes survival in macrophages. We propose that L. monocytogenes uses CadC to repress lspB expression during infection to avoid LpeA exposure to the host immune system, diminishing inflammatory cytokine expression and promoting intramacrophagic survival and virulence. CadC appears as the first metal efflux pump regulator repurposed during infection to fine-tune lipoprotein processing and host responses. © The Author 2017. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail: journals.permissions@oup.com.

Listeria monocytogenes incidence changes and diversity in some Brazilian dairy industries and retail products

DEFF Research Database (Denmark)

Oxaran, Virginie; In Lee, Sarah Hwa; Chaul, Luiza Toubas

2017-01-01

the incidence of L. monocytogenes in five dairies and retail products in the Southeast and Midwest regions of Brazil over eight months. Of 437 samples, three samples (0.7%) from retail and only one sample (0.2%) from the dairies were positive for L. monocytogenes. Thus, the contamination rate was significantly...... reduced as compared to previous studies. MultiLocus Sequence Typing (MLST) was used to determine if contamination was caused by new or persistent clones leading to the first MLST profile of L. monocytogenes from the Brazilian dairy industry. The processing environment isolate is of concern being...... a sequence-type (ST) 2, belonging to the lineage I responsible for the majority of listeriosis outbreaks. Also, ST3 and ST8 found in commercialized cheese have previously been reported in outbreaks. Despite the lower incidence, dairy products still pose a potential health risk and the occurrence of L...

Infectious Dose of Listeria monocytogenes in Outbreak Linked to Ice Cream, United States, 2015.

Science.gov (United States)

Pouillot, Régis; Klontz, Karl C; Chen, Yi; Burall, Laurel S; Macarisin, Dumitru; Doyle, Matthew; Bally, Kären M; Strain, Errol; Datta, Atin R; Hammack, Thomas S; Van Doren, Jane M

2016-12-01

The relationship between the number of ingested Listeria monocytogenes cells in food and the likelihood of developing listeriosis is not well understood. Data from an outbreak of listeriosis linked to milkshakes made from ice cream produced in 1 factory showed that contaminated products were distributed widely to the public without any reported cases, except for 4 cases of severe illness in persons who were highly susceptible. The ingestion of high doses of L. monocytogenes by these patients infected through milkshakes was unlikely if possible additional contamination associated with the preparation of the milkshake is ruled out. This outbreak illustrated that the vast majority of the population did not become ill after ingesting a low level of L. monocytogenes but raises the question of listeriosis cases in highly susceptible persons after distribution of low-level contaminated products that did not support the growth of this pathogen.

Characterization of virulent Listeria monocytogenes isolates recovered from ready-to-eat meat products and consumers in Cairo, Egypt

Directory of Open Access Journals (Sweden)

Maysa A. I. Awadallah

2014-10-01

Full Text Available Aim: This study aimed to investigate the occurrence of some virulence genes distributed in Listeria monocytogenes isolated from ready-to-eat (RTE meat products and consumers in Cairo province, Egypt. Materials and Methods: A total of 120 beef luncheon, chicken luncheon and frankfurter beef (40 samples, each were collected from 10 different local shops situated in Al-salam city, Cairo province, Egypt. Stool samples were collected from 40 people who had the habit of consuming RTE meat. The suspected L. monocytogenes isolates were subjected to a multiplex polymerase chain reaction (PCR for rapid speciation and virulence determination using primers specific for inIA, inIC, and inIJ genes. Results: Culture examination of all samples on Oxford media revealed presence of colonies characteristic to L. monocytogenes in 6 beef luncheon (15%, 4 chicken luncheon (10%, 1 frankfurter beef (2.5% and 1 human stool (2.5% samples. Species identity of L. monocytogenes was verified through the amplification of a 800 bp fragment with inIA primers in 2 out of 6 culture isolates from beef luncheon (5%, and 1 out 4 culture isolates from chicken luncheon (2.5% samples. Statistical analysis revealed no significant difference between the occurrence of L. monocytogenes in different food samples examined (p>0.05. The virulence of these strains was ascertained by the presence of 517 bp and 238 bp fragments of inIC and inIJ genes, respectively in the isolates that contained the 800 bp fragment. The culture isolates obtained from one frankfurter beef sample, and one human stool sample were found negative by multiplex PCR for the presence of L. monocytogenes and its virulence specific genes. Conclusion: It could be concluded that L. monocytogenes are circulating in beef and chicken luncheon sold in Cairo, Egypt. Multiplex PCR is reliable for confirmation of L. monocytogenes. This study suggests the implementation of hygienic measures at all levels from production to consumption

Validation of a Previously Developed Geospatial Model That Predicts the Prevalence of Listeria monocytogenes in New York State Produce Fields

Science.gov (United States)

Weller, Daniel; Shiwakoti, Suvash; Bergholz, Peter; Grohn, Yrjo; Wiedmann, Martin

2015-01-01

Technological advancements, particularly in the field of geographic information systems (GIS), have made it possible to predict the likelihood of foodborne pathogen contamination in produce production environments using geospatial models. Yet, few studies have examined the validity and robustness of such models. This study was performed to test and refine the rules associated with a previously developed geospatial model that predicts the prevalence of Listeria monocytogenes in produce farms in New York State (NYS). Produce fields for each of four enrolled produce farms were categorized into areas of high or low predicted L. monocytogenes prevalence using rules based on a field's available water storage (AWS) and its proximity to water, impervious cover, and pastures. Drag swabs (n = 1,056) were collected from plots assigned to each risk category. Logistic regression, which tested the ability of each rule to accurately predict the prevalence of L. monocytogenes, validated the rules based on water and pasture. Samples collected near water (odds ratio [OR], 3.0) and pasture (OR, 2.9) showed a significantly increased likelihood of L. monocytogenes isolation compared to that for samples collected far from water and pasture. Generalized linear mixed models identified additional land cover factors associated with an increased likelihood of L. monocytogenes isolation, such as proximity to wetlands. These findings validated a subset of previously developed rules that predict L. monocytogenes prevalence in produce production environments. This suggests that GIS and geospatial models can be used to accurately predict L. monocytogenes prevalence on farms and can be used prospectively to minimize the risk of preharvest contamination of produce. PMID:26590280

Elucidation of Listeria monocytogenes contamination routes in cold-smoked salmon processing plants detected by DNA-based typing methods

DEFF Research Database (Denmark)

Vogel, Birte Fonnesbech; Huss, Hans Henrik; Ojeniyi, B.

2001-01-01

and environment could not be excluded. Contamination of the product occurred in specific areas (the brining and slicing areas). In plant I, the same RAPD type (RAPD type 12) was found over a 4-year period, indicating that an established in-house flora persisted and was not eliminated by routine hygienic......, monocytogenes). A total of 429 strains of L. monocytogenes were subsequently compared by random amplified polymorphic DNA (RAPD) profiling, and 55 different RAPD types were found. The RAPD types detected on the products were identical to types found on the processing equipment and in the processing environment...... procedures. In plant II, where the prevalence of L, monocytogenes was much tower, no RAPD type persisted over long periods of time, and several different L, monocytogenes RAPD types were isolated. This indicates that persistent strains may be avoided by rigorous cleaning and sanitation; however, due...

Spontaneous bacteriocin resistance in Listeria monocytogenes as a susceptibility screen for identifying different mechanisms of resistance and modes of action by bacteriocins of lactic acid bacteria.

Science.gov (United States)

Macwana, Sunita; Muriana, Peter M

2012-01-01

A practical system was devised for grouping bacteriocins of lactic acid bacteria (LAB) based on mode of action as determined by changes in inhibitory activity to spontaneously-acquired bacteriocin resistance (Bac(R)). Wild type Listeria monocytogenes 39-2 was sensitive to five bacteriocins produced by 3 genera of LAB: pediocin PA-1 and pediocin Bac3 (Pediococcus), lacticin FS97 and lacticin FS56 (Lactococcus), and curvaticin FS47 (Lactobacillus). A spontaneous Bac(R) derivative of L. monocytogenes 39-2 obtained by selective recovery against lacticin FS56 provided complete resistance to the bacteriocin made by Lactococcus lactis FS56. The lacticin FS56-resistant strain of L. monocyotgenes 39-2 was also cross-resistant to curvaticin FS47 and pediocin PA-1, but not to lacticin FS97 or pediocin Bac3. The same pattern of cross-resistance was also observed with Bac(R) isolates obtained with L. monocytogenes Scott A-2. A spontaneous mutation that renders a strain cross-resistant to different bacteriocins indicates that they share a common mechanism of resistance due to similar modes of action of the bacteriocins. Spontaneous resistance was acquired to other bacteriocins (in aggregate) by following the same procedure against which the Bac(R) strain was still sensitive. In subsequent challenge assays, mixtures of bacteriocins of different modes of action provided greater inhibition than mixtures of bacteriocins of the same mode of action (as determined by our screening method). This study identifies a methodical approach to classify bacteriocins into functional groups based on mechanism of resistance (i.e., mode of action) that could be used for identifying the best mixture of bacteriocins for use as biopreservatives. Copyright © 2011 Elsevier B.V. All rights reserved.

Prevalence, distribution, and diversity of Listeria monocytogenes in retail environments, focusing on small establishments and establishments with a history of failed inspections.

Science.gov (United States)

Hoelzer, Karin; Sauders, Brian D; Sanchez, Maria D; Olsen, Peter T; Pickett, Michele M; Mangione, Kurt J; Rice, Daniel H; Corby, Joe; Stich, Stephen; Fortes, Esther D; Roof, Sherry E; Grohn, Yrjo T; Wiedmann, Martin; Oliver, Haley F

2011-07-01

Despite growing concerns about cross-contamination of ready-to-eat foods with Listeria monocytogenes, our knowledge about the ecology and transmission of L. monocytogenes in retail establishments has remained limited. We conducted a cross-sectional study to characterize the prevalence, distribution, and subtype diversity of L. monocytogenes in 120 New York State retail deli establishments that were hypothesized to present an increased risk for environmental L. monocytogenes contamination (i.e., small establishments and establishments with a history of failed New York State Agriculture and Markets inspections). Analysis of these data along with previously reported data for 121 predominantly larger retail establishments in New York State identified establishment size, geographic location, and inspection history as significant predictors of L. monocytogenes presence and prevalence. The odds of an establishment being L. monocytogenes positive were approximately twice as high for large establishments, establishments located in New York City, or establishments with poor inspection history (as compared with establishments without these attributes), even though correlation between location and inspection history complicated interpretation of results. Within an establishment, L. monocytogenes was significantly more prevalent on nonfood contact surfaces than on food contact surfaces; prevalence was particularly high for floors and in floor drains, sinks, the dairy case, and milk crates. L. monocytogenes subtype diversity differed between sites, with lineage I isolates significantly associated with nonfood contact surfaces and lineage II isolates significantly associated with food contact surfaces. Isolates belonging to the same ribotype were often found dispersed across multiple sites within an operation. Copyright ©, International Association for Food Protection

Distribution of the bacteria Listeria monocytogenes in the western part of the Sea of Okhotsk

Science.gov (United States)

Terekhova, V. E.; Sosnin, V. A.; Buzoleva, L. S.; Shakirov, R. B.

2010-04-01

The Amur River’s influence on the distribution of the opportunistic bacteria Listeria monocytogenes in the western part of the Sea of Okhotsk is discussed. The presence of Listeria in the seawater, sea ice, and sediments on the northeastern Sakhalin shelf and slope supports the idea of its connection with the Amur River discharge. The hypothesis of the allochtonic parentage of L. monocytogenes in the sea’s development is proved.

Inhibition of Listeria monocytogenes on Ready-to-Eat Meats Using Bacteriocin Mixtures Based on Mode-of-Action

Directory of Open Access Journals (Sweden)

Paul Priyesh Vijayakumar

2017-03-01

Full Text Available Bacteriocin-producing (Bac+ lactic acid bacteria (LAB comprising selected strains of Lactobacillus curvatus, Lactococcus lactis, Pediococcus acidilactici, and Enterococcus faecium and thailandicus were examined for inhibition of Listeria monocytogenes during hotdog challenge studies. The Bac+ strains, or their cell-free supernatants (CFS, were grouped according to mode-of-action (MOA as determined from prior studies. Making a mixture of as many MOAs as possible is a practical way to obtain a potent natural antimicrobial mixture to address L. monocytogenes contamination of RTE meat products (i.e., hotdogs. The heat resistance of the bacteriocins allowed the use of pasteurization to eliminate residual producer cells for use as post-process surface application or their inclusion into hotdog meat emulsion during cooking. The use of Bac+ LAB comprising 3× MOAs directly as co-inoculants on hotdogs was not effective at inhibiting L. monocytogenes. However, the use of multiple MOA Bac+ CFS mixtures in a variety of trials demonstrated the effectiveness of this approach by showing a >2-log decrease of L. monocytogenes in treatment samples and 6–7 log difference vs. controls. These data suggest that surface application of multiple mode-of-action bacteriocin mixtures can provide for an Alternative 2, and possibly Alternative 1, process category as specified by USDA-FSIS for control of L. monocytogenes on RTE meat products.

Listeria monocytogenes endophthalmitis - case report and review of risk factors and treatment outcomes.

Science.gov (United States)

Bajor, Anna; Luhr, Anke; Brockmann, Dorothee; Suerbaum, Sebastian; Framme, Carsten; Sedlacek, Ludwig

2016-07-16

The majority of cases of endophthalmitis are caused by exogenous pathogens; only 5-10 % are of endogenous origin. One cause of these rare cases of endogenous endophthalmitis is Listeria monocytogenes. Twenty-six cases of endophthalmitis due to this pathogen have been published over the last twenty years. The aim of this review is to summarize the main risk factors and common clinical findings of endogenous endophthalmitis due to Listeria monocytogenes. We report on a 62-year-old female presenting with a sterile hypopyon iritis with secondary glaucoma and an underlying rheumatoid disease. In microbiological analysis we identified Listeria monocytogenes. Further we searched through all published cases for typical signs, risk factors, details of medical and surgical treatment and outcome of endogenous endophthalmitis due to this rare pathogen. Ocular symptoms in almost all of these published cases included pain, redness of the eye, and decreased vision. Main clinical features included elevated intraocular pressure and fibrinous anterior chamber reaction, as well as a dark hypopyon. While the infection is typically spread endogenously, neither an exogenous nor endogenous source of infection could be identified in most cases. Immunocompromised patients are at higher risk of being infected than immunocompetent patients. The clinical course of endophthalmitis caused by Listeria monocytogenes had different visual outcomes. In some cases, the infection led to enucleation, blindness, or strong visual loss, whereas most patients showed a tendency of visual improvement during therapy. Early diagnosis and treatment initiation are crucial factors in the outcome of endogenous endophthalmitis caused by Listeria monocytogenes. This possible differential diagnosis should be kept in mind while treating patients with presumable sterile hypopyon and anterior uveitis having a high intraocular pressure. A bacterial source should be considered with a prompt initiation of systemic

Integrative genomic analysis identifies isoleucine and CodY as regulators of Listeria monocytogenes virulence.

Directory of Open Access Journals (Sweden)

Lior Lobel

2012-09-01

Full Text Available Intracellular bacterial pathogens are metabolically adapted to grow within mammalian cells. While these adaptations are fundamental to the ability to cause disease, we know little about the relationship between the pathogen's metabolism and virulence. Here we used an integrative Metabolic Analysis Tool that combines transcriptome data with genome-scale metabolic models to define the metabolic requirements of Listeria monocytogenes during infection. Twelve metabolic pathways were identified as differentially active during L. monocytogenes growth in macrophage cells. Intracellular replication requires de novo synthesis of histidine, arginine, purine, and branch chain amino acids (BCAAs, as well as catabolism of L-rhamnose and glycerol. The importance of each metabolic pathway during infection was confirmed by generation of gene knockout mutants in the respective pathways. Next, we investigated the association of these metabolic requirements in the regulation of L. monocytogenes virulence. Here we show that limiting BCAA concentrations, primarily isoleucine, results in robust induction of the master virulence activator gene, prfA, and the PrfA-regulated genes. This response was specific and required the nutrient responsive regulator CodY, which is known to bind isoleucine. Further analysis demonstrated that CodY is involved in prfA regulation, playing a role in prfA activation under limiting conditions of BCAAs. This study evidences an additional regulatory mechanism underlying L. monocytogenes virulence, placing CodY at the crossroads of metabolism and virulence.

Control of Listeria monocytogenes in food production plants

Directory of Open Access Journals (Sweden)

Dimitrijević Mirjana

2008-01-01

Full Text Available L. monocytogenes has been established in different plants for the production of food, including dairy plants, abattoirs, plants for the processing of fish, as well as those for the production of ready-to-eat (RTE food and this fact is being considered as the primary mechanism of food contamination with this bacteria. There is also the factor of numerous and diverse contaminated production equipment, because it has certain parts that are inaccessible for the necessary cleaning and disinfection. The temperature, position, as well as the material of the work surface are also linked to the contamination of plants with this bacteria. Investigations carried out so far have helped toward the better understanding of the manner and time of contamination of food items in the course of the production process, but there are still unresolved problems, including most certainly the biggest one - the adherence of bacteria and the creation of a biofilm, when the bacteria is in that condition more resistant to so-called stress factors which are usually used in the food industry for the purpose of decontamination of the surfaces with which foods come into contact. The control of L. monocytogenes in food production plants is possible primarily by using an integrated programme, compatible with the systems Hazard Analysis Critical Control Point (HACCP and Good Hygiene Practice (GHP, necessary in the production of food that is safe for the consumer. Essentially, the control measures that can contribute to reducing the incidence of findings of L.monocytogenes in the finished product, as well as the reducing of the level of contamination with this bacteria are linked, on the one hand, with hygiene procedures in the production process, and, on the other, with the applied technological procedures.

Short-term genome evolution of Listeria monocytogenes in a non-controlled environment

Directory of Open Access Journals (Sweden)

Ivy Reid A

2008-11-01

Full Text Available Abstract Background While increasing data on bacterial evolution in controlled environments are available, our understanding of bacterial genome evolution in natural environments is limited. We thus performed full genome analyses on four Listeria monocytogenes, including human and food isolates from both a 1988 case of sporadic listeriosis and a 2000 listeriosis outbreak, which had been linked to contaminated food from a single processing facility. All four isolates had been shown to have identical subtypes, suggesting that a specific L. monocytogenes strain persisted in this processing plant over at least 12 years. While a genome sequence for the 1988 food isolate has been reported, we sequenced the genomes of the 1988 human isolate as well as a human and a food isolate from the 2000 outbreak to allow for comparative genome analyses. Results The two L. monocytogenes isolates from 1988 and the two isolates from 2000 had highly similar genome backbone sequences with very few single nucleotide (nt polymorphisms (1 – 8 SNPs/isolate; confirmed by re-sequencing. While no genome rearrangements were identified in the backbone genome of the four isolates, a 42 kb prophage inserted in the chromosomal comK gene showed evidence for major genome rearrangements. The human-food isolate pair from each 1988 and 2000 had identical prophage sequence; however, there were significant differences in the prophage sequences between the 1988 and 2000 isolates. Diversification of this prophage appears to have been caused by multiple homologous recombination events or possibly prophage replacement. In addition, only the 2000 human isolate contained a plasmid, suggesting plasmid loss or acquisition events. Surprisingly, besides the polymorphisms found in the comK prophage, a single SNP in the tRNA Thr-4 prophage represents the only SNP that differentiates the 1988 isolates from the 2000 isolates. Conclusion Our data support the hypothesis that the 2000 human listeriosis

Use of multi-locus sequencing typing as identification method for the food-borne pathogen Listeria monocytogenes: a review

Directory of Open Access Journals (Sweden)

Sonia Lamon

2015-01-01

Full Text Available Listeria monocytogenes is an ubiquitous, intracellular pathogen which has been implicated within the past decade as the causative organism in several outbreaks of foodborne diseases. In this review, a new approach to molecular typing primarily designed for global epidemiology has been described: multi-locus sequencing typing (MLST. This approach is novel, in that it uses data that allow the unambiguous characterization of bacterial strains via the Internet. Our aim is to present the currently available selection of references on L. monocytogenes MLST detection methods and to discuss its use as gold standard to L. monocytogenes subtyping method.

Kinetic Behavior of Aggregation-Exchange Growth Process with Catalyzed-Birth

International Nuclear Information System (INIS)

Han Anjia; Chen Yu; Lin Zhenquan; Ke Jianhong

2007-01-01

We propose an aggregation model of a two-species system to mimic the growth of cities' population and assets, in which irreversible coagulation reactions and exchange reactions occur between any two aggregates of the same species, and the monomer-birth reactions of one species occur by the catalysis of the other species. In the case with population-catalyzed birth of assets, the rate kernel of an asset aggregate B k of size k grows to become an aggregate B k+1 through a monomer-birth catalyzed by a population aggregate A j of size j is J(k,j) = Jkj λ . And in mutually catalyzed birth model, the birth rate kernels of population and assets are H(k,j) = Hkj η and J(k,j) = Jkj λ , respectively. The kinetics of the system is investigated based on the mean-field theory. In the model of population-catalyzed birth of assets, the long-time asymptotic behavior of the assets aggregate size distribution obeys the conventional or modified scaling form. In mutually catalyzed birth system, the asymptotic behaviors of population and assets obey the conventional scaling form in the case of η = λ = 0, and they obey the modified scaling form in the case of η = 0,λ = 1. In the case of η = λ = 1, the total mass of population aggregates and that of asset aggregates both grow much faster than those in population-catalyzed birth of assets model, and they approaches to infinite values in finite time.

The influence of Listeria monocytogenes cells on the primary immunologic response in irradiated mice

International Nuclear Information System (INIS)

Borowski, J.; Jokoniuk, P.

1977-01-01

The influence of killed Listeria monocytogenes cells on the primary immunologic response in mice irradiated with 300 or 500 R was studied. The immunologic response of the mice to sheep red blood cells used as antigen was assessed at the cellular level (by counting PFC) and humoral level. Injection of killed Listeria monocytogenes cells before irradiation of the mice diminished the immunosuppressive effect of roentgen radiation. Injection of the cells after irradiation accelerated regeneration of immunologic reactivity in the irradiated mice. (author)

Potential of chitosan from Mucor rouxxi UCP064 as alternative natural compound to inhibit Listeria monocytogenes Potencial de quitosana de Mucor rouxxi UCP 064 como componente alternativo para inibir Listeria monocytogenes

Directory of Open Access Journals (Sweden)

Roberta A. Bento

2009-09-01

Full Text Available Listeria monocytogenes is widely distributed in nature and the infection listeriosis is recognized as a potential threat for human health because of its mortality rate. The objective of this study was to evaluate the growth profile and chitosan production by Mucor rouxxi UCP 064 grown in yam bean (Pachyrhizus erosus L. Urban medium. It was also to assess the anti-L. monocytogenes efficacy of the obtained chitosan. Higher values of biomass of M. rouxxi (16.9 g.L¹ and best yield of chitosan (62 mg.g-1 were found after 48 h of cultivation. Residual glucose and nitrogen in the growth media were 4.1 and 0.02 g.L¹ after 96 h, respectively. Obtained chitosan presented 85 % of degree of deacetylation and 2.60 x 10(4 g.mol-1of viscosimetric molecular weight. Minimum Inhibitory Concentration (MIC and Minimum Bactericidal Concentration (MBC values of chitosan against L. monocytogenes ATCC 7644 were, respectively, 2.5 and 5.0 mg.mL-1. At 2.5 and 5.0 mg.mL-1 chitosan caused cidal effect in a maximum time of 4 h. Bacterial count below 2 log cfu.mL-1were found from 2 h onwards and no recovery in bacterial growth was noted in the remainder period. These results show the biotechnological potential of yam bean medium for chitosan production by Mucor rouxxi and support the possible rational use of chitosan from fungi as natural antimicrobial to control L. monocytogenes.Listeria monocytogenes apresentase como um microrganismo amplamente distribuído na natureza, sendo que a infecção listeriose é reconhecida como uma potencial ameaça a saúde humana devido a sua taxa de mortalidade. O objetivo deste estudo foi avaliar o perfil de crescimento e de produção de quitosana por Mucor rouxxi UCP 064 cultivado em meio jacatupé (Pachyrhizus erosus L. Urban, bem como avaliar a eficácia anti-L. monocytogenes da quitosana produzida com vistas a uma possível aplicação em alimentos. Os mais elevados valores de biomassa de M. rouxxi (16,9 g.L¹ e o maior rendimento na

Irrigation Is Significantly Associated with an Increased Prevalence of Listeria monocytogenes in Produce Production Environments in New York State.

Science.gov (United States)

Weller, Daniel; Wiedmann, Martin; Strawn, Laura K

2015-06-01

Environmental (i.e., meteorological and landscape) factors and management practices can affect the prevalence of foodborne pathogens in produce production environments. This study was conducted to determine the prevalence of Listeria monocytogenes, Listeria species (including L. monocytogenes), Salmonella, and Shiga toxin-producing Escherichia coli (STEC) in produce production environments and to identify environmental factors and management practices associated with their isolation. Ten produce farms in New York State were sampled during a 6-week period in 2010, and 124 georeferenced samples (80 terrestrial, 33 water, and 11 fecal) were collected. L. monocytogenes, Listeria spp., Salmonella, and STEC were detected in 16, 44, 4, and 5% of terrestrial samples, 30, 58, 12, and 3% of water samples, and 45, 45, 27, and 9% of fecal samples, respectively. Environmental factors and management practices were evaluated for their association with terrestrial samples positive for L. monocytogenes or other Listeria species by univariate logistic regression; analysis was not conducted for Salmonella or STEC because the number of samples positive for these pathogens was low. Although univariate analysis identified associations between isolation of L. monocytogenes or Listeria spp. from terrestrial samples and various water-related factors (e.g., proximity to wetlands and precipitation), multivariate analysis revealed that only irrigation within 3 days of sample collection was significantly associated with isolation of L. monocytogenes (odds ratio = 39) and Listeria spp. (odds ratio = 5) from terrestrial samples. These findings suggest that intervention at the irrigation level may reduce the risk of produce contamination.

Differentiation of different mixed Listeria strains and also acid-injured, heat-injured, and repaired cells of Listeria monocytogenes using fourier transform infrared spectroscopy.

Science.gov (United States)

Nyarko, Esmond; Donnelly, Catherine

2015-03-01

Fourier transform infrared (FT-IR) spectroscopy was used to differentiate mixed strains of Listeria monocytogenes and mixed strains of L. monocytogenes and Listeria innocua. FT-IR spectroscopy was also applied to investigate the hypothesis that heat-injured and acid-injured cells would return to their original physiological integrity following repair. Thin smears of cells on infrared slides were prepared from cultures for mixed strains of L. monocytogenes, mixed strains of L. monocytogenes and L. innocua, and each individual strain. Heat-injured and acid-injured cells were prepared by exposing harvested cells of L. monocytogenes strain R2-764 to a temperature of 56 ± 0.2°C for 10 min or lactic acid at pH 3 for 60 min, respectively. Cellular repair involved incubating aliquots of acid-injured and heat-injured cells separately in Trypticase soy broth supplemented with 0.6% yeast extract for 22 to 24 h; bacterial thin smears on infrared slides were prepared for each treatment. Spectral collection was done using 250 scans at a resolution of 4 cm(-1) in the mid-infrared wavelength region. Application of multivariate discriminant analysis to the wavelength region from 1,800 to 900 cm(-1) separated the individual L. monocytogenes strains. Mixed strains of L. monocytogenes and L. monocytogenes cocultured with L. innocua were successfully differentiated from the individual strains when the discriminant analysis was applied. Different mixed strains of L. monocytogenes were also successfully separated when the discriminant analysis was applied. A data set for injury and repair analysis resulted in the separation of acid-injured, heat-injured, and intact cells; repaired cells clustered closer to intact cells when the discriminant analysis (1,800 to 600 cm(-1)) was applied. FT-IR spectroscopy can be used for the rapid source tracking of L. monocytogenes strains because it can differentiate between different mixed strains and individual strains of the pathogen.

Ultrasonic cleaning of conveyor belt materials using Listeria monocytogenes as a model organism.

Science.gov (United States)

Tolvanén, Riina; Lunden, Janne; Korkeala, Hannu; Wirtanen, Gun

2007-03-01

Persistent Listeria monocytogenes contamination of food industry equipment is a difficult problem to solve. Ultrasonic cleaning offers new possibilities for cleaning conveyors and other equipment that are not easy to clean. Ultrasonic cleaning was tested on three conveyor belt materials: polypropylene, acetal, and stainless steel (cold-rolled, AISI 304). Cleaning efficiency was tested at two temperatures (30 and 45 degrees C) and two cleaning times (30 and 60 s) with two cleaning detergents (KOH, and NaOH combined with KOH). Conveyor belt materials were soiled with milk-based soil and L. monocytogenes strains V1, V3, and B9, and then incubated for 72 h to attach bacteria to surfaces. Ultrasonic cleaning treatments reduced L. monocytogenes counts on stainless steel 4.61 to 5.90 log units; on acetal, 3.37 to 5.55 log units; and on polypropylene, 2.31 to 4.40 log units. The logarithmic reduction differences were statistically analyzed by analysis of variance using Statistical Package for the Social Sciences software. The logarithmic reduction was significantly greater in stainless steel than in plastic materials (P conveyor belt materials.

A small RNA controls expression of the chitinase ChiA in Listeria monocytogenes

DEFF Research Database (Denmark)

Nielsen, Jesper S; Larsen, Marianne Halberg; Lillebæk, Eva Maria Sternkopf

2011-01-01

role of LhrA in L. monocytogenes. To this end, we determined the effects of LhrA on global-wide gene expression. We observed that nearly 300 genes in L. monocytogenes are either positively or negatively affected by LhrA. Among these genes, we identified lmo0302 and chiA as direct targets of LhrA, thus...... establishing LhrA as a multiple target regulator. Lmo0302 encodes a hypothetical protein with no known function, whereas chiA encodes one of two chitinases present in L. monocytogenes. We show here that LhrA acts as a post-transcriptional regulator of lmo0302 and chiA by interfering with ribosome recruitment......, and we provide evidence that both LhrA and Hfq act to down-regulate the expression of lmo0302 and chiA. Furthermore, in vitro binding experiments show that Hfq stimulates the base pairing of LhrA to chiA mRNA. Finally, we demonstrate that LhrA has a negative effect on the chitinolytic activity of L...

Effect of Filling Type and Heating Method on Prevalence of Listeria species and Listeria monocytogenes in Dumplings Produced in Poland.

Science.gov (United States)

Szymczak, Barbara; Dąbrowski, Waldemar

2015-05-01

The count of Listeria monocytogenes was determined, before and after heat treatment, in 200 samples of dumplings of 9 brands and with different types of stuffing. Analyses were conducted according to ISO 11290-1 standard and with real-time PCR method. The highest count of L. monocytogenes was found in meat dumplings (10(2) to 10(4) CFU/g), whereas products with white cheese-potato stuffing and vegetable-mushroom stuffing contained significantly less Listeria, 20 to 80 and 5 to 32 CFU/g, respectively. In cooled meat dumplings the extent of contamination depended significantly on the producer. In addition, a significant (P monocytogenes in meat dumplings. In contrast, the microwave heating applied for 2 min at 600 W only reduced the count of L. monocytogenes by 1 to 2 logs. Hence, the microwave heating failed to reduce the risk of infection with this pathogen below the level permissible in the EU regulation, especially in the most contaminated samples. In this case, the efficacy of microwave heating was significantly (P monocytogenes (rho = 0.626), then by meat content in the stuffing (0.476), and to the lowest extent--by the type of meat (0.415 to 0.425). However, no Listeria sp. and L. monocytogenes were isolated from cooked dumplings with fruits (strawberries or blueberries). © 2015 Institute of Food Technologists®

Occurrence of Listeria monocytogenes in Ready-to-Eat Meat Products and Meat Processing Plants in Spain

Directory of Open Access Journals (Sweden)

Diego Gómez

2015-07-01

Full Text Available The aim of this work was to study the occurrence of Listeria monocytogenes in several types of ready-to-eat (RTE meat products and in the environment of meat processing plants. A total of 129 samples of RTE meat products and 110 samples from work surfaces and equipment were analyzed. L. monocytogenes was detected in 6 out of 35 cooked products (17.14%, 21 out of 57 raw-cured products (36.84%, and 9 out of 37 dry-cured, salted products (24.32%. The number of sample units that exceeded the food safety limit of 100 cfu/g decreased from the manufacture date to half shelf life, and then it was further reduced at the end of shelf life. L. monocytogenes was detected in 25 out of 110 (22.72% food contact surfaces. The number of positive and negative results from both food and environmental samples were cross-tabulated and the calculated Cohen’s kappa coefficient (κ was 0.3233, indicating a fair agreement in terms of Listeria contamination. L. monocytogenes was recovered after cleaning and disinfection procedures in four plants, highlighting the importance of thorough cleaning and disinfection.

Biosensor for the detection of Listeria monocytogenes: emerging trends

KAUST Repository

Soni, Dharmendra Kumar

2018-05-23

The early detection of Listeria monocytogenes (L. monocytogenes) and understanding the disease burden is of paramount interest. The failure to detect pathogenic bacteria in the food industry may have terrible consequences, and poses deleterious effects on human health. Therefore, integration of methods to detect and trace the route of pathogens along the entire food supply network might facilitate elucidation of the main contamination sources. Recent research interest has been oriented towards the development of rapid and affordable pathogen detection tools/techniques. An innovative and new approach like biosensors has been quite promising in revealing the foodborne pathogens. In spite of the existing knowledge, advanced research is still needed to substantiate the expeditious nature and sensitivity of biosensors for rapid and in situ analysis of foodborne pathogens. This review summarizes recent developments in optical, piezoelectric, cell-based, and electrochemical biosensors for Listeria sp. detection in clinical diagnostics, food analysis, and environmental monitoring, and also lists their drawbacks and advantages.

Validation of a Previously Developed Geospatial Model That Predicts the Prevalence of Listeria monocytogenes in New York State Produce Fields.

Science.gov (United States)

Weller, Daniel; Shiwakoti, Suvash; Bergholz, Peter; Grohn, Yrjo; Wiedmann, Martin; Strawn, Laura K

2016-02-01

Technological advancements, particularly in the field of geographic information systems (GIS), have made it possible to predict the likelihood of foodborne pathogen contamination in produce production environments using geospatial models. Yet, few studies have examined the validity and robustness of such models. This study was performed to test and refine the rules associated with a previously developed geospatial model that predicts the prevalence of Listeria monocytogenes in produce farms in New York State (NYS). Produce fields for each of four enrolled produce farms were categorized into areas of high or low predicted L. monocytogenes prevalence using rules based on a field's available water storage (AWS) and its proximity to water, impervious cover, and pastures. Drag swabs (n = 1,056) were collected from plots assigned to each risk category. Logistic regression, which tested the ability of each rule to accurately predict the prevalence of L. monocytogenes, validated the rules based on water and pasture. Samples collected near water (odds ratio [OR], 3.0) and pasture (OR, 2.9) showed a significantly increased likelihood of L. monocytogenes isolation compared to that for samples collected far from water and pasture. Generalized linear mixed models identified additional land cover factors associated with an increased likelihood of L. monocytogenes isolation, such as proximity to wetlands. These findings validated a subset of previously developed rules that predict L. monocytogenes prevalence in produce production environments. This suggests that GIS and geospatial models can be used to accurately predict L. monocytogenes prevalence on farms and can be used prospectively to minimize the risk of preharvest contamination of produce. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

Combination of endolysins and high pressure to inactivate Listeria monocytogenes.

Science.gov (United States)

van Nassau, Tomas J; Lenz, Christian A; Scherzinger, Anna S; Vogel, Rudi F

2017-12-01

Outbreaks of listeriosis are often related to the consumption of low-processed ready-to-eat food products (e.g. soft cheeses or smoked fish) contaminated with Listeria monocytogenes. Traditional preservation techniques, such as heat treatment, cannot eliminate Listeria from these products without strongly affecting the quality of the foods. We therefore investigated the use of endolysin (PlyP40, Ply511, or PlyP825) in combination with high hydrostatic pressure processing to kill L. monocytogenes in buffer. The results demonstrated a more than additive effect when both treatments were combined. For example, whereas 0.16 μg/mL PlyP825 or 300 MPa (1 min, 30 °C) applied individually reduced the cell count by 0.2 and 0.3 log cfu, respectively, a combined treatment resulted in a reduction of 5.5 log cfu. Similar results were obtained for the other endolysins combined with high pressure processing. We also showed that the synergistic inactivation of cells by endolysin and HHP is possible at a pressure level of only 200 MPa (2 min, 30 °C). Thus, the application of endolysins did not only substantially increase the bactericidal effect of high pressure, but it also enabled the inactivation of bacterial cells at much lower pressure levels. This shows the potential of using such combined processes for the inactivation of L. monocytogenes and food preservation. Copyright © 2017 Elsevier Ltd. All rights reserved.

Cholesterol impairment contributes to neuroserpin aggregation

Science.gov (United States)

Giampietro, Costanza; Lionetti, Maria Chiara; Costantini, Giulio; Mutti, Federico; Zapperi, Stefano; La Porta, Caterina A. M.

2017-03-01

Intraneural accumulation of misfolded proteins is a common feature of several neurodegenerative pathologies including Alzheimer’s and Parkinson’s diseases, and Familial Encephalopathy with Neuroserpin Inclusion Bodies (FENIB). FENIB is a rare disease due to a point mutation in neuroserpin which accelerates protein aggregation in the endoplasmic reticulum (ER). Here we show that cholesterol depletion induced either by prolonged exposure to statins or by inhibiting the sterol reg-ulatory binding-element protein (SREBP) pathway also enhances aggregation of neuroserpin proteins. These findings can be explained considering a computational model of protein aggregation under non-equilibrium conditions, where a decrease in the rate of protein clearance improves aggregation. Decreasing cholesterol in cell membranes affects their biophysical properties, including their ability to form the vesicles needed for protein clearance, as we illustrate by a simple mathematical model. Taken together, these results suggest that cholesterol reduction induces neuroserpin aggregation, even in absence of specific neuroserpin mutations. The new mechanism we uncover could be relevant also for other neurodegenerative diseases associated with protein aggregation.

Rapid detection of Listeria monocytogenes in raw milk and soft cheese by a redox potential measurement based method combined with real-time PCR.

Science.gov (United States)

Erdősi, Orsolya; Szakmár, Katalin; Reichart, Olivér; Szili, Zsuzsanna; László, Noémi; Székely Körmöczy, Péter; Laczay, Péter

2014-09-01

The incidence of outbreaks of foodborne listeriosis has indicated the need for a reliable and rapid detection of the microbe in different foodstuffs. A method combining redox potential measurement and real-time polymerase chain reaction (PCR) was developed to detect Listeria monocytogenes in artificially contaminated raw milk and soft cheese. Food samples of 25 g or 25 ml were homogenised in 225 ml of Listeria Enrichment Broth (LEB) with Oxford supplement, and the redox potential measurement technique was applied. For Listeria species the measuring time was maximum 34 h. The absence of L. monocytogenes could reliably be proven by the redox potential measurement method, but Listeria innocua and Bacillus subtilis could not be differentiated from L. monocytogenes on the basis of the redox curves. The presence of L. monocytogenes had to be confirmed by real-time PCR. The combination of these two methods proved to detect < 10 cfu/g of L. monocytogenes in a cost- and time-effective manner. This method can potentially be used as an alternative to the standard nutrient method for the rapid detection of L. monocytogenes in food.

In vivo transcriptional profiling of Listeria monocytogenes and mutagenesis identify new virulence factors involved in infection.

Directory of Open Access Journals (Sweden)

Ana Camejo

2009-05-01

Full Text Available Listeria monocytogenes is a human intracellular pathogen able to colonize host tissues after ingestion of contaminated food, causing severe invasive infections. In order to gain a better understanding of the nature of host-pathogen interactions, we studied the L. monocytogenes genome expression during mouse infection. In the spleen of infected mice, approximately 20% of the Listeria genome is differentially expressed, essentially through gene activation, as compared to exponential growth in rich broth medium. Data presented here show that, during infection, Listeria is in an active multiplication phase, as revealed by the high expression of genes involved in replication, cell division and multiplication. In vivo bacterial growth requires increased expression of genes involved in adaptation of the bacterial metabolism and stress responses, in particular to oxidative stress. Listeria interaction with its host induces cell wall metabolism and surface expression of virulence factors. During infection, L. monocytogenes also activates subversion mechanisms of host defenses, including resistance to cationic peptides, peptidoglycan modifications and release of muramyl peptides. We show that the in vivo differential expression of the Listeria genome is coordinated by a complex regulatory network, with a central role for the PrfA-SigB interplay. In particular, L. monocytogenes up regulates in vivo the two major virulence regulators, PrfA and VirR, and their downstream effectors. Mutagenesis of in vivo induced genes allowed the identification of novel L. monocytogenes virulence factors, including an LPXTG surface protein, suggesting a role for S-layer glycoproteins and for cadmium efflux system in Listeria virulence.

PE859, a novel tau aggregation inhibitor, reduces aggregated tau and prevents onset and progression of neural dysfunction in vivo.

Directory of Open Access Journals (Sweden)

Michiaki Okuda

Full Text Available In tauopathies, a neural microtubule-associated protein tau (MAPT is abnormally aggregated and forms neurofibrillary tangle. Therefore, inhibition of the tau aggregation is one of the key approaches for the treatment of these diseases. Here, we have identified a novel tau aggregation inhibitor, PE859. An oral administration of PE859 resulted in the significant reduction of sarkosyl-insoluble aggregated tau along with the prevention of onset and progression of the motor dysfunction in JNPL3 P301L-mutated human tau transgenic mice. These results suggest that PE859 is useful for the treatment of tauopathies.

Long-Term Results of Cartilage Repair after Allogeneic Transplantation of Cartilaginous Aggregates Formed from Bone Marrow–Derived Cells for Large Osteochondral Defects in Rabbit Knees

Science.gov (United States)

Mishima, Hajime; Sakai, Shinsuke; Uemura, Toshimasa

2013-01-01

Objective: The purpose of this study was to evaluate the long-term results of cartilage repair after allogeneic transplantation of cartilaginous aggregates formed from bone marrow–derived cells. Methods: Bone marrow cells were harvested from 12-day-old rabbits. The cells were subjected to a monolayer culture, and the spindle-shaped cells attached to the flask surface were defined as bone marrow–derived mesenchymal cells. After the monolayer culture, a 3-dimensional cartilaginous aggregate was formed using a bioreactor with chondrogenesis. We created osteochondral defects, measuring 5 mm in diameter and 4 mm in depth, at the femoral trochlea of 10-week-old rabbits. Two groups were established, the transplanted group in which the cartilaginous aggregate was transplanted into the defect, and the control group in which the defect was left untreated. Twenty-six and 52 weeks after surgery, the rabbits were sacrificed and their tissue repair status was evaluated macroscopically (International Cartilage Repair Society [ICRS] score) and histologically (O’Driscoll score). Results: The ICRS scores were as follows: at week 26, 7.2 ± 0.5 and 7.6 ± 0.8; at week 52, 7.6 ± 1.1 and 9.7 ± 0.7, for the transplanted and control groups, respectively. O’Driscoll scores were as follows: at week 26, 12.6 ± 1.9 and 10.1 ± 1.9; at week 52, 9.6 ± 3.0 and 14.0 ± 1.4, each for transplanted and control groups, respectively. No significant differences were observed between the groups. Conclusions: This study demonstrates that allogeneic transplantation of cartilaginous aggregates formed from bone marrow–derived cells produces comparable long-term results based on macroscopic and histological outcome measures when compared with osteochondral defects that are left untreated. PMID:26069678

Long-Term Results of Cartilage Repair after Allogeneic Transplantation of Cartilaginous Aggregates Formed from Bone Marrow-Derived Cells for Large Osteochondral Defects in Rabbit Knees.