WorldWideScience

Sample records for monocytogenes food monitoring

  1. Monitoring paneer for Listeria monocytogenes - A high risk food ...

    African Journals Online (AJOL)

    A multiplex polymerase chain reaction (PCR) assay was developed and applied to spiked and natural paneer samples to detect Listeria monocytogenes, a high risk food pathogen. The sensitivity of the assay on L. monocytogenes spiked paneer samples was 104 cells prior to enrichment, was improved to 103 cells after 4 h ...

  2. Monitoring occurrence and persistence of Listeria monocytogenes in foods and food processing environments in the Republic of Ireland

    Directory of Open Access Journals (Sweden)

    Dara eLeong

    2014-08-01

    Full Text Available Although rates of listeriosis are low in comparison to other foodborne pathogenic illnesses, listeriosis poses a significant risk to human health as the invasive form can have a mortality rate as high as 30%. Food processors, especially those who produce ready-to-eat products, need to be vigilant against Listeria monocytogenes, the causative pathogen of listeriosis, and as such, the occurrence of L. monocytogenes in food and in the food processing environment needs to be carefully monitored. To examine the prevalence and patterns of contamination in food processing facilities in Ireland, 48 food processors submitted 8 samples every 2 months from March 2013 to March 2014 to be analyzed for L. monocytogenes. No positive samples were detected for 38% of the processing facilities tested. Isolates found at the remaining 62% of facilities were characterized by serotyping and Pulsed Field Gel Electrophoresis (PFGE. A general L. monocytogenes prevalence of 4.6% was seen in all samples analyzed with similar rates seen in food and environmental samples. Differences in prevalence were seen across different food processors, food sectors, sampling months etc. and PFGE analysis allowed for the examination of contamination patterns and for the identification of several persistent strains. Seven of the food processing facilities tested showed contamination with persistent strains and evidence of bacterial transfer from the processing environment to food (the same pulsotype found in both was seen in four of the food processing facilities tested.

  3. Monitoring occurrence and persistence of Listeria monocytogenes in foods and food processing environments in the Republic of Ireland.

    Science.gov (United States)

    Leong, Dara; Alvarez-Ordóñez, Avelino; Jordan, Kieran

    2014-01-01

    Although rates of listeriosis are low in comparison to other foodborne pathogenic illness, listeriosis poses a significant risk to human health as the invasive form can have a mortality rate as high as 30%. Food processors, especially those who produce ready-to-eat (RTE) products, need to be vigilant against Listeria monocytogenes, the causative pathogen of listeriosis, and as such, the occurrence of L. monocytogenes in food and in the food processing environment needs to be carefully monitored. To examine the prevalence and patterns of contamination in food processing facilities in Ireland, 48 food processors submitted 8 samples every 2 months from March 2013 to March 2014 to be analyzed for L. monocytogenes. No positive samples were detected at 38% of the processing facilities tested. Isolates found at the remaining 62% of facilities were characterized by serotyping and Pulsed Field Gel Electrophoresis (PFGE). A general L. monocytogenes prevalence of 4.6% was seen in all samples analyzed with similar rates seen in food and environmental samples. Differences in prevalence were seen across different food processors, food sectors, sampling months etc. and PFGE analysis allowed for the examination of contamination patterns and for the identification of several persistent strains. Seven of the food processing facilities tested showed contamination with persistent strains and evidence of bacterial transfer from the processing environment to food (the same pulsotype found in both) was seen in four of the food processing facilities tested.

  4. Incidence and control of Listeria monocytogenes in foods in Denmark

    DEFF Research Database (Denmark)

    Nørrung, Birgit; Andersen, Jens Kirk; Schlundt, Jørgen

    1999-01-01

    The Danish regulatory policy on Listeria monocytogenes in foods is based on the principles of HACCP and was developed using a health risk assessment approach. The Danish policy focuses examinations and criteria for L. monocytogenes in ready-to-eat foods and is based on a combination of inspection...

  5. Listeria monocytogenes in Food-Processing Facilities, Food Contamination, and Human Listeriosis: The Brazilian Scenario.

    Science.gov (United States)

    Camargo, Anderson Carlos; Woodward, Joshua John; Call, Douglas Ruben; Nero, Luís Augusto

    2017-11-01

    Listeria monocytogenes is a foodborne pathogen that contaminates food-processing environments and persists within biofilms on equipment, utensils, floors, and drains, ultimately reaching final products by cross-contamination. This pathogen grows even under high salt conditions or refrigeration temperatures, remaining viable in various food products until the end of their shelf life. While the estimated incidence of listeriosis is lower than other enteric illnesses, infections caused by L. monocytogenes are more likely to lead to hospitalizations and fatalities. Despite the description of L. monocytogenes occurrence in Brazilian food-processing facilities and foods, there is a lack of consistent data regarding listeriosis cases and outbreaks directly associated with food consumption. Listeriosis requires rapid treatment with antibiotics and most drugs suitable for Gram-positive bacteria are effective against L. monocytogenes. Only a minority of clinical antibiotic-resistant L. monocytogenes strains have been described so far; whereas many strains recovered from food-processing facilities and foods exhibited resistance to antimicrobials not suitable against listeriosis. L. monocytogenes control in food industries is a challenge, demanding proper cleaning and application of sanitization procedures to eliminate this foodborne pathogen from the food-processing environment and ensure food safety. This review focuses on presenting the L. monocytogenes distribution in food-processing environment, food contamination, and control in the food industry, as well as the consequences of listeriosis to human health, providing a comparison of the current Brazilian situation with the international scenario.

  6. Longitudinal monitoring of Listeria monocytogenes and Listeria phages in seafood processing environments in Thailand.

    Science.gov (United States)

    Vongkamjan, Kitiya; Benjakul, Soottawat; Kim Vu, Hue Thi; Vuddhakul, Varaporn

    2017-09-01

    Listeria monocytogenes is a foodborne pathogen commonly found in environments of seafood processing, thus presenting a challenge for eradication from seafood processing facilities. Monitoring the prevalence and subtype diversity of L. monocytogenes together with phages that are specific to Listeria spp. ("Listeria phages") will provide knowledge on the bacteria-phage ecology in food processing plants. In this work, a total of 595 samples were collected from raw material, finished seafood products and environmental samples from different sites of a seafood processing plant during 17 sampling visits in 1.5 years of study. L. monocytogenes and Listeria spp. (non-monocytogenes) were found in 22 (3.7%) and 43 (7.2%) samples, respectively, whereas 29 Listeria phages were isolated from 9 (1.5%) phage-positive samples. DNA fingerprint analysis of L. monocytogenes isolates revealed 11 Random Amplified Polymorphic DNA (RAPD) profiles, with two subtypes were frequently observed over time. Our data reveal a presence of Listeria phages within the same seafood processing environments where a diverse set of L. monocytogenes subtypes was also found. Although serotype 4b was observed at lower frequency, data indicate that isolates from this seafood processing plant belonged to both epidemiologically important serotypes 1/2a and 4b, which may suggest a potential public health risk. Phages (all showed a unique genome size of 65 ± 2 kb) were classified into 9 host range groups, representing both broad- and narrow-host range. While most L. monocytogenes isolates from this facility were susceptible to phages, five isolates showed resistance to 12-20 phages. Variations in phage host range among Listeria phages isolated from food processing plant may affect a presence of a diverse set of L. monocytogenes isolates derived from the same processing environment in Thailand. Copyright © 2017 Elsevier Ltd. All rights reserved.

  7. Collection of Listeria monocytogenes Isolates from Milk, Dairy Products and Food Processing Environments in Slovakia for the Purposes of European Molecular Database

    OpenAIRE

    Kubicová Z.; Filipová M.; Jurovčíková J.; Cabanová L

    2017-01-01

    The molecular typing of Listeria monocytogenes isolates is an important tool for monitoring the spread of the strains in food chains, providing evidence for epidemiological investigations and for the detection of out-breaks. The demand of European typing data centralization, collection and sharing stimulated the generation of “EURL L. monocytogenes Database (EURL Lm DB)” in 2012 led by the European Union Reference Laboratory (EURL) for L. monocytogenes (ANSES Maisons-Alfort Laboratory for Foo...

  8. Microbiological criteria for Listeria monocytogenes in foods under special consideration of risk assessment approaches

    DEFF Research Database (Denmark)

    Nørrung, Birgit

    2000-01-01

    This paper shortly summarizes data related to risk assessment of Listeria monocytogenes. From available data on risk assessment, it is concluded that the levels of L. monocytogenes consumed is an important factor affecting the incidence of listeriosis. Foods that do not support the growth of L....... monocytogenes are unlikely to be a source of listeriosis, whereas foods that support the growth to high levels, should be the target of risk management efforts. Based on current epidemiological information from several countries, a concentration of L. monocytogenes not exceeding 100/g of food at the time...... of L. monocytogenes in the food during prevailing storage and distribution conditions is needed....

  9. Listeria monocytogenes isolated in ready-to-eat food in South Bačka region of Vojvodina province, Serbia

    Directory of Open Access Journals (Sweden)

    Gusman Vera

    2014-01-01

    Full Text Available Listeria monocytogenes is pathogenic bacterium that can contaminate food products during and after processing. As ready-to-eat food does not undergo any treatment to ensure its safety before consumption, the risk of foodborne disease must be considered if this pathogen is present in the food. As diseases caused by contaminated food are an important public health problem today, the aim of this study was to determine the prevalence of Listeria monocytogenes in different ready-to-eat food products. In the seven-month period from June 1 to December 31, 2011, a total of 1 380 food samples were examined in the Division of Sanitary Bacteriology, Center for Microbiology, Institute of Public Health of Vojvodina in Novi Sad. A total of 912 samples were analyzed for the presence of Listeria monocytogenes according to ISO 11290-2. The identity of suspected Listeria monocytogenes was confirmed using the VITEK 2 Compact system (BioMerieux, France. Out of 912 samples, Listeria monocytogenes was detected in 18 (1.97%. Listeria monocytogenes was mostly found in cooked meals (in 6 samples out of 18, sandwiches (4 samples and frozen food, such as ice-cream and frozen vegetables (4 samples. It was also found in tofu bread spreads (2 samples, cream cheese (1 sample and cakes (1 sample. The presence of Listeria monocytogenes in some ready-to-eat food could present a public health hazard, particularly to the high-risk population group, because of the high mortality rate associated with listeriosis and the widespread nature of the organism. Monitoring of listeriosis is essential to prevent foodborne outbreaks, and in assessing human health risk in ready-to-eat foods.

  10. Listeria monocytogenes serotype prevalence and biodiversity in diverse food products.

    Science.gov (United States)

    Hadjilouka, Agni; Andritsos, Nikolaos D; Paramithiotis, Spiros; Mataragas, Marios; Drosinos, Eleftherios H

    2014-12-01

    The aim of this study was to assess serotype prevalence and biodiversity of Listeria monocytogenes strains isolated from diverse food products, i.e., minced pork, fruits, and vegetables. Three hundred twenty-six samples previously purchased from supermarkets and street markets within the Athens area were studied for L. monocytogenes prevalence. A total of 121 strains were isolated from the 36 samples that were positive for L. monocytogenes. Serotyping was performed with multiplex PCR, and biodiversity was assessed with random amplified polymorphic DNA (RAPD) PCR analysis using M13, UBC155, and HLWL85 as primers and with repetitive element palindromic (rep) PCR analysis using (GTG)5 as the primer. The majority (17 of 22) of the contaminated minced pork samples contained strains identified as serotype 1/2a, either alone or in combination with strains belonging to serotypes 1/2b, 4a, 4c, or 4ab. However, all L. monocytogenes isolates from fruits and vegetables belonged to serotype 4b. Rep-PCR provided better differentiation of the isolates than did RAPD PCR and resulted in discrimination of the isolates into a larger number of unique profiles. Complete differentiation was achieved only with the combination of these subtyping techniques.

  11. Control of Listeria monocytogenes in food production plants

    Directory of Open Access Journals (Sweden)

    Dimitrijević Mirjana

    2008-01-01

    Full Text Available L. monocytogenes has been established in different plants for the production of food, including dairy plants, abattoirs, plants for the processing of fish, as well as those for the production of ready-to-eat (RTE food and this fact is being considered as the primary mechanism of food contamination with this bacteria. There is also the factor of numerous and diverse contaminated production equipment, because it has certain parts that are inaccessible for the necessary cleaning and disinfection. The temperature, position, as well as the material of the work surface are also linked to the contamination of plants with this bacteria. Investigations carried out so far have helped toward the better understanding of the manner and time of contamination of food items in the course of the production process, but there are still unresolved problems, including most certainly the biggest one - the adherence of bacteria and the creation of a biofilm, when the bacteria is in that condition more resistant to so-called stress factors which are usually used in the food industry for the purpose of decontamination of the surfaces with which foods come into contact. The control of L. monocytogenes in food production plants is possible primarily by using an integrated programme, compatible with the systems Hazard Analysis Critical Control Point (HACCP and Good Hygiene Practice (GHP, necessary in the production of food that is safe for the consumer. Essentially, the control measures that can contribute to reducing the incidence of findings of L.monocytogenes in the finished product, as well as the reducing of the level of contamination with this bacteria are linked, on the one hand, with hygiene procedures in the production process, and, on the other, with the applied technological procedures.

  12. Assessment of Listeria sp. Interference Using a Molecular Assay To Detect Listeria monocytogenes in Food.

    Science.gov (United States)

    Zittermann, Sandra I; Stanghini, Brenda; See, Ryan Soo; Melano, Roberto G; Boleszczuk, Peter; Murphy, Allana; Maki, Anne; Mallo, Gustavo V

    2016-01-01

    Detection of Listeria monocytogenes in food is currently based on enrichment methods. When L. monocytogenes is present with other Listeria species in food, the species compete during the enrichment process. Overgrowth competition of the nonpathogenic Listeria species might result in false-negative results obtained with the current reference methods. This potential issue was noted when 50 food samples artificially spiked with L. monocytogenes were tested with a real-time PCR assay and Canada's current reference method, MFHPB-30. Eleven of the samples studied were from foods naturally contaminated with Listeria species other than those used for spiking. The real-time PCR assay detected L. monocytogenes in all 11 of these samples; however, only 6 of these samples were positive by the MFHPB-30 method. To determine whether L. monocytogenes detection can be affected by other species of the same genus due to competition, an L. monocytogenes strain and a Listeria innocua strain with a faster rate of growth in the enrichment broth were artificially coinoculated at different ratios into ground pork meat samples and cultured according to the MFHPB-30 method. L. monocytogenes was detected only by the MFHPB-30 method when L. monocytogenes/L. innocua ratios were 6.0 or higher. In contrast, using the same enrichments, the real-time PCR assay detected L. monocytogenes at ratios as low as 0.6. Taken together, these findings support the hypothesis that L. monocytogenes can be outcompeted by L. innocua during the MFHPB-30 enrichment phase. However, more reliable detection of L. monocytogenes in this situation can be achieved by a PCR-based method mainly because of its sensitivity.

  13. Validation of the ANSR(®) Listeria monocytogenes Method for Detection of Listeria monocytogenes in Selected Food and Environmental Samples.

    Science.gov (United States)

    Caballero, Oscar; Alles, Susan; Le, Quynh-Nhi; Gray, R Lucas; Hosking, Edan; Pinkava, Lisa; Norton, Paul; Tolan, Jerry; Mozola, Mark; Rice, Jennifer; Chen, Yi; Ryser, Elliot; Odumeru, Joseph

    2016-01-01

    Work was conducted to validate performance of the ANSR(®) for Listeria monocytogenes method in selected food and environmental matrixes. This DNA-based assay involves amplification of nucleic acid via an isothermal reaction based on nicking enzyme amplification technology. Following single-step sample enrichment for 16-24 h for most matrixes, the assay is completed in 40 min using only simple instrumentation. When 50 distinct strains of L. monocytogenes were tested for inclusivity, 48 produced positive results, the exceptions being two strains confirmed by PCR to lack the assay target gene. Forty-seven nontarget strains (30 species), including multiple non-monocytogenes Listeria species as well as non-Listeria, Gram-positive bacteria, were tested, and all generated negative ANSR assay results. Performance of the ANSR method was compared with that of the U.S. Department of Agriculture, Food Safety and Inspection Service Microbiology Laboratory Guidebook reference culture procedure for detection of L. monocytogenes in hot dogs, pasteurized liquid egg, and sponge samples taken from an inoculated stainless steel surface. In addition, ANSR performance was measured against the U.S. Food and Drug Administration Bacteriological Analytical Manual reference method for detection of L. monocytogenes in Mexican-style cheese, cantaloupe, sprout irrigation water, and guacamole. With the single exception of pasteurized liquid egg at 16 h, ANSR method performance as quantified by the number of positives obtained was not statistically different from that of the reference methods. Robustness trials demonstrated that deliberate introduction of small deviations to the normal assay parameters did not affect ANSR method performance. Results of accelerated stability testing conducted using two manufactured lots of reagents predicts stability at the specified storage temperature of 4°C of more than 1 year.

  14. An insight into the isolation, enumeration, and molecular detection of Listeria monocytogenes in food

    Science.gov (United States)

    Law, Jodi Woan-Fei; Ab Mutalib, Nurul-Syakima; Chan, Kok-Gan; Lee, Learn-Han

    2015-01-01

    Listeria monocytogenes, a foodborne pathogen that can cause listeriosis through the consumption of food contaminated with this pathogen. The ability of L. monocytogenes to survive in extreme conditions and cause food contaminations have become a major concern. Hence, routine microbiological food testing is necessary to prevent food contamination and outbreaks of foodborne illness. This review provides insight into the methods for cultural detection, enumeration, and molecular identification of L. monocytogenes in various food samples. There are a number of enrichment and plating media that can be used for the isolation of L. monocytogenes from food samples. Enrichment media such as buffered Listeria enrichment broth, Fraser broth, and University of Vermont Medium (UVM) Listeria enrichment broth are recommended by regulatory agencies such as Food and Drug Administration-bacteriological and analytical method (FDA-BAM), US Department of Agriculture-Food and Safety (USDA-FSIS), and International Organization for Standardization (ISO). Many plating media are available for the isolation of L. monocytogenes, for instance, polymyxin acriflavin lithium-chloride ceftazidime aesculin mannitol, Oxford, and other chromogenic media. Besides, reference methods like FDA-BAM, ISO 11290 method, and USDA-FSIS method are usually applied for the cultural detection or enumeration of L. monocytogenes. most probable number technique is applied for the enumeration of L. monocytogenes in the case of low level contamination. Molecular methods including polymerase chain reaction, multiplex polymerase chain reaction, real-time/quantitative polymerase chain reaction, nucleic acid sequence-based amplification, loop-mediated isothermal amplification, DNA microarray, and next generation sequencing technology for the detection and identification of L. monocytogenes are discussed in this review. Overall, molecular methods are rapid, sensitive, specific, time- and labor-saving. In future, there are

  15. Impact of environmental factors on the culturability and viability of Listeria monocytogenes under conditions encountered in food processing plants.

    Science.gov (United States)

    Overney, Anaïs; Jacques-André-Coquin, Joséphine; Ng, Patricia; Carpentier, Brigitte; Guillier, Laurent; Firmesse, Olivier

    2017-03-06

    The ability of Listeria monocytogenes to adhere to and persist on surfaces for months or even years may be responsible for its transmission from contaminated surfaces to food products. Hence the necessity to find effective means to prevent the establishment of L. monocytogenes in food processing environments. The aim of this study was to assess, through a fractional experimental design, the environmental factors that could affect the survival of L. monocytogenes cells on surfaces to thereby prevent the persistence of this pathogen in conditions mimicking those encountered in food processing plants: culture with smoked salmon juice or meat exudate, use of two materials with different hygiene status, biofilm of L. monocytogenes in pure-culture or dual-culture with a Pseudomonas fluorescens strain, application of a drying step after cleaning and disinfection (C&D) and comparison of two strains of L. monocytogenes. Bacterial survival was assessed by culture, qPCR to quantify total cells, and propidium monoazide coupled with qPCR to quantify viable cells and highlight viable but non-culturable (VBNC) cells. Our results showed that failure to apply C&D causes cell persistence on surfaces. Moreover, the sanitation procedure leads only to a loss of culturability and appearance of VBNC populations. However, an additional daily drying step after C&D optimises the effectiveness of these procedures to reduce culturable populations. Our results reinforce the importance to use molecular tools to monitor viable pathogens in food processing plants to avoid underestimating the amounts of cells using only methods based on cell culture. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. An insight into the isolation, enumeration and molecular detection of Listeria monocytogenes in food

    Directory of Open Access Journals (Sweden)

    Jodi Woan-Fei Law

    2015-11-01

    Full Text Available Listeria monocytogenes, a foodborne pathogen that can cause listeriosis through the consumption of food contaminated with this pathogen. The ability of L. monocytogenes to survive in extreme conditions and cause food contaminations have become a major concern. Hence, routine microbiological food testing is necessary to prevent food contamination and outbreaks of foodborne illness. This review provides insight into the methods for cultural detection, enumeration and molecular identification of L. monocytogenes in various food samples. There are a number of enrichment and plating media that can be used for the isolation of L. monocytogenes from food samples. Enrichment media such as buffered Listeria Enrichment Broth (BLEB, Fraser broth and University of Vermont Medium (UVM Listeria enrichment broth are recommended by regulatory agencies such as FDA-BAM, USDA-FSIS and ISO. Many plating media are available for the isolation of L. monocytogenes, for instance, PALCAM, Oxford and other chromogenic media. Besides, reference methods like FDA-BAM, ISO 11290 method and USDA-FSIS method are usually applied for the cultural detection or enumeration of L. monocytogenes. MPN technique is applied for the enumeration of L. monocytogenes in the case of low level contamination. Molecular methods including polymerase chain reaction (PCR, multiplex polymerase chain reaction (mPCR, real-time/quantitative polymerase chain reaction (qPCR, nucleic acid sequence-based amplification (NASBA, loop-mediated isothermal amplification (LAMP, DNA microarray and Next Generation Sequencing (NGS technology for the detection and identification of L. monocytogenes are discussed in this review. Overall, molecular methods are rapid, sensitive, specific, time- and labour-saving. In future, there are chances for the development of new techniques for the detection and identification of foodborne with improved features.

  17. Prevalence and contamination levels of listeria monocytogenes in ready-to-eat foods in Tokyo, Japan.

    Science.gov (United States)

    Shimojima, Yukako; Ida, Miki; Nakama, Akiko; Nishino, Yukari; Fukui, Rie; Kuroda, Sumiyo; Hirai, Akihiko; Kai, Akemi; Sadamasu, Kenji

    2016-08-01

    We surveyed prevalence and contamination levels of Listeria monocytogenes in ready-to-eat foods between 2000 and 2012 in Tokyo. L. monocytogenes was isolated from 52 (1.7%) out of 2,980 samples. Comparing the prevalence in the study period, 2.2% were positive in the former period (2000-2005) and 1.2% in the latter (2006-2012). Using the most probable number (MPN) technique, 32 samples were contaminated with fewer than 0.3 L. monocytogenes/g, 10 samples with 0.3-1.0/g and 4 samples with more than 1.0/g (the maximum was 2.3/g). The most common serovar was 1/2a, followed by 1/2b, 4b and 1/2c. We revealed that ready-to-eat foods in Tokyo were contaminated with L. monocytogenes, although the contamination levels were low.

  18. Novel Biocontrol Methods for Listeria monocytogenes Biofilms in Food Production Facilities

    Directory of Open Access Journals (Sweden)

    Jessica A. Gray

    2018-04-01

    Full Text Available High mortality and hospitalization rates have seen Listeria monocytogenes as a foodborne pathogen of public health importance for many years and of particular concern for high-risk population groups. Food manufactures face an ongoing challenge in preventing the entry of L. monocytogenes into food production environments (FPEs due to its ubiquitous nature. In addition to this, the capacity of L. monocytogenes strains to colonize FPEs can lead to repeated identification of L. monocytogenes in FPE surveillance. The contamination of food products requiring product recall presents large economic burden to industry and is further exacerbated by damage to the brand. Poor equipment design, facility layout, and worn or damaged equipment can result in Listeria hotspots and biofilms where traditional cleaning and disinfecting procedures may be inadequate. Novel biocontrol methods may offer FPEs effective means to help improve control of L. monocytogenes and decrease cross contamination of food. Bacteriophages have been used as a medical treatment for many years for their ability to infect and lyse specific bacteria. Endolysins, the hydrolytic enzymes of bacteriophages responsible for breaking the cell wall of Gram-positive bacteria, are being explored as a biocontrol method for food preservation and in nanotechnology and medical applications. Antibacterial proteins known as bacteriocins have been used as alternatives to antibiotics for biopreservation and food product shelf life extension. Essential oils are natural antimicrobials formed by plants and have been used as food additives and preservatives for many years and more recently as a method to prevent food spoilage by microorganisms. Competitive exclusion occurs naturally among bacteria in the environment. However, intentionally selecting and applying bacteria to effect competitive exclusion of food borne pathogens has potential as a biocontrol application. This review discusses these novel biocontrol

  19. Novel Biocontrol Methods for Listeria monocytogenes Biofilms in Food Production Facilities.

    Science.gov (United States)

    Gray, Jessica A; Chandry, P Scott; Kaur, Mandeep; Kocharunchitt, Chawalit; Bowman, John P; Fox, Edward M

    2018-01-01

    High mortality and hospitalization rates have seen Listeria monocytogenes as a foodborne pathogen of public health importance for many years and of particular concern for high-risk population groups. Food manufactures face an ongoing challenge in preventing the entry of L. monocytogenes into food production environments (FPEs) due to its ubiquitous nature. In addition to this, the capacity of L. monocytogenes strains to colonize FPEs can lead to repeated identification of L. monocytogenes in FPE surveillance. The contamination of food products requiring product recall presents large economic burden to industry and is further exacerbated by damage to the brand. Poor equipment design, facility layout, and worn or damaged equipment can result in Listeria hotspots and biofilms where traditional cleaning and disinfecting procedures may be inadequate. Novel biocontrol methods may offer FPEs effective means to help improve control of L. monocytogenes and decrease cross contamination of food. Bacteriophages have been used as a medical treatment for many years for their ability to infect and lyse specific bacteria. Endolysins, the hydrolytic enzymes of bacteriophages responsible for breaking the cell wall of Gram-positive bacteria, are being explored as a biocontrol method for food preservation and in nanotechnology and medical applications. Antibacterial proteins known as bacteriocins have been used as alternatives to antibiotics for biopreservation and food product shelf life extension. Essential oils are natural antimicrobials formed by plants and have been used as food additives and preservatives for many years and more recently as a method to prevent food spoilage by microorganisms. Competitive exclusion occurs naturally among bacteria in the environment. However, intentionally selecting and applying bacteria to effect competitive exclusion of food borne pathogens has potential as a biocontrol application. This review discusses these novel biocontrol methods and their

  20. Novel Biocontrol Methods for Listeria monocytogenes Biofilms in Food Production Facilities

    Science.gov (United States)

    Gray, Jessica A.; Chandry, P. Scott; Kaur, Mandeep; Kocharunchitt, Chawalit; Bowman, John P.; Fox, Edward M.

    2018-01-01

    High mortality and hospitalization rates have seen Listeria monocytogenes as a foodborne pathogen of public health importance for many years and of particular concern for high-risk population groups. Food manufactures face an ongoing challenge in preventing the entry of L. monocytogenes into food production environments (FPEs) due to its ubiquitous nature. In addition to this, the capacity of L. monocytogenes strains to colonize FPEs can lead to repeated identification of L. monocytogenes in FPE surveillance. The contamination of food products requiring product recall presents large economic burden to industry and is further exacerbated by damage to the brand. Poor equipment design, facility layout, and worn or damaged equipment can result in Listeria hotspots and biofilms where traditional cleaning and disinfecting procedures may be inadequate. Novel biocontrol methods may offer FPEs effective means to help improve control of L. monocytogenes and decrease cross contamination of food. Bacteriophages have been used as a medical treatment for many years for their ability to infect and lyse specific bacteria. Endolysins, the hydrolytic enzymes of bacteriophages responsible for breaking the cell wall of Gram-positive bacteria, are being explored as a biocontrol method for food preservation and in nanotechnology and medical applications. Antibacterial proteins known as bacteriocins have been used as alternatives to antibiotics for biopreservation and food product shelf life extension. Essential oils are natural antimicrobials formed by plants and have been used as food additives and preservatives for many years and more recently as a method to prevent food spoilage by microorganisms. Competitive exclusion occurs naturally among bacteria in the environment. However, intentionally selecting and applying bacteria to effect competitive exclusion of food borne pathogens has potential as a biocontrol application. This review discusses these novel biocontrol methods and their

  1. An ecological perspective of Listeria monocytogenes biofilms in food processing facilities.

    Science.gov (United States)

    Valderrama, Wladir B; Cutter, Catherine N

    2013-01-01

    Listeria monocytogenes can enter the food chain at virtually any point. However, food processing environments seem to be of particular importance. From an ecological point of view, food processing facilities are microbial habitats that are constantly disturbed by cleaning and sanitizing procedures. Although L. monocytogenes is considered ubiquitous in nature, it is important to recognize that not all L. monocytogenes strains appear to be equally distributed; the distribution of the organism seems to be related to certain habitats. Currently, no direct evidence exists that L. monocytogenes-associated biofilms have played a role in food contamination or foodborne outbreaks, likely because biofilm isolation and identification are not part of an outbreak investigation, or the definition of biofilm is unclear. Because L. monocytogenes is known to colonize surfaces, we suggest that contamination patterns may be studied in the context of how biofilm formation is influenced by the environment within food processing facilities. In this review, direct and indirect epidemiological and phenotypic evidence of lineage-related biofilm formation capacity to specific ecological niches will be discussed. A critical view on the development of the biofilm concept, focused on the practical implications, strengths, and weaknesses of the current definitions also is discussed. The idea that biofilm formation may be an alternative surrogate for microbial fitness is proposed. Furthermore, current research on the influence of environmental factors on biofilm formation is discussed.

  2. Prevalence and serotype distribution of Listeria monocytogenes isolated from foods in Montevideo-Uruguay

    Directory of Open Access Journals (Sweden)

    Valeria Braga

    Full Text Available ABSTRACT The aim of this work was to study the prevalence of Listeria monocytogenes in foods obtained in retail shops and food industries located in Montevideo-Uruguay, and to identify the serogroups of the obtained isolates. Three-thousand one-hundred and seventy-five food samples (frozen, deli meats, ready-to-eat and cheese were analyzed. The obtained isolates were serogrouped by multiplex PCR and serotyped by conventional procedure. Genetic comparisons were performed using pulsed-field gel electrophoresis on a sub-set of isolates belonging to the same serotype successively recovered from the same establishment. L. monocytogenes was isolated from 11.2% of samples. The highest prevalence was observed in frozen foods (38%, followed by cheese (10%. 1/2b and 4b were the most frequently identified serotypes. In six of 236 analyzed establishments we successively recovered L. monocytogenes isolates belonging to the same serotype. Most of them corresponded to serotype 1/2b. Pulsed-field gel electrophoresis profiles suggest that at least 33% of L. monocytogenes 1/2b isolates are genetically related and that may remain viable for prolonged periods. The observed prevalence of L. monocytogenes was lower than reported in neighboring countries. Our findings highlight the role that frozen foods may play in the spread of this pathogen, and the relevance of serotypes 1/2b and 4b.

  3. Antimicrobial resistance of Listeria monocytogenes isolated from dairy-based food products.

    Science.gov (United States)

    Harakeh, Steve; Saleh, Imane; Zouhairi, Omar; Baydoun, Elias; Barbour, Elie; Alwan, Nisreen

    2009-06-15

    In this study Listeria monocytogenes (L. monocytogenes) was isolated from three traditionally consumed Lebanese dairy-based food products. One hundred and sixty four samples (45 samples of Baladi cheese, 36 samples of Shankleesh and 83 of Kishk) were collected from the Bekaa Valley in the Northeast region of Lebanon. Suspected Listeria colonies were selected and initially identified by using standard biochemical tests. Initial identification of the positive L. monocytogenes colonies was confirmed at the molecular level by Polymerase Chain Reaction (n=30) and the confirmed isolates were evaluated for their susceptibility to 10 commonly used antimicrobials. All of the 30 isolates were confirmed to be L. monocytogenes yielding a PCR product of approximately 660 base pairs (bp). L. monocytogenes was detected in 26.67%, 13.89% and 7.23% of the Baladi cheese, Shankleesh and Kishk samples, respectively. The highest resistance in L. monocytogenes isolates was noted against oxacillin (93.33%) followed by penicillin (90%). The results provide an indication of the contamination levels of dairy-based foods in Lebanon and highlight the emergence of multi-drug resistant Listeria in the environment.

  4. Prevalence and methodologies for detection, characterization and subtyping of Listeria monocytogenes and L. ivanovii in foods and environmental sources

    Directory of Open Access Journals (Sweden)

    Jin-Qiang Chen

    2017-09-01

    Full Text Available Listeria monocytogenes, one of the most important foodborne pathogens, can cause listeriosis, a lethal disease for humans. L. ivanovii, which is closely related to L. monocytogenes, is also widely distributed in nature and infects mainly warm-blooded ruminants, causing economic loss. Thus, there are high priority needs for methodologies for rapid, specific, cost-effective and accurate detection, characterization and subtyping of L. monocytogenes and L. ivanovii in foods and environmental sources. In this review, we (A described L. monocytogenes and L. ivanovii, world-wide incidence of listeriosis, and prevalence of various L. monocytogenes strains in food and environmental sources; (B comprehensively reviewed different types of traditional and newly developed methodologies, including culture-based, antigen/antibody-based, LOOP-mediated isothermal amplification, matrix-assisted laser desorption ionization-time of flight-mass spectrometry, DNA microarray, and genomic sequencing for detection and characterization of L. monocytogenes in foods and environmental sources; (C comprehensively summarized different subtyping methodologies, including pulsed-field gel electrophoresis, multi-locus sequence typing, ribotyping, and phage-typing, and whole genomic sequencing etc. for subtyping of L. monocytogenes strains from food and environmental sources; and (D described the applications of these methodologies in detection and subtyping of L. monocytogenes in foods and food processing facilities.

  5. Listeria monocytogenes cross-contamination of cheese: risk throughout the food supply chain.

    Science.gov (United States)

    Sauders, B D; D'Amico, D J

    2016-10-01

    Listeria monocytogenes has been the most common microbial cause of cheese-related recalls in both the United States and Canada in recent years. Since L. monocytogenes is inactivated by pasteurization, the majority of these cases have been linked to environmental and cross-contamination of fresh-soft, soft-ripened, and semi-soft cheeses. Cross-contamination of foods with L. monocytogenes is a continuous risk throughout the food supply chain and presents unique challenges for subsequent illness and outbreak investigations. Reports on outbreaks of listeriosis attributed to cross-contamination downstream from primary processing help highlight the critical role of epidemiological investigation coupled with coordinated molecular subtyping and surveillance in the recognition and investigation of complex foodborne outbreaks. Despite their complexity, environmental sampling throughout the supply chain coupled with improved genotyping approaches and concomitant analysis of foodborne illness epidemiological exposure data are needed to help resolve these and similar cases more rapidly and with greater confidence.

  6. Overview of food monitors

    International Nuclear Information System (INIS)

    Saito, I.

    2014-01-01

    May 11th 2011, nuclear accidents occurred by Tohoku Region Pacific Coast Earthquake made radioisotopes overflow in reactors and spread around the environments, and it caused risk of food contamination in these areas. And May 17th 2011, Ministry of Health, Labour and Welfare Japan announced provisional regulation values of radioactive materials in food in accordance with the food sanitation act. And they had notified the municipality to corresponding foods above the provisional regulation not had to be on sale. It causes massive needs for food monitoring in Japan. For reply to these massive needs, Hitachi Aloka Medical Ltd. commercialized food monitor: CAN-OSP-NAI in cooperation with CANBERRA Industries Inc. And after this, commercialized food screening system: FSS-101 for reply more expand food monitoring in Japan. This paper introduce Hitachi Aloka Medical Ltd. products which two types of food monitor product, provisional regulation values of radioactive materials in food in accordance with the food sanitation act and with comparing with past food monitoring, needs when accident happen. I wish this is going to be good report for help to radioactive and radiation detection in the future. (author)

  7. REAL-TIME PCR DETECTION OF LISTERIA MONOCYTOGENES IN FOOD SAMPLES OF ANIMAL ORIGIN

    Directory of Open Access Journals (Sweden)

    Jaroslav Pochop

    2013-02-01

    Full Text Available The aim of this study was to follow the contamination of food with Listeria monocytogenes by using Step One real time polymerase chain reaction (PCR. We used the PrepSEQ Rapid Spin Sample Preparation Kit for isolation of DNA and SensiFAST SYBR Hi-ROX Kit for the real-time PCR performance. In 24 samples of food of animal origin without incubation were detected strains of Listeria monocytogenes in 15 samples (swabs. Nine samples were negative. Our results indicated that the real-time PCR assay developed in this study could sensitively detect Listeria monocytogenes in food of animal origin without incubation. This could prevent infection caused by Listeria monocytogenes, and also could benefit food manufacturing companies by extending their product’s shelf-life as well as saving the cost of warehousing their food products while awaiting pathogen testing results. The rapid real-time PCR-based method performed very well compared to the conventional method. It is a fast, simple, specific and sensitive way to detect nucleic acids, which could be used in clinical diagnostic tests in the future.

  8. Listeria monocytogenes Identification in Food of Animal Origin Used with Real Time PCR

    Directory of Open Access Journals (Sweden)

    Jaroslav Pochop

    2013-10-01

    Full Text Available The aim of this study was to follow the contamination of food with Listeria monocytogenes by using Step One real time polymerase chain reaction (RT PCR. We used the PrepSEQ Rapid Spin Sample Preparation Kit for isolation of DNA and SensiFAST SYBR Hi-ROX Kit for the real-time PCR performance. In 20 samples of food of animal origin with incubation were detected strains of Listeria monocytogenes in 9 samples (swabs. Eleven samples were negative. Our results indicated that the real-time PCR assay developed in this study could sensitively detect Listeria monocytogenes in food of animal origin without incubation. This could prevent infection caused by Listeria monocytogenes, and also could benefit food manufacturing companies by extending their product’s shelf-life as well as saving the cost of warehousing their food products while awaiting pathogen testing results. The rapid real-time PCR-based method performed very well compared to the conventional method. It is a fast, simple, specific and sensitive way to detect nucleic acids, which could be used in clinical diagnostic tests in the future.

  9. Atmospheric plasma processes for microbial inactivation: food applications and stress response in Listeria monocytogenes

    OpenAIRE

    Gozzi, Giorgia

    2015-01-01

    This PhD thesis is focused on cold atmospheric plasma treatments (GP) for microbial inactivation in food applications. In fact GP represents a promising emerging technology alternative to the traditional methods for the decontamination of foods. The objectives of this work were to evaluate: - the effects of GP treatments on microbial inactivation in model systems and in real foods; - the stress response in L. monocytogenes following exposure to different GP treatments. As far as t...

  10. Tolerance to quaternary ammonium compound disinfectants may enhance growth of Listeria monocytogenes in the food industry.

    Science.gov (United States)

    Møretrø, Trond; Schirmer, Bjørn C T; Heir, Even; Fagerlund, Annette; Hjemli, Pernille; Langsrud, Solveig

    2017-01-16

    The antibacterial effect of disinfectants is crucial for the control of Listeria monocytogenes in food processing environments. Tolerance of L. monocytogenes to sublethal levels of disinfectants based on quaternary ammonium compounds (QAC) is conferred by the resistance determinants qacH and bcrABC. The presence and distribution of these genes have been anticipated to have a role in the survival and growth of L. monocytogenes in food processing environments where QAC based disinfectants are in common use. In this study, a panel of 680 L. monocytogenes from nine Norwegian meat- and salmon processing plants were grouped into 36 MLVA profiles. The presence of qacH and bcrABC was determined in 101 isolates from the 26 most common MLVA profiles. Five MLVA profiles contained qacH and two contained bcrABC. Isolates with qacH and bcrABC showed increased tolerance to the QAC Benzalkonium chloride (BC), with minimal inhibitory concentrations (MICs) of 5-12, 10-13 and 100ppm). A sample with lower BC concentrations (14ppm of chain length C-12 and 2.7ppm of chain length C-14) inhibited growth of L. monocytogenes not containing bcrABC or qacH, compared to strains with these genes. The study has shown that L. monocytogenes harbouring the QAC resistance genes qacH and bcrABC are prevalent in the food industry and that residuals of QAC may be present in concentrations after sanitation in the industry that result in a growth advantage for bacteria with such resistance genes. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

  11. Comparative genomics analyses revealed two virulent Listeria monocytogenes strains isolated from ready-to-eat food.

    Science.gov (United States)

    Lim, Shu Yong; Yap, Kien-Pong; Thong, Kwai Lin

    2016-01-01

    Listeria monocytogenes is an important foodborne pathogen that causes considerable morbidity in humans with high mortality rates. In this study, we have sequenced the genomes and performed comparative genomics analyses on two strains, LM115 and LM41, isolated from ready-to-eat food in Malaysia. The genome size of LM115 and LM41 was 2,959,041 and 2,963,111 bp, respectively. These two strains shared approximately 90% homologous genes. Comparative genomics and phylogenomic analyses revealed that LM115 and LM41 were more closely related to the reference strains F2365 and EGD-e, respectively. Our virulence profiling indicated a total of 31 virulence genes shared by both analysed strains. These shared genes included those that encode for internalins and L. monocytogenes pathogenicity island 1 (LIPI-1). Both the Malaysian L. monocytogenes strains also harboured several genes associated with stress tolerance to counter the adverse conditions. Seven antibiotic and efflux pump related genes which may confer resistance against lincomycin, erythromycin, fosfomycin, quinolone, tetracycline, and penicillin, and macrolides were identified in the genomes of both strains. Whole genome sequencing and comparative genomics analyses revealed two virulent L. monocytogenes strains isolated from ready-to-eat foods in Malaysia. The identification of strains with pathogenic, persistent, and antibiotic resistant potentials from minimally processed food warrant close attention from both healthcare and food industry.

  12. Microbiological challenge testing for Listeria monocytogenes in ready-to-eat food: a practical approach

    Directory of Open Access Journals (Sweden)

    Carlo Spanu

    2014-12-01

    Full Text Available Food business operators (FBOs are the primary responsible for the safety of food they place on the market. The definition and validation of the product’s shelf-life is an essential part for ensuring microbiological safety of food and health of consumers. In the frame of the Regulation (EC No 2073/2005 on microbiological criteria for foodstuffs, FBOs shall conduct shelf-life studies in order to assure that their food does not exceed the food safety criteria throughout the defined shelf-life. In particular this is required for ready-to-eat (RTE food that supports the growth of Listeria monocytogenes. Among other studies, FBOs can rely on the conclusion drawn by microbiological challenge tests. A microbiological challenge test consists in the artificial contamination of a food with a pathogen microorganism and aims at simulating its behaviour during processing and distribution under the foreseen storage and handling conditions. A number of documents published by international health authorities and research institutions describes how to conduct challenge studies. The authors reviewed the existing literature and described the methodology for implementing such laboratory studies. All the main aspects for the conduction of L. monocytogenes microbiological challenge tests were considered, from the selection of the strains, preparation and choice of the inoculum level and method of contamination, to the experimental design and data interpretation. The objective of the present document is to provide an exhaustive and practical guideline for laboratories that want to implement L. monocytogenes challenge testing on RTE food.

  13. Microbiological Challenge Testing for Listeria Monocytogenes in Ready-to-Eat Food: A Practical Approach.

    Science.gov (United States)

    Spanu, Carlo; Scarano, Christian; Ibba, Michela; Pala, Carlo; Spanu, Vincenzo; De Santis, Enrico Pietro Luigi

    2014-12-09

    Food business operators (FBOs) are the primary responsible for the safety of food they place on the market. The definition and validation of the product's shelf-life is an essential part for ensuring microbiological safety of food and health of consumers. In the frame of the Regulation (EC) No 2073/2005 on microbiological criteria for foodstuffs, FBOs shall conduct shelf-life studies in order to assure that their food does not exceed the food safety criteria throughout the defined shelf-life. In particular this is required for ready-to-eat (RTE) food that supports the growth of Listeria monocytogenes . Among other studies, FBOs can rely on the conclusion drawn by microbiological challenge tests. A microbiological challenge test consists in the artificial contamination of a food with a pathogen microorganism and aims at simulating its behaviour during processing and distribution under the foreseen storage and handling conditions. A number of documents published by international health authorities and research institutions describes how to conduct challenge studies. The authors reviewed the existing literature and described the methodology for implementing such laboratory studies. All the main aspects for the conduction of L. monocytogenes microbiological challenge tests were considered, from the selection of the strains, preparation and choice of the inoculum level and method of contamination, to the experimental design and data interpretation. The objective of the present document is to provide an exhaustive and practical guideline for laboratories that want to implement L. monocytogenes challenge testing on RTE food.

  14. Efflux pump-mediated benzalkonium chloride resistance in Listeria monocytogenes isolated from retail food.

    Science.gov (United States)

    Jiang, Xiaobing; Yu, Tao; Liang, Yu; Ji, Shengdong; Guo, Xiaowei; Ma, Jianmin; Zhou, Lijun

    2016-01-18

    In this study, efflux pump-mediated benzalkonium chloride (BC) resistance, including plasmid-encoded (Qac protein family and BcrABC) and chromosome-borne efflux pumps, was investigated in Listeria monocytogenes from retail food in China. Among the 59 L. monocytogenes strains, 13 (22.0%) strains were resistant to BC. The PCR results showed that bcrABC was harbored by 2 of 13 BC resistant strains. However, none of the qac genes were detected among the 59 strains. The bcrABC was absent in both of the plasmid cured strains, indicating that this BC resistance determinant was plasmid-encoded in the two bcrABC-positive strains. In the presence of reserpine, most of the bcrABC-negative strains had decreases in the MICs of BC, suggesting the existence of other efflux pumps and their role in BC resistance. After exposed to reserpine, the reduction in BC MICs was observed in the two cured strains, indicating that efflux pumps located on chromosome was also involved in BC resistance. Our findings suggest that food products may act as reservoirs for BC resistant isolates of L. monocytogenes and plasmid- and chromosome-encoded efflux pumps could mediate the BC resistance of L. monocytogenes, which is especially relevant to the adaption of this organism in food-related environments with frequent BC use. Copyright © 2015 Elsevier B.V. All rights reserved.

  15. Processing-Dependent and Clonal Contamination Patterns of Listeria monocytogenes in the Cured Ham Food Chain Revealed by Genetic Analysis.

    Science.gov (United States)

    Morganti, Marina; Scaltriti, Erika; Cozzolino, Paolo; Bolzoni, Luca; Casadei, Gabriele; Pierantoni, Marco; Foni, Emanuela; Pongolini, Stefano

    2016-02-01

    The quantitative and qualitative patterns of environmental contamination by Listeria monocytogenes were investigated in the production chain of dry-cured Parma ham. Standard arrays of surfaces were sampled in processing facilities during a single visit per plant in the three compartments of the food chain, i.e., ham production (19 plants) and postproduction, which was divided into deboning (43 plants) and slicing (25 plants) steps. The numbers of sampled surfaces were 384 in ham production, with 25 positive for L. monocytogenes, and 1,084 in postproduction, with 83 positives. Statistical analysis of the prevalence of contaminated surfaces showed that in ham production, contamination was higher at the beginning of processing and declined significantly toward the end, while in postproduction, prevalence rose toward the end of processing. Prevalence was higher in the deboning facilities than in slicing facilities and was dependent on the type of surface (floor/drainage > clothing > equipment). The qualitative pattern of contamination was investigated through an analysis of the survey isolates and a set of isolates derived from routine monitoring, including longitudinal isolations. Pulsed-field gel electrophoresis (PFGE) and whole-genome single-nucleotide polymorphism (SNP) analysis revealed a remarkable clonality of L. monocytogenes within plants, with the detection of 16 plant-specific clones out of 17 establishments with multiple isolates. Repeated detections of clonal isolates >6 months apart were also observed. Six was the maximum number of between-isolate differences in core SNPs observed within these clones. Based on the same six-SNP threshold, three clusters of clonal isolates, shared by six establishments, were also identified. The spread of L. monocytogenes within and between plants, as indicated by its clonal behavior, is a matter of concern for the hygienic management of establishments. Copyright © 2016, American Society for Microbiology. All Rights

  16. Collection of Listeria monocytogenes Isolates from Milk, Dairy Products and Food Processing Environments in Slovakia for the Purposes of European Molecular Database

    Directory of Open Access Journals (Sweden)

    Kubicová Z.

    2017-03-01

    Full Text Available The molecular typing of Listeria monocytogenes isolates is an important tool for monitoring the spread of the strains in food chains, providing evidence for epidemiological investigations and for the detection of out-breaks. The demand of European typing data centralization, collection and sharing stimulated the generation of “EURL L. monocytogenes Database (EURL Lm DB” in 2012 led by the European Union Reference Laboratory (EURL for L. monocytogenes (ANSES Maisons-Alfort Laboratory for Food Safety, France in close collaboration with Applied Maths. This database includes the typing results and epidemiological information on strains isolated from food, environmental or animal samples and it is in connection with human strains database TESSy (The European Surveillance System led by the ECDC (European Centre for Disease Prevention and Control. In total 147 L. monocytogenes isolates were examined by PFGE (pulsed field gel electrophoresis in 2014—2015 in VFI Dolny Kubin from different sources. Nearly half (68 of the 147 isolates in the national Slovak database came from milk or dairy products samples and the related manufacturing environment. In this work, 68 isolates associated with milk were selected and divided into 27 clusters (95 % similarity level after combined comparison analysis (AscI and ApaI by BioNumerics 6.6 software. Eight clusters included three or more similar PFGE profiles.

  17. Rapid detection of Listeria monocytogenes in foods, by a combination of PCR and DNA probe.

    Science.gov (United States)

    Ingianni, A; Floris, M; Palomba, P; Madeddu, M A; Quartuccio, M; Pompei, R

    2001-10-01

    Listeria monocytogenes is a frequent contaminant of water and foods. Its rapid detection is needed before some foods can be prepared for marketing. In this work L. monocytogenes has been searched for in foods, by a combination of polymerase chain reaction (PCR) and a DNA probe. Both PCR and the probe were prepared for recognizing a specific region of the internalin gene, which is responsible for the production of one of the most important pathogenic factors of Listeria. The combined use of PCR and the DNA probe was used for the detection of L. monocytogenes in over 180 environmental and food samples. Several detection methods were compared in this study, namely conventional culture methods; direct PCR; PCR after an enrichment step; a DNA probe alone; a DNA probe after enrichment and another commercially available gene-probe. Finally PCR and the DNA probe were used in series on all the samples collected. When the DNA probe was associated with the PCR, specific and accurate detection of listeria in the samples could be obtained in about a working-day. The present molecular method showed some advantages in terms of rapidity and specificity in comparison to the other aforementioned tests. In addition, it resulted as being easy to handle, even for non-specialized personnel in small diagnostic microbiology laboratories. Copyright 2001 Academic Press.

  18. Listeria monocytogenes isolates from food and food environment harbouring tetM and ermB resistance genes.

    Science.gov (United States)

    Haubert, L; Mendonça, M; Lopes, G V; de Itapema Cardoso, M R; da Silva, W P

    2016-01-01

    Listeria monocytogenes is a foodborne pathogen that has become an important cause of human and animal diseases worldwide. The purpose of this study was to evaluate the serotypes, virulence potential, antimicrobial resistance profile, and genetic relationships of 50 L. monocytogenes isolates from food and food environment in southern Brazil. In this study, the majority of L. monocytogenes isolates belonged to the serotypes 1/2b (42%) and 4b (26%), which are the main serotypes associated with human listeriosis. In addition, all isolates harboured internalin genes (inlA, inlC, inlJ), indicating a virulence potential. The isolates were sensitive to most of the antimicrobial compounds analysed, and five isolates (10%) were multi-resistant. Two isolates harboured antimicrobial resistance genes (tetM and ermB) and in one of them, the gene was present in the plasmid. Moreover, according to the pulsed field gel electrophoresis assay, two multi-resistant isolates were a single clone isolated from food and the processing plant. The isolates were susceptible to the most frequently used antibiotics for listeriosis treatment. However, the presence of multidrug-resistant isolates and antimicrobial resistance genes including in the plasmid could even be transferred between bacterial species, suggesting a potential health risk to consumers and a potential risk of spreading multi-resistance genes to other bacteria. Listeria monocytogenes is an important agent of foodborne diseases. The results of this study suggest a potential capacity of L. monocytogenes isolates from food and food environment to cause human infections. Antimicrobial multi-resistance profiles were detected in 10%, and two isolates harboured tetM and ermB resistance genes. Moreover, the present research can help to build up a better knowledge about antimicrobial resistance of L. monocytogenes. Additionally, we found one isolate carrying tetM resistance gene in a plasmid, that suggests a possible transmission

  19. Prevalence, enumeration and pheno- and genotypic characteristics of Listeria monocytogenes isolated from raw foods in South China

    Directory of Open Access Journals (Sweden)

    Moutong eChen

    2015-09-01

    Full Text Available Listeria monocytogenes is an important foodborne pathogen that can cause serious illness in immunocompromised individuals, pregnant women, the elderly, and newborns. The aim of this study was to: (i evaluate the prevalence and contamination level (most probable number, MPN of L. monocytogenes in 567 retail raw foods (fishery products, n=154; raw/fresh meat, n=123; frozen foods, n=110; edible fungi, n=108; vegetables, n=72 collected from South China and (ii to gain further knowledge on the phenotype and genotype distributions of this important foodborne pathogen. Approximately 22% of the samples were positive for L. monocytogenes. The contamination levels were between 0.3 and 10 MPN/g in 75.0%, between 10 and 100 MPN/g in 11.0% and less than 100 MPN/g in 14.0% of the countable samples. Five serogroups were identified among the177 foodborne L. monocytogenes isolates, with1/2a-3a (42.4% and1/2b-3b (26.0% serogroups being the most dominant. Serogroup I.1 and II.2 were only found in the edible mushrooms, while serogroup III was dominant in the fishery products, suggesting that specific serogroups of L. monocytogenes may have distinct ecological niches. Ten (5.6% L. monocytogenes isolates exhibited multidrug resistance. Genetic relatedness analysis revealed the absence of distinct associations between specific food types, antibiotic resistance, serogroups, and genetic diversity. The present study provided the first baseline data on the prevalence, contamination level, and characteristics of L. monocytogenes isolated from raw foods in South China. Some multidrug resistant strains belonged to the epidemiologically important serogroups (I.1 and II.1, implying a potential public health risk. In addition, these findings also provide basic information for the Chinese food safety associated authorities to draft appropriate standards to control L. monocytogenes contamination and improve microbiological safety of raw foods.

  20. Romer Labs RapidChek®Listeria monocytogenes Test System for the Detection of L. monocytogenes on Selected Foods and Environmental Surfaces.

    Science.gov (United States)

    Juck, Gregory; Gonzalez, Verapaz; Allen, Ann-Christine Olsson; Sutzko, Meredith; Seward, Kody; Muldoon, Mark T

    2018-04-27

    The Romer Labs RapidChek ® Listeria monocytogenes test system (Performance Tested Method ℠ 011805) was validated against the U.S. Department of Agriculture-Food Safety and Inspection Service Microbiology Laboratory Guidebook (USDA-FSIS/MLG), U.S. Food and Drug Association Bacteriological Analytical Manual (FDA/BAM), and AOAC Official Methods of Analysis ℠ (AOAC/OMA) cultural reference methods for the detection of L. monocytogenes on selected foods including hot dogs, frozen cooked breaded chicken, frozen cooked shrimp, cured ham, and ice cream, and environmental surfaces including stainless steel and plastic in an unpaired study design. The RapidChek method uses a proprietary enrichment media system, a 44-48 h enrichment at 30 ± 1°C, and detects L. monocytogenes on an immunochromatographic lateral flow device within 10 min. Different L. monocytogenes strains were used to spike each of the matrixes. Samples were confirmed based on the reference method confirmations and an alternate confirmation method. A total of 140 low-level spiked samples were tested by the RapidChek method after enrichment for 44-48 h in parallel with the cultural reference method. There were 88 RapidChek presumptive positives. One of the presumptive positives was not confirmed culturally. Additionally, one of the culturally confirmed samples did not exhibit a presumptive positive. No difference between the alternate confirmation method and reference confirmation method was observed. The respective cultural reference methods (USDA-FSIS/MLG, FDA/BAM, and AOAC/OMA) produced a total of 63 confirmed positive results. Nonspiked samples from all foods were reported as negative for L. monocytogenes by all methods. Probability of detection analysis demonstrated no significant differences in the number of positive samples detected by the RapidChek method and the respective cultural reference method.

  1. Detection of Listeria monocytogenes in ready-to-eat food by Step One real-time polymerase chain reaction.

    Science.gov (United States)

    Pochop, Jaroslav; Kačániová, Miroslava; Hleba, Lukáš; Lopasovský, L'ubomír; Bobková, Alica; Zeleňáková, Lucia; Stričík, Michal

    2012-01-01

    The aim of this study was to follow contamination of ready-to-eat food with Listeria monocytogenes by using the Step One real time polymerase chain reaction (PCR). We used the PrepSEQ Rapid Spin Sample Preparation Kit for isolation of DNA and MicroSEQ® Listeria monocytogenes Detection Kit for the real-time PCR performance. In 30 samples of ready-to-eat milk and meat products without incubation we detected strains of Listeria monocytogenes in five samples (swabs). Internal positive control (IPC) was positive in all samples. Our results indicated that the real-time PCR assay developed in this study could sensitively detect Listeria monocytogenes in ready-to-eat food without incubation.

  2. Genotypic and virulence characteristics of Listeria monocytogenes recovered from food items in Lebanon.

    Science.gov (United States)

    Haidar-Ahmad, Nathaline; Kissoyan, Kohar Annie B; Fadlallah, Sukayna M; El-Hajj, Rima; Saleh, Majd; Ghosn, Nada; Matar, Ghassan M

    2016-08-02

    Listeria monocytogenes is the agent of listeriosis, a life threatening foodborne disease for immunocompromised patients and pregnant women. This bacterium is not routinely screened for in Lebanon and there is lack of data about the prevalent strains and their potential pathogenicity. To that purpose, this study was undertaken to characterize L. monocytogenes from various food products, by assessing the in vitro biofilm forming ability, detecting their virulence potential, and characterizing them at the strain level. Fifty-nine isolates were obtained from the Lebanese Agriculture Research Institute (LARI). They were collected in 2012-2013 from local and imported food products in the Lebanese market. Biofilm formation was measured using the Microtiter Plate Assay. PCR amplification was performed for three main virulence genes; hly, actA, and inlB. Pulsed field gel electrophoresis (PFGE) and BIONUMERICS analysis were carried out. Lebanese isolates from cheese and raw meat showed higher biofilm formation than imported and Lebanese seafood isolates. A total of 100% of the isolates were PCR positive for hly and actA genes and 98.3% for inlB gene. PFGE analysis demonstrated the prevalence of 13 different subtypes with 100% similarity. Detected subtypes were grouped into 6 clusters of 90% genomic similarity. Clustered subtypes were particular to the country of origin. This study highlights the presence of L. monocytogenes in the Lebanese food market with high pathogenic potential and stresses the importance of enhanced surveillance and the implementation of strict regulations on local and imported food. Future investigations may be conducted on a larger food selection.

  3. Isolation and biochemical and molecular characterization of Listeria monocytogenes in food

    International Nuclear Information System (INIS)

    Helel, Salma

    2008-01-01

    monocytogenes is a Gram-positive bacteria, saprophytic, non-spore. This is an extremely resistant seeds to environmental conditions outside, especially since the cold psychrotrophic. It can contaminate raw vegetables, cooked meals ready for consumption or foods to be stored in the refrigerator, such as cheese or meat. It is the bacteria responsible for listeriosis. It threatens first unborn children, infants, pregnant women, the elderly and people whose immune system is weakened. Strains of Listeria spp isolated from foods (seafood, meat, meat) were first identified at the stage of the genus by classical tests (Gram staining, catalase test, oxidase test and mobility) and stage of the test case by hemolysis, CAMP test and the gallery Api Listeria. Biochemical characterization allowed after a numerical analysis, to assign 100% of isolates to the genus Listeria. Molecular characterization was performed by PCR amplification of genes coding for protein p60 (iap), the listeriolysine O (hly), the Phosphatidylinositol Phospholipase C (PI-PLC plca) Phosphatidylcholine Phospholipase C (plcB). The result showed an amplification of the iap gene of 100% of the hly gene, plca, plcB of 31.81%. This characterization represents an identification of the collection on the genetic level and shows that 31.81% of isolates, is likely to express the genes responsible for virulence factors of L. monocytogenes, to produce listeriolysine O, phospholipase C and Lecithinase. The molecular identification was performed by microarray technique and identified isolates L. September monocytogenes (five original clinical isolates and two food-borne), fourteen L. innocua (of food) and a strain not identified by DNA chip.. (Author)

  4. Phenotypic and Genotypic Analysis of Antimicrobial Resistance among Listeria monocytogenes Isolated from Australian Food Production Chains

    Directory of Open Access Journals (Sweden)

    Annaleise Wilson

    2018-02-01

    Full Text Available The current global crisis of antimicrobial resistance (AMR among important human bacterial pathogens has been amplified by an increased resistance prevalence. In recent years, a number of studies have reported higher resistance levels among Listeria monocytogenes isolates, which may have implications for treatment of listeriosis infection where resistance to key treatment antimicrobials is noted. This study examined the genotypic and phenotypic AMR patterns of 100 L. monocytogenes isolates originating from food production supplies in Australia and examined this in the context of global population trends. Low levels of resistance were noted to ciprofloxacin (2% and erythromycin (1%; however, no resistance was observed to penicillin G or tetracycline. Resistance to ciprofloxacin was associated with a mutation in the fepR gene in one isolate; however, no genetic basis for resistance in the other isolate was identified. Resistance to erythromycin was correlated with the presence of the ermB resistance gene. Both resistant isolates belonged to clonal complex 1 (CC1, and analysis of these in the context of global CC1 isolates suggested that they were more similar to isolates from India rather than the other CC1 isolates included in this study. This study provides baseline AMR data for L. monocytogenes isolated in Australia, identifies key genetic markers underlying this resistance, and highlights the need for global molecular surveillance of resistance patterns to maintain control over the potential dissemination of AMR isolates.

  5. Atlas(®) Listeria monocytogenes LmG2 Detection Assay Using Transcription Mediated Amplification to Detect Listeria monocytogenes in Selected Foods and Stainless Steel Surface.

    Science.gov (United States)

    Bres, Vanessa; Yang, Hua; Hsu, Ernie; Ren, Yan; Cheng, Ying; Wisniewski, Michele; Hanhan, Maesa; Zaslavsky, Polina; Noll, Nathan; Weaver, Brett; Campbell, Paul; Reshatoff, Michael; Becker, Michael

    2014-01-01

    The Atlas Listeria monocytogenes LmG2 Detection Assay, developed by Roka Bioscience Inc., was compared to a reference culture method for seven food types (hot dogs, cured ham, deli turkey, chicken salad, vanilla ice cream, frozen chocolate cream pie, and frozen cheese pizza) and one surface (stainless steel, grade 316). A 125 g portion of deli turkey was tested using a 1:4 food:media dilution ratio, and a 25 g portion for all other foods was tested using 1:9 food:media dilution ratio. The enrichment time and media for Roka's method was 24 to 28 h for 25 g food samples and environmental surfaces, and 44 to 48 h for 125 g at 35 ± 2°C in PALCAM broth containing 0.02 g/L nalidixic acid. Comparison of the Atlas Listeria monocytogenes LmG2 Detection Assay to the reference method required an unpaired approach. For each matrix, 20 samples inoculated at a fractional level and five samples inoculated at a high level with a different strain of Listeria monocytogenes were tested by each method. The Atlas Listeria monocytogenes LmG2 Detection Assay was compared to the Official Methods of Analysis of AOAC INTERNATIONAL 993.12 method for dairy products, the U.S. Department of Agriculture, Food Safety and Inspection Service, Microbiology Laboratory Guidebook 8.08 method for ready-to-eat meat and environmental samples, and the U.S. Food and Drug Administration Bacteriological Analytical Manual, Chapter 10 method for frozen foods. In the method developer studies, Roka's method, at 24 h (or 44 h for 125 g food samples), had 126 positives out of 200 total inoculated samples, compared to 102 positives for the reference methods at 48 h. In the independent laboratory studies, vanilla ice cream, deli turkey and stainless steel grade 316 were evaluated. Roka's method, at 24 h (or 44 h for 125 g food samples), had 64 positives out of 75 total inoculated samples compared to 54 positives for the reference methods at 48 h. The Atlas Listeria monocytogenes LmG2 Detection Assay detected all 50

  6. Survival of Listeria monocytogenes with different antibiotic resistance patterns to food-associated stresses.

    Science.gov (United States)

    Komora, Norton; Bruschi, Carolina; Magalhães, Rui; Ferreira, Vânia; Teixeira, Paula

    2017-03-20

    The ongoing rise of antibiotic resistant microbial pathogens has become one of the major public health threats worldwide. Despite all the effort and actions taken so far, a proliferation of antibiotic resistant (AR) and multi-antibiotic resistant (MAR) strains is still observed, including in foodborne pathogens. This trend has been also noted recently for isolates of Listeria monocytogenes, a species that, although remaining largely sensitive to clinically relevant antimicrobials, has been reported to develop increased tolerance to antibiotics, particularly in isolates recovered from the food-chain. In this study we compared the ability of MAR (n=8), AR (n=18) and antibiotic susceptible (AS, n=11) L. monocytogenes strains from food and clinical origin to survive to different environmental stress conditions, including temperature (58°C), acidic stress (1% v/v lactic acid, pH3.5), and osmotic stress (37% w/v NaCl). The presence of antibiotic active efflux among MAR and AR strains, and its role on L. monocytogenes tolerance to different antimicrobial compounds was also investigated, namely; hydrogen peroxide; organic acids (acetic, citric and lactic); nisin; benzalkonium chloride (BC); and, sodium nitrite. While no significant differences were observed in the survival of the 37 strains exposed to high temperature (58°C), overall the mean logarithmic reduction of clinical strains was statistically lower after acid and salt exposure than that observed for strains of food origin; but both food and clinical strains resistant to two or three antibiotics were significantly less susceptible to acid (lactic acid 1% v/v) and osmotic stresses (37% w/v NaCl) when compared to AS strains. Using the EtBr-agar Cartwheel method, it was possible to detect efflux pumps in three of the 26 MAR and AR isolates, including one control strain; the active efflux in theses isolates was proven to be associated with fluoroquinolone resistance, and possible extrusion of BC and hydrogen peroxide

  7. Detection of antimicrobial sensitiveness of isolates of Listeria monocytogenes from food chain using Vitek 2 Compact Biomerieux

    Directory of Open Access Journals (Sweden)

    Jankuloski Dean

    2010-05-01

    Full Text Available Sensitivity of 26 Listeria monocytogenes isolates toward 18 antimicrobial substances used in veterinary and human medicine was examined using the automated VITEK 2 Compact system bioMerieux. The obtained results indicate that L. monocytogenes strains isolated from food and food processing environment had resistance to several or more antimicrobial substances that are commonly used in the treatment in animals and humans. Results showed resistance of all 26 (100% isolates toward Benzylpenicilin, Ampicilin/Sublactam, Oxacillin, Imipenem and Fosfomycine. Also 7 of the isolates (26.9% were resistant to Clindamiycin, 3 (11.5% to Quinupristion/Dalfopristin and 1 strain to Teicoplanin, Vancomycin, Tetracycline and Fusic acid, respectively.

  8. Diamond like carbon Ag nanocomposites as a control measure against Campylobacter jejuni and Listeria monocytogenes on food preparation surfaces

    DEFF Research Database (Denmark)

    Tamulevičius, Sigitas; Zakarienė, Gintarė; Novoslavskij, Aleksandr

    2018-01-01

    on selective agars and quantitative real-time PCR (qPCR) including staining with propidium monoazide (PMA). It was determined, that DLC:Ag film was the most efficient coating in the reduction of C. jejuni and L. monocytogenes numbers. Culture-based enumeration revealed that C. jejuni numbers were reduced......:Ag antimicrobial surface showed a reduced ability to grow on culture media, but maintained viability during the whole experiment. Nonetheless, DLC:Ag antimicrobial surface could be further considered for the reduction of cross-contamination risk from food preparation surfaces due to their contamination with C....... jejuni and L. monocytogenes in domestic and commercial kitchens or food establishments....

  9. Current Knowledge on Listeria monocytogenes Biofilms in Food-Related Environments: Incidence, Resistance to Biocides, Ecology and Biocontrol

    Directory of Open Access Journals (Sweden)

    Pedro Rodríguez-López

    2018-06-01

    Full Text Available Although many efforts have been made to control Listeria monocytogenes in the food industry, growing pervasiveness amongst the population over the last decades has made this bacterium considered to be one of the most hazardous foodborne pathogens. Its outstanding biocide tolerance capacity and ability to promiscuously associate with other bacterial species forming multispecies communities have permitted this microorganism to survive and persist within the industrial environment. This review is designed to give the reader an overall picture of the current state-of-the-art in L. monocytogenes sessile communities in terms of food safety and legislation, ecological aspects and biocontrol strategies.

  10. Estimation of Microbial Contamination of Food from Prevalence and Concentration Data: Application to Listeria monocytogenes in Fresh Vegetables▿

    Science.gov (United States)

    Crépet, Amélie; Albert, Isabelle; Dervin, Catherine; Carlin, Frédéric

    2007-01-01

    A normal distribution and a mixture model of two normal distributions in a Bayesian approach using prevalence and concentration data were used to establish the distribution of contamination of the food-borne pathogenic bacteria Listeria monocytogenes in unprocessed and minimally processed fresh vegetables. A total of 165 prevalence studies, including 15 studies with concentration data, were taken from the scientific literature and from technical reports and used for statistical analysis. The predicted mean of the normal distribution of the logarithms of viable L. monocytogenes per gram of fresh vegetables was −2.63 log viable L. monocytogenes organisms/g, and its standard deviation was 1.48 log viable L. monocytogenes organisms/g. These values were determined by considering one contaminated sample in prevalence studies in which samples are in fact negative. This deliberate overestimation is necessary to complete calculations. With the mixture model, the predicted mean of the distribution of the logarithm of viable L. monocytogenes per gram of fresh vegetables was −3.38 log viable L. monocytogenes organisms/g and its standard deviation was 1.46 log viable L. monocytogenes organisms/g. The probabilities of fresh unprocessed and minimally processed vegetables being contaminated with concentrations higher than 1, 2, and 3 log viable L. monocytogenes organisms/g were 1.44, 0.63, and 0.17%, respectively. Introducing a sensitivity rate of 80 or 95% in the mixture model had a small effect on the estimation of the contamination. In contrast, introducing a low sensitivity rate (40%) resulted in marked differences, especially for high percentiles. There was a significantly lower estimation of contamination in the papers and reports of 2000 to 2005 than in those of 1988 to 1999 and a lower estimation of contamination of leafy salads than that of sprouts and other vegetables. The interest of the mixture model for the estimation of microbial contamination is discussed. PMID

  11. Listeria monocytogenes Prevalence and Characteristics in Retail Raw Foods in China.

    Science.gov (United States)

    Wu, Shi; Wu, Qingping; Zhang, Jumei; Chen, Moutong; Yan, Ze An; Hu, Huijuan

    2015-01-01

    The prevalence and levels of Listeria monocytogenes in retail raw foods covering most provincial capitals in China were studied with testing of 1036 samples of vegetables, edible mushrooms, raw meat, aquatic products and quick-frozen products from September 2012 to January 2014. The total prevalence of Listeria monocytogenes was 20.0% (207/1036), and the most probable number (MPN) values of 65.7% of the positive samples ranged from 0.3 to 110 MPN/g. Geographical differences were observed in this survey, and the results of both qualitative and quantitative methods indicated that the levels in the samples from North China were higher than those in the samples from South China. A total of 248 isolates were analyzed, of which approximately half belonged to molecular serogroup 1/2a-3a (45.2%), followed by 1/2b-3b-7 (30.6%), 1/2c-3c (16.1%), 4b-4d-4e (5.2%) and 4a-4c (2.8%). Most of the isolates carried hly (100%), inlB (98.8%), inlA (99.6%), inlC (98.0%) and inlJ (99.2%), and 44.8% of the isolates were llsX-positive. Seventeen epidemic clones (ECs) were detected, with 7 strains belonging to ECI (2.8%) and 10 belonging to ECIII (4.03%). Resistance to clindamycin (46.8%) was commonly observed, and 59 strains (23.8%) were susceptible to all 14 tested antibiotics, whereas 84 (33.9%) showed an intermediate level of resistance or were resistant to two or more antibiotics, including 7 multi-resistant strains that exhibited resistance to more than 10 antibiotics. The data obtained in the present study provides useful information for assessment of the possible risk posed to Chinese consumers, and this information will have a significant public health impact in China. Furthermore, the presence of virulence markers, epidemic clones, as well as the antibiotic resistance amongst the isolates strongly implies that many of these strains might be capable of causing listeriosis, and more accurate treatment of human listeriosis with effective antibiotics should be considered. This

  12. Listeria monocytogenes Prevalence and Characteristics in Retail Raw Foods in China.

    Directory of Open Access Journals (Sweden)

    Shi Wu

    Full Text Available The prevalence and levels of Listeria monocytogenes in retail raw foods covering most provincial capitals in China were studied with testing of 1036 samples of vegetables, edible mushrooms, raw meat, aquatic products and quick-frozen products from September 2012 to January 2014. The total prevalence of Listeria monocytogenes was 20.0% (207/1036, and the most probable number (MPN values of 65.7% of the positive samples ranged from 0.3 to 110 MPN/g. Geographical differences were observed in this survey, and the results of both qualitative and quantitative methods indicated that the levels in the samples from North China were higher than those in the samples from South China. A total of 248 isolates were analyzed, of which approximately half belonged to molecular serogroup 1/2a-3a (45.2%, followed by 1/2b-3b-7 (30.6%, 1/2c-3c (16.1%, 4b-4d-4e (5.2% and 4a-4c (2.8%. Most of the isolates carried hly (100%, inlB (98.8%, inlA (99.6%, inlC (98.0% and inlJ (99.2%, and 44.8% of the isolates were llsX-positive. Seventeen epidemic clones (ECs were detected, with 7 strains belonging to ECI (2.8% and 10 belonging to ECIII (4.03%. Resistance to clindamycin (46.8% was commonly observed, and 59 strains (23.8% were susceptible to all 14 tested antibiotics, whereas 84 (33.9% showed an intermediate level of resistance or were resistant to two or more antibiotics, including 7 multi-resistant strains that exhibited resistance to more than 10 antibiotics. The data obtained in the present study provides useful information for assessment of the possible risk posed to Chinese consumers, and this information will have a significant public health impact in China. Furthermore, the presence of virulence markers, epidemic clones, as well as the antibiotic resistance amongst the isolates strongly implies that many of these strains might be capable of causing listeriosis, and more accurate treatment of human listeriosis with effective antibiotics should be considered. This

  13. Listeria monocytogenes Prevalence and Characteristics in Retail Raw Foods in China

    Science.gov (United States)

    Wu, Shi; Wu, Qingping; Zhang, Jumei; Chen, Moutong; Yan, Ze′an; Hu, Huijuan

    2015-01-01

    The prevalence and levels of Listeria monocytogenes in retail raw foods covering most provincial capitals in China were studied with testing of 1036 samples of vegetables, edible mushrooms, raw meat, aquatic products and quick-frozen products from September 2012 to January 2014. The total prevalence of Listeria monocytogenes was 20.0% (207/1036), and the most probable number (MPN) values of 65.7% of the positive samples ranged from 0.3 to 110 MPN/g. Geographical differences were observed in this survey, and the results of both qualitative and quantitative methods indicated that the levels in the samples from North China were higher than those in the samples from South China. A total of 248 isolates were analyzed, of which approximately half belonged to molecular serogroup 1/2a-3a (45.2%), followed by 1/2b-3b-7 (30.6%), 1/2c-3c (16.1%), 4b-4d-4e (5.2%) and 4a-4c (2.8%). Most of the isolates carried hly (100%), inlB (98.8%), inlA (99.6%), inlC (98.0%) and inlJ (99.2%), and 44.8% of the isolates were llsX-positive. Seventeen epidemic clones (ECs) were detected, with 7 strains belonging to ECI (2.8%) and 10 belonging to ECIII (4.03%). Resistance to clindamycin (46.8%) was commonly observed, and 59 strains (23.8%) were susceptible to all 14 tested antibiotics, whereas 84 (33.9%) showed an intermediate level of resistance or were resistant to two or more antibiotics, including 7 multi-resistant strains that exhibited resistance to more than 10 antibiotics. The data obtained in the present study provides useful information for assessment of the possible risk posed to Chinese consumers, and this information will have a significant public health impact in China. Furthermore, the presence of virulence markers, epidemic clones, as well as the antibiotic resistance amongst the isolates strongly implies that many of these strains might be capable of causing listeriosis, and more accurate treatment of human listeriosis with effective antibiotics should be considered. This

  14. In vitro detection of pathogenic Listeria monocytogenes from food sources by conventional, molecular and cell culture method

    Directory of Open Access Journals (Sweden)

    J.A. Khan

    2013-09-01

    Full Text Available Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO. A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG; R: CCTCCAGAGTGATCGATGTT complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR. PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%, followed by fish meat (4.0%, and then beef (2.5%. Among various milk and milk products, curd (2.0% showed the highest prevalence, followed by raw milk (1.3%. The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 µL and 50 µL of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro resulted positive in twenty four

  15. Genes involved in Listeria monocytogenes biofilm formation at a simulated food processing plant temperature of 15 °C

    DEFF Research Database (Denmark)

    Piercey, Marta J.; Hingston, Patricia A.; Hansen, Lisbeth Truelstrup

    2016-01-01

    proteins. Deficient mutants (n=5) contained interruptions in genes related to peptidoglycan,teichoic acid, or lipoproteins. Enhanced mutants produced significantly (p b 0.05) higher cell densities in biofilm formed on stainless steel (SS) coupons at 15 °C (48 h) than deficient mutants, which were also more......Listeria monocytogenes is a pathogenic foodborne bacterium whose persistence in food processing environments is in part attributed to its biofilm formation. Most biofilm studies have been carried out at 30–37 °C rather than at temperatures found in the food processing plants (i.e., 10–20 °C......). The objective of the present study was to mine for novel genes that contribute to L. monocytogenes biofilm formation at 15 °C using the random insertional mutagenesisapproach. A library of 11,024 L. monocytogenes 568 (serotype 1/2a) Himar1 insertional mutants wascreated. Mutants with reduced or enhanced biofilm...

  16. Listeria monocytogenes in RTE foods marketed in Italy: prevalence and automated EcoRI ribotyping of the isolates.

    Science.gov (United States)

    Meloni, Domenico; Galluzzo, Pietro; Mureddu, Anna; Piras, Francesca; Griffiths, Mansel; Mazzette, Rina

    2009-02-15

    The aims of the present study were: (a) to investigate the prevalence and the enumeration of Listeria monocytogenes in 200 samples of ready to eat (RTE) foods of animal and vegetal origin collected from different outlets and processing plants in Sardinia; (b) to characterize the isolates by phenotypical and molecular methods; (c) to analyze a subset of 42 L. monocytogenes by automated EcoRI ribotyping in order to predict the strain's potential virulence for humans. The strains were isolated from: smoked fish products, cooked marinated products, meat products and pre-packaged mixed vegetable salads. Of the samples tested, 22% were positive for Listeria spp. The prevalence of L. monocytogenes was 9.5%, while the level of L. monocytogenes in the positive samples was 93%), belonging to 17 different DuPont Identification Library Codes (DUP-IDs) clones. The Simpson's numerical index of discrimination was 0.911. Cluster analysis pointed out a high similarity among strains isolated from meat, fish, and vegetables of different origin. These results confirmed the existence of a widespread population of L. monocytogenes, characterized by highly related strains existing in different geographical areas. 65% of these strains belonged to lineage II (serotypes 1/2a and 1/2c), subtypes known to be associated with sporadic human listeriosis outbreaks. The remaining 35% of the isolates (serotypes 1/2b, 3b and 4b) were allocated to lineage I and belong to distinct clonal groups (DUP-ID 1038 and 1042), which again have been associated with several outbreaks of human listeriosis. Neither atypical profiles nor lineage III strains were found. EcoRI ribotyping was confirmed as a rapid and reliable method for L. monocytogenes typing, providing useful data for epidemiologic and clonality surveys of L. monocytogenes strains isolated from RTE foods.

  17. A 3-year multi-food study of the presence and persistence of Listeria monocytogenes in 54 small food businesses in Ireland.

    Science.gov (United States)

    Leong, Dara; NicAogáin, Kerrie; Luque-Sastre, Laura; McManamon, Oisin; Hunt, Karen; Alvarez-Ordóñez, Avelino; Scollard, Johann; Schmalenberger, Achim; Fanning, Séamus; O'Byrne, Conor; Jordan, Kieran

    2017-05-16

    The problem of assessing the occurrence of the food-borne pathogen Listeria monocytogenes in the food chain, and therefore the risk of exposure of the human population, is often challenging because of the limited scope of some studies. In this study the occurrence of L. monocytogenes in food from four major food groups, dairy products, meats, seafood and vegetables, and associated food processing environments in Ireland was studied over a three-year period. Fifty-four small food businesses participated in the study and sent both food and environmental samples every 2months between 2013 and 2015. L. monocytogenes was isolated using the ISO11290 standard method. Confirmation of L. monocytogenes and identification of serogroups were achieved using a multiplex PCR assay, and for some isolates serotype was determined using commercial antisera. Pulsed- field gel electrophoresis (PFGE) analysis was performed on all isolates allowing the relatedness of isolates from different food businesses to be compared nationwide. In total, 86 distinct pulsotypes were identified. The overall occurrence of L. monocytogenes in food samples was 4.2%, while in environmental samples it was 3.8%. In general, the occurrence of L. monocytogenes in food businesses decreased over the course of the study, presumably reflecting increased awareness and vigilance. The majority of the pulsotypes detected were unique to a particular food group (63/86), while only three pulsotypes were found in all four food groups investigated. The highest occurrence in food was found in the meat category (7.5%) while seafood had the lowest rate of occurrence (1.8%). Seventeen of the pulsotypes detected in the study were persistent, where persistence was defined as repeated isolation from a single facility with a minimum time interval of 6months. Using PFGE, 11 of the pulsotypes identified in this study were indistinguishable from those of 11 clinical isolates obtained from patients in Ireland over the last 4years

  18. Effect of food microstructure on growth dynamics of Listeria monocytogenes in fish-based model systems.

    Science.gov (United States)

    Verheyen, Davy; Bolívar, Araceli; Pérez-Rodríguez, Fernando; Baka, Maria; Skåra, Torstein; Van Impe, Jan F

    2018-06-01

    Traditionally, predictive growth models for food pathogens are developed based on experiments in broth media, resulting in models which do not incorporate the influence of food microstructure. The use of model systems with various microstructures is a promising concept to get more insight into the influence of food microstructure on microbial dynamics. By means of minimal variation of compositional and physicochemical factors, these model systems can be used to study the isolated effect of certain microstructural aspects on microbial growth, survival and inactivation. In this study, the isolated effect on microbial growth dynamics of Listeria monocytogenes of two food microstructural aspects and one aspect influenced by food microstructure were investigated, i.e., the nature of the food matrix, the presence of fat droplets, and microorganism growth morphology, respectively. To this extent, fish-based model systems with various microstructures were used, i.e., a liquid, a second more viscous liquid system containing xanthan gum, an emulsion, an aqueous gel, and a gelled emulsion. Growth experiments were conducted at 4 and 10 °C, both using homogeneous and surface inoculation (only for the gelled systems). Results regarding the influence of the growth morphology indicated that the lag phase of planktonic cells in the liquid system was similar to the lag phase of submerged colonies in the xanthan system. The lag phase of submerged colonies in each gelled system was considerably longer than the lag phase of surface colonies on these respective systems. The maximum specific growth rate of planktonic cells in the liquid system was significantly lower than for submerged colonies in the xanthan system at 10 °C, while no significant differences were observed at 4 °C. The maximum cell density was higher for submerged colonies than for surface colonies. The nature of the food matrix only exerted an influence on the maximum specific growth rate, which was

  19. Analysis of multilocus sequence typing and virulence characterization of Listeria monocytogenes isolates from Chinese retail ready-to-eat food

    Directory of Open Access Journals (Sweden)

    Shi eWu

    2016-02-01

    Full Text Available Eighty Listeria monocytogenes isolates were obtained from Chinese retail ready-to-eat (RTE food and were previously characterized with serotyping and antibiotic susceptibility tests. The aim of this study was to characterize the subtype and virulence potential of these L. monocytogenes isolates by multilocus sequence typing (MLST, virulence-associate genes, epidemic clones (ECs and sequence analysis of the important virulence factor: internalin A (inlA. The result of MLST revealed that these L. monocytogenes isolates belonged to 14 different sequence types (STs. With the exception of four new STs (ST804, ST805, ST806 and ST807, all other STs observed in this study have been associated with human listeriosis and outbreaks to varying extents. Six virulence-associate genes (inlA, inlB, inlC, inlJ, hly and llsX were selected and their presence was investigated using PCR. All strains carried inlA, inlB, inlC, inlJ, and hly, whereas 38.8% (31/80 of strains harbored the listeriolysin S genes (llsX. A multiplex PCR assay was used to evaluate the presence of markers specific to epidemic clones of L. monocytogenes and identified 26.3% (21/80 of ECI in the 4b-4d-4e strains. Further study of inlA sequencing revealed that most strains contained the full-length InlA required for host cell invasion, whereas three mutations lead to premature stop codons (PMSC within a novel PMSCs at position 326 (GAA→TAA. MLST and inlA sequence analysis results were concordant, and different virulence potentials within isolates were observed. These findings suggest that L. monocytogenes isolates from RTE food in China could be virulent and be capable of causing human illness. Furthermore, the STs and virulence profiles of L. monocytogenes isolates have significant implications for epidemiological and public health studies of this pathogen.

  20. Analysis of Multilocus Sequence Typing and Virulence Characterization of Listeria monocytogenes Isolates from Chinese Retail Ready-to-Eat Food.

    Science.gov (United States)

    Wu, Shi; Wu, Qingping; Zhang, Jumei; Chen, Moutong; Guo, Weipeng

    2016-01-01

    Eighty Listeria monocytogenes isolates were obtained from Chinese retail ready-to-eat (RTE) food and were previously characterized with serotyping and antibiotic susceptibility tests. The aim of this study was to characterize the subtype and virulence potential of these L. monocytogenes isolates by multilocus sequence typing (MLST), virulence-associate genes, epidemic clones (ECs), and sequence analysis of the important virulence factor: internalin A (inlA). The result of MLST revealed that these L. monocytogenes isolates belonged to 14 different sequence types (STs). With the exception of four new STs (ST804, ST805, ST806, and ST807), all other STs observed in this study have been associated with human listeriosis and outbreaks to varying extents. Six virulence-associate genes (inlA, inlB, inlC, inlJ, hly, and llsX) were selected and their presence was investigated using PCR. All strains carried inlA, inlB, inlC, inlJ, and hly, whereas 38.8% (31/80) of strains harbored the listeriolysin S genes (llsX). A multiplex PCR assay was used to evaluate the presence of markers specific to epidemic clones of L. monocytogenes and identified 26.3% (21/80) of ECI in the 4b-4d-4e strains. Further study of inlA sequencing revealed that most strains contained the full-length InlA required for host cell invasion, whereas three mutations lead to premature stop codons (PMSC) within a novel PMSCs at position 326 (GAA → TAA). MLST and inlA sequence analysis results were concordant, and different virulence potentials within isolates were observed. These findings suggest that L. monocytogenes isolates from RTE food in China could be virulent and be capable of causing human illness. Furthermore, the STs and virulence profiles of L. monocytogenes isolates have significant implications for epidemiological and public health studies of this pathogen.

  1. Potential Impact of the Resistance to Quaternary Ammonium Disinfectants on the Persistence of Listeria monocytogenes in Food Processing Environments.

    Science.gov (United States)

    Martínez-Suárez, Joaquín V; Ortiz, Sagrario; López-Alonso, Victoria

    2016-01-01

    The persistence of certain strains of Listeria monocytogenes, even after the food processing environment has been cleaned and disinfected, suggests that this may be related to phenomena that reduce the concentration of the disinfectants to subinhibitory levels. This includes (i) the existence of environmental niches or reservoirs that are difficult for disinfectants to reach, (ii) microorganisms that form biofilms and create microenvironments in which adequate concentrations of disinfectants cannot be attained, and (iii) the acquisition of resistance mechanisms in L. monocytogenes, including those that lead to a reduction in the intracellular concentration of the disinfectants. The only available data with regard to the resistance of L. monocytogenes to disinfectants applied in food production environments refer to genotypic resistance to quaternary ammonium compounds (QACs). Although there are several well-characterized efflux pumps that confer resistance to QACs, it is a low-level resistance that does not generate resistance to QACs at the concentrations applied in the food industry. However, dilution in the environment and biodegradation result in QAC concentration gradients. As a result, the microorganisms are frequently exposed to subinhibitory concentrations of QACs. Therefore, the low-level resistance to QACs in L. monocytogenes may contribute to its environmental adaptation and persistence. In fact, in certain cases, the relationship between low-level resistance and the environmental persistence of L. monocytogenes in different food production chains has been previously established. The resistant strains would have survival advantages in these environments over sensitive strains, such as the ability to form biofilms in the presence of increased biocide concentrations.

  2. Evaluation of a loop-mediated isothermal amplification method for the detection of Listeria monocytogenes in dairy food

    Directory of Open Access Journals (Sweden)

    Erica Tirloni

    2017-12-01

    Full Text Available Objective of the present study was to test the performances of a loop-mediated isothermal amplification (LAMP-based method for the detection of Listeria monocytogenes, with particular focus on the dairy products. The specificity of the method was evaluated on 42 different Listeria spp. strains from collections, food and environmental samples. 100% (32 of 32 of the L. monocytogenes strains were correctly recognised, and none of other 10 Listeria spp. strains was misidentified. The sensitivity was evaluated on four L. monocytogenes strains from different sources. The instrument was able to detect 10-400 CFU/mL. The ability to detect low initial numbers of L. monocytogenes (0.3- 0.7 Log CFU/g was also evaluated, in duplicate, in pasteurised milk (whole and skimmed and dairy samples (fresh ricotta, crescenza, mascarpone, mozzarella, cottage cheese, cream cheese, taleggio, gorgonzola. The analysis was performed after 18, 24 and 48 h of incubation, and was coupled with the count of L. monocytogenes in the broth. Microbial loads were insufficient to achieve a positive result after 18 and 24 h in most of the samples; after 48 h, all the products, except taleggio and one gorgonzola sample, were identified as positive; the sensitivity of the method when applied to contaminated dairy foods was about 5 Log CFU/g. The LAMP method tested can be considered a very useful tool, as it is a costeffective and easy-functioning method. The preliminary data obtained should be confirmed with a validation process taking into account different food typologies.

  3. Molecular characteristics and virulence potential of Listeria monocytogenes isolates from Chinese food systems.

    Science.gov (United States)

    Chen, Jianshun; Luo, Xiaokai; Jiang, Lingli; Jin, Peijie; Wei, Wei; Liu, Dongyou; Fang, Weihuan

    2009-02-01

    In this study, we examined Listeria monocytogenes isolates from Chinese food sources in an attempt to gain further insights on the molecular characteristics and virulence potential of this important foodborne pathogen. Of the 88 L. monocytogenes food isolates recovered, 42 (47.7%) were of serovars 1/2a or 3a; 23 (26.1%) of serovars 1/2b or 3b; 15 (17.0%) of 1/2c or 3c; 6 (6.8%) of serovars 4b, 4d or 4e; and 2 (2.2%) of serovars 4a or 4c. In contrast to inlAB locus conserved in all serovars, internalin cluster between ascB and dapE varies with different serovars, with inlC2DE, inlGC2DE and inlGHE predominantly in serovars 1/2b or 4b, serovar 1/2a and serovar 1/2c. While inlF existed in all the inlGHE- and inlGC2DE-containing isolates but 17.4% of those having inlC2DE, lmo2026 existed in all the inlGHE-containing isolates but 20.0% of those bearing inlGC2DE, suggesting that inlF might have co-evolved with inlGC2DE and inlGHE while lmo2026 with inlGHE only. With the exception of serovar 4a isolate, most serovar isolates demonstrated remarkable ability to form plaques on L929 cells and produced significant mouse mortality irrespective of the internalin gene organization and whether an intact actA gene is present or not. These results indicate that majority of these food isolates may have the potential to cause human diseases if ingested via contaminated foods. Given that serovar 4b accounts for nearly half of human clinical listeriosis cases documented, the relative low proportion of serovar 4b food isolates suggests that this serovar is probably more tolerant of the adverse conditions in the host's stomach and/or more efficient in entering host cells than serovars 1/2a, 1/2b and 1/2c.

  4. Effect of several food ingredients on radiation inactivation of Escherichia coli and Listeria monocytogenes inoculated into ground pork

    Energy Technology Data Exchange (ETDEWEB)

    Yun, Hyejeong [Department of Animal Science and Biotechnology, Chungnam National University, Daejeon 305-764 (Korea, Republic of); Lacroix, Monique [Canadian Irradiation Center, Research Laboratory in Science Applied to Food, INRS-Institut Armand-Frappier, Qebec (Canada); Jung, Samooel [Department of Animal Science and Biotechnology, Chungnam National University, Daejeon 305-764 (Korea, Republic of); Kim, Keehyuk [Department of Culinary Nutrition, Woosong University, Daejeon 300-718 (Korea, Republic of); Lee, Ju Woon [Advanced Radiation Technology Institute, Korea Atomic Energy Research Institute, Jeongeup 580-185 (Korea, Republic of); Jo, Cheorun, E-mail: cheorun@cnu.ac.kr [Department of Animal Science and Biotechnology, Chungnam National University, Daejeon 305-764 (Korea, Republic of)

    2011-09-15

    The objective of this study was to examine the effects of several food ingredients on the relative radiation sensitivity (RRS) of Escherichia coli and Listeria monocytogenes inoculated onto ground pork. Garlic, leek, onion, and ginger were prepared in 3 different forms; pressurized, freeze-dried, and 70% ethanol extracted. The prepared food ingredients were subdivided into 2 groups, non-irradiated and irradiated with 5 kGy of gamma irradiation, before addition to ground pork. The prepared food ingredients were added at concentrations of 1% and 5% (w/w) into radiation-sterilized ground pork and inoculated with E. coli and L. monocytogenes (10{sup 6} CFU/mL). For E. coli inoculated pork, the most efficient ingredient was ethanol extracted leek (RRS=3.89), followed by freeze-dried ginger and leek (RRS=3.66 and 3.63, respectively) when used without pasteurization. However, when the food ingredients were irradiation-pasteurized, the freeze-dried ginger showed the highest RRS (4.10). When 5% natural materials were added, RRS was the highest for freeze-dried and ethanol extracted onion (4.44 and 4.65, respectively). For L. monocytogenes, the RRS was relatively lower than E. coli in general. The most efficient material was pressurized and freeze-dried onion (RRS=2.13 and 2.08, respectively) at a concentration of 1%. No increase in RRS was observed at increased concentration of food ingredients. These results suggest that the addition of particular food ingredients increased the efficiency of radiation-sterilization. However, changes in RRS were dependent on the species of microorganism as well as the form of the food ingredients. - Highlights: > Several food ingredients increased the efficiency of irradiation sterilization. > Different forms of food ingredients may affect the efficiency. > The increase of efficiency decreased the required irradiation dose, thereby avoiding sensory impairments of food.

  5. Effect of several food ingredients on radiation inactivation of Escherichia coli and Listeria monocytogenes inoculated into ground pork

    International Nuclear Information System (INIS)

    Yun, Hyejeong; Lacroix, Monique; Jung, Samooel; Kim, Keehyuk; Lee, Ju Woon; Jo, Cheorun

    2011-01-01

    The objective of this study was to examine the effects of several food ingredients on the relative radiation sensitivity (RRS) of Escherichia coli and Listeria monocytogenes inoculated onto ground pork. Garlic, leek, onion, and ginger were prepared in 3 different forms; pressurized, freeze-dried, and 70% ethanol extracted. The prepared food ingredients were subdivided into 2 groups, non-irradiated and irradiated with 5 kGy of gamma irradiation, before addition to ground pork. The prepared food ingredients were added at concentrations of 1% and 5% (w/w) into radiation-sterilized ground pork and inoculated with E. coli and L. monocytogenes (10 6 CFU/mL). For E. coli inoculated pork, the most efficient ingredient was ethanol extracted leek (RRS=3.89), followed by freeze-dried ginger and leek (RRS=3.66 and 3.63, respectively) when used without pasteurization. However, when the food ingredients were irradiation-pasteurized, the freeze-dried ginger showed the highest RRS (4.10). When 5% natural materials were added, RRS was the highest for freeze-dried and ethanol extracted onion (4.44 and 4.65, respectively). For L. monocytogenes, the RRS was relatively lower than E. coli in general. The most efficient material was pressurized and freeze-dried onion (RRS=2.13 and 2.08, respectively) at a concentration of 1%. No increase in RRS was observed at increased concentration of food ingredients. These results suggest that the addition of particular food ingredients increased the efficiency of radiation-sterilization. However, changes in RRS were dependent on the species of microorganism as well as the form of the food ingredients. - Highlights: → Several food ingredients increased the efficiency of irradiation sterilization. → Different forms of food ingredients may affect the efficiency. → The increase of efficiency decreased the required irradiation dose, thereby avoiding sensory impairments of food.

  6. Prevalence, antimicrobial susceptibility and multiplex PCR-serotyping of Listeria monocytogenes isolated from humans, foods and livestock in Iran.

    Science.gov (United States)

    Lotfollahi, Lida; Chaharbalesh, Ardalan; Ahangarzadeh Rezaee, Mohammad; Hasani, Alka

    2017-06-01

    Listeria monocytogenes is a foodborne pathogen causing listeriosis, which potentially affects all individuals, especially pregnant women and immunocompromised persons. The present study investigated the prevalence, antimicrobial susceptibility and serotypes distribution of the isolated L. monocytogenes from Iran. Twenty two (4.97%) of 442 human, food and livestock samples were found to be positive for L. monocytogenes. L. monocytogenes was identified in 8.8% of 125 human samples, 2.99% of 267 food and 6% of 50 livestock samples. The standard disk diffusion method and minimum inhibitory concentration (MIC) assay were used for antimicrobial susceptibility testing and multiplex PCR for serotyping. Among the 22 isolates tested, 6 (27.2%) displayed resistance to penicillin G, with all of the isolates and 2 (9%) of them showing intermediate susceptibility to clindamycin and rifampicin, respectively. According to the MIC assay, the rate of resistance to penicillin G was the same as that of disk diffusion method, but 16 (72.7%) of isolates showed intermediate susceptibility to clindamycin using E-test. In the multiplex PCR, 19 (86.4%) of isolates belonged to serotype 1/2c or 3c and the remaining 3 isolates were identified as (4b, 4d or 4e) and (1/2a or 3a), respectively. The occurrence of resistance to penicillin G, which can be used in the treatment of listeriosis, is very alarming and more prevalence of 1/2c serotype, in comparison to 3 other important ones (1/2a, 1/2b and 4b), in Iran has been reported for the first time. To the best of our knowledge, this is the first study showing the distribution of various serogroups of L. monocytogenes from human and livestock in Iran. Copyright © 2017 Elsevier Ltd. All rights reserved.

  7. Detection of Listeria monocytogenes in ready-to-eat foods sampled from a catering service in Apulia, Italy.

    Science.gov (United States)

    Caggiano, Giuseppina; De Giglio, Osvalda; Lovero, Grazia; Rutigliano, Serafina; Diella, Giusy; Balbino, Stella; Napoli, Christian; Montagna, Maria Teresa

    2015-01-01

    Listeria monocytogenes is currently considered a relevant emerging food-borne pathogen. In particular, the European Centre for Disease Prevention and Control (ECDC) illustrates its widespread presence in different foods. In the present article, L. monocytogenes prevalence was estimated in cooked ready-to-eat foods sampled from a catering service in a Apulia city, southern Italy. The study was carried out from January to June 2014 in according to Regulation (EC) No. 852/2004, and ISO 11290-1:1996/Amd.1:2004 methods. Listeria spp. was isolated in 8.3% of the samples: L. monocytogenes was identified with the highest prevalence in potato gateau (66.6%), followed by rice dishes (11.1%), Listeria innocua was isolated from potato purea (11.1%) and cooked vegetables (11.1%). These preliminary results confirm the diffusion of the microorganism in ready-to-eat products; therefore, strategies aimed at protecting the consumers should be adopted. First of all, correct hygiene procedures should be followed and then microbiological tests should be implemented in order to early detect Listeria spp. (not only LM) contamination in cooked foods.

  8. Typing and Evaluation of the Genetic Relatedness of Listeria monocytogenes Strains Isolated from Food Samples by the Multiple-Locus Variable number Tandem Repeat Analysis (MLVA

    Directory of Open Access Journals (Sweden)

    Behrooz Sadeghi kalani

    2014-12-01

    Full Text Available Background and Aim:Listeria monocytogenes cause listeriosis and fatal infections in humans. The aim of this study was typing and evaluation of the genetic relatedness of L. monocytogenes strains from food samples using MLVA technique. Materials and Methods: 317 food samples were collected from 2009 to 2013 in Tehran,Iran. After final diagnosis of L. monocytogenes DNA was extracted to perform of MLVA technique, and also PCR products were analyzed by Gene Tools software. The number of tandem repeats was determined by using special equation for each selected locus. Also typing of strains was done. Results: 24 samples of 317 food samples were positive for L. monocytogenes using standard laboratory techniques. A total 13 different types were determined by MLVA technique that type 2 and type 3 were the most abundant types by 6 and 4 strains, respectively. Conclusions: The results of this study showed the presence of L. monocytogenes in dairy products and meat samples, therefore all people, especially pregnant women should observe health tips when using these products. The results of typing showed that L. monocytogenes strains from different sources can have the same origin. MLVA technique is easy with high accuracy and this method can be used in typing and evaluation of the genetic relatedness of L. monocytogenes for determination the source of contamination.

  9. The Efficiency of UVC Radiation in the Inactivation of Listeria monocytogenes on Beef-Agar Food Models

    Directory of Open Access Journals (Sweden)

    Christian James

    2015-01-01

    Full Text Available The aim of this study is to evaluate the eff ect of meat content and surface smoothness on the deactivation of Listeria monocytogenes in beef-agar food models achieved by shortwave ultraviolet (UVC light. Food models with various meat contents were made using chopped beef slices and agar solution. Prepared models together with a Listeria selective agar (LSA plate and a slice of cooked beef were inoculated with L. monocytogenes and then exposed to UVC light. Population of Listeria reduced to below the level of detection on the LSA plates. As the content of beef in the beef-agar models increased, more L. monocytogenes cells survived. Survival was greatest on the treated cooked slice of beef. To bett er understand the effect of surface irregularities, a white light interferometer was used to analyse the surface smoothness of beef-agar media and LSA plates. No correlation was observed between the surface roughness of seven out of nine types of produced beef-agar media and the degree of inactivation resulting from UVC radiation at the given dose, whereas, less bacterial cells were killed as beef content of the food models increased. The findings of the current study show that the chemical composition of the treated sample also plays an important role in pathogen resistance and survival, meaning that two samples with similar surface irregularities but diff erent chemical composition might produce very diff erent inactivation results when exposed to UVC light.

  10. Listeria monocytogenes strains show large variations in competitive growth in mixed culture biofilms and suspensions with bacteria from food processing environments.

    Science.gov (United States)

    Heir, Even; Møretrø, Trond; Simensen, Andreas; Langsrud, Solveig

    2018-06-20

    Interactions and competition between resident bacteria in food processing environments could affect their ability to survive, grow and persist in microhabitats and niches in the food industry. In this study, the competitive ability of L. monocytogenes strains grown together in separate culture mixes with other L. monocytogenes (L. mono mix), L. innocua (Listeria mix), Gram-negative bacteria (Gram- mix) and with a multigenera mix (Listeria + Gram- mix) was investigated in biofilms on stainless steel and in suspensions at 12 °C. The mixed cultures included resident bacteria from processing surfaces in meat and salmon industry represented by L. monocytogenes (n = 6), L. innocua (n = 5) and Gram-negative bacteria (n = 6; Acinetobacter sp., Pseudomonas fragi, Pseudomonas fluorescens, Serratia liquefaciens, Stenotrophomonas maltophilia). Despite hampered in growth in mixed cultures, L. monocytogenes established in biofilms with counts at day nine between 7.3 and 9.0 log per coupon with the lowest counts in the Listeria + G- mix that was dominated by Pseudomonas. Specific L. innocua inhibited growth of L. monocytogenes strains differently; inhibition that was further enhanced by the background Gram-negative microbiota. In these multispecies and multibacteria cultures, the growth competitive effects lead to the dominance of a strong competitor L. monocytogenes strain that was only slightly inhibited by L. innocua and showed strong competitive abilities in mixed cultures with resident Gram-negative bacteria. The results indicates complex patterns of bacterial interactions and L. monocytogenes inhibition in the multibacteria cultures that only partially depend on cell contact and likely involve various antagonistic and bacterial tolerance mechanisms. The study indicates large variations among L. monocytogenes in their competitiveness under multibacterial culture conditions that should be considered in further studies towards understanding of L

  11. A review of the incidence and transmission of Listeria monocytogenes in ready-to-eat products in retail and food service environments.

    Science.gov (United States)

    Lianou, Alexandra; Sofos, John N

    2007-09-01

    Contamination of ready-to-eat products with Listeria monocytogenes may occur at several stages before consumption. Accessibility to the public and relatively limited control interventions at retail and food service establishments (compared with the processing sector of the food industry) and the lack of a specific regulatory framework increase the likelihood of introduction of this pathogen into some foods in these establishments. This review is a compilation of available information on the incidence and transmission of L. monocytogenes through ready-to-eat products at the retail and food service level. The potential transmission of L. monocytogenes within retail and food service operations has been indicated in epidemiological investigations and by survey data. Potential sources of the organism in these operations include the environment, food handlers, and incoming raw ingredients or processed products that have become contaminated after the lethality treatment at the manufacturing facility. L. monocytogenes may be present at retail and food service establishments in various ready-to-eat products, both prepackaged and those packaged in the store, and occasionally at high concentrations. This issue dictates the need for development and application of effective control measures, and potential control approaches are discussed here. Good manufacturing practices, appropriate cleaning, sanitation and hygiene programs, and temperature control required for prevention or inhibition of growth of the pathogen to high levels are critical for control of L. monocytogenes in the retail and food service sector. A comprehensive food safety system designed to be functional in retail and food service operations and based on the philosophy of hazard analysis and critical control point systems and a series of sound prerequisite programs can provide effective control of L. monocytogenes in these environments. However, competent delivery of food safety education and training to retail

  12. Monitoring paneer for Listeria monocytogenes- A high risk food ...

    African Journals Online (AJOL)

    Dr.Batish

    2012-05-15

    May 15, 2012 ... Taq DNA polymerase (Boehringer Mannheim). Appropriate positive and negative controls with each reaction were also set up. The PCR parametres included initial denaturation at 95°C for 4 min followed by. 25 cycles of denaturation at 95°C for 30 s, annealing at 60°C for 30 s, extension at 72°C for 30 s ...

  13. Effect of several food ingredients on radiation inactivation of Escherichia coli and Listeria monocytogenes inoculated into ground pork

    Science.gov (United States)

    Yun, Hyejeong; Lacroix, Monique; Jung, Samooel; Kim, Keehyuk; Lee, Ju Woon; Jo, Cheorun

    2011-09-01

    The objective of this study was to examine the effects of several food ingredients on the relative radiation sensitivity (RRS) of Escherichia coli and Listeria monocytogenes inoculated onto ground pork. Garlic, leek, onion, and ginger were prepared in 3 different forms; pressurized, freeze-dried, and 70% ethanol extracted. The prepared food ingredients were subdivided into 2 groups, non-irradiated and irradiated with 5 kGy of gamma irradiation, before addition to ground pork. The prepared food ingredients were added at concentrations of 1% and 5% (w/w) into radiation-sterilized ground pork and inoculated with E. coli and L. monocytogenes (10 6 CFU/mL). For E. coli inoculated pork, the most efficient ingredient was ethanol extracted leek (RRS=3.89), followed by freeze-dried ginger and leek (RRS=3.66 and 3.63, respectively) when used without pasteurization. However, when the food ingredients were irradiation-pasteurized, the freeze-dried ginger showed the highest RRS (4.10). When 5% natural materials were added, RRS was the highest for freeze-dried and ethanol extracted onion (4.44 and 4.65, respectively). For L. monocytogenes, the RRS was relatively lower than E. coli in general. The most efficient material was pressurized and freeze-dried onion (RRS=2.13 and 2.08, respectively) at a concentration of 1%. No increase in RRS was observed at increased concentration of food ingredients. These results suggest that the addition of particular food ingredients increased the efficiency of radiation-sterilization. However, changes in RRS were dependent on the species of microorganism as well as the form of the food ingredients.

  14. Listeria monocytogenes Isolates Carrying Virulence-Attenuating Mutations in Internalin A Are Commonly Isolated from Ready-to-Eat Food Processing Plant and Retail Environments.

    Science.gov (United States)

    VAN Stelten, A; Roberts, A R; Manuel, C S; Nightingale, K K

    2016-10-01

    Listeria monocytogenes is a human foodborne pathogen that may cause an invasive disease known as listeriosis in susceptible individuals. Internalin A (InlA; encoded by inlA) is a virulence factor that facilitates crossing of host cell barriers by L. monocytogenes . At least 19 single nucleotide polymorphisms (SNPs) in inlA that result in a premature stop codon (PMSC) have been described worldwide. SNPs leading to a PMSC in inlA have been shown to be causally associated with attenuated virulence. L. monocytogenes pathogens carrying virulence-attenuating (VA) mutations in inlA have been commonly isolated from ready-to-eat (RTE) foods but rarely have been associated with human disease. This study was conducted to determine the prevalence of VA SNPs in inlA among L. monocytogenes from environments associated with RTE food production and handling. More than 700 L. monocytogenes isolates from RTE food processing plant (n = 409) and retail (n = 319) environments were screened for the presence of VA SNPs in inlA. Overall, 26.4% of isolates from RTE food processing plant and 32.6% of isolates from retail environments carried a VA mutation in inlA. Food contact surfaces sampled at retail establishments were significantly (P < 0.0001) more likely to be contaminated by a L. monocytogenes isolate carrying a VA mutation in inlA (56% of 55 isolates) compared with nonfood contact surfaces (28% of 264 isolates). Overall, a significant proportion of L. monocytogenes isolated from RTE food production and handling environments have reduced virulence. These data will be useful in the revision of current and the development of future risk assessments that incorporate strain-specific virulence parameters.

  15. Fluorescence-Free Biosensor Methods in Detection of Food Pathogens with a Special Focus on Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Rajeswaran Radhakrishnan

    2017-12-01

    Full Text Available Food pathogens contaminate food products that allow their growth on the shelf and also under refrigerated conditions. Therefore, it is of utmost importance to lower the limit of detection (LOD of the method used and to obtain the results within hours to few days. Biosensor methods exploit the available technologies to individuate and provide an approximate quantification of the bacteria present in a sample. The main bottleneck of these methods depends on the aspecific binding to the surfaces and on a change in sensitivity when bacteria are in a complex food matrix with respect to bacteria in a liquid food sample. In this review, we introduce surface plasmon resonance (SPR, new advancements in SPR techniques, and electrochemical impedance spectroscopy (EIS, as fluorescence-free biosensing technologies for detection of L. monocytogenes in foods. The application of the two methods has facilitated L. monocytogenes detection with LOD of 1 log CFU/mL. Further advancements are envisaged through the combination of biosensor methods with immunoseparation of bacteria from larger volumes, application of lab-on-chip technologies, and EIS sensing methods for multiplex pathogen detection. Validation efforts are being conducted to demonstrate the robustness of detection, reproducibility and variability in multi-site installations.

  16. The microbiological safety of ready-to-eat specialty meats from markets and specialty food shops: a UK wide study with a focus on Salmonella and Listeria monocytogenes.

    Science.gov (United States)

    Gormley, F J; Little, C L; Grant, K A; de Pinna, E; McLauchlin, J

    2010-04-01

    From 2359 specialty meats (continental sausages, cured/fermented, dried meats) sampled from markets and specialty food shops, 98.9% of samples were of satisfactory or acceptable microbiological quality. However, 16 (0.7%) were unsatisfactory as a result of Escherichia coli, Staphylococcus aureus or Listeria spp. contamination (>or=10(2) CFU/g), and nine (0.4%) were unacceptable due to presence of Salmonella spp. or Listeria monocytogenes (>10(2) CFU/g). Meats with unacceptable levels of L. monocytogenes were within shelf life (range: 8-143 days remaining). Nine different subtypes of L. monocytogenes were detected with sero/AFLP type 1/2c VII predominating (37%), although this subtype was not overrepresented in any particular meat type (P > 0.05). Ninety-six percent of continental sausages and cured/fermented products were stored at potential for L. monocytogenes to be present at levels hazardous to health at the point of sale.

  17. The pathogenic potential of different pulsed-field gel electrophoresis types of Listeria monocytogenes strains isolated from food in Northeast Bosnia and Herzegovina.

    Science.gov (United States)

    Hodžić, Snjezana; Hukić, Mirsada; Franciosa, Giovanna; Aureli, Paolo

    2011-09-01

    Listeria monocytogenes is often present in meat and meat products that are sold in the area of northeast Bosnia and Herzegovina. The major objective of this study was to examine the virulence of L. monocytogenes strains isolated from these types of food in that geographic area. Polymerase chain reaction was used to detect eight genes responsible for virulence of this pathogen, namely, prfA, inlA, inlB, hly, plcA, plcB, actA, and mpl. All examined isolates were confirmed to possess the eight virulence genes. Ten different pulsed-field gel electrophoresis (PFGE) macrorestriction profiles were recognized among 19 L. monocytogenes strains after restriction with two different endonucleases (ApaI and AscI). The pathogenicity of three different PFGE types of L. monocytogenes was confirmed through in vivo tests, which were performed on female white mice (Pasteur strain), and it ranged from 3.55 × 10(8) LD50 to 1.58 × 10(10) LD50. All of the three different PFGE types of L. monocytogenes were regarded as moderately virulent in relation to the reference strain L. monocytogenes Scott A. This result might be one of the reasons for the absence of reported listeriosis in northeast Bosnia and Herzegovina, despite the high degree of food contamination with this pathogen.

  18. Genes involved in Listeria monocytogenes biofilm formation at a simulated food processing plant temperature of 15 °C.

    Science.gov (United States)

    Piercey, Marta J; Hingston, Patricia A; Truelstrup Hansen, Lisbeth

    2016-04-16

    Listeria monocytogenes is a pathogenic foodborne bacterium whose persistence in food processing environments is in part attributed to its biofilm formation. Most biofilm studies have been carried out at 30-37 °C rather than at temperatures found in the food processing plants (i.e., 10-20 °C). The objective of the present study was to mine for novel genes that contribute to L. monocytogenes biofilm formation at 15 °C using the random insertional mutagenesis approach. A library of 11,024 L. monocytogenes 568 (serotype 1/2a) Himar1 insertional mutants was created. Mutants with reduced or enhanced biofilm formation at 15 °C were detected in microtiter plate assays with crystal violet and safranin staining. Fourteen mutants expressed enhanced biofilm phenotypes, and harbored transposon insertions in genes encoding cell wall biosynthesis, motility, metabolism, stress response, and cell surface associated proteins. Deficient mutants (n=5) contained interruptions in genes related to peptidoglycan, teichoic acid, or lipoproteins. Enhanced mutants produced significantly (pbiofilm formed on stainless steel (SS) coupons at 15 °C (48 h) than deficient mutants, which were also more sensitive to benzalkonium chloride. All biofilm deficient mutants and four enhanced mutants in the microtiter plate assay (flaA, cheR, lmo2563 and lmo2488) formed no biofilm in a peg lid assay (Calgary biofilm device) while insertions in lmo1224 and lmo0543 led to excess biofilm in all assays. Two enhanced biofilm formers were more resistant to enzymatic removal with DNase, proteinase K or pectinase than the parent strain. Scanning electron microscopy of individual biofilms made by five mutants and the parent on SS surfaces showed formation of heterogeneous biofilm with dense zones by immotile mutants, while deficient mutants exhibited sparse growth. In conclusion, interruptions of 9 genes not previously linked to biofilm formation in L. monocytogenes (lmo2572, lmo2488 (uvrA), lmo1224, lmo0434

  19. OCCURRENCE OF LISTERIA MONOCYTOGENES IN READY TO EAT FOOD SAMPLES COLLECTED BY LOMBARDY REGION HEALTH AUTHORITIES IN 2009-2010

    Directory of Open Access Journals (Sweden)

    E. Oliverio

    2012-08-01

    Full Text Available The study provides data on the prevalence of Listeria monocytogenes in ready-to-eat food samples collected by Lombardy region health authorities and analyzed by Department of Food Microbiology, Istituto Zooprofilattico Sperimentale della Lombardia e dell’Emilia Romagna. From the total of 503 food samples analyzed, the pathogen was detected in 85 (16,9%. In particular it was highlighted in 8/152 (5,3% meat products, in 5/245 (2% dairy products and in 42/106 (39,6% fishery products. Given the considerable public health implications, the study confirms that a well-planned program of listeriosis surveillance should be enforced to suitably estimate the burden of disease and to prevent foodborne outbreaks.

  20. A bioengineered nisin derivative, M21A, in combination with food grade additives eradicates biofilms of Listeria monocytogenes.

    Directory of Open Access Journals (Sweden)

    Lorraine Anne Draper

    2016-11-01

    Full Text Available The burden of foodborne disease has large economic and social consequences worldwide. Despite strict regulations, a number of pathogens persist within the food environment, which is greatly contributed to by a build-up of resistance mechanisms and also through the formation of biofilms. Biofilms have been shown to be highly resistant to a number of antimicrobials and can be extremely difficult to remove once they are established. In parallel, the growing concern of consumers regarding the use of chemically derived antimicrobials within food has led to a drive towards more natural products. As a consequence, the use of naturally derived antimicrobials has become of particular interest. In this study we investigated the efficacy of nisin A and its bioengineered derivative M21A in combination with food grade additives to treat biofilms of a representative strain of Listeria monocytogenes. Investigations revealed the enhanced antimicrobial effects, in liquid culture, of M21A in combination with citric acid or cinnamaldehyde over its wild type nisin A counterpart. Subsequently, an investigation was conducted into the effects of these combinations on an established biofilm of the same strain. Nisin M21A (0.1 µg/ml alone or in combination with cinnamaldehyde (35 µg/ml or citric acid (175 µg/ml performed significantly better than combinations involving nisin A. All combinations of M21A with either citric acid or cinnamaldehyde eradicated the L. monocytogenes biofilm (in relation to a non-biofilm control. We conclude that M21A in combination with available food additives could further enhance the antimicrobial treatment of biofilms within the food industry, simply by substituting nisin A with M21A in current commercial products such as Nisaplin (Danisco, DuPont.

  1. Virulence factors and resistance to antimicrobials in Listeria monocytogenes serotype 1/2c isolated from food.

    Science.gov (United States)

    Gelbíčová, T; Pantůček, R; Karpíšková, R

    2016-08-01

    The aim of this study was to assess the potential risk posed to the human population by the presence of Listeria monocytogenes serotype 1/2c in food based on the characterization of virulence factors of Listeria involved in the invasion of host cells and sensitivity to antimicrobial agents. In addition to sequencing of the inlA and inlB genes, the presence of genes lapB, aut, fbpA, ami, vip and llsX was tested. A premature stop codon (PMSC) in the inlA gene was detected in all tested strains of serotype 1/2c and, concurrently, two novel PMSC mutation types were identified. However, neither PMSC in the inlB gene nor deletion of the lapB, aut, fbpA, ami and vip genes were found in any of the strains. The presence of the llsX gene was not confirmed. Even though all L. monocytogenes strains showed sensitivity to the tested antimicrobials on the basis of their phenotype, sequencing revealed the presence of IS1542 insertion in the inlA gene, indicating the possibility of sharing of mobile genetic elements associated with antimicrobial resistance among strains. Other than the presence of PMSCs in the inlA gene, no PMSC in inlB or deletion of other factors linked to the invasiveness of listeria were detected. Tested strains showed sensitivity to antibiotics used in the therapy of listeriosis. Strains of L. monocytogenes serotype 1/2c typically carry a PMSC in the inlA gene, but these strains still represent a potential threat to public health. The possibility of transfer of IS1542, associated with resistance to vancomycin, between enterococci and Listeria spp. was revealed. © 2016 The Society for Applied Microbiology.

  2. Comparison of three Listeria monocytogenes strains in a guinea-pig model simulating food-borne exposure

    DEFF Research Database (Denmark)

    Roldgaard, Bent; Andersen, Jens Bo; Hansen, Tina Beck

    2009-01-01

    Three different Listeria monocytogenes strains, LO28 (a laboratory strain with truncated InlA), 4446 (a clinical isolate) and 7291 (a food isolate), were compared in a guinea-pig model designed to mimic food-borne exposure. The objectives were (1) to verify the applicability of the animal model...... for distinguishing between Listeria with different virulence properties and (2) to explore whether it was possible to reduce the required number of animals by dosing with mixed cultures instead of monocultures. Consistent with in vitro observations of infectivity in Caco-2 cells, faecal densities and presence...... of Listeria strains gave similar results as dosage with a mixture of the three strains; thus, the mixed infection approach was a feasible way to reduce the number of animals needed for determination of listerial virulence....

  3. Diversity of Listeria monocytogenes Strains of Clinical and Food Chain Origins in Belgium between 1985 and 2014

    Science.gov (United States)

    Ceyssens, P. J.; Yde, M.; Dierick, K.; Boyen, F.; Vanderpas, J.; Vanhoof, R.; Mattheus, W.

    2016-01-01

    Listeriosis is a rare but severe disease, mainly caused by Listeria monocytogenes. This study shows the results of the laboratory-based surveillance of Listeriosis in Belgium over the period 1985–2014. Besides the incidence and some demographic data we present also more detailed microbiological and molecular characteristics of human strains isolated since 2000. The strains from the latter period were compared to food and animal strains from the same period. Our study shows that different food matrices were commonly contaminated with L. monocytogenes presenting the same PFGE profile as in patient’s isolates. Since 1985, we observed a significant decrease in incidence of the Materno-Neonatal cases (from 0.15 to 0.04 cases /100,000 inhabitants-year), which is probably to be attributed to active prevention campaigns targeting pregnant women. Despite the strengthening of different control measures by the food industry, the incidence of non-Materno-Neonatal listeriosis increased in Belgium (from 0.3 to 0.7 cases /100,000 inhabitants-year), probably due to the rise of highly susceptible patients in an aging population. This significant increase found in non-Materno-Neonatal cases (slope coefficient 7.42%/year, Pmonocytogenes isolates, a trend to increasing MIC values is evident with chloramphenicol, amoxicillin, tetracycline and ciprofloxacin. We show that fluoroquinolone resistance is not linked to chromosomal mutations, but caused by a variety of efflux pumps. Our study also shows that huge majority of known underlying pathologies (426 out of 785 cases) were cancers (185/426, 43.1%) and haematological malignancies (75/185, 40.5%). Moreover the risk population is susceptible to low levels of contamination in food stressing the need of prevention campaigns specifically targeting these persons. PMID:27723768

  4. L. monocytogenes in a cheese processing facility: Learning from contamination scenarios over three years of sampling.

    Science.gov (United States)

    Rückerl, I; Muhterem-Uyar, M; Muri-Klinger, S; Wagner, K-H; Wagner, M; Stessl, B

    2014-10-17

    The aim of this study was to analyze the changing patterns of Listeria monocytogenes contamination in a cheese processing facility manufacturing a wide range of ready-to-eat products. Characterization of L. monocytogenes isolates included genotyping by pulsed-field gel electrophoresis (PFGE) and multi-locus sequence typing (MLST). Disinfectant-susceptibility tests and the assessment of L. monocytogenes survival in fresh cheese were also conducted. During the sampling period between 2010 and 2013, a total of 1284 environmental samples were investigated. Overall occurrence rates of Listeria spp. and L. monocytogenes were 21.9% and 19.5%, respectively. Identical L. monocytogenes genotypes were found in the food processing environment (FPE), raw materials and in products. Interventions after the sampling events changed contamination scenarios substantially. The high diversity of globally, widely distributed L. monocytogenes genotypes was reduced by identifying the major sources of contamination. Although susceptible to a broad range of disinfectants and cleaners, one dominant L. monocytogenes sequence type (ST) 5 could not be eradicated from drains and floors. Significantly, intense humidity and steam could be observed in all rooms and water residues were visible on floors due to increased cleaning strategies. This could explain the high L. monocytogenes contamination of the FPE (drains, shoes and floors) throughout the study (15.8%). The outcome of a challenge experiment in fresh cheese showed that L. monocytogenes could survive after 14days of storage at insufficient cooling temperatures (8 and 16°C). All efforts to reduce L. monocytogenes environmental contamination eventually led to a transition from dynamic to stable contamination scenarios. Consequently, implementation of systematic environmental monitoring via in-house systems should either aim for total avoidance of FPE colonization, or emphasize a first reduction of L. monocytogenes to sites where

  5. 78 FR 27939 - Draft Interagency Risk Assessment-Listeria monocytogenes

    Science.gov (United States)

    2013-05-13

    ... Listeria (L.) monocytogenes contamination of certain ready-to-eat (RTE) foods, for example cheese, deli... Scott, V.N., Survey of Listeria monocytogenes in ready-to-eat foods. Journal of Food Protection, 2003... monocytogenes in ready-to-eat processed meat and poultry collected in four FoodNet states in International...

  6. Use of a novel medium, the Polymyxin Ceftazidime Oxford Medium, for isolation of Listeria monocytogenes from raw or non-pasteurized foods.

    Science.gov (United States)

    Martínez-Gonzáles, N E; Martínez-Chávez, L; Cabrera-Díaz, E; Martínez-Cárdenas, C; Gutiérrez-González, P; Castillo, A

    2016-05-01

    Polymyxin Ceftazidime Oxford Medium (PCOM), a novel selective and differential plating medium for Listeria monocytogenes was compared with Modified Oxford Agar (MOX) for efficacy to isolate L. monocytogenes and other Listeria spp. naturally present in non-pasteurized Mexican-style cheese (n = 50), non-pasteurized fresh squeezed orange juice (n = 50), raw beef chunks (n = 36), and fresh cabbage (n = 125). Samples were collected from retail markets and farms in Mexico and tested following the US Department of Agriculture enrichment technique. Listeria spp. were isolated from 23.4% of analyzed samples, and from those, 75.0% corresponded to raw beef chunks, 38.0% to non-pasteurized Mexican-style cheese, and 30.0% to fresh squeezed orange juice. No Listeria spp. were isolated from fresh cabbage samples. L. monocytogenes was recovered from 15.3% of food samples analyzed. Non-pasteurized Mexican-style cheese showed the highest proportion of L. monocytogenes positive samples (36.0%), followed by orange juice (26.0%) and raw beef (25.0%). The frequency of isolation of Listeria spp. and L. monocytogenes was not different (P > 0.05) between PCOM and MOX. The advantages of using PCOM when comparing to MOX, include the easier way to identify Listeria species, the lower cost per plate and the availability of its ingredients for Latin-American countries. Copyright © 2015 Elsevier Ltd. All rights reserved.

  7. Tracking Listeria monocytogenes contamination and virulence-associated characteristics in the ready-to-eat meat-based food products industry according to the hygiene level.

    Science.gov (United States)

    Henriques, A R; Gama, L T; Fraqueza, M J

    2017-02-02

    Listeria monocytogenes isolates collected from final products and food contact surfaces of 10 ready-to-eat meat-based food products (RTEMP) producing industries were analyzed to relate their virulence-associated characteristics and genetic profiles with the hygiene assessment of those industries. Together with sample collection, an audit was performed to evaluate the implemented food safety management system and to investigate the specific audit requisites more associated to the occurrence of those L. monocytogenes serogroups frequently related with human disease. L. monocytogenes was present in 18% of the samples. The isolates (n=62) were serogrouped and detection of virulence-associated genes inlA, inlB, inlC and inlJ, and also plcA, hlyA, actA and iap was done by multiplex PCR. After this initial characterization, selected isolates (n=31) were submitted to antibiotic resistance testing by the disk diffusion method for the currently most used human and veterinary antibiotics and resistance was low. These isolates were also subtyped by pulsed-field gel electrophoresis. Genotyping and serogrouping of L. monocytogenes isolates revealed a genetically diverse population. Our data indicate that contamination of final products does not seem to be uniquely related to the sampled food surfaces. The occurrence of those L. monocytogenes serogroups more commonly associated with human disease in industries with a high hygienic audit classification could be the result of a previous identification of the pathogen, with an enforcement of the hygiene program without recognizing the real source of contamination. This reinforces the importance of a conjoined diagnosis using audit data and microbiological testing. Food safety management systems of those industries need improvement, particularly in cleaning and sanitizing operations, analytical control, preventive maintenance, personal hygiene and root cause analysis. Copyright © 2016. Published by Elsevier B.V.

  8. The Role of Stress and Stress Adaptations in Determining the Fate of the Bacterial Pathogen Listeria monocytogenes in the Food Chain

    Science.gov (United States)

    NicAogáin, Kerrie; O’Byrne, Conor P.

    2016-01-01

    The foodborne pathogen Listeria monocytogenes is a highly adaptable organism that can persist in a wide range of environmental and food-related niches. The consumption of contaminated ready-to-eat foods can cause infections, termed listeriosis, in vulnerable humans, particularly those with weakened immune systems. Although these infections are comparatively rare they are associated with high mortality rates and therefore this pathogen has a significant impact on food safety. L. monocytogenes can adapt to and survive a wide range of stress conditions including low pH, low water activity, and low temperature, which makes it problematic for food producers who rely on these stresses for preservation. Stress tolerance in L. monocytogenes can be explained partially by the presence of the general stress response (GSR), a transcriptional response under the control of the alternative sigma factor sigma B (σB) that reconfigures gene transcription to provide homeostatic and protective functions to cope with the stress. Within the host σB also plays a key role in surviving the harsh conditions found in the gastrointestinal tract. As the infection progresses beyond the GI tract L. monocytogenes uses an intracellular infectious cycle to propagate, spread and remain protected from the host’s humoral immunity. Many of the virulence genes that facilitate this infectious cycle are under the control of a master transcriptional regulator called PrfA. In this review we consider the environmental reservoirs that enable L. monocytogenes to gain access to the food chain and discuss the stresses that the pathogen must overcome to survive and grow in these environments. The overlap that exists between stress tolerance and virulence is described. We review the principal measures that are used to control the pathogen and point to exciting new approaches that might provide improved means of control in the future. PMID:27933042

  9. The Role of Stress and Stress Adaptations in Determining the Fate of the Bacterial Pathogen Listeria monocytogenes in the Food Chain.

    Science.gov (United States)

    NicAogáin, Kerrie; O'Byrne, Conor P

    2016-01-01

    The foodborne pathogen Listeria monocytogenes is a highly adaptable organism that can persist in a wide range of environmental and food-related niches. The consumption of contaminated ready-to-eat foods can cause infections, termed listeriosis, in vulnerable humans, particularly those with weakened immune systems. Although these infections are comparatively rare they are associated with high mortality rates and therefore this pathogen has a significant impact on food safety. L. monocytogenes can adapt to and survive a wide range of stress conditions including low pH, low water activity, and low temperature, which makes it problematic for food producers who rely on these stresses for preservation. Stress tolerance in L. monocytogenes can be explained partially by the presence of the general stress response (GSR), a transcriptional response under the control of the alternative sigma factor sigma B (σ B ) that reconfigures gene transcription to provide homeostatic and protective functions to cope with the stress. Within the host σ B also plays a key role in surviving the harsh conditions found in the gastrointestinal tract. As the infection progresses beyond the GI tract L. monocytogenes uses an intracellular infectious cycle to propagate, spread and remain protected from the host's humoral immunity. Many of the virulence genes that facilitate this infectious cycle are under the control of a master transcriptional regulator called PrfA. In this review we consider the environmental reservoirs that enable L. monocytogenes to gain access to the food chain and discuss the stresses that the pathogen must overcome to survive and grow in these environments. The overlap that exists between stress tolerance and virulence is described. We review the principal measures that are used to control the pathogen and point to exciting new approaches that might provide improved means of control in the future.

  10. Modeling the behavior of Listeria monocytogenes during enrichment in half Fraser broth; impact of pooling and the duration of enrichment on the detection of L. monocytogenes in food.

    Science.gov (United States)

    Augustin, Jean-Christophe; Kalmokoff, Martin; Ells, Timothy; Favret, Sandra; Desreumaux, Jennifer; Decourseulles Brasseur, Emilie; Gnanou Besse, Nathalie

    2016-12-01

    A stochastic model describing the growth of Listeria monocytogenes during enrichment in half Fraser was developed for the purpose of estimating the effects of modifications to the first enrichment step of the EN ISO 11290-1 detection method. Information pertaining to the variability of growth rates, physiological state of the cell, and the behavior of individual cells contaminating the food were obtained from previously published studies. We used this model to investigate the impact of pooling enrichment broths (wet pooling) on the performance of the standard method. For validation of the model, the numbers of L. monocytogenes occurring in 88 naturally contaminated foods following pre-enrichment were compared to model-simulated microbial counts. The model was then used to perform simulations representative of the natural contamination observed for smoked salmon in the European baseline survey of 2010-2011. The model-estimated L. monocytogenes levels following individual enrichment or following the pooling of five broths where only one would be contaminated were compared. The model indicated a 10% loss of method sensitivity resulting from wet pooling. The model also predicted a 5% decrease in the sensitivity of the method when the duration of the enrichment was reduced from 24 to 22 h. Copyright © 2016 Elsevier Ltd. All rights reserved.

  11. PFGE standard operating procedures for Listeria monocytogenes: harmonizing the typing of food and clinical strains in Europe.

    Science.gov (United States)

    Michelon, Damien; Félix, Benjamin; Vingadassalon, Noemie; Mariet, Jean-François; Larsson, Jonas T; Møller-Nielsen, Eva; Roussel, Sophie

    2015-03-01

    Listeria monocytogenes is a foodborne pathogen responsible for a severe disease known as listeriosis. The European Centre for Disease Prevention and Control (ECDC) coordinates a network of national public health laboratories (NPHLs) in charge of typing clinical strains. In food, it is the European Union Reference Laboratory for L. monocytogenes (EURL Lm), which manages a network of National Reference Laboratories (NRLs). A pulsed-field gel electrophoresis (PFGE) standard operating procedure (EURL SOP) has been used routinely at the EURL Lm since 2007. The EURL Lm has recommended that NRLs use the EURL SOP, whereas the Statens Serum Institut (SSI), under contract for ECDC, requested that NPHLs use Halpins' SOP (HSOP) published in 2010 for the PulseNet USA network. An update of Halpins' SOP (uHSOP) was published in 2013. To facilitate the exchange of profiles among human and food European reference laboratories, it is crucial to ensure that the PFGE profiles obtained with these different SOPs are comparable. The aim here was to compare the EURL SOP with HSOP and uHSOP. The panel comprised 114 well-characterized SSI/EURL strains. All were characterized at the EURL using both the EURL SOP and uHSOP. Seventy of the 114 strains were also characterized at the SSI using HSOP. The EURL SOP and uHSOP produced indistinguishable combined (ApaI/AscI) profiles for the 114 strains tested. The EURL SOP and HSOP produced indistinguishable combined profiles for 69 of the 70 strains tested. One strain displayed for the AscI profile an additional low-intensity band at 184 kbp with HSOP. For this strain, SSI and EUR Lm had already observed the same profile from NPHLs and NRLs. However, this deviation is minor as it accounted for about 1% of all the 114 combined profiles. This study should facilitate the exchange of reproducible PFGE profiles among human and food reference laboratories.

  12. Tracking of Listeria monocytogenes in meat establishment using Whole Genome Sequencing as a food safety management tool: A proof of concept.

    Science.gov (United States)

    Nastasijevic, Ivan; Milanov, Dubravka; Velebit, Branko; Djordjevic, Vesna; Swift, Craig; Painset, Anais; Lakicevic, Brankica

    2017-09-18

    Repeated Listeria outbreaks particularly associated with Ready-To-Eat (RTE) delicatessen meat products have been reported annually at global level. The most frequent scenario that led to foodborne outbreaks was the post-thermal treatment cross-contamination of deli meat products during slicing and modified atmosphere packaging (MAP). The precondition for such cross contamination is the previous introduction of Listeria into meat processing facilities and subsequent colonization of the production environment, associated with formation of biofilms resilient to common sanitation procedures regularly applied in meat establishments. The use of Whole Genome Sequencing (WGS) can facilitate the understanding of contamination and colonization routes of pathogens within the food production environment and enable efficient pathogen tracking among different departments. This study aimed to: a) provide a proof of concept on practical use of WGS in a meat establishment to define the entry routes and spread pattern of L. monocytogenes, and b) to consider the regular use of WGS in meat processing establishments as a strong support of food safety management system. The results revealed that Listeria spp. was present in slaughter line, chilling chambers, deboning, slicing, MAP, as well as in corridors and dispatch (53 positive samples, out of 240). Eight L. monocytogenes isolates (out of 53) were identified from the slaughterhouse, chilling chambers, deboning, MAP and dispatch. L. monocytogenes isolates were of three different serotypes (1/2a, 1/2c, 4b) and correspondingly of three MLST sequence types. Overall, two pairs of L. monocytogenes isolates were genetically identical, i.e. two serotype 4b isolates (ST1), isolated from water drain at dispatch unit and two isolates obtained from slaughterhouse (floorwall junction at the carcass wash point) and MAP (water drain). These findings indicated that L. monocytogenes isolates identified in meat processing units (MAP, chilling chamber

  13. Listeria monocytogenes infection in poultry and its public health importance with special reference to food borne zoonoses.

    Science.gov (United States)

    Dhama, Kuldeep; Verma, Amit Kumar; Rajagunalan, S; Kumar, Amit; Tiwari, Ruchi; Chakraborty, Sandip; Kumar, Rajesh

    2013-04-01

    Listeriosis is a disease that causes septicemia or encephalitis in humans, animals and birds. Although, the disease is rare and sporadic in poultry but if occurs then causes septicemia or sometimes localized encephalitis. Occasionally, the disease is seen in young chicks and the causative agent, like in humans and animals, is Listeria monocytogenes. The organism is capable to infect almost all animals and poultry; however, outbreaks of listeriosis are infrequent in birds. It is widely distributed among avian species and chickens, turkeys, waterfowl (geese, ducks), game birds, pigeons, parrots, wood grouse, snowy owl, eagle, canaries, which appear to be the most commonly affected. Chickens are thought to be the carriers of Listeria and also the prime reservoirs for the infection and thus contaminate the litter and environment of the poultry production units. Listeriosis is often noticed along with other poultry diseases such as coccidiosis, infectious coryza, salmonellosis, campylobacteriosis and parasitic infections, signifying the opportunistic nature of the organism. Intestinal colonization of poultry and the presence of L. monocytogenes in feces represent a potential source of the organism for listeriosis in ruminants. Man gets infection from raw broiler meat due to Listeria contamination and unhygienic conditions of the processing area, rather than acquiring direct infection from birds. With the changing food habits of the people, the health consciousness is also increasing and since listeriosis has now been recognized as an emerging food borne zoonoses. Therefore, this review has been compiled to make aware the poultry producers and the consumers of poultry meat/products regarding the importance of the disease and its public health significance.

  14. Antibiotic Susceptibility Profiles of Listeria monocytogenes Strains Isolated from Food Products and Clinical Samples

    Directory of Open Access Journals (Sweden)

    Caplan Marius Eduard

    2014-06-01

    Full Text Available Listeria monocytogenes are o distribuţie ubiquitară în natură şi poate contamina produsele alimentare de origine animală, provocând infecţii severe la om. Până în prezent există foarte puține date cu privire la profilurile de rezistenţă ale tulpinilor circulante în România. Scopul acestui studiu a fost determinarea pattern-urilor de rezistenţă la antibiotice ale unor tulpini de L. monocytogenes (n=37 izolate din produse alimentare de origine animală şi din probe clinice. Probele din alimente (carne şi produse lactate, au fost colectate în perioada 2009-2013. Probele clinice au fost recoltate de la pacienţi cu septicemie, meningită/meningo-encefalită, cazuri de avort spontan şi nou-născuţi, spitalizaţi în perioada Aprilie 2010 - Aprilie 2013 în trei Instituţii Medicale din Bucureşti: Spitalul Elias, Spitalul Victor Babes si Institutul Naţional de Boli Infecţioase (INBI Matei Bals. Toate tulpinile testate au prezentat rezistenţă la cefalosporine şi acidul nalidixic; o tulpină izolată din melci fierţi a fost rezistentă la Trimetoprim/sulfametoxazol. Rezistenţa unora dintre tulpinile analizate la ampicilina, antibiotic de elecţie pentru terapia infecţiilor cauzate de L. monocytogenes, subliniază necesitatea testării in vitro a sensibilitatii la antibiotice a fiecarui izolat clinic pentru a stabili eficienţa diferitelor antibiotice, precum şi a unor studii epidemiologice extinse în scopul stabilirii profilurilor de rezistenţă ale tulpinilor de L. monocytogenes circulante în ţara noastră.

  15. Prevalence and level of Listeria monocytogenes and other Listeria species in selected retail ready-to-eat foods in the United Kingdom.

    Science.gov (United States)

    Little, C L; Sagoo, S K; Gillespie, I A; Grant, K; McLauchlin, J

    2009-09-01

    Although listeriosis is a rare cause of human disease in the United Kingdom, an increase in the number of cases has been observed since 2001, almost exclusively in persons older than 60 years. This increase prompted this study on the microbiological safety of ready-to-eat (RTE) foods, which included those types potentially linked to cases of listeriosis. Between May 2006 and April 2007, 6,984 RTE foods were sampled (2,168 sliced meats, 1,242 hard cheese, 1,088 sandwiches, 878 butter, 725 spreadable cheese, 515 confectionery products containing cream, and 368 probiotic drinks). The food types with the highest prevalence of Listeria monocytogenes were sandwiches (7.0%) and sliced meats (3.7% within shelf life, 4.2% end of shelf life). L. monocytogenes at > 100 CFU/g (exceeding the European Commission's food safety criteria limit) only occurred in sandwiches (0.4%) and sliced meats (0.7% within shelf life, 1.0% end of shelf life). Contamination with L. monocytogenes at >100 CFU/g was more frequent in meats that were prepacked and/or of pack size > or = 300 g and in sandwiches that were supplied prepacked that contained salad vegetables as an ingredient. Satisfactory microbiological quality was associated with premises on which the management was trained in food hygiene and those that complied with hazard analysis and critical control point principles. This study provides important information about the microbiological safety of RTE foods and demonstrates that the control of L. monocytogenes in such foods, and in particular sandwiches and sliced meats, is essential in order to minimize the risk of this bacterium being present at levels hazardous to health at the point of consumption.

  16. Genome-wide-analyses of Listeria monocytogenes from food-processing plants reveal clonal diversity and date the emergence of persisting sequence types.

    Science.gov (United States)

    Knudsen, Gitte M; Nielsen, Jesper Boye; Marvig, Rasmus L; Ng, Yin; Worning, Peder; Westh, Henrik; Gram, Lone

    2017-08-01

    Whole genome sequencing is increasing used in epidemiology, e.g. for tracing outbreaks of food-borne diseases. This requires in-depth understanding of pathogen emergence, persistence and genomic diversity along the food production chain including in food processing plants. We sequenced the genomes of 80 isolates of Listeria monocytogenes sampled from Danish food processing plants over a time-period of 20 years, and analysed the sequences together with 10 public available reference genomes to advance our understanding of interplant and intraplant genomic diversity of L. monocytogenes. Except for three persisting sequence types (ST) based on Multi Locus Sequence Typing being ST7, ST8 and ST121, long-term persistence of clonal groups was limited, and new clones were introduced continuously, potentially from raw materials. No particular gene could be linked to the persistence phenotype. Using time-based phylogenetic analyses of the persistent STs, we estimate the L. monocytogenes evolutionary rate to be 0.18-0.35 single nucleotide polymorphisms/year, suggesting that the persistent STs emerged approximately 100 years ago, which correlates with the onset of industrialization and globalization of the food market. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.

  17. Recombinant phage probes for Listeria monocytogenes

    Energy Technology Data Exchange (ETDEWEB)

    Carnazza, S; Gioffre, G; Felici, F; Guglielmino, S [Department of Microbiological, Genetic and Molecular Sciences, University of Messina, Messina (Italy)

    2007-10-03

    Monitoring of food and environmental samples for biological threats, such as Listeria monocytogenes, requires probes that specifically bind biological agents and ensure their immediate and efficient detection. There is a need for robust and inexpensive affinity probes as an alternative to antibodies. These probes may be recruited from random peptide libraries displayed on filamentous phage. In this study, we selected from two phage peptide libraries phage clones displaying peptides capable of specific and strong binding to the L. monocytogenes cell surface. The ability of isolated phage clones to interact specifically with L. monocytogenes was demonstrated using enzyme-linked immunosorbent assay (ELISA) and confirmed by co-precipitation assay. We also assessed the sensitivity of phage-bacteria binding by PCR on phage-captured Listeria cells, which could be detected at a concentration of 10{sup 4} cells ml{sup -1}. In addition, as proof-of-concept, we tested the possibility of immobilizing the affinity-selected phages to a putative biosensor surface. The quality of phage deposition was monitored by ELISA and fluorescent microscopy. Phage-bacterial binding was confirmed by high power optical phase contrast microscopy. Overall, the results of this work validate the concept of affinity-selected recombinant filamentous phages as probes for detecting and monitoring bacterial agents under any conditions that warrant their recognition, including in food products.

  18. Recombinant phage probes for Listeria monocytogenes

    Science.gov (United States)

    Carnazza, S.; Gioffrè, G.; Felici, F.; Guglielmino, S.

    2007-10-01

    Monitoring of food and environmental samples for biological threats, such as Listeria monocytogenes, requires probes that specifically bind biological agents and ensure their immediate and efficient detection. There is a need for robust and inexpensive affinity probes as an alternative to antibodies. These probes may be recruited from random peptide libraries displayed on filamentous phage. In this study, we selected from two phage peptide libraries phage clones displaying peptides capable of specific and strong binding to the L. monocytogenes cell surface. The ability of isolated phage clones to interact specifically with L. monocytogenes was demonstrated using enzyme-linked immunosorbent assay (ELISA) and confirmed by co-precipitation assay. We also assessed the sensitivity of phage-bacteria binding by PCR on phage-captured Listeria cells, which could be detected at a concentration of 104 cells ml-1. In addition, as proof-of-concept, we tested the possibility of immobilizing the affinity-selected phages to a putative biosensor surface. The quality of phage deposition was monitored by ELISA and fluorescent microscopy. Phage-bacterial binding was confirmed by high power optical phase contrast microscopy. Overall, the results of this work validate the concept of affinity-selected recombinant filamentous phages as probes for detecting and monitoring bacterial agents under any conditions that warrant their recognition, including in food products.

  19. The antimicrobial action of resveratrol against Listeria monocytogenes in food-based models and its antibiofilm properties.

    Science.gov (United States)

    Ferreira, Susana; Domingues, Fernanda

    2016-10-01

    Resveratrol (3,5,4'-trihydroxy-trans-stilbene) is a natural phytoalexin synthesized by plants in response to stress. This compound has several beneficial documented properties, namely anti-inflammatory, antioxidant, neuroprotective and antimicrobial activities. In this study the antimicrobial activity of resveratrol against Listeria monocytogenes and Listeria innocua was investigated. Resveratrol had a minimum inhibitory concentration of 200 µg mL(-1) for the tested strains, with time-kill curves demonstrating bacteriostatic activity. Inhibition of biofilm formation was also assessed, with resveratrol strongly inhibiting biofilm formation by both species even at subinhibitory concentrations. Overall, resveratrol showed antimicrobial properties on planktonic cells and on biofilm formation ability. Considering the potential use of resveratrol as a food preservative, the antimicrobial efficacy of resveratrol in food was studied in milk, lettuce leaf model and chicken juice. Resveratrol retained greater efficacy in both lettuce leaf model and chicken juice, but milk had a negative impact on its antilisterial activity, indicating a possible reduction of resveratrol availability in milk. This study reinforces resveratrol as an antimicrobial agent, pointing out its antibiofilm activity and its potential use as preservative in some food matrices. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

  20. Mechanistic model coupling gas exchange dynamics and Listeria monocytogenes growth in modified atmosphere packaging of non respiring food.

    Science.gov (United States)

    Chaix, E; Broyart, B; Couvert, O; Guillaume, C; Gontard, N; Guillard, V

    2015-10-01

    A mechanistic model coupling O2 and CO2 mass transfer (namely diffusion and solubilisation in the food itself and permeation through the packaging material) to microbial growth models was developed aiming at predicting the shelf life of modified atmosphere packaging (MAP) systems. It was experimentally validated on a non-respiring food by investigating concomitantly the O2/CO2 partial pressure in packaging headspace and the growth of Listeria monocytogenes (average microbial count) within the food sample. A sensitivity analysis has revealed that the reliability of the prediction by this "super-parametrized" model (no less than 47 parameters were required for running one simulation) was strongly dependent on the accuracy of the microbial input parameters. Once validated, this model was used to decipher the role of O2/CO2 mass transfer on microbial growth and as a MAP design tool: an example of MAP dimensioning was provided in this paper as a proof of concept. Copyright © 2015 Elsevier Ltd. All rights reserved.

  1. Antimicrobial Resistance, Virulence Profile, and Molecular Characterization of Listeria monocytogenes Isolated from Ready-to-eat Food in China, 2013-2014.

    Science.gov (United States)

    Yan, Shao Fei; Wang, Wei; Bai, Li; Hu, Yu Jie; Dong, Yin Ping; Xu, Jin; Li, Feng Qin

    2016-06-01

    We aimed to investigate the potential pathogenic profile and antibiotic resistance of Listeria monocytogenes isolated from ready-to-eat food in China. Antimicrobial resistance was determined by broth microdilution following the Clinical and Laboratory Standards Institute protocol. Molecular serotyping, virulence, and resistance genes were identified using PCR. Multi-locus sequence typing was performed on resistant strains. A total of 11.53% (113/980) isolates were resistant, from which 82.3% (93/113) harbored all the virulence genes tested. The resistant strains were subtyped into 18 sequence types (STs), from which ST2, ST5, ST8, and ST9 were involved in listeriosis. This study indicated that several L. monocytogenes isolates from ready-to-eat foods in China have pathogenic potential and are resistant to antibiotics, including antibiotics used as medicines by humans for listeriosis treatment. Copyright © 2016 The Editorial Board of Biomedical and Environmental Sciences. Published by China CDC. All rights reserved.

  2. Studies on the pathogenesis and survival of different culture forms of Listeria monocytogenes to pulsed UV-light irradiation after exposure to mild-food processing stresses.

    Science.gov (United States)

    Bradley, Derek; McNeil, Brian; Laffey, John G; Rowan, Neil J

    2012-06-01

    The effects of mild conventional food-processing conditions on Listeria monocytogenes survival to pulsed UV (PUV) irradiation and virulence-associated characteristics were investigated. Specifically, this study describes the inability of 10 strains representative of 3 different culture forms or morphotypes of L. monocytogenes to adapt to normally lethal levels of PUV-irradiation after exposure to sub-lethal concentrations of salt (7.5% (w/v) NaCl for 1 h), acid (pH 5.5 for 1 h), heating (48 °C for 1 h) or PUV (UV dose 0.08 μJ/cm(2)). Findings showed that the order of increasing sensitivity of L. monocytogenes of non-adapted and stressed morphotypes to low pH (pH 3.5 for 5 h, adjusted with lactic), high salt (17.5% w/v NaCl for 5 h), heating (60 °C for 1 h) and PUV-irradiation (100 pulses at 7.2 J and 12.8 J, equivalent to UV doses of 2.7 and 8.4 μJ/cm(2) respectively) was typical wild-type smooth (S/WT), atypical filamentous rough (FR) and atypical multiple-cell-chain (MCR) variants. Exposure of L. monocytogenes cells to sub-lethal acid, salt or heating conditions resulted in similar or increased susceptibility to PUV treatments. Only prior exposure to mild heat stressing significantly enhanced invasion of Caco-2 cells, whereas subjection of L. monocytogenes cells to combined sub-lethal salt, acid and heating conditions produced the greatest reduction in invasiveness. Implications of these findings are discussed. This constitutes the first study to show that pre-exposure to mild conventional food-processing stresses enhances sensitivity of different culture morphotypes of L. monocytogenes to PUV, which is growing in popularity as an alternative or complementary approach for decontamination in the food environment. Copyright © 2011 Elsevier Ltd. All rights reserved.

  3. Bactericidal and antibiofilm activity of bactenecin-derivative peptides against the food-pathogen Listeria monocytogenes: New perspectives for food processing industry.

    Science.gov (United States)

    Palmieri, Gianna; Balestrieri, Marco; Capuano, Federico; Proroga, Yolande T R; Pomilio, Francesco; Centorame, Patrizia; Riccio, Alessia; Marrone, Raffaele; Anastasio, Aniello

    2018-08-20

    Antimicrobial peptides have received great attention for their potential benefits to extend the shelf-life of food-products. Innate defense regulator peptide-1018 (IDR-1018) represents a promising candidate for such applications, due to its broad-spectrum antimicrobial activity, although food-isolated pathogens have been poorly investigated. Herein, we describe the design and the structural-functional characterization of a new 1018-derivative peptide named 1018-K6, in which the alanine in position 6 was replaced with a lysine. Spectroscopic analysis revealed a noticeable switch from β-sheet to helical conformations of 1018-K6 respect to IDR-1018, with a faster folding kinetic and increased structural stability. Moreover, 1018-K6 evidenced a significant antibiofilm/bactericidal efficiency specifically against Listeria monocytogenes isolates from food-products and food-processing environments, belonging to serotype 4b involved in the majority of human-listeriosis cases, with EC 50 values two- five-fold lower than those measured for IDR-1018. Therefore, a single amino-acid substitution in IDR-1018 sequence produced severe changes in peptide conformation and antimicrobial performances. Published by Elsevier B.V.

  4. How a routine checking of Escherichia coli in retailed food of animal origin can protect consumers against exposition to Campylobacter spp. and Listeria monocytogenes?

    Directory of Open Access Journals (Sweden)

    Trajković-Pavlović Ljiljana

    2010-01-01

    Full Text Available Background/Aim. According to the literature that has been published over the last two decades Campylobacter spp i Listeria monocitogens can be identified as causes of numerous diseases derived by consuming food of animal origin. The purpose of this paper was to find out how established national microbiological criteria of the Republic of Serbia on food safety in retailed food of animal origin could contribute to consumer's protection against exposition to foodborne pathogens such as Campylobacter spp. and Listeria monocytogenes. Methods. During a routine microbiological safety control of randomly selected 60 samples of fresh poultry meat, 30 samples of other fresh meat readymade for grilling, 30 samples of sausage products, 37 samples of heattreated meat, 39 samples of toppings for fast food of animal origin and 31 samples of dairy products a national food safety criteria (Escherichia coli, aerobic plate count, Salmonella spp., coagulasa positive Staphylococcus, Proteus spp., sulphitoreducting Clostridia were applied and, as well as, testing to Campylobacter spp. and Listeria monocitogens. In determination of Campylobacter spp. and Listeria monocytogenes, food quality control methods of the Food and Agriculture Organization (FAO were applied, while in determination of the other above motioned bacteria, national provisions on microbiological methods were applied who are adjusted to the FAO ones. Results. Related to the national criteria on microbiological food safety, 88 (38.8% samples, out of the total 227 tested, were rejected. When to these results, the results of laboratory tests on Listeria monocytogens were added, a terminal number of rejected samples were not changed. When to these results, the results of Campylobacter spp. testing were added, 91 (40.1% out of the 227 samples were unsatisfied. Results of logistic regression model with occurrence of Escherichia coli as dependent variable indicated that Escherichia coli was 4.5 times likely

  5. How a routine checking of Escherichia coli in retailed food of animal origin can protect consumers against exposition to Campylobacter spp. and Listeria monocytogenes?

    Science.gov (United States)

    Trajković-Pavlović, Ljiljana; Novaković, Budimka; Martinov-Cvejin, Mirjana; Gusman, Vera; Bijelović, Sanja; Dragnić, Natasa; Balać, Dragana

    2010-08-01

    According to the literature that has been published over the last two decades Campylobacter spp i Listeria monocitogens can be identified as causes of numerous diseases derived by consuming food of animal origin. The purpose of this paper was to find out how established national microbiological criteria of the Republic of Serbia on food safety in retailed food of animal origin could contribute to consumer's protection against exposition to foodborne pathogens such as Campylobacter spp. and Listeria monocytogenes. During a routine microbiological safety control of randomly selected 60 samples of fresh poultry meat, 30 samples of other fresh meat readymade for grilling, 30 samples of sausage products, 37 samples of heat-treated meat, 39 samples of toppings for fast food of animal origin and 31 samples of dairy products a national food safety criteria (Escherichia coli, aerobic plate count, Salmonella spp., coagulasa positive Staphylococcus, Proteus spp., sulphito-reducting Clostridia) were applied and, as well as, testing to Campylobacter spp. and Listeria monocitogens. In determination of Campylobacter spp. and Listeria monocytogenes, food quality control methods of the Food and Agriculture Organization (FAO) were applied, while in determination of the other above motioned bacteria, national provisions on microbiological methods were applied who are adjusted to the FAO ones. Related to the national criteria on microbiological food safety, 88 (38.8%) samples, out of the total 227 tested, were rejected. When to these results, the results of laboratory tests on Listeria monocytogens were added, a terminal number of rejected samples were not changed. When to these results, the results of Campylobacter spp. testing were added, 91 (40.1%) out of the 227 samples were unsatisfied. Results of logistic regression model with occurrence of Escherichia coli as dependent variable indicated that Escherichia coli was 4.5 times likely to occur among samples with Campylobacter spp

  6. Use of multi-locus sequencing typing as identification method for the food-borne pathogen Listeria monocytogenes: a review

    Directory of Open Access Journals (Sweden)

    Sonia Lamon

    2015-01-01

    Full Text Available Listeria monocytogenes is an ubiquitous, intracellular pathogen which has been implicated within the past decade as the causative organism in several outbreaks of foodborne diseases. In this review, a new approach to molecular typing primarily designed for global epidemiology has been described: multi-locus sequencing typing (MLST. This approach is novel, in that it uses data that allow the unambiguous characterization of bacterial strains via the Internet. Our aim is to present the currently available selection of references on L. monocytogenes MLST detection methods and to discuss its use as gold standard to L. monocytogenes subtyping method.

  7. Food contact surfaces coated with nitrogen-doped titanium dioxide: effect on Listeria monocytogenes survival under different light sources

    Energy Technology Data Exchange (ETDEWEB)

    Rodrigues, D.; Teixeira, P. [Institute for Biotechnology and Bioengineering, Centre of Biological Engineering, University of Minho, Campus de Gualtar, 4710-057 Braga (Portugal); Tavares, C.J. [Center of Physics, University of Minho, Campus de Azurém, 4800-058 Guimarães (Portugal); Azeredo, J., E-mail: jazeredo@deb.uminho.pt [Institute for Biotechnology and Bioengineering, Centre of Biological Engineering, University of Minho, Campus de Gualtar, 4710-057 Braga (Portugal)

    2013-04-01

    Improvement of food safety is a very important issue, and is on the basis of production and application of new/modified food contact surfaces. Titanium dioxide (TiO{sub 2}) and, more recently, nitrogen-doped titanium dioxide (N-TiO{sub 2}) coatings are among the possible forms to enhance food contact surfaces performance in terms of higher hygiene and easier sanitation. In this context, the present work aimed at evaluating the bactericidal activity of an N-TiO{sub 2} coating on glass and stainless steel under two different sources of visible light – fluorescent and incandescent – and ultraviolet (UV) irradiation. Listeria monocytogenes was chosen as representative of major foodborne pathogens and its survival was tested on N-TiO{sub 2} coated coupons. In terms of survival percentage, good results were obtained after exposure of coated surfaces to all light types since, apart from the value obtained after exposing glass to fluorescent light (56.3%), survival rates were always below 50%. However, no effective disinfection was obtained, given that for a disinfectant or sanitizing agent to be claimed as effective it needs to be able to promote at least a 3-log reduction of the microbial load, which was not observed for any of the experimental conditions assessed. Even so, UV irradiation was the most successful on eliminating cells on coated surfaces, since the amount of bacteria was reduced to 1.49 × 10{sup 6} CFU/ml on glass and 2.37 × 10{sup 7} on stainless steel. In contrast, both visible light sources had only slightly decreased the amount of viable cells, which remained in the range of 8 log CFU/ml. Hence, although some bactericidal effect was accomplished under visible light, UV was the most effective light source on promoting photocatalytic reactions on N-TiO{sub 2} coated coupons and none of the experimental conditions have reached a satisfactory disinfection level. Thus, this surface coating needs further research and improvement in order to become truly

  8. Food contact surfaces coated with nitrogen-doped titanium dioxide: effect on Listeria monocytogenes survival under different light sources

    International Nuclear Information System (INIS)

    Rodrigues, D.; Teixeira, P.; Tavares, C.J.; Azeredo, J.

    2013-01-01

    Improvement of food safety is a very important issue, and is on the basis of production and application of new/modified food contact surfaces. Titanium dioxide (TiO 2 ) and, more recently, nitrogen-doped titanium dioxide (N-TiO 2 ) coatings are among the possible forms to enhance food contact surfaces performance in terms of higher hygiene and easier sanitation. In this context, the present work aimed at evaluating the bactericidal activity of an N-TiO 2 coating on glass and stainless steel under two different sources of visible light – fluorescent and incandescent – and ultraviolet (UV) irradiation. Listeria monocytogenes was chosen as representative of major foodborne pathogens and its survival was tested on N-TiO 2 coated coupons. In terms of survival percentage, good results were obtained after exposure of coated surfaces to all light types since, apart from the value obtained after exposing glass to fluorescent light (56.3%), survival rates were always below 50%. However, no effective disinfection was obtained, given that for a disinfectant or sanitizing agent to be claimed as effective it needs to be able to promote at least a 3-log reduction of the microbial load, which was not observed for any of the experimental conditions assessed. Even so, UV irradiation was the most successful on eliminating cells on coated surfaces, since the amount of bacteria was reduced to 1.49 × 10 6 CFU/ml on glass and 2.37 × 10 7 on stainless steel. In contrast, both visible light sources had only slightly decreased the amount of viable cells, which remained in the range of 8 log CFU/ml. Hence, although some bactericidal effect was accomplished under visible light, UV was the most effective light source on promoting photocatalytic reactions on N-TiO 2 coated coupons and none of the experimental conditions have reached a satisfactory disinfection level. Thus, this surface coating needs further research and improvement in order to become truly effective against foodborne

  9. Food contact surfaces coated with nitrogen-doped titanium dioxide: effect on Listeria monocytogenes survival under different light sources

    Science.gov (United States)

    Rodrigues, D.; Teixeira, P.; Tavares, C. J.; Azeredo, J.

    2013-04-01

    Improvement of food safety is a very important issue, and is on the basis of production and application of new/modified food contact surfaces. Titanium dioxide (TiO2) and, more recently, nitrogen-doped titanium dioxide (N-TiO2) coatings are among the possible forms to enhance food contact surfaces performance in terms of higher hygiene and easier sanitation. In this context, the present work aimed at evaluating the bactericidal activity of an N-TiO2 coating on glass and stainless steel under two different sources of visible light - fluorescent and incandescent - and ultraviolet (UV) irradiation. Listeria monocytogenes was chosen as representative of major foodborne pathogens and its survival was tested on N-TiO2 coated coupons. In terms of survival percentage, good results were obtained after exposure of coated surfaces to all light types since, apart from the value obtained after exposing glass to fluorescent light (56.3%), survival rates were always below 50%. However, no effective disinfection was obtained, given that for a disinfectant or sanitizing agent to be claimed as effective it needs to be able to promote at least a 3-log reduction of the microbial load, which was not observed for any of the experimental conditions assessed. Even so, UV irradiation was the most successful on eliminating cells on coated surfaces, since the amount of bacteria was reduced to 1.49 × 106 CFU/ml on glass and 2.37 × 107 on stainless steel. In contrast, both visible light sources had only slightly decreased the amount of viable cells, which remained in the range of 8 log CFU/ml. Hence, although some bactericidal effect was accomplished under visible light, UV was the most effective light source on promoting photocatalytic reactions on N-TiO2 coated coupons and none of the experimental conditions have reached a satisfactory disinfection level. Thus, this surface coating needs further research and improvement in order to become truly effective against foodborne pathogens and

  10. Radiological monitoring of food in Cuba

    International Nuclear Information System (INIS)

    Jerez V, S.F.

    1996-01-01

    The appearing of the problem for protecting the environment from radioactive contamination is not an accidental matter. The introduction into the earth crust of radioactive material coming from nuclear weapons, accidents, wastes, etc, has caused, as a consequence, the contamination of the biosphere. The extensive trade of food in our country has made necessary the establishment of radiological monitoring in food, which was organized by the Department of Public Health. The structure, functions, characteristics and aspects related to radiological monitoring of food in Cuba are shown in the present paper. The organization and resources for performing the monitoring program, both for normal conditions and for nuclear and/or radiological emergency cases, are detailed. (author). 12 refs., 2 figs

  11. Aerosol studies with Listeria innocua and Listeria monocytogenes.

    Science.gov (United States)

    Zhang, Guodong; Ma, Li; Oyarzabal, Omar A; Doyle, Michael P

    2007-08-01

    Aerosol studies of Listeria monocytogenes in food processing plants have been limited by lack of a suitable surrogate microorganism. The objective of this study was to investigate the potential of using green fluorescent protein-labeled strains of Listeria innocua as a surrogate for L. monocytogenes for aerosol studies. These studies were conducted in a laboratory bioaerosol chamber and a pilot food-processing facility. Four strains of L. innocua and five strains of L. monocytogenes were used. In the laboratory chamber study, Listeria cells were released into the environment at two different cell numbers and under two airflow conditions. Trypticase soy agar (TSA) plates and oven-roasted breasts of chicken and turkey were placed in the chamber to monitor Listeria cell numbers deposited from aerosols. A similar experimental design was used in the pilot plant study; however, only L. innocua was used. Results showed that L. monocytogenes and L. innocua survived equally well on chicken and turkey breast meats and TSA plates. No-fan and continuous fan applications, which affected airflow, had no significant effect on settling rates of aerosolized L. monocytogenes and L. innocua in the bioaerosol chamber or L. innocua in the pilot plant study. Listeriae cell numbers in the air decreased rapidly during the first 1.5 h following release, with few to no listeriae detected in the air at 3 h. Aerosol particles with diameters of 1 and 2 microM correlated directly with the number of Listeria cells in the aerosol but not with particles that were 0.3, 0.5, and 5 microM in diameter. Results indicate that L. innocua can be used as a surrogate for L. monocytogenes in an aerosol study.

  12. Monitoring Industrial Food Processes Using Spectroscopy & Chemometrics

    DEFF Research Database (Denmark)

    Pedersen, Dorthe Kjær; Engelsen, Søren Balling

    2001-01-01

    In the last decade rapid spectroscopic measurements have revolutionized quality control in practically all areas of primary food and feed production. Near-infrared spectroscopy (NIR & NIT) has been implemented for monitoring the quality of millions of samples of cereals, milk and meat with unprec......In the last decade rapid spectroscopic measurements have revolutionized quality control in practically all areas of primary food and feed production. Near-infrared spectroscopy (NIR & NIT) has been implemented for monitoring the quality of millions of samples of cereals, milk and meat...

  13. Survey for Listeria monocytogenes on ready-to-eat foods from retail establishments in the United States (2010-2013): assessing potential changes of pathogen prevalence and levels in a decade

    Science.gov (United States)

    A multi-year Interagency Listeria monocytogenes Market Basket Survey (Lm MBS) was undertaken for selected categories of refrigerated ready-to eat (RTE) foods purchased at retail in four FoodNet sites in the U.S. Eighteen product types were sampled, including RTE seafood, produce, dairy, meat, eggs,...

  14. Biosensor for the detection of Listeria monocytogenes: emerging trends

    KAUST Repository

    Soni, Dharmendra Kumar

    2018-05-23

    The early detection of Listeria monocytogenes (L. monocytogenes) and understanding the disease burden is of paramount interest. The failure to detect pathogenic bacteria in the food industry may have terrible consequences, and poses deleterious effects on human health. Therefore, integration of methods to detect and trace the route of pathogens along the entire food supply network might facilitate elucidation of the main contamination sources. Recent research interest has been oriented towards the development of rapid and affordable pathogen detection tools/techniques. An innovative and new approach like biosensors has been quite promising in revealing the foodborne pathogens. In spite of the existing knowledge, advanced research is still needed to substantiate the expeditious nature and sensitivity of biosensors for rapid and in situ analysis of foodborne pathogens. This review summarizes recent developments in optical, piezoelectric, cell-based, and electrochemical biosensors for Listeria sp. detection in clinical diagnostics, food analysis, and environmental monitoring, and also lists their drawbacks and advantages.

  15. Salt stress-induced transcription of σB- and CtsR-regulated genes in persistent and non-persistent Listeria monocytogenes strains from food processing plants.

    Science.gov (United States)

    Ringus, Daina L; Ivy, Reid A; Wiedmann, Martin; Boor, Kathryn J

    2012-03-01

    Listeria monocytogenes is a foodborne pathogen that can persist in food processing environments. Six persistent and six non-persistent strains from fish processing plants and one persistent strain from a meat plant were selected to determine if expression of genes in the regulons of two stress response regulators, σ(B) and CtsR, under salt stress conditions is associated with the ability of L. monocytogenes to persist in food processing environments. Subtype data were also used to categorize the strains into genetic lineages I or II. Quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR) was used to measure transcript levels for two σ(B)-regulated genes, inlA and gadD3, and two CtsR-regulated genes, lmo1138 and clpB, before and after (t=10 min) salt shock (i.e., exposure of exponential phase cells to BHI+6% NaCl for 10 min at 37°C). Exposure to salt stress induced higher transcript levels relative to levels under non-stress conditions for all four stress and virulence genes across all wildtype strains tested. Analysis of variance (ANOVA) of induction data revealed that transcript levels for one gene (clpB) were induced at significantly higher levels in non-persistent strains compared to persistent strains (p=0.020; two-way ANOVA). Significantly higher transcript levels of gadD3 (p=0.024; two-way ANOVA) and clpB (p=0.053; two-way ANOVA) were observed after salt shock in lineage I strains compared to lineage II strains. No clear association between stress gene transcript levels and persistence was detected. Our data are consistent with an emerging model that proposes that establishment of L. monocytogenes persistence in a specific environment occurs as a random, stochastic event, rather than as a consequence of specific bacterial strain characteristics.

  16. Molecular epidemiology and genetic diversity of Listeria monocytogenes isolates from a wide variety of ready-to-eat foods and their relationship to clinical strains from listeriosis outbreaks in Chile.

    Directory of Open Access Journals (Sweden)

    David eMontero

    2015-04-01

    Full Text Available Listeria monocytogenes is a pathogen transmitted through food that can cause severe infections in high-risk groups such as pregnant women, elderly, young children and immunocompromised individuals. It is a ubiquitous bacterium that can survive in harsh conditions, such as dry environments, at low temperatures, in brine conditions and at low pH values. It also has the capacity to form biofilms, which makes it particularly successful even in colonizing surfaces within food processing plants. This study analyzed the presence of L. monocytogenes in ready-to-eat food (RTE such as sausage, cheese, fresh salads and other types of raw food. 850 samples of refrigerated and packaged food collected in 2008 and 2009 were analyzed. It was found that 25% of these samples were contaminated with L. monocytogenes strains. Serotyping and virulence genes detection by polymerase chain reaction (PCR identified that strains belonging to serotype 4b, and containing one or more genes encoded by LIPI-1, were significantly associated with specific food types. Furthermore, using pulse field gel electrophoresis (PFGE, it was possible to associate isolates from cheese with strains from clinical cases of listeriosis outbreaks that occurred during the same time period within the same geographic regions. In addition, a strong correlation was observed between isolates from frozen seafood and from clinical strains obtained from sporadic cases of listeriosis. In agreement with reports described in other countries, our results shown that Chilean strains of L. monocytogenes from food products include the most virulent serotypes, encoding for the main virulence genes of the LIPI-1 pathogenicity island, and were clonally related to clinical isolates from sporadic cases and outbreaks of listeriosis. In conclusion, we show that Chilean isolates of L. monocytogenes from RTE and raw food products can cause disease in humans, representing a public health risk that justifies permanent

  17. Molecular epidemiology and genetic diversity of Listeria monocytogenes isolates from a wide variety of ready-to-eat foods and their relationship to clinical strains from listeriosis outbreaks in Chile.

    Science.gov (United States)

    Montero, David; Bodero, Marcia; Riveros, Guillermina; Lapierre, Lisette; Gaggero, Aldo; Vidal, Roberto M; Vidal, Maricel

    2015-01-01

    Listeria monocytogenes is a pathogen transmitted through food that can cause severe infections in high-risk groups such as pregnant women, elderly, young children and immunocompromised individuals. It is a ubiquitous bacterium that can survive in harsh conditions, such as dry environments, at low temperatures, in brine conditions and at low pH values. It also has the capacity to form biofilms, which makes it particularly successful even in colonizing surfaces within food processing plants. This study analyzed the presence of L. monocytogenes in ready-to-eat food (RTE) such as sausage, cheese, fresh salads, and other types of raw food. 850 samples of refrigerated and packaged food collected in 2008 and 2009 were analyzed. It was found that 25% of these samples were contaminated with L. monocytogenes strains. Serotyping and virulence genes detection by polymerase chain reaction (PCR) identified that strains belonging to serotype 4b, and containing one or more genes encoded by pathogenicity island (LIPI-1), were significantly associated with specific food types. Furthermore, using pulse field gel electrophoresis (PFGE), it was possible to associate isolates from cheese with strains from clinical cases of listeriosis outbreaks that occurred during the same time period within the same geographic regions. In addition, a strong correlation was observed between isolates from frozen seafood and from clinical strains obtained from sporadic cases of listeriosis. In agreement with reports described in other countries, our results shown that Chilean strains of L. monocytogenes from food products include the most virulent serotypes, encoding for the main virulence genes of the LIPI-1, and were clonally related to clinical isolates from sporadic cases and outbreaks of listeriosis. In conclusion, we show that Chilean isolates of L. monocytogenes from RTE and raw food products can cause disease in humans, representing a public health risk that justifies permanent surveillance.

  18. Examination of food chain-derived Listeria monocytogenes strains of different serotypes reveals considerable diversity in inlA genotypes, mutability, and adaptation to cold temperatures.

    Science.gov (United States)

    Kovacevic, Jovana; Arguedas-Villa, Carolina; Wozniak, Anna; Tasara, Taurai; Allen, Kevin J

    2013-03-01

    Listeria monocytogenes strains belonging to serotypes 1/2a and 4b are frequently linked to listeriosis. While inlA mutations leading to premature stop codons (PMSCs) and attenuated virulence are common in 1/2a, they are rare in serotype 4b. We observed PMSCs in 35% of L. monocytogenes isolates (n = 54) recovered from the British Columbia food supply, including serotypes 1/2a (30%), 1/2c (100%), and 3a (100%), and a 3-codon deletion (amino acid positions 738 to 740) seen in 57% of 4b isolates from fish-processing facilities. Caco-2 invasion assays showed that two isolates with the deletion were significantly more invasive than EGD-SmR (P cold temperature following a downshift from 37°C to 4°C. Overall, three distinct cold-adapting groups (CAG) were observed: 46% were fast (200 h) adaptors. Intermediate CAG strains (70%) more frequently possessed inlA PMSCs than did fast (20%) and slow (10%) CAGs; in contrast, 87% of fast adaptors lacked inlA PMSCs. In conclusion, we report food chain-derived 1/2a and 4b serotypes with a 3-codon deletion possessing invasive behavior and the novel association of inlA genotypes encoding a full-length InlA with fast cold-adaptation phenotypes.

  19. Growth and membrane fluidity of food-borne pathogen Listeria monocytogenes in the presence of weak acid preservatives and hydrochloric acid

    Directory of Open Access Journals (Sweden)

    Ioannis eDiakogiannis

    2013-06-01

    Full Text Available This study addresses a major issue in microbial food safety, the elucidation of correlations between acid stress and changes in membrane fluidity of the pathogen Listeria monocytogenes. In order to assess the possible role that membrane fluidity changes play in L. monocytogenes tolerance to antimicrobial acids (acetic, lactic, hydrochloric acid at low pH or benzoic acid at neutral pH, the growth of the bacterium and the gel-to-liquid crystalline transition temperature point (Tm of cellular lipids of each adapted culture was measured and compared with unexposed cells. The Tm of extracted lipids was measured by Differential Scanning Calorimetry (DSC. A trend of increasing Tm values but not of equal extent was observed upon acid tolerance for all samples and this increase is not directly proportional to each acid antibacterial action. The smallest increase in Tm value was observed in the presence of lactic acid, which presented the highest antibacterial action. In the presence of acids with high antibacterial action such as acetic, hydrochloric acid or low antibacterial action such as benzoic acid, increased Tm values were measured. The Tm changes of lipids were also correlated with our previous data about fatty acid changes to acid adaptation. The results imply that the fatty acid changes are not the sole adaptation mechanism for decreased membrane fluidity (increased Tm. Therefore, this study indicates the importance of conducting an in-depth structural study on how acids commonly used in food systems affect the composition of individual cellular membrane lipid molecules.

  20. Listeria monocytogenes Monographic Study

    Directory of Open Access Journals (Sweden)

    Emil Tirziu

    2010-05-01

    Full Text Available Listeria monocytogenes is a ubiquitous bacteria with a remarkable resistance in discordant condition which produce listeriosis, an infectious disease that affects multiple domestic and wild animals’ species, but also humans. Receptive to listeriosis are the majority of domestic or wild mammals and birds, in the last years being registered an increase of receptivity in humans. The concept of listeriosis in human pathology, a disease caused by eating or drinking contaminated food and water, appeared for the first time in 1981, during an outbreak in Canada with seven cases in adults and 34 cases of maternalfetal listeriosis. The alimentary origin of human listeriosis can be easily explained if considered some general characteristics of the bacteria. Thus, resistance in various conditions, especially at lower temperatures, justifies its dissemination and food contamination, particularly when is conserved by refrigeration. Also, L. monocytogenes has a significant presence in alimentary products. Some studies showed that 4% of the milk products, 29% of the meat products, 5% of the vegetable products and 26% of the products obtained from fishes and shell fishes are positive for L. monocytogenes, which allows us to say that battle against these bacteria is a war against microbial contamination.

  1. Prevalence of L. monocytogenes in environmental samples collected in dairy plants of Sassari Province, Italy

    Directory of Open Access Journals (Sweden)

    Giovanni Terrosu

    2015-09-01

    Full Text Available Listeria (L. monocytogenes is frequently isolated from food production environment and often persists in dairy plants despite vigorous sanitation regimes. In recent years several alert notifications were sent to Rapid Alert System for Food Products system as a consequence of Listeria monocytogenes contamination of ricotta cheese. After the alert of 2012, competent authority (Local Health Unit of Sassari Province organised an environmental monitoring plan with the partnership of the Institute for Experimental Veterinary Medicine of Sardinia to verify analysis of dairy plants own-check according to Regulation (EC N° 2073/05 and further modifications. In 2014 n. 665 processing areas samples of n. 50 dairy plants of Sassari Province were examined. UNI EN ISO 11290-1:2005 for detection of L. monocytogenes was used. Non-compliance in n. 5 diary plants are observed (n. 8 positive samples. Post-non-compliance environmental sanitisation was efficient and own-check plans included appropriate corrective actions.

  2. Growth and biofilm formation by Listeria monocytogenes in catfish mucus extract on four food-contact surfaces at 22°C and 10°C and their reduction by commercial disinfectants

    Science.gov (United States)

    The objective of this study was to determine the effect of strain and temperature on growth and biofilm formation by Listeria monocytogenes (Lm) in high and low concentrations of catfish mucus extract on different food-contact surfaces at 10°C and 22°C. The second objective of this study was to eval...

  3. Molecular epidemiology and genetic diversity of Listeria monocytogenes isolates from a wide variety of ready-to-eat foods and their relationship to clinical strains from listeriosis outbreaks in Chile

    NARCIS (Netherlands)

    Montero, David; Bodero Baeza, Marcia; Riveros, Guillermina; Lapierre, Lisette; Gaggero, Aldo; Vidal, Roberto M.; Vidal, Maricel

    2015-01-01

    Listeria monocytogenes is a pathogen transmitted through food that can cause severe infections in high-risk groups such as pregnant women, elderly, young children and immunocompromised individuals. It is a ubiquitous bacterium that can survive in harsh conditions, such as dry environments, at low

  4. Management of Listeria monocytogenes in fermented sausages using the Food Safety Objective concept underpinned by stochastic modeling and meta-analysis.

    Science.gov (United States)

    Mataragas, M; Alessandria, V; Rantsiou, K; Cocolin, L

    2015-08-01

    In the present work, a demonstration is made on how the risk from the presence of Listeria monocytogenes in fermented sausages can be managed using the concept of Food Safety Objective (FSO) aided by stochastic modeling (Bayesian analysis and Monte Carlo simulation) and meta-analysis. For this purpose, the ICMSF equation was used, which combines the initial level (H0) of the hazard and its subsequent reduction (ΣR) and/or increase (ΣI) along the production chain. Each element of the equation was described by a distribution to investigate the effect not only of the level of the hazard, but also the effect of the accompanying variability. The distribution of each element was determined by Bayesian modeling (H0) and meta-analysis (ΣR and ΣI). The output was a normal distribution N(-5.36, 2.56) (log cfu/g) from which the percentage of the non-conforming products, i.e. the fraction above the FSO of 2 log cfu/g, was estimated at 0.202%. Different control measures were examined such as lowering initial L. monocytogenes level and inclusion of an additional killing step along the process resulting in reduction of the non-conforming products from 0.195% to 0.003% based on the mean and/or square-root change of the normal distribution, and 0.001%, respectively. Copyright © 2015 Elsevier Ltd. All rights reserved.

  5. CHALLENGE TESTS WITH LISTERIA MONOCYTOGENES IN SALAMI: PRELIMINARY RESULTS

    Directory of Open Access Journals (Sweden)

    R. Mioni

    2013-02-01

    Full Text Available Challenge tests are the preferable methodology to study the behaviour of Listeria monocytogenes on ready to eat foods, according to Regulation (EC 2073/2005. Challenge testing using L. monocytogenes in seasoned salami from different food business operators showed, after seasoning of the product, a count reduction of the inoculated organisms without any further growth of the pathogen; however differences of L. monocytogenes behaviour could be observed according to different production protocols.

  6. In vitro and in vivo invasiveness of different pulsed-field get electrophoresis types of Listeria monocytogenes

    DEFF Research Database (Denmark)

    Larsen, Charlotte Nexmann; Nørrung, Birgit; Sommer, Helle Mølgaard

    2002-01-01

    The virulence of different pulsed-field gel electrophoresis (PFGE) types of Listeria monocytogenes was examined by monitoring their ability to invade Caco-2 cells. Strains belonging to seven different PFGE types originating from both foods and humans were included. No significant differences...

  7. A framework for evaluating food security and nutrition monitoring ...

    African Journals Online (AJOL)

    Identifying cost and time-efficient approaches to food security and nutrition monitoring programs is fundamental to increasing the utility and sustainability. ... In meeting these challenges, the role of continued evaluation of food security monitoring systems - for their impact on food security decision-making - cannot be ...

  8. Survival strategies of Listeria monocytogenes - roles of regulators and transporters

    NARCIS (Netherlands)

    Wemekamp-Kamphuis, H.H.

    2003-01-01

    Outbreaks of the food-borne pathogen Listeria monocytogenes are mainly associated with ready-to-eatfoods. Survival strategies of L. monocytogenes in relation to minimally processed foods were studied.

  9. Analysis of food radiation monitoring system in Belarus

    International Nuclear Information System (INIS)

    1992-01-01

    Food radiation monitoring system in Belarus due to the Chernobyl accident is analysed. Structure of radiation monitoring network, instrumentation and modern developments. Information on permissible concentration levels in foodstuffs and water is presented and calculations of radionuclide intake for man are performed. Proposals on the creation of social centres of food radiation monitoring for Belarussian population are considered. 4 tabs

  10. Survey for Listeria monocytogenes in and on Ready-to-Eat Foods from Retail Establishments in the United States (2010 through 2013): Assessing Potential Changes of Pathogen Prevalence and Levels in a Decade.

    Science.gov (United States)

    Luchansky, John B; Chen, Yuhuan; Porto-Fett, Anna C S; Pouillot, Régis; Shoyer, Bradley A; Johnson-DeRycke, Rachel; Eblen, Denise R; Hoelzer, Karin; Shaw, William K; van Doren, Jane M; Catlin, Michelle; Lee, Jeehyun; Tikekar, Rohan; Gallagher, Daniel; Lindsay, James A; Dennis, Sherri

    2017-06-01

    A multiyear interagency Listeria monocytogenes Market Basket Survey was undertaken for selected refrigerated ready-to-eat foods purchased at retail in four FoodNet sites in the United States. Food samples from 16 food categories in six broad groups (seafood, produce, dairy, meat, eggs, and combination foods) were collected weekly at large national chain supermarkets and independent grocery stores in California, Maryland, Connecticut, and Georgia for 100 weeks between December 2010 and March 2013. Of the 27,389 total samples, 116 samples tested positive by the BAX PCR system for L. monocytogenes , and the pathogen was isolated and confirmed for 102 samples. Among the 16 food categories, the proportion of positive samples (i.e., without considering clustering effects) based on recovery of a viable isolate of L. monocytogenes ranged from 0.00% (95% confidence interval: 0.00, 0.18) for the category of soft-ripened and semisoft cheese to 1.07% (0.63, 1.68) for raw cut vegetables. Among the 571 samples that tested positive for Listeria-like organisms, the proportion of positive samples ranged from 0.79% (0.45, 1.28) for soft-ripened and semisoft cheese to 4.76% (2.80, 7.51) for fresh crab meat or sushi. Across all 16 categories, L. monocytogenes contamination was significantly associated with the four states (P < 0.05) but not with the packaging location (prepackaged by the manufacturer versus made and/or packaged in the store), the type of store (national chain versus independent), or the season. Among the 102 samples positive for L. monocytogenes , levels ranged from <0.036 most probable number per g to 6.1 log CFU/g. For delicatessen (deli) meats, smoked seafood, seafood salads, soft-ripened and semisoft cheeses, and deli-type salads without meat, the percentage of positive samples was significantly lower (P < 0.001) in this survey than that reported a decade ago based on comparable surveys in the United States. Use of mixed logistic regression models to address

  11. Detección de Listeria monocytogenes en distintos productos alimenticios y en muestras ambientales de una amplia cadena de supermercados de la ciudad de Bahía Blanca (Argentina Listeria monocytogenes detection in different food products and environmental samples of supermarkets of Bahía Blanca city (Argentine

    Directory of Open Access Journals (Sweden)

    M.A. Marzocca

    2004-12-01

    Full Text Available En el período comprendido entre enero de 2002 y julio de 2003 se realizó este trabajo que consistió en la detección de Listeria monocytogenes en diferentes alimentos: 90 muestras de fiambres cocidos, fraccionados y envasados con diferentes metodologías y 132 muestras de queso de pasta blanda. Estos productos fueron analizados utilizando el criterio presencia-ausencia en 25 g de alimento. L. monocytogenes no se halló ni en los fiambres feteados en las ventas personalizadas ni en las muestras de queso analizadas. Por el contrario, se determinó su presencia en el 10% de los fiambres feteados envasados al vacío y en el 5% de los fiambres trozados envasados al vacío. Estos resultados nos llevaron a incluir la investigación de la presencia de este patógeno en diferentes muestras medioambientales. Para ello se hisoparon 115 puntos incluyendo las líneas de procesamiento, materias primas, utensilios, heladeras. L. monocytogenes se halló en el 13,2% de las muestras analizadas: 5% correspondieron a la sala de fraccionamiento de fiambres y lácteos, 6,7% al frigorífico y 1,5% a los sitios de venta personalizada. Estos resultados indicaron la posible existencia de sitios problemáticos donde el microorganismo tendría probabilidad de formar reservorios, por lo que se extremaron las medidas rutinarias de higiene y desinfección.This work on Listeria monocytogenes detection in different foods was carried out between January 2002 and July 2003. Ninety cold-served cooked meats, sliced and packaged by different methods and 132 pieces of soft cheeses were studied. These products were analyzed using the presence/ausence in 25 g criterion. L. monocytogenes was not found either in foods sliced over the counter or in controlled cheeses, but it was found in 10% of sliced cold-served foods and 5% of cut and cold-served meats vacuum packaged. These results led us to investigate the presence of these pathogen bacteria in different environmental samples. A

  12. Risk-Based Approach for Microbiological Food Safety Management in the Dairy Industry: The Case of Listeria monocytogenes in Soft Cheese Made from Pasteurized Milk.

    Science.gov (United States)

    Tenenhaus-Aziza, Fanny; Daudin, Jean-Jacques; Maffre, Alexandre; Sanaa, Moez

    2014-01-01

    According to Codex Alimentarius Commission recommendations, management options applied at the process production level should be based on good hygiene practices, HACCP system, and new risk management metrics such as the food safety objective. To follow this last recommendation, the use of quantitative microbiological risk assessment is an appealing approach to link new risk-based metrics to management options that may be applied by food operators. Through a specific case study, Listeria monocytogenes in soft cheese made from pasteurized milk, the objective of the present article is to practically show how quantitative risk assessment could be used to direct potential intervention strategies at different food processing steps. Based on many assumptions, the model developed estimates the risk of listeriosis at the moment of consumption taking into account the entire manufacturing process and potential sources of contamination. From pasteurization to consumption, the amplification of a primo-contamination event of the milk, the fresh cheese or the process environment is simulated, over time, space, and between products, accounting for the impact of management options, such as hygienic operations and sampling plans. A sensitivity analysis of the model will help orientating data to be collected prioritarily for the improvement and the validation of the model. What-if scenarios were simulated and allowed for the identification of major parameters contributing to the risk of listeriosis and the optimization of preventive and corrective measures. © 2013 Society for Risk Analysis.

  13. Assessment of Listeria monocytogenes virulence in the Galleria mellonella insect larvae model.

    Science.gov (United States)

    Rakic Martinez, Mira; Wiedmann, Martin; Ferguson, Martine; Datta, Atin R

    2017-01-01

    Several animal models have been used to understand the molecular basis of the pathogenicity, infectious dose and strain to strain variation of Listeria monocytogenes. The greater wax worm Galleria mellonella, as an alternative model, provides some useful advantages not available with other models and has already been described as suitable for the virulence assessment of various pathogens including L. monocytogenes. The objectives of this study are: 1) confirming the usefulness of this model with a wide panel of Listeria spp. including non-pathogenic L. innocua, L. seeligeri, L. welshimeri and animal pathogen L. ivanovii; 2) assessment of virulence of several isogenic in-frame deletion mutants in virulence and stress related genes of L. monocytogenes and 3) virulence assessment of paired food and clinical isolates of L. monocytogenes from 14 major listeriosis outbreaks occurred worldwide between 1980 and 2015. Larvae injected with different concentrations of Listeria were incubated at 37°C and monitored over seven days for time needed to kill 50% of larvae (LT50) and to determine change of bacterial population in G. mellonella, 2 and 24 hours post-inoculation. Non-pathogenic members of Listeria and L. ivanovii showed significantly (P monocytogenes strains. Isogenic mutants of L. monocytogenes with the deletions in prfA, plcA, hly, actA and virR genes, also showed significantly (P monocytogenes strains related to non-invasive (gastroenteritis) outbreaks of listeriosis showed significantly (P < 0.05) lower virulence than isolates of the same serotype obtained from outbreaks with invasive symptoms. The difference, however, was dose and strain- dependent. No significant differences in virulence were observed among the serotype tested in this study.

  14. Radiation monitoring of imported food to Saudi Arabia after Chernobyl

    International Nuclear Information System (INIS)

    Abulfaraj, W.H.; Abdul-Majid, S.; Abdul-Fattah, A.F.

    1987-01-01

    Saudi Arabia has been indirectly affected by the Chernobyl accident. Large amounts of food or products that may enter the food chain are daily imported from European countries. After April 27, the Saudi government assigned the responsibilities of radiation monitoring of imported food to some universities and governmental sectors. The nuclear engineering department at King Abdulaziz Univ. (KAU) has undertaken the monitoring duties for products coming to western and southern provinces of the country. The sampling and monitoring procedures and results are described

  15. Growth of Listeria monocytogenes and Yersinia enterocolitica colonies under modified atmospheres at 4 and 8 degrees C using a model food system.

    Science.gov (United States)

    Harrison, W A; Peters, A C; Fielding, L M

    2000-01-01

    The growth of Listeria monocytogenes and Yersinia enterocolitica colonies was studied on solid media at 4 and 8 degrees C under modified atmospheres (MAs) of 5% O2: 10% CO2: 85% N2 (MA1), 30% CO2: 70% N2 (MA2) and air (control). Colony radius, determined using computer image analysis, allowed specific growth rates (mu) and the time taken to detect bacterial colonies to be estimated, after colonies became visible. At 4 degrees C both MAs decreased the growth rates of L. monocytogenes by 1.5- and 3.0-fold under MA1 (mu = 0.02 h(-1)) and MA2 (mu = 0.01 h(-1)), respectively, as compared with the control (mu = 0.03 h(-1)). The time to detection of bacterial colonies was increased from 15 d (control) to 24 (MA1) and 29 d (MA2). At 8 degrees C MA2 decreased the growth rate by 1.5-fold (mu = 0.04 h(-1)) as compared with the control (mu = 0.06 h(-1)) and detection of colonies increased from 7 (control) to 9 d (MA2). At 4 degrees C both MAs decreased the growth rates of Y. enterocolitica by 1.5- and 2.5-fold under MA1 (mu = 0.03 h(-1)) and MA2 (mu = 0.02 h(-1)), respectively, as compared with the control (mu = 0.05 h(-1)). At 8 degrees C identical growth rates were obtained under MA1 and the control (mu = 0.07 h(-1)) whilst a decrease in the growth rate was obtained under MA2 (mu = 0.04 h(-1)). The detection of colonies varied from 6 (8 degrees C, aerobic) to 19 d (4 degrees C, MA2). Refrigerated modified atmosphere packaged foods should be maintained at 4 degrees C and below to ensure product safety.

  16. Genetic Characterization of Listeria monocytogenes Isolates from Industrial and Retail Ready-to-Eat Meat-Based Foods and Their Relationship with Clinical Strains from Human Listeriosis in Portugal.

    Science.gov (United States)

    Henriques, A R; Cristino, J Melo; Fraqueza, M J

    2017-04-01

    Listeria monocytogenes isolates (n = 81) recovered from ready-to-eat meat-based food products (RTEMP) collected in industrial processing plants and retail establishments were genetically characterized for comparison with those from human clinical cases of listeriosis (n = 49). The aim was to assess RTEMP as a possible food source for human infection. L. monocytogenes was detected in 12.5% of the RTEMP samples, and in some cases, counts were above the European food safety criteria. All isolates were assessed by multiplex PCR for serogroup determination and detection of virulence-associated genes inlA, inlB, inlC, inlJ, plcA, hlyA, actA, and iap. Serogroups IIb and IVb dominated in RTEMP and human isolates, and all were positive for the assessed virulence genes. Antibiotic susceptibility testing by the disk diffusion method revealed a low level of resistance among the isolates. Pulsed-field gel electrophoresis (PFGE) of L. monocytogenes isolates, using restriction enzymes ApaI and AscI, revealed genetic variability and differentiated the isolates in five clusters. Although some pulsed-field gel electrophoresis profiles of particular RTEMP and human isolates seemed to be highly related, exhibiting more than 90% similarity, which suggests a possible common source, in most cases the strains were not genetically or temporally matched. The close genetic relatedness of RTEMP and human listeriosis strains stressed the importance of preventive measure implementation throughout the food chain.

  17. Sodium monitoring in commercially processed and restaurant foods.

    Science.gov (United States)

    Ahuja, Jaspreet K C; Pehrsson, Pamela R; Haytowitz, David B; Wasswa-Kintu, Shirley; Nickle, Melissa; Showell, Bethany; Thomas, Robin; Roseland, Janet; Williams, Juhi; Khan, Mona; Nguyen, Quynhanh; Hoy, Kathy; Martin, Carrie; Rhodes, Donna; Moshfegh, Alanna; Gillespie, Cathleen; Gunn, Janelle; Merritt, Robert; Cogswell, Mary

    2015-03-01

    Most sodium in the US diet comes from commercially processed and restaurant foods. Sodium reduction in these foods is key to several recent public health efforts. The objective was to provide an overview of a program led by the USDA, in partnership with other government agencies, to monitor sodium contents in commercially processed and restaurant foods in the United States. We also present comparisons of nutrients generated under the program to older data. We track ∼125 commercially processed and restaurant food items ("sentinel foods") annually using information from food manufacturers and periodically by nationwide sampling and laboratory analyses. In addition, we monitor >1100 other commercially processed and restaurant food items, termed "priority-2 foods" (P2Fs) biennially by using information from food manufacturers. These foods serve as indicators for assessing changes in the sodium content of commercially processed and restaurant foods in the United States. We sampled all sentinel foods nationwide and reviewed all P2Fs in 2010-2013 to determine baseline sodium concentrations. We updated sodium values for 73 sentinel foods and 551 P2Fs in the USDA's National Nutrient Database for Standard Reference (releases 23-26). Sodium values changed by at least 10% for 43 of the sentinel foods, which, for 31 foods, including commonly consumed foods such as bread, tomato catsup, and potato chips, the newer sodium values were lower. Changes in the concentrations of related nutrients (total and saturated fat, total sugar, potassium, or dietary fiber) that were recommended by the 2010 Dietary Guidelines for Americans for reduced or increased consumption accompanied sodium reduction. The results of sodium reduction efforts, based on resampling of the sentinel foods or re-review of P2Fs, will become available beginning in 2015. This monitoring program tracks sodium reduction efforts, improves food composition databases, and strengthens national nutrition monitoring. © 2015

  18. Viable-but-Nonculturable Listeria monocytogenes and Salmonella enterica Serovar Thompson Induced by Chlorine Stress Remain Infectious

    Directory of Open Access Journals (Sweden)

    Callum J. Highmore

    2018-04-01

    Full Text Available The microbiological safety of fresh produce is monitored almost exclusively by culture-based detection methods. However, bacterial food-borne pathogens are known to enter a viable-but-nonculturable (VBNC state in response to environmental stresses such as chlorine, which is commonly used for fresh produce decontamination. Here, complete VBNC induction of green fluorescent protein-tagged Listeria monocytogenes and Salmonella enterica serovar Thompson was achieved by exposure to 12 and 3 ppm chlorine, respectively. The pathogens were subjected to chlorine washing following incubation on spinach leaves. Culture data revealed that total viable L. monocytogenes and Salmonella Thompson populations became VBNC by 50 and 100 ppm chlorine, respectively, while enumeration by direct viable counting found that chlorine caused a <1-log reduction in viability. The pathogenicity of chlorine-induced VBNC L. monocytogenes and Salmonella Thompson was assessed by using Caenorhabditis elegans. Ingestion of VBNC pathogens by C. elegans resulted in a significant life span reduction (P = 0.0064 and P < 0.0001, and no significant difference between the life span reductions caused by the VBNC and culturable L. monocytogenes treatments was observed. L. monocytogenes was visualized beyond the nematode intestinal lumen, indicating resuscitation and cell invasion. These data emphasize the risk that VBNC food-borne pathogens could pose to public health should they continue to go undetected.

  19. Functional food monitoring as part of the new Dutch dietary monitoring system

    NARCIS (Netherlands)

    Rompelberg CJM; Jager M; Bakker MI; Buurma-Rethans EJM; Ocke MC; CVG

    2006-01-01

    Good data on functional food consumption necessary for an adequate Dutch nutrition policy are lacking. This lack may be overcome in future by including functional food monitoring in the new dietary monitoring system in the Netherlands. One specific form of monitoring could be an Internet-based

  20. Genome sequences of Listeria monocytogenes strains with resistance to arsenic

    Science.gov (United States)

    Listeria monocytogenes frequently exhibits resistance to arsenic. We report here the draft genome sequences of eight genetically diverse arsenic-resistant L. monocytogenes strains from human listeriosis and food-associated environments. Availability of these genomes would help to elucidate the role ...

  1. Listeria monocytogenes growth limits and stress resistance mechanisms

    NARCIS (Netherlands)

    Veen, van der S.

    2008-01-01

    The food-borne pathogen Listeria monocytogenes is a Gram-positive facultative anaerobic rod, which is the causative agent of listeriosis. Due to the severity of the disease and the fact that its incidence is increasing in numerous European countries, L. monocytogenes is of great public health

  2. Resistance of Listeria monocytogenes biofilms to sanitizing agents

    Science.gov (United States)

    Listeria monocytogenes is notorious for its capacity to colonize the environment and equipment of food processing facilities and to persist in the processing plant ecosystem, sometimes for decades. Such persistence is mediated by multiple attributes of L. monocytogenes, including the pathogen’s capa...

  3. Prevalence of Listeria monocytogenes in Retail Lightly Pickled Vegetables and Its Successful Control at Processing Plants.

    Science.gov (United States)

    Taguchi, Masumi; Kanki, Masashi; Yamaguchi, Yuko; Inamura, Hideichi; Koganei, Yosuke; Sano, Tetsuya; Nakamura, Hiromi; Asakura, Hiroshi

    2017-03-01

    Incidences of food poisoning traced to nonanimal food products have been increasingly reported. One of these was a recent large outbreak of Shiga toxin-producing Escherichia coli (STEC) O157 infection from the consumption of lightly pickled vegetables, indicating the necessity of imposing hygienic controls during manufacturing. However, little is known about the bacterial contamination levels in these minimally processed vegetables. Here we examined the prevalence of STEC, Salmonella spp., and Listeria monocytogenes in 100 lightly pickled vegetable products manufactured at 55 processing factories. Simultaneously, we also performed quantitative measurements of representative indicator bacteria (total viable counts, coliform counts, and β-glucuronidase-producing E. coli counts). STEC and Salmonella spp. were not detected in any of the samples; L. monocytogenes was detected in 12 samples manufactured at five of the factories. Microbiological surveillance at two factories (two surveys at factory A and three surveys at factory B) between June 2014 and January 2015 determined that the areas predominantly contaminated with L. monocytogenes included the refrigerators and packaging rooms. Genotyping provided further evidence that the contaminants found in these areas were linked to those found in the final products. Taken together, we demonstrated the prevalence of L. monocytogenes in lightly pickled vegetables sold at the retail level. Microbiological surveillance at the manufacturing factories further clarified the sources of the contamination in the retail products. These data indicate the necessity of implementing adequate monitoring programs to minimize health risks attributable to the consumption of these minimally processed vegetables.

  4. Kinetics of biofilm formation and desiccation survival of Listeria monocytogenes in single and dual species biofilms with Pseudomonas fluorescens, Serratia proteamaculans or Shewanella baltica on food-grade stainless steel surfaces.

    Science.gov (United States)

    Daneshvar Alavi, Hessam Edin; Truelstrup Hansen, Lisbeth

    2013-01-01

    This study investigated the dynamics of static biofilm formation (100% RH, 15 °C, 48-72 h) and desiccation survival (43% RH, 15 °C, 21 days) of Listeria monocytogenes, in dual species biofilms with the common spoilage bacteria, Pseudomonas fluorescens, Serratia proteamaculans and Shewanella baltica, on the surface of food grade stainless steel. The Gram-negative bacteria reduced the maximum biofilm population of L. monocytogenes in dual species biofilms and increased its inactivation during desiccation. However, due to the higher desiccation resistance of Listeria relative to P. fluorescens and S. baltica, the pathogen survived in greater final numbers. In contrast, S. proteamaculans outcompeted the pathogen during the biofilm formation and exhibited similar desiccation survival, causing the N21 days of Serratia to be ca 3 Log10(CFU cm(-2)) greater than that of Listeria in the dual species biofilm. Microscopy revealed biofilm morphologies with variable amounts of exopolymeric substance and the presence of separate microcolonies. Under these simulated food plant conditions, the fate of L. monocytogenes during formation of mixed biofilms and desiccation depended on the implicit characteristics of the co-cultured bacterium.

  5. Listeria monocytogenes-carrying consortia in food industry. Composition, subtyping and numerical characterisation of mono-species biofilm dynamics on stainless steel.

    Science.gov (United States)

    Rodríguez-López, Pedro; Saá-Ibusquiza, Paula; Mosquera-Fernández, Maruxa; López-Cabo, Marta

    2015-08-03

    In order to find out how real Listeria monocytogenes-carrying biofilms are in industrial settings, a total of 270 environmental samples belonging to work surfaces from fish (n = 123), meat (n = 75) and dairy industries (n = 72) were analysed in order to detect L. monocytogenes. 12 samples were positive for L. monocytogenes and a total of 18 different species were identified as accompanying microbiota in fish and meat industry. No L. monocytogenes was found in samples from dairy industry. Molecular characterisation combining results of AscI and ApaI macrorestriction PFGE assays yielded 7 different subtypes of L. monocytogenes sharing in 71.43% of cases the same serogroup (1/2a-3a). Results from dynamic numerical characterisation between L. monocytogenes monospecies biofilms on stainless steel (SS) using MATLAB-based tool BIOFILMDIVER demonstrated that except in isolate A1, in which a significant increase in the percentage of covered area (CA), average diffusion distance (ADD) and maximum diffusion distance (MDD) was observed after 120 h of culture, no significant differences were observed in the dynamics of the rest of the L. monocytogenes isolates. Quantitative dual-species biofilm association experiments performed on SS indicated that L. monocytogenes cell counts presented lower values in mixed-species cultures with certain species at 24 and 48 h compared with mono-species culture. However, they remained unaltered after 72 h except when co-cultured with Serratia fonticola which presented differences in all sampling times and was also the dominant species within the dual-species biofilm. When considering frequency of appearance of accompanying species, an ecological distribution was demonstrated as Escherichia coli appeared to be the most abundant in fish industry and Carnobacterium spp. in meat industry. Copyright © 2015 Elsevier B.V. All rights reserved.

  6. Solar irradiance limits the long-term survival of Listeria monocytogenes in seawater.

    Science.gov (United States)

    NicAogáin, K; Magill, D; O'Donoghue, B; Conneely, A; Bennett, C; O'Byrne, C P

    2018-03-01

    Seafood has often been implicated in outbreaks of food-borne illness caused by Listeria monocytogenes but the source of contamination is usually not known. In this study we investigated the possibility that this pathogen could survive in seawater for an extended time period. Freshly collected seawater samples were inoculated with 1 × 10 8  CFU per ml of L. monocytogenes EGD-e and survival was monitored by plate counting for up to 25 days. When incubated in the dark, either at ambient temperatures (4-14°C) or at 16°C, >10 4  CFU per ml survivors were present after 25 days. However, when the seawater cell suspensions were exposed to ambient light (solar irradiation) and temperatures, L. monocytogenes lost viability rapidly and no survivors could be detected after the 80 h time point. Both UV-A and visible light in the blue region of the spectrum (470 nm) were found to contribute to this effect. The stress inducible sigma factor σ B was found to play a role in survival of L. monocytogenes in seawater. Together these data demonstrate that solar irradiation is a critical determinant of L. monocytogenes survival in marine environments. The data further suggest the possibility of controlling this food-borne pathogen in food-processing environments using visible light. Listeria monocytogenes is a food-borne bacterial pathogen capable of causing the life-threatening infection, listeriosis. In seafood the route of contamination from the environment is often not well understood as this pathogen is not generally thought to survive well in seawater. Here we provide evidence that L. monocytogenes is capable of surviving for long periods of time in seawater when light is excluded. Sunlight is demonstrated to have a significant effect on the survival of this pathogen in seawater, and both visible (470 nm) and UV-A light are shown to contribute to this effect. © 2017 The Society for Applied Microbiology.

  7. Monitoring food and non-alcoholic beverage promotions to children.

    Science.gov (United States)

    Kelly, B; King, L; Baur, L; Rayner, M; Lobstein, T; Monteiro, C; Macmullan, J; Mohan, S; Barquera, S; Friel, S; Hawkes, C; Kumanyika, S; L'Abbé, M; Lee, A; Ma, J; Neal, B; Sacks, G; Sanders, D; Snowdon, W; Swinburn, B; Vandevijvere, S; Walker, C

    2013-10-01

    Food and non-alcoholic beverage marketing is recognized as an important factor influencing food choices related to non-communicable diseases. The monitoring of populations' exposure to food and non-alcoholic beverage promotions, and the content of these promotions, is necessary to generate evidence to understand the extent of the problem, and to determine appropriate and effective policy responses. A review of studies measuring the nature and extent of exposure to food promotions was conducted to identify approaches to monitoring food promotions via dominant media platforms. A step-wise approach, comprising 'minimal', 'expanded' and 'optimal' monitoring activities, was designed. This approach can be used to assess the frequency and level of exposure of population groups (especially children) to food promotions, the persuasive power of techniques used in promotional communications (power of promotions) and the nutritional composition of promoted food products. Detailed procedures for data sampling, data collection and data analysis for a range of media types are presented, as well as quantifiable measurement indicators for assessing exposure to and power of food and non-alcoholic beverage promotions. The proposed framework supports the development of a consistent system for monitoring food and non-alcoholic beverage promotions for comparison between countries and over time. © 2013 The Authors. Obesity Reviews published by John Wiley & Sons Ltd on behalf of the International Association for the Study of Obesity.

  8. Monitoring sodium in commercially processed foods from stores and restaurants

    Science.gov (United States)

    Most of the sodium we eat comes from commercially processed foods from stores and restaurants. Sodium reduction in these foods is a key component of several recent public health efforts. Agricultural Research Service (ARS) of USDA, CDC and FDA have launched a collaborative program to monitor sodium ...

  9. Diversity assessment of Listeria monocytogenes biofilm formation: Impact of growth condition, serotype and strain origin

    NARCIS (Netherlands)

    Kadam, S.R.; Besten, den H.M.W.; Veen, van der S.; Zwietering, M.H.; Moezelaar, R.; Abee, T.

    2013-01-01

    The foodborne pathogen Listeria monocytogenes has the ability to produce biofilms in food-processing environments and then contaminate food products, which is a major concern for food safety. The biofilm forming behavior of 143 L. monocytogenes strains was determined in four different media that

  10. Interaction between Food-borne Pathogens (Campylobacter jejuni, Salmonella Typhimurium and Listeria monocytogenes) and a Common Soil Flagellate (Cercomonas sp.)

    DEFF Research Database (Denmark)

    Bui, Thanh Xuan; Wolff, Anders; Madsen, Mogens

    2012-01-01

    Free-living protozoa may harbor, protect, and disperse bacteria, including those ingested and passed in viable form in feces. The flagellates are very important predators on bacteria in soil, but their role in the survival of food-borne pathogens associated with fruits and vegetables is not well...

  11. Monitoring the levels of important nutrients in the food supply.

    Science.gov (United States)

    Neal, B; Sacks, G; Swinburn, B; Vandevijvere, S; Dunford, E; Snowdon, W; Webster, J; Barquera, S; Friel, S; Hawkes, C; Kelly, B; Kumanyika, S; L'Abbé, M; Lee, A; Lobstein, T; Ma, J; Macmullan, J; Mohan, S; Monteiro, C; Rayner, M; Sanders, D; Walker, C

    2013-10-01

    A food supply that delivers energy-dense products with high levels of salt, saturated fats and trans fats, in large portion sizes, is a major cause of non-communicable diseases (NCDs). The highly processed foods produced by large food corporations are primary drivers of increases in consumption of these adverse nutrients. The objective of this paper is to present an approach to monitoring food composition that can both document the extent of the problem and underpin novel actions to address it. The monitoring approach seeks to systematically collect information on high-level contextual factors influencing food composition and assess the energy density, salt, saturated fat, trans fats and portion sizes of highly processed foods for sale in retail outlets (with a focus on supermarkets and quick-service restaurants). Regular surveys of food composition are proposed across geographies and over time using a pragmatic, standardized methodology. Surveys have already been undertaken in several high- and middle-income countries, and the trends have been valuable in informing policy approaches. The purpose of collecting data is not to exhaustively document the composition of all foods in the food supply in each country, but rather to provide information to support governments, industry and communities to develop and enact strategies to curb food-related NCDs. © 2013 The Authors. Obesity Reviews published by John Wiley & Sons Ltd on behalf of the International Association for the Study of Obesity.

  12. Phenotypic and genetic characteristics associated with Listeria monocytogenes food chain isolates displaying enhanced and diminished cold tolerance

    DEFF Research Database (Denmark)

    Hingston, P.; Chen, J.; Laing, C.

    between strains with varied cold tolerance. The objective of this study was to determine if Lm isolates with enhanced cold tolerance, exhibit other high risk characteristics that may add to their survival and/or pathogenicity. To accomplish this, 166 predominantly food/food plant Lm isolates were tested...... in brainheart infusion broth, for their ability to tolerate cold (4°C), salt (6% NaCl, 25°C), acid (pH 5, 25°C), and desiccation (33% RH, 20°C) stress. Isolates were considered tolerant or sensitive if they exhibited survival characteristics > or ... with a truncated version (n=47). Cold tolerant isolates were more likely to be tolerant to the other three stresses than intermediate and cold sensitive isolates. Similarly, cold sensitive isolates were more likely to be sensitive to the other stresses. Cold tolerant isolates had shorter (p=0.012) lag phases...

  13. A Bioengineered Nisin Derivative, M21A, in Combination with Food Grade Additives Eradicates Biofilms of Listeria monocytogenes

    OpenAIRE

    Smith, Muireann K.; Draper, Lorraine A.; Hazelhoff, Pieter-Jan; Cotter, Paul D.; Ross, R. P.; Hill, Colin

    2016-01-01

    The burden of foodborne disease has large economic and social consequences worldwide. Despite strict regulations, a number of pathogens persist within the food environment, which is greatly contributed to by a build-up of resistance mechanisms and also through the formation of biofilms. Biofilms have been shown to be highly resistant to a number of antimicrobials and can be extremely difficult to remove once they are established. In parallel, the growing concern of consumers regarding the use...

  14. Evaluation of two loop-mediated isothermal amplification methods for the detection of Salmonella Enteritidis and Listeria monocytogenes in artificially contaminated ready-to-eat fresh products

    Directory of Open Access Journals (Sweden)

    Angeliki Birmpa

    2015-08-01

    Full Text Available In the present study, the effectiveness of two loop-mediated isothermal amplification (LAMP assays was evaluated. Samples of romaine lettuce, strawberries, cherry tomatoes, green onions and sour berries were inoculated with known dilutions (100-108 CFU/g of produce of S. Enteritidis and L. monocytogenes. With LAMP assay, pathogens can be detected in less than 60 min. The limits of detection of S. Enteritidis and L. monocytogenes depended on the food sample tested and on the presence of enrichment step. After enrichment steps, all food samples were found positive even at low initial pathogen levels. The developed LAMP, assays, are expected to become a valuable, robust, innovative, powerful, cheap and fast monitoring tool, which can be extensively used for routine analysis, and screening of contaminated foods by the food industry and the Public Food Health Authorities.

  15. Assessment of Listeria monocytogenes virulence in the Galleria mellonella insect larvae model.

    Directory of Open Access Journals (Sweden)

    Mira Rakic Martinez

    Full Text Available Several animal models have been used to understand the molecular basis of the pathogenicity, infectious dose and strain to strain variation of Listeria monocytogenes. The greater wax worm Galleria mellonella, as an alternative model, provides some useful advantages not available with other models and has already been described as suitable for the virulence assessment of various pathogens including L. monocytogenes. The objectives of this study are: 1 confirming the usefulness of this model with a wide panel of Listeria spp. including non-pathogenic L. innocua, L. seeligeri, L. welshimeri and animal pathogen L. ivanovii; 2 assessment of virulence of several isogenic in-frame deletion mutants in virulence and stress related genes of L. monocytogenes and 3 virulence assessment of paired food and clinical isolates of L. monocytogenes from 14 major listeriosis outbreaks occurred worldwide between 1980 and 2015. Larvae injected with different concentrations of Listeria were incubated at 37°C and monitored over seven days for time needed to kill 50% of larvae (LT50 and to determine change of bacterial population in G. mellonella, 2 and 24 hours post-inoculation. Non-pathogenic members of Listeria and L. ivanovii showed significantly (P < 0.05 higher LT50 (lower virulence than the wild type L. monocytogenes strains. Isogenic mutants of L. monocytogenes with the deletions in prfA, plcA, hly, actA and virR genes, also showed significantly (P < 0.05 higher LT50 than the wild type strain at the inoculum of 106CFU/larva. Food isolates had significantly (P < 0.05 lower virulence than the paired clinical isolates, at all three inoculum concentrations. L. monocytogenes strains related to non-invasive (gastroenteritis outbreaks of listeriosis showed significantly (P < 0.05 lower virulence than isolates of the same serotype obtained from outbreaks with invasive symptoms. The difference, however, was dose and strain- dependent. No significant differences in

  16. Monitoring and information system about allochthonous substances in foods

    International Nuclear Information System (INIS)

    Salgovicova, D.; Krizova, S.; Dobrikova, E.

    2005-01-01

    In 1984 the Food Research Institute in Bratislava was chosen as the organization entrusted to evaluate the results from control of contaminants within field of the Ministry of Agriculture in the Slovak Republic. At the same time in the Constitution was semi-finished the methodology of automatic data processing for monitoring of food chain contamination. In correspondence with the Governmental Decree of Slovak Republic No 620/93 from 7 September 1993 and its item No. 1 - the proposal for implementation of the Environment Monitoring System and of the Integrated search Institute was commissioned by the Minister of Agriculture to act as a Centre of the Partial Monitoring System 'Food and Feed Contaminants'

  17. Enterocin B3A-B3B produced by LAB collected from infant faeces: potential utilization in the food industry for Listeria monocytogenes biofilm management.

    Science.gov (United States)

    Al-Seraih, Alaa; Belguesmia, Yanath; Baah, John; Szunerits, Sabine; Boukherroub, Rabah; Drider, Djamel

    2017-02-01

    Enterococcus faecalis B3A-B3B produces the bacteriocin B3A-B3B with activity against Listeria monocytogenes, Staphylococcus aureus, methicillin-resistant Staphylococcus aureus (MRSA) and Clostridium perfringens, but apparently not against fungi or Gram-negative bacteria, except for Salmonella Newport. B3A-B3B enterocin has two different nucleotides but similar amino acid composition to the class IIb MR10A-MR10B enterocin. B3A-B3B consists of two peptides of predicted molecular mass of 5176.31 Da (B3A) and 5182.21 Da (B3B). Importantly, B3A-B3B impeded biofilm formation of the foodborne pathogen L. monocytogenes 162 grown on stainless steel. The antimicrobial treatment of stainless steel with nisin (1 or 16 mg ml -1 ) decreased the cell numbers by about 2 log CFU ml -1 , thereby impeding the biofilm formation by L. monocytogenes 162 or its nisin-resistant derivative strain L. monocytogenes 162R. Furthermore, the combination of nisin and B3A-B3B enterocin reduced the MIC required to inhibit this pathogen grown in planktonic or biofilm cultures.

  18. Rapid colorimetric assay for detection of Listeria monocytogenes in food samples using LAMP formation of DNA concatemers and gold nanoparticle-DNA probe complex

    Science.gov (United States)

    Wachiralurpan, Sirirat; Sriyapai, Thayat; Areekit, Supatra; Sriyapai, Pichapak; Augkarawaritsawong, Suphitcha; Santiwatanakul, Somchai; Chansiri, Kosum

    2018-04-01

    ABSTRACT Listeria monocytogenes is a major foodborne pathogen of global health concern. Herein, the rapid diagnosis of L. monocytogenes has been achieved using loop-mediated isothermal amplification (LAMP) based on the phosphatidylcholine-phospholipase C gene (plcB). Colorimetric detection was then performed through the formation of DNA concatemers and a gold nanoparticle/DNA probe complex (GNP/DNA probe). The overall detection process was accomplished within approximately 1 h with no need for complicated equipment. The limits of detection for L. monocytogenes in the forms of purified genomic DNA and pure culture were 800 fg and 2.82 CFU mL-1, respectively. No cross reactions were observed from closely related bacteria species. The LAMP-GNP/DNA probe assay was applied to the detection of 200 raw chicken meat samples and compared to routine standard methods. The data revealed that the specificity, sensitivity and accuracy were 100%, 90.20% and 97.50%, respectively. The present assay was 100% in conformity with LAMP-agarose gel electrophoresis assay. Five samples that were negative by both assays appeared to have the pathogen at below the level of detection. The assay can be applied as a rapid direct screening method for L. monocytogenes.

  19. A validated PCR-based method to detect Listeria monocytogenes using raw milk as a food model - Towards an international standard

    DEFF Research Database (Denmark)

    D'Agostino, M.; Wagner, M.; Vazquez-Boland, J.A.

    2004-01-01

    the accordance (repeatability) and the concordance (reproducibility) were 99.4%. The assay was incorporated within a method for the detection of L. monocytogenes in raw milk, which involves 24 It of enrichment in half-Fraser broth followed by 16 h of enrichment in a medium that can be added directly into the PCR...

  20. A multiplex PCR assay for simultaneous detection of Escherichia coli O157:H7, Bacillus cereus, Vibrio parahaemolyticus, Salmonella spp., Listeria monocytogenes, and Staphylococcus aureus in Korean ready-to-eat food.

    Science.gov (United States)

    Lee, Nari; Kwon, Kyung Yoon; Oh, Su Kyung; Chang, Hyun-Joo; Chun, Hyang Sook; Choi, Sung-Wook

    2014-07-01

    A multiplex polymerase chain reaction (PCR) assay was developed for simultaneous detection of Escherichia coli O157:H7, Bacillus cereus, Vibrio parahaemolyticus, Salmonella spp., Listeria monocytogenes, and Staphylococcus aureus in various Korean ready-to-eat foods. The six specific primer pairs for multiplex PCR were selected based on the O157 antigen (rfbE) gene of E. coli O157:H7, the DNA gyrase subunit B (gyrB) gene of B. cereus, the toxin regulatory protein (toxR) gene of V. parahaemolyticus, the invasion protein A (invA) gene of Salmonella spp., the hemolysin (hly) gene of L. monocytogenes, and the thermonuclease (nuc) gene of S. aureus. The 16S rRNA gene was targeted as an internal control gene in the presence of bacterial DNA. The specificity and sensitivity assays for multiplex primer pairs were investigated by testing different strains. When this multiplex PCR assay was applied to evaluate the validity of detecting six foodborne pathogens in artificially inoculated several ready-to-eat food samples, the assay was able to specifically simultaneously detect as few as 1 colony-forming unit/mL of each pathogen after enrichment for 12 h. Their presence in naturally contaminated samples also indicates that the developed multiplex PCR assay is an effective and informative supplement for practical use.

  1. Review Paper of Radionuclide Monitoring in Food Sample

    International Nuclear Information System (INIS)

    Noor Fadzilah Yusof; Abdul Kadir Ishak; Wo, Y.M.; Nurrul Assyikeen Mohd Jaffary

    2011-01-01

    The uncontrolled release of radionuclides into the atmospheric and aquatic environments may occur as the result of a nuclear or radiological accident. Monitoring of the accidental release at its source and especially direct monitoring of the environmental contamination with radionuclides is necessary for assessment and application of public protective actions and longer term countermeasures as well as emergency workers' protection. In areas historically contaminated with long lived radionuclides monitoring it is essential to protect the public and substantiation of any radiological incidents. Also, dietary pathways can be contaminated with radioactive materials resulting from natural occurrence or man-made applications especially during routine operation, accidents and migration of radionuclides from radioactive waste disposal repositories into the biosphere. Therefore, efforts should be made to determine the presence of radionuclides in a potentially high radiation area especially in operational nuclear facilities. This paper will review the strategies for food monitoring that has been adapted in most countries to obtain baseline data for future reference. Also, this study is discussing the type of food selection commonly collected as sample for radionuclide analysis in different countries over the years. Sampling procedure and analysis also included in this review for better understanding of the analysis. Stake holders' involvement is considered as an important asset in the establishment of monitoring strategies. As a conclusion, future plans for food monitoring programme in Malaysia are recommended as a preparation to embark on the Nuclear Power Plant programme. (author)

  2. Differential gene expression and filamentation of Listeria monocytogenes 08-5923 exposed to sodium lactate and sodium diacetate.

    Science.gov (United States)

    Liu, Xiaoji; Basu, Urmila; Miller, Petr; McMullen, Lynn M

    2017-05-01

    This study reports the gene expression and filamentation in Listeria monocytogenes 08-5923 following exposure to food preservatives sodium lactate (NaL) and sodium diacetate (SD). L. monocytogenes 08-5923 was challenged with a mixture of NaL/SD, NaL or sodium acetate at 37 °C in tryptic soy broth. In the initial study, L. monocytogenes 08-5923 was exposed to NaL/SD for 24 h. The transcriptome was investigated by RNA sequencing. A stress response network was discovered in L. monocytogenes 08-5923, which is mediated by genes encoding two-component systems (hisJ, lisK, OmpR family gene, resE) and RNA polymerase factors (sigC, sigH). NaL/SD resulted in the down-regulation of genes in glycolysis (pykA, eno, fbaA, pgm) and up-regulation of genes in DNA repair (radC), cell division (ftsE) and cell structure synthesis (flagella synthesis: flgK, fliF, fliD). Filamentation was monitored by flow cytometry. NaL/SD mixture resulted in filamentation in L. monocytogenes 08-5923. Longer exposure was required to induce filamentation in L. monocytogenes for SD (24 h) than for NaL (8 h) when cells were exposed to individual salt. The quantitative real time PCR analysis revealed the down-regulation of ftsE in filamented cells of Listeria exposed to NaL or sodium acetate. Copyright © 2016 Elsevier Ltd. All rights reserved.

  3. Prevalence of Listeria monocytogenes in raw milk in North Lebanon

    International Nuclear Information System (INIS)

    Al Kassaa, I; El Omari, Kh.; Esmail, B.; Hamze, M; Saati, M.

    2016-01-01

    Listeriosis, although a zoonosis, is an invasive disease that can affect newborns, pregnant women and immunocompromised adults. Clinical manifestations can be expressedby febrile gastroenteritis, invasive forms including severe sepsis, meningitis, rhombencephalitis, prenatal infections and abortions. Species of Listeria bacteria are ubiquitous and adaptableto the environment in animal and plant foods. This study aimed to determine the prevalence of Listeria monocytogenes in 100 samples of fresh cow milk collected from different areas of North Lebanon. Listeria monocytogenes was detected by using the Grand VIDAS technique (Biomérieux France). The results obtained revealed the absence of Listeria monocytogenes inall analyzed samples. (Author)

  4. Monitoring the impacts of trade agreements on food environments.

    Science.gov (United States)

    Friel, S; Hattersley, L; Snowdon, W; Thow, A-M; Lobstein, T; Sanders, D; Barquera, S; Mohan, S; Hawkes, C; Kelly, B; Kumanyika, S; L'Abbe, M; Lee, A; Ma, J; Macmullan, J; Monteiro, C; Neal, B; Rayner, M; Sacks, G; Swinburn, B; Vandevijvere, S; Walker, C

    2013-10-01

    The liberalization of international trade and foreign direct investment through multilateral, regional and bilateral agreements has had profound implications for the structure and nature of food systems, and therefore, for the availability, nutritional quality, accessibility, price and promotion of foods in different locations. Public health attention has only relatively recently turned to the links between trade and investment agreements, diets and health, and there is currently no systematic monitoring of this area. This paper reviews the available evidence on the links between trade agreements, food environments and diets from an obesity and non-communicable disease (NCD) perspective. Based on the key issues identified through the review, the paper outlines an approach for monitoring the potential impact of trade agreements on food environments and obesity/NCD risks. The proposed monitoring approach encompasses a set of guiding principles, recommended procedures for data collection and analysis, and quantifiable 'minimal', 'expanded' and 'optimal' measurement indicators to be tailored to national priorities, capacity and resources. Formal risk assessment processes of existing and evolving trade and investment agreements, which focus on their impacts on food environments will help inform the development of healthy trade policy, strengthen domestic nutrition and health policy space and ultimately protect population nutrition. © 2013 The Authors. Obesity Reviews published by John Wiley & Sons Ltd on behalf of the International Association for the Study of Obesity.

  5. Monitoring consumer confidence in food safety: an exploratory study

    NARCIS (Netherlands)

    Jonge, de J.; Frewer, L.J.; Trijp, van J.C.M.; Renes, R.J.; Wit, de W.; Timmers, J.C.M.

    2004-01-01

    Abstract: In response to the potential for negative economic and societal effects resulting from a low level of consumer confidence in food safety, it is important to know how confidence is potentially influenced by external events. The aim of this article is to describe the development of a monitor

  6. Biofilm Formation of Listeria monocytogenes on Various Surfaces

    Directory of Open Access Journals (Sweden)

    M Mahdavi

    2007-10-01

    Full Text Available Introduction & Objective: Listeria monocytogenes is considered as a ubiquitous foodborne pathogen which can lead to serious infections, especially in newborns, elderly, pregnant, and immunocompromised people. The organism has been isolated from many foods and may cause meningitis, septicemia and abortion in pregnant women. Also L. monocytogenes forms biofilms on many food contact surface materials and medical devices. Development of biofilms on many surfaces is a potential source of contamination of foods that may lead to spoilage or transmission of foodborne pathogens. Materials & Methods: Biofilm formation of L. monocytogenes (RITCC 1293 serotype 4a was investigated. Hydrophobicity of L. monocytogenes was measured by MATH method. Then biofilm formation of the organism was assessed at 2, 4, 8, 16 and 20 hours on stainless steel (type 304 no 2B, polyethylene and glass by drop plate method. Results: Results indicated that L. monocytogenes with 85% of hydrophobicity formed biofilm on each of three surfaces. Biofilm formation on stainless steel surfaces was significantly more than other surfaces (p<0.05. Conclusion: The ability of biofilm formation of L. monocytogenes on medical devices and food containers is very important as far as hygiene and disease outbreaks are concerned.

  7. GEOGLAM Crop Assessment Tool: Adapting from global agricultural monitoring to food security monitoring

    Science.gov (United States)

    Humber, M. L.; Becker-Reshef, I.; Nordling, J.; Barker, B.; McGaughey, K.

    2014-12-01

    The GEOGLAM Crop Monitor's Crop Assessment Tool was released in August 2013 in support of the GEOGLAM Crop Monitor's objective to develop transparent, timely crop condition assessments in primary agricultural production areas, highlighting potential hotspots of stress/bumper crops. The Crop Assessment Tool allows users to view satellite derived products, best available crop masks, and crop calendars (created in collaboration with GEOGLAM Crop Monitor partners), then in turn submit crop assessment entries detailing the crop's condition, drivers, impacts, trends, and other information. Although the Crop Assessment Tool was originally intended to collect data on major crop production at the global scale, the types of data collected are also relevant to the food security and rangelands monitoring communities. In line with the GEOGLAM Countries at Risk philosophy of "foster[ing] the coordination of product delivery and capacity building efforts for national and regional organizations, and the development of harmonized methods and tools", a modified version of the Crop Assessment Tool is being developed for the USAID Famine Early Warning Systems Network (FEWS NET). As a member of the Countries at Risk component of GEOGLAM, FEWS NET provides agricultural monitoring, timely food security assessments, and early warnings of potential significant food shortages focusing specifically on countries at risk of food security emergencies. While the FEWS NET adaptation of the Crop Assessment Tool focuses on crop production in the context of food security rather than large scale production, the data collected is nearly identical to the data collected by the Crop Monitor. If combined, the countries monitored by FEWS NET and GEOGLAM Crop Monitor would encompass over 90 countries representing the most important regions for crop production and food security.

  8. Antibacterial efficacy of Nisin, Pediocin 34 and Enterocin FH99 against Listeria monocytogenes and cross resistance of its bacteriocin resistant variants to common food preservatives.

    Science.gov (United States)

    Kaur, G; Singh, T P; Malik, R K

    2013-01-01

    Antilisterial efficiency of three bacteriocins, viz, Nisin, Pediocin 34 and Enterocin FH99 was tested individually and in combination against Listeria mononcytogenes ATCC 53135. A greater antibacterial effect was observed when the bacteriocins were combined in pairs, indicating that the use of more than one LAB bacteriocin in combination have a higher antibacterial action than when used individually. Variants of Listeria monocytogenes ATCC 53135 resistant to Nisin, Pediocin 34 and Enterocin FH99 were developed. Bacteriocin cross-resistance of wild type and their corresponding resistant variants were assessed and results showed that resistance to a bacteriocin may extend to other bacteriocins within the same class. Resistance to Pediocin 34 conferred cross resistance to Enterocin FH 99 but not to Nisin. Similarly resistance to Enterocin FH99 conferred cross resistance to Pediocin 34 but not to Nisin. Also, the sensitivity of Nisin, Pediocin 34 and Enterocin FH99 resistant variants of Listeria monocytogenes to low pH, salt, sodium nitrite, and potassium sorbate was assayed in broth and compared to the parental wild-type strain. The Nisin, Pediocin 34 and Enterocin FH99 resistant variants did not have intrinsic resistance to low pH, sodium chloride, potassium sorbate, or sodium nitrite. In no case were the bacteriocin resistant Listeria monocytogenes variants examined were more resistant to inhibitors than the parental strains.

  9. Antibacterial efficacy of Nisin, Pediocin 34 and Enterocin FH99 against Listeria monocytogenes and cross resistance of its bacteriocin resistant variants to common food preservatives

    Directory of Open Access Journals (Sweden)

    G. Kaur

    2013-01-01

    Full Text Available Antilisterial efficiency of three bacteriocins, viz, Nisin, Pediocin 34 and Enterocin FH99 was tested individually and in combination against Listeria mononcytogenes ATCC 53135. A greater antibacterial effect was observed when the bacteriocins were combined in pairs, indicating that the use of more than one LAB bacteriocin in combination have a higher antibacterial action than when used individually. Variants of Listeria monocytogenes ATCC 53135 resistant to Nisin, Pediocin 34 and Enterocin FH99 were developed. Bacteriocin cross-resistance of wild type and their corresponding resistant variants were assessed and results showed that resistance to a bacteriocin may extend to other bacteriocins within the same class. Resistance to Pediocin 34 conferred cross resistance to Enterocin FH 99 but not to Nisin. Similarly resistance to Enterocin FH99 conferred cross resistance to Pediocin 34 but not to Nisin. Also, the sensitivity of Nisin, Pediocin 34 and Enterocin FH99 resistant variants of Listeria monocytogenes to low pH, salt, sodium nitrite, and potassium sorbate was assayed in broth and compared to the parental wild-type strain. The Nisin, Pediocin 34 and Enterocin FH99 resistant variants did not have intrinsic resistance to low pH, sodium chloride, potassium sorbate, or sodium nitrite. In no case were the bacteriocin resistant Listeria monocytogenes variants examined were more resistant to inhibitors than the parental strains.

  10. Monitoring radioactivity in food and actions of the Ministry in charge of food

    International Nuclear Information System (INIS)

    Grastilleur, Ch.

    2010-01-01

    French ministry of food, agriculture and fisheries (general directorate for food) is involved in all aspects of food safety and food controls As such, MAAP guarantees both the quality and safety of food products radioactivity controls in food participate to this global aim. Since 1987 and following the accident on Tchernobyl nuclear plant, regulations and monitoring-control programmes have been implemented by MAPP, mainly based on Cs 134 and 137 and Sr 90 researches in raw products such as game, milk and dairy products and honey A new monitoring and control programme has been implemented as from 2009, with the help of IRSN and thanks to the work on management during post-accidental phases initiated in 2005 by ASN. Mainly the activity of Cs is determined but also other parameters are measured such as Ca, K and l 131 activities in the samples analysed by IRSN. In 2009, 812 samples were programmed and all of them have proven to be conform. During the year 2010, 725 samples will be collected, Global exposure to radioactivity in France is estimated at 4000 μSv per year, food and water contributing to 6% (that is about 250 μSv) mainly due to K and Ca (natural radioactive components of the regime). (author)

  11. Presence of Listeria monocytogenes in Mediterranean-Style Dry Fermented Sausages

    Directory of Open Access Journals (Sweden)

    Domenico Meloni

    2015-03-01

    Full Text Available The morphological, physiological and epidemiological features of L. monocytogenes, together with the severity of human listeriosis infections, make L. monocytogenes of particular concern for manufacturers of cold-stored “ready to eat” (RTE foods. L. monocytogenes has been isolated from a wide variety of RTE foods and is responsible for several outbreaks associated with the consumption of RTE meat, poultry, dairy, fish and vegetable products. Although L. monocytogenes is among the most frequently-detected pathogens in dry fermented sausages, these products could be included in the category of RTE products in which the growth of L. monocytogenes is not favored and have rarely been implicated in listeriosis outbreaks. However, L. monocytogenes is highly difficult to control in fermented sausage processing environments due to its high tolerance to low pH and high salt concentration. In many Mediterranean-style dry fermented sausages, an empirical application of the hurdle technology often occurs and the frequent detection of L. monocytogenes in these products at the end of ripening highlights the need for food business operators to properly apply hurdle technology and to control the contamination routes of L. monocytogenes in the processing plants. In the following, through an up-to-date review of (personal and un- published data, the main aspects of the presence of L. monocytogenes in Mediterranean-style dry fermented sausages will be discussed.

  12. Presence of Listeria monocytogenes in Mediterranean-Style Dry Fermented Sausages.

    Science.gov (United States)

    Meloni, Domenico

    2015-03-12

    The morphological, physiological and epidemiological features of L. monocytogenes , together with the severity of human listeriosis infections, make L. monocytogenes of particular concern for manufacturers of cold-stored "ready to eat" (RTE) foods. L. monocytogenes has been isolated from a wide variety of RTE foods and is responsible for several outbreaks associated with the consumption of RTE meat, poultry, dairy, fish and vegetable products. Although L. monocytogenes is among the most frequently-detected pathogens in dry fermented sausages, these products could be included in the category of RTE products in which the growth of L. monocytogenes is not favored and have rarely been implicated in listeriosis outbreaks. However, L. monocytogenes is highly difficult to control in fermented sausage processing environments due to its high tolerance to low pH and high salt concentration. In many Mediterranean-style dry fermented sausages, an empirical application of the hurdle technology often occurs and the frequent detection of L. monocytogenes in these products at the end of ripening highlights the need for food business operators to properly apply hurdle technology and to control the contamination routes of L. monocytogenes in the processing plants. In the following, through an up-to-date review of (personal and un-) published data, the main aspects of the presence of L. monocytogenes in Mediterranean-style dry fermented sausages will be discussed.

  13. Response of Listeria monocytogenes to disinfection stress at the single-cell and population levels as monitored by intracellular pH measurements and viable-cell counts

    DEFF Research Database (Denmark)

    Kastbjerg, Vicky Gaedt; Nielsen, Dennis S.; Arneborg, Nils

    2009-01-01

    of the bacterium. In situ analyses of Listeria monocytogenes single cells were performed during exposure to different concentrations of the disinfectant Incimaxx DES to study a possible population subdivision. Bacterial survival was quantified with plate counting and disinfection stress at the single-cell level...... by measuring intracellular pH (pHi) over time by fluorescence ratio imaging microscopy. pHi values were initially 7 to 7.5 and decreased in both attached and planktonic L. monocytogenes cells during exposure to sublethal and lethal concentrations of Incimaxx DES. The response of the bacterial population...... was homogenous; hence, subpopulations were not detected. However, pregrowth with NaCl protected the planktonic bacterial cells during disinfection with Incimaxx (0.0015%) since pHi was higher (6 to 6.5) for the bacterial population pregrown with NaCl than for cells grown without NaCl (pHi 5 to 5.5) (P

  14. Regulatory Monitoring of Fortified Foods: Identifying Barriers and Good Practices

    Science.gov (United States)

    Rowe, Laura A; Vossenaar, Marieke; Garrett, Greg S

    2015-01-01

    While fortification of staple foods and condiments has gained enormous global traction, poor performance persists throughout many aspects of implementation, most notably around the critical element of regulatory monitoring, which is essential for ensuring foods meet national fortification standards. Where coverage of fortified foods is high, limited nutritional impact of fortification programs largely exists due to regulatory monitoring that insufficiently identifies and holds producers accountable for underfortified products. Based on quality assurance data from 20 national fortification programs in 12 countries, we estimate that less than half of the samples are adequately fortified against relevant national standards. In this paper, we outline key findings from a literature review, key informant interviews with 11 fortification experts, and semi-quantitative surveys with 39 individuals from regulatory agencies and the food fortification industry in 17 countries on the perceived effectiveness of regulatory monitoring systems and barriers to compliance against national fortification standards. Findings highlight that regulatory agencies and industry disagree on the value that enforcement mechanisms have in ensuring compliance against standards. Perceived political risk of enforcement and poorly resourced inspectorate capacity appear to adversely reinforce each other within an environment of unclear legislation to create a major hurdle for improving overall compliance of fortification programs against national standards. Budget constraints affect the ability of regulatory agencies to create a well-trained inspector cadre and improve the detection and enforcement of non-compliant and underfortified products. Recommendations to improve fortification compliance include improving technical capacity; ensuring sustained leadership, accountability, and funding in both the private and the public sectors; and removing political barriers to ensure consistent detection of

  15. Online monitoring of food processes using subsurface laser scattering

    DEFF Research Database (Denmark)

    Carstensen, Jens Michael; Møller, Flemming

    Online monitoring of physical parameters during food production is not a trivial task, but promising results can often be obtained with Subsurface Laser Scattering (SLS). The first SLS instruments are on the market today, and studies are needed to asses the potential of the technology. SLS can mo...... of the SLS technology is explained, and results from yoghurt fermentation and foaming of a dairy dessert product is presented....

  16. THE MONITORING OF MERCURY CONTENT IN BABY FOODS

    Directory of Open Access Journals (Sweden)

    Tomáš Tóth

    2014-02-01

    Full Text Available Children's nutrition is very important for the healthy growth and development of the child, but it affects the health of the individual as well later in adulthood. For the production of baby food, commonly available on the market are used raw materials consistently grown under very strict supervision of specially designated for children's nutrition. It shall also apply to the more stringent standards on fertilizer, soil treatment during growth, harvesting, storage and process for the production of baby food. At work, we have focused on monitoring the content of Hg in the 12 samples of baby food, available in the sales network of the Slovak Republic and comparing it with the Highest permissible quantity (0.05 mg.kg-1. On the basis of the findings shows that the content of Hg in the one sample exceeded the HPQ, the content of Hg was in the range 0.6 - 20.4% of the HPQ.

  17. Food intake monitoring: an acoustical approach to automated food intake activity detection and classification of consumed food

    International Nuclear Information System (INIS)

    Päßler, Sebastian; Fischer, Wolf-Joachim; Wolff, Matthias

    2012-01-01

    Obesity and nutrition-related diseases are currently growing challenges for medicine. A precise and timesaving method for food intake monitoring is needed. For this purpose, an approach based on the classification of sounds produced during food intake is presented. Sounds are recorded non-invasively by miniature microphones in the outer ear canal. A database of 51 participants eating seven types of food and consuming one drink has been developed for algorithm development and model training. The database is labeled manually using a protocol with introductions for annotation. The annotation procedure is evaluated using Cohen's kappa coefficient. The food intake activity is detected by the comparison of the signal energy of in-ear sounds to environmental sounds recorded by a reference microphone. Hidden Markov models are used for the recognition of single chew or swallowing events. Intake cycles are modeled as event sequences in finite-state grammars. Classification of consumed food is realized by a finite-state grammar decoder based on the Viterbi algorithm. We achieved a detection accuracy of 83% and a food classification accuracy of 79% on a test set of 10% of all records. Our approach faces the need of monitoring the time and occurrence of eating. With differentiation of consumed food, a first step toward the goal of meal weight estimation is taken. (paper)

  18. Incorporation of Listeria monocytogenes strains in raw milk biofilms.

    Science.gov (United States)

    Weiler, Christiane; Ifland, Andrea; Naumann, Annette; Kleta, Sylvia; Noll, Matthias

    2013-02-01

    Biofilms develop successively on devices of milk production without sufficient cleaning and originate from the microbial community of raw milk. The established biofilm matrices enable incorporation of pathogens like Listeria monocytogenes, which can cause a continuous contamination of food processing plants. L. monocytogenes is frequently found in raw milk and non-pasteurized raw milk products and as part of a biofilm community in milk meters and bulk milk tanks. The aim of this study was to analyze whether different L. monocytogenes strains are interacting with the microbial community of raw milk in terms of biofilm formation in the same manner, and to identify at which stage of biofilm formation a selected L. monocytogenes strain settles best. Bacterial community structure and composition of biofilms were analyzed by a cloning and sequencing approach and terminal restriction fragment length polymorphism analysis (T-RFLP) based on the bacterial 16S rRNA gene. The chemical composition of biofilms was analyzed by Fourier transform infrared spectroscopy (FTIR), while settled L. monocytogenes cells were quantified by fluorescence in situ hybridization (FISH). Addition of individual L. monocytogenes strains to raw milk caused significant shifts in the biofilm biomass, in the chemical as well as in the bacterial community composition. Biofilm formation and attachment of L. monocytogenes cells were not serotype but strain specific. However, the added L. monocytogenes strains were not abundant since mainly members of the genera Citrobacter and Lactococcus dominated the bacterial biofilm community. Overall, added L. monocytogenes strains led to a highly competitive interaction with the raw milk community and triggered alterations in biofilm formation. Copyright © 2012 Elsevier B.V. All rights reserved.

  19. Radiological monitoring of food on the French territory

    Energy Technology Data Exchange (ETDEWEB)

    Boissieux, T.; Leprieur, F.; Pierrard, O. [Institute for Radiological Protection and Nuclear Safety (France)

    2014-07-01

    Drink the milk of cows grazing near French nuclear power plants is it really safe in normal times? In case of a nuclear accident leading to release in the environment, what kind of foodstuff can we still eat? In his regulatory mission of environmental monitoring, the French Institute for Radiological Protection and Nuclear Safety (IRSN) tends to answer these questions by acquiring radioactivity data in the food chain. Food radiological monitoring program by IRSN is implemented with a three scale strategy. Locally, i.e. within the range 0 to 10 kilometers of nuclear installations, foodstuff locally produced and thus potentially exposed to radioactive sources are frequently sampled and analyzed. At the regional level, specific studies are carried out to establish an updated levels baseline of radioactivity in the environment, especially in agricultural productions characteristic of the area concerned. At the national level, monitoring food aims to map the average contamination observed all around the French territory. This work of vigilance is organized in partnerships with other French actors involved in food monitoring. In the event of a nuclear accident or small-scale incidents, it would allow having an efficient support network of samplers and measurers located on the whole French territory and quickly mobilized in short or medium terms. Since 2008, IRSN has developed a food monitoring program with the Directorate general for food (DGAL) and the Directorate general for competition policy, consumer affairs and fraud control (DGCCRF). These directions have a general mission of food safety control (animal and plant products) and animal feed-stuff, which requires the search for chemical, physical, biological and radioactive substances. Likewise, a sampling program of grain products is efficient since 1969 with the support of France Agrimer. In 2013, the food monitoring is based on multi-radionuclides analysis (cesium, iodine, tritium, alpha emitters...) in about 650

  20. LISTERIA MONOCYTOGENES RISK EVALUATION IN READY TO EAT DELI PRODUCTS

    Directory of Open Access Journals (Sweden)

    T Civera

    2013-02-01

    Full Text Available Listeria monocytogenes has become one of the major concerns for food safety. Its ability to survive and replicate at low temperature, pH and high salt concentration, makes the bacterium a threat, mostly for RTE products. For these reasons, the present research was aimed at detecting the ability of growth of L. monocytogenes in RTE products retrieved from one deli store. Samples were analysed for L. monocytogenes detection, then inoculated with the pathogen (105cell/ml and stored at refrigeration temperature for the duration of their shelf-life (15-60 days. In all the products L. monocytogenes was not detected before experimental contamination. The challenge test evidenced that experimentally inoculated L. monocytogenes was not able to multiply for the duration of the entire shelf-life. These results indicated that the tested products could be considered as foods which are not able to support the growth of L. monocytogenes, as indicated by E.C. Regulation 2073/05. However, in order to guarantee consumer’s safety, it needs to be emphasized the need of a correct application of the GMPs, required for lowering the risk of initial contamination.

  1. Listeria monocytogenes, a down-to-earth pathogen.

    Science.gov (United States)

    Vivant, Anne-Laure; Garmyn, Dominique; Piveteau, Pascal

    2013-01-01

    Listeria monocytogenes is the causative agent of the food-borne life threatening disease listeriosis. This pathogenic bacterium received much attention in the endeavor of deciphering the cellular mechanisms that underlie the onset of infection and its ability to adapt to the food processing environment. Although information is available on the presence of L. monocytogenes in many environmental niches including soil, water, plants, foodstuff and animals, understanding the ecology of L. monocytogenes in outdoor environments has received less attention. Soil is an environmental niche of pivotal importance in the transmission of this bacterium to plants and animals. Soil composition, microbial communities and macrofauna are extrinsic edaphic factors that direct the fate of L. monocytogenes in the soil environment. Moreover, farming practices may further affect its incidence. The genome of L. monocytogenes presents an extensive repertoire of genes encoding transport proteins and regulators, a characteristic of the genome of ubiquitous bacteria. Postgenomic analyses bring new insights in the process of soil adaptation. In the present paper focussing on soil, we review these extrinsic and intrinsic factors that drive environmental adaptation of L. monocytogenes.

  2. Network analytical tool for monitoring global food safety highlights China.

    Directory of Open Access Journals (Sweden)

    Tamás Nepusz

    Full Text Available BACKGROUND: The Beijing Declaration on food safety and security was signed by over fifty countries with the aim of developing comprehensive programs for monitoring food safety and security on behalf of their citizens. Currently, comprehensive systems for food safety and security are absent in many countries, and the systems that are in place have been developed on different principles allowing poor opportunities for integration. METHODOLOGY/PRINCIPAL FINDINGS: We have developed a user-friendly analytical tool based on network approaches for instant customized analysis of food alert patterns in the European dataset from the Rapid Alert System for Food and Feed. Data taken from alert logs between January 2003-August 2008 were processed using network analysis to i capture complexity, ii analyze trends, and iii predict possible effects of interventions by identifying patterns of reporting activities between countries. The detector and transgressor relationships are readily identifiable between countries which are ranked using i Google's PageRank algorithm and ii the HITS algorithm of Kleinberg. The program identifies Iran, China and Turkey as the transgressors with the largest number of alerts. However, when characterized by impact, counting the transgressor index and the number of countries involved, China predominates as a transgressor country. CONCLUSIONS/SIGNIFICANCE: This study reports the first development of a network analysis approach to inform countries on their transgressor and detector profiles as a user-friendly aid for the adoption of the Beijing Declaration. The ability to instantly access the country-specific components of the several thousand annual reports will enable each country to identify the major transgressors and detectors within its trading network. Moreover, the tool can be used to monitor trading countries for improved detector/transgressor ratios.

  3. Overlevingsstrategieën Listeria monocytogenes bij lage temperatuur

    NARCIS (Netherlands)

    Wemekamp-Kamphuis, H.H.; Abee, T.

    2004-01-01

    Listeria monocytogenes is an important food-borne pathogen that may cause severe infections in humans. Many outbreaks caused by this organism have been associated with ready-to-eat foods wich may have undergone some form of minimal processing, or have been contaminated after processing. Ready-to-eat

  4. Pathogenic potential of Listeria monocytogenes isolated from cattle ...

    African Journals Online (AJOL)

    Listeria monocytogenes is an opportunistic food-borne pathogen causing listeriosis especially among immune-compromised persons. Its high rate of morbidity and mortality has classed the organism among the top watch list in foods. It is known to produce several virulence factors which aid its survival in harsh conditions ...

  5. Isolation and characterization of an atypical Listeria monocytogenes associated with a canine urinary tract infection

    Science.gov (United States)

    Listeria monocytogenes, a well-described cause of encephalitis and abortion in ruminants and of food-borne illness in humans, is rarely associated with disease in companion animals. A case of urinary tract infection associated with an atypical, weakly hemolytic L. monocytogenes strain is described i...

  6. Sensitive enumeration of Listeria monocytogenes and other Listeria species in various naturally contaminated matrices using a membrane filtration method.

    Science.gov (United States)

    Barre, Léna; Brasseur, Emilie; Doux, Camille; Lombard, Bertrand; Besse, Nathalie Gnanou

    2015-06-01

    For the enumeration of Listeria monocytogenes (L. monocytogenes) in food, a sensitive enumeration method has been recently developed. This method is based on a membrane filtration of the food suspension followed by transfer of the filter on a selective medium to enumerate L. monocytogenes. An evaluation of this method was performed with several categories of foods naturally contaminated with L. monocytogenes. The results obtained with this technique were compared with those obtained from the modified reference EN ISO 11290-2 method for the enumeration of L. monocytogenes in food, and are found to provide more precise results. In most cases, the filtration method enabled to examine a greater quantity of food thus greatly improving the sensitivity of the enumeration. However, it was hardly applicable to some food categories because of filtration problems and background microbiota interference. Copyright © 2014 Elsevier Ltd. All rights reserved.

  7. Listeria monocytogenes: diagnostic problems

    NARCIS (Netherlands)

    Beumer, R.R.; Hazeleger, W.C.

    2003-01-01

    The first isolation methods for the detection of Listeria spp. were generally based on the direct culture of samples on simple agar media, but isolation of the pathogenic Listeria monocytogenes was difficult. In time, new techniques were developed, based on a variety of selective and elective agents

  8. Relationship between Listeria monocytogenes and Listeria spp. in seafood processing plants.

    Science.gov (United States)

    Alali, Walid Q; Schaffner, Donald W

    2013-07-01

    The objective of this study was to evaluate the relationship between prevalence of Listeria monocytogenes as an outcome and Listeria spp. as an explanatory variable by food products, food contact surfaces, and nonfood contact surfaces in seafood processing plants by using peer-reviewed published data. Nine sets of prevalence data of L. monocytogenes and Listeria spp. were collected from published studies and used for the analyses. Based on our analysis, the relationship between L. monocytogenes prevalence and Listeria spp. prevalence in food products (incoming raw materials and finish products) was significant (P = 0.04) with (low) R² = 0.36. Furthermore, Listeria spp. were not a good indicator for L. monocytogenes when testing food contact surfaces (R² = 0.10). Listeria spp. were a good indicator for L. monocytogenes only on nonfood contact surfaces (R² = 0.90). On the other hand, the presence of Listeria spp. on food contact surfaces (R² = 0.002) and nonfood contact surfaces (R² = 0.03) was not a good indicator for L. monocytogenes presence in food products. In general, prevalence of Listeria spp. does not seem to be a good indicator for L. monocytogenes prevalence in seafood processing plants.

  9. 9 CFR 430.4 - Control of Listeria monocytogenes in post-lethality exposed ready-to-eat products.

    Science.gov (United States)

    2010-01-01

    ... post-lethality exposed ready-to-eat products. 430.4 Section 430.4 Animals and Animal Products FOOD... Control of Listeria monocytogenes in post-lethality exposed ready-to-eat products. (a) Listeria... comes into direct contact with a food contact surface which is contaminated with L. monocytogenes. (b...

  10. Genes that are involved in high hydrostatic pressure treatments in a Listeria monocytogenes Scott A ctsR deletion mutant

    Science.gov (United States)

    Listeria monocytogenes is a food-borne pathogen of significant threat to public health. High Hydrostatic Pressure (HHP) treatment can be used to control L. monocytogenes in food. The CtsR (class three stress gene repressor) protein negatively regulates the expression of class III heat shock genes....

  11. Variations in virulence between different electrophoretic types of Listeria monocytogenes

    DEFF Research Database (Denmark)

    Nørrung, Birgit; Andersen, Jens Kirk

    2000-01-01

    A total of 245 strains of Listeria monocytogenes, representing 33 different electrophoretic types (ETs), were examined quantitatively for haemolytic activity. No significant difference was observed in the mean haemolytic activity between different ETs. Eighty four out of 91 strains examined were...... compared with 3.64 among food isolates). The explanation for this may be that more virulent strains are more prone to cause human infection. It is, however, also possible that strains oft. monocytogenes may become more virulent while multiplying in a living organism compared with multiplying in foods....

  12. Sentinel Wraps: Real-Time Monitoring of Food Contamination by Printing DNAzyme Probes on Food Packaging.

    Science.gov (United States)

    Yousefi, Hanie; Ali, M Monsur; Su, Hsuan-Ming; Filipe, Carlos D M; Didar, Tohid F

    2018-04-24

    Here, we report the development of a transparent, durable, and flexible sensing surface that generates a fluorescence signal in the presence of a specific target bacterium. This material can be used in packaging, and it is capable of monitoring microbial contamination in various types of food products in real time without having to remove the sample or the sensor from the package. The sensor was fabricated by covalently attaching picoliter-sized microarrays of an E. coli-specific RNA-cleaving fluorogenic DNAzyme probe (RFD-EC1) to a thin, flexible, and transparent cyclo-olefin polymer (COP) film. Our experimental results demonstrate that the developed (RFD-EC1)-COP surface is specific, stable for at least 14 days under various pH conditions (pH 3-9), and can detect E. coli in meat and apple juice at concentrations as low as 10 3 CFU/mL. Furthermore, we demonstrate that our sensor is capable of detecting bacteria while still attached to the food package, which eliminates the need to manipulate the sample. The developed biosensors are stable for at least the shelf life of perishable packaged food products and provide a packaging solution for real-time monitoring of pathogens. These sensors hold the potential to make a significant contribution to the ongoing efforts to mitigate the negative public-health-related impacts of food-borne illnesses.

  13. Cold growth behaviour and genetic comparison of Canadian and Swiss Listeria monocytogenes strains associated with the food supply chain and human listeriosis cases.

    Science.gov (United States)

    Arguedas-Villa, Carolina; Kovacevic, Jovana; Allen, Kevin J; Stephan, Roger; Tasara, Taurai

    2014-06-01

    Sixty-two strains of Listeria monocytogenes isolated in Canada and Switzerland were investigated. Comparison based on molecular genotypes confirmed that strains in these two countries are genetically diverse. Interestingly strains from both countries displayed similar range of cold growth phenotypic profiles. Based on cold growth lag phase duration periods displayed in BHI at 4 °C, the strains were similarly divided into groups of fast, intermediate and slow cold adaptors. Overall Swiss strains had faster exponential cold growth rates compared to Canadian strains. However gene expression analysis revealed no significant differences between fast and slow cold adapting strains in the ability to induce nine cold adaptation genes (lmo0501, cspA, cspD, gbuA, lmo0688, pgpH, sigB, sigH and sigL) in response to cold stress exposure. Neither was the presence of Stress survival islet 1 (SSI-1) analysed by PCR associated with enhanced cold adaptation. Phylogeny based on the sigL gene subdivided strains from these two countries into two major and one minor cluster. Fast cold adaptors were more frequently in one of the major clusters (cluster A), whereas slow cold adaptors were mainly in the other (cluster B). Genetic differences between these two major clusters are associated with various amino acid substitutions in the predicted SigL proteins. Compared to the EGDe type strain and most slow cold adaptors, most fast cold adaptors exhibited five identical amino acid substitutions (M90L, S203A/S203T, S304N, S315N, and I383T) in their SigL proteins. We hypothesize that these amino acid changes might be associated with SigL protein structural and functional changes that may promote differences in cold growth behaviour between L. monocytogenes strains. Copyright © 2014 Elsevier Ltd. All rights reserved.

  14. Listeria monocytogenes efficiently invades Caco-2 cells after low-temperature storage in broth and on deli meat.

    Science.gov (United States)

    Larsen, Marianne Halberg; Koch, Anette Granly; Ingmer, Hanne

    2010-09-01

    The objective of this study was to investigate how various growth conditions influence the virulence of Listeria monocytogenes monitored by its ability to invade the epithelial cell lines Caco-2 and INT-407. The growth conditions examined were modified atmosphere-packaged deli meat and brain heart infusion broth (BHI) with and without salt. Five strains of L. monocytogenes were selected to investigate their invasiveness and all strains invaded Caco-2 cells at higher levels than INT-407 cells. Further, the clinical strains (3443 and 3734) were more invasive (p 0.05) in invasiveness after 7 days at 10 degrees C in BHI broth or on sausage, whereas a slight increase (p < 0.05) was observed after incubation on ham for 2 and 4 weeks compared to that in BHI broth. Most importantly, our results show that L. monocytogenes efficiently invade Caco-2 cells even after 4 weeks of storage at chilled temperature. This is highly relevant for safety assessment of this organism in food as these conditions reflect storage of ready-to-eat food products in domestic refrigerators.

  15. Recombinant probiotic expressing Listeria adhesion protein attenuates Listeria monocytogenes virulence in vitro.

    Directory of Open Access Journals (Sweden)

    Ok Kyung Koo

    Full Text Available BACKGROUND: Listeria monocytogenes, an intracellular foodborne pathogen, infects immunocompromised hosts. The primary route of transmission is through contaminated food. In the gastrointestinal tract, it traverses the epithelial barrier through intracellular or paracellular routes. Strategies to prevent L. monocytogenes entry can potentially minimize infection in high-risk populations. Listeria adhesion protein (LAP aids L. monocytogenes in crossing epithelial barriers via the paracellular route. The use of recombinant probiotic bacteria expressing LAP would aid targeted clearance of Listeria from the gut and protect high-risk populations from infection. METHODOLOGY/PRINCIPAL FINDINGS: The objective was to investigate the ability of probiotic bacteria or LAP-expressing recombinant probiotic Lactobacillus paracasei (Lbp(LAP to prevent L. monocytogenes adhesion, invasion, and transwell-based transepithelial translocation in a Caco-2 cell culture model. Several wild type probiotic bacteria showed strong adhesion to Caco-2 cells but none effectively prevented L. monocytogenes infection. Pre-exposure to Lbp(LAP for 1, 4, 15, or 24 h significantly (P<0.05 reduced adhesion, invasion, and transepithelial translocation of L. monocytogenes in Caco-2 cells, whereas pre-exposure to parental Lb. paracasei had no significant effect. Similarly, Lbp(LAP pre-exposure reduced L. monocytogenes translocation by as much as 46% after 24 h. Lbp(LAP also prevented L. monocytogenes-mediated cell damage and compromise of tight junction integrity. Furthermore, Lbp(LAP cells reduced L. monocytogenes-mediated cell cytotoxicity by 99.8% after 1 h and 79% after 24 h. CONCLUSIONS/SIGNIFICANCE: Wild type probiotic bacteria were unable to prevent L. monocytogenes infection in vitro. In contrast, Lbp(LAP blocked adhesion, invasion, and translocation of L. monocytogenes by interacting with host cell receptor Hsp60, thereby protecting cells from infection. These data show promise

  16. COMPARISON OF TWO METHODS FOR THE DETECTION OF LISTERIA MONOCYTOGENES

    Directory of Open Access Journals (Sweden)

    G. Tantillo

    2013-02-01

    Full Text Available The aim of this study was to compare the performance of the conventional methods for detection of Listeria monocytogenes in food using media Oxford and ALOA (Agar Listeria acc. to Ottaviani & Agosti in according to the ISO 11290-1 to a new chromogenic medium “CHROMagar Listeria” standardized in 2005 AFNOR ( CHR – 21/1-12/01. A total of 40 pre-packed ready-to-eat food samples were examined. Using two methods six samples were found positive for Listeria monocytogenes but the medium “CHROMagar Listeria” was more selective in comparison with the others. In conclusion this study has demonstrated that isolation medium able to target specifically the detection of L. monocytogenes such as “CHROMagar Listeria” is highly recommendable because of that detection time is significantly reduced and the analysis cost is less expensive.

  17. Foreign Assistance: North Korea Restricts Food Aid Monitoring

    National Research Council Canada - National Science Library

    1999-01-01

    .... Specifically, the North Korean government, which controls food distribution, has denied the World Food Program full access to the food distribution chain and has not provided required reports on food use...

  18. HrcA and DnaK are important for static and continuous flow biofilm formation and disinfectant resistance in Listeria monocytogenes

    NARCIS (Netherlands)

    Veen, van der S.; Abee, T.

    2010-01-01

    The food-borne pathogen Listeria monocytogenes is able to form biofilms in food processing environments. Since biofilms are generally difficult to eradicate during clean-up procedures, they pose a major risk for the food industry. Stress resistance mechanisms involved in L. monocytogenes biofilm

  19. Recombinant Expression of a Genome-encoded N-acetylmuramoyl-L-alanine Amidase that Synergistically Lyses Listeria monocytogenes Biofilms with a Protease

    Science.gov (United States)

    Listeria monocytogenes plays a significant role in human food-borne disease caused by eating food contaminated with the bacterium and although incidence is low it is a leading cause of life-threatening, bacterial food-borne disease in humans. L. monocytogenes serotypes 1/2a and 4b can form mixed-cu...

  20. Prevalence of Salmonella enterica, Listeria monocytogenes, and pathogenic Escherichia coli in bulk tank milk and milk filters from US dairy operations in the National Animal Health Monitoring System Dairy 2014 study.

    Science.gov (United States)

    Sonnier, Jakeitha L; Karns, Jeffrey S; Lombard, Jason E; Kopral, Christine A; Haley, Bradd J; Kim, Seon-Woo; Van Kessel, Jo Ann S

    2018-03-01

    The dairy farm environment is a well-documented reservoir for zoonotic pathogens such as Salmonella enterica, Shiga-toxigenic Escherichia coli, and Listeria monocytogenes, and humans may be exposed to these pathogens via consumption of unpasteurized milk and dairy products. As part of the National Animal Health Monitoring System Dairy 2014 study, bulk tank milk (BTM, n = 234) and milk filters (n = 254) were collected from a total of 234 dairy operations in 17 major dairy states and analyzed for the presence of these pathogens. The invA gene was detected in samples from 18.5% of operations and Salmonella enterica was isolated from 18.0% of operations. Salmonella Dublin was detected in 0.7% of operations. Sixteen Salmonella serotypes were isolated, and the most common serotypes were Cerro, Montevideo, and Newport. Representative Salmonella isolates (n = 137) were tested against a panel of 14 antimicrobials. Most (85%) were pansusceptible; the remaining were resistant to 1 to 9 antimicrobials, and within the resistant strains the most common profile was resistance to ampicillin/clavulanic acid, ampicillin, cefoxitin, ceftiofur, ceftriaxone, chloramphenicol, streptomycin, sulfisoxazole, and tetracycline. Listeria spp. were isolated from 19.9% of operations, and L. monocytogenes was isolated from 3.0% of operations. Serogroups 1/2a and 1/2b were the most common, followed by 4b and 4a. One or more E. coli virulence genes were detected in the BTM from 30.5% of operations and in the filters from 75.3% of operations. A combination of stx 2 , eaeA, and γ-tir genes was detected in the BTM from 0.5% of operations and in the filters from 6.6% of operations. The results of this study indicate an appreciable prevalence of bacterial pathogens in BTM and filters, including serovars known to infect humans. Copyright © 2018 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  1. Rapid differentiation of Listeria monocytogenes epidemic clones III and IV and their intact compared with heat-killed populations using Fourier transform infrared spectroscopy and chemometrics.

    Science.gov (United States)

    Nyarko, Esmond B; Puzey, Kenneth A; Donnelly, Catherine W

    2014-06-01

    subtyping methods, and can be used for L. monocytogenes strain typing by food industries and public health agencies to enable faster response and intervention to listeriosis outbreaks. FT-IR can also be applied for routine monitoring of the pathogen in food processing plants and for investigating postprocessing contamination because it is capable of differentiating heat-killed and viable L. monocytogenes populations. © 2014 Institute of Food Technologists®

  2. NATURAL ATYPICAL LISTERIA INNOCUA STRAINS WITH LISTERIA MONOCYTOGENES PATHOGENICITY ISLAND 1 GENES

    Science.gov (United States)

    The detection of the human foodborne pathogen, Listeria monocytogenes, in food, environmental samples and clinical specimens associated with cases of listeriosis, a rare but high mortality-rate disease, requires distinguishing the pathogen from other Listeria species. Speciation...

  3. Local Outbreak of Listeria monocytogenes Serotype 4b Sequence Type 6 Due to Contaminated Meat Pâté.

    Science.gov (United States)

    Althaus, Denise; Jermini, Marco; Giannini, Petra; Martinetti, Gladys; Reinholz, Danuta; Nüesch-Inderbinen, Magdalena; Lehner, Angelika; Stephan, Roger

    2017-04-01

    In January and February 2016, five cases of confirmed and two cases of probable infection due to Listeria monocytogenes serotype 4b, sequence type (ST) 6 belonging to a single pulsed-field gel electrophoresis pulsotype pattern were registered in a region of southern Switzerland. L. monocytogenes was detected in blood samples (four cases) and pleural fluid (one case). Furthermore, L. monocytogenes 4b ST6 was detected in a stool sample of an asymptomatic person exposed to a common food. Forthwith, the food safety authority and a local gourmet meat producer reported L. monocytogenes contamination of meat pâté. Analysis of further food and environmental samples from the premises of the producer yielded isolates matching the clinical strains and confirmed the presence of L. monocytogenes 4b ST6 in the mincing machine as the cause of the food contamination.

  4. The Ontario Food and Nutrition Strategy: identifying indicators of food access and food literacy for early monitoring of the food environment

    Directory of Open Access Journals (Sweden)

    Beatrice A. Boucher

    2017-09-01

    Full Text Available Introduction: To address challenges Canadians face within their food environments, a comprehensive, multistakeholder, intergovernmental approach to policy development is essential. Food environment indicators are needed to assess population status and change. The Ontario Food and Nutrition Strategy (OFNS integrates the food, agriculture and nutrition sectors, and aims to improve the health of Ontarians through actions that promote healthy food systems and environments. This report describes the process of identifying indicators for 11 OFNS action areas in two strategic directions (SDs: Healthy Food Access, and Food Literacy and Skills. Methods: The OFNS Indicators Advisory Group used a five-step process to select indicators: (1 potential indicators from national and provincial data sources were identified; (2 indicators were organized by SD, action area and data type; (3 selection criteria were identified, pilot tested and finalized; (4 final criteria were applied to refine the indicator list; and (5 indicators were prioritized after reapplication of selection criteria. Results: Sixty-nine potential indicators were initially identified; however, many were individual-level rather than system-level measures. After final application of the selection criteria, one individual-level indicator and six system-level indicators were prioritized in five action areas; for six of the action areas, no indicators were available. Conclusion: Data limitations suggest that available data may not measure important aspects of the food environment, highlighting the need for action and resources to improve system-level indicators and support monitoring of the food environment and health in Ontario and across Canada.

  5. The Ontario Food and Nutrition Strategy: identifying indicators of food access and food literacy for early monitoring of the food environment.

    Science.gov (United States)

    Boucher, Beatrice A; Manafò, Elizabeth; Boddy, Meaghan R; Roblin, Lynn; Truscott, Rebecca

    2017-09-01

    To address challenges Canadians face within their food environments, a comprehensive, multistakeholder, intergovernmental approach to policy development is essential. Food environment indicators are needed to assess population status and change. The Ontario Food and Nutrition Strategy (OFNS) integrates the food, agriculture and nutrition sectors, and aims to improve the health of Ontarians through actions that promote healthy food systems and environments. This report describes the process of identifying indicators for 11 OFNS action areas in two strategic directions (SDs): Healthy Food Access, and Food Literacy and Skills. The OFNS Indicators Advisory Group used a five-step process to select indicators: (1) potential indicators from national and provincial data sources were identified; (2) indicators were organized by SD, action area and data type; (3) selection criteria were identified, pilot tested and finalized; (4) final criteria were applied to refine the indicator list; and (5) indicators were prioritized after reapplication of selection criteria. Sixty-nine potential indicators were initially identified; however, many were individual-level rather than system-level measures. After final application of the selection criteria, one individual-level indicator and six system-level indicators were prioritized in five action areas; for six of the action areas, no indicators were available. Data limitations suggest that available data may not measure important aspects of the food environment, highlighting the need for action and resources to improve system-level indicators and support monitoring of the food environment and health in Ontario and across Canada.

  6. Assessing the capacity of growth, survival, and acid adaptive response of Listeria monocytogenes during storage of various cheeses and subsequent simulated gastric digestion.

    Science.gov (United States)

    Kapetanakou, Anastasia E; Gkerekou, Maria A; Vitzilaiou, Eirini S; Skandamis, Panagiotis N

    2017-04-04

    Different physicochemical and microbiological characteristics of cheeses may affect Listeria monocytogenes potential to grow, survive, or exhibit an acid adaptive response during storage and digestion. The objectives of the present study were to assess: i) the survival or growth potential of L.monocytogenes on various cheeses during storage, ii) the effect of initial indigenous microbiota on pathogen growth in comparison to expected growth curves retrieved by existing predictive models, and iii) the impact of habituation on/in cheeses surfaces on the subsequent acid resistance during simulated gastric digestion. Portions of cream (Cottage and Mascarpone), soft (Anthotyros, Camembert, Mastelo®, Manouri, Mozzarella, Ricotta), and semi-hard (Edam, Halloumi, Gouda) cheeses were inoculated with ca. 100CFU/g or cm 2 of L.monocytogenes and stored under vacuum or aerobic conditions at 7°C (n=4). The impact of varying (initial) levels of starter culture or indigenous spoilage microbiota on pathogen growth was evaluated by purchasing cheese packages on different dates in relation to production and expiration date (subsequently reflecting to different batches) mimicking a potential situation of cheese contamination with L.monocytogenes during retail display. Values of pH and a w were also monitored and used to simulate growth of L. monocytogenes by existing models and compare it with the observed data of the study. Survival in simulated gastric fluid (SGF) (pH1.5; HCl; max. 120min) was assessed at three time points during storage. Mascarpone, Ricotta, Mozzarella, Camembert, and Halloumi supported L.monocytogenes growth by 0.5-0.8logCFU/g or cm 2 per day, since low initial levels of total viable counts (TVC) (1.8-3.8logCFU/g or cm 2 ) and high pH/a w values (ca. 6.23-6.64/0.965-0.993) were recorded. On Cottage, Anthotyros, Manouri, Mastelo®, Edam, and Gouda, the pathogen survived at populations similar or lower than the inoculation level due to the high reported competition

  7. Food and beverage environment analysis and monitoring system: a reliability study in the school food and beverage environment.

    Science.gov (United States)

    Bullock, Sally Lawrence; Craypo, Lisa; Clark, Sarah E; Barry, Jason; Samuels, Sarah E

    2010-07-01

    States and school districts around the country are developing policies that set nutrition standards for competitive foods and beverages sold outside of the US Department of Agriculture's reimbursable school lunch program. However, few tools exist for monitoring the implementation of these new policies. The objective of this research was to develop a computerized assessment tool, the Food and Beverage Environment Analysis and Monitoring System (FoodBEAMS), to collect data on the competitive school food environment and to test the inter-rater reliability of the tool among research and nonresearch professionals. FoodBEAMS was used to collect data in spring 2007 on the competitive foods and beverages sold in 21 California high schools. Adherence of the foods and beverages to California's competitive food and beverage nutrition policies for schools (Senate Bills 12 and 965) was determined using the data collected by both research and nonresearch professionals. The inter-rater reliability between the data collectors was assessed using the intraclass correlation coefficient. Researcher vs researcher and researcher vs nonresearcher inter-rater reliability was high for both foods and beverages, with intraclass correlation coefficients ranging from .972 to .987. Results of this study provide evidence that FoodBEAMS is a promising tool for assessing and monitoring adherence to nutrition standards for competitive foods sold on school campuses and can be used reliably by both research and nonresearch professionals. Copyright 2010 American Dietetic Association. Published by Elsevier Inc. All rights reserved.

  8. Morphological Change and Decreasing Transfer Rate of Biofilm-Featured Listeria monocytogenes EGDe.

    Science.gov (United States)

    Lee, Yuejia; Wang, Chinling

    2017-03-01

    Listeria monocytogenes , a lethal foodborne pathogen, has the ability to resist the hostile food processing environment and thus frequently contaminates ready-to-eat foods during processing. It is commonly accepted that the tendency of L. monocytogenes ' to generate biofilms on various surfaces enhances its resistance to the harshness of the food processing environment. However, the role of biofilm formation in the transferability of L. monocytogenes EGDe remains controversial. We examined the growth of Listeria biofilms on stainless steel surfaces and their effect on the transferability of L. monocytogenes EGDe. The experiments were a factorial 2 × 2 design with at least three biological replicates. Through scanning electron microscopy, a mature biofilm with intensive aggregates of cells was observed on the surface of stainless steel after 3 or 5 days of incubation, depending on the initial level of inoculation. During biofilm development, L. monocytogenes EGDe carried out binary fission vigorously before a mature biofilm was formed and subsequently changed its cellular morphology from rod shaped to sphere shaped. Furthermore, static biofilm, which was formed after 3 days of incubation at 25°C, significantly inhibited the transfer rate of L. monocytogenes EGDe from stainless steel blades to 15 bologna slices. During 7 days of storage at 4°C, however, bacterial growth rate was not significantly impacted by whether bacteria were transferred from biofilm and the initial concentrations of transferred bacteria on the slice. In conclusion, this study is the first to report a distinct change in morphology of L. monocytogenes EGDe at the late stage of biofilm formation. More importantly, once food is contaminated by L. monocytogenes EGDe, contamination proceeds independently of biofilm development and the initial level of contamination when food is stored at 4°C, even if contamination with L. monocytogenes EGDe was initially undetectable before storage.

  9. First Trimester Listeria monocytogenes Septicemia

    NARCIS (Netherlands)

    Goddijn, M.; Schipper, H. G.; Spanjaard, L.; Wolf, H.

    1997-01-01

    Background: Little is known about fetal outcome after Listeria monocytogenes septicemia in the first trimester of pregnancy.Case: A primigravida with L. monocytogenes septicemia at 9 weeks gestation was treated with amoxicillin. At 40 weeks gestation a healthy female infant was born.Conclusion: This

  10. Silver as antibacterial towards Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Simone eBelluco

    2016-03-01

    Full Text Available Listeria monocytogenes is a serious foodborne pathogen that can contaminate food during processing and can grow during food shelf-life. New types of safe and effective food contact materials embedding antimicrobial agents, like silver, can play an important role in the food industry. The present work aimed at evaluating the in vitro growth kinetics of different strains of L. monocytogenes in the presence of silver, both in its ionic and nano form. The antimicrobial effect was determined by assaying the number of culturable bacterial cells, which formed colonies after incubation in the presence of silver nanoparticles (AgNPs or silver nitrate (AgNO3. Ionic release experiments were performed in parallel. A different reduction of bacterial viability between silver ionic and nano forms was observed, with a time delayed effect exerted by AgNPs. An association between antimicrobial activity and ions concentration was shown by both silver chemical forms, suggesting the major role of ions in the antimicrobial mode of action.

  11. REALIS: Postgenomic Analysis of Listeria Monocytogenes

    Directory of Open Access Journals (Sweden)

    The REALIS Consortium

    2006-04-01

    Full Text Available Listeria monocytogenes is a remarkably successful food-borne pathogen. It is capable a of surviving and proliferating under conditions that exist within the food chain, such as at low temperatures, high salt and low pH and b of colonizing animal host tissues after ingestion of contaminated food, causing opportunistic infections mainly, but not exclusively, in immunocompromised hosts. The ultimate goals of REALIS are two fold: Firstly, it aims to completely decipher all genes required for survival in and adaptation of Listeria monocytogenes to two very different environments, ie., the infected host and the external environment. Secondly, using genomics and postgenomic tools, REALIS seeks to precisely address fundamental questions regarding evolutionary relationships between pathogenic and non-pathogenic Listeria and to define qualities of particularly successful clonal pathovariants in causing disease. This project will provide both industry and health care managers with rational approaches to curbing food-borne contamination, minimising risks of infection and providing novel pharmacological approaches for halting the fulminant course of infection.

  12. Influence of temperature on alkali stress adaptation in Listeria monocytogenes

    Science.gov (United States)

    Listeria monocytogenes cells may induce alkali stress adaptation when exposed to sublethal concentrations of alkaline cleaners and sanitizers that may be frequently used in the food processing environment. In the present study, the effect of temperature on the induction and the stability of such alk...

  13. Geospatial climate monitoring products: Tools for food security assessment

    Science.gov (United States)

    Verdin, James Patrick

    Many of the 250 million people living in the drylands of Sub-Saharan Africa are food insecure---they lack access at all times to enough food for an active and healthy life. Their vulnerability is due in large measure to highly variable climatic conditions and a dependence on rainfed agriculture. Famine, the most extreme food security emergency, is caused by crop failure due to bad weather, conflict, or both. Famine is a slow onset disaster, culminating after two or more bad growing seasons. After the disastrous African famines of the 1970s and 1980s, the U.S. established the Famine Early Warning System (FEWS) to make the observations of climatic and socioeconomic variables needed for early detection of food security emergencies. Two geospatial climate monitoring products, rainfall estimate and vegetation index images derived from satellite data, are operationally used by FEWS analysts. This dissertation describes research to derive new products from them to reduce ambiguity and improve the link between early warning and early response. First, rainfall estimate images were used in a geospatial crop water accounting scheme. The resulting water requirement satisfaction index was used to estimate crop yield, and a correlation of 0.80 with conventional yield reports was obtained for the 1997 maize harvest in Zimbabwe. Thus, the agricultural significance of remotely sensed patterns of precipitation in time and space was made more clear. The second product tested was the expression of a seasonal climate forecast as a series of vegetation index anomaly images. Correlations between sea surface temperature anomalies in the equatorial Pacific and vegetation index anomalies in Southern Africa were established and predictive relationships cross-validated. Using model forecast values of Pacific sea surface temperature from the National Oceanic and Atmospheric Administration for January, February, and March, forecast images of vegetation index anomalies were prepared prior to the

  14. Monitoring the health-related labelling of foods and non-alcoholic beverages in retail settings.

    Science.gov (United States)

    Rayner, M; Wood, A; Lawrence, M; Mhurchu, C N; Albert, J; Barquera, S; Friel, S; Hawkes, C; Kelly, B; Kumanyika, S; L'abbé, M; Lee, A; Lobstein, T; Ma, J; Macmullan, J; Mohan, S; Monteiro, C; Neal, B; Sacks, G; Sanders, D; Snowdon, W; Swinburn, B; Vandevijvere, S; Walker, C

    2013-10-01

    Food labelling on food packaging has the potential to have both positive and negative effects on diets. Monitoring different aspects of food labelling would help to identify priority policy options to help people make healthier food choices. A taxonomy of the elements of health-related food labelling is proposed. A systematic review of studies that assessed the nature and extent of health-related food labelling has been conducted to identify approaches to monitoring food labelling. A step-wise approach has been developed for independently assessing the nature and extent of health-related food labelling in different countries and over time. Procedures for sampling the food supply, and collecting and analysing data are proposed, as well as quantifiable measurement indicators and benchmarks for health-related food labelling. © 2013 The Authors. Obesity Reviews published by John Wiley & Sons Ltd on behalf of the International Association for the Study of Obesity.

  15. [Analysis of antibiotic susceptibility of foodborne Listeria monocytogenes in China].

    Science.gov (United States)

    Yang, Yang; Fu, Ping; Guo, Yunchang; Liu, Xiurmei

    2008-03-01

    To study the antibiotic susceptibility of foodborne Listeria monocytogenes in China. The susceptibilities of 476 strains of foodborne Listeria monocytogenes to antibiotics were determined in Broth Microdilution Susceptibility Testing in Clinical and Laboratory Standards Institute. The antibiotics of gentamicin, ampicillin, penicillin, tetracycline, doxycycline, imipenem, erythromycin, ciprofloxacin, levofloxacin, cephalothin, rifampin, vancomycin, chloramphenicol, Trimethoprim-sulfamethoxazole, ampicillin-sulbactam were used. The rates of antibiotic resistance in 467 is olates were 4.5%. Tetracycline resistance was most prevalent, accouting for 4.07% . The foods that the rates of antibiotic resistance were highest were vegetable (10%). Among 14 provinces, Jilin, Hubei and Hebei were the third top, the rate of which were 19.6% and 9.1% and 8%, respectively. It was suggested that antibiotic resistance exists in foodborne Listeria monocytogenes to a certain extent in China. It should pay more attention to the use of drugs in prevention and clinic treatment to reduce the antibiotic resistant strains.

  16. Role of Extracellular DNA during Biofilm Formation by Listeria monocytogenes

    DEFF Research Database (Denmark)

    Harmsen, Morten; Lappann, Martin; Knøchel, S

    2010-01-01

    (eDNA) may be the only central component of the biofilm matrix and that it is necessary for both initial attachment and early biofilm formation for 41 L. monocytogenes strains that were tested. DNase I treatment resulted in dispersal of biofilms, not only in microtiter tray assays but also in flow......Listeria monocytogenes is a food-borne pathogen that is capable of living in harsh environments. It is believed to do this by forming biofilms, which are surface-associated multicellular structures encased in a self-produced matrix. In this paper we show that in L. monocytogenes extracellular DNA...... cell biofilm assays. However, it was also demonstrated that in a culture without eDNA, neither Listeria genomic DNA nor salmon sperm DNA by itself could restore the capacity to adhere. A search for additional necessary components revealed that peptidoglycan (PG), specifically N-acetylglucosamine (NAG...

  17. Listeria monocytogenes response regulators important for stress tolerance and pathogenesis

    DEFF Research Database (Denmark)

    Kallipolitis, B H; Ingmer, H

    2001-01-01

    Environmental sensing by two-component signal transduction systems is likely to play a role for growth and survival of Listeria monocytogenes both during transmission in food products and within a host organism. Two-component systems typically consist of a membrane-associated sensor histidine...... kinase and a gene regulatory protein, the response regulator (RR). We have identified seven putative RR genes in L. monocytogenes LO28 by PCR using degenerate oligonucleotide primers. By insertional inactivation we obtained data suggesting that three of the putative RRs contribute to the pathogenicity...... of L. monocytogenes in mice. Strikingly, the mutants that were attenuated in virulence also had a decreased ability to grow in the presence of various stress conditions potentially encountered in an infection process. Thus, our data point to a connection between the ability of the putative two...

  18. Animal models for oral transmission of Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Sarah E F D'Orazio

    2014-02-01

    Full Text Available Listeria monocytogenes has been recognized as a food borne pathogen in humans since the 1980s, but we still understand very little about oral transmission of L. monocytogenes or the host factors that determine susceptibility to gastrointestinal infection, due to the lack of an appropriate small animal model of oral listeriosis. Early feeding trials suggested that many animals were highly resistant to oral infection, and the more reproducible intravenous or intraperitoneal routes of inoculation soon came to be favored. There are a fair number of previously published studies using an oral infection route, but the work varies widely in terms of bacterial strain choice, the methods used for oral transmission, and various manipulations used to enhance infectivity. This mini review will summarize the published literature using oral routes of L. monocytogenes infection and will highlight recent technological advances that have made oral infection a more attractive model system.

  19. A monitor for consumer confidence in the safety of food

    NARCIS (Netherlands)

    Jonge, de J.

    2008-01-01

    Despite the fact that in the developed countries food safety standards are higher than ever, food safety incidents continue to occur frequently. The accumulation of food safety incidents might affect general consumer confidence in the safety of food. Therefore, in this thesis, the concept of general

  20. Listeria monocytogenes in Fresh Produce: Outbreaks, Prevalence and Contamination Levels

    Directory of Open Access Journals (Sweden)

    Qi Zhu

    2017-03-01

    Full Text Available Listeria monocytogenes, a member of the genus Listeria, is widely distributed in agricultural environments, such as soil, manure and water. This organism is a recognized foodborne pathogenic bacterium that causes many diseases, from mild gastroenteritis to severe blood and/or central nervous system infections, as well as abortion in pregnant women. Generally, processed ready-to-eat and cold-stored meat and dairy products are considered high-risk foods for L. monocytogenes infections that cause human illness (listeriosis. However, recently, several listeriosis outbreaks have been linked to fresh produce contamination around the world. Additionally, many studies have detected L. monocytogenes in fresh produce samples and even in some minimally processed vegetables. Thus L. monocytogenes may contaminate fresh produce if present in the growing environment (soil and water. Prevention of biofilm formation is an important control measure to reduce the prevalence and survival of L. monocytogenes in growing environments and on fresh produce. This article specifically focuses on fresh produce–associated listeriosis outbreaks, prevalence in growing environments, contamination levels of fresh produce, and associated fresh produce safety challenges.

  1. Deciphering the landscape of host barriers to Listeria monocytogenes infection.

    Science.gov (United States)

    Zhang, Ting; Abel, Sören; Abel Zur Wiesch, Pia; Sasabe, Jumpei; Davis, Brigid M; Higgins, Darren E; Waldor, Matthew K

    2017-06-13

    Listeria monocytogenes is a common food-borne pathogen that can disseminate from the intestine and infect multiple organs. Here, we used sequence tag-based analysis of microbial populations (STAMP) to investigate L monocytogenes population dynamics during infection. We created a genetically barcoded library of murinized L monocytogenes and then used deep sequencing to track the pathogen's dissemination routes and quantify its founding population ( N b ) sizes in different organs. We found that the pathogen disseminates from the gastrointestinal tract to distal sites through multiple independent routes and that N b sizes vary greatly among tissues, indicative of diverse host barriers to infection. Unexpectedly, comparative analyses of sequence tags revealed that fecally excreted organisms are largely derived from the very small number of L. monocytogenes cells that colonize the gallbladder. Immune depletion studies suggest that distinct innate immune cells restrict the pathogen's capacity to establish replicative niches in the spleen and liver. Finally, studies in germ-free mice suggest that the microbiota plays a critical role in the development of the splenic, but not the hepatic, barriers that prevent L. monocytogenes from seeding these organs. Collectively, these observations illustrate the potency of the STAMP approach to decipher the impact of host factors on population dynamics of pathogens during infection.

  2. Determining If Phylogenetic Relatedness of Listeria Monocytogenes Isolates Corresponds to Persistence in Poultry Processing Plants Using Whole-Genome Sequencing

    Science.gov (United States)

    Introduction: Controlling Listeria monocytogenes on ready-to-eat meat and poultry products and in food processing facilities is challenging. Surveys have found that some L. monocytogenes types are more persistent in processing facilities than others, but the reason is unknown. It is possible persist...

  3. An outbreak of an unusual strain of Listeria monocytogenes infection in North-East Scotland

    Directory of Open Access Journals (Sweden)

    Emmanuel Okpo

    2015-11-01

    Full Text Available Summary: Listeria monocytogenes infection is an important cause of illness and hospitalization in vulnerable individuals. In the present study, we describe a community outbreak of Listeria monocytogenes in the North-East region of Scotland, which was epidemiologically, environmentally and microbiologically linked to a local meat product and ready-to-eat product manufacturer. Infected individuals were interviewed, and an environmental investigation was conducted. Clinical and environmental samples were tested by culture, and isolates were typed by fluorescent amplified fragment length polymorphism (fAFLP. Three cases of Listeria monocytogenes were linked geographically, had the same serotype (1/2a and were indistinguishable by fAFLP type XII.6. The human, food and environmental isolates were of the same serotype and were indistinguishable by molecular typing.This is the first community outbreak of L. monocytogenes reported in Scotland since the current outbreak surveillance was established in 1996. Epidemiological and laboratory evidence indicated poor hand hygiene, unhygienic practices and cross-contamination throughout the manufacturing process of ready-to-eat foods as a possible cause of the outbreak. More stringent control of commercial food establishments that provide ready-to-eat food and the need to advise specifically vulnerable groups, e.g., pregnant women, of the risk of L. monocytogenes in ready-to-eat food is urgently needed. Keywords: Listeria monocytogenes, Outbreak, Foodborne, Community acquired infection, Listeriosis

  4. LACTIC FLORA-LISTERIA MONOCYTOGENES INTERACTION

    Directory of Open Access Journals (Sweden)

    S. Colombo

    2012-08-01

    Full Text Available The EC Regulation 2073/2005 (1 requires that food processors evaluate the capability of ready-to-use (RTE products to support the development of Listeria monocytogenes when their pH and aW values are favourable to the growth of this microorganism. It is renown that the lactic flora plays an important role in many different foods, both from a technological and a food safety standpoint. This study was aimed to observe the behaviour and the potential anti-Listeria effect of some natural lactic flora present in Italian liver patè crostini (chicken heart and liver, anchovies, onions, capers, starch, no added preservatives through the Combase Predictor – Max Growth Rate predictive software. The natural lactic flora of the crostini demonstrated a variable capability to inhibit the growth of Listeria monocytogenes which depends upon : the concentration of the lactic flora at the beginning of the shelf life period and the subsequent lag phase, the possible release of anti-Listeria substances, and the maximum growth rate.

  5. Intelligent packaging for monitoring food quality: a case study on fresh fish

    NARCIS (Netherlands)

    Heising, J.K.

    2014-01-01

    Background

    Foods are prone to quality degradation in the whole supply chain, but the possibilities for monitoring the quality of foods inside the package are limited. When sensors of quality indicators are included into the package of a food, the package can become an

  6. Induction and stability of oxidative stress adaptation in Listeria monocytogenes EGD (Bug600) and F1057 in sublethal concentrations of H2O2 and NaOH

    Science.gov (United States)

    Food processing and food handling environments may contain residual levels of sanitizers or cleaners which may trigger oxidative stress adaptation in Listeria monocytogenes. The aim of this study was to determine the induction and stability of oxidative stress adaptation in L. monocytogenes EGD (Bug...

  7. Foreign Assistance: North Korea Restricts Food Aid Monitoring

    National Research Council Canada - National Science Library

    1999-01-01

    .... However, the North Korean government has not allowed the World Food Program to fully implement its procedures, and as a result, it cannot be sure that the food aid is being shipped, stored, or used as planned...

  8. Foreign Assistance: North Korean Constraints Limit Food Aid Monitoring

    National Research Council Canada - National Science Library

    Nelson, Benjamin

    1999-01-01

    .... However, the North Korean government has not allowed the World Food Program to fully implement its procedures and, as a result, it cannot be sure that the food aid is being shipped, stored, or used as planned...

  9. Genotypes Associated with Listeria monocytogenes Isolates Displaying Impaired or Enhanced Tolerances to Cold, Salt, Acid, or Desiccation Stress

    DEFF Research Database (Denmark)

    Hingston, Patricia A.; Chen, Jessica; Dhillon, Bhavjinder K

    2017-01-01

    elements. A whole genome single-nucleotide-variants phylogeny revealed sporadic distribution of tolerant isolates and closely related sensitive and tolerant isolates, highlighting that minor genetic differences can influence the stress tolerance of L. monocytogenes. Specifically, a number of cold......The human pathogen Listeria monocytogenes is a large concern in the food industry where its continuous detection in food products has caused a string of recalls in North America and Europe. Most recognized for its ability to grow in foods during refrigerated storage, L. monocytogenes can also...... tolerate several other food-related stresses with some strains possessing higher levels of tolerances than others. The objective of this study was to use a combination of phenotypic analyses and whole genome sequencing to elucidate potential relationships between L. monocytogenes genotypes and food...

  10. Effect of Listeria seeligeri or Listeria welshimeri on Listeria monocytogenes detection in and recovery from buffered Listeria enrichment broth.

    Science.gov (United States)

    Dailey, Rachel C; Welch, Lacinda J; Hitchins, Anthony D; Smiley, R Derike

    2015-04-01

    The presence of multiple species of Listeria in regulated food products is not uncommon and can complicate the recovery of Listeria monocytogenes particularly on a non-differentiating medium. The potential complications of Listeria seeligeri and Listeria welshimeri on the recovery of L. monocytogenes from inoculated food test samples using the U.S. Food and Drug Administration's (FDA) selective enrichment procedure was investigated. Post-enrichment enumeration, in the absence of food product, indicates that some L. seeligeri and L. monocytogenes pairings may have population differentials as great as 2.7 ± 0.1 logs with L. seeligeri being the predominant species. A similar observation was noted for L. welshimeri and L. monocytogenes pairings which resulted in population differentials as large as 3.7 ± 0.2 logs with L. welshimeri being the predominant species. Select strain pairings were used to inoculate guacamole, crab meat, broccoli, and cheese with subsequent recovery by the FDA Bacteriological Analytical Manual (BAM) method with 10 colonies per sample selected for confirmation. The presence of L. seeligeri had little effect on the recovery of L. monocytogenes. The presence of L. welshimeri resulted in the failure to recover L. monocytogenes in three out of the four food matrices. This work extends the observation that non-pathogenic species of Listeria can complicate the recovery of L. monocytogenes and that competition during selective enrichment is not limited to the presence of just Listeria innocua. Published by Elsevier Ltd.

  11. Effect of Listeria seeligeri or Listeria welshimeri on Listeria monocytogenes detection in and recovery from buffered Listeria enrichment broth☆

    Science.gov (United States)

    Dailey, Rachel C.; Welch, Lacinda J.; Hitchins, Anthony D.; Smiley, R. Derike

    2016-01-01

    The presence of multiple species of Listeria in regulated food products is not uncommon and can complicate the recovery of Listeria monocytogenes particularly on a non-differentiating medium. The potential complications of Listeria seeligeri and Listeria welshimeri on the recovery of L. monocytogenes from inoculated food test samples using the U.S. Food and Drug Administration's (FDA) selective enrichment procedure was investigated. Post-enrichment enumeration, in the absence of food product, indicates that some L. seeligeri and L. monocytogenes pairings may have population differentials as great as 2.7 ± 0.1 logs with L. seeligeri being the predominant species. A similar observation was noted for L. welshimeri and L. monocytogenes pairings which resulted in population differentials as large as 3.7 ± 0.2 logs with L. welshimeri being the predominant species. Select strain pairings were used to inoculate guacamole, crab meat, broccoli, and cheese with subsequent recovery by the FDA Bacteriological Analytical Manual (BAM) method with 10 colonies per sample selected for confirmation. The presence of L. seeligeri had little effect on the recovery of L. monocytogenes. The presence of L. welshimeri resulted in the failure to recover L. monocytogenes in three out of the four food matrices. This work extends the observation that non-pathogenic species of Listeria can complicate the recovery of L. monocytogenes and that competition during selective enrichment is not limited to the presence of just Listeria innocua. PMID:25475325

  12. Dynamics of biofilm formation by Listeria monocytogenes on stainless steel under mono-species and mixed-culture simulated fish processing conditions and chemical disinfection challenges.

    Science.gov (United States)

    Papaioannou, Eleni; Giaouris, Efstathios D; Berillis, Panagiotis; Boziaris, Ioannis S

    2018-02-21

    The progressive ability of a six-strains L. monocytogenes cocktail to form biofilm on stainless steel (SS), under fish-processing simulated conditions, was investigated, together with the biocide tolerance of the developed sessile communities. To do this, the pathogenic bacteria were left to form biofilms on SS coupons incubated at 15°C, for up to 240h, in periodically renewable model fish juice substrate, prepared by aquatic extraction of sea bream flesh, under both mono-species and mixed-culture conditions. In the latter case, L. monocytogenes cells were left to produce biofilms together with either a five-strains cocktail of four Pseudomonas species (fragi, savastanoi, putida and fluorescens), or whole fish indigenous microflora. The biofilm populations of L. monocytogenes, Pseudomonas spp., Enterobacteriaceae, H 2 S producing and aerobic plate count (APC) bacteria, both before and after disinfection, were enumerated by selective agar plating, following their removal from surfaces through bead vortexing. Scanning electron microscopy was also applied to monitor biofilm formation dynamics and anti-biofilm biocidal actions. Results revealed the clear dominance of Pseudomonas spp. bacteria in all the mixed-culture sessile communities throughout the whole incubation period, with the in parallel sole presence of L. monocytogenes cells to further increase (ca. 10-fold) their sessile growth. With respect to L. monocytogenes and under mono-species conditions, its maximum biofilm population (ca. 6logCFU/cm 2 ) was reached at 192h of incubation, whereas when solely Pseudomonas spp. cells were also present, its biofilm formation was either slightly hindered or favored, depending on the incubation day. However, when all the fish indigenous microflora was present, biofilm formation by the pathogen was greatly hampered and never exceeded 3logCFU/cm 2 , while under the same conditions, APC biofilm counts had already surpassed 7logCFU/cm 2 by the end of the first 96h of

  13. A criteria and indicators monitoring framework for food forestry embedded in the principles of ecological restoration.

    Science.gov (United States)

    Park, Hyeone; Higgs, Eric

    2018-02-02

    Food forestry is a burgeoning practice in North America, representing a strong multifunctional approach that combines agriculture, forestry, and ecological restoration. The Galiano Conservancy Association (GCA), a community conservation, restoration, and educational organization on Galiano Island, British Columbia in Canada, recently has created two food forests on their protected forested lands: one with primarily non-native species and the other comprising native species. These projects, aimed at food production, education, and promotion of local food security and sustainability, are also intended to contribute to the overall ecological integrity of the landscape. Monitoring is essential for assessing how effectively a project is meeting its goal and thus informing its adaptive management. Yet, presently, there are no comprehensive monitoring frameworks for food forestry available. To fill this need, this study developed a generic Criteria and Indicators (C&I) monitoring framework for food forestry, embedded in ecological restoration principles, by employing qualitative content analysis of 61 literature resources and semi-structured interviews with 16 experts in the fields of food forestry and ecological restoration. The generic C&I framework comprises 14 criteria, 39 indicators, and 109 measures and is intended to guide a comprehensive and systematic assessment for food forest projects. The GCA adapted the generic C&I framework to develop a customized monitoring framework. The Galiano C&I monitoring framework has comprehensive suite of monitoring parameters, which are collectively address multiple values and goals.

  14. A Novel Role of Listeria monocytogenes Membrane Vesicles in Inhibition of Autophagy and Cell Death.

    Science.gov (United States)

    Vdovikova, Svitlana; Luhr, Morten; Szalai, Paula; Nygård Skalman, Lars; Francis, Monika K; Lundmark, Richard; Engedal, Nikolai; Johansson, Jörgen; Wai, Sun N

    2017-01-01

    Bacterial membrane vesicle (MV) production has been mainly studied in Gram-negative species. In this study, we show that Listeria monocytogenes , a Gram-positive pathogen that causes the food-borne illness listeriosis, produces MVs both in vitro and in vivo . We found that a major virulence factor, the pore-forming hemolysin listeriolysin O (LLO), is tightly associated with the MVs, where it resides in an oxidized, inactive state. Previous studies have shown that LLO may induce cell death and autophagy. To monitor possible effects of LLO and MVs on autophagy, we performed assays for LC3 lipidation and LDH sequestration as well as analysis by confocal microscopy of HEK293 cells expressing GFP-LC3. The results revealed that MVs alone did not affect autophagy whereas they effectively abrogated autophagy induced by pure LLO or by another pore-forming toxin from Vibrio cholerae , VCC. Moreover, Listeria monocytogenes MVs significantly decreased Torin1-stimulated macroautophagy. In addition, MVs protected against necrosis of HEK293 cells caused by the lytic action of LLO. We explored the mechanisms of LLO-induced autophagy and cell death and demonstrated that the protective effect of MVs involves an inhibition of LLO-induced pore formation resulting in inhibition of autophagy and the lytic action on eukaryotic cells. Further, we determined that these MVs help bacteria to survive inside eukaryotic cells (mouse embryonic fibroblasts). Taken together, these findings suggest that intracellular release of MVs from L. monocytogenes may represent a bacterial strategy to survive inside host cells, by its control of LLO activity and by avoidance of destruction from the autophagy system during infection.

  15. A Novel Role of Listeria monocytogenes Membrane Vesicles in Inhibition of Autophagy and Cell Death

    Directory of Open Access Journals (Sweden)

    Svitlana Vdovikova

    2017-05-01

    Full Text Available Bacterial membrane vesicle (MV production has been mainly studied in Gram-negative species. In this study, we show that Listeria monocytogenes, a Gram-positive pathogen that causes the food-borne illness listeriosis, produces MVs both in vitro and in vivo. We found that a major virulence factor, the pore-forming hemolysin listeriolysin O (LLO, is tightly associated with the MVs, where it resides in an oxidized, inactive state. Previous studies have shown that LLO may induce cell death and autophagy. To monitor possible effects of LLO and MVs on autophagy, we performed assays for LC3 lipidation and LDH sequestration as well as analysis by confocal microscopy of HEK293 cells expressing GFP-LC3. The results revealed that MVs alone did not affect autophagy whereas they effectively abrogated autophagy induced by pure LLO or by another pore-forming toxin from Vibrio cholerae, VCC. Moreover, Listeria monocytogenes MVs significantly decreased Torin1-stimulated macroautophagy. In addition, MVs protected against necrosis of HEK293 cells caused by the lytic action of LLO. We explored the mechanisms of LLO-induced autophagy and cell death and demonstrated that the protective effect of MVs involves an inhibition of LLO-induced pore formation resulting in inhibition of autophagy and the lytic action on eukaryotic cells. Further, we determined that these MVs help bacteria to survive inside eukaryotic cells (mouse embryonic fibroblasts. Taken together, these findings suggest that intracellular release of MVs from L. monocytogenes may represent a bacterial strategy to survive inside host cells, by its control of LLO activity and by avoidance of destruction from the autophagy system during infection.

  16. Efficacy of ultraviolet light exposure against survival of Listeria monocytogenes on conveyor belts.

    Science.gov (United States)

    Morey, Amit; McKee, Shelly R; Dickson, James S; Singh, Manpreet

    2010-06-01

    Listeria monocytogenes has been repeatedly isolated from foods and food-processing facilities including food contact surfaces such as conveyor belts (CB). CBs are often difficult to clean and require rigorous sanitation programs for decontamination. Ultraviolet (UV) light has exhibited microbicidal properties on food contact surfaces and this study was conducted to determine the efficacy of UV against L. monocytogenes on CB made of different materials. A four-strain cocktail of L. monocytogenes (serotypes 3A, 4A, 4B, and 4C) was made to give a suspension of approximately 10(7) CFU/mL. CBs made from four different types of materials, (1) Ropanyl DM 8/2 A2 + 04 (belt 1), (2) Volta FRMW-3.0 (belt 2), (3) Volta FRMB-3.0 (belt 3), and (4) Ropanyl DM (belt 4), were inoculated with 1 mL of the four-strain cocktail (approximately 10(7) CFU/mL) of the bacterial suspension. CBs were treated with UV light (254 nm) for 1 and 3 sec at 5.53 and 5.95 mW/cm(2). Three replications of the experiments were conducted. Two-way analysis of variance of survival populations of L. monocytogenes showed that bacterial counts were significantly reduced (p belt types irrespective of UV light intensities and times of exposure. L. monocytogenes populations were reduced (p belts 1, 2, and 3 after exposure to 5.95 mW/cm(2) UV light intensity for 3 sec. L. monocytogenes-inoculated CBs that were exposed to 5.53 mW/cm(2) showed higher (p Belt 4 showed survival populations of L. monocytogenes ranging from 1.42 to 1.73 log(10) CFU/cm(2) after UV light treatment for 1 and 3 sec. UV light can be effectively used to reduce L. monocytogenes contamination on CBs.

  17. Modeling and predicting the growth boundary of Listeria monocytogenes in lightly preserved seafood

    DEFF Research Database (Denmark)

    Mejlholm, Ole; Dalgaard, Paw

    2007-01-01

    The antimicrobial effect of diacetate and lactate against Listeria monocytogenes was evaluated in challenge tests with vacuum-packaged or modified atmosphere packaged (MAP) cold-smoked salmon, marinated salmon, cold-smoked Greenland halibut, marinated Greenland halibut, and gravad salmon. MAP col...... characteristics required to prevent the growth of L. monocytogenes, thereby making it possible to identify critical control points, and is useful for compliance with the new European Union regulation on ready-to-eat foods (EC 2073/2005)....

  18. Occurrence and antimicrobial resistance patterns of Listeria monocytogenes isolated from vegetables

    OpenAIRE

    Byrne,Vanessa de Vasconcelos; Hofer,Ernesto; Vallim,Deyse Christina; Almeida,Rogeria Comastri de Castro

    2016-01-01

    Abstract Although the consumption of fresh and minimally processed vegetables is considered healthy, outbreaks related to the contamination of these products are frequently reported. Among the food-borne pathogens that contaminate vegetables is Listeria monocytogenes, a ubiquitous organism that exhibits the ability to survive and multiply at refrigerated temperatures. This study aimed to evaluate the occurrence of L. monocytogenes in vegetables as well as the antimicrobial resistance of isola...

  19. Phenotypic and Genotypic Characteristics of Listeria monocytogenes Isolated From Dairy and Meat Products

    OpenAIRE

    Bahador; Sadeghi Kalani; Valian; Irajian; Lotfollahi

    2015-01-01

    Background Listeria monocytogenes is a foodborne pathogen and a serious threat to the public health in the world. Consumption of traditional foods such as dairy and meat products can be a major reason for relative abundance and isolation of these bacteria. Objectives The purpose of this study was to determine the phenotypic and genotypic characteristics of L. monocytogenes strains isolated from dairy and meat products. ...

  20. Electroforesis en Gel de Campo Pulsado (PFGE para la diferenciación molecular de Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Angela Maria Cardoso Bernal

    2013-08-01

    Full Text Available The reporting of L. monocytogenes in food in Colombia is not a mandatory; however, foods considered high-risk are monitored, and the organism is only reported clinically as Gram-positive when it causes meningitis. L. monocytogenes is a foodborne, intracellular, pathogen which causes listeriosis, a disease lethal to humans and animals. Outbreaks of this disease worldwide can bring about human and economic losses. Only a few studies in Colombia have been able to identify and molecularly serotype isolates allowing only the theoretical distribution of serotypes by lineage. This review explains the characteristics of the pathogen, its importance in public health and in the food industry, and provides an overview of PFGE-CHEF; identifying the standard work protocol and the appropriate restriction enzymes to cut DNA. We found that the enzyme combination, XbaI-AscI, followed by ApaI offers the best results to differentiate isolates, by grouping them by lineages, and displaying intra-serotype variations. Additionally, we found that in several Latin American countries the results are analyzed using PulseNet; this ensures the comparison of PFGE patterns in equivalent conditions.

  1. Frequency of contamination Listeria monocytogenes of raw dried cured vacuum packed sausages

    Directory of Open Access Journals (Sweden)

    Hristo Daskalov

    2014-03-01

    Full Text Available The aim of this study was to collect actual data concerning the frequency of contamination with Listeria monocytogenes of some very popular in Bulgaria raw dried cured vacuum packed sausages, produced from October 2004 till May 2008. 148 vacuum-packed samples were taken from 9 different food business operators during all seasons of the year. The samples were analyzed according to USDA method for meat foods. Ten specimens were positive for presence of Listeria monocytogenes equal to 6,75% of all tested samples. In two other raw dried cured sausages L.welshimeri and L.innocua were found, but these species are not pathogenic for consumers. In the period before the official implementation of HACCP system (01.01.2006 in Bulgaria, 52 samples were examined and 5 Listeria monocytogenes isolates were found (~10%. 2,5 years after the HACCP implementation, 96 specimens from the same meat factories were tested and 5 Listeria monocytogenes isolates (5,2% were detected. Samples taken from lots, produced in winter time were contaminated with Listeria monocytogenes more often (7 of all 10 than specimens taken during other seasons. Data were discussed through the point of view of the effectiveness of hygienic practices and HACCP system application. Also, application of ‘microbiological criterion’ set in COMMISSION REGULATION (EC No 2073/2005 for ready-to-eat foods unable to support the growth of L. monocytogenes was considered.

  2. The application of the Appropriate Level of Protection (ALOP) and Food Safety Objective (FSO) concepts in food safety management, using Listeria monocytogenes in deli meats as a case study

    NARCIS (Netherlands)

    Gkogka, E.; Reij, M.W.; Gorris, L.G.M.; Zwietering, M.H.

    2011-01-01

    To establish a link between governmental food safety control and operational food safety management, the concepts of the Appropriate Level of Protection (ALOP) and the Food Safety Objective (FSO) have been suggested by international bodies as a means of making food safety control transparent and

  3. Development of plastic scintillator based food radioactivity contamination monitoring system

    International Nuclear Information System (INIS)

    Parihar, A.; Sahani, R.M.; Mahala, V.K.; Vaijapurkar, S.G.

    2016-01-01

    Radioactivity is naturally present in soil, water and food stuffs. Food can be contaminated after discharge of radioactivity into the environment from industries that concentrate natural radionuclide and from civil or military nuclear operations. The contamination can be in three ways; by direct deposition, through the food chain and induced radioactivity due to exposure of high neutron flux. The health effects on human depend on the type of radionuclide and the length of time people are exposed to it. The studies of fission product behaviour in the food chain have revealed radionuclide Strontium-90, Caesium 137 and Iodine-131 are of major concern. Plastic scintillator is already developed indigenously at Defence Laboratory, Jodhpur. Efforts has been made to develop a portable field instrument using plastic scintillator for assessment of beta ( 90 Sr) and gamma ( 137 Cs and 131 I) radioactivity in food

  4. New vision technology for multidimensional quality monitoring of food processes

    DEFF Research Database (Denmark)

    Dissing, Bjørn Skovlund

    be generated using this inductive analytical approach. For the food industry it is an additional advantage that the fast, non-invasive, remote sensing nature of the spectroscopic imaging methods allows on-line measurements. In this way spectroscopic imaging in combination with advanced data analysis meets......Spectroscopy and spectral imaging in combination with multivariate data analysis and machine learning techniques have proven to be an outstanding tool for rapid analysis of different products. This may be utilized in various industries, but especially rapid assessment of food products in food...... research and industry is of importance in this thesis. The non-invasive spectroscopic imaging techniques are able to measure individual food components simultaneously in situ in the food matrix while pattern recognition techniques effectively are able to extract the quantitative information from the vast...

  5. Listeria monocytogenes survival of UV-C radiation is enhanced by presence of sodium chloride, organic food material and by bacterial biofilm formation

    DEFF Research Database (Denmark)

    Bernbom, Nete; Vogel, Birte Fonnesbech; Gram, Lone

    2011-01-01

    The bactericidal effect on food processing surfaces of ceiling-mounted UV-C light (wavelength 254nm) was determined in a fish smoke house after the routine cleaning and disinfection procedure. The total aerobic counts were reduced during UV-C light exposure (48h) and the number of Listeria...... and that it, as all disinfecting procedures, is hampered by the presence of organic material....

  6. Responses of Escherichia coli, Listeria monocytogenes, and Staphylococcus aureus to Simulated Food Processing Treatments, Determined Using Fluorescence-Activated Cell Sorting and Plate Counting▿

    Science.gov (United States)

    Kennedy, Deirdre; Cronin, Ultan P.; Wilkinson, Martin G.

    2011-01-01

    Three common food pathogenic microorganisms were exposed to treatments simulating those used in food processing. Treated cell suspensions were then analyzed for reduction in growth by plate counting. Flow cytometry (FCM) and fluorescence-activated cell sorting (FACS) were carried out on treated cells stained for membrane integrity (Syto 9/propidium iodide) or the presence of membrane potential [DiOC2(3)]. For each microbial species, representative cells from various subpopulations detected by FCM were sorted onto selective and nonselective agar and evaluated for growth and recovery rates. In general, treatments giving rise to the highest reductions in counts also had the greatest effects on cell membrane integrity and membrane potential. Overall, treatments that impacted cell membrane permeability did not necessarily have a comparable effect on membrane potential. In addition, some bacterial species with extensively damaged membranes, as detected by FCM, appeared to be able to replicate and grow after sorting. Growth of sorted cells from various subpopulations was not always reflected in plate counts, and in some cases the staining protocol may have rendered cells unculturable. Optimized FCM protocols generated a greater insight into the extent of the heterogeneous bacterial population responses to food control measures than did plate counts. This study underlined the requirement to use FACS to relate various cytometric profiles generated by various staining protocols with the ability of cells to grow on microbial agar plates. Such information is a prerequisite for more-widespread adoption of FCM as a routine microbiological analytical technique. PMID:21602370

  7. Fødevarebetinget listeria monocytogenes endokarditis

    DEFF Research Database (Denmark)

    Frydland, Martin; Bundgaard, Henning; Moser, Claus

    2014-01-01

    Infection with Listeria monocytogenes is rare and mainly seen in immunosuppressed patients. Infection with L. monocytogenes has a mortality rate of 30%. We present a case report of L. monocytogenes bacteraemia and endocarditis in a 70-year-old man with several co-morbidities and following four...... major surgical procedures. This illustrates the findings and characteristics in one of the 16 patients who died in 2013 and 2014 this summer due to sausage-related L. monocytogenes infection....

  8. U.S. Food and Drug Administration's dioxin monitoring program

    Energy Technology Data Exchange (ETDEWEB)

    South, P.; S. Kathleen Egan; Troxell, T.; P. Michael Bolger [U.S. Food and Drug Administration, Center for Food Safety and Applied Nutrition, College Park (United States)

    2004-09-15

    Dioxin-like compounds (DLCs) are a group of environmental contaminants whose primary route of human exposure occurs via the consumption of fatty foods of animal origin. Recent safety risk assessments conducted by national and international organizations broadly agree that risk management actions should be developed to decrease DLC exposure. Since the mid-1990s, the U.S. Food and Drug Administration (FDA) has tested specific foods with the goal of describing and reducing DLC exposure. In 2001, FDA developed a strategy for DLCs (http://vm.cfsan.fda.gov/{proportional_to}lrd/dioxstra.html) and substantially expanded its dioxin monitoring program to obtain more comprehensive data on background levels of DLCs in specific food and feed samples as well as to identify and reduce pathways of DLC contamination. FDA's dioxin monitoring program analyzes food collected under its Total Diet Study (TDS) and food and feed from targeted sampling. The TDS is FDA's ongoing market basket survey of approximately 280 core foods in the U.S. food supply. FDA targeted sampling collects and analyzes foods suspected of having both higher DLC levels and more variability in those levels than other foods. The contribution of dietary DLCs to overall exposure and the possible introduction of DLCs in animalbased food via the use of particular feed components was recently identified by the National Academy of Sciences Committee on the Implications of Dioxin in the Food Supply and confirmed FDA's approach articulated in its dioxin strategy.

  9. Monitoring free radicals in γ-irradiated food

    International Nuclear Information System (INIS)

    Hunter, C.R.; Hutton, D.R.

    1988-01-01

    Irradiation of various food products, including vegetables, fruits, meats, seafoods, herbs, spices and seeds by appropriate doses by γ rays has for many years been suggested as a means of killing bacteria, viruses and pests and so preserving the foods. The position of food irradiation is under review in Australia through consumer organisations (Australian Consumers Association 1987) and by a current Federal Government inquiry. From these reviews and inquiries recommendations for irradiation, packaging, etc., are emerging, with for example, recommended maximum dose of 10 kGy for Australia, with 6 kGy being a minimum dose for grains and spices

  10. Intelligent Packaging Systems: Sensors and Nanosensors to Monitor Food Quality and Safety

    Directory of Open Access Journals (Sweden)

    Guillermo Fuertes

    2016-01-01

    Full Text Available The application of nanotechnology in different areas of food packaging is an emerging field that will grow rapidly in the coming years. Advances in food safety have yielded promising results leading to the development of intelligent packaging (IP. By these containers, it is possible to monitor and provide information of the condition of food, packaging, or the environment. This article describes the role of the different concepts of intelligent packaging. It is possible that this new technology could reach enhancing food safety, improving pathogen detection time, and controlling the quality of food and packaging throughout the supply chain.

  11. Design and development of food radioactivity contamination monitoring system

    International Nuclear Information System (INIS)

    Narayan, Pradeep; Vaijapurkar, S.G.; Bohra, Dinesh

    2014-01-01

    Radioactivity has been part and parcel of living being since the existence of the earth. It is available everywhere in our environment and being responsible for evolution of life on earth at some extent. However, the radioactivity in excess of the natural radioactive can have harmful effects on living being. The radiation exposure can be of external or internal origin or of both. The main route of internal radiation exposure is through the contaminated food chains. The concentration of natural radioactivity in food varies in range of 40-600 Bq/kg. 40 K being the single major radionuclide of food with typical radioactivity; 50 Bq/kg in milk, 420 Bq/kg in milk powder, 165 Bq/kg in potatoes, and 125 Bq/kg in beef is also the main contributor of natural radiation doses to human being. Measurement of radioactivity in food items and drinks is thus very important in controlling the internal exposure to human being especially in case of nuclear disaster. Though, the methods and techniques for food radioactivity measurement already existing, the need of portable instrument is warranted to measure the radioactivity in food items in raw form. Measurement of radioactivity may help in quick and mass screening of food items in case of nuclear emergencies. Any enhanced level of radioactivity in food items especially in case of nuclear emergency need to be evaluated for controlling its spread and restriction of consumption by the public. This way, it may help in managing internal radioactivity contamination to human being

  12. Salt Reductions in Some Foods in The Netherlands: Monitoring of Food Composition and Salt Intake.

    NARCIS (Netherlands)

    Temme, Elisabeth H M; Hendriksen, Marieke A H; Milder, Ivon E J; Toxopeus, Ido B; Westenbrink, Susanne; Brants, Henny A M; van der A, Daphne L

    2017-01-01

    High salt intake increases blood pressure and thereby the risk of chronic diseases. Food reformulation (or food product improvement) may lower the dietary intake of salt. This study describes the changes in salt contents of foods in the Dutch market over a five-year period (2011-2016) and

  13. An outbreak of an unusual strain of Listeria monocytogenes infection in North-East Scotland.

    Science.gov (United States)

    Okpo, Emmanuel; Leith, Jayne; Smith-Palmer, Alison; Bell, John; Parks, Duncan; Browning, Fiona; Byers, Lynn; Corrigan, Helen; Webster, Diana; Karcher, Anne M; Murray, Andrew; Storey, Tom

    2015-01-01

    Listeria monocytogenes infection is an important cause of illness and hospitalization in vulnerable individuals. In the present study, we describe a community outbreak of Listeria monocytogenes in the North-East region of Scotland, which was epidemiologically, environmentally and microbiologically linked to a local meat product and ready-to-eat product manufacturer. Infected individuals were interviewed, and an environmental investigation was conducted. Clinical and environmental samples were tested by culture, and isolates were typed by fluorescent amplified fragment length polymorphism (fAFLP). Three cases of Listeria monocytogenes were linked geographically, had the same serotype (1/2a) and were indistinguishable by fAFLP type XII.6. The human, food and environmental isolates were of the same serotype and were indistinguishable by molecular typing. This is the first community outbreak of L. monocytogenes reported in Scotland since the current outbreak surveillance was established in 1996. Epidemiological and laboratory evidence indicated poor hand hygiene, unhygienic practices and cross-contamination throughout the manufacturing process of ready-to-eat foods as a possible cause of the outbreak. More stringent control of commercial food establishments that provide ready-to-eat food and the need to advise specifically vulnerable groups, e.g., pregnant women, of the risk of L. monocytogenes in ready-to-eat food is urgently needed. Copyright © 2015 King Saud Bin Abdulaziz University for Health Sciences. Published by Elsevier Ltd. All rights reserved.

  14. Inhibitory Effect of Nisin on Listeria monocytogenes Inoculated into Surimi and Minced Meat

    Directory of Open Access Journals (Sweden)

    Masoud Rezaei

    2012-02-01

    Full Text Available Background & Objective: Listeria monocytogenes has already established as an important food born pathogen which induce listeriosis in human. Use of bacteriocins to provide food safety has been increased dramatically. Nisin has a wide spectrum inhibitory effect than the other bacteriocins and inhibits food-borne pathogens such as L. monocytogenes and many other Gram-positive spoilage microorganisms. The purpose of this study was to investigate the inhibitory effect of Nisin on population of Listeria monocytogenes and the role of changes in food components on the antilisterial properties of Nisin. Materials & Methods: The minced meat and surimi samples were inoculated by 1×104 cfu/g of L. monocytogenes. Then samples exposed to Nisin at the levels of 500 or 1000 IU/g were prepared. All treatments after packaging in plastic bags were kept for 12 days at refrigerator temperature. Samples were cultured on CHROMagarTM Listeria every 2 days and the number of listeria monocytogenes was counted. Results: two different concentrations of Nisin (500 or 1000 IU/g was not able to inhibit L. monocytogenes below the acceptable level for raw food (100 cells per g in minced meat and surimi of silver carp. But the number of bacteria reduces more in fish surimi as compared to the mince meal. Also, antilisterial activity of Nisin was reduced during the storage period. Conclusion: Inhibitory property of Nisin against L. monocytogenes in surimi significantly was higher than the minced (P<0.05. So it is possible the antilisterial properties of Nisin will increase by elimination of some enzymes during processing.

  15. Monitoring sodium levels in commercially processed and restaurant foods - dataset and webpages.

    Science.gov (United States)

    Nutrient Data Laboratory (NDL), Agriculture Research Service (ARS) in collaboration with Food Surveys Research Group, ARS, and the Centers for Disease Control and Prevention has been monitoring commercially processed and restaurant foods in the United States since 2010. About 125 highly consumed, s...

  16. Multivariate data analysis as a tool in advanced quality monitoring in the food production chain

    DEFF Research Database (Denmark)

    Bro, R.; van den Berg, F.; Thybo, A.

    2002-01-01

    This paper summarizes some recent advances in mathematical modeling of relevance in advanced quality monitoring in the food production chain. Using chemometrics-multivariate data analysis - it is illustrated how to tackle problems in food science more efficiently and, moreover, solve problems...

  17. Prevalence and contamination patterns of Listeria monocytogenes in catfish processing environment and fresh fillets.

    Science.gov (United States)

    Chen, Bang-Yuan; Pyla, Rajkumar; Kim, Tae-Jo; Silva, Juan L; Jung, Yean-Sung

    2010-08-01

    Catfish skins, intestines, fresh fillets, processing surfaces at different production stages, chiller water and non-food contact surfaces were sampled for Listeria monocytogenes and other Listeria species. Among 315 samples, prevalence of L. monocytogenes, Listeria innocua and a group of Listeria seeligeri-Listeria welshimeri-Listeria ivanovii was 21.6, 13.0 and 29.5%, respectively. No Listeria grayi was detected in this survey. While no L. monocytogenes strains were isolated from catfish skins and intestines, the strains were found with a frequency of 76.7% in chilled fresh catfish fillets and 43.3% in unchilled fillets. L. monocytogenes and Listeria spp. were also detected in fish contact surfaces such as deheading machine, trimming board, chiller water, conveyor belts at different stages, and fillet weighing table. Among L. monocytogenes, 1/2b (47.0%), 3b (16.0%) and 4c (14%) were the predominant serotypes isolated, whereas 4b, 4e, 1/2c and 1/2a were detected at much lower frequencies. Genotype analyses of L. monocytogenes isolates using serotyping, pulsed-field gel electrophoresis (PFGE) and enterobacterial repetitive intergenic consensus (ERIC)-PCR revealed that chiller water represented an important contamination source of L. monocytogenes in the chilled catfish fillets of two processing facilities, whereas fillet weighing table significantly contributed to the catfish fillet contamination of the third facility. This study suggests that L. monocytogenes contamination in the processed catfish fillets originates from the processing environment, rather than directly from catfish. Results from this study can aid the catfish industry to develop a plant-specific proper cleaning and sanitation procedure for equipment and the processing environment designed to specifically target L. monocytogenes contamination. Copyright 2010 Elsevier Ltd. All rights reserved.

  18. The application of the Appropriate Level of Protection (ALOP) and Food Safety Objective (FSO) concepts in food safety management, using Listeria monocytogenes in deli meats as a case study

    NARCIS (Netherlands)

    Gkogka, E.; Reij, M.W.; Gorris, L.G.M.; Zwietering, M.H.

    2013-01-01

    To establish a link between governmental food safety control and operational food safety management, the concepts of the Appropriate Level of Protection (ALOP) and the Food Safety Objective (FSO) have been suggested by international governmental bodies as a means for competent authorities to make

  19. Costing 'healthy' food baskets in Australia - a systematic review of food price and affordability monitoring tools, protocols and methods.

    Science.gov (United States)

    Lewis, Meron; Lee, Amanda

    2016-11-01

    To undertake a systematic review to determine similarities and differences in metrics and results between recently and/or currently used tools, protocols and methods for monitoring Australian healthy food prices and affordability. Electronic databases of peer-reviewed literature and online grey literature were systematically searched using the PRISMA approach for articles and reports relating to healthy food and diet price assessment tools, protocols, methods and results that utilised retail pricing. National, state, regional and local areas of Australia from 1995 to 2015. Assessment tools, protocols and methods to measure the price of 'healthy' foods and diets. The search identified fifty-nine discrete surveys of 'healthy' food pricing incorporating six major food pricing tools (those used in multiple areas and time periods) and five minor food pricing tools (those used in a single survey area or time period). Analysis demonstrated methodological differences regarding: included foods; reference households; use of availability and/or quality measures; household income sources; store sampling methods; data collection protocols; analysis methods; and results. 'Healthy' food price assessment methods used in Australia lack comparability across all metrics and most do not fully align with a 'healthy' diet as recommended by the current Australian Dietary Guidelines. None have been applied nationally. Assessment of the price, price differential and affordability of healthy (recommended) and current (unhealthy) diets would provide more robust and meaningful data to inform health and fiscal policy in Australia. The INFORMAS 'optimal' approach provides a potential framework for development of these methods.

  20. PRÉVALENCE DE LISTERIA MONOCYTOGENES DANS LE LAIT CRU DE VACHE AU LIBAN NORD

    Directory of Open Access Journals (Sweden)

    Imad al Kassaa

    2016-06-01

    Full Text Available Al Kassaa Imad, Khaled el Omari, Marwa Saati, Bachar Ismail and Monzer Hamze. 2016. Prevalence of Listeria monocytogenes in raw cow milk in north Lebanon. Lebanese Science Journal, 17(1: 39-45. Listeriosis, although a zoonosis, is an invasive disease that can affect newborns, pregnant women and immunocompromised adults. Clinical manifestations can be expressed by febrile gastroenteritis, invasive forms including severe sepsis, meningitis, rhombencephalitis, prenatal infections and abortions. Species of Listeria bacteria are ubiquitous and adaptable to the environment in animal and plant foods. This study aimed to determine the prevalence of Listeria monocytogenes in 100 samples of fresh cow milk collected from different areas of North Lebanon. Listeria monocytogenes was detected by using the Grand VIDAS technique (Biomérieux France. The results obtained revealed the absence of Listeria monocytogenes in all analyzed samples.

  1. Genotypic profile of Listeria monocytogenes isolated in refrigerated chickens in southern Rio Grande do Sul, Brazil

    Directory of Open Access Journals (Sweden)

    Karla Sequeira Mendonça

    2016-01-01

    Full Text Available ABSTRACT: Listeria monocytogenes is of notable concern to the food industry, due to its ubiquitous nature and ability to grow in adverse conditions. This study aimed to determine the genotypic profile of L. monocytogenes strains isolated from refrigerated chickens marketed in the southern part of Rio Grande do Sul, Brazil. The strains of L. monocytogenes isolated were characterized by serotyping and Pulsed Field Gel Electrophoresis (PFGE. Three different serotypes (1/2a, 1/2b and 4e were evaluated by PFGE, and the macrorestriction patterns utilizing enzymes AscI and ApaI, revealed five different pulsotypes. The presence of such varied genotypic profiles demonstrates the prevalence of L. monocytogenes contamination of chicken processing environments, which combined with ineffective cleaning procedures, allowing the survival, adaptation and proliferation of these pathogens, not only in the processing environment, but also in local grocery stores.

  2. Listeriolysin S: A bacteriocin from epidemic Listeria monocytogenes strains that targets the gut microbiota.

    Science.gov (United States)

    Quereda, Juan J; Meza-Torres, Jazmín; Cossart, Pascale; Pizarro-Cerdá, Javier

    2017-07-04

    Listeria monocytogenes is a Gram-positive food-borne pathogen that in humans may traverse the intestinal, placental and blood/brain barriers, causing gastroenteritis, abortions and meningitis. Crossing of these barriers is dependent on the bacterial ability to enter host cells, and several L. monocytogenes surface and secreted virulence factors are known to facilitate entry and the intracellular lifecycle. The study of L. monocytogenes strains associated to human listeriosis epidemics has revealed the presence of novel virulence factors. One such factor is Listeriolysin S, a thiazole/oxazole modified microcin that displays bactericidal activity and modifies the host microbiota during infection. Our recent results therefore highlight the interaction of L. monocytogenes with gut microbes as a crucial step in epidemic listeriosis. In this article, we will discuss novel implications for this family of toxins in the pathogenesis of diverse medically relevant microorganisms.

  3. Evaluation of a monoclonal antibody able to detect live Listeria monocytogenes and Listeria innocua

    DEFF Research Database (Denmark)

    Sølve, Marianne; Boel, Jeppe; Nørrung, Birgit

    2000-01-01

    A monoclonal Listeria antibody, designated B4, was evaluated. The ability of the antibody to bind to viable bacteria belonging to Listeria spp, compared to bacteria of the same species killed by beat treatment, acid or base treatment, sanitizers, and irradiation was examined. The antibody was found...... to react with viable L. monocytogenes and L. innocua, but not with heat-killed (72 degrees C, 5 min) strains of these organisms. When L. monocytogenes and L. innocua were killed by methods other than heat treatment, it was ambiguous whether the antibody detected the organism or not. It was concluded...... that the B4 antibody has potential to be used in an immune capture step to capture live L, monocytogenes and L. innocua from foods prior to identification of L. monocytogenes by polymerase chain reaction (PCR)....

  4. Listeria monocytogenes endophthalmitis following keratoconjunctivitis.

    Science.gov (United States)

    Shoughy, Samir S; Tabbara, Khalid F

    2014-01-01

    Endophthalmitis due to endogenous or exogenous bacteria is a rare infection of the eye. We report a case of endophthalmitis following Listeria monocytogenes keratoconjunctivitis in a 27-year-old healthy white male presenting with hand motion visual acuity, right eye mucopurulent conjunctivitis, elevated intraocular pressure, and pigmented hypopyon 6 months post-keratectomy. The conjunctivitis was unresponsive to a 5-day course of topical tobramycin eye drops, and the patient developed keratitis with pain that progressed to endophthalmitis after 21 days. Diagnostic B-scan revealed vitreous exudates. Intraocular fluid specimen showed Gram-positive organisms and the aqueous culture grew penicillin-/aminoglycoside-sensitive L. monocytogenes. The patient was given intravitreal and systemic vancomycin and ceftazidime. The eye was unresponsive to intravenous penicillin and gentamicin; the anterior chamber progressively flattened and developed phthisis bulbi. L. monocytogenes keratoconjunctivitis may lead to bacterial endophthalmitis. Prompt culture and early antibiotic therapy are recommended.

  5. Various Ready-to-Eat Products from Retail Stores Linked to Occurrence of Diverse Listeria monocytogenes and Listeria spp. Isolates.

    Science.gov (United States)

    Vongkamjan, Kitiya; Fuangpaiboon, Janejira; Turner, Matthew P; Vuddhakul, Varaporn

    2016-02-01

    Listeriosis outbreaks have been associated with a variety of foods. This study investigated the prevalence and diversity of Listeria monocytogenes and Listeria spp. in ready-to-eat (RTE) products and evaluated the performance of a rapid detection method, the 3M molecular detection assay for L. monocytogenes (MDA-LM), for detection of L. monocytogenes. Assay results were compared with those obtained using the U.S. Food and Drug Administration standard culture method described in the Bacteriological Analytical Manual. Products (n = 200) were purchased from retail stores: 122 aquatic products, 22 products of animal origin, 18 vegetarian products, 15 deli meat products, 13 salad and vegetable products, 4 desserts, 2 egg-based products, and 4 other products. L. monocytogenes prevalence was comparable with both methods. Overall, 15 (7.5%) of 200 samples were positive for L. monocytogenes: 3% of aquatic products, 1.5% of products of animal origin, 1% of vegetarian products, and 2% of deli meat products. Compared with the standard culture method, the sensitivity, specificity, and the accuracy of the MDA-LM were 86.7% (95% confidence interval, 58.4 to 97.7%), 98.4% (95% confidence interval, 95.0 to 99.6%), and 97.5%, respectively. Using the culture-based method, 18 (9%) of 200 samples were positive for Listeria species other than L. monocytogenes. Listeria isolates from these samples were classified into nine allelic types (ATs). The majority of isolates were classified as ATs 58 and 74, which were identified as L. monocytogenes lineages I and IV, respectively. Listeria innocua and Listeria welshimeri also were represented by isolates of multiple ATs. The MDA-LM is a rapid and reliable technique for detecting L. monocytogenes in various RTE foods. Further study is needed to develop effective control strategies to reduce L. monocytogenes contamination in RTE foods.

  6. Dual-species biofilm of Listeria monocytogenes and Escherichia coli on stainless steel surface.

    Science.gov (United States)

    de Grandi, Aline Zago; Pinto, Uelinton Manoel; Destro, Maria Teresa

    2018-04-12

    Listeria monocytogenes is a Gram-positive bacterium commonly associated with foodborne diseases. Due its ability to survive under adverse environmental conditions and to form biofilm, this bacterium is a major concern for the food industry, since it can compromise sanitation procedures and increase the risk of post-processing contamination. Little is known about the interaction between L. monocytogenes and Gram-negative bacteria on biofilm formation. Thus, in order to evaluate this interaction, Escherichia coli and L. monocytogenes were tested for their ability to form biofilms together or in monoculture. We also aimed to evaluate the ability of L. monocytogenes 1/2a and its isogenic mutant strain (ΔprfA ΔsigB) to form biofilm in the presence of E. coli. We assessed the importance of the virulence regulators, PrfA and σ B , in this process since they are involved in many aspects of L. monocytogenes pathogenicity. Biofilm formation was assessed using stainless steel AISI 304 #4 slides immersed into brain heart infusion broth, reconstituted powder milk and E. coli preconditioned medium at 25 °C. Our results indicated that a higher amount of biofilm was formed by the wild type strain of L. monocytogenes than by its isogenic mutant, indicating that prfA and sigB are important for biofilm development, especially maturation under our experimental conditions. The presence of E. coli or its metabolites in preconditioned medium did not influence biofilm formation by L. monocytogenes. Our results confirm the possibility of concomitant biofilm formation by L. monocytogenes and E. coli, two bacteria of major significance in the food industry.

  7. [Occurrence and typing of Listeria monocytogenes isolated from raw cow's milk collected on farms and from vending machines].

    Science.gov (United States)

    Gelbícová, T; Karpísková, R

    2012-04-01

    Evaluation of the incidence and characteristics of L. monocytogenes in samples of raw cow's milk collected on farms (bulk tank milk samples) and from vending machines. Detection of L. monocytogenes and enumeration were carried out according to EN/ISO 11290--1, 2. Strains were characterised by serotyping and macrorestriction analysis using pulsed-field gel electrophoresis. The presence of L. monocytogenes was detected in 3,2 % (11/346) of bulk tank milk samples and 1,8 % (4/219) samples of raw cow's milk from vending machines. Findings of L. monocytogenes in raw milk were sporadic. Only on one farm strains of L. monocytogenes were detected repeatedly. Thirteen strains of L. monocytogenes belonged to serotype 1/2a, two strains to serotype 1/2b and one to serotype 4b. Macrorestriction analysis revealed considerable heterogeinity of profiles, with nine different pulsotypes being detected. Pulsotype 711 was the most frequent. This pulsotype was found on three different farms. The incidence of L. monocytogenes in raw cow's milk is relatively low in the Czech Republic. The results confirmed that some clones of L. monocytogenes from raw milk are identical with food and human strains.

  8. Extracting additional risk managers information from a risk assessment of Listeria monocytogenes in deli meats

    NARCIS (Netherlands)

    Pérez-Rodríguez, F.; Asselt, van E.D.; García-Gimeno, R.M.; Zurera, G.; Zwietering, M.H.

    2007-01-01

    The risk assessment study of Listeria monocytogenes in ready-to-eat foods conducted by the U.S. Food and Drug Administration is an example of an extensive quantitative microbiological risk assessment that could be used by risk analysts and other scientists to obtain information and by managers and

  9. Morphological change and decreasing transfer rate of biofilm-featured Listeria monocytogenes EGDe

    Science.gov (United States)

    Listeria monocytogenes, a lethal foodborne pathogen, has the ability to resist the hostile food-processing environment and, thus, frequently contaminates ready-to-eat foods during processing. It is commonly accepted that L. monocytogenes’ tendency to generate biofilms on various surfaces enhances it...

  10. Analysing and modelling the growth behaviour of Listeria monocytogenes on RTE cooked meat products after a high pressure treatment at 400 MPa

    DEFF Research Database (Denmark)

    Hereu, A.; Dalgaard, Paw; Garriga, M.

    2014-01-01

    Various predictive models are available for high pressure inactivation of Listeria monocytogenes in food, but currently available models do not consider the growth kinetics of surviving cells during the subsequent storage of products. Therefore, we characterised the growth of L. monocytogenes in ...

  11. Listeria monocytogenes contamination in dairy plants: evaluation of Listeria monocytogenes environmental contamination in two cheese-making plants using sheeps milk

    Directory of Open Access Journals (Sweden)

    Michela Ibba

    2013-09-01

    Full Text Available Listeria monocytogenes harbouring niches established in the processing plant support post-process contamination of dairy products made from pasteurised or thermised milk. The present study investigated L. monocytogenes environmental contamination in two sheep’s milk cheese-making plants. Persistence of contamination in the area at higher risk was also investigated. During a one-year survey 7 samplings were carried out in each dairy plant, along the production lines of Pecorino Romano and ricotta salata cheese. A total of 613 environmental samples collected from food contact and non-food contact surfaces were analysed according to ISO 11290-1:2005 standard method. Identification of the isolated strains was carried out by polymerase chain reaction. L. monocytogenes prevalence was 23.2% in dairy A and 13.1% in dairy B, respectively. The higher prevalence rate was found in the following areas: salting, products washing, packaging, ricotta salata storage and Pecorino Romano ripening rooms. L. monocytogenes was never found in the cheese-making area. The probability of observing samples positive for the presence of L. monocytogenes was asso- ciated with dairy plant, sampling area and the period of cheese-making (P<0.001. The greater persistence of contamination over time was observed in the washing, salting, and Pecorino Romano ripening areas. The control of persistent environmental contamination relies on the identification of L. monocytogenes niches within the processing environment and the prevention of harborage sites formation. The importance of strict cleaning and sanitising procedure in controlling L. monocytogenes environmental contamination is confirmed by the lower level of contamination observed after these procedures were correctly implemented.

  12. Glycerol metabolism induces Listeria monocytogenes biofilm formation at the air-liquid interface.

    Science.gov (United States)

    Crespo Tapia, Natalia; den Besten, Heidy M W; Abee, Tjakko

    2018-05-20

    Listeria monocytogenes is a food-borne pathogen that can grow as a biofilm on surfaces. Biofilm formation in food-processing environments is a big concern for food safety, as it can cause product contamination through the food-processing line. Although motile aerobic bacteria have been described to form biofilms at the air-liquid interface of cell cultures, to our knowledge, this type of biofilm has not been described in L. monocytogenes before. In this study we report L. monocytogenes biofilm formation at the air-liquid interface of aerobically grown cultures, and that this phenotype is specifically induced when the media is supplemented with glycerol as a carbon and energy source. Planktonic growth, metabolic activity assays and HPLC measurements of glycerol consumption over time showed that glycerol utilization in L. monocytogenes is restricted to growth under aerobic conditions. Gene expression analysis showed that genes encoding the glycerol transporter GlpF, the glycerol kinase GlpK and the glycerol 3-phosphate dehydrogenase GlpD were upregulated in the presence of oxygen, and downregulated in absence of oxygen. Additionally, motility assays revealed the induction of aerotaxis in the presence of glycerol. Our results demonstrate that the formation of biofilms at the air-liquid interface is dependent on glycerol-induced aerotaxis towards the surface of the culture, where L. monocytogenes has access to higher concentrations of oxygen, and is therefore able to utilize this compound as a carbon source. Copyright © 2018 Elsevier B.V. All rights reserved.

  13. Monitoring of antimicrobial resistance among food animals: Principles and limitations

    DEFF Research Database (Denmark)

    Aarestrup, Frank Møller

    2004-01-01

    Large amounts of antimicrobial agents are in the production of food animals used for therapy and prophylactics of bacterial infections and in feed to promote growth. The use of antimicrobial agents causes problems in the therapy of infections through the selection for resistance among bacteria...... pathogenic for animals or humans. Current knowledge regarding the occurrence of antimicrobial resistance in food animals, the quantitative impact of the use of different antimicrobial agents on selection for resistance and the most appropriate treatment regimes to limit the development of resistance......, there are major differences between programmes designed to detect changes in a national population, individual herds or groups of animals. In addition, programmes have to be designed differently according to whether the aim is to determine changes in resistance for all antimicrobial agents or only...

  14. Listeria monocytogenes endophthalmitis following keratoconjunctivitis

    Directory of Open Access Journals (Sweden)

    Shoughy SS

    2014-01-01

    Full Text Available Samir S Shoughy,1 Khalid F Tabbara1–31The Eye Center and The Eye Foundation for Research in Ophthalmology, Riyadh, Saudi Arabia; 2Department of Ophthalmology, College of Medicine, King Saud University, Riyadh, Saudi Arabia; 3The Wilmer Ophthalmological Institute of The Johns Hopkins University School of Medicine, Baltimore, MD, USAAbstract: Endophthalmitis due to endogenous or exogenous bacteria is a rare infection of the eye. We report a case of endophthalmitis following Listeria monocytogenes keratoconjunctivitis in a 27-year-old healthy white male presenting with hand motion visual acuity, right eye mucopurulent conjunctivitis, elevated intraocular pressure, and pigmented hypopyon 6 months post-keratectomy. The conjunctivitis was unresponsive to a 5-day course of topical tobramycin eye drops, and the patient developed keratitis with pain that progressed to endophthalmitis after 21 days. Diagnostic B-scan revealed vitreous exudates. Intraocular fluid specimen showed Gram-positive organisms and the aqueous culture grew penicillin-/aminoglycoside-sensitive L. monocytogenes. The patient was given intravitreal and systemic vancomycin and ceftazidime. The eye was unresponsive to intravenous penicillin and gentamicin; the anterior chamber progressively flattened and developed phthisis bulbi. L. monocytogenes keratoconjunctivitis may lead to bacterial endophthalmitis. Prompt culture and early antibiotic therapy are recommended.Keywords: conjunctivitis, L. monocytogenes, endophthalmitis

  15. Listeria monocytogenes and Listeria spp. contamination patterns in retail delicatessen establishments in three U.S. states.

    Science.gov (United States)

    Simmons, Courtenay; Stasiewicz, Matthew J; Wright, Emily; Warchocki, Steven; Roof, Sherry; Kause, Janell R; Bauer, Nathan; Ibrahim, Salam; Wiedmann, Martin; Oliver, Haley F

    2014-11-01

    Postprocessing contamination in processing plants has historically been a significant source of Listeria monocytogenes in ready-to-eat delicatessen meats, and therefore a major cause of human listeriosis cases and outbreaks. Recent risk assessments suggest that a majority of human listeriosis cases linked to consumption of contaminated deli meats may be due to L. monocytogenes contamination that occurs at the retail level. To better understand the ecology and transmission of Listeria spp. in retail delicatessens, food and nonfood contact surfaces were tested for L. monocytogenes and other Listeria spp. in a longitudinal study conducted in 30 retail delis in three U.S. states. In phase I of the study, seven sponge samples were collected monthly for 3 months in 15 delis (5 delis per state) prior to start of daily operation; in phase II, 28 food contact and nonfood contact sites were sampled in each of 30 delis during daily operation for 6 months. Among the 314 samples collected during phase I, 6.8% were positive for L. monocytogenes. Among 4,503 samples collected during phase II, 9.5% were positive for L. monocytogenes; 9 of 30 delis showed low L. monocytogenes prevalence (Listeria spp. isolates, including 184 Listeria innocua, 48 Listeria seeligeri, and 13 Listeria welshimeri were characterized. Pulsed-field gel electrophoresis (PFGE) was used to characterize 446 L. monocytogenes isolates. PFGE showed that for 12 of 30 delis, one or more PFGE types were isolated on at least three separate occasions, providing evidence for persistence of a given L. monocytogenes subtype in the delis. For some delis, PFGE patterns for isolates from nonfood contact surfaces were distinct from patterns for occasional food contact surface isolates, suggesting limited cross-contamination between these sites in some delis. This study provides longitudinal data on L. monocytogenes contamination patterns in retail delis, which should facilitate further development of control strategies in

  16. Protocol to monitor trade agreement food-related aspects: the Fiji case study.

    Science.gov (United States)

    Ravuvu, Amerita; Friel, Sharon; Thow, Anne Marie; Snowdon, Wendy; Wate, Jillian

    2017-04-26

    Despite the growing rates of obesity and diet-related non-communicable diseases, globally, public health attention has only relatively recently turned to the links between trade agreements and the nutritional risks associated with it. Specific trade agreements appear to have played an influential role in the volume and types of foods entering different countries, yet there is currently no systematic and objective monitoring of trade agreements for their impacts on food environments. Recently, INFORMAS was set up to monitor and benchmark food environments, government policies and private sector actions within countries and globally. One of its projects/modules focuses on trade policy and in particular the food-related aspects of trade agreements. This paper describes the INFORMAS trade protocol, an approach to collecting food-related information about four domains of trade: trade in goods; trade in services and foreign direct investment; domestic supports, and policy space. Specifically, the protocol is tested in Fiji. The development and testing of this protocol in Fiji represents the first effort to set out a framework and process for objectively monitoring trade agreements and their impacts on national food supply and the wider food environment. It has shown that entry into WTO trade agreements contributed to the nutrition transition in Fiji through the increased availability of imported foods with varying nutritional quality. We observed an increase in imports of both healthy and less healthy foods. The application of the monitoring protocol also highlights challenges for data collection associated with each trade domain that should be considered for future data collection and analysis in other low and middle income countries. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  17. Recent Advances in Mycotoxin Determination for Food Monitoring via Microchip

    Directory of Open Access Journals (Sweden)

    Yan Man

    2017-10-01

    Full Text Available Mycotoxins are one of the main factors impacting food safety. Mycotoxin contamination has threatened the health of humans and animals. Conventional methods for the detection of mycotoxins are gas chromatography (GC or liquid chromatography (LC coupled with mass spectrometry (MS, or enzyme-linked immunosorbent assay (ELISA. However, all these methods are time-consuming, require large-scale instruments and skilled technicians, and consume large amounts of hazardous regents and solvents. Interestingly, a microchip requires less sample consumption and short analysis time, and can realize the integration, miniaturization, and high-throughput detection of the samples. Hence, the application of a microchip for the detection of mycotoxins can make up for the deficiency of the conventional detection methods. This review focuses on the application of a microchip to detect mycotoxins in foods. The toxicities of mycotoxins and the materials of the microchip are firstly summarized in turn. Then the application of a microchip that integrates various kinds of detection methods (optical, electrochemical, photo-electrochemical, and label-free detection to detect mycotoxins is reviewed in detail. Finally, challenges and future research directions in the development of a microchip to detect mycotoxins are previewed.

  18. Communication techniques and challenges for wireless food quality monitoring.

    Science.gov (United States)

    Jedermann, Reiner; Pötsch, Thomas; Lloyd, Chanaka

    2014-06-13

    Remote measurement of product core temperature is an important prerequisite to improve the cool chain of food products and reduce losses. This paper examines and shows possible solutions to technical challenges that still hinder practical applications of wireless sensor networks in the field of food transport supervision. The high signal attenuation by water-containing products limits the communication range to less than 0.5 m for the commonly used 2.4 GHz radio chips. By theoretical analysis of the dependency of signal attenuation on the operating frequency, we show that the signal attenuation can be largely reduced by the use of 433 MHz or 866 MHz devices, but forwarding of messages over multiple hops inside a sensor network is mostly unavoidable to guarantee full coverage of a packed container. Communication protocols have to provide compatibility with widely accepted standards for integration into the global Internet, which has been achieved by programming an implementation of the constrained application protocol for wireless sensor nodes and integrating into IPv6-based networks. The sensor's battery lifetime can be extended by optimizing communication protocols and by in-network pre-processing of the sensor data. The feasibility of remote freight supervision was demonstrated by our full-scale 'Intelligent Container' prototype.

  19. Commodity Tracker: Mobile Application for Food Security Monitoring in Haiti

    Science.gov (United States)

    Chiu, M. T.; Huang, X.; Baird, J.; Gourley, J. R.; Morelli, R.; de Lanerolle, T. R.; Haiti Food Security Monitoring Mobile App Team

    2011-12-01

    Megan Chiu, Jason Baird, Xu Huang, Trishan de Lanerolle, Ralph Morelli, Jonathan Gourley Trinity College, Computer Science Department and Environmental Science Program, 300 Summit Street, Hartford, CT 06106 megan.chiu@trincoll.edu, Jason.baird@trincoll.edu, xu.huang@trincoll.edu, trishan.delanerolle@trincoll.edu, ralph.morelli@trincoll.edu, jonathan.gourley@trincoll.edu Price data for Haiti commodities such as rice and potatoes have been traditionally recorded by hand on paper forms for many years. The information is then entered onto computer manually, thus making the process a long and arduous one. With the development of the Haiti Commodity Tracker mobile app, we are able to make this commodity price data recording process more efficient. Officials may use this information for making inferences about the difference in commodity prices and for food distribution during critical time after natural disasters. This information can also be utilized by governments and aid agencies on their food assistance programs. Agronomists record the item prices from several sample sites in a marketplace and compare those results from other markets across the region. Due to limited connectivity in rural areas, data is first saved to the phone's database and then retransmitted to a central server via SMS messaging. The mobile app is currently being field tested by an international NGO providing agricultural aid and support in rural Haiti.

  20. Prevalence of Listeria monocytogenes in raw bovine milk and milk products from central highlands of Ethiopia.

    Science.gov (United States)

    Seyoum, Eyasu Tigabu; Woldetsadik, Daniel Asrat; Mekonen, Tesfu Kassa; Gezahegn, Haile Alemayehu; Gebreyes, Wondwossen Abebe

    2015-11-30

    Listeria monocytogenes is of major significance in human and veterinary medicine. Most human Listeria infections are foodborne and the association of contaminated milk and dairy produce consumption with human listeriosis is noteworthy. In Ethiopia, there is limited data regarding the prevalence of L. monocytogenes in raw bovine milk and dairy products. The aim of this study was, therefore, to determine the prevalence of L. monocytogenes in raw bovine milk and dairy produce. A total of 443 milk and milk product samples were microbiologically analyzed following methods recommended by the U.S. Food and Drug Administration Bacteriological Analytical Manual to isolate Listeria spp. The overall prevalence of Listeria spp. was 28.4% and specifically that of L. monocytogenes was 5.6%. Taking the prevalence of Listeria spp. into consideration, cheese was found to be highly contaminated at 60%, followed by pasteurized milk samples (40%), raw milk (18.9%) and yoghurt (5%). Considering the prevalence of Listeria monocytogenes only, raw milk had the lowest contamination while cheese had the highest, followed by pasteurized milk and yoghurt. Raw milk and milk products produced in urban and peri-urban areas of central Ethiopia were contaminated with pathogenic bacteria, L. monocytogenes. The detection of this pathogen in raw milk and milk products warrants an urgent regulatory mechanism to be put in place and also the potential role of milk processing plants in the contamination of dairy products should be investigated.

  1. Phenotypic and Genotypic Characteristics of Listeria monocytogenes Isolated From Dairy and Meat Products

    Directory of Open Access Journals (Sweden)

    Bahador

    2015-08-01

    Full Text Available Background Listeria monocytogenes is a foodborne pathogen and a serious threat to the public health in the world. Consumption of traditional foods such as dairy and meat products can be a major reason for relative abundance and isolation of these bacteria. Objectives The purpose of this study was to determine the phenotypic and genotypic characteristics of L. monocytogenes strains isolated from dairy and meat products. Materials and Methods A total of 317 dairy products and meat-processed samples were collected. Antibiotic susceptibility test was performed on each sample by the disk diffusion method (Kirby Bauer. Five reference loci were used for typing of L. monocytogenes strains by MLVA (Multiple Locus VNTR Analysis Technique. Results A total of 24 L. monocytogenes isolates were collected from the dairy and meat products. Resistance of isolated L. monocytogenes strains to penicillin G were 54.54% (from dairy products and 46.15% (from processed meat. Genetic relatedness of isolates were assessed by MLVA. Out of 13 different types, type 2 with 6 strains and type 3 with 4 strains, were the most common types. Conclusions MLVA analysis showed that samples obtained from different sources could have similar genetic profile. As a result, administration of penicillin in patients with listeriosis (especially pregnant women and antibiotic susceptibility test are recommended. The fast and accurate methods such as MLVA for tracking of pollution sources of L. monocytogenes are recommended during outbreaks.

  2. Stochastic modelling of Listeria monocytogenes single cell growth in cottage cheese with mesophilic lactic acid bacteria from aroma producing cultures

    DEFF Research Database (Denmark)

    Østergaard, Nina Bjerre; Christiansen, Lasse Engbo; Dalgaard, Paw

    2015-01-01

    . 2014. Modelling the effect of lactic acid bacteria from starter- and aroma culture on growth of Listeria monocytogenes in cottage cheese. International Journal of Food Microbiology. 188, 15-25]. Growth of L. monocytogenes single cells, using lag time distributions corresponding to three different......A stochastic model was developed for simultaneous growth of low numbers of Listeria monocytogenes and populations of lactic acid bacteria from the aroma producing cultures applied in cottage cheese. During more than two years, different batches of cottage cheese with aroma culture were analysed...

  3. The challenge of setting risk-based microbiological criteria for Listeria monocytogenes

    DEFF Research Database (Denmark)

    Andersen, Jens Kirk; Nørrung, Birgit

    2011-01-01

    After more than 20 years of work with discussing the setting of microbiological criteria for Listeria monocytogenes in foods, Codex Alimentarius on Food Hygiene has finalised a proposal that was recently adopted by the Codex Alimentarius Commission. The effort of developing procedures for making...... the microbiological criteria risk-based to the greatest extent possible has challenged scientists and managers during this long time period. Yet, the establishment of microbiological criteria for L. monocytogenes is still being discussed and several approaches are possible. Setting of microbiological criteria...

  4. Sporadic case of listeriosis associated with the consumption of a Listeria monocytogenes-contaminated 'Camembert' cheese.

    Science.gov (United States)

    Gilot, P; Hermans, C; Yde, M; Gigi, J; Janssens, M; Genicot, A; André, P; Wauters, G

    1997-09-01

    Listeria monocytogenes is an intracellular gram-positive organism responsible for severe infections in both humans and animals. Whereas the food-borne transmission of listeriosis was demonstrated in several outbreaks, most cases of listeriosis occur sporadically and are rarely linked with consumption of contaminated foods. In this paper a case of septicaemia with L. monocytogenes in a 73-year-old immunocompromised man is described. Evidence for the association of this case of listeriosis with the consumption of a contaminated 'Camembert' cheese is provided by serotyping, esterase typing, DNA macrorestriction patterns analysis and level of virulence of the isolated strains for mice.

  5. Incidence of Listeria monocytogenes and Listeria spp. in a small-scale mushroom production facility.

    Science.gov (United States)

    Viswanath, Prema; Murugesan, Latha; Knabel, Stephen J; Verghese, Bindhu; Chikthimmah, Naveen; Laborde, Luke F

    2013-04-01

    Listeria monocytogenes is a foodborne pathogen of significant concern to the agricultural and food processing industry because of its ability to grow and persist in cool and moist environments and its association with listeriosis, a disease with a very high mortality rate. Although there have been no listeriosis outbreaks attributed to fresh mushrooms in the United States, retail surveys and recalls are evidence that L. monocytogenes contamination of mushrooms (Agaricus bisporus) can occur. The objective of this study was to determine the prevalence of Listeria spp., including L. monocytogenes, in a small-scale mushroom production facility on the campus of the Pennsylvania State University in the United States. Of 184 samples taken from five production zones within the facility, 29 (15.8%) samples were positive for Listeria spp. Among the Listeria spp. isolates, L. innocua was most prevalent (10.3%) followed by L. welshimeri (3.3%), L. monocytogenes (1.6%), and L. grayi (0.5%). L. monocytogenes was recovered only from the phase I raw material composting area. Isolates of L. monocytogenes were confirmed and serotyped by multiplex PCR. The epidemiological relatedness of the three L. monocytogenes isolates to those serotypes or lineages frequently encountered in listeriosis infections was determined by multi-virulence-locus sequence typing using six virulence genes, namely, prfA, inlB, inlC, dal, clpP, and lisR. The phylogenetic positions of the three isolates in the dendrogram prepared with data from other isolates of L. monocytogenes showed that all isolates were grouped with serotype 4a, lineage IIIA. To date, this serotype has rarely been reported in foodborne disease outbreaks.

  6. Control of Listeria monocytogenes in turkey deli loaves using organic acids as formulation ingredients.

    Science.gov (United States)

    Lloyd, T; Alvarado, C Z; Brashears, M M; Thompson, L D; McKee, S R; Berrang, M

    2009-10-01

    The growth of Listeria monocytogenes in further-processed meat products has become a major concern and an important food safety issue. The meat and poultry industries have incorporated interventions such as organic acids in marinades to inhibit the growth of L. monocytogenes. In this study, organic acids were utilized in the raw product and as a postcook dip to determine their inhibitory effect on the growth of L. monocytogenes in turkey deli loaves. The turkey deli loaves were processed, cooked, cooled, inoculated with streptomycin-resistant L. monocytogenes, and then dipped. Treatments were potassium lactate (PL) in the raw product with sodium lactate (SL), sodium diacetate (SD) dip, PL with SL/PL/SD dip, SL with SL/SD dip, and SL with SL/PL/SD dip. There was also a positive (inoculated) and negative (noninoculated) control, which was dipped in distilled water. Days 0, 7, 14, 21, 28, 42, and 56 were sampled for L. monocytogenes. There were no differences (P>0.05) among the organic acid treatments in the turkey deli loaves at any time points; therefore, all of the treatments increased the lag phase of L. monocytogenes, extending the shelf-life of the product. However, there was a difference between the treatments and the positive control at d 7, 14, 21, 28, 42, and 56. The growth of L. monocytogenes increased immediately in the positive control, whereas the negative control appeared to have no growth. These organic acids can provide meat processors with a useful method for extending the lag phase of L. monocytogenes in ready-to-eat meat and poultry products.

  7. Uncovering Listeria monocytogenes hypervirulence by harnessing its biodiversity

    Science.gov (United States)

    Charlier, Caroline; Touchon, Marie; Chenal-Francisque, Viviane; Leclercq, Alexandre; Criscuolo, Alexis; Gaultier, Charlotte; Roussel, Sophie; Brisabois, Anne; Disson, Olivier; Rocha, Eduardo P. C.; Brisse, Sylvain; Lecuit, Marc

    2016-01-01

    Microbial pathogenesis studies are typically performed with reference strains, thereby overlooking microbial intra-species virulence heterogeneity. Here we integrated human epidemiological and clinical data with bacterial population genomics to harness the biodiversity of the model foodborne pathogen Listeria monocytogenes and decipher the basis of its neural and placental tropisms. Taking advantage of the clonal structure of this bacterial species, we identify clones epidemiologically associated with either food or human central nervous system (CNS) and maternal-neonatal (MN) listeriosis. The latter are also most prevalent in patients without immunosuppressive comorbidities. Strikingly, CNS and MN clones are hypervirulent in a humanized mouse model of listeriosis. By integrating epidemiological data and comparative genomics, we uncovered multiple novel putative virulence factors and demonstrated experimentally the contribution of the first gene cluster mediating Listeria monocytogenes neural and placental tropisms. This study illustrates the exceptional power of harnessing microbial biodiversity to identify clinically relevant microbial virulence attributes. PMID:26829754

  8. Image Analysis-Based Food Recognition and Volume Estimation for Diet Monitoring

    OpenAIRE

    Hassannejadh, Hamid

    2017-01-01

    Food intake and eating habits have a significant impact on people's health. Widespread diseases, such as diabetes and obesity, are directly related to eating habits. Therefore, monitoring diet can be an effective way of promoting the adoption of a healthy lifestyle and of improving personal and national health economy. Studies have demonstrated that manual reporting of food intake is inaccurate and often impractical. Thus, several methods have been proposed to automate the process. This thesi...

  9. Salt Reductions in Some Foods in The Netherlands: Monitoring of Food Composition and Salt Intake.

    Science.gov (United States)

    Temme, Elisabeth H M; Hendriksen, Marieke A H; Milder, Ivon E J; Toxopeus, Ido B; Westenbrink, Susanne; Brants, Henny A M; van der A, Daphne L

    2017-07-22

    High salt intake increases blood pressure and thereby the risk of chronic diseases. Food reformulation (or food product improvement) may lower the dietary intake of salt. This study describes the changes in salt contents of foods in the Dutch market over a five-year period (2011-2016) and differences in estimated salt intake over a 10-year period (2006-2015). To assess the salt contents of foods; we obtained recent data from chemical analyses and from food labels. Salt content of these foods in 2016 was compared to salt contents in the 2011 version Dutch Food Composition Database (NEVO, version 2011), and statistically tested with General Linear Models. To estimate the daily dietary salt intake in 2006, 2010, and 2015, men and women aged 19 to 70 years were recruited through random population sampling in Doetinchem, a small town located in a rural area in the eastern part of the Netherlands. The characteristics of the study population were in 2006: n = 317, mean age 49 years, 43% men, in 2010: n = 342, mean age 46 years, 45% men, and in 2015: n = 289, mean age 46 years, 47% men. Sodium and potassium excretion was measured in a single 24-h urine sample. All estimates were converted to a common metric: salt intake in grams per day by multiplication of sodium with a factor of 2.54. In 2016 compared to 2011, the salt content in certain types of bread was on average 19 percent lower and certain types of sauce, soup, canned vegetables and legumes, and crisps had a 12 to 26 percent lower salt content. Salt content in other types of foods had not changed significantly. Between 2006, 2010 and 2015 the estimated salt intake among adults in Doetinchem remained unchanged. In 2015, the median estimated salt intake was 9.7 g per day for men and 7.4 g per day for women. As in 2006 and 2010, the estimated salt intake in 2015 exceeded the recommended maximum intake of 6 g per day set by the Dutch Health Council. In the Netherlands, the salt content of bread, certain sauces, soups

  10. Salt Reductions in Some Foods in The Netherlands: Monitoring of Food Composition and Salt Intake

    Directory of Open Access Journals (Sweden)

    Elisabeth H. M. Temme

    2017-07-01

    Full Text Available Background and objectives. High salt intake increases blood pressure and thereby the risk of chronic diseases. Food reformulation (or food product improvement may lower the dietary intake of salt. This study describes the changes in salt contents of foods in the Dutch market over a five-year period (2011–2016 and differences in estimated salt intake over a 10-year period (2006–2015. Methods. To assess the salt contents of foods; we obtained recent data from chemical analyses and from food labels. Salt content of these foods in 2016 was compared to salt contents in the 2011 version Dutch Food Composition Database (NEVO, version 2011, and statistically tested with General Linear Models. To estimate the daily dietary salt intake in 2006, 2010, and 2015, men and women aged 19 to 70 years were recruited through random population sampling in Doetinchem, a small town located in a rural area in the eastern part of the Netherlands. The characteristics of the study population were in 2006: n = 317, mean age 49 years, 43% men, in 2010: n = 342, mean age 46 years, 45% men, and in 2015: n = 289, mean age 46 years, 47% men. Sodium and potassium excretion was measured in a single 24-h urine sample. All estimates were converted to a common metric: salt intake in grams per day by multiplication of sodium with a factor of 2.54. Results. In 2016 compared to 2011, the salt content in certain types of bread was on average 19 percent lower and certain types of sauce, soup, canned vegetables and legumes, and crisps had a 12 to 26 percent lower salt content. Salt content in other types of foods had not changed significantly. Between 2006, 2010 and 2015 the estimated salt intake among adults in Doetinchem remained unchanged. In 2015, the median estimated salt intake was 9.7 g per day for men and 7.4 g per day for women. As in 2006 and 2010, the estimated salt intake in 2015 exceeded the recommended maximum intake of 6 g per day set by the Dutch Health Council

  11. Monitoring the availability of healthy and unhealthy foods and non-alcoholic beverages in community and consumer retail food environments globally.

    Science.gov (United States)

    Ni Mhurchu, C; Vandevijvere, S; Waterlander, W; Thornton, L E; Kelly, B; Cameron, A J; Snowdon, W; Swinburn, B

    2013-10-01

    Retail food environments are increasingly considered influential in determining dietary behaviours and health outcomes. We reviewed the available evidence on associations between community (type, availability and accessibility of food outlets) and consumer (product availability, prices, promotions and nutritional quality within stores) food environments and dietary outcomes in order to develop an evidence-based framework for monitoring the availability of healthy and unhealthy foods and non-alcoholic beverages in retail food environments. Current evidence is suggestive of an association between community and consumer food environments and dietary outcomes; however, substantial heterogeneity in study designs, methods and measurement tools makes it difficult to draw firm conclusions. The use of standardized tools to monitor local food environments within and across countries may help to validate this relationship. We propose a step-wise framework to monitor and benchmark community and consumer retail food environments that can be used to assess density of healthy and unhealthy food outlets; measure proximity of healthy and unhealthy food outlets to homes/schools; evaluate availability of healthy and unhealthy foods in-store; compare food environments over time and between regions and countries; evaluate compliance with local policies, guidelines or voluntary codes of practice; and determine the impact of changes to retail food environments on health outcomes, such as obesity. © 2013 The Authors. Obesity Reviews published by John Wiley & Sons Ltd on behalf of the International Association for the Study of Obesity.

  12. A putative ABC transporter is involved in negative regulation of biofilm formation by Listeria monocytogenes

    DEFF Research Database (Denmark)

    Zhu, Xinna; Long, Fei; Chen, Yonghui

    2008-01-01

    Listeria monocytogenes may persist for long periods in food processing environments. In some instances, this may be due to aggregation or biofilm formation. To investigate the mechanism controlling biofilm formation in the food-borne pathogen L. monocytogenes, we characterized LM-49, a mutant...... with enhanced ability of biofilm-formation generated via transposon Tn917 mutagenesis of L. monocytogenes 4b G. In this mutant, a Tn917 insertion has disrupted the coding region of the gene encoding a putative ATP binding cassette (ABC) transporter permease identical to Lmof2365_1771 (a putative ABC...... the same amount of biofilm biomass as the wild-type strain. Furthermore, transcription of the downstream lm.G_1770 was not influenced by the upstream Tn917 insertion, and the presence of Tn917 has no effect on biofilm formation. These results suggest that lm.G_1771 was solely responsible for the negative...

  13. Performance of Isfahan North Wastewater Treatment Plant in the Removal of Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    nahid Navijouy

    2013-08-01

    Full Text Available Listeria and in particular Listeria monocytogenes is considered a ubiquitous foodborne pathogen which can lead listeriosis in human and animals. Listeriosis can be serious and may cause meningitis, septicemia and abortion in pregnant women. Although wastewater or sludge may contaminate foods of plant origin, there are no data on occurrence of Listeria spp. in wastewater and sludge in Iran. The purpose of current investigation was to study the occurrence of Listeria spp. in various samples of wastewater and sludge in Isfahan North wastewater treatment plant. Influent, effluent, raw sludge and dried sludge samples were collected from Isfahan North municipal wastewater treatment plant. L. monocytogenes were enumerated by a three–tube most probable number (MPN assay using enrichment Fraser broth. A total of 65 various samples from five step in 13 visits were collected. The presence of Listeria spp. also was determined using USDA procedure. Then, phenotypically identified L. monocytogenes were further confirmed by Polymerase Chain Reaction amplification. L. monocytogenes isolated from 76.9%, 38.5%, 84.6%, 69.2% and 46.2% of influent, effluent, raw sludge, stabilized sludge and dried sludge respectively. The efficiency of wastewater treatment processes, digester tank and drying bed in removal L. monocytogenes were 69.6%, 64.7% and 73.4% respectively. All phenotypically identified L. monocytogenes were further confirmed by Polymerase Chain Reaction. The results of present study have shown that Listeriaspp. and L. monocytogenes in particular, were present in wastewater treatment plant effluents and sludge at high level. The bacteria may spread on agriculture land and contaminate foods of plant origin. This may cause a risk of spreading disease to human and animals.

  14. Monitoring Global Food Security with New Remote Sensing Products and Tools

    Science.gov (United States)

    Budde, M. E.; Rowland, J.; Senay, G. B.; Funk, C. C.; Husak, G. J.; Magadzire, T.; Verdin, J. P.

    2012-12-01

    Global agriculture monitoring is a crucial aspect of monitoring food security in the developing world. The Famine Early Warning Systems Network (FEWS NET) has a long history of using remote sensing and crop modeling to address food security threats in the form of drought, floods, pests, and climate change. In recent years, it has become apparent that FEWS NET requires the ability to apply monitoring and modeling frameworks at a global scale to assess potential impacts of foreign production and markets on food security at regional, national, and local levels. Scientists at the U.S. Geological Survey (USGS) Earth Resources Observation and Science (EROS) Center and the University of California Santa Barbara (UCSB) Climate Hazards Group have provided new and improved data products as well as visualization and analysis tools in support of the increased mandate for remote monitoring. We present our monitoring products for measuring actual evapotranspiration (ETa), normalized difference vegetation index (NDVI) in a near-real-time mode, and satellite-based rainfall estimates and derivatives. USGS FEWS NET has implemented a Simplified Surface Energy Balance (SSEB) model to produce operational ETa anomalies for Africa and Central Asia. During the growing season, ETa anomalies express surplus or deficit crop water use, which is directly related to crop condition and biomass. We present current operational products and provide supporting validation of the SSEB model. The expedited Moderate Resolution Imaging Spectroradiometer (eMODIS) production system provides FEWS NET with an improved NDVI dataset for crop and rangeland monitoring. eMODIS NDVI provides a reliable data stream with a relatively high spatial resolution (250-m) and short latency period (less than 12 hours) which allows for better operational vegetation monitoring. We provide an overview of these data and cite specific applications for crop monitoring. FEWS NET uses satellite rainfall estimates as inputs for

  15. The Ontario Food and Nutrition Strategy: identifying indicators of food access and food literacy for early monitoring of the food environment

    OpenAIRE

    Beatrice A. Boucher; Elizabeth Manafò; Meaghan R. Boddy; Lynn Roblin; Rebecca Truscott

    2017-01-01

    Introduction: To address challenges Canadians face within their food environments, a comprehensive, multistakeholder, intergovernmental approach to policy development is essential. Food environment indicators are needed to assess population status and change. The Ontario Food and Nutrition Strategy (OFNS) integrates the food, agriculture and nutrition sectors, and aims to improve the health of Ontarians through actions that promote healthy food systems and environments. This report describes ...

  16. Monitoring the Affordability of Healthy Eating: A Case Study of 10 Years of the Illawarra Healthy Food Basket

    OpenAIRE

    Williams, Peter

    2010-01-01

    Healthy food baskets have been used around the world for a variety of purposes, including: examining the difference in cost between healthy and unhealthy food; mapping the availability of healthy foods in different locations; calculating the minimum cost of an adequate diet for social policy planning; developing educational material on low cost eating and examining trends on food costs over time. In Australia, the Illawarra Healthy Food Basket was developed in 2000 to monitor trends in the af...

  17. Post Launch Monitoring of food products : what can be learned from pharmacovigilance

    NARCIS (Netherlands)

    van Puijenbroek, E P; Hepburn, P A; Herd, T M; van Grootheest, A C

    Post Launch Monitoring (PLM) is one of the new approaches that are used in assessing the safety of novel foods or ingredients. It shares a close resemblance with procedures applied in the field of medicines, where Post Marketing Surveillance (PMS) has been carried out since the beginning of the

  18. Building the case for independent monitoring of food advertising on Australian television.

    Science.gov (United States)

    King, Lesley; Hebden, Lana; Grunseit, Anne; Kelly, Bridget; Chapman, Kathy

    2013-12-01

    To provide an independent monitoring report examining the ongoing impact of Australian self-regulatory pledges on food and drink advertising to children on commercial television. Analysis of food advertisements across comparable sample time periods in April/May 2006, 2007, 2009, 2010 and 2011. The main outcome measure comprised change in the mean rate of non-core food advertisements from 2006 to 2011. Sydney free-to-air television channels. Televised food advertisements. In 2011 the rate of non-core food advertisements was not significantly different from that in 2006 or 2010 (3·2/h v. 4·1/h and 3·1/h), although there were variations across the intervening years. The rate of fast-food advertising in 2010 was significantly higher than in 2006 (1·8/h v. 1·1/h, P advertising on Sydney television has remained essentially unchanged between 2006 and 2011, despite the implementation of two industry self-regulatory pledges. The current study illustrates the value of independent monitoring as a basic requirement of any responsive regulatory approach.

  19. Real-time PCR detection of Listeria monocytogenes in infant formula and lettuce following macrophage-based isolation and enrichment.

    Science.gov (United States)

    Day, J B; Basavanna, U

    2015-01-01

    To develop a rapid detection procedure for Listeria monocytogenes in infant formula and lettuce using a macrophage-based enrichment protocol and real-time PCR. A macrophage cell culture system was employed for the isolation and enrichment of L. monocytogenes from infant formula and lettuce for subsequent identification using real-time PCR. Macrophage monolayers were exposed to infant formula and lettuce contaminated with a serial dilution series of L. monocytogenes. As few as approx. 10 CFU ml(-1) or g(-1) of L. monocytogenes were detected in infant formula and lettuce after 16 h postinfection by real-time PCR. Internal positive PCR controls were utilized to eliminate the possibility of false-negative results. Co-inoculation with Listeria innocua did not reduce the L. monocytogenes detection sensitivity. Intracellular L. monocytogenes could also be isolated on Listeria selective media from infected macrophage lysates for subsequent confirmation. The detection method is highly sensitive and specific for L. monocytogenes in infant formula and lettuce and establishes a rapid identification time of 20 and 48 h for presumptive and confirmatory identification, respectively. The method is a promising alternative to many currently used q-PCR detection methods which employ traditional selective media for enrichment of contaminated food samples. Macrophage enrichment of L. monocytogenes eliminates PCR inhibitory food elements and contaminating food microflora which produce cleaner samples that increase the rapidity and sensitivity of detection. Published 2014. This article is a U.S. Government work and is in the public domain in the USA.

  20. Characterizing uncertainty when evaluating risk management metrics: risk assessment modeling of Listeria monocytogenes contamination in ready-to-eat deli meats.

    Science.gov (United States)

    Gallagher, Daniel; Ebel, Eric D; Gallagher, Owen; Labarre, David; Williams, Michael S; Golden, Neal J; Pouillot, Régis; Dearfield, Kerry L; Kause, Janell

    2013-04-01

    This report illustrates how the uncertainty about food safety metrics may influence the selection of a performance objective (PO). To accomplish this goal, we developed a model concerning Listeria monocytogenes in ready-to-eat (RTE) deli meats. This application used a second order Monte Carlo model that simulates L. monocytogenes concentrations through a series of steps: the food-processing establishment, transport, retail, the consumer's home and consumption. The model accounted for growth inhibitor use, retail cross contamination, and applied an FAO/WHO dose response model for evaluating the probability of illness. An appropriate level of protection (ALOP) risk metric was selected as the average risk of illness per serving across all consumed servings-per-annum and the model was used to solve for the corresponding performance objective (PO) risk metric as the maximum allowable L. monocytogenes concentration (cfu/g) at the processing establishment where regulatory monitoring would occur. Given uncertainty about model inputs, an uncertainty distribution of the PO was estimated. Additionally, we considered how RTE deli meats contaminated at levels above the PO would be handled by the industry using three alternative approaches. Points on the PO distribution represent the probability that - if the industry complies with a particular PO - the resulting risk-per-serving is less than or equal to the target ALOP. For example, assuming (1) a target ALOP of -6.41 log10 risk of illness per serving, (2) industry concentrations above the PO that are re-distributed throughout the remaining concentration distribution and (3) no dose response uncertainty, establishment PO's of -4.98 and -4.39 log10 cfu/g would be required for 90% and 75% confidence that the target ALOP is met, respectively. The PO concentrations from this example scenario are more stringent than the current typical monitoring level of an absence in 25 g (i.e., -1.40 log10 cfu/g) or a stricter criteria of absence

  1. Evaluation Model of Plate Waste to Monitor Food Consumption in Two Different Catering Settings.

    Science.gov (United States)

    Saccares, Stefano; Scognamiglio, Umberto; Moroni, Catia; Marani, Alessandra; Calcaterra, Veronica; Amendola, Mariano; Civitelli, Giulia; Cattaruzza, Maria Sofia; Ermenegildi, Arianna; Morena, Valeria

    2014-04-17

    An increasing number of people regularly eats lunch away from home, using catering services. In this context, therefore, it is extremely important to improve the meals' quality, remaining faithful to the principles of hygiene, nutritional and organoleptic quality and proper food handling. At the same time, it is necessary to promote food choices, nutritionally correct, by evaluations of appropriateness of menus. The study of food waste allows an evaluation of the nutritional habits of consumers and an important economic consideration of the costs incurred for the implementation of the service. This becomes even more important in some particularly sensitive groups, such as children and elderly. The purpose of this work is to test a model of semi-quantitative evaluation of waste to monitor food consumption in two different catering contexts (educational and business), in order to improve the service for school students and other consumers.

  2. Monitoring of lead levels in spices and food colors using atomic absorption spectroscopy

    International Nuclear Information System (INIS)

    Rahman, S.; Khalid, N.; Ahmad, S.

    2001-01-01

    The concentration of lead has been monitored in various commercial brands of spices and food colours using atomic absorption spectrometry after digestion in a mixture of nitric acid and perchloric acid. The reliability of the procedure used was checked by analyzing the standard reference materials namely wheat flour (NBS-1567) and rice flour (NBS-1568), for their lead contents. The determined concentration of lead ranged from 5.60 to 10.12 mg g-1 in food spices and from 1.62 to 1.81 mg g-1 in food colours. The study revealed that the piper nigrum contains higher lead contents as compared to capsicum. The effect of processing/milling on the concentration of lead in spices was also studied and discussed. The daily intake of lead by adults through spices and food colours was estimated and was found to be within the recommended WHO tolerance levels. (author)

  3. Mechanistic studies of the agmatine deiminase from Listeria monocytogenes.

    Science.gov (United States)

    Soares, Charles A; Knuckley, Bryan

    2016-06-01

    Listeria monocytogenes is a Gram-positive food-borne pathogen that is capable of living within extreme environments (i.e. low temperatures and pH). This ability to survive in such conditions may arise, at least in part, from agmatine catabolism via the agmatine deiminase system (AgDS). This catabolic pathway utilizes an agmatine deiminase (AgD) to hydrolyse agmatine into N-carbamoylputrescine (NCP), with concomitant release of ammonia, which increases the pH, thus mitigating the ill effects of the acidic environment. Given the potential significance of this pathway for cell survival, we set out to study the catalytic mechanism of the AgD encoded by L. monocytogenes In the present paper, we describe the catalytic mechanism employed by this enzyme based on pH profiles, pKa measurements of the active site cysteine and solvent isotope effects (SIE). In addition, we report inhibition of this enzyme by two novel AgD inhibitors, i.e. N-(4-aminobutyl)-2-fluoro-ethanimidamide (ABFA) and N-(4-aminobutyl)-2-chloro-ethanimidamide (ABCA). In contrast with other orthologues, L. monocytogenes AgD does not use the reverse protonation or substrate-assisted mechanism, which requires an active site cysteine with a high pKa and has been commonly seen in other members of the guanidinium-modifying enzyme (GME) superfamily. Instead, the L. monocytogenes AgD has a low pKa cysteine in the active site leading to an alternative mechanism of catalysis. This is the first time that this mechanism has been observed in the GME superfamily and is significant because it explains why previously developed mechanism-based inactivators of AgDs are ineffective against this orthologue. © 2016 The Author(s). published by Portland Press Limited on behalf of the Biochemical Society.

  4. Fluxes of Ca2+ and K+ are required for the listeriolysin O-dependent internalization pathway of Listeria monocytogenes.

    Science.gov (United States)

    Vadia, Stephen; Seveau, Stephanie

    2014-03-01

    Listeria monocytogenes is responsible for the life-threatening food-borne disease listeriosis. This disease mainly affects elderly and immunocompromised individuals, causing bacteremia and meningoencephalitis. In pregnant women, L. monocytogenes infection leads to abortion and severe infection of the fetus or newborn. The L. monocytogenes intracellular life cycle is critical for pathogenesis. Previous studies have established that the major virulence factor of L. monocytogenes, the pore-forming toxin listeriolysin O (LLO), is sufficient to induce L. monocytogenes internalization into human epithelial cell lines. This internalization pathway strictly requires the formation of LLO pores in the plasma membrane and can be stimulated by the heterologous pore-forming toxin pneumolysin, suggesting that LLO acts nonspecifically by forming transmembrane pores. The present work tested the hypothesis that Ca2+ and K+ fluxes subsequent to perforation by LLO control L. monocytogenes internalization. We report that L. monocytogenes perforates the host cell plasma membrane in an LLO-dependent fashion at the early stage of invasion. In response to perforation, host cells undergo Ca2+ -dependent but K+ -independent resealing of their plasma membrane. In contrast to the plasma membrane resealing process, LLO-induced L. monocytogenes internalization requires both Ca2+ and K+ fluxes. Further linking ion fluxes to bacterial internalization, treating cells with a combination of Ca2+ and K+ ionophores but not with individual ionophores is sufficient to induce efficient internalization of large cargoes, such as 1-μm polystyrene beads and bacteria. We propose that LLO-induced L. monocytogenes internalization requires a Ca2+ - and K+ -dependent internalization pathway that is mechanistically distinct from the process of plasma membrane resealing.

  5. Inactivation of Listeria monocytogenes by disinfectants and bacteriophages in suspension and stainless steel carrier tests

    NARCIS (Netherlands)

    Chaitiemwong, N.; Hazeleger, W.C.; Beumer, R.R.

    2014-01-01

    To simulate food contact surfaces with pits or cracks, stainless steel plates with grooves (depths between 0.2 and 5 mm) were constructed. These plates were artificially contaminated with Listeria monocytogenes in clean conditions, with organic soiling, or after 14 days of biofilm formation after

  6. Survival of Listeria monocytogenes on a conveyor belt material with or without antimicrobial additives

    NARCIS (Netherlands)

    Chaitiemwong, N.; Hazeleger, W.C.; Beumer, R.R.

    2010-01-01

    Survival of Listeria monocytogenes on a conveyor belt material with or without antimicrobial additives, in the absence or presence of food debris from meat, fish and vegetables and at temperatures of 10, 25 and 37 °C was investigated. The pathogen survived best at 10 °C, and better at 25 °C than at

  7. Combined action of S-carvone and mild heat treatment on Listeria monocytogenes Scott A

    NARCIS (Netherlands)

    Karatzas, A.K.; Bennik, M.H.J.; Smid, E.J.; Kets, E.P.W.

    2000-01-01

    The combined action of the plant-derived volatile, S-carvone, and mild heat treatment on the food-borne pathogen, Listeria monocytogenes, was evaluated. The viability of exponential phase cultures grown at 8 °C could be reduced by 1.3 log units after exposure to S-carvone (5 mmol 1-1) for 30 min at

  8. [Risk assessment of Listeria monocytogenes in deli meats and vegetable salads].

    Science.gov (United States)

    Tian, Jing; Liu, Xiu-mei

    2009-09-01

    To analysis risk from Listeria monocytogenes in deli meats and vegetable salads. Use Risk Ranger which is a software programme developed by the University of Hobart, Australia and answer 11 questions on affecting the risk from hazards in the specific foods by combining data from national foodborne diseases surveillance network and some references to make semi-quantitative risk assessment for the specific food. Relative risk from Listeria monocytogenes in deli meats and vegetable salads is 61 and 52, respectively. Incidence of listeriosis caused by deli meats-Listeria monocytogenes pairs and vegetable salads-Listeria monocytogenes pairs is 5.4 and 0.2 cases per million people, respectively. Risk from the former is 32 times than that from the latter. By changing the selection for some risk factors in the model, it was known that the risks from two food-hazard combinations could decrease 10 times, if taking necessary actions after processing. Deli meats is a kind of high risk food for listeriosis.

  9. Effect of humidity and temperature on the survival of Listeria monocytogenes on surfaces.

    Science.gov (United States)

    Redfern, J; Verran, J

    2017-04-01

    Listeria monocytogenes is a pathogenic bacterium, with human disease and infection linked to dairy products, seafood, ready-to-eat meat and raw & undercooked meats. Stainless steel is the most common food preparation surface and therefore, it is important to understand how food storage conditions such as surface materials, temperature and relative humidity can affect survival of L. monocytogenes. In this study, survival of L. monocytogenes on stainless steel was investigated at three temperatures (4, 10 and 21°C), each approx. 11, 50 and 85% humidity. Results indicate that the lower the temperature, the more cells were recovered in all three humidity environments, while medium humidity enhances survival, irrespective of temperature. Lower humidity decreases recovery at all temperatures. These data support the guidance noted above that humidity control is important, and that lower humidity environments are less likely to support retention of viable L. monocytogenes on a stainless steel surface. Understanding survival of potential food-borne pathogens is essential for the safe production and preparation of food. While it has long been 'common knowledge' that relative humidity can affect the growth and survival of micro-organisms, this study systematically describes the survival of L. monocytogenes on stainless steel under varying humidity and temperatures for the first time. The outcomes from this paper will allow those involved with food manufacture and preparation to make informed judgement on environmental conditions relating to humidity control, which is lacking in the food standards guidelines. © 2017 The Society for Applied Microbiology.

  10. Space-Derived Phenology, Retrieval and Use for Drought and Food Security Monitoring

    Science.gov (United States)

    Meroni, M.; Kayitakire, F.; Rembold, F.; Urbano, F.; Schucknecht, A.; LEO, O.

    2014-12-01

    Monitoring vegetation conditions is a critical activity for assessing food security in Africa. Rural populations relying on rain-fed agriculture and livestock grazing are highly exposed to large seasonal and inter-annual fluctuations in water availability. Monitoring the state, evolution, and productivity of vegetation, crops and pastures in particular, is important to conduct food emergency responses and plan for a long-term, resilient, development strategy in this area. The timing of onset, the duration, and the intensity of vegetation growth can be retrieved from space observations and used for food security monitoring to assess seasonal vegetation development and forecast the likely seasonal outcome when the season is ongoing. In this contribution we present a set of phenology-based remote sensing studies in support to food security analysis. Key phenological indicators are retrieved using a model-fit approach applied to SOPT-VEGETATION FAPAR time series. Remote-sensing phenology is first used to estimate i) the impact of the drought in the Horn of Africa, ii) crop yield in Tunisia and, iii) rangeland biomass production in Niger. Then the impact of the start and length of vegetation growing period on the total biomass production is assessed over the Sahel. Finally, a probabilistic approach using phenological information to forecast the occurrence of an end-of-season biomass production deficit is applied over the Sahel to map hot-spots of drought-related risk.

  11. Efficacy of chlorine dioxide against Listeria monocytogenes in brine chilling solutions.

    Science.gov (United States)

    Valderrama, W B; Mills, E W; Cutter, C N

    2009-11-01

    Chilled brine solutions are used by the food industry to rapidly cool ready-to-eat meat products after cooking and before packaging. Chlorine dioxide (ClO(2)) was investigated as an antimicrobial additive to eliminate Listeria monocytogenes. Several experiments were performed using brine solutions made of sodium chloride (NaCl) and calcium chloride (CaCl(2)) inoculated with L. monocytogenes and/or treated with 3 ppm of ClO(2). First, 10 and 20% CaCl(2) and NaCl solutions (pH 7.0) were inoculated with a five-strain cocktail of L. monocytogenes to obtain approximately 7 log CFU/ml and incubated 8 h at 0 degrees C. The results demonstrated that L. monocytogenes survived in 10% CaCl(2), 10 and 20% NaCl, and pure water. L. monocytogenes levels were reduced approximately 1.2 log CFU/ml in 20% CaCl(2). Second, inoculated ( approximately 7 log CFU/ml) brine solutions (10 and 20% NaCl and 10% CaCl(2)) treated with 3 ppm of ClO(2) resulted in a approximately 4-log reduction of the pathogen within 90 s. The same was not observed in a solution of 20% CaCl(2); further investigation demonstrated that high levels of divalent cations interfere with the disinfectant. Spent brine solutions from hot dog and ham chilling were treated with ClO(2) at concentrations of 3 or 30 ppm. At these concentrations, ClO(2) did not reduce L. monocytogenes. Removal of divalent cations and organic material in brine solutions prior to disinfection with ClO(2) should be investigated to improve the efficacy of the compound against L. monocytogenes. The information from this study may be useful to processing establishments and researchers who are investigating antimicrobials in chilling brine solutions.

  12. Listeria monocytogenes meningitis in the elderly: epidemiological, clinical and therapeutic findings.

    Science.gov (United States)

    Pagliano, Pasquale; Ascione, Tiziana; Boccia, Giovanni; De Caro, Francesco; Esposito, Silvano

    2016-06-01

    Listeria monocytogenes is a Gram-positive bacillus and facultative intracellular bacterium whose transmission occurs mainly through the consumption of contaminated food, L. monocytogenes invades the host cells using various protein and can escape to the human T-cell immune system by cell-to-cell spreading. If the infection is not controlled at the stage in which the bacterium is in the liver, for instance, due to a severe immunodepression, a secondary bacteraemia can be developed and L. monocytogenes reaches the preferred sites transgressing the blood-brain barrier or the placental barrier. Individuals with T-cell dysfunction, such as pregnant women, the elderly, and those receiving immunosuppressive therapy are at the highest risk of contracting the disease. Average life expectancy throughout developed countries has rapidly increased during the latter half of the 20th century and geriatric infectious diseases have become an increasingly important issue. L. monocytogenes meningitis in young previously healthy adults has been reported only in anecdotal observations. Differently, L. monocytogenes is the third most common cause of bacterial meningitis in the elderly population, after Streptococcus pneumoniae and Neisseria meningitidis. Patients with L. monocytogenes meningitis presented with signs and symptoms that were similar to those of the general population with community-acquired bacterial meningitis, but reported a longer prodromal phase. According to literature data, the prevalence of the classic triad of fever, neck stiffness, and altered mental status is 43%, and almost all patients present with at least 2 of the 4 classic symptoms of headache, fever, neck stiffness, and altered mental status. On the basis of our published data, in patients aged over 50 years, diagnosing L. monocytogenes meningitis was more challenging than pneumococcal meningitis, as demonstrated by the lower percentage of cases receiving a correct diagnosis within 48 hours from the onset

  13. Listeria monocytogenes presence during fermentation, drying and storage of Petrovská klobása sausage

    Science.gov (United States)

    Janković, V.; Mitrović, R.; Lakićević, B.; Velebit, B.; Baltić, T.

    2017-09-01

    The majority of human listeriosis cases appear to be caused by consumption of ready-to-eat (RTE) foods contaminated at the time of consumption with high levels of Listeria monocytogenes. Although strategies to prevent growth of L. monocytogenes in RTE products are critical for reducing the incidence of human listeriosis, this pathogen is highly difficult to control in fermented sausage processing environments due to its high tolerance to low pH and high salt concentration. The aims of the present study were to investigate the occurrence, presence and elimination of L. monocytogenes in Petrovská klobása sausage during processing, fermentation, drying and storage. L. monocytogenes, which was detected at the beginning of the production cycle, disappeared before day 30. The pathogen decline was much faster in those sausages which were dried in controlled, industrial conditions than in those dried applying the traditional, household technique.

  14. Desiccation of adhering and biofilm Listeria monocytogenes on stainless steel: Survival and transfer to salmon products

    DEFF Research Database (Denmark)

    Hansen, Lisbeth Truelstrup; Vogel, Birte Fonnesbech

    2011-01-01

    The foodborne bacterial pathogen, Listeria monocytogenes, commonly contaminates foods during processing, where the microorganisms are potentially subjected to low relative humidity (RH) conditions for extended periods of time. The objective of this study was to examine survival during desiccation...... (43% RH and 15°C) of biofilm L. monocytogenes N53-1 cells on stainless steel coupons and to assess subsequent transfer to salmon products. Formation of static biofilm (2days at 100% RH and 15°C) prior to desiccation for 23days significantly (P...

  15. Combination of endolysins and high pressure to inactivate Listeria monocytogenes.

    Science.gov (United States)

    van Nassau, Tomas J; Lenz, Christian A; Scherzinger, Anna S; Vogel, Rudi F

    2017-12-01

    Outbreaks of listeriosis are often related to the consumption of low-processed ready-to-eat food products (e.g. soft cheeses or smoked fish) contaminated with Listeria monocytogenes. Traditional preservation techniques, such as heat treatment, cannot eliminate Listeria from these products without strongly affecting the quality of the foods. We therefore investigated the use of endolysin (PlyP40, Ply511, or PlyP825) in combination with high hydrostatic pressure processing to kill L. monocytogenes in buffer. The results demonstrated a more than additive effect when both treatments were combined. For example, whereas 0.16 μg/mL PlyP825 or 300 MPa (1 min, 30 °C) applied individually reduced the cell count by 0.2 and 0.3 log cfu, respectively, a combined treatment resulted in a reduction of 5.5 log cfu. Similar results were obtained for the other endolysins combined with high pressure processing. We also showed that the synergistic inactivation of cells by endolysin and HHP is possible at a pressure level of only 200 MPa (2 min, 30 °C). Thus, the application of endolysins did not only substantially increase the bactericidal effect of high pressure, but it also enabled the inactivation of bacterial cells at much lower pressure levels. This shows the potential of using such combined processes for the inactivation of L. monocytogenes and food preservation. Copyright © 2017 Elsevier Ltd. All rights reserved.

  16. Monitoring the impact of trade agreements on national food environments: trade imports and population nutrition risks in Fiji.

    Science.gov (United States)

    Ravuvu, Amerita; Friel, Sharon; Thow, Anne-Marie; Snowdon, Wendy; Wate, Jillian

    2017-06-13

    Trade agreements are increasingly recognised as playing an influential role in shaping national food environments and the availability and nutritional quality of the food supply. Global monitoring of food environments and trade policies can strengthen the evidence base for the impact of trade policy on nutrition, and support improved policy coherence. Using the INFORMAS trade monitoring protocol, we reviewed available food supply data to understand associations between Fiji's commitments under WTO trade agreements and food import volume trends. First, a desk review was conducted to map and record in one place Fiji's commitments to relevant existing trade agreements that have implications for Fiji's national food environment under the domains of the INFORMAS trade monitoring protocol. An excel database was developed to document the agreements and their provisions. The second aspect of the research focused on data extraction. We began with identifying food import volumes into Fiji by country of origin, with a particular focus on a select number of 'healthy and unhealthy' foods. We also developed a detailed listing of transnational food corporations currently operating in Fiji. The study suggests that Fiji's WTO membership, in conjunction with associated economic and agricultural policy changes have contributed to increased availability of both healthy and less healthy imported foods. In systematically monitoring the import volume trends of these two categories of food, the study highlights an increase in healthy foods such as fresh fruits and vegetables and whole-grain refined cereals. The study also shows that there has been an increase in less healthy foods including fats and oils; meat; processed dairy products; energy-dense beverages; and processed and packaged foods. By monitoring the trends of imported foods at country level from the perspective of trade agreements, we are able to develop appropriate and targeted interventions to improve diets and health. This

  17. Bacteria-eating virus approved as food additive.

    Science.gov (United States)

    Bren, Linda

    2007-01-01

    Not all viruses harm people. The Food and Drug Administration has approved a mixture of viruses as a food additive to protect people. The additive can be used in processing plants for spraying onto ready-to-eat meat and poultry products to protect consumers from the potentially life-threatening bacterium Listeria monocytogenes (L. monocytogenes).

  18. Comparison of Listeria monocytogenes recoveries from spiked mung bean sprouts by the enrichment methods of three regulatory agencies.

    Science.gov (United States)

    Cauchon, Kaitlin E; Hitchins, Anthony D; Smiley, R Derike

    2017-09-01

    Three selective enrichment methods, the United States Food and Drug Administration's (FDA method), the United States Department of Agriculture Food Safety Inspection Service's (USDA method), and the EN ISO 11290-1 standard method, were assessed for their suitability for recovery of Listeria monocytogenes from spiked mung bean sprouts. Three parameters were evaluated; the enrichment L. monocytogenes population from singly-spiked sprouts, the enrichment L. monocytogenes population from doubly-spiked (L. monocytogenes and Listeria innocua) sprouts, and the population differential resulting from the enrichment of doubly-spiked sprouts. Considerable L. monocytogenes inter-strain variation was observed. The mean enrichment L. monocytogenes populations for singly-spiked sprouts were 6.1 ± 1.2, 4.9 ± 1.2, and 6.9 ± 2.3 log CFU/mL for the FDA, USDA, and EN ISO 11290-1 methods, respectively. The mean L. monocytogenes populations for doubly-spiked sprouts were 4.7 ± 1.1, 5.5 ± 1.3, and 4.6 ± 1.4 log CFU/mL for the FDA, USDA, and ISO 11290-1 enrichment methods, respectively. The corresponding mean population differentials were 2.8 ± 1.1, 3.3 ± 1.3, and 3.6 ± 1.4 Δlog CFU/mL for the same three enrichment methods, respectively. The presence of L. innocua and resident microorganisms on the sprouts negatively impacted final levels of L. monocytogenes with all three enrichment methods. Published by Elsevier Ltd.

  19. Predicting growth rates and growth boundary of Listeria monocytogenes - An international validation study with focus on processed and ready-to-eat meat and seafood

    DEFF Research Database (Denmark)

    Mejlholm, Ole; Gunvig, A.; Borggaard, C.

    2010-01-01

    The performance of six predictive models for Listeria monocytogenes was evaluated using 1014 growth responses of the pathogen in meat, seafood, poultry and dairy products. The performance of the growth models was closely related to their complexity i.e. the number of environmental parameters they...... be accurate. The successfully validated models are useful for assessment and management of L monocytogenes in processed and ready-to-eat (RTE) foods....... to accurately predict growth responses of L. monocytogenes in the wide range of food evaluated in the present study. When complexity of L monocytogenes growth models matches the complexity of foods of interest. i.e. the number of hurdles to microbial growth, then predicted growth responses of the pathogen can...

  20. Triclosan-Induced Aminoglycoside-Tolerant Listeria monocytogenes Isolates Can Appear as Small-Colony Variants

    DEFF Research Database (Denmark)

    Kastbjerg, Vicky Gaedt; Hein-Kristensen, Line; Gram, Lone

    2014-01-01

    Exposure of the human food-borne pathogen Listeria monocytogenes to sublethal concentrations of triclosan can cause resistance to several aminoglycosides. Aminoglycoside-resistant isolates exhibit two colony morphologies: normal-size and pinpoint colonies. The purposes of the present study were...... to characterize the small colonies of L. monocytogenes and to determine if specific genetic changes could explain the triclosan-induced aminoglycoside resistance in both pinpoint and normal-size isolates. Isolates from the pinpoint colonies grew poorly under aerated conditions, but growth was restored by addition......I and that exposure to triclosan can cause resistance to antibiotics that enters the cell via active transport. Further studies are needed to elucidate if L. monocytogenes pinpoint isolates could have any clinical impact, e.g., in persistent infections....

  1. Infectious Dose of Listeria monocytogenes in Outbreak Linked to Ice Cream, United States, 2015.

    Science.gov (United States)

    Pouillot, Régis; Klontz, Karl C; Chen, Yi; Burall, Laurel S; Macarisin, Dumitru; Doyle, Matthew; Bally, Kären M; Strain, Errol; Datta, Atin R; Hammack, Thomas S; Van Doren, Jane M

    2016-12-01

    The relationship between the number of ingested Listeria monocytogenes cells in food and the likelihood of developing listeriosis is not well understood. Data from an outbreak of listeriosis linked to milkshakes made from ice cream produced in 1 factory showed that contaminated products were distributed widely to the public without any reported cases, except for 4 cases of severe illness in persons who were highly susceptible. The ingestion of high doses of L. monocytogenes by these patients infected through milkshakes was unlikely if possible additional contamination associated with the preparation of the milkshake is ruled out. This outbreak illustrated that the vast majority of the population did not become ill after ingesting a low level of L. monocytogenes but raises the question of listeriosis cases in highly susceptible persons after distribution of low-level contaminated products that did not support the growth of this pathogen.

  2. An Assessment of Different Genomic Approaches for Inferring Phylogeny of Listeria monocytogenes

    DEFF Research Database (Denmark)

    Henri, Clementine; Leekitcharoenphon, Pimlapas; Carleton, Heather A.

    2017-01-01

    Background/objectives: Whole genome sequencing (WGS) has proven to be a powerful subtyping tool for foodborne pathogenic bacteria like L. monocytogenes. The interests of genome-scale analysis for national surveillance, outbreak detection or source tracking has been largely documented. The genomic......MLPPST) or pan genome (wgMLPPST). Currently, there are little comparisons studies of these different analytical approaches. Our objective was to assess and compare different genomic methods that can be implemented in order to cluster isolates of L monocytogenes.Methods: The clustering methods were evaluated...... on a collection of 207 L. monocytogenes genomes of food origin representative of the genetic diversity of the Anses collection. The trees were then compared using robust statistical analyses.Results: The backward comparability between conventional typing methods and genomic methods revealed a near...

  3. Listeria monocytogenes Growth Kinetics in Milkshakes Made from Naturally and Artificially Contaminated Ice Cream

    Directory of Open Access Journals (Sweden)

    Joelle K. Salazar

    2018-01-01

    Full Text Available This study assessed the growth of Listeria monocytogenes in milkshakes made using the process-contaminated ice cream associated with a listeriosis outbreak in comparison to milkshakes made with artificially contaminated ice cream. For all temperatures, growth kinetics including growth rates, lag phases, maximum populations, and population increases were determined for the naturally and artificially derived contaminants at 5, 10, 15, and 25°C storage for 144 h. The artificially inoculated L. monocytogenes presented lower growth rates and shorter lag phases than the naturally contaminated populations at all temperatures except for 5°C, where the reverse was observed. At 25°C, lag phases of the naturally and artificially contaminated L. monocytogenes were 11.6 and 7.8 h, respectively. The highest increase in population was observed for the artificially inoculated pathogen at 15°C after 96 h (6.16 log CFU/mL of storage. Growth models for both contamination states in milkshakes were determined. In addition, this study evaluated the antimicrobial effectiveness of flavoring agents, including strawberry, chocolate and mint, on the growth of the pathogen in milkshakes during 10°C storage. All flavor additions resulted in decreased growth rates of L. monocytogenes for both contamination states. The addition of chocolate and mint flavoring also resulted in significantly longer lag phases for both contamination states. This study provides insight into the differences in growth between naturally and artificially contaminated L. monocytogenes in a food product.

  4. Effect of gamma-irradiation on the survival of Listeria monocytogenes and allergenicity of cherry tomatoes

    International Nuclear Information System (INIS)

    Todoriki, Setsuko; Bari, Latiful; Kitta, Kazumi; Ohba, Mika; Ito, Yasuhiro; Tsujimoto, Yuka; Kanamori, Norihito; Yano, Erika; Moriyama, Tatsuya; Kawamura, Yukio; Kawamoto, Shinichi

    2009-01-01

    The presence of Listeria monocytogenes in fresh produce is a growing concern because of the possibility of food-borne illness. Ionizing radiation is an effective non-thermal means of eliminating pathogenic bacteria in fresh produce; however, the effect of ionizing irradiation on the allergenic properties of the host commodities remains unknown. This study aimed (i) to determine the effective dose of gamma-irradiation in eliminating L. monocytogenes on whole cherry tomatoes and (ii) to evaluate the effect of gamma-irradiation on the allergenic properties of tomato proteins. Cherry tomatoes that were inoculated with a mixture of five L. monocytogenes strains were treated with gamma-rays from a 60 Co source. A 1.25 kGy dose of gamma-irradiation was found to be sufficient to eliminate L. monocytogenes on whole cherry tomatoes. The immunoblot profile of serum samples obtained from two patients with tomato allergy revealed that gamma-irradiation did not affect the allergenicity of tomato proteins for up to 7 days after irradiation when the tomatoes were stored at 20 deg. C. Additionally, the m-RNA levels of β-fructofuranosidase, polygalacturonase, pectin esterase, and superoxide dismutase, the main allergenic proteins in tomato, were not affected by the applied irradiation dose. Thus, this study demonstrated that a 1.25 kGy dose of gamma-irradiation effectively eliminates L. monocytogenes on cherry tomatoes without affecting the expression of allergenic proteins in the fruits.

  5. Growth, viability and architecture of biofilms of Listeria monocytogenes formed on abiotic surfaces

    Directory of Open Access Journals (Sweden)

    Fernanda Barbosa dos Reis-Teixeira

    Full Text Available Abstract The pathogenic bacterium Listeria monocytogenes can persist in food processing plants for many years, even when appropriate hygienic measures are in place, with potential for contaminating ready-to-eat products and, its ability to form biofilms on abiotic surfaces certainly contributes for the environmental persistence. In this research, L. monocytogenes was grown in biofilms up 8 days attached to stainless steel and glass surfaces, contributing for advancing the knowledge on architecture of mature biofilms, since many literature studies carried out on this topic considered only early stages of cell adhesion. In this study, biofilm populations of two strains of L. monocytogenes (serotypes 1/2a and 4b on stainless steel coupons and glass were examined using regular fluorescence microscopy, confocal laser scanning microscopy and classic culture method. The biofilms formed were not very dense and microscopic observations revealed uneven biofilm structures, with presence of exopolymeric matrix surrounding single cells, small aggregates and microcolonies, in a honeycomb-like arrangement. Moreover, planktonic population of L. monocytogenes (present in broth media covering the abiotic surface remained stable throughout the incubation time, which indicates an efficient dispersal mechanism, since the culture medium was replaced daily. In conclusion, even if these strains of L. monocytogenes were not able to form thick multilayer biofilms, it was noticeable their high persistence on abiotic surfaces, reinforcing the need to focus on measures to avoid biofilm formation, instead of trying to eradicate mature biofilms.

  6. Effect of gamma-irradiation on the survival of Listeria monocytogenes and allergenicity of cherry tomatoes

    Science.gov (United States)

    Todoriki, Setsuko; Bari, Latiful; Kitta, Kazumi; Ohba, Mika; Ito, Yasuhiro; Tsujimoto, Yuka; Kanamori, Norihito; Yano, Erika; Moriyama, Tatsuya; Kawamura, Yukio; Kawamoto, Shinichi

    2009-07-01

    The presence of Listeria monocytogenes in fresh produce is a growing concern because of the possibility of food-borne illness. Ionizing radiation is an effective non-thermal means of eliminating pathogenic bacteria in fresh produce; however, the effect of ionizing irradiation on the allergenic properties of the host commodities remains unknown. This study aimed (i) to determine the effective dose of gamma-irradiation in eliminating L. monocytogenes on whole cherry tomatoes and (ii) to evaluate the effect of gamma-irradiation on the allergenic properties of tomato proteins. Cherry tomatoes that were inoculated with a mixture of five L. monocytogenes strains were treated with gamma-rays from a 60Co source. A 1.25 kGy dose of gamma-irradiation was found to be sufficient to eliminate L. monocytogenes on whole cherry tomatoes. The immunoblot profile of serum samples obtained from two patients with tomato allergy revealed that gamma-irradiation did not affect the allergenicity of tomato proteins for up to 7 days after irradiation when the tomatoes were stored at 20 °C. Additionally, the m-RNA levels of β-fructofuranosidase, polygalacturonase, pectin esterase, and superoxide dismutase, the main allergenic proteins in tomato, were not affected by the applied irradiation dose. Thus, this study demonstrated that a 1.25 kGy dose of gamma-irradiation effectively eliminates L. monocytogenes on cherry tomatoes without affecting the expression of allergenic proteins in the fruits.

  7. Effect of gamma-irradiation on the survival of Listeria monocytogenes and allergenicity of cherry tomatoes

    Energy Technology Data Exchange (ETDEWEB)

    Todoriki, Setsuko [National Food Research Institute, Tsukuba, Ibaraki 305-8642 (Japan)], E-mail: setsuko@affrc.go.jp; Bari, Latiful; Kitta, Kazumi; Ohba, Mika; Ito, Yasuhiro; Tsujimoto, Yuka [National Food Research Institute, Tsukuba, Ibaraki 305-8642 (Japan); Kanamori, Norihito [Japan International Research Center for Agricultural Science, Tsukuba, Ibaraki 305-8686 (Japan); Yano, Erika; Moriyama, Tatsuya; Kawamura, Yukio [School of Agriculture, Kinki University, Nara-city, Nara 631-8505 (Japan); Kawamoto, Shinichi [National Food Research Institute, Tsukuba, Ibaraki 305-8642 (Japan)

    2009-07-15

    The presence of Listeria monocytogenes in fresh produce is a growing concern because of the possibility of food-borne illness. Ionizing radiation is an effective non-thermal means of eliminating pathogenic bacteria in fresh produce; however, the effect of ionizing irradiation on the allergenic properties of the host commodities remains unknown. This study aimed (i) to determine the effective dose of gamma-irradiation in eliminating L. monocytogenes on whole cherry tomatoes and (ii) to evaluate the effect of gamma-irradiation on the allergenic properties of tomato proteins. Cherry tomatoes that were inoculated with a mixture of five L. monocytogenes strains were treated with gamma-rays from a {sup 60}Co source. A 1.25 kGy dose of gamma-irradiation was found to be sufficient to eliminate L. monocytogenes on whole cherry tomatoes. The immunoblot profile of serum samples obtained from two patients with tomato allergy revealed that gamma-irradiation did not affect the allergenicity of tomato proteins for up to 7 days after irradiation when the tomatoes were stored at 20 deg. C. Additionally, the m-RNA levels of {beta}-fructofuranosidase, polygalacturonase, pectin esterase, and superoxide dismutase, the main allergenic proteins in tomato, were not affected by the applied irradiation dose. Thus, this study demonstrated that a 1.25 kGy dose of gamma-irradiation effectively eliminates L. monocytogenes on cherry tomatoes without affecting the expression of allergenic proteins in the fruits.

  8. Growth, viability and architecture of biofilms of Listeria monocytogenes formed on abiotic surfaces.

    Science.gov (United States)

    Reis-Teixeira, Fernanda Barbosa Dos; Alves, Virgínia Farias; de Martinis, Elaine Cristina Pereira

    The pathogenic bacterium Listeria monocytogenes can persist in food processing plants for many years, even when appropriate hygienic measures are in place, with potential for contaminating ready-to-eat products and, its ability to form biofilms on abiotic surfaces certainly contributes for the environmental persistence. In this research, L. monocytogenes was grown in biofilms up 8 days attached to stainless steel and glass surfaces, contributing for advancing the knowledge on architecture of mature biofilms, since many literature studies carried out on this topic considered only early stages of cell adhesion. In this study, biofilm populations of two strains of L. monocytogenes (serotypes 1/2a and 4b) on stainless steel coupons and glass were examined using regular fluorescence microscopy, confocal laser scanning microscopy and classic culture method. The biofilms formed were not very dense and microscopic observations revealed uneven biofilm structures, with presence of exopolymeric matrix surrounding single cells, small aggregates and microcolonies, in a honeycomb-like arrangement. Moreover, planktonic population of L. monocytogenes (present in broth media covering the abiotic surface) remained stable throughout the incubation time, which indicates an efficient dispersal mechanism, since the culture medium was replaced daily. In conclusion, even if these strains of L. monocytogenes were not able to form thick multilayer biofilms, it was noticeable their high persistence on abiotic surfaces, reinforcing the need to focus on measures to avoid biofilm formation, instead of trying to eradicate mature biofilms. Copyright © 2017. Published by Elsevier Editora Ltda.

  9. Listeria monocytogenes Growth Kinetics in Milkshakes Made from Naturally and Artificially Contaminated Ice Cream.

    Science.gov (United States)

    Salazar, Joelle K; Bathija, Vriddi M; Carstens, Christina K; Narula, Sartaj S; Shazer, Arlette; Stewart, Diana; Tortorello, Mary Lou

    2018-01-01

    This study assessed the growth of Listeria monocytogenes in milkshakes made using the process-contaminated ice cream associated with a listeriosis outbreak in comparison to milkshakes made with artificially contaminated ice cream. For all temperatures, growth kinetics including growth rates, lag phases, maximum populations, and population increases were determined for the naturally and artificially derived contaminants at 5, 10, 15, and 25°C storage for 144 h. The artificially inoculated L. monocytogenes presented lower growth rates and shorter lag phases than the naturally contaminated populations at all temperatures except for 5°C, where the reverse was observed. At 25°C, lag phases of the naturally and artificially contaminated L. monocytogenes were 11.6 and 7.8 h, respectively. The highest increase in population was observed for the artificially inoculated pathogen at 15°C after 96 h (6.16 log CFU/mL) of storage. Growth models for both contamination states in milkshakes were determined. In addition, this study evaluated the antimicrobial effectiveness of flavoring agents, including strawberry, chocolate and mint, on the growth of the pathogen in milkshakes during 10°C storage. All flavor additions resulted in decreased growth rates of L. monocytogenes for both contamination states. The addition of chocolate and mint flavoring also resulted in significantly longer lag phases for both contamination states. This study provides insight into the differences in growth between naturally and artificially contaminated L. monocytogenes in a food product.

  10. Rapid detection of Listeria monocytogenes in milk using confocal micro-Raman spectroscopy and chemometric analysis.

    Science.gov (United States)

    Wang, Junping; Xie, Xinfang; Feng, Jinsong; Chen, Jessica C; Du, Xin-jun; Luo, Jiangzhao; Lu, Xiaonan; Wang, Shuo

    2015-07-02

    Listeria monocytogenes is a facultatively anaerobic, Gram-positive, rod-shape foodborne bacterium causing invasive infection, listeriosis, in susceptible populations. Rapid and high-throughput detection of this pathogen in dairy products is critical as milk and other dairy products have been implicated as food vehicles in several outbreaks. Here we evaluated confocal micro-Raman spectroscopy (785 nm laser) coupled with chemometric analysis to distinguish six closely related Listeria species, including L. monocytogenes, in both liquid media and milk. Raman spectra of different Listeria species and other bacteria (i.e., Staphylococcus aureus, Salmonella enterica and Escherichia coli) were collected to create two independent databases for detection in media and milk, respectively. Unsupervised chemometric models including principal component analysis and hierarchical cluster analysis were applied to differentiate L. monocytogenes from Listeria and other bacteria. To further evaluate the performance and reliability of unsupervised chemometric analyses, supervised chemometrics were performed, including two discriminant analyses (DA) and soft independent modeling of class analogies (SIMCA). By analyzing Raman spectra via two DA-based chemometric models, average identification accuracies of 97.78% and 98.33% for L. monocytogenes in media, and 95.28% and 96.11% in milk were obtained, respectively. SIMCA analysis also resulted in satisfied average classification accuracies (over 93% in both media and milk). This Raman spectroscopic-based detection of L. monocytogenes in media and milk can be finished within a few hours and requires no extensive sample preparation. Copyright © 2015 Elsevier B.V. All rights reserved.

  11. Enhanced levels of cold shock proteins in Listeria monocytogenes LO28 upon exposure to low temperature and high hydrostatic pressure

    NARCIS (Netherlands)

    Wemekamp-Kamphuis, H.H.; Karatzas, A.K.; Wouters, J.A.; Abee, T.

    2002-01-01

    Listeria monocytogenes is a psychrotrophic food-borne pathogen that is problematic for the food industry because of its ubiquitous distribution in nature and its ability to grow at low temperatures and in the presence of high salt concentrations. Here we demonstrate that the process of adaptation to

  12. Importance of SigB for Listeria monocytogenes static and continuous flow biofilm formation and disinfectant resistance

    NARCIS (Netherlands)

    Veen, van der S.; Abee, T.

    2010-01-01

    Listeria monocytogenes is a food-borne pathogen that is able to form biofilms in food processing facilities. Biofilms are generally more resistant to antimicrobial agents, making it difficult to eradicate them during cleanup procedures. So far, little is known about the function of stress resistance

  13. Monitoring the Sodium Content of Restaurant Foods: Public Health Challenges and Opportunities

    Science.gov (United States)

    Cogswell, Mary E.; Gunn, Janelle P.; Curtis, Christine J.; Rhodes, Donna; Hoy, Kathy; Pehrsson, Pamela; Nickle, Melissa; Merritt, Robert

    2013-01-01

    We reviewed methods of studies assessing restaurant foods’ sodium content and nutrition databases. We systematically searched the 1964–2012 literature and manually examined references in selected articles and studies. Twenty-six (5.2%) of the 499 articles we found met the inclusion criteria and were abstracted. Five were conducted nationally. Sodium content determination methods included laboratory analysis (n = 15), point-of-purchase nutrition information or restaurants’ Web sites (n = 8), and menu analysis with a nutrient database (n = 3). There is no comprehensive data system that provides all information needed to monitor changes in sodium or other nutrients among restaurant foods. Combining information from different sources and methods may help inform a comprehensive system to monitor sodium content reduction efforts in the US food supply and to develop future strategies. PMID:23865701

  14. Radiation monitoring of imported food to Saudi Arabia after Chernobyl accident

    International Nuclear Information System (INIS)

    Abdul-Majid, S.; Abulfaraj, W.; Al-Johani, M.S.; Mamoon, A.M.; Abdulfattah, A.F.; Abubakar, K.M.

    1988-01-01

    Following Chernobyl reactor accident, King Abdulaziz University (KAU) was assigned the responsibility of monitoring food imports reaching the western ports of Saudi Arabia. This includes the three western seaports of Jeddah, Yanbu and Jizan and the airport of Jeddah. Through the seaport of Jeddah, the largest in Saudi Arabia, essentially all kinds of foodstuffs are entering. Chilled meat, fresh vegetables and other items that can not be stored for long time are coming through Jeddah airport, while Jizan and Yanbu handle mainly barley and animal feed. The monitoring program started in the middle of June. This is the time when pilgrimage season starts and about one million persons come from different parts of the world to the city of Mecca. Food imports drastically increases during this time and large number of live sheep and cows are imported for religious sacrifice

  15. Adverse Drug Event Monitoring at the Food and Drug Administration: Your Report Can Make a Difference

    OpenAIRE

    Ahmad, Syed Rizwanuddin

    2003-01-01

    The Food and Drug Administration (FDA) is responsible not only for approving drugs but also for monitoring their safety after they reach the market. The complete adverse event profile of a drug is not known at the time of approval because of the small sample size, short duration, and limited generalizability of pre-approval clinical trials. This report describes the FDA's postmarketing surveillance system, to which many clinicians submit reports of adverse drug events encountered while treati...

  16. Test what you eat. Monitoring of radioactivity in the food chain

    International Nuclear Information System (INIS)

    2014-01-01

    Since 2013, the total beta activity in animal feed products being exported to Belarus shall be lower than 600 Becquerel per kilogram. The Belgian Nuclear Research Center SCK-CEN carries out these checks on behalf of the professional association of compound feed manufacturers in Belgium. The article discusses work conducted by SCK-CEN relating to the monitoring of radioactivity in the food chain.

  17. The monitoring of radioactive substances in biological food chains by the veterinary service in Czechoslovakia

    Energy Technology Data Exchange (ETDEWEB)

    Pawel, O [Central State Veterinary Institute, Prague, Czechoslovakia (Czech Republic)

    1986-07-01

    Czechoslovakia has established an environmental monitoring system to protect the hygienic conditions of the environment from the radiation hazard. The control authorities of the Ministry of Agriculture and Food take part in this system in order to collect information on the contamination with radioactive substances of soil, plants, game, food animals, foodstuffs and raw materials, i.e. information on all links of the food chain which extends from animals to man. A radioactive substances detection programme has been launched by the appropriate authorities in agriculture, animal husbandry and veterinary service. The programme includes a two-stage laboratory analysis of radioactive substances. The majority of laboratories covering the programme are already in operation.

  18. The monitoring of radioactive substances in biological food chains by the veterinary service in Czechoslovakia

    International Nuclear Information System (INIS)

    Pawel, O.

    1986-01-01

    Czechoslovakia has established an environmental monitoring system to protect the hygienic conditions of the environment from the radiation hazard. The control authorities of the Ministry of Agriculture and Food take part in this system in order to collect information on the contamination with radioactive substances of soil, plants, game, food animals, foodstuffs and raw materials, i.e. information on all links of the food chain which extends from animals to man. A radioactive substances detection programme has been launched by the appropriate authorities in agriculture, animal husbandry and veterinary service. The programme includes a two-stage laboratory analysis of radioactive substances. The majority of laboratories covering the programme are already in operation

  19. Inhibition of Listeria monocytogenes by Lactobacillus bavaricus MN in beef systems at refrigeration temperatures.

    OpenAIRE

    Winkowski, K; Crandall, A D; Montville, T J

    1993-01-01

    The ability of Lactobacillus bavaricus, a meat isolate, to inhibit the growth of three Listeria monocytogenes strains was examined in three beef systems: beef cubes, beef cubes in gravy, and beef cubes in gravy containing glucose. The beef was minimally heat treated, inoculated with L. bavaricus at 10(5) or 10(3) CFU/g and L. monocytogenes at 10(2) CFU/g, vacuum sealed, and stored at 4 or 10 degrees C. The meat samples were monitored for microbial growth, pH, and bacteriocin production. The p...

  20. Relative validation of a food frequency questionnaire for national health and nutrition monitoring

    Directory of Open Access Journals (Sweden)

    Haftenberger Marjolein

    2010-09-01

    Full Text Available Abstract Background Validation of a food frequency questionnaire (FFQ is important as incorrect information may lead to biased associations. Therefore the relative validity of an FFQ developed for use in the German Health Examination Survey for Adults 2008-2011 (DEGS was examined. Methods Cross-sectional comparisons of food consumption data from the FFQ and from two 24-hour recalls were made in a sample of 161 participants (aged 18 to 80 years of an ongoing nationwide survey, the German National Nutrition Monitoring (NEMONIT. The data collection took place from November 2008 to April 2009. Results Spearman rank correlations between the FFQ and the 24-hour dietary recalls ranged from 0.15 for pizza to 0.80 for tea, with two third of the correlation coefficients exceeding 0.30. All correlation coefficients were statistically significant except those for pizza and cooked vegetables. The proportion of participants classified into the same or adjacent quartile of intake assessed by both methods varied between 68% for cooked vegetables and 94% for coffee. There were no statistically significant differences in food consumption estimates between both methods for 38% of the food groups. For the other food groups, the estimates of food consumption by the FFQ were not generally higher or lower than estimates from the 24-hour dietary recalls. Conclusions The FFQ appears to be reasonably valid in the assessment of food consumption of German adults. For some food groups, such as raw and cooked vegetables, relative risks estimates should be interpreted with caution because of the poor ranking agreement.

  1. Performance evaluation of the food and environmental monitoring radio-analytical laboratory in Ghana

    International Nuclear Information System (INIS)

    Agyeman, Lilian Ataa

    2016-06-01

    Since the establishment of the Radiation Protection Institute’s Food and Environmental Laboratory in 1988, there has never been any thorough evaluation of the activities of the facility to provide assurance of the quality of analytical results produced by the laboratory. The objective of this study, therefore, was to assess the performance level of the Food and Environmental monitoring laboratory with respect to the requirements for a standard analytical laboratory (IAEA, 1989) and ISO 17025. The study focused on the performance of the Gamma Spectrometry laboratory of the Radiation Protection Institute, Ghana Atomic Energy Commission which has been involved in monitoring of radionuclides in food and environmental samples. In doing that, data from 1988 to 2015 was reviewed to ascertain whether the Laboratory has being performing as required in providing quality results on food and environmental samples measured. Besides this data (records kept), the evaluation also covered some Technical Quality Control measures, such as Energy and Efficiency Calibration, that need to be put in place for such laboratories. The laboratory meets almost all conditions and equipment requirements of IAEA (1989), however the laboratory falls short of the management requirements of ISO 17025. Based on the results it was recommended, among others, that management of the laboratory should ensure there are procedures for how calibration and testing is performed for different types of equipment and also the competence of all who operate specific equipment, perform tests, evaluate results and sign test reports ensured. (au)

  2. Microbial diversity and structure are drivers of the biological barrier effect against Listeria monocytogenes in soil.

    Science.gov (United States)

    Vivant, Anne-Laure; Garmyn, Dominique; Maron, Pierre-Alain; Nowak, Virginie; Piveteau, Pascal

    2013-01-01

    Understanding the ecology of pathogenic organisms is important in order to monitor their transmission in the environment and the related health hazards. We investigated the relationship between soil microbial diversity and the barrier effect against Listeria monocytogenes invasion. By using a dilution-to-extinction approach, we analysed the consequence of eroding microbial diversity on L. monocytogenes population dynamics under standardised conditions of abiotic parameters and microbial abundance in soil microcosms. We demonstrated that highly diverse soil microbial communities act as a biological barrier against L. monocytogenes invasion and that phylogenetic composition of the community also has to be considered. This suggests that erosion of diversity may have damaging effects regarding circulation of pathogenic microorganisms in the environment.

  3. The effect of milk components and storage conditions on the virulence of Listeria monocytogenes as determined by a Caco-2 cell assay.

    Science.gov (United States)

    Pricope-Ciolacu, Luminita; Nicolau, Anca Ioana; Wagner, Martin; Rychli, Kathrin

    2013-08-16

    Nearly all cases of human listeriosis have been associated with consumption of contaminated food, therefore the investigation of the virulence of Listeria (L.) monocytogenes after exposure to environmental conditions in food matrices is critical in order to understand and control its impact on public health. As milk and dairy products have been implicated in more than half of the listeriosis outbreaks, we investigated the in vitro virulence of L. monocytogenes incubated in different milk types at various storage conditions. Incubation in pasteurized milk at refrigeration conditions (4°C) revealed a higher invasion and intracellular proliferation of four different L. monocytogenes strains compared to raw milk using human intestinal epithelial Caco-2 cells. Furthermore the period of storage, which increased L. monocytogenes cell numbers, decreased in vitro virulence. However, L. monocytogenes stored for 3weeks at 4°C in milk are still able to invade and proliferate into the host cell. Interestingly abused storage temperatures (25°C and 30°C) for a short time period (2h) revealed an attenuated impact on the in vitro virulence of L. monocytogenes compared to the storage temperature of 4°C. Regarding the major milk compounds, the level of milk fat significantly affected the in vitro virulence of L. monocytogenes. Pre-incubation in milk with high fat content (3.6%) resulted in a lower invasion capability compared to milk with low fat content. In contrast casein and lactose did not influence the invasiveness of L. monocytogenes into the host cell. In conclusion our study shows that the milk environment and different storage conditions influence the in vitro virulence of L. monocytogenes, both of which have to be considered in the risk assessment of contaminated food. Copyright © 2013 Elsevier B.V. All rights reserved.

  4. Morphological and Physiological Characterization of Listeria monocytogenes Subjected to High Hydrostatic Pressure

    Science.gov (United States)

    Ritz, M.; Tholozan, J. L.; Federighi, M.; Pilet, M. F.

    2001-01-01

    High hydrostatic pressure is a new food preservation technology known for its capacity to inactivate spoilage and pathogenic microorganisms. That inactivation is usually assessed by the number of colonies growing on solid media after treatment. Under normal conditions the method does not permit recovery of damaged cells and may underestimate the number of cells that will remain viable and grow after a few days in high-pressure-processed foodstuffs. This study investigated the damage inflicted on Listeria monocytogenes cells treated by high pressure for 10 min at 400 MPa in pH 5.6 citrate buffer. Under these conditions, no cell growth occurred after 48 h on plate count agar. Scanning electron microscopy, light scattering by flow cytometry, and cell volume measurements were compared to evaluate the morphological changes in cells after pressurization. All these methods revealed that cellular morphology was not really affected. Esterase activity, as assessed either by enzymatic activity assays or by carboxy fluorescein diacetate fluorescence monitored by flow cytometry, was dramatically lowered, but not totally obliterated, under the effects of treatment. The measurement of propidium iodide uptake followed by flow cytometry demonstrated that membrane integrity was preserved in a small part of the population, although the membrane potential measured by analytical methods or evaluated by oxonol uptake was reduced from −86 to −5 mV. These results showed that such combined methods as fluorescent dyes monitored by flow cytometry and physiological activity measurements provide valuable indications of cellular viability. PMID:11319107

  5. Monitoring of perchlorate in diverse foods and its estimated dietary exposure for Korea populations.

    Science.gov (United States)

    Lee, Ji-Woo; Oh, Sung-Hee; Oh, Jeong-Eun

    2012-12-01

    The perchlorate concentrations in various Korean food samples were monitored, and 663 samples belonging to 39 kinds of food were analyzed. The analysis results revealed that dairy products contain the highest average concentration of 6.34 μg/kg and high detection frequency of over 85%. Fruit and vegetables showed the next highest perchlorate concentration with an average of 6.17 μg/kg. Especially, with its average concentration of 39.9 μg/kg, spinach showed the highest perchlorate level among all target food samples studied. Tomato was followed by spinach, which showed a high perchlorate average concentration of 19.8 μg/kg, and over 7 μg/kg was detected in ham and sausage (avg. 7.31 μg/kg) and in instant noodles (avg. 7.58 μg/kg). Less than 2 μg/kg was detected in fishes, meats and beverages. The exposure dose of perchlorate in Korean by food intake was calculated on the basis of the analyzed perchlorate levels in this study. The daily perchlorate dose to which Korean adults are exposed is 0.04 μg/kg bw/day, which is lower than the RfD (0.7 μg/kg bw/day) value suggested by US NAS. This result indicates that Korean people's current exposure to perchlorate from domestic food consumption is evaluated as safe. Copyright © 2012 Elsevier B.V. All rights reserved.

  6. Monitoring the prevalence of genetically modified maize in commercial animal feeds and food products in Turkey.

    Science.gov (United States)

    Turkec, Aydin; Lucas, Stuart J; Karlık, Elif

    2016-07-01

    EU legislation strictly controls use of genetically modified (GM) crops in food and feed products, and requires them to be labelled if the total GM content is greater than 9 g kg(-1) (for approved GM crops). We screened maize-containing food and feed products from Turkey to assess the prevalence of GM material. With this aim, 83 food and feed products - none labelled as containing GM material - were screened using multiplex real-time polymerase chain reaction (PCR) for four common GM elements (35S/NOS/bar/FMV). Of these, 18.2% of feeds and 6% of food samples tested positive for one or more of these elements, and were subjected to event-specific PCR to identify which GM organisms they contained. Most samples were negative for the approved GM events tested, suggesting that they may contain adventitious GM contaminants. One sample was shown to contain an unapproved GM event (MON810, along with GA21) at a concentration well above the statutory labelling requirement. Current legislation has restricted the penetration of GM maize into the Turkish food industry but not eliminated it, and the proliferation of different GM events is making monitoring increasingly complex. Our results indicate that labelling requirements are not being followed in some cases. © 2015 Society of Chemical Industry. © 2015 Society of Chemical Industry.

  7. Monitoring obesity prevalence in the United States through bookmarking activities in online food portals.

    Directory of Open Access Journals (Sweden)

    Christoph Trattner

    Full Text Available Studying the impact of food consumption on people's health is a serious matter for its implications on public policy, but it has traditionally been a slow process since it requires information gathered through expensive collection processes such as surveys, census and systematic reviews of research articles. We argue that this process could be supported and hastened using data collected via online social networks. In this work we investigate the relationships between the online traces left behind by users of a large US online food community and the prevalence of obesity in 47 states and 311 counties in the US. Using data associated with the recipes bookmarked over an 9-year period by 144,839 users of the Allrecipes.com food website residing throughout the US, several hierarchical regression models are created to (i shed light on these relations and (ii establish their magnitude. The results of our analysis provide strong evidence that bookmarking activities on recipes in online food communities can provide a signal allowing food and health related issues, such as obesity to be better understood and monitored. We discover that higher fat and sugar content in bookmarked recipes is associated with higher rates of obesity. The dataset is complicated, but strong temporal and geographical trends are identifiable. We show the importance of accounting for these trends in the modeling process.

  8. Monitoring obesity prevalence in the United States through bookmarking activities in online food portals.

    Science.gov (United States)

    Trattner, Christoph; Parra, Denis; Elsweiler, David

    2017-01-01

    Studying the impact of food consumption on people's health is a serious matter for its implications on public policy, but it has traditionally been a slow process since it requires information gathered through expensive collection processes such as surveys, census and systematic reviews of research articles. We argue that this process could be supported and hastened using data collected via online social networks. In this work we investigate the relationships between the online traces left behind by users of a large US online food community and the prevalence of obesity in 47 states and 311 counties in the US. Using data associated with the recipes bookmarked over an 9-year period by 144,839 users of the Allrecipes.com food website residing throughout the US, several hierarchical regression models are created to (i) shed light on these relations and (ii) establish their magnitude. The results of our analysis provide strong evidence that bookmarking activities on recipes in online food communities can provide a signal allowing food and health related issues, such as obesity to be better understood and monitored. We discover that higher fat and sugar content in bookmarked recipes is associated with higher rates of obesity. The dataset is complicated, but strong temporal and geographical trends are identifiable. We show the importance of accounting for these trends in the modeling process.

  9. Effect of Filling Type and Heating Method on Prevalence of Listeria species and Listeria monocytogenes in Dumplings Produced in Poland.

    Science.gov (United States)

    Szymczak, Barbara; Dąbrowski, Waldemar

    2015-05-01

    The count of Listeria monocytogenes was determined, before and after heat treatment, in 200 samples of dumplings of 9 brands and with different types of stuffing. Analyses were conducted according to ISO 11290-1 standard and with real-time PCR method. The highest count of L. monocytogenes was found in meat dumplings (10(2) to 10(4) CFU/g), whereas products with white cheese-potato stuffing and vegetable-mushroom stuffing contained significantly less Listeria, 20 to 80 and 5 to 32 CFU/g, respectively. In cooled meat dumplings the extent of contamination depended significantly on the producer. In addition, a significant (P monocytogenes in meat dumplings. In contrast, the microwave heating applied for 2 min at 600 W only reduced the count of L. monocytogenes by 1 to 2 logs. Hence, the microwave heating failed to reduce the risk of infection with this pathogen below the level permissible in the EU regulation, especially in the most contaminated samples. In this case, the efficacy of microwave heating was significantly (P monocytogenes (rho = 0.626), then by meat content in the stuffing (0.476), and to the lowest extent--by the type of meat (0.415 to 0.425). However, no Listeria sp. and L. monocytogenes were isolated from cooked dumplings with fruits (strawberries or blueberries). © 2015 Institute of Food Technologists®

  10. The Response Regulator ResD Plays a Role in Metabolism of Listeria monocytogenes

    DEFF Research Database (Denmark)

    Larsen, Marianne Halberg; Sørensen, Martine; Ingmer, Hanne

    to be transmitted to food processing plants from where it can establish and survive for extended periods of time contaminating processed food products. Recently we have identified the response regulator ResD of L. monocytogenes and showed that it is important for growth in laboratory media and for sugar uptake...... in the upstream regulatory region of several genes of L. monocytogenes and the binding of the ResD protein to some of these regulatory regions upstream putative target genes is analysed by electrophoretic mobility shift assays (EMSAs). In conclusion, the response regulator ResD act is important for metabolisme...

  11. Genotypes Associated with Listeria monocytogenes Isolates Displaying Impaired or Enhanced Tolerances to Cold, Salt, Acid, or Desiccation Stress

    Science.gov (United States)

    Hingston, Patricia; Chen, Jessica; Dhillon, Bhavjinder K.; Laing, Chad; Bertelli, Claire; Gannon, Victor; Tasara, Taurai; Allen, Kevin; Brinkman, Fiona S. L.; Truelstrup Hansen, Lisbeth; Wang, Siyun

    2017-01-01

    The human pathogen Listeria monocytogenes is a large concern in the food industry where its continuous detection in food products has caused a string of recalls in North America and Europe. Most recognized for its ability to grow in foods during refrigerated storage, L. monocytogenes can also tolerate several other food-related stresses with some strains possessing higher levels of tolerances than others. The objective of this study was to use a combination of phenotypic analyses and whole genome sequencing to elucidate potential relationships between L. monocytogenes genotypes and food-related stress tolerance phenotypes. To accomplish this, 166 L. monocytogenes isolates were sequenced and evaluated for their ability to grow in cold (4°C), salt (6% NaCl, 25°C), and acid (pH 5, 25°C) stress conditions as well as survive desiccation (33% RH, 20°C). The results revealed that the stress tolerance of L. monocytogenes is associated with serotype, clonal complex (CC), full length inlA profiles, and the presence of a plasmid which was identified in 55% of isolates. Isolates with full length inlA exhibited significantly (p monocytogenes sequence types, a new inlA PMSC, and several connections between CCs and the presence/absence or variations of specific genetic elements. A whole genome single-nucleotide-variants phylogeny revealed sporadic distribution of tolerant isolates and closely related sensitive and tolerant isolates, highlighting that minor genetic differences can influence the stress tolerance of L. monocytogenes. Specifically, a number of cold and desiccation sensitive isolates contained PMSCs in σB regulator genes (rsbS, rsbU, rsbV). Collectively, the results suggest that knowing the sequence type of an isolate in addition to screening for the presence of full-length inlA and a plasmid, could help food processors and food agency investigators determine why certain isolates might be persisting in a food processing environment. Additionally, increased

  12. A Modernized System for Agricultural Monitoring for Food Security in Tanzania

    Science.gov (United States)

    Dempewolf, J.; Nakalembe, C. L.; Becker-Reshef, I.; Justice, C. J.; Tumbo, S.; Mbilinyi, B.; Maurice, S.; Mtalo, M.

    2016-12-01

    Accurate and timely information on agriculture, particularly in many countries dominated by complex smallholder, subsistence agricultural systems is often difficult to obtain or not available. This includes up-to-date information during the growing season on crop type, crop area and crop condition such as developmental stage, damage from pests and diseases, drought or flooding. These data are critical for government decision making on production forecasts, planning for commodity market transactions, food aid delivery, responding to disease outbreaks and for implementing agricultural extension and development efforts. In Tanzania we have been working closely with the National Food Security Division (NFSD) at the Ministry of Agriculture, Livestock and Fisheries (MALF) on designing and implementing an advanced agricultural monitoring system, utilizing satellite remote sensing, smart phone and internet technologies. Together with our local implementing partner, the Sokoine University of Agriculture we trained a large number of agricultural extension agents in different regions of Tanzania to deliver field data in near-realtime. Using our collaborative internet portal (Crop Monitor) the team of analysts compiles pertinent information on current crop and weather conditions from throughout the country in a standardized, consistent manner. Using the portal traditionally collected data are combined with electronically collected field data and MODIS satellite image time series from GLAM East-Africa (Global Agricultural Monitoring System, customized for stakeholders in East Africa). The main outcome of this work has been the compilation of the National Food Security Bulletin for Tanzania with plans for a public release and the intention for it to become the main avenue to dispense current updates and analysis on agriculture in the country. The same information is also a potential contribution to the international Early Warning Crop Monitor, which currently covers Tanzania

  13. Comparison of the Prevalences and Diversities of Listeria Species and Listeria monocytogenes in an Urban and a Rural Agricultural Watershed.

    Science.gov (United States)

    Stea, Emma C; Purdue, Laura M; Jamieson, Rob C; Yost, Chris K; Truelstrup Hansen, Lisbeth

    2015-06-01

    Foods and related processing environments are commonly contaminated with the pathogenic Listeria monocytogenes. To investigate potential environmental reservoirs of Listeria spp. and L. monocytogenes, surface water and point source pollution samples from an urban and a rural municipal water supply watershed in Nova Scotia, Canada, were examined over 18 months. Presumptive Listeria spp. were cultured from 72 and 35% of rural and urban water samples, respectively, with 24% of the positive samples containing two or three different Listeria spp. The L. innocua (56%) and L. welshimeri (43%) groups were predominant in the rural and urban watersheds, respectively. Analysis by the TaqMan assay showed a significantly (P monocytogenes of 62% versus 17% by the culture-based method. Both methods revealed higher prevalences in the rural watershed and during the fall and winter seasons. Elevated Escherichia coli (≥ 100 CFU/100 ml) levels were not associated with the pathogen regardless of the detection method. Isolation of Listeria spp. were associated with 70 times higher odds of isolating L. monocytogenes (odds ratio = 70; P monocytogenes isolates, followed by IVb (16.1%), IIb (15.8%), and IIc (0.4%). L. monocytogenes was detected in cow feces and raw sewage but not in septic tank samples. Pulsotyping of representative water (n = 54) and local human (n = 19) isolates suggested genetic similarities among some environmental and human L. monocytogenes isolates. In conclusion, temperate surface waters contain a diverse Listeria species population and could be a potential reservoir for L. monocytogenes, especially in rural agricultural watersheds. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  14. Electronic Field Data Collection in Support of Satellite-Based Food Security Monitoring in Tanzania

    Science.gov (United States)

    Nakalembe, C. L.; Dempewolf, J.; Justice, C. J.; Becker-Reshef, I.; Tumbo, S.; Maurice, S.; Mbilinyi, B.; Ibrahim, K.; Materu, S.

    2016-12-01

    In Tanzania agricultural extension agents traditionally collect field data on agriculture and food security on paper, covering most villages throughout the country. The process is expensive, slow and cumbersome and prone to data transcription errors when the data get entered at the district offices into electronic spreadsheets. Field data on the status and condition of agricultural crops, the population's nutritional status, food storage levels and other parameters are needed in near realtime for early warning to make critical but most importantly timely and appropriate decisions that are informed with verified data from the ground. With the ubiquitous distribution of cell phones, which are now used by the vast majority of the population in Tanzania including most farmers, new, efficient and cost-effective methods for field data collection have become available. Using smartphones and tablets data on crop conditions, pest and diseases, natural disasters and livelihoods can be collected and made available and easily accessible in near realtime. In this project we implemented a process for obtaining high quality electronic field data using the GeoODK application with a large network of field extension agents in Tanzania and Uganda. These efforts contribute to work being done on developing an advanced agriculture monitoring system for Tanzania, incorporating traditional data collection with satellite information and field data. The outcomes feed directly into the National Food Security Bulletin for Tanzania produced by the Ministry of Agriculture as well as a form a firm evidence base and field scale monitoring of the disaster risk financing in Uganda.

  15. BiomaSoft: data processing system for monitoring and evaluating food and energy production. Part I

    International Nuclear Information System (INIS)

    Quevedo, J. R.; Suárez, J.

    2015-01-01

    The integrated food and energy production in Cuba demands to process diverse and voluminous information to make local, sectoral and national decisions, in order to have incidence on public policies, for which the support of automated systems that facilitate the monitoring and evaluation (M&E) of the integrated food and energy production in Cuban municipalities is necessary. The objective of this research was to identify the tools for the design of the data processing system BiomaSoft and to contextualize its application environment. The software development methodology was RUP (Rational Unified Process), with UML (Unified Modeling Language) as modeling language and PHP (Hypertext Pre-Processor) as programming language. The environment was conceptualized through a dominion model and the functional and non-functional requisites that should be fulfilled, as well as the Use Case Diagram of the system, with the description of actors, were specified. For the display of BiomaSoft a configuration based on two types of physical nodes (a web server and client computers) was conceived, in the municipalities that participate in the project «Biomass as renewable energy source for Cuban rural areas» (BIOMAS-CUBA). It is concluded that the monitoring and evaluation of integrated food and energy production under Cuban conditions can be made through the automated system BiomaSoft, and the identification of tools for its design and the contextualization of its application environment contribute to this purpose. (author)

  16. Flagellar motility is critical for Listeria monocytogenes biofilm formation.

    Science.gov (United States)

    Lemon, Katherine P; Higgins, Darren E; Kolter, Roberto

    2007-06-01

    The food-borne pathogen Listeria monocytogenes attaches to environmental surfaces and forms biofilms that can be a source of food contamination, yet little is known about the molecular mechanisms of its biofilm development. We observed that nonmotile mutants were defective in biofilm formation. To investigate how flagella might function during biofilm formation, we compared the wild type with flagellum-minus and paralyzed-flagellum mutants. Both nonmotile mutants were defective in biofilm development, presumably at an early stage, as they were also defective in attachment to glass during the first few hours of surface exposure. This attachment defect could be significantly overcome by providing exogenous movement toward the surface via centrifugation. However, this centrifugation did not restore mature biofilm formation. Our results indicate that it is flagellum-mediated motility that is critical for both initial surface attachment and subsequent biofilm formation. Also, any role for L. monocytogenes flagella as adhesins on abiotic surfaces appears to be either minimal or motility dependent under the conditions we examined.

  17. Listeria Spp. and Listeria Monocytogenes Contamination in Ready-To-Eat Sandwiches Collected from Vending Machines.

    Science.gov (United States)

    Cossu, Francesca; Spanu, Carlo; Deidda, Silvia; Mura, Erica; Casti, Daniele; Pala, Carlo; Lamon, Sonia; Spanu, Vincenzo; Ibba, Michela; Marrocu, Elena; Scarano, Christian; Piana, Andrea; De Santis, Enrico Pietro Luigi

    2016-04-19

    Ready-to-eat (RTE) food is characterised by a long shelf-life at refrigerated temperature and can be consumed as such, without any treatment. The aim of the work was to evaluate the presence of Listeria spp. and Listeria monocytogenes in RTEs collected from refrigerated vending machines placed in hospital environment and accessible to the hospitalised patients. In 4 different sampling, 55 RTEs were collected from vending machines of six hospitals located in different areas of Sardinia region. All the samples were characterised by similar manufacturing process, such as the use of modified atmosphere packaging and belonged to 5 different producers. Listeria spp. was not countable using the enumeration method in all of the analysed samples. Using the detection method, Listeria spp. was recovered from 9 sandwich samples. Interestingly, 3 of these samples (5.5%) made by the manufacturer, were positive for L. monocytogenes contamination. The risk related to the L. monocytogenes presence in RTEs proportionally increases when food is introduced in susceptible environments , such as hospitals and consumed by susceptible people . Although the RTEs analysed showed values that complied with the European microbiological criteria for foodstuffs, the availability of these products in a susceptible environment should be carefully checked. Therefore, in order to limit the possible exposition to L. monocytogenes , more information on the risk related to RTE consumption should be provided to the hospitalised patients.

  18. Listeria spp. and Listeria monocytogenes contamination in ready-to-eat sandwiches collected from vending machines

    Directory of Open Access Journals (Sweden)

    Francesca Cossu

    2016-05-01

    Full Text Available Ready-to-eat (RTE food is characterised by a long shelf-life at refrigerated temperature and can be consumed as such, without any treatment. The aim of the work was to evaluate the presence of Listeria spp. and Listeria monocytogenes in RTEs collected from refrigerated vending machines placed in hospital environment and accessible to the hospitalised patients. In 4 different sampling, 55 RTEs were collected from vending machines of six hospitals located in different areas of Sardinia region. All the samples were characterised by similar manufacturing process, such as the use of modified atmosphere packaging and belonged to 5 different producers. Listeria spp. was not countable using the enumeration method in all of the analysed samples. Using the detection method, Listeria spp. was recovered from 9 sandwich samples. Interestingly, 3 of these samples (5.5% made by the manufacturer, were positive for L. monocytogenes contamination. The risk related to the L. monocytogenes presence in RTEs proportionally increases when food is introduced in susceptible environments, such as hospitals and consumed by susceptible people. Although the RTEs analysed showed values that complied with the European microbiological criteria for foodstuffs, the availability of these products in a susceptible environment should be carefully checked. Therefore, in order to limit the possible exposition to L. monocytogenes, more information on the risk related to RTE consumption should be provided to the hospitalised patients.

  19. Stevia rebaudiana Bertoni effect on the hemolytic potential of Listeria monocytogenes.

    Science.gov (United States)

    Sansano, S; Rivas, A; Pina-Pérez, M C; Martinez, A; Rodrigo, D

    2017-06-05

    The effect of Stevia rebaudiana Bertoni on the hemolytic potential of Listeria monocytogenes was studied by means of the assessment of the Listeriolysin O (LLO) production. The three factors under study, stevia concentration in the range [0-2.5] % (w/v), incubation temperature (10 and 37°C), and exposure time (0-65h) significantly affected (p≤0.05) the hemolytic activity of L. monocytogenes. Results showed that at the lower incubation temperature the hemolytic potential of the bacterium was significantly reduced, from 100% at 37°C to 8% at 10°C (after 65h of incubation) in unsupplemented substrate (0% stevia). Irrespective of the temperature, 10 or 37°C, supplementation of the medium with stevia at 2.5 % (w/v) reduced the bacterium's hemolytic activity by a maximum of 100%. Furthermore, the time of exposure to 2.5 % (w/v) stevia concentration was also a significant factor reducing the hemolytic capability of L. monocytogenes. The possibility of reducing the pathogenic potential of L. monocytogenes (hemolysis) by exposure to stevia should be confirmed in real food matrices, opening a research niche with a valuable future impact on food safety. Copyright © 2017 Elsevier B.V. All rights reserved.

  20. Isolation and detection of Listeria monocytogenes in poultry meat by standard culture methods and PCR

    Science.gov (United States)

    Kureljušić, J.; Rokvić, N.; Jezdimirović, N.; Kureljušić, B.; Pisinov, B.; Karabasil, N.

    2017-09-01

    Listeria is the genus of a bacteria found in soil and water and some animals, including poultry and cattle. It can be present in raw milk and food made from raw milk. It can also live in food processing plants and contaminate a variety of processed meats. Microscopically, Listeria species appear as small, Gram-positive rods, which are sometimes arranged in short chains. In direct smears, they can be coccoid, so they can be mistaken for streptococci. Longer cells can resemble corynebacteria. Flagella are produced at room temperature but not at 37°C. Haemolytic activity on blood agar has been used as a marker to distinguish Listeria monocytogenes among other Listeria species, but it is not an absolutely definitive criterion. Further biochemical characterization is necessary to distinguish between the different Listeria species. The objective of this study was to detect, isolate and identify Listeria monocytogenes from poultry meat. Within a period of six months from January to June 2017, a total of 15 samples were collected. Three samples were positive for the presence of Listeria monocytogenes. Biochemical and microbiological tests as well as PCR technique using specific primers were used to confirm L. Monocytogenes in the samples.

  1. Faecal shedding and strain diversity of Listeria monocytogenes in healthy ruminants and swine in Northern Spain

    Directory of Open Access Journals (Sweden)

    Hurtado Ana

    2009-01-01

    Full Text Available Abstract Background Listeria monocytogenes is among the most important foodborne bacterial pathogens due to the high mortality rate and severity of the infection. L. monocytogenes is a ubiquitous organism occasionally present in the intestinal tract of various animal species and faecal shedding by asymptomatically infected livestock poses a risk for contamination of farm environments and raw food at the pre-harvest stages. The aim of this study was to determine the prevalence and strain diversity of L. monocytogenes in healthy ruminants and swine herds. Results Faecal samples from 30 animals per herd were collected from 343 herds (120 sheep, 124 beef cattle, 82 dairy cattle and 17 swine in the Basque Country and screened in pools by an automated enzyme-linked fluorescent immunoassay (VIDAS® to estimate the prevalence of positive herds. Positive samples were subcultured onto the selective and differential agar ALOA and biochemically confirmed. L. monocytogenes was isolated from 46.3% of dairy cattle, 30.6% beef cattle and 14.2% sheep herds, but not from swine. Within-herd prevalence investigated by individually analysing 197 sheep and 221 cattle detected 1.5% of faecal shedders in sheep and 21.3% in cattle. Serotyping of 114 isolates identified complex 4b as the most prevalent (84.2%, followed by 1/2a (13.2%, and PFGE analysis of 68 isolates showed a highly diverse L. monocytogenes population in ruminant herds. Conclusion These results suggested that cattle represent a potentially important reservoir for L. monocytogenes in the Basque Country, and highlighted the complexity of pathogen control at the farm level.

  2. Inhibition of Listeria monocytogenes by propionic acid-based ingredients in cured deli-style Turkey.

    Science.gov (United States)

    Glass, Kathleen A; McDonnell, Lindsey M; Von Tayson, Roxanne; Wanless, Brandon; Badvela, Mani

    2013-12-01

    Listeria monocytogenes growth can be controlled on ready-to-eat meats through the incorporation of antimicrobial ingredients into the formulation or by postlethality kill steps. However, alternate approaches are needed to provide options that reduce sodium content but maintain protection against pathogen growth in meats after slicing. The objective of this study was to determine the inhibition of L. monocytogenes by propionic acid-based ingredients in high-moisture, cured turkey stored at 4 or 7°C. Six formulations of sliced, cured (120 ppm of NaNO2 ), deli-style turkey were tested, including control without antimicrobials, 3.2% lactate-diacetate blend (LD), 0.4% of a liquid propionate-benzoate-containing ingredient, or 0.3, 0.4, and 0.5% of a liquid propionate-containing ingredient. Products were inoculated with 5 log CFU L. monocytogenes per 100-g package (3 log CFU/ml rinsate), vacuum-sealed, and stored at 4 or 7°C for up to 12 weeks; and populations were enumerated by plating on modified Oxford agar. As expected, the control without antimicrobials supported rapid growth, with >2 log average per ml rinsate increase within 4 weeks of storage at 4°C, whereas growth was observed at 6 weeks for the LD treatment. For both replicate trials, all treatments that contained liquid propionate or propionate-benzoate limited L. monocytogenes growth to an increase of 1-log increase) was observed in individual samples for all propionate-containing treatments at weeks 10, 11, and 12. As expected, L. monocytogenes grew more rapidly when products were stored at 7°C, but trends in relative inhibition were similar to those observed at 4°C. These results verify that propionate-based ingredients inhibit growth of L. monocytogenes on sliced, high-moisture, cured turkey and can be considered as an alternative to reduce sodium-based salts while maintaining food safety.

  3. Prevalence, distribution, and diversity of Listeria monocytogenes in retail environments, focusing on small establishments and establishments with a history of failed inspections.

    Science.gov (United States)

    Hoelzer, Karin; Sauders, Brian D; Sanchez, Maria D; Olsen, Peter T; Pickett, Michele M; Mangione, Kurt J; Rice, Daniel H; Corby, Joe; Stich, Stephen; Fortes, Esther D; Roof, Sherry E; Grohn, Yrjo T; Wiedmann, Martin; Oliver, Haley F

    2011-07-01

    Despite growing concerns about cross-contamination of ready-to-eat foods with Listeria monocytogenes, our knowledge about the ecology and transmission of L. monocytogenes in retail establishments has remained limited. We conducted a cross-sectional study to characterize the prevalence, distribution, and subtype diversity of L. monocytogenes in 120 New York State retail deli establishments that were hypothesized to present an increased risk for environmental L. monocytogenes contamination (i.e., small establishments and establishments with a history of failed New York State Agriculture and Markets inspections). Analysis of these data along with previously reported data for 121 predominantly larger retail establishments in New York State identified establishment size, geographic location, and inspection history as significant predictors of L. monocytogenes presence and prevalence. The odds of an establishment being L. monocytogenes positive were approximately twice as high for large establishments, establishments located in New York City, or establishments with poor inspection history (as compared with establishments without these attributes), even though correlation between location and inspection history complicated interpretation of results. Within an establishment, L. monocytogenes was significantly more prevalent on nonfood contact surfaces than on food contact surfaces; prevalence was particularly high for floors and in floor drains, sinks, the dairy case, and milk crates. L. monocytogenes subtype diversity differed between sites, with lineage I isolates significantly associated with nonfood contact surfaces and lineage II isolates significantly associated with food contact surfaces. Isolates belonging to the same ribotype were often found dispersed across multiple sites within an operation. Copyright ©, International Association for Food Protection

  4. Changes in the frequency of food intake among children and teenagers: monitoring in a reference service.

    Science.gov (United States)

    Mariz, Larissa Soares; Medeiros, Carla Campos Muniz; Vieira, Caroline Evelin Nascimento Kluczynik; Enders, Bertha Cruz; Coura, Alexsandro Silva

    2013-01-01

    to identify changes in the food intake patterns among overweight children and teenagers, treated at a reference medical centre. the method used is that of a cohort study, between April 2010 and April 2011. A total of 109 children and teenagers, either obese or overweight, took part in the study. The population was divided into two subgroups depending on the permanence period (more than 6 months, and less than 6 months off the treatment). The chi-square test and logistic regression were carried out. the group which had been longer off the treatment tended to consume more soft drinks, pasta and fried foods, and less fruit and vegetables. The group with less time showed an improvement, with a reduction of consumption of soft drinks and other goodies. There was confirmation of an increased risk for consumption of soft drinks, pasta and goodies in general, as also detachment from the treatment in adolescence. The group with a longer period of monitoring has had a positive change in food intake frequency. The main contribution made by this study is that of showing that multiprofessional treatment, including some nursing care, is efficient in progressively changing the food intake of children and adolescents who are overweight.

  5. Monitoring of radioactive contamination in food and the environment 1986-1998

    International Nuclear Information System (INIS)

    Liland, Astrid; Skuterud, Lavrans; Bergan, Tone; Forseth, Torbjoern; Gaare, Eldar; Hellstroem, Turid

    2001-01-01

    The results from the national monitoring of radioactive contamination in food and the environment 1986-1998 are presented. The average 137Cs concentration is decreasing in cow's and goat's milk, sheep, reindeer and fresh water fish. Pasture and fungi are, on the contrary, not showing a general decreasing trend. The radioactivity in food and humans has been decreasing since 1987. The effective dose from intake is estimated to 0.02 mSv for an average Norwegian in 1998. Vulnerable groups may have received doses up to 0.4 mSv. One cannot rule out the possibility that some individuals in these groups have received doses superior to 1 mSv/year. (Author)

  6. Radio sensibility of listeria monocytogenes in pure culture and frozen contaminated shrimps and stored them at -18 deg C

    International Nuclear Information System (INIS)

    Rubio M V, T.; Espinoza, J.; L Sanchez, M.V.

    1997-01-01

    Full text: Listeria monocytogenes has been recognized for a number of years as a food pathogen bacteria. Ionizing radiation is a new technology and an excellent method to eliminate this microorganism form frozen food. The sensitivity of Listeria monocytogenes serotype 01 and 04 to irradiation, in pure culture and frozen shrimps was investigated. The D 10 values were of 0,26-0,37 kGy in pure culture and frozen shrimps, respectively. The D 10 founded were similar to those reported by the literature under similar conditions. Doses of 6 kGy were enough to eliminate a contamination of 10 6 -10 7 ufc/ml of L. Monocytogenes in frozen shrimps and storage them during 200 days at 18 deg C

  7. Comparative genomics of human and non-human Listeria monocytogenes sequence type 121 strains.

    Directory of Open Access Journals (Sweden)

    Kathrin Rychli

    Full Text Available The food-borne pathogen Listeria (L. monocytogenes is able to survive for months and even years in food production environments. Strains belonging to sequence type (ST121 are particularly found to be abundant and to persist in food and food production environments. To elucidate genetic determinants characteristic for L. monocytogenes ST121, we sequenced the genomes of 14 ST121 strains and compared them with currently available L. monocytogenes ST121 genomes. In total, we analyzed 70 ST121 genomes deriving from 16 different countries, different years of isolation, and different origins-including food, animal and human ST121 isolates. All ST121 genomes show a high degree of conservation sharing at least 99.7% average nucleotide identity. The main differences between the strains were found in prophage content and prophage conservation. We also detected distinct highly conserved subtypes of prophages inserted at the same genomic locus. While some of the prophages showed more than 99.9% similarity between strains from different sources and years, other prophages showed a higher level of diversity. 81.4% of the strains harbored virtually identical plasmids. 97.1% of the ST121 strains contain a truncated internalin A (inlA gene. Only one of the seven human ST121 isolates encodes a full-length inlA gene, illustrating the need of better understanding their survival and virulence mechanisms.

  8. Adenylate kinase amplification of ATP bioluminescence for hygiene monitoring in the food and beverage industry.

    Science.gov (United States)

    Corbitt, A J; Bennion, N; Forsythe, S J

    2000-06-01

    Fourteen food residues, Escherichia coli O157:H7 and Staphylococcus aureus on stainless steel surfaces were detected using a combined assay with adenylate kinase as a cellular marker and ATP bioluminescence. The limit of sensitivity ranged from 0.02 to 708 microg for minced meat and broccoli, respectively. Both methods gave the same detection limit (105 cfu) for E. coli and Staph. aureus on stainless steel surfaces. The combined adenylate kinase-ATP assay is applicable to monitor the hygiene of work surfaces, especially those prone to contamination by meat and vegetable residues.

  9. High hydrostatic pressure effects on Listeria monocytogenes and L. innocua: Evidence for variability in inactivation behaviour and in resistance to pediocin bacHA-6111-2.

    Science.gov (United States)

    Bruschi, Carolina; Komora, Norton; Castro, Sónia Marília; Saraiva, Jorge; Ferreira, Vânia Borges; Teixeira, Paula

    2017-06-01

    The effect of high hydrostatic pressure (HHP) on the survival of 14 strains of Listeria monocytogenes from food or clinical origins, selected to represent different pheno and genotypes, was evaluated. Stationary phase cells were submitted to 300, 400 and 500 MPa at 10 °C, for 5 min. A high variability in the resistance of L. monocytogenes to pressure was observed, and particularly two strains isolated from food were significantly more baroresistant than the rest. Strains of L. monocytogenes resistant to one or more antibiotics exhibited significantly higher levels of survival after the high pressure treatment at 400 MPa. No correlation was found between strains' origin or thermal tolerance and resistance to HHP. The suitability of two strains of L. innocua as surrogates of L. monocytogenes, was also investigated. These exhibited significantly higher sensitivities to HHP than observed for some L. monocytogenes. The antimicrobial effect of the antilisterial bacteriocin (bacHA-6111-2) increased after L. monocytogenes cells had been exposed to pressure. The data obtained underlines the importance of strain selection for studies aiming to evaluate HHP efficacy to ensure safety of HHP-treated foods. Copyright © 2017 Elsevier Ltd. All rights reserved.

  10. Attribution of Human Listeria monocytogenes Infections in England and Wales to Ready-to-Eat Food Sources Placed on the Market: Adaptation of the Hald Salmonella Source Attribution Model

    DEFF Research Database (Denmark)

    Little, Christine L.; Pires, Sara Monteiro; Gillespie, Iain A.

    2010-01-01

    the potential of this approach to quantify the contribution of different food sources to the burden of human listeriosis in England and Wales from 2004 to 2007. The most important food sources for the overall population were multicomponent foods (sandwiches and prepacked mixed salad vegetables) (23.1%), finfish...

  11. INFORMAS (International Network for Food and Obesity/non-communicable diseases Research, Monitoring and Action Support): summary and future directions.

    Science.gov (United States)

    Kumanyika, S

    2013-10-01

    This supplement presents the foundational elements for INFORMAS (International Network for Food and Obesity/non-communicable diseases Research, Monitoring and Action Support). As explained in the overview article by Swinburn and colleagues, INFORMAS has a compelling rationale and has set forth clear objectives, outcomes, principles and frameworks for monitoring and benchmarking key aspects of food environments and the policies and actions that influence the healthiness of food environments. This summary highlights the proposed monitoring approaches for the 10 interrelated INFORMAS modules: public and private sector policies and actions; key aspects of food environments (food composition, labelling, promotion, provision, retail, prices, and trade and investment) and population outcomes (diet quality). This ambitious effort should be feasible when approached in a step-wise manner, taking into account existing monitoring efforts, data sources, country contexts and capacity, and when adequately resourced. After protocol development and pilot testing of the modules, INFORMAS aims to be a sustainable, low-cost monitoring framework. Future directions relate to institutionalization, implementation and, ultimately, to leveraging INFORMAS data in ways that will bring key drivers of food environments into alignment with public health goals. © 2013 The Authors. Obesity Reviews published by John Wiley & Sons Ltd on behalf of the International Association for the Study of Obesity.

  12. Listeria monocytogenes contamination of the environment and surfaces of the equipment in the meat processing facilities in republic of Macedonia

    OpenAIRE

    Dean Jankuloski; Pavle Sekulovski; Risto Prodanov; Zehra Hajrulai Musliu; Biljana Stojanovska Dimzovska

    2007-01-01

    Listeria monocytogenes contamination of the environment and surfaces of the equipment was examined in seven meat processing facilities. Up to date prevalence of this foodborn pathogen in meat processing facilities facilities in Republic of Macedonia was unknown. Biofilms are composed from food spoilage microorganisms and food born pathogens. They are located on the surfaces of the equipment that come in contact with food and in facilities environment. Microorganisms in biofilm presenting micr...

  13. Predictive Food Microbiology

    DEFF Research Database (Denmark)

    Østergaard, Nina Bjerre

    Listeria monocytogenes is a well-known food borne pathogen that potentially causes listeriosis. No outbreaks or cases of listeriosis have been associated with cottage cheese, but several confirmed cases and outbreaks in the EU and the US have been related to dairy products made from raw...... or pasteurised milk. This, in combination with the fact that cottage cheese support growth of Listeria monocytogenes, induces a documentation requirement on the food producer. In the EU regulatory framework, mathematical models are recognised as a suitable supplement to traditional microbiological methods....... The models can be used for documentation of compliance with microbiological criteria for Listeria monocytogenes under reasonably foreseeable conditions. Cottage cheese is a fresh, fermented dairy product. It consists of a fermented cheese curd mixed with a fresh or cultured cream dressing. The product...

  14. Wildlife feeding in parks: methods for monitoring the effectiveness of educational interventions and wildlife food attraction behaviors

    Science.gov (United States)

    Marion, Jeffrey L.; Dvorak, Robert G.; Manning, Robert E.

    2008-01-01

    Opportunities to view and interact with wildlife are often an important part of high quality recreational experiences. Such interactions frequently include wildlife feeding, resulting in food-conditioned behaviors that may cause harm to both wildlife and visitors. This study developed and applied efficient protocols for simultaneously evaluating wildlife feeding-related behaviors of visitors and related foraging behaviors of chipmunks along a trail in Zion National Park. Unobtrusive observation protocols permitted an evaluation of educational messages delivered, and documentation of wildlife success in obtaining human food and the strength of their food attraction behavior. Significant improvements were documented for some targeted visitor behaviors and human food available to chipmunks, with minor differences between treatments. Replication of these protocols as part of a long-term monitoring program can help protected area managers evaluate and improve the efficacy of their interventions and monitor the strength of food attraction behavior in wildlife.

  15. Cleaning and Disinfection of Biofilms Composed of Listeria monocytogenes and Background Microbiota from Meat Processing Surfaces

    Science.gov (United States)

    Møretrø, Trond; Heir, Even; Briandet, Romain; Langsrud, Solveig

    2017-01-01

    ABSTRACT Surfaces of food processing premises are exposed to regular cleaning and disinfection (C&D) regimes, using biocides that are highly effective against bacteria growing as planktonic cells. However, bacteria growing in surface-associated communities (biofilms) are typically more tolerant toward C&D than their individual free-cell counterparts, and survival of pathogens such as Listeria monocytogenes may be affected by interspecies interactions within biofilms. In this study, Pseudomonas and Acinetobacter were the most frequently isolated genera surviving on conveyor belts subjected to C&D in meat processing plants. In the laboratory, Pseudomonas, Acinetobacter, and L. monocytogenes dominated the community, both in suspensions and in biofilms formed on conveyor belts, when cultures were inoculated with eleven-genus cocktails of representative bacterial strains from the identified background flora. When biofilms were exposed to daily C&D cycles mimicking treatments used in food industry, the levels of Acinetobacter and Pseudomonas mandelii diminished, and biofilms were instead dominated by Pseudomonas putida (65 to 76%), Pseudomonas fluorescens (11 to 15%) and L. monocytogenes (3 to 11%). The dominance of certain species after daily C&D correlated with high planktonic growth rates at 12°C and tolerance to C&D. In single-species biofilms, L. monocytogenes developed higher tolerance to C&D over time, for both the peracetic acid and quaternary ammonium disinfectants, indicating that a broad-spectrum mechanism was involved. Survival after C&D appeared to be a common property of L. monocytogenes strains, as persistent and sporadic subtypes showed equal survival rates in complex biofilms. Biofilms established preferentially in surface irregularities of conveyor belts, potentially constituting harborage sites for persistent contamination. IMPORTANCE In the food industry, efficient production hygiene is a key measure to avoid the accumulation of spoilage bacteria and

  16. Cleaning and disinfection of biofilms composed of Listeria monocytogenes and background microbiota from meat processing surfaces.

    Science.gov (United States)

    Fagerlund, Annette; Møretrø, Trond; Heir, Even; Briandet, Romain; Langsrud, Solveig

    2017-06-30

    Surfaces of food processing premises are exposed to regular cleaning and disinfection (C&D) regimes, using biocides that are highly effective against bacteria growing as planktonic cells. However, bacteria growing in surface associated communities (biofilms) are typically more tolerant towards C&D than their individual free cells counterparts, and survival of pathogens such as Listeria monocytogenes may be affected by interspecies interactions within biofilms. In this study, Pseudomonas and Acinetobacter were the most frequently isolated genera surviving on conveyor belts subjected to C&D in meat processing plants. In the laboratory, Pseudomonas , Acinetobacter and L. monocytogenes dominated the community both in suspensions and in biofilms formed on conveyor belts, when cultures were inoculated with eleven-genera cocktails of representative bacterial strains from the identified background flora. When biofilms were exposed to daily C&D cycles, mimicking treatments used in food industry, the levels of Acinetobacter and Pseudomonas mandelii diminished, and biofilms were instead dominated by Pseudomonas putida (65-76%), Pseudomonas fluorescens (11-15%) and L. monocytogenes (3-11%). The dominance of certain species after daily C&D correlated with high planktonic growth rates at 12°C and tolerance to C&D. In single-species biofilms, L. monocytogenes developed higher tolerance to C&D over time, both for the peracetic acid and quaternary ammonium disinfectant, indicating that a broad-spectrum mechanism was involved. Survival after C&D appeared to be a common property of L. monocytogenes strains, as both persistent and sporadic subtypes showed equal survival in complex biofilms. Biofilms established preferentially in surface irregularities of conveyor belts, potentially constituting harborage sites for persistent contamination. IMPORTANCE In food industry, efficient production hygiene is a key measure to avoid accumulation of spoilage bacteria and eliminate pathogens

  17. Occurrence of Listeria monocytogenes in smoked fish in Sokoto ...

    African Journals Online (AJOL)

    STORAGESEVER

    2008-09-03

    Sep 3, 2008 ... monocytogenes and other Listeria species are common contaminant of smoked fish, and this may pose serious public health implications. Key words: Smoked fish, Listeria monocytogenes, contamination, public health. INTRODUCTION ... L. monocytogenes belong to the recently emerging psychrotrophic ...

  18. Listeria monocytogenes infection in pregnancy and neonatal sepsis

    Directory of Open Access Journals (Sweden)

    Francesca Pascale

    2008-06-01

    Full Text Available Authors report a fatal neonatal sepsis caused by Listeria monocytogenes. While the diagnostic procedure aimed to identify the microrganism is described, it is emphasized the importance to recover Streptococcus agalactiae (GBS and L. monocytogenes by means of vaginal-rectal swab culture. The intrapartum screening for L. monocytogenes, by Polymerase Chain Reaction (PCR providing results in 75 minutes is also evaluated.

  19. Listeria spp. E Listeria monocytogenes NA PRODUÇÃO DE SALSICHAS TIPO HOT DOG

    Directory of Open Access Journals (Sweden)

    ALESSANDRA PARO RODRIGUES CESAR

    2011-06-01

    Full Text Available Listeria monocytogenes is widely distributed in the environment and it has been isolated from food that were associated to outbreaks of high lethality in many countries. Thus, this bacterium represents an important pathogen to the public health. Ready-to-eat products, likecooked stuffed food, within them, frankfurters, are associated to human listeriosis in many countries. Taking into consideration the importance of the subject and the need of more data about it, the occurrence of Listeria spp. and L. monocytogenes in industrial plants, in meat raw materials, in slurry and frankfurters was investigated.These samples were collected in two production plants with SIF (Federal Inspection Service; in one of them GMP, HACCP and SOP were implemented. The results of the 1 06 microbiological analysis were submitted to the program @Risk to obtain the risk analysis; the meanvalues results showed that 7 to 9% of the frankfurters in the market may have L. monocytogenes. The analysis indicated that 88 strains of L. monocytogenes were obtained from 1 06 samples; among them, 76 werecollected in the industrial plants that participate in the experiment, and 30 were collected in the market. In serological typification, 95% of these strains were classified as serotypes 4b, 1 /2a and 1 /2b. Besides the presence of the bacterium in frankfurthers consumed inBrazil and the risk factors associated to this pathogen, the situation concerns because of the lack of epidemiological data, absence of patterns and the deficient information given to the consumer, specially information related to the presence of L. monocytogenes, particularly important to the groups at risk, as well as information related to the importance of heating the product

  20. An outbreak of febrile gastroenteritis associated with corn contaminated by Listeria monocytogenes.

    Science.gov (United States)

    Aureli, P; Fiorucci, G C; Caroli, D; Marchiaro, G; Novara, O; Leone, L; Salmaso, S

    2000-04-27

    On May 21, 1997, numerous cases of febrile gastrointestinal illness were reported among the students and staff of two primary schools in northern Italy, all of whom had eaten at cafeterias served by the same caterer. We interviewed people who ate at the cafeterias about symptoms and foods consumed on May 20. There were no samples of foods left at the cafeterias, but we tested routine samples taken on May 20 by the caterer and environmental specimens at the catering plant. The hospitalized patients were tested for common enteropathogens and toxins. Of the 2189 persons interviewed (82 percent of those exposed), 1566 (72 percent) reported symptoms; of these, 292 (19 percent) were hospitalized. Among samples obtained from hospitalized patients, all but two of the stool specimens and all blood specimens were negative for common enteropathogens. Listeria monocytogenes was isolated from one blood specimen and from 123 of the 141 stool specimens. Consumption of a cold salad of corn and tuna was associated with the development of symptoms (relative risk, 6.19; 95 percent confidence interval, 4.81 to 7.98; Pcaterer's sample of the salad and from environmental specimens collected from the catering plant. All listeria isolates were serotype 4b and were found to be identical on DNA analysis. Experimental contamination of sterile samples of the implicated foods showed that L. monocytogenes grew on corn when kept for at least 10 hours at 25 degrees C. Food-borne infection with L. monocytogenes can cause febrile illness with gastroenteritis in immunocompetent persons.

  1. Listeria monocytogenes behaviour in presence of non-UV-irradiated titanium dioxide nanoparticles.

    Directory of Open Access Journals (Sweden)

    Maria Grazia Ammendolia

    Full Text Available Listeria monocytogenes is the agent of listeriosis, a food-borne disease. It represents a serious problem for the food industry because of its environmental persistence mainly due to its ability to form biofilm on a variety of surfaces. Microrganisms attached on the surfaces are a potential source of contamination for environment and animals and humans. Titanium dioxide nanoparticles (TiO2 NPs are used in food industry in a variety of products and it was reported that daily exposure to these nanomaterials is very high. Anti-listerial activity of TiO2 NPs was investigated only with UV-irradiated nanomaterials, based on generation of reactive oxigen species (ROS with antibacterial effect after UV exposure. Since both Listeria monocytogenes and TiO2 NPs are veicolated with foods, this study explores the interaction between Listeria monocytogenes and non UV-irradiated TiO2 NPs, with special focus on biofilm formation and intestinal cell interaction. Scanning electron microscopy and quantitative measurements of biofilm mass indicate that NPs influence both production and structural architecture of listerial biofilm. Moreover, TiO2 NPs show to interfere with bacterial interaction to intestinal cells. Increased biofilm production due to TiO2 NPs exposure may favour bacterial survival in environment and its transmission to animal and human hosts.

  2. Hierarchical Satellite-based Approach to Global Monitoring of Crop Condition and Food Production

    Science.gov (United States)

    Zheng, Y.; Wu, B.; Gommes, R.; Zhang, M.; Zhang, N.; Zeng, H.; Zou, W.; Yan, N.

    2014-12-01

    The assessment of global food security goes beyond the mere estimate of crop production: It needs to take into account the spatial and temporal patterns of food availability, as well as physical and economic access. Accurate and timely information is essential to both food producers and consumers. Taking advantage of multiple new remote sensing data sources, especially from Chinese satellites, such as FY-2/3A, HJ-1 CCD, CropWatch has expanded the scope of its international analyses through the development of new indicators and an upgraded operational methodology. The new monitoring approach adopts a hierarchical system covering four spatial levels of detail: global (sixty-five Monitoring and Reporting Units, MRU), seven major production zones (MPZ), thirty-one key countries (including China) and "sub- countries." The thirty-one countries encompass more that 80% of both global exports and production of four major crops (maize, rice, soybean and wheat). The methodology resorts to climatic and remote sensing indicators at different scales, using the integrated information to assess global, regional, and national (as well as sub-national) crop environmental condition, crop condition, drought, production, and agricultural trends. The climatic indicators for rainfall, temperature, photosynthetically active radiation (PAR) as well as potential biomass are first analysed at global scale to describe overall crop growing conditions. At MPZ scale, the key indicators pay more attention to crops and include Vegetation health index (VHI), Vegetation condition index (VCI), Cropped arable land fraction (CALF) as well as Cropping intensity (CI). Together, they characterise agricultural patterns, farming intensity and stress. CropWatch carries out detailed crop condition analyses for thirty one individual countries at the national scale with a comprehensive array of variables and indicators. The Normalized difference vegetation index (NDVI), cropped areas and crop condition are

  3. Adelie penguin population diet monitoring by analysis of food DNA in scats.

    Directory of Open Access Journals (Sweden)

    Simon N Jarman

    Full Text Available The Adélie penguin is the most important animal currently used for ecosystem monitoring in the Southern Ocean. The diet of this species is generally studied by visual analysis of stomach contents; or ratios of isotopes of carbon and nitrogen incorporated into the penguin from its food. There are significant limitations to the information that can be gained from these methods. We evaluated population diet assessment by analysis of food DNA in scats as an alternative method for ecosystem monitoring with Adélie penguins as an indicator species. Scats were collected at four locations, three phases of the breeding cycle, and in four different years. A novel molecular diet assay and bioinformatics pipeline based on nuclear small subunit ribosomal RNA gene (SSU rDNA sequencing was used to identify prey DNA in 389 scats. Analysis of the twelve population sample sets identified spatial and temporal dietary change in Adélie penguin population diet. Prey diversity was found to be greater than previously thought. Krill, fish, copepods and amphipods were the most important food groups, in general agreement with other Adélie penguin dietary studies based on hard part or stable isotope analysis. However, our DNA analysis estimated that a substantial portion of the diet was gelatinous groups such as jellyfish and comb jellies. A range of other prey not previously identified in the diet of this species were also discovered. The diverse prey identified by this DNA-based scat analysis confirms that the generalist feeding of Adélie penguins makes them a useful indicator species for prey community composition in the coastal zone of the Southern Ocean. Scat collection is a simple and non-invasive field sampling method that allows DNA-based estimation of prey community differences at many temporal and spatial scales and provides significant advantages over alternative diet analysis approaches.

  4. Adélie penguin population diet monitoring by analysis of food DNA in scats.

    Science.gov (United States)

    Jarman, Simon N; McInnes, Julie C; Faux, Cassandra; Polanowski, Andrea M; Marthick, James; Deagle, Bruce E; Southwell, Colin; Emmerson, Louise

    2013-01-01

    The Adélie penguin is the most important animal currently used for ecosystem monitoring in the Southern Ocean. The diet of this species is generally studied by visual analysis of stomach contents; or ratios of isotopes of carbon and nitrogen incorporated into the penguin from its food. There are significant limitations to the information that can be gained from these methods. We evaluated population diet assessment by analysis of food DNA in scats as an alternative method for ecosystem monitoring with Adélie penguins as an indicator species. Scats were collected at four locations, three phases of the breeding cycle, and in four different years. A novel molecular diet assay and bioinformatics pipeline based on nuclear small subunit ribosomal RNA gene (SSU rDNA) sequencing was used to identify prey DNA in 389 scats. Analysis of the twelve population sample sets identified spatial and temporal dietary change in Adélie penguin population diet. Prey diversity was found to be greater than previously thought. Krill, fish, copepods and amphipods were the most important food groups, in general agreement with other Adélie penguin dietary studies based on hard part or stable isotope analysis. However, our DNA analysis estimated that a substantial portion of the diet was gelatinous groups such as jellyfish and comb jellies. A range of other prey not previously identified in the diet of this species were also discovered. The diverse prey identified by this DNA-based scat analysis confirms that the generalist feeding of Adélie penguins makes them a useful indicator species for prey community composition in the coastal zone of the Southern Ocean. Scat collection is a simple and non-invasive field sampling method that allows DNA-based estimation of prey community differences at many temporal and spatial scales and provides significant advantages over alternative diet analysis approaches.

  5. Biocontrol and Rapid Detection of Food-borne Pathogens Using Bacteriophages and Endolysins

    Directory of Open Access Journals (Sweden)

    Jaewoo eBai

    2016-04-01

    Full Text Available Bacteriophages have been suggested as natural food preservatives as well as rapid detection materials for food-borne pathogens in various foods. Since Listeria monocytogenes-targeting phage cocktail (ListShield was approved for applications in foods, numerous phages have been screened and experimentally characterized for phage applications in foods. A single phage and phage cocktail treatments to various foods contaminated with food-borne pathogens including E. coli O157:H7, Salmonella enterica, Campylobacter jejuni, Listeria monocytogenes, Staphylococcus aureus, Cronobacter sakazakii, and Vibrio spp. revealed that they have great potential to control various food-borne pathogens and may be alternative for conventional food preservatives. In addition, phage-derived endolysins with high host specificity and host lysis activities may be preferred to food applications rather than phages. For rapid detection of food-borne pathogens, cell-wall binding domains (CBDs from endolysins have been suggested due to their high host-specific binding. Fluorescence-tagged CBDs have been successfully evaluated and suggested to be alternative materials of expensive antibodies for various detection applications. Most recently, reporter phage systems have been developed and tested to confirm their usability and accuracy for specific detection. These systems revealed some advantages like rapid detection of only viable pathogenic cells without interference by food components in a very short reaction time, suggesting that these systems may be suitable for monitoring of pathogens in foods. Consequently, phage is the next-generation biocontrol agent as well as rapid detection tool to confirm and even identify the food-borne pathogens present in various foods.

  6. Characterization of Antimicrobial Resistance of Listeria monocytogenes Strains Isolated from a Pork Processing Plant and Its Respective Meat Markets in Southern China

    DEFF Research Database (Denmark)

    Li, Lili; Olsen, Rikke Heidemann; Ye, Lei

    2016-01-01

    A total of 78 Listeria monocytogenes isolates from a pork processing plant and the respective meat markets in southern China were examined. This number includes 60 isolates from pork at markets, 5 from cooked pork products at markets, 10 from pork at a processing plant, and 3 from food......, ampicillin/sulbactam, imipenem, ciprofloxacin, levofloxacin, trimethoprim/sulfamethoxazole, and vancomycin. Two isolates were resistant to five antimicrobials. Twelve strains carried tet(M) and located on Tn916. PFGE analysis revealed genetic heterogeneity among individual serotypes. Two predominant PFGE...... types were found persistent from the processing plant to markets indicating that these two types of isolates were able to survive under environmental adverse conditions from the processing plant to markets, which need to be monitored. Compared to samples from the pork processing plant, the prevalence of...

  7. ASSESSMENT OF ACTION OF DISINFECTANTS AGAINST LISTERIA MONOCYTOGENES BIOFILMS

    Directory of Open Access Journals (Sweden)

    T. K. CABEÇA

    2008-12-01

    Full Text Available

    The purpose of this study was to assess the action of various disinfectants used in food industry against biofilm cells of Listeria monocytogenes formed on stainless steel surfaces during 24, 72 and 120 hours. Numbers of viable biofilm cells decreased after treatment with all the tested disinfectants (iodine, biguanide, quaternary ammonium compounds, peracetic acid and sodium hypochlorite. Sodium hypochlorite was the most effective disinfectant against the biofilm cells, while biguanide and iodine were the least. Scanning electron microscopy observations demonstrated attached cells on stainless steel surfaces after treatment with all the disinfectants. These observations showed that microorganisms were not completely removed from stainless steel surfaces after treatment with the disinfectants, however, the attachment did not means the viability of remaining cells. The biofilm age in hours (24, 72 and 120 had no apparent influence on resistance of microbiological cells to the disinfectants under study. In conclusion biofilm cells of L. monocytogenes can withstand disinfectants action.

  8. Enrichment dynamics of Listeria monocytogenes and the associated microbiome from naturally contaminated ice cream linked to a listeriosis outbreak.

    Science.gov (United States)

    Ottesen, Andrea; Ramachandran, Padmini; Reed, Elizabeth; White, James R; Hasan, Nur; Subramanian, Poorani; Ryan, Gina; Jarvis, Karen; Grim, Christopher; Daquiqan, Ninalynn; Hanes, Darcy; Allard, Marc; Colwell, Rita; Brown, Eric; Chen, Yi

    2016-11-16

    Microbiota that co-enrich during efforts to recover pathogens from foodborne outbreaks interfere with efficient detection and recovery. Here, dynamics of co-enriching microbiota during recovery of Listeria monocytogenes from naturally contaminated ice cream samples linked to an outbreak are described for three different initial enrichment formulations used by the Food and Drug Administration (FDA), the International Organization of Standardization (ISO), and the United States Department of Agriculture (USDA). Enrichment cultures were analyzed using DNA extraction and sequencing from samples taken every 4 h throughout 48 h of enrichment. Resphera Insight and CosmosID analysis tools were employed for high-resolution profiling of 16S rRNA amplicons and whole genome shotgun data, respectively. During enrichment, other bacterial taxa were identified, including Anoxybacillus, Geobacillus, Serratia, Pseudomonas, Erwinia, and Streptococcus spp. Surprisingly, incidence of L. monocytogenes was proportionally greater at hour 0 than when tested 4, 8, and 12 h later with all three enrichment schemes. The corresponding increase in Anoxybacillus and Geobacillus spp.indicated these taxa co-enriched in competition with L. monocytogenes during early enrichment hours. L. monocytogenes became dominant after 24 h in all three enrichments. DNA sequences obtained from shotgun metagenomic data of Listeria monocytogenes at 48 h were assembled to produce a consensus draft genome which appeared to have a similar tracking utility to pure culture isolates of L. monocytogenes. All three methods performed equally well for enrichment of Listeria monocytogenes. The observation of potential competitive exclusion of L. mono by Anoxybacillus and Geobacillus in early enrichment hours provided novel information that may be used to further optimize enrichment formulations. Application of Resphera Insight for high-resolution analysis of 16S amplicon sequences accurately identified L. monocytogenes

  9. Growth potential of Listeria monocytogenes in sliced turkey bresaola packed in modified atmosphere

    Directory of Open Access Journals (Sweden)

    Elena Dalzini

    2014-02-01

    Full Text Available According to EC Regulation No 2073/2005, for food business operators that produce ready-to-eat (RTE product, it is crucial to be able to demonstrate if the product supports the growth of Listeria monocytogenes. The objective of the study was therefore to evaluate the behaviour of L. monocytogenes in sliced RTE turkey bresaola (made by cured turkey breast 4.5% NaCl, 1% sodium lactate, sodium nitrite 150 ppm and flavouring during the shelf life of the product, simulating a contamination during the slicing operation. Considering a shelf life of 90 days, as defined by manufacturer, the packages of sliced bresaola were stored at 5°C for 7 days and at 8°C for the remaining storage time (83 days. L. monocytogenes count decreased during storage test from 1.43/1.98 log cfu/g in the three batches tested to 1.03 log cfu/g in one batch and to undetectable levels in the other two batches. The results show that the investigated product is unable to support the growth of L. monocytogenes.

  10. The virulence regulator PrfA promotes biofilm formation by Listeria monocytogenes.

    Science.gov (United States)

    Lemon, Katherine P; Freitag, Nancy E; Kolter, Roberto

    2010-08-01

    Listeria monocytogenes is a food-borne facultative intracellular pathogen. It is widespread in the environment and has several distinct life-styles. The key transcriptional activator PrfA positively regulates L. monocytogenes virulence genes to mediate the transition from extracellular, flagellum-propelled cell to intracellular pathogen. Here we report the first evidence that PrfA also has a significant positive impact on extracellular biofilm formation. Mutants lacking prfA were defective in surface-adhered biofilm formation. The DeltaprfA mutant exhibited wild-type flagellar motility, and its biofilm defect occurred after initial surface adhesion. We also observed that mutations that led to the constitutive expression of PrfA-dependent virulence genes had a minimal impact on biofilm formation. Furthermore, biofilm development was enhanced in a mutant encoding a PrfA protein variant unable to fully transition from the extracellular form to the virulent, intracellular activity conformation. These results indicate that PrfA positively regulates biofilm formation and suggest that PrfA has a global role in modulating the life-style of L. monocytogenes. The requirement of PrfA for optimal biofilm formation may provide selective pressure to maintain this critical virulence regulator when L. monocytogenes is outside host cells in the environment.

  11. Biofilm formation by Listeria monocytogenes on stainless steel surface and biotransfer potential

    Directory of Open Access Journals (Sweden)

    Maíra Maciel Mattos de Oliveira

    2010-03-01

    Full Text Available An experimental model was proposed to study biofilm formation by Listeria monocytogenes ATCC 19117 on AISI 304 (#4 stainless steel surface and biotransfer potential during this process. In this model, biofilm formation was conducted on the surface of stainless steel coupons, set on a stainless steel base with 4 divisions, each one supporting 21 coupons. Trypic Soy Broth was used as bacterial growth substrate, with incubation at 37 ºC and stirring of 50 rpm. The number of adhered cells was determined after 3, 48, 96, 144, 192 and 240 hours of biofilm formation and biotransfer potential from 96 hours. Stainless steel coupons were submitted to Scanning Electron Microscopy (SEM after 3, 144 and 240 hours. Based on the number of adhered cells and SEM, it was observed that L. monocytogenes adhered rapidly to the stainless steel surface, with mature biofilm being formed after 240 hours. The biotransfer potential of bacterium to substrate occurred at all the stages analyzed. The rapid capacity of adhesion to surface, combined with biotransfer potential throughout the biofilm formation stages, make L. monocytogenes a potential risk to the food industry. Both the experimental model developed and the methodology used were efficient in the study of biofilm formation by L. monocytogenes on stainless steel surface and biotransfer potential.

  12. Biofilm formation by Listeria monocytogenes on stainless steel surface and biotransfer potential.

    Science.gov (United States)

    de Oliveira, Maíra Maciel Mattos; Brugnera, Danilo Florisvaldo; Alves, Eduardo; Piccoli, Roberta Hilsdorf

    2010-01-01

    An experimental model was proposed to study biofilm formation by Listeria monocytogenes ATCC 19117 on AISI 304 (#4) stainless steel surface and biotransfer potential during this process. In this model, biofilm formation was conducted on the surface of stainless steel coupons, set on a stainless steel base with 4 divisions, each one supporting 21 coupons. Trypic Soy Broth was used as bacterial growth substrate, with incubation at 37 °C and stirring of 50 rpm. The number of adhered cells was determined after 3, 48, 96, 144, 192 and 240 hours of biofilm formation and biotransfer potential from 96 hours. Stainless steel coupons were submitted to Scanning Electron Microscopy (SEM) after 3, 144 and 240 hours. Based on the number of adhered cells and SEM, it was observed that L. monocytogenes adhered rapidly to the stainless steel surface, with mature biofilm being formed after 240 hours. The biotransfer potential of bacterium to substrate occurred at all the stages analyzed. The rapid capacity of adhesion to surface, combined with biotransfer potential throughout the biofilm formation stages, make L. monocytogenes a potential risk to the food industry. Both the experimental model developed and the methodology used were efficient in the study of biofilm formation by L. monocytogenes on stainless steel surface and biotransfer potential.

  13. A large outbreak of Listeria monocytogenes infection with short incubation period in a tertiary care hospital.

    Science.gov (United States)

    Johnsen, Bjørn Odd; Lingaas, Egil; Torfoss, Dag; Strøm, Erik H; Nordøy, Ingvild

    2010-12-01

    Listeria monocytogenes is a foodborne pathogen with a high mortality rate. We report a large, nosocomial outbreak of Listeria monocytogenes infection. Patients with L. monocytogenes isolated from a sterile site, or from faeces when diarrhoea and fever were present, were included. Clinical data were collected from the patient records. The incubation period was calculated as the time between exposure and start of symptoms. Seventeen patients (11 women, median age 64 years) were infected of whom 15 patients were at increased risk for listeriosis. Eleven patients received empiric antibiotic treatment, eight of them with cephalosporins. Three patients died with a resulting mortality rate of 18%. The source of the outbreak was a Camembert cheese made from pasteurised milk containing up to 360 million colony forming units per portion. The median incubation period was 3-4 days. The incubation period in this outbreak was significantly shorter than previously reported, a fact that may be due to the high number of ingested bacteria. Furthermore, food restrictions in hospitals seem warranted, as do treatment with antibiotics effective against L. monocytogenes in at-risk populations. Copyright © 2010 The British Infection Association. Published by Elsevier Ltd. All rights reserved.

  14. Exposure assessment of process-related contaminants in food by biomarker monitoring.

    Science.gov (United States)

    Rietjens, Ivonne M C M; Dussort, P; Günther, Helmut; Hanlon, Paul; Honda, Hiroshi; Mally, Angela; O'Hagan, Sue; Scholz, Gabriele; Seidel, Albrecht; Swenberg, James; Teeguarden, Justin; Eisenbrand, Gerhard

    2018-01-01

    Exposure assessment is a fundamental part of the risk assessment paradigm, but can often present a number of challenges and uncertainties. This is especially the case for process contaminants formed during the processing, e.g. heating of food, since they are in part highly reactive and/or volatile, thus making exposure assessment by analysing contents in food unreliable. New approaches are therefore required to accurately assess consumer exposure and thus better inform the risk assessment. Such novel approaches may include the use of biomarkers, physiologically based kinetic (PBK) modelling-facilitated reverse dosimetry, and/or duplicate diet studies. This review focuses on the state of the art with respect to the use of biomarkers of exposure for the process contaminants acrylamide, 3-MCPD esters, glycidyl esters, furan and acrolein. From the overview presented, it becomes clear that the field of assessing human exposure to process-related contaminants in food by biomarker monitoring is promising and strongly developing. The current state of the art as well as the existing data gaps and challenges for the future were defined. They include (1) using PBK modelling and duplicate diet studies to establish, preferably in humans, correlations between external exposure and biomarkers; (2) elucidation of the possible endogenous formation of the process-related contaminants and the resulting biomarker levels; (3) the influence of inter-individual variations and how to include that in the biomarker-based exposure predictions; (4) the correction for confounding factors; (5) the value of the different biomarkers in relation to exposure scenario's and risk assessment, and (6) the possibilities of novel methodologies. In spite of these challenges it can be concluded that biomarker-based exposure assessment provides a unique opportunity to more accurately assess consumer exposure to process-related contaminants in food and thus to better inform risk assessment.

  15. Bias in the Listeria monocytogenes enrichment procedure: Lineage 2 strains outcompete lineage 1 strains in University of Vermont selective enrichments

    DEFF Research Database (Denmark)

    Bruhn, Jesper Bartholin; Vogel, Birte Fonnesbech; Gram, Lone

    2005-01-01

    compounds in UVM I and II influenced this bias. The results of the present study demonstrate that the selective procedures used for isolation of L. monocytogenes may not allow a true representation of the types present in foods. Our results could have a significant impact on epidemiological studies...

  16. Inhibition of Listeria monocytogenes by pomegranate (Punica granatum) peel extract in meat paté at different temperatures

    NARCIS (Netherlands)

    Hayrapetyan, H.; Hazeleger, W.C.; Beumer, R.R.

    2012-01-01

    Natural antimicrobials are being more and more considered as alternative approach for controlling growth of microorganisms in food. The objective of this study was to evaluate the pomegranate extract’s (PE) potential to be used as a natural preservative in ready to eat meats. Listeria monocytogenes

  17. Initial adhesion of Listeria monocytogenes to solid surfaces under liquid flow

    DEFF Research Database (Denmark)

    Szlavik, Julie; Soares Paiva, Dionísio; Mørk, Nils

    2012-01-01

    .001) was observed but not of interactions between surface-shear stress. No correlation between surface hydrophobicity and IAR was observed. Addition of 5% NaCl during propagation resulted in a decrease in IAR whilst propagation in low nutrient media caused an increase indicating a general change in surface......Some strains of the food borne pathogen Listeria monocytogenes persist in food processing environments. The exact reason behind this phenomenon is not known, but strain differences in the ability to adhere to solid surfaces could offer an explanation. In the present work, initial adhesion of nine...... strains of L. monocytogenes was investigated under liquid flow at two levels of shear stress on six different surfaces using a flow chamber set-up with microscopy measurements. The surfaces tested were glass and PVC, and glass coated with beef extract, casein, and homogenised and unhomogenised milk...

  18. Adaptation of Listeria monocytogenes in a simulated cheese medium: effects on virulence using the Galleria mellonella infection model.

    Science.gov (United States)

    Schrama, D; Helliwell, N; Neto, L; Faleiro, M L

    2013-06-01

    The aim of this study was to evaluate the effect of the acid and salt adaptation in a cheese-based medium on the virulence potential of Listeria monocytogenes strains isolated from cheese and dairy processing environment using the Galleria mellonella model. Four L. monocytogenes strains were exposed to a cheese-based medium in conditions of induction of an acid tolerance response and osmotolerance response (pH 5·5 and 3·5% w/v NaCl) and injected in G. mellonella insects. The survival of insects and the L. monocytogenes growth kinetics in insects were evaluated. The gene expression of hly, actA and inlA genes was determined by real-time PCR. The adapted cells of two dairy strains showed reduced insect mortality (P 0·05) was found between adapted and nonadapted cells. The gene expression results evidenced an overexpression of virulence genes in cheese-based medium, but not in simulated insect-induced conditions. Our results suggest that adaptation to low pH and salt in a cheese-based medium can affect the virulence of L. monocytogenes, but this effect is strain dependent. In this study, the impact of adaptation to low pH and salt in a cheese-based medium on L. monocytogenes virulence was tested using the Wax Moth G. mellonella model. This model allowed the differentiation of the virulence potential between the L. monocytogenes strains. The effect of adaptation on virulence is strain dependent. The G. mellonella model revealed to be a prompt method to test food-related factors on L. monocytogenes virulence. © 2013 The Society for Applied Microbiology.

  19. Monitoring the Affordability of Healthy Eating: A Case Study of 10 Years of the Illawarra Healthy Food Basket

    Directory of Open Access Journals (Sweden)

    Peter Williams

    2010-11-01

    Full Text Available Healthy food baskets have been used around the world for a variety of purposes, including: examining the difference in cost between healthy and unhealthy food; mapping the availability of healthy foods in different locations; calculating the minimum cost of an adequate diet for social policy planning; developing educational material on low cost eating and examining trends on food costs over time. In Australia, the Illawarra Healthy Food Basket was developed in 2000 to monitor trends in the affordability of healthy food compared to average weekly wages and social welfare benefits for the unemployed. It consists of 57 items selected to meet the nutritional requirements of a reference family of five. Bi-annual costing from 2000–2009 has shown that the basket costs have increased by 38.4% in the 10-year period, but that affordability has remained relatively constant at around 30% of average household incomes.

  20. Monitoring the affordability of healthy eating: a case study of 10 years of the Illawarra Healthy Food Basket.

    Science.gov (United States)

    Williams, Peter

    2010-11-01

    Healthy food baskets have been used around the world for a variety of purposes, including: examining the difference in cost between healthy and unhealthy food; mapping the availability of healthy foods in different locations; calculating the minimum cost of an adequate diet for social policy planning; developing educational material on low cost eating and examining trends on food costs over time. In Australia, the Illawarra Healthy Food Basket was developed in 2000 to monitor trends in the affordability of healthy food compared to average weekly wages and social welfare benefits for the unemployed. It consists of 57 items selected to meet the nutritional requirements of a reference family of five. Bi-annual costing from 2000-2009 has shown that the basket costs have increased by 38.4% in the 10-year period, but that affordability has remained relatively constant at around 30% of average household incomes.

  1. Rapid detection of Listeria monocytogenes in raw milk and soft cheese by a redox potential measurement based method combined with real-time PCR.

    Science.gov (United States)

    Erdősi, Orsolya; Szakmár, Katalin; Reichart, Olivér; Szili, Zsuzsanna; László, Noémi; Székely Körmöczy, Péter; Laczay, Péter

    2014-09-01

    The incidence of outbreaks of foodborne listeriosis has indicated the need for a reliable and rapid detection of the microbe in different foodstuffs. A method combining redox potential measurement and real-time polymerase chain reaction (PCR) was developed to detect Listeria monocytogenes in artificially contaminated raw milk and soft cheese. Food samples of 25 g or 25 ml were homogenised in 225 ml of Listeria Enrichment Broth (LEB) with Oxford supplement, and the redox potential measurement technique was applied. For Listeria species the measuring time was maximum 34 h. The absence of L. monocytogenes could reliably be proven by the redox potential measurement method, but Listeria innocua and Bacillus subtilis could not be differentiated from L. monocytogenes on the basis of the redox curves. The presence of L. monocytogenes had to be confirmed by real-time PCR. The combination of these two methods proved to detect < 10 cfu/g of L. monocytogenes in a cost- and time-effective manner. This method can potentially be used as an alternative to the standard nutrient method for the rapid detection of L. monocytogenes in food.

  2. Prevalence and growth of Listeria monocytogenes in naturally contaminated seafood

    DEFF Research Database (Denmark)

    Jørgensen, Lasse Vigel; Huss, Hans Henrik

    1998-01-01

    Listeria monocytogenes contamination of seafood varies with product category. The highest prevalence was found in cold- smoked fish (34-60%), while the lowest was found in heat- treated and cured seafood (4-12%). The prevalence of L. monocytogenes differed greatly in cold-smoked salmon between...... production sites, ranging from monocytogenes. The organism showed moderate growth...... in naturally contaminated cold-smoked, and 'gravad', fish while the growth appeared faster in hot smoked fish. Thus L. monocytogenes is not under control in these products. Finally, the prevalence and growth of L. monocytogenes in naturally contaminated cold-smoked salmon are discussed in relation...

  3. The Metalloprotease of Listeria monocytogenes Is Activated by Intramolecular Autocatalysis▿ †

    OpenAIRE

    Bitar, Alan Pavinski; Cao, Min; Marquis, Hélène

    2007-01-01

    The metalloprotease (Mpl) of Listeria monocytogenes is a thermolysin-like protease that mediates the maturation of a broad-range phospholipase C, whose function contributes to the ability of this food-borne bacterial pathogen to survive intracellularly. Mpl is made as a proprotein that undergoes maturation by proteolytic cleavage of a large N-terminal prodomain. In this study, we identified the N terminus of mature Mpl and generated Mpl catalytic mutants to investigate the mechanism of Mpl ma...

  4. Effekt av ulike desinfeksjonsstrategier mot Listeria monocytogenes

    OpenAIRE

    Fossmo, Sabine

    2013-01-01

    Kontroll med bakterier som Listeria utgjør en stor utfordring for mange matprodusenter. Listeria monocytogenes er hovedsakelig et produksjonshygienisk problem, forbedret hygiene kan derfor være tiltak for å redusere overlevelse og smitteoverføring av bakterien i produksjonsmiljø. Hensikten med forsøkene i oppgaven var å undersøke effekten av ulike desinfeksjonsstrategier på drap av L. monocytogenes, både når bakteriene var i biofilm og i suspensjon. Dette inkluderte bruk av tradisjonelle desi...

  5. A comparative risk assessment for Listeria monocytogenes in prepackaged versus retail-sliced deli meat.

    Science.gov (United States)

    Endrikat, Sarah; Gallagher, Daniel; Pouillot, Régis; Hicks Quesenberry, Heather; Labarre, David; Schroeder, Carl M; Kause, Janell

    2010-04-01

    Deli meat was ranked as the highest-risk ready-to-eat food vehicle of Listeria monocytogenes within the 2003 U.S. Food and Drug Administration and U.S. Department of Agriculture, Food Safety and Inspection Service risk assessment. The comparative risk of L. monocytogenes in retail-sliced versus prepackaged deli meats was evaluated with a modified version of this model. Other research has found that retail-sliced deli meats have both higher prevalence and levels of L. monocytogenes than have product sliced and packaged at the manufacturer level. The updated risk assessment model considered slicing location as well as the use of growth inhibitors. The per annum comparative risk ratio for the number of deaths from retail-sliced versus prepackaged deli meats was found to be 4.89, and the per-serving comparative risk ratio was 4.27. There was a significant interaction between the use of growth inhibitors and slicing location. Almost 70% of the estimated deaths occurred from retail-sliced product that did not possess a growth inhibitor. A sensitivity analysis, assessing the effect of the model's consumer storage time and shelf life assumptions, found that even if retail-sliced deli meats were stored for a quarter of the time prepackaged deli meats were stored, retail-sliced product is 1.7 times more likely to result in death from listeriosis. Sensitivity analysis also showed that the shelf life assumption had little effect on the comparative risk ratio.

  6. Single cell swimming dynamics of Listeria monocytogenes using a nanoporous microfluidic platform

    Energy Technology Data Exchange (ETDEWEB)

    Wright, Evan [University of Guelph, Canada; Neethirajan, Suresh [University of Guelph; Warriner, Keith [University of Guelph; Retterer, Scott T [ORNL; Srijanto, Bernadeta R [ORNL

    2014-01-01

    Listeria monocytogenes remains a significant foodborne pathogen due to its virulence and ability to become established in food processing facilities. The pathogen is characterized by its ability to grow over a wide temperature range and withstand a broad range of stresses. The following reports on the chemotaxis and motility of the L. monocytogenes when exposed to relatively small concentrations of acetic acid. Using the developed nanoporous microfluidic device to precisely modulate the cellular environment, we exposed the individual Listeria cells to acetic acid and, in real time and with high resolution, observed how the cells reacted to the change in their surroundings. Our results showed that concentrations of acetic acid below 10 mM had very little, if any, effect on the motility. However, when exposed to 100 mM acetic acid, the cells exhibited a sharp drop in velocity and displayed a more random pattern of motion. These results indicate that at appropriate concentrations, acetic acid has the ability to disable the flagellum of the cells, thus impairing their motility. This drop in motility has numerous effects on the cell; its main effects being the obstruction of the cell's ability to properly form biofilms and a reduction in the overall infectivity of the cells. Since these characteristics are especially useful in controlling the proliferation of L. monocytogenes, acetic acid shows potential for application in the food industry as an active compound in designing a food packaging environment and as an antimicrobial agent.

  7. Combined effect of ultrasound and essential oils to reduce Listeria monocytogenes on fresh produce.

    Science.gov (United States)

    Özcan, Gülçin; Demirel Zorba, Nükhet Nilüfer

    2016-06-01

    Salads prepared from contaminated fresh produce have a high risk of causing food-borne illnesses. Essential oils obtained from plants have antimicrobial activity and may provide a natural approach to reduce the pathogens on fresh produce. Additionally, ultrasound treatments have been shown to reduce the microbial counts on different foods. The objective of this study was to investigate the antimicrobial activities of cinnamon and lemon essential oils in vitro and in food applications. Mixtures of lettuce, parsley and dill were inoculated with Listeria monocytogenes and then dip-treated for 5 min in one of the following treatments: sterile tap water, chlorinated water, 1% lemon essential oil, 2% cinnamon essential oil or 2% cinnamon essential oil + ultrasound. The samples were stored at 4 ℃ and collected at d 0, 1, 3, 5, 7 and 9 post inoculation. The 1% lemon (4 log) and 2% cinnamon (2 log) essential oil washes provided partial inhibition against L. monocytogenes by d 1. The combined application of 2% cinnamon oil and ultrasound resulted in only 0.85 log inhibition by d 1; however, the number of L. monocytogenes increased during storage and became nearly equal to the control at d 9. Therefore, different combinations of essential oils with other antimicrobials or novel technologies are required. © The Author(s) 2015.

  8. Apoptotic death of Listeria monocytogenes-infected human macrophages induced by lactoferricin B, a bovine lactoferrin-derived peptide.

    Science.gov (United States)

    Longhi, C; Conte, M P; Ranaldi, S; Penta, M; Valenti, P; Tinari, A; Superti, F; Seganti, L

    2005-01-01

    Listeria monocytogenes, an intracellular facultative food-borne pathogen, was reported to induce apoptosis in vitro and in vivo in a variety of cell types with the exception of murine macrophages. These cells represent the predominant compartment of bacterial multiplication and die as a result of necrosis. In this study we showed that human non-activated and IFN-gamma-activated macrophagic-like (THP-1) cells infected with L. monocytogenes, mainly die by necrosis rather than by an apoptotic process. Two natural products derived from bovine milk, lactoferrin and its derivative peptide lactoferricin B, are capable of regulating the fate of infected human macrophages. Bovine lactoferrin treatment of macrophages protects them from L. monocytogenes-induced death whereas lactoferricin B, its derivative peptide, determines a shifting of the equilibrium from necrosis to apoptosis.

  9. Chitinase Expression in Listeria monocytogenes Is Influenced by lmo0327, Which Encodes an InternalinLike Protein

    DEFF Research Database (Denmark)

    Paspaliari, Dafni Katerina; Kastbjerg, Vicky Gaedt; Ingmer, Hanne

    2017-01-01

    The chitinolytic system of Listeria monocytogenes thus far comprises two chitinases, ChiA and ChiB, and a lytic polysaccharide monooxygenase, Lmo2467. The role of the system in the bacterium appears to be pleiotropic, as besides mediating hydrolysis of chitin, the second most ubiquitous...... chitinase activities enabling them to utilize chitin as the sole source of carbon and nitrogen. Interestingly, several bacterial chitinases may also be involved in host pathogenesis. For example, in the important food borne pathogen Listeria monocytogenes, the chitinases ChiA and ChiB, and the lytic...... ChiA and ChiB in the culture supernatants of the mutant strain. Our results provide new information regarding the function of the lmo0325-lmo0327 locus in L. monocytogenes and link it to the expression of chitinolytic activity.Importance: Many bacteria from terrestrial and marine environments express...

  10. Molecular Characterization and Phylogenetic Analysis of Listeria monocytogenes Isolated from Milk and Milk Products in Kaduna, Nigeria

    Directory of Open Access Journals (Sweden)

    U. B. Usman

    2016-01-01

    Full Text Available In this study, Listeria (L. monocytogenes isolated from milk and milk products in Kaduna, Nigeria, were subjected to a multiplex PCR assay to identify virulence-associated genes (such as prf A, inl A, hly A, act A, and iap. Of the 36 isolates, 9 (25% were positive for one or two virulence-associated genes. Based on the sample type, 6 (16.9% of the isolates that possessed virulence-associated genes were obtained from raw milk, 2 (3.2% from “Manshanu,” and 1 (2.8% from “Kindrimo.” Sequence and phylogenetic analysis based on the 16S rRNA revealed that Nigerian L. monocytogenes isolates (NGA 34A, NGA 35A, NGA 41A, and NGA 38A, when compared with reference L. monocytogenes, were grouped into two distinct clusters, A and B, with sequence (NGA 34A, NGA 35A, and NGA 41A phylogenetically closer to J1776; N1-011A; R2-502; J1816; and J2-031, whereas L. monocytogenes isolate (NGA 38A clustered with EDG; J1-220; J1926; J1817; and J2-1091. The separation of the Nigerian L. monocytogenes isolates into linage A (responsible for epidemic listeriosis and lineage B (responsible for sporadic cases of listeriosis is of public health concern and that local isolates might have potentials for human food borne listeriosis based on the virulence factors so far identified.

  11. Phenotypic and Genotypic Characterization of Atypical Listeria monocytogenes and Listeria innocua Isolated from Swine Slaughterhouses and Meat Markets

    Directory of Open Access Journals (Sweden)

    Luisa Zanolli Moreno

    2014-01-01

    Full Text Available In the last decade, atypical Listeria monocytogenes and L. innocua strains have been detected in food and the environment. Because of mutations in the major virulence genes, these strains have different virulence intensities in eukaryotic cells. In this study, we performed phenotypic and genotypic characterization of atypical L. monocytogenes and L. innocua isolates obtained from swine slaughterhouses and meat markets. Forty strains were studied, including isolates of L. monocytogenes and L. innocua with low-hemolytic activity. The isolates were characterized using conventional phenotypic Listeria identification tests and by the detection and analysis of L. monocytogenes-specific genes. Analysis of 16S rRNA was used for the molecular identification of the Listeria species. The L. monocytogenes isolates were positive for all of the virulence genes studied. The atypical L. innocua strains were positive for hly, plcA, and inlC. Mutations in the InlC, InlB, InlA, PI-PLC, PC-PLC, and PrfA proteins were detected in the atypical isolates. Further in vitro and transcriptomic studies are being developed to confirm the role of these mutations in Listeria virulence.

  12. Listeria monocytogenes impact on mature or old Pseudomonas fluorescens biofilms during growth at 4 and 20ºC

    Directory of Open Access Journals (Sweden)

    Puga eCH

    2016-02-01

    Full Text Available Changes in spatial organization, as observed by confocal laser scanning microscopy (CLSM, viable cell content, biovolume and substratum surface coverage of the biofilms formed on glass by Pseudomonas fluorescens resulting from co-culture with Listeria monocytogenes, were examined. Two strains of L. monocytogenes, two culture temperatures and two biofilm developmental stages were investigated. Both L. monocytogenes strains, a persistently sampled isolate (collected repeatedly along 3 years from a meat factory and Scott A, induced shrinkage in matrix volume, both at 20ºC and 4ºC, in mature or old biofilms, without loss of P. fluorescens cell count per surface unit. The nearly homogeneous pattern of surface coverage shown by mono-species P. fluorescens biofilms, turned into more irregular layouts in co-culture with L. monocytogenes. The upper layer of both mono and dual-species biofilms turned to predominantly consist of matrix, with plenty of viable cells underneath, in old biofilms cultured at 20ºC, but not in those grown at 4ºC. Between 15 and 56% of the substratum area was covered by biofilm, the extent depending on temperature, time and L. monocytogenes strain. Real biofilms in food-related surfaces may thus be very heterogeneous regarding their superficial components, i.e. those more accessible to disinfectants. It is therefore a hygienic challenge to choose an adequate agent to disrupt them.

  13. The Application of State-of-the-Art Analytic Tools (Biosensors and Spectroscopy in Beverage and Food Fermentation Process Monitoring

    Directory of Open Access Journals (Sweden)

    Shaneel Chandra

    2017-09-01

    Full Text Available The production of several agricultural products and foods are linked with fermentation. Traditional methods used to control and monitor the quality of the products and processes are based on the use of simple chemical analysis. However, these methods are time-consuming and do not provide sufficient relevant information to guarantee the chemical changes during the process. Commonly used methods applied in the agriculture and food industries to monitor fermentation are those based on simple or single-point sensors, where only one parameter is measured (e.g., temperature or density. These sensors are used several times per day and are often the only source of data available from which the conditions and rate of fermentation are monitored. In the modern food industry, an ideal method to control and monitor the fermentation process should enable a direct, rapid, precise, and accurate determination of several target compounds, with minimal to no sample preparation or reagent consumption. Here, state-of-the-art advancements in both the application of sensors and analytical tools to monitor beverage and food fermentation processes will be discussed.

  14. Genetic Separation of Listeria monocytogenes Causing Central Nervous System Infections in Animals

    Directory of Open Access Journals (Sweden)

    Lisandra Aguilar-Bultet

    2018-02-01

    Full Text Available Listeria monocytogenes is a foodborne pathogen that causes abortion, septicemia, gastroenteritis and central nervous system (CNS infections in ruminants and humans. L. monocytogenes strains mainly belong to two distinct phylogenetic groups, named lineages I and II. In general, clinical cases in humans and animals, in particular CNS infections, are caused by lineage I strains, while most of the environmental and food strains belong to lineage II. Little is known about why lineage I is more virulent than lineage II, even though various molecular factors and mechanisms associated with pathogenesis are known. In this study, we have used a variety of whole genome sequence analyses and comparative genomic tools in order to find characteristics that distinguish lineage I from lineage II strains and CNS infection strains from non-CNS strains. We analyzed 225 strains and identified single nucleotide variants between lineages I and II, as well as differences in the gene content. Using a novel approach based on Reads Per Kilobase per Million Mapped (RPKM, we identified 167 genes predominantly absent in lineage II but present in lineage I. These genes are mostly encoding for membrane-associated proteins. Additionally, we found 77 genes that are largely absent in the non-CNS associated strains, while 39 genes are especially lacking in our defined “non-clinical” group. Based on the RPKM analysis and the metadata linked to the L. monocytogenes strains, we identified 6 genes potentially associated with CNS cases, which include a transcriptional regulator, an ABC transporter and a non-coding RNA. Although there is not a clear separation between pathogenic and non-pathogenic strains based on phylogenetic lineages, the presence of the genes identified in our study reveals potential pathogenesis traits in ruminant L. monocytogenes strains. Ultimately, the differences that we have found in our study will help steer future studies in understanding the virulence

  15. Comparative genomics and transcriptomics of lineages I, II, and III strains of Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Hain Torsten

    2012-04-01

    Full Text Available Abstract Background Listeria monocytogenes is a food-borne pathogen that causes infections with a high-mortality rate and has served as an invaluable model for intracellular parasitism. Here, we report complete genome sequences for two L. monocytogenes strains belonging to serotype 4a (L99 and 4b (CLIP80459, and transcriptomes of representative strains from lineages I, II, and III, thereby permitting in-depth comparison of genome- and transcriptome -based data from three lineages of L. monocytogenes. Lineage III, represented by the 4a L99 genome is known to contain strains less virulent for humans. Results The genome analysis of the weakly pathogenic L99 serotype 4a provides extensive evidence of virulence gene decay, including loss of several important surface proteins. The 4b CLIP80459 genome, unlike the previously sequenced 4b F2365 genome harbours an intact inlB invasion gene. These lineage I strains are characterized by the lack of prophage genes, as they share only a single prophage locus with other L. monocytogenes genomes 1/2a EGD-e and 4a L99. Comparative transcriptome analysis during intracellular growth uncovered adaptive expression level differences in lineages I, II and III of Listeria, notable amongst which was a strong intracellular induction of flagellar genes in strain 4a L99 compared to the other lineages. Furthermore, extensive differences between strains are manifest at levels of metabolic flux control and phosphorylated sugar uptake. Intriguingly, prophage gene expression was found to be a hallmark of intracellular gene expression. Deletion mutants in the single shared prophage locus of lineage II strain EGD-e 1/2a, the lma operon, revealed severe attenuation of virulence in a murine infection model. Conclusion Comparative genomics and transcriptome analysis of L. monocytogenes strains from three lineages implicate prophage genes in intracellular adaptation and indicate that gene loss and decay may have led to the emergence

  16. In vivo transcriptional profiling of Listeria monocytogenes and mutagenesis identify new virulence factors involved in infection.

    Directory of Open Access Journals (Sweden)

    Ana Camejo

    2009-05-01

    Full Text Available Listeria monocytogenes is a human intracellular pathogen able to colonize host tissues after ingestion of contaminated food, causing severe invasive infections. In order to gain a better understanding of the nature of host-pathogen interactions, we studied the L. monocytogenes genome expression during mouse infection. In the spleen of infected mice, approximately 20% of the Listeria genome is differentially expressed, essentially through gene activation, as compared to exponential growth in rich broth medium. Data presented here show that, during infection, Listeria is in an active multiplication phase, as revealed by the high expression of genes involved in replication, cell division and multiplication. In vivo bacterial growth requires increased expression of genes involved in adaptation of the bacterial metabolism and stress responses, in particular to oxidative stress. Listeria interaction with its host induces cell wall metabolism and surface expression of virulence factors. During infection, L. monocytogenes also activates subversion mechanisms of host defenses, including resistance to cationic peptides, peptidoglycan modifications and release of muramyl peptides. We show that the in vivo differential expression of the Listeria genome is coordinated by a complex regulatory network, with a central role for the PrfA-SigB interplay. In particular, L. monocytogenes up regulates in vivo the two major virulence regulators, PrfA and VirR, and their downstream effectors. Mutagenesis of in vivo induced genes allowed the identification of novel L. monocytogenes virulence factors, including an LPXTG surface protein, suggesting a role for S-layer glycoproteins and for cadmium efflux system in Listeria virulence.

  17. Genetic Separation of Listeria monocytogenes Causing Central Nervous System Infections in Animals

    Science.gov (United States)

    Aguilar-Bultet, Lisandra; Nicholson, Pamela; Rychener, Lorenz; Dreyer, Margaux; Gözel, Bulent; Origgi, Francesco C.; Oevermann, Anna; Frey, Joachim; Falquet, Laurent

    2018-01-01

    Listeria monocytogenes is a foodborne pathogen that causes abortion, septicemia, gastroenteritis and central nervous system (CNS) infections in ruminants and humans. L. monocytogenes strains mainly belong to two distinct phylogenetic groups, named lineages I and II. In general, clinical cases in humans and animals, in particular CNS infections, are caused by lineage I strains, while most of the environmental and food strains belong to lineage II. Little is known about why lineage I is more virulent than lineage II, even though various molecular factors and mechanisms associated with pathogenesis are known. In this study, we have used a variety of whole genome sequence analyses and comparative genomic tools in order to find characteristics that distinguish lineage I from lineage II strains and CNS infection strains from non-CNS strains. We analyzed 225 strains and identified single nucleotide variants between lineages I and II, as well as differences in the gene content. Using a novel approach based on Reads Per Kilobase per Million Mapped (RPKM), we identified 167 genes predominantly absent in lineage II but present in lineage I. These genes are mostly encoding for membrane-associated proteins. Additionally, we found 77 genes that are largely absent in the non-CNS associated strains, while 39 genes are especially lacking in our defined “non-clinical” group. Based on the RPKM analysis and the metadata linked to the L. monocytogenes strains, we identified 6 genes potentially associated with CNS cases, which include a transcriptional regulator, an ABC transporter and a non-coding RNA. Although there is not a clear separation between pathogenic and non-pathogenic strains based on phylogenetic lineages, the presence of the genes identified in our study reveals potential pathogenesis traits in ruminant L. monocytogenes strains. Ultimately, the differences that we have found in our study will help steer future studies in understanding the virulence mechanisms of the

  18. RAPID DNA EXTRACTION AND PCR VALIDATION FOR DIRECT DETECTION OF Listeria monocytogenes IN RAW MILK

    Directory of Open Access Journals (Sweden)

    Edith Burbano

    2006-05-01

    Full Text Available Objective. The aim of this study was to validate a method for detecting L. monocytogenes in raw milk.Materials and methods. The extraction procedure carried out using a chaotropic agent like NaI, toreduce fat in the sample to 0.2% w/v, which is the lowest limit for detection in the Gerber method, toavoid the polymerization. The raw milk samples were analyzed by using the traditional gold standardmethod for L. monocytogenes. Detection PCR was done on the specificity of primers that recognize theListeria genus by amplifying a specific fragment of about 938bp of the 16S rDNA. Several primer setswere use: L1 (CTCCATAAAGGTGACCCT, U1 (CAGCMGCCGCGGTAATWC, LF (CAAACGTTAACAACGCAGTAand LR (TCCAGAGTGATCGATGTTAA that recognize the hlyA gene of L. monocytogenes, amplifying a 750bpfragment. Results. The DNA of 39 strains evidenced high specificity of the technique since all the strainsof L. monocytogenes amplified the fragments 938bp and 750bp, specifically for genus and species,respectively. The detection limit of the PCR was 101 CFU/ml. T he PCR reproducibility showed a Kappa of0.85; the specificity and sensitivity of 100% were found, predictive positive and negative values were of100% respectively. Conclusions. These results demonstrate that is possible to detect of Listeria spp. byusing any of the three methods since they share the same sensitivity and specificity. One hundred percentof the predictive value for PCR (alternative method provides high reliability, and allows the detection ofthe positive samples. The extraction procedure combined with a PCR method can reduce in 15 days thetime of identification of L. monocytogenes in raw milk. This PCR technique could be adapted and validatedto be use for other types of food such as poultry, meat products and cheeses

  19. Short-term genome evolution of Listeria monocytogenes in a non-controlled environment

    Directory of Open Access Journals (Sweden)

    Ivy Reid A

    2008-11-01

    Full Text Available Abstract Background While increasing data on bacterial evolution in controlled environments are available, our understanding of bacterial genome evolution in natural environments is limited. We thus performed full genome analyses on four Listeria monocytogenes, including human and food isolates from both a 1988 case of sporadic listeriosis and a 2000 listeriosis outbreak, which had been linked to contaminated food from a single processing facility. All four isolates had been shown to have identical subtypes, suggesting that a specific L. monocytogenes strain persisted in this processing plant over at least 12 years. While a genome sequence for the 1988 food isolate has been reported, we sequenced the genomes of the 1988 human isolate as well as a human and a food isolate from the 2000 outbreak to allow for comparative genome analyses. Results The two L. monocytogenes isolates from 1988 and the two isolates from 2000 had highly similar genome backbone sequences with very few single nucleotide (nt polymorphisms (1 – 8 SNPs/isolate; confirmed by re-sequencing. While no genome rearrangements were identified in the backbone genome of the four isolates, a 42 kb prophage inserted in the chromosomal comK gene showed evidence for major genome rearrangements. The human-food isolate pair from each 1988 and 2000 had identical prophage sequence; however, there were significant differences in the prophage sequences between the 1988 and 2000 isolates. Diversification of this prophage appears to have been caused by multiple homologous recombination events or possibly prophage replacement. In addition, only the 2000 human isolate contained a plasmid, suggesting plasmid loss or acquisition events. Surprisingly, besides the polymorphisms found in the comK prophage, a single SNP in the tRNA Thr-4 prophage represents the only SNP that differentiates the 1988 isolates from the 2000 isolates. Conclusion Our data support the hypothesis that the 2000 human listeriosis

  20. Exoproteome analysis reveals higher abundance of proteins linked to alkaline stress in persistent Listeria monocytogenes strains.

    Science.gov (United States)

    Rychli, Kathrin; Grunert, Tom; Ciolacu, Luminita; Zaiser, Andreas; Razzazi-Fazeli, Ebrahim; Schmitz-Esser, Stephan; Ehling-Schulz, Monika; Wagner, Martin

    2016-02-02

    The foodborne pathogen Listeria monocytogenes, responsible for listeriosis a rare but severe infection disease, can survive in the food processing environment for month or even years. So-called persistent L. monocytogenes strains greatly increase the risk of (re)contamination of food products, and are therefore a great challenge for food safety. However, our understanding of the mechanism underlying persistence is still fragmented. In this study we compared the exoproteome of three persistent strains with the reference strain EGDe under mild stress conditions using 2D differential gel electrophoresis. Principal component analysis including all differentially abundant protein spots showed that the exoproteome of strain EGDe (sequence type (ST) 35) is distinct from that of the persistent strain R479a (ST8) and the two closely related ST121 strains 4423 and 6179. Phylogenetic analyses based on multilocus ST genes showed similar grouping of the strains. Comparing the exoproteome of strain EGDe and the three persistent strains resulted in identification of 22 differentially expressed protein spots corresponding to 16 proteins. Six proteins were significantly increased in the persistent L. monocytogenes exoproteomes, among them proteins involved in alkaline stress response (e.g. the membrane anchored lipoprotein Lmo2637 and the NADPH dehydrogenase NamA). In parallel the persistent strains showed increased survival under alkaline stress, which is often provided during cleaning and disinfection in the food processing environments. In addition, gene expression of the proteins linked to stress response (Lmo2637, NamA, Fhs and QoxA) was higher in the persistent strain not only at 37 °C but also at 10 °C. Invasion efficiency of EGDe was higher in intestinal epithelial Caco2 and macrophage-like THP1 cells compared to the persistent strains. Concurrently we found higher expression of proteins involved in virulence in EGDe e.g. the actin-assembly-inducing protein ActA and the

  1. Occurrence of Listeria monocytogenes in Ready-to-Eat Meat Products and Meat Processing Plants in Spain

    Directory of Open Access Journals (Sweden)

    Diego Gómez

    2015-07-01

    Full Text Available The aim of this work was to study the occurrence of Listeria monocytogenes in several types of ready-to-eat (RTE meat products and in the environment of meat processing plants. A total of 129 samples of RTE meat products and 110 samples from work surfaces and equipment were analyzed. L. monocytogenes was detected in 6 out of 35 cooked products (17.14%, 21 out of 57 raw-cured products (36.84%, and 9 out of 37 dry-cured, salted products (24.32%. The number of sample units that exceeded the food safety limit of 100 cfu/g decreased from the manufacture date to half shelf life, and then it was further reduced at the end of shelf life. L. monocytogenes was detected in 25 out of 110 (22.72% food contact surfaces. The number of positive and negative results from both food and environmental samples were cross-tabulated and the calculated Cohen’s kappa coefficient (κ was 0.3233, indicating a fair agreement in terms of Listeria contamination. L. monocytogenes was recovered after cleaning and disinfection procedures in four plants, highlighting the importance of thorough cleaning and disinfection.

  2. Listeria monocytogenes en alimentos: ¿son todos los aislamientos igual de virulentos? Foodborne Listeria monocytogenes: are all the isolates equally virulent?

    Directory of Open Access Journals (Sweden)

    V. López

    2006-12-01

    . monocytogenes strains. Despite this great step forward, there is not a single marker available to test the virulence of field isolates of this species. In the future, the combination of different molecular markers will probably allow the screening of food contamination by only the virulent clones of L. monocytogenes, thus improving the prevention of foodborne human listeriosis.

  3. Prevalence of Listeria monocytogenes in poultry meat

    Directory of Open Access Journals (Sweden)

    Mehmet ELMALI

    2015-01-01

    Full Text Available AbstractThe objectives of this study were i to isolate Listeria spp. and Listeria monocytogenes in broiler wing meat samples, ii to confirm the isolates by PCR, based on prs and hly A gene sequences, iii to determine the seasonal and monthly distribution of the isolates. A total of 120 broiler wing meat samples (60 packaged pieces wrapped using strech film in styrofoam plates and 60 unpackaged pieces bought from different markets in Hatay province were analysed. Listeria spp. was isolated from 57 (47.5% out of 120 samples. Fifty-four, out of 57 Listeria spp. isolates were identified as L. monocytogenes. L. monocytogenes was isolated from the samples collected during the spring, winter, summer, and autumn at the levels of 26.6%, 40%, 53.3%, 60%, respectively. In this study, the isolation rates were found to be the highest in autumn, while the isolation rates were found to be the lowest in spring. As a consequence, high prevalence of Listeria spp. and L. monocytogenes in poultry wing meat samples may pose a risk for human health. We consider that with obeying the rules of good hygiene practices (GHP, good manufacturing practices (GMP and HACCP can minimize the contamination with Listeria spp.

  4. Control options for Listeria monocytogenes in seafoods

    DEFF Research Database (Denmark)

    Huss, Hans Henrik; Jørgensen, Lasse Vigel; Vogel, Birte Fonnesbech

    2000-01-01

    At least three outbreaks of listeriosis associated with seafood have been reported. Listeria monocytogenes is widely distributed in the general environment including fresh water, coastal water and live fish from these areas. Contamination or recontamination of seafood may also take place during...

  5. Listeria monocytogenes : nog steeds een probleem?

    NARCIS (Netherlands)

    Beumer, R.R.

    2011-01-01

    Listeria monocytogenes is net als vele andere bacteriële voedselpathogenen al tientallen jaren bekend. De meeste grondstoffen voor voedingsmiddelen komen uit de akker- en tuinbouw, de veehouderij en de visserij. Besmetting vindt daar plaats met micro-organismen afkomstig uit grond, fecaliën, water,

  6. Quantifying Listeria monocytogenes prevalence and concentration in minced pork meat and estimating performance of three culture media from presence/absence microbiological testing using a deterministic and stochastic approach.

    Science.gov (United States)

    Andritsos, Nikolaos D; Mataragas, Marios; Paramithiotis, Spiros; Drosinos, Eleftherios H

    2013-12-01

    Listeria monocytogenes poses a serious threat to public health, and the majority of cases of human listeriosis are associated with contaminated food. Reliable microbiological testing is needed for effective pathogen control by food industry and competent authorities. The aims of this work were to estimate the prevalence and concentration of L. monocytogenes in minced pork meat by the application of a Bayesian modeling approach, and also to determine the performance of three culture media commonly used for detecting L. monocytogenes in foods from a deterministic and stochastic perspective. Samples (n = 100) collected from local markets were tested for L. monocytogenes using in parallel the PALCAM, ALOA and RAPID'L.mono selective media according to ISO 11290-1:1996 and 11290-2:1998 methods. Presence of the pathogen was confirmed by conducting biochemical and molecular tests. Independent experiments (n = 10) for model validation purposes were performed. Performance attributes were calculated from the presence-absence microbiological test results by combining the results obtained from the culture media and confirmative tests. Dirichlet distribution, the multivariate expression of a Beta distribution, was used to analyze the performance data from a stochastic perspective. No L. monocytogenes was enumerated by direct-plating (media were best at ruling in L. monocytogenes presence than ruling it out. Sensitivity and specificity varied depending on the culture-dependent method. None of the culture media was perfect in detecting L. monocytogenes in minced pork meat alone. The use of at least two culture media in parallel enhanced the efficiency of L. monocytogenes detection. Bayesian modeling may reduce the time needed to draw conclusions regarding L. monocytogenes presence and the uncertainty of the results obtained. Furthermore, the problem of observing zero counts may be overcome by applying Bayesian analysis, making the determination of a test performance feasible

  7. Listeria monocytogenes in milk and cheese: studies of prevalence, behaviour and growth modelling during cheesemaking and shelf life

    OpenAIRE

    Dalzini, Elena

    2017-01-01

    Among food-borne pathogens, L. monocytogenes represents one of the most serious food safety concerns. In particular, dairy products are often a source of this infection. During 2007 and 2009 in Italy there was an increase of notifications of listeriosis with the most cases reported in the Centre-North of Italy. This is probably attributable both to a real increase of listeriosis in Italy and to surveillance implementation. However, statistically significant increasing trends in listeriosis no...

  8. Effect of packaging and storage time on survival of Listeria monocytogenes on kippered beef steak and turkey tenders.

    Science.gov (United States)

    Uppal, Kamaldeep K; Getty, Kelly J K; Boyle, Elizabeth A E; Harper, Nigel M; Lobaton-Sulabo, April Shayne S; Barry, Bruce

    2012-01-01

    The objective of our study was to determine effect of packaging method and storage time on reducing Listeria monocytogenes in shelf-stable meat snacks. Commercially available kippered beef steak strips and turkey tenders were dipped into a 5-strain L. monocytogenes cocktail, and dried at 23 °C until a water activity of 0.80 was achieved. Inoculated samples were packaged with 4 treatments: (1) vacuum, (2) nitrogen flushed with oxygen scavenger, (3) heat sealed with oxygen scavenger, and (4) heat sealed without oxygen scavenger. Samples were stored at 23 °C and evaluated for L. monocytogenes levels at 0, 24, 48, and 72 h. Initial levels (time 0) of L. monocytogenes were approximately 5.7 log CFU/cm² for steak and tenders. After 24 h of storage time, a 1 log CFU/cm² reduction of L. monocytogenes was observed for turkey tenders for all packaging treatments. After 48 h, turkey tenders showed >1 log CFU/cm² reduction of L. monocytogenes for all packaging treatments except for vacuum, where only 0.9 log CFU/cm² reduction was observed. After 72 h, reductions for all packaging treatments for turkey tenders ranged from 1.5 to 2.4 log CFU/cm². For kippered beef steak, there was no interaction between the packaging treatments and all storage times (P > 0.05) whereas, time was different (P packaging treatments and a 2.1 log CFU/ cm² L. monocytogenes reduction at 72 h of storage time. Processors of kippered beef steak and turkey tenders could use a combination of vacuum or nitrogen-flushing or heat sealed with an oxygen scavenger packaging methods and a holding time of 24 h prior to shipping to reduce potential L. monocytogenes numbers by ≥1 log. However, processors should be encouraged to hold packaged product a minimum of 72 h to enhance the margin of safety for L. monocytogenes control. © 2011 Institute of Food Technologists®

  9. Purification of leucocin A for use on wieners to inhibit Listeria monocytogenes in the presence of spoilage organisms.

    Science.gov (United States)

    Balay, Danielle R; Dangeti, Ramana V; Kaur, Kamaljit; McMullen, Lynn M

    2017-08-16

    investigation on the ability of L. monocytogenes to form spontaneous resistance to class II bacteriocins on food matrices during prolonged storage is warranted. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. The need for integration of drought monitoring tools for proactive food security management in sub-Saharan Africa

    Science.gov (United States)

    Tadesse, T.; Haile, M.; Senay, G.; Wardlow, B.D.; Knutson, C.L.

    2008-01-01

    Reducing the impact of drought and famine remains a challenge in sub-Saharan Africa despite ongoing drought relief assistance in recent decades. This is because drought and famine are primarily addressed through a crisis management approach when a disaster occurs, rather than stressing preparedness and risk management. Moreover, drought planning and food security efforts have been hampered by a lack of integrated drought monitoring tools, inadequate early warning systems (EWS), and insufficient information flow within and between levels of government in many sub-Saharan countries. The integration of existing drought monitoring tools for sub-Saharan Africa is essential for improving food security systems to reduce the impacts of drought and famine on society in this region. A proactive approach emphasizing integration requires the collective use of multiple tools, which can be used to detect trends in food availability and provide early indicators at local, national, and regional scales on the likely occurrence of food crises. In addition, improving the ability to monitor and disseminate critical drought-related information using available modern technologies (e.g., satellites, computers, and modern communication techniques) may help trigger timely and appropriate preventive responses and, ultimately, contribute to food security and sustainable development in sub-Saharan Africa. ?? 2008 United Nations.

  11. Results from a post-launch monitoring survey on consumer purchases of foods with added phytosterols in five European countries.

    Science.gov (United States)

    Willems, Julie I; Blommaert, Mireille A E; Trautwein, Elke A

    2013-12-01

    Phytosterols (plant sterols and stanols), in the form of phytosterol-esters, are used in food products as active ingredients to lower elevated blood low density lipoprotein-cholesterol concentrations. In Europe, plant sterol-esters gained Novel Foods authorisation in 2000. As a requirement of the authorisation, Unilever developed a post-launch monitoring program to monitor the use of products with added phytosterols. This paper reports findings from the 2011 post-launch monitoring survey on consumer purchase behaviour of foods with added phytosterols. 91,000 households in the Netherlands, Belgium, United Kingdom, France and Germany were included. 11,612 purchased foods with added phytosterols, including spreads, salad dressings, milk- and yoghurt-type products. The results show that 71-82% of households purchasing products with added phytosterols were 1-2 person households. These households were also purchasing the majority of the volume sold in each country (75-85%). The average phytosterol intakes per household were 0.35-0.86 g/day; well below the 1.5-3.0 g/day phytosterols needed to achieve a significant blood cholesterol lowering benefit. Post-launch monitoring is an accepted and useful tool to estimate the consumption behaviour amongst different consumer groups. Data show that average phytosterol intakes per household were well below 1g/day, suggesting that overconsumption is unlikely. Copyright © 2013 Elsevier Ltd. All rights reserved.

  12. Roles of a novel Crp/Fnr family transcription factor Lmo0753 in soil survival, biofilm production and surface attachment to fresh produce of Listeria monocytogenes.

    Directory of Open Access Journals (Sweden)

    Joelle K Salazar

    Full Text Available Listeria monocytogenes is a foodborne bacterial pathogen and the causative agent of an infectious disease, listeriosis. L. monocytogenes is ubiquitous in nature and has the ability to persist in food processing environments for extended periods of time by forming biofilms and resisting industrial sanitization. Human listeriosis outbreaks are commonly linked to contaminated dairy products, ready-to-eat meats, and in recent years, fresh produce such as lettuce and cantaloupes. We identified a putative Crp/Fnr family transcription factor Lmo0753 that is highly specific to human-associated genetic lineages of L. monocytogenes. Lmo0753 possesses two conserved functional domains similar to the major virulence regulator PrfA in L. monocytogenes. To determine if Lmo0753 is involved in environmental persistence-related mechanisms, we compared lmo0753 deletion mutants with respective wild type and complementation mutants of two fully sequenced L. monocytogenes genetic lineage II strains 10403S and EGDe for the relative ability of growth under different nutrient availability and temperatures, soil survival, biofilm productivity and attachment to select fresh produce surfaces including romaine lettuce leaves and cantaloupe rinds. Our results collectively suggested that Lmo0753 plays an important role in L. monocytogenes biofilm production and attachment to fresh produce, which may contribute to the environmental persistence and recent emergence of this pathogen in human listeriosis outbreaks linked to fresh produce.

  13. Listeria Monocytogenes Persistence in Ready-to-Eat Sausages and in Processing Plants.

    Science.gov (United States)

    Mureddu, Anna; Mazza, Roberta; Fois, Federica; Meloni, Domenico; Bacciu, Roberto; Piras, Francesca; Mazzette, Rina

    2014-01-21

    Listeria monocytogenes is of major concern in the fermented meat products and is able to persist in their processing environments. The aim of the present work was to evaluate the virulence profile and the persistence capacity of L. monocytogenes strains isolated in Sardinian fermented sausages processing plants. Food (ground meat, sausages at the end of acidification and ripening stage) and environmental samples (a total of n. 385), collected from 4 meat processing plants located in Sardinia (Italy), were examined to detect L. monocytogenes presence. All the L. monocytogenes isolates were identified by polymerase chain reaction (PCR) method. A subset of strains was also characterised by multiplex PCR-based serogrouping, using the lmo0737 , lmo1118 , ORF2819 and ORF2110 genes. Three different multiplex PCRs were used to obtain the virulence profiles by the rrn , hlyA , actA , prfA , inlA , inlB , iap , plcA , plcB and mpl marker genes. Furthermore, in vitro biofilm forming ability and resistance to disinfectants were carried out on microtiter plate. The overall prevalence was 31.5% in food, and 68.5% in environmental samples. The prevalent serotype resulted 1/2c (43%), followed by 1/2a (40%), 4b (8.6%), and 1/2b (8.6%). The amplification products of the virulence genes were found in all the isolates with the following prevalence: 77.1% hlyA ; 100% rrn ; 100% prfA ; 97.1% iap ; 65.7% inlB ; 88.6% inlA ; 100% plcA ; 100% plcB and 74.3% mpl . As for biofilm forming ability, 37.1% of the strains were positive and resulted weak producer, but all the isolates were sensible to disinfectants showing a reduction of L. monocytogenes growth after each incubation time. More appropriate technologies and application of measures of hygienic control should be implemented to prevent the L. monocytogenes growth and cross-contamination in salsiccia sarda processing plants.

  14. Listeria monocytogenes persistence in ready-to-eat sausages and in processing plants

    Directory of Open Access Journals (Sweden)

    Anna Mureddu

    2014-02-01

    Full Text Available Listeria monocytogenes is of major concern in the fermented meat products and is able to persist in their processing environments. The aim of the present work was to evaluate the virulence profile and the persistence capacity of L. monocytogenes strains isolated in Sardinian fermented sausages processing plants. Food (ground meat, sausages at the end of acidification and ripening stage and environmental samples (a total of n. 385, collected from 4 meat processing plants located in Sardinia (Italy, were examined to detect L. monocytogenes presence. All the L. monocytogenes isolates were identified by polymerase chain reaction (PCR method. A subset of strains was also characterised by multiplex PCR-based serogrouping, using the lmo0737, lmo1118, ORF2819 and ORF2110 genes. Three different multiplex PCRs were used to obtain the virulence profiles by the rrn, hlyA, actA, prfA, inlA, inlB, iap, plcA, plcB and mpl marker genes. Furthermore, in vitro biofilm forming ability and resistance to disinfectants were carried out on microtiter plate. The overall prevalence was 31.5% in food, and 68.5% in environmental samples. The prevalent serotype resulted 1/2c (43%, followed by 1/2a (40%, 4b (8.6%, and 1/2b (8.6%. The amplification products of the virulence genes were found in all the isolates with the following prevalence: 77.1% hlyA; 100% rrn; 100% prfA; 97.1% iap; 65.7% inlB; 88.6% inlA; 100% plcA; 100% plcB and 74.3% mpl. As for biofilm forming ability, 37.1% of the strains were positive and resulted weak producer, but all the isolates were sensible to disinfectants showing a reduction of L. monocytogenes growth after each incubation time. More appropriate technologies and application of measures of hygienic control should be implemented to prevent the L. monocytogenes growth and crosscontamination in salsiccia sarda processing plants.

  15. Occurrence and antimicrobial resistance patterns of Listeria monocytogenes isolated from vegetables

    Directory of Open Access Journals (Sweden)

    Vanessa de Vasconcelos Byrne

    2016-06-01

    Full Text Available Abstract Although the consumption of fresh and minimally processed vegetables is considered healthy, outbreaks related to the contamination of these products are frequently reported. Among the food-borne pathogens that contaminate vegetables is Listeria monocytogenes, a ubiquitous organism that exhibits the ability to survive and multiply at refrigerated temperatures. This study aimed to evaluate the occurrence of L. monocytogenes in vegetables as well as the antimicrobial resistance of isolates. The results showed that 3.03% of samples were contaminated with L. monocytogenes, comprising 2.22% of raw vegetables and 5.56% of ready-to-eat vegetables. Multiplex PCR confirmed the virulence potential of the isolates. Antimicrobial resistance profiling showed that 50% of the isolates were susceptible to the antibiotics used. The resistance of one isolate to penicillin G, a commonly employed therapeutic agent, and the presence of serotype 4b, a serotype commonly associated with food-borne outbreaks, could be potential health hazards for consumers.

  16. Occurrence and antimicrobial resistance patterns of Listeria monocytogenes isolated from vegetables.

    Science.gov (United States)

    de Vasconcelos Byrne, Vanessa; Hofer, Ernesto; Vallim, Deyse Christina; de Castro Almeida, Rogeria Comastri

    2016-01-01

    Although the consumption of fresh and minimally processed vegetables is considered healthy, outbreaks related to the contamination of these products are frequently reported. Among the food-borne pathogens that contaminate vegetables is Listeria monocytogenes, a ubiquitous organism that exhibits the ability to survive and multiply at refrigerated temperatures. This study aimed to evaluate the occurrence of L. monocytogenes in vegetables as well as the antimicrobial resistance of isolates. The results showed that 3.03% of samples were contaminated with L. monocytogenes, comprising 2.22% of raw vegetables and 5.56% of ready-to-eat vegetables. Multiplex PCR confirmed the virulence potential of the isolates. Antimicrobial resistance profiling showed that 50% of the isolates were susceptible to the antibiotics used. The resistance of one isolate to penicillin G, a commonly employed therapeutic agent, and the presence of serotype 4b, a serotype commonly associated with food-borne outbreaks, could be potential health hazards for consumers. Copyright © 2016 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.

  17. Desiccation of adhering and biofilm Listeria monocytogenes on stainless steel: Survival and transfer to salmon products.

    Science.gov (United States)

    Hansen, Lisbeth Truelstrup; Vogel, Birte Fonnesbech

    2011-03-15

    The foodborne bacterial pathogen, Listeria monocytogenes, commonly contaminates foods during processing, where the microorganisms are potentially subjected to low relative humidity (RH) conditions for extended periods of time. The objective of this study was to examine survival during desiccation (43% RH and 15 °C) of biofilm L. monocytogenes N53-1 cells on stainless steel coupons and to assess subsequent transfer to salmon products. Formation of static biofilm (2 days at 100% RH and 15 °C) prior to desiccation for 23 days significantly (Pbiofilm cells also desiccated in low salt, indicating the protective effect of the biofilm matrix. Osmoadaptation of cells in 5% NaCl before formation of the static biofilm significantly (Pbiofilm cells was significantly (Pbiofilm bacteria, however, as biofilm formation enhanced desiccation survival more bacteria were still transferred to smoked and fresh salmon. In conclusion, the current work shows the protective effect of biofilm formation, salt and osmoadaptation on the desiccation survival of L. monocytogenes, which in turn increases the potential for cross-contamination during food processing. Copyright © 2011 Elsevier B.V. All rights reserved.

  18. Risk assessment and risk management at the Canadian Food Inspection Agency (CFIA): a perspective on the monitoring of foods for chemical residues.

    Science.gov (United States)

    Bietlot, Henri P; Kolakowski, Beata

    2012-08-01

    The Canadian Food Inspection Agency (CFIA) uses 'Ranked Risk Assessment' (RRA) to prioritize chemical hazards for inclusion in monitoring programmes or method development projects based on their relative risk. The relative risk is calculated for a chemical by scoring toxicity and exposure in the 'risk model scoring system' of the Risk Priority Compound List (RPCL). The relative ranking and the risk management options are maintained and updated in the RPCL. The ranking may be refined by the data generated by the sampling and testing programs. The two principal sampling and testing programmes are the National Chemical Residue Monitoring Program (NCRMP) and the Food Safety Action Plan (FSAP). The NCRMP sampling plans focus on the analysis of federally registered products (dairy, eggs, honey, meat and poultry, fresh and processed fruit and vegetable commodities, and maple syrup) for residues of veterinary drugs, pesticides, environmental contaminants, mycotoxins, and metals. The NCRMP is complemented by the Food Safety Action Plan (FSAP) targeted surveys. These surveys focus on emerging chemical hazards associated with specific foods or geographical regions for which applicable maximum residue limits (MRLs) are not set. The data from the NCRMP and FSAP also influence the risk management (follow-up) options. Follow-up actions vary according to the magnitude of the health risk, all with the objective of preventing any repeat occurrence to minimize consumer exposure to a product representing a potential risk to human health. © Her Majesty the Queen in Right of Canada 2012. Drug Testing and Analysis © 2012 John Wiley & Sons, Ltd.

  19. Monitoring Antimicrobial Resistance in the Food Supply Chain and Its Implications for FDA Policy Initiatives.

    Science.gov (United States)

    Zawack, Kelson; Li, Min; Booth, James G; Love, Will; Lanzas, Cristina; Gröhn, Yrjö T

    2016-09-01

    In response to concerning increases in antimicrobial resistance (AMR), the Food and Drug Administration (FDA) has decided to increase veterinary oversight requirements for antimicrobials and restrict their use in growth promotion. Given the high stakes of this policy for the food supply, economy, and human and veterinary health, it is important to rigorously assess the effects of this policy. We have undertaken a detailed analysis of data provided by the National Antimicrobial Resistance Monitoring System (NARMS). We examined the trends in both AMR proportion and MIC between 2004 and 2012 at slaughter and retail stages. We investigated the makeup of variation in these data and estimated the sample and effect size requirements necessary to distinguish an effect of the policy change. Finally, we applied our approach to take a detailed look at the 2005 withdrawal of approval for the fluoroquinolone enrofloxacin in poultry water. Slaughter and retail showed similar trends. Both AMR proportion and MIC were valuable in assessing AMR, capturing different information. Most variation was within years, not between years, and accounting for geographic location explained little additional variation. At current rates of data collection, a 1-fold change in MIC should be detectable in 5 years and a 6% decrease in percent resistance could be detected in 6 years following establishment of a new resistance rate. Analysis of the enrofloxacin policy change showed the complexities of the AMR policy with no statistically significant change in resistance of both Campylobacter jejuni and Campylobacter coli to ciprofloxacin, another second-generation fluoroquinolone. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  20. Monitoring Food Security Indicators from Remote Sensing and Predicting Cereal Production in Afghanistan

    Science.gov (United States)

    Pervez, M. S.; Budde, M. E.; Rowland, J.

    2015-12-01

    We extract percent of basin snow covered areas above 2500m elevation from Moderate Resolution Imaging Spectroradiometer (MODIS) 500-meter 8-day snow cover composites to monitor accumulation and depletion of snow in the basin. While the accumulation and depletion of snow cover extent provides an indication of the temporal progression of the snow pack, it does not provide insight into available water for irrigation. Therefore, we use snow model results from the National Operational Hydrologic Remote Sensing Center to quantify snow water equivalent and volume of water available within the snowpack for irrigation. In an effort to understand how water availability, along with its inter-annual variability, relates to the food security of the country, we develop a simple, effective, and easy-to-implement model to identify irrigated areas across the country on both annual and mid-season basis. The model is based on applying thresholds to peak growing season vegetation indices—derived from 250-meter MODIS images—in a decision-tree classifier to separate irrigated crops from non-irrigated vegetation. The spatial distribution and areal estimates of irrigated areas from these maps compare well with irrigated areas classified from multiple snap shots of the landscape from Landsat 5 optical and thermal images over selected locations. We observed that the extents of irrigated areas varied depending on the availability of snowmelt and can be between 1.35 million hectares in a year with significant water deficit and 2.4 million hectares in a year with significant water surplus. The changes in the amount of available water generally can contribute up to a 30% change in irrigated areas. We also observed that the strong correlation between inter-annual variability of irrigated areas and the variability in the country's cereal production could be utilized to predict an annual estimate of cereal production, providing early indication of food security scenarios for the country.

  1. Terrestrial radioactivity monitoring programme (TRAMP) report for 1994. Radioactivity in food and agricultural products in England and Wales

    International Nuclear Information System (INIS)

    1995-01-01

    The Ministry of Agriculture and Fisheries monitoring programmes for radioactivity in the terrestrial environment of the United Kingdom during 1994 are described. The results of the analyses performed with a commentary are presented. Two complimentary programmes, TRAMP and FARM, are used to ensure that radiation doses received by the public from the consumption of foodstuffs are controlled ion accordance with national and international guidelines. TRAMP concentrates on the monitoring of agricultural produce from the vicinity of the 23 licensed nuclear sites in England and Wales. The focus of FARM is the safety of the general food supply through natural food monitoring; a representative selection of industrial and landfill sites which provide potential sources of radionuclide contamination of the food chain is also monitored. In addition, monitoring programmes are undertaken for airborne grass and soil contamination in the neighbourhood of 18 nuclear sites. The overall conclusion drawn from the results presented is that public exposure to anthropogenic radioactivity due to the consumption of milk and foodstuffs grown around licensed nuclear sites in 1994 was well within acceptable limits. (67 references; 97 tables). (UK)

  2. Characterization of virulent Listeria monocytogenes isolates recovered from ready-to-eat meat products and consumers in Cairo, Egypt

    Directory of Open Access Journals (Sweden)

    Maysa A. I. Awadallah

    2014-10-01

    Full Text Available Aim: This study aimed to investigate the occurrence of some virulence genes distributed in Listeria monocytogenes isolated from ready-to-eat (RTE meat products and consumers in Cairo province, Egypt. Materials and Methods: A total of 120 beef luncheon, chicken luncheon and frankfurter beef (40 samples, each were collected from 10 different local shops situated in Al-salam city, Cairo province, Egypt. Stool samples were collected from 40 people who had the habit of consuming RTE meat. The suspected L. monocytogenes isolates were subjected to a multiplex polymerase chain reaction (PCR for rapid speciation and virulence determination using primers specific for inIA, inIC, and inIJ genes. Results: Culture examination of all samples on Oxford media revealed presence of colonies characteristic to L. monocytogenes in 6 beef luncheon (15%, 4 chicken luncheon (10%, 1 frankfurter beef (2.5% and 1 human stool (2.5% samples. Species identity of L. monocytogenes was verified through the amplification of a 800 bp fragment with inIA primers in 2 out of 6 culture isolates from beef luncheon (5%, and 1 out 4 culture isolates from chicken luncheon (2.5% samples. Statistical analysis revealed no significant difference between the occurrence of L. monocytogenes in different food samples examined (p>0.05. The virulence of these strains was ascertained by the presence of 517 bp and 238 bp fragments of inIC and inIJ genes, respectively in the isolates that contained the 800 bp fragment. The culture isolates obtained from one frankfurter beef sample, and one human stool sample were found negative by multiplex PCR for the presence of L. monocytogenes and its virulence specific genes. Conclusion: It could be concluded that L. monocytogenes are circulating in beef and chicken luncheon sold in Cairo, Egypt. Multiplex PCR is reliable for confirmation of L. monocytogenes. This study suggests the implementation of hygienic measures at all levels from production to consumption

  3. Strengthening Agricultural Decisions in Countries at Risk of Food Insecurity: The GEOGLAM Crop Monitor for Early Warning

    Science.gov (United States)

    Becker-Reshef, I.; Barker, B.; McGaughey, K.; Humber, M. L.; Sanchez, A.; Justice, C. O.; Rembold, F.; Verdin, J. P.

    2016-12-01

    Timely, reliable information on crop conditions, and prospects at the subnational scale, is critical for making informed policy and agricultural decisions for ensuring food security, particularly for the most vulnerable countries. However, such information is often incomplete or lacking. As such, the Crop Monitor for Early Warning (CM for EW) was developed with the goal to reduce uncertainty and strengthen decision support by providing actionable information on a monthly basis to national, regional and global food security agencies through timely consensus assessments of crop conditions. This information is especially critical in recent years, given the extreme weather conditions impacting food supplies including the most recent El Nino event. This initiative brings together the main international food security monitoring agencies and organizations to develop monthly crop assessments based on satellite observations, meteorological information, field observations and ground reports, which reflect an international consensus. This activity grew out of the successful Crop Monitor for the G20 Agricultural Market Information System (AMIS), which provides operational monthly crop assessments of the main producing countries of the world. The CM for EW was launched in February 2016 and has already become a trusted source of information internationally and regionally. Its assessments have been featured in a large number of news articles, reports, and press releases, including a joint statement by the USAID's FEWS NET, UN World Food Program, European Commission Joint Research Center, and the UN Food and Agriculture Organziation, on the devastating impacts of the southern African drought due to El Nino. One of the main priorities for this activity going forward is to expand its partnership with regional and national monitoring agencies, and strengthen capacity for national crop condition assessments.

  4. Prevalence and phylogenetic characterization of Listeria monocytogenes isolated from processed meat marketed in Egypt

    Directory of Open Access Journals (Sweden)

    Yasmin Mohamed

    2016-06-01

    Full Text Available Because of its high case fatality rate, listeriosis locates among the most frequent causes of death due to food-borne illness. In this study, a total of 150 processed meat samples were collected from Giza Governorate, Egypt. Phenotypic and genotypic identification of Listeria monocytogenes was performed using PCR incorporating listeriolysin O virulence gene hlyA followed by DNA sequence analysis. L. monocytogenes was confirmed in 4% of each of beef burger, minced meat, and luncheon samples. Phylogenetic analysis showed that all the six Egyptian isolates have high homology with Colombian isolate (EF030606, except one Egyptian isolate which showed high homology with Indian isolate (EU840690. The public health significance of these pathogens as well as recommended sanitary measures were discussed.

  5. Identification of Surface Protein Biomarkers of Listeria monocytogenes via Bioinformatics and Antibody-Based Protein Detection Tools

    Science.gov (United States)

    Zhang, Cathy X. Y.; Brooks, Brian W.; Huang, Hongsheng; Pagotto, Franco

    2016-01-01

    ABSTRACT The Gram-positive bacterium Listeria monocytogenes causes a significant percentage of the fatalities among foodborne illnesses in humans. Surface proteins specifically expressed in a wide range of L. monocytogenes serotypes under selective enrichment culture conditions could serve as potential biomarkers for detection and isolation of this pathogen via antibody-based methods. Our study aimed to identify such biomarkers. Interrogation of the L. monocytogenes serotype 4b strain F2365 genome identified 130 putative or known surface proteins. The homologues of four surface proteins, LMOf2365_0578, LMOf2365_0581, LMOf2365_0639, and LMOf2365_2117, were assessed as biomarkers due to the presence of conserved regions among strains of L. monocytogenes which are variable among other Listeria species. Rabbit polyclonal antibodies against the four recombinant proteins revealed the expression of only LMOf2365_0639 on the surface of serotype 4b strain LI0521 cells despite PCR detection of mRNA transcripts for all four proteins in the organism. Three of 35 monoclonal antibodies (MAbs) to LMOf2365_0639, MAbs M3643, M3644, and M3651, specifically recognized 42 (91.3%) of 46 L. monocytogenes lineage I and II isolates grown in nonselective brain heart infusion medium. While M3644 and M3651 reacted with 14 to 15 (82.4 to 88.2%) of 17 L. monocytogenes lineage I and II isolates, M3643 reacted with 22 (91.7%) of 24 lineage I, II, and III isolates grown in selective enrichment media (UVM1, modified Fraser, Palcam, and UVM2 media). The three MAbs exhibited only weak reactivities (the optical densities at 414 nm were close to the cutoff value) to some other Listeria species grown in selective enrichment media. Collectively, the data indicate the potential of LMOf2365_0639 as a surface biomarker of L. monocytogenes, with the aid of specific MAbs, for pathogen detection, identification, and isolation in clinical, environmental, and food samples. IMPORTANCE L. monocytogenes is

  6. Synergy of a combination of nisin and citric acid against Staphylococcus aureus and Listeria monocytogenes.

    Science.gov (United States)

    Zhao, Xingchen; Zhen, Zhen; Wang, Xinyang; Guo, Na

    2017-12-01

    Food-borne diseases caused by pathogens, such as Staphylococcus aureus and Listeria monocytogenes, have long attracted attention globally from researchers, food industries, and food safety authorities. Nisin (NS) is the only bacteriocin used worldwide as a generally recognised as safe (GRAS) food preservative, while citric acid (CA) has an unrestricted use in foods since it has GRAS status. In this study, synergistic interactions of NS combined with CA against S. aureus and L. monocytogenes were studied by the chequerboard microdilution method, with fractional inhibitory concentration index values ranging from 0.25 to 0.375 and 0.19 to 0.375, respectively. The positive interactions were verified by time-kill studies in pasteurised milk and disk diffusion assays. The mechanism of the synergistic antibacterial of NS and CA is proposed following SEM analysis and the determination of release of cell constituents. These results suggest that the cell walls and membrane are the probable main targets of this antimicrobial combination. These findings indicated that the combination of NS and CA not only could be used as a new promising naturally sourced food preservative, but may also reduce the problem of bacterial resistance.

  7. Incidence and pathogenicity profile of Listeria sp. isolated from food ...

    African Journals Online (AJOL)

    USER

    2010-07-26

    Jul 26, 2010 ... in the brain, adrenal glands, spleen, kidney, lungs and the gastrointestinal ..... Cryptogenic liver abscess due to Listeria monocytogenes. .... of foods in sporadic listeriosis I. Case – control study of dietry risk factors. J. Am. Med.

  8. Elongated cells of Listeria monocytogenes in biofilms in the presence of sucrose and bacteriocin-producing Leuconostoc mesenteroides A11

    Directory of Open Access Journals (Sweden)

    Regiane Priscilla Ratti

    2010-12-01

    Full Text Available Listeria monocytogenes is a foodborne pathogen which may survive in biofilms and persist in food processing plants. In this study, the ability of Leuconostoc mesenteroides (bac+ and bac- to inhibit biofilm formation by L. monocytogenes ATCC 19115 was studied with stainless steel coupons immersed in BHI broth and BHI broth plus sucrose in combination with the Lactic Acid Bacteria (LAB. Adhered cells were collected with swabs and enumerated on selective agars (Oxford for listeria and MRS for leuconostoc. Leuconostoc mesenteroides bac+ in co-culture with L. monocytogenes was effective to inhibit biofilm formation by listeria for up to 3 hours of incubation, but at 24 hours, biofilm was present in all conditions tested, as confirmed by observations of stainless steel coupons under Scanning Electron Microscopy (SEM. It was also observed that in the presence of L. mesenteroides bac+ in BHI plus sucrose, a high number of elongated cells of L. monocytogenes was present, which may indicate an adaptation response of the pathogen to stress conditions with important implications for food safety.

  9. Development and validation of a stochastic model for potential growth of Listeria monocytogenes in naturally contaminated lightly preserved seafood.

    Science.gov (United States)

    Mejlholm, Ole; Bøknæs, Niels; Dalgaard, Paw

    2015-02-01

    A new stochastic model for the simultaneous growth of Listeria monocytogenes and lactic acid bacteria (LAB) was developed and validated on data from naturally contaminated samples of cold-smoked Greenland halibut (CSGH) and cold-smoked salmon (CSS). During industrial processing these samples were added acetic and/or lactic acids. The stochastic model was developed from an existing deterministic model including the effect of 12 environmental parameters and microbial interaction (O. Mejlholm and P. Dalgaard, Food Microbiology, submitted for publication). Observed maximum population density (MPD) values of L. monocytogenes in naturally contaminated samples of CSGH and CSS were accurately predicted by the stochastic model based on measured variability in product characteristics and storage conditions. Results comparable to those from the stochastic model were obtained, when product characteristics of the least and most preserved sample of CSGH and CSS were used as input for the existing deterministic model. For both modelling approaches, it was shown that lag time and the effect of microbial interaction needs to be included to accurately predict MPD values of L. monocytogenes. Addition of organic acids to CSGH and CSS was confirmed as a suitable mitigation strategy against the risk of growth by L. monocytogenes as both types of products were in compliance with the EU regulation on ready-to-eat foods. Copyright © 2014 Elsevier Ltd. All rights reserved.

  10. Impact of the reusing of food manufacturing wastewater for irrigation in a closed system on the microbiological quality of the food crops.

    Science.gov (United States)

    Beneduce, Luciano; Gatta, Giuseppe; Bevilacqua, Antonio; Libutti, Angela; Tarantino, Emanuele; Bellucci, Micol; Troiano, Eleonora; Spano, Giuseppe

    2017-11-02

    In order to evaluate if the reuse of food industry treated wastewater is compatible for irrigation of food crops, without increased health risk, in the present study a cropping system, in which ground water and treated wastewater were used for irrigation of tomato and broccoli, during consecutive crop seasons was monitored. Water, crop environment and final products were monitored for microbial indicators and pathogenic bacteria, by conventional and molecular methods. The microbial quality of the irrigation waters influenced sporadically the presence of microbial indicators in soil. No water sample was found positive for pathogenic bacteria, independently from the source. Salmonella spp. and Listeria monocytogenes were detected in soil samples, independently from the irrigation water source. No pathogen was found to contaminate tomato plants, while Listeria monocytogenes and E. coli O157:H7 were detected on broccoli plant, but when final produce were harvested, no pathogen was detected on edible part. The level of microbial indicators and detection of pathogenic bacteria in field and plant was not dependent upon wastewater used. Our results, suggest that reuse of food industry wastewater for irrigation of agricultural crop can be applied without significant increase of potential health risk related to microbial quality. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. Detection of Listeria monocytogenes from selective enrichment broth using MALDI-TOF Mass Spectrometry.

    Science.gov (United States)

    Jadhav, Snehal; Sevior, Danielle; Bhave, Mrinal; Palombo, Enzo A

    2014-01-31

    Conventional methods used for primary detection of Listeria monocytogenes from foods and subsequent confirmation of presumptive positive samples involve prolonged incubation and biochemical testing which generally require four to five days to obtain a result. In the current study, a simple and rapid proteomics-based MALDI-TOF MS approach was developed to detect L. monocytogenes directly from selective enrichment broths. Milk samples spiked with single species and multiple species cultures were incubated in a selective enrichment broth for 24h, followed by an additional 6h secondary enrichment. As few as 1 colony-forming unit (cfu) of L. monocytogenes per mL of initial selective broth culture could be detected within 30h. On applying the same approach to solid foods previously implicated in listeriosis, namely chicken pâté, cantaloupe and Camembert cheese, detection was achieved within the same time interval at inoculation levels of 10cfu/mL. Unlike the routine application of MALDI-TOF MS for identification of bacteria from solid media, this study proposes a cost-effective and time-saving detection scheme for direct identification of L. monocytogenes from broth cultures.This article is part of a Special Issue entitled: Trends in Microbial Proteomics. Globally, foodborne diseases are major causes of illness and fatalities in humans. Hence, there is a continual need for reliable and rapid means for pathogen detection from food samples. Recent applications of MALDI-TOF MS for diagnostic microbiology focused on detection of microbes from clinical specimens. However, the current study has emphasized its use as a tool for detecting the major foodborne pathogen, Listeria monocytogenes, directly from selective enrichment broths. This proof-of-concept study proposes a detection scheme that is more rapid and simple compared to conventional methods of Listeria detection. Very low levels of the pathogen could be identified from different food samples post-enrichment in

  12. Bacteriophage biocontrol of Listeria monocytogenes on soft ripened white mold and red-smear cheeses.

    Science.gov (United States)

    Guenther, Susanne; Loessner, Martin J

    2011-03-01

    Soft-ripened cheeses belong to the type of food most often contaminated with Listeria monocytogenes, and they have been implicated in several outbreaks of listeriosis. Bacteriophages represent an attractive way to combat foodborne pathogens without affecting other properties of the food. We used the broad host range, virulent Listeria phage A511 for control of L. monocytogenes during the production and ripening phases of both types of soft-ripened cheeses, white mold (Camembert-type) cheese, as well as washed-rind cheese with a red-smear surface (Limburger-type). The surfaces of young, unripened cheese were inoculated with 10(1)-10(3) cfu/cm(2)L. monocytogenes strains Scott A (serovar 4b) or CNL 10(3)/2005 (serovar 1/2a). Phage was applied at defined time points thereafter, in single or repeated treatments, at 3 × 10(8) or 1 × 10(9) pfu/cm(2). With Scott A (10(3) cfu/cm(2)) and a single dose of A511 (3 × 10(8) pfu/cm(2)) on camembert-type cheese, viable counts dropped 2.5 logs at the end of the 21 day ripening period. Repeated phage application did not further inhibit the bacteria, whereas a single higher dose (1 × 10(9) pfu/cm(2)) was found to be more effective. On red-smear cheese ripened for 22 days, Listeria counts were down by more than 3 logs. Repeated application of A511 further delayed re-growth of Listeria, but did not affect bacterial counts after 22 days. With lower initial Listeria contamination (10(1)-10(2) cfu/cm(2)), viable counts dropped below the limit of detection, corresponding to more than 6 logs reduction compared to the control. Our data clearly demonstrate the potential of bacteriophage for biocontrol of L. monocytogenes in soft cheese.

  13. Highly specific fiber optic immunosensor coupled with immunomagnetic separation for detection of low levels of Listeria monocytogenes and L. ivanovii

    Science.gov (United States)

    2012-01-01

    Background Immunomagnetic separation (IMS) and immunoassays are widely used for pathogen detection. However, novel technology platforms with highly selective antibodies are essential to improve detection sensitivity, specificity and performance. In this study, monoclonal antibodies (MAbs) against Internalin A (InlA) and p30 were generated and used on paramagnetic beads of varying diameters for concentration, as well as on fiber-optic sensor for detection. Results Anti-InlA MAb-2D12 (IgG2a subclass) was specific for Listeria monocytogenes and L. ivanovii, and p30-specific MAb-3F8 (IgM) was specific for the genus Listeria. At all bacterial concentrations (103–108 CFU/mL) tested in the IMS assay; the 1-μm diameter MyOne beads had significantly higher capture efficiency (P Listeria antibody (9 %). Furthermore, capture efficiency for MyOne-2D12 was highly specific for L. monocytogenes and L. ivanovii. Subsequently, we captured L. monocytogenes by MyOne-2D12 and MyOne-3F8 from hotdogs inoculated with mono- or co-cultures of L. monocytogenes and L. innocua (10–40 CFU/g), enriched for 18 h and detected by fiber-optic sensor and confirmed by plating, light-scattering, and qPCR assays. The detection limit for L. monocytogenes and L. ivanovii by the fiber-optic immunosensor was 3 × 102 CFU/mL using MAb-2D12 as capture and reporter antibody. Selective media plating, light-scattering, and qPCR assays confirmed the IMS and fiber-optic results. Conclusions IMS coupled with a fiber-optic sensor using anti-InlA MAb is highly specific for L. monocytogenes and L. ivanovii and enabled detection of these pathogens at low levels from buffer or food. PMID:23176167

  14. Prevalence of Listeria monocytogenes and other Listeria species in butter from United Kingdom production, retail, and catering premises.

    Science.gov (United States)

    Lewis, H C; Little, C L; Elson, R; Greenwood, M; Grant, K A; McLauchlin, J

    2006-07-01

    Two recent listeriosis outbreaks involving butter prompted this first cross-sectional study on the prevalence, levels, and types of Listeria species in 3229 samples of butter from production, retail, and catering premises in the United Kingdom during May and June 2004. When the criteria of the Microbiological Guidelines were used, 99.4% of samples were found to be of satisfactory microbiological quality, 0.5% were of acceptable quality, and 0.1% were of unsatisfactory quality as a result of high levels (>100 CFU/g) of Listeria spp. The butter samples with Listeria spp. present at more than 100 CFU/g were negative for L. monocytogenes. L. monocytogenes was detected in 0.4% (n=13) of samples, all at levels of less than 10 CFU/g, and were therefore of acceptable quality. Butter was contaminated more frequently with Listeria spp., including L. monocytogenes, when packed in plastic tubs, when in pack sizes of 500 g or less, when stored or displayed above 8 degrees C, when a hazard analysis system was not in place, and when the manager had received no food hygiene training. This study demonstrates that although butter is regarded as a low-risk product, it may provide an environment for the persistence and growth of Listeria spp., including L. monocytogenes. The control of L. monocytogenes in food processing and supply systems is critical in order to minimize the potential for this bacterium to be present in foods at the point of consumption at levels hazardous to health.

  15. Exposure to minimally processed pear and melon during shelf life could modify the pathogenic potential of Listeria monocytogenes.

    Science.gov (United States)

    Colás-Medà, Pilar; Viñas, Inmaculada; Oliveira, Márcia; Anguera, Marina; Serrano, Jose C E; Abadias, Maribel

    2017-04-01

    Survival and virulence of foodborne pathogens can be influenced by environmental factors such as the intrinsic properties of food as well as the extrinsic properties that contribute to food shelf life (e.g., temperature and gas atmosphere). The direct contribution of food matrix characteristics on the survival of L. monocytogenes during fresh-cut fruit shelf life is not very well understood. In addition, the gastrointestinal tract is the primary route of listeriosis infection and penetration of the intestinal epithelial cell barrier is the first step in the infection process. Hence, the pathogenic potential of L. monocytogenes, measured as the capability for the organism to survive a simulated gastrointestinal tract and the proportion of cells able to subsequently adhere to and invade differentiated Caco-2 cells, subjected to fresh-cut pear and melon shelf life, was investigated. Samples were inoculated, stored at 10 °C for 7 days and evaluated after inoculation and again after 2 and 7 days of storage. A decrease in L. monocytogenes' capacity to survive a simulated gastrointestinal tract was observed with increasing storage time, regardless of the fruit matrix evaluated. Furthermore, L. monocytogenes placed on fresh-cut pear and melon was subjected to an attachment and invasion assay after crossing the simulated gastrointestinal tract. After inoculation, pathogen on fresh-cut pear showed 5-fold more capacity to adhere to Caco-2 cells than pathogen on fresh-cut melon. After 2 days of storage, L. monocytogenes grown on fresh-cut melon showed similar adhesive capacity (1.11%) than cells grown on pear (1.83%), but cells grown on melon had the higher invasive capacity (0.0093%). We can conclude that minimally processed melon could represent a more important hazard than pear under the studied shelf life. Copyright © 2016 Elsevier Ltd. All rights reserved.

  16. Radiocesium Concentration Change in Game Animals: Use of Food Monitoring Data - 13168

    International Nuclear Information System (INIS)

    Tagami, Keiko; Uchida, Shigeo

    2013-01-01

    Radionuclides were released into the environment in the Fukushima Daiichi Nuclear Power Plant (FDNPP) accident. Radiocesium (Cs-134+137) concentrations in most agricultural products became lower than the detection limit (∼10 Bq kg -1 ) from June 2011, and the concentrations have remained low. However, some wild food materials such as meat of game animals (e.g., bear and wild boar) caught in Fukushima and surrounding areas some times showed higher values than the detection limits. In this study, monitoring data on game animal meat were summarized to understand the amount of activities found in wild animals and the activity distribution in the contaminated areas. Concentration data are available from monthly reports issued by the Ministry of Health, Labour and Welfare. Data were collected on wild boar (Sus scrofa), deer (Cervus nippon), Asian black bear (Ursus thibetanus), Japanese pheasant (Phasianus versicolor), and duck (e.g. Anas poecilorhynch). There is a tendency that the concentration decreases with distance from the FDNPP; in order to compare the Cs-137 concentrations among animals, one collection site was selected. The results showed that the concentration was in the following order within one year: Asian black bear>wild boar> deer >duck and Japanese pheasant. Bear and boar are omnivorous animals and their feeding pattern would affect the concentrations in their meats. (authors)

  17. Colorimetric humidity sensor based on liquid composite materials for the monitoring of food and pharmaceuticals.

    Science.gov (United States)

    Bridgeman, Devon; Corral, Javier; Quach, Ashley; Xian, Xiaojun; Forzani, Erica

    2014-09-09

    Using supported ionic-liquid membrane (SILM)-inspired methodologies, we have synthesized, characterized, and developed a humidity sensor by coating a liquid composite material onto a hygroscopic, porous substrate. Similar to pH paper, the sensor responds to the environment's relative humidity and changes color accordingly. The humidity indicator is prepared by casting a few microliters of low-toxicity reagents on a nontoxic substrate. The sensing material is a newly synthesized liquid composite that comprises a hygroscopic medium for environmental humidity capture and a color indicator that translates the humidity level into a distinct color change. Sodium borohydride was used to form a liquid composite medium, and DenimBlu30 dye was used as a redox indicator. The liquid composite medium provides a hygroscopic response to the relative humidity, and DenimBlu30 translates the chemical changes into a visual change from yellow to blue. The borate-redox dye-based humidity sensor was prepared, and then Fourier transform infrared spectroscopy, differential scanning calorimetry, and image analysis methods were used to characterize the chemical composition, optimize synthesis, and gain insight into the sensor reactivity. Test results indicated that this new sensing material can detect relative humidity in the range of 5-100% in an irreversible manner with good reproducibility and high accuracy. The sensor is a low-cost, highly sensitive, easy-to-use humidity indicator. More importantly, it can be easily packaged with products to monitor humidity levels in pharmaceutical and food packaging.

  18. Radiocesium Concentration Change in Game Animals: Use of Food Monitoring Data - 13168

    Energy Technology Data Exchange (ETDEWEB)

    Tagami, Keiko; Uchida, Shigeo [Office of Biospheric Assessment for Waste Disposal, National Institute of Radiological Sciences, Anagawa 4-9-1, Inage-ku, Chiba 263-8555 (Japan)

    2013-07-01

    Radionuclides were released into the environment in the Fukushima Daiichi Nuclear Power Plant (FDNPP) accident. Radiocesium (Cs-134+137) concentrations in most agricultural products became lower than the detection limit (∼10 Bq kg{sup -1}) from June 2011, and the concentrations have remained low. However, some wild food materials such as meat of game animals (e.g., bear and wild boar) caught in Fukushima and surrounding areas some times showed higher values than the detection limits. In this study, monitoring data on game animal meat were summarized to understand the amount of activities found in wild animals and the activity distribution in the contaminated areas. Concentration data are available from monthly reports issued by the Ministry of Health, Labour and Welfare. Data were collected on wild boar (Sus scrofa), deer (Cervus nippon), Asian black bear (Ursus thibetanus), Japanese pheasant (Phasianus versicolor), and duck (e.g. Anas poecilorhynch). There is a tendency that the concentration decreases with distance from the FDNPP; in order to compare the Cs-137 concentrations among animals, one collection site was selected. The results showed that the concentration was in the following order within one year: Asian black bear>wild boar> deer >duck and Japanese pheasant. Bear and boar are omnivorous animals and their feeding pattern would affect the concentrations in their meats. (authors)

  19. Novel Cadmium Resistance Determinant in Listeria monocytogenes.

    Science.gov (United States)

    Parsons, Cameron; Lee, Sangmi; Jayeola, Victor; Kathariou, Sophia

    2017-03-01

    Listeria monocytogenes is a foodborne pathogen that can cause severe disease (listeriosis) in susceptible individuals. It is ubiquitous in the environment and often exhibits resistance to heavy metals. One of the determinants that enables Listeria to tolerate exposure to cadmium is the cadAC efflux system, with CadA being a P-type ATPase. Three different cadA genes (designated cadA1 to cadA3 ) were previously characterized in L. monocytogenes A novel putative cadmium resistance gene ( cadA4 ) was recently identified through whole-genome sequencing, but experimental confirmation for its involvement in cadmium resistance is lacking. In this study, we characterized cadA4 in L. monocytogenes strain F8027, a cadmium-resistant strain of serotype 4b. By screening a mariner-based transposon library of this strain, we identified a mutant with reduced tolerance to cadmium and that harbored a single transposon insertion in cadA4 The tolerance to cadmium was restored by genetic complementation with the cadmium resistance cassette ( cadA4C ), and enhanced cadmium tolerance was conferred to two unrelated cadmium-sensitive strains via heterologous complementation with cadA4C Cadmium exposure induced cadA4 expression, even at noninhibitory levels. Virulence assessments in the Galleria mellonella model suggested that a functional cadA4 suppressed virulence, potentially promoting commensal colonization of the insect larvae. Biofilm assays suggested that cadA4 inactivation reduced biofilm formation. These data not only confirm cadA4 as a novel cadmium resistance determinant in L. monocytogenes but also provide evidence for roles in virulence and biofilm formation. IMPORTANCE Listeria monocytogenes is an intracellular foodborne pathogen causing the disease listeriosis, which is responsible for numerous hospitalizations and deaths every year. Among the adaptations that enable the survival of Listeria in the environment are the abilities to persist in biofilms, grow in the cold, and

  20. Real-time pathogen monitoring during enrichment: a novel nanotechnology-based approach to food safety testing.

    Science.gov (United States)

    Weidemaier, Kristin; Carruthers, Erin; Curry, Adam; Kuroda, Melody; Fallows, Eric; Thomas, Joseph; Sherman, Douglas; Muldoon, Mark

    2015-04-02

    We describe a new approach for the real-time detection and identification of pathogens in food and environmental samples undergoing culture. Surface Enhanced Raman Scattering (SERS) nanoparticles are combined with a novel homogeneous immunoassay to allow sensitive detection of pathogens in complex samples such as stomached food without the need for wash steps or extensive sample preparation. SERS-labeled immunoassay reagents are present in the cultural enrichment vessel, and the signal is monitored real-time through the wall of the vessel while culture is ongoing. This continuous monitoring of pathogen load throughout the enrichment process enables rapid, hands-free detection of food pathogens. Furthermore, the integration of the food pathogen immunoassay directly into the enrichment vessel enables fully biocontained food safety testing, thereby significantly reducing the risk of contaminating the surrounding environment with enriched pathogens. Here, we present experimental results showing the detection of E. coli, Salmonella, or Listeria in several matrices (raw ground beef, raw ground poultry, chocolate milk, tuna salad, spinach, brie cheese, hot dogs, deli turkey, orange juice, cola, and swabs and sponges used to sample a stainless steel surface) using the SERS system and demonstrate the accuracy of the approach compared to plating results. Copyright © 2014 Elsevier B.V. All rights reserved.

  1. Listeria monocytogenes: monitoramento desse perigo biológico na cadeia produtiva de frangos do sul do Rio Grande do Sul Listeria monocytogenes: assessing this microbiological hazard in a poultry productive chain in southern Rio Grande do Sul

    Directory of Open Access Journals (Sweden)

    Élen Silveira Nalério

    2009-09-01

    Full Text Available Listeria monocytogenes é uma bactéria patogênica que se tornou um grande desafio para as indústrias de alimentos, entre elas a de frangos, assim como para os órgãos de vigilância sanitária. Apesar da produção de frangos estar em expansão na região sul do Rio Grande do Sul, não há relatos sobre esse patógeno, dessa forma, objetivou-se avaliar a prevalência de L. monocytogenes e de seus sorotipos nos diversos segmentos dessa cadeia produtiva. Nos aviários isolou-se L. monocytogenes em 2,9% (1/35 das amostras de swabs cloacais, não se isolando o microrganismo em amostras provenientes das camas de aviários. No abatedouro, 11,7% (15/128 das amostras apresentaram contaminação por L. monocytogenes e nos frangos resfriados procedentes do comércio, a prevalência foi de 33,3% (15/45.Observou-se que 51,6% (16/31 das cepas de L. monocytogenes pertenciam ao sorotipo 1/2b; 22,5% (7/31 ao sorotipo 4e; 16,1% (5/31 ao sorotipo 1/2a; 6,4% (2/31 ao sorotipo 4b; e 3,2% (1/31 ao sorotipo 1/2c. Há disseminação de L. monocytogenes na cadeia produtiva de frangos da região sul do Rio Grande do Sul e a presença de sorotipos prevalentes em casos/surtos de listeriose traz preocupação à saúde pública.Listeria monocytogenes is a pathogenic bacterium which has become a huge challenge to the food industries, including the poultry industry, and to the health surveillance agencies. Although poultry production is in expansion in southern of Rio Grande do Sul, Brazil, there are not reports about this pathogen thus this study aimed at assessing the prevalence of L monocytogenes and its serotypes in the several segments of this productive chain. In the broilers flocks L. monocytogenes were isolated in 2.9% (1/35 from cloacal swabs samples. This microorganism was not isolated from broiler houses samples. In the abattoir, 11% of the samples presented L. monocytogenes contamination, and in the chilled chicken from retailers its prevalence was 33.3% (15

  2. Antimicrobial Resistance Profiles of Listeria monocytogenes and Listeria innocua Isolated from Ready-to-Eat Products of Animal Origin in Spain.

    <