Directory of Open Access Journals (Sweden)
Dara eLeong
2014-08-01
Full Text Available Although rates of listeriosis are low in comparison to other foodborne pathogenic illnesses, listeriosis poses a significant risk to human health as the invasive form can have a mortality rate as high as 30%. Food processors, especially those who produce ready-to-eat products, need to be vigilant against Listeria monocytogenes, the causative pathogen of listeriosis, and as such, the occurrence of L. monocytogenes in food and in the food processing environment needs to be carefully monitored. To examine the prevalence and patterns of contamination in food processing facilities in Ireland, 48 food processors submitted 8 samples every 2 months from March 2013 to March 2014 to be analyzed for L. monocytogenes. No positive samples were detected for 38% of the processing facilities tested. Isolates found at the remaining 62% of facilities were characterized by serotyping and Pulsed Field Gel Electrophoresis (PFGE. A general L. monocytogenes prevalence of 4.6% was seen in all samples analyzed with similar rates seen in food and environmental samples. Differences in prevalence were seen across different food processors, food sectors, sampling months etc. and PFGE analysis allowed for the examination of contamination patterns and for the identification of several persistent strains. Seven of the food processing facilities tested showed contamination with persistent strains and evidence of bacterial transfer from the processing environment to food (the same pulsotype found in both was seen in four of the food processing facilities tested.
Leong, Dara; Alvarez-Ordóñez, Avelino; Jordan, Kieran
2014-01-01
Although rates of listeriosis are low in comparison to other foodborne pathogenic illness, listeriosis poses a significant risk to human health as the invasive form can have a mortality rate as high as 30%. Food processors, especially those who produce ready-to-eat (RTE) products, need to be vigilant against Listeria monocytogenes, the causative pathogen of listeriosis, and as such, the occurrence of L. monocytogenes in food and in the food processing environment needs to be carefully monitored. To examine the prevalence and patterns of contamination in food processing facilities in Ireland, 48 food processors submitted 8 samples every 2 months from March 2013 to March 2014 to be analyzed for L. monocytogenes. No positive samples were detected at 38% of the processing facilities tested. Isolates found at the remaining 62% of facilities were characterized by serotyping and Pulsed Field Gel Electrophoresis (PFGE). A general L. monocytogenes prevalence of 4.6% was seen in all samples analyzed with similar rates seen in food and environmental samples. Differences in prevalence were seen across different food processors, food sectors, sampling months etc. and PFGE analysis allowed for the examination of contamination patterns and for the identification of several persistent strains. Seven of the food processing facilities tested showed contamination with persistent strains and evidence of bacterial transfer from the processing environment to food (the same pulsotype found in both) was seen in four of the food processing facilities tested.
Monitoring paneer for Listeria monocytogenes - A high risk food ...
African Journals Online (AJOL)
A multiplex polymerase chain reaction (PCR) assay was developed and applied to spiked and natural paneer samples to detect Listeria monocytogenes, a high risk food pathogen. The sensitivity of the assay on L. monocytogenes spiked paneer samples was 104 cells prior to enrichment, was improved to 103 cells after 4 h ...
Camargo, Anderson Carlos; Woodward, Joshua John; Call, Douglas Ruben; Nero, Luís Augusto
2017-11-01
Listeria monocytogenes is a foodborne pathogen that contaminates food-processing environments and persists within biofilms on equipment, utensils, floors, and drains, ultimately reaching final products by cross-contamination. This pathogen grows even under high salt conditions or refrigeration temperatures, remaining viable in various food products until the end of their shelf life. While the estimated incidence of listeriosis is lower than other enteric illnesses, infections caused by L. monocytogenes are more likely to lead to hospitalizations and fatalities. Despite the description of L. monocytogenes occurrence in Brazilian food-processing facilities and foods, there is a lack of consistent data regarding listeriosis cases and outbreaks directly associated with food consumption. Listeriosis requires rapid treatment with antibiotics and most drugs suitable for Gram-positive bacteria are effective against L. monocytogenes. Only a minority of clinical antibiotic-resistant L. monocytogenes strains have been described so far; whereas many strains recovered from food-processing facilities and foods exhibited resistance to antimicrobials not suitable against listeriosis. L. monocytogenes control in food industries is a challenge, demanding proper cleaning and application of sanitization procedures to eliminate this foodborne pathogen from the food-processing environment and ensure food safety. This review focuses on presenting the L. monocytogenes distribution in food-processing environment, food contamination, and control in the food industry, as well as the consequences of listeriosis to human health, providing a comparison of the current Brazilian situation with the international scenario.
Directory of Open Access Journals (Sweden)
Gusman Vera
2014-01-01
Full Text Available Listeria monocytogenes is pathogenic bacterium that can contaminate food products during and after processing. As ready-to-eat food does not undergo any treatment to ensure its safety before consumption, the risk of foodborne disease must be considered if this pathogen is present in the food. As diseases caused by contaminated food are an important public health problem today, the aim of this study was to determine the prevalence of Listeria monocytogenes in different ready-to-eat food products. In the seven-month period from June 1 to December 31, 2011, a total of 1 380 food samples were examined in the Division of Sanitary Bacteriology, Center for Microbiology, Institute of Public Health of Vojvodina in Novi Sad. A total of 912 samples were analyzed for the presence of Listeria monocytogenes according to ISO 11290-2. The identity of suspected Listeria monocytogenes was confirmed using the VITEK 2 Compact system (BioMerieux, France. Out of 912 samples, Listeria monocytogenes was detected in 18 (1.97%. Listeria monocytogenes was mostly found in cooked meals (in 6 samples out of 18, sandwiches (4 samples and frozen food, such as ice-cream and frozen vegetables (4 samples. It was also found in tofu bread spreads (2 samples, cream cheese (1 sample and cakes (1 sample. The presence of Listeria monocytogenes in some ready-to-eat food could present a public health hazard, particularly to the high-risk population group, because of the high mortality rate associated with listeriosis and the widespread nature of the organism. Monitoring of listeriosis is essential to prevent foodborne outbreaks, and in assessing human health risk in ready-to-eat foods.
Incidence and control of Listeria monocytogenes in foods in Denmark
DEFF Research Database (Denmark)
Nørrung, Birgit; Andersen, Jens Kirk; Schlundt, Jørgen
1999-01-01
The Danish regulatory policy on Listeria monocytogenes in foods is based on the principles of HACCP and was developed using a health risk assessment approach. The Danish policy focuses examinations and criteria for L. monocytogenes in ready-to-eat foods and is based on a combination of inspection...
Novel Biocontrol Methods for Listeria monocytogenes Biofilms in Food Production Facilities.
Gray, Jessica A; Chandry, P Scott; Kaur, Mandeep; Kocharunchitt, Chawalit; Bowman, John P; Fox, Edward M
2018-01-01
High mortality and hospitalization rates have seen Listeria monocytogenes as a foodborne pathogen of public health importance for many years and of particular concern for high-risk population groups. Food manufactures face an ongoing challenge in preventing the entry of L. monocytogenes into food production environments (FPEs) due to its ubiquitous nature. In addition to this, the capacity of L. monocytogenes strains to colonize FPEs can lead to repeated identification of L. monocytogenes in FPE surveillance. The contamination of food products requiring product recall presents large economic burden to industry and is further exacerbated by damage to the brand. Poor equipment design, facility layout, and worn or damaged equipment can result in Listeria hotspots and biofilms where traditional cleaning and disinfecting procedures may be inadequate. Novel biocontrol methods may offer FPEs effective means to help improve control of L. monocytogenes and decrease cross contamination of food. Bacteriophages have been used as a medical treatment for many years for their ability to infect and lyse specific bacteria. Endolysins, the hydrolytic enzymes of bacteriophages responsible for breaking the cell wall of Gram-positive bacteria, are being explored as a biocontrol method for food preservation and in nanotechnology and medical applications. Antibacterial proteins known as bacteriocins have been used as alternatives to antibiotics for biopreservation and food product shelf life extension. Essential oils are natural antimicrobials formed by plants and have been used as food additives and preservatives for many years and more recently as a method to prevent food spoilage by microorganisms. Competitive exclusion occurs naturally among bacteria in the environment. However, intentionally selecting and applying bacteria to effect competitive exclusion of food borne pathogens has potential as a biocontrol application. This review discusses these novel biocontrol methods and their
DEFF Research Database (Denmark)
Nørrung, Birgit
2000-01-01
This paper shortly summarizes data related to risk assessment of Listeria monocytogenes. From available data on risk assessment, it is concluded that the levels of L. monocytogenes consumed is an important factor affecting the incidence of listeriosis. Foods that do not support the growth of L....... monocytogenes are unlikely to be a source of listeriosis, whereas foods that support the growth to high levels, should be the target of risk management efforts. Based on current epidemiological information from several countries, a concentration of L. monocytogenes not exceeding 100/g of food at the time...... of L. monocytogenes in the food during prevailing storage and distribution conditions is needed....
Novel Biocontrol Methods for Listeria monocytogenes Biofilms in Food Production Facilities
Directory of Open Access Journals (Sweden)
Jessica A. Gray
2018-04-01
Full Text Available High mortality and hospitalization rates have seen Listeria monocytogenes as a foodborne pathogen of public health importance for many years and of particular concern for high-risk population groups. Food manufactures face an ongoing challenge in preventing the entry of L. monocytogenes into food production environments (FPEs due to its ubiquitous nature. In addition to this, the capacity of L. monocytogenes strains to colonize FPEs can lead to repeated identification of L. monocytogenes in FPE surveillance. The contamination of food products requiring product recall presents large economic burden to industry and is further exacerbated by damage to the brand. Poor equipment design, facility layout, and worn or damaged equipment can result in Listeria hotspots and biofilms where traditional cleaning and disinfecting procedures may be inadequate. Novel biocontrol methods may offer FPEs effective means to help improve control of L. monocytogenes and decrease cross contamination of food. Bacteriophages have been used as a medical treatment for many years for their ability to infect and lyse specific bacteria. Endolysins, the hydrolytic enzymes of bacteriophages responsible for breaking the cell wall of Gram-positive bacteria, are being explored as a biocontrol method for food preservation and in nanotechnology and medical applications. Antibacterial proteins known as bacteriocins have been used as alternatives to antibiotics for biopreservation and food product shelf life extension. Essential oils are natural antimicrobials formed by plants and have been used as food additives and preservatives for many years and more recently as a method to prevent food spoilage by microorganisms. Competitive exclusion occurs naturally among bacteria in the environment. However, intentionally selecting and applying bacteria to effect competitive exclusion of food borne pathogens has potential as a biocontrol application. This review discusses these novel biocontrol
Novel Biocontrol Methods for Listeria monocytogenes Biofilms in Food Production Facilities
Gray, Jessica A.; Chandry, P. Scott; Kaur, Mandeep; Kocharunchitt, Chawalit; Bowman, John P.; Fox, Edward M.
2018-01-01
High mortality and hospitalization rates have seen Listeria monocytogenes as a foodborne pathogen of public health importance for many years and of particular concern for high-risk population groups. Food manufactures face an ongoing challenge in preventing the entry of L. monocytogenes into food production environments (FPEs) due to its ubiquitous nature. In addition to this, the capacity of L. monocytogenes strains to colonize FPEs can lead to repeated identification of L. monocytogenes in FPE surveillance. The contamination of food products requiring product recall presents large economic burden to industry and is further exacerbated by damage to the brand. Poor equipment design, facility layout, and worn or damaged equipment can result in Listeria hotspots and biofilms where traditional cleaning and disinfecting procedures may be inadequate. Novel biocontrol methods may offer FPEs effective means to help improve control of L. monocytogenes and decrease cross contamination of food. Bacteriophages have been used as a medical treatment for many years for their ability to infect and lyse specific bacteria. Endolysins, the hydrolytic enzymes of bacteriophages responsible for breaking the cell wall of Gram-positive bacteria, are being explored as a biocontrol method for food preservation and in nanotechnology and medical applications. Antibacterial proteins known as bacteriocins have been used as alternatives to antibiotics for biopreservation and food product shelf life extension. Essential oils are natural antimicrobials formed by plants and have been used as food additives and preservatives for many years and more recently as a method to prevent food spoilage by microorganisms. Competitive exclusion occurs naturally among bacteria in the environment. However, intentionally selecting and applying bacteria to effect competitive exclusion of food borne pathogens has potential as a biocontrol application. This review discusses these novel biocontrol methods and their
An ecological perspective of Listeria monocytogenes biofilms in food processing facilities.
Valderrama, Wladir B; Cutter, Catherine N
2013-01-01
Listeria monocytogenes can enter the food chain at virtually any point. However, food processing environments seem to be of particular importance. From an ecological point of view, food processing facilities are microbial habitats that are constantly disturbed by cleaning and sanitizing procedures. Although L. monocytogenes is considered ubiquitous in nature, it is important to recognize that not all L. monocytogenes strains appear to be equally distributed; the distribution of the organism seems to be related to certain habitats. Currently, no direct evidence exists that L. monocytogenes-associated biofilms have played a role in food contamination or foodborne outbreaks, likely because biofilm isolation and identification are not part of an outbreak investigation, or the definition of biofilm is unclear. Because L. monocytogenes is known to colonize surfaces, we suggest that contamination patterns may be studied in the context of how biofilm formation is influenced by the environment within food processing facilities. In this review, direct and indirect epidemiological and phenotypic evidence of lineage-related biofilm formation capacity to specific ecological niches will be discussed. A critical view on the development of the biofilm concept, focused on the practical implications, strengths, and weaknesses of the current definitions also is discussed. The idea that biofilm formation may be an alternative surrogate for microbial fitness is proposed. Furthermore, current research on the influence of environmental factors on biofilm formation is discussed.
Vongkamjan, Kitiya; Benjakul, Soottawat; Kim Vu, Hue Thi; Vuddhakul, Varaporn
2017-09-01
Listeria monocytogenes is a foodborne pathogen commonly found in environments of seafood processing, thus presenting a challenge for eradication from seafood processing facilities. Monitoring the prevalence and subtype diversity of L. monocytogenes together with phages that are specific to Listeria spp. ("Listeria phages") will provide knowledge on the bacteria-phage ecology in food processing plants. In this work, a total of 595 samples were collected from raw material, finished seafood products and environmental samples from different sites of a seafood processing plant during 17 sampling visits in 1.5 years of study. L. monocytogenes and Listeria spp. (non-monocytogenes) were found in 22 (3.7%) and 43 (7.2%) samples, respectively, whereas 29 Listeria phages were isolated from 9 (1.5%) phage-positive samples. DNA fingerprint analysis of L. monocytogenes isolates revealed 11 Random Amplified Polymorphic DNA (RAPD) profiles, with two subtypes were frequently observed over time. Our data reveal a presence of Listeria phages within the same seafood processing environments where a diverse set of L. monocytogenes subtypes was also found. Although serotype 4b was observed at lower frequency, data indicate that isolates from this seafood processing plant belonged to both epidemiologically important serotypes 1/2a and 4b, which may suggest a potential public health risk. Phages (all showed a unique genome size of 65 ± 2 kb) were classified into 9 host range groups, representing both broad- and narrow-host range. While most L. monocytogenes isolates from this facility were susceptible to phages, five isolates showed resistance to 12-20 phages. Variations in phage host range among Listeria phages isolated from food processing plant may affect a presence of a diverse set of L. monocytogenes isolates derived from the same processing environment in Thailand. Copyright © 2017 Elsevier Ltd. All rights reserved.
Antimicrobial resistance of Listeria monocytogenes isolated from dairy-based food products.
Harakeh, Steve; Saleh, Imane; Zouhairi, Omar; Baydoun, Elias; Barbour, Elie; Alwan, Nisreen
2009-06-15
In this study Listeria monocytogenes (L. monocytogenes) was isolated from three traditionally consumed Lebanese dairy-based food products. One hundred and sixty four samples (45 samples of Baladi cheese, 36 samples of Shankleesh and 83 of Kishk) were collected from the Bekaa Valley in the Northeast region of Lebanon. Suspected Listeria colonies were selected and initially identified by using standard biochemical tests. Initial identification of the positive L. monocytogenes colonies was confirmed at the molecular level by Polymerase Chain Reaction (n=30) and the confirmed isolates were evaluated for their susceptibility to 10 commonly used antimicrobials. All of the 30 isolates were confirmed to be L. monocytogenes yielding a PCR product of approximately 660 base pairs (bp). L. monocytogenes was detected in 26.67%, 13.89% and 7.23% of the Baladi cheese, Shankleesh and Kishk samples, respectively. The highest resistance in L. monocytogenes isolates was noted against oxacillin (93.33%) followed by penicillin (90%). The results provide an indication of the contamination levels of dairy-based foods in Lebanon and highlight the emergence of multi-drug resistant Listeria in the environment.
Law, Jodi Woan-Fei; Ab Mutalib, Nurul-Syakima; Chan, Kok-Gan; Lee, Learn-Han
2015-01-01
Listeria monocytogenes, a foodborne pathogen that can cause listeriosis through the consumption of food contaminated with this pathogen. The ability of L. monocytogenes to survive in extreme conditions and cause food contaminations have become a major concern. Hence, routine microbiological food testing is necessary to prevent food contamination and outbreaks of foodborne illness. This review provides insight into the methods for cultural detection, enumeration, and molecular identification of L. monocytogenes in various food samples. There are a number of enrichment and plating media that can be used for the isolation of L. monocytogenes from food samples. Enrichment media such as buffered Listeria enrichment broth, Fraser broth, and University of Vermont Medium (UVM) Listeria enrichment broth are recommended by regulatory agencies such as Food and Drug Administration-bacteriological and analytical method (FDA-BAM), US Department of Agriculture-Food and Safety (USDA-FSIS), and International Organization for Standardization (ISO). Many plating media are available for the isolation of L. monocytogenes, for instance, polymyxin acriflavin lithium-chloride ceftazidime aesculin mannitol, Oxford, and other chromogenic media. Besides, reference methods like FDA-BAM, ISO 11290 method, and USDA-FSIS method are usually applied for the cultural detection or enumeration of L. monocytogenes. most probable number technique is applied for the enumeration of L. monocytogenes in the case of low level contamination. Molecular methods including polymerase chain reaction, multiplex polymerase chain reaction, real-time/quantitative polymerase chain reaction, nucleic acid sequence-based amplification, loop-mediated isothermal amplification, DNA microarray, and next generation sequencing technology for the detection and identification of L. monocytogenes are discussed in this review. Overall, molecular methods are rapid, sensitive, specific, time- and labor-saving. In future, there are
Kubicová Z.; Filipová M.; Jurovčíková J.; Cabanová L
2017-01-01
The molecular typing of Listeria monocytogenes isolates is an important tool for monitoring the spread of the strains in food chains, providing evidence for epidemiological investigations and for the detection of out-breaks. The demand of European typing data centralization, collection and sharing stimulated the generation of “EURL L. monocytogenes Database (EURL Lm DB)” in 2012 led by the European Union Reference Laboratory (EURL) for L. monocytogenes (ANSES Maisons-Alfort Laboratory for Foo...
An insight into the isolation, enumeration and molecular detection of Listeria monocytogenes in food
Directory of Open Access Journals (Sweden)
Jodi Woan-Fei Law
2015-11-01
Full Text Available Listeria monocytogenes, a foodborne pathogen that can cause listeriosis through the consumption of food contaminated with this pathogen. The ability of L. monocytogenes to survive in extreme conditions and cause food contaminations have become a major concern. Hence, routine microbiological food testing is necessary to prevent food contamination and outbreaks of foodborne illness. This review provides insight into the methods for cultural detection, enumeration and molecular identification of L. monocytogenes in various food samples. There are a number of enrichment and plating media that can be used for the isolation of L. monocytogenes from food samples. Enrichment media such as buffered Listeria Enrichment Broth (BLEB, Fraser broth and University of Vermont Medium (UVM Listeria enrichment broth are recommended by regulatory agencies such as FDA-BAM, USDA-FSIS and ISO. Many plating media are available for the isolation of L. monocytogenes, for instance, PALCAM, Oxford and other chromogenic media. Besides, reference methods like FDA-BAM, ISO 11290 method and USDA-FSIS method are usually applied for the cultural detection or enumeration of L. monocytogenes. MPN technique is applied for the enumeration of L. monocytogenes in the case of low level contamination. Molecular methods including polymerase chain reaction (PCR, multiplex polymerase chain reaction (mPCR, real-time/quantitative polymerase chain reaction (qPCR, nucleic acid sequence-based amplification (NASBA, loop-mediated isothermal amplification (LAMP, DNA microarray and Next Generation Sequencing (NGS technology for the detection and identification of L. monocytogenes are discussed in this review. Overall, molecular methods are rapid, sensitive, specific, time- and labour-saving. In future, there are chances for the development of new techniques for the detection and identification of foodborne with improved features.
Control of Listeria monocytogenes in food production plants
Directory of Open Access Journals (Sweden)
Dimitrijević Mirjana
2008-01-01
Full Text Available L. monocytogenes has been established in different plants for the production of food, including dairy plants, abattoirs, plants for the processing of fish, as well as those for the production of ready-to-eat (RTE food and this fact is being considered as the primary mechanism of food contamination with this bacteria. There is also the factor of numerous and diverse contaminated production equipment, because it has certain parts that are inaccessible for the necessary cleaning and disinfection. The temperature, position, as well as the material of the work surface are also linked to the contamination of plants with this bacteria. Investigations carried out so far have helped toward the better understanding of the manner and time of contamination of food items in the course of the production process, but there are still unresolved problems, including most certainly the biggest one - the adherence of bacteria and the creation of a biofilm, when the bacteria is in that condition more resistant to so-called stress factors which are usually used in the food industry for the purpose of decontamination of the surfaces with which foods come into contact. The control of L. monocytogenes in food production plants is possible primarily by using an integrated programme, compatible with the systems Hazard Analysis Critical Control Point (HACCP and Good Hygiene Practice (GHP, necessary in the production of food that is safe for the consumer. Essentially, the control measures that can contribute to reducing the incidence of findings of L.monocytogenes in the finished product, as well as the reducing of the level of contamination with this bacteria are linked, on the one hand, with hygiene procedures in the production process, and, on the other, with the applied technological procedures.
Haubert, L; Mendonça, M; Lopes, G V; de Itapema Cardoso, M R; da Silva, W P
2016-01-01
Listeria monocytogenes is a foodborne pathogen that has become an important cause of human and animal diseases worldwide. The purpose of this study was to evaluate the serotypes, virulence potential, antimicrobial resistance profile, and genetic relationships of 50 L. monocytogenes isolates from food and food environment in southern Brazil. In this study, the majority of L. monocytogenes isolates belonged to the serotypes 1/2b (42%) and 4b (26%), which are the main serotypes associated with human listeriosis. In addition, all isolates harboured internalin genes (inlA, inlC, inlJ), indicating a virulence potential. The isolates were sensitive to most of the antimicrobial compounds analysed, and five isolates (10%) were multi-resistant. Two isolates harboured antimicrobial resistance genes (tetM and ermB) and in one of them, the gene was present in the plasmid. Moreover, according to the pulsed field gel electrophoresis assay, two multi-resistant isolates were a single clone isolated from food and the processing plant. The isolates were susceptible to the most frequently used antibiotics for listeriosis treatment. However, the presence of multidrug-resistant isolates and antimicrobial resistance genes including in the plasmid could even be transferred between bacterial species, suggesting a potential health risk to consumers and a potential risk of spreading multi-resistance genes to other bacteria. Listeria monocytogenes is an important agent of foodborne diseases. The results of this study suggest a potential capacity of L. monocytogenes isolates from food and food environment to cause human infections. Antimicrobial multi-resistance profiles were detected in 10%, and two isolates harboured tetM and ermB resistance genes. Moreover, the present research can help to build up a better knowledge about antimicrobial resistance of L. monocytogenes. Additionally, we found one isolate carrying tetM resistance gene in a plasmid, that suggests a possible transmission
REAL-TIME PCR DETECTION OF LISTERIA MONOCYTOGENES IN FOOD SAMPLES OF ANIMAL ORIGIN
Directory of Open Access Journals (Sweden)
Jaroslav Pochop
2013-02-01
Full Text Available The aim of this study was to follow the contamination of food with Listeria monocytogenes by using Step One real time polymerase chain reaction (PCR. We used the PrepSEQ Rapid Spin Sample Preparation Kit for isolation of DNA and SensiFAST SYBR Hi-ROX Kit for the real-time PCR performance. In 24 samples of food of animal origin without incubation were detected strains of Listeria monocytogenes in 15 samples (swabs. Nine samples were negative. Our results indicated that the real-time PCR assay developed in this study could sensitively detect Listeria monocytogenes in food of animal origin without incubation. This could prevent infection caused by Listeria monocytogenes, and also could benefit food manufacturing companies by extending their product’s shelf-life as well as saving the cost of warehousing their food products while awaiting pathogen testing results. The rapid real-time PCR-based method performed very well compared to the conventional method. It is a fast, simple, specific and sensitive way to detect nucleic acids, which could be used in clinical diagnostic tests in the future.
Listeria monocytogenes Identification in Food of Animal Origin Used with Real Time PCR
Directory of Open Access Journals (Sweden)
Jaroslav Pochop
2013-10-01
Full Text Available The aim of this study was to follow the contamination of food with Listeria monocytogenes by using Step One real time polymerase chain reaction (RT PCR. We used the PrepSEQ Rapid Spin Sample Preparation Kit for isolation of DNA and SensiFAST SYBR Hi-ROX Kit for the real-time PCR performance. In 20 samples of food of animal origin with incubation were detected strains of Listeria monocytogenes in 9 samples (swabs. Eleven samples were negative. Our results indicated that the real-time PCR assay developed in this study could sensitively detect Listeria monocytogenes in food of animal origin without incubation. This could prevent infection caused by Listeria monocytogenes, and also could benefit food manufacturing companies by extending their product’s shelf-life as well as saving the cost of warehousing their food products while awaiting pathogen testing results. The rapid real-time PCR-based method performed very well compared to the conventional method. It is a fast, simple, specific and sensitive way to detect nucleic acids, which could be used in clinical diagnostic tests in the future.
Zittermann, Sandra I; Stanghini, Brenda; See, Ryan Soo; Melano, Roberto G; Boleszczuk, Peter; Murphy, Allana; Maki, Anne; Mallo, Gustavo V
2016-01-01
Detection of Listeria monocytogenes in food is currently based on enrichment methods. When L. monocytogenes is present with other Listeria species in food, the species compete during the enrichment process. Overgrowth competition of the nonpathogenic Listeria species might result in false-negative results obtained with the current reference methods. This potential issue was noted when 50 food samples artificially spiked with L. monocytogenes were tested with a real-time PCR assay and Canada's current reference method, MFHPB-30. Eleven of the samples studied were from foods naturally contaminated with Listeria species other than those used for spiking. The real-time PCR assay detected L. monocytogenes in all 11 of these samples; however, only 6 of these samples were positive by the MFHPB-30 method. To determine whether L. monocytogenes detection can be affected by other species of the same genus due to competition, an L. monocytogenes strain and a Listeria innocua strain with a faster rate of growth in the enrichment broth were artificially coinoculated at different ratios into ground pork meat samples and cultured according to the MFHPB-30 method. L. monocytogenes was detected only by the MFHPB-30 method when L. monocytogenes/L. innocua ratios were 6.0 or higher. In contrast, using the same enrichments, the real-time PCR assay detected L. monocytogenes at ratios as low as 0.6. Taken together, these findings support the hypothesis that L. monocytogenes can be outcompeted by L. innocua during the MFHPB-30 enrichment phase. However, more reliable detection of L. monocytogenes in this situation can be achieved by a PCR-based method mainly because of its sensitivity.
Directory of Open Access Journals (Sweden)
Valeria Braga
Full Text Available ABSTRACT The aim of this work was to study the prevalence of Listeria monocytogenes in foods obtained in retail shops and food industries located in Montevideo-Uruguay, and to identify the serogroups of the obtained isolates. Three-thousand one-hundred and seventy-five food samples (frozen, deli meats, ready-to-eat and cheese were analyzed. The obtained isolates were serogrouped by multiplex PCR and serotyped by conventional procedure. Genetic comparisons were performed using pulsed-field gel electrophoresis on a sub-set of isolates belonging to the same serotype successively recovered from the same establishment. L. monocytogenes was isolated from 11.2% of samples. The highest prevalence was observed in frozen foods (38%, followed by cheese (10%. 1/2b and 4b were the most frequently identified serotypes. In six of 236 analyzed establishments we successively recovered L. monocytogenes isolates belonging to the same serotype. Most of them corresponded to serotype 1/2b. Pulsed-field gel electrophoresis profiles suggest that at least 33% of L. monocytogenes 1/2b isolates are genetically related and that may remain viable for prolonged periods. The observed prevalence of L. monocytogenes was lower than reported in neighboring countries. Our findings highlight the role that frozen foods may play in the spread of this pathogen, and the relevance of serotypes 1/2b and 4b.
Overney, Anaïs; Jacques-André-Coquin, Joséphine; Ng, Patricia; Carpentier, Brigitte; Guillier, Laurent; Firmesse, Olivier
2017-03-06
The ability of Listeria monocytogenes to adhere to and persist on surfaces for months or even years may be responsible for its transmission from contaminated surfaces to food products. Hence the necessity to find effective means to prevent the establishment of L. monocytogenes in food processing environments. The aim of this study was to assess, through a fractional experimental design, the environmental factors that could affect the survival of L. monocytogenes cells on surfaces to thereby prevent the persistence of this pathogen in conditions mimicking those encountered in food processing plants: culture with smoked salmon juice or meat exudate, use of two materials with different hygiene status, biofilm of L. monocytogenes in pure-culture or dual-culture with a Pseudomonas fluorescens strain, application of a drying step after cleaning and disinfection (C&D) and comparison of two strains of L. monocytogenes. Bacterial survival was assessed by culture, qPCR to quantify total cells, and propidium monoazide coupled with qPCR to quantify viable cells and highlight viable but non-culturable (VBNC) cells. Our results showed that failure to apply C&D causes cell persistence on surfaces. Moreover, the sanitation procedure leads only to a loss of culturability and appearance of VBNC populations. However, an additional daily drying step after C&D optimises the effectiveness of these procedures to reduce culturable populations. Our results reinforce the importance to use molecular tools to monitor viable pathogens in food processing plants to avoid underestimating the amounts of cells using only methods based on cell culture. Copyright © 2017 Elsevier B.V. All rights reserved.
Leong, Dara; NicAogáin, Kerrie; Luque-Sastre, Laura; McManamon, Oisin; Hunt, Karen; Alvarez-Ordóñez, Avelino; Scollard, Johann; Schmalenberger, Achim; Fanning, Séamus; O'Byrne, Conor; Jordan, Kieran
2017-05-16
The problem of assessing the occurrence of the food-borne pathogen Listeria monocytogenes in the food chain, and therefore the risk of exposure of the human population, is often challenging because of the limited scope of some studies. In this study the occurrence of L. monocytogenes in food from four major food groups, dairy products, meats, seafood and vegetables, and associated food processing environments in Ireland was studied over a three-year period. Fifty-four small food businesses participated in the study and sent both food and environmental samples every 2months between 2013 and 2015. L. monocytogenes was isolated using the ISO11290 standard method. Confirmation of L. monocytogenes and identification of serogroups were achieved using a multiplex PCR assay, and for some isolates serotype was determined using commercial antisera. Pulsed- field gel electrophoresis (PFGE) analysis was performed on all isolates allowing the relatedness of isolates from different food businesses to be compared nationwide. In total, 86 distinct pulsotypes were identified. The overall occurrence of L. monocytogenes in food samples was 4.2%, while in environmental samples it was 3.8%. In general, the occurrence of L. monocytogenes in food businesses decreased over the course of the study, presumably reflecting increased awareness and vigilance. The majority of the pulsotypes detected were unique to a particular food group (63/86), while only three pulsotypes were found in all four food groups investigated. The highest occurrence in food was found in the meat category (7.5%) while seafood had the lowest rate of occurrence (1.8%). Seventeen of the pulsotypes detected in the study were persistent, where persistence was defined as repeated isolation from a single facility with a minimum time interval of 6months. Using PFGE, 11 of the pulsotypes identified in this study were indistinguishable from those of 11 clinical isolates obtained from patients in Ireland over the last 4years
Directory of Open Access Journals (Sweden)
Jin-Qiang Chen
2017-09-01
Full Text Available Listeria monocytogenes, one of the most important foodborne pathogens, can cause listeriosis, a lethal disease for humans. L. ivanovii, which is closely related to L. monocytogenes, is also widely distributed in nature and infects mainly warm-blooded ruminants, causing economic loss. Thus, there are high priority needs for methodologies for rapid, specific, cost-effective and accurate detection, characterization and subtyping of L. monocytogenes and L. ivanovii in foods and environmental sources. In this review, we (A described L. monocytogenes and L. ivanovii, world-wide incidence of listeriosis, and prevalence of various L. monocytogenes strains in food and environmental sources; (B comprehensively reviewed different types of traditional and newly developed methodologies, including culture-based, antigen/antibody-based, LOOP-mediated isothermal amplification, matrix-assisted laser desorption ionization-time of flight-mass spectrometry, DNA microarray, and genomic sequencing for detection and characterization of L. monocytogenes in foods and environmental sources; (C comprehensively summarized different subtyping methodologies, including pulsed-field gel electrophoresis, multi-locus sequence typing, ribotyping, and phage-typing, and whole genomic sequencing etc. for subtyping of L. monocytogenes strains from food and environmental sources; and (D described the applications of these methodologies in detection and subtyping of L. monocytogenes in foods and food processing facilities.
Caballero, Oscar; Alles, Susan; Le, Quynh-Nhi; Gray, R Lucas; Hosking, Edan; Pinkava, Lisa; Norton, Paul; Tolan, Jerry; Mozola, Mark; Rice, Jennifer; Chen, Yi; Ryser, Elliot; Odumeru, Joseph
2016-01-01
Work was conducted to validate performance of the ANSR(®) for Listeria monocytogenes method in selected food and environmental matrixes. This DNA-based assay involves amplification of nucleic acid via an isothermal reaction based on nicking enzyme amplification technology. Following single-step sample enrichment for 16-24 h for most matrixes, the assay is completed in 40 min using only simple instrumentation. When 50 distinct strains of L. monocytogenes were tested for inclusivity, 48 produced positive results, the exceptions being two strains confirmed by PCR to lack the assay target gene. Forty-seven nontarget strains (30 species), including multiple non-monocytogenes Listeria species as well as non-Listeria, Gram-positive bacteria, were tested, and all generated negative ANSR assay results. Performance of the ANSR method was compared with that of the U.S. Department of Agriculture, Food Safety and Inspection Service Microbiology Laboratory Guidebook reference culture procedure for detection of L. monocytogenes in hot dogs, pasteurized liquid egg, and sponge samples taken from an inoculated stainless steel surface. In addition, ANSR performance was measured against the U.S. Food and Drug Administration Bacteriological Analytical Manual reference method for detection of L. monocytogenes in Mexican-style cheese, cantaloupe, sprout irrigation water, and guacamole. With the single exception of pasteurized liquid egg at 16 h, ANSR method performance as quantified by the number of positives obtained was not statistically different from that of the reference methods. Robustness trials demonstrated that deliberate introduction of small deviations to the normal assay parameters did not affect ANSR method performance. Results of accelerated stability testing conducted using two manufactured lots of reagents predicts stability at the specified storage temperature of 4°C of more than 1 year.
Recombinant phage probes for Listeria monocytogenes
Carnazza, S.; Gioffrè, G.; Felici, F.; Guglielmino, S.
2007-10-01
Monitoring of food and environmental samples for biological threats, such as Listeria monocytogenes, requires probes that specifically bind biological agents and ensure their immediate and efficient detection. There is a need for robust and inexpensive affinity probes as an alternative to antibodies. These probes may be recruited from random peptide libraries displayed on filamentous phage. In this study, we selected from two phage peptide libraries phage clones displaying peptides capable of specific and strong binding to the L. monocytogenes cell surface. The ability of isolated phage clones to interact specifically with L. monocytogenes was demonstrated using enzyme-linked immunosorbent assay (ELISA) and confirmed by co-precipitation assay. We also assessed the sensitivity of phage-bacteria binding by PCR on phage-captured Listeria cells, which could be detected at a concentration of 104 cells ml-1. In addition, as proof-of-concept, we tested the possibility of immobilizing the affinity-selected phages to a putative biosensor surface. The quality of phage deposition was monitored by ELISA and fluorescent microscopy. Phage-bacterial binding was confirmed by high power optical phase contrast microscopy. Overall, the results of this work validate the concept of affinity-selected recombinant filamentous phages as probes for detecting and monitoring bacterial agents under any conditions that warrant their recognition, including in food products.
Directory of Open Access Journals (Sweden)
Moutong eChen
2015-09-01
Full Text Available Listeria monocytogenes is an important foodborne pathogen that can cause serious illness in immunocompromised individuals, pregnant women, the elderly, and newborns. The aim of this study was to: (i evaluate the prevalence and contamination level (most probable number, MPN of L. monocytogenes in 567 retail raw foods (fishery products, n=154; raw/fresh meat, n=123; frozen foods, n=110; edible fungi, n=108; vegetables, n=72 collected from South China and (ii to gain further knowledge on the phenotype and genotype distributions of this important foodborne pathogen. Approximately 22% of the samples were positive for L. monocytogenes. The contamination levels were between 0.3 and 10 MPN/g in 75.0%, between 10 and 100 MPN/g in 11.0% and less than 100 MPN/g in 14.0% of the countable samples. Five serogroups were identified among the177 foodborne L. monocytogenes isolates, with1/2a-3a (42.4% and1/2b-3b (26.0% serogroups being the most dominant. Serogroup I.1 and II.2 were only found in the edible mushrooms, while serogroup III was dominant in the fishery products, suggesting that specific serogroups of L. monocytogenes may have distinct ecological niches. Ten (5.6% L. monocytogenes isolates exhibited multidrug resistance. Genetic relatedness analysis revealed the absence of distinct associations between specific food types, antibiotic resistance, serogroups, and genetic diversity. The present study provided the first baseline data on the prevalence, contamination level, and characteristics of L. monocytogenes isolated from raw foods in South China. Some multidrug resistant strains belonged to the epidemiologically important serogroups (I.1 and II.1, implying a potential public health risk. In addition, these findings also provide basic information for the Chinese food safety associated authorities to draft appropriate standards to control L. monocytogenes contamination and improve microbiological safety of raw foods.
Juck, Gregory; Gonzalez, Verapaz; Allen, Ann-Christine Olsson; Sutzko, Meredith; Seward, Kody; Muldoon, Mark T
2018-04-27
The Romer Labs RapidChek ® Listeria monocytogenes test system (Performance Tested Method ℠ 011805) was validated against the U.S. Department of Agriculture-Food Safety and Inspection Service Microbiology Laboratory Guidebook (USDA-FSIS/MLG), U.S. Food and Drug Association Bacteriological Analytical Manual (FDA/BAM), and AOAC Official Methods of Analysis ℠ (AOAC/OMA) cultural reference methods for the detection of L. monocytogenes on selected foods including hot dogs, frozen cooked breaded chicken, frozen cooked shrimp, cured ham, and ice cream, and environmental surfaces including stainless steel and plastic in an unpaired study design. The RapidChek method uses a proprietary enrichment media system, a 44-48 h enrichment at 30 ± 1°C, and detects L. monocytogenes on an immunochromatographic lateral flow device within 10 min. Different L. monocytogenes strains were used to spike each of the matrixes. Samples were confirmed based on the reference method confirmations and an alternate confirmation method. A total of 140 low-level spiked samples were tested by the RapidChek method after enrichment for 44-48 h in parallel with the cultural reference method. There were 88 RapidChek presumptive positives. One of the presumptive positives was not confirmed culturally. Additionally, one of the culturally confirmed samples did not exhibit a presumptive positive. No difference between the alternate confirmation method and reference confirmation method was observed. The respective cultural reference methods (USDA-FSIS/MLG, FDA/BAM, and AOAC/OMA) produced a total of 63 confirmed positive results. Nonspiked samples from all foods were reported as negative for L. monocytogenes by all methods. Probability of detection analysis demonstrated no significant differences in the number of positive samples detected by the RapidChek method and the respective cultural reference method.
Recombinant phage probes for Listeria monocytogenes
Energy Technology Data Exchange (ETDEWEB)
Carnazza, S; Gioffre, G; Felici, F; Guglielmino, S [Department of Microbiological, Genetic and Molecular Sciences, University of Messina, Messina (Italy)
2007-10-03
Monitoring of food and environmental samples for biological threats, such as Listeria monocytogenes, requires probes that specifically bind biological agents and ensure their immediate and efficient detection. There is a need for robust and inexpensive affinity probes as an alternative to antibodies. These probes may be recruited from random peptide libraries displayed on filamentous phage. In this study, we selected from two phage peptide libraries phage clones displaying peptides capable of specific and strong binding to the L. monocytogenes cell surface. The ability of isolated phage clones to interact specifically with L. monocytogenes was demonstrated using enzyme-linked immunosorbent assay (ELISA) and confirmed by co-precipitation assay. We also assessed the sensitivity of phage-bacteria binding by PCR on phage-captured Listeria cells, which could be detected at a concentration of 10{sup 4} cells ml{sup -1}. In addition, as proof-of-concept, we tested the possibility of immobilizing the affinity-selected phages to a putative biosensor surface. The quality of phage deposition was monitored by ELISA and fluorescent microscopy. Phage-bacterial binding was confirmed by high power optical phase contrast microscopy. Overall, the results of this work validate the concept of affinity-selected recombinant filamentous phages as probes for detecting and monitoring bacterial agents under any conditions that warrant their recognition, including in food products.
Bres, Vanessa; Yang, Hua; Hsu, Ernie; Ren, Yan; Cheng, Ying; Wisniewski, Michele; Hanhan, Maesa; Zaslavsky, Polina; Noll, Nathan; Weaver, Brett; Campbell, Paul; Reshatoff, Michael; Becker, Michael
2014-01-01
The Atlas Listeria monocytogenes LmG2 Detection Assay, developed by Roka Bioscience Inc., was compared to a reference culture method for seven food types (hot dogs, cured ham, deli turkey, chicken salad, vanilla ice cream, frozen chocolate cream pie, and frozen cheese pizza) and one surface (stainless steel, grade 316). A 125 g portion of deli turkey was tested using a 1:4 food:media dilution ratio, and a 25 g portion for all other foods was tested using 1:9 food:media dilution ratio. The enrichment time and media for Roka's method was 24 to 28 h for 25 g food samples and environmental surfaces, and 44 to 48 h for 125 g at 35 ± 2°C in PALCAM broth containing 0.02 g/L nalidixic acid. Comparison of the Atlas Listeria monocytogenes LmG2 Detection Assay to the reference method required an unpaired approach. For each matrix, 20 samples inoculated at a fractional level and five samples inoculated at a high level with a different strain of Listeria monocytogenes were tested by each method. The Atlas Listeria monocytogenes LmG2 Detection Assay was compared to the Official Methods of Analysis of AOAC INTERNATIONAL 993.12 method for dairy products, the U.S. Department of Agriculture, Food Safety and Inspection Service, Microbiology Laboratory Guidebook 8.08 method for ready-to-eat meat and environmental samples, and the U.S. Food and Drug Administration Bacteriological Analytical Manual, Chapter 10 method for frozen foods. In the method developer studies, Roka's method, at 24 h (or 44 h for 125 g food samples), had 126 positives out of 200 total inoculated samples, compared to 102 positives for the reference methods at 48 h. In the independent laboratory studies, vanilla ice cream, deli turkey and stainless steel grade 316 were evaluated. Roka's method, at 24 h (or 44 h for 125 g food samples), had 64 positives out of 75 total inoculated samples compared to 54 positives for the reference methods at 48 h. The Atlas Listeria monocytogenes LmG2 Detection Assay detected all 50
Prevalence and contamination levels of listeria monocytogenes in ready-to-eat foods in Tokyo, Japan.
Shimojima, Yukako; Ida, Miki; Nakama, Akiko; Nishino, Yukari; Fukui, Rie; Kuroda, Sumiyo; Hirai, Akihiko; Kai, Akemi; Sadamasu, Kenji
2016-08-01
We surveyed prevalence and contamination levels of Listeria monocytogenes in ready-to-eat foods between 2000 and 2012 in Tokyo. L. monocytogenes was isolated from 52 (1.7%) out of 2,980 samples. Comparing the prevalence in the study period, 2.2% were positive in the former period (2000-2005) and 1.2% in the latter (2006-2012). Using the most probable number (MPN) technique, 32 samples were contaminated with fewer than 0.3 L. monocytogenes/g, 10 samples with 0.3-1.0/g and 4 samples with more than 1.0/g (the maximum was 2.3/g). The most common serovar was 1/2a, followed by 1/2b, 4b and 1/2c. We revealed that ready-to-eat foods in Tokyo were contaminated with L. monocytogenes, although the contamination levels were low.
Listeria monocytogenes cross-contamination of cheese: risk throughout the food supply chain.
Sauders, B D; D'Amico, D J
2016-10-01
Listeria monocytogenes has been the most common microbial cause of cheese-related recalls in both the United States and Canada in recent years. Since L. monocytogenes is inactivated by pasteurization, the majority of these cases have been linked to environmental and cross-contamination of fresh-soft, soft-ripened, and semi-soft cheeses. Cross-contamination of foods with L. monocytogenes is a continuous risk throughout the food supply chain and presents unique challenges for subsequent illness and outbreak investigations. Reports on outbreaks of listeriosis attributed to cross-contamination downstream from primary processing help highlight the critical role of epidemiological investigation coupled with coordinated molecular subtyping and surveillance in the recognition and investigation of complex foodborne outbreaks. Despite their complexity, environmental sampling throughout the supply chain coupled with improved genotyping approaches and concomitant analysis of foodborne illness epidemiological exposure data are needed to help resolve these and similar cases more rapidly and with greater confidence.
Directory of Open Access Journals (Sweden)
Kubicová Z.
2017-03-01
Full Text Available The molecular typing of Listeria monocytogenes isolates is an important tool for monitoring the spread of the strains in food chains, providing evidence for epidemiological investigations and for the detection of out-breaks. The demand of European typing data centralization, collection and sharing stimulated the generation of “EURL L. monocytogenes Database (EURL Lm DB” in 2012 led by the European Union Reference Laboratory (EURL for L. monocytogenes (ANSES Maisons-Alfort Laboratory for Food Safety, France in close collaboration with Applied Maths. This database includes the typing results and epidemiological information on strains isolated from food, environmental or animal samples and it is in connection with human strains database TESSy (The European Surveillance System led by the ECDC (European Centre for Disease Prevention and Control. In total 147 L. monocytogenes isolates were examined by PFGE (pulsed field gel electrophoresis in 2014—2015 in VFI Dolny Kubin from different sources. Nearly half (68 of the 147 isolates in the national Slovak database came from milk or dairy products samples and the related manufacturing environment. In this work, 68 isolates associated with milk were selected and divided into 27 clusters (95 % similarity level after combined comparison analysis (AscI and ApaI by BioNumerics 6.6 software. Eight clusters included three or more similar PFGE profiles.
Jiang, Xiaobing; Yu, Tao; Liang, Yu; Ji, Shengdong; Guo, Xiaowei; Ma, Jianmin; Zhou, Lijun
2016-01-18
In this study, efflux pump-mediated benzalkonium chloride (BC) resistance, including plasmid-encoded (Qac protein family and BcrABC) and chromosome-borne efflux pumps, was investigated in Listeria monocytogenes from retail food in China. Among the 59 L. monocytogenes strains, 13 (22.0%) strains were resistant to BC. The PCR results showed that bcrABC was harbored by 2 of 13 BC resistant strains. However, none of the qac genes were detected among the 59 strains. The bcrABC was absent in both of the plasmid cured strains, indicating that this BC resistance determinant was plasmid-encoded in the two bcrABC-positive strains. In the presence of reserpine, most of the bcrABC-negative strains had decreases in the MICs of BC, suggesting the existence of other efflux pumps and their role in BC resistance. After exposed to reserpine, the reduction in BC MICs was observed in the two cured strains, indicating that efflux pumps located on chromosome was also involved in BC resistance. Our findings suggest that food products may act as reservoirs for BC resistant isolates of L. monocytogenes and plasmid- and chromosome-encoded efflux pumps could mediate the BC resistance of L. monocytogenes, which is especially relevant to the adaption of this organism in food-related environments with frequent BC use. Copyright © 2015 Elsevier B.V. All rights reserved.
Pochop, Jaroslav; Kačániová, Miroslava; Hleba, Lukáš; Lopasovský, L'ubomír; Bobková, Alica; Zeleňáková, Lucia; Stričík, Michal
2012-01-01
The aim of this study was to follow contamination of ready-to-eat food with Listeria monocytogenes by using the Step One real time polymerase chain reaction (PCR). We used the PrepSEQ Rapid Spin Sample Preparation Kit for isolation of DNA and MicroSEQ® Listeria monocytogenes Detection Kit for the real-time PCR performance. In 30 samples of ready-to-eat milk and meat products without incubation we detected strains of Listeria monocytogenes in five samples (swabs). Internal positive control (IPC) was positive in all samples. Our results indicated that the real-time PCR assay developed in this study could sensitively detect Listeria monocytogenes in ready-to-eat food without incubation.
Isolation and biochemical and molecular characterization of Listeria monocytogenes in food
International Nuclear Information System (INIS)
Helel, Salma
2008-01-01
monocytogenes is a Gram-positive bacteria, saprophytic, non-spore. This is an extremely resistant seeds to environmental conditions outside, especially since the cold psychrotrophic. It can contaminate raw vegetables, cooked meals ready for consumption or foods to be stored in the refrigerator, such as cheese or meat. It is the bacteria responsible for listeriosis. It threatens first unborn children, infants, pregnant women, the elderly and people whose immune system is weakened. Strains of Listeria spp isolated from foods (seafood, meat, meat) were first identified at the stage of the genus by classical tests (Gram staining, catalase test, oxidase test and mobility) and stage of the test case by hemolysis, CAMP test and the gallery Api Listeria. Biochemical characterization allowed after a numerical analysis, to assign 100% of isolates to the genus Listeria. Molecular characterization was performed by PCR amplification of genes coding for protein p60 (iap), the listeriolysine O (hly), the Phosphatidylinositol Phospholipase C (PI-PLC plca) Phosphatidylcholine Phospholipase C (plcB). The result showed an amplification of the iap gene of 100% of the hly gene, plca, plcB of 31.81%. This characterization represents an identification of the collection on the genetic level and shows that 31.81% of isolates, is likely to express the genes responsible for virulence factors of L. monocytogenes, to produce listeriolysine O, phospholipase C and Lecithinase. The molecular identification was performed by microarray technique and identified isolates L. September monocytogenes (five original clinical isolates and two food-borne), fourteen L. innocua (of food) and a strain not identified by DNA chip.. (Author)
Spanu, Carlo; Scarano, Christian; Ibba, Michela; Pala, Carlo; Spanu, Vincenzo; De Santis, Enrico Pietro Luigi
2014-12-09
Food business operators (FBOs) are the primary responsible for the safety of food they place on the market. The definition and validation of the product's shelf-life is an essential part for ensuring microbiological safety of food and health of consumers. In the frame of the Regulation (EC) No 2073/2005 on microbiological criteria for foodstuffs, FBOs shall conduct shelf-life studies in order to assure that their food does not exceed the food safety criteria throughout the defined shelf-life. In particular this is required for ready-to-eat (RTE) food that supports the growth of Listeria monocytogenes . Among other studies, FBOs can rely on the conclusion drawn by microbiological challenge tests. A microbiological challenge test consists in the artificial contamination of a food with a pathogen microorganism and aims at simulating its behaviour during processing and distribution under the foreseen storage and handling conditions. A number of documents published by international health authorities and research institutions describes how to conduct challenge studies. The authors reviewed the existing literature and described the methodology for implementing such laboratory studies. All the main aspects for the conduction of L. monocytogenes microbiological challenge tests were considered, from the selection of the strains, preparation and choice of the inoculum level and method of contamination, to the experimental design and data interpretation. The objective of the present document is to provide an exhaustive and practical guideline for laboratories that want to implement L. monocytogenes challenge testing on RTE food.
Lim, Shu Yong; Yap, Kien-Pong; Thong, Kwai Lin
2016-01-01
Listeria monocytogenes is an important foodborne pathogen that causes considerable morbidity in humans with high mortality rates. In this study, we have sequenced the genomes and performed comparative genomics analyses on two strains, LM115 and LM41, isolated from ready-to-eat food in Malaysia. The genome size of LM115 and LM41 was 2,959,041 and 2,963,111 bp, respectively. These two strains shared approximately 90% homologous genes. Comparative genomics and phylogenomic analyses revealed that LM115 and LM41 were more closely related to the reference strains F2365 and EGD-e, respectively. Our virulence profiling indicated a total of 31 virulence genes shared by both analysed strains. These shared genes included those that encode for internalins and L. monocytogenes pathogenicity island 1 (LIPI-1). Both the Malaysian L. monocytogenes strains also harboured several genes associated with stress tolerance to counter the adverse conditions. Seven antibiotic and efflux pump related genes which may confer resistance against lincomycin, erythromycin, fosfomycin, quinolone, tetracycline, and penicillin, and macrolides were identified in the genomes of both strains. Whole genome sequencing and comparative genomics analyses revealed two virulent L. monocytogenes strains isolated from ready-to-eat foods in Malaysia. The identification of strains with pathogenic, persistent, and antibiotic resistant potentials from minimally processed food warrant close attention from both healthcare and food industry.
Listeria monocytogenes serotype prevalence and biodiversity in diverse food products.
Hadjilouka, Agni; Andritsos, Nikolaos D; Paramithiotis, Spiros; Mataragas, Marios; Drosinos, Eleftherios H
2014-12-01
The aim of this study was to assess serotype prevalence and biodiversity of Listeria monocytogenes strains isolated from diverse food products, i.e., minced pork, fruits, and vegetables. Three hundred twenty-six samples previously purchased from supermarkets and street markets within the Athens area were studied for L. monocytogenes prevalence. A total of 121 strains were isolated from the 36 samples that were positive for L. monocytogenes. Serotyping was performed with multiplex PCR, and biodiversity was assessed with random amplified polymorphic DNA (RAPD) PCR analysis using M13, UBC155, and HLWL85 as primers and with repetitive element palindromic (rep) PCR analysis using (GTG)5 as the primer. The majority (17 of 22) of the contaminated minced pork samples contained strains identified as serotype 1/2a, either alone or in combination with strains belonging to serotypes 1/2b, 4a, 4c, or 4ab. However, all L. monocytogenes isolates from fruits and vegetables belonged to serotype 4b. Rep-PCR provided better differentiation of the isolates than did RAPD PCR and resulted in discrimination of the isolates into a larger number of unique profiles. Complete differentiation was achieved only with the combination of these subtyping techniques.
Lianou, Alexandra; Sofos, John N
2007-09-01
Contamination of ready-to-eat products with Listeria monocytogenes may occur at several stages before consumption. Accessibility to the public and relatively limited control interventions at retail and food service establishments (compared with the processing sector of the food industry) and the lack of a specific regulatory framework increase the likelihood of introduction of this pathogen into some foods in these establishments. This review is a compilation of available information on the incidence and transmission of L. monocytogenes through ready-to-eat products at the retail and food service level. The potential transmission of L. monocytogenes within retail and food service operations has been indicated in epidemiological investigations and by survey data. Potential sources of the organism in these operations include the environment, food handlers, and incoming raw ingredients or processed products that have become contaminated after the lethality treatment at the manufacturing facility. L. monocytogenes may be present at retail and food service establishments in various ready-to-eat products, both prepackaged and those packaged in the store, and occasionally at high concentrations. This issue dictates the need for development and application of effective control measures, and potential control approaches are discussed here. Good manufacturing practices, appropriate cleaning, sanitation and hygiene programs, and temperature control required for prevention or inhibition of growth of the pathogen to high levels are critical for control of L. monocytogenes in the retail and food service sector. A comprehensive food safety system designed to be functional in retail and food service operations and based on the philosophy of hazard analysis and critical control point systems and a series of sound prerequisite programs can provide effective control of L. monocytogenes in these environments. However, competent delivery of food safety education and training to retail
Directory of Open Access Journals (Sweden)
Carlo Spanu
2014-12-01
Full Text Available Food business operators (FBOs are the primary responsible for the safety of food they place on the market. The definition and validation of the product’s shelf-life is an essential part for ensuring microbiological safety of food and health of consumers. In the frame of the Regulation (EC No 2073/2005 on microbiological criteria for foodstuffs, FBOs shall conduct shelf-life studies in order to assure that their food does not exceed the food safety criteria throughout the defined shelf-life. In particular this is required for ready-to-eat (RTE food that supports the growth of Listeria monocytogenes. Among other studies, FBOs can rely on the conclusion drawn by microbiological challenge tests. A microbiological challenge test consists in the artificial contamination of a food with a pathogen microorganism and aims at simulating its behaviour during processing and distribution under the foreseen storage and handling conditions. A number of documents published by international health authorities and research institutions describes how to conduct challenge studies. The authors reviewed the existing literature and described the methodology for implementing such laboratory studies. All the main aspects for the conduction of L. monocytogenes microbiological challenge tests were considered, from the selection of the strains, preparation and choice of the inoculum level and method of contamination, to the experimental design and data interpretation. The objective of the present document is to provide an exhaustive and practical guideline for laboratories that want to implement L. monocytogenes challenge testing on RTE food.
Møretrø, Trond; Schirmer, Bjørn C T; Heir, Even; Fagerlund, Annette; Hjemli, Pernille; Langsrud, Solveig
2017-01-16
The antibacterial effect of disinfectants is crucial for the control of Listeria monocytogenes in food processing environments. Tolerance of L. monocytogenes to sublethal levels of disinfectants based on quaternary ammonium compounds (QAC) is conferred by the resistance determinants qacH and bcrABC. The presence and distribution of these genes have been anticipated to have a role in the survival and growth of L. monocytogenes in food processing environments where QAC based disinfectants are in common use. In this study, a panel of 680 L. monocytogenes from nine Norwegian meat- and salmon processing plants were grouped into 36 MLVA profiles. The presence of qacH and bcrABC was determined in 101 isolates from the 26 most common MLVA profiles. Five MLVA profiles contained qacH and two contained bcrABC. Isolates with qacH and bcrABC showed increased tolerance to the QAC Benzalkonium chloride (BC), with minimal inhibitory concentrations (MICs) of 5-12, 10-13 and 100ppm). A sample with lower BC concentrations (14ppm of chain length C-12 and 2.7ppm of chain length C-14) inhibited growth of L. monocytogenes not containing bcrABC or qacH, compared to strains with these genes. The study has shown that L. monocytogenes harbouring the QAC resistance genes qacH and bcrABC are prevalent in the food industry and that residuals of QAC may be present in concentrations after sanitation in the industry that result in a growth advantage for bacteria with such resistance genes. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.
Haidar-Ahmad, Nathaline; Kissoyan, Kohar Annie B; Fadlallah, Sukayna M; El-Hajj, Rima; Saleh, Majd; Ghosn, Nada; Matar, Ghassan M
2016-08-02
Listeria monocytogenes is the agent of listeriosis, a life threatening foodborne disease for immunocompromised patients and pregnant women. This bacterium is not routinely screened for in Lebanon and there is lack of data about the prevalent strains and their potential pathogenicity. To that purpose, this study was undertaken to characterize L. monocytogenes from various food products, by assessing the in vitro biofilm forming ability, detecting their virulence potential, and characterizing them at the strain level. Fifty-nine isolates were obtained from the Lebanese Agriculture Research Institute (LARI). They were collected in 2012-2013 from local and imported food products in the Lebanese market. Biofilm formation was measured using the Microtiter Plate Assay. PCR amplification was performed for three main virulence genes; hly, actA, and inlB. Pulsed field gel electrophoresis (PFGE) and BIONUMERICS analysis were carried out. Lebanese isolates from cheese and raw meat showed higher biofilm formation than imported and Lebanese seafood isolates. A total of 100% of the isolates were PCR positive for hly and actA genes and 98.3% for inlB gene. PFGE analysis demonstrated the prevalence of 13 different subtypes with 100% similarity. Detected subtypes were grouped into 6 clusters of 90% genomic similarity. Clustered subtypes were particular to the country of origin. This study highlights the presence of L. monocytogenes in the Lebanese food market with high pathogenic potential and stresses the importance of enhanced surveillance and the implementation of strict regulations on local and imported food. Future investigations may be conducted on a larger food selection.
78 FR 27939 - Draft Interagency Risk Assessment-Listeria monocytogenes
2013-05-13
... Listeria (L.) monocytogenes contamination of certain ready-to-eat (RTE) foods, for example cheese, deli... Scott, V.N., Survey of Listeria monocytogenes in ready-to-eat foods. Journal of Food Protection, 2003... monocytogenes in ready-to-eat processed meat and poultry collected in four FoodNet states in International...
Caggiano, Giuseppina; De Giglio, Osvalda; Lovero, Grazia; Rutigliano, Serafina; Diella, Giusy; Balbino, Stella; Napoli, Christian; Montagna, Maria Teresa
2015-01-01
Listeria monocytogenes is currently considered a relevant emerging food-borne pathogen. In particular, the European Centre for Disease Prevention and Control (ECDC) illustrates its widespread presence in different foods. In the present article, L. monocytogenes prevalence was estimated in cooked ready-to-eat foods sampled from a catering service in a Apulia city, southern Italy. The study was carried out from January to June 2014 in according to Regulation (EC) No. 852/2004, and ISO 11290-1:1996/Amd.1:2004 methods. Listeria spp. was isolated in 8.3% of the samples: L. monocytogenes was identified with the highest prevalence in potato gateau (66.6%), followed by rice dishes (11.1%), Listeria innocua was isolated from potato purea (11.1%) and cooked vegetables (11.1%). These preliminary results confirm the diffusion of the microorganism in ready-to-eat products; therefore, strategies aimed at protecting the consumers should be adopted. First of all, correct hygiene procedures should be followed and then microbiological tests should be implemented in order to early detect Listeria spp. (not only LM) contamination in cooked foods.
VAN Stelten, A; Roberts, A R; Manuel, C S; Nightingale, K K
2016-10-01
Listeria monocytogenes is a human foodborne pathogen that may cause an invasive disease known as listeriosis in susceptible individuals. Internalin A (InlA; encoded by inlA) is a virulence factor that facilitates crossing of host cell barriers by L. monocytogenes . At least 19 single nucleotide polymorphisms (SNPs) in inlA that result in a premature stop codon (PMSC) have been described worldwide. SNPs leading to a PMSC in inlA have been shown to be causally associated with attenuated virulence. L. monocytogenes pathogens carrying virulence-attenuating (VA) mutations in inlA have been commonly isolated from ready-to-eat (RTE) foods but rarely have been associated with human disease. This study was conducted to determine the prevalence of VA SNPs in inlA among L. monocytogenes from environments associated with RTE food production and handling. More than 700 L. monocytogenes isolates from RTE food processing plant (n = 409) and retail (n = 319) environments were screened for the presence of VA SNPs in inlA. Overall, 26.4% of isolates from RTE food processing plant and 32.6% of isolates from retail environments carried a VA mutation in inlA. Food contact surfaces sampled at retail establishments were significantly (P < 0.0001) more likely to be contaminated by a L. monocytogenes isolate carrying a VA mutation in inlA (56% of 55 isolates) compared with nonfood contact surfaces (28% of 264 isolates). Overall, a significant proportion of L. monocytogenes isolated from RTE food production and handling environments have reduced virulence. These data will be useful in the revision of current and the development of future risk assessments that incorporate strain-specific virulence parameters.
Rapid detection of Listeria monocytogenes in foods, by a combination of PCR and DNA probe.
Ingianni, A; Floris, M; Palomba, P; Madeddu, M A; Quartuccio, M; Pompei, R
2001-10-01
Listeria monocytogenes is a frequent contaminant of water and foods. Its rapid detection is needed before some foods can be prepared for marketing. In this work L. monocytogenes has been searched for in foods, by a combination of polymerase chain reaction (PCR) and a DNA probe. Both PCR and the probe were prepared for recognizing a specific region of the internalin gene, which is responsible for the production of one of the most important pathogenic factors of Listeria. The combined use of PCR and the DNA probe was used for the detection of L. monocytogenes in over 180 environmental and food samples. Several detection methods were compared in this study, namely conventional culture methods; direct PCR; PCR after an enrichment step; a DNA probe alone; a DNA probe after enrichment and another commercially available gene-probe. Finally PCR and the DNA probe were used in series on all the samples collected. When the DNA probe was associated with the PCR, specific and accurate detection of listeria in the samples could be obtained in about a working-day. The present molecular method showed some advantages in terms of rapidity and specificity in comparison to the other aforementioned tests. In addition, it resulted as being easy to handle, even for non-specialized personnel in small diagnostic microbiology laboratories. Copyright 2001 Academic Press.
Aerosol studies with Listeria innocua and Listeria monocytogenes.
Zhang, Guodong; Ma, Li; Oyarzabal, Omar A; Doyle, Michael P
2007-08-01
Aerosol studies of Listeria monocytogenes in food processing plants have been limited by lack of a suitable surrogate microorganism. The objective of this study was to investigate the potential of using green fluorescent protein-labeled strains of Listeria innocua as a surrogate for L. monocytogenes for aerosol studies. These studies were conducted in a laboratory bioaerosol chamber and a pilot food-processing facility. Four strains of L. innocua and five strains of L. monocytogenes were used. In the laboratory chamber study, Listeria cells were released into the environment at two different cell numbers and under two airflow conditions. Trypticase soy agar (TSA) plates and oven-roasted breasts of chicken and turkey were placed in the chamber to monitor Listeria cell numbers deposited from aerosols. A similar experimental design was used in the pilot plant study; however, only L. innocua was used. Results showed that L. monocytogenes and L. innocua survived equally well on chicken and turkey breast meats and TSA plates. No-fan and continuous fan applications, which affected airflow, had no significant effect on settling rates of aerosolized L. monocytogenes and L. innocua in the bioaerosol chamber or L. innocua in the pilot plant study. Listeriae cell numbers in the air decreased rapidly during the first 1.5 h following release, with few to no listeriae detected in the air at 3 h. Aerosol particles with diameters of 1 and 2 microM correlated directly with the number of Listeria cells in the aerosol but not with particles that were 0.3, 0.5, and 5 microM in diameter. Results indicate that L. innocua can be used as a surrogate for L. monocytogenes in an aerosol study.
Directory of Open Access Journals (Sweden)
Erica Tirloni
2017-12-01
Full Text Available Objective of the present study was to test the performances of a loop-mediated isothermal amplification (LAMP-based method for the detection of Listeria monocytogenes, with particular focus on the dairy products. The specificity of the method was evaluated on 42 different Listeria spp. strains from collections, food and environmental samples. 100% (32 of 32 of the L. monocytogenes strains were correctly recognised, and none of other 10 Listeria spp. strains was misidentified. The sensitivity was evaluated on four L. monocytogenes strains from different sources. The instrument was able to detect 10-400 CFU/mL. The ability to detect low initial numbers of L. monocytogenes (0.3- 0.7 Log CFU/g was also evaluated, in duplicate, in pasteurised milk (whole and skimmed and dairy samples (fresh ricotta, crescenza, mascarpone, mozzarella, cottage cheese, cream cheese, taleggio, gorgonzola. The analysis was performed after 18, 24 and 48 h of incubation, and was coupled with the count of L. monocytogenes in the broth. Microbial loads were insufficient to achieve a positive result after 18 and 24 h in most of the samples; after 48 h, all the products, except taleggio and one gorgonzola sample, were identified as positive; the sensitivity of the method when applied to contaminated dairy foods was about 5 Log CFU/g. The LAMP method tested can be considered a very useful tool, as it is a costeffective and easy-functioning method. The preliminary data obtained should be confirmed with a validation process taking into account different food typologies.
Heir, Even; Møretrø, Trond; Simensen, Andreas; Langsrud, Solveig
2018-06-20
Interactions and competition between resident bacteria in food processing environments could affect their ability to survive, grow and persist in microhabitats and niches in the food industry. In this study, the competitive ability of L. monocytogenes strains grown together in separate culture mixes with other L. monocytogenes (L. mono mix), L. innocua (Listeria mix), Gram-negative bacteria (Gram- mix) and with a multigenera mix (Listeria + Gram- mix) was investigated in biofilms on stainless steel and in suspensions at 12 °C. The mixed cultures included resident bacteria from processing surfaces in meat and salmon industry represented by L. monocytogenes (n = 6), L. innocua (n = 5) and Gram-negative bacteria (n = 6; Acinetobacter sp., Pseudomonas fragi, Pseudomonas fluorescens, Serratia liquefaciens, Stenotrophomonas maltophilia). Despite hampered in growth in mixed cultures, L. monocytogenes established in biofilms with counts at day nine between 7.3 and 9.0 log per coupon with the lowest counts in the Listeria + G- mix that was dominated by Pseudomonas. Specific L. innocua inhibited growth of L. monocytogenes strains differently; inhibition that was further enhanced by the background Gram-negative microbiota. In these multispecies and multibacteria cultures, the growth competitive effects lead to the dominance of a strong competitor L. monocytogenes strain that was only slightly inhibited by L. innocua and showed strong competitive abilities in mixed cultures with resident Gram-negative bacteria. The results indicates complex patterns of bacterial interactions and L. monocytogenes inhibition in the multibacteria cultures that only partially depend on cell contact and likely involve various antagonistic and bacterial tolerance mechanisms. The study indicates large variations among L. monocytogenes in their competitiveness under multibacterial culture conditions that should be considered in further studies towards understanding of L
Martínez-Suárez, Joaquín V; Ortiz, Sagrario; López-Alonso, Victoria
2016-01-01
The persistence of certain strains of Listeria monocytogenes, even after the food processing environment has been cleaned and disinfected, suggests that this may be related to phenomena that reduce the concentration of the disinfectants to subinhibitory levels. This includes (i) the existence of environmental niches or reservoirs that are difficult for disinfectants to reach, (ii) microorganisms that form biofilms and create microenvironments in which adequate concentrations of disinfectants cannot be attained, and (iii) the acquisition of resistance mechanisms in L. monocytogenes, including those that lead to a reduction in the intracellular concentration of the disinfectants. The only available data with regard to the resistance of L. monocytogenes to disinfectants applied in food production environments refer to genotypic resistance to quaternary ammonium compounds (QACs). Although there are several well-characterized efflux pumps that confer resistance to QACs, it is a low-level resistance that does not generate resistance to QACs at the concentrations applied in the food industry. However, dilution in the environment and biodegradation result in QAC concentration gradients. As a result, the microorganisms are frequently exposed to subinhibitory concentrations of QACs. Therefore, the low-level resistance to QACs in L. monocytogenes may contribute to its environmental adaptation and persistence. In fact, in certain cases, the relationship between low-level resistance and the environmental persistence of L. monocytogenes in different food production chains has been previously established. The resistant strains would have survival advantages in these environments over sensitive strains, such as the ability to form biofilms in the presence of increased biocide concentrations.
Komora, Norton; Bruschi, Carolina; Magalhães, Rui; Ferreira, Vânia; Teixeira, Paula
2017-03-20
The ongoing rise of antibiotic resistant microbial pathogens has become one of the major public health threats worldwide. Despite all the effort and actions taken so far, a proliferation of antibiotic resistant (AR) and multi-antibiotic resistant (MAR) strains is still observed, including in foodborne pathogens. This trend has been also noted recently for isolates of Listeria monocytogenes, a species that, although remaining largely sensitive to clinically relevant antimicrobials, has been reported to develop increased tolerance to antibiotics, particularly in isolates recovered from the food-chain. In this study we compared the ability of MAR (n=8), AR (n=18) and antibiotic susceptible (AS, n=11) L. monocytogenes strains from food and clinical origin to survive to different environmental stress conditions, including temperature (58°C), acidic stress (1% v/v lactic acid, pH3.5), and osmotic stress (37% w/v NaCl). The presence of antibiotic active efflux among MAR and AR strains, and its role on L. monocytogenes tolerance to different antimicrobial compounds was also investigated, namely; hydrogen peroxide; organic acids (acetic, citric and lactic); nisin; benzalkonium chloride (BC); and, sodium nitrite. While no significant differences were observed in the survival of the 37 strains exposed to high temperature (58°C), overall the mean logarithmic reduction of clinical strains was statistically lower after acid and salt exposure than that observed for strains of food origin; but both food and clinical strains resistant to two or three antibiotics were significantly less susceptible to acid (lactic acid 1% v/v) and osmotic stresses (37% w/v NaCl) when compared to AS strains. Using the EtBr-agar Cartwheel method, it was possible to detect efflux pumps in three of the 26 MAR and AR isolates, including one control strain; the active efflux in theses isolates was proven to be associated with fluoroquinolone resistance, and possible extrusion of BC and hydrogen peroxide
Listeria monocytogenes Prevalence and Characteristics in Retail Raw Foods in China.
Wu, Shi; Wu, Qingping; Zhang, Jumei; Chen, Moutong; Yan, Ze An; Hu, Huijuan
2015-01-01
The prevalence and levels of Listeria monocytogenes in retail raw foods covering most provincial capitals in China were studied with testing of 1036 samples of vegetables, edible mushrooms, raw meat, aquatic products and quick-frozen products from September 2012 to January 2014. The total prevalence of Listeria monocytogenes was 20.0% (207/1036), and the most probable number (MPN) values of 65.7% of the positive samples ranged from 0.3 to 110 MPN/g. Geographical differences were observed in this survey, and the results of both qualitative and quantitative methods indicated that the levels in the samples from North China were higher than those in the samples from South China. A total of 248 isolates were analyzed, of which approximately half belonged to molecular serogroup 1/2a-3a (45.2%), followed by 1/2b-3b-7 (30.6%), 1/2c-3c (16.1%), 4b-4d-4e (5.2%) and 4a-4c (2.8%). Most of the isolates carried hly (100%), inlB (98.8%), inlA (99.6%), inlC (98.0%) and inlJ (99.2%), and 44.8% of the isolates were llsX-positive. Seventeen epidemic clones (ECs) were detected, with 7 strains belonging to ECI (2.8%) and 10 belonging to ECIII (4.03%). Resistance to clindamycin (46.8%) was commonly observed, and 59 strains (23.8%) were susceptible to all 14 tested antibiotics, whereas 84 (33.9%) showed an intermediate level of resistance or were resistant to two or more antibiotics, including 7 multi-resistant strains that exhibited resistance to more than 10 antibiotics. The data obtained in the present study provides useful information for assessment of the possible risk posed to Chinese consumers, and this information will have a significant public health impact in China. Furthermore, the presence of virulence markers, epidemic clones, as well as the antibiotic resistance amongst the isolates strongly implies that many of these strains might be capable of causing listeriosis, and more accurate treatment of human listeriosis with effective antibiotics should be considered. This
Listeria monocytogenes Prevalence and Characteristics in Retail Raw Foods in China.
Directory of Open Access Journals (Sweden)
Shi Wu
Full Text Available The prevalence and levels of Listeria monocytogenes in retail raw foods covering most provincial capitals in China were studied with testing of 1036 samples of vegetables, edible mushrooms, raw meat, aquatic products and quick-frozen products from September 2012 to January 2014. The total prevalence of Listeria monocytogenes was 20.0% (207/1036, and the most probable number (MPN values of 65.7% of the positive samples ranged from 0.3 to 110 MPN/g. Geographical differences were observed in this survey, and the results of both qualitative and quantitative methods indicated that the levels in the samples from North China were higher than those in the samples from South China. A total of 248 isolates were analyzed, of which approximately half belonged to molecular serogroup 1/2a-3a (45.2%, followed by 1/2b-3b-7 (30.6%, 1/2c-3c (16.1%, 4b-4d-4e (5.2% and 4a-4c (2.8%. Most of the isolates carried hly (100%, inlB (98.8%, inlA (99.6%, inlC (98.0% and inlJ (99.2%, and 44.8% of the isolates were llsX-positive. Seventeen epidemic clones (ECs were detected, with 7 strains belonging to ECI (2.8% and 10 belonging to ECIII (4.03%. Resistance to clindamycin (46.8% was commonly observed, and 59 strains (23.8% were susceptible to all 14 tested antibiotics, whereas 84 (33.9% showed an intermediate level of resistance or were resistant to two or more antibiotics, including 7 multi-resistant strains that exhibited resistance to more than 10 antibiotics. The data obtained in the present study provides useful information for assessment of the possible risk posed to Chinese consumers, and this information will have a significant public health impact in China. Furthermore, the presence of virulence markers, epidemic clones, as well as the antibiotic resistance amongst the isolates strongly implies that many of these strains might be capable of causing listeriosis, and more accurate treatment of human listeriosis with effective antibiotics should be considered. This
Listeria monocytogenes Prevalence and Characteristics in Retail Raw Foods in China
Wu, Shi; Wu, Qingping; Zhang, Jumei; Chen, Moutong; Yan, Ze′an; Hu, Huijuan
2015-01-01
The prevalence and levels of Listeria monocytogenes in retail raw foods covering most provincial capitals in China were studied with testing of 1036 samples of vegetables, edible mushrooms, raw meat, aquatic products and quick-frozen products from September 2012 to January 2014. The total prevalence of Listeria monocytogenes was 20.0% (207/1036), and the most probable number (MPN) values of 65.7% of the positive samples ranged from 0.3 to 110 MPN/g. Geographical differences were observed in this survey, and the results of both qualitative and quantitative methods indicated that the levels in the samples from North China were higher than those in the samples from South China. A total of 248 isolates were analyzed, of which approximately half belonged to molecular serogroup 1/2a-3a (45.2%), followed by 1/2b-3b-7 (30.6%), 1/2c-3c (16.1%), 4b-4d-4e (5.2%) and 4a-4c (2.8%). Most of the isolates carried hly (100%), inlB (98.8%), inlA (99.6%), inlC (98.0%) and inlJ (99.2%), and 44.8% of the isolates were llsX-positive. Seventeen epidemic clones (ECs) were detected, with 7 strains belonging to ECI (2.8%) and 10 belonging to ECIII (4.03%). Resistance to clindamycin (46.8%) was commonly observed, and 59 strains (23.8%) were susceptible to all 14 tested antibiotics, whereas 84 (33.9%) showed an intermediate level of resistance or were resistant to two or more antibiotics, including 7 multi-resistant strains that exhibited resistance to more than 10 antibiotics. The data obtained in the present study provides useful information for assessment of the possible risk posed to Chinese consumers, and this information will have a significant public health impact in China. Furthermore, the presence of virulence markers, epidemic clones, as well as the antibiotic resistance amongst the isolates strongly implies that many of these strains might be capable of causing listeriosis, and more accurate treatment of human listeriosis with effective antibiotics should be considered. This
Meloni, Domenico; Galluzzo, Pietro; Mureddu, Anna; Piras, Francesca; Griffiths, Mansel; Mazzette, Rina
2009-02-15
The aims of the present study were: (a) to investigate the prevalence and the enumeration of Listeria monocytogenes in 200 samples of ready to eat (RTE) foods of animal and vegetal origin collected from different outlets and processing plants in Sardinia; (b) to characterize the isolates by phenotypical and molecular methods; (c) to analyze a subset of 42 L. monocytogenes by automated EcoRI ribotyping in order to predict the strain's potential virulence for humans. The strains were isolated from: smoked fish products, cooked marinated products, meat products and pre-packaged mixed vegetable salads. Of the samples tested, 22% were positive for Listeria spp. The prevalence of L. monocytogenes was 9.5%, while the level of L. monocytogenes in the positive samples was 93%), belonging to 17 different DuPont Identification Library Codes (DUP-IDs) clones. The Simpson's numerical index of discrimination was 0.911. Cluster analysis pointed out a high similarity among strains isolated from meat, fish, and vegetables of different origin. These results confirmed the existence of a widespread population of L. monocytogenes, characterized by highly related strains existing in different geographical areas. 65% of these strains belonged to lineage II (serotypes 1/2a and 1/2c), subtypes known to be associated with sporadic human listeriosis outbreaks. The remaining 35% of the isolates (serotypes 1/2b, 3b and 4b) were allocated to lineage I and belong to distinct clonal groups (DUP-ID 1038 and 1042), which again have been associated with several outbreaks of human listeriosis. Neither atypical profiles nor lineage III strains were found. EcoRI ribotyping was confirmed as a rapid and reliable method for L. monocytogenes typing, providing useful data for epidemiologic and clonality surveys of L. monocytogenes strains isolated from RTE foods.
Biofilm Formation of Listeria monocytogenes on Various Surfaces
Directory of Open Access Journals (Sweden)
M Mahdavi
2007-10-01
Full Text Available Introduction & Objective: Listeria monocytogenes is considered as a ubiquitous foodborne pathogen which can lead to serious infections, especially in newborns, elderly, pregnant, and immunocompromised people. The organism has been isolated from many foods and may cause meningitis, septicemia and abortion in pregnant women. Also L. monocytogenes forms biofilms on many food contact surface materials and medical devices. Development of biofilms on many surfaces is a potential source of contamination of foods that may lead to spoilage or transmission of foodborne pathogens. Materials & Methods: Biofilm formation of L. monocytogenes (RITCC 1293 serotype 4a was investigated. Hydrophobicity of L. monocytogenes was measured by MATH method. Then biofilm formation of the organism was assessed at 2, 4, 8, 16 and 20 hours on stainless steel (type 304 no 2B, polyethylene and glass by drop plate method. Results: Results indicated that L. monocytogenes with 85% of hydrophobicity formed biofilm on each of three surfaces. Biofilm formation on stainless steel surfaces was significantly more than other surfaces (p<0.05. Conclusion: The ability of biofilm formation of L. monocytogenes on medical devices and food containers is very important as far as hygiene and disease outbreaks are concerned.
Biosensor for the detection of Listeria monocytogenes: emerging trends
Soni, Dharmendra Kumar
2018-05-23
The early detection of Listeria monocytogenes (L. monocytogenes) and understanding the disease burden is of paramount interest. The failure to detect pathogenic bacteria in the food industry may have terrible consequences, and poses deleterious effects on human health. Therefore, integration of methods to detect and trace the route of pathogens along the entire food supply network might facilitate elucidation of the main contamination sources. Recent research interest has been oriented towards the development of rapid and affordable pathogen detection tools/techniques. An innovative and new approach like biosensors has been quite promising in revealing the foodborne pathogens. In spite of the existing knowledge, advanced research is still needed to substantiate the expeditious nature and sensitivity of biosensors for rapid and in situ analysis of foodborne pathogens. This review summarizes recent developments in optical, piezoelectric, cell-based, and electrochemical biosensors for Listeria sp. detection in clinical diagnostics, food analysis, and environmental monitoring, and also lists their drawbacks and advantages.
Gozzi, Giorgia
2015-01-01
This PhD thesis is focused on cold atmospheric plasma treatments (GP) for microbial inactivation in food applications. In fact GP represents a promising emerging technology alternative to the traditional methods for the decontamination of foods. The objectives of this work were to evaluate: - the effects of GP treatments on microbial inactivation in model systems and in real foods; - the stress response in L. monocytogenes following exposure to different GP treatments. As far as t...
Solar irradiance limits the long-term survival of Listeria monocytogenes in seawater.
NicAogáin, K; Magill, D; O'Donoghue, B; Conneely, A; Bennett, C; O'Byrne, C P
2018-03-01
Seafood has often been implicated in outbreaks of food-borne illness caused by Listeria monocytogenes but the source of contamination is usually not known. In this study we investigated the possibility that this pathogen could survive in seawater for an extended time period. Freshly collected seawater samples were inoculated with 1 × 10 8 CFU per ml of L. monocytogenes EGD-e and survival was monitored by plate counting for up to 25 days. When incubated in the dark, either at ambient temperatures (4-14°C) or at 16°C, >10 4 CFU per ml survivors were present after 25 days. However, when the seawater cell suspensions were exposed to ambient light (solar irradiation) and temperatures, L. monocytogenes lost viability rapidly and no survivors could be detected after the 80 h time point. Both UV-A and visible light in the blue region of the spectrum (470 nm) were found to contribute to this effect. The stress inducible sigma factor σ B was found to play a role in survival of L. monocytogenes in seawater. Together these data demonstrate that solar irradiation is a critical determinant of L. monocytogenes survival in marine environments. The data further suggest the possibility of controlling this food-borne pathogen in food-processing environments using visible light. Listeria monocytogenes is a food-borne bacterial pathogen capable of causing the life-threatening infection, listeriosis. In seafood the route of contamination from the environment is often not well understood as this pathogen is not generally thought to survive well in seawater. Here we provide evidence that L. monocytogenes is capable of surviving for long periods of time in seawater when light is excluded. Sunlight is demonstrated to have a significant effect on the survival of this pathogen in seawater, and both visible (470 nm) and UV-A light are shown to contribute to this effect. © 2017 The Society for Applied Microbiology.
Relationship between Listeria monocytogenes and Listeria spp. in seafood processing plants.
Alali, Walid Q; Schaffner, Donald W
2013-07-01
The objective of this study was to evaluate the relationship between prevalence of Listeria monocytogenes as an outcome and Listeria spp. as an explanatory variable by food products, food contact surfaces, and nonfood contact surfaces in seafood processing plants by using peer-reviewed published data. Nine sets of prevalence data of L. monocytogenes and Listeria spp. were collected from published studies and used for the analyses. Based on our analysis, the relationship between L. monocytogenes prevalence and Listeria spp. prevalence in food products (incoming raw materials and finish products) was significant (P = 0.04) with (low) R² = 0.36. Furthermore, Listeria spp. were not a good indicator for L. monocytogenes when testing food contact surfaces (R² = 0.10). Listeria spp. were a good indicator for L. monocytogenes only on nonfood contact surfaces (R² = 0.90). On the other hand, the presence of Listeria spp. on food contact surfaces (R² = 0.002) and nonfood contact surfaces (R² = 0.03) was not a good indicator for L. monocytogenes presence in food products. In general, prevalence of Listeria spp. does not seem to be a good indicator for L. monocytogenes prevalence in seafood processing plants.
Directory of Open Access Journals (Sweden)
Jankuloski Dean
2010-05-01
Full Text Available Sensitivity of 26 Listeria monocytogenes isolates toward 18 antimicrobial substances used in veterinary and human medicine was examined using the automated VITEK 2 Compact system bioMerieux. The obtained results indicate that L. monocytogenes strains isolated from food and food processing environment had resistance to several or more antimicrobial substances that are commonly used in the treatment in animals and humans. Results showed resistance of all 26 (100% isolates toward Benzylpenicilin, Ampicilin/Sublactam, Oxacillin, Imipenem and Fosfomycine. Also 7 of the isolates (26.9% were resistant to Clindamiycin, 3 (11.5% to Quinupristion/Dalfopristin and 1 strain to Teicoplanin, Vancomycin, Tetracycline and Fusic acid, respectively.
Directory of Open Access Journals (Sweden)
Pedro Rodríguez-López
2018-06-01
Full Text Available Although many efforts have been made to control Listeria monocytogenes in the food industry, growing pervasiveness amongst the population over the last decades has made this bacterium considered to be one of the most hazardous foodborne pathogens. Its outstanding biocide tolerance capacity and ability to promiscuously associate with other bacterial species forming multispecies communities have permitted this microorganism to survive and persist within the industrial environment. This review is designed to give the reader an overall picture of the current state-of-the-art in L. monocytogenes sessile communities in terms of food safety and legislation, ecological aspects and biocontrol strategies.
DEFF Research Database (Denmark)
Piercey, Marta J.; Hingston, Patricia A.; Hansen, Lisbeth Truelstrup
2016-01-01
proteins. Deficient mutants (n=5) contained interruptions in genes related to peptidoglycan,teichoic acid, or lipoproteins. Enhanced mutants produced significantly (p b 0.05) higher cell densities in biofilm formed on stainless steel (SS) coupons at 15 °C (48 h) than deficient mutants, which were also more......Listeria monocytogenes is a pathogenic foodborne bacterium whose persistence in food processing environments is in part attributed to its biofilm formation. Most biofilm studies have been carried out at 30–37 °C rather than at temperatures found in the food processing plants (i.e., 10–20 °C......). The objective of the present study was to mine for novel genes that contribute to L. monocytogenes biofilm formation at 15 °C using the random insertional mutagenesisapproach. A library of 11,024 L. monocytogenes 568 (serotype 1/2a) Himar1 insertional mutants wascreated. Mutants with reduced or enhanced biofilm...
Yun, Hyejeong; Lacroix, Monique; Jung, Samooel; Kim, Keehyuk; Lee, Ju Woon; Jo, Cheorun
2011-09-01
The objective of this study was to examine the effects of several food ingredients on the relative radiation sensitivity (RRS) of Escherichia coli and Listeria monocytogenes inoculated onto ground pork. Garlic, leek, onion, and ginger were prepared in 3 different forms; pressurized, freeze-dried, and 70% ethanol extracted. The prepared food ingredients were subdivided into 2 groups, non-irradiated and irradiated with 5 kGy of gamma irradiation, before addition to ground pork. The prepared food ingredients were added at concentrations of 1% and 5% (w/w) into radiation-sterilized ground pork and inoculated with E. coli and L. monocytogenes (10 6 CFU/mL). For E. coli inoculated pork, the most efficient ingredient was ethanol extracted leek (RRS=3.89), followed by freeze-dried ginger and leek (RRS=3.66 and 3.63, respectively) when used without pasteurization. However, when the food ingredients were irradiation-pasteurized, the freeze-dried ginger showed the highest RRS (4.10). When 5% natural materials were added, RRS was the highest for freeze-dried and ethanol extracted onion (4.44 and 4.65, respectively). For L. monocytogenes, the RRS was relatively lower than E. coli in general. The most efficient material was pressurized and freeze-dried onion (RRS=2.13 and 2.08, respectively) at a concentration of 1%. No increase in RRS was observed at increased concentration of food ingredients. These results suggest that the addition of particular food ingredients increased the efficiency of radiation-sterilization. However, changes in RRS were dependent on the species of microorganism as well as the form of the food ingredients.
Directory of Open Access Journals (Sweden)
Behrooz Sadeghi kalani
2014-12-01
Full Text Available Background and Aim:Listeria monocytogenes cause listeriosis and fatal infections in humans. The aim of this study was typing and evaluation of the genetic relatedness of L. monocytogenes strains from food samples using MLVA technique. Materials and Methods: 317 food samples were collected from 2009 to 2013 in Tehran,Iran. After final diagnosis of L. monocytogenes DNA was extracted to perform of MLVA technique, and also PCR products were analyzed by Gene Tools software. The number of tandem repeats was determined by using special equation for each selected locus. Also typing of strains was done. Results: 24 samples of 317 food samples were positive for L. monocytogenes using standard laboratory techniques. A total 13 different types were determined by MLVA technique that type 2 and type 3 were the most abundant types by 6 and 4 strains, respectively. Conclusions: The results of this study showed the presence of L. monocytogenes in dairy products and meat samples, therefore all people, especially pregnant women should observe health tips when using these products. The results of typing showed that L. monocytogenes strains from different sources can have the same origin. MLVA technique is easy with high accuracy and this method can be used in typing and evaluation of the genetic relatedness of L. monocytogenes for determination the source of contamination.
NicAogáin, Kerrie; O'Byrne, Conor P
2016-01-01
The foodborne pathogen Listeria monocytogenes is a highly adaptable organism that can persist in a wide range of environmental and food-related niches. The consumption of contaminated ready-to-eat foods can cause infections, termed listeriosis, in vulnerable humans, particularly those with weakened immune systems. Although these infections are comparatively rare they are associated with high mortality rates and therefore this pathogen has a significant impact on food safety. L. monocytogenes can adapt to and survive a wide range of stress conditions including low pH, low water activity, and low temperature, which makes it problematic for food producers who rely on these stresses for preservation. Stress tolerance in L. monocytogenes can be explained partially by the presence of the general stress response (GSR), a transcriptional response under the control of the alternative sigma factor sigma B (σ B ) that reconfigures gene transcription to provide homeostatic and protective functions to cope with the stress. Within the host σ B also plays a key role in surviving the harsh conditions found in the gastrointestinal tract. As the infection progresses beyond the GI tract L. monocytogenes uses an intracellular infectious cycle to propagate, spread and remain protected from the host's humoral immunity. Many of the virulence genes that facilitate this infectious cycle are under the control of a master transcriptional regulator called PrfA. In this review we consider the environmental reservoirs that enable L. monocytogenes to gain access to the food chain and discuss the stresses that the pathogen must overcome to survive and grow in these environments. The overlap that exists between stress tolerance and virulence is described. We review the principal measures that are used to control the pathogen and point to exciting new approaches that might provide improved means of control in the future.
NicAogáin, Kerrie; O’Byrne, Conor P.
2016-01-01
The foodborne pathogen Listeria monocytogenes is a highly adaptable organism that can persist in a wide range of environmental and food-related niches. The consumption of contaminated ready-to-eat foods can cause infections, termed listeriosis, in vulnerable humans, particularly those with weakened immune systems. Although these infections are comparatively rare they are associated with high mortality rates and therefore this pathogen has a significant impact on food safety. L. monocytogenes can adapt to and survive a wide range of stress conditions including low pH, low water activity, and low temperature, which makes it problematic for food producers who rely on these stresses for preservation. Stress tolerance in L. monocytogenes can be explained partially by the presence of the general stress response (GSR), a transcriptional response under the control of the alternative sigma factor sigma B (σB) that reconfigures gene transcription to provide homeostatic and protective functions to cope with the stress. Within the host σB also plays a key role in surviving the harsh conditions found in the gastrointestinal tract. As the infection progresses beyond the GI tract L. monocytogenes uses an intracellular infectious cycle to propagate, spread and remain protected from the host’s humoral immunity. Many of the virulence genes that facilitate this infectious cycle are under the control of a master transcriptional regulator called PrfA. In this review we consider the environmental reservoirs that enable L. monocytogenes to gain access to the food chain and discuss the stresses that the pathogen must overcome to survive and grow in these environments. The overlap that exists between stress tolerance and virulence is described. We review the principal measures that are used to control the pathogen and point to exciting new approaches that might provide improved means of control in the future. PMID:27933042
Listeria monocytogenes, a down-to-earth pathogen.
Vivant, Anne-Laure; Garmyn, Dominique; Piveteau, Pascal
2013-01-01
Listeria monocytogenes is the causative agent of the food-borne life threatening disease listeriosis. This pathogenic bacterium received much attention in the endeavor of deciphering the cellular mechanisms that underlie the onset of infection and its ability to adapt to the food processing environment. Although information is available on the presence of L. monocytogenes in many environmental niches including soil, water, plants, foodstuff and animals, understanding the ecology of L. monocytogenes in outdoor environments has received less attention. Soil is an environmental niche of pivotal importance in the transmission of this bacterium to plants and animals. Soil composition, microbial communities and macrofauna are extrinsic edaphic factors that direct the fate of L. monocytogenes in the soil environment. Moreover, farming practices may further affect its incidence. The genome of L. monocytogenes presents an extensive repertoire of genes encoding transport proteins and regulators, a characteristic of the genome of ubiquitous bacteria. Postgenomic analyses bring new insights in the process of soil adaptation. In the present paper focussing on soil, we review these extrinsic and intrinsic factors that drive environmental adaptation of L. monocytogenes.
Little, C L; Sagoo, S K; Gillespie, I A; Grant, K; McLauchlin, J
2009-09-01
Although listeriosis is a rare cause of human disease in the United Kingdom, an increase in the number of cases has been observed since 2001, almost exclusively in persons older than 60 years. This increase prompted this study on the microbiological safety of ready-to-eat (RTE) foods, which included those types potentially linked to cases of listeriosis. Between May 2006 and April 2007, 6,984 RTE foods were sampled (2,168 sliced meats, 1,242 hard cheese, 1,088 sandwiches, 878 butter, 725 spreadable cheese, 515 confectionery products containing cream, and 368 probiotic drinks). The food types with the highest prevalence of Listeria monocytogenes were sandwiches (7.0%) and sliced meats (3.7% within shelf life, 4.2% end of shelf life). L. monocytogenes at > 100 CFU/g (exceeding the European Commission's food safety criteria limit) only occurred in sandwiches (0.4%) and sliced meats (0.7% within shelf life, 1.0% end of shelf life). Contamination with L. monocytogenes at >100 CFU/g was more frequent in meats that were prepacked and/or of pack size > or = 300 g and in sandwiches that were supplied prepacked that contained salad vegetables as an ingredient. Satisfactory microbiological quality was associated with premises on which the management was trained in food hygiene and those that complied with hazard analysis and critical control point principles. This study provides important information about the microbiological safety of RTE foods and demonstrates that the control of L. monocytogenes in such foods, and in particular sandwiches and sliced meats, is essential in order to minimize the risk of this bacterium being present at levels hazardous to health at the point of consumption.
International Nuclear Information System (INIS)
Yun, Hyejeong; Lacroix, Monique; Jung, Samooel; Kim, Keehyuk; Lee, Ju Woon; Jo, Cheorun
2011-01-01
The objective of this study was to examine the effects of several food ingredients on the relative radiation sensitivity (RRS) of Escherichia coli and Listeria monocytogenes inoculated onto ground pork. Garlic, leek, onion, and ginger were prepared in 3 different forms; pressurized, freeze-dried, and 70% ethanol extracted. The prepared food ingredients were subdivided into 2 groups, non-irradiated and irradiated with 5 kGy of gamma irradiation, before addition to ground pork. The prepared food ingredients were added at concentrations of 1% and 5% (w/w) into radiation-sterilized ground pork and inoculated with E. coli and L. monocytogenes (10 6 CFU/mL). For E. coli inoculated pork, the most efficient ingredient was ethanol extracted leek (RRS=3.89), followed by freeze-dried ginger and leek (RRS=3.66 and 3.63, respectively) when used without pasteurization. However, when the food ingredients were irradiation-pasteurized, the freeze-dried ginger showed the highest RRS (4.10). When 5% natural materials were added, RRS was the highest for freeze-dried and ethanol extracted onion (4.44 and 4.65, respectively). For L. monocytogenes, the RRS was relatively lower than E. coli in general. The most efficient material was pressurized and freeze-dried onion (RRS=2.13 and 2.08, respectively) at a concentration of 1%. No increase in RRS was observed at increased concentration of food ingredients. These results suggest that the addition of particular food ingredients increased the efficiency of radiation-sterilization. However, changes in RRS were dependent on the species of microorganism as well as the form of the food ingredients. - Highlights: → Several food ingredients increased the efficiency of irradiation sterilization. → Different forms of food ingredients may affect the efficiency. → The increase of efficiency decreased the required irradiation dose, thereby avoiding sensory impairments of food.
Energy Technology Data Exchange (ETDEWEB)
Yun, Hyejeong [Department of Animal Science and Biotechnology, Chungnam National University, Daejeon 305-764 (Korea, Republic of); Lacroix, Monique [Canadian Irradiation Center, Research Laboratory in Science Applied to Food, INRS-Institut Armand-Frappier, Qebec (Canada); Jung, Samooel [Department of Animal Science and Biotechnology, Chungnam National University, Daejeon 305-764 (Korea, Republic of); Kim, Keehyuk [Department of Culinary Nutrition, Woosong University, Daejeon 300-718 (Korea, Republic of); Lee, Ju Woon [Advanced Radiation Technology Institute, Korea Atomic Energy Research Institute, Jeongeup 580-185 (Korea, Republic of); Jo, Cheorun, E-mail: cheorun@cnu.ac.kr [Department of Animal Science and Biotechnology, Chungnam National University, Daejeon 305-764 (Korea, Republic of)
2011-09-15
The objective of this study was to examine the effects of several food ingredients on the relative radiation sensitivity (RRS) of Escherichia coli and Listeria monocytogenes inoculated onto ground pork. Garlic, leek, onion, and ginger were prepared in 3 different forms; pressurized, freeze-dried, and 70% ethanol extracted. The prepared food ingredients were subdivided into 2 groups, non-irradiated and irradiated with 5 kGy of gamma irradiation, before addition to ground pork. The prepared food ingredients were added at concentrations of 1% and 5% (w/w) into radiation-sterilized ground pork and inoculated with E. coli and L. monocytogenes (10{sup 6} CFU/mL). For E. coli inoculated pork, the most efficient ingredient was ethanol extracted leek (RRS=3.89), followed by freeze-dried ginger and leek (RRS=3.66 and 3.63, respectively) when used without pasteurization. However, when the food ingredients were irradiation-pasteurized, the freeze-dried ginger showed the highest RRS (4.10). When 5% natural materials were added, RRS was the highest for freeze-dried and ethanol extracted onion (4.44 and 4.65, respectively). For L. monocytogenes, the RRS was relatively lower than E. coli in general. The most efficient material was pressurized and freeze-dried onion (RRS=2.13 and 2.08, respectively) at a concentration of 1%. No increase in RRS was observed at increased concentration of food ingredients. These results suggest that the addition of particular food ingredients increased the efficiency of radiation-sterilization. However, changes in RRS were dependent on the species of microorganism as well as the form of the food ingredients. - Highlights: > Several food ingredients increased the efficiency of irradiation sterilization. > Different forms of food ingredients may affect the efficiency. > The increase of efficiency decreased the required irradiation dose, thereby avoiding sensory impairments of food.
Hodžić, Snjezana; Hukić, Mirsada; Franciosa, Giovanna; Aureli, Paolo
2011-09-01
Listeria monocytogenes is often present in meat and meat products that are sold in the area of northeast Bosnia and Herzegovina. The major objective of this study was to examine the virulence of L. monocytogenes strains isolated from these types of food in that geographic area. Polymerase chain reaction was used to detect eight genes responsible for virulence of this pathogen, namely, prfA, inlA, inlB, hly, plcA, plcB, actA, and mpl. All examined isolates were confirmed to possess the eight virulence genes. Ten different pulsed-field gel electrophoresis (PFGE) macrorestriction profiles were recognized among 19 L. monocytogenes strains after restriction with two different endonucleases (ApaI and AscI). The pathogenicity of three different PFGE types of L. monocytogenes was confirmed through in vivo tests, which were performed on female white mice (Pasteur strain), and it ranged from 3.55 × 10(8) LD50 to 1.58 × 10(10) LD50. All of the three different PFGE types of L. monocytogenes were regarded as moderately virulent in relation to the reference strain L. monocytogenes Scott A. This result might be one of the reasons for the absence of reported listeriosis in northeast Bosnia and Herzegovina, despite the high degree of food contamination with this pathogen.
Knudsen, Gitte M; Nielsen, Jesper Boye; Marvig, Rasmus L; Ng, Yin; Worning, Peder; Westh, Henrik; Gram, Lone
2017-08-01
Whole genome sequencing is increasing used in epidemiology, e.g. for tracing outbreaks of food-borne diseases. This requires in-depth understanding of pathogen emergence, persistence and genomic diversity along the food production chain including in food processing plants. We sequenced the genomes of 80 isolates of Listeria monocytogenes sampled from Danish food processing plants over a time-period of 20 years, and analysed the sequences together with 10 public available reference genomes to advance our understanding of interplant and intraplant genomic diversity of L. monocytogenes. Except for three persisting sequence types (ST) based on Multi Locus Sequence Typing being ST7, ST8 and ST121, long-term persistence of clonal groups was limited, and new clones were introduced continuously, potentially from raw materials. No particular gene could be linked to the persistence phenotype. Using time-based phylogenetic analyses of the persistent STs, we estimate the L. monocytogenes evolutionary rate to be 0.18-0.35 single nucleotide polymorphisms/year, suggesting that the persistent STs emerged approximately 100 years ago, which correlates with the onset of industrialization and globalization of the food market. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.
CHALLENGE TESTS WITH LISTERIA MONOCYTOGENES IN SALAMI: PRELIMINARY RESULTS
Directory of Open Access Journals (Sweden)
R. Mioni
2013-02-01
Full Text Available Challenge tests are the preferable methodology to study the behaviour of Listeria monocytogenes on ready to eat foods, according to Regulation (EC 2073/2005. Challenge testing using L. monocytogenes in seasoned salami from different food business operators showed, after seasoning of the product, a count reduction of the inoculated organisms without any further growth of the pathogen; however differences of L. monocytogenes behaviour could be observed according to different production protocols.
Directory of Open Access Journals (Sweden)
J.A. Khan
2013-09-01
Full Text Available Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO. A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG; R: CCTCCAGAGTGATCGATGTT complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR. PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%, followed by fish meat (4.0%, and then beef (2.5%. Among various milk and milk products, curd (2.0% showed the highest prevalence, followed by raw milk (1.3%. The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 µL and 50 µL of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro resulted positive in twenty four
Presence of Listeria monocytogenes in Mediterranean-Style Dry Fermented Sausages
Directory of Open Access Journals (Sweden)
Domenico Meloni
2015-03-01
Full Text Available The morphological, physiological and epidemiological features of L. monocytogenes, together with the severity of human listeriosis infections, make L. monocytogenes of particular concern for manufacturers of cold-stored “ready to eat” (RTE foods. L. monocytogenes has been isolated from a wide variety of RTE foods and is responsible for several outbreaks associated with the consumption of RTE meat, poultry, dairy, fish and vegetable products. Although L. monocytogenes is among the most frequently-detected pathogens in dry fermented sausages, these products could be included in the category of RTE products in which the growth of L. monocytogenes is not favored and have rarely been implicated in listeriosis outbreaks. However, L. monocytogenes is highly difficult to control in fermented sausage processing environments due to its high tolerance to low pH and high salt concentration. In many Mediterranean-style dry fermented sausages, an empirical application of the hurdle technology often occurs and the frequent detection of L. monocytogenes in these products at the end of ripening highlights the need for food business operators to properly apply hurdle technology and to control the contamination routes of L. monocytogenes in the processing plants. In the following, through an up-to-date review of (personal and un- published data, the main aspects of the presence of L. monocytogenes in Mediterranean-style dry fermented sausages will be discussed.
Presence of Listeria monocytogenes in Mediterranean-Style Dry Fermented Sausages.
Meloni, Domenico
2015-03-12
The morphological, physiological and epidemiological features of L. monocytogenes , together with the severity of human listeriosis infections, make L. monocytogenes of particular concern for manufacturers of cold-stored "ready to eat" (RTE) foods. L. monocytogenes has been isolated from a wide variety of RTE foods and is responsible for several outbreaks associated with the consumption of RTE meat, poultry, dairy, fish and vegetable products. Although L. monocytogenes is among the most frequently-detected pathogens in dry fermented sausages, these products could be included in the category of RTE products in which the growth of L. monocytogenes is not favored and have rarely been implicated in listeriosis outbreaks. However, L. monocytogenes is highly difficult to control in fermented sausage processing environments due to its high tolerance to low pH and high salt concentration. In many Mediterranean-style dry fermented sausages, an empirical application of the hurdle technology often occurs and the frequent detection of L. monocytogenes in these products at the end of ripening highlights the need for food business operators to properly apply hurdle technology and to control the contamination routes of L. monocytogenes in the processing plants. In the following, through an up-to-date review of (personal and un-) published data, the main aspects of the presence of L. monocytogenes in Mediterranean-style dry fermented sausages will be discussed.
Directory of Open Access Journals (Sweden)
Christian James
2015-01-01
Full Text Available The aim of this study is to evaluate the eff ect of meat content and surface smoothness on the deactivation of Listeria monocytogenes in beef-agar food models achieved by shortwave ultraviolet (UVC light. Food models with various meat contents were made using chopped beef slices and agar solution. Prepared models together with a Listeria selective agar (LSA plate and a slice of cooked beef were inoculated with L. monocytogenes and then exposed to UVC light. Population of Listeria reduced to below the level of detection on the LSA plates. As the content of beef in the beef-agar models increased, more L. monocytogenes cells survived. Survival was greatest on the treated cooked slice of beef. To bett er understand the effect of surface irregularities, a white light interferometer was used to analyse the surface smoothness of beef-agar media and LSA plates. No correlation was observed between the surface roughness of seven out of nine types of produced beef-agar media and the degree of inactivation resulting from UVC radiation at the given dose, whereas, less bacterial cells were killed as beef content of the food models increased. The findings of the current study show that the chemical composition of the treated sample also plays an important role in pathogen resistance and survival, meaning that two samples with similar surface irregularities but diff erent chemical composition might produce very diff erent inactivation results when exposed to UVC light.
DEFF Research Database (Denmark)
Tamulevičius, Sigitas; Zakarienė, Gintarė; Novoslavskij, Aleksandr
2018-01-01
on selective agars and quantitative real-time PCR (qPCR) including staining with propidium monoazide (PMA). It was determined, that DLC:Ag film was the most efficient coating in the reduction of C. jejuni and L. monocytogenes numbers. Culture-based enumeration revealed that C. jejuni numbers were reduced......:Ag antimicrobial surface showed a reduced ability to grow on culture media, but maintained viability during the whole experiment. Nonetheless, DLC:Ag antimicrobial surface could be further considered for the reduction of cross-contamination risk from food preparation surfaces due to their contamination with C....... jejuni and L. monocytogenes in domestic and commercial kitchens or food establishments....
Directory of Open Access Journals (Sweden)
Giovanni Terrosu
2015-09-01
Full Text Available Listeria (L. monocytogenes is frequently isolated from food production environment and often persists in dairy plants despite vigorous sanitation regimes. In recent years several alert notifications were sent to Rapid Alert System for Food Products system as a consequence of Listeria monocytogenes contamination of ricotta cheese. After the alert of 2012, competent authority (Local Health Unit of Sassari Province organised an environmental monitoring plan with the partnership of the Institute for Experimental Veterinary Medicine of Sardinia to verify analysis of dairy plants own-check according to Regulation (EC N° 2073/05 and further modifications. In 2014 n. 665 processing areas samples of n. 50 dairy plants of Sassari Province were examined. UNI EN ISO 11290-1:2005 for detection of L. monocytogenes was used. Non-compliance in n. 5 diary plants are observed (n. 8 positive samples. Post-non-compliance environmental sanitisation was efficient and own-check plans included appropriate corrective actions.
Directory of Open Access Journals (Sweden)
Rajeswaran Radhakrishnan
2017-12-01
Full Text Available Food pathogens contaminate food products that allow their growth on the shelf and also under refrigerated conditions. Therefore, it is of utmost importance to lower the limit of detection (LOD of the method used and to obtain the results within hours to few days. Biosensor methods exploit the available technologies to individuate and provide an approximate quantification of the bacteria present in a sample. The main bottleneck of these methods depends on the aspecific binding to the surfaces and on a change in sensitivity when bacteria are in a complex food matrix with respect to bacteria in a liquid food sample. In this review, we introduce surface plasmon resonance (SPR, new advancements in SPR techniques, and electrochemical impedance spectroscopy (EIS, as fluorescence-free biosensing technologies for detection of L. monocytogenes in foods. The application of the two methods has facilitated L. monocytogenes detection with LOD of 1 log CFU/mL. Further advancements are envisaged through the combination of biosensor methods with immunoseparation of bacteria from larger volumes, application of lab-on-chip technologies, and EIS sensing methods for multiplex pathogen detection. Validation efforts are being conducted to demonstrate the robustness of detection, reproducibility and variability in multi-site installations.
Morganti, Marina; Scaltriti, Erika; Cozzolino, Paolo; Bolzoni, Luca; Casadei, Gabriele; Pierantoni, Marco; Foni, Emanuela; Pongolini, Stefano
2016-02-01
The quantitative and qualitative patterns of environmental contamination by Listeria monocytogenes were investigated in the production chain of dry-cured Parma ham. Standard arrays of surfaces were sampled in processing facilities during a single visit per plant in the three compartments of the food chain, i.e., ham production (19 plants) and postproduction, which was divided into deboning (43 plants) and slicing (25 plants) steps. The numbers of sampled surfaces were 384 in ham production, with 25 positive for L. monocytogenes, and 1,084 in postproduction, with 83 positives. Statistical analysis of the prevalence of contaminated surfaces showed that in ham production, contamination was higher at the beginning of processing and declined significantly toward the end, while in postproduction, prevalence rose toward the end of processing. Prevalence was higher in the deboning facilities than in slicing facilities and was dependent on the type of surface (floor/drainage > clothing > equipment). The qualitative pattern of contamination was investigated through an analysis of the survey isolates and a set of isolates derived from routine monitoring, including longitudinal isolations. Pulsed-field gel electrophoresis (PFGE) and whole-genome single-nucleotide polymorphism (SNP) analysis revealed a remarkable clonality of L. monocytogenes within plants, with the detection of 16 plant-specific clones out of 17 establishments with multiple isolates. Repeated detections of clonal isolates >6 months apart were also observed. Six was the maximum number of between-isolate differences in core SNPs observed within these clones. Based on the same six-SNP threshold, three clusters of clonal isolates, shared by six establishments, were also identified. The spread of L. monocytogenes within and between plants, as indicated by its clonal behavior, is a matter of concern for the hygienic management of establishments. Copyright © 2016, American Society for Microbiology. All Rights
Henriques, A R; Gama, L T; Fraqueza, M J
2017-02-02
Listeria monocytogenes isolates collected from final products and food contact surfaces of 10 ready-to-eat meat-based food products (RTEMP) producing industries were analyzed to relate their virulence-associated characteristics and genetic profiles with the hygiene assessment of those industries. Together with sample collection, an audit was performed to evaluate the implemented food safety management system and to investigate the specific audit requisites more associated to the occurrence of those L. monocytogenes serogroups frequently related with human disease. L. monocytogenes was present in 18% of the samples. The isolates (n=62) were serogrouped and detection of virulence-associated genes inlA, inlB, inlC and inlJ, and also plcA, hlyA, actA and iap was done by multiplex PCR. After this initial characterization, selected isolates (n=31) were submitted to antibiotic resistance testing by the disk diffusion method for the currently most used human and veterinary antibiotics and resistance was low. These isolates were also subtyped by pulsed-field gel electrophoresis. Genotyping and serogrouping of L. monocytogenes isolates revealed a genetically diverse population. Our data indicate that contamination of final products does not seem to be uniquely related to the sampled food surfaces. The occurrence of those L. monocytogenes serogroups more commonly associated with human disease in industries with a high hygienic audit classification could be the result of a previous identification of the pathogen, with an enforcement of the hygiene program without recognizing the real source of contamination. This reinforces the importance of a conjoined diagnosis using audit data and microbiological testing. Food safety management systems of those industries need improvement, particularly in cleaning and sanitizing operations, analytical control, preventive maintenance, personal hygiene and root cause analysis. Copyright © 2016. Published by Elsevier B.V.
Directory of Open Access Journals (Sweden)
Shi eWu
2016-02-01
Full Text Available Eighty Listeria monocytogenes isolates were obtained from Chinese retail ready-to-eat (RTE food and were previously characterized with serotyping and antibiotic susceptibility tests. The aim of this study was to characterize the subtype and virulence potential of these L. monocytogenes isolates by multilocus sequence typing (MLST, virulence-associate genes, epidemic clones (ECs and sequence analysis of the important virulence factor: internalin A (inlA. The result of MLST revealed that these L. monocytogenes isolates belonged to 14 different sequence types (STs. With the exception of four new STs (ST804, ST805, ST806 and ST807, all other STs observed in this study have been associated with human listeriosis and outbreaks to varying extents. Six virulence-associate genes (inlA, inlB, inlC, inlJ, hly and llsX were selected and their presence was investigated using PCR. All strains carried inlA, inlB, inlC, inlJ, and hly, whereas 38.8% (31/80 of strains harbored the listeriolysin S genes (llsX. A multiplex PCR assay was used to evaluate the presence of markers specific to epidemic clones of L. monocytogenes and identified 26.3% (21/80 of ECI in the 4b-4d-4e strains. Further study of inlA sequencing revealed that most strains contained the full-length InlA required for host cell invasion, whereas three mutations lead to premature stop codons (PMSC within a novel PMSCs at position 326 (GAA→TAA. MLST and inlA sequence analysis results were concordant, and different virulence potentials within isolates were observed. These findings suggest that L. monocytogenes isolates from RTE food in China could be virulent and be capable of causing human illness. Furthermore, the STs and virulence profiles of L. monocytogenes isolates have significant implications for epidemiological and public health studies of this pathogen.
Wu, Shi; Wu, Qingping; Zhang, Jumei; Chen, Moutong; Guo, Weipeng
2016-01-01
Eighty Listeria monocytogenes isolates were obtained from Chinese retail ready-to-eat (RTE) food and were previously characterized with serotyping and antibiotic susceptibility tests. The aim of this study was to characterize the subtype and virulence potential of these L. monocytogenes isolates by multilocus sequence typing (MLST), virulence-associate genes, epidemic clones (ECs), and sequence analysis of the important virulence factor: internalin A (inlA). The result of MLST revealed that these L. monocytogenes isolates belonged to 14 different sequence types (STs). With the exception of four new STs (ST804, ST805, ST806, and ST807), all other STs observed in this study have been associated with human listeriosis and outbreaks to varying extents. Six virulence-associate genes (inlA, inlB, inlC, inlJ, hly, and llsX) were selected and their presence was investigated using PCR. All strains carried inlA, inlB, inlC, inlJ, and hly, whereas 38.8% (31/80) of strains harbored the listeriolysin S genes (llsX). A multiplex PCR assay was used to evaluate the presence of markers specific to epidemic clones of L. monocytogenes and identified 26.3% (21/80) of ECI in the 4b-4d-4e strains. Further study of inlA sequencing revealed that most strains contained the full-length InlA required for host cell invasion, whereas three mutations lead to premature stop codons (PMSC) within a novel PMSCs at position 326 (GAA → TAA). MLST and inlA sequence analysis results were concordant, and different virulence potentials within isolates were observed. These findings suggest that L. monocytogenes isolates from RTE food in China could be virulent and be capable of causing human illness. Furthermore, the STs and virulence profiles of L. monocytogenes isolates have significant implications for epidemiological and public health studies of this pathogen.
DEFF Research Database (Denmark)
Larsen, Charlotte Nexmann; Nørrung, Birgit; Sommer, Helle Mølgaard
2002-01-01
The virulence of different pulsed-field gel electrophoresis (PFGE) types of Listeria monocytogenes was examined by monitoring their ability to invade Caco-2 cells. Strains belonging to seven different PFGE types originating from both foods and humans were included. No significant differences...
Survival strategies of Listeria monocytogenes - roles of regulators and transporters
Wemekamp-Kamphuis, H.H.
2003-01-01
Outbreaks of the food-borne pathogen Listeria monocytogenes are mainly associated with ready-to-eatfoods. Survival strategies of L. monocytogenes in relation to minimally processed foods were studied.
Augustin, Jean-Christophe; Kalmokoff, Martin; Ells, Timothy; Favret, Sandra; Desreumaux, Jennifer; Decourseulles Brasseur, Emilie; Gnanou Besse, Nathalie
2016-12-01
A stochastic model describing the growth of Listeria monocytogenes during enrichment in half Fraser was developed for the purpose of estimating the effects of modifications to the first enrichment step of the EN ISO 11290-1 detection method. Information pertaining to the variability of growth rates, physiological state of the cell, and the behavior of individual cells contaminating the food were obtained from previously published studies. We used this model to investigate the impact of pooling enrichment broths (wet pooling) on the performance of the standard method. For validation of the model, the numbers of L. monocytogenes occurring in 88 naturally contaminated foods following pre-enrichment were compared to model-simulated microbial counts. The model was then used to perform simulations representative of the natural contamination observed for smoked salmon in the European baseline survey of 2010-2011. The model-estimated L. monocytogenes levels following individual enrichment or following the pooling of five broths where only one would be contaminated were compared. The model indicated a 10% loss of method sensitivity resulting from wet pooling. The model also predicted a 5% decrease in the sensitivity of the method when the duration of the enrichment was reduced from 24 to 22 h. Copyright © 2016 Elsevier Ltd. All rights reserved.
Morphological Change and Decreasing Transfer Rate of Biofilm-Featured Listeria monocytogenes EGDe.
Lee, Yuejia; Wang, Chinling
2017-03-01
Listeria monocytogenes , a lethal foodborne pathogen, has the ability to resist the hostile food processing environment and thus frequently contaminates ready-to-eat foods during processing. It is commonly accepted that the tendency of L. monocytogenes ' to generate biofilms on various surfaces enhances its resistance to the harshness of the food processing environment. However, the role of biofilm formation in the transferability of L. monocytogenes EGDe remains controversial. We examined the growth of Listeria biofilms on stainless steel surfaces and their effect on the transferability of L. monocytogenes EGDe. The experiments were a factorial 2 × 2 design with at least three biological replicates. Through scanning electron microscopy, a mature biofilm with intensive aggregates of cells was observed on the surface of stainless steel after 3 or 5 days of incubation, depending on the initial level of inoculation. During biofilm development, L. monocytogenes EGDe carried out binary fission vigorously before a mature biofilm was formed and subsequently changed its cellular morphology from rod shaped to sphere shaped. Furthermore, static biofilm, which was formed after 3 days of incubation at 25°C, significantly inhibited the transfer rate of L. monocytogenes EGDe from stainless steel blades to 15 bologna slices. During 7 days of storage at 4°C, however, bacterial growth rate was not significantly impacted by whether bacteria were transferred from biofilm and the initial concentrations of transferred bacteria on the slice. In conclusion, this study is the first to report a distinct change in morphology of L. monocytogenes EGDe at the late stage of biofilm formation. More importantly, once food is contaminated by L. monocytogenes EGDe, contamination proceeds independently of biofilm development and the initial level of contamination when food is stored at 4°C, even if contamination with L. monocytogenes EGDe was initially undetectable before storage.
Lotfollahi, Lida; Chaharbalesh, Ardalan; Ahangarzadeh Rezaee, Mohammad; Hasani, Alka
2017-06-01
Listeria monocytogenes is a foodborne pathogen causing listeriosis, which potentially affects all individuals, especially pregnant women and immunocompromised persons. The present study investigated the prevalence, antimicrobial susceptibility and serotypes distribution of the isolated L. monocytogenes from Iran. Twenty two (4.97%) of 442 human, food and livestock samples were found to be positive for L. monocytogenes. L. monocytogenes was identified in 8.8% of 125 human samples, 2.99% of 267 food and 6% of 50 livestock samples. The standard disk diffusion method and minimum inhibitory concentration (MIC) assay were used for antimicrobial susceptibility testing and multiplex PCR for serotyping. Among the 22 isolates tested, 6 (27.2%) displayed resistance to penicillin G, with all of the isolates and 2 (9%) of them showing intermediate susceptibility to clindamycin and rifampicin, respectively. According to the MIC assay, the rate of resistance to penicillin G was the same as that of disk diffusion method, but 16 (72.7%) of isolates showed intermediate susceptibility to clindamycin using E-test. In the multiplex PCR, 19 (86.4%) of isolates belonged to serotype 1/2c or 3c and the remaining 3 isolates were identified as (4b, 4d or 4e) and (1/2a or 3a), respectively. The occurrence of resistance to penicillin G, which can be used in the treatment of listeriosis, is very alarming and more prevalence of 1/2c serotype, in comparison to 3 other important ones (1/2a, 1/2b and 4b), in Iran has been reported for the first time. To the best of our knowledge, this is the first study showing the distribution of various serogroups of L. monocytogenes from human and livestock in Iran. Copyright © 2017 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Callum J. Highmore
2018-04-01
Full Text Available The microbiological safety of fresh produce is monitored almost exclusively by culture-based detection methods. However, bacterial food-borne pathogens are known to enter a viable-but-nonculturable (VBNC state in response to environmental stresses such as chlorine, which is commonly used for fresh produce decontamination. Here, complete VBNC induction of green fluorescent protein-tagged Listeria monocytogenes and Salmonella enterica serovar Thompson was achieved by exposure to 12 and 3 ppm chlorine, respectively. The pathogens were subjected to chlorine washing following incubation on spinach leaves. Culture data revealed that total viable L. monocytogenes and Salmonella Thompson populations became VBNC by 50 and 100 ppm chlorine, respectively, while enumeration by direct viable counting found that chlorine caused a <1-log reduction in viability. The pathogenicity of chlorine-induced VBNC L. monocytogenes and Salmonella Thompson was assessed by using Caenorhabditis elegans. Ingestion of VBNC pathogens by C. elegans resulted in a significant life span reduction (P = 0.0064 and P < 0.0001, and no significant difference between the life span reductions caused by the VBNC and culturable L. monocytogenes treatments was observed. L. monocytogenes was visualized beyond the nematode intestinal lumen, indicating resuscitation and cell invasion. These data emphasize the risk that VBNC food-borne pathogens could pose to public health should they continue to go undetected.
Resistance of Listeria monocytogenes biofilms to sanitizing agents
Listeria monocytogenes is notorious for its capacity to colonize the environment and equipment of food processing facilities and to persist in the processing plant ecosystem, sometimes for decades. Such persistence is mediated by multiple attributes of L. monocytogenes, including the pathogen’s capa...
Assessment of Listeria monocytogenes virulence in the Galleria mellonella insect larvae model.
Directory of Open Access Journals (Sweden)
Mira Rakic Martinez
Full Text Available Several animal models have been used to understand the molecular basis of the pathogenicity, infectious dose and strain to strain variation of Listeria monocytogenes. The greater wax worm Galleria mellonella, as an alternative model, provides some useful advantages not available with other models and has already been described as suitable for the virulence assessment of various pathogens including L. monocytogenes. The objectives of this study are: 1 confirming the usefulness of this model with a wide panel of Listeria spp. including non-pathogenic L. innocua, L. seeligeri, L. welshimeri and animal pathogen L. ivanovii; 2 assessment of virulence of several isogenic in-frame deletion mutants in virulence and stress related genes of L. monocytogenes and 3 virulence assessment of paired food and clinical isolates of L. monocytogenes from 14 major listeriosis outbreaks occurred worldwide between 1980 and 2015. Larvae injected with different concentrations of Listeria were incubated at 37°C and monitored over seven days for time needed to kill 50% of larvae (LT50 and to determine change of bacterial population in G. mellonella, 2 and 24 hours post-inoculation. Non-pathogenic members of Listeria and L. ivanovii showed significantly (P < 0.05 higher LT50 (lower virulence than the wild type L. monocytogenes strains. Isogenic mutants of L. monocytogenes with the deletions in prfA, plcA, hly, actA and virR genes, also showed significantly (P < 0.05 higher LT50 than the wild type strain at the inoculum of 106CFU/larva. Food isolates had significantly (P < 0.05 lower virulence than the paired clinical isolates, at all three inoculum concentrations. L. monocytogenes strains related to non-invasive (gastroenteritis outbreaks of listeriosis showed significantly (P < 0.05 lower virulence than isolates of the same serotype obtained from outbreaks with invasive symptoms. The difference, however, was dose and strain- dependent. No significant differences in
[Risk assessment of Listeria monocytogenes in deli meats and vegetable salads].
Tian, Jing; Liu, Xiu-mei
2009-09-01
To analysis risk from Listeria monocytogenes in deli meats and vegetable salads. Use Risk Ranger which is a software programme developed by the University of Hobart, Australia and answer 11 questions on affecting the risk from hazards in the specific foods by combining data from national foodborne diseases surveillance network and some references to make semi-quantitative risk assessment for the specific food. Relative risk from Listeria monocytogenes in deli meats and vegetable salads is 61 and 52, respectively. Incidence of listeriosis caused by deli meats-Listeria monocytogenes pairs and vegetable salads-Listeria monocytogenes pairs is 5.4 and 0.2 cases per million people, respectively. Risk from the former is 32 times than that from the latter. By changing the selection for some risk factors in the model, it was known that the risks from two food-hazard combinations could decrease 10 times, if taking necessary actions after processing. Deli meats is a kind of high risk food for listeriosis.
Listeria monocytogenes Monographic Study
Directory of Open Access Journals (Sweden)
Emil Tirziu
2010-05-01
Full Text Available Listeria monocytogenes is a ubiquitous bacteria with a remarkable resistance in discordant condition which produce listeriosis, an infectious disease that affects multiple domestic and wild animals’ species, but also humans. Receptive to listeriosis are the majority of domestic or wild mammals and birds, in the last years being registered an increase of receptivity in humans. The concept of listeriosis in human pathology, a disease caused by eating or drinking contaminated food and water, appeared for the first time in 1981, during an outbreak in Canada with seven cases in adults and 34 cases of maternalfetal listeriosis. The alimentary origin of human listeriosis can be easily explained if considered some general characteristics of the bacteria. Thus, resistance in various conditions, especially at lower temperatures, justifies its dissemination and food contamination, particularly when is conserved by refrigeration. Also, L. monocytogenes has a significant presence in alimentary products. Some studies showed that 4% of the milk products, 29% of the meat products, 5% of the vegetable products and 26% of the products obtained from fishes and shell fishes are positive for L. monocytogenes, which allows us to say that battle against these bacteria is a war against microbial contamination.
Nastasijevic, Ivan; Milanov, Dubravka; Velebit, Branko; Djordjevic, Vesna; Swift, Craig; Painset, Anais; Lakicevic, Brankica
2017-09-18
Repeated Listeria outbreaks particularly associated with Ready-To-Eat (RTE) delicatessen meat products have been reported annually at global level. The most frequent scenario that led to foodborne outbreaks was the post-thermal treatment cross-contamination of deli meat products during slicing and modified atmosphere packaging (MAP). The precondition for such cross contamination is the previous introduction of Listeria into meat processing facilities and subsequent colonization of the production environment, associated with formation of biofilms resilient to common sanitation procedures regularly applied in meat establishments. The use of Whole Genome Sequencing (WGS) can facilitate the understanding of contamination and colonization routes of pathogens within the food production environment and enable efficient pathogen tracking among different departments. This study aimed to: a) provide a proof of concept on practical use of WGS in a meat establishment to define the entry routes and spread pattern of L. monocytogenes, and b) to consider the regular use of WGS in meat processing establishments as a strong support of food safety management system. The results revealed that Listeria spp. was present in slaughter line, chilling chambers, deboning, slicing, MAP, as well as in corridors and dispatch (53 positive samples, out of 240). Eight L. monocytogenes isolates (out of 53) were identified from the slaughterhouse, chilling chambers, deboning, MAP and dispatch. L. monocytogenes isolates were of three different serotypes (1/2a, 1/2c, 4b) and correspondingly of three MLST sequence types. Overall, two pairs of L. monocytogenes isolates were genetically identical, i.e. two serotype 4b isolates (ST1), isolated from water drain at dispatch unit and two isolates obtained from slaughterhouse (floorwall junction at the carcass wash point) and MAP (water drain). These findings indicated that L. monocytogenes isolates identified in meat processing units (MAP, chilling chamber
Listeria monocytogenes growth limits and stress resistance mechanisms
Veen, van der S.
2008-01-01
The food-borne pathogen Listeria monocytogenes is a Gram-positive facultative anaerobic rod, which is the causative agent of listeriosis. Due to the severity of the disease and the fact that its incidence is increasing in numerous European countries, L. monocytogenes is of great public health
Directory of Open Access Journals (Sweden)
David eMontero
2015-04-01
Full Text Available Listeria monocytogenes is a pathogen transmitted through food that can cause severe infections in high-risk groups such as pregnant women, elderly, young children and immunocompromised individuals. It is a ubiquitous bacterium that can survive in harsh conditions, such as dry environments, at low temperatures, in brine conditions and at low pH values. It also has the capacity to form biofilms, which makes it particularly successful even in colonizing surfaces within food processing plants. This study analyzed the presence of L. monocytogenes in ready-to-eat food (RTE such as sausage, cheese, fresh salads and other types of raw food. 850 samples of refrigerated and packaged food collected in 2008 and 2009 were analyzed. It was found that 25% of these samples were contaminated with L. monocytogenes strains. Serotyping and virulence genes detection by polymerase chain reaction (PCR identified that strains belonging to serotype 4b, and containing one or more genes encoded by LIPI-1, were significantly associated with specific food types. Furthermore, using pulse field gel electrophoresis (PFGE, it was possible to associate isolates from cheese with strains from clinical cases of listeriosis outbreaks that occurred during the same time period within the same geographic regions. In addition, a strong correlation was observed between isolates from frozen seafood and from clinical strains obtained from sporadic cases of listeriosis. In agreement with reports described in other countries, our results shown that Chilean strains of L. monocytogenes from food products include the most virulent serotypes, encoding for the main virulence genes of the LIPI-1 pathogenicity island, and were clonally related to clinical isolates from sporadic cases and outbreaks of listeriosis. In conclusion, we show that Chilean isolates of L. monocytogenes from RTE and raw food products can cause disease in humans, representing a public health risk that justifies permanent
Montero, David; Bodero, Marcia; Riveros, Guillermina; Lapierre, Lisette; Gaggero, Aldo; Vidal, Roberto M; Vidal, Maricel
2015-01-01
Listeria monocytogenes is a pathogen transmitted through food that can cause severe infections in high-risk groups such as pregnant women, elderly, young children and immunocompromised individuals. It is a ubiquitous bacterium that can survive in harsh conditions, such as dry environments, at low temperatures, in brine conditions and at low pH values. It also has the capacity to form biofilms, which makes it particularly successful even in colonizing surfaces within food processing plants. This study analyzed the presence of L. monocytogenes in ready-to-eat food (RTE) such as sausage, cheese, fresh salads, and other types of raw food. 850 samples of refrigerated and packaged food collected in 2008 and 2009 were analyzed. It was found that 25% of these samples were contaminated with L. monocytogenes strains. Serotyping and virulence genes detection by polymerase chain reaction (PCR) identified that strains belonging to serotype 4b, and containing one or more genes encoded by pathogenicity island (LIPI-1), were significantly associated with specific food types. Furthermore, using pulse field gel electrophoresis (PFGE), it was possible to associate isolates from cheese with strains from clinical cases of listeriosis outbreaks that occurred during the same time period within the same geographic regions. In addition, a strong correlation was observed between isolates from frozen seafood and from clinical strains obtained from sporadic cases of listeriosis. In agreement with reports described in other countries, our results shown that Chilean strains of L. monocytogenes from food products include the most virulent serotypes, encoding for the main virulence genes of the LIPI-1, and were clonally related to clinical isolates from sporadic cases and outbreaks of listeriosis. In conclusion, we show that Chilean isolates of L. monocytogenes from RTE and raw food products can cause disease in humans, representing a public health risk that justifies permanent surveillance.
Crépet, Amélie; Albert, Isabelle; Dervin, Catherine; Carlin, Frédéric
2007-01-01
A normal distribution and a mixture model of two normal distributions in a Bayesian approach using prevalence and concentration data were used to establish the distribution of contamination of the food-borne pathogenic bacteria Listeria monocytogenes in unprocessed and minimally processed fresh vegetables. A total of 165 prevalence studies, including 15 studies with concentration data, were taken from the scientific literature and from technical reports and used for statistical analysis. The predicted mean of the normal distribution of the logarithms of viable L. monocytogenes per gram of fresh vegetables was −2.63 log viable L. monocytogenes organisms/g, and its standard deviation was 1.48 log viable L. monocytogenes organisms/g. These values were determined by considering one contaminated sample in prevalence studies in which samples are in fact negative. This deliberate overestimation is necessary to complete calculations. With the mixture model, the predicted mean of the distribution of the logarithm of viable L. monocytogenes per gram of fresh vegetables was −3.38 log viable L. monocytogenes organisms/g and its standard deviation was 1.46 log viable L. monocytogenes organisms/g. The probabilities of fresh unprocessed and minimally processed vegetables being contaminated with concentrations higher than 1, 2, and 3 log viable L. monocytogenes organisms/g were 1.44, 0.63, and 0.17%, respectively. Introducing a sensitivity rate of 80 or 95% in the mixture model had a small effect on the estimation of the contamination. In contrast, introducing a low sensitivity rate (40%) resulted in marked differences, especially for high percentiles. There was a significantly lower estimation of contamination in the papers and reports of 2000 to 2005 than in those of 1988 to 1999 and a lower estimation of contamination of leafy salads than that of sprouts and other vegetables. The interest of the mixture model for the estimation of microbial contamination is discussed. PMID
Inhibitory Effect of Nisin on Listeria monocytogenes Inoculated into Surimi and Minced Meat
Directory of Open Access Journals (Sweden)
Masoud Rezaei
2012-02-01
Full Text Available Background & Objective: Listeria monocytogenes has already established as an important food born pathogen which induce listeriosis in human. Use of bacteriocins to provide food safety has been increased dramatically. Nisin has a wide spectrum inhibitory effect than the other bacteriocins and inhibits food-borne pathogens such as L. monocytogenes and many other Gram-positive spoilage microorganisms. The purpose of this study was to investigate the inhibitory effect of Nisin on population of Listeria monocytogenes and the role of changes in food components on the antilisterial properties of Nisin. Materials & Methods: The minced meat and surimi samples were inoculated by 1×104 cfu/g of L. monocytogenes. Then samples exposed to Nisin at the levels of 500 or 1000 IU/g were prepared. All treatments after packaging in plastic bags were kept for 12 days at refrigerator temperature. Samples were cultured on CHROMagarTM Listeria every 2 days and the number of listeria monocytogenes was counted. Results: two different concentrations of Nisin (500 or 1000 IU/g was not able to inhibit L. monocytogenes below the acceptable level for raw food (100 cells per g in minced meat and surimi of silver carp. But the number of bacteria reduces more in fish surimi as compared to the mince meal. Also, antilisterial activity of Nisin was reduced during the storage period. Conclusion: Inhibitory property of Nisin against L. monocytogenes in surimi significantly was higher than the minced (P<0.05. So it is possible the antilisterial properties of Nisin will increase by elimination of some enzymes during processing.
Chen, Jianshun; Luo, Xiaokai; Jiang, Lingli; Jin, Peijie; Wei, Wei; Liu, Dongyou; Fang, Weihuan
2009-02-01
In this study, we examined Listeria monocytogenes isolates from Chinese food sources in an attempt to gain further insights on the molecular characteristics and virulence potential of this important foodborne pathogen. Of the 88 L. monocytogenes food isolates recovered, 42 (47.7%) were of serovars 1/2a or 3a; 23 (26.1%) of serovars 1/2b or 3b; 15 (17.0%) of 1/2c or 3c; 6 (6.8%) of serovars 4b, 4d or 4e; and 2 (2.2%) of serovars 4a or 4c. In contrast to inlAB locus conserved in all serovars, internalin cluster between ascB and dapE varies with different serovars, with inlC2DE, inlGC2DE and inlGHE predominantly in serovars 1/2b or 4b, serovar 1/2a and serovar 1/2c. While inlF existed in all the inlGHE- and inlGC2DE-containing isolates but 17.4% of those having inlC2DE, lmo2026 existed in all the inlGHE-containing isolates but 20.0% of those bearing inlGC2DE, suggesting that inlF might have co-evolved with inlGC2DE and inlGHE while lmo2026 with inlGHE only. With the exception of serovar 4a isolate, most serovar isolates demonstrated remarkable ability to form plaques on L929 cells and produced significant mouse mortality irrespective of the internalin gene organization and whether an intact actA gene is present or not. These results indicate that majority of these food isolates may have the potential to cause human diseases if ingested via contaminated foods. Given that serovar 4b accounts for nearly half of human clinical listeriosis cases documented, the relative low proportion of serovar 4b food isolates suggests that this serovar is probably more tolerant of the adverse conditions in the host's stomach and/or more efficient in entering host cells than serovars 1/2a, 1/2b and 1/2c.
Bradley, Derek; McNeil, Brian; Laffey, John G; Rowan, Neil J
2012-06-01
The effects of mild conventional food-processing conditions on Listeria monocytogenes survival to pulsed UV (PUV) irradiation and virulence-associated characteristics were investigated. Specifically, this study describes the inability of 10 strains representative of 3 different culture forms or morphotypes of L. monocytogenes to adapt to normally lethal levels of PUV-irradiation after exposure to sub-lethal concentrations of salt (7.5% (w/v) NaCl for 1 h), acid (pH 5.5 for 1 h), heating (48 °C for 1 h) or PUV (UV dose 0.08 μJ/cm(2)). Findings showed that the order of increasing sensitivity of L. monocytogenes of non-adapted and stressed morphotypes to low pH (pH 3.5 for 5 h, adjusted with lactic), high salt (17.5% w/v NaCl for 5 h), heating (60 °C for 1 h) and PUV-irradiation (100 pulses at 7.2 J and 12.8 J, equivalent to UV doses of 2.7 and 8.4 μJ/cm(2) respectively) was typical wild-type smooth (S/WT), atypical filamentous rough (FR) and atypical multiple-cell-chain (MCR) variants. Exposure of L. monocytogenes cells to sub-lethal acid, salt or heating conditions resulted in similar or increased susceptibility to PUV treatments. Only prior exposure to mild heat stressing significantly enhanced invasion of Caco-2 cells, whereas subjection of L. monocytogenes cells to combined sub-lethal salt, acid and heating conditions produced the greatest reduction in invasiveness. Implications of these findings are discussed. This constitutes the first study to show that pre-exposure to mild conventional food-processing stresses enhances sensitivity of different culture morphotypes of L. monocytogenes to PUV, which is growing in popularity as an alternative or complementary approach for decontamination in the food environment. Copyright © 2011 Elsevier Ltd. All rights reserved.
LISTERIA MONOCYTOGENES RISK EVALUATION IN READY TO EAT DELI PRODUCTS
Directory of Open Access Journals (Sweden)
T Civera
2013-02-01
Full Text Available Listeria monocytogenes has become one of the major concerns for food safety. Its ability to survive and replicate at low temperature, pH and high salt concentration, makes the bacterium a threat, mostly for RTE products. For these reasons, the present research was aimed at detecting the ability of growth of L. monocytogenes in RTE products retrieved from one deli store. Samples were analysed for L. monocytogenes detection, then inoculated with the pathogen (105cell/ml and stored at refrigeration temperature for the duration of their shelf-life (15-60 days. In all the products L. monocytogenes was not detected before experimental contamination. The challenge test evidenced that experimentally inoculated L. monocytogenes was not able to multiply for the duration of the entire shelf-life. These results indicated that the tested products could be considered as foods which are not able to support the growth of L. monocytogenes, as indicated by E.C. Regulation 2073/05. However, in order to guarantee consumer’s safety, it needs to be emphasized the need of a correct application of the GMPs, required for lowering the risk of initial contamination.
Larsen, Marianne Halberg; Koch, Anette Granly; Ingmer, Hanne
2010-09-01
The objective of this study was to investigate how various growth conditions influence the virulence of Listeria monocytogenes monitored by its ability to invade the epithelial cell lines Caco-2 and INT-407. The growth conditions examined were modified atmosphere-packaged deli meat and brain heart infusion broth (BHI) with and without salt. Five strains of L. monocytogenes were selected to investigate their invasiveness and all strains invaded Caco-2 cells at higher levels than INT-407 cells. Further, the clinical strains (3443 and 3734) were more invasive (p 0.05) in invasiveness after 7 days at 10 degrees C in BHI broth or on sausage, whereas a slight increase (p < 0.05) was observed after incubation on ham for 2 and 4 weeks compared to that in BHI broth. Most importantly, our results show that L. monocytogenes efficiently invade Caco-2 cells even after 4 weeks of storage at chilled temperature. This is highly relevant for safety assessment of this organism in food as these conditions reflect storage of ready-to-eat food products in domestic refrigerators.
Assessment of Listeria monocytogenes virulence in the Galleria mellonella insect larvae model.
Rakic Martinez, Mira; Wiedmann, Martin; Ferguson, Martine; Datta, Atin R
2017-01-01
Several animal models have been used to understand the molecular basis of the pathogenicity, infectious dose and strain to strain variation of Listeria monocytogenes. The greater wax worm Galleria mellonella, as an alternative model, provides some useful advantages not available with other models and has already been described as suitable for the virulence assessment of various pathogens including L. monocytogenes. The objectives of this study are: 1) confirming the usefulness of this model with a wide panel of Listeria spp. including non-pathogenic L. innocua, L. seeligeri, L. welshimeri and animal pathogen L. ivanovii; 2) assessment of virulence of several isogenic in-frame deletion mutants in virulence and stress related genes of L. monocytogenes and 3) virulence assessment of paired food and clinical isolates of L. monocytogenes from 14 major listeriosis outbreaks occurred worldwide between 1980 and 2015. Larvae injected with different concentrations of Listeria were incubated at 37°C and monitored over seven days for time needed to kill 50% of larvae (LT50) and to determine change of bacterial population in G. mellonella, 2 and 24 hours post-inoculation. Non-pathogenic members of Listeria and L. ivanovii showed significantly (P monocytogenes strains. Isogenic mutants of L. monocytogenes with the deletions in prfA, plcA, hly, actA and virR genes, also showed significantly (P monocytogenes strains related to non-invasive (gastroenteritis) outbreaks of listeriosis showed significantly (P < 0.05) lower virulence than isolates of the same serotype obtained from outbreaks with invasive symptoms. The difference, however, was dose and strain- dependent. No significant differences in virulence were observed among the serotype tested in this study.
Directory of Open Access Journals (Sweden)
Michela Ibba
2013-09-01
Full Text Available Listeria monocytogenes harbouring niches established in the processing plant support post-process contamination of dairy products made from pasteurised or thermised milk. The present study investigated L. monocytogenes environmental contamination in two sheep’s milk cheese-making plants. Persistence of contamination in the area at higher risk was also investigated. During a one-year survey 7 samplings were carried out in each dairy plant, along the production lines of Pecorino Romano and ricotta salata cheese. A total of 613 environmental samples collected from food contact and non-food contact surfaces were analysed according to ISO 11290-1:2005 standard method. Identification of the isolated strains was carried out by polymerase chain reaction. L. monocytogenes prevalence was 23.2% in dairy A and 13.1% in dairy B, respectively. The higher prevalence rate was found in the following areas: salting, products washing, packaging, ricotta salata storage and Pecorino Romano ripening rooms. L. monocytogenes was never found in the cheese-making area. The probability of observing samples positive for the presence of L. monocytogenes was asso- ciated with dairy plant, sampling area and the period of cheese-making (P<0.001. The greater persistence of contamination over time was observed in the washing, salting, and Pecorino Romano ripening areas. The control of persistent environmental contamination relies on the identification of L. monocytogenes niches within the processing environment and the prevention of harborage sites formation. The importance of strict cleaning and sanitising procedure in controlling L. monocytogenes environmental contamination is confirmed by the lower level of contamination observed after these procedures were correctly implemented.
Kadam, S.R.; Besten, den H.M.W.; Veen, van der S.; Zwietering, M.H.; Moezelaar, R.; Abee, T.
2013-01-01
The foodborne pathogen Listeria monocytogenes has the ability to produce biofilms in food-processing environments and then contaminate food products, which is a major concern for food safety. The biofilm forming behavior of 143 L. monocytogenes strains was determined in four different media that
An outbreak of an unusual strain of Listeria monocytogenes infection in North-East Scotland
Directory of Open Access Journals (Sweden)
Emmanuel Okpo
2015-11-01
Full Text Available Summary: Listeria monocytogenes infection is an important cause of illness and hospitalization in vulnerable individuals. In the present study, we describe a community outbreak of Listeria monocytogenes in the North-East region of Scotland, which was epidemiologically, environmentally and microbiologically linked to a local meat product and ready-to-eat product manufacturer. Infected individuals were interviewed, and an environmental investigation was conducted. Clinical and environmental samples were tested by culture, and isolates were typed by fluorescent amplified fragment length polymorphism (fAFLP. Three cases of Listeria monocytogenes were linked geographically, had the same serotype (1/2a and were indistinguishable by fAFLP type XII.6. The human, food and environmental isolates were of the same serotype and were indistinguishable by molecular typing.This is the first community outbreak of L. monocytogenes reported in Scotland since the current outbreak surveillance was established in 1996. Epidemiological and laboratory evidence indicated poor hand hygiene, unhygienic practices and cross-contamination throughout the manufacturing process of ready-to-eat foods as a possible cause of the outbreak. More stringent control of commercial food establishments that provide ready-to-eat food and the need to advise specifically vulnerable groups, e.g., pregnant women, of the risk of L. monocytogenes in ready-to-eat food is urgently needed. Keywords: Listeria monocytogenes, Outbreak, Foodborne, Community acquired infection, Listeriosis
Genome sequences of Listeria monocytogenes strains with resistance to arsenic
Listeria monocytogenes frequently exhibits resistance to arsenic. We report here the draft genome sequences of eight genetically diverse arsenic-resistant L. monocytogenes strains from human listeriosis and food-associated environments. Availability of these genomes would help to elucidate the role ...
Silver as antibacterial towards Listeria monocytogenes
Directory of Open Access Journals (Sweden)
Simone eBelluco
2016-03-01
Full Text Available Listeria monocytogenes is a serious foodborne pathogen that can contaminate food during processing and can grow during food shelf-life. New types of safe and effective food contact materials embedding antimicrobial agents, like silver, can play an important role in the food industry. The present work aimed at evaluating the in vitro growth kinetics of different strains of L. monocytogenes in the presence of silver, both in its ionic and nano form. The antimicrobial effect was determined by assaying the number of culturable bacterial cells, which formed colonies after incubation in the presence of silver nanoparticles (AgNPs or silver nitrate (AgNO3. Ionic release experiments were performed in parallel. A different reduction of bacterial viability between silver ionic and nano forms was observed, with a time delayed effect exerted by AgNPs. An association between antimicrobial activity and ions concentration was shown by both silver chemical forms, suggesting the major role of ions in the antimicrobial mode of action.
REALIS: Postgenomic Analysis of Listeria Monocytogenes
Directory of Open Access Journals (Sweden)
The REALIS Consortium
2006-04-01
Full Text Available Listeria monocytogenes is a remarkably successful food-borne pathogen. It is capable a of surviving and proliferating under conditions that exist within the food chain, such as at low temperatures, high salt and low pH and b of colonizing animal host tissues after ingestion of contaminated food, causing opportunistic infections mainly, but not exclusively, in immunocompromised hosts. The ultimate goals of REALIS are two fold: Firstly, it aims to completely decipher all genes required for survival in and adaptation of Listeria monocytogenes to two very different environments, ie., the infected host and the external environment. Secondly, using genomics and postgenomic tools, REALIS seeks to precisely address fundamental questions regarding evolutionary relationships between pathogenic and non-pathogenic Listeria and to define qualities of particularly successful clonal pathovariants in causing disease. This project will provide both industry and health care managers with rational approaches to curbing food-borne contamination, minimising risks of infection and providing novel pharmacological approaches for halting the fulminant course of infection.
Barre, Léna; Brasseur, Emilie; Doux, Camille; Lombard, Bertrand; Besse, Nathalie Gnanou
2015-06-01
For the enumeration of Listeria monocytogenes (L. monocytogenes) in food, a sensitive enumeration method has been recently developed. This method is based on a membrane filtration of the food suspension followed by transfer of the filter on a selective medium to enumerate L. monocytogenes. An evaluation of this method was performed with several categories of foods naturally contaminated with L. monocytogenes. The results obtained with this technique were compared with those obtained from the modified reference EN ISO 11290-2 method for the enumeration of L. monocytogenes in food, and are found to provide more precise results. In most cases, the filtration method enabled to examine a greater quantity of food thus greatly improving the sensitivity of the enumeration. However, it was hardly applicable to some food categories because of filtration problems and background microbiota interference. Copyright © 2014 Elsevier Ltd. All rights reserved.
Efficacy of ultraviolet light exposure against survival of Listeria monocytogenes on conveyor belts.
Morey, Amit; McKee, Shelly R; Dickson, James S; Singh, Manpreet
2010-06-01
Listeria monocytogenes has been repeatedly isolated from foods and food-processing facilities including food contact surfaces such as conveyor belts (CB). CBs are often difficult to clean and require rigorous sanitation programs for decontamination. Ultraviolet (UV) light has exhibited microbicidal properties on food contact surfaces and this study was conducted to determine the efficacy of UV against L. monocytogenes on CB made of different materials. A four-strain cocktail of L. monocytogenes (serotypes 3A, 4A, 4B, and 4C) was made to give a suspension of approximately 10(7) CFU/mL. CBs made from four different types of materials, (1) Ropanyl DM 8/2 A2 + 04 (belt 1), (2) Volta FRMW-3.0 (belt 2), (3) Volta FRMB-3.0 (belt 3), and (4) Ropanyl DM (belt 4), were inoculated with 1 mL of the four-strain cocktail (approximately 10(7) CFU/mL) of the bacterial suspension. CBs were treated with UV light (254 nm) for 1 and 3 sec at 5.53 and 5.95 mW/cm(2). Three replications of the experiments were conducted. Two-way analysis of variance of survival populations of L. monocytogenes showed that bacterial counts were significantly reduced (p belt types irrespective of UV light intensities and times of exposure. L. monocytogenes populations were reduced (p belts 1, 2, and 3 after exposure to 5.95 mW/cm(2) UV light intensity for 3 sec. L. monocytogenes-inoculated CBs that were exposed to 5.53 mW/cm(2) showed higher (p Belt 4 showed survival populations of L. monocytogenes ranging from 1.42 to 1.73 log(10) CFU/cm(2) after UV light treatment for 1 and 3 sec. UV light can be effectively used to reduce L. monocytogenes contamination on CBs.
Directory of Open Access Journals (Sweden)
Angeliki Birmpa
2015-08-01
Full Text Available In the present study, the effectiveness of two loop-mediated isothermal amplification (LAMP assays was evaluated. Samples of romaine lettuce, strawberries, cherry tomatoes, green onions and sour berries were inoculated with known dilutions (100-108 CFU/g of produce of S. Enteritidis and L. monocytogenes. With LAMP assay, pathogens can be detected in less than 60 min. The limits of detection of S. Enteritidis and L. monocytogenes depended on the food sample tested and on the presence of enrichment step. After enrichment steps, all food samples were found positive even at low initial pathogen levels. The developed LAMP, assays, are expected to become a valuable, robust, innovative, powerful, cheap and fast monitoring tool, which can be extensively used for routine analysis, and screening of contaminated foods by the food industry and the Public Food Health Authorities.
Local Outbreak of Listeria monocytogenes Serotype 4b Sequence Type 6 Due to Contaminated Meat Pâté.
Althaus, Denise; Jermini, Marco; Giannini, Petra; Martinetti, Gladys; Reinholz, Danuta; Nüesch-Inderbinen, Magdalena; Lehner, Angelika; Stephan, Roger
2017-04-01
In January and February 2016, five cases of confirmed and two cases of probable infection due to Listeria monocytogenes serotype 4b, sequence type (ST) 6 belonging to a single pulsed-field gel electrophoresis pulsotype pattern were registered in a region of southern Switzerland. L. monocytogenes was detected in blood samples (four cases) and pleural fluid (one case). Furthermore, L. monocytogenes 4b ST6 was detected in a stool sample of an asymptomatic person exposed to a common food. Forthwith, the food safety authority and a local gourmet meat producer reported L. monocytogenes contamination of meat pâté. Analysis of further food and environmental samples from the premises of the producer yielded isolates matching the clinical strains and confirmed the presence of L. monocytogenes 4b ST6 in the mincing machine as the cause of the food contamination.
DEFF Research Database (Denmark)
Hingston, Patricia A.; Chen, Jessica; Dhillon, Bhavjinder K
2017-01-01
elements. A whole genome single-nucleotide-variants phylogeny revealed sporadic distribution of tolerant isolates and closely related sensitive and tolerant isolates, highlighting that minor genetic differences can influence the stress tolerance of L. monocytogenes. Specifically, a number of cold......The human pathogen Listeria monocytogenes is a large concern in the food industry where its continuous detection in food products has caused a string of recalls in North America and Europe. Most recognized for its ability to grow in foods during refrigerated storage, L. monocytogenes can also...... tolerate several other food-related stresses with some strains possessing higher levels of tolerances than others. The objective of this study was to use a combination of phenotypic analyses and whole genome sequencing to elucidate potential relationships between L. monocytogenes genotypes and food...
Effect of humidity and temperature on the survival of Listeria monocytogenes on surfaces.
Redfern, J; Verran, J
2017-04-01
Listeria monocytogenes is a pathogenic bacterium, with human disease and infection linked to dairy products, seafood, ready-to-eat meat and raw & undercooked meats. Stainless steel is the most common food preparation surface and therefore, it is important to understand how food storage conditions such as surface materials, temperature and relative humidity can affect survival of L. monocytogenes. In this study, survival of L. monocytogenes on stainless steel was investigated at three temperatures (4, 10 and 21°C), each approx. 11, 50 and 85% humidity. Results indicate that the lower the temperature, the more cells were recovered in all three humidity environments, while medium humidity enhances survival, irrespective of temperature. Lower humidity decreases recovery at all temperatures. These data support the guidance noted above that humidity control is important, and that lower humidity environments are less likely to support retention of viable L. monocytogenes on a stainless steel surface. Understanding survival of potential food-borne pathogens is essential for the safe production and preparation of food. While it has long been 'common knowledge' that relative humidity can affect the growth and survival of micro-organisms, this study systematically describes the survival of L. monocytogenes on stainless steel under varying humidity and temperatures for the first time. The outcomes from this paper will allow those involved with food manufacture and preparation to make informed judgement on environmental conditions relating to humidity control, which is lacking in the food standards guidelines. © 2017 The Society for Applied Microbiology.
LACTIC FLORA-LISTERIA MONOCYTOGENES INTERACTION
Directory of Open Access Journals (Sweden)
S. Colombo
2012-08-01
Full Text Available The EC Regulation 2073/2005 (1 requires that food processors evaluate the capability of ready-to-use (RTE products to support the development of Listeria monocytogenes when their pH and aW values are favourable to the growth of this microorganism. It is renown that the lactic flora plays an important role in many different foods, both from a technological and a food safety standpoint. This study was aimed to observe the behaviour and the potential anti-Listeria effect of some natural lactic flora present in Italian liver patè crostini (chicken heart and liver, anchovies, onions, capers, starch, no added preservatives through the Combase Predictor – Max Growth Rate predictive software. The natural lactic flora of the crostini demonstrated a variable capability to inhibit the growth of Listeria monocytogenes which depends upon : the concentration of the lactic flora at the beginning of the shelf life period and the subsequent lag phase, the possible release of anti-Listeria substances, and the maximum growth rate.
An outbreak of an unusual strain of Listeria monocytogenes infection in North-East Scotland.
Okpo, Emmanuel; Leith, Jayne; Smith-Palmer, Alison; Bell, John; Parks, Duncan; Browning, Fiona; Byers, Lynn; Corrigan, Helen; Webster, Diana; Karcher, Anne M; Murray, Andrew; Storey, Tom
2015-01-01
Listeria monocytogenes infection is an important cause of illness and hospitalization in vulnerable individuals. In the present study, we describe a community outbreak of Listeria monocytogenes in the North-East region of Scotland, which was epidemiologically, environmentally and microbiologically linked to a local meat product and ready-to-eat product manufacturer. Infected individuals were interviewed, and an environmental investigation was conducted. Clinical and environmental samples were tested by culture, and isolates were typed by fluorescent amplified fragment length polymorphism (fAFLP). Three cases of Listeria monocytogenes were linked geographically, had the same serotype (1/2a) and were indistinguishable by fAFLP type XII.6. The human, food and environmental isolates were of the same serotype and were indistinguishable by molecular typing. This is the first community outbreak of L. monocytogenes reported in Scotland since the current outbreak surveillance was established in 1996. Epidemiological and laboratory evidence indicated poor hand hygiene, unhygienic practices and cross-contamination throughout the manufacturing process of ready-to-eat foods as a possible cause of the outbreak. More stringent control of commercial food establishments that provide ready-to-eat food and the need to advise specifically vulnerable groups, e.g., pregnant women, of the risk of L. monocytogenes in ready-to-eat food is urgently needed. Copyright © 2015 King Saud Bin Abdulaziz University for Health Sciences. Published by Elsevier Ltd. All rights reserved.
Rückerl, I; Muhterem-Uyar, M; Muri-Klinger, S; Wagner, K-H; Wagner, M; Stessl, B
2014-10-17
The aim of this study was to analyze the changing patterns of Listeria monocytogenes contamination in a cheese processing facility manufacturing a wide range of ready-to-eat products. Characterization of L. monocytogenes isolates included genotyping by pulsed-field gel electrophoresis (PFGE) and multi-locus sequence typing (MLST). Disinfectant-susceptibility tests and the assessment of L. monocytogenes survival in fresh cheese were also conducted. During the sampling period between 2010 and 2013, a total of 1284 environmental samples were investigated. Overall occurrence rates of Listeria spp. and L. monocytogenes were 21.9% and 19.5%, respectively. Identical L. monocytogenes genotypes were found in the food processing environment (FPE), raw materials and in products. Interventions after the sampling events changed contamination scenarios substantially. The high diversity of globally, widely distributed L. monocytogenes genotypes was reduced by identifying the major sources of contamination. Although susceptible to a broad range of disinfectants and cleaners, one dominant L. monocytogenes sequence type (ST) 5 could not be eradicated from drains and floors. Significantly, intense humidity and steam could be observed in all rooms and water residues were visible on floors due to increased cleaning strategies. This could explain the high L. monocytogenes contamination of the FPE (drains, shoes and floors) throughout the study (15.8%). The outcome of a challenge experiment in fresh cheese showed that L. monocytogenes could survive after 14days of storage at insufficient cooling temperatures (8 and 16°C). All efforts to reduce L. monocytogenes environmental contamination eventually led to a transition from dynamic to stable contamination scenarios. Consequently, implementation of systematic environmental monitoring via in-house systems should either aim for total avoidance of FPE colonization, or emphasize a first reduction of L. monocytogenes to sites where
Taguchi, Masumi; Kanki, Masashi; Yamaguchi, Yuko; Inamura, Hideichi; Koganei, Yosuke; Sano, Tetsuya; Nakamura, Hiromi; Asakura, Hiroshi
2017-03-01
Incidences of food poisoning traced to nonanimal food products have been increasingly reported. One of these was a recent large outbreak of Shiga toxin-producing Escherichia coli (STEC) O157 infection from the consumption of lightly pickled vegetables, indicating the necessity of imposing hygienic controls during manufacturing. However, little is known about the bacterial contamination levels in these minimally processed vegetables. Here we examined the prevalence of STEC, Salmonella spp., and Listeria monocytogenes in 100 lightly pickled vegetable products manufactured at 55 processing factories. Simultaneously, we also performed quantitative measurements of representative indicator bacteria (total viable counts, coliform counts, and β-glucuronidase-producing E. coli counts). STEC and Salmonella spp. were not detected in any of the samples; L. monocytogenes was detected in 12 samples manufactured at five of the factories. Microbiological surveillance at two factories (two surveys at factory A and three surveys at factory B) between June 2014 and January 2015 determined that the areas predominantly contaminated with L. monocytogenes included the refrigerators and packaging rooms. Genotyping provided further evidence that the contaminants found in these areas were linked to those found in the final products. Taken together, we demonstrated the prevalence of L. monocytogenes in lightly pickled vegetables sold at the retail level. Microbiological surveillance at the manufacturing factories further clarified the sources of the contamination in the retail products. These data indicate the necessity of implementing adequate monitoring programs to minimize health risks attributable to the consumption of these minimally processed vegetables.
Frequency of contamination Listeria monocytogenes of raw dried cured vacuum packed sausages
Directory of Open Access Journals (Sweden)
Hristo Daskalov
2014-03-01
Full Text Available The aim of this study was to collect actual data concerning the frequency of contamination with Listeria monocytogenes of some very popular in Bulgaria raw dried cured vacuum packed sausages, produced from October 2004 till May 2008. 148 vacuum-packed samples were taken from 9 different food business operators during all seasons of the year. The samples were analyzed according to USDA method for meat foods. Ten specimens were positive for presence of Listeria monocytogenes equal to 6,75% of all tested samples. In two other raw dried cured sausages L.welshimeri and L.innocua were found, but these species are not pathogenic for consumers. In the period before the official implementation of HACCP system (01.01.2006 in Bulgaria, 52 samples were examined and 5 Listeria monocytogenes isolates were found (~10%. 2,5 years after the HACCP implementation, 96 specimens from the same meat factories were tested and 5 Listeria monocytogenes isolates (5,2% were detected. Samples taken from lots, produced in winter time were contaminated with Listeria monocytogenes more often (7 of all 10 than specimens taken during other seasons. Data were discussed through the point of view of the effectiveness of hygienic practices and HACCP system application. Also, application of ‘microbiological criterion’ set in COMMISSION REGULATION (EC No 2073/2005 for ready-to-eat foods unable to support the growth of L. monocytogenes was considered.
Directory of Open Access Journals (Sweden)
Trajković-Pavlović Ljiljana
2010-01-01
Full Text Available Background/Aim. According to the literature that has been published over the last two decades Campylobacter spp i Listeria monocitogens can be identified as causes of numerous diseases derived by consuming food of animal origin. The purpose of this paper was to find out how established national microbiological criteria of the Republic of Serbia on food safety in retailed food of animal origin could contribute to consumer's protection against exposition to foodborne pathogens such as Campylobacter spp. and Listeria monocytogenes. Methods. During a routine microbiological safety control of randomly selected 60 samples of fresh poultry meat, 30 samples of other fresh meat readymade for grilling, 30 samples of sausage products, 37 samples of heattreated meat, 39 samples of toppings for fast food of animal origin and 31 samples of dairy products a national food safety criteria (Escherichia coli, aerobic plate count, Salmonella spp., coagulasa positive Staphylococcus, Proteus spp., sulphitoreducting Clostridia were applied and, as well as, testing to Campylobacter spp. and Listeria monocitogens. In determination of Campylobacter spp. and Listeria monocytogenes, food quality control methods of the Food and Agriculture Organization (FAO were applied, while in determination of the other above motioned bacteria, national provisions on microbiological methods were applied who are adjusted to the FAO ones. Results. Related to the national criteria on microbiological food safety, 88 (38.8% samples, out of the total 227 tested, were rejected. When to these results, the results of laboratory tests on Listeria monocytogens were added, a terminal number of rejected samples were not changed. When to these results, the results of Campylobacter spp. testing were added, 91 (40.1% out of the 227 samples were unsatisfied. Results of logistic regression model with occurrence of Escherichia coli as dependent variable indicated that Escherichia coli was 4.5 times likely
Trajković-Pavlović, Ljiljana; Novaković, Budimka; Martinov-Cvejin, Mirjana; Gusman, Vera; Bijelović, Sanja; Dragnić, Natasa; Balać, Dragana
2010-08-01
According to the literature that has been published over the last two decades Campylobacter spp i Listeria monocitogens can be identified as causes of numerous diseases derived by consuming food of animal origin. The purpose of this paper was to find out how established national microbiological criteria of the Republic of Serbia on food safety in retailed food of animal origin could contribute to consumer's protection against exposition to foodborne pathogens such as Campylobacter spp. and Listeria monocytogenes. During a routine microbiological safety control of randomly selected 60 samples of fresh poultry meat, 30 samples of other fresh meat readymade for grilling, 30 samples of sausage products, 37 samples of heat-treated meat, 39 samples of toppings for fast food of animal origin and 31 samples of dairy products a national food safety criteria (Escherichia coli, aerobic plate count, Salmonella spp., coagulasa positive Staphylococcus, Proteus spp., sulphito-reducting Clostridia) were applied and, as well as, testing to Campylobacter spp. and Listeria monocitogens. In determination of Campylobacter spp. and Listeria monocytogenes, food quality control methods of the Food and Agriculture Organization (FAO) were applied, while in determination of the other above motioned bacteria, national provisions on microbiological methods were applied who are adjusted to the FAO ones. Related to the national criteria on microbiological food safety, 88 (38.8%) samples, out of the total 227 tested, were rejected. When to these results, the results of laboratory tests on Listeria monocytogens were added, a terminal number of rejected samples were not changed. When to these results, the results of Campylobacter spp. testing were added, 91 (40.1%) out of the 227 samples were unsatisfied. Results of logistic regression model with occurrence of Escherichia coli as dependent variable indicated that Escherichia coli was 4.5 times likely to occur among samples with Campylobacter spp
Glycerol metabolism induces Listeria monocytogenes biofilm formation at the air-liquid interface.
Crespo Tapia, Natalia; den Besten, Heidy M W; Abee, Tjakko
2018-05-20
Listeria monocytogenes is a food-borne pathogen that can grow as a biofilm on surfaces. Biofilm formation in food-processing environments is a big concern for food safety, as it can cause product contamination through the food-processing line. Although motile aerobic bacteria have been described to form biofilms at the air-liquid interface of cell cultures, to our knowledge, this type of biofilm has not been described in L. monocytogenes before. In this study we report L. monocytogenes biofilm formation at the air-liquid interface of aerobically grown cultures, and that this phenotype is specifically induced when the media is supplemented with glycerol as a carbon and energy source. Planktonic growth, metabolic activity assays and HPLC measurements of glycerol consumption over time showed that glycerol utilization in L. monocytogenes is restricted to growth under aerobic conditions. Gene expression analysis showed that genes encoding the glycerol transporter GlpF, the glycerol kinase GlpK and the glycerol 3-phosphate dehydrogenase GlpD were upregulated in the presence of oxygen, and downregulated in absence of oxygen. Additionally, motility assays revealed the induction of aerotaxis in the presence of glycerol. Our results demonstrate that the formation of biofilms at the air-liquid interface is dependent on glycerol-induced aerotaxis towards the surface of the culture, where L. monocytogenes has access to higher concentrations of oxygen, and is therefore able to utilize this compound as a carbon source. Copyright © 2018 Elsevier B.V. All rights reserved.
Martínez-Gonzáles, N E; Martínez-Chávez, L; Cabrera-Díaz, E; Martínez-Cárdenas, C; Gutiérrez-González, P; Castillo, A
2016-05-01
Polymyxin Ceftazidime Oxford Medium (PCOM), a novel selective and differential plating medium for Listeria monocytogenes was compared with Modified Oxford Agar (MOX) for efficacy to isolate L. monocytogenes and other Listeria spp. naturally present in non-pasteurized Mexican-style cheese (n = 50), non-pasteurized fresh squeezed orange juice (n = 50), raw beef chunks (n = 36), and fresh cabbage (n = 125). Samples were collected from retail markets and farms in Mexico and tested following the US Department of Agriculture enrichment technique. Listeria spp. were isolated from 23.4% of analyzed samples, and from those, 75.0% corresponded to raw beef chunks, 38.0% to non-pasteurized Mexican-style cheese, and 30.0% to fresh squeezed orange juice. No Listeria spp. were isolated from fresh cabbage samples. L. monocytogenes was recovered from 15.3% of food samples analyzed. Non-pasteurized Mexican-style cheese showed the highest proportion of L. monocytogenes positive samples (36.0%), followed by orange juice (26.0%) and raw beef (25.0%). The frequency of isolation of Listeria spp. and L. monocytogenes was not different (P > 0.05) between PCOM and MOX. The advantages of using PCOM when comparing to MOX, include the easier way to identify Listeria species, the lower cost per plate and the availability of its ingredients for Latin-American countries. Copyright © 2015 Elsevier Ltd. All rights reserved.
Yan, Shao Fei; Wang, Wei; Bai, Li; Hu, Yu Jie; Dong, Yin Ping; Xu, Jin; Li, Feng Qin
2016-06-01
We aimed to investigate the potential pathogenic profile and antibiotic resistance of Listeria monocytogenes isolated from ready-to-eat food in China. Antimicrobial resistance was determined by broth microdilution following the Clinical and Laboratory Standards Institute protocol. Molecular serotyping, virulence, and resistance genes were identified using PCR. Multi-locus sequence typing was performed on resistant strains. A total of 11.53% (113/980) isolates were resistant, from which 82.3% (93/113) harbored all the virulence genes tested. The resistant strains were subtyped into 18 sequence types (STs), from which ST2, ST5, ST8, and ST9 were involved in listeriosis. This study indicated that several L. monocytogenes isolates from ready-to-eat foods in China have pathogenic potential and are resistant to antibiotics, including antibiotics used as medicines by humans for listeriosis treatment. Copyright © 2016 The Editorial Board of Biomedical and Environmental Sciences. Published by China CDC. All rights reserved.
Hingston, Patricia; Chen, Jessica; Dhillon, Bhavjinder K.; Laing, Chad; Bertelli, Claire; Gannon, Victor; Tasara, Taurai; Allen, Kevin; Brinkman, Fiona S. L.; Truelstrup Hansen, Lisbeth; Wang, Siyun
2017-01-01
The human pathogen Listeria monocytogenes is a large concern in the food industry where its continuous detection in food products has caused a string of recalls in North America and Europe. Most recognized for its ability to grow in foods during refrigerated storage, L. monocytogenes can also tolerate several other food-related stresses with some strains possessing higher levels of tolerances than others. The objective of this study was to use a combination of phenotypic analyses and whole genome sequencing to elucidate potential relationships between L. monocytogenes genotypes and food-related stress tolerance phenotypes. To accomplish this, 166 L. monocytogenes isolates were sequenced and evaluated for their ability to grow in cold (4°C), salt (6% NaCl, 25°C), and acid (pH 5, 25°C) stress conditions as well as survive desiccation (33% RH, 20°C). The results revealed that the stress tolerance of L. monocytogenes is associated with serotype, clonal complex (CC), full length inlA profiles, and the presence of a plasmid which was identified in 55% of isolates. Isolates with full length inlA exhibited significantly (p monocytogenes sequence types, a new inlA PMSC, and several connections between CCs and the presence/absence or variations of specific genetic elements. A whole genome single-nucleotide-variants phylogeny revealed sporadic distribution of tolerant isolates and closely related sensitive and tolerant isolates, highlighting that minor genetic differences can influence the stress tolerance of L. monocytogenes. Specifically, a number of cold and desiccation sensitive isolates contained PMSCs in σB regulator genes (rsbS, rsbU, rsbV). Collectively, the results suggest that knowing the sequence type of an isolate in addition to screening for the presence of full-length inlA and a plasmid, could help food processors and food agency investigators determine why certain isolates might be persisting in a food processing environment. Additionally, increased
Piercey, Marta J; Hingston, Patricia A; Truelstrup Hansen, Lisbeth
2016-04-16
Listeria monocytogenes is a pathogenic foodborne bacterium whose persistence in food processing environments is in part attributed to its biofilm formation. Most biofilm studies have been carried out at 30-37 °C rather than at temperatures found in the food processing plants (i.e., 10-20 °C). The objective of the present study was to mine for novel genes that contribute to L. monocytogenes biofilm formation at 15 °C using the random insertional mutagenesis approach. A library of 11,024 L. monocytogenes 568 (serotype 1/2a) Himar1 insertional mutants was created. Mutants with reduced or enhanced biofilm formation at 15 °C were detected in microtiter plate assays with crystal violet and safranin staining. Fourteen mutants expressed enhanced biofilm phenotypes, and harbored transposon insertions in genes encoding cell wall biosynthesis, motility, metabolism, stress response, and cell surface associated proteins. Deficient mutants (n=5) contained interruptions in genes related to peptidoglycan, teichoic acid, or lipoproteins. Enhanced mutants produced significantly (pbiofilm formed on stainless steel (SS) coupons at 15 °C (48 h) than deficient mutants, which were also more sensitive to benzalkonium chloride. All biofilm deficient mutants and four enhanced mutants in the microtiter plate assay (flaA, cheR, lmo2563 and lmo2488) formed no biofilm in a peg lid assay (Calgary biofilm device) while insertions in lmo1224 and lmo0543 led to excess biofilm in all assays. Two enhanced biofilm formers were more resistant to enzymatic removal with DNase, proteinase K or pectinase than the parent strain. Scanning electron microscopy of individual biofilms made by five mutants and the parent on SS surfaces showed formation of heterogeneous biofilm with dense zones by immotile mutants, while deficient mutants exhibited sparse growth. In conclusion, interruptions of 9 genes not previously linked to biofilm formation in L. monocytogenes (lmo2572, lmo2488 (uvrA), lmo1224, lmo0434
Variations in virulence between different electrophoretic types of Listeria monocytogenes
DEFF Research Database (Denmark)
Nørrung, Birgit; Andersen, Jens Kirk
2000-01-01
A total of 245 strains of Listeria monocytogenes, representing 33 different electrophoretic types (ETs), were examined quantitatively for haemolytic activity. No significant difference was observed in the mean haemolytic activity between different ETs. Eighty four out of 91 strains examined were...... compared with 3.64 among food isolates). The explanation for this may be that more virulent strains are more prone to cause human infection. It is, however, also possible that strains oft. monocytogenes may become more virulent while multiplying in a living organism compared with multiplying in foods....
9 CFR 430.4 - Control of Listeria monocytogenes in post-lethality exposed ready-to-eat products.
2010-01-01
... post-lethality exposed ready-to-eat products. 430.4 Section 430.4 Animals and Animal Products FOOD... Control of Listeria monocytogenes in post-lethality exposed ready-to-eat products. (a) Listeria... comes into direct contact with a food contact surface which is contaminated with L. monocytogenes. (b...
COMPARISON OF TWO METHODS FOR THE DETECTION OF LISTERIA MONOCYTOGENES
Directory of Open Access Journals (Sweden)
G. Tantillo
2013-02-01
Full Text Available The aim of this study was to compare the performance of the conventional methods for detection of Listeria monocytogenes in food using media Oxford and ALOA (Agar Listeria acc. to Ottaviani & Agosti in according to the ISO 11290-1 to a new chromogenic medium “CHROMagar Listeria” standardized in 2005 AFNOR ( CHR – 21/1-12/01. A total of 40 pre-packed ready-to-eat food samples were examined. Using two methods six samples were found positive for Listeria monocytogenes but the medium “CHROMagar Listeria” was more selective in comparison with the others. In conclusion this study has demonstrated that isolation medium able to target specifically the detection of L. monocytogenes such as “CHROMagar Listeria” is highly recommendable because of that detection time is significantly reduced and the analysis cost is less expensive.
Palmieri, Gianna; Balestrieri, Marco; Capuano, Federico; Proroga, Yolande T R; Pomilio, Francesco; Centorame, Patrizia; Riccio, Alessia; Marrone, Raffaele; Anastasio, Aniello
2018-08-20
Antimicrobial peptides have received great attention for their potential benefits to extend the shelf-life of food-products. Innate defense regulator peptide-1018 (IDR-1018) represents a promising candidate for such applications, due to its broad-spectrum antimicrobial activity, although food-isolated pathogens have been poorly investigated. Herein, we describe the design and the structural-functional characterization of a new 1018-derivative peptide named 1018-K6, in which the alanine in position 6 was replaced with a lysine. Spectroscopic analysis revealed a noticeable switch from β-sheet to helical conformations of 1018-K6 respect to IDR-1018, with a faster folding kinetic and increased structural stability. Moreover, 1018-K6 evidenced a significant antibiofilm/bactericidal efficiency specifically against Listeria monocytogenes isolates from food-products and food-processing environments, belonging to serotype 4b involved in the majority of human-listeriosis cases, with EC 50 values two- five-fold lower than those measured for IDR-1018. Therefore, a single amino-acid substitution in IDR-1018 sequence produced severe changes in peptide conformation and antimicrobial performances. Published by Elsevier B.V.
Overlevingsstrategieën Listeria monocytogenes bij lage temperatuur
Wemekamp-Kamphuis, H.H.; Abee, T.
2004-01-01
Listeria monocytogenes is an important food-borne pathogen that may cause severe infections in humans. Many outbreaks caused by this organism have been associated with ready-to-eat foods wich may have undergone some form of minimal processing, or have been contaminated after processing. Ready-to-eat
Verheyen, Davy; Bolívar, Araceli; Pérez-Rodríguez, Fernando; Baka, Maria; Skåra, Torstein; Van Impe, Jan F
2018-06-01
Traditionally, predictive growth models for food pathogens are developed based on experiments in broth media, resulting in models which do not incorporate the influence of food microstructure. The use of model systems with various microstructures is a promising concept to get more insight into the influence of food microstructure on microbial dynamics. By means of minimal variation of compositional and physicochemical factors, these model systems can be used to study the isolated effect of certain microstructural aspects on microbial growth, survival and inactivation. In this study, the isolated effect on microbial growth dynamics of Listeria monocytogenes of two food microstructural aspects and one aspect influenced by food microstructure were investigated, i.e., the nature of the food matrix, the presence of fat droplets, and microorganism growth morphology, respectively. To this extent, fish-based model systems with various microstructures were used, i.e., a liquid, a second more viscous liquid system containing xanthan gum, an emulsion, an aqueous gel, and a gelled emulsion. Growth experiments were conducted at 4 and 10 °C, both using homogeneous and surface inoculation (only for the gelled systems). Results regarding the influence of the growth morphology indicated that the lag phase of planktonic cells in the liquid system was similar to the lag phase of submerged colonies in the xanthan system. The lag phase of submerged colonies in each gelled system was considerably longer than the lag phase of surface colonies on these respective systems. The maximum specific growth rate of planktonic cells in the liquid system was significantly lower than for submerged colonies in the xanthan system at 10 °C, while no significant differences were observed at 4 °C. The maximum cell density was higher for submerged colonies than for surface colonies. The nature of the food matrix only exerted an influence on the maximum specific growth rate, which was
The challenge of setting risk-based microbiological criteria for Listeria monocytogenes
DEFF Research Database (Denmark)
Andersen, Jens Kirk; Nørrung, Birgit
2011-01-01
After more than 20 years of work with discussing the setting of microbiological criteria for Listeria monocytogenes in foods, Codex Alimentarius on Food Hygiene has finalised a proposal that was recently adopted by the Codex Alimentarius Commission. The effort of developing procedures for making...... the microbiological criteria risk-based to the greatest extent possible has challenged scientists and managers during this long time period. Yet, the establishment of microbiological criteria for L. monocytogenes is still being discussed and several approaches are possible. Setting of microbiological criteria...
Luchansky, John B; Chen, Yuhuan; Porto-Fett, Anna C S; Pouillot, Régis; Shoyer, Bradley A; Johnson-DeRycke, Rachel; Eblen, Denise R; Hoelzer, Karin; Shaw, William K; van Doren, Jane M; Catlin, Michelle; Lee, Jeehyun; Tikekar, Rohan; Gallagher, Daniel; Lindsay, James A; Dennis, Sherri
2017-06-01
A multiyear interagency Listeria monocytogenes Market Basket Survey was undertaken for selected refrigerated ready-to-eat foods purchased at retail in four FoodNet sites in the United States. Food samples from 16 food categories in six broad groups (seafood, produce, dairy, meat, eggs, and combination foods) were collected weekly at large national chain supermarkets and independent grocery stores in California, Maryland, Connecticut, and Georgia for 100 weeks between December 2010 and March 2013. Of the 27,389 total samples, 116 samples tested positive by the BAX PCR system for L. monocytogenes , and the pathogen was isolated and confirmed for 102 samples. Among the 16 food categories, the proportion of positive samples (i.e., without considering clustering effects) based on recovery of a viable isolate of L. monocytogenes ranged from 0.00% (95% confidence interval: 0.00, 0.18) for the category of soft-ripened and semisoft cheese to 1.07% (0.63, 1.68) for raw cut vegetables. Among the 571 samples that tested positive for Listeria-like organisms, the proportion of positive samples ranged from 0.79% (0.45, 1.28) for soft-ripened and semisoft cheese to 4.76% (2.80, 7.51) for fresh crab meat or sushi. Across all 16 categories, L. monocytogenes contamination was significantly associated with the four states (P < 0.05) but not with the packaging location (prepackaged by the manufacturer versus made and/or packaged in the store), the type of store (national chain versus independent), or the season. Among the 102 samples positive for L. monocytogenes , levels ranged from <0.036 most probable number per g to 6.1 log CFU/g. For delicatessen (deli) meats, smoked seafood, seafood salads, soft-ripened and semisoft cheeses, and deli-type salads without meat, the percentage of positive samples was significantly lower (P < 0.001) in this survey than that reported a decade ago based on comparable surveys in the United States. Use of mixed logistic regression models to address
Liu, Xiaoji; Basu, Urmila; Miller, Petr; McMullen, Lynn M
2017-05-01
This study reports the gene expression and filamentation in Listeria monocytogenes 08-5923 following exposure to food preservatives sodium lactate (NaL) and sodium diacetate (SD). L. monocytogenes 08-5923 was challenged with a mixture of NaL/SD, NaL or sodium acetate at 37 °C in tryptic soy broth. In the initial study, L. monocytogenes 08-5923 was exposed to NaL/SD for 24 h. The transcriptome was investigated by RNA sequencing. A stress response network was discovered in L. monocytogenes 08-5923, which is mediated by genes encoding two-component systems (hisJ, lisK, OmpR family gene, resE) and RNA polymerase factors (sigC, sigH). NaL/SD resulted in the down-regulation of genes in glycolysis (pykA, eno, fbaA, pgm) and up-regulation of genes in DNA repair (radC), cell division (ftsE) and cell structure synthesis (flagella synthesis: flgK, fliF, fliD). Filamentation was monitored by flow cytometry. NaL/SD mixture resulted in filamentation in L. monocytogenes 08-5923. Longer exposure was required to induce filamentation in L. monocytogenes for SD (24 h) than for NaL (8 h) when cells were exposed to individual salt. The quantitative real time PCR analysis revealed the down-regulation of ftsE in filamented cells of Listeria exposed to NaL or sodium acetate. Copyright © 2016 Elsevier Ltd. All rights reserved.
Dailey, Rachel C; Welch, Lacinda J; Hitchins, Anthony D; Smiley, R Derike
2015-04-01
The presence of multiple species of Listeria in regulated food products is not uncommon and can complicate the recovery of Listeria monocytogenes particularly on a non-differentiating medium. The potential complications of Listeria seeligeri and Listeria welshimeri on the recovery of L. monocytogenes from inoculated food test samples using the U.S. Food and Drug Administration's (FDA) selective enrichment procedure was investigated. Post-enrichment enumeration, in the absence of food product, indicates that some L. seeligeri and L. monocytogenes pairings may have population differentials as great as 2.7 ± 0.1 logs with L. seeligeri being the predominant species. A similar observation was noted for L. welshimeri and L. monocytogenes pairings which resulted in population differentials as large as 3.7 ± 0.2 logs with L. welshimeri being the predominant species. Select strain pairings were used to inoculate guacamole, crab meat, broccoli, and cheese with subsequent recovery by the FDA Bacteriological Analytical Manual (BAM) method with 10 colonies per sample selected for confirmation. The presence of L. seeligeri had little effect on the recovery of L. monocytogenes. The presence of L. welshimeri resulted in the failure to recover L. monocytogenes in three out of the four food matrices. This work extends the observation that non-pathogenic species of Listeria can complicate the recovery of L. monocytogenes and that competition during selective enrichment is not limited to the presence of just Listeria innocua. Published by Elsevier Ltd.
Dailey, Rachel C.; Welch, Lacinda J.; Hitchins, Anthony D.; Smiley, R. Derike
2016-01-01
The presence of multiple species of Listeria in regulated food products is not uncommon and can complicate the recovery of Listeria monocytogenes particularly on a non-differentiating medium. The potential complications of Listeria seeligeri and Listeria welshimeri on the recovery of L. monocytogenes from inoculated food test samples using the U.S. Food and Drug Administration's (FDA) selective enrichment procedure was investigated. Post-enrichment enumeration, in the absence of food product, indicates that some L. seeligeri and L. monocytogenes pairings may have population differentials as great as 2.7 ± 0.1 logs with L. seeligeri being the predominant species. A similar observation was noted for L. welshimeri and L. monocytogenes pairings which resulted in population differentials as large as 3.7 ± 0.2 logs with L. welshimeri being the predominant species. Select strain pairings were used to inoculate guacamole, crab meat, broccoli, and cheese with subsequent recovery by the FDA Bacteriological Analytical Manual (BAM) method with 10 colonies per sample selected for confirmation. The presence of L. seeligeri had little effect on the recovery of L. monocytogenes. The presence of L. welshimeri resulted in the failure to recover L. monocytogenes in three out of the four food matrices. This work extends the observation that non-pathogenic species of Listeria can complicate the recovery of L. monocytogenes and that competition during selective enrichment is not limited to the presence of just Listeria innocua. PMID:25475325
International Nuclear Information System (INIS)
Saito, I.
2014-01-01
May 11th 2011, nuclear accidents occurred by Tohoku Region Pacific Coast Earthquake made radioisotopes overflow in reactors and spread around the environments, and it caused risk of food contamination in these areas. And May 17th 2011, Ministry of Health, Labour and Welfare Japan announced provisional regulation values of radioactive materials in food in accordance with the food sanitation act. And they had notified the municipality to corresponding foods above the provisional regulation not had to be on sale. It causes massive needs for food monitoring in Japan. For reply to these massive needs, Hitachi Aloka Medical Ltd. commercialized food monitor: CAN-OSP-NAI in cooperation with CANBERRA Industries Inc. And after this, commercialized food screening system: FSS-101 for reply more expand food monitoring in Japan. This paper introduce Hitachi Aloka Medical Ltd. products which two types of food monitor product, provisional regulation values of radioactive materials in food in accordance with the food sanitation act and with comparing with past food monitoring, needs when accident happen. I wish this is going to be good report for help to radioactive and radiation detection in the future. (author)
Veen, van der S.; Abee, T.
2010-01-01
The food-borne pathogen Listeria monocytogenes is able to form biofilms in food processing environments. Since biofilms are generally difficult to eradicate during clean-up procedures, they pose a major risk for the food industry. Stress resistance mechanisms involved in L. monocytogenes biofilm
Pathogenic potential of Listeria monocytogenes isolated from cattle ...
African Journals Online (AJOL)
Listeria monocytogenes is an opportunistic food-borne pathogen causing listeriosis especially among immune-compromised persons. Its high rate of morbidity and mortality has classed the organism among the top watch list in foods. It is known to produce several virulence factors which aid its survival in harsh conditions ...
Directory of Open Access Journals (Sweden)
Annaleise Wilson
2018-02-01
Full Text Available The current global crisis of antimicrobial resistance (AMR among important human bacterial pathogens has been amplified by an increased resistance prevalence. In recent years, a number of studies have reported higher resistance levels among Listeria monocytogenes isolates, which may have implications for treatment of listeriosis infection where resistance to key treatment antimicrobials is noted. This study examined the genotypic and phenotypic AMR patterns of 100 L. monocytogenes isolates originating from food production supplies in Australia and examined this in the context of global population trends. Low levels of resistance were noted to ciprofloxacin (2% and erythromycin (1%; however, no resistance was observed to penicillin G or tetracycline. Resistance to ciprofloxacin was associated with a mutation in the fepR gene in one isolate; however, no genetic basis for resistance in the other isolate was identified. Resistance to erythromycin was correlated with the presence of the ermB resistance gene. Both resistant isolates belonged to clonal complex 1 (CC1, and analysis of these in the context of global CC1 isolates suggested that they were more similar to isolates from India rather than the other CC1 isolates included in this study. This study provides baseline AMR data for L. monocytogenes isolated in Australia, identifies key genetic markers underlying this resistance, and highlights the need for global molecular surveillance of resistance patterns to maintain control over the potential dissemination of AMR isolates.
Prevalence of Listeria monocytogenes in raw milk in North Lebanon
International Nuclear Information System (INIS)
Al Kassaa, I; El Omari, Kh.; Esmail, B.; Hamze, M; Saati, M.
2016-01-01
Listeriosis, although a zoonosis, is an invasive disease that can affect newborns, pregnant women and immunocompromised adults. Clinical manifestations can be expressedby febrile gastroenteritis, invasive forms including severe sepsis, meningitis, rhombencephalitis, prenatal infections and abortions. Species of Listeria bacteria are ubiquitous and adaptableto the environment in animal and plant foods. This study aimed to determine the prevalence of Listeria monocytogenes in 100 samples of fresh cow milk collected from different areas of North Lebanon. Listeria monocytogenes was detected by using the Grand VIDAS technique (Biomérieux France). The results obtained revealed the absence of Listeria monocytogenes inall analyzed samples. (Author)
Directory of Open Access Journals (Sweden)
Angela Maria Cardoso Bernal
2013-08-01
Full Text Available The reporting of L. monocytogenes in food in Colombia is not a mandatory; however, foods considered high-risk are monitored, and the organism is only reported clinically as Gram-positive when it causes meningitis. L. monocytogenes is a foodborne, intracellular, pathogen which causes listeriosis, a disease lethal to humans and animals. Outbreaks of this disease worldwide can bring about human and economic losses. Only a few studies in Colombia have been able to identify and molecularly serotype isolates allowing only the theoretical distribution of serotypes by lineage. This review explains the characteristics of the pathogen, its importance in public health and in the food industry, and provides an overview of PFGE-CHEF; identifying the standard work protocol and the appropriate restriction enzymes to cut DNA. We found that the enzyme combination, XbaI-AscI, followed by ApaI offers the best results to differentiate isolates, by grouping them by lineages, and displaying intra-serotype variations. Additionally, we found that in several Latin American countries the results are analyzed using PulseNet; this ensures the comparison of PFGE patterns in equivalent conditions.
Henriques, A R; Cristino, J Melo; Fraqueza, M J
2017-04-01
Listeria monocytogenes isolates (n = 81) recovered from ready-to-eat meat-based food products (RTEMP) collected in industrial processing plants and retail establishments were genetically characterized for comparison with those from human clinical cases of listeriosis (n = 49). The aim was to assess RTEMP as a possible food source for human infection. L. monocytogenes was detected in 12.5% of the RTEMP samples, and in some cases, counts were above the European food safety criteria. All isolates were assessed by multiplex PCR for serogroup determination and detection of virulence-associated genes inlA, inlB, inlC, inlJ, plcA, hlyA, actA, and iap. Serogroups IIb and IVb dominated in RTEMP and human isolates, and all were positive for the assessed virulence genes. Antibiotic susceptibility testing by the disk diffusion method revealed a low level of resistance among the isolates. Pulsed-field gel electrophoresis (PFGE) of L. monocytogenes isolates, using restriction enzymes ApaI and AscI, revealed genetic variability and differentiated the isolates in five clusters. Although some pulsed-field gel electrophoresis profiles of particular RTEMP and human isolates seemed to be highly related, exhibiting more than 90% similarity, which suggests a possible common source, in most cases the strains were not genetically or temporally matched. The close genetic relatedness of RTEMP and human listeriosis strains stressed the importance of preventive measure implementation throughout the food chain.
DEFF Research Database (Denmark)
Roldgaard, Bent; Andersen, Jens Bo; Hansen, Tina Beck
2009-01-01
Three different Listeria monocytogenes strains, LO28 (a laboratory strain with truncated InlA), 4446 (a clinical isolate) and 7291 (a food isolate), were compared in a guinea-pig model designed to mimic food-borne exposure. The objectives were (1) to verify the applicability of the animal model...... for distinguishing between Listeria with different virulence properties and (2) to explore whether it was possible to reduce the required number of animals by dosing with mixed cultures instead of monocultures. Consistent with in vitro observations of infectivity in Caco-2 cells, faecal densities and presence...... of Listeria strains gave similar results as dosage with a mixture of the three strains; thus, the mixed infection approach was a feasible way to reduce the number of animals needed for determination of listerial virulence....
Gormley, F J; Little, C L; Grant, K A; de Pinna, E; McLauchlin, J
2010-04-01
From 2359 specialty meats (continental sausages, cured/fermented, dried meats) sampled from markets and specialty food shops, 98.9% of samples were of satisfactory or acceptable microbiological quality. However, 16 (0.7%) were unsatisfactory as a result of Escherichia coli, Staphylococcus aureus or Listeria spp. contamination (>or=10(2) CFU/g), and nine (0.4%) were unacceptable due to presence of Salmonella spp. or Listeria monocytogenes (>10(2) CFU/g). Meats with unacceptable levels of L. monocytogenes were within shelf life (range: 8-143 days remaining). Nine different subtypes of L. monocytogenes were detected with sero/AFLP type 1/2c VII predominating (37%), although this subtype was not overrepresented in any particular meat type (P > 0.05). Ninety-six percent of continental sausages and cured/fermented products were stored at potential for L. monocytogenes to be present at levels hazardous to health at the point of sale.
Simmons, Courtenay; Stasiewicz, Matthew J; Wright, Emily; Warchocki, Steven; Roof, Sherry; Kause, Janell R; Bauer, Nathan; Ibrahim, Salam; Wiedmann, Martin; Oliver, Haley F
2014-11-01
Postprocessing contamination in processing plants has historically been a significant source of Listeria monocytogenes in ready-to-eat delicatessen meats, and therefore a major cause of human listeriosis cases and outbreaks. Recent risk assessments suggest that a majority of human listeriosis cases linked to consumption of contaminated deli meats may be due to L. monocytogenes contamination that occurs at the retail level. To better understand the ecology and transmission of Listeria spp. in retail delicatessens, food and nonfood contact surfaces were tested for L. monocytogenes and other Listeria spp. in a longitudinal study conducted in 30 retail delis in three U.S. states. In phase I of the study, seven sponge samples were collected monthly for 3 months in 15 delis (5 delis per state) prior to start of daily operation; in phase II, 28 food contact and nonfood contact sites were sampled in each of 30 delis during daily operation for 6 months. Among the 314 samples collected during phase I, 6.8% were positive for L. monocytogenes. Among 4,503 samples collected during phase II, 9.5% were positive for L. monocytogenes; 9 of 30 delis showed low L. monocytogenes prevalence (Listeria spp. isolates, including 184 Listeria innocua, 48 Listeria seeligeri, and 13 Listeria welshimeri were characterized. Pulsed-field gel electrophoresis (PFGE) was used to characterize 446 L. monocytogenes isolates. PFGE showed that for 12 of 30 delis, one or more PFGE types were isolated on at least three separate occasions, providing evidence for persistence of a given L. monocytogenes subtype in the delis. For some delis, PFGE patterns for isolates from nonfood contact surfaces were distinct from patterns for occasional food contact surface isolates, suggesting limited cross-contamination between these sites in some delis. This study provides longitudinal data on L. monocytogenes contamination patterns in retail delis, which should facilitate further development of control strategies in
Directory of Open Access Journals (Sweden)
Lorraine Anne Draper
2016-11-01
Full Text Available The burden of foodborne disease has large economic and social consequences worldwide. Despite strict regulations, a number of pathogens persist within the food environment, which is greatly contributed to by a build-up of resistance mechanisms and also through the formation of biofilms. Biofilms have been shown to be highly resistant to a number of antimicrobials and can be extremely difficult to remove once they are established. In parallel, the growing concern of consumers regarding the use of chemically derived antimicrobials within food has led to a drive towards more natural products. As a consequence, the use of naturally derived antimicrobials has become of particular interest. In this study we investigated the efficacy of nisin A and its bioengineered derivative M21A in combination with food grade additives to treat biofilms of a representative strain of Listeria monocytogenes. Investigations revealed the enhanced antimicrobial effects, in liquid culture, of M21A in combination with citric acid or cinnamaldehyde over its wild type nisin A counterpart. Subsequently, an investigation was conducted into the effects of these combinations on an established biofilm of the same strain. Nisin M21A (0.1 µg/ml alone or in combination with cinnamaldehyde (35 µg/ml or citric acid (175 µg/ml performed significantly better than combinations involving nisin A. All combinations of M21A with either citric acid or cinnamaldehyde eradicated the L. monocytogenes biofilm (in relation to a non-biofilm control. We conclude that M21A in combination with available food additives could further enhance the antimicrobial treatment of biofilms within the food industry, simply by substituting nisin A with M21A in current commercial products such as Nisaplin (Danisco, DuPont.
Ceyssens, P. J.; Yde, M.; Dierick, K.; Boyen, F.; Vanderpas, J.; Vanhoof, R.; Mattheus, W.
2016-01-01
Listeriosis is a rare but severe disease, mainly caused by Listeria monocytogenes. This study shows the results of the laboratory-based surveillance of Listeriosis in Belgium over the period 1985–2014. Besides the incidence and some demographic data we present also more detailed microbiological and molecular characteristics of human strains isolated since 2000. The strains from the latter period were compared to food and animal strains from the same period. Our study shows that different food matrices were commonly contaminated with L. monocytogenes presenting the same PFGE profile as in patient’s isolates. Since 1985, we observed a significant decrease in incidence of the Materno-Neonatal cases (from 0.15 to 0.04 cases /100,000 inhabitants-year), which is probably to be attributed to active prevention campaigns targeting pregnant women. Despite the strengthening of different control measures by the food industry, the incidence of non-Materno-Neonatal listeriosis increased in Belgium (from 0.3 to 0.7 cases /100,000 inhabitants-year), probably due to the rise of highly susceptible patients in an aging population. This significant increase found in non-Materno-Neonatal cases (slope coefficient 7.42%/year, Pmonocytogenes isolates, a trend to increasing MIC values is evident with chloramphenicol, amoxicillin, tetracycline and ciprofloxacin. We show that fluoroquinolone resistance is not linked to chromosomal mutations, but caused by a variety of efflux pumps. Our study also shows that huge majority of known underlying pathologies (426 out of 785 cases) were cancers (185/426, 43.1%) and haematological malignancies (75/185, 40.5%). Moreover the risk population is susceptible to low levels of contamination in food stressing the need of prevention campaigns specifically targeting these persons. PMID:27723768
Listeria monocytogenes plays a significant role in human food-borne disease caused by eating food contaminated with the bacterium and although incidence is low it is a leading cause of life-threatening, bacterial food-borne disease in humans. L. monocytogenes serotypes 1/2a and 4b can form mixed-cu...
Incorporation of Listeria monocytogenes strains in raw milk biofilms.
Weiler, Christiane; Ifland, Andrea; Naumann, Annette; Kleta, Sylvia; Noll, Matthias
2013-02-01
Biofilms develop successively on devices of milk production without sufficient cleaning and originate from the microbial community of raw milk. The established biofilm matrices enable incorporation of pathogens like Listeria monocytogenes, which can cause a continuous contamination of food processing plants. L. monocytogenes is frequently found in raw milk and non-pasteurized raw milk products and as part of a biofilm community in milk meters and bulk milk tanks. The aim of this study was to analyze whether different L. monocytogenes strains are interacting with the microbial community of raw milk in terms of biofilm formation in the same manner, and to identify at which stage of biofilm formation a selected L. monocytogenes strain settles best. Bacterial community structure and composition of biofilms were analyzed by a cloning and sequencing approach and terminal restriction fragment length polymorphism analysis (T-RFLP) based on the bacterial 16S rRNA gene. The chemical composition of biofilms was analyzed by Fourier transform infrared spectroscopy (FTIR), while settled L. monocytogenes cells were quantified by fluorescence in situ hybridization (FISH). Addition of individual L. monocytogenes strains to raw milk caused significant shifts in the biofilm biomass, in the chemical as well as in the bacterial community composition. Biofilm formation and attachment of L. monocytogenes cells were not serotype but strain specific. However, the added L. monocytogenes strains were not abundant since mainly members of the genera Citrobacter and Lactococcus dominated the bacterial biofilm community. Overall, added L. monocytogenes strains led to a highly competitive interaction with the raw milk community and triggered alterations in biofilm formation. Copyright © 2012 Elsevier B.V. All rights reserved.
Vongkamjan, Kitiya; Fuangpaiboon, Janejira; Turner, Matthew P; Vuddhakul, Varaporn
2016-02-01
Listeriosis outbreaks have been associated with a variety of foods. This study investigated the prevalence and diversity of Listeria monocytogenes and Listeria spp. in ready-to-eat (RTE) products and evaluated the performance of a rapid detection method, the 3M molecular detection assay for L. monocytogenes (MDA-LM), for detection of L. monocytogenes. Assay results were compared with those obtained using the U.S. Food and Drug Administration standard culture method described in the Bacteriological Analytical Manual. Products (n = 200) were purchased from retail stores: 122 aquatic products, 22 products of animal origin, 18 vegetarian products, 15 deli meat products, 13 salad and vegetable products, 4 desserts, 2 egg-based products, and 4 other products. L. monocytogenes prevalence was comparable with both methods. Overall, 15 (7.5%) of 200 samples were positive for L. monocytogenes: 3% of aquatic products, 1.5% of products of animal origin, 1% of vegetarian products, and 2% of deli meat products. Compared with the standard culture method, the sensitivity, specificity, and the accuracy of the MDA-LM were 86.7% (95% confidence interval, 58.4 to 97.7%), 98.4% (95% confidence interval, 95.0 to 99.6%), and 97.5%, respectively. Using the culture-based method, 18 (9%) of 200 samples were positive for Listeria species other than L. monocytogenes. Listeria isolates from these samples were classified into nine allelic types (ATs). The majority of isolates were classified as ATs 58 and 74, which were identified as L. monocytogenes lineages I and IV, respectively. Listeria innocua and Listeria welshimeri also were represented by isolates of multiple ATs. The MDA-LM is a rapid and reliable technique for detecting L. monocytogenes in various RTE foods. Further study is needed to develop effective control strategies to reduce L. monocytogenes contamination in RTE foods.
Directory of Open Access Journals (Sweden)
E. Oliverio
2012-08-01
Full Text Available The study provides data on the prevalence of Listeria monocytogenes in ready-to-eat food samples collected by Lombardy region health authorities and analyzed by Department of Food Microbiology, Istituto Zooprofilattico Sperimentale della Lombardia e dell’Emilia Romagna. From the total of 503 food samples analyzed, the pathogen was detected in 85 (16,9%. In particular it was highlighted in 8/152 (5,3% meat products, in 5/245 (2% dairy products and in 42/106 (39,6% fishery products. Given the considerable public health implications, the study confirms that a well-planned program of listeriosis surveillance should be enforced to suitably estimate the burden of disease and to prevent foodborne outbreaks.
Dual-species biofilm of Listeria monocytogenes and Escherichia coli on stainless steel surface.
de Grandi, Aline Zago; Pinto, Uelinton Manoel; Destro, Maria Teresa
2018-04-12
Listeria monocytogenes is a Gram-positive bacterium commonly associated with foodborne diseases. Due its ability to survive under adverse environmental conditions and to form biofilm, this bacterium is a major concern for the food industry, since it can compromise sanitation procedures and increase the risk of post-processing contamination. Little is known about the interaction between L. monocytogenes and Gram-negative bacteria on biofilm formation. Thus, in order to evaluate this interaction, Escherichia coli and L. monocytogenes were tested for their ability to form biofilms together or in monoculture. We also aimed to evaluate the ability of L. monocytogenes 1/2a and its isogenic mutant strain (ΔprfA ΔsigB) to form biofilm in the presence of E. coli. We assessed the importance of the virulence regulators, PrfA and σ B , in this process since they are involved in many aspects of L. monocytogenes pathogenicity. Biofilm formation was assessed using stainless steel AISI 304 #4 slides immersed into brain heart infusion broth, reconstituted powder milk and E. coli preconditioned medium at 25 °C. Our results indicated that a higher amount of biofilm was formed by the wild type strain of L. monocytogenes than by its isogenic mutant, indicating that prfA and sigB are important for biofilm development, especially maturation under our experimental conditions. The presence of E. coli or its metabolites in preconditioned medium did not influence biofilm formation by L. monocytogenes. Our results confirm the possibility of concomitant biofilm formation by L. monocytogenes and E. coli, two bacteria of major significance in the food industry.
Listeria monocytogenes is a food-borne pathogen of significant threat to public health. High Hydrostatic Pressure (HHP) treatment can be used to control L. monocytogenes in food. The CtsR (class three stress gene repressor) protein negatively regulates the expression of class III heat shock genes....
Listeria monocytogenes in Fresh Produce: Outbreaks, Prevalence and Contamination Levels
Directory of Open Access Journals (Sweden)
Qi Zhu
2017-03-01
Full Text Available Listeria monocytogenes, a member of the genus Listeria, is widely distributed in agricultural environments, such as soil, manure and water. This organism is a recognized foodborne pathogenic bacterium that causes many diseases, from mild gastroenteritis to severe blood and/or central nervous system infections, as well as abortion in pregnant women. Generally, processed ready-to-eat and cold-stored meat and dairy products are considered high-risk foods for L. monocytogenes infections that cause human illness (listeriosis. However, recently, several listeriosis outbreaks have been linked to fresh produce contamination around the world. Additionally, many studies have detected L. monocytogenes in fresh produce samples and even in some minimally processed vegetables. Thus L. monocytogenes may contaminate fresh produce if present in the growing environment (soil and water. Prevention of biofilm formation is an important control measure to reduce the prevalence and survival of L. monocytogenes in growing environments and on fresh produce. This article specifically focuses on fresh produce–associated listeriosis outbreaks, prevalence in growing environments, contamination levels of fresh produce, and associated fresh produce safety challenges.
Day, J B; Basavanna, U
2015-01-01
To develop a rapid detection procedure for Listeria monocytogenes in infant formula and lettuce using a macrophage-based enrichment protocol and real-time PCR. A macrophage cell culture system was employed for the isolation and enrichment of L. monocytogenes from infant formula and lettuce for subsequent identification using real-time PCR. Macrophage monolayers were exposed to infant formula and lettuce contaminated with a serial dilution series of L. monocytogenes. As few as approx. 10 CFU ml(-1) or g(-1) of L. monocytogenes were detected in infant formula and lettuce after 16 h postinfection by real-time PCR. Internal positive PCR controls were utilized to eliminate the possibility of false-negative results. Co-inoculation with Listeria innocua did not reduce the L. monocytogenes detection sensitivity. Intracellular L. monocytogenes could also be isolated on Listeria selective media from infected macrophage lysates for subsequent confirmation. The detection method is highly sensitive and specific for L. monocytogenes in infant formula and lettuce and establishes a rapid identification time of 20 and 48 h for presumptive and confirmatory identification, respectively. The method is a promising alternative to many currently used q-PCR detection methods which employ traditional selective media for enrichment of contaminated food samples. Macrophage enrichment of L. monocytogenes eliminates PCR inhibitory food elements and contaminating food microflora which produce cleaner samples that increase the rapidity and sensitivity of detection. Published 2014. This article is a U.S. Government work and is in the public domain in the USA.
Short-term genome evolution of Listeria monocytogenes in a non-controlled environment
Directory of Open Access Journals (Sweden)
Ivy Reid A
2008-11-01
Full Text Available Abstract Background While increasing data on bacterial evolution in controlled environments are available, our understanding of bacterial genome evolution in natural environments is limited. We thus performed full genome analyses on four Listeria monocytogenes, including human and food isolates from both a 1988 case of sporadic listeriosis and a 2000 listeriosis outbreak, which had been linked to contaminated food from a single processing facility. All four isolates had been shown to have identical subtypes, suggesting that a specific L. monocytogenes strain persisted in this processing plant over at least 12 years. While a genome sequence for the 1988 food isolate has been reported, we sequenced the genomes of the 1988 human isolate as well as a human and a food isolate from the 2000 outbreak to allow for comparative genome analyses. Results The two L. monocytogenes isolates from 1988 and the two isolates from 2000 had highly similar genome backbone sequences with very few single nucleotide (nt polymorphisms (1 – 8 SNPs/isolate; confirmed by re-sequencing. While no genome rearrangements were identified in the backbone genome of the four isolates, a 42 kb prophage inserted in the chromosomal comK gene showed evidence for major genome rearrangements. The human-food isolate pair from each 1988 and 2000 had identical prophage sequence; however, there were significant differences in the prophage sequences between the 1988 and 2000 isolates. Diversification of this prophage appears to have been caused by multiple homologous recombination events or possibly prophage replacement. In addition, only the 2000 human isolate contained a plasmid, suggesting plasmid loss or acquisition events. Surprisingly, besides the polymorphisms found in the comK prophage, a single SNP in the tRNA Thr-4 prophage represents the only SNP that differentiates the 1988 isolates from the 2000 isolates. Conclusion Our data support the hypothesis that the 2000 human listeriosis
Occurrence and antimicrobial resistance patterns of Listeria monocytogenes isolated from vegetables
Directory of Open Access Journals (Sweden)
Vanessa de Vasconcelos Byrne
2016-06-01
Full Text Available Abstract Although the consumption of fresh and minimally processed vegetables is considered healthy, outbreaks related to the contamination of these products are frequently reported. Among the food-borne pathogens that contaminate vegetables is Listeria monocytogenes, a ubiquitous organism that exhibits the ability to survive and multiply at refrigerated temperatures. This study aimed to evaluate the occurrence of L. monocytogenes in vegetables as well as the antimicrobial resistance of isolates. The results showed that 3.03% of samples were contaminated with L. monocytogenes, comprising 2.22% of raw vegetables and 5.56% of ready-to-eat vegetables. Multiplex PCR confirmed the virulence potential of the isolates. Antimicrobial resistance profiling showed that 50% of the isolates were susceptible to the antibiotics used. The resistance of one isolate to penicillin G, a commonly employed therapeutic agent, and the presence of serotype 4b, a serotype commonly associated with food-borne outbreaks, could be potential health hazards for consumers.
Occurrence and antimicrobial resistance patterns of Listeria monocytogenes isolated from vegetables
Byrne,Vanessa de Vasconcelos; Hofer,Ernesto; Vallim,Deyse Christina; Almeida,Rogeria Comastri de Castro
2016-01-01
Abstract Although the consumption of fresh and minimally processed vegetables is considered healthy, outbreaks related to the contamination of these products are frequently reported. Among the food-borne pathogens that contaminate vegetables is Listeria monocytogenes, a ubiquitous organism that exhibits the ability to survive and multiply at refrigerated temperatures. This study aimed to evaluate the occurrence of L. monocytogenes in vegetables as well as the antimicrobial resistance of isola...
Listeria monocytogenes, a well-described cause of encephalitis and abortion in ruminants and of food-borne illness in humans, is rarely associated with disease in companion animals. A case of urinary tract infection associated with an atypical, weakly hemolytic L. monocytogenes strain is described i...
A multi-year Interagency Listeria monocytogenes Market Basket Survey (Lm MBS) was undertaken for selected categories of refrigerated ready-to eat (RTE) foods purchased at retail in four FoodNet sites in the U.S. Eighteen product types were sampled, including RTE seafood, produce, dairy, meat, eggs,...
Stevia rebaudiana Bertoni effect on the hemolytic potential of Listeria monocytogenes.
Sansano, S; Rivas, A; Pina-Pérez, M C; Martinez, A; Rodrigo, D
2017-06-05
The effect of Stevia rebaudiana Bertoni on the hemolytic potential of Listeria monocytogenes was studied by means of the assessment of the Listeriolysin O (LLO) production. The three factors under study, stevia concentration in the range [0-2.5] % (w/v), incubation temperature (10 and 37°C), and exposure time (0-65h) significantly affected (p≤0.05) the hemolytic activity of L. monocytogenes. Results showed that at the lower incubation temperature the hemolytic potential of the bacterium was significantly reduced, from 100% at 37°C to 8% at 10°C (after 65h of incubation) in unsupplemented substrate (0% stevia). Irrespective of the temperature, 10 or 37°C, supplementation of the medium with stevia at 2.5 % (w/v) reduced the bacterium's hemolytic activity by a maximum of 100%. Furthermore, the time of exposure to 2.5 % (w/v) stevia concentration was also a significant factor reducing the hemolytic capability of L. monocytogenes. The possibility of reducing the pathogenic potential of L. monocytogenes (hemolysis) by exposure to stevia should be confirmed in real food matrices, opening a research niche with a valuable future impact on food safety. Copyright © 2017 Elsevier B.V. All rights reserved.
Performance of Isfahan North Wastewater Treatment Plant in the Removal of Listeria monocytogenes
Directory of Open Access Journals (Sweden)
nahid Navijouy
2013-08-01
Full Text Available Listeria and in particular Listeria monocytogenes is considered a ubiquitous foodborne pathogen which can lead listeriosis in human and animals. Listeriosis can be serious and may cause meningitis, septicemia and abortion in pregnant women. Although wastewater or sludge may contaminate foods of plant origin, there are no data on occurrence of Listeria spp. in wastewater and sludge in Iran. The purpose of current investigation was to study the occurrence of Listeria spp. in various samples of wastewater and sludge in Isfahan North wastewater treatment plant. Influent, effluent, raw sludge and dried sludge samples were collected from Isfahan North municipal wastewater treatment plant. L. monocytogenes were enumerated by a three–tube most probable number (MPN assay using enrichment Fraser broth. A total of 65 various samples from five step in 13 visits were collected. The presence of Listeria spp. also was determined using USDA procedure. Then, phenotypically identified L. monocytogenes were further confirmed by Polymerase Chain Reaction amplification. L. monocytogenes isolated from 76.9%, 38.5%, 84.6%, 69.2% and 46.2% of influent, effluent, raw sludge, stabilized sludge and dried sludge respectively. The efficiency of wastewater treatment processes, digester tank and drying bed in removal L. monocytogenes were 69.6%, 64.7% and 73.4% respectively. All phenotypically identified L. monocytogenes were further confirmed by Polymerase Chain Reaction. The results of present study have shown that Listeriaspp. and L. monocytogenes in particular, were present in wastewater treatment plant effluents and sludge at high level. The bacteria may spread on agriculture land and contaminate foods of plant origin. This may cause a risk of spreading disease to human and animals.
Hoelzer, Karin; Sauders, Brian D; Sanchez, Maria D; Olsen, Peter T; Pickett, Michele M; Mangione, Kurt J; Rice, Daniel H; Corby, Joe; Stich, Stephen; Fortes, Esther D; Roof, Sherry E; Grohn, Yrjo T; Wiedmann, Martin; Oliver, Haley F
2011-07-01
Despite growing concerns about cross-contamination of ready-to-eat foods with Listeria monocytogenes, our knowledge about the ecology and transmission of L. monocytogenes in retail establishments has remained limited. We conducted a cross-sectional study to characterize the prevalence, distribution, and subtype diversity of L. monocytogenes in 120 New York State retail deli establishments that were hypothesized to present an increased risk for environmental L. monocytogenes contamination (i.e., small establishments and establishments with a history of failed New York State Agriculture and Markets inspections). Analysis of these data along with previously reported data for 121 predominantly larger retail establishments in New York State identified establishment size, geographic location, and inspection history as significant predictors of L. monocytogenes presence and prevalence. The odds of an establishment being L. monocytogenes positive were approximately twice as high for large establishments, establishments located in New York City, or establishments with poor inspection history (as compared with establishments without these attributes), even though correlation between location and inspection history complicated interpretation of results. Within an establishment, L. monocytogenes was significantly more prevalent on nonfood contact surfaces than on food contact surfaces; prevalence was particularly high for floors and in floor drains, sinks, the dairy case, and milk crates. L. monocytogenes subtype diversity differed between sites, with lineage I isolates significantly associated with nonfood contact surfaces and lineage II isolates significantly associated with food contact surfaces. Isolates belonging to the same ribotype were often found dispersed across multiple sites within an operation. Copyright ©, International Association for Food Protection
Listeria monocytogenes behaviour in presence of non-UV-irradiated titanium dioxide nanoparticles.
Directory of Open Access Journals (Sweden)
Maria Grazia Ammendolia
Full Text Available Listeria monocytogenes is the agent of listeriosis, a food-borne disease. It represents a serious problem for the food industry because of its environmental persistence mainly due to its ability to form biofilm on a variety of surfaces. Microrganisms attached on the surfaces are a potential source of contamination for environment and animals and humans. Titanium dioxide nanoparticles (TiO2 NPs are used in food industry in a variety of products and it was reported that daily exposure to these nanomaterials is very high. Anti-listerial activity of TiO2 NPs was investigated only with UV-irradiated nanomaterials, based on generation of reactive oxigen species (ROS with antibacterial effect after UV exposure. Since both Listeria monocytogenes and TiO2 NPs are veicolated with foods, this study explores the interaction between Listeria monocytogenes and non UV-irradiated TiO2 NPs, with special focus on biofilm formation and intestinal cell interaction. Scanning electron microscopy and quantitative measurements of biofilm mass indicate that NPs influence both production and structural architecture of listerial biofilm. Moreover, TiO2 NPs show to interfere with bacterial interaction to intestinal cells. Increased biofilm production due to TiO2 NPs exposure may favour bacterial survival in environment and its transmission to animal and human hosts.
Animal models for oral transmission of Listeria monocytogenes
Directory of Open Access Journals (Sweden)
Sarah E F D'Orazio
2014-02-01
Full Text Available Listeria monocytogenes has been recognized as a food borne pathogen in humans since the 1980s, but we still understand very little about oral transmission of L. monocytogenes or the host factors that determine susceptibility to gastrointestinal infection, due to the lack of an appropriate small animal model of oral listeriosis. Early feeding trials suggested that many animals were highly resistant to oral infection, and the more reproducible intravenous or intraperitoneal routes of inoculation soon came to be favored. There are a fair number of previously published studies using an oral infection route, but the work varies widely in terms of bacterial strain choice, the methods used for oral transmission, and various manipulations used to enhance infectivity. This mini review will summarize the published literature using oral routes of L. monocytogenes infection and will highlight recent technological advances that have made oral infection a more attractive model system.
Directory of Open Access Journals (Sweden)
Ok Kyung Koo
Full Text Available BACKGROUND: Listeria monocytogenes, an intracellular foodborne pathogen, infects immunocompromised hosts. The primary route of transmission is through contaminated food. In the gastrointestinal tract, it traverses the epithelial barrier through intracellular or paracellular routes. Strategies to prevent L. monocytogenes entry can potentially minimize infection in high-risk populations. Listeria adhesion protein (LAP aids L. monocytogenes in crossing epithelial barriers via the paracellular route. The use of recombinant probiotic bacteria expressing LAP would aid targeted clearance of Listeria from the gut and protect high-risk populations from infection. METHODOLOGY/PRINCIPAL FINDINGS: The objective was to investigate the ability of probiotic bacteria or LAP-expressing recombinant probiotic Lactobacillus paracasei (Lbp(LAP to prevent L. monocytogenes adhesion, invasion, and transwell-based transepithelial translocation in a Caco-2 cell culture model. Several wild type probiotic bacteria showed strong adhesion to Caco-2 cells but none effectively prevented L. monocytogenes infection. Pre-exposure to Lbp(LAP for 1, 4, 15, or 24 h significantly (P<0.05 reduced adhesion, invasion, and transepithelial translocation of L. monocytogenes in Caco-2 cells, whereas pre-exposure to parental Lb. paracasei had no significant effect. Similarly, Lbp(LAP pre-exposure reduced L. monocytogenes translocation by as much as 46% after 24 h. Lbp(LAP also prevented L. monocytogenes-mediated cell damage and compromise of tight junction integrity. Furthermore, Lbp(LAP cells reduced L. monocytogenes-mediated cell cytotoxicity by 99.8% after 1 h and 79% after 24 h. CONCLUSIONS/SIGNIFICANCE: Wild type probiotic bacteria were unable to prevent L. monocytogenes infection in vitro. In contrast, Lbp(LAP blocked adhesion, invasion, and translocation of L. monocytogenes by interacting with host cell receptor Hsp60, thereby protecting cells from infection. These data show promise
DEFF Research Database (Denmark)
Mejlholm, Ole; Gunvig, A.; Borggaard, C.
2010-01-01
The performance of six predictive models for Listeria monocytogenes was evaluated using 1014 growth responses of the pathogen in meat, seafood, poultry and dairy products. The performance of the growth models was closely related to their complexity i.e. the number of environmental parameters they...... be accurate. The successfully validated models are useful for assessment and management of L monocytogenes in processed and ready-to-eat (RTE) foods....... to accurately predict growth responses of L. monocytogenes in the wide range of food evaluated in the present study. When complexity of L monocytogenes growth models matches the complexity of foods of interest. i.e. the number of hurdles to microbial growth, then predicted growth responses of the pathogen can...
Directory of Open Access Journals (Sweden)
Diego Gómez
2015-07-01
Full Text Available The aim of this work was to study the occurrence of Listeria monocytogenes in several types of ready-to-eat (RTE meat products and in the environment of meat processing plants. A total of 129 samples of RTE meat products and 110 samples from work surfaces and equipment were analyzed. L. monocytogenes was detected in 6 out of 35 cooked products (17.14%, 21 out of 57 raw-cured products (36.84%, and 9 out of 37 dry-cured, salted products (24.32%. The number of sample units that exceeded the food safety limit of 100 cfu/g decreased from the manufacture date to half shelf life, and then it was further reduced at the end of shelf life. L. monocytogenes was detected in 25 out of 110 (22.72% food contact surfaces. The number of positive and negative results from both food and environmental samples were cross-tabulated and the calculated Cohen’s kappa coefficient (κ was 0.3233, indicating a fair agreement in terms of Listeria contamination. L. monocytogenes was recovered after cleaning and disinfection procedures in four plants, highlighting the importance of thorough cleaning and disinfection.
Gelbíčová, T; Pantůček, R; Karpíšková, R
2016-08-01
The aim of this study was to assess the potential risk posed to the human population by the presence of Listeria monocytogenes serotype 1/2c in food based on the characterization of virulence factors of Listeria involved in the invasion of host cells and sensitivity to antimicrobial agents. In addition to sequencing of the inlA and inlB genes, the presence of genes lapB, aut, fbpA, ami, vip and llsX was tested. A premature stop codon (PMSC) in the inlA gene was detected in all tested strains of serotype 1/2c and, concurrently, two novel PMSC mutation types were identified. However, neither PMSC in the inlB gene nor deletion of the lapB, aut, fbpA, ami and vip genes were found in any of the strains. The presence of the llsX gene was not confirmed. Even though all L. monocytogenes strains showed sensitivity to the tested antimicrobials on the basis of their phenotype, sequencing revealed the presence of IS1542 insertion in the inlA gene, indicating the possibility of sharing of mobile genetic elements associated with antimicrobial resistance among strains. Other than the presence of PMSCs in the inlA gene, no PMSC in inlB or deletion of other factors linked to the invasiveness of listeria were detected. Tested strains showed sensitivity to antibiotics used in the therapy of listeriosis. Strains of L. monocytogenes serotype 1/2c typically carry a PMSC in the inlA gene, but these strains still represent a potential threat to public health. The possibility of transfer of IS1542, associated with resistance to vancomycin, between enterococci and Listeria spp. was revealed. © 2016 The Society for Applied Microbiology.
Occurrence and antimicrobial resistance patterns of Listeria monocytogenes isolated from vegetables.
de Vasconcelos Byrne, Vanessa; Hofer, Ernesto; Vallim, Deyse Christina; de Castro Almeida, Rogeria Comastri
2016-01-01
Although the consumption of fresh and minimally processed vegetables is considered healthy, outbreaks related to the contamination of these products are frequently reported. Among the food-borne pathogens that contaminate vegetables is Listeria monocytogenes, a ubiquitous organism that exhibits the ability to survive and multiply at refrigerated temperatures. This study aimed to evaluate the occurrence of L. monocytogenes in vegetables as well as the antimicrobial resistance of isolates. The results showed that 3.03% of samples were contaminated with L. monocytogenes, comprising 2.22% of raw vegetables and 5.56% of ready-to-eat vegetables. Multiplex PCR confirmed the virulence potential of the isolates. Antimicrobial resistance profiling showed that 50% of the isolates were susceptible to the antibiotics used. The resistance of one isolate to penicillin G, a commonly employed therapeutic agent, and the presence of serotype 4b, a serotype commonly associated with food-borne outbreaks, could be potential health hazards for consumers. Copyright © 2016 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.
Dhama, Kuldeep; Verma, Amit Kumar; Rajagunalan, S; Kumar, Amit; Tiwari, Ruchi; Chakraborty, Sandip; Kumar, Rajesh
2013-04-01
Listeriosis is a disease that causes septicemia or encephalitis in humans, animals and birds. Although, the disease is rare and sporadic in poultry but if occurs then causes septicemia or sometimes localized encephalitis. Occasionally, the disease is seen in young chicks and the causative agent, like in humans and animals, is Listeria monocytogenes. The organism is capable to infect almost all animals and poultry; however, outbreaks of listeriosis are infrequent in birds. It is widely distributed among avian species and chickens, turkeys, waterfowl (geese, ducks), game birds, pigeons, parrots, wood grouse, snowy owl, eagle, canaries, which appear to be the most commonly affected. Chickens are thought to be the carriers of Listeria and also the prime reservoirs for the infection and thus contaminate the litter and environment of the poultry production units. Listeriosis is often noticed along with other poultry diseases such as coccidiosis, infectious coryza, salmonellosis, campylobacteriosis and parasitic infections, signifying the opportunistic nature of the organism. Intestinal colonization of poultry and the presence of L. monocytogenes in feces represent a potential source of the organism for listeriosis in ruminants. Man gets infection from raw broiler meat due to Listeria contamination and unhygienic conditions of the processing area, rather than acquiring direct infection from birds. With the changing food habits of the people, the health consciousness is also increasing and since listeriosis has now been recognized as an emerging food borne zoonoses. Therefore, this review has been compiled to make aware the poultry producers and the consumers of poultry meat/products regarding the importance of the disease and its public health significance.
Morphological change and decreasing transfer rate of biofilm-featured Listeria monocytogenes EGDe
Listeria monocytogenes, a lethal foodborne pathogen, has the ability to resist the hostile food-processing environment and, thus, frequently contaminates ready-to-eat foods during processing. It is commonly accepted that L. monocytogenes’ tendency to generate biofilms on various surfaces enhances it...
Bahador; Sadeghi Kalani; Valian; Irajian; Lotfollahi
2015-01-01
Background Listeria monocytogenes is a foodborne pathogen and a serious threat to the public health in the world. Consumption of traditional foods such as dairy and meat products can be a major reason for relative abundance and isolation of these bacteria. Objectives The purpose of this study was to determine the phenotypic and genotypic characteristics of L. monocytogenes strains isolated from dairy and meat products. ...
Comparative genomics of human and non-human Listeria monocytogenes sequence type 121 strains.
Directory of Open Access Journals (Sweden)
Kathrin Rychli
Full Text Available The food-borne pathogen Listeria (L. monocytogenes is able to survive for months and even years in food production environments. Strains belonging to sequence type (ST121 are particularly found to be abundant and to persist in food and food production environments. To elucidate genetic determinants characteristic for L. monocytogenes ST121, we sequenced the genomes of 14 ST121 strains and compared them with currently available L. monocytogenes ST121 genomes. In total, we analyzed 70 ST121 genomes deriving from 16 different countries, different years of isolation, and different origins-including food, animal and human ST121 isolates. All ST121 genomes show a high degree of conservation sharing at least 99.7% average nucleotide identity. The main differences between the strains were found in prophage content and prophage conservation. We also detected distinct highly conserved subtypes of prophages inserted at the same genomic locus. While some of the prophages showed more than 99.9% similarity between strains from different sources and years, other prophages showed a higher level of diversity. 81.4% of the strains harbored virtually identical plasmids. 97.1% of the ST121 strains contain a truncated internalin A (inlA gene. Only one of the seven human ST121 isolates encodes a full-length inlA gene, illustrating the need of better understanding their survival and virulence mechanisms.
Listeria monocytogenes response regulators important for stress tolerance and pathogenesis
DEFF Research Database (Denmark)
Kallipolitis, B H; Ingmer, H
2001-01-01
Environmental sensing by two-component signal transduction systems is likely to play a role for growth and survival of Listeria monocytogenes both during transmission in food products and within a host organism. Two-component systems typically consist of a membrane-associated sensor histidine...... kinase and a gene regulatory protein, the response regulator (RR). We have identified seven putative RR genes in L. monocytogenes LO28 by PCR using degenerate oligonucleotide primers. By insertional inactivation we obtained data suggesting that three of the putative RRs contribute to the pathogenicity...... of L. monocytogenes in mice. Strikingly, the mutants that were attenuated in virulence also had a decreased ability to grow in the presence of various stress conditions potentially encountered in an infection process. Thus, our data point to a connection between the ability of the putative two...
Jadhav, Snehal; Sevior, Danielle; Bhave, Mrinal; Palombo, Enzo A
2014-01-31
Conventional methods used for primary detection of Listeria monocytogenes from foods and subsequent confirmation of presumptive positive samples involve prolonged incubation and biochemical testing which generally require four to five days to obtain a result. In the current study, a simple and rapid proteomics-based MALDI-TOF MS approach was developed to detect L. monocytogenes directly from selective enrichment broths. Milk samples spiked with single species and multiple species cultures were incubated in a selective enrichment broth for 24h, followed by an additional 6h secondary enrichment. As few as 1 colony-forming unit (cfu) of L. monocytogenes per mL of initial selective broth culture could be detected within 30h. On applying the same approach to solid foods previously implicated in listeriosis, namely chicken pâté, cantaloupe and Camembert cheese, detection was achieved within the same time interval at inoculation levels of 10cfu/mL. Unlike the routine application of MALDI-TOF MS for identification of bacteria from solid media, this study proposes a cost-effective and time-saving detection scheme for direct identification of L. monocytogenes from broth cultures.This article is part of a Special Issue entitled: Trends in Microbial Proteomics. Globally, foodborne diseases are major causes of illness and fatalities in humans. Hence, there is a continual need for reliable and rapid means for pathogen detection from food samples. Recent applications of MALDI-TOF MS for diagnostic microbiology focused on detection of microbes from clinical specimens. However, the current study has emphasized its use as a tool for detecting the major foodborne pathogen, Listeria monocytogenes, directly from selective enrichment broths. This proof-of-concept study proposes a detection scheme that is more rapid and simple compared to conventional methods of Listeria detection. Very low levels of the pathogen could be identified from different food samples post-enrichment in
Deciphering the landscape of host barriers to Listeria monocytogenes infection.
Zhang, Ting; Abel, Sören; Abel Zur Wiesch, Pia; Sasabe, Jumpei; Davis, Brigid M; Higgins, Darren E; Waldor, Matthew K
2017-06-13
Listeria monocytogenes is a common food-borne pathogen that can disseminate from the intestine and infect multiple organs. Here, we used sequence tag-based analysis of microbial populations (STAMP) to investigate L monocytogenes population dynamics during infection. We created a genetically barcoded library of murinized L monocytogenes and then used deep sequencing to track the pathogen's dissemination routes and quantify its founding population ( N b ) sizes in different organs. We found that the pathogen disseminates from the gastrointestinal tract to distal sites through multiple independent routes and that N b sizes vary greatly among tissues, indicative of diverse host barriers to infection. Unexpectedly, comparative analyses of sequence tags revealed that fecally excreted organisms are largely derived from the very small number of L. monocytogenes cells that colonize the gallbladder. Immune depletion studies suggest that distinct innate immune cells restrict the pathogen's capacity to establish replicative niches in the spleen and liver. Finally, studies in germ-free mice suggest that the microbiota plays a critical role in the development of the splenic, but not the hepatic, barriers that prevent L. monocytogenes from seeding these organs. Collectively, these observations illustrate the potency of the STAMP approach to decipher the impact of host factors on population dynamics of pathogens during infection.
Beneduce, Luciano; Gatta, Giuseppe; Bevilacqua, Antonio; Libutti, Angela; Tarantino, Emanuele; Bellucci, Micol; Troiano, Eleonora; Spano, Giuseppe
2017-11-02
In order to evaluate if the reuse of food industry treated wastewater is compatible for irrigation of food crops, without increased health risk, in the present study a cropping system, in which ground water and treated wastewater were used for irrigation of tomato and broccoli, during consecutive crop seasons was monitored. Water, crop environment and final products were monitored for microbial indicators and pathogenic bacteria, by conventional and molecular methods. The microbial quality of the irrigation waters influenced sporadically the presence of microbial indicators in soil. No water sample was found positive for pathogenic bacteria, independently from the source. Salmonella spp. and Listeria monocytogenes were detected in soil samples, independently from the irrigation water source. No pathogen was found to contaminate tomato plants, while Listeria monocytogenes and E. coli O157:H7 were detected on broccoli plant, but when final produce were harvested, no pathogen was detected on edible part. The level of microbial indicators and detection of pathogenic bacteria in field and plant was not dependent upon wastewater used. Our results, suggest that reuse of food industry wastewater for irrigation of agricultural crop can be applied without significant increase of potential health risk related to microbial quality. Copyright © 2017 Elsevier B.V. All rights reserved.
Role of Extracellular DNA during Biofilm Formation by Listeria monocytogenes
DEFF Research Database (Denmark)
Harmsen, Morten; Lappann, Martin; Knøchel, S
2010-01-01
(eDNA) may be the only central component of the biofilm matrix and that it is necessary for both initial attachment and early biofilm formation for 41 L. monocytogenes strains that were tested. DNase I treatment resulted in dispersal of biofilms, not only in microtiter tray assays but also in flow......Listeria monocytogenes is a food-borne pathogen that is capable of living in harsh environments. It is believed to do this by forming biofilms, which are surface-associated multicellular structures encased in a self-produced matrix. In this paper we show that in L. monocytogenes extracellular DNA...... cell biofilm assays. However, it was also demonstrated that in a culture without eDNA, neither Listeria genomic DNA nor salmon sperm DNA by itself could restore the capacity to adhere. A search for additional necessary components revealed that peptidoglycan (PG), specifically N-acetylglucosamine (NAG...
Chaix, E; Broyart, B; Couvert, O; Guillaume, C; Gontard, N; Guillard, V
2015-10-01
A mechanistic model coupling O2 and CO2 mass transfer (namely diffusion and solubilisation in the food itself and permeation through the packaging material) to microbial growth models was developed aiming at predicting the shelf life of modified atmosphere packaging (MAP) systems. It was experimentally validated on a non-respiring food by investigating concomitantly the O2/CO2 partial pressure in packaging headspace and the growth of Listeria monocytogenes (average microbial count) within the food sample. A sensitivity analysis has revealed that the reliability of the prediction by this "super-parametrized" model (no less than 47 parameters were required for running one simulation) was strongly dependent on the accuracy of the microbial input parameters. Once validated, this model was used to decipher the role of O2/CO2 mass transfer on microbial growth and as a MAP design tool: an example of MAP dimensioning was provided in this paper as a proof of concept. Copyright © 2015 Elsevier Ltd. All rights reserved.
Miladi, Hanene; Elabed, Hamouda; Ben Slama, Rihab; Rhim, Amel; Bakhrouf, Amina
2017-03-01
Listeria monocytogenes is a food-borne pathogen of humans and other animals. The striking ability to survive several stresses usually used for food preservation makes L. monocytogenes one of the biggest concerns to the food industry. This ubiquity can be partly explained by the ability of the organism to grow and persist at very low temperatures, a consequence of its ability to accumulate cryoprotective compound called osmolytes. A quantitative RT-PCR assay was used to measure mRNA transcript accumulation for the stress response genes opuCA and betL (encoding carnitine and betaine transporters, respectively) and the housekeeping gene 16S rRNA. Assays were conducted on mid-exponential phase L. monocytogenes cells exposed to conditions reflecting cold and freezing stress, conditions usually used to preserve foods. We showed that expression of the two cold-adapted genes encoded the transporters of the cryoprotectants carnitine and betaine in ATCC 19115 and the food-isolated L. monocytogenes S1 is induced after cold and freezing stress exposure. Furthermore, transcriptional analysis of the genes encoding opuCA and betL revealed that each transporter is induced to different degrees upon cold shock of L. monocytogenes ATCC 19115 and S1. Our results confirm an increase in carnitine uptake at low temperatures more than in betaine after cold-shocked temperature compared to the non-stress control treatment. It was concluded the use of carnitine and betaine as cryoprotectants is essential for rapid induction of the tested stress response under conditions typically encountered during food preservation.
Combination of endolysins and high pressure to inactivate Listeria monocytogenes.
van Nassau, Tomas J; Lenz, Christian A; Scherzinger, Anna S; Vogel, Rudi F
2017-12-01
Outbreaks of listeriosis are often related to the consumption of low-processed ready-to-eat food products (e.g. soft cheeses or smoked fish) contaminated with Listeria monocytogenes. Traditional preservation techniques, such as heat treatment, cannot eliminate Listeria from these products without strongly affecting the quality of the foods. We therefore investigated the use of endolysin (PlyP40, Ply511, or PlyP825) in combination with high hydrostatic pressure processing to kill L. monocytogenes in buffer. The results demonstrated a more than additive effect when both treatments were combined. For example, whereas 0.16 μg/mL PlyP825 or 300 MPa (1 min, 30 °C) applied individually reduced the cell count by 0.2 and 0.3 log cfu, respectively, a combined treatment resulted in a reduction of 5.5 log cfu. Similar results were obtained for the other endolysins combined with high pressure processing. We also showed that the synergistic inactivation of cells by endolysin and HHP is possible at a pressure level of only 200 MPa (2 min, 30 °C). Thus, the application of endolysins did not only substantially increase the bactericidal effect of high pressure, but it also enabled the inactivation of bacterial cells at much lower pressure levels. This shows the potential of using such combined processes for the inactivation of L. monocytogenes and food preservation. Copyright © 2017 Elsevier Ltd. All rights reserved.
Daneshvar Alavi, Hessam Edin; Truelstrup Hansen, Lisbeth
2013-01-01
This study investigated the dynamics of static biofilm formation (100% RH, 15 °C, 48-72 h) and desiccation survival (43% RH, 15 °C, 21 days) of Listeria monocytogenes, in dual species biofilms with the common spoilage bacteria, Pseudomonas fluorescens, Serratia proteamaculans and Shewanella baltica, on the surface of food grade stainless steel. The Gram-negative bacteria reduced the maximum biofilm population of L. monocytogenes in dual species biofilms and increased its inactivation during desiccation. However, due to the higher desiccation resistance of Listeria relative to P. fluorescens and S. baltica, the pathogen survived in greater final numbers. In contrast, S. proteamaculans outcompeted the pathogen during the biofilm formation and exhibited similar desiccation survival, causing the N21 days of Serratia to be ca 3 Log10(CFU cm(-2)) greater than that of Listeria in the dual species biofilm. Microscopy revealed biofilm morphologies with variable amounts of exopolymeric substance and the presence of separate microcolonies. Under these simulated food plant conditions, the fate of L. monocytogenes during formation of mixed biofilms and desiccation depended on the implicit characteristics of the co-cultured bacterium.
Cauchon, Kaitlin E; Hitchins, Anthony D; Smiley, R Derike
2017-09-01
Three selective enrichment methods, the United States Food and Drug Administration's (FDA method), the United States Department of Agriculture Food Safety Inspection Service's (USDA method), and the EN ISO 11290-1 standard method, were assessed for their suitability for recovery of Listeria monocytogenes from spiked mung bean sprouts. Three parameters were evaluated; the enrichment L. monocytogenes population from singly-spiked sprouts, the enrichment L. monocytogenes population from doubly-spiked (L. monocytogenes and Listeria innocua) sprouts, and the population differential resulting from the enrichment of doubly-spiked sprouts. Considerable L. monocytogenes inter-strain variation was observed. The mean enrichment L. monocytogenes populations for singly-spiked sprouts were 6.1 ± 1.2, 4.9 ± 1.2, and 6.9 ± 2.3 log CFU/mL for the FDA, USDA, and EN ISO 11290-1 methods, respectively. The mean L. monocytogenes populations for doubly-spiked sprouts were 4.7 ± 1.1, 5.5 ± 1.3, and 4.6 ± 1.4 log CFU/mL for the FDA, USDA, and ISO 11290-1 enrichment methods, respectively. The corresponding mean population differentials were 2.8 ± 1.1, 3.3 ± 1.3, and 3.6 ± 1.4 Δlog CFU/mL for the same three enrichment methods, respectively. The presence of L. innocua and resident microorganisms on the sprouts negatively impacted final levels of L. monocytogenes with all three enrichment methods. Published by Elsevier Ltd.
Evaluation of a monoclonal antibody able to detect live Listeria monocytogenes and Listeria innocua
DEFF Research Database (Denmark)
Sølve, Marianne; Boel, Jeppe; Nørrung, Birgit
2000-01-01
A monoclonal Listeria antibody, designated B4, was evaluated. The ability of the antibody to bind to viable bacteria belonging to Listeria spp, compared to bacteria of the same species killed by beat treatment, acid or base treatment, sanitizers, and irradiation was examined. The antibody was found...... to react with viable L. monocytogenes and L. innocua, but not with heat-killed (72 degrees C, 5 min) strains of these organisms. When L. monocytogenes and L. innocua were killed by methods other than heat treatment, it was ambiguous whether the antibody detected the organism or not. It was concluded...... that the B4 antibody has potential to be used in an immune capture step to capture live L, monocytogenes and L. innocua from foods prior to identification of L. monocytogenes by polymerase chain reaction (PCR)....
Michelon, Damien; Félix, Benjamin; Vingadassalon, Noemie; Mariet, Jean-François; Larsson, Jonas T; Møller-Nielsen, Eva; Roussel, Sophie
2015-03-01
Listeria monocytogenes is a foodborne pathogen responsible for a severe disease known as listeriosis. The European Centre for Disease Prevention and Control (ECDC) coordinates a network of national public health laboratories (NPHLs) in charge of typing clinical strains. In food, it is the European Union Reference Laboratory for L. monocytogenes (EURL Lm), which manages a network of National Reference Laboratories (NRLs). A pulsed-field gel electrophoresis (PFGE) standard operating procedure (EURL SOP) has been used routinely at the EURL Lm since 2007. The EURL Lm has recommended that NRLs use the EURL SOP, whereas the Statens Serum Institut (SSI), under contract for ECDC, requested that NPHLs use Halpins' SOP (HSOP) published in 2010 for the PulseNet USA network. An update of Halpins' SOP (uHSOP) was published in 2013. To facilitate the exchange of profiles among human and food European reference laboratories, it is crucial to ensure that the PFGE profiles obtained with these different SOPs are comparable. The aim here was to compare the EURL SOP with HSOP and uHSOP. The panel comprised 114 well-characterized SSI/EURL strains. All were characterized at the EURL using both the EURL SOP and uHSOP. Seventy of the 114 strains were also characterized at the SSI using HSOP. The EURL SOP and uHSOP produced indistinguishable combined (ApaI/AscI) profiles for the 114 strains tested. The EURL SOP and HSOP produced indistinguishable combined profiles for 69 of the 70 strains tested. One strain displayed for the AscI profile an additional low-intensity band at 184 kbp with HSOP. For this strain, SSI and EUR Lm had already observed the same profile from NPHLs and NRLs. However, this deviation is minor as it accounted for about 1% of all the 114 combined profiles. This study should facilitate the exchange of reproducible PFGE profiles among human and food reference laboratories.
Nyarko, Esmond B; Puzey, Kenneth A; Donnelly, Catherine W
2014-06-01
subtyping methods, and can be used for L. monocytogenes strain typing by food industries and public health agencies to enable faster response and intervention to listeriosis outbreaks. FT-IR can also be applied for routine monitoring of the pathogen in food processing plants and for investigating postprocessing contamination because it is capable of differentiating heat-killed and viable L. monocytogenes populations. © 2014 Institute of Food Technologists®
Gallagher, Daniel; Ebel, Eric D; Gallagher, Owen; Labarre, David; Williams, Michael S; Golden, Neal J; Pouillot, Régis; Dearfield, Kerry L; Kause, Janell
2013-04-01
This report illustrates how the uncertainty about food safety metrics may influence the selection of a performance objective (PO). To accomplish this goal, we developed a model concerning Listeria monocytogenes in ready-to-eat (RTE) deli meats. This application used a second order Monte Carlo model that simulates L. monocytogenes concentrations through a series of steps: the food-processing establishment, transport, retail, the consumer's home and consumption. The model accounted for growth inhibitor use, retail cross contamination, and applied an FAO/WHO dose response model for evaluating the probability of illness. An appropriate level of protection (ALOP) risk metric was selected as the average risk of illness per serving across all consumed servings-per-annum and the model was used to solve for the corresponding performance objective (PO) risk metric as the maximum allowable L. monocytogenes concentration (cfu/g) at the processing establishment where regulatory monitoring would occur. Given uncertainty about model inputs, an uncertainty distribution of the PO was estimated. Additionally, we considered how RTE deli meats contaminated at levels above the PO would be handled by the industry using three alternative approaches. Points on the PO distribution represent the probability that - if the industry complies with a particular PO - the resulting risk-per-serving is less than or equal to the target ALOP. For example, assuming (1) a target ALOP of -6.41 log10 risk of illness per serving, (2) industry concentrations above the PO that are re-distributed throughout the remaining concentration distribution and (3) no dose response uncertainty, establishment PO's of -4.98 and -4.39 log10 cfu/g would be required for 90% and 75% confidence that the target ALOP is met, respectively. The PO concentrations from this example scenario are more stringent than the current typical monitoring level of an absence in 25 g (i.e., -1.40 log10 cfu/g) or a stricter criteria of absence
Pricope-Ciolacu, Luminita; Nicolau, Anca Ioana; Wagner, Martin; Rychli, Kathrin
2013-08-16
Nearly all cases of human listeriosis have been associated with consumption of contaminated food, therefore the investigation of the virulence of Listeria (L.) monocytogenes after exposure to environmental conditions in food matrices is critical in order to understand and control its impact on public health. As milk and dairy products have been implicated in more than half of the listeriosis outbreaks, we investigated the in vitro virulence of L. monocytogenes incubated in different milk types at various storage conditions. Incubation in pasteurized milk at refrigeration conditions (4°C) revealed a higher invasion and intracellular proliferation of four different L. monocytogenes strains compared to raw milk using human intestinal epithelial Caco-2 cells. Furthermore the period of storage, which increased L. monocytogenes cell numbers, decreased in vitro virulence. However, L. monocytogenes stored for 3weeks at 4°C in milk are still able to invade and proliferate into the host cell. Interestingly abused storage temperatures (25°C and 30°C) for a short time period (2h) revealed an attenuated impact on the in vitro virulence of L. monocytogenes compared to the storage temperature of 4°C. Regarding the major milk compounds, the level of milk fat significantly affected the in vitro virulence of L. monocytogenes. Pre-incubation in milk with high fat content (3.6%) resulted in a lower invasion capability compared to milk with low fat content. In contrast casein and lactose did not influence the invasiveness of L. monocytogenes into the host cell. In conclusion our study shows that the milk environment and different storage conditions influence the in vitro virulence of L. monocytogenes, both of which have to be considered in the risk assessment of contaminated food. Copyright © 2013 Elsevier B.V. All rights reserved.
Ferreira, Susana; Domingues, Fernanda
2016-10-01
Resveratrol (3,5,4'-trihydroxy-trans-stilbene) is a natural phytoalexin synthesized by plants in response to stress. This compound has several beneficial documented properties, namely anti-inflammatory, antioxidant, neuroprotective and antimicrobial activities. In this study the antimicrobial activity of resveratrol against Listeria monocytogenes and Listeria innocua was investigated. Resveratrol had a minimum inhibitory concentration of 200 µg mL(-1) for the tested strains, with time-kill curves demonstrating bacteriostatic activity. Inhibition of biofilm formation was also assessed, with resveratrol strongly inhibiting biofilm formation by both species even at subinhibitory concentrations. Overall, resveratrol showed antimicrobial properties on planktonic cells and on biofilm formation ability. Considering the potential use of resveratrol as a food preservative, the antimicrobial efficacy of resveratrol in food was studied in milk, lettuce leaf model and chicken juice. Resveratrol retained greater efficacy in both lettuce leaf model and chicken juice, but milk had a negative impact on its antilisterial activity, indicating a possible reduction of resveratrol availability in milk. This study reinforces resveratrol as an antimicrobial agent, pointing out its antibiofilm activity and its potential use as preservative in some food matrices. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.
Directory of Open Access Journals (Sweden)
M.A. Marzocca
2004-12-01
Full Text Available En el período comprendido entre enero de 2002 y julio de 2003 se realizó este trabajo que consistió en la detección de Listeria monocytogenes en diferentes alimentos: 90 muestras de fiambres cocidos, fraccionados y envasados con diferentes metodologías y 132 muestras de queso de pasta blanda. Estos productos fueron analizados utilizando el criterio presencia-ausencia en 25 g de alimento. L. monocytogenes no se halló ni en los fiambres feteados en las ventas personalizadas ni en las muestras de queso analizadas. Por el contrario, se determinó su presencia en el 10% de los fiambres feteados envasados al vacío y en el 5% de los fiambres trozados envasados al vacío. Estos resultados nos llevaron a incluir la investigación de la presencia de este patógeno en diferentes muestras medioambientales. Para ello se hisoparon 115 puntos incluyendo las líneas de procesamiento, materias primas, utensilios, heladeras. L. monocytogenes se halló en el 13,2% de las muestras analizadas: 5% correspondieron a la sala de fraccionamiento de fiambres y lácteos, 6,7% al frigorífico y 1,5% a los sitios de venta personalizada. Estos resultados indicaron la posible existencia de sitios problemáticos donde el microorganismo tendría probabilidad de formar reservorios, por lo que se extremaron las medidas rutinarias de higiene y desinfección.This work on Listeria monocytogenes detection in different foods was carried out between January 2002 and July 2003. Ninety cold-served cooked meats, sliced and packaged by different methods and 132 pieces of soft cheeses were studied. These products were analyzed using the presence/ausence in 25 g criterion. L. monocytogenes was not found either in foods sliced over the counter or in controlled cheeses, but it was found in 10% of sliced cold-served foods and 5% of cut and cold-served meats vacuum packaged. These results led us to investigate the presence of these pathogen bacteria in different environmental samples. A
Flagellar motility is critical for Listeria monocytogenes biofilm formation.
Lemon, Katherine P; Higgins, Darren E; Kolter, Roberto
2007-06-01
The food-borne pathogen Listeria monocytogenes attaches to environmental surfaces and forms biofilms that can be a source of food contamination, yet little is known about the molecular mechanisms of its biofilm development. We observed that nonmotile mutants were defective in biofilm formation. To investigate how flagella might function during biofilm formation, we compared the wild type with flagellum-minus and paralyzed-flagellum mutants. Both nonmotile mutants were defective in biofilm development, presumably at an early stage, as they were also defective in attachment to glass during the first few hours of surface exposure. This attachment defect could be significantly overcome by providing exogenous movement toward the surface via centrifugation. However, this centrifugation did not restore mature biofilm formation. Our results indicate that it is flagellum-mediated motility that is critical for both initial surface attachment and subsequent biofilm formation. Also, any role for L. monocytogenes flagella as adhesins on abiotic surfaces appears to be either minimal or motility dependent under the conditions we examined.
The Response Regulator ResD Plays a Role in Metabolism of Listeria monocytogenes
DEFF Research Database (Denmark)
Larsen, Marianne Halberg; Sørensen, Martine; Ingmer, Hanne
to be transmitted to food processing plants from where it can establish and survive for extended periods of time contaminating processed food products. Recently we have identified the response regulator ResD of L. monocytogenes and showed that it is important for growth in laboratory media and for sugar uptake...... in the upstream regulatory region of several genes of L. monocytogenes and the binding of the ResD protein to some of these regulatory regions upstream putative target genes is analysed by electrophoretic mobility shift assays (EMSAs). In conclusion, the response regulator ResD act is important for metabolisme...
Gilot, P; Hermans, C; Yde, M; Gigi, J; Janssens, M; Genicot, A; André, P; Wauters, G
1997-09-01
Listeria monocytogenes is an intracellular gram-positive organism responsible for severe infections in both humans and animals. Whereas the food-borne transmission of listeriosis was demonstrated in several outbreaks, most cases of listeriosis occur sporadically and are rarely linked with consumption of contaminated foods. In this paper a case of septicaemia with L. monocytogenes in a 73-year-old immunocompromised man is described. Evidence for the association of this case of listeriosis with the consumption of a contaminated 'Camembert' cheese is provided by serotyping, esterase typing, DNA macrorestriction patterns analysis and level of virulence of the isolated strains for mice.
Kureljušić, J.; Rokvić, N.; Jezdimirović, N.; Kureljušić, B.; Pisinov, B.; Karabasil, N.
2017-09-01
Listeria is the genus of a bacteria found in soil and water and some animals, including poultry and cattle. It can be present in raw milk and food made from raw milk. It can also live in food processing plants and contaminate a variety of processed meats. Microscopically, Listeria species appear as small, Gram-positive rods, which are sometimes arranged in short chains. In direct smears, they can be coccoid, so they can be mistaken for streptococci. Longer cells can resemble corynebacteria. Flagella are produced at room temperature but not at 37°C. Haemolytic activity on blood agar has been used as a marker to distinguish Listeria monocytogenes among other Listeria species, but it is not an absolutely definitive criterion. Further biochemical characterization is necessary to distinguish between the different Listeria species. The objective of this study was to detect, isolate and identify Listeria monocytogenes from poultry meat. Within a period of six months from January to June 2017, a total of 15 samples were collected. Three samples were positive for the presence of Listeria monocytogenes. Biochemical and microbiological tests as well as PCR technique using specific primers were used to confirm L. Monocytogenes in the samples.
DEFF Research Database (Denmark)
Zhu, Xinna; Long, Fei; Chen, Yonghui
2008-01-01
Listeria monocytogenes may persist for long periods in food processing environments. In some instances, this may be due to aggregation or biofilm formation. To investigate the mechanism controlling biofilm formation in the food-borne pathogen L. monocytogenes, we characterized LM-49, a mutant...... with enhanced ability of biofilm-formation generated via transposon Tn917 mutagenesis of L. monocytogenes 4b G. In this mutant, a Tn917 insertion has disrupted the coding region of the gene encoding a putative ATP binding cassette (ABC) transporter permease identical to Lmof2365_1771 (a putative ABC...... the same amount of biofilm biomass as the wild-type strain. Furthermore, transcription of the downstream lm.G_1770 was not influenced by the upstream Tn917 insertion, and the presence of Tn917 has no effect on biofilm formation. These results suggest that lm.G_1771 was solely responsible for the negative...
Directory of Open Access Journals (Sweden)
Paul Priyesh Vijayakumar
2015-06-01
Full Text Available Lactic acid bacteria (LAB have historically been used in food fermentations to preserve foods and are generally-recognized-as-safe (GRAS by the FDA for use as food ingredients. In addition to lactic acid; some strains also produce bacteriocins that have been proposed for use as food preservatives. In this study we examined the inhibition of Listeria monocytogenes 39-2 by neutralized and non-neutralized bacteriocin preparations (Bac+ preps produced by Lactobacillus curvatus FS47; Lb. curvatus Beef3; Pediococcus acidilactici Bac3; Lactococcus lactis FLS1; Enterococcus faecium FS56-1; and Enterococcus thailandicus FS92. Activity differences between non-neutralized and neutralized Bac+ preps in agar spot assays could not readily be attributed to acid because a bacteriocin-negative control strain was not inhibitory to Listeria in these assays. When neutralized and non-neutralized Bac+ preps were used in microplate growth inhibition assays against L. monocytogenes 39-2 we observed some differences attributed to acid inhibition. A microplate growth inhibition assay was used to compare inhibitory reactions of wild-type and bacteriocin-resistant variants of L. monocytogenes to differentiate bacteriocins with different modes-of-action (MOA whereby curvaticins FS47 and Beef3, and pediocin Bac3 were categorized to be in MOA1; enterocins FS92 and FS56-1 in MOA2; and lacticin FLS1 in MOA3. The microplate bacteriocin MOA assay establishes a platform to evaluate the best combination of bacteriocin preparations for use in food applications as biopreservatives against L. monocytogenes.
Vijayakumar, Paul Priyesh; Muriana, Peter M
2015-06-11
Lactic acid bacteria (LAB) have historically been used in food fermentations to preserve foods and are generally-recognized-as-safe (GRAS) by the FDA for use as food ingredients. In addition to lactic acid; some strains also produce bacteriocins that have been proposed for use as food preservatives. In this study we examined the inhibition of Listeria monocytogenes 39-2 by neutralized and non-neutralized bacteriocin preparations (Bac+ preps) produced by Lactobacillus curvatus FS47; Lb. curvatus Beef3; Pediococcus acidilactici Bac3; Lactococcus lactis FLS1; Enterococcus faecium FS56-1; and Enterococcus thailandicus FS92. Activity differences between non-neutralized and neutralized Bac+ preps in agar spot assays could not readily be attributed to acid because a bacteriocin-negative control strain was not inhibitory to Listeria in these assays. When neutralized and non-neutralized Bac+ preps were used in microplate growth inhibition assays against L. monocytogenes 39-2 we observed some differences attributed to acid inhibition. A microplate growth inhibition assay was used to compare inhibitory reactions of wild-type and bacteriocin-resistant variants of L. monocytogenes to differentiate bacteriocins with different modes-of-action (MOA) whereby curvaticins FS47 and Beef3, and pediocin Bac3 were categorized to be in MOA1; enterocins FS92 and FS56-1 in MOA2; and lacticin FLS1 in MOA3. The microplate bacteriocin MOA assay establishes a platform to evaluate the best combination of bacteriocin preparations for use in food applications as biopreservatives against L. monocytogenes.
Modeling and predicting the growth boundary of Listeria monocytogenes in lightly preserved seafood
DEFF Research Database (Denmark)
Mejlholm, Ole; Dalgaard, Paw
2007-01-01
The antimicrobial effect of diacetate and lactate against Listeria monocytogenes was evaluated in challenge tests with vacuum-packaged or modified atmosphere packaged (MAP) cold-smoked salmon, marinated salmon, cold-smoked Greenland halibut, marinated Greenland halibut, and gravad salmon. MAP col...... characteristics required to prevent the growth of L. monocytogenes, thereby making it possible to identify critical control points, and is useful for compliance with the new European Union regulation on ready-to-eat foods (EC 2073/2005)....
Fagerlund, Annette; Langsrud, Solveig; Schirmer, Bjørn C. T.; Møretrø, Trond; Heir, Even
2016-01-01
Listeria monocytogenes is an important foodborne pathogen responsible for the disease listeriosis, and can be found throughout the environment, in many foods and in food processing facilities. The main cause of listeriosis is consumption of food contaminated from sources in food processing environments. Persistence in food processing facilities has previously been shown for the L. monocytogenes sequence type (ST) 8 subtype. In the current study, five ST8 strains were subjected to whole-genome sequencing and compared with five additionally available ST8 genomes, allowing comparison of strains from salmon, poultry and cheese industry, in addition to a human clinical isolate. Genome-wide analysis of single-nucleotide polymorphisms (SNPs) confirmed that almost identical strains were detected in a Danish salmon processing plant in 1996 and in a Norwegian salmon processing plant in 2001 and 2011. Furthermore, we show that L. monocytogenes ST8 was likely to have been transferred between two poultry processing plants as a result of relocation of processing equipment. The SNP data were used to infer the phylogeny of the ST8 strains, separating them into two main genetic groups. Within each group, the plasmid and prophage content was almost entirely conserved, but between groups, these sequences showed strong divergence. The accessory genome of the ST8 strains harbored genetic elements which could be involved in rendering the ST8 strains resilient to incoming mobile genetic elements. These included two restriction-modification loci, one of which was predicted to show phase variable recognition sequence specificity through site-specific domain shuffling. Analysis indicated that the ST8 strains harbor all important known L. monocytogenes virulence factors, and ST8 strains are commonly identified as the causative agents of invasive listeriosis. Therefore, the persistence of this L. monocytogenes subtype in food processing facilities poses a significant concern for food safety
Introduction: Controlling Listeria monocytogenes on ready-to-eat meat and poultry products and in food processing facilities is challenging. Surveys have found that some L. monocytogenes types are more persistent in processing facilities than others, but the reason is unknown. It is possible persist...
Quereda, Juan J; Meza-Torres, Jazmín; Cossart, Pascale; Pizarro-Cerdá, Javier
2017-07-04
Listeria monocytogenes is a Gram-positive food-borne pathogen that in humans may traverse the intestinal, placental and blood/brain barriers, causing gastroenteritis, abortions and meningitis. Crossing of these barriers is dependent on the bacterial ability to enter host cells, and several L. monocytogenes surface and secreted virulence factors are known to facilitate entry and the intracellular lifecycle. The study of L. monocytogenes strains associated to human listeriosis epidemics has revealed the presence of novel virulence factors. One such factor is Listeriolysin S, a thiazole/oxazole modified microcin that displays bactericidal activity and modifies the host microbiota during infection. Our recent results therefore highlight the interaction of L. monocytogenes with gut microbes as a crucial step in epidemic listeriosis. In this article, we will discuss novel implications for this family of toxins in the pathogenesis of diverse medically relevant microorganisms.
PRÉVALENCE DE LISTERIA MONOCYTOGENES DANS LE LAIT CRU DE VACHE AU LIBAN NORD
Directory of Open Access Journals (Sweden)
Imad al Kassaa
2016-06-01
Full Text Available Al Kassaa Imad, Khaled el Omari, Marwa Saati, Bachar Ismail and Monzer Hamze. 2016. Prevalence of Listeria monocytogenes in raw cow milk in north Lebanon. Lebanese Science Journal, 17(1: 39-45. Listeriosis, although a zoonosis, is an invasive disease that can affect newborns, pregnant women and immunocompromised adults. Clinical manifestations can be expressed by febrile gastroenteritis, invasive forms including severe sepsis, meningitis, rhombencephalitis, prenatal infections and abortions. Species of Listeria bacteria are ubiquitous and adaptable to the environment in animal and plant foods. This study aimed to determine the prevalence of Listeria monocytogenes in 100 samples of fresh cow milk collected from different areas of North Lebanon. Listeria monocytogenes was detected by using the Grand VIDAS technique (Biomérieux France. The results obtained revealed the absence of Listeria monocytogenes in all analyzed samples.
Erdősi, Orsolya; Szakmár, Katalin; Reichart, Olivér; Szili, Zsuzsanna; László, Noémi; Székely Körmöczy, Péter; Laczay, Péter
2014-09-01
The incidence of outbreaks of foodborne listeriosis has indicated the need for a reliable and rapid detection of the microbe in different foodstuffs. A method combining redox potential measurement and real-time polymerase chain reaction (PCR) was developed to detect Listeria monocytogenes in artificially contaminated raw milk and soft cheese. Food samples of 25 g or 25 ml were homogenised in 225 ml of Listeria Enrichment Broth (LEB) with Oxford supplement, and the redox potential measurement technique was applied. For Listeria species the measuring time was maximum 34 h. The absence of L. monocytogenes could reliably be proven by the redox potential measurement method, but Listeria innocua and Bacillus subtilis could not be differentiated from L. monocytogenes on the basis of the redox curves. The presence of L. monocytogenes had to be confirmed by real-time PCR. The combination of these two methods proved to detect < 10 cfu/g of L. monocytogenes in a cost- and time-effective manner. This method can potentially be used as an alternative to the standard nutrient method for the rapid detection of L. monocytogenes in food.
Listeria Monocytogenes Persistence in Ready-to-Eat Sausages and in Processing Plants.
Mureddu, Anna; Mazza, Roberta; Fois, Federica; Meloni, Domenico; Bacciu, Roberto; Piras, Francesca; Mazzette, Rina
2014-01-21
Listeria monocytogenes is of major concern in the fermented meat products and is able to persist in their processing environments. The aim of the present work was to evaluate the virulence profile and the persistence capacity of L. monocytogenes strains isolated in Sardinian fermented sausages processing plants. Food (ground meat, sausages at the end of acidification and ripening stage) and environmental samples (a total of n. 385), collected from 4 meat processing plants located in Sardinia (Italy), were examined to detect L. monocytogenes presence. All the L. monocytogenes isolates were identified by polymerase chain reaction (PCR) method. A subset of strains was also characterised by multiplex PCR-based serogrouping, using the lmo0737 , lmo1118 , ORF2819 and ORF2110 genes. Three different multiplex PCRs were used to obtain the virulence profiles by the rrn , hlyA , actA , prfA , inlA , inlB , iap , plcA , plcB and mpl marker genes. Furthermore, in vitro biofilm forming ability and resistance to disinfectants were carried out on microtiter plate. The overall prevalence was 31.5% in food, and 68.5% in environmental samples. The prevalent serotype resulted 1/2c (43%), followed by 1/2a (40%), 4b (8.6%), and 1/2b (8.6%). The amplification products of the virulence genes were found in all the isolates with the following prevalence: 77.1% hlyA ; 100% rrn ; 100% prfA ; 97.1% iap ; 65.7% inlB ; 88.6% inlA ; 100% plcA ; 100% plcB and 74.3% mpl . As for biofilm forming ability, 37.1% of the strains were positive and resulted weak producer, but all the isolates were sensible to disinfectants showing a reduction of L. monocytogenes growth after each incubation time. More appropriate technologies and application of measures of hygienic control should be implemented to prevent the L. monocytogenes growth and cross-contamination in salsiccia sarda processing plants.
Listeria monocytogenes persistence in ready-to-eat sausages and in processing plants
Directory of Open Access Journals (Sweden)
Anna Mureddu
2014-02-01
Full Text Available Listeria monocytogenes is of major concern in the fermented meat products and is able to persist in their processing environments. The aim of the present work was to evaluate the virulence profile and the persistence capacity of L. monocytogenes strains isolated in Sardinian fermented sausages processing plants. Food (ground meat, sausages at the end of acidification and ripening stage and environmental samples (a total of n. 385, collected from 4 meat processing plants located in Sardinia (Italy, were examined to detect L. monocytogenes presence. All the L. monocytogenes isolates were identified by polymerase chain reaction (PCR method. A subset of strains was also characterised by multiplex PCR-based serogrouping, using the lmo0737, lmo1118, ORF2819 and ORF2110 genes. Three different multiplex PCRs were used to obtain the virulence profiles by the rrn, hlyA, actA, prfA, inlA, inlB, iap, plcA, plcB and mpl marker genes. Furthermore, in vitro biofilm forming ability and resistance to disinfectants were carried out on microtiter plate. The overall prevalence was 31.5% in food, and 68.5% in environmental samples. The prevalent serotype resulted 1/2c (43%, followed by 1/2a (40%, 4b (8.6%, and 1/2b (8.6%. The amplification products of the virulence genes were found in all the isolates with the following prevalence: 77.1% hlyA; 100% rrn; 100% prfA; 97.1% iap; 65.7% inlB; 88.6% inlA; 100% plcA; 100% plcB and 74.3% mpl. As for biofilm forming ability, 37.1% of the strains were positive and resulted weak producer, but all the isolates were sensible to disinfectants showing a reduction of L. monocytogenes growth after each incubation time. More appropriate technologies and application of measures of hygienic control should be implemented to prevent the L. monocytogenes growth and crosscontamination in salsiccia sarda processing plants.
Influence of temperature on alkali stress adaptation in Listeria monocytogenes
Listeria monocytogenes cells may induce alkali stress adaptation when exposed to sublethal concentrations of alkaline cleaners and sanitizers that may be frequently used in the food processing environment. In the present study, the effect of temperature on the induction and the stability of such alk...
An Assessment of Different Genomic Approaches for Inferring Phylogeny of Listeria monocytogenes
DEFF Research Database (Denmark)
Henri, Clementine; Leekitcharoenphon, Pimlapas; Carleton, Heather A.
2017-01-01
Background/objectives: Whole genome sequencing (WGS) has proven to be a powerful subtyping tool for foodborne pathogenic bacteria like L. monocytogenes. The interests of genome-scale analysis for national surveillance, outbreak detection or source tracking has been largely documented. The genomic......MLPPST) or pan genome (wgMLPPST). Currently, there are little comparisons studies of these different analytical approaches. Our objective was to assess and compare different genomic methods that can be implemented in order to cluster isolates of L monocytogenes.Methods: The clustering methods were evaluated...... on a collection of 207 L. monocytogenes genomes of food origin representative of the genetic diversity of the Anses collection. The trees were then compared using robust statistical analyses.Results: The backward comparability between conventional typing methods and genomic methods revealed a near...
Food processing and food handling environments may contain residual levels of sanitizers or cleaners which may trigger oxidative stress adaptation in Listeria monocytogenes. The aim of this study was to determine the induction and stability of oxidative stress adaptation in L. monocytogenes EGD (Bug...
[Analysis of antibiotic susceptibility of foodborne Listeria monocytogenes in China].
Yang, Yang; Fu, Ping; Guo, Yunchang; Liu, Xiurmei
2008-03-01
To study the antibiotic susceptibility of foodborne Listeria monocytogenes in China. The susceptibilities of 476 strains of foodborne Listeria monocytogenes to antibiotics were determined in Broth Microdilution Susceptibility Testing in Clinical and Laboratory Standards Institute. The antibiotics of gentamicin, ampicillin, penicillin, tetracycline, doxycycline, imipenem, erythromycin, ciprofloxacin, levofloxacin, cephalothin, rifampin, vancomycin, chloramphenicol, Trimethoprim-sulfamethoxazole, ampicillin-sulbactam were used. The rates of antibiotic resistance in 467 is olates were 4.5%. Tetracycline resistance was most prevalent, accouting for 4.07% . The foods that the rates of antibiotic resistance were highest were vegetable (10%). Among 14 provinces, Jilin, Hubei and Hebei were the third top, the rate of which were 19.6% and 9.1% and 8%, respectively. It was suggested that antibiotic resistance exists in foodborne Listeria monocytogenes to a certain extent in China. It should pay more attention to the use of drugs in prevention and clinic treatment to reduce the antibiotic resistant strains.
An outbreak of febrile gastroenteritis associated with corn contaminated by Listeria monocytogenes.
Aureli, P; Fiorucci, G C; Caroli, D; Marchiaro, G; Novara, O; Leone, L; Salmaso, S
2000-04-27
On May 21, 1997, numerous cases of febrile gastrointestinal illness were reported among the students and staff of two primary schools in northern Italy, all of whom had eaten at cafeterias served by the same caterer. We interviewed people who ate at the cafeterias about symptoms and foods consumed on May 20. There were no samples of foods left at the cafeterias, but we tested routine samples taken on May 20 by the caterer and environmental specimens at the catering plant. The hospitalized patients were tested for common enteropathogens and toxins. Of the 2189 persons interviewed (82 percent of those exposed), 1566 (72 percent) reported symptoms; of these, 292 (19 percent) were hospitalized. Among samples obtained from hospitalized patients, all but two of the stool specimens and all blood specimens were negative for common enteropathogens. Listeria monocytogenes was isolated from one blood specimen and from 123 of the 141 stool specimens. Consumption of a cold salad of corn and tuna was associated with the development of symptoms (relative risk, 6.19; 95 percent confidence interval, 4.81 to 7.98; Pcaterer's sample of the salad and from environmental specimens collected from the catering plant. All listeria isolates were serotype 4b and were found to be identical on DNA analysis. Experimental contamination of sterile samples of the implicated foods showed that L. monocytogenes grew on corn when kept for at least 10 hours at 25 degrees C. Food-borne infection with L. monocytogenes can cause febrile illness with gastroenteritis in immunocompetent persons.
DEFF Research Database (Denmark)
Kastbjerg, Vicky Gaedt; Hein-Kristensen, Line; Gram, Lone
2014-01-01
Exposure of the human food-borne pathogen Listeria monocytogenes to sublethal concentrations of triclosan can cause resistance to several aminoglycosides. Aminoglycoside-resistant isolates exhibit two colony morphologies: normal-size and pinpoint colonies. The purposes of the present study were...... to characterize the small colonies of L. monocytogenes and to determine if specific genetic changes could explain the triclosan-induced aminoglycoside resistance in both pinpoint and normal-size isolates. Isolates from the pinpoint colonies grew poorly under aerated conditions, but growth was restored by addition......I and that exposure to triclosan can cause resistance to antibiotics that enters the cell via active transport. Further studies are needed to elucidate if L. monocytogenes pinpoint isolates could have any clinical impact, e.g., in persistent infections....
International Nuclear Information System (INIS)
Rubio M V, T.; Espinoza, J.; L Sanchez, M.V.
1997-01-01
Full text: Listeria monocytogenes has been recognized for a number of years as a food pathogen bacteria. Ionizing radiation is a new technology and an excellent method to eliminate this microorganism form frozen food. The sensitivity of Listeria monocytogenes serotype 01 and 04 to irradiation, in pure culture and frozen shrimps was investigated. The D 10 values were of 0,26-0,37 kGy in pure culture and frozen shrimps, respectively. The D 10 founded were similar to those reported by the literature under similar conditions. Doses of 6 kGy were enough to eliminate a contamination of 10 6 -10 7 ufc/ml of L. Monocytogenes in frozen shrimps and storage them during 200 days at 18 deg C
Montero, David; Bodero Baeza, Marcia; Riveros, Guillermina; Lapierre, Lisette; Gaggero, Aldo; Vidal, Roberto M.; Vidal, Maricel
2015-01-01
Listeria monocytogenes is a pathogen transmitted through food that can cause severe infections in high-risk groups such as pregnant women, elderly, young children and immunocompromised individuals. It is a ubiquitous bacterium that can survive in harsh conditions, such as dry environments, at low
Bruschi, Carolina; Komora, Norton; Castro, Sónia Marília; Saraiva, Jorge; Ferreira, Vânia Borges; Teixeira, Paula
2017-06-01
The effect of high hydrostatic pressure (HHP) on the survival of 14 strains of Listeria monocytogenes from food or clinical origins, selected to represent different pheno and genotypes, was evaluated. Stationary phase cells were submitted to 300, 400 and 500 MPa at 10 °C, for 5 min. A high variability in the resistance of L. monocytogenes to pressure was observed, and particularly two strains isolated from food were significantly more baroresistant than the rest. Strains of L. monocytogenes resistant to one or more antibiotics exhibited significantly higher levels of survival after the high pressure treatment at 400 MPa. No correlation was found between strains' origin or thermal tolerance and resistance to HHP. The suitability of two strains of L. innocua as surrogates of L. monocytogenes, was also investigated. These exhibited significantly higher sensitivities to HHP than observed for some L. monocytogenes. The antimicrobial effect of the antilisterial bacteriocin (bacHA-6111-2) increased after L. monocytogenes cells had been exposed to pressure. The data obtained underlines the importance of strain selection for studies aiming to evaluate HHP efficacy to ensure safety of HHP-treated foods. Copyright © 2017 Elsevier Ltd. All rights reserved.
DEFF Research Database (Denmark)
Østergaard, Nina Bjerre
Listeria monocytogenes is a well-known food borne pathogen that potentially causes listeriosis. No outbreaks or cases of listeriosis have been associated with cottage cheese, but several confirmed cases and outbreaks in the EU and the US have been related to dairy products made from raw...... or pasteurised milk. This, in combination with the fact that cottage cheese support growth of Listeria monocytogenes, induces a documentation requirement on the food producer. In the EU regulatory framework, mathematical models are recognised as a suitable supplement to traditional microbiological methods....... The models can be used for documentation of compliance with microbiological criteria for Listeria monocytogenes under reasonably foreseeable conditions. Cottage cheese is a fresh, fermented dairy product. It consists of a fermented cheese curd mixed with a fresh or cultured cream dressing. The product...
Fødevarebetinget listeria monocytogenes endokarditis
DEFF Research Database (Denmark)
Frydland, Martin; Bundgaard, Henning; Moser, Claus
2014-01-01
Infection with Listeria monocytogenes is rare and mainly seen in immunosuppressed patients. Infection with L. monocytogenes has a mortality rate of 30%. We present a case report of L. monocytogenes bacteraemia and endocarditis in a 70-year-old man with several co-morbidities and following four...... major surgical procedures. This illustrates the findings and characteristics in one of the 16 patients who died in 2013 and 2014 this summer due to sausage-related L. monocytogenes infection....
Bacteria-eating virus approved as food additive.
Bren, Linda
2007-01-01
Not all viruses harm people. The Food and Drug Administration has approved a mixture of viruses as a food additive to protect people. The additive can be used in processing plants for spraying onto ready-to-eat meat and poultry products to protect consumers from the potentially life-threatening bacterium Listeria monocytogenes (L. monocytogenes).
Gelbícová, T; Karpísková, R
2012-04-01
Evaluation of the incidence and characteristics of L. monocytogenes in samples of raw cow's milk collected on farms (bulk tank milk samples) and from vending machines. Detection of L. monocytogenes and enumeration were carried out according to EN/ISO 11290--1, 2. Strains were characterised by serotyping and macrorestriction analysis using pulsed-field gel electrophoresis. The presence of L. monocytogenes was detected in 3,2 % (11/346) of bulk tank milk samples and 1,8 % (4/219) samples of raw cow's milk from vending machines. Findings of L. monocytogenes in raw milk were sporadic. Only on one farm strains of L. monocytogenes were detected repeatedly. Thirteen strains of L. monocytogenes belonged to serotype 1/2a, two strains to serotype 1/2b and one to serotype 4b. Macrorestriction analysis revealed considerable heterogeinity of profiles, with nine different pulsotypes being detected. Pulsotype 711 was the most frequent. This pulsotype was found on three different farms. The incidence of L. monocytogenes in raw cow's milk is relatively low in the Czech Republic. The results confirmed that some clones of L. monocytogenes from raw milk are identical with food and human strains.
Efficacy of chlorine dioxide against Listeria monocytogenes in brine chilling solutions.
Valderrama, W B; Mills, E W; Cutter, C N
2009-11-01
Chilled brine solutions are used by the food industry to rapidly cool ready-to-eat meat products after cooking and before packaging. Chlorine dioxide (ClO(2)) was investigated as an antimicrobial additive to eliminate Listeria monocytogenes. Several experiments were performed using brine solutions made of sodium chloride (NaCl) and calcium chloride (CaCl(2)) inoculated with L. monocytogenes and/or treated with 3 ppm of ClO(2). First, 10 and 20% CaCl(2) and NaCl solutions (pH 7.0) were inoculated with a five-strain cocktail of L. monocytogenes to obtain approximately 7 log CFU/ml and incubated 8 h at 0 degrees C. The results demonstrated that L. monocytogenes survived in 10% CaCl(2), 10 and 20% NaCl, and pure water. L. monocytogenes levels were reduced approximately 1.2 log CFU/ml in 20% CaCl(2). Second, inoculated ( approximately 7 log CFU/ml) brine solutions (10 and 20% NaCl and 10% CaCl(2)) treated with 3 ppm of ClO(2) resulted in a approximately 4-log reduction of the pathogen within 90 s. The same was not observed in a solution of 20% CaCl(2); further investigation demonstrated that high levels of divalent cations interfere with the disinfectant. Spent brine solutions from hot dog and ham chilling were treated with ClO(2) at concentrations of 3 or 30 ppm. At these concentrations, ClO(2) did not reduce L. monocytogenes. Removal of divalent cations and organic material in brine solutions prior to disinfection with ClO(2) should be investigated to improve the efficacy of the compound against L. monocytogenes. The information from this study may be useful to processing establishments and researchers who are investigating antimicrobials in chilling brine solutions.
Lewis, H C; Little, C L; Elson, R; Greenwood, M; Grant, K A; McLauchlin, J
2006-07-01
Two recent listeriosis outbreaks involving butter prompted this first cross-sectional study on the prevalence, levels, and types of Listeria species in 3229 samples of butter from production, retail, and catering premises in the United Kingdom during May and June 2004. When the criteria of the Microbiological Guidelines were used, 99.4% of samples were found to be of satisfactory microbiological quality, 0.5% were of acceptable quality, and 0.1% were of unsatisfactory quality as a result of high levels (>100 CFU/g) of Listeria spp. The butter samples with Listeria spp. present at more than 100 CFU/g were negative for L. monocytogenes. L. monocytogenes was detected in 0.4% (n=13) of samples, all at levels of less than 10 CFU/g, and were therefore of acceptable quality. Butter was contaminated more frequently with Listeria spp., including L. monocytogenes, when packed in plastic tubs, when in pack sizes of 500 g or less, when stored or displayed above 8 degrees C, when a hazard analysis system was not in place, and when the manager had received no food hygiene training. This study demonstrates that although butter is regarded as a low-risk product, it may provide an environment for the persistence and growth of Listeria spp., including L. monocytogenes. The control of L. monocytogenes in food processing and supply systems is critical in order to minimize the potential for this bacterium to be present in foods at the point of consumption at levels hazardous to health.
NATURAL ATYPICAL LISTERIA INNOCUA STRAINS WITH LISTERIA MONOCYTOGENES PATHOGENICITY ISLAND 1 GENES
The detection of the human foodborne pathogen, Listeria monocytogenes, in food, environmental samples and clinical specimens associated with cases of listeriosis, a rare but high mortality-rate disease, requires distinguishing the pathogen from other Listeria species. Speciation...
Lloyd, T; Alvarado, C Z; Brashears, M M; Thompson, L D; McKee, S R; Berrang, M
2009-10-01
The growth of Listeria monocytogenes in further-processed meat products has become a major concern and an important food safety issue. The meat and poultry industries have incorporated interventions such as organic acids in marinades to inhibit the growth of L. monocytogenes. In this study, organic acids were utilized in the raw product and as a postcook dip to determine their inhibitory effect on the growth of L. monocytogenes in turkey deli loaves. The turkey deli loaves were processed, cooked, cooled, inoculated with streptomycin-resistant L. monocytogenes, and then dipped. Treatments were potassium lactate (PL) in the raw product with sodium lactate (SL), sodium diacetate (SD) dip, PL with SL/PL/SD dip, SL with SL/SD dip, and SL with SL/PL/SD dip. There was also a positive (inoculated) and negative (noninoculated) control, which was dipped in distilled water. Days 0, 7, 14, 21, 28, 42, and 56 were sampled for L. monocytogenes. There were no differences (P>0.05) among the organic acid treatments in the turkey deli loaves at any time points; therefore, all of the treatments increased the lag phase of L. monocytogenes, extending the shelf-life of the product. However, there was a difference between the treatments and the positive control at d 7, 14, 21, 28, 42, and 56. The growth of L. monocytogenes increased immediately in the positive control, whereas the negative control appeared to have no growth. These organic acids can provide meat processors with a useful method for extending the lag phase of L. monocytogenes in ready-to-eat meat and poultry products.
Harter, Eva; Wagner, Eva Maria; Zaiser, Andreas; Halecker, Sabrina; Wagner, Martin; Rychli, Kathrin
2017-08-15
The foodborne pathogen Listeria monocytogenes is able to survive a variety of stress conditions leading to the colonization of different niches like the food processing environment. This study focuses on the hypervariable genetic hot spot lmo0443 to lmo0449 haboring three inserts: the stress survival islet 1 (SSI-1), the single-gene insert LMOf2365_0481 , and two homologous genes of the nonpathogenic species Listeria innocua : lin0464 , coding for a putative transcriptional regulator, and lin0465 , encoding an intracellular PfpI protease. Our prevalence study revealed a different distribution of the inserts between human and food-associated isolates. The lin0464-lin0465 insert was predominantly found in food-associated strains of sequence type 121 (ST121). Functional characterization of this insert showed that the putative PfpI protease Lin0465 is involved in alkaline and oxidative stress responses but not in acidic, gastric, heat, cold, osmotic, and antibiotic stresses. In parallel, deletion of lin0464 decreased survival under alkaline and oxidative stresses. The expression of both genes increased significantly under oxidative stress conditions independently of the alternative sigma factor σ B Furthermore, we showed that the expression of the protease gene lin0465 is regulated by the transcription factor lin0464 under stress conditions, suggesting that lin0464 and lin0465 form a functional unit. In conclusion, we identified a novel stress survival islet 2 (SSI-2), predominantly present in L. monocytogenes ST121 strains, beneficial for survival under alkaline and oxidative stresses, potentially supporting adaptation and persistence of L. monocytogenes in food processing environments. IMPORTANCE Listeria monocytogenes strains of ST121 are known to persist for months and even years in food processing environments, thereby increasing the risk of food contamination and listeriosis. However, the molecular mechanism underlying this remarkable niche-specific adaptation
Metselaar, Karin I; Abee, Tjakko; Zwietering, Marcel H; den Besten, Heidy M W
2016-09-01
Listeria monocytogenes exhibits a heterogeneous response upon stress exposure which can be partially attributed to the presence of stable stress-resistant variants. This study aimed to evaluate the impact of the presence of stress-resistant variants of Listeria monocytogenes and their corresponding trade-offs on population composition under different environmental conditions. A set of stress robustness and growth parameters of the wild type (WT) and an rpsU deletion variant was obtained and used to model their growth behavior under combined mild stress conditions and to model their kinetics under single- and mixed-strain conditions in a simulated food chain. Growth predictions for the WT and the rpsU deletion variant matched the experimental data generally well, although some deviations from the predictions were observed. The data highlighted the influence of the environmental conditions on the ratio between the WT and variant. Prediction of performance in the simulated food chain proved to be challenging. The trend of faster growth and lower stress robustness for the WT than for the rpsU variant in the different steps of the chain was confirmed, but especially for the inactivation steps and the time needed to resume growth after an inactivation step, the experimental data deviated from the model predictions. This report provides insights into the conditions which can select for stress-resistant variants in industrial settings and discusses their potential persistence in food processing environments. Listeria monocytogenes exhibits a heterogeneous stress response which can partially be attributed to the presence of genetic variants. These stress-resistant variants survive better under severe conditions but have, on the other hand, a reduced growth rate. To date, the ecological behavior and potential impact of the presence of stress-resistant variants is not fully understood. In this study, we quantitatively assessed growth and inactivation behavior of wild-type L
Single cell swimming dynamics of Listeria monocytogenes using a nanoporous microfluidic platform
Energy Technology Data Exchange (ETDEWEB)
Wright, Evan [University of Guelph, Canada; Neethirajan, Suresh [University of Guelph; Warriner, Keith [University of Guelph; Retterer, Scott T [ORNL; Srijanto, Bernadeta R [ORNL
2014-01-01
Listeria monocytogenes remains a significant foodborne pathogen due to its virulence and ability to become established in food processing facilities. The pathogen is characterized by its ability to grow over a wide temperature range and withstand a broad range of stresses. The following reports on the chemotaxis and motility of the L. monocytogenes when exposed to relatively small concentrations of acetic acid. Using the developed nanoporous microfluidic device to precisely modulate the cellular environment, we exposed the individual Listeria cells to acetic acid and, in real time and with high resolution, observed how the cells reacted to the change in their surroundings. Our results showed that concentrations of acetic acid below 10 mM had very little, if any, effect on the motility. However, when exposed to 100 mM acetic acid, the cells exhibited a sharp drop in velocity and displayed a more random pattern of motion. These results indicate that at appropriate concentrations, acetic acid has the ability to disable the flagellum of the cells, thus impairing their motility. This drop in motility has numerous effects on the cell; its main effects being the obstruction of the cell's ability to properly form biofilms and a reduction in the overall infectivity of the cells. Since these characteristics are especially useful in controlling the proliferation of L. monocytogenes, acetic acid shows potential for application in the food industry as an active compound in designing a food packaging environment and as an antimicrobial agent.
Directory of Open Access Journals (Sweden)
Ioannis eDiakogiannis
2013-06-01
Full Text Available This study addresses a major issue in microbial food safety, the elucidation of correlations between acid stress and changes in membrane fluidity of the pathogen Listeria monocytogenes. In order to assess the possible role that membrane fluidity changes play in L. monocytogenes tolerance to antimicrobial acids (acetic, lactic, hydrochloric acid at low pH or benzoic acid at neutral pH, the growth of the bacterium and the gel-to-liquid crystalline transition temperature point (Tm of cellular lipids of each adapted culture was measured and compared with unexposed cells. The Tm of extracted lipids was measured by Differential Scanning Calorimetry (DSC. A trend of increasing Tm values but not of equal extent was observed upon acid tolerance for all samples and this increase is not directly proportional to each acid antibacterial action. The smallest increase in Tm value was observed in the presence of lactic acid, which presented the highest antibacterial action. In the presence of acids with high antibacterial action such as acetic, hydrochloric acid or low antibacterial action such as benzoic acid, increased Tm values were measured. The Tm changes of lipids were also correlated with our previous data about fatty acid changes to acid adaptation. The results imply that the fatty acid changes are not the sole adaptation mechanism for decreased membrane fluidity (increased Tm. Therefore, this study indicates the importance of conducting an in-depth structural study on how acids commonly used in food systems affect the composition of individual cellular membrane lipid molecules.
Ringus, Daina L; Ivy, Reid A; Wiedmann, Martin; Boor, Kathryn J
2012-03-01
Listeria monocytogenes is a foodborne pathogen that can persist in food processing environments. Six persistent and six non-persistent strains from fish processing plants and one persistent strain from a meat plant were selected to determine if expression of genes in the regulons of two stress response regulators, σ(B) and CtsR, under salt stress conditions is associated with the ability of L. monocytogenes to persist in food processing environments. Subtype data were also used to categorize the strains into genetic lineages I or II. Quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR) was used to measure transcript levels for two σ(B)-regulated genes, inlA and gadD3, and two CtsR-regulated genes, lmo1138 and clpB, before and after (t=10 min) salt shock (i.e., exposure of exponential phase cells to BHI+6% NaCl for 10 min at 37°C). Exposure to salt stress induced higher transcript levels relative to levels under non-stress conditions for all four stress and virulence genes across all wildtype strains tested. Analysis of variance (ANOVA) of induction data revealed that transcript levels for one gene (clpB) were induced at significantly higher levels in non-persistent strains compared to persistent strains (p=0.020; two-way ANOVA). Significantly higher transcript levels of gadD3 (p=0.024; two-way ANOVA) and clpB (p=0.053; two-way ANOVA) were observed after salt shock in lineage I strains compared to lineage II strains. No clear association between stress gene transcript levels and persistence was detected. Our data are consistent with an emerging model that proposes that establishment of L. monocytogenes persistence in a specific environment occurs as a random, stochastic event, rather than as a consequence of specific bacterial strain characteristics.
DEFF Research Database (Denmark)
Hereu, A.; Dalgaard, Paw; Garriga, M.
2014-01-01
Various predictive models are available for high pressure inactivation of Listeria monocytogenes in food, but currently available models do not consider the growth kinetics of surviving cells during the subsequent storage of products. Therefore, we characterised the growth of L. monocytogenes in ...
Kovacevic, Jovana; Arguedas-Villa, Carolina; Wozniak, Anna; Tasara, Taurai; Allen, Kevin J
2013-03-01
Listeria monocytogenes strains belonging to serotypes 1/2a and 4b are frequently linked to listeriosis. While inlA mutations leading to premature stop codons (PMSCs) and attenuated virulence are common in 1/2a, they are rare in serotype 4b. We observed PMSCs in 35% of L. monocytogenes isolates (n = 54) recovered from the British Columbia food supply, including serotypes 1/2a (30%), 1/2c (100%), and 3a (100%), and a 3-codon deletion (amino acid positions 738 to 740) seen in 57% of 4b isolates from fish-processing facilities. Caco-2 invasion assays showed that two isolates with the deletion were significantly more invasive than EGD-SmR (P cold temperature following a downshift from 37°C to 4°C. Overall, three distinct cold-adapting groups (CAG) were observed: 46% were fast (200 h) adaptors. Intermediate CAG strains (70%) more frequently possessed inlA PMSCs than did fast (20%) and slow (10%) CAGs; in contrast, 87% of fast adaptors lacked inlA PMSCs. In conclusion, we report food chain-derived 1/2a and 4b serotypes with a 3-codon deletion possessing invasive behavior and the novel association of inlA genotypes encoding a full-length InlA with fast cold-adaptation phenotypes.
Listeria monocytogenes presence during fermentation, drying and storage of Petrovská klobása sausage
Janković, V.; Mitrović, R.; Lakićević, B.; Velebit, B.; Baltić, T.
2017-09-01
The majority of human listeriosis cases appear to be caused by consumption of ready-to-eat (RTE) foods contaminated at the time of consumption with high levels of Listeria monocytogenes. Although strategies to prevent growth of L. monocytogenes in RTE products are critical for reducing the incidence of human listeriosis, this pathogen is highly difficult to control in fermented sausage processing environments due to its high tolerance to low pH and high salt concentration. The aims of the present study were to investigate the occurrence, presence and elimination of L. monocytogenes in Petrovská klobása sausage during processing, fermentation, drying and storage. L. monocytogenes, which was detected at the beginning of the production cycle, disappeared before day 30. The pathogen decline was much faster in those sausages which were dried in controlled, industrial conditions than in those dried applying the traditional, household technique.
Directory of Open Access Journals (Sweden)
Regiane Priscilla Ratti
2010-12-01
Full Text Available Listeria monocytogenes is a foodborne pathogen which may survive in biofilms and persist in food processing plants. In this study, the ability of Leuconostoc mesenteroides (bac+ and bac- to inhibit biofilm formation by L. monocytogenes ATCC 19115 was studied with stainless steel coupons immersed in BHI broth and BHI broth plus sucrose in combination with the Lactic Acid Bacteria (LAB. Adhered cells were collected with swabs and enumerated on selective agars (Oxford for listeria and MRS for leuconostoc. Leuconostoc mesenteroides bac+ in co-culture with L. monocytogenes was effective to inhibit biofilm formation by listeria for up to 3 hours of incubation, but at 24 hours, biofilm was present in all conditions tested, as confirmed by observations of stainless steel coupons under Scanning Electron Microscopy (SEM. It was also observed that in the presence of L. mesenteroides bac+ in BHI plus sucrose, a high number of elongated cells of L. monocytogenes was present, which may indicate an adaptation response of the pathogen to stress conditions with important implications for food safety.
Listeria spp. E Listeria monocytogenes NA PRODUÇÃO DE SALSICHAS TIPO HOT DOG
Directory of Open Access Journals (Sweden)
ALESSANDRA PARO RODRIGUES CESAR
2011-06-01
Full Text Available Listeria monocytogenes is widely distributed in the environment and it has been isolated from food that were associated to outbreaks of high lethality in many countries. Thus, this bacterium represents an important pathogen to the public health. Ready-to-eat products, likecooked stuffed food, within them, frankfurters, are associated to human listeriosis in many countries. Taking into consideration the importance of the subject and the need of more data about it, the occurrence of Listeria spp. and L. monocytogenes in industrial plants, in meat raw materials, in slurry and frankfurters was investigated.These samples were collected in two production plants with SIF (Federal Inspection Service; in one of them GMP, HACCP and SOP were implemented. The results of the 1 06 microbiological analysis were submitted to the program @Risk to obtain the risk analysis; the meanvalues results showed that 7 to 9% of the frankfurters in the market may have L. monocytogenes. The analysis indicated that 88 strains of L. monocytogenes were obtained from 1 06 samples; among them, 76 werecollected in the industrial plants that participate in the experiment, and 30 were collected in the market. In serological typification, 95% of these strains were classified as serotypes 4b, 1 /2a and 1 /2b. Besides the presence of the bacterium in frankfurthers consumed inBrazil and the risk factors associated to this pathogen, the situation concerns because of the lack of epidemiological data, absence of patterns and the deficient information given to the consumer, specially information related to the presence of L. monocytogenes, particularly important to the groups at risk, as well as information related to the importance of heating the product
Chen, Bang-Yuan; Pyla, Rajkumar; Kim, Tae-Jo; Silva, Juan L; Jung, Yean-Sung
2010-08-01
Catfish skins, intestines, fresh fillets, processing surfaces at different production stages, chiller water and non-food contact surfaces were sampled for Listeria monocytogenes and other Listeria species. Among 315 samples, prevalence of L. monocytogenes, Listeria innocua and a group of Listeria seeligeri-Listeria welshimeri-Listeria ivanovii was 21.6, 13.0 and 29.5%, respectively. No Listeria grayi was detected in this survey. While no L. monocytogenes strains were isolated from catfish skins and intestines, the strains were found with a frequency of 76.7% in chilled fresh catfish fillets and 43.3% in unchilled fillets. L. monocytogenes and Listeria spp. were also detected in fish contact surfaces such as deheading machine, trimming board, chiller water, conveyor belts at different stages, and fillet weighing table. Among L. monocytogenes, 1/2b (47.0%), 3b (16.0%) and 4c (14%) were the predominant serotypes isolated, whereas 4b, 4e, 1/2c and 1/2a were detected at much lower frequencies. Genotype analyses of L. monocytogenes isolates using serotyping, pulsed-field gel electrophoresis (PFGE) and enterobacterial repetitive intergenic consensus (ERIC)-PCR revealed that chiller water represented an important contamination source of L. monocytogenes in the chilled catfish fillets of two processing facilities, whereas fillet weighing table significantly contributed to the catfish fillet contamination of the third facility. This study suggests that L. monocytogenes contamination in the processed catfish fillets originates from the processing environment, rather than directly from catfish. Results from this study can aid the catfish industry to develop a plant-specific proper cleaning and sanitation procedure for equipment and the processing environment designed to specifically target L. monocytogenes contamination. Copyright 2010 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Sonia Lamon
2015-01-01
Full Text Available Listeria monocytogenes is an ubiquitous, intracellular pathogen which has been implicated within the past decade as the causative organism in several outbreaks of foodborne diseases. In this review, a new approach to molecular typing primarily designed for global epidemiology has been described: multi-locus sequencing typing (MLST. This approach is novel, in that it uses data that allow the unambiguous characterization of bacterial strains via the Internet. Our aim is to present the currently available selection of references on L. monocytogenes MLST detection methods and to discuss its use as gold standard to L. monocytogenes subtyping method.
Møretrø, Trond; Heir, Even; Briandet, Romain; Langsrud, Solveig
2017-01-01
ABSTRACT Surfaces of food processing premises are exposed to regular cleaning and disinfection (C&D) regimes, using biocides that are highly effective against bacteria growing as planktonic cells. However, bacteria growing in surface-associated communities (biofilms) are typically more tolerant toward C&D than their individual free-cell counterparts, and survival of pathogens such as Listeria monocytogenes may be affected by interspecies interactions within biofilms. In this study, Pseudomonas and Acinetobacter were the most frequently isolated genera surviving on conveyor belts subjected to C&D in meat processing plants. In the laboratory, Pseudomonas, Acinetobacter, and L. monocytogenes dominated the community, both in suspensions and in biofilms formed on conveyor belts, when cultures were inoculated with eleven-genus cocktails of representative bacterial strains from the identified background flora. When biofilms were exposed to daily C&D cycles mimicking treatments used in food industry, the levels of Acinetobacter and Pseudomonas mandelii diminished, and biofilms were instead dominated by Pseudomonas putida (65 to 76%), Pseudomonas fluorescens (11 to 15%) and L. monocytogenes (3 to 11%). The dominance of certain species after daily C&D correlated with high planktonic growth rates at 12°C and tolerance to C&D. In single-species biofilms, L. monocytogenes developed higher tolerance to C&D over time, for both the peracetic acid and quaternary ammonium disinfectants, indicating that a broad-spectrum mechanism was involved. Survival after C&D appeared to be a common property of L. monocytogenes strains, as persistent and sporadic subtypes showed equal survival rates in complex biofilms. Biofilms established preferentially in surface irregularities of conveyor belts, potentially constituting harborage sites for persistent contamination. IMPORTANCE In the food industry, efficient production hygiene is a key measure to avoid the accumulation of spoilage bacteria and
Fagerlund, Annette; Møretrø, Trond; Heir, Even; Briandet, Romain; Langsrud, Solveig
2017-06-30
Surfaces of food processing premises are exposed to regular cleaning and disinfection (C&D) regimes, using biocides that are highly effective against bacteria growing as planktonic cells. However, bacteria growing in surface associated communities (biofilms) are typically more tolerant towards C&D than their individual free cells counterparts, and survival of pathogens such as Listeria monocytogenes may be affected by interspecies interactions within biofilms. In this study, Pseudomonas and Acinetobacter were the most frequently isolated genera surviving on conveyor belts subjected to C&D in meat processing plants. In the laboratory, Pseudomonas , Acinetobacter and L. monocytogenes dominated the community both in suspensions and in biofilms formed on conveyor belts, when cultures were inoculated with eleven-genera cocktails of representative bacterial strains from the identified background flora. When biofilms were exposed to daily C&D cycles, mimicking treatments used in food industry, the levels of Acinetobacter and Pseudomonas mandelii diminished, and biofilms were instead dominated by Pseudomonas putida (65-76%), Pseudomonas fluorescens (11-15%) and L. monocytogenes (3-11%). The dominance of certain species after daily C&D correlated with high planktonic growth rates at 12°C and tolerance to C&D. In single-species biofilms, L. monocytogenes developed higher tolerance to C&D over time, both for the peracetic acid and quaternary ammonium disinfectant, indicating that a broad-spectrum mechanism was involved. Survival after C&D appeared to be a common property of L. monocytogenes strains, as both persistent and sporadic subtypes showed equal survival in complex biofilms. Biofilms established preferentially in surface irregularities of conveyor belts, potentially constituting harborage sites for persistent contamination. IMPORTANCE In food industry, efficient production hygiene is a key measure to avoid accumulation of spoilage bacteria and eliminate pathogens
Growth potential of Listeria monocytogenes in sliced turkey bresaola packed in modified atmosphere
Directory of Open Access Journals (Sweden)
Elena Dalzini
2014-02-01
Full Text Available According to EC Regulation No 2073/2005, for food business operators that produce ready-to-eat (RTE product, it is crucial to be able to demonstrate if the product supports the growth of Listeria monocytogenes. The objective of the study was therefore to evaluate the behaviour of L. monocytogenes in sliced RTE turkey bresaola (made by cured turkey breast 4.5% NaCl, 1% sodium lactate, sodium nitrite 150 ppm and flavouring during the shelf life of the product, simulating a contamination during the slicing operation. Considering a shelf life of 90 days, as defined by manufacturer, the packages of sliced bresaola were stored at 5°C for 7 days and at 8°C for the remaining storage time (83 days. L. monocytogenes count decreased during storage test from 1.43/1.98 log cfu/g in the three batches tested to 1.03 log cfu/g in one batch and to undetectable levels in the other two batches. The results show that the investigated product is unable to support the growth of L. monocytogenes.
Incidence of Listeria monocytogenes and Listeria spp. in a small-scale mushroom production facility.
Viswanath, Prema; Murugesan, Latha; Knabel, Stephen J; Verghese, Bindhu; Chikthimmah, Naveen; Laborde, Luke F
2013-04-01
Listeria monocytogenes is a foodborne pathogen of significant concern to the agricultural and food processing industry because of its ability to grow and persist in cool and moist environments and its association with listeriosis, a disease with a very high mortality rate. Although there have been no listeriosis outbreaks attributed to fresh mushrooms in the United States, retail surveys and recalls are evidence that L. monocytogenes contamination of mushrooms (Agaricus bisporus) can occur. The objective of this study was to determine the prevalence of Listeria spp., including L. monocytogenes, in a small-scale mushroom production facility on the campus of the Pennsylvania State University in the United States. Of 184 samples taken from five production zones within the facility, 29 (15.8%) samples were positive for Listeria spp. Among the Listeria spp. isolates, L. innocua was most prevalent (10.3%) followed by L. welshimeri (3.3%), L. monocytogenes (1.6%), and L. grayi (0.5%). L. monocytogenes was recovered only from the phase I raw material composting area. Isolates of L. monocytogenes were confirmed and serotyped by multiplex PCR. The epidemiological relatedness of the three L. monocytogenes isolates to those serotypes or lineages frequently encountered in listeriosis infections was determined by multi-virulence-locus sequence typing using six virulence genes, namely, prfA, inlB, inlC, dal, clpP, and lisR. The phylogenetic positions of the three isolates in the dendrogram prepared with data from other isolates of L. monocytogenes showed that all isolates were grouped with serotype 4a, lineage IIIA. To date, this serotype has rarely been reported in foodborne disease outbreaks.
Directory of Open Access Journals (Sweden)
Bahador
2015-08-01
Full Text Available Background Listeria monocytogenes is a foodborne pathogen and a serious threat to the public health in the world. Consumption of traditional foods such as dairy and meat products can be a major reason for relative abundance and isolation of these bacteria. Objectives The purpose of this study was to determine the phenotypic and genotypic characteristics of L. monocytogenes strains isolated from dairy and meat products. Materials and Methods A total of 317 dairy products and meat-processed samples were collected. Antibiotic susceptibility test was performed on each sample by the disk diffusion method (Kirby Bauer. Five reference loci were used for typing of L. monocytogenes strains by MLVA (Multiple Locus VNTR Analysis Technique. Results A total of 24 L. monocytogenes isolates were collected from the dairy and meat products. Resistance of isolated L. monocytogenes strains to penicillin G were 54.54% (from dairy products and 46.15% (from processed meat. Genetic relatedness of isolates were assessed by MLVA. Out of 13 different types, type 2 with 6 strains and type 3 with 4 strains, were the most common types. Conclusions MLVA analysis showed that samples obtained from different sources could have similar genetic profile. As a result, administration of penicillin in patients with listeriosis (especially pregnant women and antibiotic susceptibility test are recommended. The fast and accurate methods such as MLVA for tracking of pollution sources of L. monocytogenes are recommended during outbreaks.
Rodríguez-López, Pedro; Saá-Ibusquiza, Paula; Mosquera-Fernández, Maruxa; López-Cabo, Marta
2015-08-03
In order to find out how real Listeria monocytogenes-carrying biofilms are in industrial settings, a total of 270 environmental samples belonging to work surfaces from fish (n = 123), meat (n = 75) and dairy industries (n = 72) were analysed in order to detect L. monocytogenes. 12 samples were positive for L. monocytogenes and a total of 18 different species were identified as accompanying microbiota in fish and meat industry. No L. monocytogenes was found in samples from dairy industry. Molecular characterisation combining results of AscI and ApaI macrorestriction PFGE assays yielded 7 different subtypes of L. monocytogenes sharing in 71.43% of cases the same serogroup (1/2a-3a). Results from dynamic numerical characterisation between L. monocytogenes monospecies biofilms on stainless steel (SS) using MATLAB-based tool BIOFILMDIVER demonstrated that except in isolate A1, in which a significant increase in the percentage of covered area (CA), average diffusion distance (ADD) and maximum diffusion distance (MDD) was observed after 120 h of culture, no significant differences were observed in the dynamics of the rest of the L. monocytogenes isolates. Quantitative dual-species biofilm association experiments performed on SS indicated that L. monocytogenes cell counts presented lower values in mixed-species cultures with certain species at 24 and 48 h compared with mono-species culture. However, they remained unaltered after 72 h except when co-cultured with Serratia fonticola which presented differences in all sampling times and was also the dominant species within the dual-species biofilm. When considering frequency of appearance of accompanying species, an ecological distribution was demonstrated as Escherichia coli appeared to be the most abundant in fish industry and Carnobacterium spp. in meat industry. Copyright © 2015 Elsevier B.V. All rights reserved.
Pérez-Rodríguez, F.; Asselt, van E.D.; García-Gimeno, R.M.; Zurera, G.; Zwietering, M.H.
2007-01-01
The risk assessment study of Listeria monocytogenes in ready-to-eat foods conducted by the U.S. Food and Drug Administration is an example of an extensive quantitative microbiological risk assessment that could be used by risk analysts and other scientists to obtain information and by managers and
Cossu, Francesca; Spanu, Carlo; Deidda, Silvia; Mura, Erica; Casti, Daniele; Pala, Carlo; Lamon, Sonia; Spanu, Vincenzo; Ibba, Michela; Marrocu, Elena; Scarano, Christian; Piana, Andrea; De Santis, Enrico Pietro Luigi
2016-04-19
Ready-to-eat (RTE) food is characterised by a long shelf-life at refrigerated temperature and can be consumed as such, without any treatment. The aim of the work was to evaluate the presence of Listeria spp. and Listeria monocytogenes in RTEs collected from refrigerated vending machines placed in hospital environment and accessible to the hospitalised patients. In 4 different sampling, 55 RTEs were collected from vending machines of six hospitals located in different areas of Sardinia region. All the samples were characterised by similar manufacturing process, such as the use of modified atmosphere packaging and belonged to 5 different producers. Listeria spp. was not countable using the enumeration method in all of the analysed samples. Using the detection method, Listeria spp. was recovered from 9 sandwich samples. Interestingly, 3 of these samples (5.5%) made by the manufacturer, were positive for L. monocytogenes contamination. The risk related to the L. monocytogenes presence in RTEs proportionally increases when food is introduced in susceptible environments , such as hospitals and consumed by susceptible people . Although the RTEs analysed showed values that complied with the European microbiological criteria for foodstuffs, the availability of these products in a susceptible environment should be carefully checked. Therefore, in order to limit the possible exposition to L. monocytogenes , more information on the risk related to RTE consumption should be provided to the hospitalised patients.
Directory of Open Access Journals (Sweden)
Francesca Cossu
2016-05-01
Full Text Available Ready-to-eat (RTE food is characterised by a long shelf-life at refrigerated temperature and can be consumed as such, without any treatment. The aim of the work was to evaluate the presence of Listeria spp. and Listeria monocytogenes in RTEs collected from refrigerated vending machines placed in hospital environment and accessible to the hospitalised patients. In 4 different sampling, 55 RTEs were collected from vending machines of six hospitals located in different areas of Sardinia region. All the samples were characterised by similar manufacturing process, such as the use of modified atmosphere packaging and belonged to 5 different producers. Listeria spp. was not countable using the enumeration method in all of the analysed samples. Using the detection method, Listeria spp. was recovered from 9 sandwich samples. Interestingly, 3 of these samples (5.5% made by the manufacturer, were positive for L. monocytogenes contamination. The risk related to the L. monocytogenes presence in RTEs proportionally increases when food is introduced in susceptible environments, such as hospitals and consumed by susceptible people. Although the RTEs analysed showed values that complied with the European microbiological criteria for foodstuffs, the availability of these products in a susceptible environment should be carefully checked. Therefore, in order to limit the possible exposition to L. monocytogenes, more information on the risk related to RTE consumption should be provided to the hospitalised patients.
Combined effect of ultrasound and essential oils to reduce Listeria monocytogenes on fresh produce.
Özcan, Gülçin; Demirel Zorba, Nükhet Nilüfer
2016-06-01
Salads prepared from contaminated fresh produce have a high risk of causing food-borne illnesses. Essential oils obtained from plants have antimicrobial activity and may provide a natural approach to reduce the pathogens on fresh produce. Additionally, ultrasound treatments have been shown to reduce the microbial counts on different foods. The objective of this study was to investigate the antimicrobial activities of cinnamon and lemon essential oils in vitro and in food applications. Mixtures of lettuce, parsley and dill were inoculated with Listeria monocytogenes and then dip-treated for 5 min in one of the following treatments: sterile tap water, chlorinated water, 1% lemon essential oil, 2% cinnamon essential oil or 2% cinnamon essential oil + ultrasound. The samples were stored at 4 ℃ and collected at d 0, 1, 3, 5, 7 and 9 post inoculation. The 1% lemon (4 log) and 2% cinnamon (2 log) essential oil washes provided partial inhibition against L. monocytogenes by d 1. The combined application of 2% cinnamon oil and ultrasound resulted in only 0.85 log inhibition by d 1; however, the number of L. monocytogenes increased during storage and became nearly equal to the control at d 9. Therefore, different combinations of essential oils with other antimicrobials or novel technologies are required. © The Author(s) 2015.
Veen, van der S.; Abee, T.
2010-01-01
Listeria monocytogenes is a food-borne pathogen that is able to form biofilms in food processing facilities. Biofilms are generally more resistant to antimicrobial agents, making it difficult to eradicate them during cleanup procedures. So far, little is known about the function of stress resistance
DEFF Research Database (Denmark)
Østergaard, Nina Bjerre; Christiansen, Lasse Engbo; Dalgaard, Paw
2015-01-01
. 2014. Modelling the effect of lactic acid bacteria from starter- and aroma culture on growth of Listeria monocytogenes in cottage cheese. International Journal of Food Microbiology. 188, 15-25]. Growth of L. monocytogenes single cells, using lag time distributions corresponding to three different......A stochastic model was developed for simultaneous growth of low numbers of Listeria monocytogenes and populations of lactic acid bacteria from the aroma producing cultures applied in cottage cheese. During more than two years, different batches of cottage cheese with aroma culture were analysed...
The virulence regulator PrfA promotes biofilm formation by Listeria monocytogenes.
Lemon, Katherine P; Freitag, Nancy E; Kolter, Roberto
2010-08-01
Listeria monocytogenes is a food-borne facultative intracellular pathogen. It is widespread in the environment and has several distinct life-styles. The key transcriptional activator PrfA positively regulates L. monocytogenes virulence genes to mediate the transition from extracellular, flagellum-propelled cell to intracellular pathogen. Here we report the first evidence that PrfA also has a significant positive impact on extracellular biofilm formation. Mutants lacking prfA were defective in surface-adhered biofilm formation. The DeltaprfA mutant exhibited wild-type flagellar motility, and its biofilm defect occurred after initial surface adhesion. We also observed that mutations that led to the constitutive expression of PrfA-dependent virulence genes had a minimal impact on biofilm formation. Furthermore, biofilm development was enhanced in a mutant encoding a PrfA protein variant unable to fully transition from the extracellular form to the virulent, intracellular activity conformation. These results indicate that PrfA positively regulates biofilm formation and suggest that PrfA has a global role in modulating the life-style of L. monocytogenes. The requirement of PrfA for optimal biofilm formation may provide selective pressure to maintain this critical virulence regulator when L. monocytogenes is outside host cells in the environment.
Escolar, Cristina; Gómez, Diego; Del Carmen Rota García, María; Conchello, Pilar; Herrera, Antonio
2017-06-01
The objective of this work was to investigate the antimicrobial resistance in Listeria spp. isolated from food of animal origin. A total of 50 Listeria strains isolated from meat and dairy products, consisting of 7 Listeria monocytogenes and 43 Listeria innocua strains, were characterized for antimicrobial susceptibility against nine antimicrobials. The strains were screened by real-time PCR for the presence of antimicrobial resistance genes: tet M, tet L, mef A, msr A, erm A, erm B, lnu A, and lnu B. Multidrug resistance was identified in 27 Listeria strains, 4 belonging to L. monocytogenes. Resistance to clindamycin was the most common resistance phenotype and was identified in 45 Listeria strains; the mechanisms of resistance are still unknown. A medium prevalence of resistance to tetracycline (15 and 9 resistant and intermediate strains) and ciprofloxacin (13 resistant strains) was also found. Tet M was detected in Listeria strains with reduced susceptibility to tetracycline, providing evidence that both L. innocua and L. monocytogenes displayed acquired resistance. The presence of antimicrobial resistance genes in L. innocua and L. monocytogenes indicates that these genes may be transferred to commensal and pathogenic bacteria via the food chain; besides this, antibiotic resistance in L. monocytogenes could compromise the effective treatment of listeriosis in humans.
Directory of Open Access Journals (Sweden)
Caplan Marius Eduard
2014-06-01
Full Text Available Listeria monocytogenes are o distribuţie ubiquitară în natură şi poate contamina produsele alimentare de origine animală, provocând infecţii severe la om. Până în prezent există foarte puține date cu privire la profilurile de rezistenţă ale tulpinilor circulante în România. Scopul acestui studiu a fost determinarea pattern-urilor de rezistenţă la antibiotice ale unor tulpini de L. monocytogenes (n=37 izolate din produse alimentare de origine animală şi din probe clinice. Probele din alimente (carne şi produse lactate, au fost colectate în perioada 2009-2013. Probele clinice au fost recoltate de la pacienţi cu septicemie, meningită/meningo-encefalită, cazuri de avort spontan şi nou-născuţi, spitalizaţi în perioada Aprilie 2010 - Aprilie 2013 în trei Instituţii Medicale din Bucureşti: Spitalul Elias, Spitalul Victor Babes si Institutul Naţional de Boli Infecţioase (INBI Matei Bals. Toate tulpinile testate au prezentat rezistenţă la cefalosporine şi acidul nalidixic; o tulpină izolată din melci fierţi a fost rezistentă la Trimetoprim/sulfametoxazol. Rezistenţa unora dintre tulpinile analizate la ampicilina, antibiotic de elecţie pentru terapia infecţiilor cauzate de L. monocytogenes, subliniază necesitatea testării in vitro a sensibilitatii la antibiotice a fiecarui izolat clinic pentru a stabili eficienţa diferitelor antibiotice, precum şi a unor studii epidemiologice extinse în scopul stabilirii profilurilor de rezistenţă ale tulpinilor de L. monocytogenes circulante în ţara noastră.
Directory of Open Access Journals (Sweden)
V. López
2006-12-01
. monocytogenes strains. Despite this great step forward, there is not a single marker available to test the virulence of field isolates of this species. In the future, the combination of different molecular markers will probably allow the screening of food contamination by only the virulent clones of L. monocytogenes, thus improving the prevention of foodborne human listeriosis.
Evaluation of the Thermo Scientific SureTect Listeria monocytogenes Assay.
Cloke, Jonathan; Leon-Velarde, Carlos; Larson, Nathan; Dave, Keron; Evans, Katharine; Crabtree, David; Hughes, Annette; Hopper, Craig; Simpson, Helen; Withey, Sophie; Oleksiuk, Milena; Holopainen, Jani; Wickstrand, Nina; Kauppinen, Mikko
2014-01-01
The Thermo Scientific SureTect Listeria monocytogenes Assay is a new real-time PCR assay for the detection of Listeria monocytogenes in food and environmental samples. This assay was validated using the AOAC Research Institute (AOAC-RI) Performance Tested Methods program in comparison to the reference method detailed in International Organization for Standardization 11290-1:1996, including Amendment 1:2004 with the following foods and food contact surfaces: smoked salmon, processed cheese, fresh bagged spinach, fresh cantaloupe, cooked prawns (chilled product), cooked sliced turkey meat (chilled product), ice cream, pork frankfurters, salami, ground raw beef meat (12% fat), plastic, and stainless steel. All matrixes were tested by Thermo Fisher Scientific, Microbiology Division, Basingstoke, UK. In addition, three matrixes (pork frankfurters, bagged lettuce, and stainless steel) were analyzed independently as part of the AOAC-RI controlled laboratory study by the University of Guelph, Canada. Using probability of detection (POD) statistical analysis, a significant difference was demonstrated between the candidate and reference methods for salami, cooked sliced turkey and ice cream in favor of the SureTect assay. For all other matrixes, no significant difference by POD was seen between the two methods during the study. Inclusivity and exclusivity testing was also conducted with 53 and 30 isolates, respectively, which demonstrated that the SureTect assay was able to detect all serotypes of L. monocytogenes. None of the exclusivity isolates analyzed were detected by the SureTect assay. Ruggedness testing was conducted to evaluate the performance of the assay with specific method deviations outside the recommended parameters open to variation, i.e., enrichment time and temperature and lysis temperature, which demonstrated that the assay gave reliable performance. Accelerated stability testing was also conducted, validating the assay shelf life.
Initial adhesion of Listeria monocytogenes to solid surfaces under liquid flow
DEFF Research Database (Denmark)
Szlavik, Julie; Soares Paiva, Dionísio; Mørk, Nils
2012-01-01
.001) was observed but not of interactions between surface-shear stress. No correlation between surface hydrophobicity and IAR was observed. Addition of 5% NaCl during propagation resulted in a decrease in IAR whilst propagation in low nutrient media caused an increase indicating a general change in surface......Some strains of the food borne pathogen Listeria monocytogenes persist in food processing environments. The exact reason behind this phenomenon is not known, but strain differences in the ability to adhere to solid surfaces could offer an explanation. In the present work, initial adhesion of nine...... strains of L. monocytogenes was investigated under liquid flow at two levels of shear stress on six different surfaces using a flow chamber set-up with microscopy measurements. The surfaces tested were glass and PVC, and glass coated with beef extract, casein, and homogenised and unhomogenised milk...
Directory of Open Access Journals (Sweden)
Karla Sequeira Mendonça
2016-01-01
Full Text Available ABSTRACT: Listeria monocytogenes is of notable concern to the food industry, due to its ubiquitous nature and ability to grow in adverse conditions. This study aimed to determine the genotypic profile of L. monocytogenes strains isolated from refrigerated chickens marketed in the southern part of Rio Grande do Sul, Brazil. The strains of L. monocytogenes isolated were characterized by serotyping and Pulsed Field Gel Electrophoresis (PFGE. Three different serotypes (1/2a, 1/2b and 4e were evaluated by PFGE, and the macrorestriction patterns utilizing enzymes AscI and ApaI, revealed five different pulsotypes. The presence of such varied genotypic profiles demonstrates the prevalence of L. monocytogenes contamination of chicken processing environments, which combined with ineffective cleaning procedures, allowing the survival, adaptation and proliferation of these pathogens, not only in the processing environment, but also in local grocery stores.
Pagliano, Pasquale; Ascione, Tiziana; Boccia, Giovanni; De Caro, Francesco; Esposito, Silvano
2016-06-01
Listeria monocytogenes is a Gram-positive bacillus and facultative intracellular bacterium whose transmission occurs mainly through the consumption of contaminated food, L. monocytogenes invades the host cells using various protein and can escape to the human T-cell immune system by cell-to-cell spreading. If the infection is not controlled at the stage in which the bacterium is in the liver, for instance, due to a severe immunodepression, a secondary bacteraemia can be developed and L. monocytogenes reaches the preferred sites transgressing the blood-brain barrier or the placental barrier. Individuals with T-cell dysfunction, such as pregnant women, the elderly, and those receiving immunosuppressive therapy are at the highest risk of contracting the disease. Average life expectancy throughout developed countries has rapidly increased during the latter half of the 20th century and geriatric infectious diseases have become an increasingly important issue. L. monocytogenes meningitis in young previously healthy adults has been reported only in anecdotal observations. Differently, L. monocytogenes is the third most common cause of bacterial meningitis in the elderly population, after Streptococcus pneumoniae and Neisseria meningitidis. Patients with L. monocytogenes meningitis presented with signs and symptoms that were similar to those of the general population with community-acquired bacterial meningitis, but reported a longer prodromal phase. According to literature data, the prevalence of the classic triad of fever, neck stiffness, and altered mental status is 43%, and almost all patients present with at least 2 of the 4 classic symptoms of headache, fever, neck stiffness, and altered mental status. On the basis of our published data, in patients aged over 50 years, diagnosing L. monocytogenes meningitis was more challenging than pneumococcal meningitis, as demonstrated by the lower percentage of cases receiving a correct diagnosis within 48 hours from the onset
Zhao, Xingchen; Zhen, Zhen; Wang, Xinyang; Guo, Na
2017-12-01
Food-borne diseases caused by pathogens, such as Staphylococcus aureus and Listeria monocytogenes, have long attracted attention globally from researchers, food industries, and food safety authorities. Nisin (NS) is the only bacteriocin used worldwide as a generally recognised as safe (GRAS) food preservative, while citric acid (CA) has an unrestricted use in foods since it has GRAS status. In this study, synergistic interactions of NS combined with CA against S. aureus and L. monocytogenes were studied by the chequerboard microdilution method, with fractional inhibitory concentration index values ranging from 0.25 to 0.375 and 0.19 to 0.375, respectively. The positive interactions were verified by time-kill studies in pasteurised milk and disk diffusion assays. The mechanism of the synergistic antibacterial of NS and CA is proposed following SEM analysis and the determination of release of cell constituents. These results suggest that the cell walls and membrane are the probable main targets of this antimicrobial combination. These findings indicated that the combination of NS and CA not only could be used as a new promising naturally sourced food preservative, but may also reduce the problem of bacterial resistance.
Andritsos, Nikolaos D; Mataragas, Marios; Paramithiotis, Spiros; Drosinos, Eleftherios H
2013-12-01
Listeria monocytogenes poses a serious threat to public health, and the majority of cases of human listeriosis are associated with contaminated food. Reliable microbiological testing is needed for effective pathogen control by food industry and competent authorities. The aims of this work were to estimate the prevalence and concentration of L. monocytogenes in minced pork meat by the application of a Bayesian modeling approach, and also to determine the performance of three culture media commonly used for detecting L. monocytogenes in foods from a deterministic and stochastic perspective. Samples (n = 100) collected from local markets were tested for L. monocytogenes using in parallel the PALCAM, ALOA and RAPID'L.mono selective media according to ISO 11290-1:1996 and 11290-2:1998 methods. Presence of the pathogen was confirmed by conducting biochemical and molecular tests. Independent experiments (n = 10) for model validation purposes were performed. Performance attributes were calculated from the presence-absence microbiological test results by combining the results obtained from the culture media and confirmative tests. Dirichlet distribution, the multivariate expression of a Beta distribution, was used to analyze the performance data from a stochastic perspective. No L. monocytogenes was enumerated by direct-plating (media were best at ruling in L. monocytogenes presence than ruling it out. Sensitivity and specificity varied depending on the culture-dependent method. None of the culture media was perfect in detecting L. monocytogenes in minced pork meat alone. The use of at least two culture media in parallel enhanced the efficiency of L. monocytogenes detection. Bayesian modeling may reduce the time needed to draw conclusions regarding L. monocytogenes presence and the uncertainty of the results obtained. Furthermore, the problem of observing zero counts may be overcome by applying Bayesian analysis, making the determination of a test performance feasible
Hansen, Lisbeth Truelstrup; Vogel, Birte Fonnesbech
2011-03-15
The foodborne bacterial pathogen, Listeria monocytogenes, commonly contaminates foods during processing, where the microorganisms are potentially subjected to low relative humidity (RH) conditions for extended periods of time. The objective of this study was to examine survival during desiccation (43% RH and 15 °C) of biofilm L. monocytogenes N53-1 cells on stainless steel coupons and to assess subsequent transfer to salmon products. Formation of static biofilm (2 days at 100% RH and 15 °C) prior to desiccation for 23 days significantly (Pbiofilm cells also desiccated in low salt, indicating the protective effect of the biofilm matrix. Osmoadaptation of cells in 5% NaCl before formation of the static biofilm significantly (Pbiofilm cells was significantly (Pbiofilm bacteria, however, as biofilm formation enhanced desiccation survival more bacteria were still transferred to smoked and fresh salmon. In conclusion, the current work shows the protective effect of biofilm formation, salt and osmoadaptation on the desiccation survival of L. monocytogenes, which in turn increases the potential for cross-contamination during food processing. Copyright © 2011 Elsevier B.V. All rights reserved.
von Laer, Ana Eucares; de Lima, Andréia Saldanha; Trindade, Paula dos Santos; Andriguetto, Cristiano; Destro, Maria Teresa; da Silva, Wladimir Padilha
2009-01-01
Listeria monocytogenes is a bacterium capable to adhere to the surfaces of equipment and utensils and subsequently form biofilms. It can to persist in the food processing environmental for extended periods of time being able to contaminate the final product. The aim of this study was to trace the contamination route of L. monocytogenes on a fresh mixed sausage processing line, from raw material to the final product. The isolates obtained were characterized by serotyping and molecular typing by pulsed-field gel electrophoresis (PFGE) using the restriction enzymes ApaI and AscI. L. monocytogenes was detected in 25% of the samples. The samples of raw material were not contaminated, however, the microorganism was detected in 21% of the environmental samples (food contact and non-food contact), 20.8% of the equipments, 20% of the food worker’s hands, 40% of the mass ready to packaging and in all the final products samples, demonstrating that the contamination of final product occurred during the processing and the importance of cross contamination. PFGE yielded 22 pulsotypes wich formed 7 clusters, and serotyping yielded 3 serotypes and 1 serogroup, however, the presence of serotypes 4b and 1/2b in the final product is of great concern for public health. The tracing of contamination showed that some strains are adapted and persisted in the processing environment in this industry. PMID:24031402
Uyttendaele, M; Busschaert, P; Valero, A; Geeraerd, A H; Vermeulen, A; Jacxsens, L; Goh, K K; De Loy, A; Van Impe, J F; Devlieghere, F
2009-07-31
Processed ready-to-eat (RTE) foods with a prolonged shelf-life under refrigeration are at risk products for listeriosis. This manuscript provides an overview of prevalence data (n=1974) and challenge tests (n=299) related to Listeria monocytogenes for three categories of RTE food i) mayonnaise-based deli-salads (1187 presence/absence tests and 182 challenge tests), ii) cooked meat products (639 presence/absence tests and 92 challenge tests), and iii) smoked fish (90 presence/absence tests and 25 challenge tests), based on data records obtained from various food business operators in Belgium in the frame of the validation and verification of their HACCP plans over the period 2005-2007. Overall, the prevalence of L. monocytogenes in these RTE foods in the present study was lower compared to former studies in Belgium. For mayonnaise-based deli-salads, in 80 out of 1187 samples (6.7%) the pathogen was detected in 25 g. L. monocytogenes positive samples were often associated with smoked fish deli-salads. Cooked meat products showed a 1.1% (n=639) prevalence of the pathogen. For both food categories, numbers per gram never exceeded 100 CFU. L. monocytogenes was detected in 27.8% (25/90) smoked fish samples, while 4/25 positive samples failed to comply to the 100 CFU/g limit set out in EU Regulation 2073/2005. Challenge testing showed growth potential in 18/182 (9.9%) deli-salads and 61/92 (66%) cooked meat products. Nevertheless, both for deli-salads and cooked meat products, appropriate product formulation and storage conditions based upon hurdle technology could guarantee no growth of L. monocytogenes throughout the shelf-life as specified by the food business operator. Challenge testing of smoked fish showed growth of L. monocytogenes in 12/25 samples stored for 3-4 weeks at 4 degrees C. Of 45 (non-inoculated) smoked fish samples (13 of which were initially positive in 25 g) which were subjected to shelf-life testing, numbers exceeded 100 CFU/g in only one sample
Colás-Medà, Pilar; Viñas, Inmaculada; Oliveira, Márcia; Anguera, Marina; Serrano, Jose C E; Abadias, Maribel
2017-04-01
Survival and virulence of foodborne pathogens can be influenced by environmental factors such as the intrinsic properties of food as well as the extrinsic properties that contribute to food shelf life (e.g., temperature and gas atmosphere). The direct contribution of food matrix characteristics on the survival of L. monocytogenes during fresh-cut fruit shelf life is not very well understood. In addition, the gastrointestinal tract is the primary route of listeriosis infection and penetration of the intestinal epithelial cell barrier is the first step in the infection process. Hence, the pathogenic potential of L. monocytogenes, measured as the capability for the organism to survive a simulated gastrointestinal tract and the proportion of cells able to subsequently adhere to and invade differentiated Caco-2 cells, subjected to fresh-cut pear and melon shelf life, was investigated. Samples were inoculated, stored at 10 °C for 7 days and evaluated after inoculation and again after 2 and 7 days of storage. A decrease in L. monocytogenes' capacity to survive a simulated gastrointestinal tract was observed with increasing storage time, regardless of the fruit matrix evaluated. Furthermore, L. monocytogenes placed on fresh-cut pear and melon was subjected to an attachment and invasion assay after crossing the simulated gastrointestinal tract. After inoculation, pathogen on fresh-cut pear showed 5-fold more capacity to adhere to Caco-2 cells than pathogen on fresh-cut melon. After 2 days of storage, L. monocytogenes grown on fresh-cut melon showed similar adhesive capacity (1.11%) than cells grown on pear (1.83%), but cells grown on melon had the higher invasive capacity (0.0093%). We can conclude that minimally processed melon could represent a more important hazard than pear under the studied shelf life. Copyright © 2016 Elsevier Ltd. All rights reserved.
Functional food monitoring as part of the new Dutch dietary monitoring system
Rompelberg CJM; Jager M; Bakker MI; Buurma-Rethans EJM; Ocke MC; CVG
2006-01-01
Good data on functional food consumption necessary for an adequate Dutch nutrition policy are lacking. This lack may be overcome in future by including functional food monitoring in the new dietary monitoring system in the Netherlands. One specific form of monitoring could be an Internet-based
Rychli, Kathrin; Grunert, Tom; Ciolacu, Luminita; Zaiser, Andreas; Razzazi-Fazeli, Ebrahim; Schmitz-Esser, Stephan; Ehling-Schulz, Monika; Wagner, Martin
2016-02-02
The foodborne pathogen Listeria monocytogenes, responsible for listeriosis a rare but severe infection disease, can survive in the food processing environment for month or even years. So-called persistent L. monocytogenes strains greatly increase the risk of (re)contamination of food products, and are therefore a great challenge for food safety. However, our understanding of the mechanism underlying persistence is still fragmented. In this study we compared the exoproteome of three persistent strains with the reference strain EGDe under mild stress conditions using 2D differential gel electrophoresis. Principal component analysis including all differentially abundant protein spots showed that the exoproteome of strain EGDe (sequence type (ST) 35) is distinct from that of the persistent strain R479a (ST8) and the two closely related ST121 strains 4423 and 6179. Phylogenetic analyses based on multilocus ST genes showed similar grouping of the strains. Comparing the exoproteome of strain EGDe and the three persistent strains resulted in identification of 22 differentially expressed protein spots corresponding to 16 proteins. Six proteins were significantly increased in the persistent L. monocytogenes exoproteomes, among them proteins involved in alkaline stress response (e.g. the membrane anchored lipoprotein Lmo2637 and the NADPH dehydrogenase NamA). In parallel the persistent strains showed increased survival under alkaline stress, which is often provided during cleaning and disinfection in the food processing environments. In addition, gene expression of the proteins linked to stress response (Lmo2637, NamA, Fhs and QoxA) was higher in the persistent strain not only at 37 °C but also at 10 °C. Invasion efficiency of EGDe was higher in intestinal epithelial Caco2 and macrophage-like THP1 cells compared to the persistent strains. Concurrently we found higher expression of proteins involved in virulence in EGDe e.g. the actin-assembly-inducing protein ActA and the
Fravalo, Philippe; Cherifi, Tamazight; Neira Feliciano, Kersti Dina; Letellier, Ann; Fairbrother, Julie-Hélène; Bekal, Sadjia
2017-01-01
The introduction of Listeria monocytogenes into the food production chain is a concern, with numerous grouped cases of listeriosis associated with milk-derived or pork-derived products have been documented. Management of this zoonotic pathogen considers all strains as an equal risk. Recently, a new perspective for characterisation of strain virulence was introduced with the discovery of the unaltered sequence of InlA as a determinant of strain virulence; this has also been reported as an infrequent finding among so-called environmental strains, that is, strains isolated from food or from surfaces in food industries. The aim of this study was to differentiate L monocytogenes strains isolated from animal cases versus those from human cases and to differentiate clinical strains from environmental ones using a Caenorhabditis elegans virulence testing model. In Quebec in 2013/2014, the surveillance of L monocytogenes clinical isolates registered a total of 20 strains of animal origin and 16 pulsed-field gel electrophoresis types isolated from human cases. The mixed PCR multiplex agglutination protocol used for geno-serotyping clearly discriminated genogroup IVB strains from bovine and human origins. The presence of a premature stop codon single nucleotide polymorphism in the inlA gene sequence in clinical strains and the identical behaviour of particular strains in the C elegans model are discussed in this paper from the perspective of industrial management of L monocytogenes risk. PMID:28761668
Zhang, Cathy X. Y.; Brooks, Brian W.; Huang, Hongsheng; Pagotto, Franco
2016-01-01
ABSTRACT The Gram-positive bacterium Listeria monocytogenes causes a significant percentage of the fatalities among foodborne illnesses in humans. Surface proteins specifically expressed in a wide range of L. monocytogenes serotypes under selective enrichment culture conditions could serve as potential biomarkers for detection and isolation of this pathogen via antibody-based methods. Our study aimed to identify such biomarkers. Interrogation of the L. monocytogenes serotype 4b strain F2365 genome identified 130 putative or known surface proteins. The homologues of four surface proteins, LMOf2365_0578, LMOf2365_0581, LMOf2365_0639, and LMOf2365_2117, were assessed as biomarkers due to the presence of conserved regions among strains of L. monocytogenes which are variable among other Listeria species. Rabbit polyclonal antibodies against the four recombinant proteins revealed the expression of only LMOf2365_0639 on the surface of serotype 4b strain LI0521 cells despite PCR detection of mRNA transcripts for all four proteins in the organism. Three of 35 monoclonal antibodies (MAbs) to LMOf2365_0639, MAbs M3643, M3644, and M3651, specifically recognized 42 (91.3%) of 46 L. monocytogenes lineage I and II isolates grown in nonselective brain heart infusion medium. While M3644 and M3651 reacted with 14 to 15 (82.4 to 88.2%) of 17 L. monocytogenes lineage I and II isolates, M3643 reacted with 22 (91.7%) of 24 lineage I, II, and III isolates grown in selective enrichment media (UVM1, modified Fraser, Palcam, and UVM2 media). The three MAbs exhibited only weak reactivities (the optical densities at 414 nm were close to the cutoff value) to some other Listeria species grown in selective enrichment media. Collectively, the data indicate the potential of LMOf2365_0639 as a surface biomarker of L. monocytogenes, with the aid of specific MAbs, for pathogen detection, identification, and isolation in clinical, environmental, and food samples. IMPORTANCE L. monocytogenes is
Radiological monitoring of food in Cuba
International Nuclear Information System (INIS)
Jerez V, S.F.
1996-01-01
The appearing of the problem for protecting the environment from radioactive contamination is not an accidental matter. The introduction into the earth crust of radioactive material coming from nuclear weapons, accidents, wastes, etc, has caused, as a consequence, the contamination of the biosphere. The extensive trade of food in our country has made necessary the establishment of radiological monitoring in food, which was organized by the Department of Public Health. The structure, functions, characteristics and aspects related to radiological monitoring of food in Cuba are shown in the present paper. The organization and resources for performing the monitoring program, both for normal conditions and for nuclear and/or radiological emergency cases, are detailed. (author). 12 refs., 2 figs
Directory of Open Access Journals (Sweden)
Negar Hamidian
2017-07-01
Full Text Available 1-Mortazavi S, Gods rohani M, Juyande H. milk and dairy products technology. The University Ferdowsi Mashhad; 1996. p. 266. 2-Azadnia P, Ghasemi M, Abbasi M, Taarof N, Jashni M. Microbial Quality of Traditional Ice Cream Produced by Small-Scale Manufacturers in Khormoj and Its Comparison with the Iranian National Standard. Journal of Animal and Veterinary Advances 2011;10(6:742-4. 3- Ziabari Mirnezami H. What do you know about milk (Milk chemical technology: Tehran University; 1996. 4-Movassagh MH, Movassagh A, Mahmoodi H, Servatkhah F, Sourorbakhsh MR. Microbiological contamination of the traditional chocolate Ice cream sold in the Northwest Region of Iran. Global Veterinaria 2011;6(3:269-71. 5-Karim G, Razavilar V, Akhonndzade A. survey contamination of traditional ice cream to bacteria causing the infection and food poisoning[persian]. Tehran University Faculty of Veterinary 1374;50:71-8. 6-Kanbakan U, Con A, Ayar A. Determination of microbiological contamination sources during ice cream production in Denizli, Turkey. Food Control 2004;15(6:463-70. 7- Fallah AA, Saei-Dehkordi SS, Rahnama M, Tahmasby H, Mahzounieh M. Prevalence and antimicrobial resistance patterns of Listeria species isolated from poultry products marketed in Iran. Food Control 2012;28(2:327-32. 8-Farber J, Peterkin P. Listeria monocytogenes, a food-borne pathogen. Microbiological reviews 1991;55(3:476. 9-Navratilova P, Schlegelova J, Sustackova A, Napravnikova E, Lukasova J, Klimova E. Prevalence of Listeria monocytogenes in milk, meat and foodstuff of animal origin and the phenotype of antibiotic resistance of isolated strains. Veterinarni Medicina-UZPI 2004;49. 10-Williams SK, Roof S, Boyle EA, Burson D, Thippareddi H, Geornaras I, et al. Molecular ecology of Listeria monocytogenes and other Listeria species in small and very small ready-to-eat meat processing plants. J Food Prot 2011;74(1:63-77. 11-Halter E, Neuhaus K, Scherer S. Listeria weihenstephanensis sp. nov
Endrikat, Sarah; Gallagher, Daniel; Pouillot, Régis; Hicks Quesenberry, Heather; Labarre, David; Schroeder, Carl M; Kause, Janell
2010-04-01
Deli meat was ranked as the highest-risk ready-to-eat food vehicle of Listeria monocytogenes within the 2003 U.S. Food and Drug Administration and U.S. Department of Agriculture, Food Safety and Inspection Service risk assessment. The comparative risk of L. monocytogenes in retail-sliced versus prepackaged deli meats was evaluated with a modified version of this model. Other research has found that retail-sliced deli meats have both higher prevalence and levels of L. monocytogenes than have product sliced and packaged at the manufacturer level. The updated risk assessment model considered slicing location as well as the use of growth inhibitors. The per annum comparative risk ratio for the number of deaths from retail-sliced versus prepackaged deli meats was found to be 4.89, and the per-serving comparative risk ratio was 4.27. There was a significant interaction between the use of growth inhibitors and slicing location. Almost 70% of the estimated deaths occurred from retail-sliced product that did not possess a growth inhibitor. A sensitivity analysis, assessing the effect of the model's consumer storage time and shelf life assumptions, found that even if retail-sliced deli meats were stored for a quarter of the time prepackaged deli meats were stored, retail-sliced product is 1.7 times more likely to result in death from listeriosis. Sensitivity analysis also showed that the shelf life assumption had little effect on the comparative risk ratio.
Biofilm formation by Listeria monocytogenes on stainless steel surface and biotransfer potential
Directory of Open Access Journals (Sweden)
Maíra Maciel Mattos de Oliveira
2010-03-01
Full Text Available An experimental model was proposed to study biofilm formation by Listeria monocytogenes ATCC 19117 on AISI 304 (#4 stainless steel surface and biotransfer potential during this process. In this model, biofilm formation was conducted on the surface of stainless steel coupons, set on a stainless steel base with 4 divisions, each one supporting 21 coupons. Trypic Soy Broth was used as bacterial growth substrate, with incubation at 37 ºC and stirring of 50 rpm. The number of adhered cells was determined after 3, 48, 96, 144, 192 and 240 hours of biofilm formation and biotransfer potential from 96 hours. Stainless steel coupons were submitted to Scanning Electron Microscopy (SEM after 3, 144 and 240 hours. Based on the number of adhered cells and SEM, it was observed that L. monocytogenes adhered rapidly to the stainless steel surface, with mature biofilm being formed after 240 hours. The biotransfer potential of bacterium to substrate occurred at all the stages analyzed. The rapid capacity of adhesion to surface, combined with biotransfer potential throughout the biofilm formation stages, make L. monocytogenes a potential risk to the food industry. Both the experimental model developed and the methodology used were efficient in the study of biofilm formation by L. monocytogenes on stainless steel surface and biotransfer potential.
Biofilm formation by Listeria monocytogenes on stainless steel surface and biotransfer potential.
de Oliveira, Maíra Maciel Mattos; Brugnera, Danilo Florisvaldo; Alves, Eduardo; Piccoli, Roberta Hilsdorf
2010-01-01
An experimental model was proposed to study biofilm formation by Listeria monocytogenes ATCC 19117 on AISI 304 (#4) stainless steel surface and biotransfer potential during this process. In this model, biofilm formation was conducted on the surface of stainless steel coupons, set on a stainless steel base with 4 divisions, each one supporting 21 coupons. Trypic Soy Broth was used as bacterial growth substrate, with incubation at 37 °C and stirring of 50 rpm. The number of adhered cells was determined after 3, 48, 96, 144, 192 and 240 hours of biofilm formation and biotransfer potential from 96 hours. Stainless steel coupons were submitted to Scanning Electron Microscopy (SEM) after 3, 144 and 240 hours. Based on the number of adhered cells and SEM, it was observed that L. monocytogenes adhered rapidly to the stainless steel surface, with mature biofilm being formed after 240 hours. The biotransfer potential of bacterium to substrate occurred at all the stages analyzed. The rapid capacity of adhesion to surface, combined with biotransfer potential throughout the biofilm formation stages, make L. monocytogenes a potential risk to the food industry. Both the experimental model developed and the methodology used were efficient in the study of biofilm formation by L. monocytogenes on stainless steel surface and biotransfer potential.
The objective of this study was to determine the effect of strain and temperature on growth and biofilm formation by Listeria monocytogenes (Lm) in high and low concentrations of catfish mucus extract on different food-contact surfaces at 10°C and 22°C. The second objective of this study was to eval...
Biocontrol and Rapid Detection of Food-borne Pathogens Using Bacteriophages and Endolysins
Directory of Open Access Journals (Sweden)
Jaewoo eBai
2016-04-01
Full Text Available Bacteriophages have been suggested as natural food preservatives as well as rapid detection materials for food-borne pathogens in various foods. Since Listeria monocytogenes-targeting phage cocktail (ListShield was approved for applications in foods, numerous phages have been screened and experimentally characterized for phage applications in foods. A single phage and phage cocktail treatments to various foods contaminated with food-borne pathogens including E. coli O157:H7, Salmonella enterica, Campylobacter jejuni, Listeria monocytogenes, Staphylococcus aureus, Cronobacter sakazakii, and Vibrio spp. revealed that they have great potential to control various food-borne pathogens and may be alternative for conventional food preservatives. In addition, phage-derived endolysins with high host specificity and host lysis activities may be preferred to food applications rather than phages. For rapid detection of food-borne pathogens, cell-wall binding domains (CBDs from endolysins have been suggested due to their high host-specific binding. Fluorescence-tagged CBDs have been successfully evaluated and suggested to be alternative materials of expensive antibodies for various detection applications. Most recently, reporter phage systems have been developed and tested to confirm their usability and accuracy for specific detection. These systems revealed some advantages like rapid detection of only viable pathogenic cells without interference by food components in a very short reaction time, suggesting that these systems may be suitable for monitoring of pathogens in foods. Consequently, phage is the next-generation biocontrol agent as well as rapid detection tool to confirm and even identify the food-borne pathogens present in various foods.
Little, C L; Taylor, F C; Sagoo, S K; Gillespie, I A; Grant, K; McLauchlin, J
2007-01-01
As part of the European Commission (EC) co-ordinated programme for 2005, a study of pre-packaged ready-to-eat (RTE) mixed salads containing meat or seafood ingredients from retail premises was undertaken in the UK to determine the frequency and level of Listeria monocytogenes in these products. Almost all (99.8%; 2682/2686) samples were of satisfactory/acceptable microbiological quality. Two (0.1%) samples exceeded EC legal food safety criteria due to the presence of L. monocytogenes in excess of 100 cfu g(-1) (1.7 x 10(2), 9.9 x 10(2)cfu g(-1)) while another two (0.1%) were unsatisfactory due to L. welshimeri levels over 100 cfu g(-1) (1.2 x 10(3), 6.0 x 10(3) cfu g(-1)). Overall contamination of Listeria spp. and L. monocytogenes found in samples of mixed salads in the UK was 10.8% and 4.8%, respectively. Almost twice as many salad samples with meat ingredients were contaminated with Listeria spp. and L. monocytogenes (14.7% and 6.0%, respectively) compared to samples with seafood ingredients (7.4% and 3.8%, respectively). Pre-packaged mixed salads were contaminated with Listeria spp. and L. monocytogenes more frequently when: collected from sandwich shops; not packaged on the premises; stored or displayed above 8 degrees C. This study demonstrates that the control of L. monocytogenes in food manufacturing and at retail sale is essential in order to minimize the potential for this bacterium to be present in mixed salads at the point of consumption at levels hazardous to health.
Vangay, P; Steingrimsson, J; Wiedmann, M; Stasiewicz, M J
2014-10-01
Increasing evidence suggests that persistence of Listeria monocytogenes in food processing plants has been the underlying cause of a number of human listeriosis outbreaks. This study extracts criteria used by food safety experts in determining bacterial persistence in the environment, using retail delicatessen operations as a model. Using the Delphi method, we conducted an expert elicitation with 10 food safety experts from academia, industry, and government to classify L. monocytogenes persistence based on environmental sampling results collected over six months for 30 retail delicatessen stores. The results were modeled using variations of random forest, support vector machine, logistic regression, and linear regression; variable importance values of random forest and support vector machine models were consolidated to rank important variables in the experts' classifications. The duration of subtype isolation ranked most important across all expert categories. Sampling site category also ranked high in importance and validation errors doubled when this covariate was removed. Support vector machine and random forest models successfully classified the data with average validation errors of 3.1% and 2.2% (n = 144), respectively. Our findings indicate that (i) the frequency of isolations over time and sampling site information are critical factors for experts determining subtype persistence, (ii) food safety experts from different sectors may not use the same criteria in determining persistence, and (iii) machine learning models have potential for future use in environmental surveillance and risk management programs. Future work is necessary to validate the accuracy of expert and machine classification against biological measurement of L. monocytogenes persistence. © 2014 Society for Risk Analysis.
Uncovering Listeria monocytogenes hypervirulence by harnessing its biodiversity
Charlier, Caroline; Touchon, Marie; Chenal-Francisque, Viviane; Leclercq, Alexandre; Criscuolo, Alexis; Gaultier, Charlotte; Roussel, Sophie; Brisabois, Anne; Disson, Olivier; Rocha, Eduardo P. C.; Brisse, Sylvain; Lecuit, Marc
2016-01-01
Microbial pathogenesis studies are typically performed with reference strains, thereby overlooking microbial intra-species virulence heterogeneity. Here we integrated human epidemiological and clinical data with bacterial population genomics to harness the biodiversity of the model foodborne pathogen Listeria monocytogenes and decipher the basis of its neural and placental tropisms. Taking advantage of the clonal structure of this bacterial species, we identify clones epidemiologically associated with either food or human central nervous system (CNS) and maternal-neonatal (MN) listeriosis. The latter are also most prevalent in patients without immunosuppressive comorbidities. Strikingly, CNS and MN clones are hypervirulent in a humanized mouse model of listeriosis. By integrating epidemiological data and comparative genomics, we uncovered multiple novel putative virulence factors and demonstrated experimentally the contribution of the first gene cluster mediating Listeria monocytogenes neural and placental tropisms. This study illustrates the exceptional power of harnessing microbial biodiversity to identify clinically relevant microbial virulence attributes. PMID:26829754
Winkowski, K; Crandall, A D; Montville, T J
1993-01-01
The ability of Lactobacillus bavaricus, a meat isolate, to inhibit the growth of three Listeria monocytogenes strains was examined in three beef systems: beef cubes, beef cubes in gravy, and beef cubes in gravy containing glucose. The beef was minimally heat treated, inoculated with L. bavaricus at 10(5) or 10(3) CFU/g and L. monocytogenes at 10(2) CFU/g, vacuum sealed, and stored at 4 or 10 degrees C. The meat samples were monitored for microbial growth, pH, and bacteriocin production. The p...
Listeria spp. in Street-Vended Ready-to-Eat Foods
El-Shenawy, Moustafa; El-Shenawy, Mohamed; Mañes, Jordi; Soriano, Jose M.
2011-01-01
Street-vended ready-to-eat food sold in Egypt, including sandwiches and dishes of traditional food, was examined for the presence of Listeria species. Out of 576 samples, 24% were found to contain Listeria species. L. monocytogenes and L. innocua were isolated from 57% and 39% of the contaminated samples, respectively. Other Listeria spp. were detected with lower frequency. L. monocytogenes of ≥103 CFU/g were detected in 7% of the total examined samples, which represent 49% of the contaminated food samples (meat, poultry, seafood, dairy products, and products of plant origin). Most of the samples contaminated by L. monocytogenes had high levels of total viable bacterial counts. The results obtained may help to clarify the epidemiology of listeriosis in the country and draw the attention of the decision makers to issue hygienic regulations for food processing industries as well as street vendors in order to ensure safe street-vended ready-to-eat food. PMID:22194742
Listeria spp. in Street-Vended Ready-to-Eat Foods
Directory of Open Access Journals (Sweden)
Moustafa El-Shenawy
2011-01-01
Full Text Available Street-vended ready-to-eat food sold in Egypt, including sandwiches and dishes of traditional food, was examined for the presence of Listeria species. Out of 576 samples, 24% were found to contain Listeria species. L. monocytogenes and L. innocua were isolated from 57% and 39% of the contaminated samples, respectively. Other Listeria spp. were detected with lower frequency. L. monocytogenes of ≥103 CFU/g were detected in 7% of the total examined samples, which represent 49% of the contaminated food samples (meat, poultry, seafood, dairy products, and products of plant origin. Most of the samples contaminated by L. monocytogenes had high levels of total viable bacterial counts. The results obtained may help to clarify the epidemiology of listeriosis in the country and draw the attention of the decision makers to issue hygienic regulations for food processing industries as well as street vendors in order to ensure safe street-vended ready-to-eat food.
Listeria monocytogenes inhibition by defatted mustard meal-based edible films.
Lee, Hahn-Bit; Noh, Bong Soo; Min, Sea C
2012-02-01
An antimicrobial edible film was developed from defatted mustard meal (Sinapis alba) (DMM), a byproduct from the bio-fuel industry, without incorporating external antimicrobials and its antimicrobial activity against Listeria monocytogenes and physical properties were investigated. The DMM colloidal solution consisting of 184 g water, 14 g DMM, and 2g glycerol was homogenized and incubated at 37°C for 0.2, 0.5, 24 or 48 h to prepare a film-forming solution. The pH of a portion of the film-forming solution (pH 5.5) was adjusted to 2.0 or 4.0. Films were formed by drying the film-forming solutions at 23°C for 48 h. The film-forming solution incubated for 48 h inhibited L. monocytogenes in broth and on agar media. Antimicrobial effects of the film prepared from the 48 h-incubated solution increased with decrease in pH of the solution from 5.5 to 2.0. The film from the film forming solution incubated for 48 h (pH 2.0) initially inhibited more than 4.0 log CFU/g of L. monocytogenes inoculated on film-coated salmon. The film-coating retarded the growth of L. monocytogenes in smoked salmon at 5, 10, and 15°C and the antimicrobial effect during storage was more noticeable when the coating was applied before inoculation than when it was applied after inoculation. The tensile strength, percentage elongation, solubility in watercxu, and water vapor permeability of the anti microbial film were 2.44 ± 0.19 MPa, 6.40 ± 1.13%, 3.19 ± 0.90%, and 3.18 ± 0.63 gmm/kPa hm(2), respectively. The antimicrobial DMM films have demonstrated a potential to be applied to foods as wraps or coatings to control the growth of L. monocytogenes. Copyright © 2011 Elsevier B.V. All rights reserved.
DEFF Research Database (Denmark)
Hansen, Lisbeth Truelstrup; Vogel, Birte Fonnesbech
2011-01-01
The foodborne bacterial pathogen, Listeria monocytogenes, commonly contaminates foods during processing, where the microorganisms are potentially subjected to low relative humidity (RH) conditions for extended periods of time. The objective of this study was to examine survival during desiccation...... (43% RH and 15°C) of biofilm L. monocytogenes N53-1 cells on stainless steel coupons and to assess subsequent transfer to salmon products. Formation of static biofilm (2days at 100% RH and 15°C) prior to desiccation for 23days significantly (P...
Vivant, Anne-Laure; Garmyn, Dominique; Maron, Pierre-Alain; Nowak, Virginie; Piveteau, Pascal
2013-01-01
Understanding the ecology of pathogenic organisms is important in order to monitor their transmission in the environment and the related health hazards. We investigated the relationship between soil microbial diversity and the barrier effect against Listeria monocytogenes invasion. By using a dilution-to-extinction approach, we analysed the consequence of eroding microbial diversity on L. monocytogenes population dynamics under standardised conditions of abiotic parameters and microbial abundance in soil microcosms. We demonstrated that highly diverse soil microbial communities act as a biological barrier against L. monocytogenes invasion and that phylogenetic composition of the community also has to be considered. This suggests that erosion of diversity may have damaging effects regarding circulation of pathogenic microorganisms in the environment.
Nicholas, R; Dunton, P; Tatham, A; Fielding, L
2013-08-01
The effects of gaseous ozone and open air factor (OAF) on environmental Listeria monocytogenes attached to three common food contact surfaces were investigated. Listeria monocytogenes on different food contact surfaces was treated with ozone and OAF. Microbiological counts, scanning electron microscopy (SEM) and atomic force microscopy (AFM) were performed. Ozone at 10 ppm gave <1-log reduction when L. monocytogenes was attached to stainless steel, while 45 ppm gave a log reduction of 3.41. OAF gave better log reductions than 10 ppm ozone, but lower log reductions than 45 ppm. Significant differences were found between surfaces. Biofilm organisms were significantly more resistant than those surface attached on stainless steel. SEM and AFM demonstrated different membrane and cell surface modifications following ozone or OAF treatment. The strain used demonstrated higher resistance to ozone than previous studies. This may be due to the fact that it was isolated from a food manufacturing premises that used oxidizing disinfectants. OAF was more effective at reducing the levels of the organism than an ozone concentration of 10 ppm. Pathogen management strategies must account for resistance of environmental strains when validating cleaning and disinfection. OAF has shown potential for surface decontamination compared with ozone. SEM and AFM are valuable tools for determining mechanisms of action of antimicrobial agents. © 2013 The Society for Applied Microbiology.
Directory of Open Access Journals (Sweden)
Maysa A. I. Awadallah
2014-10-01
Full Text Available Aim: This study aimed to investigate the occurrence of some virulence genes distributed in Listeria monocytogenes isolated from ready-to-eat (RTE meat products and consumers in Cairo province, Egypt. Materials and Methods: A total of 120 beef luncheon, chicken luncheon and frankfurter beef (40 samples, each were collected from 10 different local shops situated in Al-salam city, Cairo province, Egypt. Stool samples were collected from 40 people who had the habit of consuming RTE meat. The suspected L. monocytogenes isolates were subjected to a multiplex polymerase chain reaction (PCR for rapid speciation and virulence determination using primers specific for inIA, inIC, and inIJ genes. Results: Culture examination of all samples on Oxford media revealed presence of colonies characteristic to L. monocytogenes in 6 beef luncheon (15%, 4 chicken luncheon (10%, 1 frankfurter beef (2.5% and 1 human stool (2.5% samples. Species identity of L. monocytogenes was verified through the amplification of a 800 bp fragment with inIA primers in 2 out of 6 culture isolates from beef luncheon (5%, and 1 out 4 culture isolates from chicken luncheon (2.5% samples. Statistical analysis revealed no significant difference between the occurrence of L. monocytogenes in different food samples examined (p>0.05. The virulence of these strains was ascertained by the presence of 517 bp and 238 bp fragments of inIC and inIJ genes, respectively in the isolates that contained the 800 bp fragment. The culture isolates obtained from one frankfurter beef sample, and one human stool sample were found negative by multiplex PCR for the presence of L. monocytogenes and its virulence specific genes. Conclusion: It could be concluded that L. monocytogenes are circulating in beef and chicken luncheon sold in Cairo, Egypt. Multiplex PCR is reliable for confirmation of L. monocytogenes. This study suggests the implementation of hygienic measures at all levels from production to consumption
Growth, viability and architecture of biofilms of Listeria monocytogenes formed on abiotic surfaces
Directory of Open Access Journals (Sweden)
Fernanda Barbosa dos Reis-Teixeira
Full Text Available Abstract The pathogenic bacterium Listeria monocytogenes can persist in food processing plants for many years, even when appropriate hygienic measures are in place, with potential for contaminating ready-to-eat products and, its ability to form biofilms on abiotic surfaces certainly contributes for the environmental persistence. In this research, L. monocytogenes was grown in biofilms up 8 days attached to stainless steel and glass surfaces, contributing for advancing the knowledge on architecture of mature biofilms, since many literature studies carried out on this topic considered only early stages of cell adhesion. In this study, biofilm populations of two strains of L. monocytogenes (serotypes 1/2a and 4b on stainless steel coupons and glass were examined using regular fluorescence microscopy, confocal laser scanning microscopy and classic culture method. The biofilms formed were not very dense and microscopic observations revealed uneven biofilm structures, with presence of exopolymeric matrix surrounding single cells, small aggregates and microcolonies, in a honeycomb-like arrangement. Moreover, planktonic population of L. monocytogenes (present in broth media covering the abiotic surface remained stable throughout the incubation time, which indicates an efficient dispersal mechanism, since the culture medium was replaced daily. In conclusion, even if these strains of L. monocytogenes were not able to form thick multilayer biofilms, it was noticeable their high persistence on abiotic surfaces, reinforcing the need to focus on measures to avoid biofilm formation, instead of trying to eradicate mature biofilms.
Growth, viability and architecture of biofilms of Listeria monocytogenes formed on abiotic surfaces.
Reis-Teixeira, Fernanda Barbosa Dos; Alves, Virgínia Farias; de Martinis, Elaine Cristina Pereira
The pathogenic bacterium Listeria monocytogenes can persist in food processing plants for many years, even when appropriate hygienic measures are in place, with potential for contaminating ready-to-eat products and, its ability to form biofilms on abiotic surfaces certainly contributes for the environmental persistence. In this research, L. monocytogenes was grown in biofilms up 8 days attached to stainless steel and glass surfaces, contributing for advancing the knowledge on architecture of mature biofilms, since many literature studies carried out on this topic considered only early stages of cell adhesion. In this study, biofilm populations of two strains of L. monocytogenes (serotypes 1/2a and 4b) on stainless steel coupons and glass were examined using regular fluorescence microscopy, confocal laser scanning microscopy and classic culture method. The biofilms formed were not very dense and microscopic observations revealed uneven biofilm structures, with presence of exopolymeric matrix surrounding single cells, small aggregates and microcolonies, in a honeycomb-like arrangement. Moreover, planktonic population of L. monocytogenes (present in broth media covering the abiotic surface) remained stable throughout the incubation time, which indicates an efficient dispersal mechanism, since the culture medium was replaced daily. In conclusion, even if these strains of L. monocytogenes were not able to form thick multilayer biofilms, it was noticeable their high persistence on abiotic surfaces, reinforcing the need to focus on measures to avoid biofilm formation, instead of trying to eradicate mature biofilms. Copyright © 2017. Published by Elsevier Editora Ltda.
Infectious Dose of Listeria monocytogenes in Outbreak Linked to Ice Cream, United States, 2015.
Pouillot, Régis; Klontz, Karl C; Chen, Yi; Burall, Laurel S; Macarisin, Dumitru; Doyle, Matthew; Bally, Kären M; Strain, Errol; Datta, Atin R; Hammack, Thomas S; Van Doren, Jane M
2016-12-01
The relationship between the number of ingested Listeria monocytogenes cells in food and the likelihood of developing listeriosis is not well understood. Data from an outbreak of listeriosis linked to milkshakes made from ice cream produced in 1 factory showed that contaminated products were distributed widely to the public without any reported cases, except for 4 cases of severe illness in persons who were highly susceptible. The ingestion of high doses of L. monocytogenes by these patients infected through milkshakes was unlikely if possible additional contamination associated with the preparation of the milkshake is ruled out. This outbreak illustrated that the vast majority of the population did not become ill after ingesting a low level of L. monocytogenes but raises the question of listeriosis cases in highly susceptible persons after distribution of low-level contaminated products that did not support the growth of this pathogen.
Directory of Open Access Journals (Sweden)
Ninoska eCordero
2016-03-01
Full Text Available Listeria monocytogenes has become one of the principal foodborne pathogens worldwide. The capacity of this bacterium to grow at low temperatures has opened an interesting field of study in terms of the identification and classification of new strains of L. monocytogenes with different growth capacities at low temperatures. We determined the growth rate at 8 ºC of 110 strains of L. monocytogenes isolated from different food matrices. We identified a group of slow and fast strains according to their growth rate at 8 °C and performed a global transcriptomic assay in strains previously adapted to low temperature. We then identified shared and specific transcriptional mechanisms, metabolic and cellular processes of both groups; bacterial motility was the principal process capable of differentiating the adaptation capacity of L. monocytogenes strains with different ranges of tolerance to low temperatures. Strains belonging to the fast group were less motile, which may allow these strains to achieve a greater rate of proliferation at low temperature.
A Novel Role of Listeria monocytogenes Membrane Vesicles in Inhibition of Autophagy and Cell Death.
Vdovikova, Svitlana; Luhr, Morten; Szalai, Paula; Nygård Skalman, Lars; Francis, Monika K; Lundmark, Richard; Engedal, Nikolai; Johansson, Jörgen; Wai, Sun N
2017-01-01
Bacterial membrane vesicle (MV) production has been mainly studied in Gram-negative species. In this study, we show that Listeria monocytogenes , a Gram-positive pathogen that causes the food-borne illness listeriosis, produces MVs both in vitro and in vivo . We found that a major virulence factor, the pore-forming hemolysin listeriolysin O (LLO), is tightly associated with the MVs, where it resides in an oxidized, inactive state. Previous studies have shown that LLO may induce cell death and autophagy. To monitor possible effects of LLO and MVs on autophagy, we performed assays for LC3 lipidation and LDH sequestration as well as analysis by confocal microscopy of HEK293 cells expressing GFP-LC3. The results revealed that MVs alone did not affect autophagy whereas they effectively abrogated autophagy induced by pure LLO or by another pore-forming toxin from Vibrio cholerae , VCC. Moreover, Listeria monocytogenes MVs significantly decreased Torin1-stimulated macroautophagy. In addition, MVs protected against necrosis of HEK293 cells caused by the lytic action of LLO. We explored the mechanisms of LLO-induced autophagy and cell death and demonstrated that the protective effect of MVs involves an inhibition of LLO-induced pore formation resulting in inhibition of autophagy and the lytic action on eukaryotic cells. Further, we determined that these MVs help bacteria to survive inside eukaryotic cells (mouse embryonic fibroblasts). Taken together, these findings suggest that intracellular release of MVs from L. monocytogenes may represent a bacterial strategy to survive inside host cells, by its control of LLO activity and by avoidance of destruction from the autophagy system during infection.
A Novel Role of Listeria monocytogenes Membrane Vesicles in Inhibition of Autophagy and Cell Death
Directory of Open Access Journals (Sweden)
Svitlana Vdovikova
2017-05-01
Full Text Available Bacterial membrane vesicle (MV production has been mainly studied in Gram-negative species. In this study, we show that Listeria monocytogenes, a Gram-positive pathogen that causes the food-borne illness listeriosis, produces MVs both in vitro and in vivo. We found that a major virulence factor, the pore-forming hemolysin listeriolysin O (LLO, is tightly associated with the MVs, where it resides in an oxidized, inactive state. Previous studies have shown that LLO may induce cell death and autophagy. To monitor possible effects of LLO and MVs on autophagy, we performed assays for LC3 lipidation and LDH sequestration as well as analysis by confocal microscopy of HEK293 cells expressing GFP-LC3. The results revealed that MVs alone did not affect autophagy whereas they effectively abrogated autophagy induced by pure LLO or by another pore-forming toxin from Vibrio cholerae, VCC. Moreover, Listeria monocytogenes MVs significantly decreased Torin1-stimulated macroautophagy. In addition, MVs protected against necrosis of HEK293 cells caused by the lytic action of LLO. We explored the mechanisms of LLO-induced autophagy and cell death and demonstrated that the protective effect of MVs involves an inhibition of LLO-induced pore formation resulting in inhibition of autophagy and the lytic action on eukaryotic cells. Further, we determined that these MVs help bacteria to survive inside eukaryotic cells (mouse embryonic fibroblasts. Taken together, these findings suggest that intracellular release of MVs from L. monocytogenes may represent a bacterial strategy to survive inside host cells, by its control of LLO activity and by avoidance of destruction from the autophagy system during infection.
Zilelidou, Evangelia; Karmiri, Christina-Vasiliki; Zoumpopoulou, Georgia; Mavrogonatou, Eleni; Kletsas, Dimitris; Tsakalidou, Effie; Papadimitriou, Konstantinos; Drosinos, Eleftherios
2016-01-01
ABSTRACT Various Listeria monocytogenes strains may contaminate a single food product, potentially resulting in simultaneous exposure of consumers to multiple strains. However, due to bias in strain recovery, L. monocytogenes strains isolated from foods by selective enrichment (SE) might not always represent those that can better survive the immune system of a patient. We investigated the effect of cocultivation in tryptic soy broth with 0.6% yeast extract (TSB-Y) at 10°C for 8 days on (i) the detection of L. monocytogenes strains during SE with the ISO 11290-1:1996/Amd 1:2004 protocol and (ii) the in vitro virulence of strains toward the Caco-2 human colon epithelial cancer cell line following exposure to simulated gastric fluid (SGF; pH 2.0)-HCl (37°C). We determined whether the strains which were favored by SE would be effective competitors under the conditions of challenges related to gastrointestinal passage of the pathogen. Interstrain competition of L. monocytogenes in TSB-Y determined the relative population of each strain at the beginning of SE. This in turn impacted the outcome of SE (i.e., favoring survival of competitors with better fitness) and the levels exposed subsequently to SGF. However, strong growth competitors could be outcompeted after SGF exposure and infection of Caco-2 cells by strains outgrown in TSB-Y and underdetected (or even missed) during enrichment. Our data demonstrate a preferential selection of certain L. monocytogenes strains during enrichments, often not reflecting a selective advantage of strains during infection. These findings highlight a noteworthy scenario associated with the difficulty of matching the source of infection (food) with the L. monocytogenes isolate appearing to be the causative agent during listeriosis outbreak investigations. IMPORTANCE This report is relevant to understanding the processes involved in selection and prevalence of certain L. monocytogenes strains in different environments (i.e., foods or
Mataragas, M; Alessandria, V; Rantsiou, K; Cocolin, L
2015-08-01
In the present work, a demonstration is made on how the risk from the presence of Listeria monocytogenes in fermented sausages can be managed using the concept of Food Safety Objective (FSO) aided by stochastic modeling (Bayesian analysis and Monte Carlo simulation) and meta-analysis. For this purpose, the ICMSF equation was used, which combines the initial level (H0) of the hazard and its subsequent reduction (ΣR) and/or increase (ΣI) along the production chain. Each element of the equation was described by a distribution to investigate the effect not only of the level of the hazard, but also the effect of the accompanying variability. The distribution of each element was determined by Bayesian modeling (H0) and meta-analysis (ΣR and ΣI). The output was a normal distribution N(-5.36, 2.56) (log cfu/g) from which the percentage of the non-conforming products, i.e. the fraction above the FSO of 2 log cfu/g, was estimated at 0.202%. Different control measures were examined such as lowering initial L. monocytogenes level and inclusion of an additional killing step along the process resulting in reduction of the non-conforming products from 0.195% to 0.003% based on the mean and/or square-root change of the normal distribution, and 0.001%, respectively. Copyright © 2015 Elsevier Ltd. All rights reserved.
Vadia, Stephen; Seveau, Stephanie
2014-03-01
Listeria monocytogenes is responsible for the life-threatening food-borne disease listeriosis. This disease mainly affects elderly and immunocompromised individuals, causing bacteremia and meningoencephalitis. In pregnant women, L. monocytogenes infection leads to abortion and severe infection of the fetus or newborn. The L. monocytogenes intracellular life cycle is critical for pathogenesis. Previous studies have established that the major virulence factor of L. monocytogenes, the pore-forming toxin listeriolysin O (LLO), is sufficient to induce L. monocytogenes internalization into human epithelial cell lines. This internalization pathway strictly requires the formation of LLO pores in the plasma membrane and can be stimulated by the heterologous pore-forming toxin pneumolysin, suggesting that LLO acts nonspecifically by forming transmembrane pores. The present work tested the hypothesis that Ca2+ and K+ fluxes subsequent to perforation by LLO control L. monocytogenes internalization. We report that L. monocytogenes perforates the host cell plasma membrane in an LLO-dependent fashion at the early stage of invasion. In response to perforation, host cells undergo Ca2+ -dependent but K+ -independent resealing of their plasma membrane. In contrast to the plasma membrane resealing process, LLO-induced L. monocytogenes internalization requires both Ca2+ and K+ fluxes. Further linking ion fluxes to bacterial internalization, treating cells with a combination of Ca2+ and K+ ionophores but not with individual ionophores is sufficient to induce efficient internalization of large cargoes, such as 1-μm polystyrene beads and bacteria. We propose that LLO-induced L. monocytogenes internalization requires a Ca2+ - and K+ -dependent internalization pathway that is mechanistically distinct from the process of plasma membrane resealing.
Day, J B; Basavanna, U
2015-04-01
Listeriosis, a disease contracted via the consumption of foods contaminated with pathogenic Listeria species, can produce severe symptoms and high mortality in susceptible people and animals. The development of molecular methods and immuno-based techniques for detection of pathogenic Listeria in foods has been challenging due to the presence of assay inhibiting food components. In this study, we utilize a macrophage cell culture system for the isolation and enrichment of Listeria monocytogenes and Listeria ivanovii from infant formula and leafy green vegetables for subsequent identification using the Luminex xMAP technique. Macrophage monolayers were exposed to infant formula, lettuce and celery contaminated with L. monocytogenes or L. ivanovii. Magnetic microspheres conjugated to Listeria specific antibody were used to capture Listeria from infected macrophages and then analyzed using the Bio-Plex 200 analyzer. As few as 10 CFU/mL or g of L. monocytogenes was detected in all foods tested. The detection limit for L. ivanovii was 10 CFU/mL in infant formula and 100 CFU/g in leafy greens. Microsphere bound Listeria obtained from infected macrophage lysates could also be isolated on selective media for subsequent confirmatory identification. This method presumptively identifies L. monocytogenes and L. ivanovii from infant formula, lettuce and celery in less than 28 h with confirmatory identifications completed in less than 48 h. Published by Elsevier Ltd.
Poimenidou, Sofia V; Chatzithoma, Danai-Natalia; Nychas, George-John; Skandamis, Panagiotis N
2016-01-01
Pathogens found on fresh produce may encounter low temperatures, high acidity and limited nutrient availability. The aim of this study was to evaluate the effect of habituation of Listeria monocytogenes on cherry tomatoes or lettuce leaves on its subsequent response to inhibitory levels of acid, osmotic and heat stress. Habituation was performed by inoculating lettuce coupons, whole cherry tomatoes or tryptic soy broth (TSB) with a three-strains composite of L. monocytogenes, which were further incubated at 5°C for 24 hours or 5 days. Additionally, cells grown overnight in TSB supplemented with 0.6% yeast extract (TSBYE) at 30°C were used as control cells. Following habituation, L. monocytogenes cells were harvested and exposed to: (i) pH 3.5 adjusted with lactic acid, acetic acid or hydrochloric acid (HCl), and pH 1.5 (HCl) for 6 h; (ii) 20% NaCl and (iii) 60°C for 150 s. Results showed that tomato-habituated L. monocytogenes cells were more tolerant (P lettuce, and habituation on both foods resulted in more stress resistant cells than prior growth in TSB. On the contrary, the highest resistance to heat stress (P lettuce-habituated L. monocytogenes cells followed by TSB-grown cells at 5°C for 24 h, whereas tomato-habituated cells were highly sensitized. Prolonged starvation on fresh produce (5 days vs. 24 h) increased resistance to osmotic and acid stress, but reduced thermotolerance, regardless of the pre-exposure environment (i.e., tomatoes, lettuce or TSB). These results indicate that L. monocytogenes cells habituated on fresh produce at low temperatures might acquire resistance to subsequent antimicrobial treatments raising important food safety implications.
Hmaïed, F; Helel, S; Le Berre, V; François, J-M; Leclercq, A; Lecuit, M; Smaoui, H; Kechrid, A; Boudabous, A; Barkallah, I
2014-02-01
We aimed at evaluating the prevalence of Listeria species isolated from food samples and characterizing food and human cases isolates. Between 2005 and 2007, one hundred food samples collected in the markets of Tunis were analysed in our study. Five strains of Listeria monocytogenes responsible for human listeriosis isolated in hospital of Tunis were included. Multiplex PCR serogrouping and pulsed field gel electrophoresis (PFGE) applying the enzyme AscI and ApaI were used for the characterization of isolates of L. monocytogenes. We have developed a rapid microarray-based assay to a reliable discrimination of species within the Listeria genus. The prevalence of Listeria spp. in food samples was estimated at 14% by using classical biochemical identification. Two samples were assigned to L. monocytogenes and 12 to L. innocua. DNA microarray allowed unambiguous identification of Listeria species. Our results obtained by microarray-based assay were in accordance with the biochemical identification. The two food L. monocytogenes isolates were assigned to the PCR serogroup IIa (serovar 1/2a). Whereas human L. monocytogenes isolates were of PCR serogroup IVb, (serovars 4b). These isolates present a high similarity in PFGE. Food L. monocytogenes isolates were classified into two different pulsotypes. These pulsotypes were different from that of the five strains responsible for the human cases. We confirmed the presence of Listeria spp. in variety of food samples in Tunis. Increased food and clinical surveillance must be taken into consideration in Tunisia to identify putative infections sources. Copyright © 2013 Elsevier Masson SAS. All rights reserved.
Maté, Javier; Periago, Paula M; Ros-Chumillas, María; Grullón, Coralin; Huertas, Juan Pablo; Palop, Alfredo
2017-04-01
The application of d-limonene in form of nanoemulsion has been proved to reduce dramatically the thermal resistance of Listeria monocytogenes in culture media. The present research shows very promising results on the application in food products. The thermal resistance of L. monocytogenes was reduced 90 times when 0.5 mM nanoemulsified d-limonene was added to apple juice. This is the biggest reduction in the heat resistance of a microorganism caused by an antimicrobial described ever. However, no effect was found in carrot juice. A carrot juice system was prepared in an attempt to unravel which juice constituents were responsible for the lack of effect. When fat and fibre were not included in the carrot juice system formulation, the thermal resistance of L. monocytogenes was, again, dramatically reduced in presence of nanoemulsified d-limonene, so these components were shown to interfere with the effect. Once this interaction with food constituents becomes solved, the addition of nanoemulsified antimicrobials would allow to reduce greatly the intensity of the thermal treatments currently applied in the food processing industry. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.
Directory of Open Access Journals (Sweden)
Dean Jankuloski
2007-11-01
Full Text Available Listeria monocytogenes contamination of the environment and surfaces of the equipment was examined in seven meat processing facilities. Up to date prevalence of this foodborn pathogen in meat processing facilities facilities in Republic of Macedonia was unknown. Biofilms are composed from food spoilage microorganisms and food born pathogens. They are located on the surfaces of the equipment that come in contact with food and in facilities environment. Microorganisms in biofilm presenting micro eco system and are source of dissemination and contamination of food born pathogens in final meat products. During the preparation of this study we have covered a 7 meat processing facilities and we took a total of 39 swabs from surfaces that come in direct or indirect contact with food. Listeria monocytogenes was discovered in 10 (25,64% swabs (locations. Prevalence of other Listeria spp. compared with total number of taken samples was 15 (38,46% Listeria innocua, 3 (7,69% Listeria welshimeri and 1 (2,65% isolate Listeria seeligeri.
First Trimester Listeria monocytogenes Septicemia
Goddijn, M.; Schipper, H. G.; Spanjaard, L.; Wolf, H.
1997-01-01
Background: Little is known about fetal outcome after Listeria monocytogenes septicemia in the first trimester of pregnancy.Case: A primigravida with L. monocytogenes septicemia at 9 weeks gestation was treated with amoxicillin. At 40 weeks gestation a healthy female infant was born.Conclusion: This
Sodium monitoring in commercially processed and restaurant foods.
Ahuja, Jaspreet K C; Pehrsson, Pamela R; Haytowitz, David B; Wasswa-Kintu, Shirley; Nickle, Melissa; Showell, Bethany; Thomas, Robin; Roseland, Janet; Williams, Juhi; Khan, Mona; Nguyen, Quynhanh; Hoy, Kathy; Martin, Carrie; Rhodes, Donna; Moshfegh, Alanna; Gillespie, Cathleen; Gunn, Janelle; Merritt, Robert; Cogswell, Mary
2015-03-01
Most sodium in the US diet comes from commercially processed and restaurant foods. Sodium reduction in these foods is key to several recent public health efforts. The objective was to provide an overview of a program led by the USDA, in partnership with other government agencies, to monitor sodium contents in commercially processed and restaurant foods in the United States. We also present comparisons of nutrients generated under the program to older data. We track ∼125 commercially processed and restaurant food items ("sentinel foods") annually using information from food manufacturers and periodically by nationwide sampling and laboratory analyses. In addition, we monitor >1100 other commercially processed and restaurant food items, termed "priority-2 foods" (P2Fs) biennially by using information from food manufacturers. These foods serve as indicators for assessing changes in the sodium content of commercially processed and restaurant foods in the United States. We sampled all sentinel foods nationwide and reviewed all P2Fs in 2010-2013 to determine baseline sodium concentrations. We updated sodium values for 73 sentinel foods and 551 P2Fs in the USDA's National Nutrient Database for Standard Reference (releases 23-26). Sodium values changed by at least 10% for 43 of the sentinel foods, which, for 31 foods, including commonly consumed foods such as bread, tomato catsup, and potato chips, the newer sodium values were lower. Changes in the concentrations of related nutrients (total and saturated fat, total sugar, potassium, or dietary fiber) that were recommended by the 2010 Dietary Guidelines for Americans for reduced or increased consumption accompanied sodium reduction. The results of sodium reduction efforts, based on resampling of the sentinel foods or re-review of P2Fs, will become available beginning in 2015. This monitoring program tracks sodium reduction efforts, improves food composition databases, and strengthens national nutrition monitoring. © 2015
Seyoum, Eyasu Tigabu; Woldetsadik, Daniel Asrat; Mekonen, Tesfu Kassa; Gezahegn, Haile Alemayehu; Gebreyes, Wondwossen Abebe
2015-11-30
Listeria monocytogenes is of major significance in human and veterinary medicine. Most human Listeria infections are foodborne and the association of contaminated milk and dairy produce consumption with human listeriosis is noteworthy. In Ethiopia, there is limited data regarding the prevalence of L. monocytogenes in raw bovine milk and dairy products. The aim of this study was, therefore, to determine the prevalence of L. monocytogenes in raw bovine milk and dairy produce. A total of 443 milk and milk product samples were microbiologically analyzed following methods recommended by the U.S. Food and Drug Administration Bacteriological Analytical Manual to isolate Listeria spp. The overall prevalence of Listeria spp. was 28.4% and specifically that of L. monocytogenes was 5.6%. Taking the prevalence of Listeria spp. into consideration, cheese was found to be highly contaminated at 60%, followed by pasteurized milk samples (40%), raw milk (18.9%) and yoghurt (5%). Considering the prevalence of Listeria monocytogenes only, raw milk had the lowest contamination while cheese had the highest, followed by pasteurized milk and yoghurt. Raw milk and milk products produced in urban and peri-urban areas of central Ethiopia were contaminated with pathogenic bacteria, L. monocytogenes. The detection of this pathogen in raw milk and milk products warrants an urgent regulatory mechanism to be put in place and also the potential role of milk processing plants in the contamination of dairy products should be investigated.
Humber, M. L.; Becker-Reshef, I.; Nordling, J.; Barker, B.; McGaughey, K.
2014-12-01
The GEOGLAM Crop Monitor's Crop Assessment Tool was released in August 2013 in support of the GEOGLAM Crop Monitor's objective to develop transparent, timely crop condition assessments in primary agricultural production areas, highlighting potential hotspots of stress/bumper crops. The Crop Assessment Tool allows users to view satellite derived products, best available crop masks, and crop calendars (created in collaboration with GEOGLAM Crop Monitor partners), then in turn submit crop assessment entries detailing the crop's condition, drivers, impacts, trends, and other information. Although the Crop Assessment Tool was originally intended to collect data on major crop production at the global scale, the types of data collected are also relevant to the food security and rangelands monitoring communities. In line with the GEOGLAM Countries at Risk philosophy of "foster[ing] the coordination of product delivery and capacity building efforts for national and regional organizations, and the development of harmonized methods and tools", a modified version of the Crop Assessment Tool is being developed for the USAID Famine Early Warning Systems Network (FEWS NET). As a member of the Countries at Risk component of GEOGLAM, FEWS NET provides agricultural monitoring, timely food security assessments, and early warnings of potential significant food shortages focusing specifically on countries at risk of food security emergencies. While the FEWS NET adaptation of the Crop Assessment Tool focuses on crop production in the context of food security rather than large scale production, the data collected is nearly identical to the data collected by the Crop Monitor. If combined, the countries monitored by FEWS NET and GEOGLAM Crop Monitor would encompass over 90 countries representing the most important regions for crop production and food security.
DEFF Research Database (Denmark)
Holch, Anne; Ingmer, Hanne; Licht, Tine Rask
2013-01-01
potential of a group of food-processing persistent L. monocytogenes strains encoding a premature stop codon in inlA (encoding internalin A) by using two orally dosed models, pregnant mice and pregnant guinea pigs. A food-processing persistent strain of L. monocytogenes invaded placentas (n = 58; 10...... % positive) and fetuses (3 % positive) of pregnant mice (n = 9 animals per strain), similar to a genetically manipulated murinized strain, EGD-e InlAm* (n = 61; 3 and 2 %, respectively). In pregnant guinea pigs (n = 9 animals per bacterial strain), a maternofetal strain (from a human fetal clinical fatal...... case) was isolated from 34 % of placenta samples (n = 50), whereas both food-processing persistent strains were found in 5 % of placenta samples (n = 36 or 37). One of the food-processing persistent strains, N53-1, was found in up to 8 % of guinea pig fetal liver and brain samples, whereas...
Directory of Open Access Journals (Sweden)
Joelle K. Salazar
2018-01-01
Full Text Available This study assessed the growth of Listeria monocytogenes in milkshakes made using the process-contaminated ice cream associated with a listeriosis outbreak in comparison to milkshakes made with artificially contaminated ice cream. For all temperatures, growth kinetics including growth rates, lag phases, maximum populations, and population increases were determined for the naturally and artificially derived contaminants at 5, 10, 15, and 25°C storage for 144 h. The artificially inoculated L. monocytogenes presented lower growth rates and shorter lag phases than the naturally contaminated populations at all temperatures except for 5°C, where the reverse was observed. At 25°C, lag phases of the naturally and artificially contaminated L. monocytogenes were 11.6 and 7.8 h, respectively. The highest increase in population was observed for the artificially inoculated pathogen at 15°C after 96 h (6.16 log CFU/mL of storage. Growth models for both contamination states in milkshakes were determined. In addition, this study evaluated the antimicrobial effectiveness of flavoring agents, including strawberry, chocolate and mint, on the growth of the pathogen in milkshakes during 10°C storage. All flavor additions resulted in decreased growth rates of L. monocytogenes for both contamination states. The addition of chocolate and mint flavoring also resulted in significantly longer lag phases for both contamination states. This study provides insight into the differences in growth between naturally and artificially contaminated L. monocytogenes in a food product.
Salazar, Joelle K; Bathija, Vriddi M; Carstens, Christina K; Narula, Sartaj S; Shazer, Arlette; Stewart, Diana; Tortorello, Mary Lou
2018-01-01
This study assessed the growth of Listeria monocytogenes in milkshakes made using the process-contaminated ice cream associated with a listeriosis outbreak in comparison to milkshakes made with artificially contaminated ice cream. For all temperatures, growth kinetics including growth rates, lag phases, maximum populations, and population increases were determined for the naturally and artificially derived contaminants at 5, 10, 15, and 25°C storage for 144 h. The artificially inoculated L. monocytogenes presented lower growth rates and shorter lag phases than the naturally contaminated populations at all temperatures except for 5°C, where the reverse was observed. At 25°C, lag phases of the naturally and artificially contaminated L. monocytogenes were 11.6 and 7.8 h, respectively. The highest increase in population was observed for the artificially inoculated pathogen at 15°C after 96 h (6.16 log CFU/mL) of storage. Growth models for both contamination states in milkshakes were determined. In addition, this study evaluated the antimicrobial effectiveness of flavoring agents, including strawberry, chocolate and mint, on the growth of the pathogen in milkshakes during 10°C storage. All flavor additions resulted in decreased growth rates of L. monocytogenes for both contamination states. The addition of chocolate and mint flavoring also resulted in significantly longer lag phases for both contamination states. This study provides insight into the differences in growth between naturally and artificially contaminated L. monocytogenes in a food product.
Longhi, C; Conte, M P; Ranaldi, S; Penta, M; Valenti, P; Tinari, A; Superti, F; Seganti, L
2005-01-01
Listeria monocytogenes, an intracellular facultative food-borne pathogen, was reported to induce apoptosis in vitro and in vivo in a variety of cell types with the exception of murine macrophages. These cells represent the predominant compartment of bacterial multiplication and die as a result of necrosis. In this study we showed that human non-activated and IFN-gamma-activated macrophagic-like (THP-1) cells infected with L. monocytogenes, mainly die by necrosis rather than by an apoptotic process. Two natural products derived from bovine milk, lactoferrin and its derivative peptide lactoferricin B, are capable of regulating the fate of infected human macrophages. Bovine lactoferrin treatment of macrophages protects them from L. monocytogenes-induced death whereas lactoferricin B, its derivative peptide, determines a shifting of the equilibrium from necrosis to apoptosis.
DEFF Research Database (Denmark)
Paspaliari, Dafni Katerina; Kastbjerg, Vicky Gaedt; Ingmer, Hanne
2017-01-01
The chitinolytic system of Listeria monocytogenes thus far comprises two chitinases, ChiA and ChiB, and a lytic polysaccharide monooxygenase, Lmo2467. The role of the system in the bacterium appears to be pleiotropic, as besides mediating hydrolysis of chitin, the second most ubiquitous...... chitinase activities enabling them to utilize chitin as the sole source of carbon and nitrogen. Interestingly, several bacterial chitinases may also be involved in host pathogenesis. For example, in the important food borne pathogen Listeria monocytogenes, the chitinases ChiA and ChiB, and the lytic...... ChiA and ChiB in the culture supernatants of the mutant strain. Our results provide new information regarding the function of the lmo0325-lmo0327 locus in L. monocytogenes and link it to the expression of chitinolytic activity.Importance: Many bacteria from terrestrial and marine environments express...
Nguyen, Uyen T; Burrows, Lori L
2014-09-18
Current sanitation methods in the food industry are not always sufficient for prevention or dispersal of Listeria monocytogenes biofilms. Here, we determined if prevention of adherence or dispersal of existing biofilms could occur if biofilm matrix components were disrupted enzymatically. Addition of DNase during biofilm formation reduced attachment (biofilms with 100μg/ml of DNase for 24h induced incomplete biofilm dispersal, with biofilm remaining compared to control. In contrast, addition of proteinase K completely inhibited biofilm formation, and 72h biofilms-including those grown under stimulatory conditions-were completely dispersed with 100μg/ml proteinase K. Generally-regarded-as-safe proteases bromelain and papain were less effective dispersants than proteinase K. In a time course assay, complete dispersal of L. monocytogenes biofilms from both polystyrene and type 304H food-grade stainless steel occurred within 5min at proteinase K concentrations above 25μg/ml. These data confirm that both DNA and proteins are required for L. monocytogenes biofilm development and maintenance, and that these components of the biofilm matrix can be targeted for effective prevention and removal of biofilms. Copyright © 2014 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Luisa Zanolli Moreno
2014-01-01
Full Text Available In the last decade, atypical Listeria monocytogenes and L. innocua strains have been detected in food and the environment. Because of mutations in the major virulence genes, these strains have different virulence intensities in eukaryotic cells. In this study, we performed phenotypic and genotypic characterization of atypical L. monocytogenes and L. innocua isolates obtained from swine slaughterhouses and meat markets. Forty strains were studied, including isolates of L. monocytogenes and L. innocua with low-hemolytic activity. The isolates were characterized using conventional phenotypic Listeria identification tests and by the detection and analysis of L. monocytogenes-specific genes. Analysis of 16S rRNA was used for the molecular identification of the Listeria species. The L. monocytogenes isolates were positive for all of the virulence genes studied. The atypical L. innocua strains were positive for hly, plcA, and inlC. Mutations in the InlC, InlB, InlA, PI-PLC, PC-PLC, and PrfA proteins were detected in the atypical isolates. Further in vitro and transcriptomic studies are being developed to confirm the role of these mutations in Listeria virulence.
Directory of Open Access Journals (Sweden)
Benjamin Félix
2018-04-01
Full Text Available Listeria monocytogenes is an ubiquitous pathogenic bacterium, transmissible to humans through the consumption of contaminated food. The pork production sector has been hit hard by a series of L. monocytogenes-related food poisoning outbreaks in France. An overview of the diversity of strains circulating at all levels of the pork production chain, from pig farming (PF to finished food products (FFP, is needed to identify the contamination routes and improve food safety. Until now, no typing data has been available on strains isolated across the entire pig and pork production chain. Here, we analyzed the population genetic structure of 687 L. monocytogenes strains isolated over the last 20 years in virtually all the French départements from three compartments of this production sector: PF, the food processing environment (FPE, and FFP. The genetic structure was described based on Multilocus sequence typing (MLST clonal complexes (CCs. The CCs were obtained by mapping the PFGE profiles of the strains. The distribution of CCs was compared firstly between the three compartments and then with CCs obtained from 1106 strains isolated from other food production sectors in France. The predominant CCs of pig and pork strains were not equally distributed among the three compartments: the CC37, CC59, and CC77 strains, rarely found in FPE and FFP, were prevalent in PF. The two most prevalent CCs in the FPE and FFP compartments, CC9 and CC121, were rarely or never detected in PF. No CC was exclusively associated with the pork sector. Three CCs (CC5, CC6, and CC2 were considered ubiquitous, because they were observed in comparable proportions in all food production sectors. The two most prevalent CCs in all sectors were CC9 and CC121, but their distribution was disparate. CC9 was associated with meat products and food products combining several food categories, whereas CC121 was not associated with any given sector. Based on these results, CC121 is likely able
Félix, Benjamin; Feurer, Carole; Maillet, Aurelien; Guillier, Laurent; Boscher, Evelyne; Kerouanton, Annaëlle; Denis, Martine; Roussel, Sophie
2018-01-01
Listeria monocytogenes is an ubiquitous pathogenic bacterium, transmissible to humans through the consumption of contaminated food. The pork production sector has been hit hard by a series of L. monocytogenes-related food poisoning outbreaks in France. An overview of the diversity of strains circulating at all levels of the pork production chain, from pig farming (PF) to finished food products (FFP), is needed to identify the contamination routes and improve food safety. Until now, no typing data has been available on strains isolated across the entire pig and pork production chain. Here, we analyzed the population genetic structure of 687 L. monocytogenes strains isolated over the last 20 years in virtually all the French départements from three compartments of this production sector: PF, the food processing environment (FPE), and FFP. The genetic structure was described based on Multilocus sequence typing (MLST) clonal complexes (CCs). The CCs were obtained by mapping the PFGE profiles of the strains. The distribution of CCs was compared firstly between the three compartments and then with CCs obtained from 1106 strains isolated from other food production sectors in France. The predominant CCs of pig and pork strains were not equally distributed among the three compartments: the CC37, CC59, and CC77 strains, rarely found in FPE and FFP, were prevalent in PF. The two most prevalent CCs in the FPE and FFP compartments, CC9 and CC121, were rarely or never detected in PF. No CC was exclusively associated with the pork sector. Three CCs (CC5, CC6, and CC2) were considered ubiquitous, because they were observed in comparable proportions in all food production sectors. The two most prevalent CCs in all sectors were CC9 and CC121, but their distribution was disparate. CC9 was associated with meat products and food products combining several food categories, whereas CC121 was not associated with any given sector. Based on these results, CC121 is likely able to colonize a
Food Safety Practices Linked with Proper Refrigerator Temperatures in Retail Delis.
Brown, Laura G; Hoover, Edward Rickamer; Faw, Brenda V; Hedeen, Nicole K; Nicholas, David; Wong, Melissa R; Shepherd, Craig; Gallagher, Daniel L; Kause, Janell R
2018-05-01
Listeria monocytogenes (L. monocytogenes) causes the third highest number of foodborne illness deaths annually. L. monocytogenes contamination of sliced deli meats at the retail level is a significant contributing factor to L. monocytogenes illness. The Centers for Disease Control and Prevention's Environmental Health Specialists Network (EHS-Net) conducted a study to learn more about retail delis' practices concerning L. monocytogenes growth and cross-contamination prevention. This article presents data from this study on the frequency with which retail deli refrigerator temperatures exceed 41°F, the Food and Drug Administration (FDA)-recommended maximum temperature for ready-to-eat food requiring time and temperature control for safety (TCS) (such as retail deli meat). This provision was designed to control bacterial growth in TCS foods. This article also presents data on deli and staff characteristics related to the frequency with which retail delis refrigerator temperatures exceed 41°F. Data from observations of 445 refrigerators in 245 delis showed that in 17.1% of delis, at least one refrigerator was >41°F. We also found that refrigeration temperatures reported in this study were lower than those reported in a related 2007 study. Delis with more than one refrigerator, that lacked refrigerator temperature recording, and had a manager who had never been food safety certified had greater odds of having a refrigerator temperature >41°F. The data from this study suggest that retail temperature control is improving over time. They also identify a food safety gap: some delis have refrigerator temperatures that exceed 41°F. We also found that two food safety interventions were related to better refrigerated storage practices: kitchen manager certification and recording refrigerated storage temperatures. Regulatory food safety programs and the retail industry may wish to consider encouraging or requiring kitchen manager certification and recording refrigerated
Mechanistic studies of the agmatine deiminase from Listeria monocytogenes.
Soares, Charles A; Knuckley, Bryan
2016-06-01
Listeria monocytogenes is a Gram-positive food-borne pathogen that is capable of living within extreme environments (i.e. low temperatures and pH). This ability to survive in such conditions may arise, at least in part, from agmatine catabolism via the agmatine deiminase system (AgDS). This catabolic pathway utilizes an agmatine deiminase (AgD) to hydrolyse agmatine into N-carbamoylputrescine (NCP), with concomitant release of ammonia, which increases the pH, thus mitigating the ill effects of the acidic environment. Given the potential significance of this pathway for cell survival, we set out to study the catalytic mechanism of the AgD encoded by L. monocytogenes In the present paper, we describe the catalytic mechanism employed by this enzyme based on pH profiles, pKa measurements of the active site cysteine and solvent isotope effects (SIE). In addition, we report inhibition of this enzyme by two novel AgD inhibitors, i.e. N-(4-aminobutyl)-2-fluoro-ethanimidamide (ABFA) and N-(4-aminobutyl)-2-chloro-ethanimidamide (ABCA). In contrast with other orthologues, L. monocytogenes AgD does not use the reverse protonation or substrate-assisted mechanism, which requires an active site cysteine with a high pKa and has been commonly seen in other members of the guanidinium-modifying enzyme (GME) superfamily. Instead, the L. monocytogenes AgD has a low pKa cysteine in the active site leading to an alternative mechanism of catalysis. This is the first time that this mechanism has been observed in the GME superfamily and is significant because it explains why previously developed mechanism-based inactivators of AgDs are ineffective against this orthologue. © 2016 The Author(s). published by Portland Press Limited on behalf of the Biochemical Society.
Ultrasonic cleaning of conveyor belt materials using Listeria monocytogenes as a model organism.
Tolvanén, Riina; Lunden, Janne; Korkeala, Hannu; Wirtanen, Gun
2007-03-01
Persistent Listeria monocytogenes contamination of food industry equipment is a difficult problem to solve. Ultrasonic cleaning offers new possibilities for cleaning conveyors and other equipment that are not easy to clean. Ultrasonic cleaning was tested on three conveyor belt materials: polypropylene, acetal, and stainless steel (cold-rolled, AISI 304). Cleaning efficiency was tested at two temperatures (30 and 45 degrees C) and two cleaning times (30 and 60 s) with two cleaning detergents (KOH, and NaOH combined with KOH). Conveyor belt materials were soiled with milk-based soil and L. monocytogenes strains V1, V3, and B9, and then incubated for 72 h to attach bacteria to surfaces. Ultrasonic cleaning treatments reduced L. monocytogenes counts on stainless steel 4.61 to 5.90 log units; on acetal, 3.37 to 5.55 log units; and on polypropylene, 2.31 to 4.40 log units. The logarithmic reduction differences were statistically analyzed by analysis of variance using Statistical Package for the Social Sciences software. The logarithmic reduction was significantly greater in stainless steel than in plastic materials (P conveyor belt materials.
Mejlholm, Ole; Bøknæs, Niels; Dalgaard, Paw
2015-02-01
A new stochastic model for the simultaneous growth of Listeria monocytogenes and lactic acid bacteria (LAB) was developed and validated on data from naturally contaminated samples of cold-smoked Greenland halibut (CSGH) and cold-smoked salmon (CSS). During industrial processing these samples were added acetic and/or lactic acids. The stochastic model was developed from an existing deterministic model including the effect of 12 environmental parameters and microbial interaction (O. Mejlholm and P. Dalgaard, Food Microbiology, submitted for publication). Observed maximum population density (MPD) values of L. monocytogenes in naturally contaminated samples of CSGH and CSS were accurately predicted by the stochastic model based on measured variability in product characteristics and storage conditions. Results comparable to those from the stochastic model were obtained, when product characteristics of the least and most preserved sample of CSGH and CSS were used as input for the existing deterministic model. For both modelling approaches, it was shown that lag time and the effect of microbial interaction needs to be included to accurately predict MPD values of L. monocytogenes. Addition of organic acids to CSGH and CSS was confirmed as a suitable mitigation strategy against the risk of growth by L. monocytogenes as both types of products were in compliance with the EU regulation on ready-to-eat foods. Copyright © 2014 Elsevier Ltd. All rights reserved.
Analysis of food radiation monitoring system in Belarus
International Nuclear Information System (INIS)
1992-01-01
Food radiation monitoring system in Belarus due to the Chernobyl accident is analysed. Structure of radiation monitoring network, instrumentation and modern developments. Information on permissible concentration levels in foodstuffs and water is presented and calculations of radionuclide intake for man are performed. Proposals on the creation of social centres of food radiation monitoring for Belarussian population are considered. 4 tabs
Modeling the growth of Listeria monocytogenes in mold-ripened cheeses.
Lobacz, Adriana; Kowalik, Jaroslaw; Tarczynska, Anna
2013-06-01
This study presents possible applications of predictive microbiology to model the safety of mold-ripened cheeses with respect to bacteria of the species Listeria monocytogenes during (1) the ripening of Camembert cheese, (2) cold storage of Camembert cheese at temperatures ranging from 3 to 15°C, and (3) cold storage of blue cheese at temperatures ranging from 3 to 15°C. The primary models used in this study, such as the Baranyi model and modified Gompertz function, were fitted to growth curves. The Baranyi model yielded the most accurate goodness of fit and the growth rates generated by this model were used for secondary modeling (Ratkowsky simple square root and polynomial models). The polynomial model more accurately predicted the influence of temperature on the growth rate, reaching the adjusted coefficients of multiple determination 0.97 and 0.92 for Camembert and blue cheese, respectively. The observed growth rates of L. monocytogenes in mold-ripened cheeses were compared with simulations run with the Pathogen Modeling Program (PMP 7.0, USDA, Wyndmoor, PA) and ComBase Predictor (Institute of Food Research, Norwich, UK). However, the latter predictions proved to be consistently overestimated and contained a significant error level. In addition, a validation process using independent data generated in dairy products from the ComBase database (www.combase.cc) was performed. In conclusion, it was found that L. monocytogenes grows much faster in Camembert than in blue cheese. Both the Baranyi and Gompertz models described this phenomenon accurately, although the Baranyi model contained a smaller error. Secondary modeling and further validation of the generated models highlighted the issue of usability and applicability of predictive models in the food processing industry by elaborating models targeted at a specific product or a group of similar products. Copyright © 2013 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Pradhan, Abani K; Ivanek, Renata; Gröhn, Yrjö T; Geornaras, Ifigenia; Sofos, John N; Wiedmann, Martin
2009-05-01
Foodborne disease associated with consumption of ready-to-eat foods contaminated with Listeria monocytogenes represents a considerable pubic health concern. In a risk assessment published in 2003, the U.S. Food and Drug Administration and the U.S. Food Safety and Inspection Service estimated that about 90% of human listeriosis cases in the United States are caused by consumption of contaminated deli meats. In this risk assessment, all deli meats were grouped into one of 23 categories of ready-to-eat foods, and only the postretail growth of L. monocytogenes was considered. To provide an improved risk assessment for L. monocytogenes in deli meats, we developed a revised risk assessment that (i) models risk for three subcategories of deli meats (i.e., ham, turkey, and roast beef) and (ii) models L. monocytogenes contamination and growth from production to consumption while considering subcategory-specific growth kinetics parameters (i.e., lag phase and exponential growth rate). This model also was used to assess how reformulation of the chosen deli meat subcategories with L. monocytogenes growth inhibitors (i.e., lactate and diacetate) would impact the number of human listeriosis cases. Use of product-specific growth parameters demonstrated how certain deli meat categories differ in the relative risk of causing listeriosis; products that support more rapid growth and have reduced lag phases (e.g., turkey) represent a higher risk. Although reformulation of deli meats with growth inhibitors was estimated to reduce by about 2.5- to 7.8-fold the number of human listeriosis cases linked to a given deli meat subcategory and thus would reduce the overall risk of human listeriosis, even with reformulation deli meats would still cause a considerable number of human listeriosis cases. A combination of strategies is thus needed to provide continued reduction of these cases. Risk assessment models such as that described here will be critical for evaluation of different control
Bacteriophage biocontrol of Listeria monocytogenes on soft ripened white mold and red-smear cheeses.
Guenther, Susanne; Loessner, Martin J
2011-03-01
Soft-ripened cheeses belong to the type of food most often contaminated with Listeria monocytogenes, and they have been implicated in several outbreaks of listeriosis. Bacteriophages represent an attractive way to combat foodborne pathogens without affecting other properties of the food. We used the broad host range, virulent Listeria phage A511 for control of L. monocytogenes during the production and ripening phases of both types of soft-ripened cheeses, white mold (Camembert-type) cheese, as well as washed-rind cheese with a red-smear surface (Limburger-type). The surfaces of young, unripened cheese were inoculated with 10(1)-10(3) cfu/cm(2)L. monocytogenes strains Scott A (serovar 4b) or CNL 10(3)/2005 (serovar 1/2a). Phage was applied at defined time points thereafter, in single or repeated treatments, at 3 × 10(8) or 1 × 10(9) pfu/cm(2). With Scott A (10(3) cfu/cm(2)) and a single dose of A511 (3 × 10(8) pfu/cm(2)) on camembert-type cheese, viable counts dropped 2.5 logs at the end of the 21 day ripening period. Repeated phage application did not further inhibit the bacteria, whereas a single higher dose (1 × 10(9) pfu/cm(2)) was found to be more effective. On red-smear cheese ripened for 22 days, Listeria counts were down by more than 3 logs. Repeated application of A511 further delayed re-growth of Listeria, but did not affect bacterial counts after 22 days. With lower initial Listeria contamination (10(1)-10(2) cfu/cm(2)), viable counts dropped below the limit of detection, corresponding to more than 6 logs reduction compared to the control. Our data clearly demonstrate the potential of bacteriophage for biocontrol of L. monocytogenes in soft cheese.
Chaitiemwong, N.; Hazeleger, W.C.; Beumer, R.R.
2014-01-01
To simulate food contact surfaces with pits or cracks, stainless steel plates with grooves (depths between 0.2 and 5 mm) were constructed. These plates were artificially contaminated with Listeria monocytogenes in clean conditions, with organic soiling, or after 14 days of biofilm formation after
Wemekamp-Kamphuis, H.H.; Karatzas, A.K.; Wouters, J.A.; Abee, T.
2002-01-01
Listeria monocytogenes is a psychrotrophic food-borne pathogen that is problematic for the food industry because of its ubiquitous distribution in nature and its ability to grow at low temperatures and in the presence of high salt concentrations. Here we demonstrate that the process of adaptation to
A framework for evaluating food security and nutrition monitoring ...
African Journals Online (AJOL)
Identifying cost and time-efficient approaches to food security and nutrition monitoring programs is fundamental to increasing the utility and sustainability. ... In meeting these challenges, the role of continued evaluation of food security monitoring systems - for their impact on food security decision-making - cannot be ...
Directory of Open Access Journals (Sweden)
Hurtado Ana
2009-01-01
Full Text Available Abstract Background Listeria monocytogenes is among the most important foodborne bacterial pathogens due to the high mortality rate and severity of the infection. L. monocytogenes is a ubiquitous organism occasionally present in the intestinal tract of various animal species and faecal shedding by asymptomatically infected livestock poses a risk for contamination of farm environments and raw food at the pre-harvest stages. The aim of this study was to determine the prevalence and strain diversity of L. monocytogenes in healthy ruminants and swine herds. Results Faecal samples from 30 animals per herd were collected from 343 herds (120 sheep, 124 beef cattle, 82 dairy cattle and 17 swine in the Basque Country and screened in pools by an automated enzyme-linked fluorescent immunoassay (VIDAS® to estimate the prevalence of positive herds. Positive samples were subcultured onto the selective and differential agar ALOA and biochemically confirmed. L. monocytogenes was isolated from 46.3% of dairy cattle, 30.6% beef cattle and 14.2% sheep herds, but not from swine. Within-herd prevalence investigated by individually analysing 197 sheep and 221 cattle detected 1.5% of faecal shedders in sheep and 21.3% in cattle. Serotyping of 114 isolates identified complex 4b as the most prevalent (84.2%, followed by 1/2a (13.2%, and PFGE analysis of 68 isolates showed a highly diverse L. monocytogenes population in ruminant herds. Conclusion These results suggested that cattle represent a potentially important reservoir for L. monocytogenes in the Basque Country, and highlighted the complexity of pathogen control at the farm level.
Inhibition of Listeria monocytogenes by propionic acid-based ingredients in cured deli-style Turkey.
Glass, Kathleen A; McDonnell, Lindsey M; Von Tayson, Roxanne; Wanless, Brandon; Badvela, Mani
2013-12-01
Listeria monocytogenes growth can be controlled on ready-to-eat meats through the incorporation of antimicrobial ingredients into the formulation or by postlethality kill steps. However, alternate approaches are needed to provide options that reduce sodium content but maintain protection against pathogen growth in meats after slicing. The objective of this study was to determine the inhibition of L. monocytogenes by propionic acid-based ingredients in high-moisture, cured turkey stored at 4 or 7°C. Six formulations of sliced, cured (120 ppm of NaNO2 ), deli-style turkey were tested, including control without antimicrobials, 3.2% lactate-diacetate blend (LD), 0.4% of a liquid propionate-benzoate-containing ingredient, or 0.3, 0.4, and 0.5% of a liquid propionate-containing ingredient. Products were inoculated with 5 log CFU L. monocytogenes per 100-g package (3 log CFU/ml rinsate), vacuum-sealed, and stored at 4 or 7°C for up to 12 weeks; and populations were enumerated by plating on modified Oxford agar. As expected, the control without antimicrobials supported rapid growth, with >2 log average per ml rinsate increase within 4 weeks of storage at 4°C, whereas growth was observed at 6 weeks for the LD treatment. For both replicate trials, all treatments that contained liquid propionate or propionate-benzoate limited L. monocytogenes growth to an increase of 1-log increase) was observed in individual samples for all propionate-containing treatments at weeks 10, 11, and 12. As expected, L. monocytogenes grew more rapidly when products were stored at 7°C, but trends in relative inhibition were similar to those observed at 4°C. These results verify that propionate-based ingredients inhibit growth of L. monocytogenes on sliced, high-moisture, cured turkey and can be considered as an alternative to reduce sodium-based salts while maintaining food safety.
Johnsen, Bjørn Odd; Lingaas, Egil; Torfoss, Dag; Strøm, Erik H; Nordøy, Ingvild
2010-12-01
Listeria monocytogenes is a foodborne pathogen with a high mortality rate. We report a large, nosocomial outbreak of Listeria monocytogenes infection. Patients with L. monocytogenes isolated from a sterile site, or from faeces when diarrhoea and fever were present, were included. Clinical data were collected from the patient records. The incubation period was calculated as the time between exposure and start of symptoms. Seventeen patients (11 women, median age 64 years) were infected of whom 15 patients were at increased risk for listeriosis. Eleven patients received empiric antibiotic treatment, eight of them with cephalosporins. Three patients died with a resulting mortality rate of 18%. The source of the outbreak was a Camembert cheese made from pasteurised milk containing up to 360 million colony forming units per portion. The median incubation period was 3-4 days. The incubation period in this outbreak was significantly shorter than previously reported, a fact that may be due to the high number of ingested bacteria. Furthermore, food restrictions in hospitals seem warranted, as do treatment with antibiotics effective against L. monocytogenes in at-risk populations. Copyright © 2010 The British Infection Association. Published by Elsevier Ltd. All rights reserved.
International Nuclear Information System (INIS)
Todoriki, Setsuko; Bari, Latiful; Kitta, Kazumi; Ohba, Mika; Ito, Yasuhiro; Tsujimoto, Yuka; Kanamori, Norihito; Yano, Erika; Moriyama, Tatsuya; Kawamura, Yukio; Kawamoto, Shinichi
2009-01-01
The presence of Listeria monocytogenes in fresh produce is a growing concern because of the possibility of food-borne illness. Ionizing radiation is an effective non-thermal means of eliminating pathogenic bacteria in fresh produce; however, the effect of ionizing irradiation on the allergenic properties of the host commodities remains unknown. This study aimed (i) to determine the effective dose of gamma-irradiation in eliminating L. monocytogenes on whole cherry tomatoes and (ii) to evaluate the effect of gamma-irradiation on the allergenic properties of tomato proteins. Cherry tomatoes that were inoculated with a mixture of five L. monocytogenes strains were treated with gamma-rays from a 60 Co source. A 1.25 kGy dose of gamma-irradiation was found to be sufficient to eliminate L. monocytogenes on whole cherry tomatoes. The immunoblot profile of serum samples obtained from two patients with tomato allergy revealed that gamma-irradiation did not affect the allergenicity of tomato proteins for up to 7 days after irradiation when the tomatoes were stored at 20 deg. C. Additionally, the m-RNA levels of β-fructofuranosidase, polygalacturonase, pectin esterase, and superoxide dismutase, the main allergenic proteins in tomato, were not affected by the applied irradiation dose. Thus, this study demonstrated that a 1.25 kGy dose of gamma-irradiation effectively eliminates L. monocytogenes on cherry tomatoes without affecting the expression of allergenic proteins in the fruits.
Todoriki, Setsuko; Bari, Latiful; Kitta, Kazumi; Ohba, Mika; Ito, Yasuhiro; Tsujimoto, Yuka; Kanamori, Norihito; Yano, Erika; Moriyama, Tatsuya; Kawamura, Yukio; Kawamoto, Shinichi
2009-07-01
The presence of Listeria monocytogenes in fresh produce is a growing concern because of the possibility of food-borne illness. Ionizing radiation is an effective non-thermal means of eliminating pathogenic bacteria in fresh produce; however, the effect of ionizing irradiation on the allergenic properties of the host commodities remains unknown. This study aimed (i) to determine the effective dose of gamma-irradiation in eliminating L. monocytogenes on whole cherry tomatoes and (ii) to evaluate the effect of gamma-irradiation on the allergenic properties of tomato proteins. Cherry tomatoes that were inoculated with a mixture of five L. monocytogenes strains were treated with gamma-rays from a 60Co source. A 1.25 kGy dose of gamma-irradiation was found to be sufficient to eliminate L. monocytogenes on whole cherry tomatoes. The immunoblot profile of serum samples obtained from two patients with tomato allergy revealed that gamma-irradiation did not affect the allergenicity of tomato proteins for up to 7 days after irradiation when the tomatoes were stored at 20 °C. Additionally, the m-RNA levels of β-fructofuranosidase, polygalacturonase, pectin esterase, and superoxide dismutase, the main allergenic proteins in tomato, were not affected by the applied irradiation dose. Thus, this study demonstrated that a 1.25 kGy dose of gamma-irradiation effectively eliminates L. monocytogenes on cherry tomatoes without affecting the expression of allergenic proteins in the fruits.
Energy Technology Data Exchange (ETDEWEB)
Todoriki, Setsuko [National Food Research Institute, Tsukuba, Ibaraki 305-8642 (Japan)], E-mail: setsuko@affrc.go.jp; Bari, Latiful; Kitta, Kazumi; Ohba, Mika; Ito, Yasuhiro; Tsujimoto, Yuka [National Food Research Institute, Tsukuba, Ibaraki 305-8642 (Japan); Kanamori, Norihito [Japan International Research Center for Agricultural Science, Tsukuba, Ibaraki 305-8686 (Japan); Yano, Erika; Moriyama, Tatsuya; Kawamura, Yukio [School of Agriculture, Kinki University, Nara-city, Nara 631-8505 (Japan); Kawamoto, Shinichi [National Food Research Institute, Tsukuba, Ibaraki 305-8642 (Japan)
2009-07-15
The presence of Listeria monocytogenes in fresh produce is a growing concern because of the possibility of food-borne illness. Ionizing radiation is an effective non-thermal means of eliminating pathogenic bacteria in fresh produce; however, the effect of ionizing irradiation on the allergenic properties of the host commodities remains unknown. This study aimed (i) to determine the effective dose of gamma-irradiation in eliminating L. monocytogenes on whole cherry tomatoes and (ii) to evaluate the effect of gamma-irradiation on the allergenic properties of tomato proteins. Cherry tomatoes that were inoculated with a mixture of five L. monocytogenes strains were treated with gamma-rays from a {sup 60}Co source. A 1.25 kGy dose of gamma-irradiation was found to be sufficient to eliminate L. monocytogenes on whole cherry tomatoes. The immunoblot profile of serum samples obtained from two patients with tomato allergy revealed that gamma-irradiation did not affect the allergenicity of tomato proteins for up to 7 days after irradiation when the tomatoes were stored at 20 deg. C. Additionally, the m-RNA levels of {beta}-fructofuranosidase, polygalacturonase, pectin esterase, and superoxide dismutase, the main allergenic proteins in tomato, were not affected by the applied irradiation dose. Thus, this study demonstrated that a 1.25 kGy dose of gamma-irradiation effectively eliminates L. monocytogenes on cherry tomatoes without affecting the expression of allergenic proteins in the fruits.
Wang, Junping; Xie, Xinfang; Feng, Jinsong; Chen, Jessica C; Du, Xin-jun; Luo, Jiangzhao; Lu, Xiaonan; Wang, Shuo
2015-07-02
Listeria monocytogenes is a facultatively anaerobic, Gram-positive, rod-shape foodborne bacterium causing invasive infection, listeriosis, in susceptible populations. Rapid and high-throughput detection of this pathogen in dairy products is critical as milk and other dairy products have been implicated as food vehicles in several outbreaks. Here we evaluated confocal micro-Raman spectroscopy (785 nm laser) coupled with chemometric analysis to distinguish six closely related Listeria species, including L. monocytogenes, in both liquid media and milk. Raman spectra of different Listeria species and other bacteria (i.e., Staphylococcus aureus, Salmonella enterica and Escherichia coli) were collected to create two independent databases for detection in media and milk, respectively. Unsupervised chemometric models including principal component analysis and hierarchical cluster analysis were applied to differentiate L. monocytogenes from Listeria and other bacteria. To further evaluate the performance and reliability of unsupervised chemometric analyses, supervised chemometrics were performed, including two discriminant analyses (DA) and soft independent modeling of class analogies (SIMCA). By analyzing Raman spectra via two DA-based chemometric models, average identification accuracies of 97.78% and 98.33% for L. monocytogenes in media, and 95.28% and 96.11% in milk were obtained, respectively. SIMCA analysis also resulted in satisfied average classification accuracies (over 93% in both media and milk). This Raman spectroscopic-based detection of L. monocytogenes in media and milk can be finished within a few hours and requires no extensive sample preparation. Copyright © 2015 Elsevier B.V. All rights reserved.
Stea, Emma C; Purdue, Laura M; Jamieson, Rob C; Yost, Chris K; Truelstrup Hansen, Lisbeth
2015-06-01
Foods and related processing environments are commonly contaminated with the pathogenic Listeria monocytogenes. To investigate potential environmental reservoirs of Listeria spp. and L. monocytogenes, surface water and point source pollution samples from an urban and a rural municipal water supply watershed in Nova Scotia, Canada, were examined over 18 months. Presumptive Listeria spp. were cultured from 72 and 35% of rural and urban water samples, respectively, with 24% of the positive samples containing two or three different Listeria spp. The L. innocua (56%) and L. welshimeri (43%) groups were predominant in the rural and urban watersheds, respectively. Analysis by the TaqMan assay showed a significantly (P monocytogenes of 62% versus 17% by the culture-based method. Both methods revealed higher prevalences in the rural watershed and during the fall and winter seasons. Elevated Escherichia coli (≥ 100 CFU/100 ml) levels were not associated with the pathogen regardless of the detection method. Isolation of Listeria spp. were associated with 70 times higher odds of isolating L. monocytogenes (odds ratio = 70; P monocytogenes isolates, followed by IVb (16.1%), IIb (15.8%), and IIc (0.4%). L. monocytogenes was detected in cow feces and raw sewage but not in septic tank samples. Pulsotyping of representative water (n = 54) and local human (n = 19) isolates suggested genetic similarities among some environmental and human L. monocytogenes isolates. In conclusion, temperate surface waters contain a diverse Listeria species population and could be a potential reservoir for L. monocytogenes, especially in rural agricultural watersheds. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
The prevalence of Listeria spp. food contamination in Iran: A systematic review and meta-analysis.
Hamidiyan, Negar; Salehi-Abargouei, Amin; Rezaei, Zeynab; Dehghani-Tafti, Roohollah; Akrami-Mohajeri, Fateme
2018-05-01
Listeria monocytogenes can cause circling disease, encephalitis, meningitis, septicemia, and mastitis in dairy cattle. Contamination from the environment can contaminate foods with Listeria spp. Consumption of foods containing L. monocytogenes can lead to listeriosis in susceptible people (adults with a compromised immune system), pregnant women, and infants. The objective of this study was to determine the prevalence of Listeria spp. and L. monocytogenes in various foods in Iran. We searched PubMed, Science direct, Scopus, Google scholar, and Iranian local databases including Iranian scientific information database and Magiran for relevant studies up to May 2015 using related keywords. In our preliminary search, we retrieved 1344 articles. After removing duplicates and reviewing titles/abstracts, 117 articles were considered, out of which, 75 articles had sufficient quality for inclusion in this meta-analysis. The prevalence of Listeria spp. contamination was about 18.3% in poultry, 8.5% in raw meat, 14.6% in ready-to-eat (RTE) foods, 10% in sea foods, 7.3% in traditional dairy, 3.2% in commercial dairy, and 0.1% in eggs. The findings showed that L. monocytogenes was most prevalent in ready to eat (9.2%), seafood (5.1%), poultry (5%), traditional dairy (4%), raw meat (2.6%), commercial dairy (1.4%), and egg (0.2%), respectively. Furthermore, the presence of L. monocytogenes particularly in RTE foods (that are consumed without further heat processing) and under-cooked products could be a potential risk for public health. So, contamination should be controlled at all levels of the food chain. Copyright © 2018. Published by Elsevier Ltd.
DEFF Research Database (Denmark)
Piercey, Marta J.; C. Ells, Timothy; Macintosh, Andrew J.
2017-01-01
needed to inhibit the formation of biofilm by LGI1/CC8 strains during incubation for 48 h and 6 days compared to other strains. Formation of biofilm on stainless steel was not significantly (p > 0.05) different among the strains. Analysis of genetic sequence data from desiccation and BAC sensitive (CP4 5......Listeria monocytogenes is a pathogenic foodborne microorganism noted for its ability to survive in the environment and food processing facilities. Survival may be related to the phenotype of individual strains including the ability to form biofilms and resist desiccation and/or sanitizer exposure....... The objectives of this research were to compare 14 L. monocytogenes strains isolated from blood (3), food (6) and water (5) with respect to their benzalkonium chloride (BAC) sensitivity, desiccation resistance, and ability to form biofilm. Correlations were tested between those responses, and the presence...
Listeria spp. in Street-Vended Ready-to-Eat Foods
El-Shenawy, Moustafa; El-Shenawy, Mohamed; Ma?es, Jordi; Soriano, Jose M.
2011-01-01
Street-vended ready-to-eat food sold in Egypt, including sandwiches and dishes of traditional food, was examined for the presence of Listeria species. Out of 576 samples, 24% were found to contain Listeria species. L. monocytogenes and L. innocua were isolated from 57% and 39% of the contaminated samples, respectively. Other Listeria spp. were detected with lower frequency. L. monocytogenes of ≥103 CFU/g were detected in 7% of the total examined samples, which represent 49% of the contamina...
Tamburro, Manuela; Ripabelli, Giancarlo; Vitullo, Monia; Dallman, Timothy James; Pontello, Mirella; Amar, Corinne Francoise Laurence; Sammarco, Michela Lucia
2015-06-01
In this study, tolerance at sublethal concentration of benzalkonium chloride and transcription levels of mdrL, ladR, lde, sigB and bcrABC genes in Listeria monocytogenes strains were evaluated. Viable cells reduction occurred in 45% of strains and clinical isolates showed lower sensitivity than isolates from foods. An increased transcription of an efflux system encoding gene was found in 60% of strains, and simultaneous mdrL overexpression and ladR underexpression occurred in 30% of isolates. A significant association between reduced benzalkonium chloride activity and both mdrL and sigB overexpression was observed; sigB expression also correlated with both mdrL and ladR genes. The bcrABC gene was only found in six strains, all isolated from foods and sensitive to benzalkonium chloride, and in four strains an underexpression was observed. Disinfection at sublethal concentration was less effective in clinical isolates, and mdrL and sigB expression was significantly affected by disinfection. Further insights are needed to understand the adaptation to benzalkonium chloride and to evaluate whether changes in gene expression could affect the L. monocytogenes virulence traits and persistence in the environment. Copyright © 2015 Elsevier Ltd. All rights reserved.
ASSESSMENT OF ACTION OF DISINFECTANTS AGAINST LISTERIA MONOCYTOGENES BIOFILMS
Directory of Open Access Journals (Sweden)
T. K. CABEÇA
2008-12-01
Full Text Available
The purpose of this study was to assess the action of various disinfectants used in food industry against biofilm cells of Listeria monocytogenes formed on stainless steel surfaces during 24, 72 and 120 hours. Numbers of viable biofilm cells decreased after treatment with all the tested disinfectants (iodine, biguanide, quaternary ammonium compounds, peracetic acid and sodium hypochlorite. Sodium hypochlorite was the most effective disinfectant against the biofilm cells, while biguanide and iodine were the least. Scanning electron microscopy observations demonstrated attached cells on stainless steel surfaces after treatment with all the disinfectants. These observations showed that microorganisms were not completely removed from stainless steel surfaces after treatment with the disinfectants, however, the attachment did not means the viability of remaining cells. The biofilm age in hours (24, 72 and 120 had no apparent influence on resistance of microbiological cells to the disinfectants under study. In conclusion biofilm cells of L. monocytogenes can withstand disinfectants action.
Occurrence of Listeria monocytogenes in smoked fish in Sokoto ...
African Journals Online (AJOL)
STORAGESEVER
2008-09-03
Sep 3, 2008 ... monocytogenes and other Listeria species are common contaminant of smoked fish, and this may pose serious public health implications. Key words: Smoked fish, Listeria monocytogenes, contamination, public health. INTRODUCTION ... L. monocytogenes belong to the recently emerging psychrotrophic ...
Jadhav, Snehal; Gulati, Vandana; Fox, Edward M; Karpe, Avinash; Beale, David J; Sevior, Danielle; Bhave, Mrinal; Palombo, Enzo A
2015-06-02
Listeria monocytogenes is an important foodborne pathogen responsible for the sometimes fatal disease listeriosis. Public health concerns and stringent regulations associated with the presence of this pathogen in food and food processing environments underline the need for rapid and reliable detection and subtyping techniques. In the current study, the application of matrix assisted laser desorption/ionisation-time-of-flight mass spectrometry (MALDI-TOF MS) as a single identification and source-tracking tool for a collection of L. monocytogenes isolates, obtained predominantly from dairy sources within Australia, was explored. The isolates were cultured on different growth media and analysed using MALDI-TOF MS at two incubation times (24 and 48 h). Whilst reliable genus-level identification was achieved from most media, identification at the species level was found to be dependent on culture conditions. Successful speciation was highest for isolates cultured on the chromogenic Agar Listeria Ottaviani Agosti agar (ALOA, 91% of isolates) and non-selective horse blood agar (HBA, 89%) for 24h. Chemometric statistical analysis of the MALDI-TOF MS data enabled source-tracking of L. monocytogenes isolates obtained from four different dairy sources. Strain-level discrimination was also observed to be influenced by culture conditions. In addition, t-test/analysis of variance (ANOVA) was used to identify potential biomarker peaks that differentiated the isolates according to their source of isolation. Source-tracking using MALDI-TOF MS was compared and correlated with the gold standard pulsed-field gel electrophoresis (PFGE) technique. The discriminatory index and the congruence between both techniques were compared using the Simpsons Diversity Index and adjusted Rand and Wallace coefficients. Overall, MALDI-TOF MS based source-tracking (using data obtained by culturing the isolates on HBA) and PFGE demonstrated good congruence with a Wallace coefficient of 0.71 and
Uppal, Kamaldeep K; Getty, Kelly J K; Boyle, Elizabeth A E; Harper, Nigel M; Lobaton-Sulabo, April Shayne S; Barry, Bruce
2012-01-01
The objective of our study was to determine effect of packaging method and storage time on reducing Listeria monocytogenes in shelf-stable meat snacks. Commercially available kippered beef steak strips and turkey tenders were dipped into a 5-strain L. monocytogenes cocktail, and dried at 23 °C until a water activity of 0.80 was achieved. Inoculated samples were packaged with 4 treatments: (1) vacuum, (2) nitrogen flushed with oxygen scavenger, (3) heat sealed with oxygen scavenger, and (4) heat sealed without oxygen scavenger. Samples were stored at 23 °C and evaluated for L. monocytogenes levels at 0, 24, 48, and 72 h. Initial levels (time 0) of L. monocytogenes were approximately 5.7 log CFU/cm² for steak and tenders. After 24 h of storage time, a 1 log CFU/cm² reduction of L. monocytogenes was observed for turkey tenders for all packaging treatments. After 48 h, turkey tenders showed >1 log CFU/cm² reduction of L. monocytogenes for all packaging treatments except for vacuum, where only 0.9 log CFU/cm² reduction was observed. After 72 h, reductions for all packaging treatments for turkey tenders ranged from 1.5 to 2.4 log CFU/cm². For kippered beef steak, there was no interaction between the packaging treatments and all storage times (P > 0.05) whereas, time was different (P packaging treatments and a 2.1 log CFU/ cm² L. monocytogenes reduction at 72 h of storage time. Processors of kippered beef steak and turkey tenders could use a combination of vacuum or nitrogen-flushing or heat sealed with an oxygen scavenger packaging methods and a holding time of 24 h prior to shipping to reduce potential L. monocytogenes numbers by ≥1 log. However, processors should be encouraged to hold packaged product a minimum of 72 h to enhance the margin of safety for L. monocytogenes control. © 2011 Institute of Food Technologists®
Monitoring food and non-alcoholic beverage promotions to children.
Kelly, B; King, L; Baur, L; Rayner, M; Lobstein, T; Monteiro, C; Macmullan, J; Mohan, S; Barquera, S; Friel, S; Hawkes, C; Kumanyika, S; L'Abbé, M; Lee, A; Ma, J; Neal, B; Sacks, G; Sanders, D; Snowdon, W; Swinburn, B; Vandevijvere, S; Walker, C
2013-10-01
Food and non-alcoholic beverage marketing is recognized as an important factor influencing food choices related to non-communicable diseases. The monitoring of populations' exposure to food and non-alcoholic beverage promotions, and the content of these promotions, is necessary to generate evidence to understand the extent of the problem, and to determine appropriate and effective policy responses. A review of studies measuring the nature and extent of exposure to food promotions was conducted to identify approaches to monitoring food promotions via dominant media platforms. A step-wise approach, comprising 'minimal', 'expanded' and 'optimal' monitoring activities, was designed. This approach can be used to assess the frequency and level of exposure of population groups (especially children) to food promotions, the persuasive power of techniques used in promotional communications (power of promotions) and the nutritional composition of promoted food products. Detailed procedures for data sampling, data collection and data analysis for a range of media types are presented, as well as quantifiable measurement indicators for assessing exposure to and power of food and non-alcoholic beverage promotions. The proposed framework supports the development of a consistent system for monitoring food and non-alcoholic beverage promotions for comparison between countries and over time. © 2013 The Authors. Obesity Reviews published by John Wiley & Sons Ltd on behalf of the International Association for the Study of Obesity.
Analysis of process factors of dry fermented salami to control Listeria monocytogenes
Directory of Open Access Journals (Sweden)
Enrico Novelli
2017-01-01
Full Text Available Challenge tests are a clear opportunity for manufacturers interested in the evaluation of their management system with the aim to reduce the spread of foodborne pathogens. This is a main concern especially in ready-to-eat food in relation to the risk associated with Listeria monocytogenes. For small and medium-scale food industry the manufacturing practices and products formulation are characterised by a wider variability and poor repeatability. The use of ad hoc challenge test and the comparison among different processing systems are strongly required. This paper reports a preliminary comparison among different challenge tests (n=12 commissioned by three manufacturers of raw-fermented salami during a period of three years (2013-2016. The challenge tests were designed to evaluate the growth potential (δ of L. monocytogenes during the whole processing period of the salami. The doughs were prepared according to different formulations: the simplest formulation was represented by the use of salt, potassium nitrate, black pepper and starter cultures, while the most composited formulations also included the use of sugars and ascorbic acid in addition to nitrite salt. All the processing steps were conducted within an experimental laboratory dedicated for the processing of meat. After stuffing, the salami were dried and ripened under temperature and relative humidity control. The sugar inclusion can be considered as a protective factor, while the drying step at high temperature (above 20°C was associated with higher δ values (δ>0.5 log10 cfu/g. The addition of starter cultures, and the subsequent acidification highlighted the importance of pH as the parameter able to affect the L. monocytogenes growth.
Analysis of Process Factors of Dry Fermented Salami to Control Listeria Monocytogenes
Novelli, Enrico; Dal Santo, Lucia; Balzan, Stefania; Cardazzo, Barbara; Spolaor, Dino; Lombardi, Angiolella; Carraro, Lisa; Fasolato, Luca
2017-01-01
Challenge tests are a clear opportunity for manufacturers interested in the evaluation of their management system with the aim to reduce the spread of foodborne pathogens. This is a main concern especially in ready-to-eat food in relation to the risk associated with Listeria monocytogenes. For small and medium-scale food industry the manufacturing practices and products formulation are characterised by a wider variability and poor repeatability. The use of ad hoc challenge test and the comparison among different processing systems are strongly required. This paper reports a preliminary comparison among different challenge tests (n=12) commissioned by three manufacturers of raw-fermented salami during a period of three years (2013-2016). The challenge tests were designed to evaluate the growth potential (δ) of L. monocytogenes during the whole processing period of the salami. The doughs were prepared according to different formulations: the simplest formulation was represented by the use of salt, potassium nitrate, black pepper and starter cultures, while the most composited formulations also included the use of sugars and ascorbic acid in addition to nitrite salt. All the processing steps were conducted within an experimental laboratory dedicated for the processing of meat. After stuffing, the salami were dried and ripened under temperature and relative humidity control. The sugar inclusion can be considered as a protective factor, while the drying step at high temperature (above 20°C) was associated with higher δ values (δ>0.5 log10 cfu/g). The addition of starter cultures, and the subsequent acidification highlighted the importance of pH as the parameter able to affect the L. monocytogenes growth. PMID:28462203
Ochiai, Yoshitsugu; Yamada, Fumiya; Yoshikawa, Yuko; Mochizuki, Mariko; Takano, Takashi; Hondo, Ryo; Ueda, Fukiko
2017-10-16
The food-borne pathogen Listeria monocytogenes is present persistently in food processing environments, where this bacterium is exposed to various stress factors, including oxidative stress. This study aimed to elucidate the temperature-dependent response of L. monocytogenes to H 2 O 2 exposure and the phenotypic changes in colony formation by H 2 O 2 -treated bacteria. Survival curves indicated an increase in the resistance to H 2 O 2 in L. monocytogenes as the temperature decreased during the stress exposure procedure. Transcriptional induction of genes with key roles in response to H 2 O 2 , including sigB and kat, was observed at 37°C, but not at 20°C, whereas other stress response genes were induced at both temperatures. Following H 2 O 2 exposure, L. monocytogenes produced small colony phenotypes and the colony size decreased in a stress exposure duration-dependent manner. Resuscitated cells with no ability to form colonies in the absence of sodium pyruvate were also found. Our findings show the possibility that a sequential transition in the injury phenotype from small colony phenotype to resuscitated cells occurred during the course of exposure to H 2 O 2 . The higher H 2 O 2 resistance at 20°C than 37°C suggests further investigation of the response to H 2 O 2 exposure under the lower temperatures, including refrigeration temperature, which may contribute to elucidation of bacterial survival over extended time periods in food-processing environments. Copyright © 2017 Elsevier B.V. All rights reserved.
Schrama, D; Helliwell, N; Neto, L; Faleiro, M L
2013-06-01
The aim of this study was to evaluate the effect of the acid and salt adaptation in a cheese-based medium on the virulence potential of Listeria monocytogenes strains isolated from cheese and dairy processing environment using the Galleria mellonella model. Four L. monocytogenes strains were exposed to a cheese-based medium in conditions of induction of an acid tolerance response and osmotolerance response (pH 5·5 and 3·5% w/v NaCl) and injected in G. mellonella insects. The survival of insects and the L. monocytogenes growth kinetics in insects were evaluated. The gene expression of hly, actA and inlA genes was determined by real-time PCR. The adapted cells of two dairy strains showed reduced insect mortality (P 0·05) was found between adapted and nonadapted cells. The gene expression results evidenced an overexpression of virulence genes in cheese-based medium, but not in simulated insect-induced conditions. Our results suggest that adaptation to low pH and salt in a cheese-based medium can affect the virulence of L. monocytogenes, but this effect is strain dependent. In this study, the impact of adaptation to low pH and salt in a cheese-based medium on L. monocytogenes virulence was tested using the Wax Moth G. mellonella model. This model allowed the differentiation of the virulence potential between the L. monocytogenes strains. The effect of adaptation on virulence is strain dependent. The G. mellonella model revealed to be a prompt method to test food-related factors on L. monocytogenes virulence. © 2013 The Society for Applied Microbiology.
Kapetanakou, Anastasia E; Gkerekou, Maria A; Vitzilaiou, Eirini S; Skandamis, Panagiotis N
2017-04-04
Different physicochemical and microbiological characteristics of cheeses may affect Listeria monocytogenes potential to grow, survive, or exhibit an acid adaptive response during storage and digestion. The objectives of the present study were to assess: i) the survival or growth potential of L.monocytogenes on various cheeses during storage, ii) the effect of initial indigenous microbiota on pathogen growth in comparison to expected growth curves retrieved by existing predictive models, and iii) the impact of habituation on/in cheeses surfaces on the subsequent acid resistance during simulated gastric digestion. Portions of cream (Cottage and Mascarpone), soft (Anthotyros, Camembert, Mastelo®, Manouri, Mozzarella, Ricotta), and semi-hard (Edam, Halloumi, Gouda) cheeses were inoculated with ca. 100CFU/g or cm 2 of L.monocytogenes and stored under vacuum or aerobic conditions at 7°C (n=4). The impact of varying (initial) levels of starter culture or indigenous spoilage microbiota on pathogen growth was evaluated by purchasing cheese packages on different dates in relation to production and expiration date (subsequently reflecting to different batches) mimicking a potential situation of cheese contamination with L.monocytogenes during retail display. Values of pH and a w were also monitored and used to simulate growth of L. monocytogenes by existing models and compare it with the observed data of the study. Survival in simulated gastric fluid (SGF) (pH1.5; HCl; max. 120min) was assessed at three time points during storage. Mascarpone, Ricotta, Mozzarella, Camembert, and Halloumi supported L.monocytogenes growth by 0.5-0.8logCFU/g or cm 2 per day, since low initial levels of total viable counts (TVC) (1.8-3.8logCFU/g or cm 2 ) and high pH/a w values (ca. 6.23-6.64/0.965-0.993) were recorded. On Cottage, Anthotyros, Manouri, Mastelo®, Edam, and Gouda, the pathogen survived at populations similar or lower than the inoculation level due to the high reported competition
Combined action of S-carvone and mild heat treatment on Listeria monocytogenes Scott A
Karatzas, A.K.; Bennik, M.H.J.; Smid, E.J.; Kets, E.P.W.
2000-01-01
The combined action of the plant-derived volatile, S-carvone, and mild heat treatment on the food-borne pathogen, Listeria monocytogenes, was evaluated. The viability of exponential phase cultures grown at 8 °C could be reduced by 1.3 log units after exposure to S-carvone (5 mmol 1-1) for 30 min at
Chaitiemwong, N.; Hazeleger, W.C.; Beumer, R.R.
2010-01-01
Survival of Listeria monocytogenes on a conveyor belt material with or without antimicrobial additives, in the absence or presence of food debris from meat, fish and vegetables and at temperatures of 10, 25 and 37 °C was investigated. The pathogen survived best at 10 °C, and better at 25 °C than at
DEFF Research Database (Denmark)
Mejlholm, Ole; Bøknæs, Niels; Dalgaard, Paw
2015-01-01
added acetic and/or lactic acids. The stochastic model was developed from an existing deterministic model including the effect of 12 environmental parameters and microbial interaction (O. Mejlholm and P. Dalgaard, Food Microbiology, submitted for publication). Observed maximum population density (MPD...... of the least and most preserved sample of CSGH and CSS were used as input for the existing deterministic model. For both modelling approaches, it was shown that lag time and the effect of microbial interaction needs to be included to accurately predict MPD values of L. monocytogenes. Addition of organic acids...... to CSGH and CSS was confirmed as a suitable mitigation strategy against the risk of growth by L. monocytogenes as both types of products were in compliance with the EU regulation on ready-to-eat foods....
Directory of Open Access Journals (Sweden)
Yasmin Mohamed
2016-06-01
Full Text Available Because of its high case fatality rate, listeriosis locates among the most frequent causes of death due to food-borne illness. In this study, a total of 150 processed meat samples were collected from Giza Governorate, Egypt. Phenotypic and genotypic identification of Listeria monocytogenes was performed using PCR incorporating listeriolysin O virulence gene hlyA followed by DNA sequence analysis. L. monocytogenes was confirmed in 4% of each of beef burger, minced meat, and luncheon samples. Phylogenetic analysis showed that all the six Egyptian isolates have high homology with Colombian isolate (EF030606, except one Egyptian isolate which showed high homology with Indian isolate (EU840690. The public health significance of these pathogens as well as recommended sanitary measures were discussed.
Listeria monocytogenes infection in pregnancy and neonatal sepsis
Directory of Open Access Journals (Sweden)
Francesca Pascale
2008-06-01
Full Text Available Authors report a fatal neonatal sepsis caused by Listeria monocytogenes. While the diagnostic procedure aimed to identify the microrganism is described, it is emphasized the importance to recover Streptococcus agalactiae (GBS and L. monocytogenes by means of vaginal-rectal swab culture. The intrapartum screening for L. monocytogenes, by Polymerase Chain Reaction (PCR providing results in 75 minutes is also evaluated.
González, David; Vitas, Ana Isabel; Díez-Leturia, María; García-Jalón, Isabel
2013-12-01
The aim of this study was to obtain data from refrigerated ready-to-eat seafood products at retail in Spain (young eels, crabstick and smoked salmon), regarding prevalence and levels of Listeria monocytogenes, storage temperatures and the impact of transport conditions (type of bag) on the temperature of the product. The one-year surveillance period was carried out according to the EC Regulation No. 2073/2005, taking 5 units/batch and analyzing 250 samples following ISO 11290-1/A1 and ISO 11290-2/A methodologies. Low prevalence of L. monocytogenes was observed in surimi products, while 4.8% of smoked salmon samples were positive for Listeria with low levels (<10 cfu/g) and uneven pathogen distribution. A single company was responsible for 80% of the positive lots. All purchased products showed values higher than 4 °C at retail and an average increase of 2.5 °C or up to 6.2 °C was recorded when isothermal or plastic shopping bags were used for transport, respectively. To avoid noncompliance of the Food Safety Objective for L. monocytogenes in seafood RTE products more efforts from all stakeholders are needed, with special attention so as to improve control and maintenance of refrigerators at retail and to enhance consumer education regarding food safety practices. Copyright © 2013 Elsevier Ltd. All rights reserved.
Szymczak, Barbara; Dąbrowski, Waldemar
2015-05-01
The count of Listeria monocytogenes was determined, before and after heat treatment, in 200 samples of dumplings of 9 brands and with different types of stuffing. Analyses were conducted according to ISO 11290-1 standard and with real-time PCR method. The highest count of L. monocytogenes was found in meat dumplings (10(2) to 10(4) CFU/g), whereas products with white cheese-potato stuffing and vegetable-mushroom stuffing contained significantly less Listeria, 20 to 80 and 5 to 32 CFU/g, respectively. In cooled meat dumplings the extent of contamination depended significantly on the producer. In addition, a significant (P monocytogenes in meat dumplings. In contrast, the microwave heating applied for 2 min at 600 W only reduced the count of L. monocytogenes by 1 to 2 logs. Hence, the microwave heating failed to reduce the risk of infection with this pathogen below the level permissible in the EU regulation, especially in the most contaminated samples. In this case, the efficacy of microwave heating was significantly (P monocytogenes (rho = 0.626), then by meat content in the stuffing (0.476), and to the lowest extent--by the type of meat (0.415 to 0.425). However, no Listeria sp. and L. monocytogenes were isolated from cooked dumplings with fruits (strawberries or blueberries). © 2015 Institute of Food Technologists®
Listeria monocytogenes - Danger for health safety vegetable production.
Kljujev, Igor; Raicevic, Vera; Jovicic-Petrovic, Jelena; Vujovic, Bojana; Mirkovic, Milica; Rothballer, Michael
2018-04-22
The microbiologically contaminated vegetables represent a risk for consumers, especially vegetables without thermal processing. It is known that human pathogen bacteria, such as Listeria monocytogenes, could exist on fresh vegetables. The fresh vegetables could become Listeria-contaminated if they come in touch with contaminated soil, manure, irrigation water. The aim of this work was to investigate the presence of Listeria spp. and L. monocytogenes in different kind of vegetables grown in field and greenhouse condition as well as surface and endophytic colonization plant roots of different vegetables species by L. monocytogenes in laboratory conditions. The detection of Listeria spp. and L. monocytogenes in vegetable samples was done using ISO and PCR methods. The investigation of colonization vegetable roots and detection Listeria-cells inside plant root tissue was done using Fluorescence in situ hybridization (FISH) method in combination with confocal laser scanning microscopy (CLSM). The results showed that 25.58% vegetable samples were positive for Listeria spp. and only one sample (carrot) was positive for L. monocytogenes out of 43 samples in total collected from field and greenhouse. The strain L. monocytogenes EGD-E surface and endophytic colonized carrot root in highest degree while strain L. monocytogenes SV4B was the most represented at leafy vegetable plants, such at lettuce (1.68 × 10 6 cells/mm 3 absolutely dry root) and spinach (1.39 × 10 6 cells/mm 3 absolutely dry root) root surface. The cells of L. monocytogenes SV4B were visible as single cells in interior tissue of plant roots (celery and sweet corn roots) as well as in the interior of the plant root cell at sweet corn root. The cells of L. monocytogenes EGD-E bind to the surface of the plant root and they were less commonly found out on root hair. In the inner layers of the root, those bacterial cells were inhabited intercellular spaces mainly as single cells very close to the
Chen, Jianshun; Jiang, Lingli; Chen, Xueyan; Luo, Xiaokai; Chen, Yang; Yu, Ying; Tian, Guoming; Liu, Dongyou; Fang, Weihuan
2009-03-01
The genus Listeria consists of six closely related species and forms three phylogenetic groups: L. monocytogenes- L. innocua, L. ivanovii-L. seeligeri-L. welshimeri, and L. grayi. In this report, we attempted to examine the evolutionary relationship in the L. monocytogenes-L. innocua group by probing the nucleotide sequences of 23S rRNA and 16S rRNA, and the gene clusters lmo0029-lmo0042, ascBdapE, rplS-infC, and prs-ldh in L. monocytogenes serovars 1/2a, 4a, and 4b, and L. innocua. Additionally, we assessed the status of L. monocytogenes-specific inlA and inlB genes and 10 L. innocua-specific genes in these species/serovars, together with phenotypic characterization by using in vivo and in vitro procedures. The results indicate that L. monocytogenes serovar 4a strains are genetically similar to L. innocua in the lmo0035-lmo0042, ascB-dapE, and rplS-infC regions and also possess L. innocua-specific genes lin0372 and lin1073. Furthermore, both L. monocytogenes serovar 4a and L. innocua exhibit impaired intercellular spread ability and negligible pathogenicity in mouse model. On the other hand, despite resembling L. monocytogenes serovars 1/2a and 4b in having a nearly identical virulence gene cluster, and inlA and inlB genes, these serovar 4a strains differ from serovars 1/2a and 4b by harboring notably altered actA and plcB genes, displaying strong phospholipase activity and subdued in vivo and in vitro virulence. Thus, by possessing many genes common to L. monocytogenes serovars 1/2a and 4b, and sharing many similar gene deletions with L. innocua, L. monocytogenes serovar 4a represents a possible evolutionary intermediate between L. monocytogenes serovars 1/2a and 4b and L. innocua.
Directory of Open Access Journals (Sweden)
Élen Silveira Nalério
2009-09-01
Full Text Available Listeria monocytogenes é uma bactéria patogênica que se tornou um grande desafio para as indústrias de alimentos, entre elas a de frangos, assim como para os órgãos de vigilância sanitária. Apesar da produção de frangos estar em expansão na região sul do Rio Grande do Sul, não há relatos sobre esse patógeno, dessa forma, objetivou-se avaliar a prevalência de L. monocytogenes e de seus sorotipos nos diversos segmentos dessa cadeia produtiva. Nos aviários isolou-se L. monocytogenes em 2,9% (1/35 das amostras de swabs cloacais, não se isolando o microrganismo em amostras provenientes das camas de aviários. No abatedouro, 11,7% (15/128 das amostras apresentaram contaminação por L. monocytogenes e nos frangos resfriados procedentes do comércio, a prevalência foi de 33,3% (15/45.Observou-se que 51,6% (16/31 das cepas de L. monocytogenes pertenciam ao sorotipo 1/2b; 22,5% (7/31 ao sorotipo 4e; 16,1% (5/31 ao sorotipo 1/2a; 6,4% (2/31 ao sorotipo 4b; e 3,2% (1/31 ao sorotipo 1/2c. Há disseminação de L. monocytogenes na cadeia produtiva de frangos da região sul do Rio Grande do Sul e a presença de sorotipos prevalentes em casos/surtos de listeriose traz preocupação à saúde pública.Listeria monocytogenes is a pathogenic bacterium which has become a huge challenge to the food industries, including the poultry industry, and to the health surveillance agencies. Although poultry production is in expansion in southern of Rio Grande do Sul, Brazil, there are not reports about this pathogen thus this study aimed at assessing the prevalence of L monocytogenes and its serotypes in the several segments of this productive chain. In the broilers flocks L. monocytogenes were isolated in 2.9% (1/35 from cloacal swabs samples. This microorganism was not isolated from broiler houses samples. In the abattoir, 11% of the samples presented L. monocytogenes contamination, and in the chilled chicken from retailers its prevalence was 33.3% (15
Jahan, M; Holley, R A
2016-04-01
Listeria monocytogenes is an important foodborne pathogen that can cause infection in children, pregnant women, the immunocompromised and the elderly. Antibiotic resistance in this species would represent a significant public health problem since the organism has a high fatality/case ratio and resistance may contribute to failure of therapeutic treatment. This study was designed to explore whether the in vitro transferability of antibiotic resistance from enterococci to Listeria spp. could occur. It was found that 2/8 Listeria strains were able to acquire tetracycline resistance from Enterococcus faecium. Listeria monocytogenes GLM-2 acquired the resistance determinant tet(M) and additional streptomycin resistance through in vitro mating with Ent. faecium S27 isolated from commercial fermented dry sausage. Similarly, Listeria innocua became more resistant to tetracycline, but the genetic basis for this change was not confirmed. It has been suggested that enterococci may transfer antibiotic resistance genes via transposons to Listeria spp., and this may explain, in part, the origin of their antibiotic resistance. Thus, the presence of enterococci in food should not be ignored since they may actively contribute to enhanced antibiotic resistance of L. monocytogenes and other pathogens. Acquisition of antibiotic resistance by pathogenic bacteria in the absence of antibiotic pressure represents an unquantified threat to human health. In the present work resistance to tetracycline and streptomycin were transferred by nonplasmid-based conjugation from Enterococcus faecium isolated from fermented sausage to Listeria monocytogenes and Listeria innocua. Thus, natural transfer of antibiotic resistance to Listeria strains may occur in the future which reinforces the concern about the safety of enterococcal strains present in foods. © 2016 The Society for Applied Microbiology.
RFID technologies for imported foods inspection
Food-borne illness typically occurs due to contamination of food products with Escherichia coli, Salmonella spp., Listeria monocytogenes and other pathogens. Unfortunately, it takes several weeks to identify the source of such contamination, possibly due to lack of a central database system that is ...
Listeria monocytogenes as a vector for anti-cancer therapies.
LENUS (Irish Health Repository)
Tangney, Mark
2012-01-31
The intracellular pathogen Listeria monocytogenes represents a promising therapeutic vector for the delivery of DNA, RNA or protein to cancer cells or to prime immune responses against tumour-specific antigens. A number of biological properties make L. monocytogenes a promising platform for development as a vector for either gene therapy or as an anti-cancer vaccine vector. L. monocytogenes is particularly efficient in mediating internalization into host cells. Once inside cells, the bacterium produces specific virulence factors which lyse the vaculolar membrane and allow escape into the cytoplasm. Once in the cytosol, L. monocytogenes is capable of actin-based motility and cell-to-cell spread without an extracellular phase. The cytoplasmic location of L. monocytogenes is significant as this potentiates entry of antigens into the MHC Class I antigen processing pathway leading to priming of specific CD8(+) T cell responses. The cytoplasmic location is also beneficial for the delivery of DNA (bactofection) by L. monocytogenes whilst cell-to-cell spread may facilitate access of the vector to cells throughout the tumour. Several preclinical studies have demonstrated the ability of L. monocytogenes for intracellular gene or protein delivery in vitro and in vivo, and this vector has also displayed safety and efficacy in clinical trial. Here, we review the features of the L. monocytogenes host-pathogen interaction that make this bacterium such an attractive candidate with which to induce appropriate therapeutic responses. We focus primarily upon work that has led to attenuation of the pathogen, demonstrated DNA, RNA or protein delivery to tumour cells as well as research that shows the efficacy of L. monocytogenes as a vector for tumour-specific vaccine delivery.
Hingston, Patricia A; Stea, Emma C; Knøchel, Susanne; Hansen, Truelstrup
2013-10-01
This study investigated the effect of initial contamination levels, biofilm maturity and presence of salt and fatty food soils on desiccation survival of Listeria monocytogenes on stainless steel (SS) coupons. L. monocytogenes cultures grown (at 15 °C for 48 h) in Tryptic Soy Broth with 1% glucose (TSB-glu) containing either 0.5 or 5% (w/v) NaCl were re-suspended in TSB-glu containing either 0.5 or 5% NaCl and used to contaminate SS coupons at levels of 3.5, 5.5, and 7.5 log CFU/cm². Desiccation (at 15 °C for 20 days, 43% RH) commenced immediately (non-biofilm) or following biofilm formation (at 15 °C for 48 h, 100% RH). To study the impact of food lipids, non-biofilm L. monocytogenes cells were suspended in TSB-glu containing either canola oil (5-10%) or lard (20-60%) and desiccated as above on SS coupons. Following desiccation for 20 days, survivors decreased by 1.4-3.7 log CFU/cm² for non-biofilm L. monocytogenes cells. The contamination level had no significant (p > 0.05) effect on survival kinetics. SEM micrographs showed mature biofilms on coupons initially contaminated with 5.5 and 7.5 log CFU/cm². Mature biofilm cells were significantly (p biofilms formed by the lowest contamination level. Besides biofilm maturity/formation, previous osmoadaptation, exposure to lard (20-60%) or salt (5%) during desiccation significantly (p biofilms and salty or fatty soils on food contact surfaces. Copyright © 2013 Elsevier Ltd. All rights reserved.
Zhang, Xiaoguang; Tsuji, Sachiko; Kitaoka, Hayato; Kobayashi, Hiroshi; Tamai, Mitsuru; Honjoh, Ken-Ichi; Miyamoto, Takahisa
2017-10-01
Detection of foodborne pathogens at very low levels is still a challenge. A custom-built multichannel surface plasmon resonance (SPR) biosensor and simultaneous enrichment broth (SEB) were used to develop a simultaneous detection method for 3 important foodborne pathogens, Escherichia coli O157:H7 (O157:H7), Salmonella enteritidis, and Listeria monocytogenes, at a very low level. These 3 foodborne pathogens at a very low level (14, 6, and 28 CFU/25 g (mL) for O157:H7, S. enteritidis, and L. monocytogenes, respectively) were inoculated in SEB and incubated at 37 ˚C for 24 h. Sample prepared from the simultaneous enrichment culture was analyzed using the multichannel SPR biosensor and sensor chip immobilized with polyclonal antibodies specific to each of the target pathogens. O157:H7, S. enteritidis, and L. monocytogenes in chicken were detected simultaneously at an inoculum dose of 14, 6, and 28 CFU/25 g, respectively. Our method using a custom-built multichannel SPR biosensor and enrichment in SEB is expected as a rapid and simultaneous detection method for low levels of O157:H7, S. enteritidis, and L. monocytogenes in food. Our method is expected as a rapid and simultaneous detection method for pathogens at very low levels. It has great potential for safety control of food and microbiological detection applications. © 2017 Institute of Food Technologists®.
Prevalence and growth of Listeria monocytogenes in naturally contaminated seafood
DEFF Research Database (Denmark)
Jørgensen, Lasse Vigel; Huss, Hans Henrik
1998-01-01
Listeria monocytogenes contamination of seafood varies with product category. The highest prevalence was found in cold- smoked fish (34-60%), while the lowest was found in heat- treated and cured seafood (4-12%). The prevalence of L. monocytogenes differed greatly in cold-smoked salmon between...... production sites, ranging from monocytogenes. The organism showed moderate growth...... in naturally contaminated cold-smoked, and 'gravad', fish while the growth appeared faster in hot smoked fish. Thus L. monocytogenes is not under control in these products. Finally, the prevalence and growth of L. monocytogenes in naturally contaminated cold-smoked salmon are discussed in relation...
Listeria monocytogenes endophthalmitis following keratoconjunctivitis
Directory of Open Access Journals (Sweden)
Shoughy SS
2014-01-01
Full Text Available Samir S Shoughy,1 Khalid F Tabbara1–31The Eye Center and The Eye Foundation for Research in Ophthalmology, Riyadh, Saudi Arabia; 2Department of Ophthalmology, College of Medicine, King Saud University, Riyadh, Saudi Arabia; 3The Wilmer Ophthalmological Institute of The Johns Hopkins University School of Medicine, Baltimore, MD, USAAbstract: Endophthalmitis due to endogenous or exogenous bacteria is a rare infection of the eye. We report a case of endophthalmitis following Listeria monocytogenes keratoconjunctivitis in a 27-year-old healthy white male presenting with hand motion visual acuity, right eye mucopurulent conjunctivitis, elevated intraocular pressure, and pigmented hypopyon 6 months post-keratectomy. The conjunctivitis was unresponsive to a 5-day course of topical tobramycin eye drops, and the patient developed keratitis with pain that progressed to endophthalmitis after 21 days. Diagnostic B-scan revealed vitreous exudates. Intraocular fluid specimen showed Gram-positive organisms and the aqueous culture grew penicillin-/aminoglycoside-sensitive L. monocytogenes. The patient was given intravitreal and systemic vancomycin and ceftazidime. The eye was unresponsive to intravenous penicillin and gentamicin; the anterior chamber progressively flattened and developed phthisis bulbi. L. monocytogenes keratoconjunctivitis may lead to bacterial endophthalmitis. Prompt culture and early antibiotic therapy are recommended.Keywords: conjunctivitis, L. monocytogenes, endophthalmitis
Directory of Open Access Journals (Sweden)
Puga eCH
2016-02-01
Full Text Available Changes in spatial organization, as observed by confocal laser scanning microscopy (CLSM, viable cell content, biovolume and substratum surface coverage of the biofilms formed on glass by Pseudomonas fluorescens resulting from co-culture with Listeria monocytogenes, were examined. Two strains of L. monocytogenes, two culture temperatures and two biofilm developmental stages were investigated. Both L. monocytogenes strains, a persistently sampled isolate (collected repeatedly along 3 years from a meat factory and Scott A, induced shrinkage in matrix volume, both at 20ºC and 4ºC, in mature or old biofilms, without loss of P. fluorescens cell count per surface unit. The nearly homogeneous pattern of surface coverage shown by mono-species P. fluorescens biofilms, turned into more irregular layouts in co-culture with L. monocytogenes. The upper layer of both mono and dual-species biofilms turned to predominantly consist of matrix, with plenty of viable cells underneath, in old biofilms cultured at 20ºC, but not in those grown at 4ºC. Between 15 and 56% of the substratum area was covered by biofilm, the extent depending on temperature, time and L. monocytogenes strain. Real biofilms in food-related surfaces may thus be very heterogeneous regarding their superficial components, i.e. those more accessible to disinfectants. It is therefore a hygienic challenge to choose an adequate agent to disrupt them.
Prevalence of food contamination with Listeria spp. in Kermanshah, Islamic Republic of Iran.
Akya, A; Najafi, A; Moradi, J; Mohebi, Z; Adabagher, S
2013-05-01
Listeria monocytogenes is a human pathogen causing serious diseases. We aimed to determine food contamination with Listeria spp. in Kermanshah, Islamic Republic of Iran. Samples (185 dairy, 187 meat products and 158 ready-to-eat foods such as salads) were randomly collected from markets. After processing, samples were cultured in half-Fraser and Fraser broth followed by cultivation on PALCAM and Oxford media. Confirmatory tests including carbohydrate utilization were performed on isolates to determine species. Bacteria were isolated from 66/530 samples (12.5%). Meat products showed the highest (27.2%) and dairy products the lowest (3.8%) contamination rates. L. innocua was found in 56 (10.6%) samples, but L. monocytogenes was only found in 3 samples (0.6%). The results indicate that the rate of contamination with L. monocytogenes, even for ready-to-eat foods, was low but for other Listeria spp., in particular strains of L. innocua, the rate of contamination was higher, suggesting that more control on food sanitation is required.
Monitoring Industrial Food Processes Using Spectroscopy & Chemometrics
DEFF Research Database (Denmark)
Pedersen, Dorthe Kjær; Engelsen, Søren Balling
2001-01-01
In the last decade rapid spectroscopic measurements have revolutionized quality control in practically all areas of primary food and feed production. Near-infrared spectroscopy (NIR & NIT) has been implemented for monitoring the quality of millions of samples of cereals, milk and meat with unprec......In the last decade rapid spectroscopic measurements have revolutionized quality control in practically all areas of primary food and feed production. Near-infrared spectroscopy (NIR & NIT) has been implemented for monitoring the quality of millions of samples of cereals, milk and meat...
Directory of Open Access Journals (Sweden)
U. B. Usman
2016-01-01
Full Text Available In this study, Listeria (L. monocytogenes isolated from milk and milk products in Kaduna, Nigeria, were subjected to a multiplex PCR assay to identify virulence-associated genes (such as prf A, inl A, hly A, act A, and iap. Of the 36 isolates, 9 (25% were positive for one or two virulence-associated genes. Based on the sample type, 6 (16.9% of the isolates that possessed virulence-associated genes were obtained from raw milk, 2 (3.2% from “Manshanu,” and 1 (2.8% from “Kindrimo.” Sequence and phylogenetic analysis based on the 16S rRNA revealed that Nigerian L. monocytogenes isolates (NGA 34A, NGA 35A, NGA 41A, and NGA 38A, when compared with reference L. monocytogenes, were grouped into two distinct clusters, A and B, with sequence (NGA 34A, NGA 35A, and NGA 41A phylogenetically closer to J1776; N1-011A; R2-502; J1816; and J2-031, whereas L. monocytogenes isolate (NGA 38A clustered with EDG; J1-220; J1926; J1817; and J2-1091. The separation of the Nigerian L. monocytogenes isolates into linage A (responsible for epidemic listeriosis and lineage B (responsible for sporadic cases of listeriosis is of public health concern and that local isolates might have potentials for human food borne listeriosis based on the virulence factors so far identified.
The Metalloprotease of Listeria monocytogenes Is Activated by Intramolecular Autocatalysis▿ †
Bitar, Alan Pavinski; Cao, Min; Marquis, Hélène
2007-01-01
The metalloprotease (Mpl) of Listeria monocytogenes is a thermolysin-like protease that mediates the maturation of a broad-range phospholipase C, whose function contributes to the ability of this food-borne bacterial pathogen to survive intracellularly. Mpl is made as a proprotein that undergoes maturation by proteolytic cleavage of a large N-terminal prodomain. In this study, we identified the N terminus of mature Mpl and generated Mpl catalytic mutants to investigate the mechanism of Mpl ma...
Marwati, T.; Cahyaningrum, N.; Widodo, S.; Januarsyah, T.; Purwoko
2018-01-01
Bacteriocin is a protein compound which has bactericidal ability against pathogen bacteria. This research aims to study the inhibitory activity of bacteriocin produced from Lactobacillus SCG 1223 against Listeria monocytogenes, Salmonella thypimuruim and Escherchia coli. The bacteriocin produce from Lactobacillus SCG 1223 in the MRS broth media The experimental design used was Completely Randomized Design. The variations used in this design were percentage of inoculum (5%, 10%), medium pH (4, 6), incubation temperature (27°C, 40°C), and incubation time (4, 10, 14 hours). Result showed that bacteriocin from Lactobacillus SCG 1223 had wide spectrum toward L. monocytogenes, S. thypimuruim and E. coli. The highest bacteriocin activity toward L. monocytogenes produced by Lactobacillus SCG 1223 with 10% inoculum in media with initial pH 6, incubation temperature 27°C for 14 hour, toward S. thypimurium produced by Lactobacillus SCG 1223 with in media with initial pH 6, incubation temperature 40°C for 14 hour, and toward E. coli was 1085.81 AU/ml, produced by Lactobacillus SCG 1223 in MRS broth with initial pH 4, incubation temperature 40°C for 14 hour. This study is expected to find a new food preservative that can inhibit the growth of pathogenic bacteria and extend the shelf life of food. From the economic prospective of view, bacteriocin is very promising natural alternative biopreservatives.
Ottesen, Andrea; Ramachandran, Padmini; Reed, Elizabeth; White, James R; Hasan, Nur; Subramanian, Poorani; Ryan, Gina; Jarvis, Karen; Grim, Christopher; Daquiqan, Ninalynn; Hanes, Darcy; Allard, Marc; Colwell, Rita; Brown, Eric; Chen, Yi
2016-11-16
Microbiota that co-enrich during efforts to recover pathogens from foodborne outbreaks interfere with efficient detection and recovery. Here, dynamics of co-enriching microbiota during recovery of Listeria monocytogenes from naturally contaminated ice cream samples linked to an outbreak are described for three different initial enrichment formulations used by the Food and Drug Administration (FDA), the International Organization of Standardization (ISO), and the United States Department of Agriculture (USDA). Enrichment cultures were analyzed using DNA extraction and sequencing from samples taken every 4 h throughout 48 h of enrichment. Resphera Insight and CosmosID analysis tools were employed for high-resolution profiling of 16S rRNA amplicons and whole genome shotgun data, respectively. During enrichment, other bacterial taxa were identified, including Anoxybacillus, Geobacillus, Serratia, Pseudomonas, Erwinia, and Streptococcus spp. Surprisingly, incidence of L. monocytogenes was proportionally greater at hour 0 than when tested 4, 8, and 12 h later with all three enrichment schemes. The corresponding increase in Anoxybacillus and Geobacillus spp.indicated these taxa co-enriched in competition with L. monocytogenes during early enrichment hours. L. monocytogenes became dominant after 24 h in all three enrichments. DNA sequences obtained from shotgun metagenomic data of Listeria monocytogenes at 48 h were assembled to produce a consensus draft genome which appeared to have a similar tracking utility to pure culture isolates of L. monocytogenes. All three methods performed equally well for enrichment of Listeria monocytogenes. The observation of potential competitive exclusion of L. mono by Anoxybacillus and Geobacillus in early enrichment hours provided novel information that may be used to further optimize enrichment formulations. Application of Resphera Insight for high-resolution analysis of 16S amplicon sequences accurately identified L. monocytogenes
Hayrapetyan, H.; Hazeleger, W.C.; Beumer, R.R.
2012-01-01
Natural antimicrobials are being more and more considered as alternative approach for controlling growth of microorganisms in food. The objective of this study was to evaluate the pomegranate extract’s (PE) potential to be used as a natural preservative in ready to eat meats. Listeria monocytogenes
Directory of Open Access Journals (Sweden)
Realpe-Delgado, María Elena
2016-10-01
Full Text Available Salmonella spp., Campylobacter spp., and L. monocytogenes are zoonotic foodborne pathogens, associated with the consumption of contaminated foods of animal origin. In this study we determined the prevalence and risk factors associated with the presence of these microorganisms at all stages of the production system, in two Colombian poultry companies (EI-EI-I and II. In EI-I, Campylobacter spp., and Salmonella spp., were isolated from 10 % and 4.4 % of the specimens, and S. Heidelberg was the predominant serotype. Salmonella spp., was found in 6 % of hands and stool samples of workers. S. Saphra was the most prevalent serotype. In EI-II, the prevalence of Campylobacter spp., and Salmonella spp., from animal specimens was 7 % and 17 %, respectively. L. monocytogenes was not detected. This study established the prevalence of these zoonotic pathogens through the production chain and showed the presence of pathogen carriers among workers/food handlers. “Lack of medical examination of employees in the previous year” was found to be a possible risk factor for carriage of Salmonella spp.
Genetic Separation of Listeria monocytogenes Causing Central Nervous System Infections in Animals
Directory of Open Access Journals (Sweden)
Lisandra Aguilar-Bultet
2018-02-01
Full Text Available Listeria monocytogenes is a foodborne pathogen that causes abortion, septicemia, gastroenteritis and central nervous system (CNS infections in ruminants and humans. L. monocytogenes strains mainly belong to two distinct phylogenetic groups, named lineages I and II. In general, clinical cases in humans and animals, in particular CNS infections, are caused by lineage I strains, while most of the environmental and food strains belong to lineage II. Little is known about why lineage I is more virulent than lineage II, even though various molecular factors and mechanisms associated with pathogenesis are known. In this study, we have used a variety of whole genome sequence analyses and comparative genomic tools in order to find characteristics that distinguish lineage I from lineage II strains and CNS infection strains from non-CNS strains. We analyzed 225 strains and identified single nucleotide variants between lineages I and II, as well as differences in the gene content. Using a novel approach based on Reads Per Kilobase per Million Mapped (RPKM, we identified 167 genes predominantly absent in lineage II but present in lineage I. These genes are mostly encoding for membrane-associated proteins. Additionally, we found 77 genes that are largely absent in the non-CNS associated strains, while 39 genes are especially lacking in our defined “non-clinical” group. Based on the RPKM analysis and the metadata linked to the L. monocytogenes strains, we identified 6 genes potentially associated with CNS cases, which include a transcriptional regulator, an ABC transporter and a non-coding RNA. Although there is not a clear separation between pathogenic and non-pathogenic strains based on phylogenetic lineages, the presence of the genes identified in our study reveals potential pathogenesis traits in ruminant L. monocytogenes strains. Ultimately, the differences that we have found in our study will help steer future studies in understanding the virulence
Genetic Separation of Listeria monocytogenes Causing Central Nervous System Infections in Animals
Aguilar-Bultet, Lisandra; Nicholson, Pamela; Rychener, Lorenz; Dreyer, Margaux; Gözel, Bulent; Origgi, Francesco C.; Oevermann, Anna; Frey, Joachim; Falquet, Laurent
2018-01-01
Listeria monocytogenes is a foodborne pathogen that causes abortion, septicemia, gastroenteritis and central nervous system (CNS) infections in ruminants and humans. L. monocytogenes strains mainly belong to two distinct phylogenetic groups, named lineages I and II. In general, clinical cases in humans and animals, in particular CNS infections, are caused by lineage I strains, while most of the environmental and food strains belong to lineage II. Little is known about why lineage I is more virulent than lineage II, even though various molecular factors and mechanisms associated with pathogenesis are known. In this study, we have used a variety of whole genome sequence analyses and comparative genomic tools in order to find characteristics that distinguish lineage I from lineage II strains and CNS infection strains from non-CNS strains. We analyzed 225 strains and identified single nucleotide variants between lineages I and II, as well as differences in the gene content. Using a novel approach based on Reads Per Kilobase per Million Mapped (RPKM), we identified 167 genes predominantly absent in lineage II but present in lineage I. These genes are mostly encoding for membrane-associated proteins. Additionally, we found 77 genes that are largely absent in the non-CNS associated strains, while 39 genes are especially lacking in our defined “non-clinical” group. Based on the RPKM analysis and the metadata linked to the L. monocytogenes strains, we identified 6 genes potentially associated with CNS cases, which include a transcriptional regulator, an ABC transporter and a non-coding RNA. Although there is not a clear separation between pathogenic and non-pathogenic strains based on phylogenetic lineages, the presence of the genes identified in our study reveals potential pathogenesis traits in ruminant L. monocytogenes strains. Ultimately, the differences that we have found in our study will help steer future studies in understanding the virulence mechanisms of the
Rios-Covian, David; Nogacka, Alicja; Salazar, Nuria; Hernández-Barranco, A M; Cuesta, Isabel; Gueimonde, Miguel; de Los Reyes Gavilán, Clara G
2018-03-01
Mechanistic features that characterize the interaction and inhibition of the food-borne pathogen Listeria monocytogenes by members of the genus Bifidobacterium still remain unclear. In the present work, we tried to shed light on the influence that co-cultivation of L. monocytogenes with Bifidobacterium breve may exert on both microorganisms and on virulence of the pathogen. Production of acetate and lactate was measured by gas chromatography and high-performance liquid chromatography, respectively; bacterial counts were obtained by plate count; gene expression was determined by RT-qPCR; and haemolytic activity was analyzed against goat erythrocytes. We found slightly but significantly lower final counts of Listeria and Bifidobacterium (p monocytogenes cells from cocultures than in those from monocultures. In contrast, the hly and luxS genes, which code for the cytolysin listeriolysin O and participate in biofilm formation, respectively, were overexpressed when L. monocytogenes was grown in coculture. This indicates that the presence of Bifidobacterium is able to modify the gene expression and haemolytic activity of L. monocytogenes when both microorganisms grow together.
Directory of Open Access Journals (Sweden)
Ana Camejo
2009-05-01
Full Text Available Listeria monocytogenes is a human intracellular pathogen able to colonize host tissues after ingestion of contaminated food, causing severe invasive infections. In order to gain a better understanding of the nature of host-pathogen interactions, we studied the L. monocytogenes genome expression during mouse infection. In the spleen of infected mice, approximately 20% of the Listeria genome is differentially expressed, essentially through gene activation, as compared to exponential growth in rich broth medium. Data presented here show that, during infection, Listeria is in an active multiplication phase, as revealed by the high expression of genes involved in replication, cell division and multiplication. In vivo bacterial growth requires increased expression of genes involved in adaptation of the bacterial metabolism and stress responses, in particular to oxidative stress. Listeria interaction with its host induces cell wall metabolism and surface expression of virulence factors. During infection, L. monocytogenes also activates subversion mechanisms of host defenses, including resistance to cationic peptides, peptidoglycan modifications and release of muramyl peptides. We show that the in vivo differential expression of the Listeria genome is coordinated by a complex regulatory network, with a central role for the PrfA-SigB interplay. In particular, L. monocytogenes up regulates in vivo the two major virulence regulators, PrfA and VirR, and their downstream effectors. Mutagenesis of in vivo induced genes allowed the identification of novel L. monocytogenes virulence factors, including an LPXTG surface protein, suggesting a role for S-layer glycoproteins and for cadmium efflux system in Listeria virulence.
Listeria monocytogenes endophthalmitis following keratoconjunctivitis.
Shoughy, Samir S; Tabbara, Khalid F
2014-01-01
Endophthalmitis due to endogenous or exogenous bacteria is a rare infection of the eye. We report a case of endophthalmitis following Listeria monocytogenes keratoconjunctivitis in a 27-year-old healthy white male presenting with hand motion visual acuity, right eye mucopurulent conjunctivitis, elevated intraocular pressure, and pigmented hypopyon 6 months post-keratectomy. The conjunctivitis was unresponsive to a 5-day course of topical tobramycin eye drops, and the patient developed keratitis with pain that progressed to endophthalmitis after 21 days. Diagnostic B-scan revealed vitreous exudates. Intraocular fluid specimen showed Gram-positive organisms and the aqueous culture grew penicillin-/aminoglycoside-sensitive L. monocytogenes. The patient was given intravitreal and systemic vancomycin and ceftazidime. The eye was unresponsive to intravenous penicillin and gentamicin; the anterior chamber progressively flattened and developed phthisis bulbi. L. monocytogenes keratoconjunctivitis may lead to bacterial endophthalmitis. Prompt culture and early antibiotic therapy are recommended.
DEFF Research Database (Denmark)
Holch, Anne; Webb, Kristen; Lukjancenko, Oksana
2013-01-01
Listeria monocytogenes is a food-borne human-pathogenic bacterium that can cause infections with a high mortality rate. It has a remarkable ability to persist in food processing facilities. Here we report the genome sequences for two L. monocytogenes strains (N53-1 and La111) that were isolated 6...... that has been isolated as a persistent subtype in several European countries. The purpose of this study was to use genome analyses to identify genes or proteins that could contribute to persistence. In a genome comparison, the two persistent strains were extremely similar and collectively differed from...... are required to determine if the absence of these genes promotes persistence. While the genome comparison did not point to a clear physiological explanation of the persistent phenotype, the remarkable similarity between the two strains indicates that subtypes with specific traits are selected for in the food...
Radiation monitoring of imported food to Saudi Arabia after Chernobyl
International Nuclear Information System (INIS)
Abulfaraj, W.H.; Abdul-Majid, S.; Abdul-Fattah, A.F.
1987-01-01
Saudi Arabia has been indirectly affected by the Chernobyl accident. Large amounts of food or products that may enter the food chain are daily imported from European countries. After April 27, the Saudi government assigned the responsibilities of radiation monitoring of imported food to some universities and governmental sectors. The nuclear engineering department at King Abdulaziz Univ. (KAU) has undertaken the monitoring duties for products coming to western and southern provinces of the country. The sampling and monitoring procedures and results are described
Balay, Danielle R; Dangeti, Ramana V; Kaur, Kamaljit; McMullen, Lynn M
2017-08-16
investigation on the ability of L. monocytogenes to form spontaneous resistance to class II bacteriocins on food matrices during prolonged storage is warranted. Copyright © 2017 Elsevier B.V. All rights reserved.
Guilbaud, Morgan; Piveteau, Pascal; Desvaux, Mickaël; Brisse, Sylvain; Briandet, Romain
2015-03-01
Listeria monocytogenes is involved in food-borne illness with a high mortality rate. The persistence of the pathogen along the food chain can be associated with its ability to form biofilms on inert surfaces. While most of the phenotypes associated with biofilms are related to their spatial organization, most published data comparing biofilm formation by L. monocytogenes isolates are based on the quantitative crystal violet assay, which does not give access to structural information. Using a high-throughput confocal-imaging approach, the aim of this work was to decipher the structural diversity of biofilms formed by 96 L. monocytogenes strains isolated from various environments. Prior to large-scale analysis, an experimental design was created to improve L. monocytogenes biofilm formation in microscopic-grade microplates, with special emphasis on the growth medium composition. Microscopic analysis of biofilms formed under the selected conditions by the 96 isolates revealed only weak correlation between the genetic lineages of the isolates and the structural properties of the biofilms. However, a gradient in their geometric descriptors (biovolume, mean thickness, and roughness), ranging from flat multilayers to complex honeycomb-like structures, was shown. The dominant honeycomb-like morphotype was characterized by hollow voids hosting free-swimming cells and localized pockets containing mixtures of dead cells and extracellular DNA (eDNA). Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Directory of Open Access Journals (Sweden)
Juliana Durack
Full Text Available The ability of Listeria monocytogenes to adapt to various food and food- processing environments has been attributed to its robustness, persistence and prevalence in the food supply chain. To improve the present understanding of molecular mechanisms involved in hyperosmotic and low-temperature stress adaptation of L. monocytogenes, we undertook transcriptomics analysis on three strains adapted to sub-lethal levels of these stress stimuli and assessed functional gene response. Adaptation to hyperosmotic and cold-temperature stress has revealed many parallels in terms of gene expression profiles in strains possessing different levels of stress tolerance. Gene sets associated with ribosomes and translation, transcription, cell division as well as fatty acid biosynthesis and peptide transport showed activation in cells adapted to either cold or hyperosmotic stress. Repression of genes associated with carbohydrate metabolism and transport as well as flagella was evident in stressed cells, likely linked to activation of CodY regulon and consequential cellular energy conservation.
Dean Jankuloski; Pavle Sekulovski; Risto Prodanov; Zehra Hajrulai Musliu; Biljana Stojanovska Dimzovska
2007-01-01
Listeria monocytogenes contamination of the environment and surfaces of the equipment was examined in seven meat processing facilities. Up to date prevalence of this foodborn pathogen in meat processing facilities facilities in Republic of Macedonia was unknown. Biofilms are composed from food spoilage microorganisms and food born pathogens. They are located on the surfaces of the equipment that come in contact with food and in facilities environment. Microorganisms in biofilm presenting micr...
DEFF Research Database (Denmark)
Martinez Rios, Veronica; Østergaard Jørgensen, Marie; Koukou, Ioulia
Absence of L. monocytogenes growth in ready-to-eat foods at the consumer phase is estimated to reduce listeriosis cases per year by 37% (EFSA, 16, 1-173, 2018). Spreadable cheeses are ready-to-eat foods with products characteristics including pH of 5.6-6.4 and NaCl of 0.7-1.6% w/w that may support...
Plasma agriculture and innovative food cycles
It is predicted that humankind may face the global issues of a pandemic and food crisis due to the rapid growth of the population, reaching almost 10 billion by 2050. Contamination of foods with human pathogens such as Salmonella, Listeria monocytogenes, Escherichia coli O157:H7, and norovirus is an...
Aarnisalo, Kaarina; Vihavainen, Elina; Rantala, Leila; Maijala, Riitta; Suihko, Maija-Liisa; Hielm, Sebastian; Tuominen, Pirkko; Ranta, Jukka; Raaska, Laura
2008-02-10
Microbial risk assessment provides a means of estimating consumer risks associated with food products. The methods can also be applied at the plant level. In this study results of microbiological analyses were used to develop a robust single plant level risk assessment. Furthermore, the prevalence and numbers of Listeria monocytogenes in marinated broiler legs in Finland were estimated. These estimates were based on information on the prevalence, numbers and genotypes of L. monocytogenes in 186 marinated broiler legs from 41 retail stores. The products were from three main Finnish producers, which produce 90% of all marinated broiler legs sold in Finland. The prevalence and numbers of L. monocytogenes were estimated by Monte Carlo simulation using WinBUGS, but the model is applicable to any software featuring standard probability distributions. The estimated mean annual number of L. monocytogenes-positive broiler legs sold in Finland was 7.2x10(6) with a 95% credible interval (CI) 6.7x10(6)-7.7x10(6). That would be 34%+/-1% of the marinated broiler legs sold in Finland. The mean number of L. monocytogenes in marinated broiler legs estimated at the sell-by-date was 2 CFU/g, with a 95% CI of 0-14 CFU/g. Producer-specific L. monocytogenes strains were recovered from the products throughout the year, which emphasizes the importance of characterizing the isolates and identifying strains that may cause problems as part of risk assessment studies. As the levels of L. monocytogenes were low, the risk of acquiring listeriosis from these products proved to be insignificant. Consequently there was no need for a thorough national level risk assessment. However, an approach using worst-case and average point estimates was applied to produce an example of single producer level risk assessment based on limited data. This assessment also indicated that the risk from these products was low. The risk-based approach presented in this work can provide estimation of public health risk
Monitoring and information system about allochthonous substances in foods
International Nuclear Information System (INIS)
Salgovicova, D.; Krizova, S.; Dobrikova, E.
2005-01-01
In 1984 the Food Research Institute in Bratislava was chosen as the organization entrusted to evaluate the results from control of contaminants within field of the Ministry of Agriculture in the Slovak Republic. At the same time in the Constitution was semi-finished the methodology of automatic data processing for monitoring of food chain contamination. In correspondence with the Governmental Decree of Slovak Republic No 620/93 from 7 September 1993 and its item No. 1 - the proposal for implementation of the Environment Monitoring System and of the Integrated search Institute was commissioned by the Minister of Agriculture to act as a Centre of the Partial Monitoring System 'Food and Feed Contaminants'
Langiano, E; Atrei, P; La Torre, G; De Vito, E; Ricciardi, G
2002-01-01
The presence of bacterial food pathogens was evaluated in 154 food samples collected from supermarkets and butchers in the city of Cassino (South-Central Italy). Food pathogens were identified in 17.5% of the total food samples. In the raw meat samples, 24.6% tested positives for Listeria monocytogenes, 4.3% for Salmonella and 2.9% for Escherichia coli O157. Y. enterocolitica, only investigated in pork meat, was identified in 7.4% of the samples. In poultry, L. monocytogenes was identified in 55% of the samples.
Lee, Nari; Kwon, Kyung Yoon; Oh, Su Kyung; Chang, Hyun-Joo; Chun, Hyang Sook; Choi, Sung-Wook
2014-07-01
A multiplex polymerase chain reaction (PCR) assay was developed for simultaneous detection of Escherichia coli O157:H7, Bacillus cereus, Vibrio parahaemolyticus, Salmonella spp., Listeria monocytogenes, and Staphylococcus aureus in various Korean ready-to-eat foods. The six specific primer pairs for multiplex PCR were selected based on the O157 antigen (rfbE) gene of E. coli O157:H7, the DNA gyrase subunit B (gyrB) gene of B. cereus, the toxin regulatory protein (toxR) gene of V. parahaemolyticus, the invasion protein A (invA) gene of Salmonella spp., the hemolysin (hly) gene of L. monocytogenes, and the thermonuclease (nuc) gene of S. aureus. The 16S rRNA gene was targeted as an internal control gene in the presence of bacterial DNA. The specificity and sensitivity assays for multiplex primer pairs were investigated by testing different strains. When this multiplex PCR assay was applied to evaluate the validity of detecting six foodborne pathogens in artificially inoculated several ready-to-eat food samples, the assay was able to specifically simultaneously detect as few as 1 colony-forming unit/mL of each pathogen after enrichment for 12 h. Their presence in naturally contaminated samples also indicates that the developed multiplex PCR assay is an effective and informative supplement for practical use.
Mata, Marcia M; da Silva, Wladimir P; Wilson, Richard; Lowe, Edwin; Bowman, John P
2015-02-06
Contamination of industrial and domestic food usage environments by the attachement of bacterial food-borne pathogen Listeria monocytogenes has public health and economic implications. Comprehensive proteomics experiments using label-free liquid chromatography/tandem mass spectrometry were used to compare the proteomes of two different L. monocytogenes strains (Siliken_1/2c and F2365_4b), which show very different capacities to attach to surfaces. Growth temperature and strain type were highly influential on the proteomes in both attached and planktonic cells. On the basis of the proteomic data, it is highly unlikely that specific surface proteins play a direct role in adherence to inanimate surfaces. Instead, strain-dependent responses related to cell envelope polymer biosynthesis and stress response regulation likely contribute to a different ability to attach and also to survive external stressors. Collectively, the divergent proteome-level responses observed define strain- and growth-temperature-dependent differences relevant to attachment efficacy, highlight relevant proteins involved in stress protection in attached cells, and suggest that strain differences and growth conditions are important in relation to environmental persistence.
Directory of Open Access Journals (Sweden)
M. Barile
2011-04-01
Full Text Available Listeria monocytogenes is the causative agent of listeriosis typically caused by ready-to-eat processed food that have a refrigerated shelf-life, but lightly preserved fish products also belong to a high-risk category. Aim of the work was to evaluate antimicrobial activity linked bacteriocin-producing of LAB isolated from gilthead breams and sea basses fillets packaged in modified atmospheres. Fifty-five LAB strains were screened against 21 strains of Listeria monocytogenes, 1 Listeria innocua held in the culture collection of Department of Zootechnical Sciences and Food Ispection (SIA and submitted to antagonistic activity using the spot on lawn and the agar well diffusion assay. Lactococcus lactis sub. lactis Sa31 was able to produce bacteriocin in agar and different broth medium. The bacteriocin man31 showed sensitivity to trypsin, pronase E and papain, inactivation at temperatures ≥ 100°C, bactericidal mode of action and antilisterial act, rapidly. The bacteriocin man31 caused a reduction of L. monocytogenes ½ c growth about log10 > 3 UFC/ml, when was applied on indicator strain at 20,480 AU/ml concentration, in vitro.
Inhibition strategies of Listeria monocytogenes biofilms-current knowledge and future outlooks.
Oloketuyi, Sandra F; Khan, Fazlurrahman
2017-09-01
There is an increasing trend in the food industry on the Listeria monocytogenes biofilm formation and inhibition. This is attributed to its easy survival on contact surfaces, resistance to disinfectants or antibiotics and growth under the stringent condition used for food processing and preservation thereby leading to food contamination products by direct or indirect exposure. Though, there is a lack of conclusive evidences about the mechanism of biofilm formation, in this review, the concept of biofilm formation and various chemical, physical, and green technology approaches to prevent or control the biofilm formed is discussed. State-of-the-art approaches ranging from the application of natural to synthetic molecules with high effectiveness and non-toxicity targeted at the different steps of biofilm formation could positively influence the biofilm inhibition in the future. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Biofilm-Forming Abilities of Listeria monocytogenes Serotypes Isolated from Different Sources
Doijad, Swapnil P.; Barbuddhe, Sukhadeo B.; Garg, Sandeep; Poharkar, Krupali V.; Kalorey, Dewanand R.; Kurkure, Nitin V.; Rawool, Deepak B.; Chakraborty, Trinad
2015-01-01
A total of 98 previously characterized and serotyped L. monocytogenes strains, comprising 32 of 1/2a; 20 of 1/2b and 46 of 4b serotype, from clinical and food sources were studied for their capability to form a biofilm. The microtiter plate assay revealed 62 (63.26%) strains as weak, 27 (27.55%) strains as moderate, and 9 (9.18%) strains as strong biofilm formers. Among the strong biofilm formers, 6 strains were of serotype 1/2a and 3 strains were of serotype 1/2b. None of the strain from 4b serotype exhibited strong biofilm formation. No firm correlation (p = 0.015) was noticed between any serotype and respective biofilm formation ability. Electron microscopic studies showed that strong biofilm forming isolates could synthesize a biofilm within 24 h on surfaces important in food industries such as stainless steel, ceramic tiles, high-density polyethylene plastics, polyvinyl chloride pipes, and glass. Cell enumeration of strong, moderate, and weak biofilm was performed to determine if the number of cells correlated with the biofilm-forming capabilities of the isolates. Strong, moderate, and weak biofilm showed 570±127× 103 cells/cm2, 33±26× 103 cells/cm2, 5±3× 103 cells/cm2, respectively, indicating that the number of cells was directly proportional to the strength of the biofilm. The hydrophobicity index (HI) analysis revealed higher hydrophobicity with an increased biofilm formation. Fatty acid methyl esterase analysis revealed the amount of certain fatty acids such as iso-C15:0, anteiso-C15:0, and anteiso-C17:0 fatty acids correlated with the biofilm-forming capability of L. monocytogenes. This study showed that different strains of L. monocytogenes form biofilm of different intensities which did not completely correlate with their serotype; however, it correlated with the number of cells, hydrophobicity, and amount of certain fatty acids. PMID:26360831
Biofilm-Forming Abilities of Listeria monocytogenes Serotypes Isolated from Different Sources.
Directory of Open Access Journals (Sweden)
Swapnil P Doijad
Full Text Available A total of 98 previously characterized and serotyped L. monocytogenes strains, comprising 32 of 1/2a; 20 of 1/2b and 46 of 4b serotype, from clinical and food sources were studied for their capability to form a biofilm. The microtiter plate assay revealed 62 (63.26% strains as weak, 27 (27.55% strains as moderate, and 9 (9.18% strains as strong biofilm formers. Among the strong biofilm formers, 6 strains were of serotype 1/2a and 3 strains were of serotype 1/2b. None of the strain from 4b serotype exhibited strong biofilm formation. No firm correlation (p = 0.015 was noticed between any serotype and respective biofilm formation ability. Electron microscopic studies showed that strong biofilm forming isolates could synthesize a biofilm within 24 h on surfaces important in food industries such as stainless steel, ceramic tiles, high-density polyethylene plastics, polyvinyl chloride pipes, and glass. Cell enumeration of strong, moderate, and weak biofilm was performed to determine if the number of cells correlated with the biofilm-forming capabilities of the isolates. Strong, moderate, and weak biofilm showed 570±127× 103 cells/cm2, 33±26× 103 cells/cm2, 5±3× 103 cells/cm2, respectively, indicating that the number of cells was directly proportional to the strength of the biofilm. The hydrophobicity index (HI analysis revealed higher hydrophobicity with an increased biofilm formation. Fatty acid methyl esterase analysis revealed the amount of certain fatty acids such as iso-C15:0, anteiso-C15:0, and anteiso-C17:0 fatty acids correlated with the biofilm-forming capability of L. monocytogenes. This study showed that different strains of L. monocytogenes form biofilm of different intensities which did not completely correlate with their serotype; however, it correlated with the number of cells, hydrophobicity, and amount of certain fatty acids.
Radiological monitoring of food on the French territory
Energy Technology Data Exchange (ETDEWEB)
Boissieux, T.; Leprieur, F.; Pierrard, O. [Institute for Radiological Protection and Nuclear Safety (France)
2014-07-01
Drink the milk of cows grazing near French nuclear power plants is it really safe in normal times? In case of a nuclear accident leading to release in the environment, what kind of foodstuff can we still eat? In his regulatory mission of environmental monitoring, the French Institute for Radiological Protection and Nuclear Safety (IRSN) tends to answer these questions by acquiring radioactivity data in the food chain. Food radiological monitoring program by IRSN is implemented with a three scale strategy. Locally, i.e. within the range 0 to 10 kilometers of nuclear installations, foodstuff locally produced and thus potentially exposed to radioactive sources are frequently sampled and analyzed. At the regional level, specific studies are carried out to establish an updated levels baseline of radioactivity in the environment, especially in agricultural productions characteristic of the area concerned. At the national level, monitoring food aims to map the average contamination observed all around the French territory. This work of vigilance is organized in partnerships with other French actors involved in food monitoring. In the event of a nuclear accident or small-scale incidents, it would allow having an efficient support network of samplers and measurers located on the whole French territory and quickly mobilized in short or medium terms. Since 2008, IRSN has developed a food monitoring program with the Directorate general for food (DGAL) and the Directorate general for competition policy, consumer affairs and fraud control (DGCCRF). These directions have a general mission of food safety control (animal and plant products) and animal feed-stuff, which requires the search for chemical, physical, biological and radioactive substances. Likewise, a sampling program of grain products is efficient since 1969 with the support of France Agrimer. In 2013, the food monitoring is based on multi-radionuclides analysis (cesium, iodine, tritium, alpha emitters...) in about 650
Listeria monocytogenes associated kerato-conjunctivitis in four horses in Norway.
Revold, Tobias; Abayneh, Takele; Brun-Hansen, Hege; Kleppe, Signe L; Ropstad, Ernst-Otto; Hellings, Robert A; Sørum, Henning
2015-11-09
Listeria monocytogenes has been reported to cause various infectious diseases in both humans and animals. More rarely, ocular infections have been reported. To our knowledge, only two cases of Listeria keratitis have been described in horses. We report kerato-conjunctivitis in four Norwegian horses associated with L. monocytogenes. Clinically, all cases were presented with recurrent unilateral kerato-conjunctivitis. L. monocytogenes bacteria were isolated from swab samples from all cases, and cytology carried out in 3 cases was indicative of L. monocytogenes infection. The present report describes the first known cases in which L. monocytogenes has been isolated from keratitic lesions in horses in Norway. A potential risk factor may be feeding of silage or haylage, but other sources of infection cannot be ruled out. The phenotypic features including antimicrobial susceptibility and serotype of the isolates are described. Laboratory detection of L. monocytogenes demands extra caution since only low numbers of bacteria were detected in the eye-swabs, probably due to the low volume of sample material and the intracellular niche of the bacterium. A general poor response to treatment in all these cases indicates that clinicians should pay extra attention to intensity and duration of treatment if L. monocytogenes is identified in connection with equine kerato-conjunctivitis.
Garedew, Legesse; Taddese, Ayele; Biru, Tigist; Nigatu, Seleshe; Kebede, Elias; Ejo, Mebrat; Fikru, Abraham; Birhanu, Tamiru
2015-05-12
Listeriosis, mostly caused by Listeria monocytogenes species, has become a major concern to public health authorities due to its clinical severity and high mortality rate, particularly in high risk groups. Currently, there is limited information regarding the prevalence and antimicrobial susceptibility profiles of listeria species in ready-to-eat foods of animal origin in Gondar town, Ethiopia. The aim of this study was to determine the prevalence and antimicrobial susceptibility pattern of Listeria species isolated from ready-to-eat food of animal origin from public dinning places in Gondar town, Ethiopia. A cross sectional study on ready-toeat foods of animal origin sampled from major supermarkets, butcher shops, pastry shops, restaurants and hotels was carried out. Culture, biochemical and sugar tests were conducted for listeria species identification and disc diffusion test was performed to study the antimicrobial susceptibility profiles of the isolates. Out of 384 food samples examined, 96 (25%) were positive for Listeria species. Listeria monocytogenes was detected in 24 (6.25%) of the samples. Listeria monocytogenes was isolated from cake, raw meat, ice cream, minced beef, fish, unpasteurized milk and pizza in that order from higher to lower rate. Assessment of antimicrobial susceptibility profile of L. monocytogenes revealed the presence of four multi-drug resistant isolates. The higher resistance rate was recorded for penicillin, nalidixic acid, tetracycline and chloramphenicol, in decreasing order. All L. monocytogenes identified in the current study were sensitive to amoxicillin, cephalothin, cloxacillin, sulfamethoxazole, gentamicin and vancomycin. The presence of L. monocytogenes including drug resistant and multidrug resistant isolates in some ready-to-eat food items is an indicator of the presence of public health hazards to the consumer, particularly to the high-risk groups. Hence awareness creation on food safety and implementation of regulations
Prevalence and risk factors for Listeria monocytogenes in broiler flocks in Shiraz, southern Iran.
Hosseinzadeh, Saeid; Shekarforoush, Seyed Shahram; Ansari-Lari, Maryam; EsalatPanah-Fard Jahromi, Mehdi; Berizi, Enayat; Abdollahi, Mostafa
2012-06-01
Listeria monocytogenes has been identified as an important foodborne pathogen in recent years. In humans, it most commonly affects pregnant women, neonates, children, elderly people, and persons with a suppressed immune system. It could contaminate both raw and cooked meat and poultry products. Studies regarding prevalence and risk factors of L. monocytogenes in broilers flocks are limited. Therefore, the present study was conducted to determine the prevalence and risk factors for L. monocytogenes in poultry flocks in Shiraz, southern Iran. During August to September 2009, in total, 100 broiler flocks were selected at slaughter, and 21 specimens were collected from cloacal samples from each flock. Polymerase chain reaction (PCR) was performed on the samples enriched in buffered Listeria enrichment broth (BLEB), using specific primers. Furthermore, enriched samples in BLEB and/or BLEB treated with 5% KOH were subcultured on Palcam medium. Data about farm and flocks were collected using a structured questionnaire. The prevalence of L. monocytogenes was 7% (95% CI, 2-12%) and 1% using PCR and culture, respectively. Results showed that using antibiotics during rearing period was dramatically reduced the rate of isolation (odds ratio [OR]=0.07, p=0.03), whereas house capacity of more than 10,000 birds (OR=24.03, p=0.04) and number of houses (OR=2, p=0.02) significantly increased the prevalence. The correlation between poor management of large poultry flocks and increasing the risk of contamination was more likely due to the recontamination of cooked poultry/undercooking or cross-contamination of other ready-to-eat foods.
An Assessment of Different Genomic Approaches for Inferring Phylogeny of Listeria monocytogenes
Directory of Open Access Journals (Sweden)
Clémentine Henri
2017-11-01
Full Text Available Background/objectives: Whole genome sequencing (WGS has proven to be a powerful subtyping tool for foodborne pathogenic bacteria like L. monocytogenes. The interests of genome-scale analysis for national surveillance, outbreak detection or source tracking has been largely documented. The genomic data however can be exploited with many different bioinformatics methods like single nucleotide polymorphism (SNP, core-genome multi locus sequence typing (cgMLST, whole-genome multi locus sequence typing (wgMLST or multi locus predicted protein sequence typing (MLPPST on either core-genome (cgMLPPST or pan-genome (wgMLPPST. Currently, there are little comparisons studies of these different analytical approaches. Our objective was to assess and compare different genomic methods that can be implemented in order to cluster isolates of L. monocytogenes.Methods: The clustering methods were evaluated on a collection of 207 L. monocytogenes genomes of food origin representative of the genetic diversity of the Anses collection. The trees were then compared using robust statistical analyses.Results: The backward comparability between conventional typing methods and genomic methods revealed a near-perfect concordance. The importance of selecting a proper reference when calling SNPs was highlighted, although distances between strains remained identical. The analysis also revealed that the topology of the phylogenetic trees between wgMLST and cgMLST were remarkably similar. The comparison between SNP and cgMLST or SNP and wgMLST approaches showed that the topologies of phylogenic trees were statistically similar with an almost equivalent clustering.Conclusion: Our study revealed high concordance between wgMLST, cgMLST, and SNP approaches which are all suitable for typing of L. monocytogenes. The comparable clustering is an important observation considering that the two approaches have been variously implemented among reference laboratories.
Papaioannou, Eleni; Giaouris, Efstathios D; Berillis, Panagiotis; Boziaris, Ioannis S
2018-02-21
The progressive ability of a six-strains L. monocytogenes cocktail to form biofilm on stainless steel (SS), under fish-processing simulated conditions, was investigated, together with the biocide tolerance of the developed sessile communities. To do this, the pathogenic bacteria were left to form biofilms on SS coupons incubated at 15°C, for up to 240h, in periodically renewable model fish juice substrate, prepared by aquatic extraction of sea bream flesh, under both mono-species and mixed-culture conditions. In the latter case, L. monocytogenes cells were left to produce biofilms together with either a five-strains cocktail of four Pseudomonas species (fragi, savastanoi, putida and fluorescens), or whole fish indigenous microflora. The biofilm populations of L. monocytogenes, Pseudomonas spp., Enterobacteriaceae, H 2 S producing and aerobic plate count (APC) bacteria, both before and after disinfection, were enumerated by selective agar plating, following their removal from surfaces through bead vortexing. Scanning electron microscopy was also applied to monitor biofilm formation dynamics and anti-biofilm biocidal actions. Results revealed the clear dominance of Pseudomonas spp. bacteria in all the mixed-culture sessile communities throughout the whole incubation period, with the in parallel sole presence of L. monocytogenes cells to further increase (ca. 10-fold) their sessile growth. With respect to L. monocytogenes and under mono-species conditions, its maximum biofilm population (ca. 6logCFU/cm 2 ) was reached at 192h of incubation, whereas when solely Pseudomonas spp. cells were also present, its biofilm formation was either slightly hindered or favored, depending on the incubation day. However, when all the fish indigenous microflora was present, biofilm formation by the pathogen was greatly hampered and never exceeded 3logCFU/cm 2 , while under the same conditions, APC biofilm counts had already surpassed 7logCFU/cm 2 by the end of the first 96h of
Directory of Open Access Journals (Sweden)
Licht Tine
2007-06-01
Full Text Available Abstract Background Listeria monocytogenes has been implicated in several food borne outbreaks as well as sporadic cases of disease. Increased understanding of the biology of this organism is important in the prevention of food borne listeriosis. The infectivity of Listeria monocytogenes ScottA, cultivated with and without oxygen restriction, was compared in vitro and in vivo. Fluorescent protein labels were applied to allow certain identification of Listeria cells from untagged bacteria in in vivo samples, and to distinguish between cells grown under different conditions in mixed infection experiments. Results Infection of Caco-2 cells revealed that Listeria cultivated under oxygen-restricted conditions were approximately 100 fold more invasive than similar cultures grown without oxygen restriction. This was observed for exponentially growing bacteria, as well as for stationary-phase cultures. Oral dosage of guinea pigs with Listeria resulted in a significantly higher prevalence (p Listeria in fecal samples was observed after dosage with oxygen-restricted bacteria. These differences were seen after challenge with single Listeria cultures, as well as with a mixture of two cultures grown with and without oxygen restriction. Conclusion Our results show for the first time that the environmental conditions to which L. monocytogenes is exposed prior to ingestion are decisive for its in vivo infective potential in the gastrointestinal tract after passage of the gastric barrier. This is highly relevant for safety assessment of this organism in food.
RAPID DNA EXTRACTION AND PCR VALIDATION FOR DIRECT DETECTION OF Listeria monocytogenes IN RAW MILK
Directory of Open Access Journals (Sweden)
Edith Burbano
2006-05-01
Full Text Available Objective. The aim of this study was to validate a method for detecting L. monocytogenes in raw milk.Materials and methods. The extraction procedure carried out using a chaotropic agent like NaI, toreduce fat in the sample to 0.2% w/v, which is the lowest limit for detection in the Gerber method, toavoid the polymerization. The raw milk samples were analyzed by using the traditional gold standardmethod for L. monocytogenes. Detection PCR was done on the specificity of primers that recognize theListeria genus by amplifying a specific fragment of about 938bp of the 16S rDNA. Several primer setswere use: L1 (CTCCATAAAGGTGACCCT, U1 (CAGCMGCCGCGGTAATWC, LF (CAAACGTTAACAACGCAGTAand LR (TCCAGAGTGATCGATGTTAA that recognize the hlyA gene of L. monocytogenes, amplifying a 750bpfragment. Results. The DNA of 39 strains evidenced high specificity of the technique since all the strainsof L. monocytogenes amplified the fragments 938bp and 750bp, specifically for genus and species,respectively. The detection limit of the PCR was 101 CFU/ml. T he PCR reproducibility showed a Kappa of0.85; the specificity and sensitivity of 100% were found, predictive positive and negative values were of100% respectively. Conclusions. These results demonstrate that is possible to detect of Listeria spp. byusing any of the three methods since they share the same sensitivity and specificity. One hundred percentof the predictive value for PCR (alternative method provides high reliability, and allows the detection ofthe positive samples. The extraction procedure combined with a PCR method can reduce in 15 days thetime of identification of L. monocytogenes in raw milk. This PCR technique could be adapted and validatedto be use for other types of food such as poultry, meat products and cheeses
Bacterial food-borne pathogens in Indian food
International Nuclear Information System (INIS)
Bandekar, J.R.
2015-01-01
Food technology and food processing techniques have made tremendous advances in preservation of food and ensuring safety of food by killing food-borne pathogens. In addition to old techniques such as pasteurization, canning, dehydration, fermentation and salting, a number of new techniques such as radiation processing, high pressure technology and pulsed electric field technology are being applied for preservation of food and to ensure food safety. Total Quality Management (TQM) concepts have been developed to take care of food safety from farm to table. Hazard Analysis at Critical Control Points (HACCP) is being applied for mass scale production of food to make food free from pathogens. Despite these advances, food-borne diseases have become one of the most widespread public health problems in the world. About two thirds of all the outbreaks are traced to microbial contaminated food. According to World Health Organization (WHO) estimates, food-borne and waterborne diarrhoeal diseases kill an estimated 2 million people annually, including many children. Food safety is a major concern not only for developing countries but also for the developed countries. A number of factors such as emergence of new food-borne pathogens, development of drug resistance in pathogens, changing life style, globalization of the food supply etc. are responsible for the continuous persistence of food-borne diseases. The food-borne disease outbreaks due to E. coli O157:H7, Listeria monocytogenes, Salmonella and Campylobacter, are responsible for recall of many foods resulting in heavy losses to food industry. Due to consumer demand, a number of Ready-To-Eat (RTE) minimally processed foods are increasingly marketed; however, there is increased risk of foodborne diseases with these products. Food Technology Division of Bhabha Atomic Research Centre, Mumbai, has been working on food-borne bacterial pathogens particularly Salmonella, Campylobacter, Listeria monocytogenes, Vibrio and Aeromonasf
Prevalence and location of Listeria monocytogenes in farmed rainbow trout.
Miettinen, Hanna; Wirtanen, Gun
2005-10-15
A total of 510 rainbow trout originating from fish farms in lakes and sea areas around Finland were studied for the presence of Listeria monocytogenes. Samples were studied as pools from five fish. Gill, viscera, and skin from the pooled samples were analysed separately. The individual samples were analysed later if the pooled sample was found to be Listeria positive. The prevalence of Listeria spp. and L. monocytogenes in pooled unprocessed fresh rainbow trout was on average 35.0% and 14.6%, respectively. On the other hand, the prevalence of Listeria spp. and L. monocytogenes in individual thawed fish was found to be 14.3% and 8.8%, respectively. These numbers tend to overestimate and underestimate the real situation because not all fish in pooled samples were necessarily contaminated and in some of the Listeria positive pooled samples all individual samples turned out to be Listeria free. The prevalence of L. monocytogenes varied greatly between different fish farms from zero to 100% in pooled samples and from zero to 75% according to individually studied fish samples. Some indications of the influence of weather conditions and seasonal variations that strongly affected the Listeria contamination of fish were also noticed. The location of Listeria spp. and L. monocytogenes in different parts of the fish differed with statistical significance in rainbow trout. Up to 95.6% of the L. monocytogenes and 84.5% of Listeria spp. positive samples were gill samples. Only 4.4% (2/45) of the L. monocytogenes positive samples were obtained from skin or viscera. Closer study at one fish farm revealed that there was only one L. monocytogenes ribotype present in the contaminated fish, although water and surfaces were heavily contaminated with six other L. monocytogenes ribotypes.
A case of bovine raw milk contamination with Listeria monocytogenes
Directory of Open Access Journals (Sweden)
Hunt Karen
2012-07-01
Full Text Available Abstract During routine sampling of bulk raw milk on a dairy farm, the pathogenic bacteria Listeria monocytogenes was found to be a contaminant, at numbers L. monocytogenes, indicating a possible case of excretion of the L. monocytogenes directly into the milk. Milk samples were collected from the individual cows and analysed, resulting in the identification of L. monocytogenes excretion (at 280 cfu/ml from one of the 4 mammary quarters of one dairy cow out of 180. When the infected cow was isolated from the herd, no L. monocytogenes was detected from the remaining herd. The pulsed-field gel electrophoresis pattern of the strain from the individual cow was indistinguishable from that originally isolated from the bulk milk. The infected cow did not show any clinical signs of disease, nor did the appearance of the milk have any physical abnormalities. Antibiotic treatment of the infected mammary quarter was found to be ineffective. This study shows that there can be risks associated with direct contamination of raw milk with L. monocytogenes.
Inhibition of sortase A by chalcone prevents Listeria monocytogenes infection.
Li, Hongen; Chen, Yutao; Zhang, Bing; Niu, Xiaodi; Song, Meng; Luo, Zhaoqing; Lu, Gejin; Liu, Bowen; Zhao, Xiaoran; Wang, Jianfeng; Deng, Xuming
2016-04-15
The critical role of sortase A in gram-positive bacterial pathogenicity makes this protein a good potential target for antimicrobial therapy. In this study, we report for the first time the crystal structure of Listeria monocytogenes sortase A and identify the active sites that mediate its transpeptidase activity. We also used a sortase A (SrtA) enzyme activity inhibition assay, simulation, and isothermal titration calorimetry analysis to discover that chalcone, an agent with little anti-L. monocytogenes activity, could significantly inhibit sortase A activity with an IC50 of 28.41 ± 5.34 μM by occupying the active site of SrtA. The addition of chalcone to a co-culture of L. monocytogenes and Caco-2 cells significantly inhibited bacterial entry into the cells and L. monocytogenes-mediated cytotoxicity. Additionally, chalcone treatment decreased the mortality of infected mice, the bacterial burden in target organs, and the pathological damage to L. monocytogenes-infected mice. In conclusion, these findings suggest that chalcone is a promising candidate for the development of treatment against L. monocytogenes infection. Copyright © 2016 Elsevier Inc. All rights reserved.
Wachiralurpan, Sirirat; Sriyapai, Thayat; Areekit, Supatra; Sriyapai, Pichapak; Augkarawaritsawong, Suphitcha; Santiwatanakul, Somchai; Chansiri, Kosum
2018-04-01
ABSTRACT Listeria monocytogenes is a major foodborne pathogen of global health concern. Herein, the rapid diagnosis of L. monocytogenes has been achieved using loop-mediated isothermal amplification (LAMP) based on the phosphatidylcholine-phospholipase C gene (plcB). Colorimetric detection was then performed through the formation of DNA concatemers and a gold nanoparticle/DNA probe complex (GNP/DNA probe). The overall detection process was accomplished within approximately 1 h with no need for complicated equipment. The limits of detection for L. monocytogenes in the forms of purified genomic DNA and pure culture were 800 fg and 2.82 CFU mL-1, respectively. No cross reactions were observed from closely related bacteria species. The LAMP-GNP/DNA probe assay was applied to the detection of 200 raw chicken meat samples and compared to routine standard methods. The data revealed that the specificity, sensitivity and accuracy were 100%, 90.20% and 97.50%, respectively. The present assay was 100% in conformity with LAMP-agarose gel electrophoresis assay. Five samples that were negative by both assays appeared to have the pathogen at below the level of detection. The assay can be applied as a rapid direct screening method for L. monocytogenes.
Thiamine plays a critical role in the acid tolerance of Listeria monocytogenes.
Madeo, Moira; O'Riordan, Niamh; Fuchs, Thilo M; Utratna, Marta; Karatzas, Kimon Andreas G; O'Byrne, Conor P
2012-01-01
Understanding the molecular basis of acid tolerance in the food-borne pathogen Listeria monocytogenes is important as this property contributes to survival in the food-chain and enhances survival within infected hosts. The aim of this study was to identify genes contributing to acid tolerance in L. monocytogenes using transposon mutagenesis and subsequently to elucidate the physiological role of these genes in acid tolerance. One mutant harboring a Tn917 insertion in the thiT gene (formerly lmo1429), which encodes a thiamine (vitamin B1) uptake system, was found to be highly sensitive to acid. The acid-sensitive phenotype associated with loss of this gene was confirmed with an independently isolated mutant, from which the thiT gene was deleted (∆thiT). Cells of both wild-type and ∆thiT mutant that were thiamine depleted were found to be significantly more acid sensitive than control cultures. Thiamine-depleted cultures failed to produce significant concentrations of acetoin, consistent with the known thiamine dependence of acetolactate synthase, an enzyme required for acetoin synthesis from pyruvate. As acetoin synthesis is a proton-consuming process, we suggest that the acid sensitivity observed in thiamine-depleted cultures may be owing to an inability to produce acetoin. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.
Maurella, Cristiana; Gallina, Silvia; Ru, Giuseppe; Adriano, Daniela; Bellio, Alberto; Bianchi, Daniela Manila; Chiavacci, Laura; Crescio, Maria Ines; Croce, Margherita; D'Errico, Valeria; Dupont, Maria Franca; Marra, Alessandro; Natangelo, Ubaldo; Pomilio, Francesco; Romano, Angelo; Stanzione, Stefano; Zaccaria, Teresa; Zuccon, Fabio; Caramelli, Maria; Decastelli, Lucia
2018-01-01
In May 2016, two separate clusters of febrile gastroenteritis caused by Listeria monocytogenes were detected by the local health authority in Piedmont, in northern Italy. We carried out epidemiological, microbiological and traceback investigations to identify the source. The people affected were students and staff members from two different schools in two different villages located in the Province of Turin; five of them were hospitalised. The epidemiological investigation identified a cooked beef ham served at the school canteens as the source of the food-borne outbreak. L. monocytogenes was isolated from the food, the stools of the hospitalised pupils and the environment of the factory producing the cooked beef ham. All isolates except one were serotype 1/2a, shared an indistinguishable PFGE pattern and were 100% identical by whole genome sequencing (WGS). By combining a classical epidemiological approach with both molecular subtyping and WGS techniques, we were able to identify and confirm a Listeria gastroenteritis outbreak associated with consumption of sliced cold beef ham. PMID:29536831
Sleator, R D; Gahan CGM; O'Driscoll, B; Hill, C
2000-09-25
Survival of the food-borne pathogen Listeria monocytogenes in environments of elevated osmolarity and reduced temperature is attributed, at least in part, to the accumulation of the trimethylammonium compound glycine betaine. Previously we identified betL, a gene encoding the secondary glycine betaine transporter BetL, which we linked to the salt tolerance of Listeria. In this report, we demonstrate that betL, preceded by a consensus sigmaB-dependent promoter, is regulated by osmotic up-shock, at least in part at the level of transcription. Using allelic exchange mutagenesis we constructed an in-frame deletion in betL, and used this mutant to determine the role of BetL in contributing to the growth and survival of L. monocytogenes, both in a high risk food (Camembert cheese) and animal model. Our results indicate that while BetL plays an important role in glycine betaine mediated osmoprotection, mutating the gene does not significantly effect either the cryotolerance or virulence of the organism.
Review Paper of Radionuclide Monitoring in Food Sample
International Nuclear Information System (INIS)
Noor Fadzilah Yusof; Abdul Kadir Ishak; Wo, Y.M.; Nurrul Assyikeen Mohd Jaffary
2011-01-01
The uncontrolled release of radionuclides into the atmospheric and aquatic environments may occur as the result of a nuclear or radiological accident. Monitoring of the accidental release at its source and especially direct monitoring of the environmental contamination with radionuclides is necessary for assessment and application of public protective actions and longer term countermeasures as well as emergency workers' protection. In areas historically contaminated with long lived radionuclides monitoring it is essential to protect the public and substantiation of any radiological incidents. Also, dietary pathways can be contaminated with radioactive materials resulting from natural occurrence or man-made applications especially during routine operation, accidents and migration of radionuclides from radioactive waste disposal repositories into the biosphere. Therefore, efforts should be made to determine the presence of radionuclides in a potentially high radiation area especially in operational nuclear facilities. This paper will review the strategies for food monitoring that has been adapted in most countries to obtain baseline data for future reference. Also, this study is discussing the type of food selection commonly collected as sample for radionuclide analysis in different countries over the years. Sampling procedure and analysis also included in this review for better understanding of the analysis. Stake holders' involvement is considered as an important asset in the establishment of monitoring strategies. As a conclusion, future plans for food monitoring programme in Malaysia are recommended as a preparation to embark on the Nuclear Power Plant programme. (author)
Monitoring radioactivity in food and actions of the Ministry in charge of food
International Nuclear Information System (INIS)
Grastilleur, Ch.
2010-01-01
French ministry of food, agriculture and fisheries (general directorate for food) is involved in all aspects of food safety and food controls As such, MAAP guarantees both the quality and safety of food products radioactivity controls in food participate to this global aim. Since 1987 and following the accident on Tchernobyl nuclear plant, regulations and monitoring-control programmes have been implemented by MAPP, mainly based on Cs 134 and 137 and Sr 90 researches in raw products such as game, milk and dairy products and honey A new monitoring and control programme has been implemented as from 2009, with the help of IRSN and thanks to the work on management during post-accidental phases initiated in 2005 by ASN. Mainly the activity of Cs is determined but also other parameters are measured such as Ca, K and l 131 activities in the samples analysed by IRSN. In 2009, 812 samples were programmed and all of them have proven to be conform. During the year 2010, 725 samples will be collected, Global exposure to radioactivity in France is estimated at 4000 μSv per year, food and water contributing to 6% (that is about 250 μSv) mainly due to K and Ca (natural radioactive components of the regime). (author)
Dalzini, Elena
2017-01-01
Among food-borne pathogens, L. monocytogenes represents one of the most serious food safety concerns. In particular, dairy products are often a source of this infection. During 2007 and 2009 in Italy there was an increase of notifications of listeriosis with the most cases reported in the Centre-North of Italy. This is probably attributable both to a real increase of listeriosis in Italy and to surveillance implementation. However, statistically significant increasing trends in listeriosis no...
Internalization of Listeria monocytogenes in cantaloupes during dump tank washing and hydrocooling.
Macarisin, Dumitru; Wooten, Anna; De Jesus, Antonio; Hur, Minji; Bae, Seonjae; Patel, Jitendra; Evans, Peter; Brown, Eric; Hammack, Thomas; Chen, Yi
2017-09-18
Recent listeriosis outbreaks and recalls associated with cantaloupes urge for studies to understand the mechanisms of cantaloupe contamination by Listeria monocytogenes. Postharvest practices such as washing and hydrocooling were suggested to facilitate the contamination of fresh fruits by human pathogens. This study assessed the potential of L. monocytogenes internalization into cantaloupes during dump tank washing and immersion-type hydrocooling in water contaminated with L. monocytogenes. The effect of cantaloupe cultivar, water temperature, and harvesting technique on L. monocytogenes internalization was also evaluated. Full slip (cantaloupe without any residual stem) Western and Eastern cultivar cantaloupes were pre-warmed to 42°C (to imitate peak-high field temperatures of freshly harvested cantaloupes) and then immersed in water at 6°C and 18°C containing 4 and 6logCFU/ml of L. monocytogenes. Clipped (cantaloupe with short stem residues obtained by clipping the stem at harvest) Western and Eastern cantaloupes were pre-warmed to 42°C and then immersed in water at 6°C containing 6logCFU/ml of L. monocytogenes. Additionally, full slip and clipped Western cantaloupes were equilibrated to 18°C and then immersed in water at 18°C containing 6logCFU/ml of L. monocytogenes (isothermal immersion without temperature differential). Water containing L. monocytogenes infiltrated both full slip and clipped cantaloupes through the stems/stem scars and was then distributed along the vascular system in hypodermal mesocarp reaching the calyx area of the fruit. The current study demonstrated that, under experimental conditions, L. monocytogenes can internalize into cantaloupes during immersion in water contaminated by L. monocytogenes, both in the presence and absence of temperature differential, and that temperature differential moderately enhanced the internalization of L. monocytogenes. The incidence and levels of L. monocytogenes internalized in the middle
International Nuclear Information System (INIS)
Rodrigues, D.; Teixeira, P.; Tavares, C.J.; Azeredo, J.
2013-01-01
Improvement of food safety is a very important issue, and is on the basis of production and application of new/modified food contact surfaces. Titanium dioxide (TiO 2 ) and, more recently, nitrogen-doped titanium dioxide (N-TiO 2 ) coatings are among the possible forms to enhance food contact surfaces performance in terms of higher hygiene and easier sanitation. In this context, the present work aimed at evaluating the bactericidal activity of an N-TiO 2 coating on glass and stainless steel under two different sources of visible light – fluorescent and incandescent – and ultraviolet (UV) irradiation. Listeria monocytogenes was chosen as representative of major foodborne pathogens and its survival was tested on N-TiO 2 coated coupons. In terms of survival percentage, good results were obtained after exposure of coated surfaces to all light types since, apart from the value obtained after exposing glass to fluorescent light (56.3%), survival rates were always below 50%. However, no effective disinfection was obtained, given that for a disinfectant or sanitizing agent to be claimed as effective it needs to be able to promote at least a 3-log reduction of the microbial load, which was not observed for any of the experimental conditions assessed. Even so, UV irradiation was the most successful on eliminating cells on coated surfaces, since the amount of bacteria was reduced to 1.49 × 10 6 CFU/ml on glass and 2.37 × 10 7 on stainless steel. In contrast, both visible light sources had only slightly decreased the amount of viable cells, which remained in the range of 8 log CFU/ml. Hence, although some bactericidal effect was accomplished under visible light, UV was the most effective light source on promoting photocatalytic reactions on N-TiO 2 coated coupons and none of the experimental conditions have reached a satisfactory disinfection level. Thus, this surface coating needs further research and improvement in order to become truly effective against foodborne
Rodrigues, D.; Teixeira, P.; Tavares, C. J.; Azeredo, J.
2013-04-01
Improvement of food safety is a very important issue, and is on the basis of production and application of new/modified food contact surfaces. Titanium dioxide (TiO2) and, more recently, nitrogen-doped titanium dioxide (N-TiO2) coatings are among the possible forms to enhance food contact surfaces performance in terms of higher hygiene and easier sanitation. In this context, the present work aimed at evaluating the bactericidal activity of an N-TiO2 coating on glass and stainless steel under two different sources of visible light - fluorescent and incandescent - and ultraviolet (UV) irradiation. Listeria monocytogenes was chosen as representative of major foodborne pathogens and its survival was tested on N-TiO2 coated coupons. In terms of survival percentage, good results were obtained after exposure of coated surfaces to all light types since, apart from the value obtained after exposing glass to fluorescent light (56.3%), survival rates were always below 50%. However, no effective disinfection was obtained, given that for a disinfectant or sanitizing agent to be claimed as effective it needs to be able to promote at least a 3-log reduction of the microbial load, which was not observed for any of the experimental conditions assessed. Even so, UV irradiation was the most successful on eliminating cells on coated surfaces, since the amount of bacteria was reduced to 1.49 × 106 CFU/ml on glass and 2.37 × 107 on stainless steel. In contrast, both visible light sources had only slightly decreased the amount of viable cells, which remained in the range of 8 log CFU/ml. Hence, although some bactericidal effect was accomplished under visible light, UV was the most effective light source on promoting photocatalytic reactions on N-TiO2 coated coupons and none of the experimental conditions have reached a satisfactory disinfection level. Thus, this surface coating needs further research and improvement in order to become truly effective against foodborne pathogens and
Ndahetuye, Jean Baptiste; Koo, Ok Kyung; O'Bryan, Corliss A; Ricke, Steven C; Crandall, Philip G
2012-08-01
The study was conducted to evaluate the attachment of three lactic acid bacteria (LAB) strains and their combination in a cocktail, to stainless steel coupons from a deli slicer, and their ability to inhibit the attachment of Listeria monocytogenes. In a previous study, three LAB strains, Pediococcus acidilactici, Lactobacillus amylovorus, and Lactobacillus animalis, were isolated from ready-to-eat meat and exhibited antilisterial effect. In the study reported here, hydrophobicity tests were determined according to the method of microbial adhesion to solvent. The attachment of the cells was evaluated on stainless steel coupons from deli slicers. Extracellular carbohydrates were determined with a colorimetric method. Based on these tests, L. animalis exhibited the greatest hydrophobicity (26.3%), and its adherence increased sharply from 24 to 72 h, whereas L. amylovorus yielded the lowest hydrophobicity (3.86%) and was weakly adherent. Although P. acidilactici had moderate hydrophobicity (10.1%), it adhered strongly. The attached LAB strains produced significantly (P < 0.05) higher total carbohydrates than their planktonic counterparts did, which is an important characteristic for attachment. Three conditions were simulated to evaluate the ability of the LAB cocktail (10(8) CFU/ml) to competitively exclude L. monocytogenes (10(3) CFU/ml) on the surface of the coupons. The coupons were pretreated with the LAB cocktail for 24 h prior to the addition of L. monocytogenes, simultaneously treated with the LAB cocktail and L. monocytogenes, or pretreated with L. monocytogenes 24 h prior to the addition of the LAB cocktail. The LAB cocktail was able to reduce the attachment L. monocytogenes significantly (P < 0.05). The LAB cocktail indicated potential attachment on stainless steel and bacteriostatic activity toward L. monocytogenes attached on stainless steel, which indicates a possible role for LAB as a biosanitizer in the food industry.
Directory of Open Access Journals (Sweden)
Xiang eWang
2015-10-01
Full Text Available Ground pork meat with natural microbiota and inoculated with low initial densities (1-10 or 10-100 CFU/g of Salmonella enterica or Listeria monocytogenes was stored under abusive temperature at 10°C and thermally treated by a simulated home pan-frying procedure. The growth and inactivation characteristics were also evaluated in broth. In ground pork meat, the population of S. enterica increased by less than one log after 12-days of storage at 10°C, whereas L. monocytogenes increased by 2.3 to 2.8 log units. No unusual intrinsic heat resistance of the pathogens was noted when tested in broth at 60°C although shoulders were observed on the inactivation curves of L. monocytogenes. After growth of S. enterica and L. monocytogenes at 10°C for 5 days to levels of 1.95 log CFU/g and 3.10 log CFU/g, respectively, in ground pork meat, their inactivation in the burger subjected to a simulated home pan-frying was studied. After thermal treatment S. enterica was undetectable but L. monocytogenes was recovered in three out of six of the 25 g burger samples. Overall, the present study shows that data on growth and inactivation of broths are indicative but may underestimate as well as overestimate behavior of pathogens and thus need confirmation in food matrix conditions to assess food safety in reasonably foreseen abusive conditions of storage and usual home pan-frying of of meat burgers in Belgium.
Paudyal, Ranju; Barnes, Ruth H; Karatzas, Kimon Andreas G
2018-02-01
Here it is demonstrated a novel approach in disinfection regimes where specific molecular acid resistance systems are inhibited aiming to eliminate microorganisms under acidic conditions. Despite the importance of the Glutamate Decarboxylase (GAD) system for survival of Listeria monocytogenes and other pathogens under acidic conditions, its potential inhibition by specific compounds that could lead to its elimination from foods or food preparation premises has not been studied. The effects of maleic acid on the acid resistance of L. monocytogenes were investigated and found that it has a higher antimicrobial activity under acidic conditions than other organic acids, while this could not be explained by its pKa or Ka values. The effects were found to be more pronounced on strains with higher GAD activity. Maleic acid affected the extracellular GABA levels while it did not affect the intracellular ones. Maleic acid had a major impact mainly on GadD2 activity as also shown in cell lysates. Furthermore, it was demonstrated that maleic acid is able to partly remove biofilms of L. monocytogenes. Maleic acid is able to inhibit the GAD of L. monocytogenes significantly enhancing its sensitivity to acidic conditions and together with its ability to remove biofilms, make a good candidate for disinfection regimes. Copyright © 2017 Elsevier Ltd. All rights reserved.
Chen, Jianshun; Chen, Qiaomiao; Jiang, Jianjun; Hu, Hongxia; Ye, Jiangbo; Fang, Weihuan
2010-01-01
Listeria monocytogenes, the causative organism of listeriosis, is primarily transmitted to humans through contaminated food. In this study, we examined 1275 batches of aquatic products imported from 29 countries and found that 36 batches from 8 countries were contaminated by Listeria (2.8%), with L. monocytogenes accounting for 2.6% (33/1275) and L. innocua for 0.2% (3/1275). Of the 23 selected L. monocytogenes isolates (from the 33 identified), 15 (65.2%) were of serovar 4b complex (4b, 4d, or 4e), three (13.0%) of 1/2a or 3a, four (17.4%) of 1/2b or 3b, and one (4.4%) of 1/2c or 3c. Notably, four of the 23 isolates belonged to epidemic clone I (ECI) and another four were associated with epidemic clone II (ECII), two highly clonal 4b clusters responsible for most of the documented listeriosis outbreaks. In the multilocus sequence typing scheme based on the concatenated genes gyrB-dapE-hisJ-sigB-ribC-purM-betL-gap-tuf, serovar 4b complex isolates from imported aquatic products exhibited significant genetic diversity. While the four ECI isolates were genetically related to those from Chinese diseased animals, both lacking one proline-rich repeat of ActA, the four ECII isolates were located between 1/2b or 3b strains. As the L. monocytogenes isolates from imported aquatic products possessed a nearly complete set of major infection-related genes, they demonstrated virulence potential in mouse model.
Directory of Open Access Journals (Sweden)
Hain Torsten
2012-04-01
Full Text Available Abstract Background Listeria monocytogenes is a food-borne pathogen that causes infections with a high-mortality rate and has served as an invaluable model for intracellular parasitism. Here, we report complete genome sequences for two L. monocytogenes strains belonging to serotype 4a (L99 and 4b (CLIP80459, and transcriptomes of representative strains from lineages I, II, and III, thereby permitting in-depth comparison of genome- and transcriptome -based data from three lineages of L. monocytogenes. Lineage III, represented by the 4a L99 genome is known to contain strains less virulent for humans. Results The genome analysis of the weakly pathogenic L99 serotype 4a provides extensive evidence of virulence gene decay, including loss of several important surface proteins. The 4b CLIP80459 genome, unlike the previously sequenced 4b F2365 genome harbours an intact inlB invasion gene. These lineage I strains are characterized by the lack of prophage genes, as they share only a single prophage locus with other L. monocytogenes genomes 1/2a EGD-e and 4a L99. Comparative transcriptome analysis during intracellular growth uncovered adaptive expression level differences in lineages I, II and III of Listeria, notable amongst which was a strong intracellular induction of flagellar genes in strain 4a L99 compared to the other lineages. Furthermore, extensive differences between strains are manifest at levels of metabolic flux control and phosphorylated sugar uptake. Intriguingly, prophage gene expression was found to be a hallmark of intracellular gene expression. Deletion mutants in the single shared prophage locus of lineage II strain EGD-e 1/2a, the lma operon, revealed severe attenuation of virulence in a murine infection model. Conclusion Comparative genomics and transcriptome analysis of L. monocytogenes strains from three lineages implicate prophage genes in intracellular adaptation and indicate that gene loss and decay may have led to the emergence
DEFF Research Database (Denmark)
Ojeniyi, B.; Wegener, Henrik Caspar; Jensen, N.E.
1996-01-01
Listeria monocytogenes was isolated from 11/236 (4 . 7%) caecal samples from parent flocks, providing broilers to the abattoirs investigated. Caecal samples from 2078 broilers representing 90 randomly selected broiler flocks were negative for L. monocytogenes. A total of 3080 samples from seven...... abattoirs including poultry processing line samples, and final products were also examined for L. monocytogenes. Listeria monocytogenes was isolated in 0 . 3% to 18 . 7% of the samples collected in the different abattoirs. Epidemiological typing of 247 L. monocytogenes isolates, including serotyping, phage...... isolates of L. monocytogenes since only 120/247 (48 . 6%) isolates were typable by phage typing and 230/247 (93 . 1%) L. monocytogenes belonged to serotype 01 while 6/247 (2 . 4%) belonged to 04. The discovery of a few dominating clones in each abattoir might indicate an endemic occurrence of L...
Directory of Open Access Journals (Sweden)
Joelle K Salazar
Full Text Available Listeria monocytogenes is a foodborne bacterial pathogen and the causative agent of an infectious disease, listeriosis. L. monocytogenes is ubiquitous in nature and has the ability to persist in food processing environments for extended periods of time by forming biofilms and resisting industrial sanitization. Human listeriosis outbreaks are commonly linked to contaminated dairy products, ready-to-eat meats, and in recent years, fresh produce such as lettuce and cantaloupes. We identified a putative Crp/Fnr family transcription factor Lmo0753 that is highly specific to human-associated genetic lineages of L. monocytogenes. Lmo0753 possesses two conserved functional domains similar to the major virulence regulator PrfA in L. monocytogenes. To determine if Lmo0753 is involved in environmental persistence-related mechanisms, we compared lmo0753 deletion mutants with respective wild type and complementation mutants of two fully sequenced L. monocytogenes genetic lineage II strains 10403S and EGDe for the relative ability of growth under different nutrient availability and temperatures, soil survival, biofilm productivity and attachment to select fresh produce surfaces including romaine lettuce leaves and cantaloupe rinds. Our results collectively suggested that Lmo0753 plays an important role in L. monocytogenes biofilm production and attachment to fresh produce, which may contribute to the environmental persistence and recent emergence of this pathogen in human listeriosis outbreaks linked to fresh produce.
Low prevalence of Listeria monocytogenes in cull sows and pork.
Wesley, Irene V; Larsen, Steven; Hurd, H Scott; McKean, James D; Griffith, Ronald; Rivera, Fernando; Nannapaneni, Ramakrishna; Cox, Mandy; Johnson, Michael; Wagner, Dean; de Martino, Mary
2008-03-01
The goal of this study was to determine the prevalence of Listeria monocytogenes in sows slaughtered at a single Midwestern plant on two occasions (trial 1, n = 179 sows; trial 2, n = 160 sows). Fecal samples collected antemortem (trial 1) as well as animal tissues, and carcass swabs collected at the abattoir (trials 1 and 2) were analyzed. Eight isolates of L. monocytogenes were recovered from five samples that represented 0.18% of the total samples (n = 2,775). In trial 1, L. monocytogenes was detected in a tonsil sample (0.6%; 1 positive of 181 tonsils), in a carcass (0.6%; 1 positive of 179 carcasses), which was sampled prior to the organic rinse, and in two chopped meat block samples (1.2%; 2 positive of 165 samples). In trial 2, L. monocytogenes was only detected in a single chopped meat block sample (0.15%; 1 positive of 688 total samples). These data indicate the low prevalence of L. monocytogenes in the cull sow.
Krawczyk-Balska, A; Markiewicz, Z
2016-02-01
Intrinsic resistance to antibiotics is a serious therapeutic problem in the case of many bacterial species. The Gram-positive human pathogen Listeria monocytogenes is intrinsically resistant to broad spectrum cephalosporin antibiotics, which are commonly used in therapy of bacterial infections. Besides three penicillin-binding proteins the intrinsic cephalosporin resistome of L. monocytogenes includes multidrug resistance transporter transporters, proteins involved in peptidoglycan biosynthesis and modification, cell envelope proteins with structural or general detoxification function, cytoplasmic proteins with unknown function and regulatory proteins. Analysis of the regulation of the expression of genes involved in the intrinsic resistance of L. monocytogenes to cephalosporins highlights the high complexity of control of the intrinsic resistance phenotype. The regulation of the transcription of the intrinsic resistome determinants involves the activity of eight regulators, namely LisR, CesR, LiaR, VirR, σ(B) , σ(H) , σ(L) and PrfA, of which the most prominent role play LisR, CesR and σ(B) . Furthermore, the vast majority of the intrinsic resistome determinants contribute to the tolerance of different stress conditions and virulence. A study indicates that O-acetyltransferase OatA is the most promising candidate for co-drug development since an agent targeting OatA should sensitize L. monocytogenes to certain antibiotics, therefore improving the efficacy of listeriosis treatment as well as food preservation measures. © 2015 The Society for Applied Microbiology.
Sant'Ana, Anderson S; Barbosa, Matheus S; Destro, Maria Teresa; Landgraf, Mariza; Franco, Bernadette D G M
2012-06-15
Growth potential (δ) is defined as the difference between the population of a microorganism at the end of shelf-life of specific food and its initial population. The determination of δ of Salmonella and Listeria monocytogenes in RTE vegetables can be very useful to determine likely threats to food safety. However, little is known on the behavior of these microorganisms in several RTE vegetables. Therefore, the aim of this study was to determine the δ of both pathogens in nine different types of RTE vegetables (escarole, collard green, spinach, watercress, arugula, grated carrot, green salad, and mix for yakisoba) stored at refrigeration (7°C) and abuse temperature (15°C). The population of aerobic microorganisms and lactic acid bacteria, including those showing antimicrobial activity has been also determined. Results indicated that L. monocytogenes was able to grow (δ≥0.5 log(10)) in more storage conditions and vegetables than Salmonella. Both microorganisms were inhibited in carrots, although a more pronounced effect has been observed against L. monocytogenes. The highest δ values were obtained when the RTE vegetables were stored 15°C/6days in collard greens (δ=3.3) and arugula (δ=3.2) (L. monocytogenes) and arugula (δ=4.1) and escarole (δ=2.8) (Salmonella). In most vegetables and storage conditions studied, the counts of total aerobic microorganisms raised significantly independent of the temperature of storage (pvegetables partially or fully stored at abuse temperature with recovery of isolates showing antimicrobial activity. In conclusion, the results of this study show that Salmonella and L. monocytogenes may grow and reach high populations in RTE vegetables depending on storage conditions and the definition of effective intervention strategies are needed to control their growth in these products. Copyright © 2012 Elsevier B.V. All rights reserved.
Chau, Man Ling; Aung, Kyaw Thu; Hapuarachchi, Hapuarachchige Chanditha; Lee, Pei Sze Valarie; Lim, Pei Ying; Kang, Joanne Su Lin; Ng, Youming; Yap, Hooi Ming; Yuk, Hyun-Gyun; Gutiérrez, Ramona Alikiiteaga; Ng, Lee Ching
2017-02-28
As the preparation of salads involves extensive handling and the use of uncooked ingredients, they are particularly vulnerable to microbial contamination. This study aimed to determine the microbial safety and quality of pre-packed salads and salad bar ingredients sold in Singapore, so as to identify public health risks that could arise from consuming salads and to determine areas for improvement in the management of food safety. The most frequently encountered organism in pre-packed salad samples was B. cereus, particularly in pasta salads (33.3%, 10/30). The most commonly detected organism in salad bar ingredients was L. monocytogenes, in particular seafood ingredients (44.1%, 15/34), largely due to contaminated smoked salmon. Further investigation showed that 21.6% (37/171) of the pre-packed smoked salmon sold in supermarkets contained L. monocytogenes. Significantly higher prevalence of L. monocytogenes and higher Standard Plate Count were detected in smoked salmon at salad bars compared to pre-packed smoked salmon in supermarkets, which suggested multiplication of the organism as the products move down the supply chain. Further molecular analysis revealed that L. monocytogenes Sequence Type (ST) 2 and ST87 were present in a particular brand of pre-packed salmon products over a 4-year period, implying a potential persistent contamination problem at the manufacturing level. Our findings highlighted a need to improve manufacturing and retail hygiene processes as well as to educate vulnerable populations to avoid consuming food prone to L. monocytogenes contamination.
Osaili, Tareq M; Al-Nabulsi, Anas A; Shaker, Reyad R; Jaradat, Ziad W; Taha, Mohammad; Al-Kherasha, Mohammed; Meherat, Mervet; Holley, Richard
2014-01-01
The presence of Salmonella, Listeria monocytogenes, and Escherichia coli O157:H7 in ready-to-eat (RTE) meat products is considered a major concern for food control authorities worldwide. The aims of this study were to determine (i) the prevalence of Salmonella, L. monocytogenes, and E. coli O157:H7 in Mediterranean RTE chicken and beef (CB) products sold in Jordanian restaurants and (ii) the susceptibility of the isolates to antibiotics. A total of 1,028 samples of various types of RTE CB products (550 RTE chicken and 478 RTE beef products) were analyzed by methods described by the International Organization for Standardization followed by molecular confirmation of the isolates. The VITEK2 automated system was used for testing antibiotic susceptibility of the isolates. The overall prevalence of Salmonella serovars in RTE CB products was 0.5%, with 0.8 and 0.2% in RTE chicken and RTE beef, respectively. The overall prevalence of L. monocytogenes in RTE CB products was 2%, with 2.7 and 1.5% in RTE chicken and RTE beef products, respectively. E. coli O157:H7 was not isolated from any of the tested samples. Multidrug-resistant Salmonella and L. monocytogenes isolates were found. The majority of Salmonella isolates were sensitive to most of the tested antibiotics, and all of the isolates were resistant to more than one antibiotic. Similarly, more than 85% of L. monocytogenes isolates were sensitive to nine antibiotics, and the majority of L. monocytogenes isolates were resistant to fosfomycin and oxacillin.
Behaviour of Listeria monocytogenes in packaged fresh mushrooms (Agaricus bisporus).
González-Fandos, E; Olarte, C; Giménez, M; Sanz, S; Simón, A
2001-11-01
The aim of this study was to evaluate the potential of Listeria monocytogenes to grow in mushrooms packaged in two different types of PVC films when stored at 4 degrees C and 10 degrees C. Mushrooms were packed in two polymeric films (perforated and nonperforated PVC) and stored at 4 degrees C and 10 degrees C. The carbon dioxide and oxygen content inside the packages, aerobic mesophiles, psychrotrophs, Pseudomonas spp., Listeria monocytogenes, faecal coliforms, Escherichia coli, anaerobic spores and major sensory factors were determined. The mushrooms packaged in nonperforated film and stored at 4 degrees C had the most desirable quality parameters (texture, development stage and absence of moulds). Listeria monocytogenes was able to grow at 4 degrees C and 10 degrees C in inoculated mushrooms packaged in perforated and nonperforated films between 1 and 2 log units during the first 48 h. After 10 d of storage, the populations of L. monocytogenes were higher in mushrooms packaged in nonperforated film and stored at 10 degrees C. MAP followed by storage at 4 degrees C or 10 degrees C extends the shelf life by maintaining an acceptable appearance, but allows the growth and survival of L. monocytogenes. According to this study additional hurdles must be studied in order to prevent the growth of L. monocytogenes.
International Nuclear Information System (INIS)
Päßler, Sebastian; Fischer, Wolf-Joachim; Wolff, Matthias
2012-01-01
Obesity and nutrition-related diseases are currently growing challenges for medicine. A precise and timesaving method for food intake monitoring is needed. For this purpose, an approach based on the classification of sounds produced during food intake is presented. Sounds are recorded non-invasively by miniature microphones in the outer ear canal. A database of 51 participants eating seven types of food and consuming one drink has been developed for algorithm development and model training. The database is labeled manually using a protocol with introductions for annotation. The annotation procedure is evaluated using Cohen's kappa coefficient. The food intake activity is detected by the comparison of the signal energy of in-ear sounds to environmental sounds recorded by a reference microphone. Hidden Markov models are used for the recognition of single chew or swallowing events. Intake cycles are modeled as event sequences in finite-state grammars. Classification of consumed food is realized by a finite-state grammar decoder based on the Viterbi algorithm. We achieved a detection accuracy of 83% and a food classification accuracy of 79% on a test set of 10% of all records. Our approach faces the need of monitoring the time and occurrence of eating. With differentiation of consumed food, a first step toward the goal of meal weight estimation is taken. (paper)
Product unit neural network models for predicting the growth limits of Listeria monocytogenes.
Valero, A; Hervás, C; García-Gimeno, R M; Zurera, G
2007-08-01
A new approach to predict the growth/no growth interface of Listeria monocytogenes as a function of storage temperature, pH, citric acid (CA) and ascorbic acid (AA) is presented. A linear logistic regression procedure was performed and a non-linear model was obtained by adding new variables by means of a Neural Network model based on Product Units (PUNN). The classification efficiency of the training data set and the generalization data of the new Logistic Regression PUNN model (LRPU) were compared with Linear Logistic Regression (LLR) and Polynomial Logistic Regression (PLR) models. 92% of the total cases from the LRPU model were correctly classified, an improvement on the percentage obtained using the PLR model (90%) and significantly higher than the results obtained with the LLR model, 80%. On the other hand predictions of LRPU were closer to data observed which permits to design proper formulations in minimally processed foods. This novel methodology can be applied to predictive microbiology for describing growth/no growth interface of food-borne microorganisms such as L. monocytogenes. The optimal balance is trying to find models with an acceptable interpretation capacity and with good ability to fit the data on the boundaries of variable range. The results obtained conclude that these kinds of models might well be very a valuable tool for mathematical modeling.
Misiou, Ourania; van Nassau, Tomas J; Lenz, Christian A; Vogel, Rudi F
2018-02-02
The aim of this work was to examine the combination of endolysin PlyP825 and high hydrostatic pressure (HHP) processing against a cocktail of stationary phase Listeria monocytogenes cells in several Listeria-critical food products (i.e. milk, mozzarella and smoked salmon). In order to determine the efficacy of the combined application, both challenge-lethality tests and storage tests were performed. In milk and mozzarella, we could demonstrate that the application of PlyP825 prior to HHP processing allowed for a synergistic inactivation of cells, a reduction in the pressure level with equal antimicrobial efficacy and an enhanced eradication of L. monocytogenes during storage at abuse temperatures. For smoked salmon, no such effects were detected. Although the efficacy of the method was highly dependent on the food vehicle and parameters applied, we hereby demonstrated the potential of the combined endolysin-HHP application for complete eradication of L. monocytogenes from foods at milder processing conditions. Copyright © 2017 Elsevier B.V. All rights reserved.
Bacterial biofilm formation in different surfaces of food industries
Directory of Open Access Journals (Sweden)
Karine Angélica Dalla Costa
2017-06-01
Full Text Available The term biofilm describes the sessile microbial life form, characterized by microorganism adhesion to any surface and with the production of extracellular polymeric substances. In food industries, the formation of biofilms results in serious problems, since it can be a contamination source of the food product, compromising the final product quality and consumer health. The aim of this study was to verify the adhesion of biofilms (sessile cells of pathogenic and/or deteriorating bacteria against surfaces of the food industry. The bacterial species tested were Pseudomonas aeruginosa ATCC 27853, Staphylococcus aureus ATCC 29213, Listeria monocytogenes ATCC 19117 and Salmonella Typhimurium ATCC 14028. It was used stainless steel and polypropylene coupons as contact surfaces. The results demonstrated that P. aeruginosa and S. Typhimurium showed higher biofilm formation capacity. Statistically, there was no difference in count of P. aeruginosa and S. Typhimurium (p > 0.05 cells. The same occurred between L. monocytogenes and S. aureus. However, the counts of P. aeruginosa and S. Typhimurium cells were statistically higher than S. aureus and L. monocytogenes (p < 0.05. By means of scanning electron microscopy it was also found increased adhesion of P. aeruginosa. The results revealed that P. aeruginosa was the bacterial species with higher biofilm formation capacity among the others.
Schmitter, Sibylle; Fieseler, Lars; Klumpp, Jochen; Bertram, Ralph; Loessner, Martin J
2017-08-01
To enable specific and tightly controlled gene expression both in vitro and during the intracellular lifecycle of the pathogen Listeria monocytogenes, a TetR-dependent genetic induction system was developed. Highest concentration of cytoplasmic TetR and best repression of tetO-controlled genes was obtained by tetR expression from the synthetic promoter Pt 17 . Anhydrotetracycline (ATc) as inducer permitted concentration-dependent, fine-tuned expression of genes under control of the tetO operator and a suitable promoter. The actin-polymerizing ActA protein represents a major virulence factor of L. monocytogenes, required for actin-based motility and cell-to-cell spread in infected host cells. To be able to observe its spatial and temporal distribution on intracellular L. monocytogenes cells, conditional mutants featuring actA placed under TetR control were used to infect PtK2 epithelial cells. Following induction at different time intervals, the subsequent recruitment of actin by L. monocytogenes could be monitored. We found that cells displayed functional ActA after approximately 15 min, while formation of polarized actin tail was complete after 90-120 min. At this point, intracellular motility of the induced mutants was indistinguishable from wild-type bacteria. Interestingly, de novo ActA synthesis in intracellular Listeria also demonstrated the temporal, asymmetric redistribution of the membrane-anchored proteins from the lateral walls toward the cell poles. © 2017 John Wiley & Sons Ltd.
Methods combined with irradiation for food preservation
Pinela, José; Antonio, Amilcar L.; Ferreira, Isabel C.F.R.
2018-01-01
In recent years, consumers have been looking for safer, higher quality foods, but also more convenient and ready-to-eat. Quality assurance through the elimination of pathogenic microorganisms has been a major concern for the food industry. However, an alarming number of diseases are still caused by different foodborne pathogens, which cause hundreds of deaths.1 Escherichia coli and Listeria monocytogenes are food poisoning microorganisms frequently involved in microbial outb...
DEFF Research Database (Denmark)
Bruhn, Jesper Bartholin; Vogel, Birte Fonnesbech; Gram, Lone
2005-01-01
compounds in UVM I and II influenced this bias. The results of the present study demonstrate that the selective procedures used for isolation of L. monocytogenes may not allow a true representation of the types present in foods. Our results could have a significant impact on epidemiological studies...
Establishment and Application of a Visual DNA Microarray for the Detection of Food-borne Pathogens.
Li, Yongjin
2016-01-01
The accurate detection and identification of food-borne pathogenic microorganisms is critical for food safety nowadays. In the present work, a visual DNA microarray was established and applied to detect pathogens commonly found in food, including Salmonella enterica, Shigella flexneri, E. coli O157:H7 and Listeria monocytogenes in food samples. Multiplex PCR (mPCR) was employed to simultaneously amplify specific gene fragments, fimY for Salmonella, ipaH for Shigella, iap for L. monocytogenes and ECs2841 for E. coli O157:H7, respectively. Biotinylated PCR amplicons annealed to the microarray probes were then reacted with a streptavidin-alkaline phosphatase conjugate and nitro blue tetrazolium/5-bromo-4-chloro-3'-indolylphosphate, p-toluidine salt (NBT/BCIP); the positive results were easily visualized as blue dots formatted on the microarray surface. The performance of a DNA microarray was tested against 14 representative collection strains and mock-contamination food samples. The combination of mPCR and a visual micro-plate chip specifically and sensitively detected Salmonella enterica, Shigella flexneri, E. coli O157:H7 and Listeria monocytogenes in standard strains and food matrices with a sensitivity of ∼10(2) CFU/mL of bacterial culture. Thus, the developed method is advantageous because of its high throughput, cost-effectiveness and ease of use.
DEFF Research Database (Denmark)
Paspaliari, Dafni Katerina; Kastbjerg, Vicky Gaedt; Ingmer, Hanne
2017-01-01
carbohydrate in nature, the chitinases have been deemed important for colonization of unicellular moulds, as well as mammalian hosts. In order to identify additional components of the chitinolytic system, we screened a transposon mutant library for mutants exhibiting impaired chitin hydrolysis. The screening...... ChiA and ChiB in the culture supernatants of the mutant strain. Our results provide new information regarding the function of the lmo0325-lmo0327 locus in L. monocytogenes and link it to the expression of chitinolytic activity.Importance: Many bacteria from terrestrial and marine environments express...... chitinase activities enabling them to utilize chitin as the sole source of carbon and nitrogen. Interestingly, several bacterial chitinases may also be involved in host pathogenesis. For example, in the important food borne pathogen Listeria monocytogenes, the chitinases ChiA and ChiB, and the lytic...
Prevalence and characteristics of Listeria monocytogenes in bovine colostrum in Japan.
Hasegawa, Megumi; Iwabuchi, Eriko; Yamamoto, Shiori; Esaki, Hidetake; Kobayashi, Kazuhiko; Ito, Masahiko; Hirai, Katsuya
2013-02-01
This study was conducted to determine the prevalence and characteristics of Listeria monocytogenes in bovine colostrum in Japan. We collected bovine colostrum samples from 210 dams from 21 dairy farms in Hokkaido prefecture (Japan) between March and June 2009. L. monocytogenes was detected in samples from 6 (28.6%) of the 21 farms. Of the 210 samples, 16 (7.6%) were positive for L. monocytogenes. We recovered 80 L. monocytogenes isolates; 44 (55%) isolates were classified as serotype 1/2b and 36 (45%) were classified as serotype 4b. The isolates were susceptible to penicillin, ampicillin, amoxicillin, gentamicin, kanamycin, streptomycin, erythromycin, vancomycin, tetracycline, chloramphenicol, ciprofloxacin, and trimethoprim-sulfamethoxazole. Pulsed-field gel electrophoresis (PFGE) characterization of the 80 isolates revealed six PFGE types. Two PFGE types corresponded to human listeriosis cases. Most L. monocytogenes isolates possessed virulence-associated genes (actA, hly, iap, inlA, inlC, mpl, plcA, plcB, opuCA, prfA, and clpC). One PFGE type isolate possessed an epidemic clone II marker. Our findings suggest that isolates from bovine colostrum have the potential to cause human and animal listeriosis. This is the first study on the prevalence and characteristics of L. monocytogenes isolated from bovine colostrum obtained from dairy farms. Our results have important implications for improving public health and elucidating the epidemiology of L. monocytogenes in bovine colostrum.
Prevalence of Listeria monocytogenes in poultry meat
Directory of Open Access Journals (Sweden)
Mehmet ELMALI
2015-01-01
Full Text Available AbstractThe objectives of this study were i to isolate Listeria spp. and Listeria monocytogenes in broiler wing meat samples, ii to confirm the isolates by PCR, based on prs and hly A gene sequences, iii to determine the seasonal and monthly distribution of the isolates. A total of 120 broiler wing meat samples (60 packaged pieces wrapped using strech film in styrofoam plates and 60 unpackaged pieces bought from different markets in Hatay province were analysed. Listeria spp. was isolated from 57 (47.5% out of 120 samples. Fifty-four, out of 57 Listeria spp. isolates were identified as L. monocytogenes. L. monocytogenes was isolated from the samples collected during the spring, winter, summer, and autumn at the levels of 26.6%, 40%, 53.3%, 60%, respectively. In this study, the isolation rates were found to be the highest in autumn, while the isolation rates were found to be the lowest in spring. As a consequence, high prevalence of Listeria spp. and L. monocytogenes in poultry wing meat samples may pose a risk for human health. We consider that with obeying the rules of good hygiene practices (GHP, good manufacturing practices (GMP and HACCP can minimize the contamination with Listeria spp.
Directory of Open Access Journals (Sweden)
Wanessa Altimiras Costa
2009-12-01
Full Text Available Este estudo avaliou um sistema de biocontrole para inibição de Listeria monocytogenes em couve minimamente processada, objetivando sua segurança durante estocagem sob refrigeração e em condições de abuso de temperatura. O potencial inibitório de bactérias láticas tolerantes ao sal e psicrotróficas contaminantes naturais da couve e Lactobacillus plantarum, Lactobacillus delbrueckii ATCC 9649 e Lactobacillus casei CCT 1465 foram avaliadas contra L. monocytogenes. O isolado de couve identificado como P. acidilactici CCA3 inibiu L. monocytogenes a 10 e 15 °C em ágar MRS e foi selecionado como possível agente de biocontrole. O número de L. monocytogenes na couve minimamente processada aumentou 3,7 e 4,7 ciclos logarítmicos a 5 e 10 °C, respectivamente, após 20 dias de armazenamento e 4,6 ciclos logarítmicos após oito dias a 15 °C. Entretanto, quando 10(8 UFC.g-1 de P. acidilactici CCA3 foram inoculados no produto processado, o crescimento de L. monocytogenes reduziu 2,3 ciclos logarítmicos sob temperatura abusiva de 15 °C. A acidez titulável e as características sensoriais da couve não foram alteradas pela presença de CCA3 ao longo do período de vida útil. Estes resultados sugerem o potencial de aplicação dos bioconservantes na couve minimamente processada, que necessitam estar associados à refrigeração e sanitização para garantir segurança.This study evaluated a biological control system for the inhibition of Listeria monocytogenes in minimally processed kale focusing on its freshness under refrigeration and extreme temperatures. The inhibitory potential of salt and cold tolerant lactic bacteria from natural microflora of kale, Lactobacillus delbrueckii ATCC 9649, Lactobacillus plantarum, and Lactobacillus casei CCT 1465 strains were evaluated against L. monocytogenes. Pediococcus acidilactici CCA3 isolated from kale exhibited a large inhibition zone of L. monocytogenes at 10 and 15 °C in MRS agar and was
Iacumin, Lucilla; Manzano, Marisa; Comi, Giuseppe
2016-01-05
The anti-listerial activity of generally recognized as safe (GRAS) bacteriophage Listex P100 (phage P100) was demonstrated in broths and on the surface of slices of dry-cured ham against 5 strains or serotypes (i.e., Scott A, 1/2a, 1/2b, and 4b) of Listeria monocytogenes. In a broth model system, phage P100 at a concentration equal to or greater than 7 log PFU/mL completely inhibited 2 log CFU/cm² or 3 log CFU/cm² of L. monocytogenes growth at 30 °C. The temperature (4, 10, 20 °C) seemed to influence P100 activity; the best results were obtained at 4 °C. On dry-cured ham slices, a P100 concentration ranging from 5 to 8 log PFU/cm² was required to obtain a significant reduction in L. monocytogenes. At 4, 10, and 20 °C, an inoculum of 8 log PFU/cm² was required to completely eliminate 2 log L. monocytogenes/cm² and to reach the absence in 25 g product according to USA food law. Conversely, it was impossible to completely eradicate L. monocytogenes with an inoculum of approximately of 3.0 and 4.0 log CFU/cm² and with a P100 inoculum ranging from 1 to 7 log PFU/cm². P100 remained stable on dry-cured ham slices over a 14-day storage period, with only a marginal loss of 0.2 log PFU/cm² from an initial phage treatment of approximately 8 log PFU/cm². Moreover, phage P100 eliminated free L. monocytogenes cells and biofilms on the machinery surfaces used for dry-cured ham production. These findings demonstrate that the GRAS bacteriophage Listex P100 at level of 8 log PFU/cm² is listericidal and useful for reducing the L. monocytogenes concentration or eradicating the bacteria from dry-cured ham.
Directory of Open Access Journals (Sweden)
Lucilla Iacumin
2016-01-01
Full Text Available The anti-listerial activity of generally recognized as safe (GRAS bacteriophage Listex P100 (phage P100 was demonstrated in broths and on the surface of slices of dry-cured ham against 5 strains or serotypes (i.e., Scott A, 1/2a, 1/2b, and 4b of Listeria monocytogenes. In a broth model system, phage P100 at a concentration equal to or greater than 7 log PFU/mL completely inhibited 2 log CFU/cm2 or 3 log CFU/cm2 of L. monocytogenes growth at 30 °C. The temperature (4, 10, 20 °C seemed to influence P100 activity; the best results were obtained at 4 °C. On dry-cured ham slices, a P100 concentration ranging from 5 to 8 log PFU/cm2 was required to obtain a significant reduction in L. monocytogenes. At 4, 10, and 20 °C, an inoculum of 8 log PFU/cm2 was required to completely eliminate 2 log L. monocytogenes/cm2 and to reach the absence in 25 g product according to USA food law. Conversely, it was impossible to completely eradicate L. monocytogenes with an inoculum of approximately of 3.0 and 4.0 log CFU/cm2 and with a P100 inoculum ranging from 1 to 7 log PFU/cm2. P100 remained stable on dry-cured ham slices over a 14-day storage period, with only a marginal loss of 0.2 log PFU/cm2 from an initial phage treatment of approximately 8 log PFU/cm2. Moreover, phage P100 eliminated free L. monocytogenes cells and biofilms on the machinery surfaces used for dry-cured ham production. These findings demonstrate that the GRAS bacteriophage Listex P100 at level of 8 log PFU/cm2 is listericidal and useful for reducing the L. monocytogenes concentration or eradicating the bacteria from dry-cured ham.
da Silva Malheiros, Patrícia; Sant'Anna, Voltaire; Micheletto, Yasmine Miguel Serafini; da Silveira, Nadya Pesce; Brandelli, Adriano
2011-08-01
Antimicrobial peptide P34, a substance showing antibacterial activity against pathogenic and food spoilage bacteria, was encapsulated in liposomes prepared from partially purified soybean phosphatidylcholine, and their physicochemical characteristics were evaluated. The antimicrobial activity was estimated by agar diffusion assay using Listeria monocytogenes ATCC 7644 as indicator strain. A concentration of 3,200 AU/mL of P34 was encapsulated in nanovesicles and stocked at 4 °C. No significant difference ( p > 0.05) in the biological activity of free and encapsulated P34 was observed through 24 days. Size and PDI of liposomes, investigated by light scattering analysis, were on average 150 nm and 0.22 respectively. Zeta potential was -27.42 mV. There was no significant change ( p > 0.05) in the physicochemical properties of liposomes during the time of evaluation. The liposomes presented closed spherical morphology as visualized by transmission electron microscopy (TEM). The mode of action of liposome-encapsulated P34 under L. monocytogenes cells was investigated by TEM. Liposomes appeared to adhere but not fuse with the bacterial cell wall, suggesting that the antimicrobial is released from nanovesicles to act against the microorganism. The effect of free and encapsulated P34 was tested against L. monocytogenes, showing that free bacteriocin inhibited the pathogen more quickly than the encapsulated P34. Liposomes prepared with low-cost lipid showed high encapsulation efficiency for a new antimicrobial peptide and were stable during storage. The mode of action against the pathogen L. monocytogenes was characterized.
Listeria monocytogenes in retailed raw chicken meat in Turkey.
Siriken, Belgin; Ayaz, Naim Deniz; Erol, Irfan
2014-01-01
The objectives of this study were, to find the prevalence and antimicrobial resistance of L. monocytogenes from a total of 116 chicken meat samples including 50 carcasses and 66 meat parts marketed in Turkey between 2008 and 2009 using immunomagnetic separation (IMS) based cultivation technique, to detect the hlyA gene for the verification of the isolates by PCR, and to identify the genoserotypes of the L. monocytogenes isolates by multiplex PCR assay. In the study, 51 L. monocytogenes colonies were isolated from 34 (29.3%) chicken meat samples (eleven [22.0%] carcasses and 23 [34.8%] pieces of meat) by IMS based cultivation technique and confirmed by PCR. According to the multiplex PCR results, all the 51 isolates were identified as genoserotype IIa (1/2a or 3a). L. monocytogenes isolates were also tested for their susceptibility to eight antibiotic (gentamicin, vancomycin, chloramphenicol, streptomycin, tetracycline, ampicillin, penicillin G, erythromycin) agents using the disk diffusion method. 14 isolates (27.45%) were susceptible to all eight antimicrobials drugs tested and the remaining 37 isolates (72.54%) were resistant to gentamicin (one isolate, 1.96%), vancomycin (four isolates, 7.84%), penicillin G (six isolates, 11.76%), streptomycin (nine isolates, 17.64%; resistant or intermediate), tetracycline (seven isolates, 13.72%) and ampicillin (six isolates, 11.76%). This study showed that antimicrobial resistance is not highly prevalent in L. monocytogenes isolated from chicken carcasses and pieces of meat. The presence of L. monocytogenes in chicken samples suggests an importance of this pathogen in chicken.
Produce contamination associated with enteric pathogens such Escherichia coli O157:H7, salmonella spp., Listeria monocytogenes, Shigella and others are significant challenges to food safety. This is due to the illnesses and economic impacts resulting from the outbreaks. Innovative technologies for i...
Ritz, M.; Tholozan, J. L.; Federighi, M.; Pilet, M. F.
2001-01-01
High hydrostatic pressure is a new food preservation technology known for its capacity to inactivate spoilage and pathogenic microorganisms. That inactivation is usually assessed by the number of colonies growing on solid media after treatment. Under normal conditions the method does not permit recovery of damaged cells and may underestimate the number of cells that will remain viable and grow after a few days in high-pressure-processed foodstuffs. This study investigated the damage inflicted on Listeria monocytogenes cells treated by high pressure for 10 min at 400 MPa in pH 5.6 citrate buffer. Under these conditions, no cell growth occurred after 48 h on plate count agar. Scanning electron microscopy, light scattering by flow cytometry, and cell volume measurements were compared to evaluate the morphological changes in cells after pressurization. All these methods revealed that cellular morphology was not really affected. Esterase activity, as assessed either by enzymatic activity assays or by carboxy fluorescein diacetate fluorescence monitored by flow cytometry, was dramatically lowered, but not totally obliterated, under the effects of treatment. The measurement of propidium iodide uptake followed by flow cytometry demonstrated that membrane integrity was preserved in a small part of the population, although the membrane potential measured by analytical methods or evaluated by oxonol uptake was reduced from −86 to −5 mV. These results showed that such combined methods as fluorescent dyes monitored by flow cytometry and physiological activity measurements provide valuable indications of cellular viability. PMID:11319107
Olaimat, Amin N; Holley, Richard A
2016-08-01
Ready-to-eat meats are considered foods at high risk to cause life-threatening Listeria monocytogenes infections. This study screened 5 L. monocytogenes strains for their ability to hydrolyze sinigrin (a glucosinolate in Oriental mustard), which formed allyl isothiocyanate (AITC) and reduced L. monocytogenes viability on inoculated vacuum-packed, cooked, cured roast chicken slices at 4 °C. Tests involved incorporation of 25-50 μl/g AITC directly or 100-250 mg/g Oriental mustard extract in 0.5% (w/v) κ-carrageenan/2% (w/v) chitosan-based coatings prepared using 1.5% malic or acetic acid. L. monocytogenes strains hydrolyzed 33.6%-48.4% pure sinigrin in MH broth by 21 d at 25 °C. Acidified κ-carrageenan/chitosan coatings containing 25-50 μl/g AITC or 100-250 mg/g mustard reduced the viability of L. monocytogenes and aerobic bacteria on cooked, cured roast chicken slices by 4.1 to >7.0 log10 CFU/g compared to uncoated chicken stored at 4 °C for 70 d. Coatings containing malic acid were significantly more antimicrobial than those with acetic acid. During storage for 70 d, acidified κ-carrageenan/chitosan coatings containing 25-50 μl/g AITC or 250 mg/g mustard extract reduced lactic acid bacteria (LAB) numbers 3.8 to 5.4 log10 CFU/g on chicken slices compared to uncoated samples. Acidified κ-carrageenan/chitosan-based coatings containing either AITC or Oriental mustard extract at the concentrations tested had the ability to control L. monocytogenes viability and delay growth of potential spoilage bacteria on refrigerated, vacuum-packed cured roast chicken. Copyright © 2016. Published by Elsevier Ltd.
2012-01-01
Background Immunomagnetic separation (IMS) and immunoassays are widely used for pathogen detection. However, novel technology platforms with highly selective antibodies are essential to improve detection sensitivity, specificity and performance. In this study, monoclonal antibodies (MAbs) against Internalin A (InlA) and p30 were generated and used on paramagnetic beads of varying diameters for concentration, as well as on fiber-optic sensor for detection. Results Anti-InlA MAb-2D12 (IgG2a subclass) was specific for Listeria monocytogenes and L. ivanovii, and p30-specific MAb-3F8 (IgM) was specific for the genus Listeria. At all bacterial concentrations (103–108 CFU/mL) tested in the IMS assay; the 1-μm diameter MyOne beads had significantly higher capture efficiency (P Listeria antibody (9 %). Furthermore, capture efficiency for MyOne-2D12 was highly specific for L. monocytogenes and L. ivanovii. Subsequently, we captured L. monocytogenes by MyOne-2D12 and MyOne-3F8 from hotdogs inoculated with mono- or co-cultures of L. monocytogenes and L. innocua (10–40 CFU/g), enriched for 18 h and detected by fiber-optic sensor and confirmed by plating, light-scattering, and qPCR assays. The detection limit for L. monocytogenes and L. ivanovii by the fiber-optic immunosensor was 3 × 102 CFU/mL using MAb-2D12 as capture and reporter antibody. Selective media plating, light-scattering, and qPCR assays confirmed the IMS and fiber-optic results. Conclusions IMS coupled with a fiber-optic sensor using anti-InlA MAb is highly specific for L. monocytogenes and L. ivanovii and enabled detection of these pathogens at low levels from buffer or food. PMID:23176167
Ye, M; Neetoo, H; Chen, H
2011-10-01
Listeria monocytogenes is a major safety concern for ready-to-eat foods. The overall objective of this study was to investigate whether prior frozen storage could enhance the efficacy of edible coatings against L. monocytogenes on cold-smoked salmon during subsequent refrigerated storage. A formulation consisting of sodium lactate (SL, 1·2-2·4%) and sodium diacetate (SD, 0·125-0·25%) or 2·5% Opti.Form (a commercial formulation of SL and SD) was incorporated into each of five edible coatings: alginate, κ-carrageenan, pectin, gelatin and starch. The coatings were applied onto the surface of cold-smoked salmon slices inoculated with L. monocytogenes at a level of 500 CFU cm⁻². In the first phase, the slices were first frozen at -18°C for 6 days and stored at 22°C for 6 days. Alginate, gelatin and starch appeared to be the most effective carriers. In the second phase, cold-smoked salmon slices were inoculated with L. monocytogenes, coated with alginate, gelatin or starch with or without the antimicrobials and stored frozen at -18°C for 12 months. Every 2 months, samples were removed from the freezer and kept at 4°C for 30 days. Prior frozen storage at -18°C substantially enhanced the antilisterial efficacy of the edible coatings with or without antimicrobials during the subsequent refrigerated storage. Plain coatings with ≥ 2 months frozen storage and antimicrobial edible coatings represent an effective intervention to inhibit the growth of L. monocytogenes on cold-smoked salmon. This study demonstrates the effectiveness of the conjunct application of frozen storage and edible coatings to control the growth of L. monocytogenes to enhance the microbiological safety of cold-smoked salmon. © 2011 The Authors. Journal of Applied Microbiology © 2011 The Society for Applied Microbiology.
Commensal microbes provide first line defense against Listeria monocytogenes infection
Littmann, Eric R.; Kim, Sohn G.; Morjaria, Sejal M.; Ling, Lilan; Gyaltshen, Yangtsho; Taur, Ying; Leiner, Ingrid M.
2017-01-01
Listeria monocytogenes is a foodborne pathogen that causes septicemia, meningitis and chorioamnionitis and is associated with high mortality. Immunocompetent humans and animals, however, can tolerate high doses of L. monocytogenes without developing systemic disease. The intestinal microbiota provides colonization resistance against many orally acquired pathogens, and antibiotic-mediated depletion of the microbiota reduces host resistance to infection. Here we show that a diverse microbiota markedly reduces Listeria monocytogenes colonization of the gut lumen and prevents systemic dissemination. Antibiotic administration to mice before low dose oral inoculation increases L. monocytogenes growth in the intestine. In immunodeficient or chemotherapy-treated mice, the intestinal microbiota provides nonredundant defense against lethal, disseminated infection. We have assembled a consortium of commensal bacteria belonging to the Clostridiales order, which exerts in vitro antilisterial activity and confers in vivo resistance upon transfer into germ free mice. Thus, we demonstrate a defensive role of the gut microbiota against Listeria monocytogenes infection and identify intestinal commensal species that, by enhancing resistance against this pathogen, represent potential probiotics. PMID:28588016
Directory of Open Access Journals (Sweden)
Daniel R. Rissi
2010-01-01
Full Text Available São descritos sete casos de doença neurológica em ovinos por Listeria monocytogenes no Rio Grande do Sul e Paraná entre 2000 e 2007. Foram afetados ovinos com idades entre 12-24 meses. Os casos ocorreram no verão e início da primavera e os índices gerais de morbidade e letalidade foram de 3,15% e 100%, respectivamente. Quando essa informação estava disponível, nenhum dos ovinos afetados era alimentado com silagem. Em três propriedades havia contato próximo dos ovinos afetados com outras espécies. A evolução do quadro clínico foi de 12 horas a três dias e os sinais clínicos foram caracterizados por decúbito (7/7, desvio da cabeça (4/7, incoordenação (3/7, depressão (3/7, andar em círculos (2/7, cegueira unilateral, emagrecimento progressivo, febre, midríase, movimentos de pedalagem, nistagmo lateral, opistótono, paralisia flácida dos membros pélvicos ou dos quatro membros, salivação excessiva e tremores (1/7 cada. Histologicamente observou-se encefalite com microabscessos, predominantemente unilateral com variáveis graus de gliose e alterações degenerativas como esferóides axonais e infiltração de células Gitter. As lesões se estendiam desde a medula oblonga até o mesencéfalo. Antígenos de Listeria monocytogenes foram detectados por imuno-histoquímica em seções de tronco encefálico de todos os ovinos afetados. O diagnóstico foi realizado com base nos achados epidemiológicos e clinico-patológicos, e confirmado pela imuno-histoquímica (IHQ utilizando anticorpo policlonal anti-L. monocytogenes.Seven cases of neurological disease in sheep caused by Listeria monocytogenes in Rio Grande do Sul and Paraná state, southern Brazil are described. The cases occurred between 2000 and 2007 and 12-24-month-old sheep were affected. Overall morbidity and lethality rates were 3.15% and 100%, respectively. Cases occurred in the summer and early spring. When this information was available, affected sheep had not been
Ndahi, M D; Kwaga, J K P; Bello, M; Kabir, J; Umoh, V J; Yakubu, S E; Nok, A J
2014-03-01
The bacterial genera Listeria and Staphylococcus have been frequently isolated from food products and are responsible for a number of animal and human diseases. The aim of the study was to simultaneously isolate and characterize L. monocytogenes and Staphylococcus species from 300 samples of raw meat and meat products, to determine the susceptibility of the organisms to commonly used antimicrobial agents and to determine the presence of haemolysin A (hyl) virulence gene in L. monocytogenes and staphylococcal cassette chromosome mecA (SCCmec) gene in the Staph. aureus isolates using PCR. Of the 85 Listeria isolates tested, 12 L. monocytogenes were identified and tested for their sensitivity to 14 antimicrobial agents. All the 12 isolates (100%) were resistant to nine antimicrobial agents, but however sensitive to gentamicin. Only one isolate was found to harbour the hylA gene. Twenty-nine isolates were confirmed as Staph. aureus by the Microbact 12S identification system and were all presumptively identified as methicillin-resistant Staph. aureus species using oxacillin-resistant Staph. aureus basal medium (ORSAB). The 29 Staph. aureus isolates were tested for their sensitivity to 16 antimicrobial agents, and 11 were resistant to methicillin. None of the 11 Staph. aureus isolates harboured the methicillin resistance, mecA gene. Listeria monocytogenes and Staphylococcus aureus are important agents of foodborne diseases. Occurrence of these infectious agents was established in meat and meat products in Zaria, Nigeria. Majority of isolates obtained from this study, displayed multidrug resistance to commonly used antimicrobial agents, including methicillin resistance among the Staph. aureus isolates. The potential virulence of L. monocytogenes found in ready-to-eat food was documented by the carriage of hly A gene by one of the isolates. A different mechanism of methicillin resistance or different homologue of mec A gene may be circulating among Nigerian
Chen, Yi; Pouillot, Régis; S Burall, Laurel; Strain, Errol A; Van Doren, Jane M; De Jesus, Antonio J; Laasri, Anna; Wang, Hua; Ali, Laila; Tatavarthy, Aparna; Zhang, Guodong; Hu, Lijun; Day, James; Sheth, Ishani; Kang, Jihun; Sahu, Surasri; Srinivasan, Devayani; Brown, Eric W; Parish, Mickey; Zink, Donald L; Datta, Atin R; Hammack, Thomas S; Macarisin, Dumitru
2017-01-16
A precise and accurate method for enumeration of low level of Listeria monocytogenes in foods is critical to a variety of studies. In this study, paired comparison of most probable number (MPN) and direct plating enumeration of L. monocytogenes was conducted on a total of 1730 outbreak-associated ice cream samples that were naturally contaminated with low level of L. monocytogenes. MPN was performed on all 1730 samples. Direct plating was performed on all samples using the RAPID'L.mono (RLM) agar (1600 samples) and agar Listeria Ottaviani and Agosti (ALOA; 130 samples). Probabilistic analysis with Bayesian inference model was used to compare paired direct plating and MPN estimates of L. monocytogenes in ice cream samples because assumptions implicit in ordinary least squares (OLS) linear regression analyses were not met for such a comparison. The probabilistic analysis revealed good agreement between the MPN and direct plating estimates, and this agreement showed that the MPN schemes and direct plating schemes using ALOA or RLM evaluated in the present study were suitable for enumerating low levels of L. monocytogenes in these ice cream samples. The statistical analysis further revealed that OLS linear regression analyses of direct plating and MPN data did introduce bias that incorrectly characterized systematic differences between estimates from the two methods. Published by Elsevier B.V.
Listeria monocytogenes infection of HD11, chicken macrophage-like cells.
Jarvis, N A; Donaldson, J R; O'Bryan, C A; Ricke, S C; Crandall, P G
2017-04-01
Listeria monocytogenes can be carried by and infect poultry, although the clinical disease in birds is rare. Escape from macrophage phagocytosis is a key step in pathogenesis for L. monocytogenes. Therefore, we investigated the infection of the chicken macrophage-like cell line HD11 with 2 strains of L. monocytogenes EGD-e and Scott A. After infection, L. monocytogenes was quantified by spread plating and HD11 was quantified with trypan blue exclusion stain before enumeration. The standard macrophage killing protocols require washing the cell monolayers 3 times with PBS, which was found to negatively influence HD11 monolayers. Maximum bacterial densities within macrophages were not different between the 2 Listeria strains. HD11 required more than 11 h to effectively reduce intracellular L. monocytogenes Scott A, and Scott A was more susceptible to HD11 killing than EGD-e. It appears that Listeria infection initially causes attenuation of HD11 growth, and infected HD11 cells do not begin to lyse until at least 11 h post infection. These results suggest that there are subtle strain to strain differences in response to HD11 macrophage phagocytosis. The long lead-time required for HD11 to kill L. monocytogenes cells means that there is sufficient time available for chicken macrophages to circulate in the blood and transfer the intracellular Listeria to multiple tissues. © 2016 Poultry Science Association Inc.
Survival of Bactericidal Antibiotic Treatment by a Persister Subpopulation of Listeria monocytogenes
DEFF Research Database (Denmark)
Knudsen, Gitte Maegaard; Ng, Yin; Gram, Lone
2013-01-01
Listeria monocytogenes can cause the serious infection listeriosis, which despite antibiotic treatment has a high mortality. Understanding the response of L. monocytogenes to antibiotic exposure is therefore important to ensure treatment success. Some bacteria survive antibiotic treatment...... by formation of persisters, which are a dormant antibiotic-tolerant subpopulation. The purpose of this study was to determine whether L. monocytogenes can form persisters and how bacterial physiology affects the number of persisters in the population. A stationary-phase culture of L. monocytogenes was adjusted...... that eradication of persisters is possible. Our study adds L. monocytogenes to the list of bacterial species capable of surviving bactericidal antibiotics in a dormant stage, and this persister phenomenon should be borne in mind when developing treatment regimens....
Chaitiemwong, N; Hazeleger, W C; Beumer, R R
2010-08-15
Survival of Listeria monocytogenes on a conveyor belt material with or without antimicrobial additives, in the absence or presence of food debris from meat, fish and vegetables and at temperatures of 10, 25 and 37 degrees C was investigated. The pathogen survived best at 10 degrees C, and better at 25 degrees C than at 37 degrees C on both conveyor belt materials. The reduction in the numbers of the pathogen on belt material with antimicrobial additives in the first 6h at 10 degrees C was 0.6 log unit, which was significantly higher (Padditives. Reductions were significantly less (Pfood residue. At 37 degrees C and 20% relative humidity, large decreases in the numbers of the pathogen on both conveyor belt materials during the first 6h were observed. Under these conditions, there was no obvious effect of the antimicrobial substances. However, at 25 degrees C and 10 degrees C and high humidity (60-75% rh), a rapid decrease in bacterial numbers on the belt material with antimicrobial substances was observed. Apparently the reduction in numbers of L. monocytogenes on belt material with antimicrobial additives was greater than on belt material without additives only when the surfaces were wet. Moreover, the presence of food debris neutralized the effect of the antimicrobials. The results suggest that the antimicrobial additives in conveyor belt material could help to reduce numbers of microorganisms on belts at low temperatures when food residues are absent and belts are not rapidly dried. Copyright 2010 Elsevier B.V. All rights reserved.
Al-Seraih, Alaa; Belguesmia, Yanath; Baah, John; Szunerits, Sabine; Boukherroub, Rabah; Drider, Djamel
2017-02-01
Enterococcus faecalis B3A-B3B produces the bacteriocin B3A-B3B with activity against Listeria monocytogenes, Staphylococcus aureus, methicillin-resistant Staphylococcus aureus (MRSA) and Clostridium perfringens, but apparently not against fungi or Gram-negative bacteria, except for Salmonella Newport. B3A-B3B enterocin has two different nucleotides but similar amino acid composition to the class IIb MR10A-MR10B enterocin. B3A-B3B consists of two peptides of predicted molecular mass of 5176.31 Da (B3A) and 5182.21 Da (B3B). Importantly, B3A-B3B impeded biofilm formation of the foodborne pathogen L. monocytogenes 162 grown on stainless steel. The antimicrobial treatment of stainless steel with nisin (1 or 16 mg ml -1 ) decreased the cell numbers by about 2 log CFU ml -1 , thereby impeding the biofilm formation by L. monocytogenes 162 or its nisin-resistant derivative strain L. monocytogenes 162R. Furthermore, the combination of nisin and B3A-B3B enterocin reduced the MIC required to inhibit this pathogen grown in planktonic or biofilm cultures.
Monitoring the impacts of trade agreements on food environments.
Friel, S; Hattersley, L; Snowdon, W; Thow, A-M; Lobstein, T; Sanders, D; Barquera, S; Mohan, S; Hawkes, C; Kelly, B; Kumanyika, S; L'Abbe, M; Lee, A; Ma, J; Macmullan, J; Monteiro, C; Neal, B; Rayner, M; Sacks, G; Swinburn, B; Vandevijvere, S; Walker, C
2013-10-01
The liberalization of international trade and foreign direct investment through multilateral, regional and bilateral agreements has had profound implications for the structure and nature of food systems, and therefore, for the availability, nutritional quality, accessibility, price and promotion of foods in different locations. Public health attention has only relatively recently turned to the links between trade and investment agreements, diets and health, and there is currently no systematic monitoring of this area. This paper reviews the available evidence on the links between trade agreements, food environments and diets from an obesity and non-communicable disease (NCD) perspective. Based on the key issues identified through the review, the paper outlines an approach for monitoring the potential impact of trade agreements on food environments and obesity/NCD risks. The proposed monitoring approach encompasses a set of guiding principles, recommended procedures for data collection and analysis, and quantifiable 'minimal', 'expanded' and 'optimal' measurement indicators to be tailored to national priorities, capacity and resources. Formal risk assessment processes of existing and evolving trade and investment agreements, which focus on their impacts on food environments will help inform the development of healthy trade policy, strengthen domestic nutrition and health policy space and ultimately protect population nutrition. © 2013 The Authors. Obesity Reviews published by John Wiley & Sons Ltd on behalf of the International Association for the Study of Obesity.
Detection of Listeria Spp. and Listeria monocytogenes in vegetables ...
African Journals Online (AJOL)
This paper aimed to study the prevalence and antibiotic resistance pattern among Listeria monocytogenes in raw vegetables sourced from commercial farms and local farms in Terengganu. Thirteen types of vegetables investigated for the presence of L. monocytogenes using multiplex PCR and LAMP methods. Isolation of ...
Directory of Open Access Journals (Sweden)
Wang Y
2017-01-01
Full Text Available Yi Wang,1 Hui Li,1,2 Yan Wang,1 Hua Li,1 Lijuan Luo,1 Jianguo Xu,1 Changyun Ye1 1State Key Laboratory of Infectious Disease Prevention and Control, National Institute for Communicable Disease Control and Prevention, Collaborative Innovation Center for Diagnosis and Treatment of Infectious Diseases, Chinese Center for Disease Control and Prevention, Changping, Beijing, 2Department of Microbiology, GuiZhou Medical University, Guiyang, Guizhou, People’s Republic of China Abstract: Listeria monocytogenes, one of most problematic foodborne pathogens, is responsible for listeriosis in both humans and animals and mainly transmitted through the food chain. In this report, we propose a simple, rapid, and nearly instrument-free molecular technique using multiple cross displacement amplification (MCDA label-based gold nanoparticles lateral flow biosensor (LFB for specific, sensitive, and visual detection of L. monocytogenes. The MCDA-LFB method was carried out at a constant temperature (61°C for only 20 min during the reaction stage, and then the amplification mixtures were directly detected by using LFB, eliminating the use of an electrophoresis instrument, special reagents, or amplicon analysis equipment. The whole procedure, from sample processing to result indicating, was finished within 1 h. The analytical specificity of MCDA-LFB method was successfully determined by distinguishing the target bacterium from other pathogens. The analytical sensitivity of the MCDA-LFB assay was 10 fg of genomic templates per reaction in pure culture, which was in complete accordance with MCDA by gel electrophoresis, real-time turbidity, and colorimetric indicator. The assay was also successfully applied to detecting L. monocytogenes in pork samples. Therefore, the rapidity, simplicity, and nearly equipment-free platform of the MCDA-LFB technique make it possible for food control, clinical diagnosis, and more. The proof-of-concept assay can be reconfigured to detect
Lamas, Alexandre; Miranda, José Manuel; Vázquez, Beatriz; Cepeda, Alberto; Franco, Carlos Manuel
2016-10-31
In recent years, the use of nitrites and sulfites as food preservatives has been a cause for concern due to the health problems that these additives can cause in humans. Natural products have been studied as an alternative, but most of them have hardly been applied in the food industry for technological and economic reasons. In this sense, organic salts such as sodium acetate are a good alternative due to their affordability. Thus, this study evaluated the capacity of sodium nitrite, sodium sulfite, a sodium acetate product (TQI C-6000), and chitosan to inhibit two important foodborne pathogens, Salmonella enterica and Listeria monocytogenes . The MIC of each chemical was in vitro evaluated and their antibacterial action was subsequently checked in situ using minced meat as a food model. MIC values of sodium nitrite (10,000 mg/L) and sodium sulfite (50,000 mg/L) for Salmonella enterica were higher than the values allowed by legislation (450 mg/L for sulfites and 150 mg/L for nitrites). Additionally, the sodium acetate product caused the inhibition of Salmonella enterica and Listeria at a relative low quantity. The two foodborne pathogens were inhibited in the food model with 1% of the sodium acetate product. Additionally, there were no significant differences between sodium nitrite, sodium sulfite, and sodium acetate products in the inhibition of Salmonella enterica and Listeria monocytogenes in the food model. Thus, products based on sodium acetate can be an alternative to traditional preservatives in food products.
Lunestad, B T; Truong, T T T; Lindstedt, B-A
2013-10-01
The objective of this study was to characterize Listeria monocytogenes isolated from farmed Atlantic salmon (Salmo salar) and the processing environment in three different Norwegian factories, and compare these to clinical isolates by multiple-locus variable-number tandem repeat analysis (MLVA). The 65 L. monocytogenes isolates obtained gave 15 distinct MLVA profiles. There was great heterogeneity in the distribution of MLVA profiles in factories and within each factory. Nine of the 15 MLVA profiles found in the fish-associated isolates were found to match human profiles. The MLVA profile 07-07-09-10-06 was the most common strain in Norwegian listeriosis patients. L. monocytogenes with this profile has previously been associated with at least two known listeriosis outbreaks in Norway, neither determined to be due to fish consumption. However, since this profile was also found in fish and in the processing environment, fish should be considered as a possible food vehicle during sporadic cases and outbreaks of listeriosis.
Early trigeminal nerve involvement in Listeria monocytogenes rhombencephalitis
DEFF Research Database (Denmark)
Karlsson, William K; Harboe, Zitta Barrella; Roed, Casper
2017-01-01
dysfunction on that side. In addition, we identified another 120 cases of Listeria rhombencephalitis following a systematic review. Cranial nerves VII, V, IX, and X, respectively, medulla oblongata, cerebellum and pons, were the most frequently involved brain structures. The present clinical and radiological...... findings corroborate earlier data from animal experiments, indicating that L. monocytogenes may be capable of retrograde intra-axonal migration along the cranial nerves. We suggest that in a subset of patients with rhombencephalitis L. monocytogenes enters the cerebellopontine angle through the trigeminal......Listeria monocytogenes is associated with rhombencephalitis. However, the exact mechanisms of brainstem invasion remains poorly understood. Here, we demonstrate clinical and radiological data suggesting that Listeria may invade the brainstem via the trigeminal nerve. Three females (41, 64 and 70...
Sugiri, Yoni Darmawan; Gölz, Greta; Meeyam, Tongkorn; Baumann, Maximilian P O; Kleer, Josef; Chaisowwong, Warangkhana; Alter, Thomas
2014-08-01
This study was conducted to determine the prevalence and quantify the number of Listeria monocytogenes in fresh chicken carcasses sold in traditional markets and supermarkets in Bandung, West Java, Indonesia, and to determine the antimicrobial resistance patterns of the isolated L. monocytogenes strains. The overall prevalence of L. monocytogenes in chicken carcasses was 15.8% (29/184). When comparing samples from traditional markets and supermarkets, no significant difference in the L. monocytogenes prevalence was detectable (15.2 versus 16.3%). Of the samples, 97.3% had L. monocytogenes counts study were grouped into the molecular serogroup IIb, comprising the serovars 1/2b, 3b, and 7.
Naik, Milind Mohan; Bhangui, Purva; Bhat, Chinmay
2017-12-01
Listeria monocytogenes are Gram-positive well-known emerging food-borne pathogens causing listeriosis in humans. In the present study, we have isolated biofilm-forming Listeria sp. from utensils used by a local milk collection dairy society at Usgao Goa, which collects milk for Goa dairy. Through biochemical tests and 16S rRNA sequence analysis, the bacterium was confirmed to be L. monocytogenes and designated as strain BN3, having GenBank accession number MF095110. We report for the first time Gram-positive L. monocytogenes strain BN3 producing iron-chelating siderophores by chrome azurol S (CAS) agar test. Also, this is a first report which reveals that L. monocytogenes strain BN3 responds to N-hexanoyl-homoserine lactone molecule (C 6 -HSL) by gradual increase in their biofilm-forming potential with a gradual increase in AHL (C 6 -HSL) concentration (250, 500 nM-1 μM) as compared to control revealed by crystal violet assay (CV) in microtiter plate. These results were further confirmed by scanning electron microscopy (SEM). A significant decrease in biofilm formation was observed when L. monocytogenes strain BN3 was treated with 10 µg/ml (R)-2-(2-hydroxynaphthalen-1-yl)thiazolidine-4-carboxylic acid, but when 250 and 500 nM AHL molecules were added, biofilm formation in strain BN3 was found to be enhanced as compared to control even in the presence of antibacterial compound, (R)-2-(2-hydroxynaphthalen-1-yl)thiazolidine-4-carboxylic acid. These results revealed that AHL molecules nullify the effect of antimicrobial compound and promote biofilm formation in L. monocytogenes strain BN3.
Irkin, Reyhan; Korukluoglu, Mihriban
2009-04-01
Food safety is a fundamental concern of both consumers and the food industry. The increasing incidence of foodborne diseases increases the demand of using antimicrobials in foods. Spices and plants are rich in essential oils and show inhibition activity against microorganisms, which are composed of many compounds. In this research, effects of garlic, bay, black pepper, origanum, orange, thyme, tea tree, mint, clove, and cumin essential oils on Listeria monocytogenes AUFE 39237, Escherichia coli ATCC 25922, Salmonella enteritidis ATCC 13076, Proteus mirabilis AUFE 43566, Bacillus cereus AUFE 81154, Saccharomyces uvarum UUFE 16732, Kloeckera apiculata UUFE 10628, Candida albicans ATCC 10231, Candida oleophila UUPP 94365, and Metschnikowia fructicola UUPP 23067 and effects of thyme oil at a concentration of 0.5% on L. monocytogenes and C. albicans in apple-carrot juice during +4 degrees C storage (first to fifth day) were investigated. Strong antibacterial and antifungal activities of some essential oils were found. Thyme, origanum, clove, and orange essential oils were the most inhibitory against bacteria and yeasts. Cumin, tea tree, and mint oils inhibited the yeasts actively. It is concluded that some essential oils could be used as potential biopreservatives capable of controlling foodborne pathogens and food spoilage yeasts.
Modeling the growth of Listeria monocytogenes in soft blue-white cheese
DEFF Research Database (Denmark)
Rosshaug, Per Sand; Detmer, Ann; Ingmer, Hanne
2012-01-01
The aim of this study was to develop a predictive model simulating growth over time of the pathogenic bacterium Listeria monocytogenes in a soft blue-white cheese. The physicochemical properties in a matrix such as cheese are essential controlling factors influencing the growth of L. monocytogenes....... We developed a predictive tertiary model of the bacterial growth of L. monocytogenes as a function of temperature, pH, NaCl, and lactic acid. We measured the variations over time of the physicochemical properties in the cheese. Our predictive model was developed based on broth data produced...... production and retail conditions showed that the number of L. monocytogenes cells increases 3 to 3.5 log within the shelf life of the cheese....
Occurrence of Listeria monocytogenes in smoked fish in Sokoto ...
African Journals Online (AJOL)
The present study was conducted to determine the prevalence of Listeria monocytogenes in smoked fish in Sokoto, Nigeria. A total of 115 different species of smoked fish from the various retail outlets and market places within the metropolis were analysed for the presence of L. monocytogenes using ISO culture method.
Impact of Pathogen Population Heterogeneity and Stress-Resistant Variants on Food Safety.
Abee, T; Koomen, J; Metselaar, K I; Zwietering, M H; den Besten, H M W
2016-01-01
This review elucidates the state-of-the-art knowledge about pathogen population heterogeneity and describes the genotypic and phenotypic analyses of persister subpopulations and stress-resistant variants. The molecular mechanisms underlying the generation of persister phenotypes and genetic variants are identified. Zooming in on Listeria monocytogenes, a comparative whole-genome sequence analysis of wild types and variants that enabled the identification of mutations in variants obtained after a single exposure to lethal food-relevant stresses is described. Genotypic and phenotypic features are compared to those for persistent strains isolated from food processing environments. Inactivation kinetics, models used for fitting, and the concept of kinetic modeling-based schemes for detection of variants are presented. Furthermore, robustness and fitness parameters of L. monocytogenes wild type and variants are used to model their performance in food chains. Finally, the impact of stress-resistant variants and persistence in food processing environments on food safety is discussed.
Harrison, W A; Peters, A C; Fielding, L M
2000-01-01
The growth of Listeria monocytogenes and Yersinia enterocolitica colonies was studied on solid media at 4 and 8 degrees C under modified atmospheres (MAs) of 5% O2: 10% CO2: 85% N2 (MA1), 30% CO2: 70% N2 (MA2) and air (control). Colony radius, determined using computer image analysis, allowed specific growth rates (mu) and the time taken to detect bacterial colonies to be estimated, after colonies became visible. At 4 degrees C both MAs decreased the growth rates of L. monocytogenes by 1.5- and 3.0-fold under MA1 (mu = 0.02 h(-1)) and MA2 (mu = 0.01 h(-1)), respectively, as compared with the control (mu = 0.03 h(-1)). The time to detection of bacterial colonies was increased from 15 d (control) to 24 (MA1) and 29 d (MA2). At 8 degrees C MA2 decreased the growth rate by 1.5-fold (mu = 0.04 h(-1)) as compared with the control (mu = 0.06 h(-1)) and detection of colonies increased from 7 (control) to 9 d (MA2). At 4 degrees C both MAs decreased the growth rates of Y. enterocolitica by 1.5- and 2.5-fold under MA1 (mu = 0.03 h(-1)) and MA2 (mu = 0.02 h(-1)), respectively, as compared with the control (mu = 0.05 h(-1)). At 8 degrees C identical growth rates were obtained under MA1 and the control (mu = 0.07 h(-1)) whilst a decrease in the growth rate was obtained under MA2 (mu = 0.04 h(-1)). The detection of colonies varied from 6 (8 degrees C, aerobic) to 19 d (4 degrees C, MA2). Refrigerated modified atmosphere packaged foods should be maintained at 4 degrees C and below to ensure product safety.
DEFF Research Database (Denmark)
Li, Lili; Olsen, Rikke Heidemann; Ye, Lei
2016-01-01
A total of 78 Listeria monocytogenes isolates from a pork processing plant and the respective meat markets in southern China were examined. This number includes 60 isolates from pork at markets, 5 from cooked pork products at markets, 10 from pork at a processing plant, and 3 from food......, ampicillin/sulbactam, imipenem, ciprofloxacin, levofloxacin, trimethoprim/sulfamethoxazole, and vancomycin. Two isolates were resistant to five antimicrobials. Twelve strains carried tet(M) and located on Tn916. PFGE analysis revealed genetic heterogeneity among individual serotypes. Two predominant PFGE...... types were found persistent from the processing plant to markets indicating that these two types of isolates were able to survive under environmental adverse conditions from the processing plant to markets, which need to be monitored. Compared to samples from the pork processing plant, the prevalence of...
Bullock, Sally Lawrence; Craypo, Lisa; Clark, Sarah E; Barry, Jason; Samuels, Sarah E
2010-07-01
States and school districts around the country are developing policies that set nutrition standards for competitive foods and beverages sold outside of the US Department of Agriculture's reimbursable school lunch program. However, few tools exist for monitoring the implementation of these new policies. The objective of this research was to develop a computerized assessment tool, the Food and Beverage Environment Analysis and Monitoring System (FoodBEAMS), to collect data on the competitive school food environment and to test the inter-rater reliability of the tool among research and nonresearch professionals. FoodBEAMS was used to collect data in spring 2007 on the competitive foods and beverages sold in 21 California high schools. Adherence of the foods and beverages to California's competitive food and beverage nutrition policies for schools (Senate Bills 12 and 965) was determined using the data collected by both research and nonresearch professionals. The inter-rater reliability between the data collectors was assessed using the intraclass correlation coefficient. Researcher vs researcher and researcher vs nonresearcher inter-rater reliability was high for both foods and beverages, with intraclass correlation coefficients ranging from .972 to .987. Results of this study provide evidence that FoodBEAMS is a promising tool for assessing and monitoring adherence to nutrition standards for competitive foods sold on school campuses and can be used reliably by both research and nonresearch professionals. Copyright 2010 American Dietetic Association. Published by Elsevier Inc. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Rodrigues, D.; Teixeira, P. [Institute for Biotechnology and Bioengineering, Centre of Biological Engineering, University of Minho, Campus de Gualtar, 4710-057 Braga (Portugal); Tavares, C.J. [Center of Physics, University of Minho, Campus de Azurém, 4800-058 Guimarães (Portugal); Azeredo, J., E-mail: jazeredo@deb.uminho.pt [Institute for Biotechnology and Bioengineering, Centre of Biological Engineering, University of Minho, Campus de Gualtar, 4710-057 Braga (Portugal)
2013-04-01
Improvement of food safety is a very important issue, and is on the basis of production and application of new/modified food contact surfaces. Titanium dioxide (TiO{sub 2}) and, more recently, nitrogen-doped titanium dioxide (N-TiO{sub 2}) coatings are among the possible forms to enhance food contact surfaces performance in terms of higher hygiene and easier sanitation. In this context, the present work aimed at evaluating the bactericidal activity of an N-TiO{sub 2} coating on glass and stainless steel under two different sources of visible light – fluorescent and incandescent – and ultraviolet (UV) irradiation. Listeria monocytogenes was chosen as representative of major foodborne pathogens and its survival was tested on N-TiO{sub 2} coated coupons. In terms of survival percentage, good results were obtained after exposure of coated surfaces to all light types since, apart from the value obtained after exposing glass to fluorescent light (56.3%), survival rates were always below 50%. However, no effective disinfection was obtained, given that for a disinfectant or sanitizing agent to be claimed as effective it needs to be able to promote at least a 3-log reduction of the microbial load, which was not observed for any of the experimental conditions assessed. Even so, UV irradiation was the most successful on eliminating cells on coated surfaces, since the amount of bacteria was reduced to 1.49 × 10{sup 6} CFU/ml on glass and 2.37 × 10{sup 7} on stainless steel. In contrast, both visible light sources had only slightly decreased the amount of viable cells, which remained in the range of 8 log CFU/ml. Hence, although some bactericidal effect was accomplished under visible light, UV was the most effective light source on promoting photocatalytic reactions on N-TiO{sub 2} coated coupons and none of the experimental conditions have reached a satisfactory disinfection level. Thus, this surface coating needs further research and improvement in order to become truly
Effekt av ulike desinfeksjonsstrategier mot Listeria monocytogenes
Fossmo, Sabine
2013-01-01
Kontroll med bakterier som Listeria utgjør en stor utfordring for mange matprodusenter. Listeria monocytogenes er hovedsakelig et produksjonshygienisk problem, forbedret hygiene kan derfor være tiltak for å redusere overlevelse og smitteoverføring av bakterien i produksjonsmiljø. Hensikten med forsøkene i oppgaven var å undersøke effekten av ulike desinfeksjonsstrategier på drap av L. monocytogenes, både når bakteriene var i biofilm og i suspensjon. Dette inkluderte bruk av tradisjonelle desi...
Ohshima, Chihiro; Takahashi, Hajime; Iwakawa, Ai; Kuda, Takashi; Kimura, Bon
2017-07-17
Listeria monocytogenes, which is responsible for causing food poisoning known as listeriosis, infects humans and animals. Widely distributed in the environment, this bacterium is known to contaminate food products after being transmitted to factories via raw materials. To minimize the contamination of products by food pathogens, it is critical to identify and eliminate factory entry routes and pathways for the causative bacteria. High resolution melting analysis (HRMA) is a method that takes advantage of differences in DNA sequences and PCR product lengths that are reflected by the disassociation temperature. Through our research, we have developed a multiple locus variable-number tandem repeat analysis (MLVA) using HRMA as a simple and rapid method to differentiate L. monocytogenes isolates. While evaluating our developed method, the ability of MLVA-HRMA, MLVA using capillary electrophoresis, and multilocus sequence typing (MLST) was compared for their ability to discriminate between strains. The MLVA-HRMA method displayed greater discriminatory ability than MLST and MLVA using capillary electrophoresis, suggesting that the variation in the number of repeat units, along with mutations within the DNA sequence, was accurately reflected by the melting curve of HRMA. Rather than relying on DNA sequence analysis or high-resolution electrophoresis, the MLVA-HRMA method employs the same process as PCR until the analysis step, suggesting a combination of speed and simplicity. The result of MLVA-HRMA method is able to be shared between different laboratories. There are high expectations that this method will be adopted for regular inspections at food processing facilities in the near future. Copyright © 2017. Published by Elsevier B.V.
Effects of prebiotics on the infective potential of Listeria monocytogenes
DEFF Research Database (Denmark)
Ebersbach, Tine
% xylooligosaccharides (XOS), galactooligosaccharides (GOS), inulin, apple pectin or polydextrose for three weeks before oral challenge with L. monocytogenes. XOS and GOS significantly improved resistance of guinea pigs to L. monocytogenes, while inulin and apple pectin decreased the resistance. No significant effect...
Methods for detecting pathogens in the beef food chain: detecting particular pathogens
The main food-borne pathogens of concern in the beef food chain are Shiga toxin-producing Escherichia coli (STEC) and Salmonella spp.; however, the presence of other pathogens, including Listeria monocytogenes, Campylobacter spp., Clostridium spp., Bacillus cereus, and Mycobacterium avium subsp. par...
Restraining reactive oxygen species in Listeria monocytogenes promotes the apoptosis of glial cells.
Li, Sen; Li, Yixuan; Chen, Guowei; Zhang, Jingchen; Xu, Fei; Wu, Man
2017-07-01
Listeria monocytogenes is a facultative anaerobic foodborne pathogen that can traverse the blood-brain barrier and cause brain infection. L. monocytogenes infection induces host cell apoptosis in several cell types. In this study, we investigated the apoptosis of human glioma cell line U251 invaded by L. monocytogenes and evaluated the function of bacterial reactive oxygen species (ROS) during infection. Bacterial ROS level was reduced by carrying out treatment with N-acetyl cysteine (NAC) and diphenyleneiodonium chloride (DPI). After infection, the apoptosis of U251 cells was examined by flow cytometry assay and propidium iodide staining. DPI and NAC efficiently decreased ROS level in L. monocytogenes without affecting bacterial growth. Moreover, the apoptosis of glial cells was enhanced upon invasion of DPI- and NAC-pretreated L. monocytogenes. Results indicate that the apoptosis of glial cells can be induced by L. monocytogenes, and that the inhibition of bacterial ROS increases the apoptosis of host cells.
Utilization of mathematical models to manage risk of holding cold food without temperature control.
Schaffner, Donald W
2013-06-01
This document describes the development of a tool to manage the risk of the transportation of cold food without temperature control. The tool uses predictions from ComBase predictor and builds on the 2009 U.S. Food and Drug Administration Model Food Code and supporting scientific data in the Food Code annex. I selected Salmonella spp. and Listeria monocytogenes as the organisms for risk management. Salmonella spp. were selected because they are associated with a wide variety of foods and grow rapidly at temperatures >17°C. L. monocytogenes was selected because it is frequently present in the food processing environment, it was used in the original analysis contained in the Food Code Annex, and it grows relatively rapidly at temperatures supplier collected as part of this project. The resulting model-based tool will be a useful aid to risk managers and customers of wholesale cash and carry food service suppliers, as well as to anyone interested in assessing and managing the risks posed by holding cold foods out of temperature control in supermarkets, delis, restaurants, cafeterias, and homes.
Listeria monocytogenes internalizes in Romaine Lettuce grown in greenhouse conditions
Listeria monocytogenes has been implicated in a number of outbreaks involving fresh produce, including an outbreak in 2016 resulting from contaminated packaged salads. The persistence and internalization potential of L. monocytogenes in romaine lettuce was evaluated, and the persistence of two L. mo...
Growth inhibition of Listeria monocytogenes by a nonbacteriocinogenic Carnobacterium piscicola
DEFF Research Database (Denmark)
Nilsson, Lilian; Bech Hansen, T.; Garrido, P.
2005-01-01
Aims: This study elucidates the mechanisms by which a nonbacteriocinogenic Carnobacterium piscicola inhibits growth of Listeria monocytogenes. Methods and Results: Listeria monocytogenes was exposed to live cultures of a bacteriocin-negative variant of C. piscicola A9b in co-culture, in a diffusion...... chamber system, and to a cell-free supernatant. Suppression of maximum cell density (0-3.5 log units) of L. monocytogenes was proportional to initial levels of C. pisciola (10(3)-10(7) CFU ml(-1)). Cell-to-cell contact was not required to cause inhibition. The cell-free C. piscicola supernatant caused...... a decrease in L. monocytogenes maximum cell density, which was abolished by glucose addition but not by amino acid, vitamin or mineral addition. The fermentate also gave rise to a longer lag phase and a reduction in growth rate. These effects were independent of glucose and may have been caused by acetate...
Prevalence and serotypes of Listeria monocytogenes contamination in Chinese beef processing plants.
Zhu, Lixian; Feng, Xiaohui; Zhang, Lihua; Zhu, Ruiliang; Luo, Xin
2012-06-01
The aim of this work was to study the epidemiology of Listeria spp., particularly Listeria monocytogenes, and to identify the serotypes present in contaminated samples from beef processing plants in China. A total of 439 samples were obtained from bovine feces, hides, and carcasses at three commercial processing plants. A standard protocol (ISO 11290-1) was followed to detect Listeria spp. and L. monocytogenes, and multiplex polymerase chain reaction was used to identify the various L. monocytogenes serotypes. The overall prevalences of Listeria spp. and L. monocytogenes were 65.6% and 26.4%, respectively, and the contamination was highest in the hide samples. The identified L. monocytogenes serotypes were 1/2c and 1/2a. The results of the current study indicate that Listeria spp. contamination is common in Chinese beef processing plants; specific measures should be taken to prevent and/or treat L. monocytogenes contamination of feces and hides in beef slaughter plants. Furthermore, because Listeria spp. contamination was found to be prevalent, it should, therefore, be studied further. The prevention of cases of sporadic listeriosis in China should also be addressed.
Isolation, identification, and characterization of Listeria spp. from various animal origin foods
Nayak, Deepti N.; Savalia, C. V.; Kalyani, I. H.; Kumar, Rajeev; Kshirsagar, D. P.
2015-01-01
Aim: The present study was undertaken with the prime objective of isolating and identifying Listeria spp. from various foods of animal origin sold at retail market outlets in the city of Navsari, Gujarat. Materials and Methods: Total 200 samples comprising of milk, milk products, meat, and fish (50 each) collected aseptically from local market which were subjected first to pre-enrichment in half strength Fraser broth followed by enrichment in full strength Fraser broth and subsequent plating on PALCAM agar. The growth with the typical colony characteristics were further identified up to species level on the basis of their morphological and biochemical characteristics. Cultures identified as Listeria monocytogenes were further subjected to in vitro pathogenicity tests and detection of different virulence-associated genes viz. actA, hlyA, and iap using polymerase chain reaction. Results: Of the total 200 food samples of animal origin; 18 (9%) were found positive for Listeria spp. which were identified as Listeria seeligeri (6, 33.3%), Listeria innocua (5, 27.7%), Listeria welshimeri (4, 22.2%), and L. monocytogenes (3, 16.6%). The highest prevalence was observed in milk samples (8). Species wise, 6 isolates of L. seeligeri which included two each from cow milk, buffalo milk, and meat samples; 5 L. innocua isolates included four recovered from fish and one from meat sample; 4 L. welshimeri comprised of two isolates from ice cream and one each from buffalo milk and meat sample; and 3 isolates of L. monocytogenes recovered from milk (1 cow and 2 buffalo milk). All 3 L. monocytogenes isolates screened for the presence of virulence genes viz. actA, hlyA, and iap using the specific primers revealed the presence of all the genes suggesting the possibility of danger of foodborne listeriosis among raw milk consumers. Conclusion: Listeria spp. was isolated from 9% (18/200) of the animal origin food samples viz.; milk, milk products, meat, and fish with the highest prevalence
Isolation, identification, and characterization of Listeria spp. from various animal origin foods
Directory of Open Access Journals (Sweden)
Deepti N. Nayak
2015-06-01
Full Text Available Aim: The present study was undertaken with the prime objective of isolating and identifying Listeria spp. from various foods of animal origin sold at retail market outlets in the city of Navsari, Gujarat. Materials and Methods: Total 200 samples comprising of milk, milk products, meat, and fish (50 each collected aseptically from local market which were subjected first to pre-enrichment in half strength Fraser broth followed by enrichment in full strength Fraser broth and subsequent plating on PALCAM agar. The growth with the typical colony characteristics were further identified up to species level on the basis of their morphological and biochemical characteristics. Cultures identified as Listeria monocytogenes were further subjected to in vitro pathogenicity tests and detection of different virulence associated genes viz. actA, hlyA, and iap using polymerase chain reaction. Results: Of the total 200 food samples of animal origin; 18 (9% were found positive for Listeria spp. which were identified as Listeria seeligeri (6, 33.3%, Listeria innocua (5, 27.7%, Listeria welshimeri (4, 22.2%, and L. monocytogenes (3, 16.6%. The highest prevalence was observed in milk samples (8. Species wise, 6 isolates of L. seeligeri which included two each from cow milk, buffalo milk, and meat samples; 5 L. innocua isolates included four recovered from fish and one from meat sample; 4 L. welshimeri comprised of two isolates from ice cream and one each from buffalo milk and meat sample; and 3 isolates of L. monocytogenes recovered from milk (1 cow and 2 buffalo milk. All 3 L. monocytogenes isolates screened for the presence of virulence genes viz. actA, hlyA, and iap using the specific primers revealed the presence of all the genes suggesting the possibility of danger of foodborne listeriosis among raw milk consumers. Conclusion: Listeria spp. was isolated from 9% (18/200 of the animal origin food samples viz.; milk, milk products, meat, and fish with the highest
Directory of Open Access Journals (Sweden)
Ana Espinoza M
2004-04-01
Full Text Available Objetivo: Determinar la presencia de L. monocytogenes en quesos frescos de producción artesanal expendidos en los mercados de Ica durante el periodo enero - marzo de 2003. Material y Métodos: De la totalidad de los puestos que expenden queso fresco artesanal en los mercados Santo Domingo, Alejandro Toledo, San Antonio y Modelo, se evaluaron 74 muestras teniendo como unidad muestral 200 g según la Norma Técnica Peruana ISO 28329-1. El procesamiento, aislamiento e identificación se realizó de acuerdo con la metodología recomendada por el manual de bacteriología analítica de la Food and Drug Administration (FDA. Resultados: De las 74 muestras, 3 (4,05% presentaban L. monocytogenes, y de ellas, una muestra correspondió al mercado Alejandro Toledo y 2 muestras al mercado Modelo. Se logró aislar 28 cepas de las cuales 6 (21,4% correspondieron a L. monocytogenes, y 22 (78,6% a otros microorganismos como Lactococcus lactis ss lactis, Enterococcus spp. y Bacillus spp. No se logró aislar L. monocytogenes en los mercados Santo Domingo y San Antonio; sin embargo, en el mercado Alejandro Toledo se aisló una cepa y en el mercado Modelo, se aislaron 5 cepas, lo cual demuestra la presencia significativa de L. monocytogenes sólo en el mercado Modelo. Conclusiones: Existe L. monocytogenes en quesos frescos de producción artesanal, representando un riesgo potencial para la población consumidora.
Prebiotic Oligosaccharides Potentiate Host Protective Responses against L. Monocytogenes Infection
Directory of Open Access Journals (Sweden)
Poyin Chen
2017-12-01
Full Text Available Prebiotic oligosaccharides are used to modulate enteric pathogens and reduce pathogen shedding. The interactions with prebiotics that alter Listeria monocytogenes infection are not yet clearly delineated. L. monocytogenes cellular invasion requires a concerted manipulation of host epithelial cell membrane receptors to initiate internalization and infection often via receptor glycosylation. Bacterial interactions with host glycans are intimately involved in modulating cellular responses through signaling cascades at the membrane and in intracellular compartments. Characterizing the mechanisms underpinning these modulations is essential for predictive use of dietary prebiotics to diminish pathogen association. We demonstrated that human milk oligosaccharide (HMO pretreatment of colonic epithelial cells (Caco-2 led to a 50% decrease in Listeria association, while Biomos pretreatment increased host association by 150%. L. monocytogenes-induced gene expression changes due to oligosaccharide pretreatment revealed global alterations in host signaling pathways that resulted in differential subcellular localization of L. monocytogenes during early infection. Ultimately, HMO pretreatment led to bacterial clearance in Caco-2 cells via induction of the unfolded protein response and eIF2 signaling, while Biomos pretreatment resulted in the induction of host autophagy and L. monocytogenes vacuolar escape earlier in the infection progression. This study demonstrates the capacity of prebiotic oligosaccharides to minimize infection through induction of host-intrinsic protective responses.
Tiwari, Uma; Cummins, Enda; Valero, Antonio; Walsh, Des; Dalmasso, Marion; Jordan, Kieran; Duffy, Geraldine
2015-06-01
The objective of this study was to model and quantify the level of Listeria monocytogenes in raw milk cheese (RMc) and pasteurized milk cheese (PMc) from farm to fork using a Bayesian inference approach combined with a quantitative risk assessment. The modeling approach included a prediction of contamination arising from the farm environment as well from cross-contamination within the cheese-processing facility through storage and subsequent human exposure. The model predicted a high concentration of L. monocytogenes in contaminated RMc (mean 2.19 log10 CFU/g) compared to PMc (mean -1.73 log10 CFU/g). The mean probability of illness (P1 for low-risk population, LR) and (P2 for high-risk population, HR, e.g., immunocompromised) adult Irish consumers following exposure to contaminated cheese was 7 × 10(-8) (P1 ) and 9 × 10(-4) (P2 ) for RMc and 7 × 10(-10) (P1 ) and 8 × 10(-6) (P2 ) for PMc, respectively. In addition, the model was used to evaluate performance objectives at various stages, namely, the cheese making and ripening stages, and to set a food safety objective at the time of consumption. A scenario analysis predicted various probabilities of L. monocytogenes contamination along the cheese-processing chain for both RMc and PMc. The sensitivity analysis showed the critical factors for both cheeses were the serving size of the cheese, storage time, and temperature at the distribution stage. The developed model will allow food processors and policymakers to identify the possible routes of contamination along the cheese-processing chain and to reduce the risk posed to human health. © 2015 Society for Risk Analysis.
Listeria monocytogenes: diagnostic problems
Beumer, R.R.; Hazeleger, W.C.
2003-01-01
The first isolation methods for the detection of Listeria spp. were generally based on the direct culture of samples on simple agar media, but isolation of the pathogenic Listeria monocytogenes was difficult. In time, new techniques were developed, based on a variety of selective and elective agents
Directory of Open Access Journals (Sweden)
Alexandre Lamas
2016-10-01
Full Text Available In recent years, the use of nitrites and sulfites as food preservatives has been a cause for concern due to the health problems that these additives can cause in humans. Natural products have been studied as an alternative, but most of them have hardly been applied in the food industry for technological and economic reasons. In this sense, organic salts such as sodium acetate are a good alternative due to their affordability. Thus, this study evaluated the capacity of sodium nitrite, sodium sulfite, a sodium acetate product (TQI C-6000, and chitosan to inhibit two important foodborne pathogens, Salmonella enterica and Listeria monocytogenes. The MIC of each chemical was in vitro evaluated and their antibacterial action was subsequently checked in situ using minced meat as a food model. MIC values of sodium nitrite (10,000 mg/L and sodium sulfite (50,000 mg/L for Salmonella enterica were higher than the values allowed by legislation (450 mg/L for sulfites and 150 mg/L for nitrites. Additionally, the sodium acetate product caused the inhibition of Salmonella enterica and Listeria at a relative low quantity. The two foodborne pathogens were inhibited in the food model with 1% of the sodium acetate product. Additionally, there were no significant differences between sodium nitrite, sodium sulfite, and sodium acetate products in the inhibition of Salmonella enterica and Listeria monocytogenes in the food model. Thus, products based on sodium acetate can be an alternative to traditional preservatives in food products.
Directory of Open Access Journals (Sweden)
Jung Hwa Lee
Full Text Available Gram-negative bacteria produce extracellular outer membrane vesicles (OMVs that interact with host cells. Unlike Gram-negative bacteria, less is known about the production and role of extracellular membrane vesicles (MVs in Gram-positive bacteria. The food-borne pathogen Listeria monocytogenes can survive under extreme environmental and energy stress conditions and the transcription factor σ(B is involved in this survival ability. Here, we first determined the production of MVs from L. monocytogenes and evaluated whether general stress transcription factor σ(B affected production of MVs in L. monocytogenes. L. monocytogenes secreted MVs during in vitro broth culture. The wild-type strain actively produced MVs approximately nine times more and also produced more intact shapes of MVs than those of the isogenic ΔsigB mutant. A proteomic analysis showed that 130 and 89 MV proteins were identified in the wild-type and ΔsigB mutant strains, respectively. Wild-type strain-derived MVs contained proteins regulated by σ(B such as transporters (OpuCA and OpuCC, stress response (Kat, metabolism (LacD, translation (InfC, and cell division protein (FtsZ. Gene Ontology (GO enrichment analysis showed that wild-type-derived MV proteins corresponded to several GO terms, including response to stress (heat, acid, and bile resistance and extracellular polysaccharide biosynthetic process, but not the ΔsigB mutant. Internalin B (InlB was almost three times more contained in MVs derived from the wild-type strain than in MVs derived from the ΔsigB mutant. Taken together, these results suggest that σ(B plays a pivotal role in the production of MVs and protein profiles contained in MVs. L. monocytogenes MVs may contribute to host infection and survival ability under various stressful conditions.
Firouzi, R; Shekarforoush, S S; Nazer, A H K; Borumand, Z; Jooyandeh, A R
2007-11-01
The in vitro effects of plant essential oils (EOs) against pathogenic bacteria are well known, yet few studies have addressed the effects of these compounds against pathogens associated with ready-to-cook foods. Experiments were conducted to determine the effectiveness of oregano and nutmeg EOs on the growth and survival of Yersinia enterocolitica and Listeria monocytogenes in broth culture and in Iranian barbecued chicken. Ready-to-cook Iranian barbecued chicken was prepared according to the common practice with 1, 2, and 3 microl/g of oregano and nutmeg EOs. The test and control (without EOs) samples were inoculated with Y. enterocolitica and L. monocytogenes to a final concentration of 6 to 7 log CFU/g and stored at 3, 8, and 20 degrees C. Microorganisms were counted just before and at 24, 48, and 72 h after storage based on growth on Yersinia selective agar supplemented with cefsulodine, igrasan, and novobiocin and on Listeria selective agar supplemented with nalidixic acid and acriflavin. In the broth culture system, the nutmeg EO had a greater effect on L. monocytogenes (MIC = 0.20 nicrol/ml) than did the oregano EO (MIC = 0.26 microl/ml). However, the oregano EO had a greater effect on Y. enterocolitica (MIC = 0.16 microl/ml) than did the nutmeg EO (MIC = 0.25 microl/ml). In ready-to-cook Iranian barbecued chicken, the log CFU per gram of both bacteria after up to 72 h of incubation was not decreased significantly by various combinations of oregano and nutmeg EOs (1, 2, and 3 microl/g) and storage temperatures (3, 8, and 20 degrees C) when compared with control samples (without EOs). Although examination of spices in culture media can yield accurate microbiological data, without complementary tests in foods these data are of limited value for assessing food safety.
Chung, Hyun-Jung; Yousef, Ahmed E
2010-09-30
The purpose of this study was to evaluate combinations of high pressure processing (HPP) and Lactobacillus casei antimicrobial activity against Listeria monocytogenes strains with variation in pressure resistance in culture and in a food model. In culture, combination of HPP (350 MPa, for 1-20 min) and Lb. casei cell extract (CE, 32 CEAU/ml) showed a significant synergistic bactericidal effect (P5 log(10)CFU/ml. Synergy between CE and HPP was most evident in the pressure-resistant strain, OSY-8578. Similar result was observed in meat products where high pressure (500 MPa for 1 min), and high-activity CE (100 CEAU/g) caused >5 log reduction in the viability of L. monocytogenes Scott A. The combination treatment resulted in the absence of peaks associated with cellular components in DSC thermogram suggesting that the presence of CE may have caused a considerable damage to cellular components during the high pressure treatment. Copyright 2010 Elsevier B.V. All rights reserved.
Rocha, Cláudia E; Mol, Juliana P S; Garcia, Luize N N; Costa, Luciana F; Santos, Renato L; Paixão, Tatiane A
2017-01-01
Listeria monocytogenes is a Gram-positive, facultative intracellular and invasive bacterium that has tropism to the placenta, and causes fetal morbidity and mortality in several mammalian species. While infection with L. monocytogenes and L. ivanovii are known as important causes of abortion and reproductive failure in cattle, the pathogenesis of maternal-fetal listeriosis in this species is poorly known. This study used the bovine chorioallantoic membrane explant model to investigate the kinetics of L. monocytogenes, L. ivanovii, and L. innocua infections in bovine trophoblastic cells for up to 8 h post infection. L. monocytogenes and L. ivanovii were able to invade and multiply in trophoblastic cells without causing cell death or inducing expression of pro-inflammatory genes. Although L. innocua was unable to multiply in bovine trophoblastic cells, it induced transcription of the pro-inflammatory mediator CXCL6. This study demonstrated for the first time the susceptibility of bovine trophoblastic cells to L. monocytogenes and L. ivanovii infection.
de Oliveira, Thales Leandro Coutinho; das Graças Cardoso, Maria; de Araújo Soares, Rodrigo; Ramos, Eduardo Mendes; Piccoli, Roberta Hilsdorf; Tebaldi, Victor Maximiliano Reis
2013-01-01
This research evaluated the antimicrobial effect of the clove (Syzygium aromaticum) and lemongrass (Cymbopogon citratus (DC.) Stapf.) essential oils (EOs) against Listeria monocytogenes ATCC 19117 growth added to bovine ground meat stored under refrigeration (5 ± 2 °C) for three days. The EOs, extracted by hydrodistillation and analyzed by gas chromatography-mass spectrometry (GC-MS), were tested in vitro using an agar well diffusion methodology for determination of Minimum Inhibitory Concentration (MIC). The MIC concentrations for both essential oils on culture tested of L. monocytogenes were 1.56%. The EOs concentrations applied in contaminated ground beef were 1.56, 3.125 and 6.25% (w/v) based on MIC levels and possible activity reductions by food constituents. The bacteria populations were significantly reduced (p ≤ 0.05) after one day of storage in ground meat samples treated with clove and lemongrass EOs at concentrations of 1.56%. There were no significant counts of L. monocytogenes in samples at the other concentrations of the two oils applied after the second day of storage. The sensory acceptability evaluation of the bovine ground meat samples treated with EOs showed that the addition at concentrations higher than 1.56% promote undesirable alterations of taste, odor and characteristic color. The application of EOs at low concentrations in food products can be used in combination with other preservation methods, such as refrigeration, to control pathogens and spoilage bacteria during shelf-life; which goes according to current market trends, where consumers are requesting natural products.