WorldWideScience

Sample records for monocytogenes expressing specific

  1. Recombinant probiotic expressing Listeria adhesion protein attenuates Listeria monocytogenes virulence in vitro.

    Directory of Open Access Journals (Sweden)

    Ok Kyung Koo

    Full Text Available BACKGROUND: Listeria monocytogenes, an intracellular foodborne pathogen, infects immunocompromised hosts. The primary route of transmission is through contaminated food. In the gastrointestinal tract, it traverses the epithelial barrier through intracellular or paracellular routes. Strategies to prevent L. monocytogenes entry can potentially minimize infection in high-risk populations. Listeria adhesion protein (LAP aids L. monocytogenes in crossing epithelial barriers via the paracellular route. The use of recombinant probiotic bacteria expressing LAP would aid targeted clearance of Listeria from the gut and protect high-risk populations from infection. METHODOLOGY/PRINCIPAL FINDINGS: The objective was to investigate the ability of probiotic bacteria or LAP-expressing recombinant probiotic Lactobacillus paracasei (Lbp(LAP to prevent L. monocytogenes adhesion, invasion, and transwell-based transepithelial translocation in a Caco-2 cell culture model. Several wild type probiotic bacteria showed strong adhesion to Caco-2 cells but none effectively prevented L. monocytogenes infection. Pre-exposure to Lbp(LAP for 1, 4, 15, or 24 h significantly (P<0.05 reduced adhesion, invasion, and transepithelial translocation of L. monocytogenes in Caco-2 cells, whereas pre-exposure to parental Lb. paracasei had no significant effect. Similarly, Lbp(LAP pre-exposure reduced L. monocytogenes translocation by as much as 46% after 24 h. Lbp(LAP also prevented L. monocytogenes-mediated cell damage and compromise of tight junction integrity. Furthermore, Lbp(LAP cells reduced L. monocytogenes-mediated cell cytotoxicity by 99.8% after 1 h and 79% after 24 h. CONCLUSIONS/SIGNIFICANCE: Wild type probiotic bacteria were unable to prevent L. monocytogenes infection in vitro. In contrast, Lbp(LAP blocked adhesion, invasion, and translocation of L. monocytogenes by interacting with host cell receptor Hsp60, thereby protecting cells from infection. These data show promise

  2. Cloning and Expression of Listeria monocytogenes Listeriolysin O in Lactobacillus plantarum

    Directory of Open Access Journals (Sweden)

    Masoumeh Hayati

    2017-11-01

    Full Text Available Background: The protein listeriolysin O (LLO encoded by hly gene, is one of the most important virulence factors of Listeria monocytogenes. This highly potent immunogenic cholesterol binding toxin has hemolytic activity, responsible for phagosomal membrane disruption and bacterial escape to the cytoplasm and facilitating the stimulation of CD8+ T cells and Th1 response. Recently pathobiotechnological vaccination using probiotic bacteria have been proposed. One of these strategies is expression of LLO in non-pathogenic bacteria such as lactic acid bacteria as delivery strains. Objectives: Our aim in this study was cloning of hly gene in a Lactobacillus species via pNZ8110, an inducible expression vector which is specific for Lactococcus species. Materials and Methods: hly gene was amplified by PCR and cloned into pNZ8110 by restriction enzymes cutting and ligation method. After transformation and propagation in E. coli MC1061 intermediate host, it was successfully electrotransformed into Lactobacillus plantarum. Results: Gel electrophoresis of colony PCR, extracted plasmids and restriction analysis along with sequencing confirmed the transformation. After induction using supernatant of nisin producer Lactococcus lactis NZ9700 strain, Expression of LLO was confirmed by SDS PAGE and western blot. Conclusion: Here, we have employed a nonpathogenic probiotic strain; Lactobacillus plantarum for the first time to express hly gene of Listeria monocytogenes in order to propose a new vaccine candidate.

  3. Lineage specific recombination rates and microevolution in Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Nightingale Kendra K

    2008-10-01

    Full Text Available Abstract Background The bacterium Listeria monocytogenes is a saprotroph as well as an opportunistic human foodborne pathogen, which has previously been shown to consist of at least two widespread lineages (termed lineages I and II and an uncommon lineage (lineage III. While some L. monocytogenes strains show evidence for considerable diversification by homologous recombination, our understanding of the contribution of recombination to L. monocytogenes evolution is still limited. We therefore used STRUCTURE and ClonalFrame, two programs that model the effect of recombination, to make inferences about the population structure and different aspects of the recombination process in L. monocytogenes. Analyses were performed using sequences for seven loci (including the house-keeping genes gap, prs, purM and ribC, the stress response gene sigB, and the virulence genes actA and inlA for 195 L. monocytogenes isolates. Results Sequence analyses with ClonalFrame and the Sawyer's test showed that recombination is more prevalent in lineage II than lineage I and is most frequent in two house-keeping genes (ribC and purM and the two virulence genes (actA and inlA. The relative occurrence of recombination versus point mutation is about six times higher in lineage II than in lineage I, which causes a higher genetic variability in lineage II. Unlike lineage I, lineage II represents a genetically heterogeneous population with a relatively high proportion (30% average of genetic material imported from external sources. Phylograms, constructed with correcting for recombination, as well as Tajima's D data suggest that both lineages I and II have suffered a population bottleneck. Conclusion Our study shows that evolutionary lineages within a single bacterial species can differ considerably in the relative contributions of recombination to genetic diversification. Accounting for recombination in phylogenetic studies is critical, and new evolutionary models that

  4. Changes in gene expression during adaptation of Listeria monocytogenes to the soil environment.

    Science.gov (United States)

    Piveteau, Pascal; Depret, Géraldine; Pivato, Barbara; Garmyn, Dominique; Hartmann, Alain

    2011-01-01

    Listeria monocytogenes is a ubiquitous opportunistic pathogen responsible for listeriosis. In order to study the processes underlying its ability to adapt to the soil environment, whole-genome arrays were used to analyse transcriptome modifications 15 minutes, 30 minutes and 18 h after inoculation of L. monocytogenes EGD-e in soil extracts. Growth was observed within the first day of incubation and large numbers were still detected in soil extract and soil microcosms one year after the start of the experiment. Major transcriptional reprofiling was observed. Nutrient acquisition mechanisms (phosphoenolpyruvate-dependent phosphotransferase systems and ABC transporters) and enzymes involved in catabolism of specific carbohydrates (β-glucosidases; chitinases) were prevalent. This is consistent with the overrepresentation of the CodY regulon that suggests that in a nutrient depleted environment, L. monocytogenes recruits its extensive repertoire of transporters to acquire a range of substrates for energy production.

  5. RNAi screen reveals host cell kinases specifically involved in Listeria monocytogenes spread from cell to cell.

    Directory of Open Access Journals (Sweden)

    Ryan Chong

    Full Text Available Intracellular bacterial pathogens, such as Listeria monocytogenes and Rickettsia conorii display actin-based motility in the cytosol of infected cells and spread from cell to cell through the formation of membrane protrusions at the cell cortex. Whereas the mechanisms supporting cytosolic actin-based motility are fairly well understood, it is unclear whether specific host factors may be required for supporting the formation and resolution of membrane protrusions. To address this gap in knowledge, we have developed high-throughput fluorescence microscopy and computer-assisted image analysis procedures to quantify pathogen spread in human epithelial cells. We used the approach to screen a siRNA library covering the human kinome and identified 7 candidate kinases whose depletion led to severe spreading defects in cells infected with L. monocytogenes. We conducted systematic validation procedures with redundant silencing reagents and confirmed the involvement of the serine/threonine kinases, CSNK1A1 and CSNK2B. We conducted secondary assays showing that, in contrast with the situation observed in CSNK2B-depleted cells, L. monocytogenes formed wild-type cytosolic tails and displayed wild-type actin-based motility in the cytosol of CSNK1A1-depleted cells. Furthermore, we developed a protrusion formation assay and showed that the spreading defect observed in CSNK1A1-depleted cells correlated with the formation of protrusion that did not resolve into double-membrane vacuoles. Moreover, we developed sending and receiving cell-specific RNAi procedures and showed that CSNK1A was required in the sending cells, but was dispensable in the receiving cells, for protrusion resolution. Finally, we showed that the observed defects were specific to Listeria monocytogenes, as Rickettsia conorii displayed wild-type cell-to-cell spread in CSNK1A1- and CSNK2B-depleted cells. We conclude that, in addition to the specific host factors supporting cytosolic actin

  6. Influence of sublethal concentrations of common disinfectants on expression of virulence genes in Listeria monocytogenes

    DEFF Research Database (Denmark)

    Kastbjerg, Vicky Gaedt; Larsen, M. H.; Gram, Lone

    2010-01-01

    Listeria monocytogenes is a food-borne human pathogen that causes listeriosis, a relatively rare infection with a high fatality rate. The regulation of virulence gene expression is influenced by several environmental factors, and the aim of the present study was to determine how disinfectants use......, such as antibiotic resistance....... by Northern blot analysis. Eleven disinfectants representing four different groups of active components were evaluated in this study. Disinfectants with the same active ingredients had a similar effect on gene expression. Peroxy and chlorine compounds reduced the expression of the virulence genes...

  7. Listeriolysin O Regulates the Expression of Optineurin, an Autophagy Adaptor That Inhibits the Growth of Listeria monocytogenes.

    Science.gov (United States)

    Puri, Madhu; La Pietra, Luigi; Mraheil, Mobarak Abu; Lucas, Rudolf; Chakraborty, Trinad; Pillich, Helena

    2017-09-05

    Autophagy, a well-established defense mechanism, enables the elimination of intracellular pathogens including Listeria monocytogenes . Host cell recognition results in ubiquitination of L . monocytogenes and interaction with autophagy adaptors p62/SQSTM1 and NDP52, which target bacteria to autophagosomes by binding to microtubule-associated protein 1 light chain 3 (LC3). Although studies have indicated that L . monocytogenes induces autophagy, the significance of this process in the infectious cycle and the mechanisms involved remain poorly understood. Here, we examined the role of the autophagy adaptor optineurin (OPTN), the phosphorylation of which by the TANK binding kinase 1 (TBK1) enhances its affinity for LC3 and promotes autophagosomal degradation, during L . monocytogenes infection. In LC3- and OPTN-depleted host cells, intracellular replicating L . monocytogenes increased, an effect not seen with a mutant lacking the pore-forming toxin listeriolysin O (LLO). LLO induced the production of OPTN. In host cells expressing an inactive TBK1, bacterial replication was also inhibited. Our studies have uncovered an OPTN-dependent pathway in which L . monocytogenes uses LLO to restrict bacterial growth. Hence, manipulation of autophagy by L . monocytogenes , either through induction or evasion, represents a key event in its intracellular life style and could lead to either cytosolic growth or persistence in intracellular vacuolar structures.

  8. A small RNA controls expression of the chitinase ChiA in Listeria monocytogenes

    DEFF Research Database (Denmark)

    Nielsen, Jesper S; Larsen, Marianne Halberg; Lillebæk, Eva Maria Sternkopf

    2011-01-01

    role of LhrA in L. monocytogenes. To this end, we determined the effects of LhrA on global-wide gene expression. We observed that nearly 300 genes in L. monocytogenes are either positively or negatively affected by LhrA. Among these genes, we identified lmo0302 and chiA as direct targets of LhrA, thus...... establishing LhrA as a multiple target regulator. Lmo0302 encodes a hypothetical protein with no known function, whereas chiA encodes one of two chitinases present in L. monocytogenes. We show here that LhrA acts as a post-transcriptional regulator of lmo0302 and chiA by interfering with ribosome recruitment......, and we provide evidence that both LhrA and Hfq act to down-regulate the expression of lmo0302 and chiA. Furthermore, in vitro binding experiments show that Hfq stimulates the base pairing of LhrA to chiA mRNA. Finally, we demonstrate that LhrA has a negative effect on the chitinolytic activity of L...

  9. RNA- and protein-mediated control of Listeria monocytogenes virulence gene expression

    Science.gov (United States)

    Lebreton, Alice; Cossart, Pascale

    2017-01-01

    ABSTRACT The model opportunistic pathogen Listeria monocytogenes has been the object of extensive research, aiming at understanding its ability to colonize diverse environmental niches and animal hosts. Bacterial transcriptomes in various conditions reflect this efficient adaptability. We review here our current knowledge of the mechanisms allowing L. monocytogenes to respond to environmental changes and trigger pathogenicity, with a special focus on RNA-mediated control of gene expression. We highlight how these studies have brought novel concepts in prokaryotic gene regulation, such as the ‘excludon’ where the 5′-UTR of a messenger also acts as an antisense regulator of an operon transcribed in opposite orientation, or the notion that riboswitches can regulate non-coding RNAs to integrate complex metabolic stimuli into regulatory networks. Overall, the Listeria model exemplifies that fine RNA tuners act together with master regulatory proteins to orchestrate appropriate transcriptional programmes. PMID:27217337

  10. Gene expression in Listeria monocytogenes exposed to sublethal concentration of benzalkonium chloride.

    Science.gov (United States)

    Tamburro, Manuela; Ripabelli, Giancarlo; Vitullo, Monia; Dallman, Timothy James; Pontello, Mirella; Amar, Corinne Francoise Laurence; Sammarco, Michela Lucia

    2015-06-01

    In this study, tolerance at sublethal concentration of benzalkonium chloride and transcription levels of mdrL, ladR, lde, sigB and bcrABC genes in Listeria monocytogenes strains were evaluated. Viable cells reduction occurred in 45% of strains and clinical isolates showed lower sensitivity than isolates from foods. An increased transcription of an efflux system encoding gene was found in 60% of strains, and simultaneous mdrL overexpression and ladR underexpression occurred in 30% of isolates. A significant association between reduced benzalkonium chloride activity and both mdrL and sigB overexpression was observed; sigB expression also correlated with both mdrL and ladR genes. The bcrABC gene was only found in six strains, all isolated from foods and sensitive to benzalkonium chloride, and in four strains an underexpression was observed. Disinfection at sublethal concentration was less effective in clinical isolates, and mdrL and sigB expression was significantly affected by disinfection. Further insights are needed to understand the adaptation to benzalkonium chloride and to evaluate whether changes in gene expression could affect the L. monocytogenes virulence traits and persistence in the environment. Copyright © 2015 Elsevier Ltd. All rights reserved.

  11. Highly specific fiber optic immunosensor coupled with immunomagnetic separation for detection of low levels of Listeria monocytogenes and L. ivanovii

    Science.gov (United States)

    2012-01-01

    Background Immunomagnetic separation (IMS) and immunoassays are widely used for pathogen detection. However, novel technology platforms with highly selective antibodies are essential to improve detection sensitivity, specificity and performance. In this study, monoclonal antibodies (MAbs) against Internalin A (InlA) and p30 were generated and used on paramagnetic beads of varying diameters for concentration, as well as on fiber-optic sensor for detection. Results Anti-InlA MAb-2D12 (IgG2a subclass) was specific for Listeria monocytogenes and L. ivanovii, and p30-specific MAb-3F8 (IgM) was specific for the genus Listeria. At all bacterial concentrations (103–108 CFU/mL) tested in the IMS assay; the 1-μm diameter MyOne beads had significantly higher capture efficiency (P Listeria antibody (9 %). Furthermore, capture efficiency for MyOne-2D12 was highly specific for L. monocytogenes and L. ivanovii. Subsequently, we captured L. monocytogenes by MyOne-2D12 and MyOne-3F8 from hotdogs inoculated with mono- or co-cultures of L. monocytogenes and L. innocua (10–40 CFU/g), enriched for 18 h and detected by fiber-optic sensor and confirmed by plating, light-scattering, and qPCR assays. The detection limit for L. monocytogenes and L. ivanovii by the fiber-optic immunosensor was 3 × 102 CFU/mL using MAb-2D12 as capture and reporter antibody. Selective media plating, light-scattering, and qPCR assays confirmed the IMS and fiber-optic results. Conclusions IMS coupled with a fiber-optic sensor using anti-InlA MAb is highly specific for L. monocytogenes and L. ivanovii and enabled detection of these pathogens at low levels from buffer or food. PMID:23176167

  12. Chitinase expression in Listeria monocytogenes is positively regulated by the Agr system

    DEFF Research Database (Denmark)

    Paspaliari, Dafni Katerina; Mollerup, Maria Storm; Kallipolitis, Birgitte H.

    2014-01-01

    The food-borne pathogen Listeria monocytogenes encodes two chitinases, ChiA and ChiB, which allow the bacterium to hydrolyze chitin, the second most abundant polysaccharide in nature. Intriguingly, despite the absence of chitin in human and mammalian hosts, both of the chitinases have been deemed...... important for infection, through a mechanism that, at least in the case of ChiA, involves modulation of host immune responses. In this study, we show that the expression of the two chitinases is subject to regulation by the listerial agr system, a homologue of the agr quorum-sensing system of Staphylococcus...... chitinolytic activity on agar plates. Agr was specifically induced in response to chitin addition in stationary phase and agrD was found to regulate the amount of chiA, but not chiB, transcripts. Although the transcript levels of chiB did not depend on agrD, the extracellular protein levels of both chitinases...

  13. Chitinase Expression in Listeria monocytogenes Is Influenced by lmo0327, Which Encodes an InternalinLike Protein

    DEFF Research Database (Denmark)

    Paspaliari, Dafni Katerina; Kastbjerg, Vicky Gaedt; Ingmer, Hanne

    2017-01-01

    The chitinolytic system of Listeria monocytogenes thus far comprises two chitinases, ChiA and ChiB, and a lytic polysaccharide monooxygenase, Lmo2467. The role of the system in the bacterium appears to be pleiotropic, as besides mediating hydrolysis of chitin, the second most ubiquitous...... chitinase activities enabling them to utilize chitin as the sole source of carbon and nitrogen. Interestingly, several bacterial chitinases may also be involved in host pathogenesis. For example, in the important food borne pathogen Listeria monocytogenes, the chitinases ChiA and ChiB, and the lytic...... ChiA and ChiB in the culture supernatants of the mutant strain. Our results provide new information regarding the function of the lmo0325-lmo0327 locus in L. monocytogenes and link it to the expression of chitinolytic activity.Importance: Many bacteria from terrestrial and marine environments express...

  14. Effect of co-culture with enterocinogenic E. faecium on L. monocytogenes key virulence gene expression

    Directory of Open Access Journals (Sweden)

    Eleftherios H. Drosinos

    2016-08-01

    Full Text Available The aim of the present study was to assess the expression of key virulence genes during co-culture of L. monocytogenes with a bacteriocinogenic E. faecium strain in liquid growth medium. For that purpose, BHI broth was inoculated with 7 log CFU·mL–1 L. monocytogenes and 4, 5 or 6 log CFU·mL–1 E. faecium. Sampling took place after 8 and 24 h of incubation, corresponding to the maximum and minimum of enterocin production, respectively. The RNA was extracted, stabilized and expression of prfA, sigB, hly, plcA, plcB, inlA, inlB, inlC and inlJ, was assessed by RT-qPCR. Most of the genes were downregulated during co-culture at 5 °C. Moreover, a statistically significant effect of the inoculum level was evident in most of the cases. On the contrary, no effect on the transcription level of most of the genes was observed during co-culture at 37 °C.

  15. The MogR Transcriptional Repressor Regulates Nonhierarchal Expression of Flagellar Motility Genes and Virulence in Listeria monocytogenes.

    Directory of Open Access Journals (Sweden)

    2006-04-01

    Full Text Available Flagella are surface structures critical for motility and virulence of many bacterial species. In Listeria monocytogenes, MogR tightly represses expression of flagellin (FlaA during extracellular growth at 37 degrees C and during intracellular infection. MogR is also required for full virulence in a murine model of infection. Using in vitro and in vivo infection models, we determined that the severe virulence defect of MogR-negative bacteria is due to overexpression of FlaA. Specifically, overproduction of FlaA in MogR-negative bacteria caused pleiotropic defects in bacterial division (chaining phenotype, intracellular spread, and virulence in mice. DNA binding and microarray analyses revealed that MogR represses transcription of all known flagellar motility genes by binding directly to a minimum of two TTTT-N(5-AAAA recognition sites positioned within promoter regions such that RNA polymerase binding is occluded. Analysis of MogR protein levels demonstrated that modulation of MogR repression activity confers the temperature-specificity to flagellar motility gene expression. Epistasis analysis revealed that MogR repression of transcription is antagonized in a temperature-dependent manner by the DegU response regulator and that DegU further regulates FlaA levels through a posttranscriptional mechanism. These studies provide the first known example to our knowledge of a transcriptional repressor functioning as a master regulator controlling nonhierarchal expression of flagellar motility genes.

  16. Inhibitory effect of live-attenuated Listeria monocytogenes-based vaccines expressing MIA gene on malignant melanoma.

    Science.gov (United States)

    Qian, Yue; Zhang, Na; Jiang, Ping; Chen, Siyuan; Chu, Shujuan; Hamze, Firas; Wu, Yan; Luo, Qin; Feng, Aiping

    2012-08-01

    Listeria monocytogenes (LM), a Gram-positive facultative intracellular bacterium, can be used as an effective exogenous antigen expression vector in tumor-target therapy. But for successful clinical application, it is necessary to construct attenuated LM stain that is safe yet retains the potency of LM based on the full virulent pathogen. In this study, attenuated LM and recombinants of LM expressing melanoma inhibitory activity (MIA) were constructed successfully. The median lethal dose (LD(50)) and invasion efficiency of attenuated LM strains were detected. The recombinants were utilized for immunotherapy of animal model of B16F10 melanoma. The level of MIA mRNA expression in tumor tissue was detected by using real-time polymerase chain reaction (PCR) with specific sequence, meanwhile the anti-tumor immune response was assayed by flow cytometric analysis and enzyme-linked immunosorbent spot (ELISPOT) assay. The results showed the toxicity and invasiveness of attenuated LM were decreased as compared with LM, and attenuated LM expressing MIA, especially the double-genes attenuated LM recombinant, could significantly induce anti-tumor immune response and inhibit tumor growth. This study implicates attenuated LM may be a safer and more effective vector for immunotherapy of melanoma.

  17. Differential gene expression and filamentation of Listeria monocytogenes 08-5923 exposed to sodium lactate and sodium diacetate.

    Science.gov (United States)

    Liu, Xiaoji; Basu, Urmila; Miller, Petr; McMullen, Lynn M

    2017-05-01

    This study reports the gene expression and filamentation in Listeria monocytogenes 08-5923 following exposure to food preservatives sodium lactate (NaL) and sodium diacetate (SD). L. monocytogenes 08-5923 was challenged with a mixture of NaL/SD, NaL or sodium acetate at 37 °C in tryptic soy broth. In the initial study, L. monocytogenes 08-5923 was exposed to NaL/SD for 24 h. The transcriptome was investigated by RNA sequencing. A stress response network was discovered in L. monocytogenes 08-5923, which is mediated by genes encoding two-component systems (hisJ, lisK, OmpR family gene, resE) and RNA polymerase factors (sigC, sigH). NaL/SD resulted in the down-regulation of genes in glycolysis (pykA, eno, fbaA, pgm) and up-regulation of genes in DNA repair (radC), cell division (ftsE) and cell structure synthesis (flagella synthesis: flgK, fliF, fliD). Filamentation was monitored by flow cytometry. NaL/SD mixture resulted in filamentation in L. monocytogenes 08-5923. Longer exposure was required to induce filamentation in L. monocytogenes for SD (24 h) than for NaL (8 h) when cells were exposed to individual salt. The quantitative real time PCR analysis revealed the down-regulation of ftsE in filamented cells of Listeria exposed to NaL or sodium acetate. Copyright © 2016 Elsevier Ltd. All rights reserved.

  18. Metabolic Genetic Screens Reveal Multidimensional Regulation of Virulence Gene Expression in Listeria monocytogenes and an Aminopeptidase That Is Critical for PrfA Protein Activation.

    Science.gov (United States)

    Friedman, Sivan; Linsky, Marika; Lobel, Lior; Rabinovich, Lev; Sigal, Nadejda; Herskovits, Anat A

    2017-06-01

    Listeria monocytogenes is an environmental saprophyte and intracellular bacterial pathogen. Upon invading mammalian cells, the bacterium senses abrupt changes in its metabolic environment, which are rapidly transduced to regulation of virulence gene expression. To explore the relationship between L. monocytogenes metabolism and virulence, we monitored virulence gene expression dynamics across a library of genetic mutants grown under two metabolic conditions known to activate the virulent state: charcoal-treated rich medium containing glucose-1-phosphate and minimal defined medium containing limiting concentrations of branched-chain amino acids (BCAAs). We identified over 100 distinct mutants that exhibit aberrant virulence gene expression profiles, the majority of which mapped to nonessential metabolic genes. Mutants displayed enhanced, decreased, and early and late virulence gene expression profiles, as well as persistent levels, demonstrating a high plasticity in virulence gene regulation. Among the mutants, one was noteworthy for its particularly low virulence gene expression level and mapped to an X-prolyl aminopeptidase (PepP). We show that this peptidase plays a role in posttranslational activation of the major virulence regulator, PrfA. Specifically, PepP mediates recruitment of PrfA to the cytoplasmic membrane, a step identified as critical for PrfA protein activation. This study establishes a novel step in the complex mechanism of PrfA activation and further highlights the cross regulation of metabolism and virulence. Copyright © 2017 American Society for Microbiology.

  19. Chitinase Expression in Listeria monocytogenes Is Influenced by lmo0327, Which Encodes an InternalinLike Protein

    DEFF Research Database (Denmark)

    Paspaliari, Dafni Katerina; Kastbjerg, Vicky Gaedt; Ingmer, Hanne

    2017-01-01

    carbohydrate in nature, the chitinases have been deemed important for colonization of unicellular moulds, as well as mammalian hosts. In order to identify additional components of the chitinolytic system, we screened a transposon mutant library for mutants exhibiting impaired chitin hydrolysis. The screening...... ChiA and ChiB in the culture supernatants of the mutant strain. Our results provide new information regarding the function of the lmo0325-lmo0327 locus in L. monocytogenes and link it to the expression of chitinolytic activity.Importance: Many bacteria from terrestrial and marine environments express...... chitinase activities enabling them to utilize chitin as the sole source of carbon and nitrogen. Interestingly, several bacterial chitinases may also be involved in host pathogenesis. For example, in the important food borne pathogen Listeria monocytogenes, the chitinases ChiA and ChiB, and the lytic...

  20. Receptor binding proteins of Listeria monocytogenes bacteriophages A118 and P35 recognize serovar-specific teichoic acids

    Energy Technology Data Exchange (ETDEWEB)

    Bielmann, Regula; Habann, Matthias; Eugster, Marcel R. [Institute of Food, Nutrition and Health, ETH Zurich, Schmelzbergstrasse 7, 8092 Zurich (Switzerland); Lurz, Rudi [Max-Planck Institute for Molecular Genetics, 14195 Berlin (Germany); Calendar, Richard [Department of Molecular and Cell Biology, University of California, Berkeley, CA 94720-3202 (United States); Klumpp, Jochen, E-mail: jochen.klumpp@hest.ethz.ch [Institute of Food, Nutrition and Health, ETH Zurich, Schmelzbergstrasse 7, 8092 Zurich (Switzerland); Loessner, Martin J. [Institute of Food, Nutrition and Health, ETH Zurich, Schmelzbergstrasse 7, 8092 Zurich (Switzerland)

    2015-03-15

    Adsorption of a bacteriophage to the host requires recognition of a cell wall-associated receptor by a receptor binding protein (RBP). This recognition is specific, and high affinity binding is essential for efficient virus attachment. The molecular details of phage adsorption to the Gram-positive cell are poorly understood. We present the first description of receptor binding proteins and a tail tip structure for the siphovirus group infecting Listeria monocytogenes. The host-range determining factors in two phages, A118 and P35 specific for L. monocytogenes serovar 1/2 have been determined. Two proteins were identified as RBPs in phage A118. Rhamnose residues in wall teichoic acids represent the binding ligands for both proteins. In phage P35, protein gp16 could be identified as RBP and the role of both rhamnose and N-acetylglucosamine in phage adsorption was confirmed. Immunogold-labeling and transmission electron microscopy allowed the creation of a topological model of the A118 phage tail. - Highlights: • We present the first description of receptor binding proteins and a tail tip structure for the Siphovirus group infecting Listeria monocytogenes. • The host-range determining factors in two phages, A118 and P35 specific for L. monocytogenes serovar 1/2 have been determined. • Rhamnose residues in wall teichoic acids represent the binding ligands for both receptor binding proteins in phage A118. • Rhamnose and N-acetylglucosamine are required for adsorption of phage P35. • We preset a topological model of the A118 phage tail.

  1. Development of multiple strain competitive index assays for Listeria monocytogenes using pIMC; a new site-specific integrative vector

    Directory of Open Access Journals (Sweden)

    Cronin Michael

    2008-06-01

    Full Text Available Abstract Background The foodborne, gram-positive pathogen, Listeria monocytogenes, is capable of causing lethal infections in compromised individuals. In the post genomic era of L. monocytogenes research, techniques are required to identify and validate genes involved in the pathogenicity and environmental biology of the organism. The aim here was to develop a widely applicable method to tag L. monocytogenes strains, with a particular emphasis on the development of multiple strain competitive index assays. Results We have constructed a new site-specific integrative vector, pIMC, based on pPL2, for the selection of L. monocytogenes from complex samples. The pIMC vector was further modified through the incorporation of IPTG inducible markers (antibiotic and phenotypic to produce a suite of four vectors which allowed the discrimination of multiple strains from a single sample. We were able to perform murine infection studies with up to four EGDe isolates within a single mouse and showed that the tags did not impact upon growth rate or virulence. The system also allowed the identification of subtle differences in virulence between strains of L. monocytogenes commonly used in laboratory studies. Conclusion This study has developed a competitive index assay that can be broadly applied to all L. monocytogenes strains. Improved statistical robustness of the data was observed, resulting in fewer mice being required for virulence assays. The competitive index assays provide a powerful method to analyse the virulence or fitness of L. monocytogenes in complex biological samples.

  2. The Listeria monocytogenes Bile Stimulon under Acidic Conditions Is Characterized by Strain-Specific Patterns and the Upregulation of Motility, Cell Wall Modification Functions, and the PrfA Regulon

    Science.gov (United States)

    Guariglia-Oropeza, Veronica; Orsi, Renato H.; Guldimann, Claudia; Wiedmann, Martin; Boor, Kathryn J.

    2018-01-01

    Listeria monocytogenes uses a variety of transcriptional regulation strategies to adapt to the extra-host environment, the gastrointestinal tract, and the intracellular host environment. While the alternative sigma factor SigB has been proposed to be a key transcriptional regulator that facilitates L. monocytogenes adaptation to the gastrointestinal environment, the L. monocytogenes' transcriptional response to bile exposure is not well-understood. RNA-seq characterization of the bile stimulon was performed in two L. monocytogenes strains representing lineages I and II. Exposure to bile at pH 5.5 elicited a large transcriptomic response with ~16 and 23% of genes showing differential transcription in 10403S and H7858, respectively. The bile stimulon includes genes involved in motility and cell wall modification mechanisms, as well as genes in the PrfA regulon, which likely facilitate survival during the gastrointestinal stages of infection that follow bile exposure. The fact that bile exposure induced the PrfA regulon, but did not induce further upregulation of the SigB regulon (beyond that expected by exposure to pH 5.5), suggests a model where at the earlier stages of gastrointestinal infection (e.g., acid exposure in the stomach), SigB-dependent gene expression plays an important role. Subsequent exposure to bile induces the PrfA regulon, potentially priming L. monocytogenes for subsequent intracellular infection stages. Some members of the bile stimulon showed lineage- or strain-specific distribution when 27 Listeria genomes were analyzed. Even though sigB null mutants showed increased sensitivity to bile, the SigB regulon was not found to be upregulated in response to bile beyond levels expected by exposure to pH 5.5. Comparison of wildtype and corresponding ΔsigB strains newly identified 26 SigB-dependent genes, all with upstream putative SigB-dependent promoters. PMID:29467736

  3. Chitinase Expression in Listeria monocytogenes Is Influenced by lmo0327, Which Encodes an Internalin-Like Protein.

    Science.gov (United States)

    Paspaliari, Dafni Katerina; Kastbjerg, Vicky Gaedt; Ingmer, Hanne; Popowska, Magdalena; Larsen, Marianne Halberg

    2017-11-15

    The chitinolytic system of Listeria monocytogenes thus far comprises two chitinases, ChiA and ChiB, and a lytic polysaccharide monooxygenase, Lmo2467. The role of the system in the bacterium appears to be pleiotropic, as besides mediating the hydrolysis of chitin, the second most ubiquitous carbohydrate in nature, the chitinases have been deemed important for the colonization of unicellular molds, as well as mammalian hosts. To identify additional components of the chitinolytic system, we screened a transposon mutant library for mutants exhibiting impaired chitin hydrolysis. The screening yielded a mutant with a transposon insertion in a locus corresponding to lmo0327 of the EGD-e strain. lmo0327 encodes a large (1,349 amino acids [aa]) cell wall-associated protein that has been proposed to possess murein hydrolase activity. The single inactivation of lmo0327 , as well as of lmo0325 that codes for a putative transcriptional regulator functionally related to lmo0327 , led to an almost complete abolishment of chitinolytic activity. The effect could be traced at the transcriptional level, as both chiA and chiB transcripts were dramatically decreased in the lmo0327 mutant. In accordance with that, we could barely detect ChiA and ChiB in the culture supernatants of the mutant strain. Our results provide new information regarding the function of the lmo0325-lmo0327 locus in L. monocytogenes and link it to the expression of chitinolytic activity. IMPORTANCE Many bacteria from terrestrial and marine environments express chitinase activities enabling them to utilize chitin as the sole source of carbon and nitrogen. Interestingly, several bacterial chitinases may also be involved in host pathogenesis. For example, in the important foodborne pathogen Listeria monocytogenes , the chitinases ChiA and ChiB and the lytic polysaccharide monooxygenase Lmo2467 are implicated in chitin assimilation but also act as virulence factors during the infection of mammalian hosts. Therefore

  4. Bifidobacterium breve IPLA20005 affects in vitro the expression of hly and luxS genes, related to the virulence of Listeria monocytogenes Lm23.

    Science.gov (United States)

    Rios-Covian, David; Nogacka, Alicja; Salazar, Nuria; Hernández-Barranco, A M; Cuesta, Isabel; Gueimonde, Miguel; de Los Reyes Gavilán, Clara G

    2018-03-01

    Mechanistic features that characterize the interaction and inhibition of the food-borne pathogen Listeria monocytogenes by members of the genus Bifidobacterium still remain unclear. In the present work, we tried to shed light on the influence that co-cultivation of L. monocytogenes with Bifidobacterium breve may exert on both microorganisms and on virulence of the pathogen. Production of acetate and lactate was measured by gas chromatography and high-performance liquid chromatography, respectively; bacterial counts were obtained by plate count; gene expression was determined by RT-qPCR; and haemolytic activity was analyzed against goat erythrocytes. We found slightly but significantly lower final counts of Listeria and Bifidobacterium (p monocytogenes cells from cocultures than in those from monocultures. In contrast, the hly and luxS genes, which code for the cytolysin listeriolysin O and participate in biofilm formation, respectively, were overexpressed when L. monocytogenes was grown in coculture. This indicates that the presence of Bifidobacterium is able to modify the gene expression and haemolytic activity of L. monocytogenes when both microorganisms grow together.

  5. Immersion infection of germ-free zebrafish with Listeria monocytogenes induces transient expression of innate immune response genes

    Directory of Open Access Journals (Sweden)

    Ying eShan

    2015-04-01

    Full Text Available Zebrafish, Denio rerio, could be an alternative to other classic animal models for human infectious diseases to examine the processes of microbial infections and host-pathogen interactions in vivo because of their small body dimension but large clutch size. We established germ-free zebrafish infection models of Listeria monocytogenes through different routes of infection: oral immersion and injection via yolk sac, brain ventricle and blood island. Immersion of zebrafish larva even with 1010CFU/mL L. monocytogenes EGDe strain in egg water was unable to cause mortality, but GFP-expressing bacteria in the gut lumen could be observed in frozen sections. Several selected maker genes of the innate immune system, including cyp1a, irg1l, il1b and mmp9, were significantly induced by oral immersion not only with strain EGDe, but also with strain M7 and L. innocua, though to a lesser degree (P < 0.01. Such induction appears to be transient with peak at 48 h post-infection, but returned to basal level at 72 h post-infection. Of the three injection routes, mortality after infection by yolk sac was 80% in early stage of infection. Few eggs could survive and hatch. Injection into zebrafish embryos via brain ventricle or blood island led to progressive lethal infection. L. mocytogenes EGDe showed steady replication in the fish embryos and was far more pathogenic than strain M7, which is consistent with findings in the murine model. We conclude that zebrafish could serve as susceptible and microscopically visible infection models for L. monocytogenes via different routes and could be applied to further studies on the interactions between bacterial virulence factors and host immune responses.

  6. The combination of energy-dependent internal adaptation mechanisms and external factors enables Listeria monocytogenes to express a strong starvation survival response during multiple-nutrient starvation.

    Science.gov (United States)

    Lungu, Bwalya; Saldivar, Joshua C; Story, Robert; Ricke, Steven C; Johnson, Michael G

    2010-05-01

    The goal of this study was to characterize the starvation survival response (SSR) of a wild-type Listeria monocytogenes 10403S and an isogenic DeltasigB mutant strain during multiple-nutrient starvation conditions over 28 days. This study examined the effects of inhibitors of protein synthesis, the proton motive force, substrate level phosphorylation, and oxidative phosphorylation on the SSR of L. monocytogenes 10403S and a DeltasigB mutant during multiple-nutrient starvation. The effects of starvation buffer changes on viability were also examined. During multiple-nutrient starvation, both strains expressed a strong SSR, suggesting that L. monocytogenes possesses SigB-independent mechanism(s) for survival during multiple-nutrient starvation. Neither strain was able to express an SSR following starvation buffer changes, indicating that the nutrients/factors present in the starvation buffer could be a source of energy for cell maintenance and survival. Neither the wild-type nor the DeltasigB mutant strain was able to elicit an SSR when exposed to the protein synthesis inhibitor chloramphenicol within the first 4 h of starvation. However, both strains expressed an SSR when exposed to chloramphenicol after 6 h or more of starvation, suggesting that the majority of proteins required to elicit an effective SSR in L. monocytogenes are likely produced somewhere between 4 and 6 h of starvation. The varying SSRs of both strains to the different metabolic inhibitors under aerobic or anaerobic conditions suggested that (1) energy derived from the proton motive force is important for an effective SSR, (2) L. monocytogenes utilizes an anaerobic electron transport during multiple-nutrient starvation conditions, and (3) the glycolytic pathway is an important energy source during multiple-nutrient starvation when oxygen is available, and less important under anaerobic conditions. Collectively, the data suggest that the combination of energy-dependent internal adaptation mechanisms

  7. Staphylococcus aureus but not Listeria monocytogenes adapt to triclosan and adaptation correlates with increased fabI expression and agr deficiency

    DEFF Research Database (Denmark)

    Nielsen, Lene Nørby; Larsen, Marianne Halberg; Skovgaard, Sissel

    2013-01-01

    was initially 4 mg/L and remained unaltered by the exposure. The adapted S. aureus isolates retained normal colony size but displayed increased expression of fabI encoding an essential enzyme in bacterial fatty acid synthesis. Also, they displayed decreased or no expression of the virulence associated agr......C of the agr quorum sensing system. While most adapted strains of USA300 carried mutations in fabI, none of the adapted strains of 8325-4 did. Conclusions. Adaptability to triclosan varies substantially between Gram positive human pathogens. S. aureus displayed an intrinsically lower MIC for triclosan compared...... to L. monocytogenes but was easily adapted leading to the same MIC as L. monocytogenes. Even though all adapted S. aureus strains over-expressed fabI and eliminated expression of the agr quorum sensing system, adaptation in USA300 involved fabI mutations whereas this was not the case for 8325-4. Thus...

  8. Strand specific RNA-sequencing and membrane lipid profiling reveals growth phase-dependent cold stress response mechanisms in Listeria monocytogenes.

    Directory of Open Access Journals (Sweden)

    Patricia Hingston

    Full Text Available The human pathogen Listeria monocytogenes continues to pose a challenge in the food industry, where it is known to contaminate ready-to-eat foods and grow during refrigerated storage. Increased knowledge of the cold-stress response of this pathogen will enhance the ability to control it in the food-supply-chain. This study utilized strand-specific RNA sequencing and whole cell fatty acid (FA profiling to characterize the bacterium's cold stress response. RNA and FAs were extracted from a cold-tolerant strain at five time points between early lag phase and late stationary-phase, both at 4°C and 20°C. Overall, more genes (1.3× were suppressed than induced at 4°C. Late stationary-phase cells exhibited the greatest number (n = 1,431 and magnitude (>1,000-fold of differentially expressed genes (>2-fold, p<0.05 in response to cold. A core set of 22 genes was upregulated at all growth phases, including nine genes required for branched-chain fatty acid (BCFA synthesis, the osmolyte transporter genes opuCBCD, and the internalin A and D genes. Genes suppressed at 4°C were largely associated with cobalamin (B12 biosynthesis or the production/export of cell wall components. Antisense transcription accounted for up to 1.6% of total mapped reads with higher levels (2.5× observed at 4°C than 20°C. The greatest number of upregulated antisense transcripts at 4°C occurred in early lag phase, however, at both temperatures, antisense expression levels were highest in late stationary-phase cells. Cold-induced FA membrane changes included a 15% increase in the proportion of BCFAs and a 15% transient increase in unsaturated FAs between lag and exponential phase. These increases probably reduced the membrane phase transition temperature until optimal levels of BCFAs could be produced. Collectively, this research provides new information regarding cold-induced membrane composition changes in L. monocytogenes, the growth-phase dependency of its cold

  9. Transcriptomic Analysis of the Adaptation of Listeria monocytogenes to Lagoon and Soil Matrices Associated with a Piggery Environment: Comparison of Expression Profiles.

    Science.gov (United States)

    Vivant, Anne-Laure; Desneux, Jeremy; Pourcher, Anne-Marie; Piveteau, Pascal

    2017-01-01

    Understanding how Listeria monocytogenes , the causative agent of listeriosis, adapts to the environment is crucial. Adaptation to new matrices requires regulation of gene expression. To determine how the pathogen adapts to lagoon effluent and soil, two matrices where L. monocytogenes has been isolated, we compared the transcriptomes of L. monocytogenes CIP 110868 20 min and 24 h after its transfer to effluent and soil extract. Results showed major variations in the transcriptome of L. monocytogenes in the lagoon effluent but only minor modifications in the soil. In both the lagoon effluent and in the soil, genes involved in mobility and chemotaxis and in the transport of carbohydrates were the most frequently represented in the set of genes with higher transcript levels, and genes with phage-related functions were the most represented in the set of genes with lower transcript levels. A modification of the cell envelop was only found in the lagoon environment. Finally, the differential analysis included a large proportion of regulators, regulons, and ncRNAs.

  10. Transcriptomic Analysis of the Adaptation of Listeria monocytogenes to Lagoon and Soil Matrices Associated with a Piggery Environment: Comparison of Expression Profiles

    Science.gov (United States)

    Vivant, Anne-Laure; Desneux, Jeremy; Pourcher, Anne-Marie; Piveteau, Pascal

    2017-01-01

    Understanding how Listeria monocytogenes, the causative agent of listeriosis, adapts to the environment is crucial. Adaptation to new matrices requires regulation of gene expression. To determine how the pathogen adapts to lagoon effluent and soil, two matrices where L. monocytogenes has been isolated, we compared the transcriptomes of L. monocytogenes CIP 110868 20 min and 24 h after its transfer to effluent and soil extract. Results showed major variations in the transcriptome of L. monocytogenes in the lagoon effluent but only minor modifications in the soil. In both the lagoon effluent and in the soil, genes involved in mobility and chemotaxis and in the transport of carbohydrates were the most frequently represented in the set of genes with higher transcript levels, and genes with phage-related functions were the most represented in the set of genes with lower transcript levels. A modification of the cell envelop was only found in the lagoon environment. Finally, the differential analysis included a large proportion of regulators, regulons, and ncRNAs. PMID:29018416

  11. Strand specific RNA-sequencing and membrane lipid profiling reveals growth phase-dependent cold stress response mechanisms in Listeria monocytogenes

    DEFF Research Database (Denmark)

    Hingston, Patricia; Chen, Jessica; Allen, Kevin

    2017-01-01

    The human pathogen Listeria monocytogenes continues to pose a challenge in the food industry, where it is known to contaminate ready-to-eat foods and grow during refrigerated storage. Increased knowledge of the cold-stress response of this pathogen will enhance the ability to control it in the food-supply-chain....... This study utilized strand-specific RNA sequencing and whole cell fatty acid (FA) profiling to characterize the bacterium’s cold stress response. RNA and FAs were extracted from a cold-tolerant strain at five time points between early lag phase and late stationary-phase, both at 4°C and 20°C. Overall, more...... genes (1.3×) were suppressed than induced at 4°C. Late stationary-phase cells exhibited the greatest number (n = 1,431) and magnitude (>1,000-fold) of differentially expressed genes (>2-fold, pcold. A core set of 22 genes was upregulated at all growth phases, including nine genes...

  12. Strand specific RNA-sequencing and membrane lipid profiling reveals growth phase-dependent cold stress response mechanisms in Listeria monocytogenes

    Science.gov (United States)

    Hingston, Patricia; Chen, Jessica; Allen, Kevin; Truelstrup Hansen, Lisbeth

    2017-01-01

    The human pathogen Listeria monocytogenes continues to pose a challenge in the food industry, where it is known to contaminate ready-to-eat foods and grow during refrigerated storage. Increased knowledge of the cold-stress response of this pathogen will enhance the ability to control it in the food-supply-chain. This study utilized strand-specific RNA sequencing and whole cell fatty acid (FA) profiling to characterize the bacterium’s cold stress response. RNA and FAs were extracted from a cold-tolerant strain at five time points between early lag phase and late stationary-phase, both at 4°C and 20°C. Overall, more genes (1.3×) were suppressed than induced at 4°C. Late stationary-phase cells exhibited the greatest number (n = 1,431) and magnitude (>1,000-fold) of differentially expressed genes (>2-fold, pmonocytogenes, the growth-phase dependency of its cold-stress regulon, and the active roles of antisense transcripts in regulating its cold stress response. PMID:28662112

  13. Co-expression of Nisin Z and Leucocin C as a Basis for Effective Protection Against Listeria monocytogenes in Pasteurized Milk

    Directory of Open Access Journals (Sweden)

    Yuxin Fu

    2018-03-01

    Full Text Available Nisin, an important bacteriocin from Lactococcus lactis subsp., is primarily active against various Gram-positive bacteria. Leucocin C, produced by Leuconostoc carnosum 4010, is a class IIa bacteriocin used to inhibit the growth of Listeria monocytogenes. Because two bacteriocins have different modes of action, the combined use of them could be a potential strategy for effective inhibition of foodborne pathogens. In this study, L. lactis N8-r-lecCI (N8 harboring lecCI gene coexpressing nisin–leucocin C was constructed based on the food-grade carrier L. lactis N8. Production of both bacteriocins was stably maintained. Antimicrobial measurements showed that the recombinant strain is effectively against Listeria monocytogenes and Staphylococcus aureus and moderately against Salmonella enterica serovar Enteritidis and Escherichia coli because of its stronger antibacterial activity than the parental strain, this result first demonstrated that the co-expression of nisin and leucocin C results in highly efficient antimicrobial activity. The checkerboard assay showed that the antibacterial activity of L. lactis N8-r-lecCI supernatant was enhanced in the presence of low concentration of EDTA. Analysis of the scanning electron microscope image showed the biggest cellular morphology change in L. monocytogenes treated with a mixture of EDTA and L. lactis N8-r-lecCI supernatant. The practical effect was verified in pasteurized milk through time-kill assay. The L. lactis N8-r-lecCI strain expressing both nisin and leucocin C has a promising application prospect in pasteurized milk processing and preservation because of its strong antibacterial activity.

  14. Antimicrobial peptides effectively kill a broad spectrum of Listeria monocytogenes and Staphylococcus aureus strains independently of origin, sub-type, or virulence factor expression

    Directory of Open Access Journals (Sweden)

    Kristensen Hans-Henrik

    2008-11-01

    Full Text Available Abstract Background Host defense peptides (HDPs, or antimicrobial peptides (AMPs, are important components of the innate immune system that bacterial pathogens must overcome to establish an infection and HDPs have been suggested as novel antimicrobial therapeutics in treatment of infectious diseases. Hence it is important to determine the natural variation in susceptibility to HDPs to ensure a successful use in clinical treatment regimes. Results Strains of two human bacterial pathogens, Listeria monocytogenes and Staphylococcus aureus, were selected to cover a wide range of origin, sub-type, and phenotypic behavior. Strains within each species were equally sensitive to HDPs and oxidative stress representing important components of the innate immune defense system. Four non-human peptides (protamine, plectasin, novicidin, and novispirin G10 were similar in activity profile (MIC value spectrum to the human β-defensin 3 (HBD-3. All strains were inhibited by concentrations of hydrogen peroxide between 0.1% – 1.0%. Sub-selections of both species differed in expression of several virulence-related factors and in their ability to survive in human whole blood and kill the nematode virulence model Caenorhabditis elegans. For L. monocytogenes, proliferation in whole blood was paralleled by high invasion in Caco-2 cells and fast killing of C. elegans, however, no such pattern in phenotypic behavior was observed for S. aureus and none of the phenotypic differences were correlated to sensitivity to HDPs. Conclusion Strains of L. monocytogenes and S. aureus were within each species equally sensitive to a range of HDPs despite variations in subtype, origin, and phenotypic behavior. Our results suggest that therapeutic use of HDPs will not be hampered by occurrence of naturally tolerant strains of the two species investigated in the present study.

  15. Stimulation of Inducible Nitric Oxide Synthase Expression by Beta Interferon Increases Necrotic Death of Macrophages upon Listeria monocytogenes Infection▿

    OpenAIRE

    Zwaferink, Heather; Stockinger, Silvia; Reipert, Siegfried; Decker, Thomas

    2008-01-01

    Murine macrophage death upon infection with Listeria monocytogenes was previously shown to be increased by beta interferon, produced by the infected cells. We saw that interferon-upregulated caspase activation or other interferon-inducible, death-associated proteins, including TRAIL, protein kinase R, and p53, were not necessary for cell death. Macrophage death was reduced when inducible nitric oxide synthase (iNOS) was inhibited during infection, and iNOS-deficient macrophages were less susc...

  16. Hepatocyte specific expression of human cloned genes

    Energy Technology Data Exchange (ETDEWEB)

    Cortese, R

    1986-01-01

    A large number of proteins are specifically synthesized in the hepatocyte. Only the adult liver expresses the complete repertoire of functions which are required at various stages during development. There is therefore a complex series of regulatory mechanisms responsible for the maintenance of the differentiated state and for the developmental and physiological variations in the pattern of gene expression. Human hepatoma cell lines HepG2 and Hep3B display a pattern of gene expression similar to adult and fetal liver, respectively; in contrast, cultured fibroblasts or HeLa cells do not express most of the liver specific genes. They have used these cell lines for transfection experiments with cloned human liver specific genes. DNA segments coding for alpha1-antitrypsin and retinol binding protein (two proteins synthesized both in fetal and adult liver) are expressed in the hepatoma cell lines HepG2 and Hep3B, but not in HeLa cells or fibroblasts. A DNA segment coding for haptoglobin (a protein synthesized only after birth) is only expressed in the hepatoma cell line HepG2 but not in Hep3B nor in non hepatic cell lines. The information for tissue specific expression is located in the 5' flanking region of all three genes. In vivo competition experiments show that these DNA segments bind to a common, apparently limiting, transacting factor. Conventional techniques (Bal deletions, site directed mutagenesis, etc.) have been used to precisely identify the DNA sequences responsible for these effects. The emerging picture is complex: they have identified multiple, separate transcriptional signals, essential for maximal promoter activation and tissue specific expression. Some of these signals show a negative effect on transcription in fibroblast cell lines.

  17. Listeria monocytogenes CadC Regulates Cadmium Efflux and Fine-tunes Lipoprotein Localization to Escape the Host Immune Response and Promote Infection.

    Science.gov (United States)

    Pombinho, Rita; Camejo, Ana; Vieira, Ana; Reis, Olga; Carvalho, Filipe; Almeida, Maria Teresa; Pinheiro, Jorge Campos; Sousa, Sandra; Cabanes, Didier

    2017-05-01

    Listeria monocytogenes is a major intracellular human foodborne bacterial pathogen. We previously revealed L. monocytogenes cadC as highly expressed during mouse infection. Here we show that L. monocytogenes CadC is a sequence-specific, DNA-binding and cadmium-dependent regulator of CadA, an efflux pump conferring cadmium resistance. CadC but not CadA is required for L. monocytogenes infection in vivo. Interestingly, CadC also directly represses lspB, a gene encoding a lipoprotein signal peptidase whose expression appears detrimental for infection. lspB overexpression promotes the release of the LpeA lipoprotein to the extracellular medium, inducing tumor necrosis factor α and interleukin 6 expression, thus impairing L. monocytogenes survival in macrophages. We propose that L. monocytogenes uses CadC to repress lspB expression during infection to avoid LpeA exposure to the host immune system, diminishing inflammatory cytokine expression and promoting intramacrophagic survival and virulence. CadC appears as the first metal efflux pump regulator repurposed during infection to fine-tune lipoprotein processing and host responses. © The Author 2017. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail: journals.permissions@oup.com.

  18. microRNA expression during trophectoderm specification.

    Directory of Open Access Journals (Sweden)

    Srinivas R Viswanathan

    2009-07-01

    Full Text Available Segregation of the trophectoderm from the inner cell mass of the embryo represents the first cell-fate decision of mammalian development. Transcription factors essential for specifying trophectoderm have been identified, but the role of microRNAs (miRNAs in modulating this fate-choice has been largely unexplored. We have compared miRNA expression in embryonic stem cell (ESC-derived trophectoderm and in staged murine embryos to identify a set of candidate miRNAs likely to be involved in trophectoderm specification.We profiled embryonic stem cells (ESCs as they were induced to differentiate into trophectodermal cells by ectopic expression of HRas/Q61L. We also profiled murine embryos at progressive stages of preimplantation development (zygote, 2-cell, 4-cell, 8-cell, morula, and blastocyst, which includes the time window in which the trophectoderm is specified in vivo Q61L/H.We describe miRNA expression changes that occur during trophectoderm specification and validate that our in vitro system faithfully recapitulates trophectoderm specification in vivo. By comparing our in vitro and in vivo datasets, we have identified a minimal set of candidate miRNAs likely to play a role in trophectoderm specification. These miRNAs are predicted to regulate a host of development-associated target genes, and many of these miRNAs have previously reported roles in development and differentiation. Additionally, we highlight a number of miRNAs whose tight developmental regulation may reflect a functional role in other stages of embryogenesis. Our embryo profiling data may be useful to investigators studying trophectoderm specification and other stages of preimplantation development.

  19. Recombinant Expression of a Genome-encoded N-acetylmuramoyl-L-alanine Amidase that Synergistically Lyses Listeria monocytogenes Biofilms with a Protease

    Science.gov (United States)

    Listeria monocytogenes plays a significant role in human food-borne disease caused by eating food contaminated with the bacterium and although incidence is low it is a leading cause of life-threatening, bacterial food-borne disease in humans. L. monocytogenes serotypes 1/2a and 4b can form mixed-cu...

  20. Glycerol metabolism induces Listeria monocytogenes biofilm formation at the air-liquid interface.

    Science.gov (United States)

    Crespo Tapia, Natalia; den Besten, Heidy M W; Abee, Tjakko

    2018-05-20

    Listeria monocytogenes is a food-borne pathogen that can grow as a biofilm on surfaces. Biofilm formation in food-processing environments is a big concern for food safety, as it can cause product contamination through the food-processing line. Although motile aerobic bacteria have been described to form biofilms at the air-liquid interface of cell cultures, to our knowledge, this type of biofilm has not been described in L. monocytogenes before. In this study we report L. monocytogenes biofilm formation at the air-liquid interface of aerobically grown cultures, and that this phenotype is specifically induced when the media is supplemented with glycerol as a carbon and energy source. Planktonic growth, metabolic activity assays and HPLC measurements of glycerol consumption over time showed that glycerol utilization in L. monocytogenes is restricted to growth under aerobic conditions. Gene expression analysis showed that genes encoding the glycerol transporter GlpF, the glycerol kinase GlpK and the glycerol 3-phosphate dehydrogenase GlpD were upregulated in the presence of oxygen, and downregulated in absence of oxygen. Additionally, motility assays revealed the induction of aerotaxis in the presence of glycerol. Our results demonstrate that the formation of biofilms at the air-liquid interface is dependent on glycerol-induced aerotaxis towards the surface of the culture, where L. monocytogenes has access to higher concentrations of oxygen, and is therefore able to utilize this compound as a carbon source. Copyright © 2018 Elsevier B.V. All rights reserved.

  1. The specificity of long noncoding RNA expression.

    Science.gov (United States)

    Gloss, Brian S; Dinger, Marcel E

    2016-01-01

    Over the last decade, long noncoding RNAs (lncRNAs) have emerged as a fundamental molecular class whose members play pivotal roles in the regulation of the genome. The observation of pervasive transcription of mammalian genomes in the early 2000s sparked a revolution in the understanding of information flow in eukaryotic cells and the incredible flexibility and dynamic nature of the transcriptome. As a molecular class, distinct loci yielding lncRNAs are set to outnumber those yielding mRNAs. However, like many important discoveries, the road leading to uncovering this diverse class of molecules that act through a remarkable repertoire of mechanisms, was not a straight one. The same characteristic that most distinguishes lncRNAs from mRNAs, i.e. their developmental-stage, tissue-, and cell-specific expression, was one of the major impediments to their discovery and recognition as potentially functional regulatory molecules. With growing numbers of lncRNAs being assigned to biological functions, the specificity of lncRNA expression is now increasingly recognized as a characteristic that imbues lncRNAs with great potential as biomarkers and for the development of highly targeted therapeutics. Here we review the history of lncRNA research and how technological advances and insight into biological complexity have gone hand-in-hand in shaping this revolution. We anticipate that as increasing numbers of these molecules, often described as the dark matter of the genome, are characterized and the structure-function relationship of lncRNAs becomes better understood, it may ultimately be feasible to decipher what these non-(protein)-coding genes encode. This article is part of a Special Issue entitled: Clues to long noncoding RNA taxonomy1, edited by Dr. Tetsuro Hirose and Dr. Shinichi Nakagawa. Copyright © 2015 Elsevier B.V. All rights reserved.

  2. Comparative Genomics Reveals the Diversity of Restriction-Modification Systems and DNA Methylation Sites in Listeria monocytogenes.

    Science.gov (United States)

    Chen, Poyin; den Bakker, Henk C; Korlach, Jonas; Kong, Nguyet; Storey, Dylan B; Paxinos, Ellen E; Ashby, Meredith; Clark, Tyson; Luong, Khai; Wiedmann, Martin; Weimer, Bart C

    2017-02-01

    Listeria monocytogenes is a bacterial pathogen that is found in a wide variety of anthropogenic and natural environments. Genome sequencing technologies are rapidly becoming a powerful tool in facilitating our understanding of how genotype, classification phenotypes, and virulence phenotypes interact to predict the health risks of individual bacterial isolates. Currently, 57 closed L. monocytogenes genomes are publicly available, representing three of the four phylogenetic lineages, and they suggest that L. monocytogenes has high genomic synteny. This study contributes an additional 15 closed L. monocytogenes genomes that were used to determine the associations between the genome and methylome with host invasion magnitude. In contrast to previous findings, large chromosomal inversions and rearrangements were detected in five isolates at the chromosome terminus and within rRNA genes, including a previously undescribed inversion within rRNA-encoding regions. Each isolate's epigenome contained highly diverse methyltransferase recognition sites, even within the same serotype and methylation pattern. Eleven strains contained a single chromosomally encoded methyltransferase, one strain contained two methylation systems (one system on a plasmid), and three strains exhibited no methylation, despite the occurrence of methyltransferase genes. In three isolates a new, unknown DNA modification was observed in addition to diverse methylation patterns, accompanied by a novel methylation system. Neither chromosome rearrangement nor strain-specific patterns of epigenome modification observed within virulence genes were correlated with serotype designation, clonal complex, or in vitro infectivity. These data suggest that genome diversity is larger than previously considered in L. monocytogenes and that as more genomes are sequenced, additional structure and methylation novelty will be observed in this organism. Listeria monocytogenes is the causative agent of listeriosis, a disease

  3. Allele specific expression and methylation in the bumblebee, Bombus terrestris

    Directory of Open Access Journals (Sweden)

    Zoë Lonsdale

    2017-09-01

    Full Text Available The social hymenoptera are emerging as models for epigenetics. DNA methylation, the addition of a methyl group, is a common epigenetic marker. In mammals and flowering plants methylation affects allele specific expression. There is contradictory evidence for the role of methylation on allele specific expression in social insects. The aim of this paper is to investigate allele specific expression and monoallelic methylation in the bumblebee, Bombus terrestris. We found nineteen genes that were both monoallelically methylated and monoallelically expressed in a single bee. Fourteen of these genes express the hypermethylated allele, while the other five express the hypomethylated allele. We also searched for allele specific expression in twenty-nine published RNA-seq libraries. We found 555 loci with allele-specific expression. We discuss our results with reference to the functional role of methylation in gene expression in insects and in the as yet unquantified role of genetic cis effects in insect allele specific methylation and expression.

  4. A screen for kinase inhibitors identifies antimicrobial imidazopyridine aminofurazans as specific inhibitors of the Listeria monocytogenes PASTA kinase PrkA.

    Science.gov (United States)

    Schaenzer, Adam J; Wlodarchak, Nathan; Drewry, David H; Zuercher, William J; Rose, Warren E; Striker, Rob; Sauer, John-Demian

    2017-10-13

    Bacterial signaling systems such as protein kinases and quorum sensing have become increasingly attractive targets for the development of novel antimicrobial agents in a time of rising antibiotic resistance. The family of bacterial P enicillin-binding-protein A nd S erine/ T hreonine kinase- A ssociated (PASTA) kinases is of particular interest due to the role of these kinases in regulating resistance to β-lactam antibiotics. As such, small-molecule kinase inhibitors that target PASTA kinases may prove beneficial as treatments adjunctive to β-lactam therapy. Despite this interest, only limited progress has been made in identifying functional inhibitors of the PASTA kinases that have both activity against the intact microbe and high kinase specificity. Here, we report the results of a small-molecule screen that identified GSK690693, an imidazopyridine aminofurazan-type kinase inhibitor that increases the sensitivity of the intracellular pathogen Listeria monocytogenes to various β-lactams by inhibiting the PASTA kinase PrkA. GSK690693 potently inhibited PrkA kinase activity biochemically and exhibited significant selectivity for PrkA relative to the Staphylococcus aureus PASTA kinase Stk1. Furthermore, other imidazopyridine aminofurazans could effectively inhibit PrkA and potentiate β-lactam antibiotic activity to varying degrees. The presence of the 2-methyl-3-butyn-2-ol (alkynol) moiety was important for both biochemical and antimicrobial activity. Finally, mutagenesis studies demonstrated residues in the back pocket of the active site are important for GSK690693 selectivity. These data suggest that targeted screens can successfully identify PASTA kinase inhibitors with both biochemical and antimicrobial specificity. Moreover, the imidazopyridine aminofurazans represent a family of PASTA kinase inhibitors that have the potential to be optimized for selective PASTA kinase inhibition.

  5. Quantitative microbiological risk assessment as a tool to obtain useful information for risk managers - specific application to Listeria monocytogenes and ready-to-eat meat products

    NARCIS (Netherlands)

    Mataragas, M.; Zwietering, M.H.; Skandamis, P.N.; Drosinos, E.H.

    2010-01-01

    The presence of Listeria monocytogenes in a sliced cooked, cured ham-like meat product was quantitatively assessed. Sliced cooked, cured meat products are considered as high risk products. These ready-to-eat, RTE, products (no special preparation, e.g. thermal treatment, before eating is required),

  6. Dissecting specific and global transcriptional regulation of bacterial gene expression

    NARCIS (Netherlands)

    Gerosa, Luca; Kochanowski, Karl; Heinemann, Matthias; Sauer, Uwe

    Gene expression is regulated by specific transcriptional circuits but also by the global expression machinery as a function of growth. Simultaneous specific and global regulation thus constitutes an additional-but often neglected-layer of complexity in gene expression. Here, we develop an

  7. A Dual Microscopy-Based Assay To Assess Listeria monocytogenes Cellular Entry and Vacuolar Escape.

    Science.gov (United States)

    Quereda, Juan J; Pizarro-Cerdá, Javier; Balestrino, Damien; Bobard, Alexandre; Danckaert, Anne; Aulner, Nathalie; Shorte, Spencer; Enninga, Jost; Cossart, Pascale

    2016-01-01

    Listeria monocytogenes is a Gram-positive bacterium and a facultative intracellular pathogen that invades mammalian cells, disrupts its internalization vacuole, and proliferates in the host cell cytoplasm. Here, we describe a novel image-based microscopy assay that allows discrimination between cellular entry and vacuolar escape, enabling high-content screening to identify factors specifically involved in these two steps. We first generated L. monocytogenes and Listeria innocua strains expressing a β-lactamase covalently attached to the bacterial cell wall. These strains were then incubated with HeLa cells containing the Förster resonance energy transfer (FRET) probe CCF4 in their cytoplasm. The CCF4 probe was cleaved by the bacterial surface β-lactamase only in cells inoculated with L. monocytogenes but not those inoculated with L. innocua, thereby demonstrating bacterial access to the host cytoplasm. Subsequently, we performed differential immunofluorescence staining to distinguish extracellular versus total bacterial populations in samples that were also analyzed by the FRET-based assay. With this two-step analysis, bacterial entry can be distinguished from vacuolar rupture in a single experiment. Our novel approach represents a powerful tool for identifying factors that determine the intracellular niche of L. monocytogenes. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  8. Identification of Surface Protein Biomarkers of Listeria monocytogenes via Bioinformatics and Antibody-Based Protein Detection Tools

    Science.gov (United States)

    Zhang, Cathy X. Y.; Brooks, Brian W.; Huang, Hongsheng; Pagotto, Franco

    2016-01-01

    ABSTRACT The Gram-positive bacterium Listeria monocytogenes causes a significant percentage of the fatalities among foodborne illnesses in humans. Surface proteins specifically expressed in a wide range of L. monocytogenes serotypes under selective enrichment culture conditions could serve as potential biomarkers for detection and isolation of this pathogen via antibody-based methods. Our study aimed to identify such biomarkers. Interrogation of the L. monocytogenes serotype 4b strain F2365 genome identified 130 putative or known surface proteins. The homologues of four surface proteins, LMOf2365_0578, LMOf2365_0581, LMOf2365_0639, and LMOf2365_2117, were assessed as biomarkers due to the presence of conserved regions among strains of L. monocytogenes which are variable among other Listeria species. Rabbit polyclonal antibodies against the four recombinant proteins revealed the expression of only LMOf2365_0639 on the surface of serotype 4b strain LI0521 cells despite PCR detection of mRNA transcripts for all four proteins in the organism. Three of 35 monoclonal antibodies (MAbs) to LMOf2365_0639, MAbs M3643, M3644, and M3651, specifically recognized 42 (91.3%) of 46 L. monocytogenes lineage I and II isolates grown in nonselective brain heart infusion medium. While M3644 and M3651 reacted with 14 to 15 (82.4 to 88.2%) of 17 L. monocytogenes lineage I and II isolates, M3643 reacted with 22 (91.7%) of 24 lineage I, II, and III isolates grown in selective enrichment media (UVM1, modified Fraser, Palcam, and UVM2 media). The three MAbs exhibited only weak reactivities (the optical densities at 414 nm were close to the cutoff value) to some other Listeria species grown in selective enrichment media. Collectively, the data indicate the potential of LMOf2365_0639 as a surface biomarker of L. monocytogenes, with the aid of specific MAbs, for pathogen detection, identification, and isolation in clinical, environmental, and food samples. IMPORTANCE L. monocytogenes is

  9. Lactococcus lactis expressing either Staphylococcus aureus fibronectin-binding protein A or Listeria monocytogenes internalin A can efficiently internalize and deliver DNA in human epithelial cells.

    Science.gov (United States)

    Innocentin, Silvia; Guimarães, Valeria; Miyoshi, Anderson; Azevedo, Vasco; Langella, Philippe; Chatel, Jean-Marc; Lefèvre, François

    2009-07-01

    Lactococci are noninvasive bacteria frequently used as protein delivery vectors and, more recently, as in vitro and in vivo DNA delivery vehicles. We previously showed that a functional eukaryotic enhanced green fluorescent protein (eGFP) expression plasmid vector was delivered in epithelial cells by Lactococcus lactis producing Listeria monocytogenes internalin A (L. lactis InlA(+)), but this strategy is limited in vivo to transgenic mice and guinea pigs. In this study, we compare the internalization ability of L. lactis InlA(+) and L. lactis producing either the fibronectin-binding protein A of Staphylococcus aureus (L. lactis FnBPA(+)) or its fibronectin binding domains C and D (L. lactis CD(+)). L. lactis FnBPA(+) and L. lactis InlA(+) showed comparable internalization rates in Caco-2 cells, while the internalization rate observed with L. lactis CD(+) was lower. As visualized by conventional and confocal fluorescence microscopy, large clusters of L. lactis FnBPA(+), L. lactis CD(+), and L. lactis InlA(+) were present in the cytoplasm of Caco-2 cells after internalization. Moreover, the internalization rates of Lactobacillus acidophilus NCFM and of an NCFM mutant strain with the gene coding for the fibronectin-binding protein (fbpA) inactivated were also evaluated in Caco-2 cells. Similar low internalization rates were observed for both wild-type L. acidophilus NCFM and the fbpA mutant, suggesting that commensal fibronectin binding proteins have a role in adhesion but not in invasion. L. lactis FnBPA(+), L. lactis CD(+), and L. lactis InlA(+) were then used to deliver a eukaryotic eGFP expression plasmid in Caco-2 cells: flow cytometry analysis showed that the highest percentage of green fluorescent Caco-2 cells was observed after coculture with either L. lactis FnBPA(+) or L. lactis InlA(+). Analysis of the in vivo efficiency of these invasive recombinant strains is currently in progress to validate their potential as DNA vaccine delivery vehicles.

  10. Quantifying Listeria monocytogenes prevalence and concentration in minced pork meat and estimating performance of three culture media from presence/absence microbiological testing using a deterministic and stochastic approach.

    Science.gov (United States)

    Andritsos, Nikolaos D; Mataragas, Marios; Paramithiotis, Spiros; Drosinos, Eleftherios H

    2013-12-01

    Listeria monocytogenes poses a serious threat to public health, and the majority of cases of human listeriosis are associated with contaminated food. Reliable microbiological testing is needed for effective pathogen control by food industry and competent authorities. The aims of this work were to estimate the prevalence and concentration of L. monocytogenes in minced pork meat by the application of a Bayesian modeling approach, and also to determine the performance of three culture media commonly used for detecting L. monocytogenes in foods from a deterministic and stochastic perspective. Samples (n = 100) collected from local markets were tested for L. monocytogenes using in parallel the PALCAM, ALOA and RAPID'L.mono selective media according to ISO 11290-1:1996 and 11290-2:1998 methods. Presence of the pathogen was confirmed by conducting biochemical and molecular tests. Independent experiments (n = 10) for model validation purposes were performed. Performance attributes were calculated from the presence-absence microbiological test results by combining the results obtained from the culture media and confirmative tests. Dirichlet distribution, the multivariate expression of a Beta distribution, was used to analyze the performance data from a stochastic perspective. No L. monocytogenes was enumerated by direct-plating (media were best at ruling in L. monocytogenes presence than ruling it out. Sensitivity and specificity varied depending on the culture-dependent method. None of the culture media was perfect in detecting L. monocytogenes in minced pork meat alone. The use of at least two culture media in parallel enhanced the efficiency of L. monocytogenes detection. Bayesian modeling may reduce the time needed to draw conclusions regarding L. monocytogenes presence and the uncertainty of the results obtained. Furthermore, the problem of observing zero counts may be overcome by applying Bayesian analysis, making the determination of a test performance feasible

  11. TetR-dependent gene regulation in intracellular Listeria monocytogenes demonstrates the spatiotemporal surface distribution of ActA.

    Science.gov (United States)

    Schmitter, Sibylle; Fieseler, Lars; Klumpp, Jochen; Bertram, Ralph; Loessner, Martin J

    2017-08-01

    To enable specific and tightly controlled gene expression both in vitro and during the intracellular lifecycle of the pathogen Listeria monocytogenes, a TetR-dependent genetic induction system was developed. Highest concentration of cytoplasmic TetR and best repression of tetO-controlled genes was obtained by tetR expression from the synthetic promoter Pt 17 . Anhydrotetracycline (ATc) as inducer permitted concentration-dependent, fine-tuned expression of genes under control of the tetO operator and a suitable promoter. The actin-polymerizing ActA protein represents a major virulence factor of L. monocytogenes, required for actin-based motility and cell-to-cell spread in infected host cells. To be able to observe its spatial and temporal distribution on intracellular L. monocytogenes cells, conditional mutants featuring actA placed under TetR control were used to infect PtK2 epithelial cells. Following induction at different time intervals, the subsequent recruitment of actin by L. monocytogenes could be monitored. We found that cells displayed functional ActA after approximately 15 min, while formation of polarized actin tail was complete after 90-120 min. At this point, intracellular motility of the induced mutants was indistinguishable from wild-type bacteria. Interestingly, de novo ActA synthesis in intracellular Listeria also demonstrated the temporal, asymmetric redistribution of the membrane-anchored proteins from the lateral walls toward the cell poles. © 2017 John Wiley & Sons Ltd.

  12. Predicting tissue-specific expressions based on sequence characteristics

    KAUST Repository

    Paik, Hyojung; Ryu, Tae Woo; Heo, Hyoungsam; Seo, Seungwon; Lee, Doheon; Hur, Cheolgoo

    2011-01-01

    In multicellular organisms, including humans, understanding expression specificity at the tissue level is essential for interpreting protein function, such as tissue differentiation. We developed a prediction approach via generated sequence features from overrepresented patterns in housekeeping (HK) and tissue-specific (TS) genes to classify TS expression in humans. Using TS domains and transcriptional factor binding sites (TFBSs), sequence characteristics were used as indices of expressed tissues in a Random Forest algorithm by scoring exclusive patterns considering the biological intuition; TFBSs regulate gene expression, and the domains reflect the functional specificity of a TS gene. Our proposed approach displayed better performance than previous attempts and was validated using computational and experimental methods.

  13. Predicting tissue-specific expressions based on sequence characteristics

    KAUST Repository

    Paik, Hyojung

    2011-04-30

    In multicellular organisms, including humans, understanding expression specificity at the tissue level is essential for interpreting protein function, such as tissue differentiation. We developed a prediction approach via generated sequence features from overrepresented patterns in housekeeping (HK) and tissue-specific (TS) genes to classify TS expression in humans. Using TS domains and transcriptional factor binding sites (TFBSs), sequence characteristics were used as indices of expressed tissues in a Random Forest algorithm by scoring exclusive patterns considering the biological intuition; TFBSs regulate gene expression, and the domains reflect the functional specificity of a TS gene. Our proposed approach displayed better performance than previous attempts and was validated using computational and experimental methods.

  14. Listeria monocytogenes as a vector for anti-cancer therapies.

    LENUS (Irish Health Repository)

    Tangney, Mark

    2012-01-31

    The intracellular pathogen Listeria monocytogenes represents a promising therapeutic vector for the delivery of DNA, RNA or protein to cancer cells or to prime immune responses against tumour-specific antigens. A number of biological properties make L. monocytogenes a promising platform for development as a vector for either gene therapy or as an anti-cancer vaccine vector. L. monocytogenes is particularly efficient in mediating internalization into host cells. Once inside cells, the bacterium produces specific virulence factors which lyse the vaculolar membrane and allow escape into the cytoplasm. Once in the cytosol, L. monocytogenes is capable of actin-based motility and cell-to-cell spread without an extracellular phase. The cytoplasmic location of L. monocytogenes is significant as this potentiates entry of antigens into the MHC Class I antigen processing pathway leading to priming of specific CD8(+) T cell responses. The cytoplasmic location is also beneficial for the delivery of DNA (bactofection) by L. monocytogenes whilst cell-to-cell spread may facilitate access of the vector to cells throughout the tumour. Several preclinical studies have demonstrated the ability of L. monocytogenes for intracellular gene or protein delivery in vitro and in vivo, and this vector has also displayed safety and efficacy in clinical trial. Here, we review the features of the L. monocytogenes host-pathogen interaction that make this bacterium such an attractive candidate with which to induce appropriate therapeutic responses. We focus primarily upon work that has led to attenuation of the pathogen, demonstrated DNA, RNA or protein delivery to tumour cells as well as research that shows the efficacy of L. monocytogenes as a vector for tumour-specific vaccine delivery.

  15. Repressor-mediated tissue-specific gene expression in plants

    Science.gov (United States)

    Meagher, Richard B [Athens, GA; Balish, Rebecca S [Oxford, OH; Tehryung, Kim [Athens, GA; McKinney, Elizabeth C [Athens, GA

    2009-02-17

    Plant tissue specific gene expression by way of repressor-operator complexes, has enabled outcomes including, without limitation, male sterility and engineered plants having root-specific gene expression of relevant proteins to clean environmental pollutants from soil and water. A mercury hyperaccumulation strategy requires that mercuric ion reductase coding sequence is strongly expressed. The actin promoter vector, A2pot, engineered to contain bacterial lac operator sequences, directed strong expression in all plant vegetative organs and tissues. In contrast, the expression from the A2pot construct was restricted primarily to root tissues when a modified bacterial repressor (LacIn) was coexpressed from the light-regulated rubisco small subunit promoter in above-ground tissues. Also provided are analogous repressor operator complexes for selective expression in other plant tissues, for example, to produce male sterile plants.

  16. Listeria monocytogenes: diagnostic problems

    NARCIS (Netherlands)

    Beumer, R.R.; Hazeleger, W.C.

    2003-01-01

    The first isolation methods for the detection of Listeria spp. were generally based on the direct culture of samples on simple agar media, but isolation of the pathogenic Listeria monocytogenes was difficult. In time, new techniques were developed, based on a variety of selective and elective agents

  17. Incorporation of Listeria monocytogenes strains in raw milk biofilms.

    Science.gov (United States)

    Weiler, Christiane; Ifland, Andrea; Naumann, Annette; Kleta, Sylvia; Noll, Matthias

    2013-02-01

    Biofilms develop successively on devices of milk production without sufficient cleaning and originate from the microbial community of raw milk. The established biofilm matrices enable incorporation of pathogens like Listeria monocytogenes, which can cause a continuous contamination of food processing plants. L. monocytogenes is frequently found in raw milk and non-pasteurized raw milk products and as part of a biofilm community in milk meters and bulk milk tanks. The aim of this study was to analyze whether different L. monocytogenes strains are interacting with the microbial community of raw milk in terms of biofilm formation in the same manner, and to identify at which stage of biofilm formation a selected L. monocytogenes strain settles best. Bacterial community structure and composition of biofilms were analyzed by a cloning and sequencing approach and terminal restriction fragment length polymorphism analysis (T-RFLP) based on the bacterial 16S rRNA gene. The chemical composition of biofilms was analyzed by Fourier transform infrared spectroscopy (FTIR), while settled L. monocytogenes cells were quantified by fluorescence in situ hybridization (FISH). Addition of individual L. monocytogenes strains to raw milk caused significant shifts in the biofilm biomass, in the chemical as well as in the bacterial community composition. Biofilm formation and attachment of L. monocytogenes cells were not serotype but strain specific. However, the added L. monocytogenes strains were not abundant since mainly members of the genera Citrobacter and Lactococcus dominated the bacterial biofilm community. Overall, added L. monocytogenes strains led to a highly competitive interaction with the raw milk community and triggered alterations in biofilm formation. Copyright © 2012 Elsevier B.V. All rights reserved.

  18. Small RNA expression and strain specificity in the rat

    Directory of Open Access Journals (Sweden)

    de Bruijn Ewart

    2010-04-01

    Full Text Available Abstract Background Digital gene expression (DGE profiling has become an established tool to study RNA expression. Here, we provide an in-depth analysis of small RNA DGE profiles from two different rat strains (BN-Lx and SHR from six different rat tissues (spleen, liver, brain, testis, heart, kidney. We describe the expression patterns of known and novel micro (miRNAs and piwi-interacting (piRNAs. Results We confirmed the expression of 588 known miRNAs (54 in antisense orientation and identified 56 miRNAs homologous to known human or mouse miRNAs, as well as 45 new rat miRNAs. Furthermore, we confirmed specific A to I editing in brain for mir-376a/b/c and identified mir-377 as a novel editing target. In accordance with earlier findings, we observed a highly tissue-specific expression pattern for all tissues analyzed. The brain was found to express the highest number of tissue-specific miRNAs, followed by testis. Notably, our experiments also revealed robust strain-specific differential miRNA expression in the liver that is caused by genetic variation between the strains. Finally, we identified two types of germline-specific piRNAs in testis, mapping either to transposons or in strand-specific clusters. Conclusions Taken together, the small RNA compendium described here advances the annotation of small RNAs in the rat genome. Strain and tissue-specific expression patterns furthermore provide a strong basis for studying the role of small RNAs in regulatory networks as well as biological process like physiology and neurobiology that are extensively studied in this model system.

  19. Listeria monocytogenes: Overview and Targeting Advances

    Directory of Open Access Journals (Sweden)

    Mostafa F.N. Abushahba

    2016-04-01

    Full Text Available Listeria monocytogenes is a serious foodborne zoonotic pathogen capable of causing gastroenteritis and severe systemic infections such as septicemia, meningitis or abortion in the infected individuals what is called listeriosis. The bacterium is reported as the third leading cause of death among the foodborne pathogens preceded by nontyphoidal Salmonella spp. and Toxoplasma gondii. The power to tolerate a wide range of temperatures is considered the most prominent trait distinguishing it from the other foodborne pathogens. Within the infected host, the bacteria harbor inside macrophages and jump from cell to another without leaving the safeguarding milieu of the host's cells utilizing a set of genes including hly (listeriolysin O, plcA (phosphatidylinositol-specific phospholipase c, plcB (phosphatidylcholine-phospholipase C and actA (actin-assembly inducing protein. In addition to the health concerns associated with antibiotics, treatment failure likely occurs among listeriosis-infected persons especially with the inability of most antibiotics to access intracellular replicative niches and achieve the optimum therapeutic concentrations within the infected cells. Recently, one novel choice, peptide nucleic acid (PNA, has been emerged to target this bacterium as a model of targeting intracellular pathogens with anti-sense agents. PNA is a one of the DNA analogues which works via specific inhibition of bacterial gene expression.

  20. Cardiomyocyte expression and cell-specific processing of procholecystokinin

    DEFF Research Database (Denmark)

    Gøtze, Jens P.; Johnsen, Anders H.; Kistorp, Caroline

    2015-01-01

    has only been suggested using transcriptional measures or methods, with the post-translational phase of gene expression unaddressed. In this study, we examined the cardiac expression of the CCK gene in adult mammals and its expression at the protein level. Using quantitative PCR, a library of sequence......-specific pro-CCK assays, peptide purification, and mass spectrometry, we demonstrate that the mammalian heart expresses pro-CCK in amounts comparable to natriuretic prohormones and processes it to a unique, triple-sulfated, and N-terminally truncated product distinct from intestinal and cerebral CCK peptides...

  1. Synapse-specific and compartmentalized expression of presynaptic homeostatic potentiation

    Science.gov (United States)

    Li, Xiling; Goel, Pragya; Chen, Catherine; Angajala, Varun; Chen, Xun

    2018-01-01

    Postsynaptic compartments can be specifically modulated during various forms of synaptic plasticity, but it is unclear whether this precision is shared at presynaptic terminals. Presynaptic homeostatic plasticity (PHP) stabilizes neurotransmission at the Drosophila neuromuscular junction, where a retrograde enhancement of presynaptic neurotransmitter release compensates for diminished postsynaptic receptor functionality. To test the specificity of PHP induction and expression, we have developed a genetic manipulation to reduce postsynaptic receptor expression at one of the two muscles innervated by a single motor neuron. We find that PHP can be induced and expressed at a subset of synapses, over both acute and chronic time scales, without influencing transmission at adjacent release sites. Further, homeostatic modulations to CaMKII, vesicle pools, and functional release sites are compartmentalized and do not spread to neighboring pre- or post-synaptic structures. Thus, both PHP induction and expression mechanisms are locally transmitted and restricted to specific synaptic compartments. PMID:29620520

  2. Genotyping of Listeria monocytogenes isolates from poultry carcasses using high resolution melting (HRM) analysis.

    Science.gov (United States)

    Sakaridis, Ioannis; Ganopoulos, Ioannis; Madesis, Panagiotis; Tsaftaris, Athanasios; Argiriou, Anagnostis

    2014-01-02

    An outbreak situation of human listeriosis requires a fast and accurate protocol for typing Listeria monocytogenes . Existing techniques are either characterized by low discriminatory power or are laborious and require several days to give a final result. Polymerase chain reaction (PCR) coupled with high resolution melting (HRM) analysis was investigated in this study as an alternative tool for a rapid and precise genotyping of L. monocytogenes isolates. Fifty-five isolates of L. monocytogenes isolated from poultry carcasses and the environment of four slaughterhouses were typed by HRM analysis using two specific markers, internalin B and ssrA genes. The analysis of genotype confidence percentage of L. monocytogenes isolates produced by HRM analysis generated dendrograms with two major groups and several subgroups. Furthermore, the analysis of the HRM curves revealed that all L. monocytogenes isolates could easily be distinguished. In conclusion, HRM was proven to be a fast and powerful tool for genotyping isolates of L. monocytogenes .

  3. Targeting and crossing of the human maternofetal barrier by Listeria monocytogenes: role of internalin interaction with trophoblast E-cadherin.

    Science.gov (United States)

    Lecuit, Marc; Nelson, D Michael; Smith, Steve D; Khun, Huot; Huerre, Michel; Vacher-Lavenu, Marie-Cécile; Gordon, Jeffrey I; Cossart, Pascale

    2004-04-20

    Listeria monocytogenes produces severe fetoplacental infections in humans. How it targets and crosses the maternofetal barrier is unknown. We used immunohistochemistry to examine the location of L. monocytogenes in placental and amniotic tissue samples obtained from women with fetoplacental listeriosis. The results raised the possibility that L. monocytogenes crosses the maternofetal barrier through the villous syncytiotrophoblast, with secondary infection occurring via the amniotic epithelium. Because epidemiological studies indicate that the bacterial surface protein, internalin (InlA), may play a role in human fetoplacental listeriosis, we investigated the cellular patterns of expression of its host receptor, E-cadherin, at the maternofetal interface. E-cadherin was found on the basal and apical plasma membranes of syncytiotrophoblasts and in villous cytotrophoblasts. Established trophoblastic cell lines, primary trophoblast cultures, and placental villous explants were each exposed to isogenic InlA+ or InlA- strains of L. monocytogenes, and to L. innocua expressing or not InlA. Quantitative assays of cellular invasion demonstrated that bacterial entry into syncytiotrophoblasts occurs via the apical membrane in an InlA-E-cadherin dependent manner. In human placental villous explants, bacterial invasion of the syncytiotrophoblast barrier and underlying villous tissue and subsequent replication produces histopathological lesions that mimic those seen in placentas of women with listeriosis. Thus, the InlA-E-cadherin interaction that plays a key role in the crossing of the intestinal barrier in humans is also exploited by L. monocytogenes to target and cross the placental barrier. Such a ligand-receptor interaction allowing a pathogen to specifically cross the placental villous trophoblast barrier has not been reported previously.

  4. Listeria monocytogenes Monographic Study

    Directory of Open Access Journals (Sweden)

    Emil Tirziu

    2010-05-01

    Full Text Available Listeria monocytogenes is a ubiquitous bacteria with a remarkable resistance in discordant condition which produce listeriosis, an infectious disease that affects multiple domestic and wild animals’ species, but also humans. Receptive to listeriosis are the majority of domestic or wild mammals and birds, in the last years being registered an increase of receptivity in humans. The concept of listeriosis in human pathology, a disease caused by eating or drinking contaminated food and water, appeared for the first time in 1981, during an outbreak in Canada with seven cases in adults and 34 cases of maternalfetal listeriosis. The alimentary origin of human listeriosis can be easily explained if considered some general characteristics of the bacteria. Thus, resistance in various conditions, especially at lower temperatures, justifies its dissemination and food contamination, particularly when is conserved by refrigeration. Also, L. monocytogenes has a significant presence in alimentary products. Some studies showed that 4% of the milk products, 29% of the meat products, 5% of the vegetable products and 26% of the products obtained from fishes and shell fishes are positive for L. monocytogenes, which allows us to say that battle against these bacteria is a war against microbial contamination.

  5. Specificity of Facial Expression Labeling Deficits in Childhood Psychopathology

    Science.gov (United States)

    Guyer, Amanda E.; McClure, Erin B.; Adler, Abby D.; Brotman, Melissa A.; Rich, Brendan A.; Kimes, Alane S.; Pine, Daniel S.; Ernst, Monique; Leibenluft, Ellen

    2007-01-01

    Background: We examined whether face-emotion labeling deficits are illness-specific or an epiphenomenon of generalized impairment in pediatric psychiatric disorders involving mood and behavioral dysregulation. Method: Two hundred fifty-two youths (7-18 years old) completed child and adult facial expression recognition subtests from the Diagnostic…

  6. Antimicrobial peptides effectively kill a broad spectrum of Listeria monocytogenes and Staphylococcus aureus strains independently of origin, sub-type, or virulence factor expression

    DEFF Research Database (Denmark)

    Gottlieb, Caroline Trebbien; Thomsen, L.E.; Ingmer, H.

    2008-01-01

    -type, and phenotypic behavior. Strains within each species were equally sensitive to HDPs and oxidative stress representing important components of the innate immune defense system. Four non-human peptides (protamine, plectasin, novicidin, and novispirin G10) were similar in activity profile (MIC value spectrum......Background Host defense peptides (HDPs), or antimicrobial peptides (AMPs), are important components of the innate immune system that bacterial pathogens must overcome to establish an infection and HDPs have been suggested as novel antimicrobial therapeutics in treatment of infectious diseases...... Caenorhabditis elegans. For L. monocytogenes, proliferation in whole blood was paralleled by high invasion in Caco-2 cells and fast killing of C. elegans, however, no such pattern in phenotypic behavior was observed for S. aureus and none of the phenotypic differences were correlated to sensitivity to HDPs...

  7. First Trimester Listeria monocytogenes Septicemia

    NARCIS (Netherlands)

    Goddijn, M.; Schipper, H. G.; Spanjaard, L.; Wolf, H.

    1997-01-01

    Background: Little is known about fetal outcome after Listeria monocytogenes septicemia in the first trimester of pregnancy.Case: A primigravida with L. monocytogenes septicemia at 9 weeks gestation was treated with amoxicillin. At 40 weeks gestation a healthy female infant was born.Conclusion: This

  8. Novel Cadmium Resistance Determinant in Listeria monocytogenes.

    Science.gov (United States)

    Parsons, Cameron; Lee, Sangmi; Jayeola, Victor; Kathariou, Sophia

    2017-03-01

    Listeria monocytogenes is a foodborne pathogen that can cause severe disease (listeriosis) in susceptible individuals. It is ubiquitous in the environment and often exhibits resistance to heavy metals. One of the determinants that enables Listeria to tolerate exposure to cadmium is the cadAC efflux system, with CadA being a P-type ATPase. Three different cadA genes (designated cadA1 to cadA3 ) were previously characterized in L. monocytogenes A novel putative cadmium resistance gene ( cadA4 ) was recently identified through whole-genome sequencing, but experimental confirmation for its involvement in cadmium resistance is lacking. In this study, we characterized cadA4 in L. monocytogenes strain F8027, a cadmium-resistant strain of serotype 4b. By screening a mariner-based transposon library of this strain, we identified a mutant with reduced tolerance to cadmium and that harbored a single transposon insertion in cadA4 The tolerance to cadmium was restored by genetic complementation with the cadmium resistance cassette ( cadA4C ), and enhanced cadmium tolerance was conferred to two unrelated cadmium-sensitive strains via heterologous complementation with cadA4C Cadmium exposure induced cadA4 expression, even at noninhibitory levels. Virulence assessments in the Galleria mellonella model suggested that a functional cadA4 suppressed virulence, potentially promoting commensal colonization of the insect larvae. Biofilm assays suggested that cadA4 inactivation reduced biofilm formation. These data not only confirm cadA4 as a novel cadmium resistance determinant in L. monocytogenes but also provide evidence for roles in virulence and biofilm formation. IMPORTANCE Listeria monocytogenes is an intracellular foodborne pathogen causing the disease listeriosis, which is responsible for numerous hospitalizations and deaths every year. Among the adaptations that enable the survival of Listeria in the environment are the abilities to persist in biofilms, grow in the cold, and

  9. Recombinant phage probes for Listeria monocytogenes

    Energy Technology Data Exchange (ETDEWEB)

    Carnazza, S; Gioffre, G; Felici, F; Guglielmino, S [Department of Microbiological, Genetic and Molecular Sciences, University of Messina, Messina (Italy)

    2007-10-03

    Monitoring of food and environmental samples for biological threats, such as Listeria monocytogenes, requires probes that specifically bind biological agents and ensure their immediate and efficient detection. There is a need for robust and inexpensive affinity probes as an alternative to antibodies. These probes may be recruited from random peptide libraries displayed on filamentous phage. In this study, we selected from two phage peptide libraries phage clones displaying peptides capable of specific and strong binding to the L. monocytogenes cell surface. The ability of isolated phage clones to interact specifically with L. monocytogenes was demonstrated using enzyme-linked immunosorbent assay (ELISA) and confirmed by co-precipitation assay. We also assessed the sensitivity of phage-bacteria binding by PCR on phage-captured Listeria cells, which could be detected at a concentration of 10{sup 4} cells ml{sup -1}. In addition, as proof-of-concept, we tested the possibility of immobilizing the affinity-selected phages to a putative biosensor surface. The quality of phage deposition was monitored by ELISA and fluorescent microscopy. Phage-bacterial binding was confirmed by high power optical phase contrast microscopy. Overall, the results of this work validate the concept of affinity-selected recombinant filamentous phages as probes for detecting and monitoring bacterial agents under any conditions that warrant their recognition, including in food products.

  10. Recombinant phage probes for Listeria monocytogenes

    Science.gov (United States)

    Carnazza, S.; Gioffrè, G.; Felici, F.; Guglielmino, S.

    2007-10-01

    Monitoring of food and environmental samples for biological threats, such as Listeria monocytogenes, requires probes that specifically bind biological agents and ensure their immediate and efficient detection. There is a need for robust and inexpensive affinity probes as an alternative to antibodies. These probes may be recruited from random peptide libraries displayed on filamentous phage. In this study, we selected from two phage peptide libraries phage clones displaying peptides capable of specific and strong binding to the L. monocytogenes cell surface. The ability of isolated phage clones to interact specifically with L. monocytogenes was demonstrated using enzyme-linked immunosorbent assay (ELISA) and confirmed by co-precipitation assay. We also assessed the sensitivity of phage-bacteria binding by PCR on phage-captured Listeria cells, which could be detected at a concentration of 104 cells ml-1. In addition, as proof-of-concept, we tested the possibility of immobilizing the affinity-selected phages to a putative biosensor surface. The quality of phage deposition was monitored by ELISA and fluorescent microscopy. Phage-bacterial binding was confirmed by high power optical phase contrast microscopy. Overall, the results of this work validate the concept of affinity-selected recombinant filamentous phages as probes for detecting and monitoring bacterial agents under any conditions that warrant their recognition, including in food products.

  11. Global expression differences and tissue specific expression differences in rice evolution result in two contrasting types of differentially expressed genes

    KAUST Repository

    Horiuchi, Youko

    2015-12-23

    Background Since the development of transcriptome analysis systems, many expression evolution studies characterized evolutionary forces acting on gene expression, without explicit discrimination between global expression differences and tissue specific expression differences. However, different types of gene expression alteration should have different effects on an organism, the evolutionary forces that act on them might be different, and different types of genes might show different types of differential expression between species. To confirm this, we studied differentially expressed (DE) genes among closely related groups that have extensive gene expression atlases, and clarified characteristics of different types of DE genes including the identification of regulating loci for differential expression using expression quantitative loci (eQTL) analysis data. Results We detected differentially expressed (DE) genes between rice subspecies in five homologous tissues that were verified using japonica and indica transcriptome atlases in public databases. Using the transcriptome atlases, we classified DE genes into two types, global DE genes and changed-tissues DE genes. Global type DE genes were not expressed in any tissues in the atlas of one subspecies, however changed-tissues type DE genes were expressed in both subspecies with different tissue specificity. For the five tissues in the two japonica-indica combinations, 4.6 ± 0.8 and 5.9 ± 1.5 % of highly expressed genes were global and changed-tissues DE genes, respectively. Changed-tissues DE genes varied in number between tissues, increasing linearly with the abundance of tissue specifically expressed genes in the tissue. Molecular evolution of global DE genes was rapid, unlike that of changed-tissues DE genes. Based on gene ontology, global and changed-tissues DE genes were different, having no common GO terms. Expression differences of most global DE genes were regulated by cis-eQTLs. Expression

  12. Listeria monocytogenes serovar 4a is a possible evolutionary intermediate between L. monocytogenes serovars 1/2a and 4b and L. innocua.

    Science.gov (United States)

    Chen, Jianshun; Jiang, Lingli; Chen, Xueyan; Luo, Xiaokai; Chen, Yang; Yu, Ying; Tian, Guoming; Liu, Dongyou; Fang, Weihuan

    2009-03-01

    The genus Listeria consists of six closely related species and forms three phylogenetic groups: L. monocytogenes- L. innocua, L. ivanovii-L. seeligeri-L. welshimeri, and L. grayi. In this report, we attempted to examine the evolutionary relationship in the L. monocytogenes-L. innocua group by probing the nucleotide sequences of 23S rRNA and 16S rRNA, and the gene clusters lmo0029-lmo0042, ascBdapE, rplS-infC, and prs-ldh in L. monocytogenes serovars 1/2a, 4a, and 4b, and L. innocua. Additionally, we assessed the status of L. monocytogenes-specific inlA and inlB genes and 10 L. innocua-specific genes in these species/serovars, together with phenotypic characterization by using in vivo and in vitro procedures. The results indicate that L. monocytogenes serovar 4a strains are genetically similar to L. innocua in the lmo0035-lmo0042, ascB-dapE, and rplS-infC regions and also possess L. innocua-specific genes lin0372 and lin1073. Furthermore, both L. monocytogenes serovar 4a and L. innocua exhibit impaired intercellular spread ability and negligible pathogenicity in mouse model. On the other hand, despite resembling L. monocytogenes serovars 1/2a and 4b in having a nearly identical virulence gene cluster, and inlA and inlB genes, these serovar 4a strains differ from serovars 1/2a and 4b by harboring notably altered actA and plcB genes, displaying strong phospholipase activity and subdued in vivo and in vitro virulence. Thus, by possessing many genes common to L. monocytogenes serovars 1/2a and 4b, and sharing many similar gene deletions with L. innocua, L. monocytogenes serovar 4a represents a possible evolutionary intermediate between L. monocytogenes serovars 1/2a and 4b and L. innocua.

  13. Freedom of expression: cell-type-specific gene profiling.

    Science.gov (United States)

    Otsuki, Leo; Cheetham, Seth W; Brand, Andrea H

    2014-01-01

    Cell fate and behavior are results of differential gene regulation, making techniques to profile gene expression in specific cell types highly desirable. Many methods now enable investigation at the DNA, RNA and protein level. This review introduces the most recent and popular techniques, and discusses key issues influencing the choice between these such as ease, cost and applicability of information gained. Interdisciplinary collaborations will no doubt contribute further advances, including not just in single cell type but single-cell expression profiling. © 2014 Wiley Periodicals, Inc.

  14. A regulatory code for neuron-specific odor receptor expression.

    Directory of Open Access Journals (Sweden)

    Anandasankar Ray

    2008-05-01

    Full Text Available Olfactory receptor neurons (ORNs must select-from a large repertoire-which odor receptors to express. In Drosophila, most ORNs express one of 60 Or genes, and most Or genes are expressed in a single ORN class in a process that produces a stereotyped receptor-to-neuron map. The construction of this map poses a problem of receptor gene regulation that is remarkable in its dimension and about which little is known. By using a phylogenetic approach and the genome sequences of 12 Drosophila species, we systematically identified regulatory elements that are evolutionarily conserved and specific for individual Or genes of the maxillary palp. Genetic analysis of these elements supports a model in which each receptor gene contains a zip code, consisting of elements that act positively to promote expression in a subset of ORN classes, and elements that restrict expression to a single ORN class. We identified a transcription factor, Scalloped, that mediates repression. Some elements are used in other chemosensory organs, and some are conserved upstream of axon-guidance genes. Surprisingly, the odor response spectra and organization of maxillary palp ORNs have been extremely well-conserved for tens of millions of years, even though the amino acid sequences of the receptors are not highly conserved. These results, taken together, define the logic by which individual ORNs in the maxillary palp select which odor receptors to express.

  15. Recruitment of the major vault protein by InlK: a Listeria monocytogenes strategy to avoid autophagy.

    Directory of Open Access Journals (Sweden)

    Laurent Dortet

    2011-08-01

    Full Text Available L. monocytogenes is a facultative intracellular bacterium responsible for listeriosis. It is able to invade, survive and replicate in phagocytic and non-phagocytic cells. The infectious process at the cellular level has been extensively studied and many virulence factors have been identified. Yet, the role of InlK, a member of the internalin family specific to L. monocytogenes, remains unknown. Here, we first show using deletion analysis and in vivo infection, that InlK is a bona fide virulence factor, poorly expressed in vitro and well expressed in vivo, and that it is anchored to the bacterial surface by sortase A. We then demonstrate by a yeast two hybrid screen using InlK as a bait, validated by pulldown experiments and immunofluorescence analysis that intracytosolic bacteria via an interaction with the protein InlK interact with the Major Vault Protein (MVP, the main component of cytoplasmic ribonucleoproteic particules named vaults. Although vaults have been implicated in several cellular processes, their role has remained elusive. Our analysis demonstrates that MVP recruitment disguises intracytosolic bacteria from autophagic recognition, leading to an increased survival rate of InlK over-expressing bacteria compared to InlK(- bacteria. Together these results reveal that MVP is hijacked by L. monocytogenes in order to counteract the autophagy process, a finding that could have major implications in deciphering the cellular role of vault particles.

  16. Heart-specific expression of laminopathic mutations in transgenic zebrafish.

    Science.gov (United States)

    Verma, Ajay D; Parnaik, Veena K

    2017-07-01

    Lamins are key determinants of nuclear organization and function in the metazoan nucleus. Mutations in human lamin A cause a spectrum of genetic diseases that affect cardiac muscle and skeletal muscle as well as other tissues. A few laminopathies have been modeled using the mouse. As zebrafish is a well established model for the study of cardiac development and disease, we have investigated the effects of heart-specific lamin A mutations in transgenic zebrafish. We have developed transgenic lines of zebrafish expressing conserved lamin A mutations that cause cardiac dysfunction in humans. Expression of zlamin A mutations Q291P and M368K in the heart was driven by the zebrafish cardiac troponin T2 promoter. Homozygous mutant embryos displayed nuclear abnormalities in cardiomyocyte nuclei. Expression analysis showed the upregulation of genes involved in heart regeneration in transgenic mutant embryos and a cell proliferation marker was increased in adult heart tissue. At the physiological level, there was deviation of up to 20% from normal heart rate in transgenic embryos expressing mutant lamins. Adult homozygous zebrafish were fertile and did not show signs of early mortality. Our results suggest that transgenic zebrafish models of heart-specific laminopathies show cardiac regeneration and moderate deviations in heart rate during embryonic development. © 2017 International Federation for Cell Biology.

  17. Heritability and tissue specificity of expression quantitative trait loci

    Czech Academy of Sciences Publication Activity Database

    Petretto, E.; Mangion, J.; Dickens, N. J.; Cook, S.A.; Kumaran, M. K.; Lu, H.; Fischer, J.; Maatz, H.; Křen, Vladimír; Pravenec, Michal; Hubner, N.; Aitman, T. J.

    2006-01-01

    Roč. 2, č. 10 (2006), s. 1625-1633 ISSN 1553-7390 R&D Projects: GA MŠk(CZ) 1M0520; GA ČR(CZ) GA301/06/0028; GA ČR(CZ) GA301/04/0390 Grant - others:HHMI(US) 55005624 Institutional research plan: CEZ:AV0Z50110509 Keywords : expression QTL * heritability * tissue specificity Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 7.671, year: 2006

  18. Expression cloning of camelid nanobodies specific for Xenopus embryonic antigens.

    Directory of Open Access Journals (Sweden)

    Keiji Itoh

    Full Text Available Developmental biology relies heavily on the use of conventional antibodies, but their production and maintenance involves significant effort. Here we use an expression cloning approach to identify variable regions of llama single domain antibodies (known as nanobodies, which recognize specific embryonic antigens. A nanobody cDNA library was prepared from lymphocytes of a llama immunized with Xenopus embryo lysates. Pools of bacterially expressed cDNAs were sib-selected for the ability to produce specific staining patterns in gastrula embryos. Three different nanobodies were isolated: NbP1 and NbP3 stained yolk granules, while the reactivity of NbP7 was predominantly restricted to the cytoplasm and the cortex. The isolated nanobodies recognized specific protein bands in immunoblot analysis. A reverse proteomic approach identified NbP1 target antigen as EP45/Seryp, a serine protease inhibitor. Given the unique stability of nanobodies and the ease of their expression in diverse systems, we propose that nanobody cDNA libraries represent a promising resource for molecular markers for developmental biology.

  19. Comparative experimental infection of Listeria monocytogenes and Listeria ivanovii in bovine trophoblasts.

    Science.gov (United States)

    Rocha, Cláudia E; Mol, Juliana P S; Garcia, Luize N N; Costa, Luciana F; Santos, Renato L; Paixão, Tatiane A

    2017-01-01

    Listeria monocytogenes is a Gram-positive, facultative intracellular and invasive bacterium that has tropism to the placenta, and causes fetal morbidity and mortality in several mammalian species. While infection with L. monocytogenes and L. ivanovii are known as important causes of abortion and reproductive failure in cattle, the pathogenesis of maternal-fetal listeriosis in this species is poorly known. This study used the bovine chorioallantoic membrane explant model to investigate the kinetics of L. monocytogenes, L. ivanovii, and L. innocua infections in bovine trophoblastic cells for up to 8 h post infection. L. monocytogenes and L. ivanovii were able to invade and multiply in trophoblastic cells without causing cell death or inducing expression of pro-inflammatory genes. Although L. innocua was unable to multiply in bovine trophoblastic cells, it induced transcription of the pro-inflammatory mediator CXCL6. This study demonstrated for the first time the susceptibility of bovine trophoblastic cells to L. monocytogenes and L. ivanovii infection.

  20. Prebiotic Oligosaccharides Potentiate Host Protective Responses against L. Monocytogenes Infection

    Directory of Open Access Journals (Sweden)

    Poyin Chen

    2017-12-01

    Full Text Available Prebiotic oligosaccharides are used to modulate enteric pathogens and reduce pathogen shedding. The interactions with prebiotics that alter Listeria monocytogenes infection are not yet clearly delineated. L. monocytogenes cellular invasion requires a concerted manipulation of host epithelial cell membrane receptors to initiate internalization and infection often via receptor glycosylation. Bacterial interactions with host glycans are intimately involved in modulating cellular responses through signaling cascades at the membrane and in intracellular compartments. Characterizing the mechanisms underpinning these modulations is essential for predictive use of dietary prebiotics to diminish pathogen association. We demonstrated that human milk oligosaccharide (HMO pretreatment of colonic epithelial cells (Caco-2 led to a 50% decrease in Listeria association, while Biomos pretreatment increased host association by 150%. L. monocytogenes-induced gene expression changes due to oligosaccharide pretreatment revealed global alterations in host signaling pathways that resulted in differential subcellular localization of L. monocytogenes during early infection. Ultimately, HMO pretreatment led to bacterial clearance in Caco-2 cells via induction of the unfolded protein response and eIF2 signaling, while Biomos pretreatment resulted in the induction of host autophagy and L. monocytogenes vacuolar escape earlier in the infection progression. This study demonstrates the capacity of prebiotic oligosaccharides to minimize infection through induction of host-intrinsic protective responses.

  1. Listeria monocytogenes in Fresh Produce: Outbreaks, Prevalence and Contamination Levels

    Directory of Open Access Journals (Sweden)

    Qi Zhu

    2017-03-01

    Full Text Available Listeria monocytogenes, a member of the genus Listeria, is widely distributed in agricultural environments, such as soil, manure and water. This organism is a recognized foodborne pathogenic bacterium that causes many diseases, from mild gastroenteritis to severe blood and/or central nervous system infections, as well as abortion in pregnant women. Generally, processed ready-to-eat and cold-stored meat and dairy products are considered high-risk foods for L. monocytogenes infections that cause human illness (listeriosis. However, recently, several listeriosis outbreaks have been linked to fresh produce contamination around the world. Additionally, many studies have detected L. monocytogenes in fresh produce samples and even in some minimally processed vegetables. Thus L. monocytogenes may contaminate fresh produce if present in the growing environment (soil and water. Prevention of biofilm formation is an important control measure to reduce the prevalence and survival of L. monocytogenes in growing environments and on fresh produce. This article specifically focuses on fresh produce–associated listeriosis outbreaks, prevalence in growing environments, contamination levels of fresh produce, and associated fresh produce safety challenges.

  2. Genes that are involved in high hydrostatic pressure treatments in a Listeria monocytogenes Scott A ctsR deletion mutant

    Science.gov (United States)

    Listeria monocytogenes is a food-borne pathogen of significant threat to public health. High Hydrostatic Pressure (HHP) treatment can be used to control L. monocytogenes in food. The CtsR (class three stress gene repressor) protein negatively regulates the expression of class III heat shock genes....

  3. Pyrosequencing data reveals tissue-specific expression of lineage-specific transcripts in chickpea

    OpenAIRE

    Garg, Rohini; Jain, Mukesh

    2011-01-01

    Chickpea is a very important crop legume plant, which provides a protein-rich supplement to cereal-based diets and has the ability to fix atmospheric nitrogen. Despite its economic importance, the functional genomic resources for chickpea are very limited. Recently, we reported the complete transcriptome of chickpea using next generation sequencing technologies. We analyzed the tissue-specific expression of chickpea transcripts based on RNA-seq data. In addition, we identified two sets of lin...

  4. COMPARISON OF TWO METHODS FOR THE DETECTION OF LISTERIA MONOCYTOGENES

    Directory of Open Access Journals (Sweden)

    G. Tantillo

    2013-02-01

    Full Text Available The aim of this study was to compare the performance of the conventional methods for detection of Listeria monocytogenes in food using media Oxford and ALOA (Agar Listeria acc. to Ottaviani & Agosti in according to the ISO 11290-1 to a new chromogenic medium “CHROMagar Listeria” standardized in 2005 AFNOR ( CHR – 21/1-12/01. A total of 40 pre-packed ready-to-eat food samples were examined. Using two methods six samples were found positive for Listeria monocytogenes but the medium “CHROMagar Listeria” was more selective in comparison with the others. In conclusion this study has demonstrated that isolation medium able to target specifically the detection of L. monocytogenes such as “CHROMagar Listeria” is highly recommendable because of that detection time is significantly reduced and the analysis cost is less expensive.

  5. Role of Extracellular DNA during Biofilm Formation by Listeria monocytogenes

    DEFF Research Database (Denmark)

    Harmsen, Morten; Lappann, Martin; Knøchel, S

    2010-01-01

    (eDNA) may be the only central component of the biofilm matrix and that it is necessary for both initial attachment and early biofilm formation for 41 L. monocytogenes strains that were tested. DNase I treatment resulted in dispersal of biofilms, not only in microtiter tray assays but also in flow......Listeria monocytogenes is a food-borne pathogen that is capable of living in harsh environments. It is believed to do this by forming biofilms, which are surface-associated multicellular structures encased in a self-produced matrix. In this paper we show that in L. monocytogenes extracellular DNA...... cell biofilm assays. However, it was also demonstrated that in a culture without eDNA, neither Listeria genomic DNA nor salmon sperm DNA by itself could restore the capacity to adhere. A search for additional necessary components revealed that peptidoglycan (PG), specifically N-acetylglucosamine (NAG...

  6. Fødevarebetinget listeria monocytogenes endokarditis

    DEFF Research Database (Denmark)

    Frydland, Martin; Bundgaard, Henning; Moser, Claus

    2014-01-01

    Infection with Listeria monocytogenes is rare and mainly seen in immunosuppressed patients. Infection with L. monocytogenes has a mortality rate of 30%. We present a case report of L. monocytogenes bacteraemia and endocarditis in a 70-year-old man with several co-morbidities and following four...... major surgical procedures. This illustrates the findings and characteristics in one of the 16 patients who died in 2013 and 2014 this summer due to sausage-related L. monocytogenes infection....

  7. Spontaneous Loss of Virulence in Natural Populations of Listeria monocytogenes.

    Science.gov (United States)

    Maury, Mylène M; Chenal-Francisque, Viviane; Bracq-Dieye, Hélène; Han, Lei; Leclercq, Alexandre; Vales, Guillaume; Moura, Alexandra; Gouin, Edith; Scortti, Mariela; Disson, Olivier; Vázquez-Boland, José A; Lecuit, Marc

    2017-11-01

    The pathogenesis of Listeria monocytogenes depends on the ability of this bacterium to escape from the phagosome of the host cells via the action of the pore-forming toxin listeriolysin O (LLO). Expression of the LLO-encoding gene ( hly ) requires the transcriptional activator PrfA, and both hly and prfA genes are essential for L. monocytogenes virulence. Here, we used the hemolytic activity of LLO as a phenotypic marker to screen for spontaneous virulence-attenuating mutations in L. monocytogenes Sixty nonhemolytic isolates were identified among a collection of 57,820 confirmed L. monocytogenes strains isolated from a variety of sources (0.1%). In most cases (56/60; 93.3%), the nonhemolytic phenotype resulted from nonsense, missense, or frameshift mutations in prfA Five strains carried hly mutations leading to a single amino acid substitution (G299V) or a premature stop codon causing strong virulence attenuation in mice. In one strain, both hly and gshF (encoding a glutathione synthase required for full PrfA activity) were missing due to genomic rearrangements likely caused by a transposable element. The PrfA/LLO loss-of-function (PrfA - /LLO - ) mutants belonged to phylogenetically diverse clades of L. monocytogenes , and most were identified among nonclinical strains (57/60). Consistent with the rare occurrence of loss-of-virulence mutations, we show that prfA and hly are under purifying selection. Although occurring at a low frequency, PrfA - /LLO - mutational events in L. monocytogenes lead to niche restriction and open an evolutionary path for obligate saprophytism in this facultative intracellular pathogen. Copyright © 2017 Maury et al.

  8. Specific expression of bioluminescence reporter gene in cardiomyocyte regulated by tissue specific promoter

    Energy Technology Data Exchange (ETDEWEB)

    Nguyen, Vu Hong; Tae, Seong Ho; Le, Nguyen Uyen Chi; Min, Jung Joon [Chonnam National University Medical School, Gwangju (Korea, Republic of)

    2007-07-01

    As the human heart is not capable of regenerating the great numbers of cardiac cells that are lost after myocardial infarction, impaired cardiac function is the inevitable result of ischemic disease. Recently, human embryonic stem cells (hESCs) have gained popularity as a potentially ideal cell candidate for tissue regeneration. In particular, hESCs are capable of cardiac lineage-specific differentiation and confer improvement of cardiac function following transplantation into animal models. Although such data are encouraging, the specific strategy for in vivo and non-invasive detection of differentiated cardiac lineage is still limited. Therefore, in the present study, we established the gene construction in which the optical reporter gene Firefly luciferase was controlled by Myosin Heavy Chain promoter for specific expressing in heart cells. The vector consisting of - MHC promoter and a firefly luciferase coding sequence flanked by full-length bovine growth hormone (BGH) 3'-polyadenylation sequence based on pcDNA3.1- vector backbone. To test the specific transcription of this promoter in g of MHC-Fluc or CMV-Flue (for control) plasmid DNA in myocardial tissue, 20 phosphate-buffered saline was directly injected into mouse myocardium through a midline sternotomy and liver. After 1 week of injection, MHC-Fluc expression was detected from heart region which was observed under cooled CCD camera of in vivo imaging system but not from liver. In control group injected with CMV-Flue, the bioluminescence was detected from all these organs. The expression of Flue under control of Myosin Heavy Chain promoter may become a suitable optical reporter gene for stem cell-derived cardiac lineage differentiation study.

  9. Tissue-specific expression of type IX collagen

    International Nuclear Information System (INIS)

    Nishimura, I.; Muragaki, Y.; Ninomiya, Y.; Olsen, B.R.; Hayashi, M.

    1990-01-01

    This paper reports on the tissue-specific expression of type IX collagen, a major component of cartilage fibrils. It contains molecules with three genetically distinct subunits. The subunits form three triple-helical (CO) domains separated by non-triple-helical (NC) sequences. One of the subunits in cartilage, α1(IX), contains a large amino-terminal globular domain, NC4, while a second subunit, α2(IX), contains a covalently attached chondroitin sulfate chain. The site of attachment for this chain is located within the non-triple-helical sequence NC3, which separates the amino-terminal and central triple-helical domains of the type IX molecules. The NC3 region is 5 amino acid residues longer in the α2(IX) chain than in the α1(IX) and α3(IX) chains. This may explain why type IX molecules tend to show a sharp angle in the NC3 region, and why monoclonal antibody molecules that are specific for the stub left after chondroitinase ABC digestion of the chondroitin sulfate side chain always are located on the outside of the angle

  10. Subinhibitory concentrations of antibiotics affect stress and virulence gene expression in Listeria monocytogenes and cause enhanced stress sensitivity but do not affect Caco‐2 cell invasion

    DEFF Research Database (Denmark)

    Knudsen, Gitte Maegaard; Holch, Anne; Gram, Lone

    2012-01-01

    with promoter fusions, 14 of 16 antibiotics induced or repressed expression of one or more stress and/or virulence genes. Despite ampicillin‐induced up‐regulation of PinlA‐lacZ expression, Caco‐2 cell invasion was not affected. Subinhibitory concentrations of ampicillin and tetracycline caused up‐ and down...

  11. Listeria monocytogenes endophthalmitis following keratoconjunctivitis.

    Science.gov (United States)

    Shoughy, Samir S; Tabbara, Khalid F

    2014-01-01

    Endophthalmitis due to endogenous or exogenous bacteria is a rare infection of the eye. We report a case of endophthalmitis following Listeria monocytogenes keratoconjunctivitis in a 27-year-old healthy white male presenting with hand motion visual acuity, right eye mucopurulent conjunctivitis, elevated intraocular pressure, and pigmented hypopyon 6 months post-keratectomy. The conjunctivitis was unresponsive to a 5-day course of topical tobramycin eye drops, and the patient developed keratitis with pain that progressed to endophthalmitis after 21 days. Diagnostic B-scan revealed vitreous exudates. Intraocular fluid specimen showed Gram-positive organisms and the aqueous culture grew penicillin-/aminoglycoside-sensitive L. monocytogenes. The patient was given intravitreal and systemic vancomycin and ceftazidime. The eye was unresponsive to intravenous penicillin and gentamicin; the anterior chamber progressively flattened and developed phthisis bulbi. L. monocytogenes keratoconjunctivitis may lead to bacterial endophthalmitis. Prompt culture and early antibiotic therapy are recommended.

  12. Oocyte-specific gene Oog1 suppresses the expression of spermatogenesis-specific genes in oocytes.

    Science.gov (United States)

    Honda, Shinnosuke; Miki, Yuka; Miyamoto, Yuya; Kawahara, Yu; Tsukamoto, Satoshi; Imai, Hiroshi; Minami, Naojiro

    2018-05-03

    Oog1, an oocyte-specific gene that encodes a protein of 425 amino acids, is present in five copies on mouse chromosomes 4 and 12. In mouse oocytes, Oog1 mRNA expression begins at embryonic day 15.5 and almost disappears by the late two-cell stage. Meanwhile, OOG1 protein is detectable in oocytes in ovarian cysts and disappears by the four-cell stage; the protein is transported to the nucleus in late one-cell to early two-cell stage embryos. In this study, we examined the role of Oog1 during oogenesis in mice. Oog1 RNAi-transgenic mice were generated by expressing double-stranded hairpin Oog1 RNA, which is processed into siRNAs targeting Oog1 mRNA. Quantitative RT-PCR revealed that the amount of Oog1 mRNA was dramatically reduced in oocytes obtained from Oog1-knockdown mice, whereas the abundance of spermatogenesis-associated transcripts (Klhl10, Tekt2, Tdrd6, and Tnp2) was increased in Oog1 knockdown ovaries. Tdrd6 is involved in the formation of the chromatoid body, Tnp2 contributes to the formation of sperm heads, Tekt2 is required for the formation of ciliary and flagellar microtubules, and Klhl10 plays a key role in the elongated sperm differentiation. These results indicate that Oog1 down-regulates the expression of spermatogenesis-associated genes in female germ cells, allowing them to develop normally into oocytes.

  13. Listeria monocytogenes Induces a Virulence-Dependent microRNA Signature That Regulates the Immune Response in Galleria mellonella

    Directory of Open Access Journals (Sweden)

    Gopala K. Mannala

    2017-12-01

    Full Text Available microRNAs (miRNAs coordinate several physiological and pathological processes by regulating the fate of mRNAs. Studies conducted in vitro indicate a role of microRNAs in the control of host-microbe interactions. However, there is limited understanding of miRNA functions in in vivo models of bacterial infections. In this study, we systematically explored changes in miRNA expression levels of Galleria mellonella larvae (greater-wax moth, a model system that recapitulates the vertebrate innate immunity, following infection with L. monocytogenes. Using an insect-specific miRNA microarray with more than 2000 probes, we found differential expression of 90 miRNAs (39 upregulated and 51 downregulated in response to infection with L. monocytogenes. We validated the expression of a subset of miRNAs which have mammalian homologs of known or predicted function. In contrast, non-pathogenic L. innocua failed to induce these miRNAs, indicating a virulence-dependent miRNA deregulation. To predict miRNA targets using established algorithms, we generated a publically available G. mellonella transcriptome database. We identified miRNA targets involved in innate immunity, signal transduction and autophagy, including spätzle, MAP kinase, and optineurin, respectively, which exhibited a virulence-specific differential expression. Finally, in silico estimation of minimum free energy of miRNA-mRNA duplexes of validated microRNAs and target transcripts revealed a regulatory network of the host immune response to L. monocytogenes. In conclusion, this study provides evidence for a role of miRNAs in the regulation of the innate immune response following bacterial infection in a simple, rapid and scalable in vivo model that may predict host-microbe interactions in higher vertebrates.

  14. Endothelium specific matrilysin (MMP-7) expression in human cancers

    NARCIS (Netherlands)

    Sier, C.F.M.; Hawinkels, L.J.A.C.; Zijlmans, H.J.M.A.A.; Zuidwijk, K.; Jonge de; Muller, E.S.M.; Ferreira, V.; Hanemaaijer, R.; Mulder-Stapel, A.A.; Kenter, G.G.; Verspaget, H.W.; Gorter, A.

    2008-01-01

    Over-expression of matrilysin (MMP-7) is predominantly associated with epithelial (pre)malignant cells. In the present study MMP-7 expression is also found in endothelial cells in various human cancer types. Endothelial MMP-7 was associated with CD34 and/or CD105 expression. These

  15. Prevalence and contamination patterns of Listeria monocytogenes in catfish processing environment and fresh fillets.

    Science.gov (United States)

    Chen, Bang-Yuan; Pyla, Rajkumar; Kim, Tae-Jo; Silva, Juan L; Jung, Yean-Sung

    2010-08-01

    Catfish skins, intestines, fresh fillets, processing surfaces at different production stages, chiller water and non-food contact surfaces were sampled for Listeria monocytogenes and other Listeria species. Among 315 samples, prevalence of L. monocytogenes, Listeria innocua and a group of Listeria seeligeri-Listeria welshimeri-Listeria ivanovii was 21.6, 13.0 and 29.5%, respectively. No Listeria grayi was detected in this survey. While no L. monocytogenes strains were isolated from catfish skins and intestines, the strains were found with a frequency of 76.7% in chilled fresh catfish fillets and 43.3% in unchilled fillets. L. monocytogenes and Listeria spp. were also detected in fish contact surfaces such as deheading machine, trimming board, chiller water, conveyor belts at different stages, and fillet weighing table. Among L. monocytogenes, 1/2b (47.0%), 3b (16.0%) and 4c (14%) were the predominant serotypes isolated, whereas 4b, 4e, 1/2c and 1/2a were detected at much lower frequencies. Genotype analyses of L. monocytogenes isolates using serotyping, pulsed-field gel electrophoresis (PFGE) and enterobacterial repetitive intergenic consensus (ERIC)-PCR revealed that chiller water represented an important contamination source of L. monocytogenes in the chilled catfish fillets of two processing facilities, whereas fillet weighing table significantly contributed to the catfish fillet contamination of the third facility. This study suggests that L. monocytogenes contamination in the processed catfish fillets originates from the processing environment, rather than directly from catfish. Results from this study can aid the catfish industry to develop a plant-specific proper cleaning and sanitation procedure for equipment and the processing environment designed to specifically target L. monocytogenes contamination. Copyright 2010 Elsevier Ltd. All rights reserved.

  16. Cancer-specific binary expression system activated in mice by bacteriophage HK022 Integrase

    DEFF Research Database (Denmark)

    Elias, Amer; Spector, Itay; Sogolovsky-Bard, Ilana

    2016-01-01

    Binary systems based on site-specific recombination have been used for tumor specific transcription targeting of suicide genes in animal models. In these binary systems a site specific recombinase or integrase that is expressed from a tumor specific promoter drives tumor specific expression of a ...

  17. Spontaneous nisin-resistant Listeria monocytogenes mutants with increased expression of a putative penicillin-binding protein and their sensitivity to various antibiotics

    DEFF Research Database (Denmark)

    Gravesen, Anne; Sorensen, K.; Aarestrup, Frank Møller

    2001-01-01

    -molecular-weight penicillin-binding proteins (PBPs), a histidine protein kinase, a protein of unknown function, and ClpB (putative functions from homology), The three former proteins had increased expression in a total of six out of 10 independent mutants originating from five different wildtype strains, indicating...

  18. PRÉVALENCE DE LISTERIA MONOCYTOGENES DANS LE LAIT CRU DE VACHE AU LIBAN NORD

    Directory of Open Access Journals (Sweden)

    Imad al Kassaa

    2016-06-01

    Full Text Available Al Kassaa Imad, Khaled el Omari, Marwa Saati, Bachar Ismail and Monzer Hamze. 2016. Prevalence of Listeria monocytogenes in raw cow milk in north Lebanon. Lebanese Science Journal, 17(1: 39-45. Listeriosis, although a zoonosis, is an invasive disease that can affect newborns, pregnant women and immunocompromised adults. Clinical manifestations can be expressed by febrile gastroenteritis, invasive forms including severe sepsis, meningitis, rhombencephalitis, prenatal infections and abortions. Species of Listeria bacteria are ubiquitous and adaptable to the environment in animal and plant foods. This study aimed to determine the prevalence of Listeria monocytogenes in 100 samples of fresh cow milk collected from different areas of North Lebanon. Listeria monocytogenes was detected by using the Grand VIDAS technique (Biomérieux France. The results obtained revealed the absence of Listeria monocytogenes in all analyzed samples.

  19. Organ-specific gene expression: the bHLH protein Sage provides tissue specificity to Drosophila FoxA.

    Science.gov (United States)

    Fox, Rebecca M; Vaishnavi, Aria; Maruyama, Rika; Andrew, Deborah J

    2013-05-01

    FoxA transcription factors play major roles in organ-specific gene expression, regulating, for example, glucagon expression in the pancreas, GLUT2 expression in the liver, and tyrosine hydroxylase expression in dopaminergic neurons. Organ-specific gene regulation by FoxA proteins is achieved through cooperative regulation with a broad array of transcription factors with more limited expression domains. Fork head (Fkh), the sole Drosophila FoxA family member, is required for the development of multiple distinct organs, yet little is known regarding how Fkh regulates tissue-specific gene expression. Here, we characterize Sage, a bHLH transcription factor expressed exclusively in the Drosophila salivary gland (SG). We show that Sage is required for late SG survival and normal tube morphology. We find that many Sage targets, identified by microarray analysis, encode SG-specific secreted cargo, transmembrane proteins, and the enzymes that modify these proteins. We show that both Sage and Fkh are required for the expression of Sage target genes, and that co-expression of Sage and Fkh is sufficient to drive target gene expression in multiple cell types. Sage and Fkh drive expression of the bZip transcription factor Senseless (Sens), which boosts expression of Sage-Fkh targets, and Sage, Fkh and Sens colocalize on SG chromosomes. Importantly, expression of Sage-Fkh target genes appears to simply add to the tissue-specific gene expression programs already established in other cell types, and Sage and Fkh cannot alter the fate of most embryonic cell types even when expressed early and continuously.

  20. Listeria monocytogenes endophthalmitis following keratoconjunctivitis

    Directory of Open Access Journals (Sweden)

    Shoughy SS

    2014-01-01

    Full Text Available Samir S Shoughy,1 Khalid F Tabbara1–31The Eye Center and The Eye Foundation for Research in Ophthalmology, Riyadh, Saudi Arabia; 2Department of Ophthalmology, College of Medicine, King Saud University, Riyadh, Saudi Arabia; 3The Wilmer Ophthalmological Institute of The Johns Hopkins University School of Medicine, Baltimore, MD, USAAbstract: Endophthalmitis due to endogenous or exogenous bacteria is a rare infection of the eye. We report a case of endophthalmitis following Listeria monocytogenes keratoconjunctivitis in a 27-year-old healthy white male presenting with hand motion visual acuity, right eye mucopurulent conjunctivitis, elevated intraocular pressure, and pigmented hypopyon 6 months post-keratectomy. The conjunctivitis was unresponsive to a 5-day course of topical tobramycin eye drops, and the patient developed keratitis with pain that progressed to endophthalmitis after 21 days. Diagnostic B-scan revealed vitreous exudates. Intraocular fluid specimen showed Gram-positive organisms and the aqueous culture grew penicillin-/aminoglycoside-sensitive L. monocytogenes. The patient was given intravitreal and systemic vancomycin and ceftazidime. The eye was unresponsive to intravenous penicillin and gentamicin; the anterior chamber progressively flattened and developed phthisis bulbi. L. monocytogenes keratoconjunctivitis may lead to bacterial endophthalmitis. Prompt culture and early antibiotic therapy are recommended.Keywords: conjunctivitis, L. monocytogenes, endophthalmitis

  1. Stress Survival Islet 2, Predominantly Present in Listeria monocytogenes Strains of Sequence Type 121, Is Involved in the Alkaline and Oxidative Stress Responses.

    Science.gov (United States)

    Harter, Eva; Wagner, Eva Maria; Zaiser, Andreas; Halecker, Sabrina; Wagner, Martin; Rychli, Kathrin

    2017-08-15

    The foodborne pathogen Listeria monocytogenes is able to survive a variety of stress conditions leading to the colonization of different niches like the food processing environment. This study focuses on the hypervariable genetic hot spot lmo0443 to lmo0449 haboring three inserts: the stress survival islet 1 (SSI-1), the single-gene insert LMOf2365_0481 , and two homologous genes of the nonpathogenic species Listeria innocua : lin0464 , coding for a putative transcriptional regulator, and lin0465 , encoding an intracellular PfpI protease. Our prevalence study revealed a different distribution of the inserts between human and food-associated isolates. The lin0464-lin0465 insert was predominantly found in food-associated strains of sequence type 121 (ST121). Functional characterization of this insert showed that the putative PfpI protease Lin0465 is involved in alkaline and oxidative stress responses but not in acidic, gastric, heat, cold, osmotic, and antibiotic stresses. In parallel, deletion of lin0464 decreased survival under alkaline and oxidative stresses. The expression of both genes increased significantly under oxidative stress conditions independently of the alternative sigma factor σ B Furthermore, we showed that the expression of the protease gene lin0465 is regulated by the transcription factor lin0464 under stress conditions, suggesting that lin0464 and lin0465 form a functional unit. In conclusion, we identified a novel stress survival islet 2 (SSI-2), predominantly present in L. monocytogenes ST121 strains, beneficial for survival under alkaline and oxidative stresses, potentially supporting adaptation and persistence of L. monocytogenes in food processing environments. IMPORTANCE Listeria monocytogenes strains of ST121 are known to persist for months and even years in food processing environments, thereby increasing the risk of food contamination and listeriosis. However, the molecular mechanism underlying this remarkable niche-specific adaptation

  2. Analysis of Transcriptional Signatures in Response to Listeria monocytogenes Infection Reveals Temporal Changes That Result from Type I Interferon Signaling

    Science.gov (United States)

    Potempa, Krzysztof; Graham, Christine M.; Moreira-Teixeira, Lucia; McNab, Finlay W.; Howes, Ashleigh; Stavropoulos, Evangelos; Pascual, Virginia; Banchereau, Jacques; Chaussabel, Damien; O’Garra, Anne

    2016-01-01

    Analysis of the mouse transcriptional response to Listeria monocytogenes infection reveals that a large set of genes are perturbed in both blood and tissue and that these transcriptional responses are enriched for pathways of the immune response. Further we identified enrichment for both type I and type II interferon (IFN) signaling molecules in the blood and tissues upon infection. Since type I IFN signaling has been reported widely to impair bacterial clearance we examined gene expression from blood and tissues of wild type (WT) and type I IFNαβ receptor-deficient (Ifnar1-/-) mice at the basal level and upon infection with L. monocytogenes. Measurement of the fold change response upon infection in the absence of type I IFN signaling demonstrated an upregulation of specific genes at day 1 post infection. A less marked reduction of the global gene expression signature in blood or tissues from infected Ifnar1-/- as compared to WT mice was observed at days 2 and 3 after infection, with marked reduction in key genes such as Oasg1 and Stat2. Moreover, on in depth analysis, changes in gene expression in uninfected mice of key IFN regulatory genes including Irf9, Irf7, Stat1 and others were identified, and although induced by an equivalent degree upon infection this resulted in significantly lower final gene expression levels upon infection of Ifnar1-/- mice. These data highlight how dysregulation of this network in the steady state and temporally upon infection may determine the outcome of this bacterial infection and how basal levels of type I IFN-inducible genes may perturb an optimal host immune response to control intracellular bacterial infections such as L. monocytogenes. PMID:26918359

  3. Global expression differences and tissue specific expression differences in rice evolution result in two contrasting types of differentially expressed genes

    KAUST Repository

    Horiuchi, Youko; Harushima, Yoshiaki; Fujisawa, Hironori; Mochizuki, Takako; Fujita, Masahiro; Ohyanagi, Hajime; Kurata, Nori

    2015-01-01

    Since the development of transcriptome analysis systems, many expression evolution studies characterized evolutionary forces acting on gene expression, without explicit discrimination between global expression differences and tissue

  4. CURCUMIN DECREASES SPECIFICITY PROTEIN (Sp) EXPRESSION IN BLADDER CANCER CELLS

    OpenAIRE

    Chadalapaka, Gayathri; Jutooru, Indira; Chintharlapalli, Sudhakar; Papineni, Sabitha; Smith, Roger; Li, Xiangrong; Safe, Stephen

    2008-01-01

    Curcumin is the active component of tumeric, and this polyphenolic compound has been extensively investigated as an anticancer drug that modulates multiple pathways and genes. In this study, 10 – 25 µM curcumin inhibited 253JB-V and KU7 bladder cancer cell growth, and this was accompanied by induction of apoptosis and decreased expression of the proapoptotic protein survivin and the angiogenic proteins vascular endothelial growth factor (VEGF) and VEGF receptor 1 (VEGFR1). Since expression of...

  5. Prevalence and methodologies for detection, characterization and subtyping of Listeria monocytogenes and L. ivanovii in foods and environmental sources

    Directory of Open Access Journals (Sweden)

    Jin-Qiang Chen

    2017-09-01

    Full Text Available Listeria monocytogenes, one of the most important foodborne pathogens, can cause listeriosis, a lethal disease for humans. L. ivanovii, which is closely related to L. monocytogenes, is also widely distributed in nature and infects mainly warm-blooded ruminants, causing economic loss. Thus, there are high priority needs for methodologies for rapid, specific, cost-effective and accurate detection, characterization and subtyping of L. monocytogenes and L. ivanovii in foods and environmental sources. In this review, we (A described L. monocytogenes and L. ivanovii, world-wide incidence of listeriosis, and prevalence of various L. monocytogenes strains in food and environmental sources; (B comprehensively reviewed different types of traditional and newly developed methodologies, including culture-based, antigen/antibody-based, LOOP-mediated isothermal amplification, matrix-assisted laser desorption ionization-time of flight-mass spectrometry, DNA microarray, and genomic sequencing for detection and characterization of L. monocytogenes in foods and environmental sources; (C comprehensively summarized different subtyping methodologies, including pulsed-field gel electrophoresis, multi-locus sequence typing, ribotyping, and phage-typing, and whole genomic sequencing etc. for subtyping of L. monocytogenes strains from food and environmental sources; and (D described the applications of these methodologies in detection and subtyping of L. monocytogenes in foods and food processing facilities.

  6. Septicaemia models using Streptococcus pneumoniae and Listeria monocytogenes: understanding the role of complement properdin.

    Science.gov (United States)

    Dupont, Aline; Mohamed, Fatima; Salehen, Nur'Ain; Glenn, Sarah; Francescut, Lorenza; Adib, Rozita; Byrne, Simon; Brewin, Hannah; Elliott, Irina; Richards, Luke; Dimitrova, Petya; Schwaeble, Wilhelm; Ivanovska, Nina; Kadioglu, Aras; Machado, Lee R; Andrew, Peter W; Stover, Cordula

    2014-08-01

    Streptococcus pneumoniae and Listeria monocytogenes, pathogens which can cause severe infectious disease in human, were used to infect properdin-deficient and wildtype mice. The aim was to deduce a role for properdin, positive regulator of the alternative pathway of complement activation, by comparing and contrasting the immune response of the two genotypes in vivo. We show that properdin-deficient and wildtype mice mounted antipneumococcal serotype-specific IgM antibodies, which were protective. Properdin-deficient mice, however, had increased survival in the model of streptococcal pneumonia and sepsis. Low activity of the classical pathway of complement and modulation of FcγR2b expression appear to be pathogenically involved. In listeriosis, however, properdin-deficient mice had reduced survival and a dendritic cell population that was impaired in maturation and activity. In vitro analyses of splenocytes and bone marrow-derived myeloid cells support the view that the opposing outcomes of properdin-deficient and wildtype mice in these two infection models is likely to be due to a skewing of macrophage activity to an M2 phenotype in the properdin-deficient mice. The phenotypes observed thus appear to reflect the extent to which M2- or M1-polarised macrophages are involved in the immune responses to S. pneumoniae and L. monocytogenes. We conclude that properdin controls the strength of immune responses by affecting humoral as well as cellular phenotypes during acute bacterial infection and ensuing inflammation.

  7. Allele specific expression in worker reproduction genes in the bumblebee Bombus terrestris

    Directory of Open Access Journals (Sweden)

    Harindra E. Amarasinghe

    2015-07-01

    Full Text Available Methylation has previously been associated with allele specific expression in ants. Recently, we found methylation is important in worker reproduction in the bumblebee Bombus terrestris. Here we searched for allele specific expression in twelve genes associated with worker reproduction in bees. We found allele specific expression in Ecdysone 20 monooxygenase and IMP-L2-like. Although we were unable to confirm a genetic or epigenetic cause for this allele specific expression, the expression patterns of the two genes match those predicted for imprinted genes.

  8. MicroRNA-146a Deficiency Protects against Listeria monocytogenes Infection by Modulating the Gut Microbiota

    Directory of Open Access Journals (Sweden)

    Chong-Tao Du

    2018-03-01

    Full Text Available The gut microbiota and microRNAs play important roles in the defense against infection. However, the role of miR-146a in L. monocytogenes infection and gut microbiota remains unclear. We tried to determine whether miR-146a controlled L. monocytogenes infection by regulating the gut microbiota. Wild-type and miR-146a-deficient mice or macrophages were used to characterize the impact of miR-146a on animal survival, cell death, bacterial clearance, and gut microbiota following L. monocytogenes challenge. We found that L. monocytogenes infection induced miR-146a expression both in vitro and in vivo. When compared to wild-type mice, miR-146a-deficient mice were more resistant to L. monocytogenes infection. MiR-146a deficiency in macrophages resulted in reduced invasion and intracellular survival of L. monocytogenes. High-throughput sequencing of 16S rRNA revealed that the gut microbiota composition differed between miR-146a-deficient and wild-type mice. Relative to wild-type mice, miR-146a-deficient mice had decreased levels of the Proteobacteria phylum, Prevotellaceae family, and Parasutterella genus, and significantly increased short-chain fatty acid producing bacteria, including the genera Alistipes, Blautia, Coprococcus_1, and Ruminococcus_1. Wild-type mice co-housed with miR-146a-deficient mice had increased resistance to L. monocytogenes, indicating that miR-146a deficiency guides the gut microbiota to alleviate infection. Together, these results suggest that miR-146a deficiency protects against L. monocytogenes infection by regulating the gut microbiota.

  9. MicroRNA-146a Deficiency Protects against Listeria monocytogenes Infection by Modulating the Gut Microbiota.

    Science.gov (United States)

    Du, Chong-Tao; Gao, Wei; Ma, Ke; Yu, Shui-Xing; Li, Na; Yan, Shi-Qing; Zhou, Feng-Hua; Liu, Zhen-Zhen; Chen, Wei; Lei, Lian-Cheng; Yang, Yong-Jun; Han, Wen-Yu

    2018-03-26

    The gut microbiota and microRNAs play important roles in the defense against infection. However, the role of miR-146a in L. monocytogenes infection and gut microbiota remains unclear. We tried to determine whether miR-146a controlled L. monocytogenes infection by regulating the gut microbiota. Wild-type and miR-146a-deficient mice or macrophages were used to characterize the impact of miR-146a on animal survival, cell death, bacterial clearance, and gut microbiota following L. monocytogenes challenge. We found that L. monocytogenes infection induced miR-146a expression both in vitro and in vivo. When compared to wild-type mice, miR-146a-deficient mice were more resistant to L. monocytogenes infection. MiR-146a deficiency in macrophages resulted in reduced invasion and intracellular survival of L. monocytogenes . High-throughput sequencing of 16S rRNA revealed that the gut microbiota composition differed between miR-146a-deficient and wild-type mice. Relative to wild-type mice, miR-146a-deficient mice had decreased levels of the Proteobacteria phylum, Prevotellaceae family, and Parasutterella genus, and significantly increased short-chain fatty acid producing bacteria, including the genera Alistipes , Blautia , Coprococcus_1, and Ruminococcus_1 . Wild-type mice co-housed with miR-146a-deficient mice had increased resistance to L. monocytogenes , indicating that miR-146a deficiency guides the gut microbiota to alleviate infection. Together, these results suggest that miR-146a deficiency protects against L. monocytogenes infection by regulating the gut microbiota.

  10. Construction of mammary gland specific expression plasmid pIN ...

    African Journals Online (AJOL)

    DR. NJ TONUKARI

    2012-04-03

    Apr 3, 2012 ... its function in expressing goat insulin-like growth factor 1 (IGF-1). The backbone ... Liver and mammary gland were harvested from Saanen dairy goats. ..... lactating mammary of goat, sheep and cattle found that αs1- and ...

  11. Heterologous Expression of Three Plant Serpins with Distinct Inhibitory Specificities

    DEFF Research Database (Denmark)

    Dahl, Søren Weis; Rasmussen, Søren Kjærsgård; Hejgaard, Jørn

    1996-01-01

    For the first time, inhibitory plant serpins, including WSZ1 from wheat, BSZ4, and the previously unknown protein BSZx from barley, have been expressed in Escherichia coli, and a procedure for fast purification of native plant serpins has been developed, BSZx, BSZ4, and WSZ1 were assayed...... favorable P-2 Leu. BSZ4 inhibited cathepsin G (k(a) = 2.7 x 10(4) M(-1) s(-1)) at P-1 Met but was hydrolyzed by trypsin and chymotrypsin. The three plant serpins formed stable SDS-resistant complexes with the proteinases in accordance with the kinetic data....

  12. Closed expressions for specific massive multiloop self-energy integrals

    International Nuclear Information System (INIS)

    Berends, F.A.; Boehm, M.; Buza, M.; Scharf, R.

    1994-01-01

    In this paper the class of N loop massive scalar self-energy diagrams with N + 1 propagators is studied in an arbitrary number of dimensions. As it is known these integrals cannot be expressed in terms of polylogarithms. Here it is shown, however, that they can be described by generalized hypergeometric functions of several variables, namely Laricella functions. These results represent previous small and large momentum expansions in closed form. Numerical comparisons for the finite part in four dimensions with a two-dimensional integral representation show good agreement. (orig.)

  13. An insight into the isolation, enumeration and molecular detection of Listeria monocytogenes in food

    Directory of Open Access Journals (Sweden)

    Jodi Woan-Fei Law

    2015-11-01

    Full Text Available Listeria monocytogenes, a foodborne pathogen that can cause listeriosis through the consumption of food contaminated with this pathogen. The ability of L. monocytogenes to survive in extreme conditions and cause food contaminations have become a major concern. Hence, routine microbiological food testing is necessary to prevent food contamination and outbreaks of foodborne illness. This review provides insight into the methods for cultural detection, enumeration and molecular identification of L. monocytogenes in various food samples. There are a number of enrichment and plating media that can be used for the isolation of L. monocytogenes from food samples. Enrichment media such as buffered Listeria Enrichment Broth (BLEB, Fraser broth and University of Vermont Medium (UVM Listeria enrichment broth are recommended by regulatory agencies such as FDA-BAM, USDA-FSIS and ISO. Many plating media are available for the isolation of L. monocytogenes, for instance, PALCAM, Oxford and other chromogenic media. Besides, reference methods like FDA-BAM, ISO 11290 method and USDA-FSIS method are usually applied for the cultural detection or enumeration of L. monocytogenes. MPN technique is applied for the enumeration of L. monocytogenes in the case of low level contamination. Molecular methods including polymerase chain reaction (PCR, multiplex polymerase chain reaction (mPCR, real-time/quantitative polymerase chain reaction (qPCR, nucleic acid sequence-based amplification (NASBA, loop-mediated isothermal amplification (LAMP, DNA microarray and Next Generation Sequencing (NGS technology for the detection and identification of L. monocytogenes are discussed in this review. Overall, molecular methods are rapid, sensitive, specific, time- and labour-saving. In future, there are chances for the development of new techniques for the detection and identification of foodborne with improved features.

  14. Longitudinal monitoring of Listeria monocytogenes and Listeria phages in seafood processing environments in Thailand.

    Science.gov (United States)

    Vongkamjan, Kitiya; Benjakul, Soottawat; Kim Vu, Hue Thi; Vuddhakul, Varaporn

    2017-09-01

    Listeria monocytogenes is a foodborne pathogen commonly found in environments of seafood processing, thus presenting a challenge for eradication from seafood processing facilities. Monitoring the prevalence and subtype diversity of L. monocytogenes together with phages that are specific to Listeria spp. ("Listeria phages") will provide knowledge on the bacteria-phage ecology in food processing plants. In this work, a total of 595 samples were collected from raw material, finished seafood products and environmental samples from different sites of a seafood processing plant during 17 sampling visits in 1.5 years of study. L. monocytogenes and Listeria spp. (non-monocytogenes) were found in 22 (3.7%) and 43 (7.2%) samples, respectively, whereas 29 Listeria phages were isolated from 9 (1.5%) phage-positive samples. DNA fingerprint analysis of L. monocytogenes isolates revealed 11 Random Amplified Polymorphic DNA (RAPD) profiles, with two subtypes were frequently observed over time. Our data reveal a presence of Listeria phages within the same seafood processing environments where a diverse set of L. monocytogenes subtypes was also found. Although serotype 4b was observed at lower frequency, data indicate that isolates from this seafood processing plant belonged to both epidemiologically important serotypes 1/2a and 4b, which may suggest a potential public health risk. Phages (all showed a unique genome size of 65 ± 2 kb) were classified into 9 host range groups, representing both broad- and narrow-host range. While most L. monocytogenes isolates from this facility were susceptible to phages, five isolates showed resistance to 12-20 phages. Variations in phage host range among Listeria phages isolated from food processing plant may affect a presence of a diverse set of L. monocytogenes isolates derived from the same processing environment in Thailand. Copyright © 2017 Elsevier Ltd. All rights reserved.

  15. An insight into the isolation, enumeration, and molecular detection of Listeria monocytogenes in food

    Science.gov (United States)

    Law, Jodi Woan-Fei; Ab Mutalib, Nurul-Syakima; Chan, Kok-Gan; Lee, Learn-Han

    2015-01-01

    Listeria monocytogenes, a foodborne pathogen that can cause listeriosis through the consumption of food contaminated with this pathogen. The ability of L. monocytogenes to survive in extreme conditions and cause food contaminations have become a major concern. Hence, routine microbiological food testing is necessary to prevent food contamination and outbreaks of foodborne illness. This review provides insight into the methods for cultural detection, enumeration, and molecular identification of L. monocytogenes in various food samples. There are a number of enrichment and plating media that can be used for the isolation of L. monocytogenes from food samples. Enrichment media such as buffered Listeria enrichment broth, Fraser broth, and University of Vermont Medium (UVM) Listeria enrichment broth are recommended by regulatory agencies such as Food and Drug Administration-bacteriological and analytical method (FDA-BAM), US Department of Agriculture-Food and Safety (USDA-FSIS), and International Organization for Standardization (ISO). Many plating media are available for the isolation of L. monocytogenes, for instance, polymyxin acriflavin lithium-chloride ceftazidime aesculin mannitol, Oxford, and other chromogenic media. Besides, reference methods like FDA-BAM, ISO 11290 method, and USDA-FSIS method are usually applied for the cultural detection or enumeration of L. monocytogenes. most probable number technique is applied for the enumeration of L. monocytogenes in the case of low level contamination. Molecular methods including polymerase chain reaction, multiplex polymerase chain reaction, real-time/quantitative polymerase chain reaction, nucleic acid sequence-based amplification, loop-mediated isothermal amplification, DNA microarray, and next generation sequencing technology for the detection and identification of L. monocytogenes are discussed in this review. Overall, molecular methods are rapid, sensitive, specific, time- and labor-saving. In future, there are

  16. An outbreak of an unusual strain of Listeria monocytogenes infection in North-East Scotland

    Directory of Open Access Journals (Sweden)

    Emmanuel Okpo

    2015-11-01

    Full Text Available Summary: Listeria monocytogenes infection is an important cause of illness and hospitalization in vulnerable individuals. In the present study, we describe a community outbreak of Listeria monocytogenes in the North-East region of Scotland, which was epidemiologically, environmentally and microbiologically linked to a local meat product and ready-to-eat product manufacturer. Infected individuals were interviewed, and an environmental investigation was conducted. Clinical and environmental samples were tested by culture, and isolates were typed by fluorescent amplified fragment length polymorphism (fAFLP. Three cases of Listeria monocytogenes were linked geographically, had the same serotype (1/2a and were indistinguishable by fAFLP type XII.6. The human, food and environmental isolates were of the same serotype and were indistinguishable by molecular typing.This is the first community outbreak of L. monocytogenes reported in Scotland since the current outbreak surveillance was established in 1996. Epidemiological and laboratory evidence indicated poor hand hygiene, unhygienic practices and cross-contamination throughout the manufacturing process of ready-to-eat foods as a possible cause of the outbreak. More stringent control of commercial food establishments that provide ready-to-eat food and the need to advise specifically vulnerable groups, e.g., pregnant women, of the risk of L. monocytogenes in ready-to-eat food is urgently needed. Keywords: Listeria monocytogenes, Outbreak, Foodborne, Community acquired infection, Listeriosis

  17. Prevalence and serotypes of Listeria monocytogenes contamination in Chinese beef processing plants.

    Science.gov (United States)

    Zhu, Lixian; Feng, Xiaohui; Zhang, Lihua; Zhu, Ruiliang; Luo, Xin

    2012-06-01

    The aim of this work was to study the epidemiology of Listeria spp., particularly Listeria monocytogenes, and to identify the serotypes present in contaminated samples from beef processing plants in China. A total of 439 samples were obtained from bovine feces, hides, and carcasses at three commercial processing plants. A standard protocol (ISO 11290-1) was followed to detect Listeria spp. and L. monocytogenes, and multiplex polymerase chain reaction was used to identify the various L. monocytogenes serotypes. The overall prevalences of Listeria spp. and L. monocytogenes were 65.6% and 26.4%, respectively, and the contamination was highest in the hide samples. The identified L. monocytogenes serotypes were 1/2c and 1/2a. The results of the current study indicate that Listeria spp. contamination is common in Chinese beef processing plants; specific measures should be taken to prevent and/or treat L. monocytogenes contamination of feces and hides in beef slaughter plants. Furthermore, because Listeria spp. contamination was found to be prevalent, it should, therefore, be studied further. The prevention of cases of sporadic listeriosis in China should also be addressed.

  18. Prevalence of Listeria monocytogenes in raw bovine milk and milk products from central highlands of Ethiopia.

    Science.gov (United States)

    Seyoum, Eyasu Tigabu; Woldetsadik, Daniel Asrat; Mekonen, Tesfu Kassa; Gezahegn, Haile Alemayehu; Gebreyes, Wondwossen Abebe

    2015-11-30

    Listeria monocytogenes is of major significance in human and veterinary medicine. Most human Listeria infections are foodborne and the association of contaminated milk and dairy produce consumption with human listeriosis is noteworthy. In Ethiopia, there is limited data regarding the prevalence of L. monocytogenes in raw bovine milk and dairy products. The aim of this study was, therefore, to determine the prevalence of L. monocytogenes in raw bovine milk and dairy produce. A total of 443 milk and milk product samples were microbiologically analyzed following methods recommended by the U.S. Food and Drug Administration Bacteriological Analytical Manual to isolate Listeria spp. The overall prevalence of Listeria spp. was 28.4% and specifically that of L. monocytogenes was 5.6%. Taking the prevalence of Listeria spp. into consideration, cheese was found to be highly contaminated at 60%, followed by pasteurized milk samples (40%), raw milk (18.9%) and yoghurt (5%). Considering the prevalence of Listeria monocytogenes only, raw milk had the lowest contamination while cheese had the highest, followed by pasteurized milk and yoghurt. Raw milk and milk products produced in urban and peri-urban areas of central Ethiopia were contaminated with pathogenic bacteria, L. monocytogenes. The detection of this pathogen in raw milk and milk products warrants an urgent regulatory mechanism to be put in place and also the potential role of milk processing plants in the contamination of dairy products should be investigated.

  19. Symbiont modulates expression of specific gene categories in Angomonas deanei

    Directory of Open Access Journals (Sweden)

    Luciana Loureiro Penha

    Full Text Available Trypanosomatids are parasites that cause disease in humans, animals, and plants. Most are non-pathogenic and some harbor a symbiotic bacterium. Endosymbiosis is part of the evolutionary process of vital cell functions such as respiration and photosynthesis. Angomonas deanei is an example of a symbiont-containing trypanosomatid. In this paper, we sought to investigate how symbionts influence host cells by characterising and comparing the transcriptomes of the symbiont-containing A. deanei (wild type and the symbiont-free aposymbiotic strains. The comparison revealed that the presence of the symbiont modulates several differentially expressed genes. Empirical analysis of differential gene expression showed that 216 of the 7625 modulated genes were significantly changed. Finally, gene set enrichment analysis revealed that the largest categories of genes that downregulated in the absence of the symbiont were those involved in oxidation-reduction process, ATP hydrolysis coupled proton transport and glycolysis. In contrast, among the upregulated gene categories were those involved in proteolysis, microtubule-based movement, and cellular metabolic process. Our results provide valuable information for dissecting the mechanism of endosymbiosis in A. deanei.

  20. Formal specification of a query expression generator using RSL ...

    African Journals Online (AJOL)

    From the specification, an implementation of our generator is generated in C++ using a command within the RSL project support environment that translates RSL to C++. The preliminary results with our generator show that it holds promise as a stand-alone tool as well. (Botswana Journal of Technology: 2002 11(2): 9-17) ...

  1. Caste-Specific and Sex-Specific Expression of Chemoreceptor Genes in a Termite.

    Directory of Open Access Journals (Sweden)

    Yuki Mitaka

    Full Text Available The sophisticated colony organization of eusocial insects is primarily maintained through the utilization of pheromones. The regulation of these complex social interactions requires intricate chemoreception systems. The recent publication of the genome of Zootermopsis nevadensis opened a new avenue to study molecular basis of termite caste systems. Although there has been a growing interest in the termite chemoreception system that regulates their sophisticated caste system, the relationship between division of labor and expression of chemoreceptor genes remains to be explored. Using high-throughput mRNA sequencing (RNA-seq, we found several chemoreceptors that are differentially expressed among castes and between sexes in a subterranean termite Reticulitermes speratus. In total, 53 chemoreception-related genes were annotated, including 22 odorant receptors, 7 gustatory receptors, 12 ionotropic receptors, 9 odorant-binding proteins, and 3 chemosensory proteins. Most of the chemoreception-related genes had caste-related and sex-related expression patterns; in particular, some chemoreception genes showed king-biased or queen-biased expression patterns. Moreover, more than half of the genes showed significant age-dependent differences in their expression in female and/or male reproductives. These results reveal a strong relationship between the evolution of the division of labor and the regulation of chemoreceptor gene expression, thereby demonstrating the chemical communication and underlining chemoreception mechanism in social insects.

  2. Phloretin Attenuates Listeria monocytogenes Virulence Both In vitro and In vivo by Simultaneously Targeting Listeriolysin O and Sortase A.

    Science.gov (United States)

    Wang, Jianfeng; Liu, Bowen; Teng, Zihao; Zhou, Xuan; Wang, Xiyan; Zhang, Bing; Lu, Gejin; Niu, Xiaodi; Yang, Yongjun; Deng, Xuming

    2017-01-01

    The critical roles of sortase A (SrtA) and listeriolysin O (LLO) in Listeria monocytogenes pathogenicity render these two virulence factors as ideal targets for the development of anti-virulence agents against L. monocytogenes infection. Additionally, the structures of SrtA and LLO are highly conserved among the members of sortase enzyme family and cholesterol dependent toxin family. Here, phloretin, a natural polyphenolic compound derived from apples and pears that has little anti- L. monocytogenes activity, was identified to simultaneously inhibit LLO expression and neutralize SrtA catalytic activity. Phloretin neutralized SrtA activity by causing a conformational change in the protein's active pocket, which prevented engagement with its substrate. Treatment with phloretin simultaneously reduced L. monocytogenes invasion into host cells and blocked the escape of vacuole-entrapped L. monocytogenes into cytoplasm. Further, L. monocytogenes -infected mice that received phloretin showed lower mortality, decreased bacterial burden and reduced pathological injury. Our results demonstrate that phloretin is a promising anti-infective therapeutic for infections caused by L. monocytogenes due to its simultaneous targeting of SrtA and LLO, which may result in fewer side effects than those caused by other antibiotics.

  3. Expression of antibacterial resistance at the site of a delayed hypersensitivity reaction.

    OpenAIRE

    Patel, P J

    1980-01-01

    The site of a delayed hypersensitivity reaction to tuberculin or bovine serum ablumin was shown to contain mechanisms that expressed increased antibacterial activity, as evidenced by restricted growth of a local inoculum of Listeria monocytogenes. As was the case with a delayed hypersensitivity reaction, the local generation of antibacterial activity was antigen specific and T-cell dependent. Antibacterial resistance was always expressed at the site of injection of specific antigen in sensiti...

  4. Thioredoxin A Is Essential for Motility and Contributes to Host Infection of Listeria monocytogenes via Redox Interactions

    Directory of Open Access Journals (Sweden)

    Changyong Cheng

    2017-06-01

    Full Text Available Microbes employ the thioredoxin system to defend against oxidative stress and ensure correct disulfide bonding to maintain protein function. Listeria monocytogenes has been shown to encode a putative thioredoxin, TrxA, but its biological roles and underlying mechanisms remain unknown. Here, we showed that expression of L. monocytogenes TrxA is significantly induced in bacteria treated with the thiol-specific oxidizing agent, diamide. Deletion of trxA markedly compromised tolerance of the pathogen to diamide, and mainly impaired early stages of infection in human intestinal epithelial Caco-2 cells. In addition, most trxA mutant bacteria were not associated with polymerized actin, and the rare bacteria that were associated with polymerized actin displayed very short tails or clouds during infection. Deletion or constitutive overexpression of TrxA, which was regulated by SigH, severely attenuated the virulence of the pathogen. Transcriptome analysis of L. monocytogenes revealed over 270 genes that were differentially transcribed in the ΔtrxA mutant compared to the wild-type, especially for the virulence-associated genes plcA, mpl, hly, actA, and plcB. Particularly, deletion of TrxA completely reduced LLO expression, and thereby led to a thoroughly impaired hemolytic activity. Expression of these virulence factors are positively regulated by the master regulator PrfA that was found here to use TrxA to maintain its reduced forms for activation. Interestingly, the trxA deletion mutant completely lacked flagella and was non-motile. We further confirmed that this deficiency is attributable to TrxA in maintaining the reduced intracellular monomer status of MogR, the key regulator for flagellar formation, to ensure correct dimerization. In summary, we demonstrated for the first time that L. monocytogenes thioredoxin A as a vital cellular reductase is essential for maintaining a highly reducing environment in the bacterial cytosol, which provides a

  5. Thioredoxin A Is Essential for Motility and Contributes to Host Infection of Listeria monocytogenes via Redox Interactions.

    Science.gov (United States)

    Cheng, Changyong; Dong, Zhimei; Han, Xiao; Wang, Hang; Jiang, Li; Sun, Jing; Yang, Yongchun; Ma, Tiantian; Shao, Chunyan; Wang, Xiaodu; Chen, Zhongwei; Fang, Weihuan; Freitag, Nancy E; Huang, Huarong; Song, Houhui

    2017-01-01

    Microbes employ the thioredoxin system to defend against oxidative stress and ensure correct disulfide bonding to maintain protein function. Listeria monocytogenes has been shown to encode a putative thioredoxin, TrxA, but its biological roles and underlying mechanisms remain unknown. Here, we showed that expression of L. monocytogenes TrxA is significantly induced in bacteria treated with the thiol-specific oxidizing agent, diamide. Deletion of trxA markedly compromised tolerance of the pathogen to diamide, and mainly impaired early stages of infection in human intestinal epithelial Caco-2 cells. In addition, most trxA mutant bacteria were not associated with polymerized actin, and the rare bacteria that were associated with polymerized actin displayed very short tails or clouds during infection. Deletion or constitutive overexpression of TrxA, which was regulated by SigH, severely attenuated the virulence of the pathogen. Transcriptome analysis of L. monocytogenes revealed over 270 genes that were differentially transcribed in the Δ trxA mutant compared to the wild-type, especially for the virulence-associated genes plcA, mpl, hly, actA , and plcB . Particularly, deletion of TrxA completely reduced LLO expression, and thereby led to a thoroughly impaired hemolytic activity. Expression of these virulence factors are positively regulated by the master regulator PrfA that was found here to use TrxA to maintain its reduced forms for activation. Interestingly, the trxA deletion mutant completely lacked flagella and was non-motile. We further confirmed that this deficiency is attributable to TrxA in maintaining the reduced intracellular monomer status of MogR, the key regulator for flagellar formation, to ensure correct dimerization. In summary, we demonstrated for the first time that L. monocytogenes thioredoxin A as a vital cellular reductase is essential for maintaining a highly reducing environment in the bacterial cytosol, which provides a favorable condition for

  6. Anger expression among Danish cyclists and drivers: A comparison based on mode specific anger expression inventories

    DEFF Research Database (Denmark)

    Møller, Mette; Haustein, Sonja

    2017-01-01

    , gender, self-reported aggressive behaviours and traffic fines: Women scored for instance lower in physical expression, while older people scored higher in constructive expression. The effect of age and gender on anger expression among drivers and cyclists remained significant when controlling......Based on the short form of the driving anger expression inventory (DAX-short, 15-item), the present study developed an adapted version of the DAX for cyclists (CAX, 14 items). The data basis was an online survey of 2000 inhabitants of Denmark. A principle component analysis on the translated DAX...... for exposure and other factors in linear regression analyses. These analyses also showed a relationship between a positive attitude towards driving and higher levels of anger expression among drivers, while this was not the case for cyclists....

  7. Construction and Development of a Cardiac Tissue-Specific and Hypoxia-Inducible Expression Vector

    Directory of Open Access Journals (Sweden)

    Shahrooz Ghaderi

    2018-03-01

    Full Text Available Purpose: Cardiovascular gene therapy is a sophisticated approach, thanks to the safety of vectors, stable transgene expression, delivery method, and different layers of the heart. To date, numerous expression vectors have been introduced in biotechnology and biopharmacy industries in relation to genetic manipulation. Despite the rapid growth of these modalities, they must be intelligently designed, addressing the cardiac-specific transgene expression and less side effects. Herein, we conducted a pilot project aiming to design a cardiac-specific hypoxia-inducible expression cassette. Methods: We explored a new approach to design an expression cassette containing cardiac specific enhancer, hypoxia response elements (HRE, cardiac specific promoter, internal ribosome entry site (IRES, and beta globin poly A sequence to elicit specific and inducible expression of the gene of interest. Enhanced green fluorescent protein (eGFP was sub-cloned by BglII and NotI into the cassette. The specificity and inducible expression of the cassette was determined in both mouse myoblast C2C12 and mammary glandular tumor 4T1 as ‘twin’ cells. eGFP expression was evaluated by immunofluorescence microscope and flow cytometry at 520 nm emission peak. Results: Our data revealed that the designed expression cassette provided tissue specific and hypoxia inducible (O2<1% transgene expression. Conclusion: It is suggested that cardiac-specific enhancer combined with cardiac-specific promoter are efficient for myoblast specific gene expression. As well, this is for the first time that HRE are derived from three well known hypoxia-regulated promoters. Therefore, there is no longer need to overlap PCR process for one repeated sequence just in one promoter.

  8. Tissue specific and androgen-regulated expression of human prostate-specific transglutaminase

    NARCIS (Netherlands)

    H.J. Dubbink (Erik Jan); N.S. Verkaik (Nicole); P.W. Faber; J. Trapman (Jan); F.H. Schröder (Fritz); J.C. Romijn (Johannes)

    1996-01-01

    textabstractTransglutaminases (TGases) are calcium-dependent enzymes catalysing the post-translational cross-linking of proteins. In the prostate at least two TGases are present, the ubiquitously expressed tissue-type TGase (TGC), and a prostate-restricted TGase (TGP).

  9. A novel mammal-specific three partite enhancer element regulates node and notochord-specific Noto expression.

    Directory of Open Access Journals (Sweden)

    Leonie Alten

    Full Text Available The vertebrate organizer and notochord have conserved, essential functions for embryonic development and patterning. The restricted expression of developmental regulators in these tissues is directed by specific cis-regulatory modules (CRMs whose sequence conservation varies considerably. Some CRMs have been conserved throughout vertebrates and likely represent ancestral regulatory networks, while others have diverged beyond recognition but still function over a wide evolutionary range. Here we identify and characterize a mammalian-specific CRM required for node and notochord specific (NNC expression of NOTO, a transcription factor essential for node morphogenesis, nodal cilia movement and establishment of laterality in mouse. A 523 bp enhancer region (NOCE upstream the Noto promoter was necessary and sufficient for NNC expression from the endogenous Noto locus. Three subregions in NOCE together mediated full activity in vivo. Binding sites for known transcription factors in NOCE were functional in vitro but dispensable for NOCE activity in vivo. A FOXA2 site in combination with a novel motif was necessary for NOCE activity in vivo. Strikingly, syntenic regions in non-mammalian vertebrates showed no recognizable sequence similarities. In contrast to its activity in mouse NOCE did not drive NNC expression in transgenic fish. NOCE represents a novel, mammal-specific CRM required for the highly restricted Noto expression in the node and nascent notochord and thus regulates normal node development and function.

  10. A novel mammal-specific three partite enhancer element regulates node and notochord-specific Noto expression.

    Science.gov (United States)

    Alten, Leonie; Schuster-Gossler, Karin; Eichenlaub, Michael P; Wittbrodt, Beate; Wittbrodt, Joachim; Gossler, Achim

    2012-01-01

    The vertebrate organizer and notochord have conserved, essential functions for embryonic development and patterning. The restricted expression of developmental regulators in these tissues is directed by specific cis-regulatory modules (CRMs) whose sequence conservation varies considerably. Some CRMs have been conserved throughout vertebrates and likely represent ancestral regulatory networks, while others have diverged beyond recognition but still function over a wide evolutionary range. Here we identify and characterize a mammalian-specific CRM required for node and notochord specific (NNC) expression of NOTO, a transcription factor essential for node morphogenesis, nodal cilia movement and establishment of laterality in mouse. A 523 bp enhancer region (NOCE) upstream the Noto promoter was necessary and sufficient for NNC expression from the endogenous Noto locus. Three subregions in NOCE together mediated full activity in vivo. Binding sites for known transcription factors in NOCE were functional in vitro but dispensable for NOCE activity in vivo. A FOXA2 site in combination with a novel motif was necessary for NOCE activity in vivo. Strikingly, syntenic regions in non-mammalian vertebrates showed no recognizable sequence similarities. In contrast to its activity in mouse NOCE did not drive NNC expression in transgenic fish. NOCE represents a novel, mammal-specific CRM required for the highly restricted Noto expression in the node and nascent notochord and thus regulates normal node development and function.

  11. Supplementary Material for: Global expression differences and tissue specific expression differences in rice evolution result in two contrasting types of differentially expressed genes

    KAUST Repository

    Horiuchi, Youko; Harushima, Yoshiaki; Fujisawa, Hironori; Mochizuki, Takako; Fujita, Masahiro; Ohyanagi, Hajime; Kurata, Nori

    2015-01-01

    Abstract Background Since the development of transcriptome analysis systems, many expression evolution studies characterized evolutionary forces acting on gene expression, without explicit discrimination between global expression differences and tissue specific expression differences. However, different types of gene expression alteration should have different effects on an organism, the evolutionary forces that act on them might be different, and different types of genes might show different types of differential expression between species. To confirm this, we studied differentially expressed (DE) genes among closely related groups that have extensive gene expression atlases, and clarified characteristics of different types of DE genes including the identification of regulating loci for differential expression using expression quantitative loci (eQTL) analysis data. Results We detected differentially expressed (DE) genes between rice subspecies in five homologous tissues that were verified using japonica and indica transcriptome atlases in public databases. Using the transcriptome atlases, we classified DE genes into two types, global DE genes and changed-tissues DE genes. Global type DE genes were not expressed in any tissues in the atlas of one subspecies, however changed-tissues type DE genes were expressed in both subspecies with different tissue specificity. For the five tissues in the two japonica-indica combinations, 4.6 ± 0.8 and 5.9 ± 1.5 % of highly expressed genes were global and changed-tissues DE genes, respectively. Changed-tissues DE genes varied in number between tissues, increasing linearly with the abundance of tissue specifically expressed genes in the tissue. Molecular evolution of global DE genes was rapid, unlike that of changed-tissues DE genes. Based on gene ontology, global and changed-tissues DE genes were different, having no common GO terms. Expression differences of most global DE genes were regulated by cis

  12. Lysine-specific demethylase 2A expression is associated with cell growth and cyclin D1 expression in colorectal adenocarcinoma.

    Science.gov (United States)

    Cao, Lin-Lin; Du, Changzheng; Liu, Hangqi; Pei, Lin; Qin, Li; Jia, Mei; Wang, Hui

    2018-04-01

    Lysine-specific demethylase 2A (KDM2A), a specific H3K36me1/2 demethylase, has been reported to be closely associated with several types of cancer. In this study, we aimed to investigate the expression and function of KDM2A in colorectal adenocarcinoma. A total of 215 colorectal adenocarcinoma specimens were collected, and then subjected to immunohistochemistry assay to evaluate the expression levels of KDM2A, cyclin D1 and other proteins in colorectal adenocarcinoma tissues. Real-time polymerase chain reaction, Western blot, and other molecular biology methods were used to explore the role of KDM2A in colorectal adenocarcinoma cells. In this study, we report that the expression level of KDM2A is high in colorectal adenocarcinoma tissues, and this high expression promotes the proliferation and colony formation of colorectal adenocarcinoma cells, as demonstrated by KDM2A knockdown experiments. In addition, the expression of KDM2A is closely associated with cyclin D1 expression in colorectal adenocarcinoma tissues and cell lines. Our study reveals a novel role for high-expressed KDM2A in colorectal adenocarcinoma cell growth, and that the expression of KDM2A is associated with that of cyclin D1 in colorectal adenocarcinoma.

  13. Allele Workbench: transcriptome pipeline and interactive graphics for allele-specific expression.

    Directory of Open Access Journals (Sweden)

    Carol A Soderlund

    Full Text Available Sequencing the transcriptome can answer various questions such as determining the transcripts expressed in a given species for a specific tissue or condition, evaluating differential expression, discovering variants, and evaluating allele-specific expression. Differential expression evaluates the expression differences between different strains, tissues, and conditions. Allele-specific expression evaluates expression differences between parental alleles. Both differential expression and allele-specific expression have been studied for heterosis (hybrid vigor, where the hybrid has improved performance over the parents for one or more traits. The Allele Workbench software was developed for a heterosis study that evaluated allele-specific expression for a mouse F1 hybrid using libraries from multiple tissues with biological replicates. This software has been made into a distributable package, which includes a pipeline, a Java interface to build the database, and a Java interface for query and display of the results. The required input is a reference genome, annotation file, and one or more RNA-Seq libraries with optional replicates. It evaluates allelic imbalance at the SNP and transcript level and flags transcripts with significant opposite directional allele-specific expression. The Java interface allows the user to view data from libraries, replicates, genes, transcripts, exons, and variants, including queries on allele imbalance for selected libraries. To determine the impact of allele-specific SNPs on protein folding, variants are annotated with their effect (e.g., missense, and the parental protein sequences may be exported for protein folding analysis. The Allele Workbench processing results in transcript files and read counts that can be used as input to the previously published Transcriptome Computational Workbench, which has a new algorithm for determining a trimmed set of gene ontology terms. The software with demo files is available

  14. Various Ready-to-Eat Products from Retail Stores Linked to Occurrence of Diverse Listeria monocytogenes and Listeria spp. Isolates.

    Science.gov (United States)

    Vongkamjan, Kitiya; Fuangpaiboon, Janejira; Turner, Matthew P; Vuddhakul, Varaporn

    2016-02-01

    Listeriosis outbreaks have been associated with a variety of foods. This study investigated the prevalence and diversity of Listeria monocytogenes and Listeria spp. in ready-to-eat (RTE) products and evaluated the performance of a rapid detection method, the 3M molecular detection assay for L. monocytogenes (MDA-LM), for detection of L. monocytogenes. Assay results were compared with those obtained using the U.S. Food and Drug Administration standard culture method described in the Bacteriological Analytical Manual. Products (n = 200) were purchased from retail stores: 122 aquatic products, 22 products of animal origin, 18 vegetarian products, 15 deli meat products, 13 salad and vegetable products, 4 desserts, 2 egg-based products, and 4 other products. L. monocytogenes prevalence was comparable with both methods. Overall, 15 (7.5%) of 200 samples were positive for L. monocytogenes: 3% of aquatic products, 1.5% of products of animal origin, 1% of vegetarian products, and 2% of deli meat products. Compared with the standard culture method, the sensitivity, specificity, and the accuracy of the MDA-LM were 86.7% (95% confidence interval, 58.4 to 97.7%), 98.4% (95% confidence interval, 95.0 to 99.6%), and 97.5%, respectively. Using the culture-based method, 18 (9%) of 200 samples were positive for Listeria species other than L. monocytogenes. Listeria isolates from these samples were classified into nine allelic types (ATs). The majority of isolates were classified as ATs 58 and 74, which were identified as L. monocytogenes lineages I and IV, respectively. Listeria innocua and Listeria welshimeri also were represented by isolates of multiple ATs. The MDA-LM is a rapid and reliable technique for detecting L. monocytogenes in various RTE foods. Further study is needed to develop effective control strategies to reduce L. monocytogenes contamination in RTE foods.

  15. Effect of gamma-irradiation on the survival of Listeria monocytogenes and allergenicity of cherry tomatoes

    International Nuclear Information System (INIS)

    Todoriki, Setsuko; Bari, Latiful; Kitta, Kazumi; Ohba, Mika; Ito, Yasuhiro; Tsujimoto, Yuka; Kanamori, Norihito; Yano, Erika; Moriyama, Tatsuya; Kawamura, Yukio; Kawamoto, Shinichi

    2009-01-01

    The presence of Listeria monocytogenes in fresh produce is a growing concern because of the possibility of food-borne illness. Ionizing radiation is an effective non-thermal means of eliminating pathogenic bacteria in fresh produce; however, the effect of ionizing irradiation on the allergenic properties of the host commodities remains unknown. This study aimed (i) to determine the effective dose of gamma-irradiation in eliminating L. monocytogenes on whole cherry tomatoes and (ii) to evaluate the effect of gamma-irradiation on the allergenic properties of tomato proteins. Cherry tomatoes that were inoculated with a mixture of five L. monocytogenes strains were treated with gamma-rays from a 60 Co source. A 1.25 kGy dose of gamma-irradiation was found to be sufficient to eliminate L. monocytogenes on whole cherry tomatoes. The immunoblot profile of serum samples obtained from two patients with tomato allergy revealed that gamma-irradiation did not affect the allergenicity of tomato proteins for up to 7 days after irradiation when the tomatoes were stored at 20 deg. C. Additionally, the m-RNA levels of β-fructofuranosidase, polygalacturonase, pectin esterase, and superoxide dismutase, the main allergenic proteins in tomato, were not affected by the applied irradiation dose. Thus, this study demonstrated that a 1.25 kGy dose of gamma-irradiation effectively eliminates L. monocytogenes on cherry tomatoes without affecting the expression of allergenic proteins in the fruits.

  16. Effect of gamma-irradiation on the survival of Listeria monocytogenes and allergenicity of cherry tomatoes

    Science.gov (United States)

    Todoriki, Setsuko; Bari, Latiful; Kitta, Kazumi; Ohba, Mika; Ito, Yasuhiro; Tsujimoto, Yuka; Kanamori, Norihito; Yano, Erika; Moriyama, Tatsuya; Kawamura, Yukio; Kawamoto, Shinichi

    2009-07-01

    The presence of Listeria monocytogenes in fresh produce is a growing concern because of the possibility of food-borne illness. Ionizing radiation is an effective non-thermal means of eliminating pathogenic bacteria in fresh produce; however, the effect of ionizing irradiation on the allergenic properties of the host commodities remains unknown. This study aimed (i) to determine the effective dose of gamma-irradiation in eliminating L. monocytogenes on whole cherry tomatoes and (ii) to evaluate the effect of gamma-irradiation on the allergenic properties of tomato proteins. Cherry tomatoes that were inoculated with a mixture of five L. monocytogenes strains were treated with gamma-rays from a 60Co source. A 1.25 kGy dose of gamma-irradiation was found to be sufficient to eliminate L. monocytogenes on whole cherry tomatoes. The immunoblot profile of serum samples obtained from two patients with tomato allergy revealed that gamma-irradiation did not affect the allergenicity of tomato proteins for up to 7 days after irradiation when the tomatoes were stored at 20 °C. Additionally, the m-RNA levels of β-fructofuranosidase, polygalacturonase, pectin esterase, and superoxide dismutase, the main allergenic proteins in tomato, were not affected by the applied irradiation dose. Thus, this study demonstrated that a 1.25 kGy dose of gamma-irradiation effectively eliminates L. monocytogenes on cherry tomatoes without affecting the expression of allergenic proteins in the fruits.

  17. Adhesion to the host cell surface is sufficient to mediate Listeria monocytogenes entry into epithelial cells

    Science.gov (United States)

    Ortega, Fabian E.; Rengarajan, Michelle; Chavez, Natalie; Radhakrishnan, Prathima; Gloerich, Martijn; Bianchini, Julie; Siemers, Kathleen; Luckett, William S.; Lauer, Peter; Nelson, W. James; Theriot, Julie A.

    2017-01-01

    The intestinal epithelium is the first physiological barrier breached by the Gram-positive facultative pathogen Listeria monocytogenes during an in vivo infection. Listeria monocytogenes binds to the epithelial host cell receptor E-cadherin, which mediates a physical link between the bacterium and filamentous actin (F-actin). However, the importance of anchoring the bacterium to F-actin through E-cadherin for bacterial invasion has not been tested directly in epithelial cells. Here we demonstrate that depleting αE-catenin, which indirectly links E-cadherin to F-actin, did not decrease L. monocytogenes invasion of epithelial cells in tissue culture. Instead, invasion increased due to increased bacterial adhesion to epithelial monolayers with compromised cell–cell junctions. Furthermore, expression of a mutant E-cadherin lacking the intracellular domain was sufficient for efficient L. monocytogenes invasion of epithelial cells. Importantly, direct biotin-mediated binding of bacteria to surface lipids in the plasma membrane of host epithelial cells was sufficient for uptake. Our results indicate that the only requirement for L. monocytogenes invasion of epithelial cells is adhesion to the host cell surface, and that E-cadherin–mediated coupling of the bacterium to F-actin is not required. PMID:28877987

  18. Identification of a Peptide-Pheromone that Enhances Listeria monocytogenes Escape from Host Cell Vacuoles

    Science.gov (United States)

    Xayarath, Bobbi; Alonzo, Francis; Freitag, Nancy E.

    2015-01-01

    Listeria monocytogenes is a Gram-positive facultative intracellular bacterial pathogen that invades mammalian cells and escapes from membrane-bound vacuoles to replicate within the host cell cytosol. Gene products required for intracellular bacterial growth and bacterial spread to adjacent cells are regulated by a transcriptional activator known as PrfA. PrfA becomes activated following L. monocytogenes entry into host cells, however the signal that stimulates PrfA activation has not yet been defined. Here we provide evidence for L. monocytogenes secretion of a small peptide pheromone, pPplA, which enhances the escape of L. monocytogenes from host cell vacuoles and may facilitate PrfA activation. The pPplA pheromone is generated via the proteolytic processing of the PplA lipoprotein secretion signal peptide. While the PplA lipoprotein is dispensable for pathogenesis, bacteria lacking the pPplA pheromone are significantly attenuated for virulence in mice and have a reduced efficiency of bacterial escape from the vacuoles of nonprofessional phagocytic cells. Mutational activation of PrfA restores virulence and eliminates the need for pPplA-dependent signaling. Experimental evidence suggests that the pPplA peptide may help signal to L. monocytogenes its presence within the confines of the host cell vacuole, stimulating the expression of gene products that contribute to vacuole escape and facilitating PrfA activation to promote bacterial growth within the cytosol. PMID:25822753

  19. Effect of gamma-irradiation on the survival of Listeria monocytogenes and allergenicity of cherry tomatoes

    Energy Technology Data Exchange (ETDEWEB)

    Todoriki, Setsuko [National Food Research Institute, Tsukuba, Ibaraki 305-8642 (Japan)], E-mail: setsuko@affrc.go.jp; Bari, Latiful; Kitta, Kazumi; Ohba, Mika; Ito, Yasuhiro; Tsujimoto, Yuka [National Food Research Institute, Tsukuba, Ibaraki 305-8642 (Japan); Kanamori, Norihito [Japan International Research Center for Agricultural Science, Tsukuba, Ibaraki 305-8686 (Japan); Yano, Erika; Moriyama, Tatsuya; Kawamura, Yukio [School of Agriculture, Kinki University, Nara-city, Nara 631-8505 (Japan); Kawamoto, Shinichi [National Food Research Institute, Tsukuba, Ibaraki 305-8642 (Japan)

    2009-07-15

    The presence of Listeria monocytogenes in fresh produce is a growing concern because of the possibility of food-borne illness. Ionizing radiation is an effective non-thermal means of eliminating pathogenic bacteria in fresh produce; however, the effect of ionizing irradiation on the allergenic properties of the host commodities remains unknown. This study aimed (i) to determine the effective dose of gamma-irradiation in eliminating L. monocytogenes on whole cherry tomatoes and (ii) to evaluate the effect of gamma-irradiation on the allergenic properties of tomato proteins. Cherry tomatoes that were inoculated with a mixture of five L. monocytogenes strains were treated with gamma-rays from a {sup 60}Co source. A 1.25 kGy dose of gamma-irradiation was found to be sufficient to eliminate L. monocytogenes on whole cherry tomatoes. The immunoblot profile of serum samples obtained from two patients with tomato allergy revealed that gamma-irradiation did not affect the allergenicity of tomato proteins for up to 7 days after irradiation when the tomatoes were stored at 20 deg. C. Additionally, the m-RNA levels of {beta}-fructofuranosidase, polygalacturonase, pectin esterase, and superoxide dismutase, the main allergenic proteins in tomato, were not affected by the applied irradiation dose. Thus, this study demonstrated that a 1.25 kGy dose of gamma-irradiation effectively eliminates L. monocytogenes on cherry tomatoes without affecting the expression of allergenic proteins in the fruits.

  20. Highly specific expression of luciferase gene in lungs of naive nude mice directed by prostate-specific antigen promoter

    International Nuclear Information System (INIS)

    Li Hongwei; Li Jinzhong; Helm, Gregory A.; Pan Dongfeng

    2005-01-01

    PSA promoter has been demonstrated the utility for tissue-specific toxic gene therapy in prostate cancer models. Characterization of foreign gene overexpression in normal animals elicited by PSA promoter should help evaluate therapy safety. Here we constructed an adenovirus vector (AdPSA-Luc), containing firefly luciferase gene under the control of the 5837 bp long prostate-specific antigen promoter. A charge coupled device video camera was used to non-invasively image expression of firefly luciferase in nude mice on days 3, 7, 11 after injection of 2 x 10 9 PFU of AdPSA-Luc virus via tail vein. The result showed highly specific expression of the luciferase gene in lungs of mice from day 7. The finding indicates the potential limitations of the suicide gene therapy of prostate cancer based on selectivity of PSA promoter. By contrary, it has encouraging implications for further development of vectors via PSA promoter to enable gene therapy for pulmonary diseases

  1. Prevalence and Persistence of Listeria monocytogenes in Ready-to-Eat Tilapia Sashimi Processing Plants.

    Science.gov (United States)

    Chen, Bang-Yuan; Wang, Chung-Yi; Wang, Chia-Lan; Fan, Yang-Chi; Weng, I-Ting; Chou, Chung-Hsi

    2016-11-01

    A 2-year study was performed at two ready-to-eat tilapia sashimi processing plants (A and B) to identify possible routes of contamination with Listeria monocytogenes during processing. Samples were collected from the aquaculture environments, transportation tanks, processing plants, and final products. Seventy-nine L. monocytogenes isolates were found in the processing environments and final products; 3.96% (50 of 1,264 samples) and 3.86% (29 of 752 samples) of the samples from plants A and B, respectively, were positive for L. monocytogenes . No L. monocytogenes was detected in the aquaculture environments or transportation tanks. The predominant L. monocytogenes serotypes were 1/2b (55.70%) and 4b (37.97%); serotypes 3b and 4e were detected at much lower percentages. At both plants, most processing sections were contaminated with L. monocytogenes before the start of processing, which indicated that the cleaning and sanitizing methods did not achieve adequate pathogen removal. Eleven seropulsotypes were revealed by pulsed-field gel electrophoresis and serotyping. Analysis of seropulsotype distribution revealed that the contamination was disseminated by the processing work; the same seropulsotypes were repeatedly found along the work flow line and in the final products. Specific seropulsotypes were persistently found during different sampling periods, which suggests that the sanitation procedures or equipment used at these plants were inadequate. Plant staff should improve the sanitation procedures and equipment to reduce the risk of L. monocytogenes cross-contamination and ensure the safety of ready-to-eat tilapia products.

  2. Prevalence of Listeria monocytogenes in ready-to-eat seafood marketed in Thessaloniki (Northern Greece

    Directory of Open Access Journals (Sweden)

    N. Soultos

    2014-11-01

    Full Text Available Aim: In the current study, a contribution to the knowledge on the prevalence and level of contamination of Listeria monocytogenes in ready-to-eat (RTE seafood marketed in Thessaloniki (Northern Greece was provided; the serovar identity of the L. monocytogenes isolates was also determined. Materials and Methods: A total of 132 RTE seafood samples consisting of 74 smoked fish products, 18 salted fish products, 16 dried fish products, 9 raw marinated fish products, 10 cooked marinated cephalopods and 5 surimi crab stick products were analyzed. L. monocytogenes were isolated and enumerated based on ISO 11290-1/A1 and ISO 11290-2/A1 protocols, respectively, and identified using a multiplex polymerase chain reaction (PCR system utilizing genus and species specific primers. For the identification of serotypes a second multiplex PCR assay was used which clusters L. monocytogenes strains into four major serogroups. Results: Of the samples examined, 11 (8.3% proved positive for Listeria spp. with 8 (6.1% yielding L. monocytogenes. Only in one sample of smoked mackerel the level of L. monocytogenes exceeded the legal safety limit of 100 cfu/g set out in Commission Regulation (EC No. 1441/2007. Serotyping showed higher percentages of isolates belonging to PCR serogroup 3:1/2b, 3b, 7 (46.7% and serogroup 1:1/2a, 3a (40% followed by serogroup 4:4b, 4d, 4e (13.3%. Conclusion: This study demonstrated that L. monocytogenes can be isolated from processed RTE seafood products at retail in Thessaloniki (Northern Greece in low concentrations. However, the presence of this human pathogen in RTE seafood should not be overlooked, but it should be considered as having significance public health implications, particularly among the persons who are at greater risk. Therefore, RTE seafood should be produced under appropriate hygienic and technological conditions since the product does not undergo any treatment before consumption.

  3. Large scale gene expression meta-analysis reveals tissue-specific, sex-biased gene expression in humans

    Directory of Open Access Journals (Sweden)

    Benjamin Mayne

    2016-10-01

    Full Text Available The severity and prevalence of many diseases are known to differ between the sexes. Organ specific sex-biased gene expression may underpin these and other sexually dimorphic traits. To further our understanding of sex differences in transcriptional regulation, we performed meta-analyses of sex biased gene expression in multiple human tissues. We analysed 22 publicly available human gene expression microarray data sets including over 2500 samples from 15 different tissues and 9 different organs. Briefly, by using an inverse-variance method we determined the effect size difference of gene expression between males and females. We found the greatest sex differences in gene expression in the brain, specifically in the anterior cingulate cortex, (1818 genes, followed by the heart (375 genes, kidney (224 genes, colon (218 genes and thyroid (163 genes. More interestingly, we found different parts of the brain with varying numbers and identity of sex-biased genes, indicating that specific cortical regions may influence sexually dimorphic traits. The majority of sex-biased genes in other tissues such as the bladder, liver, lungs and pancreas were on the sex chromosomes or involved in sex hormone production. On average in each tissue, 32% of autosomal genes that were expressed in a sex-biased fashion contained androgen or estrogen hormone response elements. Interestingly, across all tissues, we found approximately two-thirds of autosomal genes that were sex-biased were not under direct influence of sex hormones. To our knowledge this is the largest analysis of sex-biased gene expression in human tissues to date. We identified many sex-biased genes that were not under the direct influence of sex chromosome genes or sex hormones. These may provide targets for future development of sex-specific treatments for diseases.

  4. The use of Listeria monocytogenes as a DNA delivery vector for cancer gene therapy.

    LENUS (Irish Health Repository)

    Tangney, Mark

    2012-01-31

    Listeria monocytogenes is an intracellular pathogen that lyses the phagosomal vacuole of infected cells, proliferates in the host cell cytoplasm and can actively enter adjacent cells. The pathogen is therefore well suited to exploitation as a vector for the delivery of DNA to target cells as the lifecycle favors cellular targeting with vector amplification and the potential for cell-to-cell spread. We have recently demonstrated DNA transfer by L. monocytogenes in growing tumors in murine models. Our approach exploited an ampicillin sensitive stain of L. monocytogenes which can be lysed through systemic administration of ampicillin to facilitate release of plasmid DNA for expression by infected mammalian cells. Here, we discuss the implications of this technology and the potential for future improvements of the system.

  5. In vivo transcriptional profiling of Listeria monocytogenes and mutagenesis identify new virulence factors involved in infection.

    Directory of Open Access Journals (Sweden)

    Ana Camejo

    2009-05-01

    Full Text Available Listeria monocytogenes is a human intracellular pathogen able to colonize host tissues after ingestion of contaminated food, causing severe invasive infections. In order to gain a better understanding of the nature of host-pathogen interactions, we studied the L. monocytogenes genome expression during mouse infection. In the spleen of infected mice, approximately 20% of the Listeria genome is differentially expressed, essentially through gene activation, as compared to exponential growth in rich broth medium. Data presented here show that, during infection, Listeria is in an active multiplication phase, as revealed by the high expression of genes involved in replication, cell division and multiplication. In vivo bacterial growth requires increased expression of genes involved in adaptation of the bacterial metabolism and stress responses, in particular to oxidative stress. Listeria interaction with its host induces cell wall metabolism and surface expression of virulence factors. During infection, L. monocytogenes also activates subversion mechanisms of host defenses, including resistance to cationic peptides, peptidoglycan modifications and release of muramyl peptides. We show that the in vivo differential expression of the Listeria genome is coordinated by a complex regulatory network, with a central role for the PrfA-SigB interplay. In particular, L. monocytogenes up regulates in vivo the two major virulence regulators, PrfA and VirR, and their downstream effectors. Mutagenesis of in vivo induced genes allowed the identification of novel L. monocytogenes virulence factors, including an LPXTG surface protein, suggesting a role for S-layer glycoproteins and for cadmium efflux system in Listeria virulence.

  6. Analysis of cell-type-specific gene expression during mouse spermatogenesis

    DEFF Research Database (Denmark)

    Almstrup, Kristian; Nielsen, John E; Hansen, Martin Asser

    2004-01-01

    In rodents, changes in gene expression during spermatogenesis can be monitored by sampling testis from each day during postnatal development. However, changes in gene expression at the tissue level can reflect changes in the concentration of an mRNA in a specific cell type, changes in volume of s...

  7. Elucidation of Listeria monocytogenes contamination routes in cold-smoked salmon processing plants detected by DNA-based typing methods

    DEFF Research Database (Denmark)

    Vogel, Birte Fonnesbech; Huss, Hans Henrik; Ojeniyi, B.

    2001-01-01

    and environment could not be excluded. Contamination of the product occurred in specific areas (the brining and slicing areas). In plant I, the same RAPD type (RAPD type 12) was found over a 4-year period, indicating that an established in-house flora persisted and was not eliminated by routine hygienic......, monocytogenes). A total of 429 strains of L. monocytogenes were subsequently compared by random amplified polymorphic DNA (RAPD) profiling, and 55 different RAPD types were found. The RAPD types detected on the products were identical to types found on the processing equipment and in the processing environment...... procedures. In plant II, where the prevalence of L, monocytogenes was much tower, no RAPD type persisted over long periods of time, and several different L, monocytogenes RAPD types were isolated. This indicates that persistent strains may be avoided by rigorous cleaning and sanitation; however, due...

  8. Genotypes Associated with Listeria monocytogenes Isolates Displaying Impaired or Enhanced Tolerances to Cold, Salt, Acid, or Desiccation Stress

    DEFF Research Database (Denmark)

    Hingston, Patricia A.; Chen, Jessica; Dhillon, Bhavjinder K

    2017-01-01

    elements. A whole genome single-nucleotide-variants phylogeny revealed sporadic distribution of tolerant isolates and closely related sensitive and tolerant isolates, highlighting that minor genetic differences can influence the stress tolerance of L. monocytogenes. Specifically, a number of cold......The human pathogen Listeria monocytogenes is a large concern in the food industry where its continuous detection in food products has caused a string of recalls in North America and Europe. Most recognized for its ability to grow in foods during refrigerated storage, L. monocytogenes can also...... tolerate several other food-related stresses with some strains possessing higher levels of tolerances than others. The objective of this study was to use a combination of phenotypic analyses and whole genome sequencing to elucidate potential relationships between L. monocytogenes genotypes and food...

  9. Microarray meta-analysis to explore abiotic stress-specific gene expression patterns in Arabidopsis.

    Science.gov (United States)

    Shen, Po-Chih; Hour, Ai-Ling; Liu, Li-Yu Daisy

    2017-12-01

    Abiotic stresses are the major limiting factors that affect plant growth, development, yield and final quality. Deciphering the underlying mechanisms of plants' adaptations to stresses using few datasets might overlook the different aspects of stress tolerance in plants, which might be simultaneously and consequently operated in the system. Fortunately, the accumulated microarray expression data offer an opportunity to infer abiotic stress-specific gene expression patterns through meta-analysis. In this study, we propose to combine microarray gene expression data under control, cold, drought, heat, and salt conditions and determined modules (gene sets) of genes highly associated with each other according to the observed expression data. By analyzing the expression variations of the Eigen genes from different conditions, we had identified two, three, and five gene modules as cold-, heat-, and salt-specific modules, respectively. Most of the cold- or heat-specific modules were differentially expressed to a particular degree in shoot samples, while most of the salt-specific modules were differentially expressed to a particular degree in root samples. A gene ontology (GO) analysis on the stress-specific modules suggested that the gene modules exclusively enriched stress-related GO terms and that different genes under the same GO terms may be alternatively disturbed in different conditions. The gene regulatory events for two genes, DREB1A and DEAR1, in the cold-specific gene module had also been validated, as evidenced through the literature search. Our protocols study the specificity of the gene modules that were specifically activated under a particular type of abiotic stress. The biplot can also assist to visualize the stress-specific gene modules. In conclusion, our approach has the potential to further elucidate mechanisms in plants and beneficial for future experiments design under different abiotic stresses.

  10. An ecological perspective of Listeria monocytogenes biofilms in food processing facilities.

    Science.gov (United States)

    Valderrama, Wladir B; Cutter, Catherine N

    2013-01-01

    Listeria monocytogenes can enter the food chain at virtually any point. However, food processing environments seem to be of particular importance. From an ecological point of view, food processing facilities are microbial habitats that are constantly disturbed by cleaning and sanitizing procedures. Although L. monocytogenes is considered ubiquitous in nature, it is important to recognize that not all L. monocytogenes strains appear to be equally distributed; the distribution of the organism seems to be related to certain habitats. Currently, no direct evidence exists that L. monocytogenes-associated biofilms have played a role in food contamination or foodborne outbreaks, likely because biofilm isolation and identification are not part of an outbreak investigation, or the definition of biofilm is unclear. Because L. monocytogenes is known to colonize surfaces, we suggest that contamination patterns may be studied in the context of how biofilm formation is influenced by the environment within food processing facilities. In this review, direct and indirect epidemiological and phenotypic evidence of lineage-related biofilm formation capacity to specific ecological niches will be discussed. A critical view on the development of the biofilm concept, focused on the practical implications, strengths, and weaknesses of the current definitions also is discussed. The idea that biofilm formation may be an alternative surrogate for microbial fitness is proposed. Furthermore, current research on the influence of environmental factors on biofilm formation is discussed.

  11. An outbreak of an unusual strain of Listeria monocytogenes infection in North-East Scotland.

    Science.gov (United States)

    Okpo, Emmanuel; Leith, Jayne; Smith-Palmer, Alison; Bell, John; Parks, Duncan; Browning, Fiona; Byers, Lynn; Corrigan, Helen; Webster, Diana; Karcher, Anne M; Murray, Andrew; Storey, Tom

    2015-01-01

    Listeria monocytogenes infection is an important cause of illness and hospitalization in vulnerable individuals. In the present study, we describe a community outbreak of Listeria monocytogenes in the North-East region of Scotland, which was epidemiologically, environmentally and microbiologically linked to a local meat product and ready-to-eat product manufacturer. Infected individuals were interviewed, and an environmental investigation was conducted. Clinical and environmental samples were tested by culture, and isolates were typed by fluorescent amplified fragment length polymorphism (fAFLP). Three cases of Listeria monocytogenes were linked geographically, had the same serotype (1/2a) and were indistinguishable by fAFLP type XII.6. The human, food and environmental isolates were of the same serotype and were indistinguishable by molecular typing. This is the first community outbreak of L. monocytogenes reported in Scotland since the current outbreak surveillance was established in 1996. Epidemiological and laboratory evidence indicated poor hand hygiene, unhygienic practices and cross-contamination throughout the manufacturing process of ready-to-eat foods as a possible cause of the outbreak. More stringent control of commercial food establishments that provide ready-to-eat food and the need to advise specifically vulnerable groups, e.g., pregnant women, of the risk of L. monocytogenes in ready-to-eat food is urgently needed. Copyright © 2015 King Saud Bin Abdulaziz University for Health Sciences. Published by Elsevier Ltd. All rights reserved.

  12. Listeria monocytogenes incidence changes and diversity in some Brazilian dairy industries and retail products.

    Science.gov (United States)

    Oxaran, Virginie; Lee, Sarah Hwa In; Chaul, Luíza Toubas; Corassin, Carlos Humberto; Barancelli, Giovana Verginia; Alves, Virgínia Farias; de Oliveira, Carlos Augusto Fernandes; Gram, Lone; De Martinis, Elaine Cristina Pereira

    2017-12-01

    Listeria monocytogenes can cause listeriosis, a severe foodborne disease. In Brazil, despite very few reported cases of listeriosis, the pathogen has been repeatedly isolated from dairies. This has led the government to implement specific legislation to reduce the hazard. Here, we determined the incidence of L. monocytogenes in five dairies and retail products in the Southeast and Midwest regions of Brazil over eight months. Of 437 samples, three samples (0.7%) from retail and only one sample (0.2%) from the dairies were positive for L. monocytogenes. Thus, the contamination rate was significantly reduced as compared to previous studies. MultiLocus Sequence Typing (MLST) was used to determine if contamination was caused by new or persistent clones leading to the first MLST profile of L. monocytogenes from the Brazilian dairy industry. The processing environment isolate is of concern being a sequence-type (ST) 2, belonging to the lineage I responsible for the majority of listeriosis outbreaks. Also, ST3 and ST8 found in commercialized cheese have previously been reported in outbreaks. Despite the lower incidence, dairy products still pose a potential health risk and the occurrence of L. monocytogenes in dairies and retail products emphasize the need for continuous surveillance of this pathogen in the Brazilian dairy industry. Copyright © 2017 Elsevier Ltd. All rights reserved.

  13. Down regulation of macrophage IFNGR1 exacerbates systemic L. monocytogenes infection.

    Directory of Open Access Journals (Sweden)

    Emily M Eshleman

    2017-05-01

    Full Text Available Interferons (IFNs target macrophages to regulate inflammation and resistance to microbial infections. The type II IFN (IFNγ acts on a cell surface receptor (IFNGR to promote gene expression that enhance macrophage inflammatory and anti-microbial activity. Type I IFNs can dampen macrophage responsiveness to IFNγ and are associated with increased susceptibility to numerous bacterial infections. The precise mechanisms responsible for these effects remain unclear. Type I IFNs silence macrophage ifngr1 transcription and thus reduce cell surface expression of IFNGR1. To test how these events might impact macrophage activation and host resistance during bacterial infection, we developed transgenic mice that express a functional FLAG-tagged IFNGR1 (fGR1 driven by a macrophage-specific promoter. Macrophages from fGR1 mice expressed physiologic levels of cell surface IFNGR1 at steady state and responded equivalently to WT C57Bl/6 macrophages when treated with IFNγ alone. However, fGR1 macrophages retained cell surface IFNGR1 and showed enhanced responsiveness to IFNγ in the presence of type I IFNs. When fGR1 mice were infected with the bacterium Listeria monocytogenes their resistance was significantly increased, despite normal type I and II IFN production. Enhanced resistance was dependent on IFNγ and associated with increased macrophage activation and antimicrobial function. These results argue that down regulation of myeloid cell IFNGR1 is an important mechanism by which type I IFNs suppress inflammatory and anti-bacterial functions of macrophages.

  14. Tissue-specific RNA expression marks distant-acting developmental enhancers.

    Directory of Open Access Journals (Sweden)

    Han Wu

    2014-09-01

    Full Text Available Short non-coding transcripts can be transcribed from distant-acting transcriptional enhancer loci, but the prevalence of such enhancer RNAs (eRNAs within the transcriptome, and the association of eRNA expression with tissue-specific enhancer activity in vivo remain poorly understood. Here, we investigated the expression dynamics of tissue-specific non-coding RNAs in embryonic mouse tissues via deep RNA sequencing. Overall, approximately 80% of validated in vivo enhancers show tissue-specific RNA expression that correlates with tissue-specific enhancer activity. Globally, we identified thousands of tissue-specifically transcribed non-coding regions (TSTRs displaying various genomic hallmarks of bona fide enhancers. In transgenic mouse reporter assays, over half of tested TSTRs functioned as enhancers with reproducible activity in the predicted tissue. Together, our results demonstrate that tissue-specific eRNA expression is a common feature of in vivo enhancers, as well as a major source of extragenic transcription, and that eRNA expression signatures can be used to predict tissue-specific enhancers independent of known epigenomic enhancer marks.

  15. Identification of imprinted genes subject to parent-of-origin specific expression in Arabidopsis thaliana seeds

    LENUS (Irish Health Repository)

    McKeown, Peter C

    2011-08-12

    Abstract Background Epigenetic regulation of gene dosage by genomic imprinting of some autosomal genes facilitates normal reproductive development in both mammals and flowering plants. While many imprinted genes have been identified and intensively studied in mammals, smaller numbers have been characterized in flowering plants, mostly in Arabidopsis thaliana. Identification of additional imprinted loci in flowering plants by genome-wide screening for parent-of-origin specific uniparental expression in seed tissues will facilitate our understanding of the origins and functions of imprinted genes in flowering plants. Results cDNA-AFLP can detect allele-specific expression that is parent-of-origin dependent for expressed genes in which restriction site polymorphisms exist in the transcripts derived from each allele. Using a genome-wide cDNA-AFLP screen surveying allele-specific expression of 4500 transcript-derived fragments, we report the identification of 52 maternally expressed genes (MEGs) displaying parent-of-origin dependent expression patterns in Arabidopsis siliques containing F1 hybrid seeds (3, 4 and 5 days after pollination). We identified these MEGs by developing a bioinformatics tool (GenFrag) which can directly determine the identities of transcript-derived fragments from (i) their size and (ii) which selective nucleotides were added to the primers used to generate them. Hence, GenFrag facilitates increased throughput for genome-wide cDNA-AFLP fragment analyses. The 52 MEGs we identified were further filtered for high expression levels in the endosperm relative to the seed coat to identify the candidate genes most likely representing novel imprinted genes expressed in the endosperm of Arabidopsis thaliana. Expression in seed tissues of the three top-ranked candidate genes, ATCDC48, PDE120 and MS5-like, was confirmed by Laser-Capture Microdissection and qRT-PCR analysis. Maternal-specific expression of these genes in Arabidopsis thaliana F1 seeds was

  16. Identification of imprinted genes subject to parent-of-origin specific expression in Arabidopsis thaliana seeds

    Directory of Open Access Journals (Sweden)

    Wennblom Trevor J

    2011-08-01

    Full Text Available Abstract Background Epigenetic regulation of gene dosage by genomic imprinting of some autosomal genes facilitates normal reproductive development in both mammals and flowering plants. While many imprinted genes have been identified and intensively studied in mammals, smaller numbers have been characterized in flowering plants, mostly in Arabidopsis thaliana. Identification of additional imprinted loci in flowering plants by genome-wide screening for parent-of-origin specific uniparental expression in seed tissues will facilitate our understanding of the origins and functions of imprinted genes in flowering plants. Results cDNA-AFLP can detect allele-specific expression that is parent-of-origin dependent for expressed genes in which restriction site polymorphisms exist in the transcripts derived from each allele. Using a genome-wide cDNA-AFLP screen surveying allele-specific expression of 4500 transcript-derived fragments, we report the identification of 52 maternally expressed genes (MEGs displaying parent-of-origin dependent expression patterns in Arabidopsis siliques containing F1 hybrid seeds (3, 4 and 5 days after pollination. We identified these MEGs by developing a bioinformatics tool (GenFrag which can directly determine the identities of transcript-derived fragments from (i their size and (ii which selective nucleotides were added to the primers used to generate them. Hence, GenFrag facilitates increased throughput for genome-wide cDNA-AFLP fragment analyses. The 52 MEGs we identified were further filtered for high expression levels in the endosperm relative to the seed coat to identify the candidate genes most likely representing novel imprinted genes expressed in the endosperm of Arabidopsis thaliana. Expression in seed tissues of the three top-ranked candidate genes, ATCDC48, PDE120 and MS5-like, was confirmed by Laser-Capture Microdissection and qRT-PCR analysis. Maternal-specific expression of these genes in Arabidopsis thaliana F1

  17. Evolutionary constraints shape caste-specific gene expression across 15 ant species.

    Science.gov (United States)

    Morandin, Claire; Mikheyev, Alexander S; Pedersen, Jes Søe; Helanterä, Heikki

    2017-05-01

    Development of polymorphic phenotypes from similar genomes requires gene expression differences. However, little is known about how morph-specific gene expression patterns vary on a broad phylogenetic scale. We hypothesize that evolution of morph-specific gene expression, and consequently morph-specific phenotypic evolution, may be constrained by gene essentiality and the amount of pleiotropic constraints. Here, we use comparative transcriptomics of queen and worker morphs, that is, castes, from 15 ant species to understand the constraints of morph-biased gene expression. In particular, we investigate how measures of evolutionary constraints at the sequence level (expression level, connectivity, and number of gene ontology [GO] terms) correlate with morph-biased expression. Our results show that genes indeed vary in their potential to become morph-biased. The existence of genes that are constrained in becoming caste-biased potentially limits the evolutionary decoupling of the caste phenotypes, that is, it might result in "caste load" occasioning from antagonistic fitness variation, similarly to sexually antagonistic fitness variation between males and females. On the other hand, we suggest that genes under low constraints are released from antagonistic variation and thus more likely to be co-opted for morph specific use. Overall, our results suggest that the factors that affect sequence evolutionary rates and evolution of plastic expression may largely overlap. © 2017 The Author(s). Evolution © 2017 The Society for the Study of Evolution.

  18. Prevalence, enumeration and pheno- and genotypic characteristics of Listeria monocytogenes isolated from raw foods in South China

    Directory of Open Access Journals (Sweden)

    Moutong eChen

    2015-09-01

    Full Text Available Listeria monocytogenes is an important foodborne pathogen that can cause serious illness in immunocompromised individuals, pregnant women, the elderly, and newborns. The aim of this study was to: (i evaluate the prevalence and contamination level (most probable number, MPN of L. monocytogenes in 567 retail raw foods (fishery products, n=154; raw/fresh meat, n=123; frozen foods, n=110; edible fungi, n=108; vegetables, n=72 collected from South China and (ii to gain further knowledge on the phenotype and genotype distributions of this important foodborne pathogen. Approximately 22% of the samples were positive for L. monocytogenes. The contamination levels were between 0.3 and 10 MPN/g in 75.0%, between 10 and 100 MPN/g in 11.0% and less than 100 MPN/g in 14.0% of the countable samples. Five serogroups were identified among the177 foodborne L. monocytogenes isolates, with1/2a-3a (42.4% and1/2b-3b (26.0% serogroups being the most dominant. Serogroup I.1 and II.2 were only found in the edible mushrooms, while serogroup III was dominant in the fishery products, suggesting that specific serogroups of L. monocytogenes may have distinct ecological niches. Ten (5.6% L. monocytogenes isolates exhibited multidrug resistance. Genetic relatedness analysis revealed the absence of distinct associations between specific food types, antibiotic resistance, serogroups, and genetic diversity. The present study provided the first baseline data on the prevalence, contamination level, and characteristics of L. monocytogenes isolated from raw foods in South China. Some multidrug resistant strains belonged to the epidemiologically important serogroups (I.1 and II.1, implying a potential public health risk. In addition, these findings also provide basic information for the Chinese food safety associated authorities to draft appropriate standards to control L. monocytogenes contamination and improve microbiological safety of raw foods.

  19. Laterality of Facial Expressions of Emotion: Universal and Culture-Specific Influences

    Directory of Open Access Journals (Sweden)

    Manas K. Mandal

    2004-01-01

    Full Text Available Recent research indicates that (a the perception and expression of facial emotion are lateralized to a great extent in the right hemisphere, and, (b whereas facial expressions of emotion embody universal signals, culture-specific learning moderates the expression and interpretation of these emotions. In the present article, we review the literature on laterality and universality, and propose that, although some components of facial expressions of emotion are governed biologically, others are culturally influenced. We suggest that the left side of the face is more expressive of emotions, is more uninhibited, and displays culture-specific emotional norms. The right side of face, on the other hand, is less susceptible to cultural display norms and exhibits more universal emotional signals.

  20. Laterality of facial expressions of emotion: Universal and culture-specific influences.

    Science.gov (United States)

    Mandal, Manas K; Ambady, Nalini

    2004-01-01

    Recent research indicates that (a) the perception and expression of facial emotion are lateralized to a great extent in the right hemisphere, and, (b) whereas facial expressions of emotion embody universal signals, culture-specific learning moderates the expression and interpretation of these emotions. In the present article, we review the literature on laterality and universality, and propose that, although some components of facial expressions of emotion are governed biologically, others are culturally influenced. We suggest that the left side of the face is more expressive of emotions, is more uninhibited, and displays culture-specific emotional norms. The right side of face, on the other hand, is less susceptible to cultural display norms and exhibits more universal emotional signals. Copyright 2004 IOS Press

  1. Evaluation of DNA extraction methods for PCR-based detection of Listeria monocytogenes from vegetables.

    Science.gov (United States)

    Vojkovska, H; Kubikova, I; Kralik, P

    2015-03-01

    Epidemiological data indicate that raw vegetables are associated with outbreaks of Listeria monocytogenes. Therefore, there is a demand for the availability of rapid and sensitive methods, such as PCR assays, for the detection and accurate discrimination of L. monocytogenes. However, the efficiency of PCR methods can be negatively affected by inhibitory compounds commonly found in vegetable matrices that may cause false-negative results. Therefore, the sample processing and DNA isolation steps must be carefully evaluated prior to the introduction of such methods into routine practice. In this study, we compared the ability of three column-based and four magnetic bead-based commercial DNA isolation kits to extract DNA of the model micro-organism L. monocytogenes from raw vegetables. The DNA isolation efficiency of all isolation kits was determined using a triplex real-time qPCR assay designed to specifically detect L. monocytogenes. The kit with best performance, the PowerSoil(™) Microbial DNA Isolation Kit, is suitable for the extraction of amplifiable DNA from L. monocytogenes cells in vegetable with efficiencies ranging between 29.6 and 70.3%. Coupled with the triplex real-time qPCR assay, this DNA isolation kit is applicable to the samples with bacterial loads of 10(3) bacterial cells per gram of L. monocytogenes. Several recent outbreaks of Listeria monocytogenes have been associated with the consumption of fruits and vegetables. Real-time PCR assays allow fast detection and accurate quantification of microbes. However, the success of real-time PCR is dependent on the success with which template DNA can be extracted. The results of this study suggest that the PowerSoil(™) Microbial DNA Isolation Kit can be used for the extraction of amplifiable DNA from L. monocytogenes cells in vegetable with efficiencies ranging between 29.6 and 70.3%. This method is applicable to samples with bacterial loads of 10(3) bacterial cells per gram of L. monocytogenes. © 2014

  2. A BAC-based transgenic mouse specifically expresses an inducible Cre in the urothelium.

    Directory of Open Access Journals (Sweden)

    Tian Huai Shen

    Full Text Available Cre-loxp mediated conditional knockout strategy has played critical roles for revealing functions of many genes essential for development, as well as the causal relationships between gene mutations and diseases in the postnatal adult mice. One key factor of this strategy is the availability of mice with tissue- or cell type-specific Cre expression. However, the success of the traditional molecular cloning approach to generate mice with tissue specific Cre expression often depends on luck. Here we provide a better alternative by using bacterial artificial chromosome (BAC-based recombineering to insert iCreERT2 cDNA at the ATG start of the Upk2 gene. The BAC-based transgenic mice express the inducible Cre specifically in the urothelium as demonstrated by mRNA expression and staining for LacZ expression after crossing with a Rosa26 reporter mouse. Taking into consideration the size of the gene of interest and neighboring genes included in a BAC, this method should be widely applicable for generation of mice with tissue specific gene expression or deletions in a more specific manner than previously reported.

  3. High expression of testes-specific protease 50 is associated with poor prognosis in colorectal carcinoma.

    Directory of Open Access Journals (Sweden)

    Lei Zheng

    Full Text Available BACKGROUND: Testes-specific protease 50 (TSP50 is normally expressed in testes and abnormally expressed in breast cancer, but whether TSP50 is expressed in colorectal carcinoma (CRC and its clinical significance is unclear. We aimed to detect TSP50 expression in CRC, correlate it with clinicopathological factors, and assess its potential diagnostic and prognostic value. METHODOLOGY/PRINCIPAL FINDINGS: TSP50 mRNAs and proteins were detected in 7 CRC cell lines and 8 CRC specimens via RT-PCR and Western blot analysis. Immunohistochemical analysis of TSP50, p53 and carcinoembryonic antigen (CEA with tissue microarrays composed of 95 CRCs, 20 colorectal adenomas and 20 normal colorectal tissues were carried out and correlated with clinicopathological characteristics and disease-specific survival for CRC patients. There was no significant correlation between the expression levels of TSP50 and p53 (P = 0.751 or CEA (P = 0.663. Abundant expression of TSP50 protein was found in CRCs (68.4% while it was poorly expressed in colorectal adenomas and normal tissues (P<0.0001. Thus, CRCs can be distinguished from them with high specificity (92.5% and positive predictive value (PPV, 95.6%. The survival of CRC patients with high TSP50 expression was significantly shorter than that of the patients with low TSP50 expression (P = 0.010, specifically in patients who had early-stage tumors (stage I and II; P = 0.004. Multivariate Cox regression analysis indicated that high TSP50 expression was a statistically significant independent risk factor (hazard ratio  = 2.205, 95% CI = 1.214-4.004, P = 0.009. CONCLUSION: Our data demonstrate that TSP50 is a potential effective indicator of poor survival for CRC patients, especially for those with early-stage tumors.

  4. In silico analysis of stomach lineage specific gene set expression pattern in gastric cancer

    International Nuclear Information System (INIS)

    Pandi, Narayanan Sathiya; Suganya, Sivagurunathan; Rajendran, Suriliyandi

    2013-01-01

    Highlights: •Identified stomach lineage specific gene set (SLSGS) was found to be under expressed in gastric tumors. •Elevated expression of SLSGS in gastric tumor is a molecular predictor of metabolic type gastric cancer. •In silico pathway scanning identified estrogen-α signaling is a putative regulator of SLSGS in gastric cancer. •Elevated expression of SLSGS in GC is associated with an overall increase in the survival of GC patients. -- Abstract: Stomach lineage specific gene products act as a protective barrier in the normal stomach and their expression maintains the normal physiological processes, cellular integrity and morphology of the gastric wall. However, the regulation of stomach lineage specific genes in gastric cancer (GC) is far less clear. In the present study, we sought to investigate the role and regulation of stomach lineage specific gene set (SLSGS) in GC. SLSGS was identified by comparing the mRNA expression profiles of normal stomach tissue with other organ tissue. The obtained SLSGS was found to be under expressed in gastric tumors. Functional annotation analysis revealed that the SLSGS was enriched for digestive function and gastric epithelial maintenance. Employing a single sample prediction method across GC mRNA expression profiles identified the under expression of SLSGS in proliferative type and invasive type gastric tumors compared to the metabolic type gastric tumors. Integrative pathway activation prediction analysis revealed a close association between estrogen-α signaling and SLSGS expression pattern in GC. Elevated expression of SLSGS in GC is associated with an overall increase in the survival of GC patients. In conclusion, our results highlight that estrogen mediated regulation of SLSGS in gastric tumor is a molecular predictor of metabolic type GC and prognostic factor in GC

  5. In silico analysis of stomach lineage specific gene set expression pattern in gastric cancer

    Energy Technology Data Exchange (ETDEWEB)

    Pandi, Narayanan Sathiya, E-mail: sathiyapandi@gmail.com; Suganya, Sivagurunathan; Rajendran, Suriliyandi

    2013-10-04

    Highlights: •Identified stomach lineage specific gene set (SLSGS) was found to be under expressed in gastric tumors. •Elevated expression of SLSGS in gastric tumor is a molecular predictor of metabolic type gastric cancer. •In silico pathway scanning identified estrogen-α signaling is a putative regulator of SLSGS in gastric cancer. •Elevated expression of SLSGS in GC is associated with an overall increase in the survival of GC patients. -- Abstract: Stomach lineage specific gene products act as a protective barrier in the normal stomach and their expression maintains the normal physiological processes, cellular integrity and morphology of the gastric wall. However, the regulation of stomach lineage specific genes in gastric cancer (GC) is far less clear. In the present study, we sought to investigate the role and regulation of stomach lineage specific gene set (SLSGS) in GC. SLSGS was identified by comparing the mRNA expression profiles of normal stomach tissue with other organ tissue. The obtained SLSGS was found to be under expressed in gastric tumors. Functional annotation analysis revealed that the SLSGS was enriched for digestive function and gastric epithelial maintenance. Employing a single sample prediction method across GC mRNA expression profiles identified the under expression of SLSGS in proliferative type and invasive type gastric tumors compared to the metabolic type gastric tumors. Integrative pathway activation prediction analysis revealed a close association between estrogen-α signaling and SLSGS expression pattern in GC. Elevated expression of SLSGS in GC is associated with an overall increase in the survival of GC patients. In conclusion, our results highlight that estrogen mediated regulation of SLSGS in gastric tumor is a molecular predictor of metabolic type GC and prognostic factor in GC.

  6. Triclosan-Induced Aminoglycoside-Tolerant Listeria monocytogenes Isolates Can Appear as Small-Colony Variants

    DEFF Research Database (Denmark)

    Kastbjerg, Vicky Gaedt; Hein-Kristensen, Line; Gram, Lone

    2014-01-01

    Exposure of the human food-borne pathogen Listeria monocytogenes to sublethal concentrations of triclosan can cause resistance to several aminoglycosides. Aminoglycoside-resistant isolates exhibit two colony morphologies: normal-size and pinpoint colonies. The purposes of the present study were...... to characterize the small colonies of L. monocytogenes and to determine if specific genetic changes could explain the triclosan-induced aminoglycoside resistance in both pinpoint and normal-size isolates. Isolates from the pinpoint colonies grew poorly under aerated conditions, but growth was restored by addition......I and that exposure to triclosan can cause resistance to antibiotics that enters the cell via active transport. Further studies are needed to elucidate if L. monocytogenes pinpoint isolates could have any clinical impact, e.g., in persistent infections....

  7. Concordance of gene expression in human protein complexes reveals tissue specificity and pathology

    DEFF Research Database (Denmark)

    Börnigen, Daniela; Pers, Tune Hannes; Thorrez, Lieven

    2013-01-01

    Disease-causing variants in human genes usually lead to phenotypes specific to only a few tissues. Here, we present a method for predicting tissue specificity based on quantitative deregulation of protein complexes. The underlying assumption is that the degree of coordinated expression among prot...

  8. Transcriptional Profiling Identifies Location-Specific and Breed-Specific Differentially Expressed Genes in Embryonic Myogenesis in Anas Platyrhynchos.

    Directory of Open Access Journals (Sweden)

    Rong-Ping Zhang

    Full Text Available Skeletal muscle growth and development are highly orchestrated processes involving significant changes in gene expressions. Differences in the location-specific and breed-specific genes and pathways involved have important implications for meat productions and meat quality. Here, RNA-Seq was performed to identify differences in the muscle deposition between two muscle locations and two duck breeds for functional genomics studies. To achieve those goals, skeletal muscle samples were collected from the leg muscle (LM and the pectoral muscle (PM of two genetically different duck breeds, Heiwu duck (H and Peking duck (P, at embryonic 15 days. Functional genomics studies were performed in two experiments: Experiment 1 directly compared the location-specific genes between PM and LM, and Experiment 2 compared the two breeds (H and P at the same developmental stage (embryonic 15 days. Almost 13 million clean reads were generated using Illumina technology (Novogene, Beijing, China on each library, and more than 70% of the reads mapped to the Peking duck (Anas platyrhynchos genome. A total of 168 genes were differentially expressed between the two locations analyzed in Experiment 1, whereas only 8 genes were differentially expressed when comparing the same location between two breeds in Experiment 2. Gene Ontology (GO and the Kyoto Encyclopedia of Genes and Genomes pathways (KEGG were used to functionally annotate DEGs (differentially expression genes. The DEGs identified in Experiment 1 were mainly involved in focal adhesion, the PI3K-Akt signaling pathway and ECM-receptor interaction pathways (corrected P-value<0.05. In Experiment 2, the DEGs were associated with only the ribosome signaling pathway (corrected P-value<0.05. In addition, quantitative real-time PCR was used to confirm 15 of the differentially expressed genes originally detected by RNA-Seq. A comparative transcript analysis of the leg and pectoral muscles of two duck breeds not only

  9. TiGER: a database for tissue-specific gene expression and regulation.

    Science.gov (United States)

    Liu, Xiong; Yu, Xueping; Zack, Donald J; Zhu, Heng; Qian, Jiang

    2008-06-09

    Understanding how genes are expressed and regulated in different tissues is a fundamental and challenging question. However, most of currently available biological databases do not focus on tissue-specific gene regulation. The recent development of computational methods for tissue-specific combinational gene regulation, based on transcription factor binding sites, enables us to perform a large-scale analysis of tissue-specific gene regulation in human tissues. The results are stored in a web database called TiGER (Tissue-specific Gene Expression and Regulation). The database contains three types of data including tissue-specific gene expression profiles, combinatorial gene regulations, and cis-regulatory module (CRM) detections. At present the database contains expression profiles for 19,526 UniGene genes, combinatorial regulations for 7,341 transcription factor pairs and 6,232 putative CRMs for 2,130 RefSeq genes. We have developed and made publicly available a database, TiGER, which summarizes and provides large scale data sets for tissue-specific gene expression and regulation in a variety of human tissues. This resource is available at 1.

  10. TiGER: A database for tissue-specific gene expression and regulation

    Directory of Open Access Journals (Sweden)

    Zack Donald J

    2008-06-01

    Full Text Available Abstract Background Understanding how genes are expressed and regulated in different tissues is a fundamental and challenging question. However, most of currently available biological databases do not focus on tissue-specific gene regulation. Results The recent development of computational methods for tissue-specific combinational gene regulation, based on transcription factor binding sites, enables us to perform a large-scale analysis of tissue-specific gene regulation in human tissues. The results are stored in a web database called TiGER (Tissue-specific Gene Expression and Regulation. The database contains three types of data including tissue-specific gene expression profiles, combinatorial gene regulations, and cis-regulatory module (CRM detections. At present the database contains expression profiles for 19,526 UniGene genes, combinatorial regulations for 7,341 transcription factor pairs and 6,232 putative CRMs for 2,130 RefSeq genes. Conclusion We have developed and made publicly available a database, TiGER, which summarizes and provides large scale data sets for tissue-specific gene expression and regulation in a variety of human tissues. This resource is available at 1.

  11. Identification and target prediction of miRNAs specifically expressed in rat neural tissue

    Directory of Open Access Journals (Sweden)

    Tu Kang

    2009-05-01

    Full Text Available Abstract Background MicroRNAs (miRNAs are a large group of RNAs that play important roles in regulating gene expression and protein translation. Several studies have indicated that some miRNAs are specifically expressed in human, mouse and zebrafish tissues. For example, miR-1 and miR-133 are specifically expressed in muscles. Tissue-specific miRNAs may have particular functions. Although previous studies have reported the presence of human, mouse and zebrafish tissue-specific miRNAs, there have been no detailed reports of rat tissue-specific miRNAs. In this study, Home-made rat miRNA microarrays which established in our previous study were used to investigate rat neural tissue-specific miRNAs, and mapped their target genes in rat tissues. This study will provide information for the functional analysis of these miRNAs. Results In order to obtain as complete a picture of specific miRNA expression in rat neural tissues as possible, customized miRNA microarrays with 152 selected miRNAs from miRBase were used to detect miRNA expression in 14 rat tissues. After a general clustering analysis, 14 rat tissues could be clearly classified into neural and non-neural tissues based on the obtained expression profiles with p values Conclusion Our work provides a global view of rat neural tissue-specific miRNA profiles and a target map of miRNAs, which is expected to contribute to future investigations of miRNA regulatory mechanisms in neural systems.

  12. In silico analysis of stomach lineage specific gene set expression pattern in gastric cancer.

    Science.gov (United States)

    Pandi, Narayanan Sathiya; Suganya, Sivagurunathan; Rajendran, Suriliyandi

    2013-10-04

    Stomach lineage specific gene products act as a protective barrier in the normal stomach and their expression maintains the normal physiological processes, cellular integrity and morphology of the gastric wall. However, the regulation of stomach lineage specific genes in gastric cancer (GC) is far less clear. In the present study, we sought to investigate the role and regulation of stomach lineage specific gene set (SLSGS) in GC. SLSGS was identified by comparing the mRNA expression profiles of normal stomach tissue with other organ tissue. The obtained SLSGS was found to be under expressed in gastric tumors. Functional annotation analysis revealed that the SLSGS was enriched for digestive function and gastric epithelial maintenance. Employing a single sample prediction method across GC mRNA expression profiles identified the under expression of SLSGS in proliferative type and invasive type gastric tumors compared to the metabolic type gastric tumors. Integrative pathway activation prediction analysis revealed a close association between estrogen-α signaling and SLSGS expression pattern in GC. Elevated expression of SLSGS in GC is associated with an overall increase in the survival of GC patients. In conclusion, our results highlight that estrogen mediated regulation of SLSGS in gastric tumor is a molecular predictor of metabolic type GC and prognostic factor in GC. Copyright © 2013 Elsevier Inc. All rights reserved.

  13. Cohort-specific imputation of gene expression improves prediction of warfarin dose for African Americans.

    Science.gov (United States)

    Gottlieb, Assaf; Daneshjou, Roxana; DeGorter, Marianne; Bourgeois, Stephane; Svensson, Peter J; Wadelius, Mia; Deloukas, Panos; Montgomery, Stephen B; Altman, Russ B

    2017-11-24

    Genome-wide association studies are useful for discovering genotype-phenotype associations but are limited because they require large cohorts to identify a signal, which can be population-specific. Mapping genetic variation to genes improves power and allows the effects of both protein-coding variation as well as variation in expression to be combined into "gene level" effects. Previous work has shown that warfarin dose can be predicted using information from genetic variation that affects protein-coding regions. Here, we introduce a method that improves dose prediction by integrating tissue-specific gene expression. In particular, we use drug pathways and expression quantitative trait loci knowledge to impute gene expression-on the assumption that differential expression of key pathway genes may impact dose requirement. We focus on 116 genes from the pharmacokinetic and pharmacodynamic pathways of warfarin within training and validation sets comprising both European and African-descent individuals. We build gene-tissue signatures associated with warfarin dose in a cohort-specific manner and identify a signature of 11 gene-tissue pairs that significantly augments the International Warfarin Pharmacogenetics Consortium dosage-prediction algorithm in both populations. Our results demonstrate that imputed expression can improve dose prediction and bridge population-specific compositions. MATLAB code is available at https://github.com/assafgo/warfarin-cohort.

  14. 78 FR 27939 - Draft Interagency Risk Assessment-Listeria monocytogenes

    Science.gov (United States)

    2013-05-13

    ... Listeria (L.) monocytogenes contamination of certain ready-to-eat (RTE) foods, for example cheese, deli... Scott, V.N., Survey of Listeria monocytogenes in ready-to-eat foods. Journal of Food Protection, 2003... monocytogenes in ready-to-eat processed meat and poultry collected in four FoodNet states in International...

  15. Occurrence of Listeria monocytogenes in smoked fish in Sokoto ...

    African Journals Online (AJOL)

    STORAGESEVER

    2008-09-03

    Sep 3, 2008 ... monocytogenes and other Listeria species are common contaminant of smoked fish, and this may pose serious public health implications. Key words: Smoked fish, Listeria monocytogenes, contamination, public health. INTRODUCTION ... L. monocytogenes belong to the recently emerging psychrotrophic ...

  16. Listeria monocytogenes infection in pregnancy and neonatal sepsis

    Directory of Open Access Journals (Sweden)

    Francesca Pascale

    2008-06-01

    Full Text Available Authors report a fatal neonatal sepsis caused by Listeria monocytogenes. While the diagnostic procedure aimed to identify the microrganism is described, it is emphasized the importance to recover Streptococcus agalactiae (GBS and L. monocytogenes by means of vaginal-rectal swab culture. The intrapartum screening for L. monocytogenes, by Polymerase Chain Reaction (PCR providing results in 75 minutes is also evaluated.

  17. Anatomical specificity of vascular endothelial growth factor expression in glioblastomas: a voxel-based mapping analysis

    Energy Technology Data Exchange (ETDEWEB)

    Fan, Xing [Capital Medical University, Department of Neurosurgery, Beijing Tiantan Hospital, Beijing (China); Wang, Yinyan [Capital Medical University, Department of Neurosurgery, Beijing Tiantan Hospital, Beijing (China); Capital Medical University, Department of Neuropathology, Beijing Neurosurgical Institute, Beijing (China); Wang, Kai; Ma, Jun; Li, Shaowu [Capital Medical University, Department of Neuroradiology, Beijing Tiantan Hospital, Beijing (China); Liu, Shuai [Chinese Academy of Medical Sciences and Peking Union Medical College, Departments of Neurosurgery, Peking Union Medical College Hospital, Beijing (China); Liu, Yong [Chinese Academy of Sciences, Brainnetome Center, Institute of Automation, Beijing (China); Jiang, Tao [Capital Medical University, Department of Neurosurgery, Beijing Tiantan Hospital, Beijing (China); Beijing Academy of Critical Illness in Brain, Department of Clinical Oncology, Beijing (China)

    2016-01-15

    The expression of vascular endothelial growth factor (VEGF) is a common genetic alteration in malignant gliomas and contributes to the angiogenesis of tumors. This study aimed to investigate the anatomical specificity of VEGF expression levels in glioblastomas using voxel-based neuroimaging analysis. Clinical information, MR scans, and immunohistochemistry stains of 209 patients with glioblastomas were reviewed. All tumor lesions were segmented manually and subsequently registered to standard brain space. Voxel-based regression analysis was performed to correlate the brain regions of tumor involvement with the level of VEGF expression. Brain regions identified as significantly associated with high or low VEGF expression were preserved following permutation correction. High VEGF expression was detected in 123 (58.9 %) of the 209 patients. Voxel-based statistical analysis demonstrated that high VEGF expression was more likely in tumors located in the left frontal lobe and the right caudate and low VEGF expression was more likely in tumors that occurred in the posterior region of the right lateral ventricle. Voxel-based neuroimaging analysis revealed the anatomic specificity of VEGF expression in glioblastoma, which may further our understanding of genetic heterogeneity during tumor origination. This finding provides primary theoretical support for potential future application of customized antiangiogenic therapy. (orig.)

  18. Anatomical specificity of vascular endothelial growth factor expression in glioblastomas: a voxel-based mapping analysis

    International Nuclear Information System (INIS)

    Fan, Xing; Wang, Yinyan; Wang, Kai; Ma, Jun; Li, Shaowu; Liu, Shuai; Liu, Yong; Jiang, Tao

    2016-01-01

    The expression of vascular endothelial growth factor (VEGF) is a common genetic alteration in malignant gliomas and contributes to the angiogenesis of tumors. This study aimed to investigate the anatomical specificity of VEGF expression levels in glioblastomas using voxel-based neuroimaging analysis. Clinical information, MR scans, and immunohistochemistry stains of 209 patients with glioblastomas were reviewed. All tumor lesions were segmented manually and subsequently registered to standard brain space. Voxel-based regression analysis was performed to correlate the brain regions of tumor involvement with the level of VEGF expression. Brain regions identified as significantly associated with high or low VEGF expression were preserved following permutation correction. High VEGF expression was detected in 123 (58.9 %) of the 209 patients. Voxel-based statistical analysis demonstrated that high VEGF expression was more likely in tumors located in the left frontal lobe and the right caudate and low VEGF expression was more likely in tumors that occurred in the posterior region of the right lateral ventricle. Voxel-based neuroimaging analysis revealed the anatomic specificity of VEGF expression in glioblastoma, which may further our understanding of genetic heterogeneity during tumor origination. This finding provides primary theoretical support for potential future application of customized antiangiogenic therapy. (orig.)

  19. Carbon dioxide and nisin act synergistically on Listeria monocytogenes

    DEFF Research Database (Denmark)

    Nilsson, Lilian; Chen, Y.H.; Chikindas, M.L.

    2000-01-01

    This paper examines the synergistic action of carbon dioxide and nisin on Listeria monocytogenes Scott A wild-type and nisin-resistant (Nis(r)) cells grown in broth at 4 degrees C. Carbon dioxide extended the lag phase and decreased the specific growth rate of both strains, but to a greater degree...... for cultures in CO2. This synergism between nisin and CO2 was examined mechanistically by following the leakage of carboxyfluorescein (CF) from listerial liposomes. Carbon dioxide enhanced nisin-induced CF leakage, indicating that the synergistic action of CO2 and nisin occurs at the cytoplasmic membrane...

  20. Evaluation of Sex-Specific Gene Expression in Archived Dried Blood Spots (DBS

    Directory of Open Access Journals (Sweden)

    Scott Jewell

    2012-08-01

    Full Text Available Screening newborns for treatable serious conditions is mandated in all US states and many other countries. After screening, Guthrie cards with residual blood (whole spots or portions of spots are typically stored at ambient temperature in many facilities. The potential of archived dried blood spots (DBS for at-birth molecular studies in epidemiological and clinical research is substantial. However, it is also challenging as analytes from DBS may be degraded due to preparation and storage conditions. We previously reported an improved assay for obtaining global RNA gene expression from blood spots. Here, we evaluated sex-specific gene expression and its preservation in DBS using oligonucleotide microarray technology. We found X inactivation-specific transcript (XIST, lysine-specific demethylase 5D (KDM5D (also known as selected cDNA on Y, homolog of mouse (SMCY, uncharacterized LOC729444 (LOC729444, and testis-specific transcript, Y-linked 21 (TTTY21 to be differentially-expressed by sex of the newborn. Our finding that trait-specific RNA gene expression is preserved in unfrozen DBS, demonstrates the technical feasibility of performing molecular genetic profiling using such samples. With millions of DBS potentially available for research, we see new opportunities in using newborn molecular gene expression to better understand molecular pathogenesis of perinatal diseases.

  1. Functional expression of an ajmaline pathway-specific esterase from Rauvolfia in a novel plant-virus expression system.

    Science.gov (United States)

    Ruppert, Martin; Woll, Jörn; Giritch, Anatoli; Genady, Ezzat; Ma, Xueyan; Stöckigt, Joachim

    2005-11-01

    Acetylajmalan esterase (AAE) plays an essential role in the late stage of ajmaline biosynthesis. Based on the partial peptide sequences of AAE isolated and purified from Rauvolfia cell suspensions, a full-length AAE cDNA clone was isolated. The amino acid sequence of AAE has the highest level of identity of 40% to putative lipases known from the Arabidopsis thaliana genome project. Based on the primary structure AAE is a new member of the GDSL lipase superfamily. The expression in Escherichia coli failed although a wide range of conditions were tested. With a novel virus-based plant expression system, it was possible to express AAE functionally in leaves of Nicotiana benthamiana Domin. An extraordinarily high enzyme activity was detected in the Nicotiana tissue, which exceeded that in Rauvolfia serpentina (L.) Benth. ex Kurz cell suspension cultures about 20-fold. This expression allowed molecular analysis of AAE for the first time and increased the number of functionally expressed alkaloid genes from Rauvolfia now to eight, and the number of ajmaline pathway-specific cDNAs to a total of six.

  2. Real-time PCR detection of Listeria monocytogenes in infant formula and lettuce following macrophage-based isolation and enrichment.

    Science.gov (United States)

    Day, J B; Basavanna, U

    2015-01-01

    To develop a rapid detection procedure for Listeria monocytogenes in infant formula and lettuce using a macrophage-based enrichment protocol and real-time PCR. A macrophage cell culture system was employed for the isolation and enrichment of L. monocytogenes from infant formula and lettuce for subsequent identification using real-time PCR. Macrophage monolayers were exposed to infant formula and lettuce contaminated with a serial dilution series of L. monocytogenes. As few as approx. 10 CFU ml(-1) or g(-1) of L. monocytogenes were detected in infant formula and lettuce after 16 h postinfection by real-time PCR. Internal positive PCR controls were utilized to eliminate the possibility of false-negative results. Co-inoculation with Listeria innocua did not reduce the L. monocytogenes detection sensitivity. Intracellular L. monocytogenes could also be isolated on Listeria selective media from infected macrophage lysates for subsequent confirmation. The detection method is highly sensitive and specific for L. monocytogenes in infant formula and lettuce and establishes a rapid identification time of 20 and 48 h for presumptive and confirmatory identification, respectively. The method is a promising alternative to many currently used q-PCR detection methods which employ traditional selective media for enrichment of contaminated food samples. Macrophage enrichment of L. monocytogenes eliminates PCR inhibitory food elements and contaminating food microflora which produce cleaner samples that increase the rapidity and sensitivity of detection. Published 2014. This article is a U.S. Government work and is in the public domain in the USA.

  3. In vitro detection of pathogenic Listeria monocytogenes from food sources by conventional, molecular and cell culture method

    Directory of Open Access Journals (Sweden)

    J.A. Khan

    2013-09-01

    Full Text Available Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO. A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG; R: CCTCCAGAGTGATCGATGTT complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR. PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%, followed by fish meat (4.0%, and then beef (2.5%. Among various milk and milk products, curd (2.0% showed the highest prevalence, followed by raw milk (1.3%. The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 µL and 50 µL of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro resulted positive in twenty four

  4. Visualization of gold and platinum nanoparticles interacting with Salmonella enteritidis and Listeria monocytogenes

    DEFF Research Database (Denmark)

    Sawosz, Ewa; Chwalibog, André; Szeliga, Jacek

    2010-01-01

    -Au and nano-Pt respectively), with Salmonella Enteritidis (Gram-negative) and Listeria monocytogenes (Gram-positive), to reveal possibilities of constructing bacteria-nanoparticle vehicles. Methods: Hydrocolloids of nano-Au or nano-Pt were added to two bacteria suspensions in the following order: nano...... as a vehicle to deliver nano-Pt to specific points in the body....

  5. Digital sorting of complex tissues for cell type-specific gene expression profiles.

    Science.gov (United States)

    Zhong, Yi; Wan, Ying-Wooi; Pang, Kaifang; Chow, Lionel M L; Liu, Zhandong

    2013-03-07

    Cellular heterogeneity is present in almost all gene expression profiles. However, transcriptome analysis of tissue specimens often ignores the cellular heterogeneity present in these samples. Standard deconvolution algorithms require prior knowledge of the cell type frequencies within a tissue or their in vitro expression profiles. Furthermore, these algorithms tend to report biased estimations. Here, we describe a Digital Sorting Algorithm (DSA) for extracting cell-type specific gene expression profiles from mixed tissue samples that is unbiased and does not require prior knowledge of cell type frequencies. The results suggest that DSA is a specific and sensitivity algorithm in gene expression profile deconvolution and will be useful in studying individual cell types of complex tissues.

  6. Fos and jun proteins are specifically expressed during differentiation of human keratinocytes.

    Science.gov (United States)

    Mehic, Denis; Bakiri, Latifa; Ghannadan, Minoo; Wagner, Erwin F; Tschachler, Erwin

    2005-01-01

    Activator protein 1 (AP-1) proteins play key roles in the regulation of cell proliferation and differentiation. In this study we investigated the expression of Fos and Jun proteins in different models of terminal differentiation of human keratinocytes and in skin from psoriasis patients. All Jun and Fos proteins, with the exception of FosB, were efficiently expressed in keratinocytes in monolayer cultures. In contrast, in normal epidermis as well as in organotypic epidermal cultures, the expression pattern of AP-1 proteins was dependent on the differentiation stage. Fos proteins were readily detected in nuclei of keratinocytes of basal and suprabasal layers. JunB and JunD were expressed in all layers of normal epidermis. Interestingly, expression of c-Jun started suprabasally, then disappeared and became detectable again in distinct cells of the outermost granular layer directly at the transition zone to the stratum corneum. In psoriatic epidermis, c-Jun expression was prominent in both hyperproliferating basal and suprabasal keratinocytes, whereas c-Fos expression was unchanged. These data indicate that AP-1 proteins are expressed in a highly specific manner during terminal differentiation of keratinocytes and that the enhanced expression of c-Jun in basal and suprabasal keratinocytes might contribute to the pathogenesis of psoriasis.

  7. In vitro activity of naturally occurring peptides (defensins against Listeria monocytogenes Ação in vitro de peptídeos naturais (defensinas sobre Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Maria da Graça F. Nascimento

    1994-12-01

    Full Text Available Autoclaved distilled water samples were inoculated with L. monocytogenes strain V7 and strain VPH-1, and incubated aerobically, at 30 C for 48 hours. Each strain was tested individually, and growth curves were determined at 1, 2, 3, 4, 5, 21, 24, and 48 hours. The growth or survival of L. monocytogenes was similar for both strains, with survivors at 24 hour-incubation. The microbicidal activity of one synthetic cationic peptide (NP-2 was examined against L. monocytogenes strain V7, in a water system. Antibacterial activity of NP-2 (1, 5, and 10 g/ml was best expressed at 60 minute-incubation, with 10 g/ml of peptide, at 30 C.Amostras de água destilada, autoclavadas, foram inoculadas com L. monocytogenes cepa V7 e cepa VPH-1, e incubadas, aerobicamente, a 30ºC por 48 horas. Cada cepa foi testada individualmente, e determinou-se curvas de crescimento a 1, 2, 3, 4, 5, 21, 24, e 48 horas. O crescimento ou sobrevivência das duas cepas foi semelhante e encontrou-se sobreviventes em 24 horas de incubação. Examinou-se a atividade bactericida de um dos peptídeos catiônicos sintéticos (NP-2 contra L. monocytogenes cepa V7, em sistema aquoso. A atividade antibacteriana de NP-2 (1, 5, and 10µg/ml foi melhor aos 60 minutos de incubação, com 10µg/ml de peptídeo, a 30 C.

  8. Adaptation of Listeria monocytogenes in a simulated cheese medium: effects on virulence using the Galleria mellonella infection model.

    Science.gov (United States)

    Schrama, D; Helliwell, N; Neto, L; Faleiro, M L

    2013-06-01

    The aim of this study was to evaluate the effect of the acid and salt adaptation in a cheese-based medium on the virulence potential of Listeria monocytogenes strains isolated from cheese and dairy processing environment using the Galleria mellonella model. Four L. monocytogenes strains were exposed to a cheese-based medium in conditions of induction of an acid tolerance response and osmotolerance response (pH 5·5 and 3·5% w/v NaCl) and injected in G. mellonella insects. The survival of insects and the L. monocytogenes growth kinetics in insects were evaluated. The gene expression of hly, actA and inlA genes was determined by real-time PCR. The adapted cells of two dairy strains showed reduced insect mortality (P 0·05) was found between adapted and nonadapted cells. The gene expression results evidenced an overexpression of virulence genes in cheese-based medium, but not in simulated insect-induced conditions. Our results suggest that adaptation to low pH and salt in a cheese-based medium can affect the virulence of L. monocytogenes, but this effect is strain dependent. In this study, the impact of adaptation to low pH and salt in a cheese-based medium on L. monocytogenes virulence was tested using the Wax Moth G. mellonella model. This model allowed the differentiation of the virulence potential between the L. monocytogenes strains. The effect of adaptation on virulence is strain dependent. The G. mellonella model revealed to be a prompt method to test food-related factors on L. monocytogenes virulence. © 2013 The Society for Applied Microbiology.

  9. Sex-Specificity of Mineralocorticoid Target Gene Expression during Renal Development, and Long-Term Consequences

    Science.gov (United States)

    Dumeige, Laurence; Storey, Caroline; Decourtye, Lyvianne; Nehlich, Melanie; Lhadj, Christophe; Viengchareun, Say; Kappeler, Laurent; Lombès, Marc; Martinerie, Laetitia

    2017-01-01

    Sex differences have been identified in various biological processes, including hypertension. The mineralocorticoid signaling pathway is an important contributor to early arterial hypertension, however its sex-specific expression has been scarcely studied, particularly with respect to the kidney. Basal systolic blood pressure (SBP) and heart rate (HR) were measured in adult male and female mice. Renal gene expression studies of major players of mineralocorticoid signaling were performed at different developmental stages in male and female mice using reverse transcription quantitative PCR (RT-qPCR), and were compared to those of the same genes in the lung, another mineralocorticoid epithelial target tissue that regulates ion exchange and electrolyte balance. The role of sex hormones in the regulation of these genes was also investigated in differentiated KC3AC1 renal cells. Additionally, renal expression of the 11 β-hydroxysteroid dehydrogenase type 2 (11βHSD2) protein, a regulator of mineralocorticoid specificity, was measured by immunoblotting and its activity was indirectly assessed in the plasma using liquid-chromatography coupled to mass spectrometry in tandem (LC-MSMS) method. SBP and HR were found to be significantly lower in females compared to males. This was accompanied by a sex- and tissue-specific expression profile throughout renal development of the mineralocorticoid target genes serum and glucocorticoid-regulated kinase 1 (Sgk1) and glucocorticoid-induced leucine zipper protein (Gilz), together with Hsd11b2, Finally, the implication of sex hormones in this sex-specific expression profile was demonstrated in vitro, most notably for Gilz mRNA expression. We demonstrate a tissue-specific, sex-dependent and developmentally-regulated pattern of expression of the mineralocorticoid pathway that could have important implications in physiology and pathology. PMID:28230786

  10. Comparative genomics and transcriptomics of lineages I, II, and III strains of Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Hain Torsten

    2012-04-01

    Full Text Available Abstract Background Listeria monocytogenes is a food-borne pathogen that causes infections with a high-mortality rate and has served as an invaluable model for intracellular parasitism. Here, we report complete genome sequences for two L. monocytogenes strains belonging to serotype 4a (L99 and 4b (CLIP80459, and transcriptomes of representative strains from lineages I, II, and III, thereby permitting in-depth comparison of genome- and transcriptome -based data from three lineages of L. monocytogenes. Lineage III, represented by the 4a L99 genome is known to contain strains less virulent for humans. Results The genome analysis of the weakly pathogenic L99 serotype 4a provides extensive evidence of virulence gene decay, including loss of several important surface proteins. The 4b CLIP80459 genome, unlike the previously sequenced 4b F2365 genome harbours an intact inlB invasion gene. These lineage I strains are characterized by the lack of prophage genes, as they share only a single prophage locus with other L. monocytogenes genomes 1/2a EGD-e and 4a L99. Comparative transcriptome analysis during intracellular growth uncovered adaptive expression level differences in lineages I, II and III of Listeria, notable amongst which was a strong intracellular induction of flagellar genes in strain 4a L99 compared to the other lineages. Furthermore, extensive differences between strains are manifest at levels of metabolic flux control and phosphorylated sugar uptake. Intriguingly, prophage gene expression was found to be a hallmark of intracellular gene expression. Deletion mutants in the single shared prophage locus of lineage II strain EGD-e 1/2a, the lma operon, revealed severe attenuation of virulence in a murine infection model. Conclusion Comparative genomics and transcriptome analysis of L. monocytogenes strains from three lineages implicate prophage genes in intracellular adaptation and indicate that gene loss and decay may have led to the emergence

  11. Expression of androgen receptor and prostate-specific antigen in male breast carcinoma

    International Nuclear Information System (INIS)

    Kidwai, Noman; Gong, Yun; Sun, Xiaoping; Deshpande, Charuhas G; Yeldandi, Anjana V; Rao, M Sambasiva; Badve, Sunil

    2004-01-01

    The androgen-regulated proteins prostate-specific antigen (PSA) and prostate-specific acid phosphatase (PSAP) are present in high concentrations in normal prostate and prostatic cancer and are considered to be tissue-specific to prostate. These markers are commonly used to diagnose metastatic prostate carcinoma at various sites including the male breast. However, expression of these two proteins in tumors arising in tissues regulated by androgens such as male breast carcinoma has not been thoroughly evaluated. In this study we analyzed the expression of PSA, PSAP and androgen receptor (AR) by immunohistochemistry in 26 cases of male breast carcinomas and correlated these with the expression of other prognostic markers. AR, PSA and PSAP expression was observed in 81%, 23% and 0% of carcinomas, respectively. Combined expression of AR and PSA was observed in only four tumors. Although the biological significance of PSA expression in male breast carcinomas is not clear, caution should be exercised when it is used as a diagnostic marker of metastatic prostate carcinoma

  12. RAPID DNA EXTRACTION AND PCR VALIDATION FOR DIRECT DETECTION OF Listeria monocytogenes IN RAW MILK

    Directory of Open Access Journals (Sweden)

    Edith Burbano

    2006-05-01

    Full Text Available Objective. The aim of this study was to validate a method for detecting L. monocytogenes in raw milk.Materials and methods. The extraction procedure carried out using a chaotropic agent like NaI, toreduce fat in the sample to 0.2% w/v, which is the lowest limit for detection in the Gerber method, toavoid the polymerization. The raw milk samples were analyzed by using the traditional gold standardmethod for L. monocytogenes. Detection PCR was done on the specificity of primers that recognize theListeria genus by amplifying a specific fragment of about 938bp of the 16S rDNA. Several primer setswere use: L1 (CTCCATAAAGGTGACCCT, U1 (CAGCMGCCGCGGTAATWC, LF (CAAACGTTAACAACGCAGTAand LR (TCCAGAGTGATCGATGTTAA that recognize the hlyA gene of L. monocytogenes, amplifying a 750bpfragment. Results. The DNA of 39 strains evidenced high specificity of the technique since all the strainsof L. monocytogenes amplified the fragments 938bp and 750bp, specifically for genus and species,respectively. The detection limit of the PCR was 101 CFU/ml. T he PCR reproducibility showed a Kappa of0.85; the specificity and sensitivity of 100% were found, predictive positive and negative values were of100% respectively. Conclusions. These results demonstrate that is possible to detect of Listeria spp. byusing any of the three methods since they share the same sensitivity and specificity. One hundred percentof the predictive value for PCR (alternative method provides high reliability, and allows the detection ofthe positive samples. The extraction procedure combined with a PCR method can reduce in 15 days thetime of identification of L. monocytogenes in raw milk. This PCR technique could be adapted and validatedto be use for other types of food such as poultry, meat products and cheeses

  13. Cohort-specific imputation of gene expression improves prediction of warfarin dose for African Americans

    Directory of Open Access Journals (Sweden)

    Assaf Gottlieb

    2017-11-01

    Full Text Available Abstract Background Genome-wide association studies are useful for discovering genotype–phenotype associations but are limited because they require large cohorts to identify a signal, which can be population-specific. Mapping genetic variation to genes improves power and allows the effects of both protein-coding variation as well as variation in expression to be combined into “gene level” effects. Methods Previous work has shown that warfarin dose can be predicted using information from genetic variation that affects protein-coding regions. Here, we introduce a method that improves dose prediction by integrating tissue-specific gene expression. In particular, we use drug pathways and expression quantitative trait loci knowledge to impute gene expression—on the assumption that differential expression of key pathway genes may impact dose requirement. We focus on 116 genes from the pharmacokinetic and pharmacodynamic pathways of warfarin within training and validation sets comprising both European and African-descent individuals. Results We build gene-tissue signatures associated with warfarin dose in a cohort-specific manner and identify a signature of 11 gene-tissue pairs that significantly augments the International Warfarin Pharmacogenetics Consortium dosage-prediction algorithm in both populations. Conclusions Our results demonstrate that imputed expression can improve dose prediction and bridge population-specific compositions. MATLAB code is available at https://github.com/assafgo/warfarin-cohort

  14. Expression of phosphoinositide-specific phospholipase C isoforms in native endothelial cells.

    Science.gov (United States)

    Béziau, Delphine M; Toussaint, Fanny; Blanchette, Alexandre; Dayeh, Nour R; Charbel, Chimène; Tardif, Jean-Claude; Dupuis, Jocelyn; Ledoux, Jonathan

    2015-01-01

    Phospholipase C (PLC) comprises a superfamily of enzymes that play a key role in a wide array of intracellular signalling pathways, including protein kinase C and intracellular calcium. Thirteen different mammalian PLC isoforms have been identified and classified into 6 families (PLC-β, γ, δ, ε, ζ and η) based on their biochemical properties. Although the expression of PLC isoforms is tissue-specific, concomitant expression of different PLC has been reported, suggesting that PLC family is involved in multiple cellular functions. Despite their critical role, the PLC isoforms expressed in native endothelial cells (ECs) remains undetermined. A conventional PCR approach was initially used to elucidate the mRNA expression pattern of PLC isoforms in 3 distinct murine vascular beds: mesenteric (MA), pulmonary (PA) and middle cerebral arteries (MCA). mRNA encoding for most PLC isoforms was detected in MA, MCA and PA with the exception of η2 and β2 (only expressed in PA), δ4 (only expressed in MCA), η1 (expressed in all but MA) and ζ (not detected in any vascular beds tested). The endothelial-specific PLC expression was then sought in freshly isolated ECs. Interestingly, the PLC expression profile appears to differ across the investigated arterial beds. While mRNA for 8 of the 13 PLC isoforms was detected in ECs from MA, two additional PLC isoforms were detected in ECs from PA and MCA. Co-expression of multiple PLC isoforms in ECs suggests an elaborate network of signalling pathways: PLC isoforms may contribute to the complexity or diversity of signalling by their selective localization in cellular microdomains. However in situ immunofluorescence revealed a homogeneous distribution for all PLC isoforms probed (β3, γ2 and δ1) in intact endothelium. Although PLC isoforms play a crucial role in endothelial signal transduction, subcellular localization alone does not appear to be sufficient to determine the role of PLC in the signalling microdomains found in the

  15. Expression of phosphoinositide-specific phospholipase C isoforms in native endothelial cells.

    Directory of Open Access Journals (Sweden)

    Delphine M Béziau

    Full Text Available Phospholipase C (PLC comprises a superfamily of enzymes that play a key role in a wide array of intracellular signalling pathways, including protein kinase C and intracellular calcium. Thirteen different mammalian PLC isoforms have been identified and classified into 6 families (PLC-β, γ, δ, ε, ζ and η based on their biochemical properties. Although the expression of PLC isoforms is tissue-specific, concomitant expression of different PLC has been reported, suggesting that PLC family is involved in multiple cellular functions. Despite their critical role, the PLC isoforms expressed in native endothelial cells (ECs remains undetermined. A conventional PCR approach was initially used to elucidate the mRNA expression pattern of PLC isoforms in 3 distinct murine vascular beds: mesenteric (MA, pulmonary (PA and middle cerebral arteries (MCA. mRNA encoding for most PLC isoforms was detected in MA, MCA and PA with the exception of η2 and β2 (only expressed in PA, δ4 (only expressed in MCA, η1 (expressed in all but MA and ζ (not detected in any vascular beds tested. The endothelial-specific PLC expression was then sought in freshly isolated ECs. Interestingly, the PLC expression profile appears to differ across the investigated arterial beds. While mRNA for 8 of the 13 PLC isoforms was detected in ECs from MA, two additional PLC isoforms were detected in ECs from PA and MCA. Co-expression of multiple PLC isoforms in ECs suggests an elaborate network of signalling pathways: PLC isoforms may contribute to the complexity or diversity of signalling by their selective localization in cellular microdomains. However in situ immunofluorescence revealed a homogeneous distribution for all PLC isoforms probed (β3, γ2 and δ1 in intact endothelium. Although PLC isoforms play a crucial role in endothelial signal transduction, subcellular localization alone does not appear to be sufficient to determine the role of PLC in the signalling microdomains found

  16. Sublethal Concentrations of Antibiotics Cause Shift to Anaerobic Metabolism in Listeria monocytogenes and Induce Phenotypes Linked to Antibiotic Tolerance

    DEFF Research Database (Denmark)

    Knudsen, Gitte Maegaard; Fromberg, Arvid; Ng, Yin

    2016-01-01

    The human pathogenic bacterium Listeria monocytogenes is exposed to antibiotics both during clinical treatment and in its saprophytic lifestyle. As one of the keys to successful treatment is continued antibiotic sensitivity, the purpose of this study was to determine if exposure to sublethal...... antibiotic concentrations would affect the bacterial physiology and induce antibiotic tolerance. Transcriptomic analyses demonstrated that each of the four antibiotics tested caused an antibiotic-specific gene expression pattern related to mode-of-action of the particular antibiotic. All four antibiotics...... in Imo1179 (eutE) encoding an aldehyde oxidoreductase where rerouting caused increased ethanol production was tolerant to three of four antibiotics tested. This shift in metabolism could be a survival strategy in response to antibiotics to avoid generation of ROS production from respiration by oxidation...

  17. Novel Biocontrol Methods for Listeria monocytogenes Biofilms in Food Production Facilities

    Directory of Open Access Journals (Sweden)

    Jessica A. Gray

    2018-04-01

    Full Text Available High mortality and hospitalization rates have seen Listeria monocytogenes as a foodborne pathogen of public health importance for many years and of particular concern for high-risk population groups. Food manufactures face an ongoing challenge in preventing the entry of L. monocytogenes into food production environments (FPEs due to its ubiquitous nature. In addition to this, the capacity of L. monocytogenes strains to colonize FPEs can lead to repeated identification of L. monocytogenes in FPE surveillance. The contamination of food products requiring product recall presents large economic burden to industry and is further exacerbated by damage to the brand. Poor equipment design, facility layout, and worn or damaged equipment can result in Listeria hotspots and biofilms where traditional cleaning and disinfecting procedures may be inadequate. Novel biocontrol methods may offer FPEs effective means to help improve control of L. monocytogenes and decrease cross contamination of food. Bacteriophages have been used as a medical treatment for many years for their ability to infect and lyse specific bacteria. Endolysins, the hydrolytic enzymes of bacteriophages responsible for breaking the cell wall of Gram-positive bacteria, are being explored as a biocontrol method for food preservation and in nanotechnology and medical applications. Antibacterial proteins known as bacteriocins have been used as alternatives to antibiotics for biopreservation and food product shelf life extension. Essential oils are natural antimicrobials formed by plants and have been used as food additives and preservatives for many years and more recently as a method to prevent food spoilage by microorganisms. Competitive exclusion occurs naturally among bacteria in the environment. However, intentionally selecting and applying bacteria to effect competitive exclusion of food borne pathogens has potential as a biocontrol application. This review discusses these novel biocontrol

  18. Novel Biocontrol Methods for Listeria monocytogenes Biofilms in Food Production Facilities.

    Science.gov (United States)

    Gray, Jessica A; Chandry, P Scott; Kaur, Mandeep; Kocharunchitt, Chawalit; Bowman, John P; Fox, Edward M

    2018-01-01

    High mortality and hospitalization rates have seen Listeria monocytogenes as a foodborne pathogen of public health importance for many years and of particular concern for high-risk population groups. Food manufactures face an ongoing challenge in preventing the entry of L. monocytogenes into food production environments (FPEs) due to its ubiquitous nature. In addition to this, the capacity of L. monocytogenes strains to colonize FPEs can lead to repeated identification of L. monocytogenes in FPE surveillance. The contamination of food products requiring product recall presents large economic burden to industry and is further exacerbated by damage to the brand. Poor equipment design, facility layout, and worn or damaged equipment can result in Listeria hotspots and biofilms where traditional cleaning and disinfecting procedures may be inadequate. Novel biocontrol methods may offer FPEs effective means to help improve control of L. monocytogenes and decrease cross contamination of food. Bacteriophages have been used as a medical treatment for many years for their ability to infect and lyse specific bacteria. Endolysins, the hydrolytic enzymes of bacteriophages responsible for breaking the cell wall of Gram-positive bacteria, are being explored as a biocontrol method for food preservation and in nanotechnology and medical applications. Antibacterial proteins known as bacteriocins have been used as alternatives to antibiotics for biopreservation and food product shelf life extension. Essential oils are natural antimicrobials formed by plants and have been used as food additives and preservatives for many years and more recently as a method to prevent food spoilage by microorganisms. Competitive exclusion occurs naturally among bacteria in the environment. However, intentionally selecting and applying bacteria to effect competitive exclusion of food borne pathogens has potential as a biocontrol application. This review discusses these novel biocontrol methods and their

  19. Novel Biocontrol Methods for Listeria monocytogenes Biofilms in Food Production Facilities

    Science.gov (United States)

    Gray, Jessica A.; Chandry, P. Scott; Kaur, Mandeep; Kocharunchitt, Chawalit; Bowman, John P.; Fox, Edward M.

    2018-01-01

    High mortality and hospitalization rates have seen Listeria monocytogenes as a foodborne pathogen of public health importance for many years and of particular concern for high-risk population groups. Food manufactures face an ongoing challenge in preventing the entry of L. monocytogenes into food production environments (FPEs) due to its ubiquitous nature. In addition to this, the capacity of L. monocytogenes strains to colonize FPEs can lead to repeated identification of L. monocytogenes in FPE surveillance. The contamination of food products requiring product recall presents large economic burden to industry and is further exacerbated by damage to the brand. Poor equipment design, facility layout, and worn or damaged equipment can result in Listeria hotspots and biofilms where traditional cleaning and disinfecting procedures may be inadequate. Novel biocontrol methods may offer FPEs effective means to help improve control of L. monocytogenes and decrease cross contamination of food. Bacteriophages have been used as a medical treatment for many years for their ability to infect and lyse specific bacteria. Endolysins, the hydrolytic enzymes of bacteriophages responsible for breaking the cell wall of Gram-positive bacteria, are being explored as a biocontrol method for food preservation and in nanotechnology and medical applications. Antibacterial proteins known as bacteriocins have been used as alternatives to antibiotics for biopreservation and food product shelf life extension. Essential oils are natural antimicrobials formed by plants and have been used as food additives and preservatives for many years and more recently as a method to prevent food spoilage by microorganisms. Competitive exclusion occurs naturally among bacteria in the environment. However, intentionally selecting and applying bacteria to effect competitive exclusion of food borne pathogens has potential as a biocontrol application. This review discusses these novel biocontrol methods and their

  20. Prevalence and growth of Listeria monocytogenes in naturally contaminated seafood

    DEFF Research Database (Denmark)

    Jørgensen, Lasse Vigel; Huss, Hans Henrik

    1998-01-01

    Listeria monocytogenes contamination of seafood varies with product category. The highest prevalence was found in cold- smoked fish (34-60%), while the lowest was found in heat- treated and cured seafood (4-12%). The prevalence of L. monocytogenes differed greatly in cold-smoked salmon between...... production sites, ranging from monocytogenes. The organism showed moderate growth...... in naturally contaminated cold-smoked, and 'gravad', fish while the growth appeared faster in hot smoked fish. Thus L. monocytogenes is not under control in these products. Finally, the prevalence and growth of L. monocytogenes in naturally contaminated cold-smoked salmon are discussed in relation...

  1. Using a periclinal chimera to unravel layer-specific gene expression in plants.

    Science.gov (United States)

    Filippis, Ioannis; Lopez-Cobollo, Rosa; Abbott, James; Butcher, Sarah; Bishop, Gerard J

    2013-09-01

    Plant organs are made from multiple cell types, and defining the expression level of a gene in any one cell or group of cells from a complex mixture is difficult. Dicotyledonous plants normally have three distinct layers of cells, L1, L2 and L3. Layer L1 is the single layer of cells making up the epidermis, layer L2 the single cell sub-epidermal layer and layer L3 constitutes the rest of the internal cells. Here we show how it is possible to harvest an organ and characterise the level of layer-specific expression by using a periclinal chimera that has its L1 layer from Solanum pennellii and its L2 and L3 layers from Solanum lycopersicum. This is possible by measuring the level of the frequency of species-specific transcripts. RNA-seq analysis enabled the genome-wide assessment of whether a gene is expressed in the L1 or L2/L3 layers. From 13 277 genes that are expressed in both the chimera and the parental lines and with at least one polymorphism between the parental alleles, we identified 382 genes that are preferentially expressed in L1 in contrast to 1159 genes in L2/L3. Gene ontology analysis shows that many genes preferentially expressed in L1 are involved in cutin and wax biosynthesis, whereas numerous genes that are preferentially expressed in L2/L3 tissue are associated with chloroplastic processes. These data indicate the use of such chimeras and provide detailed information on the level of layer-specific expression of genes. © 2013 East Malling Research The Plant Journal © 2013 John Wiley & Sons Ltd.

  2. Salt stress-induced transcription of σB- and CtsR-regulated genes in persistent and non-persistent Listeria monocytogenes strains from food processing plants.

    Science.gov (United States)

    Ringus, Daina L; Ivy, Reid A; Wiedmann, Martin; Boor, Kathryn J

    2012-03-01

    Listeria monocytogenes is a foodborne pathogen that can persist in food processing environments. Six persistent and six non-persistent strains from fish processing plants and one persistent strain from a meat plant were selected to determine if expression of genes in the regulons of two stress response regulators, σ(B) and CtsR, under salt stress conditions is associated with the ability of L. monocytogenes to persist in food processing environments. Subtype data were also used to categorize the strains into genetic lineages I or II. Quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR) was used to measure transcript levels for two σ(B)-regulated genes, inlA and gadD3, and two CtsR-regulated genes, lmo1138 and clpB, before and after (t=10 min) salt shock (i.e., exposure of exponential phase cells to BHI+6% NaCl for 10 min at 37°C). Exposure to salt stress induced higher transcript levels relative to levels under non-stress conditions for all four stress and virulence genes across all wildtype strains tested. Analysis of variance (ANOVA) of induction data revealed that transcript levels for one gene (clpB) were induced at significantly higher levels in non-persistent strains compared to persistent strains (p=0.020; two-way ANOVA). Significantly higher transcript levels of gadD3 (p=0.024; two-way ANOVA) and clpB (p=0.053; two-way ANOVA) were observed after salt shock in lineage I strains compared to lineage II strains. No clear association between stress gene transcript levels and persistence was detected. Our data are consistent with an emerging model that proposes that establishment of L. monocytogenes persistence in a specific environment occurs as a random, stochastic event, rather than as a consequence of specific bacterial strain characteristics.

  3. Tetracycline-inducible system for regulation of skeletal muscle-specific gene expression in transgenic mice

    Science.gov (United States)

    Grill, Mischala A.; Bales, Mark A.; Fought, Amber N.; Rosburg, Kristopher C.; Munger, Stephanie J.; Antin, Parker B.

    2003-01-01

    Tightly regulated control of over-expression is often necessary to study one aspect or time point of gene function and, in transgenesis, may help to avoid lethal effects and complications caused by ubiquitous over-expression. We have utilized the benefits of an optimized tet-on system and a modified muscle creatine kinase (MCK) promoter to generate a skeletal muscle-specific, doxycycline (Dox) controlled over-expression system in transgenic mice. A DNA construct was generated in which the codon optimized reverse tetracycline transactivator (rtTA) was placed under control of a skeletal muscle-specific version of the mouse MCK promoter. Transgenic mice containing this construct expressed rtTA almost exclusively in skeletal muscles. These mice were crossed to a second transgenic line containing a bi-directional promoter centered on a tet responder element driving both a luciferase reporter gene and a tagged gene of interest; in this case the calpain inhibitor calpastatin. Compound hemizygous mice showed high level, Dox dependent muscle-specific luciferase activity often exceeding 10,000-fold over non-muscle tissues of the same mouse. Western and immunocytochemical analysis demonstrated similar Dox dependent muscle-specific induction of the tagged calpastatin protein. These findings demonstrate the effectiveness and flexibility of the tet-on system to provide a tightly regulated over-expression system in adult skeletal muscle. The MCKrtTA transgenic lines can be combined with other transgenic responder lines for skeletal muscle-specific over-expression of any target gene of interest.

  4. Prostate-specific antigen and hormone receptor expression in male and female breast carcinoma

    Directory of Open Access Journals (Sweden)

    Cohen Cynthia

    2010-09-01

    Full Text Available Abstract Background Prostate carcinoma is among the most common solid tumors to secondarily involve the male breast. Prostate specific antigen (PSA and prostate-specific acid phosphatase (PSAP are expressed in benign and malignant prostatic tissue, and immunohistochemical staining for these markers is often used to confirm the prostatic origin of metastatic carcinoma. PSA expression has been reported in male and female breast carcinoma and in gynecomastia, raising concerns about the utility of PSA for differentiating prostate carcinoma metastasis to the male breast from primary breast carcinoma. This study examined the frequency of PSA, PSAP, and hormone receptor expression in male breast carcinoma (MBC, female breast carcinoma (FBC, and gynecomastia. Methods Immunohistochemical staining for PSA, PSAP, AR, ER, and PR was performed on tissue microarrays representing six cases of gynecomastia, thirty MBC, and fifty-six FBC. Results PSA was positive in two of fifty-six FBC (3.7%, focally positive in one of thirty MBC (3.3%, and negative in the five examined cases of gynecomastia. PSAP expression was absent in MBC, FBC, and gynecomastia. Hormone receptor expression was similar in males and females (AR 74.1% in MBC vs. 67.9% in FBC, p = 0.62; ER 85.2% vs. 68.5%, p = 0.18; and PR 51.9% vs. 48.2%, p = 0.82. Conclusions PSA and PSAP are useful markers to distinguish primary breast carcinoma from prostate carcinoma metastatic to the male breast. Although PSA expression appeared to correlate with hormone receptor expression, the incidence of PSA expression in our population was too low to draw significant conclusions about an association between PSA expression and hormone receptor status in breast lesions.

  5. Effekt av ulike desinfeksjonsstrategier mot Listeria monocytogenes

    OpenAIRE

    Fossmo, Sabine

    2013-01-01

    Kontroll med bakterier som Listeria utgjør en stor utfordring for mange matprodusenter. Listeria monocytogenes er hovedsakelig et produksjonshygienisk problem, forbedret hygiene kan derfor være tiltak for å redusere overlevelse og smitteoverføring av bakterien i produksjonsmiljø. Hensikten med forsøkene i oppgaven var å undersøke effekten av ulike desinfeksjonsstrategier på drap av L. monocytogenes, både når bakteriene var i biofilm og i suspensjon. Dette inkluderte bruk av tradisjonelle desi...

  6. Systematic identification and integrative analysis of novel genes expressed specifically or predominantly in mouse epididymis

    Directory of Open Access Journals (Sweden)

    Lee Hoyong

    2006-12-01

    Full Text Available Abstract Background Maturation of spermatozoa, including development of motility and the ability to fertilize the oocyte, occurs during transit through the microenvironment of the epididymis. Comprehensive understanding of sperm maturation requires identification and characterization of unique genes expressed in the epididymis. Results We systematically identified 32 novel genes with epididymis-specific or -predominant expression in the mouse epididymis UniGene library, containing 1505 gene-oriented transcript clusters, by in silico and in vitro analyses. The Northern blot analysis revealed various characteristics of the genes at the transcript level, such as expression level, size and the presence of isoform. We found that expression of the half of the genes is regulated by androgens. Further expression analyses demonstrated that the novel genes are region-specific and developmentally regulated. Computational analysis showed that 15 of the genes lack human orthologues, suggesting their implication in male reproduction unique to the mouse. A number of the novel genes are putative epididymal protease inhibitors or β-defensins. We also found that six of the genes have secretory activity, indicating that they may interact with sperm and have functional roles in sperm maturation. Conclusion We identified and characterized 32 novel epididymis-specific or -predominant genes by an integrative approach. Our study is unique in the aspect of systematic identification of novel epididymal genes and should be a firm basis for future investigation into molecular mechanisms underlying sperm maturation in the epididymis.

  7. Cell-type-specific expression of NFIX in the developing and adult cerebellum.

    Science.gov (United States)

    Fraser, James; Essebier, Alexandra; Gronostajski, Richard M; Boden, Mikael; Wainwright, Brandon J; Harvey, Tracey J; Piper, Michael

    2017-07-01

    Transcription factors from the nuclear factor one (NFI) family have been shown to play a central role in regulating neural progenitor cell differentiation within the embryonic and post-natal brain. NFIA and NFIB, for instance, promote the differentiation and functional maturation of granule neurons within the cerebellum. Mice lacking Nfix exhibit delays in the development of neuronal and glial lineages within the cerebellum, but the cell-type-specific expression of this transcription factor remains undefined. Here, we examined the expression of NFIX, together with various cell-type-specific markers, within the developing and adult cerebellum using both chromogenic immunohistochemistry and co-immunofluorescence labelling and confocal microscopy. In embryos, NFIX was expressed by progenitor cells within the rhombic lip and ventricular zone. After birth, progenitor cells within the external granule layer, as well as migrating and mature granule neurons, expressed NFIX. Within the adult cerebellum, NFIX displayed a broad expression profile, and was evident within granule cells, Bergmann glia, and interneurons, but not within Purkinje neurons. Furthermore, transcriptomic profiling of cerebellar granule neuron progenitor cells showed that multiple splice variants of Nfix are expressed within this germinal zone of the post-natal brain. Collectively, these data suggest that NFIX plays a role in regulating progenitor cell biology within the embryonic and post-natal cerebellum, as well as an ongoing role within multiple neuronal and glial populations within the adult cerebellum.

  8. Retrotransposon hypomethylation in melanoma and expression of a placenta-specific gene.

    Directory of Open Access Journals (Sweden)

    Erin C Macaulay

    Full Text Available In the human placenta, DNA hypomethylation permits the expression of retrotransposon-derived genes that are normally silenced by methylation in somatic tissues. We previously identified hypomethylation of a retrotransposon-derived transcript of the voltage-gated potassium channel gene KCNH5 that is expressed only in human placenta. However, an RNA sequence from this placental-specific transcript has been reported in melanoma. This study examined the promoter methylation and expression of the retrotransposon-derived KCNH5 transcript in 25 melanoma cell lines to determine whether the acquisition of 'placental' epigenetic marks is a feature of melanoma. Methylation and gene expression analysis revealed hypomethylation of this retrotransposon in melanoma cell lines, particularly in those samples that express the placental KCNH5 transcript. Therefore we propose that hypomethylation of the placental-specific KCNH5 promoter is frequently associated with KCNH5 expression in melanoma cells. Our findings show that melanoma can develop hypomethylation of a retrotransposon-derived gene; a characteristic notably shared with the normal placenta.

  9. Compositions and methods for xylem-specific expression in plant cells

    Energy Technology Data Exchange (ETDEWEB)

    Han, Kyung-Hwan; Ko, Jae-Heung

    2017-12-19

    The invention provides promoter sequences that regulate specific expression of operably linked sequences in developing xylem cells and/or in developing xylem tissue. The developing xylem-specific sequences are exemplified by the DX5, DX8, DX11, and DX15 promoters, portions thereof, and homologs thereof. The invention further provides expression vectors, cells, tissues and plants that contain the invention's sequences. The compositions of the invention and methods of using them are useful in, for example, improving the quantity (biomass) and/or the quality (wood density, lignin content, sugar content etc.) of expressed biomass feedstock products that may be used for bioenergy, biorefinary, and generating wood products such as pulp, paper, and solid wood.

  10. Tissue-specific mRNA expression profiling in grape berry tissues

    Science.gov (United States)

    Grimplet, Jerome; Deluc, Laurent G; Tillett, Richard L; Wheatley, Matthew D; Schlauch, Karen A; Cramer, Grant R; Cushman, John C

    2007-01-01

    Background Berries of grape (Vitis vinifera) contain three major tissue types (skin, pulp and seed) all of which contribute to the aroma, color, and flavor characters of wine. The pericarp, which is composed of the exocarp (skin) and mesocarp (pulp), not only functions to protect and feed the developing seed, but also to assist in the dispersal of the mature seed by avian and mammalian vectors. The skin provides volatile and nonvolatile aroma and color compounds, the pulp contributes organic acids and sugars, and the seeds provide condensed tannins, all of which are important to the formation of organoleptic characteristics of wine. In order to understand the transcriptional network responsible for controlling tissue-specific mRNA expression patterns, mRNA expression profiling was conducted on each tissue of mature berries of V. vinifera Cabernet Sauvignon using the Affymetrix GeneChip® Vitis oligonucleotide microarray ver. 1.0. In order to monitor the influence of water-deficit stress on tissue-specific expression patterns, mRNA expression profiles were also compared from mature berries harvested from vines subjected to well-watered or water-deficit conditions. Results Overall, berry tissues were found to express approximately 76% of genes represented on the Vitis microarray. Approximately 60% of these genes exhibited significant differential expression in one or more of the three major tissue types with more than 28% of genes showing pronounced (2-fold or greater) differences in mRNA expression. The largest difference in tissue-specific expression was observed between the seed and pulp/skin. Exocarp tissue, which is involved in pathogen defense and pigment production, showed higher mRNA abundance relative to other berry tissues for genes involved with flavonoid biosynthesis, pathogen resistance, and cell wall modification. Mesocarp tissue, which is considered a nutritive tissue, exhibited a higher mRNA abundance of genes involved in cell wall function and

  11. Tissue-specific mRNA expression profiling in grape berry tissues

    Directory of Open Access Journals (Sweden)

    Cramer Grant R

    2007-06-01

    Full Text Available Abstract Background Berries of grape (Vitis vinifera contain three major tissue types (skin, pulp and seed all of which contribute to the aroma, color, and flavor characters of wine. The pericarp, which is composed of the exocarp (skin and mesocarp (pulp, not only functions to protect and feed the developing seed, but also to assist in the dispersal of the mature seed by avian and mammalian vectors. The skin provides volatile and nonvolatile aroma and color compounds, the pulp contributes organic acids and sugars, and the seeds provide condensed tannins, all of which are important to the formation of organoleptic characteristics of wine. In order to understand the transcriptional network responsible for controlling tissue-specific mRNA expression patterns, mRNA expression profiling was conducted on each tissue of mature berries of V. vinifera Cabernet Sauvignon using the Affymetrix GeneChip® Vitis oligonucleotide microarray ver. 1.0. In order to monitor the influence of water-deficit stress on tissue-specific expression patterns, mRNA expression profiles were also compared from mature berries harvested from vines subjected to well-watered or water-deficit conditions. Results Overall, berry tissues were found to express approximately 76% of genes represented on the Vitis microarray. Approximately 60% of these genes exhibited significant differential expression in one or more of the three major tissue types with more than 28% of genes showing pronounced (2-fold or greater differences in mRNA expression. The largest difference in tissue-specific expression was observed between the seed and pulp/skin. Exocarp tissue, which is involved in pathogen defense and pigment production, showed higher mRNA abundance relative to other berry tissues for genes involved with flavonoid biosynthesis, pathogen resistance, and cell wall modification. Mesocarp tissue, which is considered a nutritive tissue, exhibited a higher mRNA abundance of genes involved in cell

  12. Regulatory regions in the rat lactase-phlorizin hydrolase gene that control cell-specific expression

    NARCIS (Netherlands)

    Verhave, Menno; Krasinski, Stephen D.; Christian, Sara I.; van Schaik, Sandrijn; van den Brink, Gijs R.; Doting, Edwina M. H.; Maas, Saskia M.; Wolthers, Katja C.; Grand, Richard J.; Montgomery, Robert K.

    2004-01-01

    OBJECTIVES: Lactase-phlorizin hydrolase (LPH) is an enterocyte-specific gene whose expression has been well-characterized, not only developmentally but also along the crypt-villus axis and along the length of the small bowel. Previous studies from the authors' laboratory have demonstrated that 2 kb

  13. High-Throughput Screening to Identify Regulators of Meiosis-Specific Gene Expression in Saccharomyces cerevisiae.

    Science.gov (United States)

    Kassir, Yona

    2017-01-01

    Meiosis and gamete formation are processes that are essential for sexual reproduction in all eukaryotic organisms. Multiple intracellular and extracellular signals feed into pathways that converge on transcription factors that induce the expression of meiosis-specific genes. Once triggered the meiosis-specific gene expression program proceeds in a cascade that drives progress through the events of meiosis and gamete formation. Meiosis-specific gene expression is tightly controlled by a balance of positive and negative regulatory factors that respond to a plethora of signaling pathways. The budding yeast Saccharomyces cerevisiae has proven to be an outstanding model for the dissection of gametogenesis owing to the sophisticated genetic manipulations that can be performed with the cells. It is possible to use a variety selection and screening methods to identify genes and their functions. High-throughput screening technology has been developed to allow an array of all viable yeast gene deletion mutants to be screened for phenotypes and for regulators of gene expression. This chapter describes a protocol that has been used to screen a library of homozygous diploid yeast deletion strains to identify regulators of the meiosis-specific IME1 gene.

  14. Sex-specific gonadal and gene expression changes throughout development in fathead minnow

    Science.gov (United States)

    Although fathead minnows (Pimephales promelas) are commonly used as a model fish in endocrine disruption studies, none have characterized sex-specific baseline expression of genes involved in sex differentiation during development in this species. Using a sex-linked DNA marker t...

  15. Variation of prostate-specific antigen expression in different tumour growth patterns present in prostatectomy specimens

    NARCIS (Netherlands)

    M.P.W. Gallee; E. Visser-de Jong (E.); J.A.G.M. van der Korput (J. A G M); Th.H. van der Kwast (Theo); F.J.W. ten Kate (Fiebo); F.H. Schröder (Fritz); J. Trapman (Jan)

    1990-01-01

    textabstractA series of 55 randomly chosen radical prostatectomy specimens was analyzed for expression of prostate-specific antigen (PSA) by immunohistochemical techniques. Tissue sections were selected in such a manner that in addition to glandular benign prostatic hyperplasia (BPH), one or more

  16. Specific RNA Interference in Caenorhabditis elegans by Ingested dsRNA Expressed in Bacillus subtilis

    NARCIS (Netherlands)

    Lezzerini, M.; van de Ven, K.; Veerman, M.; Brul, S.; Budovskaya, Y.V.

    2015-01-01

    In nematodes, genome-wide RNAi-screening has been widely used as a rapid and efficient method to identify genes involved in the aging processes. By far the easiest way of inducing RNA interference (RNAi) in Caenorhabditis elegans is by feeding Escherichia coli that expresses specific double stranded

  17. Prolonged liver-specific transgene expression by a non-primate lentiviral vector

    International Nuclear Information System (INIS)

    Condiotti, Reba; Curran, Michael A.; Nolan, Garry P.; Giladi, Hilla; Ketzinel-Gilad, Mali; Gross, Eitan; Galun, Eithan

    2004-01-01

    Liver-directed gene therapy has the potential for treatment of numerous inherited diseases affecting metabolic functions. The aim of this study was to evaluate gene expression in hepatocytes using feline immunodeficiency virus-based lentiviral vectors, which may be potentially safer than those based on human immunodeficiency virus. In vitro studies revealed that gene expression was stable for up to 24 days post-transduction and integration into the host cell genome was suggested by Alu PCR and Southern blot analyses. Systemic in vivo administration of viral particles by the hydrodynamics method resulted in high levels of gene expression exclusively in the liver for over 7 months whereas injection of plasmid DNA by the same method led to transient expression levels. Our studies suggest that feline immunodeficiency-based lentiviral vectors specifically transduce liver cells and may be used as a novel vehicle of gene delivery for treatment of metabolic disease

  18. Genes expressed in specific areas of the human fetal cerebral cortex display distinct patterns of evolution.

    Directory of Open Access Journals (Sweden)

    Nelle Lambert

    2011-03-01

    Full Text Available The developmental mechanisms through which the cerebral cortex increased in size and complexity during primate evolution are essentially unknown. To uncover genetic networks active in the developing cerebral cortex, we combined three-dimensional reconstruction of human fetal brains at midgestation and whole genome expression profiling. This novel approach enabled transcriptional characterization of neurons from accurately defined cortical regions containing presumptive Broca and Wernicke language areas, as well as surrounding associative areas. We identified hundreds of genes displaying differential expression between the two regions, but no significant difference in gene expression between left and right hemispheres. Validation by qRTPCR and in situ hybridization confirmed the robustness of our approach and revealed novel patterns of area- and layer-specific expression throughout the developing cortex. Genes differentially expressed between cortical areas were significantly associated with fast-evolving non-coding sequences harboring human-specific substitutions that could lead to divergence in their repertoires of transcription factor binding sites. Strikingly, while some of these sequences were accelerated in the human lineage only, many others were accelerated in chimpanzee and/or mouse lineages, indicating that genes important for cortical development may be particularly prone to changes in transcriptional regulation across mammals. Genes differentially expressed between cortical regions were also enriched for transcriptional targets of FoxP2, a key gene for the acquisition of language abilities in humans. Our findings point to a subset of genes with a unique combination of cortical areal expression and evolutionary patterns, suggesting that they play important roles in the transcriptional network underlying human-specific neural traits.

  19. Specific expression patterns and cell distribution of ancient and modern PAG in bovine placenta during pregnancy.

    Science.gov (United States)

    Touzard, Eve; Reinaud, Pierrette; Dubois, Olivier; Guyader-Joly, Catherine; Humblot, Patrice; Ponsart, Claire; Charpigny, Gilles

    2013-10-01

    Pregnancy-associated glycoproteins (PAGs) constitute a multigenic family of aspartic proteinases expressed in the trophoblast of the ruminant placenta. In Bos taurus, this family comprises 21 members segregated into ancient and modern phylogenetic groups. Ancient PAGs have been reported to be synthesized throughout the trophoblastic cell layer whereas modern PAGs are produced by binucleate cells of cotyledons. The aim of this study was to investigate modern and ancient PAGs during gestation in cotyledonary and intercotyledonary tissues. To obtain convincing and innovative results despite the high sequence identity shared between PAGs, we designed specific tools such as amplification primers and antibodies. Using real-time RT-PCR, we described the transcript expression of 16 bovine PAGs. Overall, PAGs are characterized by an increase in their expression during gestation. However, we demonstrated a segregation of modern PAGs in cotyledons and of ancient PAGs in the intercotyledonary chorion, except for the ancient PAG2 expressed in cotyledons. By raising specific antibodies against the modern PAG1 and ancient PAG11 and PAG2, we established the expression kinetics of the proteins using western blotting. Immunohistochemistry showed that PAGs were produced by specific cellular populations: PAG1 by binucleate cells in the whole trophoblastic layer, PAG11 was localized in binucleate cells of the intercotyledonary trophoblast and the chorionic plate of the cotyledon, while PAG2 was produced in mononucleate cells of the internal villi of the cotyledon. These results revealed a highly specific regulation of PAG expression and cell localization as a function of their phylogenetic status, suggesting distinct biological functions within placental tissues.

  20. Structural evolution and tissue-specific expression of tetrapod-specific second isoform of secretory pathway Ca2+-ATPase

    International Nuclear Information System (INIS)

    Pestov, Nikolay B.; Dmitriev, Ruslan I.; Kostina, Maria B.; Korneenko, Tatyana V.; Shakhparonov, Mikhail I.; Modyanov, Nikolai N.

    2012-01-01

    Highlights: ► Full-length secretory pathway Ca-ATPase (SPCA2) cloned from rat duodenum. ► ATP2C2 gene (encoding SPCA2) exists only in genomes of Tetrapoda. ► Rat and pig SPCA2 are expressed in intestines, lung and some secretory glands. ► Subcellular localization of SPCA2 may depend on tissue type. ► In rat duodenum, SPCA2 is localized in plasma membrane-associated compartments. -- Abstract: Secretory pathway Ca-ATPases are less characterized mammalian calcium pumps than plasma membrane Ca-ATPases and sarco-endoplasmic reticulum Ca-ATPases. Here we report analysis of molecular evolution, alternative splicing, tissue-specific expression and subcellular localization of the second isoform of the secretory pathway Ca-ATPase (SPCA2), the product of the ATP2C2 gene. The primary structure of SPCA2 from rat duodenum deduced from full-length transcript contains 944 amino acid residues, and exhibits 65% sequence identity with known SPCA1. The rat SPCA2 sequence is also highly homologous to putative human protein KIAA0703, however, the latter seems to have an aberrant N-terminus originating from intron 2. The tissue-specificity of SPCA2 expression is different from ubiquitous SPCA1. Rat SPCA2 transcripts were detected predominantly in gastrointestinal tract, lung, trachea, lactating mammary gland, skin and preputial gland. In the newborn pig, the expression profile is very similar with one remarkable exception: porcine bulbourethral gland gave the strongest signal. Upon overexpression in cultured cells, SPCA2 shows an intracellular distribution with remarkable enrichment in Golgi. However, in vivo SPCA2 may be localized in compartments that differ among various tissues: it is intracellular in epidermis, but enriched in plasma membranes of the intestinal epithelium. Analysis of SPCA2 sequences from various vertebrate species argue that ATP2C2 gene radiated from ATP2C1 (encoding SPCA1) during adaptation of tetrapod ancestors to terrestrial habitats.

  1. The virulence regulator PrfA promotes biofilm formation by Listeria monocytogenes.

    Science.gov (United States)

    Lemon, Katherine P; Freitag, Nancy E; Kolter, Roberto

    2010-08-01

    Listeria monocytogenes is a food-borne facultative intracellular pathogen. It is widespread in the environment and has several distinct life-styles. The key transcriptional activator PrfA positively regulates L. monocytogenes virulence genes to mediate the transition from extracellular, flagellum-propelled cell to intracellular pathogen. Here we report the first evidence that PrfA also has a significant positive impact on extracellular biofilm formation. Mutants lacking prfA were defective in surface-adhered biofilm formation. The DeltaprfA mutant exhibited wild-type flagellar motility, and its biofilm defect occurred after initial surface adhesion. We also observed that mutations that led to the constitutive expression of PrfA-dependent virulence genes had a minimal impact on biofilm formation. Furthermore, biofilm development was enhanced in a mutant encoding a PrfA protein variant unable to fully transition from the extracellular form to the virulent, intracellular activity conformation. These results indicate that PrfA positively regulates biofilm formation and suggest that PrfA has a global role in modulating the life-style of L. monocytogenes. The requirement of PrfA for optimal biofilm formation may provide selective pressure to maintain this critical virulence regulator when L. monocytogenes is outside host cells in the environment.

  2. Oviduct-Specific Expression of Human Neutrophil Defensin 4 in Lentivirally Generated Transgenic Chickens

    Science.gov (United States)

    Liu, Tongxin; Wu, Hanyu; Cao, Dainan; Li, Qingyuan; Zhang, Yaqiong; Li, Ning; Hu, Xiaoxiang

    2015-01-01

    The expression of oviduct-specific recombinant proteins in transgenic chickens is a promising technology for the production of therapeutic biologics in eggs. In this study, we constructed a lentiviral vector encoding an expression cassette for human neutrophil defensin 4 (HNP4), a compound that displays high activity against Escherichia coli, and produced transgenic chickens that expressed the recombinant HNP4 protein in egg whites. After the antimicrobial activity of the recombinant HNP4 protein was tested at the cellular level, a 2.8-kb ovalbumin promoter was used to drive HNP4 expression specifically in oviduct tissues. From 669 injected eggs, 218 chickens were successfully hatched. Ten G0 roosters, with semens identified as positive for the transgene, were mated with wild-type hens to generate G1 chickens. From 1,274 total offspring, fifteen G1 transgenic chickens were positive for the transgene, which was confirmed by PCR and Southern blotting. The results of the Southern blotting and genome walking indicated that a single copy of the HNP4 gene was integrated into chromosomes 1, 2, 3, 4, 6 and 24 of the chickens. As expected, HNP4 expression was restricted to the oviduct tissues, and the levels of both transcriptional and translational HNP4 expression varied greatly in transgenic chickens with different transgene insertion sites. The amount of HNP4 protein expressed in the eggs of G1 and G2 heterozygous transgenic chickens ranged from 1.65 μg/ml to 10.18 μg/ml. These results indicated that the production of transgenic chickens that expressed HNP4 protein in egg whites was successful. PMID:26020529

  3. A 310-bp minimal promoter mediates smooth muscle cell-specific expression of telokin.

    Science.gov (United States)

    Smith, A F; Bigsby, R M; Word, R A; Herring, B P

    1998-05-01

    A cell-specific promoter located in an intron of the smooth muscle myosin light chain kinase gene directs transcription of telokin exclusively in smooth muscle cells. Transgenic mice were generated in which a 310-bp rabbit telokin promoter fragment, extending from -163 to +147, was used to drive expression of simian virus 40 large T antigen. Smooth muscle-specific expression of the T-antigen transgene paralleled that of the endogenous telokin gene in all smooth muscle tissues except uterus. The 310-bp promoter fragment resulted in very low levels of transgene expression in uterus; in contrast, a transgene driven by a 2.4-kb fragment (-2250 to +147) resulted in high levels of transgene expression in uterine smooth muscle. Telokin expression levels correlate with the estrogen status of human myometrial tissues, suggesting that deletion of an estrogen response element (ERE) may account for the low levels of transgene expression driven by the 310-bp rabbit telokin promoter in uterine smooth muscle. Experiments in A10 smooth muscle cells directly showed that reporter gene expression driven by the 2.4-kb, but not 310-bp, promoter fragment could be stimulated two- to threefold by estrogen. This stimulation was mediated through an ERE located between -1447 and -1474. Addition of the ERE to the 310-bp fragment restored estrogen responsiveness in A10 cells. These data demonstrate that in addition to a minimal 310-bp proximal promoter at least one distal cis-acting regulatory element is required for telokin expression in uterine smooth muscle. The distal element may include an ERE between -1447 and -1474.

  4. [Risk assessment of Listeria monocytogenes in deli meats and vegetable salads].

    Science.gov (United States)

    Tian, Jing; Liu, Xiu-mei

    2009-09-01

    To analysis risk from Listeria monocytogenes in deli meats and vegetable salads. Use Risk Ranger which is a software programme developed by the University of Hobart, Australia and answer 11 questions on affecting the risk from hazards in the specific foods by combining data from national foodborne diseases surveillance network and some references to make semi-quantitative risk assessment for the specific food. Relative risk from Listeria monocytogenes in deli meats and vegetable salads is 61 and 52, respectively. Incidence of listeriosis caused by deli meats-Listeria monocytogenes pairs and vegetable salads-Listeria monocytogenes pairs is 5.4 and 0.2 cases per million people, respectively. Risk from the former is 32 times than that from the latter. By changing the selection for some risk factors in the model, it was known that the risks from two food-hazard combinations could decrease 10 times, if taking necessary actions after processing. Deli meats is a kind of high risk food for listeriosis.

  5. Noninvasive monitoring of placenta-specific transgene expression by bioluminescence imaging.

    Directory of Open Access Journals (Sweden)

    Xiujun Fan

    Full Text Available BACKGROUND: Placental dysfunction underlies numerous complications of pregnancy. A major obstacle to understanding the roles of potential mediators of placental pathology has been the absence of suitable methods for tissue-specific gene manipulation and sensitive assays for studying gene functions in the placentas of intact animals. We describe a sensitive and noninvasive method of repetitively tracking placenta-specific gene expression throughout pregnancy using lentivirus-mediated transduction of optical reporter genes in mouse blastocysts. METHODOLOGY/PRINCIPAL FINDINGS: Zona-free blastocysts were incubated with lentivirus expressing firefly luciferase (Fluc and Tomato fluorescent fusion protein for trophectoderm-specific infection and transplanted into day 3 pseudopregnant recipients (GD3. Animals were examined for Fluc expression by live bioluminescence imaging (BLI at different points during pregnancy, and the placentas were examined for tomato expression in different cell types on GD18. In another set of experiments, blastocysts with maximum photon fluxes in the range of 2.0E+4 to 6.0E+4 p/s/cm(2/sr were transferred. Fluc expression was detectable in all surrogate dams by day 5 of pregnancy by live imaging, and the signal increased dramatically thereafter each day until GD12, reaching a peak at GD16 and maintaining that level through GD18. All of the placentas, but none of the fetuses, analyzed on GD18 by BLI showed different degrees of Fluc expression. However, only placentas of dams transferred with selected blastocysts showed uniform photon distribution with no significant variability of photon intensity among placentas of the same litter. Tomato expression in the placentas was limited to only trophoblast cell lineages. CONCLUSIONS/SIGNIFICANCE: These results, for the first time, demonstrate the feasibility of selecting lentivirally-transduced blastocysts for uniform gene expression in all placentas of the same litter and early

  6. Incorporation of gene-specific variability improves expression analysis using high-density DNA microarrays

    Directory of Open Access Journals (Sweden)

    Spitznagel Edward

    2003-11-01

    Full Text Available Abstract Background The assessment of data reproducibility is essential for application of microarray technology to exploration of biological pathways and disease states. Technical variability in data analysis largely depends on signal intensity. Within that context, the reproducibility of individual probe sets has not been hitherto addressed. Results We used an extraordinarily large replicate data set derived from human placental trophoblast to analyze probe-specific contribution to variability of gene expression. We found that signal variability, in addition to being signal-intensity dependant, is probe set-specific. Importantly, we developed a novel method to quantify the contribution of this probe set-specific variability. Furthermore, we devised a formula that incorporates a priori-computed, replicate-based information on probe set- and intensity-specific variability in determination of expression changes even without technical replicates. Conclusion The strategy of incorporating probe set-specific variability is superior to analysis based on arbitrary fold-change thresholds. We recommend its incorporation to any computation of gene expression changes using high-density DNA microarrays. A Java application implementing our T-score is available at http://www.sadovsky.wustl.edu/tscore.html.

  7. Specific DNA-binding proteins and DNA sequences involved in steroid hormone regulation of gene expression

    International Nuclear Information System (INIS)

    Spelsberg, T.; Hora, J.; Horton, M.; Goldberger, A.; Littlefield, B.; Seelke, R.; Toyoda, H.

    1987-01-01

    Steroid hormones circulate in the blood and are taken by target cells via complexes with intracellular binding proteins termed receptors, that are hormone and tissue specific. Each receptor binds it specific steroid with very high affinity, having an equilibrium dissociation constant (K/sub d/) in the range of 10 -9 to 10 -10 M. Once bound by their specific steroid hormones, the steroid receptors undergo a conformational change which allows them to bind with high affinity to sites on chromatin, termed nuclear acceptor sites. There are estimated 5,000 to 10,000 of these sites expressed with an equal number not expressed (''masked'') in intact chromatin. The result of the binding to nuclear acceptor sites is an alteration of gene transcription or, in some cases, gene expression as measured by the changing levels of specific RNAs and proteins in that target tissue. Each steroid regulates specific effects on the RNA and protein profiles. The chronology of the above mechanism of action after injection of radiolabelled steroid as is follows: Steroid-receptor complex formation (1 minute), nuclear acceptor sites (2 minutes), effects on RNA synthesis (10 to 30 minutes), and finally the changing protein profiles via changes in protein synthesis and protein turnover (1 to 6 hours). Thus steroid receptors represent one of the first identified intracellular gene regulation proteins. The receptor molecules themselves are regulated by the presence or absence of the steroid molecule

  8. Expression in Arabidopsis of a nucellus-specific promoter from watermelon (Citrullus lanatus).

    Science.gov (United States)

    Dwivedi, Krishna K; Roche, Dominique; Carman, John G

    2010-11-01

    Though many tissue-specific promoters have been identified, few have been associated specifically with the angiospermous megasporangium (nucellus). In the present study the 2000-bp regulatory region upstream to the watermelon, Citrullus lanatus (Thunb.) Matsum & Nakai, gene WM403 (GenBank accession no. AF008925), which shows nucellus-specific expression, was cloned from watermelon gDNA and fused to the β-glucuronidase reporter gene (GUS). The resulting plasmid, WM403 Prom::GUS(+), which also contained NPTII, was transformed into Arabidopsis thaliana ecotype Co1-0. Seedlings were selected on kanamycin-containing medium, and transformants were confirmed by PCR. GUS assays of T(3) transformants revealed weak promoter activation in epidermal layers of the placenta and locule septum during premeiotic ovule development but strong activation in the nucellus, embryo sac and early embryo, from early embryo sac formation to early globular embryo formation. Expression in seeds was absent thereafter. These results indicate that the WM403 promoter may be useful in driving nucellus-specific gene expression in plants including candidate genes for important nucellus-specific traits such as apospory or adventitious embryony. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.

  9. Programmed death-1 expression on HIV-1-specific CD8+ T cells is shaped by epitope specificity, T-cell receptor clonotype usage and antigen load

    DEFF Research Database (Denmark)

    Kløverpris, Henrik N; McGregor, Reuben; McLaren, James E

    2014-01-01

    of differentiation on HIV-1-specific CD8+ T-cell populations(n = 128) spanning 11 different epitope targets. RESULTS: Expression levels of PD-1, but not CD244 or LAG-3, varied substantially across epitope specificities both within and between individuals. Differential expression of PD-1 on T-cell receptor (TCR...

  10. The diversity of nanos expression in echinoderm embryos supports different mechanisms in germ cell specification.

    Science.gov (United States)

    Fresques, Tara; Swartz, Steven Zachary; Juliano, Celina; Morino, Yoshiaki; Kikuchi, Mani; Akasaka, Koji; Wada, Hiroshi; Yajima, Mamiko; Wessel, Gary M

    2016-07-01

    Specification of the germ cell lineage is required for sexual reproduction in all animals. However, the timing and mechanisms of germ cell specification is remarkably diverse in animal development. Echinoderms, such as sea urchins and sea stars, are excellent model systems to study the molecular and cellular mechanisms that contribute to germ cell specification. In several echinoderm embryos tested, the germ cell factor Vasa accumulates broadly during early development and is restricted after gastrulation to cells that contribute to the germ cell lineage. In the sea urchin, however, the germ cell factor Vasa is restricted to a specific lineage by the 32-cell stage. We therefore hypothesized that the germ cell specification program in the sea urchin/Euechinoid lineage has evolved to an earlier developmental time point. To test this hypothesis we determined the expression pattern of a second germ cell factor, Nanos, in four out of five extant echinoderm clades. Here we find that Nanos mRNA does not accumulate until the blastula stage or later during the development of all other echinoderm embryos except those that belong to the Echinoid lineage. Instead, Nanos is expressed in a restricted domain at the 32-128 cell stage in Echinoid embryos. Our results support the model that the germ cell specification program underwent a heterochronic shift in the Echinoid lineage. A comparison of Echinoid and non-Echinoid germ cell specification mechanisms will contribute to our understanding of how these mechanisms have changed during animal evolution. © 2016 Wiley Periodicals, Inc.

  11. Reprimo tissue-specific expression pattern is conserved between zebrafish and human.

    Directory of Open Access Journals (Sweden)

    Ricardo J Figueroa

    Full Text Available Reprimo (RPRM, a member of the RPRM gene family, is a tumor-suppressor gene involved in the regulation of the p53-mediated cell cycle arrest at G2/M. RPRM has been associated with malignant tumor progression and proposed as a potential biomarker for early cancer detection. However, the expression and role of RPRM, as well as its family, are poorly understood and their physiology is as yet unstudied. In this scenario, a model system like the zebrafish could serve to dissect the role of the RPRM family members in vivo. Phylogenetic analysis reveals that RPRM and RPRML have been differentially retained by most species throughout vertebrate evolution, yet RPRM3 has been retained only in a small group of distantly related species, including zebrafish. Herein, we characterized the spatiotemporal expression of RPRM (present in zebrafish as an infraclass duplication rprma/rprmb, RPRML and RPRM3 in the zebrafish. By whole-mount in situ hybridization (WISH and fluorescent in situ hybridization (FISH, we demonstrate that rprm (rprma/rprmb and rprml show a similar spatiotemporal expression profile during zebrafish development. At early developmental stages rprmb is expressed in somites. After one day post-fertilization, rprm (rprma/rprmb and rprml are expressed in the notochord, brain, blood vessels and digestive tube. On the other hand, rprm3 shows the most unique expression profile, being expressed only in the central nervous system (CNS. We assessed the expression patterns of RPRM gene transcripts in adult zebrafish and human RPRM protein product in tissue samples by RT-qPCR and immunohistochemistry (IHC staining, respectively. Strikingly, tissue-specific expression patterns of the RPRM transcripts and protein are conserved between zebrafish and humans. We propose the zebrafish as a powerful tool to elucidate the both physiological and pathological roles of the RPRM gene family.

  12. Specific gene expression profiles and chromosomal abnormalities are associated with infant disseminated neuroblastoma

    Directory of Open Access Journals (Sweden)

    Kushner Brian

    2009-02-01

    Full Text Available Abstract Background Neuroblastoma (NB tumours have the highest incidence of spontaneous remission, especially among the stage 4s NB subgroup affecting infants. Clinical distinction of stage 4s from lethal stage 4 can be difficult, but critical for therapeutic decisions. The aim of this study was to investigate chromosomal alterations and differential gene expression amongst infant disseminated NB subgroups. Methods Thirty-five NB tumours from patients diagnosed at Results All stage 4s patients underwent spontaneous remission, only 48% stage 4 patients survived despite combined modality therapy. Stage 4 tumours were 90% near-diploid/tetraploid, 44% MYCN amplified, 77% had 1p LOH (50% 1p36, 23% 11q and/or 14q LOH (27% and 47% had 17q gain. Stage 4s were 90% near-triploid, none MYCN amplified and LOH was restricted to 11q. Initial comparison analyses between stage 4s and 4 P P = 0.0054, 91% with higher expression in stage 4. Less definite expression profiles were observed between stage 4s and 4 P P = 0.005 was maintained. Distinct gene expression profiles but no significant association with specific chromosomal region localization was observed between stage 4s and stage 4 Conclusion Specific chromosomal aberrations are associated with distinct gene expression profiles which characterize spontaneously regressing or aggressive infant NB, providing the biological basis for the distinct clinical behaviour.

  13. Cell-Specific PEAR1 Methylation Studies Reveal a Locus that Coordinates Expression of Multiple Genes

    Directory of Open Access Journals (Sweden)

    Benedetta Izzi

    2018-04-01

    Full Text Available Chromosomal interactions connect distant enhancers and promoters on the same chromosome, activating or repressing gene expression. PEAR1 encodes the Platelet-Endothelial Aggregation Receptor 1, a contact receptor involved in platelet function and megakaryocyte and endothelial cell proliferation. PEAR1 expression during megakaryocyte differentiation is controlled by DNA methylation at its first CpG island. We identified a PEAR1 cell-specific methylation sensitive region in endothelial cells and megakaryocytes that showed strong chromosomal interactions with ISGL20L2, RRNAD1, MRLP24, HDGF and PRCC, using available promoter capture Hi-C datasets. These genes are involved in ribosome processing, protein synthesis, cell cycle and cell proliferation. We next studied the methylation and expression profile of these five genes in Human Umbilical Vein Endothelial Cells (HUVECs and megakaryocyte precursors. While cell-specific PEAR1 methylation corresponded to variability in expression for four out of five genes, no methylation change was observed in their promoter regions across cell types. Our data suggest that PEAR1 cell-type specific methylation changes may control long distance interactions with other genes. Further studies are needed to show whether such interaction data might be relevant for the genome-wide association data that showed a role for non-coding PEAR1 variants in the same region and platelet function, platelet count and cardiovascular risk.

  14. From specificity to sensitivity: affective states modulate visual working memory for emotional expressive faces.

    Science.gov (United States)

    Maran, Thomas; Sachse, Pierre; Furtner, Marco

    2015-01-01

    Previous findings suggest that visual working memory (VWM) preferentially remembers angry looking faces. However, the meaning of facial actions is construed in relation to context. To date, there are no studies investigating the role of perceiver-based context when processing emotional cues in VWM. To explore the influence of affective context on VWM for faces, we conducted two experiments using both a VWM task for emotionally expressive faces and a mood induction procedure. Affective context was manipulated by unpleasant (Experiment 1) and pleasant (Experiment 2) IAPS pictures in order to induce an affect high in motivational intensity (defensive or appetitive, respectively) compared to a low arousal control condition. Results indicated specifically increased sensitivity of VWM for angry looking faces in the neutral condition. Enhanced VWM for angry faces was prevented by inducing affects of high motivational intensity. In both experiments, affective states led to a switch from specific enhancement of angry expressions in VWM to an equally sensitive representation of all emotional expressions. Our findings demonstrate that emotional expressions are of different behavioral relevance for the receiver depending on the affective context, supporting a functional organization of VWM along with flexible resource allocation. In VWM, stimulus processing adjusts to situational requirements and transitions from a specifically prioritizing default mode in predictable environments to a sensitive, hypervigilant mode in exposure to emotional events.

  15. From Specificity to Sensitivity: Affective states modulate visual working memory for emotional expressive faces

    Directory of Open Access Journals (Sweden)

    Thomas eMaran

    2015-08-01

    Full Text Available Previous findings suggest that visual working memory preferentially remembers angry looking faces. However, the meaning of facial actions is construed in relation to context. To date, there are no studies investigating the role of perceiver-based context when processing emotional cues in visual working memory. To explore the influence of affective context on visual working memory for faces, we conducted two experiments using both a visual working memory task for emotionally expressive faces and a mood induction procedure. Affective context was manipulated by unpleasant (Experiment 1 and pleasant (Experiment 2 IAPS pictures in order to induce an affect high in motivational intensity (defensive or appetitive, respectively compared to a low arousal control condition. Results indicated specifically increased sensitivity of visual working memory for angry looking faces in the neutral condition. Enhanced visual working memory for angry faces was prevented by inducing affects of high motivational intensity. In both experiments, affective states led to a switch from specific enhancement of angry expressions in visual working memory to an equally sensitive representation of all emotional expressions. Our findings demonstrate that emotional expressions are of different behavioral relevance for the receiver depending on the affective context, supporting a functional organization of visual working memory along with flexible resource allocation. In visual working memory, stimulus processing adjusts to situational requirements and transitions from a specifically prioritizing default mode in predictable environments to a sensitive, hypervigilant mode in exposure to emotional events.

  16. TOPAZ1, a novel germ cell-specific expressed gene conserved during evolution across vertebrates.

    Directory of Open Access Journals (Sweden)

    Adrienne Baillet

    Full Text Available BACKGROUND: We had previously reported that the Suppression Subtractive Hybridization (SSH approach was relevant for the isolation of new mammalian genes involved in oogenesis and early follicle development. Some of these transcripts might be potential new oocyte and granulosa cell markers. We have now characterized one of them, named TOPAZ1 for the Testis and Ovary-specific PAZ domain gene. PRINCIPAL FINDINGS: Sheep and mouse TOPAZ1 mRNA have 4,803 bp and 4,962 bp open reading frames (20 exons, respectively, and encode putative TOPAZ1 proteins containing 1,600 and 1653 amino acids. They possess PAZ and CCCH domains. In sheep, TOPAZ1 mRNA is preferentially expressed in females during fetal life with a peak during prophase I of meiosis, and in males during adulthood. In the mouse, Topaz1 is a germ cell-specific gene. TOPAZ1 protein is highly conserved in vertebrates and specifically expressed in mouse and sheep gonads. It is localized in the cytoplasm of germ cells from the sheep fetal ovary and mouse adult testis. CONCLUSIONS: We have identified a novel PAZ-domain protein that is abundantly expressed in the gonads during germ cell meiosis. The expression pattern of TOPAZ1, and its high degree of conservation, suggests that it may play an important role in germ cell development. Further characterization of TOPAZ1 may elucidate the mechanisms involved in gametogenesis, and particularly in the RNA silencing process in the germ line.

  17. Influence of freezing stress on morphological alteration and biofilm formation by Listeria monocytogenes: relationship with cell surface hydrophobicity and membrane fluidity.

    Science.gov (United States)

    Miladi, Hanene; Ammar, Emna; Ben Slama, Rihab; Sakly, Nawfel; Bakhrouf, Amina

    2013-11-01

    The morphological changes and adhesive property of three Listeria monocytogenes strains submitted to freezing stress (-20 °C) were studied. The atomic force micrographs showed a reduction in the cell size and an evolution to coccoid shape. The phenotypic slime production of L. monocytogenes and the expression of the adhesive gene were investigated before and after 10 months of incubation in salmon at -20°. Our results showed that after ten months, stressed stains become more adherent and able to produce slime. In addition, we noted that this pathogen presents same physiological changes to adapt to starvation conditions. The cellular fatty acids composition of adhered and floating cells of three L. monocytogenes strains was taken into consideration. The stressed strains presented different chain lengths and therefore an increase in the hydrophobicity level. Moreover, we noted that the adhesive property of L. monocytogenes strains affects the Benzalkonium chloride bacterial sensitivity which increased after biofilm formation.

  18. Cerebellum-specific and age-dependent expression of an endogenous retrovirus with intact coding potential

    Directory of Open Access Journals (Sweden)

    Itoh Takayuki

    2011-10-01

    Full Text Available Abstract Background Endogenous retroviruses (ERVs, including murine leukemia virus (MuLV type-ERVs (MuLV-ERVs, are presumed to occupy ~10% of the mouse genome. In this study, following the identification of a full-length MuLV-ERV by in silico survey of the C57BL/6J mouse genome, its distribution in different mouse strains and expression characteristics were investigated. Results Application of a set of ERV mining protocols identified a MuLV-ERV locus with full coding potential on chromosome 8 (named ERVmch8. It appears that ERVmch8 shares the same genomic locus with a replication-incompetent MuLV-ERV, called Emv2; however, it was not confirmed due to a lack of relevant annotation and Emv2 sequence information. The ERVmch8 sequence was more prevalent in laboratory strains compared to wild-derived strains. Among 16 different tissues of ~12 week-old female C57BL/6J mice, brain homogenate was the only tissue with evident expression of ERVmch8. Further ERVmch8 expression analysis in six different brain compartments and four peripheral neuronal tissues of C57BL/6J mice revealed no significant expression except for the cerebellum in which the ERVmch8 locus' low methylation status was unique compared to the other brain compartments. The ERVmch8 locus was found to be surrounded by genes associated with neuronal development and/or inflammation. Interestingly, cerebellum-specific ERVmch8 expression was age-dependent with almost no expression at 2 weeks and a plateau at 6 weeks. Conclusions The ecotropic ERVmch8 locus on the C57BL/6J mouse genome was relatively undermethylated in the cerebellum, and its expression was cerebellum-specific and age-dependent.

  19. Specific gene expression responses to parasite genotypes reveal redundancy of innate immunity in vertebrates.

    Directory of Open Access Journals (Sweden)

    David Haase

    Full Text Available Vertebrate innate immunity is the first line of defense against an invading pathogen and has long been assumed to be largely unspecific with respect to parasite/pathogen species. However, recent phenotypic evidence suggests that immunogenetic variation, i.e. allelic variability in genes associated with the immune system, results in host-parasite genotype-by-genotype interactions and thus specific innate immune responses. Immunogenetic variation is common in all vertebrate taxa and this reflects an effective immunological function in complex environments. However, the underlying variability in host gene expression patterns as response of innate immunity to within-species genetic diversity of macroparasites in vertebrates is unknown. We hypothesized that intra-specific variation among parasite genotypes must be reflected in host gene expression patterns. Here we used high-throughput RNA-sequencing to examine the effect of parasite genotypes on gene expression patterns of a vertebrate host, the three-spined stickleback (Gasterosteus aculeatus. By infecting naïve fish with distinct trematode genotypes of the species Diplostomum pseudospathaceum we show that gene activity of innate immunity in three-spined sticklebacks depended on the identity of an infecting macroparasite genotype. In addition to a suite of genes indicative for a general response against the trematode we also find parasite-strain specific gene expression, in particular in the complement system genes, despite similar infection rates of single clone treatments. The observed discrepancy between infection rates and gene expression indicates the presence of alternative pathways which execute similar functions. This suggests that the innate immune system can induce redundant responses specific to parasite genotypes.

  20. Characterization of germ cell-specific expression of the orphan nuclear receptor, germ cell nuclear factor.

    Science.gov (United States)

    Katz, D; Niederberger, C; Slaughter, G R; Cooney, A J

    1997-10-01

    Nuclear receptors, such as those for androgens, estrogens, and progesterones, control many reproductive processes. Proteins with structures similar to these receptors, but for which ligands have not yet been identified, have been termed orphan nuclear receptors. One of these orphans, germ cell nuclear factor (GCNF), has been shown to be germ cell specific in the adult and, therefore, may also participate in the regulation of reproductive functions. In this paper, we examine more closely the expression patterns of GCNF in germ cells to begin to define spatio-temporal domains of its activity. In situ hybridization showed that GCNF messenger RNA (mRNA) is lacking in the testis of hypogonadal mutant mice, which lack developed spermatids, but is present in the wild-type testis. Thus, GCNF is, indeed, germ cell specific in the adult male. Quantitation of the specific in situ hybridization signal in wild-type testis reveals that GCNF mRNA is most abundant in stage VII round spermatids. Similarly, Northern analysis and specific in situ hybridization show that GCNF expression first occurs in testis of 20-day-old mice, when round spermatids first emerge. Therefore, in the male, GCNF expression occurs postmeiotically and may participate in the morphological changes of the maturing spermatids. In contrast, female expression of GCNF is shown in growing oocytes that have not completed the first meiotic division. Thus, GCNF in the female is expressed before the completion of meiosis. Finally, the nature of the two different mRNAs that hybridize to the GCNF complementary DNA was studied. Although both messages contain the DNA binding domain, only the larger message is recognized by a probe from the extreme 3' untranslated region. In situ hybridization with these differential probes demonstrates that both messages are present in growing oocytes. In addition, the coding region and portions of the 3' untranslated region of the GCNF complementary DNA are conserved in the rat.

  1. Long-term in vitro, cell-type-specific genome-wide reprogramming of gene expression

    International Nuclear Information System (INIS)

    Hakelien, Anne-Mari; Gaustad, Kristine G.; Taranger, Christel K.; Skalhegg, Bjorn S.; Kuentziger, Thomas; Collas, Philippe

    2005-01-01

    We demonstrate a cell extract-based, genome-wide and heritable reprogramming of gene expression in vitro. Kidney epithelial 293T cells have previously been shown to take on T cell properties following a brief treatment with an extract of Jurkat T cells. We show here that 293T cells exposed for 1 h to a Jurkat cell extract undergo genome-wide, target cell-type-specific and long-lasting transcriptional changes. Microarray analyses indicate that on any given week after extract treatment, ∼2500 genes are upregulated >3-fold, of which ∼900 are also expressed in Jurkat cells. Concomitantly, ∼1500 genes are downregulated or repressed, of which ∼500 are also downregulated in Jurkat cells. Gene expression changes persist for over 30 passages (∼80 population doublings) in culture. Target cell-type specificity of these changes is shown by the lack of activation or repression of Jurkat-specific genes by extracts of 293T cells or carcinoma cells. Quantitative RT-PCR analysis confirms the long-term transcriptional activation of genes involved in key T cell functions. Additionally, growth of cells in suspended aggregates, expression of CD3 and CD28 T cell surface markers, and interleukin-2 secretion by 293T cells treated with extract of adult peripheral blood T cells illustrate a functional nuclear reprogramming. Therefore, target cell-type-specific and heritable changes in gene expression, and alterations in cell function, can be promoted by extracts derived from transformed cells as well as from adult primary cells

  2. Prevalence of Listeria monocytogenes in poultry meat

    Directory of Open Access Journals (Sweden)

    Mehmet ELMALI

    2015-01-01

    Full Text Available AbstractThe objectives of this study were i to isolate Listeria spp. and Listeria monocytogenes in broiler wing meat samples, ii to confirm the isolates by PCR, based on prs and hly A gene sequences, iii to determine the seasonal and monthly distribution of the isolates. A total of 120 broiler wing meat samples (60 packaged pieces wrapped using strech film in styrofoam plates and 60 unpackaged pieces bought from different markets in Hatay province were analysed. Listeria spp. was isolated from 57 (47.5% out of 120 samples. Fifty-four, out of 57 Listeria spp. isolates were identified as L. monocytogenes. L. monocytogenes was isolated from the samples collected during the spring, winter, summer, and autumn at the levels of 26.6%, 40%, 53.3%, 60%, respectively. In this study, the isolation rates were found to be the highest in autumn, while the isolation rates were found to be the lowest in spring. As a consequence, high prevalence of Listeria spp. and L. monocytogenes in poultry wing meat samples may pose a risk for human health. We consider that with obeying the rules of good hygiene practices (GHP, good manufacturing practices (GMP and HACCP can minimize the contamination with Listeria spp.

  3. Control options for Listeria monocytogenes in seafoods

    DEFF Research Database (Denmark)

    Huss, Hans Henrik; Jørgensen, Lasse Vigel; Vogel, Birte Fonnesbech

    2000-01-01

    At least three outbreaks of listeriosis associated with seafood have been reported. Listeria monocytogenes is widely distributed in the general environment including fresh water, coastal water and live fish from these areas. Contamination or recontamination of seafood may also take place during...

  4. Listeria monocytogenes : nog steeds een probleem?

    NARCIS (Netherlands)

    Beumer, R.R.

    2011-01-01

    Listeria monocytogenes is net als vele andere bacteriële voedselpathogenen al tientallen jaren bekend. De meeste grondstoffen voor voedingsmiddelen komen uit de akker- en tuinbouw, de veehouderij en de visserij. Besmetting vindt daar plaats met micro-organismen afkomstig uit grond, fecaliën, water,

  5. Expression of genes encoding multi-transmembrane proteins in specific primate taste cell populations.

    Directory of Open Access Journals (Sweden)

    Bryan D Moyer

    Full Text Available BACKGROUND: Using fungiform (FG and circumvallate (CV taste buds isolated by laser capture microdissection and analyzed using gene arrays, we previously constructed a comprehensive database of gene expression in primates, which revealed over 2,300 taste bud-associated genes. Bioinformatics analyses identified hundreds of genes predicted to encode multi-transmembrane domain proteins with no previous association with taste function. A first step in elucidating the roles these gene products play in gustation is to identify the specific taste cell types in which they are expressed. METHODOLOGY/PRINCIPAL FINDINGS: Using double label in situ hybridization analyses, we identified seven new genes expressed in specific taste cell types, including sweet, bitter, and umami cells (TRPM5-positive, sour cells (PKD2L1-positive, as well as other taste cell populations. Transmembrane protein 44 (TMEM44, a protein with seven predicted transmembrane domains with no homology to GPCRs, is expressed in a TRPM5-negative and PKD2L1-negative population that is enriched in the bottom portion of taste buds and may represent developmentally immature taste cells. Calcium homeostasis modulator 1 (CALHM1, a component of a novel calcium channel, along with family members CALHM2 and CALHM3; multiple C2 domains; transmembrane 1 (MCTP1, a calcium-binding transmembrane protein; and anoctamin 7 (ANO7, a member of the recently identified calcium-gated chloride channel family, are all expressed in TRPM5 cells. These proteins may modulate and effect calcium signalling stemming from sweet, bitter, and umami receptor activation. Synaptic vesicle glycoprotein 2B (SV2B, a regulator of synaptic vesicle exocytosis, is expressed in PKD2L1 cells, suggesting that this taste cell population transmits tastant information to gustatory afferent nerve fibers via exocytic neurotransmitter release. CONCLUSIONS/SIGNIFICANCE: Identification of genes encoding multi-transmembrane domain proteins

  6. Key metalloproteinases are expressed by specific cell types in experimental autoimmune encephalomyelitis

    DEFF Research Database (Denmark)

    Toft-Hansen, Henrik; Nuttall, Robert K; Edwards, Dylan R

    2004-01-01

    animal model, experimental autoimmune encephalomyelitis (EAE). We used real-time RT-PCR to profile the expression of all 22 known mouse MMPs, seven ADAMs, and all four known TIMPs in spinal cord from SJL/J mice and mice with adoptively transferred myelin basic protein (MBP)-specific EAE. A significant...... cellular sources of these strongly affected proteins in the inflamed CNS, we isolated macrophages, granulocytes, microglia, and T cells by cell sorting from the CNS of mice with EAE and analyzed their expression by real-time RT-PCR. This identified macrophages as a major source of MMP-12 and TIMP-1...

  7. Snorc is a novel cartilage specific small membrane proteoglycan expressed in differentiating and articular chondrocytes

    DEFF Research Database (Denmark)

    Heinonen, J; Taipaleenmäki, H; Roering, P

    2011-01-01

    OBJECTIVE: Maintenance of chondrocyte phenotype is a major issue in prevention of degeneration and repair of articular cartilage. Although the critical pathways in chondrocyte maturation and homeostasis have been revealed, the in-depth understanding is deficient and novel modifying components...... subgroups. Cartilage specific expression was highest in proliferating and prehypertrophic zones during development, and in adult articular cartilage, expression was restricted to the uncalcified zone, including chondrocyte clusters in human osteoarthritic cartilage. Studies with experimental chondrogenesis...... chondrocytes and adult articular chondrocytes with possible functions associated with development and maintenance of chondrocyte phenotype....

  8. Dual-specificity anti-sigma factor reinforces control of cell-type specific gene expression in Bacillus subtilis.

    Directory of Open Access Journals (Sweden)

    Mónica Serrano

    2015-04-01

    Full Text Available Gene expression during spore development in Bacillus subtilis is controlled by cell type-specific RNA polymerase sigma factors. σFand σE control early stages of development in the forespore and the mother cell, respectively. When, at an intermediate stage in development, the mother cell engulfs the forespore, σF is replaced by σG and σE is replaced by σK. The anti-sigma factor CsfB is produced under the control of σF and binds to and inhibits the auto-regulatory σG, but not σF. A position in region 2.1, occupied by an asparagine in σG and by a glutamate in οF, is sufficient for CsfB discrimination of the two sigmas, and allows it to delay the early to late switch in forespore gene expression. We now show that following engulfment completion, csfB is switched on in the mother cell under the control of σK and that CsfB binds to and inhibits σE but not σK, possibly to facilitate the switch from early to late gene expression. We show that a position in region 2.3 occupied by a conserved asparagine in σE and by a conserved glutamate in σK suffices for discrimination by CsfB. We also show that CsfB prevents activation of σG in the mother cell and the premature σG-dependent activation of σK. Thus, CsfB establishes negative feedback loops that curtail the activity of σE and prevent the ectopic activation of σG in the mother cell. The capacity of CsfB to directly block σE activity may also explain how CsfB plays a role as one of the several mechanisms that prevent σE activation in the forespore. Thus the capacity of CsfB to differentiate between the highly similar σF/σG and σE/σK pairs allows it to rinforce the cell-type specificity of these sigma factors and the transition from early to late development in B. subtilis, and possibly in all sporeformers that encode a CsfB orthologue.

  9. Tissue Specific Expression of Cre in Rat Tyrosine Hydroxylase and Dopamine Active Transporter-Positive Neurons.

    Science.gov (United States)

    Liu, Zhenyi; Brown, Andrew; Fisher, Dan; Wu, Yumei; Warren, Joe; Cui, Xiaoxia

    2016-01-01

    The rat is a preferred model system over the mouse for neurological studies, and cell type-specific Cre expression in the rat enables precise ablation of gene function in neurons of interest, which is especially valuable for neurodegenerative disease modeling and optogenetics. Yet, few such Cre rats are available. Here we report the characterization of two Cre rats, tyrosine hydroxylase (TH)-Cre and dopamine active transporter (DAT or Slc6a3)-Cre, by using a combination of immunohistochemistry (IHC) and mRNA fluorescence in situ hybridization (FISH) as well as a fluorescent reporter for Cre activity. We detected Cre expression in expected neurons in both Cre lines. Interestingly, we also found that in Th-Cre rats, but not DAT-Cre rats, Cre is expressed in female germ cells, allowing germline excision of the floxed allele and hence the generation of whole-body knockout rats. In summary, our data demonstrate that targeted integration of Cre cassette lead to faithful recapitulation of expression pattern of the endogenous promoter, and mRNA FISH, in addition to IHC, is an effective method for the analysis of the spatiotemporal gene expression patterns in the rat brain, alleviating the dependence on high quality antibodies that are often not available against rat proteins. The Th-Cre and the DAT-Cre rat lines express Cre in selective subsets of dopaminergic neurons and should be particularly useful for researches on Parkinson's disease.

  10. Rapid expression of transgenes driven by seed-specific constructs in leaf tissue: DHA production

    Directory of Open Access Journals (Sweden)

    Zhou Xue-Rong

    2010-03-01

    Full Text Available Abstract Background Metabolic engineering of seed biosynthetic pathways to diversify and improve crop product quality is a highly active research area. The validation of genes driven by seed-specific promoters is time-consuming since the transformed plants must be grown to maturity before the gene function can be analysed. Results In this study we demonstrate that genes driven by seed-specific promoters contained within complex constructs can be transiently-expressed in the Nicotiana benthamiana leaf-assay system by co-infiltrating the Arabidopsis thaliana LEAFY COTYLEDON2 (LEC2 gene. A real-world case study is described in which we first assembled an efficient transgenic DHA synthesis pathway using a traditional N. benthamiana Cauliflower Mosaic Virus (CaMV 35S-driven leaf assay before using the LEC2-extended assay to rapidly validate a complex seed-specific construct containing the same genes before stable transformation in Arabidopsis. Conclusions The LEC2-extended N. benthamiana assay allows the transient activation of seed-specific promoters in leaf tissue. In this study we have used the assay as a rapid preliminary screen of a complex seed-specific transgenic construct prior to stable transformation, a feature that will become increasingly useful as genetic engineering moves from the manipulation of single genes to the engineering of complex pathways. We propose that the assay will prove useful for other applications wherein rapid expression of transgenes driven by seed-specific constructs in leaf tissue are sought.

  11. Genomic presence of gadD1 glutamate decarboxylase correlates with the organization of ascB-dapE internalin cluster in Listeria monocytogenes.

    Science.gov (United States)

    Chen, Jianshun; Fang, Chun; Zheng, Tianlun; Zhu, Ningyu; Bei, Yijiang; Fang, Weihuan

    2012-02-01

    The ability to survive and proliferate in acidic environments is a prerequisite for the infection of Listeria monocytogenes. The glutamate decarboxylase (GAD) system is responsible for acid resistance, and three GAD homologs have been identified in L. monocytogenes: gadD1, gadD2, and gadD3. To examine whether GAD genes are specific to lineage, serovar, or certain subpopulation, we performed a systematic investigation on the prevalence of GAD genes in 164 L. monocytogenes. In contrast to gadD2 and gadD3 conserved in all L. monocytogenes strains, gadD1 was identified in 36.6% (60/164) of L. monocytogenes strains, including all serovar 1/2c and 68.5% (37/54) of serovar 1/2a strains, as well as a small fraction of serovar 1/2b (3.4%, 1/29) and lineage III (13.8%, 4/29) strains. All serovar 4b and lineage IV strains lacked this gene. According to the ascB-dapE structure, L. monocytogenes strains were classified into four subpopulations, carrying inlC2DE, inlGC2DE, inlGHE, or no internalin cluster, respectively. All L. monocytogenes strains with inlGC2DE or inlGHE pattern harbored gadD1, whereas those bearing inlC2DE or no internalin cluster between ascB and dapE lacked gadD1. In addition, other five non-monocytogenes Listeria species lacking ascB-dapE internalin cluster were gadD1-negative. Overall, the presence of gadD1 is not fully dependent on lineages or serovars but correlates with ascB-dapE internalin profiles, suggesting gadD1 might have co-evolved with the ascB-dapE internalin cluster in the primitive L. monocytogenes before divergence of serovars.

  12. Listeria monocytogenes strains show large variations in competitive growth in mixed culture biofilms and suspensions with bacteria from food processing environments.

    Science.gov (United States)

    Heir, Even; Møretrø, Trond; Simensen, Andreas; Langsrud, Solveig

    2018-06-20

    Interactions and competition between resident bacteria in food processing environments could affect their ability to survive, grow and persist in microhabitats and niches in the food industry. In this study, the competitive ability of L. monocytogenes strains grown together in separate culture mixes with other L. monocytogenes (L. mono mix), L. innocua (Listeria mix), Gram-negative bacteria (Gram- mix) and with a multigenera mix (Listeria + Gram- mix) was investigated in biofilms on stainless steel and in suspensions at 12 °C. The mixed cultures included resident bacteria from processing surfaces in meat and salmon industry represented by L. monocytogenes (n = 6), L. innocua (n = 5) and Gram-negative bacteria (n = 6; Acinetobacter sp., Pseudomonas fragi, Pseudomonas fluorescens, Serratia liquefaciens, Stenotrophomonas maltophilia). Despite hampered in growth in mixed cultures, L. monocytogenes established in biofilms with counts at day nine between 7.3 and 9.0 log per coupon with the lowest counts in the Listeria + G- mix that was dominated by Pseudomonas. Specific L. innocua inhibited growth of L. monocytogenes strains differently; inhibition that was further enhanced by the background Gram-negative microbiota. In these multispecies and multibacteria cultures, the growth competitive effects lead to the dominance of a strong competitor L. monocytogenes strain that was only slightly inhibited by L. innocua and showed strong competitive abilities in mixed cultures with resident Gram-negative bacteria. The results indicates complex patterns of bacterial interactions and L. monocytogenes inhibition in the multibacteria cultures that only partially depend on cell contact and likely involve various antagonistic and bacterial tolerance mechanisms. The study indicates large variations among L. monocytogenes in their competitiveness under multibacterial culture conditions that should be considered in further studies towards understanding of L

  13. Mammary Specific Expression of Cre Recombinase Under the Control of an Endogenous MMTV LTR: A Conditional Knock-Out System

    National Research Council Canada - National Science Library

    Czarneski, Jennifer

    2000-01-01

    .... The hypothesis of the project was to develop a novel breast cancer model using the tissue-specific expression of the Mtv-17 locus, which was previously shown by this lab to only be expressed in the mammary gland...

  14. Muscle fiber type specific induction of slow myosin heavy chain 2 gene expression by electrical stimulation

    International Nuclear Information System (INIS)

    Crew, Jennifer R.; Falzari, Kanakeshwari; DiMario, Joseph X.

    2010-01-01

    Vertebrate skeletal muscle fiber types are defined by a broad array of differentially expressed contractile and metabolic protein genes. The mechanisms that establish and maintain these different fiber types vary throughout development and with changing functional demand. Chicken skeletal muscle fibers can be generally categorized as fast and fast/slow based on expression of the slow myosin heavy chain 2 (MyHC2) gene in fast/slow muscle fibers. To investigate the cellular and molecular mechanisms that control fiber type formation in secondary or fetal muscle fibers, myoblasts from the fast pectoralis major (PM) and fast/slow medial adductor (MA) muscles were isolated, allowed to differentiate in vitro, and electrically stimulated. MA muscle fibers were induced to express the slow MyHC2 gene by electrical stimulation, whereas PM muscle fibers did not express the slow MyHC2 gene under identical stimulation conditions. However, PM muscle fibers did express the slow MyHC2 gene when electrical stimulation was combined with inhibition of inositol triphosphate receptor (IP3R) activity. Electrical stimulation was sufficient to increase nuclear localization of expressed nuclear-factor-of-activated-T-cells (NFAT), NFAT-mediated transcription, and slow MyHC2 promoter activity in MA muscle fibers. In contrast, both electrical stimulation and inhibitors of IP3R activity were required for these effects in PM muscle fibers. Electrical stimulation also increased levels of peroxisome-proliferator-activated receptor-γ co-activator-1 (PGC-1α) protein in PM and MA muscle fibers. These results indicate that MA muscle fibers can be induced by electrical stimulation to express the slow MyHC2 gene and that fast PM muscle fibers are refractory to stimulation-induced slow MyHC2 gene expression due to fast PM muscle fiber specific cellular mechanisms involving IP3R activity.

  15. The Effect of Oxygen on Bile Resistance in Listeria monocytogenes

    Science.gov (United States)

    Wright, Morgan L; Pendarvis, Ken; Nanduri, Bindu; Edelmann, Mariola J; Jenkins, Haley N; Reddy, Joseph S; Wilson, Jessica G; Ding, Xuan; Broadway, Paul R; Ammari, Mais G; Paul, Oindrila; Roberts, Brandy; Donaldson, Janet R

    2016-01-01

    Listeria monocytogenes is a Gram-positive facultative anaerobe that is the causative agent of the disease listeriosis. The infectious ability of this bacterium is dependent upon resistance to stressors encountered within the gastrointestinal tract, including bile. Previous studies have indicated bile salt hydrolase activity increases under anaerobic conditions, suggesting anaerobic conditions influence stress responses. Therefore, the goal of this study was to determine if reduced oxygen availability increased bile resistance of L. monocytogenes. Four strains representing three serovars were evaluated for changes in viability and proteome expression following exposure to bile in aerobic or anaerobic conditions. Viability for F2365 (serovar 4b), EGD-e (serovar 1/2a), and 10403S (serovar 1/2a) increased following exposure to 10% porcine bile under anaerobic conditions (P 0.05) in bile resistance between aerobic and anaerobic conditions, indicating that oxygen availability does not influence resistance in this strain. The proteomic analysis indicated F2365 and EGD-e had an increased expression of proteins associated with cell envelope and membrane bioenergetics under anaerobic conditions, including thioredoxin-disulfide reductase and cell division proteins. Interestingly, HCC23 had an increase in several dehydrogenases following exposure to bile under aerobic conditions, suggesting that the NADH:NAD+ is altered and may impact bile resistance. Variations were observed in the expression of the cell shape proteins between strains, which corresponded to morphological differences observed by scanning electron microscopy. These data indicate that oxygen availability influences bile resistance. Further research is needed to decipher how these changes in metabolism impact pathogenicity in vivo and also the impact that this has on susceptibility of a host to listeriosis. PMID:27274623

  16. Cloning, characterization and effect of TmPGRP-LE gene silencing on survival of Tenebrio molitor against Listeria monocytogenes infection.

    Science.gov (United States)

    Tindwa, Hamisi; Patnaik, Bharat Bhusan; Kim, Dong Hyun; Mun, Seulgi; Jo, Yong Hun; Lee, Bok Luel; Lee, Yong Seok; Kim, Nam Jung; Han, Yeon Soo

    2013-11-14

    Peptidoglycan recognition proteins (PGRPs) are a family of innate immune molecules that recognize bacterial peptidoglycan. PGRP-LE, a member of the PGRP family, selectively binds to diaminopimelic acid (DAP)-type peptidoglycan to activate both the immune deficiency (Imd) and proPhenoloxidase (proPO) pathways in insects. A PGRP-LE-dependent induction of autophagy to control Listeria monocytogenes has also been reported. We identified and partially characterized a novel PGRP-LE homologue, from Tenebrio molitor and analyzed its functional role in the survival of the insect against infection by a DAP-type PGN containing intracellular pathogen, L. monocytogenes. The cDNA is comprised of an open reading frame (ORF) of 990 bp and encodes a polypeptide of 329 residues. TmPGRP-LE contains one PGRP domain, but lacks critical residues for amidase activity. Quantitative RT-PCR analysis showed a broad constitutive expression of the transcript at various stages of development spanning from larva to adult. RNAi mediated knockdown of the transcripts, followed by a challenge with L. monocytogenes, showed a significant reduction in survival rate of the larvae, suggesting a putative role of TmPGRP-LE in sensing and control of L. monocytogenes infection in T. molitor. These results implicate PGRP-LE as a defense protein necessary for survival of T. molitor against infection by L. monocytogenes.

  17. Cloning, Characterization and Effect of TmPGRP-LE Gene Silencing on Survival of Tenebrio Molitor against Listeria monocytogenes Infection

    Directory of Open Access Journals (Sweden)

    Yeon Soo Han

    2013-11-01

    Full Text Available Peptidoglycan recognition proteins (PGRPs are a family of innate immune molecules that recognize bacterial peptidoglycan. PGRP-LE, a member of the PGRP family, selectively binds to diaminopimelic acid (DAP-type peptidoglycan to activate both the immune deficiency (Imd and proPhenoloxidase (proPO pathways in insects. A PGRP-LE-dependent induction of autophagy to control Listeria monocytogenes has also been reported. We identified and partially characterized a novel PGRP-LE homologue, from Tenebrio molitor and analyzed its functional role in the survival of the insect against infection by a DAP-type PGN containing intracellular pathogen, L. monocytogenes. The cDNA is comprised of an open reading frame (ORF of 990 bp and encodes a polypeptide of 329 residues. TmPGRP-LE contains one PGRP domain, but lacks critical residues for amidase activity. Quantitative RT-PCR analysis showed a broad constitutive expression of the transcript at various stages of development spanning from larva to adult. RNAi mediated knockdown of the transcripts, followed by a challenge with L. monocytogenes, showed a significant reduction in survival rate of the larvae, suggesting a putative role of TmPGRP-LE in sensing and control of L. monocytogenes infection in T. molitor. These results implicate PGRP-LE as a defense protein necessary for survival of T. molitor against infection by L. monocytogenes.

  18. Survival of Listeria monocytogenes in simulated gastrointestinal system and transcriptional profiling of stress- and adhesion-related genes

    DEFF Research Database (Denmark)

    Jiang, Lingli; Olesen, Inger; Andersen, Thomas

    2010-01-01

    -related genes after exposure to the conditions similar to those encountered in the mouth, stomach, and small intestine. None of the L. monocytogenes strains investigated could survive in the gastric juice at pH 2.5 or 3.0. Their survival increased at higher pH (3.5 and 4.0) in the gastric stress. Relative...... afterpassing through the simulated gastrointestinal tract, whereas that of the adhesion-related gene ami was downregulated. Taken together, this study revealed that L. monocytogenes strains enhanced the expression of stressrelated genes and decreased the transcription of adhesion-related gene in order...

  19. REAL-TIME PCR DETECTION OF LISTERIA MONOCYTOGENES IN FOOD SAMPLES OF ANIMAL ORIGIN

    Directory of Open Access Journals (Sweden)

    Jaroslav Pochop

    2013-02-01

    Full Text Available The aim of this study was to follow the contamination of food with Listeria monocytogenes by using Step One real time polymerase chain reaction (PCR. We used the PrepSEQ Rapid Spin Sample Preparation Kit for isolation of DNA and SensiFAST SYBR Hi-ROX Kit for the real-time PCR performance. In 24 samples of food of animal origin without incubation were detected strains of Listeria monocytogenes in 15 samples (swabs. Nine samples were negative. Our results indicated that the real-time PCR assay developed in this study could sensitively detect Listeria monocytogenes in food of animal origin without incubation. This could prevent infection caused by Listeria monocytogenes, and also could benefit food manufacturing companies by extending their product’s shelf-life as well as saving the cost of warehousing their food products while awaiting pathogen testing results. The rapid real-time PCR-based method performed very well compared to the conventional method. It is a fast, simple, specific and sensitive way to detect nucleic acids, which could be used in clinical diagnostic tests in the future.

  20. Listeria monocytogenes Identification in Food of Animal Origin Used with Real Time PCR

    Directory of Open Access Journals (Sweden)

    Jaroslav Pochop

    2013-10-01

    Full Text Available The aim of this study was to follow the contamination of food with Listeria monocytogenes by using Step One real time polymerase chain reaction (RT PCR. We used the PrepSEQ Rapid Spin Sample Preparation Kit for isolation of DNA and SensiFAST SYBR Hi-ROX Kit for the real-time PCR performance. In 20 samples of food of animal origin with incubation were detected strains of Listeria monocytogenes in 9 samples (swabs. Eleven samples were negative. Our results indicated that the real-time PCR assay developed in this study could sensitively detect Listeria monocytogenes in food of animal origin without incubation. This could prevent infection caused by Listeria monocytogenes, and also could benefit food manufacturing companies by extending their product’s shelf-life as well as saving the cost of warehousing their food products while awaiting pathogen testing results. The rapid real-time PCR-based method performed very well compared to the conventional method. It is a fast, simple, specific and sensitive way to detect nucleic acids, which could be used in clinical diagnostic tests in the future.

  1. Integrative genomic analysis identifies isoleucine and CodY as regulators of Listeria monocytogenes virulence.

    Directory of Open Access Journals (Sweden)

    Lior Lobel

    2012-09-01

    Full Text Available Intracellular bacterial pathogens are metabolically adapted to grow within mammalian cells. While these adaptations are fundamental to the ability to cause disease, we know little about the relationship between the pathogen's metabolism and virulence. Here we used an integrative Metabolic Analysis Tool that combines transcriptome data with genome-scale metabolic models to define the metabolic requirements of Listeria monocytogenes during infection. Twelve metabolic pathways were identified as differentially active during L. monocytogenes growth in macrophage cells. Intracellular replication requires de novo synthesis of histidine, arginine, purine, and branch chain amino acids (BCAAs, as well as catabolism of L-rhamnose and glycerol. The importance of each metabolic pathway during infection was confirmed by generation of gene knockout mutants in the respective pathways. Next, we investigated the association of these metabolic requirements in the regulation of L. monocytogenes virulence. Here we show that limiting BCAA concentrations, primarily isoleucine, results in robust induction of the master virulence activator gene, prfA, and the PrfA-regulated genes. This response was specific and required the nutrient responsive regulator CodY, which is known to bind isoleucine. Further analysis demonstrated that CodY is involved in prfA regulation, playing a role in prfA activation under limiting conditions of BCAAs. This study evidences an additional regulatory mechanism underlying L. monocytogenes virulence, placing CodY at the crossroads of metabolism and virulence.

  2. Isolation and detection of Listeria monocytogenes in poultry meat by standard culture methods and PCR

    Science.gov (United States)

    Kureljušić, J.; Rokvić, N.; Jezdimirović, N.; Kureljušić, B.; Pisinov, B.; Karabasil, N.

    2017-09-01

    Listeria is the genus of a bacteria found in soil and water and some animals, including poultry and cattle. It can be present in raw milk and food made from raw milk. It can also live in food processing plants and contaminate a variety of processed meats. Microscopically, Listeria species appear as small, Gram-positive rods, which are sometimes arranged in short chains. In direct smears, they can be coccoid, so they can be mistaken for streptococci. Longer cells can resemble corynebacteria. Flagella are produced at room temperature but not at 37°C. Haemolytic activity on blood agar has been used as a marker to distinguish Listeria monocytogenes among other Listeria species, but it is not an absolutely definitive criterion. Further biochemical characterization is necessary to distinguish between the different Listeria species. The objective of this study was to detect, isolate and identify Listeria monocytogenes from poultry meat. Within a period of six months from January to June 2017, a total of 15 samples were collected. Three samples were positive for the presence of Listeria monocytogenes. Biochemical and microbiological tests as well as PCR technique using specific primers were used to confirm L. Monocytogenes in the samples.

  3. Muscle-specific expression of hypoxia-inducible factor in human skeletal muscle

    DEFF Research Database (Denmark)

    Mounier, Rémi; Pedersen, Bente Klarlund; Plomgaard, Peter

    2010-01-01

    fibres that possess unique patterns of protein and gene expression, producing different capillarization and energy metabolism systems. In this work, we analysed HIF-1alpha mRNA and protein expression related to the fibre-type composition in untrained human skeletal muscle by obtaining muscle biopsies...... from triceps brachii (characterized by a high proportion of type II fibres), from soleus (characterized by a high proportion of type I fibres) and from vastus lateralis (characterized by an equal proportion of type I and II fibres). The hypothesis was that type I muscle fibres would have lower HIF-1......alpha protein level. Interestingly, none of the HIF-1alpha target genes, like the most studied angiogenic factor involved in muscle angiogenesis, vascular endothelial growth factor (VEGF), exhibited a muscle fibre-specific-related mRNA expression at rest in normoxia. However, soleus presented...

  4. Retroviral vectors encoding ADA regulatory locus control region provide enhanced T-cell-specific transgene expression.

    Science.gov (United States)

    Trinh, Alice T; Ball, Bret G; Weber, Erin; Gallaher, Timothy K; Gluzman-Poltorak, Zoya; Anderson, French; Basile, Lena A

    2009-12-30

    Murine retroviral vectors have been used in several hundred gene therapy clinical trials, but have fallen out of favor for a number of reasons. One issue is that gene expression from viral or internal promoters is highly variable and essentially unregulated. Moreover, with retroviral vectors, gene expression is usually silenced over time. Mammalian genes, in contrast, are characterized by highly regulated, precise levels of expression in both a temporal and a cell-specific manner. To ascertain if recapitulation of endogenous adenosine deaminase (ADA) expression can be achieved in a vector construct we created a new series of Moloney murine leukemia virus (MuLV) based retroviral vector that carry human regulatory elements including combinations of the ADA promoter, the ADA locus control region (LCR), ADA introns and human polyadenylation sequences in a self-inactivating vector backbone. A MuLV-based retroviral vector with a self-inactivating (SIN) backbone, the phosphoglycerate kinase promoter (PGK) and the enhanced green fluorescent protein (eGFP), as a reporter gene, was generated. Subsequent vectors were constructed from this basic vector by deletion or addition of certain elements. The added elements that were assessed are the human ADA promoter, human ADA locus control region (LCR), introns 7, 8, and 11 from the human ADA gene, and human growth hormone polyadenylation signal. Retroviral vector particles were produced by transient three-plasmid transfection of 293T cells. Retroviral vectors encoding eGFP were titered by transducing 293A cells, and then the proportion of GFP-positive cells was determined using fluorescence-activated cell sorting (FACS). Non T-cell and T-cell lines were transduced at a multiplicity of infection (MOI) of 0.1 and the yield of eGFP transgene expression was evaluated by FACS analysis using mean fluorescent intensity (MFI) detection. Vectors that contained the ADA LCR were preferentially expressed in T-cell lines. Further improvements

  5. Retroviral vectors encoding ADA regulatory locus control region provide enhanced T-cell-specific transgene expression

    Science.gov (United States)

    2009-01-01

    Background Murine retroviral vectors have been used in several hundred gene therapy clinical trials, but have fallen out of favor for a number of reasons. One issue is that gene expression from viral or internal promoters is highly variable and essentially unregulated. Moreover, with retroviral vectors, gene expression is usually silenced over time. Mammalian genes, in contrast, are characterized by highly regulated, precise levels of expression in both a temporal and a cell-specific manner. To ascertain if recapitulation of endogenous adenosine deaminase (ADA) expression can be achieved in a vector construct we created a new series of Moloney murine leukemia virus (MuLV) based retroviral vector that carry human regulatory elements including combinations of the ADA promoter, the ADA locus control region (LCR), ADA introns and human polyadenylation sequences in a self-inactivating vector backbone. Methods A MuLV-based retroviral vector with a self-inactivating (SIN) backbone, the phosphoglycerate kinase promoter (PGK) and the enhanced green fluorescent protein (eGFP), as a reporter gene, was generated. Subsequent vectors were constructed from this basic vector by deletion or addition of certain elements. The added elements that were assessed are the human ADA promoter, human ADA locus control region (LCR), introns 7, 8, and 11 from the human ADA gene, and human growth hormone polyadenylation signal. Retroviral vector particles were produced by transient three-plasmid transfection of 293T cells. Retroviral vectors encoding eGFP were titered by transducing 293A cells, and then the proportion of GFP-positive cells was determined using fluorescence-activated cell sorting (FACS). Non T-cell and T-cell lines were transduced at a multiplicity of infection (MOI) of 0.1 and the yield of eGFP transgene expression was evaluated by FACS analysis using mean fluorescent intensity (MFI) detection. Results Vectors that contained the ADA LCR were preferentially expressed in T

  6. Ionizing radiation enhances immunogenicity of cells expressing a tumor-specific T-cell epitope

    International Nuclear Information System (INIS)

    Ciernik, Ilja F.; Romero, Pedro; Berzofsky, Jay A.; Carbone, David P.

    1999-01-01

    Background: p53 point mutations represent potential tumor-specific cytolytic T lymphocyte (CTL) epitopes. Whether ionizing radiation (IR) alters the immunological properties of cells expressing mutant p53 in respect of the CTL epitope generated by a defined point mutation has not been evaluated. Methods: Mutant p53-expressing syngeneic, nontumor forming BALB/c 3T3 fibroblasts, tumor forming ras-transfected BALB/c 3T3 sarcomas, and DBA/2-derived P815 mastocytoma cells, which differ at the level of minor histocompatibility antigens, were used as cellular vaccines. Cells were either injected with or without prior IR into naive BALB/c mice. Cellular cytotoxicity was assessed after secondary restimulation of effector spleen cells in vitro. Results: Injection of P815 mastocytoma cells expressing the mutant p53 induced mutation-specific CTL in BALB/c mice irrespective of prior irradiation. However, syngeneic fibroblasts or fibrosarcomas endogenously expressing mutant p53 were able to induce significant mutation-specific CTL only when irradiated prior to injection into BALB/c mice. IR of fibroblasts did not detectably alter the expression of cell surface molecules involved in immune response induction, nor did it alter the short-term in vitro viability of the fibroblasts. Interestingly, radioactively-labeled fibroblasts injected into mice after irradiation showed altered organ distribution, suggesting that the in vivo fate of these cells may play a crucial role in their immunogenicity. Conclusions: These findings indicate that IR can alter the immunogenicity of syngeneic normal as well as tumor forming fibroblasts in vivo, and support the view that ionizing radiation enhances immunogenicity of cellular tumor vaccines

  7. Cardiac-Specific Gene Expression Facilitated by an Enhanced Myosin Light Chain Promoter

    Directory of Open Access Journals (Sweden)

    Wolfgang Boecker

    2004-04-01

    Full Text Available Background: Adenoviral gene transfer has been shown to be effective in cardiac myocytes in vitro and in vivo. A major limitation of myocardial gene therapy is the extracardiac transgene expression. Methods: To minimize extracardiac gene expression, we have constructed a tissue-specific promoter for cardiac gene transfer, namely, the 250-bp fragment of the myosin light chain-2v (MLC-2v gene, which is known to be expressed in a tissue-specific manner in ventricular myocardium followed by a luciferase (luc reporter gene (Ad.4 × MLC250.Luc. Rat cardiomyocytes, liver and kidney cells were infected with Ad.4 × MLC.Luc or control vectors. For in vivo testing, Ad.4 × MLC250.Luc was injected into the myocardium or in the liver of rats. Kinetics of promoter activity were monitored over 8 days using a cooled CCD camera. Results: In vitro: By infecting hepatic versus cardiomyocyte cells, we found that the promoter specificity ratio (luc activity in cardiomyocytes per liver cells was 20.4 versus 0.9 (Ad.4 × MLC250.Luc vs. Ad.CMV. In vivo: Ad.4 × MLC250.Luc significantly reduced luc activity in liver (38.4-fold, lung (16.1-fold, and kidney (21.8-fold versus Ad.CMV (p = .01; whereas activity in the heart was only 3.8-fold decreased. The gene expression rate of cardiomyocytes versus hepatocytes was 7:1 (Ad.4 × MLC.Luc versus 1:1.4 (Ad.CMV.Luc. Discussion: This new vector may be useful to validate therapeutic approaches in animal disease models and offers the perspective for selective expression of therapeutic genes in the diseased heart.

  8. Tissue- Specific Expression Analysis of Anthocyanin Biosynthetic Genes in White- and Red-Fleshed Grape Cultivars

    Directory of Open Access Journals (Sweden)

    Sha Xie

    2015-12-01

    Full Text Available Yan73, a teinturier (dyer grape variety in China, is one of the few Vitis vinifera cultivars with red-coloured berry flesh. To examine the tissue-specific expression of genes associated with berry colour in Yan73, we analysed the differential accumulation of anthocyanins in the skin and flesh tissues of two red-skinned grape varieties with either red (Yan73 or white flesh (Muscat Hamburg based on HPLC-MS analysis, as well as the differential expression of 18 anthocyanin biosynthesis genes in both varieties by quantitative RT-PCR. The results revealed that the transcripts of GST, OMT, AM3, CHS3, UFGT, MYBA1, F3′5′H, F3H1 and LDOX were barely detectable in the white flesh of Muscat Hamburg. In particular, GST, OMT, AM3, CHS3 and F3H1 showed approximately 50-fold downregulation in the white flesh of Muscat Hamburg compared to the red flesh of Yan73. A correlation analysis between the accumulation of different types of anthocyanins and gene expression indicated that the cumulative expression of GST, F3′5′H, LDOX and MYBA1 was more closely associated with the acylated anthocyanins and the 3′5′-OH anthocyanins, while OMT and AM3 were more closely associated with the total anthocyanins and methoxylated anthocyanins. Therefore, the transcripts of OMT, AM3, GST, F3′5′H, LDOX and MYBA1 explained most of the variation in the amount and composition of anthocyanins in skin and flesh of Yan73. The data suggest that the specific localization of anthocyanins in the flesh tissue of Yan73 is most likely due to the tissue-specific expression of OMT, AM3, GST, F3′5′H, LDOX and MYBA1 in the flesh.

  9. Systems-level analysis of cell-specific AQP2 gene expression in renal collecting duct.

    Science.gov (United States)

    Yu, Ming-Jiun; Miller, R Lance; Uawithya, Panapat; Rinschen, Markus M; Khositseth, Sookkasem; Braucht, Drew W W; Chou, Chung-Lin; Pisitkun, Trairak; Nelson, Raoul D; Knepper, Mark A

    2009-02-17

    We used a systems biology-based approach to investigate the basis of cell-specific expression of the water channel aquaporin-2 (AQP2) in the renal collecting duct. Computational analysis of the 5'-flanking region of the AQP2 gene (Genomatix) revealed 2 conserved clusters of putative transcriptional regulator (TR) binding elements (BEs) centered at -513 bp (corresponding to the SF1, NFAT, and FKHD TR families) and -224 bp (corresponding to the AP2, SRF, CREB, GATA, and HOX TR families). Three other conserved motifs corresponded to the ETS, EBOX, and RXR TR families. To identify TRs that potentially bind to these BEs, we carried out mRNA profiling (Affymetrix) in mouse mpkCCDc14 collecting duct cells, revealing expression of 25 TRs that are also expressed in native inner medullary collecting duct. One showed a significant positive correlation with AQP2 mRNA abundance among mpkCCD subclones (Ets1), and 2 showed a significant negative correlation (Elf1 and an orphan nuclear receptor Nr1h2). Transcriptomic profiling in native proximal tubules (PT), medullary thick ascending limbs (MTAL), and IMCDs from kidney identified 14 TRs (including Ets1 and HoxD3) expressed in the IMCD but not PT or MTAL (candidate AQP2 enhancer roles), and 5 TRs (including HoxA5, HoxA9 and HoxA10) expressed in PT and MTAL but not in IMCD (candidate AQP2 repressor roles). In luciferase reporter assays, overexpression of 3 ETS family TRs transactivated the mouse proximal AQP2 promoter. The results implicate ETS family TRs in cell-specific expression of AQP2 and point to HOX, RXR, CREB and GATA family TRs as playing likely additional roles.

  10. Regional specificity in deltamethrin induced cytochrome P450 expression in rat brain

    International Nuclear Information System (INIS)

    Yadav, Sanjay; Johri, Ashu; Dhawan, Alok; Seth, Prahlad K.; Parmar, Devendra

    2006-01-01

    Oral administration of deltamethrin (5 mg/kg x 7 or 15 or 21 days) was found to produce a time-dependent increase in the mRNA expression of xenobiotic metabolizing cytochrome P450 1A1 (CYP1A1), 1A2 and CYP2B1, 2B2 isoenzymes in rat brain. RT-PCR studies further showed that increase in the mRNA expression of these CYP isoenzymes observed after 21 days of exposure was region specific. Hippocampus exhibited maximum increase in the mRNA expression of CYP1A1, which was followed by pons-medulla, cerebellum and hypothalamus. The mRNA expression of CYP2B1 also exhibited maximum increase in the hypothalamus and hippocampus followed by almost similar increase in midbrain and cerebellum. In contrast, mRNA expression of CYP1A2 and CYP2B2, the constitutive isoenzymes exhibited relatively higher increase in pons-medulla, cerebellum and frontal cortex. Immunoblotting studies carried out with polyclonal antibody raised against rat liver CYP1A1/1A2 or CYP2B1/2B2 isoenzymes also showed increase in immunoreactivity comigrating with CYP1A1/1A2 or 2B1/2B2 in the microsomal fractions isolated from hippocampus, hypothalamus and cerebellum of rat treated with deltamethrin. Though the exact relationship of the xenobiotic metabolizing CYPs with the physiological function of the brain is yet to be clearly understood, the increase in the mRNA expression of the CYPs in the brain regions that regulate specific brain functions affected by deltamethrin have further indicated that modulation of these CYPs could be associated with the various endogenous functions of the brain

  11. Highly tissue specific expression of Sphinx supports its male courtship related role in Drosophila melanogaster.

    Science.gov (United States)

    Chen, Ying; Dai, Hongzheng; Chen, Sidi; Zhang, Luoying; Long, Manyuan

    2011-04-26

    Sphinx is a lineage-specific non-coding RNA gene involved in regulating courtship behavior in Drosophila melanogaster. The 5' flanking region of the gene is conserved across Drosophila species, with the proximal 300 bp being conserved out to D. virilis and a further 600 bp region being conserved amongst the melanogaster subgroup (D. melanogaster, D. simulans, D. sechellia, D. yakuba, and D. erecta). Using a green fluorescence protein transformation system, we demonstrated that a 253 bp region of the highly conserved segment was sufficient to drive sphinx expression in male accessory gland. GFP signals were also observed in brain, wing hairs and leg bristles. An additional ∼800 bp upstream region was able to enhance expression specifically in proboscis, suggesting the existence of enhancer elements. Using anti-GFP staining, we identified putative sphinx expression signal in the brain antennal lobe and inner antennocerebral tract, suggesting that sphinx might be involved in olfactory neuron mediated regulation of male courtship behavior. Whole genome expression profiling of the sphinx knockout mutation identified significant up-regulated gene categories related to accessory gland protein function and odor perception, suggesting sphinx might be a negative regulator of its target genes.

  12. Highly tissue specific expression of Sphinx supports its male courtship related role in Drosophila melanogaster.

    Directory of Open Access Journals (Sweden)

    Ying Chen

    2011-04-01

    Full Text Available Sphinx is a lineage-specific non-coding RNA gene involved in regulating courtship behavior in Drosophila melanogaster. The 5' flanking region of the gene is conserved across Drosophila species, with the proximal 300 bp being conserved out to D. virilis and a further 600 bp region being conserved amongst the melanogaster subgroup (D. melanogaster, D. simulans, D. sechellia, D. yakuba, and D. erecta. Using a green fluorescence protein transformation system, we demonstrated that a 253 bp region of the highly conserved segment was sufficient to drive sphinx expression in male accessory gland. GFP signals were also observed in brain, wing hairs and leg bristles. An additional ∼800 bp upstream region was able to enhance expression specifically in proboscis, suggesting the existence of enhancer elements. Using anti-GFP staining, we identified putative sphinx expression signal in the brain antennal lobe and inner antennocerebral tract, suggesting that sphinx might be involved in olfactory neuron mediated regulation of male courtship behavior. Whole genome expression profiling of the sphinx knockout mutation identified significant up-regulated gene categories related to accessory gland protein function and odor perception, suggesting sphinx might be a negative regulator of its target genes.

  13. Transcript-specific effects of adrenalectomy on seizure-induced BDNF expression in rat hippocampus

    DEFF Research Database (Denmark)

    Lauterborn, J C; Poulsen, F R; Stinis, C T

    1998-01-01

    Activity-induced brain-derived neurotrophic factor (BDNF) expression is negatively modulated by circulating adrenal steroids. The rat BDNF gene gives rise to four major transcript forms that each contain a unique 5' exon (I-IV) and a common 3' exon (V) that codes for BDNF protein. Exon-specific i......Activity-induced brain-derived neurotrophic factor (BDNF) expression is negatively modulated by circulating adrenal steroids. The rat BDNF gene gives rise to four major transcript forms that each contain a unique 5' exon (I-IV) and a common 3' exon (V) that codes for BDNF protein. Exon...... and in exon II-containing mRNA with 30-days survival. In the dentate gyrus granule cells, adrenalectomy markedly potentiated increases in exon I and II cRNA labeling, but not increases in exon III and IV cRNA labeling, elicited by one hippocampal afterdischarge. Similarly, for the granule cells and CA1...... no effect on exon IV-containing mRNA content. These results demonstrate that the negative effects of adrenal hormones on activity-induced BDNF expression are by far the greatest for transcripts containing exons I and II. Together with evidence for region-specific transcript expression, these results suggest...

  14. A preliminary study on a specifically expressed arabidopsis promotor in vascular bundle

    International Nuclear Information System (INIS)

    Gu Yunhong; Xie Chuanxiao; Wu Lifang; Yu Zengliang

    2003-01-01

    From a population of about 3500 single plants in Arabidopsis promoter trapping bank, one plant whose GUS-gene had been specifically expressed in vascular bundle, was screened by the method of gus tissue staining. The T-DNA flanking sequence was amplified using TAIL-PCR. This band will be purified and connected to TA cloning vector. After sequencing and searching in the genebank, its function will be demonstrated through transformation

  15. The use of genetic transformation in the study of ovarian-specific gene expression

    International Nuclear Information System (INIS)

    Manzi, A.; Andone, S.; Rotoli, D.; Capua, M.R.; Gargiulo, G.; Graziani, F.; Malva, C.

    1998-01-01

    We are using genetic and molecular approaches to understand the mechanisms controlling the establishment of the cellular specificity of expression during oogenesis. Female-sterile mutations have been isolated and the molecular analysis is revealing interesting cell-cell interaction systems that work not only during oogenesis but also at other developmental stages. We will review in this paper our most recent studies on genes involved in ovarian development. (author)

  16. Enhanced specificity in immunoscreening of expression cDNA clones using radiolabeled antigen overlay

    International Nuclear Information System (INIS)

    Chao, S.; Chao, L.; Chao, J.

    1989-01-01

    A highly sensitive and specific method has been developed for immunoscreening clones from an expression cDNA library. The procedures utilize a radiolabeled antigen detection method described originally for the immunoblotting of plasma proteins. Screening of rat alpha 1-antitrypsin clones was used. Comparison between Western blots of alpha 1-antitrypsin using both labeled antigen and protein A detection methods showed that the former yielded lower background and greater sensitivity than the latter. Further, this technique was shown to have a lower detection limit of less than 20 ng through Western blot analysis of varying concentrations of alpha 1-antitrypsin. The procedures are based on the expression of the protein by cDNA clones containing the DNA inserts in the correct reading frame. Following the transfer of phage proteins to nitrocellulose membranes, the bivalent antibodies bind monovalently to both nitrocellulose-bound-antigen in the phage lysates and radiolabeled antigen. The radiolabeled antigen overlay method is superior to the protein A detection method in sensitivity, specificity and reproducibility. This improved method can be applied in general for screening expression cDNA libraries, provided that the specific antiserum and radiolabeled antigen are available

  17. Expression of a novel cardiac-specific tropomyosin isoform in humans

    International Nuclear Information System (INIS)

    Denz, Christopher R.; Narshi, Aruna; Zajdel, Robert W.; Dube, Dipak K.

    2004-01-01

    Tropomyosins are a family of actin binding proteins encoded by a group of highly conserved genes. Humans have four tropomyosin-encoding genes: TPM1, TPM2, TPM3, and TPM4, each of which is known to generate multiple isoforms by alternative splicing, promoters, and 3 ' end processing. TPM1 is the most versatile and encodes a variety of tissue specific isoforms. The TPM1 isoform specific to striated muscle, designated TPM1α, consists of 10 exons: 1a, 2b, 3, 4, 5, 6b, 7, 8, and 9a/b. In this study, using RT-PCR with adult and fetal human RNAs, we present evidence for the expression of a novel isoform of the TPM1 gene that is specifically expressed in cardiac tissues. The new isoform is designated TPM1κ and contains exon 2a instead of 2b. Ectopic expression of human GFP.TPM1κ fusion protein can promote myofibrillogenesis in cardiac mutant axolotl hearts that are lacking in tropomyosin

  18. Gene expression signatures of radiation response are specific, durable and accurate in mice and humans.

    Directory of Open Access Journals (Sweden)

    Sarah K Meadows

    2008-04-01

    Full Text Available Previous work has demonstrated the potential for peripheral blood (PB gene expression profiling for the detection of disease or environmental exposures.We have sought to determine the impact of several variables on the PB gene expression profile of an environmental exposure, ionizing radiation, and to determine the specificity of the PB signature of radiation versus other genotoxic stresses. Neither genotype differences nor the time of PB sampling caused any lessening of the accuracy of PB signatures to predict radiation exposure, but sex difference did influence the accuracy of the prediction of radiation exposure at the lowest level (50 cGy. A PB signature of sepsis was also generated and both the PB signature of radiation and the PB signature of sepsis were found to be 100% specific at distinguishing irradiated from septic animals. We also identified human PB signatures of radiation exposure and chemotherapy treatment which distinguished irradiated patients and chemotherapy-treated individuals within a heterogeneous population with accuracies of 90% and 81%, respectively.We conclude that PB gene expression profiles can be identified in mice and humans that are accurate in predicting medical conditions, are specific to each condition and remain highly accurate over time.

  19. Substrate-specific gene expression in Batrachochytrium dendrobatidis, the chytrid pathogen of amphibians.

    Directory of Open Access Journals (Sweden)

    Erica Bree Rosenblum

    Full Text Available Determining the mechanisms of host-pathogen interaction is critical for understanding and mitigating infectious disease. Mechanisms of fungal pathogenicity are of particular interest given the recent outbreaks of fungal diseases in wildlife populations. Our study focuses on Batrachochytrium dendrobatidis (Bd, the chytrid pathogen responsible for amphibian declines around the world. Previous studies have hypothesized a role for several specific families of secreted proteases as pathogenicity factors in Bd, but the expression of these genes has only been evaluated in laboratory growth conditions. Here we conduct a genome-wide study of Bd gene expression under two different nutrient conditions. We compare Bd gene expression profiles in standard laboratory growth media and in pulverized host tissue (i.e., frog skin. A large proportion of genes in the Bd genome show increased expression when grown in host tissue, indicating the importance of studying pathogens on host substrate. A number of gene classes show particularly high levels of expression in host tissue, including three families of secreted proteases (metallo-, serine- and aspartyl-proteases, adhesion genes, lipase-3 encoding genes, and a group of phylogenetically unusual crinkler-like effectors. We discuss the roles of these different genes as putative pathogenicity factors and discuss what they can teach us about Bd's metabolic targets, host invasion, and pathogenesis.

  20. Universal and culture-specific factors in the recognition and performance of musical affect expressions.

    Science.gov (United States)

    Laukka, Petri; Eerola, Tuomas; Thingujam, Nutankumar S; Yamasaki, Teruo; Beller, Grégory

    2013-06-01

    We present a cross-cultural study on the performance and perception of affective expression in music. Professional bowed-string musicians from different musical traditions (Swedish folk music, Hindustani classical music, Japanese traditional music, and Western classical music) were instructed to perform short pieces of music to convey 11 emotions and related states to listeners. All musical stimuli were judged by Swedish, Indian, and Japanese participants in a balanced design, and a variety of acoustic and musical cues were extracted. Results first showed that the musicians' expressive intentions could be recognized with accuracy above chance both within and across musical cultures, but communication was, in general, more accurate for culturally familiar versus unfamiliar music, and for basic emotions versus nonbasic affective states. We further used a lens-model approach to describe the relations between the strategies that musicians use to convey various expressions and listeners' perceptions of the affective content of the music. Many acoustic and musical cues were similarly correlated with both the musicians' expressive intentions and the listeners' affective judgments across musical cultures, but the match between musicians' and listeners' uses of cues was better in within-cultural versus cross-cultural conditions. We conclude that affective expression in music may depend on a combination of universal and culture-specific factors.

  1. Nuclear factor 1 regulates adipose tissue-specific expression in the mouse GLUT4 gene

    International Nuclear Information System (INIS)

    Miura, Shinji; Tsunoda, Nobuyo; Ikeda, Shinobu; Kai, Yuko; Cooke, David W.; Lane, M. Daniel; Ezaki, Osamu

    2004-01-01

    Previous studies demonstrated that an adipose tissue-specific element(s) (ASE) of the murine GLUT4 gene is located between -551 and -506 in the 5'-flanking sequence and that a high-fat responsive element(s) for down-regulation of the GLUT4 gene is located between bases -701 and -552. A binding site for nuclear factor 1 (NF1), that mediates insulin and cAMP-induced repression of GLUT4 in 3T3-L1 adipocytes is located between bases -700 and -688. To examine the role of NF1 in the regulation of GLUT4 gene expression in white adipose tissues (WAT) in vivo, we created two types of transgenic mice harboring mutated either 5' or 3' half-site of NF1-binding sites in GLUT4 minigene constructs. In both cases, the GLUT4 minigene was not expressed in WAT, while expression was maintained in brown adipose tissue, skeletal muscle, and heart. This was an unexpected finding, since a -551 GLUT4 minigene that did not have the NF1-binding site was expressed in WAT. We propose a model that explains the requirement for both the ASE and the NF1-binding site for expression of GLUT4 in WAT

  2. Tissue-Specific Expression of Monocarboxylate Transporters during Fasting in Mice

    Science.gov (United States)

    Schutkowski, Alexandra; Wege, Nicole; Stangl, Gabriele I.; König, Bettina

    2014-01-01

    Monocarboxylates such as pyruvate, lactate and ketone bodies are crucial for energy supply of all tissues, especially during energy restriction. The transport of monocarboxylates across the plasma membrane of cells is mediated by monocarboxylate transporters (MCTs). Out of 14 known mammalian MCTs, six isoforms have been functionally characterized to transport monocarboxylates and short chain fatty acids (MCT1-4), thyroid hormones (MCT8, -10) and aromatic amino acids (MCT10). Knowledge on the regulation of the different MCT isoforms is rare. In an attempt to get more insights in regulation of MCT expression upon energy deprivation, we carried out a comprehensive analysis of tissue specific expression of five MCT isoforms upon 48 h of fasting in mice. Due to the crucial role of peroxisome proliferator-activated receptor (PPAR)-α as a central regulator of energy metabolism and as known regulator of MCT1 expression, we included both wildtype (WT) and PPARα knockout (KO) mice in our study. Liver, kidney, heart, small intestine, hypothalamus, pituitary gland and thyroid gland of the mice were analyzed. Here we show that the expression of all examined MCT isoforms was markedly altered by fasting compared to feeding. Expression of MCT1, MCT2 and MCT10 was either increased or decreased by fasting dependent on the analyzed tissue. MCT4 and MCT8 were down-regulated by fasting in all examined tissues. However, PPARα appeared to have a minor impact on MCT isoform regulation. Due to the fundamental role of MCTs in transport of energy providing metabolites and hormones involved in the regulation of energy homeostasis, we assumed that the observed fasting-induced adaptations of MCT expression seem to ensure an adequate energy supply of tissues during the fasting state. Since, MCT isoforms 1–4 are also necessary for the cellular uptake of drugs, the fasting-induced modifications of MCT expression have to be considered in future clinical care algorithms. PMID:25390336

  3. Specificity in suppression of SOS expression by recA4162 and uvrD303.

    Science.gov (United States)

    Massoni, Shawn C; Sandler, Steven J

    2013-12-01

    Detection and repair of DNA damage is essential in all organisms and depends on the ability of proteins recognizing and processing specific DNA substrates. In E. coli, the RecA protein forms a filament on single-stranded DNA (ssDNA) produced by DNA damage and induces the SOS response. Previous work has shown that one type of recA mutation (e.g., recA4162 (I298V)) and one type of uvrD mutation (e.g., uvrD303 (D403A, D404A)) can differentially decrease SOS expression depending on the type of inducing treatments (UV damage versus RecA mutants that constitutively express SOS). Here it is tested using other SOS inducing conditions if there is a general feature of ssDNA generated during these treatments that allows recA4162 and uvrD303 to decrease SOS expression. The SOS inducing conditions tested include growing cells containing temperature-sensitive DNA replication mutations (dnaE486, dnaG2903, dnaN159, dnaZ2016 (at 37°C)), a del(polA)501 mutation and induction of Double-Strand Breaks (DSBs). uvrD303 could decrease SOS expression under all conditions, while recA4162 could decrease SOS expression under all conditions except in the polA strain or when DSBs occur. It is hypothesized that recA4162 suppresses SOS expression best when the ssDNA occurs at a gap and that uvrD303 is able to decrease SOS expression when the ssDNA is either at a gap or when it is generated at a DSB (but does so better at a gap). Copyright © 2013 Elsevier B.V. All rights reserved.

  4. Nidogen-1 regulates laminin-1-dependent mammary-specific gene expression

    Energy Technology Data Exchange (ETDEWEB)

    Pujuguet, Philippe; Simian, Marina; Liaw, Jane; Timpl, Rupert; Werb, Zena; Bissell, Mina J..

    2000-02-01

    Nidogen-1 (entactin) acts as a bridge between the extracellular matrix molecules laminin-1 and type IV collagen, and thus participates in the assembly of basement membranes. To investigate the role of nidogen-1 in regulating cell-type-specific gene expression in mammary epithelium, we designed a culture microecosystem in which each component, including epithelial cells, mesenchymal cells, lactogenic hormones and extracellular matrix, could be controlled. We found that primary and established mesenchymal and myoepithelial cells synthesized and secreted nidogen-1, whereas expression was absent in primary and established epithelial cells. In an epithelial cell line containing mesenchymal cells, nidogen-1 was produced by the mesenchymal cells but deposited between the epithelial cells. In this mixed culture, mammary epithelial cells express b-casein in the presence of lactogenic hormones. Addition of either laminin-1 plus nidogen-1, or laminin-1 alone to mammary epithelial cells induced b- casein production. We asked whether recombinant nidogen-1 alone could signal directly for b-casein. Nidogen-1 did not induce b-casein synthesis in epithelial cells, but it augmented the inductive capacity of laminin-1. These data suggest that nidogen-1 can cooperate with laminin-1 to regulate b-casein expression. Addition of full length nidogen-1 to the mixed cultures had no effect on b-casein gene expression; however, a nidogen-1 fragment containing the laminin-1 binding domain, but lacking the type IV collagen-binding domain, had a dominant negative effect on b-casein expression. These data point to a physiological role for nidogen-1 in the basement membrane-induced gene expression by epithelial cells.

  5. Obstructive sleep apnea and intermittent hypoxia increase expression of dual specificity phosphatase 1.

    Science.gov (United States)

    Hoffmann, Michal S; Singh, Prachi; Wolk, Robert; Narkiewicz, Krzysztof; Somers, Virend K

    2013-12-01

    Dual specificity phosphatase 1 (DUSP1) inhibits mitogen activated protein kinase activity, and is activated by several stimuli such as sustained hypoxia, oxidative stress, and hormones. However, the effect of intermittent hypoxia is not known. The aim of this study was to evaluate the role of intermittent hypoxia on DUSP1 expression, and to validate its role in a human model of intermittent hypoxia, as seen in obstructive sleep apnea (OSA). OSA is characterized by recurrent episodes of hypoxemia/reoxygenation and is a known risk factor for cardiovascular morbidity. In-vitro studies using human coronary artery endothelial cells (HCAEC) and ex-vivo studies using white blood cells isolated from healthy and OSA subjects. Intermittent hypoxia induced DUSP1 expression in human coronary artery endothelial cells (HCAEC), and in granulocytes isolated from healthy human subjects. Functionally, DUSP1 increased the expression and activity of manganese superoxide dismutase (MnSOD) in HCAEC. Further, significant increases in DUSP1 mRNA from total blood, and in DUSP1 protein in mononuclear cells and granulocytes isolated from OSA subjects, were observed in the early morning hours after one night of intermittent hypoxemia due to untreated OSA. This early-morning OSA-induced augmentation of DUSP1 gene expression was attenuated by continuous positive airway pressure (CPAP) treatment of OSA. Intermittent hypoxia increases MnSOD activity via increased DUSP1 expression in HCAEC. Similarly, overnight intermittent hypoxemia in patients with OSA induces expression of DUSP1, which may mediate increases of MnSOD expression and activity. This may contribute significantly to neutralizing the effects of reactive oxygen species, a consequence of the intermittent hypoxemia/reperfusion elicited by OSA. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  6. Evolution of New cis-Regulatory Motifs Required for Cell-Specific Gene Expression in Caenorhabditis.

    Directory of Open Access Journals (Sweden)

    Michalis Barkoulas

    2016-09-01

    Full Text Available Patterning of C. elegans vulval cell fates relies on inductive signaling. In this induction event, a single cell, the gonadal anchor cell, secretes LIN-3/EGF and induces three out of six competent precursor cells to acquire a vulval fate. We previously showed that this developmental system is robust to a four-fold variation in lin-3/EGF genetic dose. Here using single-molecule FISH, we find that the mean level of expression of lin-3 in the anchor cell is remarkably conserved. No change in lin-3 expression level could be detected among C. elegans wild isolates and only a low level of change-less than 30%-in the Caenorhabditis genus and in Oscheius tipulae. In C. elegans, lin-3 expression in the anchor cell is known to require three transcription factor binding sites, specifically two E-boxes and a nuclear-hormone-receptor (NHR binding site. Mutation of any of these three elements in C. elegans results in a dramatic decrease in lin-3 expression. Yet only a single E-box is found in the Drosophilae supergroup of Caenorhabditis species, including C. angaria, while the NHR-binding site likely only evolved at the base of the Elegans group. We find that a transgene from C. angaria bearing a single E-box is sufficient for normal expression in C. elegans. Even a short 58 bp cis-regulatory fragment from C. angaria with this single E-box is able to replace the three transcription factor binding sites at the endogenous C. elegans lin-3 locus, resulting in the wild-type expression level. Thus, regulatory evolution occurring in cis within a 58 bp lin-3 fragment, results in a strict requirement for the NHR binding site and a second E-box in C. elegans. This single-cell, single-molecule, quantitative and functional evo-devo study demonstrates that conserved expression levels can hide extensive change in cis-regulatory site requirements and highlights the evolution of new cis-regulatory elements required for cell-specific gene expression.

  7. CHALLENGE TESTS WITH LISTERIA MONOCYTOGENES IN SALAMI: PRELIMINARY RESULTS

    Directory of Open Access Journals (Sweden)

    R. Mioni

    2013-02-01

    Full Text Available Challenge tests are the preferable methodology to study the behaviour of Listeria monocytogenes on ready to eat foods, according to Regulation (EC 2073/2005. Challenge testing using L. monocytogenes in seasoned salami from different food business operators showed, after seasoning of the product, a count reduction of the inoculated organisms without any further growth of the pathogen; however differences of L. monocytogenes behaviour could be observed according to different production protocols.

  8. Co-expression networks reveal the tissue-specific regulation of transcription and splicing.

    Science.gov (United States)

    Saha, Ashis; Kim, Yungil; Gewirtz, Ariel D H; Jo, Brian; Gao, Chuan; McDowell, Ian C; Engelhardt, Barbara E; Battle, Alexis

    2017-11-01

    Gene co-expression networks capture biologically important patterns in gene expression data, enabling functional analyses of genes, discovery of biomarkers, and interpretation of genetic variants. Most network analyses to date have been limited to assessing correlation between total gene expression levels in a single tissue or small sets of tissues. Here, we built networks that additionally capture the regulation of relative isoform abundance and splicing, along with tissue-specific connections unique to each of a diverse set of tissues. We used the Genotype-Tissue Expression (GTEx) project v6 RNA sequencing data across 50 tissues and 449 individuals. First, we developed a framework called Transcriptome-Wide Networks (TWNs) for combining total expression and relative isoform levels into a single sparse network, capturing the interplay between the regulation of splicing and transcription. We built TWNs for 16 tissues and found that hubs in these networks were strongly enriched for splicing and RNA binding genes, demonstrating their utility in unraveling regulation of splicing in the human transcriptome. Next, we used a Bayesian biclustering model that identifies network edges unique to a single tissue to reconstruct Tissue-Specific Networks (TSNs) for 26 distinct tissues and 10 groups of related tissues. Finally, we found genetic variants associated with pairs of adjacent nodes in our networks, supporting the estimated network structures and identifying 20 genetic variants with distant regulatory impact on transcription and splicing. Our networks provide an improved understanding of the complex relationships of the human transcriptome across tissues. © 2017 Saha et al.; Published by Cold Spring Harbor Laboratory Press.

  9. Suppression of prolactin gene expression in GH cells correlates with site-specific DNA methylation.

    Science.gov (United States)

    Zhang, Z X; Kumar, V; Rivera, R T; Pasion, S G; Chisholm, J; Biswas, D K

    1989-10-01

    Prolactin- (PRL) producing and nonproducing subclones of the GH line of (rat) pituitary tumor cells have been compared to elucidate the regulatory mechanisms of PRL gene expression. Particular emphasis was placed on delineating the molecular basis of the suppressed state of the PRL gene in the prolactin-nonproducing (PRL-) GH subclone (GH(1)2C1). We examined six methylatable cytosine residues (5, -CCGG- and 1, -GCGC-) within the 30-kb region of the PRL gene in these subclones. This analysis revealed that -CCGG-sequences of the transcribed region, and specifically, one in the fourth exon of the PRL gene, were heavily methylated in the PRL-, GH(1)2C1 cells. Furthermore, the inhibition of PRL gene expression in GH(1)2C1 was reversed by short-term treatment of the cells with a sublethal concentration of azacytidine (AzaC), an inhibitor of DNA methylation. The reversion of PRL gene expression by AzaC was correlated with the concurrent demethylation of the same -CCGG- sequences in the transcribed region of PRL gene. An inverse correlation between PRL gene expression and the level of methylation of the internal -C- residues in the specific -CCGG-sequence of the transcribed region of the PRL gene was demonstrated. The DNase I sensitivity of these regions of the PRL gene in PRL+, PRL-, and AzaC-treated cells was also consistent with an inverse relationship between methylation state, a higher order of structural modification, and gene expression.(ABSTRACT TRUNCATED AT 250 WORDS)

  10. Stimulation of Protein Expression Through the Harmonic Resonance of Frequency-Specific Music.

    Science.gov (United States)

    Orhan, Ibrahim Y; Gulbahar, Burak A

    2016-12-01

    The use of specific frequencies for specific individual amino acids may increase the potential energy of protein molecules in the medium [1]. The resonance would also increase the movement of particles in the cytosol, increasing the collisions necessary for the conduction of protein expression. The clash of two waves that share frequencies will exhibit an increase in energy through an increase in amplitude [2]. The increase in energy would in turn increase the number of collisions forming the tRNA-amino acid, increasing the amino acid acquiry for ribosomes to improve intracellular efficiency in gene expression. To test the hypothesis, Red Fluorescent Protein (RFP) in transformated BL-21 strains of E. coli and p53 protein of MCF-7 were examined after exposure to sounds of specific frequencies. Through the exposure of the experimental systems to a sequence of sounds that match the frequencies of specific amino acids, the levels of RFP exhibition respective to the control groups in the bacterial medium increased two-fold in terms of RFU. The experiments that targeted the p53 protein with the 'music' showed a decrease in the cell prevalence in the MCF-7 type breast cancer cells by 28%, by decreasing the speed of tumour formation. Exposure to 'music' that was designed through assigning a musical note for every single one of the twenty unique amino acids, produced both an analytical and a visible shift in protein synthesis, making it as potential tool for reducing procedural time uptake.

  11. Effective intervention for expressive grammar in children with specific language impairment.

    Science.gov (United States)

    Smith-Lock, Karen M; Leitao, Suze; Lambert, Lara; Nickels, Lyndsey

    2013-01-01

    Children with specific language impairment are known to struggle with expressive grammar. While some studies have shown successful intervention under laboratory conditions, there is a paucity of evidence for the effectiveness of grammar treatment in young children in community settings. To evaluate the effectiveness of a school-based intervention programme for expressive grammar in 5-year-olds with specific language impairment. Thirty-four 5-year-old children attending a specialized school for children with language impairment participated in the study. Nineteen children received treatment for expressive grammar (experimental group) and 15 children received a control treatment. Treatment consisted of weekly 1-h sessions of small group activities in a classroom setting for 8 weeks. Techniques included direct instruction, focused stimulation, recasting and imitation. Results were analysed at the group level and as a case series with each child as their own control in a single-subject design. There was a significant difference in grammatical performance pre- and post-treatment for children who received grammar treatment (Cohen's d = 1.24), but not for a group of children who received a control treatment. Further, no difference in performance was found in the equivalent time period prior to treatment, nor for an untreated target. Treatment success was more pronounced in children without articulation difficulties which interfered with their ability to produce the grammatical targets (Cohen's d = 1.66). Individual analyses indicated the treatment effect was significant for the majority of children. Individually targeted intervention delivered in small groups in a classroom setting was effective in improving production of expressive grammatical targets in 5-year-old children with specific language impairment. © 2013 Royal College of Speech and Language Therapists.

  12. Listeria monocytogenes en alimentos: ¿son todos los aislamientos igual de virulentos? Foodborne Listeria monocytogenes: are all the isolates equally virulent?

    Directory of Open Access Journals (Sweden)

    V. López

    2006-12-01

    Full Text Available Listeria monocytogenes es un patógeno humano que se transmite a través de los alimentos y que causa infecciones graves, con una alta tasa de mortalidad. A pesar de la ubicuidad del microorganismo, la tasa real de la enfermedad es bastante baja y se asocia casi siempre a condiciones predisponentes. Tradicionalmente se consideraba que los aislamientos presentes en los alimentos y en el ambiente tenían la misma capacidad patogénica que los aislamientos de origen clínico. Pero el análisis de mutaciones en los genes de determinados factores de virulencia (internalina, hemolisina, fosfolipasas, proteína de superficie ActA y proteína reguladora PrfA, los estudios cuantitativos realizados con cultivos celulares y la genética de poblaciones, están replanteando la discusión sobre la variabilidad de la virulencia de L. monocytogenes. A pesar de todos estos avances, no existe un único marcador que permita comprobar la virulencia de los aislamientos naturales de esta especie. Probablemente en el futuro, la combinación de diferentes marcadores moleculares permitirá detectar los alimentos contaminados sólo por los clones virulentos de L. monocytogenes, con lo que se mejorará la prevención de la listeriosis humana transmitida por alimentos.Listeria monocytogenes is a foodborne human pathogen responsible for invasive infections presenting overall a high mortality. Despite the ubiquity of the microorganism, the actual disease rate is quite low and the disease is most often associated with an underlying predisposition. Foodborne and environmental isolates were traditionally considered of similar pathogenicity compared to clinical isolates. But the analysis of mutations in the genes encoding specific virulence factors (internalin, hemolysin, phospholipases, surface protein ActA and regulator protein PrfA, quantitative studies with cell cultures and population genetics have raised considerable concerns about virulence differences among L

  13. Phenotypic and Genotypic Characterization of Atypical Listeria monocytogenes and Listeria innocua Isolated from Swine Slaughterhouses and Meat Markets

    Directory of Open Access Journals (Sweden)

    Luisa Zanolli Moreno

    2014-01-01

    Full Text Available In the last decade, atypical Listeria monocytogenes and L. innocua strains have been detected in food and the environment. Because of mutations in the major virulence genes, these strains have different virulence intensities in eukaryotic cells. In this study, we performed phenotypic and genotypic characterization of atypical L. monocytogenes and L. innocua isolates obtained from swine slaughterhouses and meat markets. Forty strains were studied, including isolates of L. monocytogenes and L. innocua with low-hemolytic activity. The isolates were characterized using conventional phenotypic Listeria identification tests and by the detection and analysis of L. monocytogenes-specific genes. Analysis of 16S rRNA was used for the molecular identification of the Listeria species. The L. monocytogenes isolates were positive for all of the virulence genes studied. The atypical L. innocua strains were positive for hly, plcA, and inlC. Mutations in the InlC, InlB, InlA, PI-PLC, PC-PLC, and PrfA proteins were detected in the atypical isolates. Further in vitro and transcriptomic studies are being developed to confirm the role of these mutations in Listeria virulence.

  14. Visualization of gold and platinum nanoparticles interacting with Salmonella Enteritidis and Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Ewa Sawosz

    2010-08-01

    Full Text Available Ewa Sawosz1, André Chwalibog2, Jacek Szeliga3, Filip Sawosz2, Marta Grodzik1, Marlena Rupiewicz1, Tomasz Niemiec1, Katarzyna Kacprzyk11Division of Biotechnology and Biochemistry of Nutrition, Warsaw University of Life Sciences, Warsaw, Poland; 2Department of Basic Animal and Veterinary Sciences, University of Copenhagen, Copenhagen, Denmark; 3Division of Microbiology of Analytical Centre, Warsaw University of Life Sciences, Warsaw, PolandPurpose: Rapid development of nanotechnology has recently brought significant attention to the extraordinary biological features of nanomaterials. The objective of the present ­investigation was to evaluate morphological characteristics of the assembles of gold and platinum nanoparticles (nano-Au and nano-Pt respectively, with Salmonella Enteritidis (Gram-negative and Listeria monocytogenes (Gram-positive, to reveal possibilities of constructing bacteria-nanoparticle vehicles.Methods: Hydrocolloids of nano-Au or nano-Pt were added to two bacteria suspensions in the following order: nano-Au + Salmonella Enteritidis; nano-Au + Listeria monocytogenes; nano-Pt + Salmonella Enteritidis; nano-Pt + Listeria monocytogenes. Samples were inspected by transmission electron microscope.Results: Visualization of morphological interaction between nano-Au and Salmonella Enteritidis and Listeria monocytogenes, showed that nano-Au were aggregated within flagella or biofilm network and did not penetrate the bacterial cell. The analysis of morphological effects of interaction of nano-Pt with bacteria revealed that nano-Pt entered cells of Listeria monocytogenes and were removed from the cells. In the case of Salmonella Enteritidis, nano-Pt were seen inside bacteria cells, probably bound to DNA and partly left bacterial cells. After washing and centrifugation, some of the nano-Pt-DNA complexes were observed within Salmonella Enteritidis.Conclusion: The results indicate that the bacteria could be used as a vehicle to deliver nano

  15. Antimicrobial medium- and long-chain free fatty acids prevent PrfA-dependent activation of virulence genes in Listeria monocytogenes.

    Science.gov (United States)

    Sternkopf Lillebæk, Eva Maria; Lambert Nielsen, Stine; Scheel Thomasen, Rikke; Færgeman, Nils J; Kallipolitis, Birgitte H

    The foodborne pathogen Listeria monocytogenes is the causative agent of the invasive disease listeriosis. Infection by L. monocytogenes involves bacterial crossing of the intestinal barrier and intracellular replication in a variety of host cells. The PrfA protein is the master regulator of virulence factors required for bacterial entry, intracellular replication and cell-to-cell spread. PrfA-dependent activation of virulence genes occurs primarily in the blood and during intracellular infection. In contrast, PrfA does not play a significant role in regulation of virulence gene expression in the intestinal environment. In the gastrointestinal phase of infection, the bacterium encounters a variety of antimicrobial agents, including medium- and long-chain free fatty acids that are commonly found in our diet and as active components of bile. Here we show that subinhibitory concentrations of specific antimicrobial free fatty acids act to downregulate transcription of PrfA-activated virulence genes. Interestingly, the inhibitory effect is also evident in cells encoding a constitutively active variant of PrfA. Collectively, our data suggest that antimicrobial medium- and long-chain free fatty acids may act as signals to prevent PrfA-mediated activation of virulence genes in environments where PrfA activation is not required, such as in food and the gastrointestinal tract. Copyright © 2017 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

  16. Matrix metalloproteinase-9 plays a role in protecting zebrafish from lethal infection with Listeria monocytogenes by enhancing macrophage migration.

    Science.gov (United States)

    Shan, Ying; Zhang, Yikai; Zhuo, Xunhui; Li, Xiaoliang; Peng, Jinrong; Fang, Weihuan

    2016-07-01

    Zebrafish could serve as an alternative animal model for pathogenic bacteria in multiple infectious routes. Our previous study showed that immersion infection in zebrafish with Listeria monocytogenes did not cause lethality but induced transient expression of several immune response genes. We used an Affymetrix gene chip to examine the expression profiles of genes of zebrafish immersion-infected with L. monocytogenes. A total of 239 genes were up-regulated and 56 genes down-regulated compared with uninfected fish. Highest expression (>20-fold) was seen with the mmp-9 gene encoding the matrix metalloproteinase-9 (Mmp-9) known to degrade the extracellular matrix proteins. By morpholino knockdown of mmp-9, we found that the morphants showed rapid death with much higher bacterial load after intravenous or intraventricular (brain ventricle) infection with L. monocytogenes. Macrophages in mmp-9-knockdown morphants had significant defect in migrating to the brain cavity upon intraventricular infection. Decreased migration of murine macrophages with knockdown of mmp-9 and cd44 was also seen in transwell inserts with 8-μm pore polycarbonate membrane, as compared with the scrambled RNA. These findings suggest that Mmp-9 is a protective molecule against infection by L. monocytogenes by engaging in migration of zebrafish macrophages to the site of infection via a non-proteolytic role. Further work is required on the molecular mechanisms governing Mmp-9-driven macrophage migration in zebrafish. Copyright © 2016 Elsevier Ltd. All rights reserved.

  17. Reprogramming LCLs to iPSCs Results in Recovery of Donor-Specific Gene Expression Signature.

    Directory of Open Access Journals (Sweden)

    Samantha M Thomas

    2015-05-01

    Full Text Available Renewable in vitro cell cultures, such as lymphoblastoid cell lines (LCLs, have facilitated studies that contributed to our understanding of genetic influence on human traits. However, the degree to which cell lines faithfully maintain differences in donor-specific phenotypes is still debated. We have previously reported that standard cell line maintenance practice results in a loss of donor-specific gene expression signatures in LCLs. An alternative to the LCL model is the induced pluripotent stem cell (iPSC system, which carries the potential to model tissue-specific physiology through the use of differentiation protocols. Still, existing LCL banks represent an important source of starting material for iPSC generation, and it is possible that the disruptions in gene regulation associated with long-term LCL maintenance could persist through the reprogramming process. To address this concern, we studied the effect of reprogramming mature LCL cultures from six unrelated donors to iPSCs on the ensuing gene expression patterns within and between individuals. We show that the reprogramming process results in a recovery of donor-specific gene regulatory signatures, increasing the number of genes with a detectable donor effect by an order of magnitude. The proportion of variation in gene expression statistically attributed to donor increases from 6.9% in LCLs to 24.5% in iPSCs (P < 10-15. Since environmental contributions are unlikely to be a source of individual variation in our system of highly passaged cultured cell lines, our observations suggest that the effect of genotype on gene regulation is more pronounced in iPSCs than in LCLs. Our findings indicate that iPSCs can be a powerful model system for studies of phenotypic variation across individuals in general, and the genetic association with variation in gene regulation in particular. We further conclude that LCLs are an appropriate starting material for iPSC generation.

  18. Presence and expression of hydrogenase specific C-terminal endopeptidases in cyanobacteria

    Directory of Open Access Journals (Sweden)

    Lindblad Peter

    2003-05-01

    Full Text Available Abstract Background Hydrogenases catalyze the simplest of all chemical reactions: the reduction of protons to molecular hydrogen or vice versa. Cyanobacteria can express an uptake, a bidirectional or both NiFe-hydrogenases. Maturation of those depends on accessory proteins encoded by hyp-genes. The last maturation step involves the cleavage of a ca. 30 amino acid long peptide from the large subunit by a C-terminal endopeptidase. Until know, nothing is known about the maturation of cyanobacterial NiFe-hydrogenases. The availability of three complete cyanobacterial genome sequences from strains with either only the uptake (Nostoc punctiforme ATCC 29133/PCC 73102, only the bidirectional (Synechocystis PCC 6803 or both NiFe-hydrogenases (Anabaena PCC 7120 prompted us to mine these genomes for hydrogenase maturation related genes. In this communication we focus on the presence and the expression of the NiFe-hydrogenases and the corresponding C-terminal endopeptidases, in the three strains mentioned above. Results We identified genes encoding putative cyanobacterial hydrogenase specific C-terminal endopeptidases in all analyzed cyanobacterial genomes. The genes are not part of any known hydrogenase related gene cluster. The derived amino acid sequences show only low similarity (28–41% to the well-analyzed hydrogenase specific C-terminal endopeptidase HybD from Escherichia coli, the crystal structure of which is known. However, computational secondary and tertiary structure modeling revealed the presence of conserved structural patterns around the highly conserved active site. Gene expression analysis shows that the endopeptidase encoding genes are expressed under both nitrogen-fixing and non-nitrogen-fixing conditions. Conclusion Anabaena PCC 7120 possesses two NiFe-hydrogenases and two hydrogenase specific C-terminal endopeptidases but only one set of hyp-genes. Thus, in contrast to the Hyp-proteins, the C-terminal endopeptidases are the only known

  19. Cell-specific prediction and application of drug-induced gene expression profiles.

    Science.gov (United States)

    Hodos, Rachel; Zhang, Ping; Lee, Hao-Chih; Duan, Qiaonan; Wang, Zichen; Clark, Neil R; Ma'ayan, Avi; Wang, Fei; Kidd, Brian; Hu, Jianying; Sontag, David; Dudley, Joel

    2018-01-01

    Gene expression profiling of in vitro drug perturbations is useful for many biomedical discovery applications including drug repurposing and elucidation of drug mechanisms. However, limited data availability across cell types has hindered our capacity to leverage or explore the cell-specificity of these perturbations. While recent efforts have generated a large number of drug perturbation profiles across a variety of human cell types, many gaps remain in this combinatorial drug-cell space. Hence, we asked whether it is possible to fill these gaps by predicting cell-specific drug perturbation profiles using available expression data from related conditions--i.e. from other drugs and cell types. We developed a computational framework that first arranges existing profiles into a three-dimensional array (or tensor) indexed by drugs, genes, and cell types, and then uses either local (nearest-neighbors) or global (tensor completion) information to predict unmeasured profiles. We evaluate prediction accuracy using a variety of metrics, and find that the two methods have complementary performance, each superior in different regions in the drug-cell space. Predictions achieve correlations of 0.68 with true values, and maintain accurate differentially expressed genes (AUC 0.81). Finally, we demonstrate that the predicted profiles add value for making downstream associations with drug targets and therapeutic classes.

  20. A study on the kinetic behavior of Listeria monocytogenes in ice cream stored under static and dynamic chilling and freezing conditions.

    Science.gov (United States)

    Gougouli, M; Angelidis, A S; Koutsoumanis, K

    2008-02-01

    The kinetic behavior of Listeria monocytogenes in 2 commercial ice cream products (A and B) that were inoculated and stored under static chilling (4 to 16 degrees C), static freezing (-5 to -33 degrees C), dynamic chilling, and dynamic chilling-freezing conditions was studied, simulating conditions of the aging process and of normal or abuse conditions during distribution and storage. The ice cream products A and B had different compositions but similar pH (6.50 and 6.67, respectively) and water activity (0.957 and 0.965, respectively) values. For both chilling and freezing conditions, the kinetic behavior of the pathogen was similar in the 2 products, indicating that the pH and water activity, together with temperature, were the main factors controlling growth. Under chilling conditions, L. monocytogenes grew well at all temperatures tested. Under freezing conditions, no significant changes in the population of the pathogen were observed throughout a 90-d storage period for either of the inoculum levels tested (10(3) and 10(6) cfu/g). Growth data from chilled storage conditions were fitted to a mathematical model, and the calculated maximum specific growth rate was modeled as a function of temperature by using a square root model. The model was further validated under dynamic chilling and dynamic chilling-freezing conditions by using 4 different storage temperature scenarios. Under dynamic chilling conditions, the model accurately predicted the growth of the pathogen in both products, with 99.5% of the predictions lying within the +/- 20% relative error zone. The results from the chilling-freezing storage experiments showed that the pathogen was able to initiate growth within a very short time after a temperature upshift from freezing to chilling temperatures. This indicates that the freezing conditions did not cause a severe stress in L. monocytogenes cells capable of leading to a significant "additional" lag phase during the subsequent growth of the pathogen at

  1. Cancer cell specific cytotoxic gene expression mediated by ARF tumor suppressor promoter constructs

    International Nuclear Information System (INIS)

    Kurayoshi, Kenta; Ozono, Eiko; Iwanaga, Ritsuko; Bradford, Andrew P.; Komori, Hideyuki; Ohtani, Kiyoshi

    2014-01-01

    Highlights: • ARF promoter showed higher responsiveness to deregulated E2F activity than the E2F1 promoter. • ARF promoter showed higher cancer cell-specificity than E2F1 promoter to drive gene expression. • HSV-TK driven by ARF promoter showed higher cancer cell-specific cytotoxicity than that driven by E2F1 promoter. - Abstract: In current cancer treatment protocols, such as radiation and chemotherapy, side effects on normal cells are major obstacles to radical therapy. To avoid these side effects, a cancer cell-specific approach is needed. One way to specifically target cancer cells is to utilize a cancer specific promoter to express a cytotoxic gene (suicide gene therapy) or a viral gene required for viral replication (oncolytic virotherapy). For this purpose, the selected promoter should have minimal activity in normal cells to avoid side effects, and high activity in a wide variety of cancers to obtain optimal therapeutic efficacy. In contrast to the AFP, CEA and PSA promoters, which have high activity only in a limited spectrum of tumors, the E2F1 promoter exhibits high activity in wide variety of cancers. This is based on the mechanism of carcinogenesis. Defects in the RB pathway and activation of the transcription factor E2F, the main target of the RB pathway, are observed in almost all cancers. Consequently, the E2F1 promoter, which is mainly regulated by E2F, has high activity in wide variety of cancers. However, E2F is also activated by growth stimulation in normal growing cells, suggesting that the E2F1 promoter may also be highly active in normal growing cells. In contrast, we found that the tumor suppressor ARF promoter is activated by deregulated E2F activity, induced by forced inactivation of pRB, but does not respond to physiological E2F activity induced by growth stimulation. We also found that the deregulated E2F activity, which activates the ARF promoter, is detected only in cancer cell lines. These observations suggest that ARF promoter

  2. Cancer cell specific cytotoxic gene expression mediated by ARF tumor suppressor promoter constructs

    Energy Technology Data Exchange (ETDEWEB)

    Kurayoshi, Kenta [Department of Bioscience, School of Science and Technology, Kwansei Gakuin University, 2-1 Gakuen, Sanda, Hyogo 669-1337 (Japan); Ozono, Eiko [Centre for Molecular Oncology, Barts Cancer Institute, Queen Mary, University of London, John Vane Science Centre, Charterhouse Square, London EC1M 6BQ (United Kingdom); Iwanaga, Ritsuko; Bradford, Andrew P. [Department of Obstetrics and Gynecology, University of Colorado School of Medicine, Anschutz Medical Campus, 12800 East 19th Avenue, Aurora, CO 80045 (United States); Komori, Hideyuki [Center for Stem Cell Biology, Life Sciences Institute, University of Michigan, Ann Arbor, MI 48109 (United States); Ohtani, Kiyoshi, E-mail: btm88939@kwansei.ac.jp [Department of Bioscience, School of Science and Technology, Kwansei Gakuin University, 2-1 Gakuen, Sanda, Hyogo 669-1337 (Japan)

    2014-07-18

    Highlights: • ARF promoter showed higher responsiveness to deregulated E2F activity than the E2F1 promoter. • ARF promoter showed higher cancer cell-specificity than E2F1 promoter to drive gene expression. • HSV-TK driven by ARF promoter showed higher cancer cell-specific cytotoxicity than that driven by E2F1 promoter. - Abstract: In current cancer treatment protocols, such as radiation and chemotherapy, side effects on normal cells are major obstacles to radical therapy. To avoid these side effects, a cancer cell-specific approach is needed. One way to specifically target cancer cells is to utilize a cancer specific promoter to express a cytotoxic gene (suicide gene therapy) or a viral gene required for viral replication (oncolytic virotherapy). For this purpose, the selected promoter should have minimal activity in normal cells to avoid side effects, and high activity in a wide variety of cancers to obtain optimal therapeutic efficacy. In contrast to the AFP, CEA and PSA promoters, which have high activity only in a limited spectrum of tumors, the E2F1 promoter exhibits high activity in wide variety of cancers. This is based on the mechanism of carcinogenesis. Defects in the RB pathway and activation of the transcription factor E2F, the main target of the RB pathway, are observed in almost all cancers. Consequently, the E2F1 promoter, which is mainly regulated by E2F, has high activity in wide variety of cancers. However, E2F is also activated by growth stimulation in normal growing cells, suggesting that the E2F1 promoter may also be highly active in normal growing cells. In contrast, we found that the tumor suppressor ARF promoter is activated by deregulated E2F activity, induced by forced inactivation of pRB, but does not respond to physiological E2F activity induced by growth stimulation. We also found that the deregulated E2F activity, which activates the ARF promoter, is detected only in cancer cell lines. These observations suggest that ARF promoter

  3. Identification of specific gene expression profiles in fibroblasts derived from middle ear cholesteatoma.

    Science.gov (United States)

    Yoshikawa, Mamoru; Kojima, Hiromi; Wada, Kota; Tsukidate, Toshiharu; Okada, Naoko; Saito, Hirohisa; Moriyama, Hiroshi

    2006-07-01

    To investigate the role of fibroblasts in the pathogenesis of cholesteatoma. Tissue specimens were obtained from our patients. Middle ear cholesteatoma-derived fibroblasts (MECFs) and postauricular skin-derived fibroblasts (SFs) as controls were then cultured for a few weeks. These fibroblasts were stimulated with interleukin (IL) 1alpha and/or IL-1beta before gene expression assays. We used the human genome U133A probe array (GeneChip) and real-time polymerase chain reaction to examine and compare the gene expression profiles of the MECFs and SFs. Six patients who had undergone tympanoplasty. The IL-1alpha-regulated genes were classified into 4 distinct clusters on the basis of profiles differentially regulated by SF and MECF using a hierarchical clustering analysis. The messenger RNA expressions of LARC (liver and activation-regulated chemokine), GMCSF (granulocyte-macrophage colony-stimulating factor), epiregulin, ICAM1 (intercellular adhesion molecule 1), and TGFA (transforming growth factor alpha) were more strongly up-regulated by IL-1alpha and/or IL-1beta in MECF than in SF, suggesting that these fibroblasts derived from different tissues retained their typical gene expression profiles. Fibroblasts may play a role in hyperkeratosis of middle ear cholesteatoma by releasing molecules involved in inflammation and epidermal growth. These fibroblasts may retain tissue-specific characteristics presumably controlled by epigenetic mechanisms.

  4. Specific expression of human intelectin-1 in malignant pleural mesothelioma and gastrointestinal goblet cells.

    Directory of Open Access Journals (Sweden)

    Kota Washimi

    Full Text Available Malignant pleural mesothelioma (MPM is a fatal tumor. It is often hard to discriminate MPM from metastatic tumors of other types because currently, there are no reliable immunopathological markers for MPM. MPM is differentially diagnosed by some immunohistochemical tests on pathology specimens. In the present study, we investigated the expression of intelectin-1, a new mesothelioma marker, in normal tissues in the whole body and in many cancers, including MPM, by immunohistochemical analysis. We found that in normal tissues, human intelectin-1 was mainly secreted from gastrointestinal goblet cells along with mucus into the intestinal lumen, and it was also expressed, to a lesser extent, in mesothelial cells and urinary epithelial cells. Eighty-eight percent of epithelioid-type MPMs expressed intelectin-1, whereas sarcomatoid-type MPMs, biphasic MPMs, and poorly differentiated MPMs were rarely positive for intelectin-1. Intelectin-1 was not expressed in other cancers, except in mucus-producing adenocarcinoma. These results suggest that intelectin-1 is a better marker for epithelioid-type MPM than other mesothelioma markers because of its specificity and the simplicity of pathological assessment. Pleural intelectin-1 could be a useful diagnostic marker for MPM with applications in histopathological identification of MPM.

  5. Programmed Death-1 expression on Epstein Barr virus specific CD8+ T cells varies by stage of infection, epitope specificity, and T-cell receptor usage.

    Directory of Open Access Journals (Sweden)

    Thomas C Greenough

    Full Text Available BACKGROUND: Programmed Death-1 (PD-1 is an inhibitory member of the CD28 family of molecules expressed on CD8+ T cells in response to antigenic stimulation. To better understand the role of PD-1 in antiviral immunity we examined the expression of PD-1 on Epstein-Barr virus (EBV epitope-specific CD8+ T cells during acute infectious mononucleosis (AIM and convalescence. METHODOLOGY/PRINCIPAL FINDINGS: Using flow cytometry, we observed higher frequencies of EBV-specific CD8+ T cells and higher intensity of PD-1 expression on EBV-specific CD8+ T cells during AIM than during convalescence. PD-1 expression during AIM directly correlated with viral load and with the subsequent degree of CD8+ T cell contraction in convalescence. Consistent differences in PD-1 expression were observed between CD8+ T cells with specificity for two different EBV lytic antigen epitopes. Similar differences were observed in the degree to which PD-1 was upregulated on these epitope-specific CD8+ T cells following peptide stimulation in vitro. EBV epitope-specific CD8+ T cell proliferative responses to peptide stimulation were diminished during AIM regardless of PD-1 expression and were unaffected by blocking PD-1 interactions with PD-L1. Significant variability in PD-1 expression was observed on EBV epitope-specific CD8+ T cell subsets defined by V-beta usage. CONCLUSIONS/SIGNIFICANCE: These observations suggest that PD-1 expression is not only dependent on the degree of antigen presentation, but also on undefined characteristics of the responding cell that segregate with epitope specificity and V-beta usage.

  6. Brain region-specific altered expression and association of mitochondria-related genes in autism.

    Science.gov (United States)

    Anitha, Ayyappan; Nakamura, Kazuhiko; Thanseem, Ismail; Yamada, Kazuo; Iwayama, Yoshimi; Toyota, Tomoko; Matsuzaki, Hideo; Miyachi, Taishi; Yamada, Satoru; Tsujii, Masatsugu; Tsuchiya, Kenji J; Matsumoto, Kaori; Iwata, Yasuhide; Suzuki, Katsuaki; Ichikawa, Hironobu; Sugiyama, Toshiro; Yoshikawa, Takeo; Mori, Norio

    2012-11-01

    Mitochondrial dysfunction (MtD) has been observed in approximately five percent of children with autism spectrum disorders (ASD). MtD could impair highly energy-dependent processes such as neurodevelopment, thereby contributing to autism. Most of the previous studies of MtD in autism have been restricted to the biomarkers of energy metabolism, while most of the genetic studies have been based on mutations in the mitochondrial DNA (mtDNA). Despite the mtDNA, most of the proteins essential for mitochondrial replication and function are encoded by the genomic DNA; so far, there have been very few studies of those genes. Therefore, we carried out a detailed study involving gene expression and genetic association studies of genes related to diverse mitochondrial functions. For gene expression analysis, postmortem brain tissues (anterior cingulate gyrus (ACG), motor cortex (MC) and thalamus (THL)) from autism patients (n=8) and controls (n=10) were obtained from the Autism Tissue Program (Princeton, NJ, USA). Quantitative real-time PCR arrays were used to quantify the expression of 84 genes related to diverse functions of mitochondria, including biogenesis, transport, translocation and apoptosis. We used the delta delta Ct (∆∆Ct) method for quantification of gene expression. DNA samples from 841 Caucasian and 188 Japanese families were used in the association study of genes selected from the gene expression analysis. FBAT was used to examine genetic association with autism. Several genes showed brain region-specific expression alterations in autism patients compared to controls. Metaxin 2 (MTX2), neurofilament, light polypeptide (NEFL) and solute carrier family 25, member 27 (SLC25A27) showed consistently reduced expression in the ACG, MC and THL of autism patients. NEFL (P = 0.038; Z-score 2.066) and SLC25A27 (P = 0.046; Z-score 1.990) showed genetic association with autism in Caucasian and Japanese samples, respectively. The expression of DNAJC19, DNM1L, LRPPRC

  7. Brain region-specific altered expression and association of mitochondria-related genes in autism

    Directory of Open Access Journals (Sweden)

    Anitha Ayyappan

    2012-11-01

    Full Text Available Abstract Background Mitochondrial dysfunction (MtD has been observed in approximately five percent of children with autism spectrum disorders (ASD. MtD could impair highly energy-dependent processes such as neurodevelopment, thereby contributing to autism. Most of the previous studies of MtD in autism have been restricted to the biomarkers of energy metabolism, while most of the genetic studies have been based on mutations in the mitochondrial DNA (mtDNA. Despite the mtDNA, most of the proteins essential for mitochondrial replication and function are encoded by the genomic DNA; so far, there have been very few studies of those genes. Therefore, we carried out a detailed study involving gene expression and genetic association studies of genes related to diverse mitochondrial functions. Methods For gene expression analysis, postmortem brain tissues (anterior cingulate gyrus (ACG, motor cortex (MC and thalamus (THL from autism patients (n=8 and controls (n=10 were obtained from the Autism Tissue Program (Princeton, NJ, USA. Quantitative real-time PCR arrays were used to quantify the expression of 84 genes related to diverse functions of mitochondria, including biogenesis, transport, translocation and apoptosis. We used the delta delta Ct (∆∆Ct method for quantification of gene expression. DNA samples from 841 Caucasian and 188 Japanese families were used in the association study of genes selected from the gene expression analysis. FBAT was used to examine genetic association with autism. Results Several genes showed brain region-specific expression alterations in autism patients compared to controls. Metaxin 2 (MTX2, neurofilament, light polypeptide (NEFL and solute carrier family 25, member 27 (SLC25A27 showed consistently reduced expression in the ACG, MC and THL of autism patients. NEFL (P = 0.038; Z-score 2.066 and SLC25A27 (P = 0.046; Z-score 1.990 showed genetic association with autism in Caucasian and Japanese samples, respectively. The

  8. A cucumber mosaic virus based expression system for the production of porcine circovirus specific vaccines.

    Directory of Open Access Journals (Sweden)

    Akos Gellért

    Full Text Available Potential porcine circovirus type 2 (PCV2 capsid protein epitopes, suitable for expression on the surface of cucumber mosaic virus (CMV particles were determined by a thorough analysis of the predicted PCV capsid protein structure. The ab initio protein structure prediction was carried out with fold recognition and threading methods. The putative PCV epitopes were selected on the basis of PCV virion models and integrated into the plant virus coat protein, after amino acid position 131. The recombinants were tested for infectivity and stability on different Nicotiana species and stable recombinant virus particles were purified. The particles were tested for their ability to bind to PCV induced porcine antibodies and used for specific antibody induction in mice and pigs. The results showed that PCV epitopes expressed on the CMV surface were recognized by the porcine antibodies and they were also able to induce PCV specific antibody response. Challenge experiment with PCV2 carried out in immunized pigs showed partial protection against the infection. Based on these results it was concluded that specific antiviral vaccine production for the given pathogen was feasible, offering an inexpensive way for the mass production of such vaccines.

  9. A cucumber mosaic virus based expression system for the production of porcine circovirus specific vaccines.

    Science.gov (United States)

    Gellért, Akos; Salánki, Katalin; Tombácz, Kata; Tuboly, Tamás; Balázs, Ervin

    2012-01-01

    Potential porcine circovirus type 2 (PCV2) capsid protein epitopes, suitable for expression on the surface of cucumber mosaic virus (CMV) particles were determined by a thorough analysis of the predicted PCV capsid protein structure. The ab initio protein structure prediction was carried out with fold recognition and threading methods. The putative PCV epitopes were selected on the basis of PCV virion models and integrated into the plant virus coat protein, after amino acid position 131. The recombinants were tested for infectivity and stability on different Nicotiana species and stable recombinant virus particles were purified. The particles were tested for their ability to bind to PCV induced porcine antibodies and used for specific antibody induction in mice and pigs. The results showed that PCV epitopes expressed on the CMV surface were recognized by the porcine antibodies and they were also able to induce PCV specific antibody response. Challenge experiment with PCV2 carried out in immunized pigs showed partial protection against the infection. Based on these results it was concluded that specific antiviral vaccine production for the given pathogen was feasible, offering an inexpensive way for the mass production of such vaccines.

  10. Identification of an elaborate NK-specific system regulating HLA-C expression.

    Directory of Open Access Journals (Sweden)

    Hongchuan Li

    2018-01-01

    Full Text Available The HLA-C gene appears to have evolved in higher primates to serve as a dominant source of ligands for the KIR2D family of inhibitory MHC class I receptors. The expression of NK cell-intrinsic MHC class I has been shown to regulate the murine Ly49 family of MHC class I receptors due to the interaction of these receptors with NK cell MHC in cis. However, cis interactions have not been demonstrated for the human KIR and HLA proteins. We report the discovery of an elaborate NK cell-specific system regulating HLA-C expression, indicating an important role for HLA-C in the development and function of NK cells. A large array of alternative transcripts with differences in intron/exon content are generated from an upstream NK-specific HLA-C promoter, and exon content varies between HLA-C alleles due to SNPs in splice donor/acceptor sites. Skipping of the first coding exon of HLA-C generates a subset of untranslatable mRNAs, and the proportion of untranslatable HLA-C mRNA decreases as NK cells mature, correlating with increased protein expression by mature NK cells. Polymorphism in a key Ets-binding site of the NK promoter has generated HLA-C alleles that lack significant promoter activity, resulting in reduced HLA-C expression and increased functional activity. The NK-intrinsic regulation of HLA-C thus represents a novel mechanism controlling the lytic activity of NK cells during development.

  11. Lineage specific expression of Polycomb Group Proteins in human embryonic stem cells in vitro.

    Science.gov (United States)

    Pethe, Prasad; Pursani, Varsha; Bhartiya, Deepa

    2015-05-01

    Human embryonic (hES) stem cells are an excellent model to study lineage specification and differentiation into various cell types. Differentiation necessitates repression of specific genes not required for a particular lineage. Polycomb Group (PcG) proteins are key histone modifiers, whose primary function is gene repression. PcG proteins form complexes called Polycomb Repressive Complexes (PRCs), which catalyze histone modifications such as H2AK119ub1, H3K27me3, and H3K9me3. PcG proteins play a crucial role during differentiation of stem cells. The expression of PcG transcripts during differentiation of hES cells into endoderm, mesoderm, and ectoderm lineage is yet to be shown. In-house derived hES cell line KIND1 was differentiated into endoderm, mesoderm, and ectoderm lineages; followed by characterization using RT-PCR for HNF4A, CDX2, MEF2C, TBX5, SOX1, and MAP2. qRT-PCR and western blotting was performed to compare expression of PcG transcripts and proteins across all the three lineages. We observed that cells differentiated into endoderm showed upregulation of RING1B, BMI1, EZH2, and EED transcripts. Mesoderm differentiation was characterized by significant downregulation of all PcG transcripts during later stages. BMI1 and RING1B were upregulated while EZH2, SUZ12, and EED remained low during ectoderm differentiation. Western blotting also showed distinct expression of BMI1 and EZH2 during differentiation into three germ layers. Our study shows that hES cells differentiating into endoderm, mesoderm, and ectoderm lineages show distinct PcG expression profile at transcript and protein level. © 2015 International Federation for Cell Biology.

  12. Tissue-specific expression and regulatory networks of pig microRNAome.

    Directory of Open Access Journals (Sweden)

    Paolo Martini

    Full Text Available BACKGROUND: Despite the economic and medical importance of the pig, knowledge about its genome organization, gene expression regulation, and molecular mechanisms involved in physiological processes is far from that achieved for mouse and rat, the two most used model organisms in biomedical research. MicroRNAs (miRNAs are a wide class of molecules that exert a recognized role in gene expression modulation, but only 280 miRNAs in pig have been characterized to date. RESULTS: We applied a novel computational approach to predict species-specific and conserved miRNAs in the pig genome, which were then subjected to experimental validation. We experimentally identified candidate miRNAs sequences grouped in high-confidence (424 and medium-confidence (353 miRNAs according to RNA-seq results. A group of miRNAs was also validated by PCR experiments. We established the subtle variability in expression of isomiRs and miRNA-miRNA star couples supporting a biological function for these molecules. Finally, miRNA and mRNA expression profiles produced from the same sample of 20 different tissue of the animal were combined, using a correlation threshold to filter miRNA-target predictions, to identify tissue-specific regulatory networks. CONCLUSIONS: Our data represent a significant progress in the current understanding of miRNAome in pig. The identification of miRNAs, their target mRNAs, and the construction of regulatory circuits will provide new insights into the complex biological networks in several tissues of this important animal model.

  13. Dispositional emotional expressivity, cancer-specific coping, and distress in socioeconomically-disadvantaged Latinas.

    Science.gov (United States)

    Moreno, Patricia I; Bauer, Margaret R; Yanez, Betina; Jorge, Alexandra; Maggard-Gibbons, Melinda; Stanton, Annette L

    2016-06-01

    Coping processes directed toward avoiding and approaching stressor-related thoughts and emotions predict psychological adjustment. However, few studies have examined how the relationship between dispositional emotional tendencies and stressor-specific coping affects outcomes. The aim of the current study was to examine the association of dispositional emotional expressivity (i.e., the propensity to experience and express emotions strongly) with cancer-specific coping through avoidance and emotional approach to predict intrusive thoughts and depressive symptoms in Latinas with breast cancer. Recently diagnosed Latina breast cancer patients receiving treatment completed standardized assessments via interview at 2 time points: within 18 months of diagnosis (Time 1; N = 95) and 3 months later (Time 2; N = 79). Most women were immigrants (93%), reported a combined household income of $20,000 or less (75%), did not graduate from high school (59%), and primarily spoke Spanish (88%). In path analyses, more recent immigration was associated with greater dispositional expressivity, which in turn was associated with coping with the cancer experience using both greater avoidance and emotional approach strategies. Only avoidance-oriented strategies predicted an increase in intrusive thoughts at 3 months. No significant effects on depressive symptoms were observed. Findings suggest that Latina breast cancer patients who have a propensity to experience and express emotions strongly may be initially overwhelmed by their cancer-related emotions and consequently turn to avoidance-oriented and emotional approach strategies to cope with their diagnosis. Avoidance-oriented coping in turn may uniquely predict an increase in cancer-related intrusive thoughts 3 months later. (PsycINFO Database Record (c) 2016 APA, all rights reserved).

  14. Enteroendocrine cells are specifically marked by cell surface expression of claudin-4 in mouse small intestine.

    Directory of Open Access Journals (Sweden)

    Takahiro Nagatake

    Full Text Available Enteroendocrine cells are solitary epithelial cells scattered throughout the gastrointestinal tract and produce various types of hormones, constituting one of the largest endocrine systems in the body. The study of these rare epithelial cells has been hampered by the difficulty in isolating them because of the lack of specific cell surface markers. Here, we report that enteroendocrine cells selectively express a tight junction membrane protein, claudin-4 (Cld4, and are efficiently isolated with the use of an antibody specific for the Cld4 extracellular domain and flow cytometry. Sorted Cld4+ epithelial cells in the small intestine exclusively expressed a chromogranin A gene (Chga and other enteroendocrine cell-related genes (Ffar1, Ffar4, Gpr119, and the population was divided into two subpopulations based on the activity of binding to Ulex europaeus agglutinin-1 (UEA-1. A Cld4+UEA-1- cell population almost exclusively expressed glucose-dependent insulinotropic polypeptide gene (Gip, thus representing K cells, whereas a Cld4+UEA-1+ cell population expressed other gut hormone genes, including glucagon-like peptide 1 (Gcg, pancreatic polypeptide-like peptide with N-terminal tyrosine amide (Pyy, cholecystokinin (Cck, secretin (Sct, and tryptophan hydroxylase 1 (Tph1. In addition, we found that orally administered luminal antigens were taken up by the solitary Cld4+ cells in the small intestinal villi, raising the possibility that enteroendocrine cells might also play a role in initiation of mucosal immunity. Our results provide a useful tool for the cellular and functional characterization of enteroendocrine cells.

  15. Improved adhesive properties of recombinant bifidobacteria expressing the Bifidobacterium bifidum-specific lipoprotein BopA

    Directory of Open Access Journals (Sweden)

    Gleinser Marita

    2012-06-01

    Full Text Available Abstract Background Bifidobacteria belong to one of the predominant bacterial groups in the intestinal microbiota of infants and adults. Several beneficial effects on the health status of their human hosts have been demonstrated making bifidobacteria interesting candidates for probiotic applications. Adhesion of probiotics to the intestinal epithelium is discussed as a prerequisite for colonisation of and persistence in the gastrointestinal tract. Results In the present study, 15 different strains of bifidobacteria were tested for adhesion. B. bifidum was identified as the species showing highest adhesion to all tested intestinal epithelial cell (IEC lines. Adhesion of B. bifidum S17 to IECs was strongly reduced after treatment of bacteria with pronase. These results strongly indicate that a proteinaceous cell surface component mediates adhesion of B. bifidum S17 to IECs. In silico analysis of the currently accessible Bifidobacterium genomes identified bopA encoding a lipoprotein as a B. bifidum-specific gene previously shown to function as an adhesin of B. bifidum MIMBb75. The in silico results were confirmed by Southern Blot analysis. Furthermore, Northern Blot analysis demonstrated that bopA is expressed in all B. bifidum strains tested under conditions used to cultivate bacteria for adhesion assays. The BopA gene was successfully expressed in E. coli and purified by Ni-NTA affinity chromatography as a C-terminal His6-fusion. Purified BopA had an inhibitory effect on adhesion of B. bifidum S17 to IECs. Moreover, bopA was successfully expressed in B. bifidum S17 and B. longum/infantis E18. Strains overexpressing bopA showed enhanced adhesion to IECs, clearly demonstrating a role of BopA in adhesion of B. bifidum strains. Conclusions BopA was identified as a B. bifidum-specific protein involved in adhesion to IECs. Bifidobacterium strains expressing bopA show enhanced adhesion. Our results represent the first report on recombinant

  16. Tissue- and environmental response-specific expression of 10 PP2C transcripts in Mesembryanthemum crystallinum.

    Science.gov (United States)

    Miyazaki, S; Koga, R; Bohnert, H J; Fukuhara, T

    1999-03-01

    Ten transcripts (Mpc1-10) homologous to protein phosphatases of the 2C family have been isolated from the halophyte Mesembryanthemum crystallinum (common ice plant). Transcripts range in size from 1.6 to 2.6 kb, and encode proteins whose catalytic domains are between 24% and 62% identical to that of the Arabidopsis PP2C, ABI1. Transcript expression is tissue specific. Two isoforms are present only in roots (Mpc1 and Mpc5), three in young leaves (Mpc6, 8 and 9), two in old leaves (Mpc6 and Mpc8), and two in post-flowering leaves (Mpc8 and Mpc9). Mpc2 is strongly expressed in roots and also in seeds, meristematic tissues and mature flowers. Mpc3 is specific for leaf meristems, and Mpc4 is found in root and leaf meristems. Mpc7 is restricted to meristematic tissues. Mpc10 is only present in mature flowers. Mpc2 (in roots and leaves), Mpc5 (in roots) and Mpc8 (weakly in leaves) are induced by salinity stress and drought conditions with different kinetics in different tissues, but other Mpcs are downregulated by stress. Cold stress (4 degrees C) leads to a decline in Mpc5 and Mp6, but low temperature provoked a long-term (days) increase in Mpc2 levels in leaves and a transient increase (less than 24 h) in roots. Four full-length transcripts have been obtained. In each case, after over-expression in E. coli, the isolated proteins exhibited (Mg2+-dependent, okadeic acid-insensitive) protein phosphatase activity, although activity against 32P-phosphocasein varied among different PP2Cs. Determination of tissue developmental and stress response specificity of PP2C will facilitate functional studies of signal-transducing enzymes in this halophytic organism.

  17. Differences in gene expression of human xylosyltransferases and determination of acceptor specificities for various proteoglycans

    Energy Technology Data Exchange (ETDEWEB)

    Roch, Christina; Kuhn, Joachim; Kleesiek, Knut [Institut fuer Laboratoriums- und Transfusionsmedizin, Herz- und Diabeteszentrum NRW, Universitaetsklinik der Ruhr-Universitaet Bochum, 32545 Bad Oeynhausen (Germany); Goetting, Christian, E-mail: cgoetting@hdz-nrw.de [Institut fuer Laboratoriums- und Transfusionsmedizin, Herz- und Diabeteszentrum NRW, Universitaetsklinik der Ruhr-Universitaet Bochum, 32545 Bad Oeynhausen (Germany)

    2010-01-01

    The xylosyltransferase (XT) isoforms XT-I and XT-II initiate the posttranslational glycosaminoglycan (GAG) synthesis. Here, we determined the relative expression of both isoforms in 33 human cell lines. The majority of tested cell lines showed dominant XYLT2 gene expression, while only in 23132/87, JAR, NCI-H510A and THP-1 was the XT-I mRNA expression higher. Nearly equal expression levels were detected in six cell lines. Additionally, to shed light on putative differences in acceptor specificities the acceptor properties of potential acceptor sequences were determined. Peptides were expressed as glutathione-S-transferase fusion proteins containing putative or known GAG attachment sites of in vivo proteoglycans. Kinetic analysis showed that K{sub m} and V{sub max} values for XT-I mediated xylosylation were slightly higher than those for XT-II, and that XT-I showed a lesser stringency concerning the acceptor sequence. Mutagenesis of the bikunin peptide sequence in the G-S-G attachment site and flanking regions generated potential acceptor molecules. Here, mutations on the N-terminal side and the attachment site were found to be more susceptible to a loss of acceptor function than mutations in the C-terminus. Altogether the known consensus sequence a-a-a-a-G-S-G-a-a/G-a ('a' representing Asp or Glu) for XT-I mediated xylosylation could be approved and additionally extended to apply to XT-II as well.

  18. Gene Expression Programs in Response to Hypoxia: Cell Type Specificity and Prognostic Significance in Human Cancers.

    Directory of Open Access Journals (Sweden)

    2006-01-01

    Full Text Available BACKGROUND: Inadequate oxygen (hypoxia triggers a multifaceted cellular response that has important roles in normal physiology and in many human diseases. A transcription factor, hypoxia-inducible factor (HIF, plays a central role in the hypoxia response; its activity is regulated by the oxygen-dependent degradation of the HIF-1alpha protein. Despite the ubiquity and importance of hypoxia responses, little is known about the variation in the global transcriptional response to hypoxia among different cell types or how this variation might relate to tissue- and cell-specific diseases. METHODS AND FINDINGS: We analyzed the temporal changes in global transcript levels in response to hypoxia in primary renal proximal tubule epithelial cells, breast epithelial cells, smooth muscle cells, and endothelial cells with DNA microarrays. The extent of the transcriptional response to hypoxia was greatest in the renal tubule cells. This heightened response was associated with a uniquely high level of HIF-1alpha RNA in renal cells, and it could be diminished by reducing HIF-1alpha expression via RNA interference. A gene-expression signature of the hypoxia response, derived from our studies of cultured mammary and renal tubular epithelial cells, showed coordinated variation in several human cancers, and was a strong predictor of clinical outcomes in breast and ovarian cancers. In an analysis of a large, published gene-expression dataset from breast cancers, we found that the prognostic information in the hypoxia signature was virtually independent of that provided by the previously reported wound signature and more predictive of outcomes than any of the clinical parameters in current use. CONCLUSIONS: The transcriptional response to hypoxia varies among human cells. Some of this variation is traceable to variation in expression of the HIF1A gene. A gene-expression signature of the cellular response to hypoxia is associated with a significantly poorer prognosis

  19. Expression of Aspergillus nidulans phy Gene in Nicotiana benthamiana Produces Active Phytase with Broad Specificities

    Directory of Open Access Journals (Sweden)

    Tae-Kyun Oh

    2014-09-01

    Full Text Available A full-length phytase gene (phy of Aspergillus nidulans was amplified from the cDNA library by polymerase chain reaction (PCR, and it was introduced into a bacterial expression vector, pET-28a. The recombinant protein (rPhy-E, 56 kDa was overexpressed in the insoluble fraction of Escherichia coli culture, purified by Ni-NTA resin under denaturing conditions and injected into rats as an immunogen. To express A. nidulans phytase in a plant, the full-length of phy was cloned into a plant expression binary vector, pPZP212. The resultant construct was tested for its transient expression by Agrobacterium-infiltration into Nicotiana benthamiana leaves. Compared with a control, the agro-infiltrated leaf tissues showed the presence of phy mRNA and its high expression level in N. benthamiana. The recombinant phytase (rPhy-P, 62 kDa was strongly reacted with the polyclonal antibody against the nonglycosylated rPhy-E. The rPhy-P showed glycosylation, two pH optima (pH 4.5 and pH 5.5, an optimum temperature at 45~55 °C, thermostability and broad substrate specificities. After deglycosylation by peptide-N-glycosidase F (PNGase-F, the rPhy-P significantly lost the phytase activity and retained 1/9 of the original activity after 10 min of incubation at 45 °C. Therefore, the deglycosylation caused a significant reduction in enzyme thermostability. In animal experiments, oral administration of the rPhy-P at 1500 U/kg body weight/day for seven days caused a significant reduction of phosphorus excretion by 16% in rat feces. Besides, the rPhy-P did not result in any toxicological changes and clinical signs.

  20. Expression of Aspergillus nidulans phy Gene in Nicotiana benthamiana Produces Active Phytase with Broad Specificities

    Science.gov (United States)

    Oh, Tae-Kyun; Oh, Sung; Kim, Seongdae; Park, Jae Sung; Vinod, Nagarajan; Jang, Kyung Min; Kim, Sei Chang; Choi, Chang Won; Ko, Suk-Min; Jeong, Dong Kee; Udayakumar, Rajangam

    2014-01-01

    A full-length phytase gene (phy) of Aspergillus nidulans was amplified from the cDNA library by polymerase chain reaction (PCR), and it was introduced into a bacterial expression vector, pET-28a. The recombinant protein (rPhy-E, 56 kDa) was overexpressed in the insoluble fraction of Escherichia coli culture, purified by Ni-NTA resin under denaturing conditions and injected into rats as an immunogen. To express A. nidulans phytase in a plant, the full-length of phy was cloned into a plant expression binary vector, pPZP212. The resultant construct was tested for its transient expression by Agrobacterium-infiltration into Nicotiana benthamiana leaves. Compared with a control, the agro-infiltrated leaf tissues showed the presence of phy mRNA and its high expression level in N. benthamiana. The recombinant phytase (rPhy-P, 62 kDa) was strongly reacted with the polyclonal antibody against the nonglycosylated rPhy-E. The rPhy-P showed glycosylation, two pH optima (pH 4.5 and pH 5.5), an optimum temperature at 45~55 °C, thermostability and broad substrate specificities. After deglycosylation by peptide-N-glycosidase F (PNGase-F), the rPhy-P significantly lost the phytase activity and retained 1/9 of the original activity after 10 min of incubation at 45 °C. Therefore, the deglycosylation caused a significant reduction in enzyme thermostability. In animal experiments, oral administration of the rPhy-P at 1500 U/kg body weight/day for seven days caused a significant reduction of phosphorus excretion by 16% in rat feces. Besides, the rPhy-P did not result in any toxicological changes and clinical signs. PMID:25192284

  1. Immunoreactive neuron-specific enolase (NSE) is expressed in testicular carcinoma-in-situ

    DEFF Research Database (Denmark)

    Kang, J L; Rajpert-De Meyts, E; Skakkebaek, N E

    1996-01-01

    Neuron-specific enolase (NSE) is a well-known marker of tumours that have neuroendocrine origin. High levels of NSE have also been described in various types of testicular germ cell neoplasms, particularly in seminomas. To evaluate the presence of NSE in testicular carcinoma-in situ (CIS), a prei...... are evidence against a relationship between NSE and N-myc in testicular germ cell tumours. The high expression of NSE in CIS and overt germ cell tumours may be due to the increased gene dosage effect associated with the overrepresentation of isochromosome 12p....

  2. Ki-67 expression reveals strong, transient influenza specific CD4 T cell responses after adult vaccination

    OpenAIRE

    Li, Xi; Miao, Hongyu; Henn, Alicia; Topham, David J.; Wu, Hulin; Zand, Martin S.; Mosmann, Tim R.

    2012-01-01

    Although previous studies have found minimal changes in CD4 T cell responses after vaccination of adults with trivalent inactivated influenza vaccine, daily sampling and monitoring of the proliferation marker Ki-67 have now been used to reveal that a substantial fraction of influenza-specific CD4 T cells respond to vaccination. At 4–6 days after vaccination, there is a sharp rise in the numbers of Ki-67-expressing PBMC that produce IFNγ, IL-2 and/or TNFα in vitro in response to influenza vacc...

  3. [Neonatal meningitis due to Listeria monocytogenes after 3 weeks of maternal treatment during pregnancy].

    Science.gov (United States)

    Fayol, L; Beizig, S; Le Monnier, A; Lacroze, V; Simeoni, U

    2009-04-01

    We report the case of a pregnant woman with listeriosis at 26 gestational weeks followed by premature labor at 30 gestational weeks. Bacterial meningitis was suspected in the neonate with ventriculitis on sonography, a high level of protein in the cerebrospinal fluid (CSF), and an identified specific bacterial genome of Listeria monocytogenes (PCR 16S rDNA and sequencing and specific amplification of L. monocytogenes hly gene) in CSF. Neonatal meningitis was complicated with cerebral venous sinus thrombosis and ventriculomegaly. Listeriosis during pregnancy can lead to severe complications in the neonate. Thus, listeriosis should be a diagnostic concern in febrile pregnant women at any stage of pregnancy. First-line treatment is based on high-dose amoxicillin (> or =6g/day) and must be used for at least 3 weeks for treatment of listeriosis during pregnancy. If the fetus survives, longer therapy until delivery can be discussed.

  4. Astrocyte-specific regulation of hMeCP2 expression in Drosophila

    Directory of Open Access Journals (Sweden)

    David L. Hess-Homeier

    2014-10-01

    Full Text Available Alterations in the expression of Methyl-CpG-binding protein 2 (MeCP2 either by mutations or gene duplication leads to a wide spectrum of neurodevelopmental disorders including Rett Syndrome and MeCP2 duplication disorder. Common features of Rett Syndrome (RTT, MeCP2 duplication disorder, and neuropsychiatric disorders indicate that even moderate changes in MeCP2 protein levels result in functional and structural cell abnormalities. In this study, we investigated two areas of MeCP2 pathophysiology using Drosophila as a model system: the effects of MeCP2 glial gain-of-function activity on circuits controlling sleep behavior, and the cell-type specific regulation of MeCP2 expression. In this study, we first examined the effects of elevated MeCP2 levels on microcircuits by expressing human MeCP2 (hMeCP2 in astrocytes and distinct subsets of amine neurons including dopamine and octopamine (OA neurons. Depending on the cell-type, hMeCP2 expression reduced sleep levels, altered daytime/nighttime sleep patterns, and generated sleep maintenance deficits. Second, we identified a 498 base pair region of the MeCP2e2 isoform that is targeted for regulation in distinct subsets of astrocytes. Levels of the full-length hMeCP2e2 and mutant RTT R106W protein decreased in astrocytes in a temporally and spatially regulated manner. In contrast, expression of the deletion Δ166 hMeCP2 protein was not altered in the entire astrocyte population. qPCR experiments revealed a reduction in full-length hMeCP2e2 transcript levels suggesting transgenic hMeCP2 expression is regulated at the transcriptional level. Given the phenotypic complexities that are caused by alterations in MeCP2 levels, our results provide insight into distinct cellular mechanisms that control MeCP2 expression and link microcircuit abnormalities with defined behavioral deficits.

  5. Tissue specific promoters improve the localization of radiation-inducible gene expression

    International Nuclear Information System (INIS)

    Hallahan, Dennis; Kataoka, Yasushi; Kuchibhotla, Jaya; Virudachalam, Subbu; Weichselbaum, Ralph

    1996-01-01

    Purpose: Site-specific activation of gene expression can be achieved by the use of a promoter that is induced by physical agents such as x-rays. The purpose of the present study was to determine whether site-specific activation of gene therapy can also be achieved within the vascular endothelium by use of radiation-inducible promoters. We studied induction of promoter-reporter gene constructs using previously identified radiation-promoters from c-jun, c-fos, Egr-1, ICAM-1, ELAM-1 after transfection into in the vascular endothelium. Methods: The following radiation-inducible genetic constructs were created: The ELAM-1 promoter fragment was cloned into pOGH to obtain the pE-sel(-587 +35)GH reporter construct. The ICAM-1 promoter fragment (-1162/+1) was cloned upstream of the CAT coding region of the pCAT-plasmid (Promega) after removal of the SV40 promoter by Bgl2/Stu1 digestion to create the pBS-CAT plasmid. The 132 to +170 bp segment of the 5' untranslated region of the c-jun promoter was cloned to the CAT reporter gene to create the -132/+170 cjun-CAT. The Egr-1 promoter fragment (-425/+75) was cloned upstream of the CAT coding region to create the pE425-CAT plasmid. Tandem repeats of the AP-1 binding site were cloned upstream of the CAT coding region (3 xTRE-CAT). Tandem repeats of the Egr binding site (EBS) were cloned upstream of the CAT coding region (EBS-CAT). Human vascular endothelial cells from both large vessel and small vessel origin (HUVEC and HMEC), as well as human tumor cell lines were transfected with plasmids -132/+170 cjun-CAT, pE425-CAT, 3 xTRE-CAT, EBS-CAT, pE-sel-GH and pBS-CAT by use of liposomes. Humor tumor cell lines included SQ20B (squamous), RIT3 (sarcoma), and HL525 (leukemia). Each plasmid was cotransfected with a plasmid containing a CMV promoter linked to the LacZ gene (1 μg). Transfected cells were treated with mock irradiation or x-rays. Cell extracts were assayed for reporter gene expression. Results: Radiation-induced gene

  6. A study of sensitivity and specificity of CD64 expression in acute myeloid leukemia

    International Nuclear Information System (INIS)

    Jin Haijie; Gao Xiaoning; Chen Weihua; Li Meng; Sun Jingfen; Han Xiaopin; Yu Li

    2008-01-01

    To study the sensitivity and specificity of CD64 in immunotyping of acute myeloid leukemia(AML). The bone marrow cells from 132 patients with AML were labelled with a series of antigens and were analyzed by flow cytometry. CD64 has high sensitivity in patients with acute myelomonocytic leukemia (M4) 96.4% and acute monocytic leukemia (MS) (96.4% and 100%, respectively). The expressions of CD64 was very low on patients with other kinds of AML(M0, M1, M2, M3, M6, M7). The specificity of CD64 in patients with M4 and M5 was 56.5%. The results suggest that the CD64 is helpful in the differential diagnosis of M4 and M5 in AML patients. (authors)

  7. Male Specific Gene Expression in Dioecious Phoenix Dactylifera (Date Palm) Tree at Flowering Stage

    International Nuclear Information System (INIS)

    Al-Ameri, A. A.; Al-Qurainy, F.; Gaafar, A. R. Z.; Khan, S.; Nadeem, M.

    2016-01-01

    Date palm is a long-living and evergreen important tree in the semiarid regions. Its fruit is rich in carbohydrate and fibres. Transcriptional profiling was compared among male and female trees of dioecious date palm at flowering stage. Male specific genes are expressed at flowering stage which was studied using the cDNA-SCoT marker. We developed sequence characterized amplified region (SCAR) markers of size 253 bp from male tree based on cDNA-SCoT fingerprinting. Further, developed SCAR marker was validated on the independently collected samples of both types of trees at flowering stage. The unique and specific band (253 bp) was amplified from male samples only whereas it was absent from female samples. (author)

  8. Male germ cell-specific expression of a novel Patched-domain containing gene Ptchd3

    International Nuclear Information System (INIS)

    Fan Jun; Akabane, Hiroto; Zheng Xuehai; Zhou Xuan; Zhang Li; Liu Qiang; Zhang Yonglian; Yang Jing; Zhu Guozhang

    2007-01-01

    The Hedgehog (Hh) signaling pathway plays an important role in various biological processes, including pattern formation, cell fate determination, proliferation, and differentiation. Hh function is mediated through its membrane receptor Patched. Herein, we have characterized a novel Patched-domain containing gene Ptchd3 in mouse. Messenger RNA of Ptchd3 was exclusively detected in the testis, and existed in two isoforms Ptchd3a and Ptchd3b. The expression of these two mRNA isoforms was shown to be developmentally regulated in testes, and specifically found in male germ cells. Further analysis revealed that the Ptchd3 protein was located on the midpiece of mouse, rat and human sperm. Collectively, these results indicate that Ptchd3 is a novel male germ cell-specific gene and may be involved in the Hh signaling to regulate sperm development and/or sperm function

  9. Receptor-like protein-tyrosine phosphatase alpha specifically inhibits insulin-increased prolactin gene expression

    DEFF Research Database (Denmark)

    Jacob, K K; Sap, J; Stanley, F M

    1998-01-01

    A physiologically relevant response to insulin, stimulation of prolactin promoter activity in GH4 pituitary cells, was used as an assay to study the specificity of protein-tyrosine phosphatase function. Receptor-like protein-tyrosine phosphatase alpha (RPTPalpha) blocks the effect of insulin...... is specific by two criteria. A number of potential RPTPalpha targets were ruled out by finding (a) that they are not affected or (b) that they are not on the pathway to insulin-increased prolactin-CAT activity. The negative effect of RPTPalpha on insulin activation of the prolactin promoter is not due...... to reduced phosphorylation or kinase activity of the insulin receptor or to reduced phosphorylation of insulin receptor substrate-1 or Shc. Inhibitor studies suggest that insulin-increased prolactin gene expression is mediated by a Ras-like GTPase but is not mitogen-activated protein kinase dependent...

  10. IDENTITY ISSUES AND BAHIA’S CULTURAL SPECIFICITY EXPRESSED THROUGH MUSIC AND LITERATURE: A GEOGRAPHIC VIEW

    Directory of Open Access Journals (Sweden)

    Janio Roque Barros de Castro

    2014-07-01

    Full Text Available This work intends to examine how some Jorge Amado’s literary works and some music from the singer and songwriter Dorival Caymmi express in different ways, different places in Bahia, specially its capital, Salvador. Specific cultural aspects of everyday life, worldviews and the ways of people from Bahia, inspired literary works and songs that spread beyond the scope of the Bahia State, the elements of this “baianidade” which can be read, understood and analyzed in different ways in other states or countries. It aims to discuss how some important literary and musical works of these authors expressed and still express the african-bahia elements and some identity aspects of the people from Bahia. It was found that in both the literary texts and the musicality of the authors under review, the places and landscape stand out as cultural spaces and symbolic buildings of high visibility, such as Pelourinho, the historic center of Salvador, and the Church of Bomfim , an important religious and devotional temple of Salvador.

  11. Comparison of Two Mouse Ameloblast-like Cell Lines for Enamel-specific Gene Expression

    Directory of Open Access Journals (Sweden)

    Juni eSarkar

    2014-07-01

    Full Text Available Ameloblasts are ectoderm-derived cells that produce an extracellular enamel matrix that mineralizes to form enamel. The development and use of immortalized cell lines, with a stable phenotype, is an important contribution to biological studies as it allows for the investigation of molecular activities without the continuous need for animals. In this study we compare the expression profiles of enamel-specific genes in two mouse derived ameloblast-like cell lines: LS8 and ALC cells. Quantitative PCR analysis indicates that, relative to each other, LS8 cells express greater mRNA levels for genes that define secretory-stage activities (Amelx, Ambn, Enam and Mmp20, while ALC express greater mRNA levels for genes that define maturation-stage activities (Odam and Klk4. Western blot analyses show that Amelx, Ambn and Odam proteins are detectable in ALC, but not LS8 cells. Unstimulated ALC cells form calcified nodules, while LS8 cells do not. These data provide greater insight as to the suitability of both cell lines to contribute to biological studies on enamel formation and biomineralization, and highlight some of the strengths and weaknesses when relying on enamel epithelial organ-derived cell lines to study molecular activities of amelogenesis.

  12. Specific Tandem 3'UTR Patterns and Gene Expression Profiles in Mouse Thy1+ Germline Stem Cells.

    Directory of Open Access Journals (Sweden)

    Yan Huang

    Full Text Available A recently developed strategy of sequencing alternative polyadenylation (APA sites (SAPAS with second-generation sequencing technology can be used to explore complete genome-wide patterns of tandem APA sites and global gene expression profiles. spermatogonial stem cells (SSCs maintain long-term reproductive abilities in male mammals. The detailed mechanisms by which SSCs self-renew and generate mature spermatozoa are not clear. To understand the specific alternative polyadenylation pattern and global gene expression profile of male germline stem cells (GSCs, mainly referred to SSCs here, we isolated and purified mouse Thy1+ cells from testis by magnetic-activated cell sorting (MACS and then used the SAPAS method for analysis, using pluripotent embryonic stem cells (ESCs and differentiated mouse embryonic fibroblast cells (MEFs as controls. As a result, we obtained 99,944 poly(A sites, approximately 40% of which were newly detected in our experiments. These poly(A sites originated from three mouse cell types and covered 17,499 genes, including 831 long non-coding RNA (lncRNA genes. We observed that GSCs tend to have shorter 3'UTR lengths while MEFs tend towards longer 3'UTR lengths. We also identified 1337 genes that were highly expressed in GSCs, and these genes were highly consistent with the functional characteristics of GSCs. Our detailed bioinformatics analysis identified APA site-switching events at 3'UTRs and many new specifically expressed genes in GSCs, which we experimentally confirmed. Furthermore, qRT-PCR was performed to validate several events of the 334 genes with distal-to-proximal poly(A switch in GSCs. Consistently APA reporter assay confirmed the total 3'UTR shortening in GSCs compared to MEFs. We also analyzed the cis elements around the proximal poly(A site preferentially used in GSCs and found C-rich elements may contribute to this regulation. Overall, our results identified the expression level and polyadenylation site

  13. Preparation of a recombinant adenoviral encoding human NIS gene and its specific expression in cardiomyocytes

    International Nuclear Information System (INIS)

    Wang Lihua; Zhang Miao; Guo Rui; Shi Shuo; Li Biao

    2012-01-01

    Objective: To construct a recombinant adenovirus vector containing the human NIS gene with the myosin light chain-2(MLC-2v) gene as the promoter and evaluate its specific expression and feasibility as a reporter gene in cardiomyocytes. Methods: MLC-2v promoter and NIS were subcloned into an adenovirus shuttle vector, and forwarded by homologous recombination in the bacteria BJ5183 containing AdEasy-1 plasmid. Positive recombinant adenovirus vector was selected, packaged and amplified in the HEK293 cells to obtain recombinant adenovirus Ad-MLC-NIS. Ad-cytomegalovirus (CMV)-NIS with cytomegalovirus as the promoter, Ad-MLC without NIS and Ad-NIS without promoter were constructed as the controls. Cardiomyocytes and non-cardiomyocytes were then infected by the adenovirus. The protein expression was tested by Western blot analysis. The function and features of NIS protein were evaluated by dynamic iodide uptake and NaClO 4 iodine uptake inhibition test in vitro. The viability and proliferation of cardiomyocytes after adenovirus transfection and radioiodine incubation were checked by trypan blue staining. Results: Recombinant NIS adenovirus was successfully constructed. Western blot analysis showed that the NIS protein was highly expressed in cardiomyocytes transfected with Ad-MLC-NIS, and all cells transfected with Ad-CMV-NIS. However, in non-cardiomyocytes transfected with Ad-MLC-NIS, little NIS protein was detected. Dynamic iodine uptake tests showed that the peaks of iodide uptake of the three different cell lines (H9C2, A549, U87 cell) transfected with Ad-MLC-NIS were 5844.0, 833.6 and 846.0 counts · min -1 , respectively. The iodide uptake function of H9C2 was inhibited by NaClO 4 . There was almost no change in cell viability and proliferation when the MOI was 100. Conclusions: Ad-MLC-NIS allows myocardial specific expression of an external gene, and the cardiomyocytes with NIS expression are capable of iodine uptake. Further research of NIS as a reporter gene in

  14. Specific Tandem 3'UTR Patterns and Gene Expression Profiles in Mouse Thy1+ Germline Stem Cells

    Science.gov (United States)

    Lin, Zhuoheng; Feng, Xuyang; Jiang, Xue; Songyang, Zhou; Huang, Junjiu

    2015-01-01

    A recently developed strategy of sequencing alternative polyadenylation (APA) sites (SAPAS) with second-generation sequencing technology can be used to explore complete genome-wide patterns of tandem APA sites and global gene expression profiles. spermatogonial stem cells (SSCs) maintain long-term reproductive abilities in male mammals. The detailed mechanisms by which SSCs self-renew and generate mature spermatozoa are not clear. To understand the specific alternative polyadenylation pattern and global gene expression profile of male germline stem cells (GSCs, mainly referred to SSCs here), we isolated and purified mouse Thy1+ cells from testis by magnetic-activated cell sorting (MACS) and then used the SAPAS method for analysis, using pluripotent embryonic stem cells (ESCs) and differentiated mouse embryonic fibroblast cells (MEFs) as controls. As a result, we obtained 99,944 poly(A) sites, approximately 40% of which were newly detected in our experiments. These poly(A) sites originated from three mouse cell types and covered 17,499 genes, including 831 long non-coding RNA (lncRNA) genes. We observed that GSCs tend to have shorter 3'UTR lengths while MEFs tend towards longer 3'UTR lengths. We also identified 1337 genes that were highly expressed in GSCs, and these genes were highly consistent with the functional characteristics of GSCs. Our detailed bioinformatics analysis identified APA site-switching events at 3'UTRs and many new specifically expressed genes in GSCs, which we experimentally confirmed. Furthermore, qRT-PCR was performed to validate several events of the 334 genes with distal-to-proximal poly(A) switch in GSCs. Consistently APA reporter assay confirmed the total 3'UTR shortening in GSCs compared to MEFs. We also analyzed the cis elements around the proximal poly(A) site preferentially used in GSCs and found C-rich elements may contribute to this regulation. Overall, our results identified the expression level and polyadenylation site profiles and

  15. Roles of a novel Crp/Fnr family transcription factor Lmo0753 in soil survival, biofilm production and surface attachment to fresh produce of Listeria monocytogenes.

    Directory of Open Access Journals (Sweden)

    Joelle K Salazar

    Full Text Available Listeria monocytogenes is a foodborne bacterial pathogen and the causative agent of an infectious disease, listeriosis. L. monocytogenes is ubiquitous in nature and has the ability to persist in food processing environments for extended periods of time by forming biofilms and resisting industrial sanitization. Human listeriosis outbreaks are commonly linked to contaminated dairy products, ready-to-eat meats, and in recent years, fresh produce such as lettuce and cantaloupes. We identified a putative Crp/Fnr family transcription factor Lmo0753 that is highly specific to human-associated genetic lineages of L. monocytogenes. Lmo0753 possesses two conserved functional domains similar to the major virulence regulator PrfA in L. monocytogenes. To determine if Lmo0753 is involved in environmental persistence-related mechanisms, we compared lmo0753 deletion mutants with respective wild type and complementation mutants of two fully sequenced L. monocytogenes genetic lineage II strains 10403S and EGDe for the relative ability of growth under different nutrient availability and temperatures, soil survival, biofilm productivity and attachment to select fresh produce surfaces including romaine lettuce leaves and cantaloupe rinds. Our results collectively suggested that Lmo0753 plays an important role in L. monocytogenes biofilm production and attachment to fresh produce, which may contribute to the environmental persistence and recent emergence of this pathogen in human listeriosis outbreaks linked to fresh produce.

  16. Transcriptional profiling reveals gland-specific differential expression in the three major salivary glands of the adult mouse.

    Science.gov (United States)

    Gao, Xin; Oei, Maria S; Ovitt, Catherine E; Sincan, Murat; Melvin, James E

    2018-04-01

    RNA-Seq was used to better understand the molecular nature of the biological differences among the three major exocrine salivary glands in mammals. Transcriptional profiling found that the adult murine parotid, submandibular, and sublingual salivary glands express greater than 14,300 protein-coding genes, and nearly 2,000 of these genes were differentially expressed. Principle component analysis of the differentially expressed genes revealed three distinct clusters according to gland type. The three salivary gland transcriptomes were dominated by a relatively few number of highly expressed genes (6.3%) that accounted for more than 90% of transcriptional output. Of the 912 transcription factors expressed in the major salivary glands, greater than 90% of them were detected in all three glands, while expression for ~2% of them was enriched in an individual gland. Expression of these unique transcription factors correlated with sublingual and parotid specific subsets of both highly expressed and differentially expressed genes. Gene ontology analyses revealed that the highly expressed genes common to all glands were associated with global functions, while many of the genes expressed in a single gland play a major role in the function of that gland. In summary, transcriptional profiling of the three murine major salivary glands identified a limited number of highly expressed genes, differentially expressed genes, and unique transcription factors that represent the transcriptional signatures underlying gland-specific biological properties.

  17. Kinetics and regional specificity of irinotecan-induced gene expression in the gastrointestinal tract

    International Nuclear Information System (INIS)

    Bowen, Joanne M.; Tsykin, Anna; Stringer, Andrea M.; Logan, Richard M.; Gibson, Rachel J.; Keefe, Dorothy M.K.

    2010-01-01

    Gastrointestinal toxicity remains a significant and dose-limiting complication of cancer treatment. While the pathophysiology is becoming clearer, considerable gaps in the knowledge remain surrounding the timing and site-specific gene changes which occur in response to insult. As such, this study aimed to assess gene expression profiles in a number of regions along the gastrointestinal tract following treatment with the chemotherapy agent, irinotecan, and correlate them with markers of cell death and tissue damage. Data analysis of microarray results found that genes involved in apoptosis, mitogen activated kinase (MAPK) signalling and inflammation were upregulated within 6 h, while genes involved in cell proliferation, wound healing and blood vessel formation were upregulated at later time points up to 72 h. Cell death was significantly increased at 6 and 24 h, and the stomach showed the lowest severity of overt tissue damage. Real time PCR of MAPK signalling pathway genes found that the jejunum and colon had significantly increased expression in a number of genes at 72 h, where as the stomach was unchanged. These results indicate that overall severity of tissue damage may be determined by precisely timed target gene responses specific to each region. Therapeutic targeting of key gene responses at the appropriate time point may prove to be effective for prevention of chemotherapy-induced gastrointestinal damage.

  18. Accurate polynomial expressions for the density and specific volume of seawater using the TEOS-10 standard

    Science.gov (United States)

    Roquet, F.; Madec, G.; McDougall, Trevor J.; Barker, Paul M.

    2015-06-01

    A new set of approximations to the standard TEOS-10 equation of state are presented. These follow a polynomial form, making it computationally efficient for use in numerical ocean models. Two versions are provided, the first being a fit of density for Boussinesq ocean models, and the second fitting specific volume which is more suitable for compressible models. Both versions are given as the sum of a vertical reference profile (6th-order polynomial) and an anomaly (52-term polynomial, cubic in pressure), with relative errors of ∼0.1% on the thermal expansion coefficients. A 75-term polynomial expression is also presented for computing specific volume, with a better accuracy than the existing TEOS-10 48-term rational approximation, especially regarding the sound speed, and it is suggested that this expression represents a valuable approximation of the TEOS-10 equation of state for hydrographic data analysis. In the last section, practical aspects about the implementation of TEOS-10 in ocean models are discussed.

  19. Screening of Genes Specifically Expressed in Males of Fenneropenaeus chinensis and Their Potential as Sex Markers

    Directory of Open Access Journals (Sweden)

    Shihao Li

    2013-01-01

    Full Text Available The androgenic gland (AG, playing an important role in sex differentiation of male crustacean, is a target candidate to understand the mechanism of male development and to mine male-specific sex markers. An SSH library (designated as male reproduction-related tissues—SSH library, MRT-SSH library for short was constructed using cDNA from tissues located at the basal part of the 5th pereiopods, including AG and part of spermatophore sac, as tester, and the cDNA from the basal part of the 4th pereiopods of these male shrimp as driver. 402 ESTs from the SSH library were sequenced and assembled into 48 contigs and 104 singlets. Twelve contigs and 14 singlets were identified as known genes. The proteins encoded by the identified genes were categorized, according to their proposed functions, into neuropeptide hormone and hormone transporter, RNA posttranscriptional regulation, translation, cell growth and death, metabolism, genetic information processing, signal transduction/transport, or immunity-related proteins. Eleven highly expressed contigs in the SSH library were selected for validation of the MRT-SSH library and screening sex markers of shrimp. One contig, specifically expressed in male shrimp, had a potential to be developed as a transcriptomic sex marker in shrimp.

  20. Recombinant Listeria monocytogenes as a Live Vaccine Vehicle for the Induction of Protective Anti-Viral Cell-Mediated Immunity

    Science.gov (United States)

    Shen, Hao; Slifka, Mark K.; Matloubian, Mehrdad; Jensen, Eric R.; Ahmed, Rafi; Miller, Jeff F.

    1995-04-01

    Listeria monocytogenes (LM) is a Gram-positive bacterium that is able to enter host cells, escape from the endocytic vesicle, multiply within the cytoplasm, and spread directly from cell to cell without encountering the extracellular milieu. The ability of LM to gain access to the host cell cytosol allows proteins secreted by the bacterium to efficiently enter the pathway for major histocompatibility complex class I antigen processing and presentation. We have established a genetic system for expression and secretion of foreign antigens by recombinant strains, based on stable site-specific integration of expression cassettes into the LM genome. The ability of LM recombinants to induce protective immunity against a heterologous pathogen was demonstrated with lymphocytic choriomeningitis virus (LCMV). LM strains expressing the entire LCMV nucleoprotein or an H-2L^d-restricted nucleoprotein epitope (aa 118-126) were constructed. Immunization of mice with LM vaccine strains conferred protection against challenge with virulent strains of LCMV that otherwise establish chronic infection in naive adult mice. In vivo depletion of CD8^+ T cells from vaccinated mice abrogated their ability to clear viral infection, showing that protective anti-viral immunity was due to CD8^+ T cells.

  1. Survival strategies of Listeria monocytogenes - roles of regulators and transporters

    NARCIS (Netherlands)

    Wemekamp-Kamphuis, H.H.

    2003-01-01

    Outbreaks of the food-borne pathogen Listeria monocytogenes are mainly associated with ready-to-eatfoods. Survival strategies of L. monocytogenes in relation to minimally processed foods were studied.

  2. Incidence and control of Listeria monocytogenes in foods in Denmark

    DEFF Research Database (Denmark)

    Nørrung, Birgit; Andersen, Jens Kirk; Schlundt, Jørgen

    1999-01-01

    The Danish regulatory policy on Listeria monocytogenes in foods is based on the principles of HACCP and was developed using a health risk assessment approach. The Danish policy focuses examinations and criteria for L. monocytogenes in ready-to-eat foods and is based on a combination of inspection...

  3. Listeria monocytogenes internalizes in Romaine Lettuce grown in greenhouse conditions

    Science.gov (United States)

    Listeria monocytogenes has been implicated in a number of outbreaks involving fresh produce, including an outbreak in 2016 resulting from contaminated packaged salads. The persistence and internalization potential of L. monocytogenes in romaine lettuce was evaluated, and the persistence of two L. mo...

  4. Occurrence of Listeria monocytogenes in smoked fish in Sokoto ...

    African Journals Online (AJOL)

    The present study was conducted to determine the prevalence of Listeria monocytogenes in smoked fish in Sokoto, Nigeria. A total of 115 different species of smoked fish from the various retail outlets and market places within the metropolis were analysed for the presence of L. monocytogenes using ISO culture method.

  5. Detection of Listeria Spp. and Listeria monocytogenes in vegetables ...

    African Journals Online (AJOL)

    This paper aimed to study the prevalence and antibiotic resistance pattern among Listeria monocytogenes in raw vegetables sourced from commercial farms and local farms in Terengganu. Thirteen types of vegetables investigated for the presence of L. monocytogenes using multiplex PCR and LAMP methods. Isolation of ...

  6. Genome sequences of Listeria monocytogenes strains with resistance to arsenic

    Science.gov (United States)

    Listeria monocytogenes frequently exhibits resistance to arsenic. We report here the draft genome sequences of eight genetically diverse arsenic-resistant L. monocytogenes strains from human listeriosis and food-associated environments. Availability of these genomes would help to elucidate the role ...

  7. Listeria monocytogenes growth limits and stress resistance mechanisms

    NARCIS (Netherlands)

    Veen, van der S.

    2008-01-01

    The food-borne pathogen Listeria monocytogenes is a Gram-positive facultative anaerobic rod, which is the causative agent of listeriosis. Due to the severity of the disease and the fact that its incidence is increasing in numerous European countries, L. monocytogenes is of great public health

  8. Resistance of Listeria monocytogenes biofilms to sanitizing agents

    Science.gov (United States)

    Listeria monocytogenes is notorious for its capacity to colonize the environment and equipment of food processing facilities and to persist in the processing plant ecosystem, sometimes for decades. Such persistence is mediated by multiple attributes of L. monocytogenes, including the pathogen’s capa...

  9. Effects of prebiotics on the infective potential of Listeria monocytogenes

    DEFF Research Database (Denmark)

    Ebersbach, Tine

    % xylooligosaccharides (XOS), galactooligosaccharides (GOS), inulin, apple pectin or polydextrose for three weeks before oral challenge with L. monocytogenes. XOS and GOS significantly improved resistance of guinea pigs to L. monocytogenes, while inulin and apple pectin decreased the resistance. No significant effect...

  10. Monitoring paneer for Listeria monocytogenes - A high risk food ...

    African Journals Online (AJOL)

    A multiplex polymerase chain reaction (PCR) assay was developed and applied to spiked and natural paneer samples to detect Listeria monocytogenes, a high risk food pathogen. The sensitivity of the assay on L. monocytogenes spiked paneer samples was 104 cells prior to enrichment, was improved to 103 cells after 4 h ...

  11. Osteoblast-specific transcription factor Osterix increases vitamin D receptor gene expression in osteoblasts.

    Directory of Open Access Journals (Sweden)

    Chi Zhang

    Full Text Available Osterix (Osx is an osteoblast-specific transcription factor required for osteoblast differentiation from mesenchymal stem cells. In Osx knock-out mice, no bone formation occurs. The vitamin D receptor (VDR is a member of the nuclear hormone receptor superfamily that regulates target gene transcription to ensure appropriate control of calcium homeostasis and bone development. Here, we provide several lines of evidence that show that the VDR gene is a target for transcriptional regulation by Osx in osteoblasts. For example, calvaria obtained from Osx-null embryos displayed dramatic reductions in VDR expression compared to wild-type calvaria. Stable overexpression of Osx stimulated VDR expression in C2C12 mesenchymal cells. Inhibition of Osx expression by siRNA led to downregulation of VDR. In contrast, Osx levels remained unchanged in osteoblasts in VDR-null mice. Mechanistic approaches using transient transfection assays showed that Osx directly activated a 1 kb fragment of the VDR promoter in a dose-dependent manner. To define the region of the VDR promoter that was responsive to Osx, a series of VDR promoter deletion mutants were examined and the minimal Osx-responsive region was refined to the proximal 120 bp of the VDR promoter. Additional point mutants were used to identify two GC-rich regions that were responsible for VDR promoter activation by Osx. Chromatin immunoprecipitation assays demonstrated that endogenous Osx was associated with the native VDR promoter in primary osteoblasts in vivo. Cumulatively, these data strongly support a direct regulatory role for Osx in VDR gene expression. They further provide new insight into potential mechanisms and pathways that Osx controls in osteoblasts and during the process of osteoblastic cell differentiation.

  12. Direct and specific effect of sevoflurane anesthesia on rat Per2 expression in the suprachiasmatic nucleus.

    Directory of Open Access Journals (Sweden)

    Megumi Anzai

    Full Text Available BACKGROUND: Our previous studies revealed that application of the inhalation anesthetic, sevoflurane, reversibly repressed the expression of Per2 in the mouse suprachiasmatic nucleus (SCN. We aimed to examine whether sevoflurane directly affects the SCN. METHODS: We performed in vivo and in vitro experiments to investigate rat Per2 expression under sevoflurane-treatment. The in vivo effects of sevoflurane on rPer2 expression were examined by quantitative in situ hybridization with a radioactively-labeled cRNA probe. Additionally, we examined the effect of sevoflurane anesthesia on rest/activity rhythms in the rat. In the in vitro experiments, we applied sevoflurane to SCN explant cultures from Per2-dLuc transgenic rats, and monitored luciferase bioluminescence, representing Per2 promoter activity. Bioluminescence from two peripheral organs, the kidney cortex and the anterior pituitary gland, were also analyzed. RESULTS: Application of sevoflurane in rats significantly suppressed Per2 expression in the SCN compared with untreated animals. We observed no sevoflurane-induced phase-shift in the rest/activity rhythms. In the in vitro experiments, the intermittent application of sevoflurane repressed the increase of Per2-dLuc luminescence and led to a phase delay in the Per2-dLuc luminescence rhythm. Sevoflurane treatment did not suppress bioluminescence in the kidney cortex or the anterior pituitary gland. CONCLUSION: The suppression of Per2-dLuc luminescence by sevoflurane in in vitro SCN cultures isolated from peripheral inputs and other nuclei suggest a direct action of sevoflurane on the SCN itself. That sevoflurane has no such effect on peripheral organs suggests that this action might be mediated through a neuron-specific cellular mechanism or a regulation of the signal transduction between neurons.

  13. Novel strong tissue specific promoter for gene expression in human germ cells

    Directory of Open Access Journals (Sweden)

    Kuzmin Denis

    2010-08-01

    Full Text Available Abstract Background Tissue specific promoters may be utilized for a variety of applications, including programmed gene expression in cell types, tissues and organs of interest, for developing different cell culture models or for use in gene therapy. We report a novel, tissue-specific promoter that was identified and engineered from the native upstream regulatory region of the human gene NDUFV1 containing an endogenous retroviral sequence. Results Among seven established human cell lines and five primary cultures, this modified NDUFV1 upstream sequence (mNUS was active only in human undifferentiated germ-derived cells (lines Tera-1 and EP2102, where it demonstrated high promoter activity (~twice greater than that of the SV40 early promoter, and comparable to the routinely used cytomegaloviral promoter. To investigate the potential applicability of the mNUS promoter for biotechnological needs, a construct carrying a recombinant cytosine deaminase (RCD suicide gene under the control of mNUS was tested in cell lines of different tissue origin. High cytotoxic effect of RCD with a cell-death rate ~60% was observed only in germ-derived cells (Tera-1, whereas no effect was seen in a somatic, kidney-derived control cell line (HEK293. In further experiments, we tested mNUS-driven expression of a hyperactive Sleeping Beauty transposase (SB100X. The mNUS-SB100X construct mediated stable transgene insertions exclusively in germ-derived cells, thereby providing further evidence of tissue-specificity of the mNUS promoter. Conclusions We conclude that mNUS may be used as an efficient promoter for tissue-specific gene expression in human germ-derived cells in many applications. Our data also suggest that the 91 bp-long sequence located exactly upstream NDUFV1 transcriptional start site plays a crucial role in the activity of this gene promoter in vitro in the majority of tested cell types (10/12, and an important role - in the rest two cell lines.

  14. Expression

    Directory of Open Access Journals (Sweden)

    Wang-Xia Wang

    2014-02-01

    Full Text Available The miR-15/107 family comprises a group of 10 paralogous microRNAs (miRNAs, sharing a 5′ AGCAGC sequence. These miRNAs have overlapping targets. In order to characterize the expression of miR-15/107 family miRNAs, we employed customized TaqMan Low-Density micro-fluid PCR-array to investigate the expression of miR-15/107 family members, and other selected miRNAs, in 11 human tissues obtained at autopsy including the cerebral cortex, frontal cortex, primary visual cortex, thalamus, heart, lung, liver, kidney, spleen, stomach and skeletal muscle. miR-103, miR-195 and miR-497 were expressed at similar levels across various tissues, whereas miR-107 is enriched in brain samples. We also examined the expression patterns of evolutionarily conserved miR-15/107 miRNAs in three distinct primary rat brain cell preparations (enriched for cortical neurons, astrocytes and microglia, respectively. In primary cultures of rat brain cells, several members of the miR-15/107 family are enriched in neurons compared to other cell types in the central nervous system (CNS. In addition to mature miRNAs, we also examined the expression of precursors (pri-miRNAs. Our data suggested a generally poor correlation between the expression of mature miRNAs and their precursors. In summary, we provide a detailed study of the tissue and cell type-specific expression profile of this highly expressed and phylogenetically conserved family of miRNA genes.

  15. Rapid detection of Listeria monocytogenes in foods, by a combination of PCR and DNA probe.

    Science.gov (United States)

    Ingianni, A; Floris, M; Palomba, P; Madeddu, M A; Quartuccio, M; Pompei, R

    2001-10-01

    Listeria monocytogenes is a frequent contaminant of water and foods. Its rapid detection is needed before some foods can be prepared for marketing. In this work L. monocytogenes has been searched for in foods, by a combination of polymerase chain reaction (PCR) and a DNA probe. Both PCR and the probe were prepared for recognizing a specific region of the internalin gene, which is responsible for the production of one of the most important pathogenic factors of Listeria. The combined use of PCR and the DNA probe was used for the detection of L. monocytogenes in over 180 environmental and food samples. Several detection methods were compared in this study, namely conventional culture methods; direct PCR; PCR after an enrichment step; a DNA probe alone; a DNA probe after enrichment and another commercially available gene-probe. Finally PCR and the DNA probe were used in series on all the samples collected. When the DNA probe was associated with the PCR, specific and accurate detection of listeria in the samples could be obtained in about a working-day. The present molecular method showed some advantages in terms of rapidity and specificity in comparison to the other aforementioned tests. In addition, it resulted as being easy to handle, even for non-specialized personnel in small diagnostic microbiology laboratories. Copyright 2001 Academic Press.

  16. Conjugated action of two species-specific invasion proteins for fetoplacental listeriosis.

    Science.gov (United States)

    Disson, Olivier; Grayo, Solène; Huillet, Eugénie; Nikitas, Georgios; Langa-Vives, Francina; Dussurget, Olivier; Ragon, Marie; Le Monnier, Alban; Babinet, Charles; Cossart, Pascale; Lecuit, Marc

    2008-10-23

    The ability to cross host barriers is an essential virulence determinant of invasive microbial pathogens. Listeria monocytogenes is a model microorganism that crosses human intestinal and placental barriers, and causes severe maternofetal infections by an unknown mechanism. Several studies have helped to characterize the bacterial invasion proteins InlA and InlB. However, their respective species specificity has complicated investigations on their in vivo role. Here we describe two novel and complementary animal models for human listeriosis: the gerbil, a natural host for L. monocytogenes, and a knock-in mouse line ubiquitously expressing humanized E-cadherin. Using these two models, we uncover the essential and interdependent roles of InlA and InlB in fetoplacental listeriosis, and thereby decipher the molecular mechanism underlying the ability of a microbe to target and cross the placental barrier.

  17. Characterization of virulent Listeria monocytogenes isolates recovered from ready-to-eat meat products and consumers in Cairo, Egypt

    Directory of Open Access Journals (Sweden)

    Maysa A. I. Awadallah

    2014-10-01

    Full Text Available Aim: This study aimed to investigate the occurrence of some virulence genes distributed in Listeria monocytogenes isolated from ready-to-eat (RTE meat products and consumers in Cairo province, Egypt. Materials and Methods: A total of 120 beef luncheon, chicken luncheon and frankfurter beef (40 samples, each were collected from 10 different local shops situated in Al-salam city, Cairo province, Egypt. Stool samples were collected from 40 people who had the habit of consuming RTE meat. The suspected L. monocytogenes isolates were subjected to a multiplex polymerase chain reaction (PCR for rapid speciation and virulence determination using primers specific for inIA, inIC, and inIJ genes. Results: Culture examination of all samples on Oxford media revealed presence of colonies characteristic to L. monocytogenes in 6 beef luncheon (15%, 4 chicken luncheon (10%, 1 frankfurter beef (2.5% and 1 human stool (2.5% samples. Species identity of L. monocytogenes was verified through the amplification of a 800 bp fragment with inIA primers in 2 out of 6 culture isolates from beef luncheon (5%, and 1 out 4 culture isolates from chicken luncheon (2.5% samples. Statistical analysis revealed no significant difference between the occurrence of L. monocytogenes in different food samples examined (p>0.05. The virulence of these strains was ascertained by the presence of 517 bp and 238 bp fragments of inIC and inIJ genes, respectively in the isolates that contained the 800 bp fragment. The culture isolates obtained from one frankfurter beef sample, and one human stool sample were found negative by multiplex PCR for the presence of L. monocytogenes and its virulence specific genes. Conclusion: It could be concluded that L. monocytogenes are circulating in beef and chicken luncheon sold in Cairo, Egypt. Multiplex PCR is reliable for confirmation of L. monocytogenes. This study suggests the implementation of hygienic measures at all levels from production to consumption

  18. Genotypes Associated with Listeria monocytogenes Isolates Displaying Impaired or Enhanced Tolerances to Cold, Salt, Acid, or Desiccation Stress

    Science.gov (United States)

    Hingston, Patricia; Chen, Jessica; Dhillon, Bhavjinder K.; Laing, Chad; Bertelli, Claire; Gannon, Victor; Tasara, Taurai; Allen, Kevin; Brinkman, Fiona S. L.; Truelstrup Hansen, Lisbeth; Wang, Siyun

    2017-01-01

    The human pathogen Listeria monocytogenes is a large concern in the food industry where its continuous detection in food products has caused a string of recalls in North America and Europe. Most recognized for its ability to grow in foods during refrigerated storage, L. monocytogenes can also tolerate several other food-related stresses with some strains possessing higher levels of tolerances than others. The objective of this study was to use a combination of phenotypic analyses and whole genome sequencing to elucidate potential relationships between L. monocytogenes genotypes and food-related stress tolerance phenotypes. To accomplish this, 166 L. monocytogenes isolates were sequenced and evaluated for their ability to grow in cold (4°C), salt (6% NaCl, 25°C), and acid (pH 5, 25°C) stress conditions as well as survive desiccation (33% RH, 20°C). The results revealed that the stress tolerance of L. monocytogenes is associated with serotype, clonal complex (CC), full length inlA profiles, and the presence of a plasmid which was identified in 55% of isolates. Isolates with full length inlA exhibited significantly (p monocytogenes sequence types, a new inlA PMSC, and several connections between CCs and the presence/absence or variations of specific genetic elements. A whole genome single-nucleotide-variants phylogeny revealed sporadic distribution of tolerant isolates and closely related sensitive and tolerant isolates, highlighting that minor genetic differences can influence the stress tolerance of L. monocytogenes. Specifically, a number of cold and desiccation sensitive isolates contained PMSCs in σB regulator genes (rsbS, rsbU, rsbV). Collectively, the results suggest that knowing the sequence type of an isolate in addition to screening for the presence of full-length inlA and a plasmid, could help food processors and food agency investigators determine why certain isolates might be persisting in a food processing environment. Additionally, increased

  19. The Small Colony Variant of Listeria monocytogenes Is More Tolerant to Antibiotics and Has Altered Survival in RAW 264.7 Murine Macrophages

    DEFF Research Database (Denmark)

    Curtis, Thomas; Gram, Lone; Knudsen, Gitte Maegaard

    2016-01-01

    Small Colony Variant (SCV) cells of bacteria are a slow-growing phenotype that result from specific defects in the electron transport chain. They form pinpoint colonies on agar plates and have a variety of phenotypic characteristics, such as altered carbon metabolism, decreased toxin and lytic...... monocytogenes (strain SCV E18), similar to the high persister mutant phenotype, survived significantly better than the wild type when exposed over a 48-h period to concentrations above Minimal Inhibitory Concentration for most tested antibiotics. SCV E18 survived more poorly than the wildtype in unactivated RAW......264.7 macrophage cells, presumably because of its reduced listeriolysin O expression, however, it survived better in reactive oxygen species producing, phorbol 12-myristate 13-acetate-activated macrophages. Although SCV E18 was sensitive to oxygen as it entered the stationary phase...

  20. Analysis of multilocus sequence typing and virulence characterization of Listeria monocytogenes isolates from Chinese retail ready-to-eat food

    Directory of Open Access Journals (Sweden)

    Shi eWu

    2016-02-01

    Full Text Available Eighty Listeria monocytogenes isolates were obtained from Chinese retail ready-to-eat (RTE food and were previously characterized with serotyping and antibiotic susceptibility tests. The aim of this study was to characterize the subtype and virulence potential of these L. monocytogenes isolates by multilocus sequence typing (MLST, virulence-associate genes, epidemic clones (ECs and sequence analysis of the important virulence factor: internalin A (inlA. The result of MLST revealed that these L. monocytogenes isolates belonged to 14 different sequence types (STs. With the exception of four new STs (ST804, ST805, ST806 and ST807, all other STs observed in this study have been associated with human listeriosis and outbreaks to varying extents. Six virulence-associate genes (inlA, inlB, inlC, inlJ, hly and llsX were selected and their presence was investigated using PCR. All strains carried inlA, inlB, inlC, inlJ, and hly, whereas 38.8% (31/80 of strains harbored the listeriolysin S genes (llsX. A multiplex PCR assay was used to evaluate the presence of markers specific to epidemic clones of L. monocytogenes and identified 26.3% (21/80 of ECI in the 4b-4d-4e strains. Further study of inlA sequencing revealed that most strains contained the full-length InlA required for host cell invasion, whereas three mutations lead to premature stop codons (PMSC within a novel PMSCs at position 326 (GAA→TAA. MLST and inlA sequence analysis results were concordant, and different virulence potentials within isolates were observed. These findings suggest that L. monocytogenes isolates from RTE food in China could be virulent and be capable of causing human illness. Furthermore, the STs and virulence profiles of L. monocytogenes isolates have significant implications for epidemiological and public health studies of this pathogen.

  1. Analysis of Multilocus Sequence Typing and Virulence Characterization of Listeria monocytogenes Isolates from Chinese Retail Ready-to-Eat Food.

    Science.gov (United States)

    Wu, Shi; Wu, Qingping; Zhang, Jumei; Chen, Moutong; Guo, Weipeng

    2016-01-01

    Eighty Listeria monocytogenes isolates were obtained from Chinese retail ready-to-eat (RTE) food and were previously characterized with serotyping and antibiotic susceptibility tests. The aim of this study was to characterize the subtype and virulence potential of these L. monocytogenes isolates by multilocus sequence typing (MLST), virulence-associate genes, epidemic clones (ECs), and sequence analysis of the important virulence factor: internalin A (inlA). The result of MLST revealed that these L. monocytogenes isolates belonged to 14 different sequence types (STs). With the exception of four new STs (ST804, ST805, ST806, and ST807), all other STs observed in this study have been associated with human listeriosis and outbreaks to varying extents. Six virulence-associate genes (inlA, inlB, inlC, inlJ, hly, and llsX) were selected and their presence was investigated using PCR. All strains carried inlA, inlB, inlC, inlJ, and hly, whereas 38.8% (31/80) of strains harbored the listeriolysin S genes (llsX). A multiplex PCR assay was used to evaluate the presence of markers specific to epidemic clones of L. monocytogenes and identified 26.3% (21/80) of ECI in the 4b-4d-4e strains. Further study of inlA sequencing revealed that most strains contained the full-length InlA required for host cell invasion, whereas three mutations lead to premature stop codons (PMSC) within a novel PMSCs at position 326 (GAA → TAA). MLST and inlA sequence analysis results were concordant, and different virulence potentials within isolates were observed. These findings suggest that L. monocytogenes isolates from RTE food in China could be virulent and be capable of causing human illness. Furthermore, the STs and virulence profiles of L. monocytogenes isolates have significant implications for epidemiological and public health studies of this pathogen.

  2. Highly dynamic and sex-specific expression of microRNAs during early ES cell differentiation.

    Directory of Open Access Journals (Sweden)

    Constance Ciaudo

    2009-08-01

    Full Text Available Embryonic stem (ES cells are pluripotent cells derived from the inner cell mass of the mammalian blastocyst. Cellular differentiation entails loss of pluripotency and gain of lineage-specific characteristics. However, the molecular controls that govern the differentiation process remain poorly understood. We have characterized small RNA expression profiles in differentiating ES cells as a model for early mammalian development. High-throughput 454 pyro-sequencing was performed on 19-30 nt RNAs isolated from undifferentiated male and female ES cells, as well as day 2 and 5 differentiating derivatives. A discrete subset of microRNAs (miRNAs largely dominated the small RNA repertoire, and the dynamics of their accumulation could be readily used to discriminate pluripotency from early differentiation events. Unsupervised partitioning around meloids (PAM analysis revealed that differentiating ES cell miRNAs can be divided into three expression clusters with highly contrasted accumulation patterns. PAM analysis afforded an unprecedented level of definition in the temporal fluctuations of individual members of several miRNA genomic clusters. Notably, this unravelled highly complex post-transcriptional regulations of the key pluripotency miR-290 locus, and helped identify miR-293 as a clear outlier within this cluster. Accordingly, the miR-293 seed sequence and its predicted cellular targets differed drastically from those of the other abundant cluster members, suggesting that previous conclusions drawn from whole miR-290 over-expression need to be reconsidered. Our analysis in ES cells also uncovered a striking male-specific enrichment of the miR-302 family, which share the same seed sequence with most miR-290 family members. Accordingly, a miR-302 representative was strongly enriched in embryonic germ cells derived from primordial germ cells of male but not female mouse embryos. Identifying the chromatin remodelling and E2F-dependent transcription

  3. vasa is expressed in somatic cells of the embryonic gonad in a sex-specific manner in Drosophila melanogaster

    Directory of Open Access Journals (Sweden)

    Andrew D. Renault

    2012-08-01

    Vasa is a DEAD box helicase expressed in the Drosophila germline at all stages of development. vasa homologs are found widely in animals and vasa has become the gene of choice in identifying germ cells. I now show that Drosophila vasa expression is not restricted to the germline but is also expressed in a somatic lineage, the embryonic somatic gonadal precursor cells. This expression is sexually dimorphic, being maintained specifically in males, and is regulated post-transcriptionally. Although somatic Vasa expression is not required for gonad coalescence, these data support the notion that Vasa is not solely a germline factor.

  4. vasa is expressed in somatic cells of the embryonic gonad in a sex-specific manner in Drosophila melanogaster.

    Science.gov (United States)

    Renault, Andrew D

    2012-10-15

    Vasa is a DEAD box helicase expressed in the Drosophila germline at all stages of development. vasa homologs are found widely in animals and vasa has become the gene of choice in identifying germ cells. I now show that Drosophila vasa expression is not restricted to the germline but is also expressed in a somatic lineage, the embryonic somatic gonadal precursor cells. This expression is sexually dimorphic, being maintained specifically in males, and is regulated post-transcriptionally. Although somatic Vasa expression is not required for gonad coalescence, these data support the notion that Vasa is not solely a germline factor.

  5. Surface engineered magnetic nanoparticles for specific immunotargeting of cadherin expressing cells

    International Nuclear Information System (INIS)

    Moros, Maria; Puertas, Sara; Saez, Berta; Grazú, Valeria; Delhaes, Flavien; Feracci, Helene; De la Fuente, Jesús M

    2016-01-01

    In spite of historic advances in cancer biology and recent development of sophisticated chemotherapeutics, the outlook for patients with advanced cancer is still grim. In this sense nanoparticles (NPs), through their unique physical properties, enable the development of new approaches for cancer diagnosis and treatment. Thus far the most used active targeting scheme involves NPs functionalization with antibodies specific to molecules overexpressed on cancer cell’s surface. Therefore, such active targeting relies on differences in NPs uptake kinetics rates between tumor and healthy cells. Many cancers of epithelial origin are associated with the inappropriate expression of non-epithelial cadherins (e.g. N-, P-, -11) with concomitant loss of E-cadherin. Such phenomenon named cadherin switching favors tumor development and metastasis via interactions of tumor cells with stromal components. That is why we optimized the oriented functionalization of fluorescently labelled magnetic NPs with a novel antibody specific for the extracellular domain of cadherin-11. The obtained Ab-NPs exhibited high specificity when incubated with two cell lines used as models of tumor and healthy cells. Thus, cadherin switching offers a great opportunity for the development of active targeting strategies aimed to improve the early detection and treatment of cancer. (paper)

  6. Several synthetic progestins disrupt the glial cell specific-brain aromatase expression in developing zebra fish

    International Nuclear Information System (INIS)

    Cano-Nicolau, Joel; Garoche, Clémentine; Hinfray, Nathalie; Pellegrini, Elisabeth; Boujrad, Noureddine; Pakdel, Farzad; Kah, Olivier; Brion, François

    2016-01-01

    The effects of some progestins on fish reproduction have been recently reported revealing the hazard of this class of steroidal pharmaceuticals. However, their effects at the central nervous system level have been poorly studied until now. Notwithstanding, progesterone, although still widely considered primarily a sex hormone, is an important agent affecting many central nervous system functions. Herein, we investigated the effects of a large set of synthetic ligands of the nuclear progesterone receptor on the glial-specific expression of the zebrafish brain aromatase (cyp19a1b) using zebrafish mechanism-based assays. Progesterone and 24 progestins were first screened on transgenic cyp19a1b-GFP zebrafish embryos. We showed that progesterone, dydrogesterone, drospirenone and all the progesterone-derived progestins had no effect on GFP expression. Conversely, all progestins derived from 19-nortesterone induced GFP in a concentration-dependent manner with EC 50 ranging from the low nM range to hundreds nM. The 19-nortestosterone derived progestins levonorgestrel (LNG) and norethindrone (NET) were further tested in a radial glial cell context using U251-MG cells co-transfected with zebrafish ER subtypes (zfERα, zfERβ1 or zfERβ2) and cyp19a1b promoter linked to luciferase. Progesterone had no effect on luciferase activity while NET and LNG induced luciferase activity that was blocked by ICI 182,780. Zebrafish-ERs competition assays showed that NET and LNG were unable to bind to ERs, suggesting that the effects of these compounds on cyp19a1b require metabolic activation prior to elicit estrogenic activity. Overall, we demonstrate that 19-nortestosterone derived progestins elicit estrogenic activity by inducing cyp19a1b expression in radial glial cells. Given the crucial role of radial glial cells and neuro-estrogens in early development of brain, the consequences of exposure of fish to these compounds require further investigation. - Highlights: • P4 + 24 progestins

  7. Several synthetic progestins disrupt the glial cell specific-brain aromatase expression in developing zebra fish

    Energy Technology Data Exchange (ETDEWEB)

    Cano-Nicolau, Joel [Team NEED, Institut de recherche en Santé Environnement et Travail (Irset), INSERM U1085, Université de Rennes 1, Campus de Beaulieu, SFR Biosit, 35042 Rennes cedex (France); Garoche, Clémentine; Hinfray, Nathalie [Unité d' Ecotoxicologie in vitro et in vivo , Institut National de l' Environnement Industriel et des Risques (INERIS), BP 2, 60550 Verneuil-en-Halatte (France); Pellegrini, Elisabeth [Team NEED, Institut de recherche en Santé Environnement et Travail (Irset), INSERM U1085, Université de Rennes 1, Campus de Beaulieu, SFR Biosit, 35042 Rennes cedex (France); Boujrad, Noureddine; Pakdel, Farzad [TREK, Institut de recherche en Santé Environnement et Travail (Irset), INSERM U1085, Université de Rennes 1, Campus de Beaulieu, SFR Biosit, 35042 Rennes cedex (France); Kah, Olivier, E-mail: oliver.kah@univ-rennes1.fr [Team NEED, Institut de recherche en Santé Environnement et Travail (Irset), INSERM U1085, Université de Rennes 1, Campus de Beaulieu, SFR Biosit, 35042 Rennes cedex (France); Brion, François, E-mail: francois.brion@ineris.fr [Unité d' Ecotoxicologie in vitro et in vivo , Institut National de l' Environnement Industriel et des Risques (INERIS), BP 2, 60550 Verneuil-en-Halatte (France)

    2016-08-15

    The effects of some progestins on fish reproduction have been recently reported revealing the hazard of this class of steroidal pharmaceuticals. However, their effects at the central nervous system level have been poorly studied until now. Notwithstanding, progesterone, although still widely considered primarily a sex hormone, is an important agent affecting many central nervous system functions. Herein, we investigated the effects of a large set of synthetic ligands of the nuclear progesterone receptor on the glial-specific expression of the zebrafish brain aromatase (cyp19a1b) using zebrafish mechanism-based assays. Progesterone and 24 progestins were first screened on transgenic cyp19a1b-GFP zebrafish embryos. We showed that progesterone, dydrogesterone, drospirenone and all the progesterone-derived progestins had no effect on GFP expression. Conversely, all progestins derived from 19-nortesterone induced GFP in a concentration-dependent manner with EC{sub 50} ranging from the low nM range to hundreds nM. The 19-nortestosterone derived progestins levonorgestrel (LNG) and norethindrone (NET) were further tested in a radial glial cell context using U251-MG cells co-transfected with zebrafish ER subtypes (zfERα, zfERβ1 or zfERβ2) and cyp19a1b promoter linked to luciferase. Progesterone had no effect on luciferase activity while NET and LNG induced luciferase activity that was blocked by ICI 182,780. Zebrafish-ERs competition assays showed that NET and LNG were unable to bind to ERs, suggesting that the effects of these compounds on cyp19a1b require metabolic activation prior to elicit estrogenic activity. Overall, we demonstrate that 19-nortestosterone derived progestins elicit estrogenic activity by inducing cyp19a1b expression in radial glial cells. Given the crucial role of radial glial cells and neuro-estrogens in early development of brain, the consequences of exposure of fish to these compounds require further investigation. - Highlights: • P4 + 24

  8. Analysis of adenovirus-induced immunity to infection with Listeria monocytogenes: Fading protection coincides with declining CD8 T cell numbers and phenotypic changes.

    Science.gov (United States)

    Jahn, Marie Louise; Steffensen, Maria Abildgaard; Christensen, Jan Pravsgaard; Thomsen, Allan Randrup

    2018-05-11

    Defining correlates of T cell mediated protection is important in order to accelerate the development of efficient T cell based vaccines conferring long-term immunity. Extensive studies have provided important insight regarding the characteristics and functional properties of the effector and memory CD8 T cells induced by viral vector based vaccines. However, long-term protection has been difficult to achieve with T cell inducing vaccines, and the determinants underlying this loss in protection over time are still not fully defined. In this study we analyzed different parameters of the CD8 T cell response as a function of time after vaccination with a human serotype 5 adenovector expressing the glycoprotein (GP) of LCMV tethered to the MHC class II-associated invariant chain. Using this vector we have previously found that CD8 T cells mediate protection from challenge with GP-expressing Listeria monocytogenes at 60 days post vaccination, but only little protection after further 60 days, and we now confirm this observation. A comparison of vaccine-primed CD8 T cells early and late after vaccination revealed a minor decline in the overall numbers of antigen specific memory CD8 T cells during this interval. More importantly, we also observed phenotypic changes over time with a distinct decline in the frequency and number of KLRG1 + CD8 T cells, and, notably, adoptive transfer studies confirmed that memory CD8 T cells expressing KLRG1 are central to protection from systemic L. monocytogenes infection. Together these findings imply that multiple factors including changes in memory T cell numbers and phenotypic composition over time influence the longevity of CD8 T-cell mediated protection. Copyright © 2018 Elsevier Ltd. All rights reserved.

  9. Exoproteome analysis reveals higher abundance of proteins linked to alkaline stress in persistent Listeria monocytogenes strains.

    Science.gov (United States)

    Rychli, Kathrin; Grunert, Tom; Ciolacu, Luminita; Zaiser, Andreas; Razzazi-Fazeli, Ebrahim; Schmitz-Esser, Stephan; Ehling-Schulz, Monika; Wagner, Martin

    2016-02-02

    The foodborne pathogen Listeria monocytogenes, responsible for listeriosis a rare but severe infection disease, can survive in the food processing environment for month or even years. So-called persistent L. monocytogenes strains greatly increase the risk of (re)contamination of food products, and are therefore a great challenge for food safety. However, our understanding of the mechanism underlying persistence is still fragmented. In this study we compared the exoproteome of three persistent strains with the reference strain EGDe under mild stress conditions using 2D differential gel electrophoresis. Principal component analysis including all differentially abundant protein spots showed that the exoproteome of strain EGDe (sequence type (ST) 35) is distinct from that of the persistent strain R479a (ST8) and the two closely related ST121 strains 4423 and 6179. Phylogenetic analyses based on multilocus ST genes showed similar grouping of the strains. Comparing the exoproteome of strain EGDe and the three persistent strains resulted in identification of 22 differentially expressed protein spots corresponding to 16 proteins. Six proteins were significantly increased in the persistent L. monocytogenes exoproteomes, among them proteins involved in alkaline stress response (e.g. the membrane anchored lipoprotein Lmo2637 and the NADPH dehydrogenase NamA). In parallel the persistent strains showed increased survival under alkaline stress, which is often provided during cleaning and disinfection in the food processing environments. In addition, gene expression of the proteins linked to stress response (Lmo2637, NamA, Fhs and QoxA) was higher in the persistent strain not only at 37 °C but also at 10 °C. Invasion efficiency of EGDe was higher in intestinal epithelial Caco2 and macrophage-like THP1 cells compared to the persistent strains. Concurrently we found higher expression of proteins involved in virulence in EGDe e.g. the actin-assembly-inducing protein ActA and the

  10. Listeriolysin S, a novel peptide haemolysin associated with a subset of lineage I Listeria monocytogenes.

    Directory of Open Access Journals (Sweden)

    Paul D Cotter

    Full Text Available Streptolysin S (SLS is a bacteriocin-like haemolytic and cytotoxic virulence factor that plays a key role in the virulence of Group A Streptococcus (GAS, the causative agent of pharyngitis, impetigo, necrotizing fasciitis and streptococcal toxic shock syndrome. Although it has long been thought that SLS and related peptides are produced by GAS and related streptococci only, there is evidence to suggest that a number of the most notorious Gram-positive pathogenic bacteria, including Listeria monocytogenes, Clostridium botulinum and Staphylococcus aureus, produce related peptides. The distribution of the L. monocytogenes cluster is particularly noteworthy in that it is found exclusively among a subset of lineage I strains; i.e., those responsible for the majority of outbreaks of listeriosis. Expression of these genes results in the production of a haemolytic and cytotoxic factor, designated Listeriolysin S, which contributes to virulence of the pathogen as assessed by murine- and human polymorphonuclear neutrophil-based studies. Thus, in the process of establishing the existence of an extended family of SLS-like modified virulence peptides (MVPs, the genetic basis for the enhanced virulence of a proportion of lineage I L. monocytogenes may have been revealed.

  11. A novel Listeria monocytogenes-based DNA delivery system for cancer gene therapy.

    LENUS (Irish Health Repository)

    van Pijkeren, Jan Peter

    2012-01-31

    Bacteria-mediated transfer of plasmid DNA to mammalian cells (bactofection) has been shown to have significant potential as an approach to express heterologous proteins in various cell types. This is achieved through entry of the entire bacterium into cells, followed by release of plasmid DNA. In a murine model, we show that Listeria monocytogenes can invade and spread in tumors, and establish the use of Listeria to deliver genes to tumors in vivo. A novel approach to vector lysis and release of plasmid DNA through antibiotic administration was developed. Ampicillin administration facilitated both plasmid transfer and safety control of vector. To further improve on the gene delivery system, we selected a Listeria monocytogenes derivative that is more sensitive to ampicillin, and less pathogenic than the wild-type strain. Incorporation of a eukaryotic-transcribed lysin cassette in the plasmid further increased bacterial lysis. Successful gene delivery of firefly luciferase to growing tumors in murine models and to patient breast tumor samples ex vivo was achieved. The model described encompasses a three-phase treatment regimen, involving (1) intratumoral administration of vector followed by a period of vector spread, (2) systemic ampicillin administration to induce vector lysis and plasmid transfer, and (3) systemic administration of combined moxifloxacin and ampicillin to eliminate systemic vector. For the first time, our results reveal the potential of Listeria monocytogenes for in vivo gene delivery.

  12. Expression of liver-specific functions in rat hepatocytes following sublethal and lethal acetaminophen poisoning

    DEFF Research Database (Denmark)

    Tygstrup, N; Jensen, S A; Krog, B

    1996-01-01

    AIM: In order to study the short-term effect of moderate and severe reduction of liver function by acetaminophen poisoning of different severity on gene expression for liver-specific functions, rats were given 3.75 and 7.5 g per kg body weight acetaminophen intragastrically. The lower dose...... is associated with low mortality; after the higher dose, most rats die at between 12 and 24 h. METHODS: In the morning, 1 1/2, 3, 6, 9, and 12 h after the injection, the rats were killed and RNA was extracted from liver tissue. By slot-blot hybridization mRNA steady-state levels were determined for enzymes...

  13. Regulated expression of the neural cell adhesion molecule L1 by specific patterns of neural impulses.

    Science.gov (United States)

    Itoh, K; Stevens, B; Schachner, M; Fields, R D

    1995-11-24

    Development of the mammalian nervous system is regulated by neural impulse activity, but the molecular mechanisms are not well understood. If cell recognition molecules [for example, L1 and the neural cell adhesion molecule (NCAM)] were influenced by specific patterns of impulse activity, cell-cell interactions controlling nervous system structure could be regulated by nervous system function at critical stages of development. Low-frequency electrical pulses delivered to mouse sensory neurons in culture (0.1 hertz for 5 days) down-regulated expression of L1 messenger RNA and protein (but not NCAM). Fasciculation of neurites, adhesion of neuroblastoma cells, and the number of Schwann cells on neurites was reduced after 0.1-hertz stimulation, but higher frequencies or stimulation after synaptogenesis were without effect.

  14. Genetic Approaches to Study Meiosis and Meiosis-Specific Gene Expression in Saccharomyces cerevisiae.

    Science.gov (United States)

    Kassir, Yona; Stuart, David T

    2017-01-01

    The budding yeast Saccharomyces cerevisiae has a long history as a model organism for studies of meiosis and the cell cycle. The popularity of this yeast as a model is in large part due to the variety of genetic and cytological approaches that can be effectively performed with the cells. Cultures of the cells can be induced to synchronously progress through meiosis and sporulation allowing large-scale gene expression and biochemical studies to be performed. Additionally, the spore tetrads resulting from meiosis make it possible to characterize the haploid products of meiosis allowing investigation of meiotic recombination and chromosome segregation. Here we describe genetic methods for analysis progression of S. cerevisiae through meiosis and sporulation with an emphasis on strategies for the genetic analysis of regulators of meiosis-specific genes.

  15. Neuronal type-specific gene expression profiling and laser-capture microdissection.

    Science.gov (United States)

    Pietersen, Charmaine Y; Lim, Maribel P; Macey, Laurel; Woo, Tsung-Ung W; Sonntag, Kai C

    2011-01-01

    The human brain is an exceptionally heterogeneous structure. In order to gain insight into the neurobiological basis of neural circuit disturbances in various neurologic or psychiatric diseases, it is often important to define the molecular cascades that are associated with these disturbances in a neuronal type-specific manner. This can be achieved by the use of laser microdissection, in combination with molecular techniques such as gene expression profiling. To identify neurons in human postmortem brain tissue, one can use the inherent properties of the neuron, such as pigmentation and morphology or its structural composition through immunohistochemistry (IHC). Here, we describe the isolation of homogeneous neuronal cells and high-quality RNA from human postmortem brain material using a combination of rapid IHC, Nissl staining, or simple morphology with Laser-Capture Microdissection (LCM) or Laser Microdissection (LMD).

  16. Cell-specific expression of plant nutrient transporter genes in orchid mycorrhizae.

    Science.gov (United States)

    Fochi, Valeria; Falla, Nicole; Girlanda, Mariangela; Perotto, Silvia; Balestrini, Raffaella

    2017-10-01

    Orchid mycorrhizal protocorms and roots are heterogeneous structures composed of different plant cell-types, where cells colonized by intracellular fungal coils (the pelotons) are close to non-colonized plant cells. Moreover, the fungal coils undergo rapid turnover inside the colonized cells, so that plant cells containing coils at different developmental stages can be observed in the same tissue section. Here, we have investigated by laser microdissection (LMD) the localization of specific plant gene transcripts in different cell-type populations collected from mycorrhizal protocorms and roots of the Mediterranean orchid Serapias vomeracea colonized by Tulasnella calospora. RNAs extracted from the different cell-type populations have been used to study plant gene expression, focusing on genes potentially involved in N uptake and transport and previously identified as up-regulated in symbiotic protocorms. Results clearly showed that some plant N transporters are differentially expressed in cells containing fungal coils at different developmental stages, as well as in non-colonized cells, and allowed the identification of new functional markers associated to coil-containing cells. Copyright © 2017 Elsevier B.V. All rights reserved.

  17. Allele-specific gene expression in a wild nonhuman primate population

    Science.gov (United States)

    Tung, J.; Akinyi, M. Y.; Mutura, S.; Altmann, J.; Wray, G. A.; Alberts, S. C.

    2015-01-01

    Natural populations hold enormous potential for evolutionary genetic studies, especially when phenotypic, genetic and environmental data are all available on the same individuals. However, untangling the genotype-phenotype relationship in natural populations remains a major challenge. Here, we describe results of an investigation of one class of phenotype, allele-specific gene expression (ASGE), in the well-studied natural population of baboons of the Amboseli basin, Kenya. ASGE measurements identify cases in which one allele of a gene is overexpressed relative to the alternative allele of the same gene, within individuals, thus providing a control for background genetic and environmental effects. Here, we characterize the incidence of ASGE in the Amboseli baboon population, focusing on the genetic and environmental contributions to ASGE in a set of eleven genes involved in immunity and defence. Within this set, we identify evidence for common ASGE in four genes. We also present examples of two relationships between cis-regulatory genetic variants and the ASGE phenotype. Finally, we identify one case in which this relationship is influenced by a novel gene-environment interaction. Specifically, the dominance rank of an individual’s mother during its early life (an aspect of that individual’s social environment) influences the expression of the gene CCL5 via an interaction with cis-regulatory genetic variation. These results illustrate how environmental and ecological data can be integrated into evolutionary genetic studies of functional variation in natural populations. They also highlight the potential importance of early life environmental variation in shaping the genetic architecture of complex traits in wild mammals. PMID:21226779

  18. Gene expression patterns specific to the regenerating limb of the Mexican axolotl

    Directory of Open Access Journals (Sweden)

    James R. Monaghan

    2012-07-01

    Salamander limb regeneration is dependent upon tissue interactions that are local to the amputation site. Communication among limb epidermis, peripheral nerves, and mesenchyme coordinate cell migration, cell proliferation, and tissue patterning to generate a blastema, which will form missing limb structures. An outstanding question is how cross-talk between these tissues gives rise to the regeneration blastema. To identify genes associated with epidermis-nerve-mesenchymal interactions during limb regeneration, we examined histological and transcriptional changes during the first week following injury in the wound epidermis and subjacent cells between three injury types; 1 a flank wound on the side of the animal that will not regenerate a limb, 2 a denervated limb that will not regenerate a limb, and 3 an innervated limb that will regenerate a limb. Early, histological and transcriptional changes were similar between the injury types, presumably because a common wound-healing program is employed across anatomical locations. However, some transcripts were enriched in limbs compared to the flank and are associated with vertebrate limb development. Many of these genes were activated before blastema outgrowth and expressed in specific tissue types including the epidermis, peripheral nerve, and mesenchyme. We also identified a relatively small group of transcripts that were more highly expressed in innervated limbs versus denervated limbs. These transcripts encode for proteins involved in myelination of peripheral nerves, epidermal cell function, and proliferation of mesenchymal cells. Overall, our study identifies limb-specific and nerve-dependent genes that are upstream of regenerative growth, and thus promising candidates for the regulation of blastema formation.

  19. Recombinant human parvovirus B19 vectors: erythroid cell-specific delivery and expression of transduced genes.

    Science.gov (United States)

    Ponnazhagan, S; Weigel, K A; Raikwar, S P; Mukherjee, P; Yoder, M C; Srivastava, A

    1998-06-01

    A novel packaging strategy combining the salient features of two human parvoviruses, namely the pathogenic parvovirus B19 and the nonpathogenic adeno-associated virus type 2 (AAV), was developed to achieve erythroid cell-specific delivery as well as expression of the transduced gene. The development of such a chimeric vector system was accomplished by packaging heterologous DNA sequences cloned within the inverted terminal repeats of AAV and subsequently packaging the DNA inside the capsid structure of B19 virus. Recombinant B19 virus particles were assembled, as evidenced by electron microscopy as well as DNA slot blot analyses. The hybrid vector failed to transduce nonerythroid human cells, such as 293 cells, as expected. However, MB-02 cells, a human megakaryocytic leukemia cell line which can be infected by B19 virus following erythroid differentiation with erythropoietin (N. C. Munshi, S. Z. Zhou, M. J. Woody, D. A. Morgan, and A. Srivastava, J. Virol. 67:562-566, 1993) but lacks the putative receptor for AAV (S. Ponnazhagan, X.-S. Wang, M. J. Woody, F. Luo, L. Y. Kang, M. L. Nallari, N. C. Munshi, S. Z. Zhou, and A. Srivastava, J. Gen. Virol. 77:1111-1122, 1996), were readily transduced by this vector. The hybrid vector was also found to specifically target the erythroid population in primary human bone marrow cells as well as more immature hematopoietic progenitor cells following erythroid differentiation, as evidenced by selective expression of the transduced gene in these target cells. Preincubation with anticapsid antibodies against B19 virus, but not anticapsid antibodies against AAV, inhibited transduction of primary human erythroid cells. The efficiency of transduction of primary human erythroid cells by the recombinant B19 virus vector was significantly higher than that by the recombinant AAV vector. Further development of the AAV-B19 virus hybrid vector system should prove beneficial in gene therapy protocols aimed at the correction of inherited and

  20. Recombinant Human Parvovirus B19 Vectors: Erythroid Cell-Specific Delivery and Expression of Transduced Genes

    Science.gov (United States)

    Ponnazhagan, Selvarangan; Weigel, Kirsten A.; Raikwar, Sudhanshu P.; Mukherjee, Pinku; Yoder, Mervin C.; Srivastava, Arun

    1998-01-01

    A novel packaging strategy combining the salient features of two human parvoviruses, namely the pathogenic parvovirus B19 and the nonpathogenic adeno-associated virus type 2 (AAV), was developed to achieve erythroid cell-specific delivery as well as expression of the transduced gene. The development of such a chimeric vector system was accomplished by packaging heterologous DNA sequences cloned within the inverted terminal repeats of AAV and subsequently packaging the DNA inside the capsid structure of B19 virus. Recombinant B19 virus particles were assembled, as evidenced by electron microscopy as well as DNA slot blot analyses. The hybrid vector failed to transduce nonerythroid human cells, such as 293 cells, as expected. However, MB-02 cells, a human megakaryocytic leukemia cell line which can be infected by B19 virus following erythroid differentiation with erythropoietin (N. C. Munshi, S. Z. Zhou, M. J. Woody, D. A. Morgan, and A. Srivastava, J. Virol. 67:562–566, 1993) but lacks the putative receptor for AAV (S. Ponnazhagan, X.-S. Wang, M. J. Woody, F. Luo, L. Y. Kang, M. L. Nallari, N. C. Munshi, S. Z. Zhou, and A. Srivastava, J. Gen. Virol. 77:1111–1122, 1996), were readily transduced by this vector. The hybrid vector was also found to specifically target the erythroid population in primary human bone marrow cells as well as more immature hematopoietic progenitor cells following erythroid differentiation, as evidenced by selective expression of the transduced gene in these target cells. Preincubation with anticapsid antibodies against B19 virus, but not anticapsid antibodies against AAV, inhibited transduction of primary human erythroid cells. The efficiency of transduction of primary human erythroid cells by the recombinant B19 virus vector was significantly higher than that by the recombinant AAV vector. Further development of the AAV-B19 virus hybrid vector system should prove beneficial in gene therapy protocols aimed at the correction of inherited

  1. Adaptations to endosymbiosis in a cnidarian-dinoflagellate association: differential gene expression and specific gene duplications.

    Science.gov (United States)

    Ganot, Philippe; Moya, Aurélie; Magnone, Virginie; Allemand, Denis; Furla, Paola; Sabourault, Cécile

    2011-07-01

    Trophic endosymbiosis between anthozoans and photosynthetic dinoflagellates forms the key foundation of reef ecosystems. Dysfunction and collapse of symbiosis lead to bleaching (symbiont expulsion), which is responsible for the severe worldwide decline of coral reefs. Molecular signals are central to the stability of this partnership and are therefore closely related to coral health. To decipher inter-partner signaling, we developed genomic resources (cDNA library and microarrays) from the symbiotic sea anemone Anemonia viridis. Here we describe differential expression between symbiotic (also called zooxanthellate anemones) or aposymbiotic (also called bleached) A. viridis specimens, using microarray hybridizations and qPCR experiments. We mapped, for the first time, transcript abundance separately in the epidermal cell layer and the gastrodermal cells that host photosynthetic symbionts. Transcriptomic profiles showed large inter-individual variability, indicating that aposymbiosis could be induced by different pathways. We defined a restricted subset of 39 common genes that are characteristic of the symbiotic or aposymbiotic states. We demonstrated that transcription of many genes belonging to this set is specifically enhanced in the symbiotic cells (gastroderm). A model is proposed where the aposymbiotic and therefore heterotrophic state triggers vesicular trafficking, whereas the symbiotic and therefore autotrophic state favors metabolic exchanges between host and symbiont. Several genetic pathways were investigated in more detail: i) a key vitamin K-dependant process involved in the dinoflagellate-cnidarian recognition; ii) two cnidarian tissue-specific carbonic anhydrases involved in the carbon transfer from the environment to the intracellular symbionts; iii) host collagen synthesis, mostly supported by the symbiotic tissue. Further, we identified specific gene duplications and showed that the cnidarian-specific isoform was also up-regulated both in the

  2. Adaptations to endosymbiosis in a cnidarian-dinoflagellate association: differential gene expression and specific gene duplications.

    Directory of Open Access Journals (Sweden)

    Philippe Ganot

    2011-07-01

    Full Text Available Trophic endosymbiosis between anthozoans and photosynthetic dinoflagellates forms the key foundation of reef ecosystems. Dysfunction and collapse of symbiosis lead to bleaching (symbiont expulsion, which is responsible for the severe worldwide decline of coral reefs. Molecular signals are central to the stability of this partnership and are therefore closely related to coral health. To decipher inter-partner signaling, we developed genomic resources (cDNA library and microarrays from the symbiotic sea anemone Anemonia viridis. Here we describe differential expression between symbiotic (also called zooxanthellate anemones or aposymbiotic (also called bleached A. viridis specimens, using microarray hybridizations and qPCR experiments. We mapped, for the first time, transcript abundance separately in the epidermal cell layer and the gastrodermal cells that host photosynthetic symbionts. Transcriptomic profiles showed large inter-individual variability, indicating that aposymbiosis could be induced by different pathways. We defined a restricted subset of 39 common genes that are characteristic of the symbiotic or aposymbiotic states. We demonstrated that transcription of many genes belonging to this set is specifically enhanced in the symbiotic cells (gastroderm. A model is proposed where the aposymbiotic and therefore heterotrophic state triggers vesicular trafficking, whereas the symbiotic and therefore autotrophic state favors metabolic exchanges between host and symbiont. Several genetic pathways were investigated in more detail: i a key vitamin K-dependant process involved in the dinoflagellate-cnidarian recognition; ii two cnidarian tissue-specific carbonic anhydrases involved in the carbon transfer from the environment to the intracellular symbionts; iii host collagen synthesis, mostly supported by the symbiotic tissue. Further, we identified specific gene duplications and showed that the cnidarian-specific isoform was also up-regulated both

  3. Comparative proteomic analysis of Listeria monocytogenes exposed to enterocin AS-48 in planktonic and sessile states.

    Science.gov (United States)

    Caballero Gómez, Natacha; Abriouel, Hikmate; Ennahar, Said; Gálvez, Antonio

    2013-10-15

    Enterocin AS-48 is a cyclic peptide of great interest for application in food preservation and sanitation. In the present study, the proteome response of Listeria monocytogenes to purified enterocin AS-48 was studied under two different conditions: planktonic cells and sessile cells grown on polystyrene plates. Ten different proteins were differentially expressed in planktonic L. monocytogenes cells treated with 0.1 μg/ml enterocin AS-48 compared to the untreated controls. Overexpressed proteins were related to stress response (DnaK) or carbohydrate transport and metabolism, while underexpressed and unexpressed proteins were related to metabolism (such as glyceraldehyde-3-phosphate dehydrogenase, pyruvate oxidase, glutamate dehydrogenase or glutamate decarboxylase) or stress (GroEL). In the sessile state, L. monocytogenes cells tolerated up to 10 μg/ml bacteriocin, and the treated biofilm cells overexpressed a set of 11 proteins, some of which could be related to stress response (DnaK, GroEL), protein synthesis and carbohydrate metabolism, while glyceraldehyde-3-phosphate dehydrogenase was the only unexpressed protein. Some of the overexpressed proteins (such as elongation factor Tu and GroEL) could also be implicated in cell adhesion. These results suggest different cell responses of L. monocytogenes to enterocin AS-48 in the planktonic and in the sessile state, including stress response and cell metabolism proteins. While in the planktonic state the bacterium may tend to compensate for the cytoplasmic cell permeability changes induced by AS-48 by reinforcing carbohydrate transport and metabolism, sessile cells seem to respond by shifting carbohydrate metabolism and reinforcing protein synthesis. Stress response proteins also seem to be important in the response to AS-48, but the stress response seems to be different in planktonic and in sessile cells. © 2013.

  4. Internalin profiling and multilocus sequence typing suggest four Listeria innocua subgroups with different evolutionary distances from Listeria monocytogenes.

    Science.gov (United States)

    Chen, Jianshun; Chen, Qiaomiao; Jiang, Lingli; Cheng, Changyong; Bai, Fan; Wang, Jun; Mo, Fan; Fang, Weihuan

    2010-03-31

    Ecological, biochemical and genetic resemblance as well as clear differences of virulence between L. monocytogenes and L. innocua make this bacterial clade attractive as a model to examine evolution of pathogenicity. This study was attempted to examine the population structure of L. innocua and the microevolution in the L. innocua-L. monocytogenes clade via profiling of 37 internalin genes and multilocus sequence typing based on the sequences of 9 unlinked genes gyrB, sigB, dapE, hisJ, ribC, purM, gap, tuf and betL. L. innocua was genetically monophyletic compared to L. monocytogenes, and comprised four subgroups. Subgroups A and B correlated with internalin types 1 and 3 (except the strain 0063 belonging to subgroup C) and internalin types 2 and 4 respectively. The majority of L. innocua strains belonged to these two subgroups. Subgroup A harbored a whole set of L. monocytogenes-L. innocua common and L. innocua-specific internalin genes, and displayed higher recombination rates than those of subgroup B, including the relative frequency of occurrence of recombination versus mutation (rho/theta) and the relative effect of recombination versus point mutation (r/m). Subgroup A also exhibited a significantly smaller exterior/interior branch length ratio than expected under the coalescent model, suggesting a recent expansion of its population size. The phylogram based on the analysis with correction for recombination revealed that the time to the most recent common ancestor (TMRCA) of L. innocua subgroups A and B were similar. Additionally, subgroup D, which correlated with internalin type 5, branched off from the other three subgroups. All L. innocua strains lacked seventeen virulence genes found in L. monocytogenes (except for the subgroup D strain L43 harboring inlJ and two subgroup B strains bearing bsh) and were nonpathogenic to mice. L. innocua represents a young species descending from L. monocytogenes and comprises four subgroups: two major subgroups A and B

  5. Internalin profiling and multilocus sequence typing suggest four Listeria innocua subgroups with different evolutionary distances from Listeria monocytogenes

    Science.gov (United States)

    2010-01-01

    Background Ecological, biochemical and genetic resemblance as well as clear differences of virulence between L. monocytogenes and L. innocua make this bacterial clade attractive as a model to examine evolution of pathogenicity. This study was attempted to examine the population structure of L. innocua and the microevolution in the L. innocua-L. monocytogenes clade via profiling of 37 internalin genes and multilocus sequence typing based on the sequences of 9 unlinked genes gyrB, sigB, dapE, hisJ, ribC, purM, gap, tuf and betL. Results L. innocua was genetically monophyletic compared to L. monocytogenes, and comprised four subgroups. Subgroups A and B correlated with internalin types 1 and 3 (except the strain 0063 belonging to subgroup C) and internalin types 2 and 4 respectively. The majority of L. innocua strains belonged to these two subgroups. Subgroup A harbored a whole set of L. monocytogenes-L. innocua common and L. innocua-specific internalin genes, and displayed higher recombination rates than those of subgroup B, including the relative frequency of occurrence of recombination versus mutation (ρ/θ) and the relative effect of recombination versus point mutation (r/m). Subgroup A also exhibited a significantly smaller exterior/interior branch length ratio than expected under the coalescent model, suggesting a recent expansion of its population size. The phylogram based on the analysis with correction for recombination revealed that the time to the most recent common ancestor (TMRCA) of L. innocua subgroups A and B were similar. Additionally, subgroup D, which correlated with internalin type 5, branched off from the other three subgroups. All L. innocua strains lacked seventeen virulence genes found in L. monocytogenes (except for the subgroup D strain L43 harboring inlJ and two subgroup B strains bearing bsh) and were nonpathogenic to mice. Conclusions L. innocua represents a young species descending from L. monocytogenes and comprises four subgroups: two

  6. Internalin profiling and multilocus sequence typing suggest four Listeria innocua subgroups with different evolutionary distances from Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Wang Jun

    2010-03-01

    Full Text Available Abstract Background Ecological, biochemical and genetic resemblance as well as clear differences of virulence between L. monocytogenes and L. innocua make this bacterial clade attractive as a model to examine evolution of pathogenicity. This study was attempted to examine the population structure of L. innocua and the microevolution in the L. innocua-L. monocytogenes clade via profiling of 37 internalin genes and multilocus sequence typing based on the sequences of 9 unlinked genes gyrB, sigB, dapE, hisJ, ribC, purM, gap, tuf and betL. Results L. innocua was genetically monophyletic compared to L. monocytogenes, and comprised four subgroups. Subgroups A and B correlated with internalin types 1 and 3 (except the strain 0063 belonging to subgroup C and internalin types 2 and 4 respectively. The majority of L. innocua strains belonged to these two subgroups. Subgroup A harbored a whole set of L. monocytogenes-L. innocua common and L. innocua-specific internalin genes, and displayed higher recombination rates than those of subgroup B, including the relative frequency of occurrence of recombination versus mutation (ρ/θ and the relative effect of recombination versus point mutation (r/m. Subgroup A also exhibited a significantly smaller exterior/interior branch length ratio than expected under the coalescent model, suggesting a recent expansion of its population size. The phylogram based on the analysis with correction for recombination revealed that the time to the most recent common ancestor (TMRCA of L. innocua subgroups A and B were similar. Additionally, subgroup D, which correlated with internalin type 5, branched off from the other three subgroups. All L. innocua strains lacked seventeen virulence genes found in L. monocytogenes (except for the subgroup D strain L43 harboring inlJ and two subgroup B strains bearing bsh and were nonpathogenic to mice. Conclusions L. innocua represents a young species descending from L. monocytogenes and

  7. Maternal obesity programs increased leptin gene expression in rat male offspring via epigenetic modifications in a depot-specific manner

    Directory of Open Access Journals (Sweden)

    Simon Lecoutre

    2017-08-01

    Conclusions: Consistent with the DOHaD hypothesis, persistent epigenetic remodeling occurs at regulatory regions especially within intergenic sequences, linked to higher leptin gene expression in adult HF offspring in a depot-specific manner.

  8. Specificity Protein (Sp) Transcription Factors and Metformin Regulate Expression of the Long Non-coding RNA HULC

    Science.gov (United States)

    There is evidence that specificity protein 1 (Sp1) transcription factor (TF) regulates expression of long non-coding RNAs (lncRNAs) in hepatocellular carcinoma (HCC) cells. RNA interference (RNAi) studies showed that among several lncRNAs expressed in HepG2, SNU-449 and SK-Hep-1...

  9. The intrinsic cephalosporin resistome of Listeria monocytogenes in the context of stress response, gene regulation, pathogenesis and therapeutics.

    Science.gov (United States)

    Krawczyk-Balska, A; Markiewicz, Z

    2016-02-01

    Intrinsic resistance to antibiotics is a serious therapeutic problem in the case of many bacterial species. The Gram-positive human pathogen Listeria monocytogenes is intrinsically resistant to broad spectrum cephalosporin antibiotics, which are commonly used in therapy of bacterial infections. Besides three penicillin-binding proteins the intrinsic cephalosporin resistome of L. monocytogenes includes multidrug resistance transporter transporters, proteins involved in peptidoglycan biosynthesis and modification, cell envelope proteins with structural or general detoxification function, cytoplasmic proteins with unknown function and regulatory proteins. Analysis of the regulation of the expression of genes involved in the intrinsic resistance of L. monocytogenes to cephalosporins highlights the high complexity of control of the intrinsic resistance phenotype. The regulation of the transcription of the intrinsic resistome determinants involves the activity of eight regulators, namely LisR, CesR, LiaR, VirR, σ(B) , σ(H) , σ(L) and PrfA, of which the most prominent role play LisR, CesR and σ(B) . Furthermore, the vast majority of the intrinsic resistome determinants contribute to the tolerance of different stress conditions and virulence. A study indicates that O-acetyltransferase OatA is the most promising candidate for co-drug development since an agent targeting OatA should sensitize L. monocytogenes to certain antibiotics, therefore improving the efficacy of listeriosis treatment as well as food preservation measures. © 2015 The Society for Applied Microbiology.

  10. Relative Expression Levels Rather Than Specific Activity Plays the Major Role in Determining In Vivo AKT Isoform Substrate Specificity

    Directory of Open Access Journals (Sweden)

    Rachel S. Lee

    2011-01-01

    Full Text Available The AKT protooncogene mediates many cellular processes involved in normal development and disease states such as cancer. The three structurally similar isoforms: AKT1, AKT2, and AKT3 exhibit both functional redundancy and isoform-specific functions; however the basis for their differential signalling remains unclear. Here we show that in vitro, purified AKT3 is ∼47-fold more active than AKT1 at phosphorylating peptide and protein substrates. Despite these marked variations in specific activity between the individual isoforms, a comprehensive analysis of phosphorylation of validated AKT substrates indicated only subtle differences in signalling via individual isoforms in vivo. Therefore, we hypothesise, at least in this model system, that relative tissue/cellular abundance, rather than specific activity, plays the dominant role in determining AKT substrate specificity in situ.

  11. Cadmium induces the expression of specific stress proteins in sea urchin embryos

    International Nuclear Information System (INIS)

    Roccheri, Maria Carmela; Agnello, Maria; Bonaventura, Rosa; Matranga, Valeria

    2004-01-01

    Marine organisms are highly sensitive to many environmental stresses, and consequently, the analysis of their bio-molecular responses to different stress agents is very important for the understanding of putative repair mechanisms. Sea urchin embryos represent a simple though significant model system to test how specific stress can simultaneously affect development and protein expression. Here, we used Paracentrotus lividus sea urchin embryos to study the effects of time-dependent continuous exposure to subacute/sublethal cadmium concentrations. We found that, between 15 and 24 h of exposure, the synthesis of a specific set of stress proteins (90, 72-70, 56, 28, and 25 kDa) was induced, with an increase in the rate of synthesis of 72-70 kDa (hsps), 56 kDa (hsp), and 25 kDa, which was dependent on the lengths of treatment. Recovery experiments in which cadmium was removed showed that while stress proteins continued to be synthesized, embryo development was resumed only after short lengths of exposure

  12. Ki-67 expression reveals strong, transient influenza specific CD4 T cell responses after adult vaccination.

    Science.gov (United States)

    Li, Xi; Miao, Hongyu; Henn, Alicia; Topham, David J; Wu, Hulin; Zand, Martin S; Mosmann, Tim R

    2012-06-29

    Although previous studies have found minimal changes in CD4 T cell responses after vaccination of adults with trivalent inactivated influenza vaccine, daily sampling and monitoring of the proliferation marker Ki-67 have now been used to reveal that a substantial fraction of influenza-specific CD4 T cells respond to vaccination. At 4-6 days after vaccination, there is a sharp rise in the numbers of Ki-67-expressing PBMC that produce IFNγ, IL-2 and/or TNFα in vitro in response to influenza vaccine or peptide. Ki-67(+) cell numbers then decline rapidly, and 10 days after vaccination, both Ki-67(+) and overall influenza-specific cell numbers are similar to pre-vaccination levels. These results provide a tool for assessing the quality and quantity of CD4 T cell responses to different influenza vaccines, and raise the possibility that the anti-influenza T cell memory response may be qualitatively altered by vaccination, even if the overall memory cell numbers do not change significantly. Copyright © 2012. Published by Elsevier Ltd.

  13. Early Changes in Costameric and Mitochondrial Protein Expression with Unloading Are Muscle Specific

    Directory of Open Access Journals (Sweden)

    Martin Flück

    2014-01-01

    Full Text Available We hypothesised that load-sensitive expression of costameric proteins, which hold the sarcomere in place and position the mitochondria, contributes to the early adaptations of antigravity muscle to unloading and would depend on muscle fibre composition and chymotrypsin activity of the proteasome. Biopsies were obtained from vastus lateralis (VL and soleus (SOL muscles of eight men before and after 3 days of unilateral lower limb suspension (ULLS and subjected to fibre typing and measures for costameric (FAK and FRNK, mitochondrial (NDUFA9, SDHA, UQCRC1, UCP3, and ATP5A1, and MHCI protein and RNA content. Mean cross-sectional area (MCSA of types I and II muscle fibres in VL and type I fibres in SOL demonstrated a trend for a reduction after ULLS (0.05≤P<0.10. FAK phosphorylation at tyrosine 397 showed a 20% reduction in VL muscle (P=0.029. SOL muscle demonstrated a specific reduction in UCP3 content (-23%; P = 0.012. Muscle-specific effects of ULLS were identified for linear relationships between measured proteins, chymotrypsin activity and fibre MCSA. The molecular modifications in costamere turnover and energy homoeostasis identify that aspects of atrophy and fibre transformation are detectable at the protein level in weight-bearing muscles within 3 days of unloading.

  14. Early Changes in Costameric and Mitochondrial Protein Expression with Unloading Are Muscle Specific

    Science.gov (United States)

    Li, Ruowei; Linnehan, Richard M.; Castells, Josiane; Tesch, Per; Gustafsson, Thomas

    2014-01-01

    We hypothesised that load-sensitive expression of costameric proteins, which hold the sarcomere in place and position the mitochondria, contributes to the early adaptations of antigravity muscle to unloading and would depend on muscle fibre composition and chymotrypsin activity of the proteasome. Biopsies were obtained from vastus lateralis (VL) and soleus (SOL) muscles of eight men before and after 3 days of unilateral lower limb suspension (ULLS) and subjected to fibre typing and measures for costameric (FAK and FRNK), mitochondrial (NDUFA9, SDHA, UQCRC1, UCP3, and ATP5A1), and MHCI protein and RNA content. Mean cross-sectional area (MCSA) of types I and II muscle fibres in VL and type I fibres in SOL demonstrated a trend for a reduction after ULLS (0.05 ≤ P < 0.10). FAK phosphorylation at tyrosine 397 showed a 20% reduction in VL muscle (P = 0.029). SOL muscle demonstrated a specific reduction in UCP3 content (−23%; P = 0.012). Muscle-specific effects of ULLS were identified for linear relationships between measured proteins, chymotrypsin activity and fibre MCSA. The molecular modifications in costamere turnover and energy homoeostasis identify that aspects of atrophy and fibre transformation are detectable at the protein level in weight-bearing muscles within 3 days of unloading. PMID:25313365

  15. Post-proliferative immature radial glial cells female-specifically express aromatase in the medaka optic tectum.

    Directory of Open Access Journals (Sweden)

    Akio Takeuchi

    Full Text Available Aromatase, the key enzyme responsible for estrogen biosynthesis, is present in the brain of all vertebrates. Much evidence has accumulated that aromatase is highly and exclusively expressed in proliferating mature radial glial cells in the brain of teleost fish even in adulthood, unlike in other vertebrates. However, the physiological significance of this expression remains unknown. We recently found that aromatase is female-specifically expressed in the optic tectum of adult medaka fish. In the present study, we demonstrated that, contrary to the accepted view of the teleost brain, female-specific aromatase-expressing cells in the medaka optic tectum represent a transient subset of post-proliferative immature radial glial cells in the neural stem cell lineage. This finding led us to hypothesize that female-specific aromatase expression and consequent estrogen production causes some sex difference in the life cycle of tectal cells. As expected, the female tectum exhibited higher expression of genes indicative of cell proliferation and radial glial maturation and lower expression of an anti-apoptotic gene than did the male tectum, suggesting a female-biased acceleration of the cell life cycle. Complicating the interpretation of this result, however, is the additional observation that estrogen administration masculinized the expression of these genes in the optic tectum, while simultaneously stimulating aromatase expression. Taken together, these results provide evidence that a unique subpopulation of neural stem cells female-specifically express aromatase in the optic tectum and suggest that this aromatase expression and resultant estrogen synthesis have an impact on the life cycle of tectal cells, whether stimulatory or inhibitory.

  16. Prevalence and location of Listeria monocytogenes in farmed rainbow trout.

    Science.gov (United States)

    Miettinen, Hanna; Wirtanen, Gun

    2005-10-15

    A total of 510 rainbow trout originating from fish farms in lakes and sea areas around Finland were studied for the presence of Listeria monocytogenes. Samples were studied as pools from five fish. Gill, viscera, and skin from the pooled samples were analysed separately. The individual samples were analysed later if the pooled sample was found to be Listeria positive. The prevalence of Listeria spp. and L. monocytogenes in pooled unprocessed fresh rainbow trout was on average 35.0% and 14.6%, respectively. On the other hand, the prevalence of Listeria spp. and L. monocytogenes in individual thawed fish was found to be 14.3% and 8.8%, respectively. These numbers tend to overestimate and underestimate the real situation because not all fish in pooled samples were necessarily contaminated and in some of the Listeria positive pooled samples all individual samples turned out to be Listeria free. The prevalence of L. monocytogenes varied greatly between different fish farms from zero to 100% in pooled samples and from zero to 75% according to individually studied fish samples. Some indications of the influence of weather conditions and seasonal variations that strongly affected the Listeria contamination of fish were also noticed. The location of Listeria spp. and L. monocytogenes in different parts of the fish differed with statistical significance in rainbow trout. Up to 95.6% of the L. monocytogenes and 84.5% of Listeria spp. positive samples were gill samples. Only 4.4% (2/45) of the L. monocytogenes positive samples were obtained from skin or viscera. Closer study at one fish farm revealed that there was only one L. monocytogenes ribotype present in the contaminated fish, although water and surfaces were heavily contaminated with six other L. monocytogenes ribotypes.

  17. OrfX, a Nucleomodulin Required for Listeria monocytogenes Virulence

    Directory of Open Access Journals (Sweden)

    Andrzej Prokop

    2017-10-01

    Full Text Available Listeria monocytogenes is a bacterial pathogen causing severe foodborne infections in humans and animals. Listeria can enter into host cells and survive and multiply therein, due to an arsenal of virulence determinants encoded in different loci on the chromosome. Several key Listeria virulence genes are clustered in Listeria pathogenicity island 1. This important locus also contains orfX (lmo0206, a gene of unknown function. Here, we found that OrfX is a small, secreted protein whose expression is positively regulated by PrfA, the major transcriptional activator of Listeria virulence genes. We provide evidence that OrfX is a virulence factor that dampens the oxidative response of infected macrophages, which contributes to intracellular survival of bacteria. OrfX is targeted to the nucleus and interacts with the regulatory protein RybP. We show that in macrophages, the expression of OrfX decreases the level of RybP, which controls cellular infection. Collectively, these data reveal that Listeria targets RybP and evades macrophage oxidative stress for efficient infection. Altogether, OrfX is after LntA, the second virulence factor acting directly in the nucleus.

  18. Irf3 polymorphism alters induction of interferon beta in response to Listeria monocytogenes infection.

    Directory of Open Access Journals (Sweden)

    Oleg Garifulin

    2007-09-01

    Full Text Available Genetic makeup of the host plays a significant role in the course and outcome of infection. Inbred strains of mice display a wide range of sensitivities to Listeria monocytogenes infection and thus serve as a good model for analysis of the effect of genetic polymorphism. The outcome of L. monocytogenes infection in mice is influenced by the ability of this bacterium to induce expression of interferon beta mRNA, encoded in mouse by the Ifnb1 (interferon beta 1, fibroblast gene. Mouse strains that lack components of the IFN beta signaling pathway are substantially more resistant to infection. We found that macrophages from the ByJ substrain of the common C57BL/6 inbred strain of mice are impaired in their ability to induce Ifnb1 expression in response to bacterial and viral infections. We mapped the locus that controls differential expression of Ifnb1 to a region on Chromosome 7 that includes interferon regulatory factor 3 (Irf3, which encodes a transcription factor responsible for early induction of Ifnb1 expression. In C57BL/6ByJ mice, Irf3 mRNA was inefficiently spliced, with a significant proportion of the transcripts retaining intron 5. Analysis of the Irf3 locus identified a single base-pair polymorphism and revealed that intron 5 of Irf3 is spliced by the atypical U12-type spliceosome. We found that the polymorphism disrupts a U12-type branchpoint and has a profound effect on the efficiency of splicing of Irf3. We demonstrate that a naturally occurring change in the splicing control element has a dramatic effect on the resistance to L. monocytogenes infection. Thus, the C57BL/6ByJ mouse strain serves as an example of how a mammalian host can counter bacterial virulence strategies by introducing subtle alteration of noncoding sequences.

  19. Gene co-expression networks in liver and muscle transcriptome reveal sex-specific gene expression in lambs fed with a mix of essential oils

    DEFF Research Database (Denmark)

    Sabino, Marcella; Carmelo, Victor Adriano Okstoft; Mazzoni, Gianluca

    2018-01-01

    the potential of RNA-Sequencing data in order to evaluate the effect of an EO supplementary diet on gene expression in both lamb liver and muscle. Using a treatment and sex interaction model, 13 and 4 differentially expressed genes were identified in liver and muscle respectively. Sex-specific differentially...... on the expression profile of both liver and muscle tissues. We hypothesize that the presence of EOs could have beneficial effects on wellness of male lamb and further analyses are needed to understand the biological mechanisms behind the different effect of EO metabolites based on sex. Using lamb as a model...

  20. Tissue specific haemoglobin gene expression suggests adaptation to local marine conditions in North Sea flounder (Platichthys flesus L.)

    DEFF Research Database (Denmark)

    Larsen, P.F.; Eg Nielsen, Einar; Hansen, M.M.

    2013-01-01

    Recent genetic analyses of candidate genes and gene expression in marine fishes have provided evidence of local adaptation in response to environmental differences, despite the lack of strong signals of population structure from conventional neutral genetic markers. In this study expression...... in flounder. In gill tissue a plastic response to salinity treatments was observed with general up-regulation of these genes concomitant with higher salinity. For liver tissue a population specific expression differences was observed with lower expression at simulated non-native compared to native salinities...... in high gene flow marine fishes. © 2013 The Genetics Society of Korea...

  1. Prevalence of Listeria monocytogenes in raw milk in North Lebanon

    International Nuclear Information System (INIS)

    Al Kassaa, I; El Omari, Kh.; Esmail, B.; Hamze, M; Saati, M.

    2016-01-01

    Listeriosis, although a zoonosis, is an invasive disease that can affect newborns, pregnant women and immunocompromised adults. Clinical manifestations can be expressedby febrile gastroenteritis, invasive forms including severe sepsis, meningitis, rhombencephalitis, prenatal infections and abortions. Species of Listeria bacteria are ubiquitous and adaptableto the environment in animal and plant foods. This study aimed to determine the prevalence of Listeria monocytogenes in 100 samples of fresh cow milk collected from different areas of North Lebanon. Listeria monocytogenes was detected by using the Grand VIDAS technique (Biomérieux France). The results obtained revealed the absence of Listeria monocytogenes inall analyzed samples. (Author)

  2. Cancer-specific transgene expression mediated by systemic injection of nanoparticles.

    Science.gov (United States)

    Chisholm, Edward J; Vassaux, Georges; Martin-Duque, Pilar; Chevre, Raphael; Lambert, Olivier; Pitard, Bruno; Merron, Andrew; Weeks, Mark; Burnet, Jerome; Peerlinck, Inge; Dai, Ming-Shen; Alusi, Ghassan; Mather, Stephen J; Bolton, Katherine; Uchegbu, Ijeoma F; Schatzlein, Andreas G; Baril, Patrick

    2009-03-15

    The lack of safe and efficient systemic gene delivery vectors has largely reduced the potential of gene therapy in the clinic. Previously, we have reported that polypropylenimine dendrimer PPIG3/DNA nanoparticles are capable of tumor transfection upon systemic administration in tumor-bearing mice. To be safely applicable in the clinic, it is crucial to investigate the colloidal stability of nanoparticles and to monitor the exact biodistribution of gene transfer in the whole body of the live subject. Our biophysical characterization shows that dendrimers, when complexed with DNA, are capable of forming spontaneously in solution a supramolecular assembly that possesses all the features required to diffuse in experimental tumors through the enhanced permeability and retention effect. We show that these nanoparticles are of sizes ranging from 33 to 286 nm depending on the DNA concentration, with a colloidal stable and well-organized fingerprint-like structure in which DNA molecules are condensed with an even periodicity of 2.8 nm. Whole-body nuclear imaging using small-animal nano-single-photon emission computed tomography/computer tomography scanner and the human Na/I symporter (NIS) as reporter gene shows unique and highly specific tumor targeting with no detection of gene transfer in any of the other tissues of tumor-bearing mice. Tumor-selective transgene expression was confirmed by quantitative reverse transcription-PCR at autopsy of scanned animals, whereas genomic PCR showed that the tumor sites are the predominant sites of nanoparticle accumulation. Considering that NIS imaging of transgene expression has been recently validated in humans, our data highlight the potential of these nanoparticles as a new formulation for cancer gene therapy.

  3. Identification and functional characterization of a novel monotreme- specific antibacterial protein expressed during lactation.

    Directory of Open Access Journals (Sweden)

    Swathi Bisana

    Full Text Available Monotremes are the only oviparous mammals and exhibit a fascinating combination of reptilian and mammalian characters. They represent a component of synapsidal reproduction by laying shelled eggs which are incubated outside the mother's body. This is accompanied by a prototherian lactation process, marking them as representatives of early mammals. The only extant monotremes are the platypus, and the short- and long- beaked echidnas, and their distributions are limited to Australia and New Guinea. Apart for a short weaning period, milk is the sole source of nutrition and protection for the hatchlings which are altricial and immunologically naive. The duration of lactation in these mammals is prolonged relative to the gestational length and period of incubation of eggs. Much of the development of monotreme young occurs in the non-sterile ex-utero environment. Therefore the role of milk in the growth, development and disease protection of the young is of significant interest. By sequencing the cDNA of cells harvested from monotreme milk, we have identified a novel monotreme- specific transcript, and the corresponding gene was designated as the EchAMP. The expression profile of this gene in various tissues revealed that it is highly expressed in milk cells. The peptides corresponding to the EchAMP protein have been identified in a sample of echidna milk In silico analysis indicated putative antimicrobial potential for the cognate protein of EchAMP. This was further confirmed by in vitro assays using a host of bacteria. Interestingly, EchAMP did not display any activity against a commensal gut floral species. These results support the hypothesis of enhancement of survival of the young by antimicrobial bioactives of mammary gland origin and thus emphasize the protective, non- nutritional role of milk in mammals.

  4. A Bystander Mechanism Explains the Specific Phenotype of a Broadly Expressed Misfolded Protein.

    Directory of Open Access Journals (Sweden)

    Lauren Klabonski

    2016-12-01

    Full Text Available Misfolded proteins in transgenic models of conformational diseases interfere with proteostasis machinery and compromise the function of many structurally and functionally unrelated metastable proteins. This collateral damage to cellular proteins has been termed 'bystander' mechanism. How a single misfolded protein overwhelms the proteostasis, and how broadly-expressed mutant proteins cause cell type-selective phenotypes in disease are open questions. We tested the gain-of-function mechanism of a R37C folding mutation in an endogenous IGF-like C.elegans protein DAF-28. DAF-28(R37C is broadly expressed, but only causes dysfunction in one specific neuron, ASI, leading to a distinct developmental phenotype. We find that this phenotype is caused by selective disruption of normal biogenesis of an unrelated endogenous protein, DAF-7/TGF-β. The combined deficiency of DAF-28 and DAF-7 biogenesis, but not of DAF-28 alone, explains the gain-of-function phenotype-deficient pro-growth signaling by the ASI neuron. Using functional, fluorescently-tagged protein, we find that, in animals with mutant DAF-28/IGF, the wild-type DAF-7/TGF-β is mislocalized to and accumulates in the proximal axon of the ASI neuron. Activation of two different branches of the unfolded protein response can modulate both the developmental phenotype and DAF-7 mislocalization in DAF-28(R37C animals, but appear to act through divergent mechanisms. Our finding that bystander targeting of TGF-β explains the phenotype caused by a folding mutation in an IGF-like protein suggests that, in conformational diseases, bystander misfolding may specify the distinct phenotypes caused by different folding mutations.

  5. LACTIC FLORA-LISTERIA MONOCYTOGENES INTERACTION

    Directory of Open Access Journals (Sweden)

    S. Colombo

    2012-08-01

    Full Text Available The EC Regulation 2073/2005 (1 requires that food processors evaluate the capability of ready-to-use (RTE products to support the development of Listeria monocytogenes when their pH and aW values are favourable to the growth of this microorganism. It is renown that the lactic flora plays an important role in many different foods, both from a technological and a food safety standpoint. This study was aimed to observe the behaviour and the potential anti-Listeria effect of some natural lactic flora present in Italian liver patè crostini (chicken heart and liver, anchovies, onions, capers, starch, no added preservatives through the Combase Predictor – Max Growth Rate predictive software. The natural lactic flora of the crostini demonstrated a variable capability to inhibit the growth of Listeria monocytogenes which depends upon : the concentration of the lactic flora at the beginning of the shelf life period and the subsequent lag phase, the possible release of anti-Listeria substances, and the maximum growth rate.

  6. Silver as antibacterial towards Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Simone eBelluco

    2016-03-01

    Full Text Available Listeria monocytogenes is a serious foodborne pathogen that can contaminate food during processing and can grow during food shelf-life. New types of safe and effective food contact materials embedding antimicrobial agents, like silver, can play an important role in the food industry. The present work aimed at evaluating the in vitro growth kinetics of different strains of L. monocytogenes in the presence of silver, both in its ionic and nano form. The antimicrobial effect was determined by assaying the number of culturable bacterial cells, which formed colonies after incubation in the presence of silver nanoparticles (AgNPs or silver nitrate (AgNO3. Ionic release experiments were performed in parallel. A different reduction of bacterial viability between silver ionic and nano forms was observed, with a time delayed effect exerted by AgNPs. An association between antimicrobial activity and ions concentration was shown by both silver chemical forms, suggesting the major role of ions in the antimicrobial mode of action.

  7. REALIS: Postgenomic Analysis of Listeria Monocytogenes

    Directory of Open Access Journals (Sweden)

    The REALIS Consortium

    2006-04-01

    Full Text Available Listeria monocytogenes is a remarkably successful food-borne pathogen. It is capable a of surviving and proliferating under conditions that exist within the food chain, such as at low temperatures, high salt and low pH and b of colonizing animal host tissues after ingestion of contaminated food, causing opportunistic infections mainly, but not exclusively, in immunocompromised hosts. The ultimate goals of REALIS are two fold: Firstly, it aims to completely decipher all genes required for survival in and adaptation of Listeria monocytogenes to two very different environments, ie., the infected host and the external environment. Secondly, using genomics and postgenomic tools, REALIS seeks to precisely address fundamental questions regarding evolutionary relationships between pathogenic and non-pathogenic Listeria and to define qualities of particularly successful clonal pathovariants in causing disease. This project will provide both industry and health care managers with rational approaches to curbing food-borne contamination, minimising risks of infection and providing novel pharmacological approaches for halting the fulminant course of infection.

  8. Listeria monocytogenes in five Sardinian swine slaughterhouses: prevalence, serotype, and genotype characterization.

    Science.gov (United States)

    Meloni, Domenico; Piras, Francesca; Mureddu, Anna; Fois, Federica; Consolati, Simonetta Gianna; Lamon, Sonia; Mazzette, Rina

    2013-11-01

    In a 3-year study (2008 to 2011) to estimate the prevalence and the contamination sources of Listeria monocytogenes in pork meat in Sardinia, Italy, 211 samples were collected from five Sardinian swine slaughterhouses: 171 samples from slaughtered pigs and 40 from the slaughterhouse environment. Fifty L. monocytogenes isolates were characterized by PCR-based serotyping, presence of virulence-associated genes, and pulsed-field gel electrophoresis restriction analysis. The overall prevalence of L. monocytogenes was 33% in swine carcasses, 7% in cecal material, 23% on meat contact surfaces, and 25% on noncontact surfaces. Only two serotypes were detected: 1/2c (78%) and 1/2a (22%). In all, based on the presence of virulence-associated genes, eight pathogenic profiles were detected. Only 42% of all isolates carried the full complement of virulence-associated genes and were allotted to profile 1. Six pulsed-field gel electrophoresis profiles persisted in the slaughterhouses; restriction profiles appeared to be specific to each plant.

  9. The high prevalence of Listeria monocytogenes peritonitis in cirrhotic patients of an Egyptian Medical Center.

    Science.gov (United States)

    El Sayed Zaki, Maysaa; El Shabrawy, Walaa Othman; El-Eshmawy, Mervat M; Aly Eletreby, Shahera

    2011-09-01

    Spontaneous bacterial peritonitis (SBP) is a potentially lethal complication of cirrhosis. It is probably the most characteristic infectious complication of cirrhosis. The aim of this study was to evaluate the bacterial and fungal causes of SBP in Egyptian population. Furthermore to predict the occurrence of rare pathogen like Listeria monocytogenes in those patients. The study included 100 patients with end stage liver disease associated with ascites. Patients were suspected to have SBP. The ascitic fluids were subjected to full cytological and microbiological study. The peritoneal fluid cytological study revealed that 50 samples had cell counts >250 cells/mm(3). 37 samples had growth and 13 samples had no growth (CNNA). The distribution of isolated pathogens was Gram positive cocci 48.8% followed by L. monocytogenes 24.4%, Gram negative bacilli 12.2% and Mycobacterium tuberculosis 7.3. The cells counts associated with listeria culture were 475 cells/mm(3) with sensitivity 70% and specificity 68%. The study highlights the prevalence of microorganisms in Egyptian patients with liver cirrhosis associated with ascites. It reflects the occurrence of L. monocytogenes as an important pathogen of such clinical situation. Other rare pathogens like M. tuberculosis are not uncommon in those patients. Copyright © 2011 King Saud Bin Abdulaziz University for Health Sciences. Published by Elsevier Ltd. All rights reserved.

  10. Microarray Gene Expression Analysis to Evaluate Cell Type Specific Expression of Targets Relevant for Immunotherapy of Hematological Malignancies.

    Directory of Open Access Journals (Sweden)

    M J Pont

    Full Text Available Cellular immunotherapy has proven to be effective in the treatment of hematological cancers by donor lymphocyte infusion after allogeneic hematopoietic stem cell transplantation and more recently by targeted therapy with chimeric antigen or T-cell receptor-engineered T cells. However, dependent on the tissue distribution of the antigens that are targeted, anti-tumor responses can be accompanied by undesired side effects. Therefore, detailed tissue distribution analysis is essential to estimate potential efficacy and toxicity of candidate targets for immunotherapy of hematological malignancies. We performed microarray gene expression analysis of hematological malignancies of different origins, healthy hematopoietic cells and various non-hematopoietic cell types from organs that are often targeted in detrimental immune responses after allogeneic stem cell transplantation leading to graft-versus-host disease. Non-hematopoietic cells were also cultured in the presence of IFN-γ to analyze gene expression under inflammatory circumstances. Gene expression was investigated by Illumina HT12.0 microarrays and quality control analysis was performed to confirm the cell-type origin and exclude contamination of non-hematopoietic cell samples with peripheral blood cells. Microarray data were validated by quantitative RT-PCR showing strong correlations between both platforms. Detailed gene expression profiles were generated for various minor histocompatibility antigens and B-cell surface antigens to illustrate the value of the microarray dataset to estimate efficacy and toxicity of candidate targets for immunotherapy. In conclusion, our microarray database provides a relevant platform to analyze and select candidate antigens with hematopoietic (lineage-restricted expression as potential targets for immunotherapy of hematological cancers.

  11. Prevalence and risk factors for Listeria monocytogenes in broiler flocks in Shiraz, southern Iran.

    Science.gov (United States)

    Hosseinzadeh, Saeid; Shekarforoush, Seyed Shahram; Ansari-Lari, Maryam; EsalatPanah-Fard Jahromi, Mehdi; Berizi, Enayat; Abdollahi, Mostafa

    2012-06-01

    Listeria monocytogenes has been identified as an important foodborne pathogen in recent years. In humans, it most commonly affects pregnant women, neonates, children, elderly people, and persons with a suppressed immune system. It could contaminate both raw and cooked meat and poultry products. Studies regarding prevalence and risk factors of L. monocytogenes in broilers flocks are limited. Therefore, the present study was conducted to determine the prevalence and risk factors for L. monocytogenes in poultry flocks in Shiraz, southern Iran. During August to September 2009, in total, 100 broiler flocks were selected at slaughter, and 21 specimens were collected from cloacal samples from each flock. Polymerase chain reaction (PCR) was performed on the samples enriched in buffered Listeria enrichment broth (BLEB), using specific primers. Furthermore, enriched samples in BLEB and/or BLEB treated with 5% KOH were subcultured on Palcam medium. Data about farm and flocks were collected using a structured questionnaire. The prevalence of L. monocytogenes was 7% (95% CI, 2-12%) and 1% using PCR and culture, respectively. Results showed that using antibiotics during rearing period was dramatically reduced the rate of isolation (odds ratio [OR]=0.07, p=0.03), whereas house capacity of more than 10,000 birds (OR=24.03, p=0.04) and number of houses (OR=2, p=0.02) significantly increased the prevalence. The correlation between poor management of large poultry flocks and increasing the risk of contamination was more likely due to the recontamination of cooked poultry/undercooking or cross-contamination of other ready-to-eat foods.

  12. Prevalence of Listeria spp. and Molecular Characterization of Listeria monocytogenes Isolates from Broilers at the Abattoir.

    Science.gov (United States)

    Bouayad, Leila; Hamdi, Taha M; Naim, Malek; Leclercq, Alexandre; Lecuit, Marc

    2015-07-01

    Products from three broiler abattoirs were sampled for Listeria species to evaluate the changes in the prevalence and contamination rates at two stages of processing. Sampling was performed at the evisceration stage and at the end of processing after packaging and refrigerating at 4°C for 24 h. A total of 212 samples were collected; 52 were from abattoir A, and 80 samples each were collected from abattoirs B and C. Among all samples, 99 (46.7%) tested positive for Listeria, including L. monocytogenes 19 (8.9%), L. innocua 69 (32.5%), L. grayi 10 (4.7%), and L. welshimeri 1 (0.5%). The L. monocytogenes contamination rate varied from 5% to 11.5% in the 3 abattoirs. L. innocua was the most common species identified and was found in 8.8% of the samples from abattoir A and 33.7% of the samples from both abattoirs B and C. Twenty-six of the L. monocytogenes isolates obtained from positive samples were subjected to serotyping by multiplex polymerase chain reaction and characterization by the pulsed-field gel electrophoresis (PFGE) method using two cutting enzymes, ApaI and AscI. Three molecular serogroups were identified: IIa, IIb, and IVb. Serogroup IIa was common to all abattoirs, and serogroups IIb and IVb were found only in abattoir C. The 10 different obtained PFGE profiles were grouped into 7 clusters; some of these clusters were common to the 3 abattoirs, and others were specific to the abattoirs in which they were identified. This study revealed a high prevalence of Listeria spp., particularly L. monocytogenes, in raw broilers. This high incidence presents a risk to consumers due to the potential occurrence of cross-contamination with other foods in domestic refrigerators and the ability of these microorganisms to survive in undercooked products.

  13. Downstream Toll-like receptor signaling mediates adaptor-specific cytokine expression following focal cerebral ischemia

    Directory of Open Access Journals (Sweden)

    Bolanle Famakin

    2012-07-01

    Full Text Available Abstract Background Deletion of some Toll-like receptors (TLRs affords protection against cerebral ischemia, but disruption of their known major downstream adaptors does not. To determine whether compensation in the production of downstream effectors by one pathway when the other is disrupted can explain these findings, we examined cytokine/chemokine expression and inflammatory infiltrates in wild-type (WT, MyD88−/− and TRIF-mutant mice following permanent middle cerebral artery occlusion (pMCAO. Methods Cytokine/chemokine expression was measured with a 25-plex bead array in the serum and brains of all three groups of mice at baseline (no surgery/naïve and at 3 hours and 24 hours following pMCAO. Brain inflammatory and neutrophil infiltrates were examined 24 hours following pMCAO. Results IL-6, keratinocyte chemoattractant (KC, granulocyte colony-stimulating factor (G-CSF and IL-10 were significantly decreased in MyD88−/− mice compared to WT mice following pMCAO. Significantly, decreased levels of the neutrophil chemoattractants KC and G-CSF corresponded with a trend toward fewer neutrophils in the brains of MyD88−/− mice. IP-10 was significantly decreased when either pathway was disrupted. MIP-1α was significantly decreased in TRIF-mutant mice, consistent with TRIF-dependent production. MyD88−/− mice showed elevations of a number of Th2 cytokines, such as IL-13, at baseline, which became significantly decreased following pMCAO. Conclusions Both MyD88 and TRIF mediate pathway-specific cytokine production following focal cerebral ischemia. Our results also suggest a compensatory Th2-type skew at baseline in MyD88−/− mice and a paradoxical switch to a Th1 phenotype following focal cerebral ischemia. The MyD88 pathway directs the expression of neutrophil chemoattractants following cerebral ischemia.

  14. Transgenic over-expression of YY1 induces pathologic cardiac hypertrophy in a sex-specific manner

    Science.gov (United States)

    Stauffer, Brian L.; Dockstader, Karen; Russell, Gloria; Hijmans, Jamie; Walker, Lisa; Cecil, Mackenzie; Demos-Davies, Kimberly; Medway, Allen; McKinsey, Timothy A.; Sucharov, Carmen C.

    2015-01-01

    YY1 can activate or repress transcription of various genes. In cardiac myocytes in culture YY1 has been shown to regulate expression of several genes involved in myocyte pathology. YY1 can also acutely protect the heart against detrimental changes in gene expression. In this study we show that cardiac over-expression of YY1 induces pathologic cardiac hypertrophy in male mice, measured by changes in gene expression and lower ejection fraction/fractional shortening. In contrast, female animals are protected against pathologic gene expression changes and cardiac dysfunction. Furthermore, we show that YY1 regulates, in a sex-specific manner, the expression of mammalian enable (Mena), a factor that regulates cytoskeletal actin dynamics and whose expression is increased in several models of cardiac pathology, and that Mena expression in humans with heart failure is sex-dependent. Finally, we show that sex differences in YY1 expression are also observed in human heart failure. In summary, this is the first work to show that YY1 has a sex-specific effect in the regulation of cardiac pathology. PMID:25935483

  15. Characterization of conditionally expressed mutants affecting age-specific Drosophila melanogaster : Lethal conditions and temperature-sensitive periods

    NARCIS (Netherlands)

    Vermeulen, CJ; Bijlsma, R

    The specific genetic basis of inbreeding depression is poorly understood. To address this question, two conditionally expressed lethal effects that were found to cause line-specific life span reductions in two separate inbred lines of Drosophila melanogaster. were characterized phenotypically and

  16. Age-Related Gene Expression in the Frontal Cortex Suggests Synaptic Function Changes in Specific Inhibitory Neuron Subtypes

    Directory of Open Access Journals (Sweden)

    Leon French

    2017-05-01

    Full Text Available Genome-wide expression profiling of the human brain has revealed genes that are differentially expressed across the lifespan. Characterizing these genes adds to our understanding of both normal functions and pathological conditions. Additionally, the specific cell-types that contribute to the motor, sensory and cognitive declines during aging are unclear. Here we test if age-related genes show higher expression in specific neural cell types. Our study leverages data from two sources of murine single-cell expression data and two sources of age-associations from large gene expression studies of postmortem human brain. We used nonparametric gene set analysis to test for age-related enrichment of genes associated with specific cell-types; we also restricted our analyses to specific gene ontology groups. Our analyses focused on a primary pair of single-cell expression data from the mouse visual cortex and age-related human post-mortem gene expression information from the orbitofrontal cortex. Additional pairings that used data from the hippocampus, prefrontal cortex, somatosensory cortex and blood were used to validate and test specificity of our findings. We found robust age-related up-regulation of genes that are highly expressed in oligodendrocytes and astrocytes, while genes highly expressed in layer 2/3 glutamatergic neurons were down-regulated across age. Genes not specific to any neural cell type were also down-regulated, possibly due to the bulk tissue source of the age-related genes. A gene ontology-driven dissection of the cell-type enriched genes highlighted the strong down-regulation of genes involved in synaptic transmission and cell-cell signaling in the Somatostatin (Sst neuron subtype that expresses the cyclin dependent kinase 6 (Cdk6 and in the vasoactive intestinal peptide (Vip neuron subtype expressing myosin binding protein C, slow type (Mybpc1. These findings provide new insights into cell specific susceptibility to normal aging

  17. Purification, cDNA Cloning, and Developmental Expression of the Nodule-Specific Uricase from Phaseolus vulgaris L. 1

    Science.gov (United States)

    Sánchez, Federico; Campos, Francisco; Padilla, Jaime; Bonneville, Jean-Marc; Enríquez, Consuelo; Caput, Daniel

    1987-01-01

    Nodule-specific uricase (uricase II) from Phaseolus vulgaris L. was purified to homogeneity by chromatographic methods. Purification data indicated that uricase II is approximately 2% of the total soluble protein from mature nodules. Specific antiserum was raised and used to determine the developmental expression and for immunoselection of polysomes. Uricase II was antigenically detected early in nodule development, 2 to 3 days before nitrogen fixation. Uricase-encoding cDNA clones were isolated by hybridizing a nodule-specific pUC9 cDNA library with labeled mRNA from immunoselected polysomes and a 35,000 molecular weight uricase II-encoding cDNA from soybean. An homologous clone (pNF-UR07) was used to assess the expression pattern of the specific transcript during development. Northern-blot analysis indicated that uricase II mRNA is exclusively expressed in nodule tissue. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 PMID:16665575

  18. Listeria monocytogenes Isolates Carrying Virulence-Attenuating Mutations in Internalin A Are Commonly Isolated from Ready-to-Eat Food Processing Plant and Retail Environments.

    Science.gov (United States)

    VAN Stelten, A; Roberts, A R; Manuel, C S; Nightingale, K K

    2016-10-01

    Listeria monocytogenes is a human foodborne pathogen that may cause an invasive disease known as listeriosis in susceptible individuals. Internalin A (InlA; encoded by inlA) is a virulence factor that facilitates crossing of host cell barriers by L. monocytogenes . At least 19 single nucleotide polymorphisms (SNPs) in inlA that result in a premature stop codon (PMSC) have been described worldwide. SNPs leading to a PMSC in inlA have been shown to be causally associated with attenuated virulence. L. monocytogenes pathogens carrying virulence-attenuating (VA) mutations in inlA have been commonly isolated from ready-to-eat (RTE) foods but rarely have been associated with human disease. This study was conducted to determine the prevalence of VA SNPs in inlA among L. monocytogenes from environments associated with RTE food production and handling. More than 700 L. monocytogenes isolates from RTE food processing plant (n = 409) and retail (n = 319) environments were screened for the presence of VA SNPs in inlA. Overall, 26.4% of isolates from RTE food processing plant and 32.6% of isolates from retail environments carried a VA mutation in inlA. Food contact surfaces sampled at retail establishments were significantly (P < 0.0001) more likely to be contaminated by a L. monocytogenes isolate carrying a VA mutation in inlA (56% of 55 isolates) compared with nonfood contact surfaces (28% of 264 isolates). Overall, a significant proportion of L. monocytogenes isolated from RTE food production and handling environments have reduced virulence. These data will be useful in the revision of current and the development of future risk assessments that incorporate strain-specific virulence parameters.

  19. A Genetic Screen Reveals that Synthesis of 1,4-Dihydroxy-2-Naphthoate (DHNA), but Not Full-Length Menaquinone, Is Required for Listeria monocytogenes Cytosolic Survival.

    Science.gov (United States)

    Chen, Grischa Y; McDougal, Courtney E; D'Antonio, Marc A; Portman, Jonathan L; Sauer, John-Demian

    2017-03-21

    Through unknown mechanisms, the host cytosol restricts bacterial colonization; therefore, only professional cytosolic pathogens are adapted to colonize this host environment. Listeria monocytogenes is a Gram-positive intracellular pathogen that is highly adapted to colonize the cytosol of both phagocytic and nonphagocytic cells. To identify L. monocytogenes determinants of cytosolic survival, we designed and executed a novel screen to isolate L. monocytogenes mutants with cytosolic survival defects. Multiple mutants identified in the screen were defective for synthesis of menaquinone (MK), an essential molecule in the electron transport chain. Analysis of an extensive set of MK biosynthesis and respiratory chain mutants revealed that cellular respiration was not required for cytosolic survival of L. monocytogenes but that, instead, synthesis of 1,4-dihydroxy-2-naphthoate (DHNA), an MK biosynthesis intermediate, was essential. Recent discoveries showed that modulation of the central metabolism of both host and pathogen can influence the outcome of host-pathogen interactions. Our results identify a potentially novel function of the MK biosynthetic intermediate DHNA and specifically highlight how L. monocytogenes metabolic adaptations promote cytosolic survival and evasion of host immunity. IMPORTANCE Cytosolic bacterial pathogens, such as Listeria monocytogenes and Francisella tularensis , are exquisitely evolved to colonize the host cytosol in a variety of cell types. Establishing an intracellular niche shields these pathogens from effectors of humoral immunity, grants access to host nutrients, and is essential for pathogenesis. Through yet-to-be-defined mechanisms, the host cytosol restricts replication of non-cytosol-adapted bacteria, likely through a combination of cell autonomous defenses (CADs) and nutritional immunity. Utilizing a novel genetic screen, we identified determinants of L. monocytogenes cytosolic survival and virulence and identified a role

  20. Different transcriptional responses from slow and fast growth rate strains of Listeria monocytogenes adapted to low temperature

    Directory of Open Access Journals (Sweden)

    Ninoska eCordero

    2016-03-01

    Full Text Available Listeria monocytogenes has become one of the principal foodborne pathogens worldwide. The capacity of this bacterium to grow at low temperatures has opened an interesting field of study in terms of the identification and classification of new strains of L. monocytogenes with different growth capacities at low temperatures. We determined the growth rate at 8 ºC of 110 strains of L. monocytogenes isolated from different food matrices. We identified a group of slow and fast strains according to their growth rate at 8 °C and performed a global transcriptomic assay in strains previously adapted to low temperature. We then identified shared and specific transcriptional mechanisms, metabolic and cellular processes of both groups; bacterial motility was the principal process capable of differentiating the adaptation capacity of L. monocytogenes strains with different ranges of tolerance to low temperatures. Strains belonging to the fast group were less motile, which may allow these strains to achieve a greater rate of proliferation at low temperature.

  1. Hygienic Shortcomings of Frozen Dessert Freezing Equipment and Fate of Listeria monocytogenes on Ice Cream-Soiled Stainless Steel.

    Science.gov (United States)

    Inuwa, A; Lunt, A; Czuprynski, C; Miller, G; Rankin, S A

    2017-10-19

    Although frozen dairy desserts have a strong record of safety, recent outbreaks of foodborne disease linked to ice creams have brought new attention to this industry. There is concern that small-scale frozen dessert equipment may not comply with or be reviewed against published comprehensive design and construction sanitation specifications (National Sanitation Foundation or 3-A sanitary standards). Equipment sanitary design issues may result in reduced efficacy of cleaning and sanitation, thus increasing the likelihood of postprocess contamination with pathogenic bacteria. In this context, and given that Listeria monocytogenes outbreaks are of great concern for the frozen dessert industry, a complementary study was conducted to evaluate the fate of L. monocytogenes in ice cream mix on a stainless steel surface. Our results showed that L. monocytogenes survived for up to 6 weeks at room temperature and 9 weeks at 4°C in contaminated ice cream on a stainless steel surface. Furthermore, chlorine- and acid-based surface sanitizers had no detrimental effect on the L. monocytogenes when used at a concentration and contact time (1 min) recommended by the manufacturer; significant reduction in CFU required 5 to 20 min of contact time.

  2. Evaluation of the performance of quantitative detection of the Listeria monocytogenes prfA locus with droplet digital PCR.

    Science.gov (United States)

    Witte, Anna Kristina; Fister, Susanne; Mester, Patrick; Schoder, Dagmar; Rossmanith, Peter

    2016-11-01

    Fast and reliable pathogen detection is an important issue for human health. Since conventional microbiological methods are rather slow, there is growing interest in detection and quantification using molecular methods. The droplet digital polymerase chain reaction (ddPCR) is a relatively new PCR method for absolute and accurate quantification without external standards. Using the Listeria monocytogenes specific prfA assay, we focused on the questions of whether the assay was directly transferable to ddPCR and whether ddPCR was suitable for samples derived from heterogeneous matrices, such as foodstuffs that often included inhibitors and a non-target bacterial background flora. Although the prfA assay showed suboptimal cluster formation, use of ddPCR for quantification of L. monocytogenes from pure bacterial cultures, artificially contaminated cheese, and naturally contaminated foodstuff was satisfactory over a relatively broad dynamic range. Moreover, results demonstrated the outstanding detection limit of one copy. However, while poorer DNA quality, such as resulting from longer storage, can impair ddPCR, internal amplification control (IAC) of prfA by ddPCR, that is integrated in the genome of L. monocytogenes ΔprfA, showed even slightly better quantification over a broader dynamic range. Graphical Abstract Evaluating the absolute quantification potential of ddPCR targeting Listeria monocytogenes prfA.

  3. Ectopic expression of specific GA2 oxidase mutants promotes yield and stress tolerance in rice.

    Science.gov (United States)

    Lo, Shuen-Fang; Ho, Tuan-Hua David; Liu, Yi-Lun; Jiang, Mirng-Jier; Hsieh, Kun-Ting; Chen, Ku-Ting; Yu, Lin-Chih; Lee, Miin-Huey; Chen, Chi-Yu; Huang, Tzu-Pi; Kojima, Mikiko; Sakakibara, Hitoshi; Chen, Liang-Jwu; Yu, Su-May

    2017-07-01

    A major challenge of modern agricultural biotechnology is the optimization of plant architecture for enhanced productivity, stress tolerance and water use efficiency (WUE). To optimize plant height and tillering that directly link to grain yield in cereals and are known to be tightly regulated by gibberellins (GAs), we attenuated the endogenous levels of GAs in rice via its degradation. GA 2-oxidase (GA2ox) is a key enzyme that inactivates endogenous GAs and their precursors. We identified three conserved domains in a unique class of C 20 GA2ox, GA2ox6, which is known to regulate the architecture and function of rice plants. We mutated nine specific amino acids in these conserved domains and observed a gradient of effects on plant height. Ectopic expression of some of these GA2ox6 mutants moderately lowered GA levels and reprogrammed transcriptional networks, leading to reduced plant height, more productive tillers, expanded root system, higher WUE and photosynthesis rate, and elevated abiotic and biotic stress tolerance in transgenic rice. Combinations of these beneficial traits conferred not only drought and disease tolerance but also increased grain yield by 10-30% in field trials. Our studies hold the promise of manipulating GA levels to substantially improve plant architecture, stress tolerance and grain yield in rice and possibly in other major crops. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  4. Site-specific proteolytic degradation of IgG monoclonal antibodies expressed in tobacco plants.

    Science.gov (United States)

    Hehle, Verena K; Lombardi, Raffaele; van Dolleweerd, Craig J; Paul, Mathew J; Di Micco, Patrizio; Morea, Veronica; Benvenuto, Eugenio; Donini, Marcello; Ma, Julian K-C

    2015-02-01

    Plants are promising hosts for the production of monoclonal antibodies (mAbs). However, proteolytic degradation of antibodies produced both in stable transgenic plants and using transient expression systems is still a major issue for efficient high-yield recombinant protein accumulation. In this work, we have performed a detailed study of the degradation profiles of two human IgG1 mAbs produced in plants: an anti-HIV mAb 2G12 and a tumour-targeting mAb H10. Even though they use different light chains (κ and λ, respectively), the fragmentation pattern of both antibodies was similar. The majority of Ig fragments result from proteolytic degradation, but there are only a limited number of plant proteolytic cleavage events in the immunoglobulin light and heavy chains. All of the cleavage sites identified were in the proximity of interdomain regions and occurred at each interdomain site, with the exception of the VL /CL interface in mAb H10 λ light chain. Cleavage site sequences were analysed, and residue patterns characteristic of proteolytic enzymes substrates were identified. The results of this work help to define common degradation events in plant-produced mAbs and raise the possibility of predicting antibody degradation patterns 'a priori' and designing novel stabilization strategies by site-specific mutagenesis. © 2014 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

  5. Uptake and Metabolism of Antibiotics Roseoflavin and 8-Demethyl-8-Aminoriboflavin in Riboflavin-Auxotrophic Listeria monocytogenes.

    Science.gov (United States)

    Matern, Andreas; Pedrolli, Danielle; Großhennig, Stephanie; Johansson, Jörgen; Mack, Matthias

    2016-12-01

    The riboflavin analogs roseoflavin (RoF) and 8-demethyl-8-aminoriboflavin (AF) are produced by the bacteria Streptomyces davawensis and Streptomyces cinnabarinus Riboflavin analogs have the potential to be used as broad-spectrum antibiotics, and we therefore studied the metabolism of riboflavin (vitamin B 2 ), RoF, and AF in the human pathogen Listeria monocytogenes, a bacterium which is a riboflavin auxotroph. We show that the L. monocytogenes protein Lmo1945 is responsible for the uptake of riboflavin, RoF, and AF. Following import, these flavins are phosphorylated/adenylylated by the bifunctional flavokinase/flavin adenine dinucleotide (FAD) synthetase Lmo1329 and adenylylated by the unique FAD synthetase Lmo0728, the first monofunctional FAD synthetase to be described in bacteria. Lmo1329 generates the cofactors flavin mononucleotide (FMN) and FAD, whereas Lmo0728 produces FAD only. The combined activities of Lmo1329 and Lmo0728 are responsible for the intracellular formation of the toxic cofactor analogs roseoflavin mononucleotide (RoFMN), roseoflavin adenine dinucleotide (RoFAD), 8-demethyl-8-aminoriboflavin mononucleotide (AFMN), and 8-demethyl-8-aminoriboflavin adenine dinucleotide (AFAD). In vivo reporter gene assays and in vitro transcription/translation experiments show that the L. monocytogenes FMN riboswitch Rli96, which controls expression of the riboflavin transport gene lmo1945, is negatively affected by riboflavin/FMN and RoF/RoFMN but not by AF/AFMN. Treatment of L. monocytogenes with RoF or AF leads to drastically reduced FMN/FAD levels. We suggest that the reduced flavin cofactor levels in combination with concomitant synthesis of inactive cofactor analogs (RoFMN, RoFAD, AFMN, and AFAD) explain why RoF and AF contribute to antibiotic activity in L. monocytogenes IMPORTANCE: The riboflavin analogs roseoflavin (RoF) and 8-demethyl-8-aminoriboflavin (AF) are small molecules which are produced by Streptomyces davawensis and Streptomyces cinnabarinus

  6. An Effective Counterselection System for Listeria monocytogenes and Its Use To Characterize the Monocin Genomic Region of Strain 10403S.

    Science.gov (United States)

    Argov, Tal; Rabinovich, Lev; Sigal, Nadejda; Herskovits, Anat A

    2017-03-15

    Construction of Listeria monocytogenes mutants by allelic exchange has been laborious and time-consuming due to lack of proficient selection markers for the final recombination event, that is, a marker conveying substance sensitivity to the bacteria bearing it, enabling the exclusion of merodiploids and selection for plasmid loss. In order to address this issue, we engineered a counterselection marker based on a mutated phenylalanyl-tRNA synthetase gene ( pheS* ). This mutation renders the phenylalanine-binding site of the enzyme more promiscuous and allows the binding of the toxic p -chloro-phenylalanine analog ( p -Cl-phe) as a substrate. When pheS* is introduced into L. monocytogenes and highly expressed under control of a constitutively active promoter, the bacteria become sensitive to p -Cl-phe supplemented in the medium. This enabled us to utilize pheS* as a negative selection marker and generate a novel, efficient suicide vector for allelic exchange in L. monocytogenes We used this vector to investigate the monocin genomic region in L. monocytogenes strain 10403S by constructing deletion mutants of the region. We have found this region to be active and to cause bacterial lysis upon mitomycin C treatment. The future applications of such an effective counterselection system, which does not require any background genomic alterations, are vast, as it can be modularly used in various selection systems (e.g., genetic screens). We expect this counterselection marker to be a valuable genetic tool in research on L. monocytogenes IMPORTANCE L. monocytogenes is an opportunistic intracellular pathogen and a widely studied model organism. An efficient counterselection marker is a long-standing need in Listeria research for improving the ability to design and perform various genetic manipulations and screening systems for different purposes. We report the construction and utilization of an efficient suicide vector for allelic exchange which can be conjugated, leaves no

  7. Distinct cell-specific expression of homospermidine synthase involved in pyrrolizidine alkaloid biosynthesis in three species of the boraginales.

    Science.gov (United States)

    Niemüller, Daniel; Reimann, Andreas; Ober, Dietrich

    2012-07-01

    Homospermidine synthase (HSS) is the first specific enzyme in pyrrolizidine alkaloid (PA) biosynthesis, a pathway involved in the plant's chemical defense. HSS has been shown to be recruited repeatedly by duplication of a gene involved in primary metabolism. Within the lineage of the Boraginales, only one gene duplication event gave rise to HSS. Here, we demonstrate that the tissue-specific expression of HSS in three boraginaceous species, Heliotropium indicum, Symphytum officinale, and Cynoglossum officinale, is unique with respect to plant organ, tissue, and cell type. Within H. indicum, HSS is expressed exclusively in nonspecialized cells of the lower epidermis of young leaves and shoots. In S. officinale, HSS expression has been detected in the cells of the root endodermis and in leaves directly underneath developing inflorescences. In young roots of C. officinale, HSS is detected only in cells of the endodermis, but in a later developmental stage, additionally in the pericycle. The individual expression patterns are compared with those within the Senecioneae lineage (Asteraceae), where HSS expression is reproducibly found in specific cells of the endodermis and the adjacent cortex parenchyma of the roots. The individual expression patterns within the Boraginales species are discussed as being a requirement for the successful recruitment of HSS after gene duplication. The diversity of HSS expression within this lineage adds a further facet to the already diverse patterns of expression that have been observed for HSS in other PA-producing plant lineages, making this PA-specific enzyme one of the most diverse expressed proteins described in the literature.

  8. Development of a GAL4-VP16/UAS trans-activation system for tissue specific expression in Medicago truncatula.

    Directory of Open Access Journals (Sweden)

    Amélie Sevin-Pujol

    Full Text Available Promoters with tissue-specific activity are very useful to address cell-autonomous and non cell autonomous functions of candidate genes. Although this strategy is widely used in Arabidopsis thaliana, its use to study tissue-specific regulation of root symbiotic interactions in legumes has only started recently. Moreover, using tissue specific promoter activity to drive a GAL4-VP16 chimeric transcription factor that can bind short upstream activation sequences (UAS is an efficient way to target and enhance the expression of any gene of interest. Here, we developed a collection of promoters with different root cell layers specific activities in Medicago truncatula and tested their abilities to drive the expression of a chimeric GAL4-VP16 transcription factor in a trans-activation UAS: β-Glucuronidase (GUS reporter gene system. By developing a binary vector devoted to modular Golden Gate cloning together with a collection of adapted tissue specific promoters and coding sequences we could test the activity of four of these promoters in trans-activation GAL4/UAS systems and compare them to "classical" promoter GUS fusions. Roots showing high levels of tissue specific expression of the GUS activity could be obtained with this trans-activation system. We therefore provide the legume community with new tools for efficient modular Golden Gate cloning, tissue specific expression and a trans-activation system. This study provides the ground work for future development of stable transgenic lines in Medicago truncatula.

  9. Dyslexia risk variant rs600753 is linked with dyslexia-specific differential allelic expression of DYX1C1

    Directory of Open Access Journals (Sweden)

    Bent Müller

    2018-02-01

    Full Text Available Abstract An increasing number of genetic variants involved in dyslexia development were discovered during the last years, yet little is known about the molecular functional mechanisms of these SNPs. In this study we investigated whether dyslexia candidate SNPs have a direct, disease-specific effect on local expression levels of the assumed target gene by using a differential allelic expression assay. In total, 12 SNPs previously associated with dyslexia and related phenotypes were suitable for analysis. Transcripts corresponding to four SNPs were sufficiently expressed in 28 cell lines originating from controls and a family affected by dyslexia. We observed a significant effect of rs600753 on expression levels of DYX1C1 in forward and reverse sequencing approaches. The expression level of the rs600753 risk allele was increased in the respective seven cell lines from members of the dyslexia family which might be due to a disturbed transcription factor binding sites. When considering our results in the context of neuroanatomical dyslexia-specific findings, we speculate that this mechanism may be part of the pathomechanisms underlying the dyslexia-specific brain phenotype. Our results suggest that allele-specific DYX1C1 expression levels depend on genetic variants of rs600753 and contribute to dyslexia. However, these results are preliminary and need replication.

  10. Expression analysis of five tobacco EIN3 family members in relation to tissue-specific ethylene responses.

    Science.gov (United States)

    Rieu, I; Mariani, C; Weterings, K

    2003-10-01

    Ethylene induces different sets of genes in different tissues and at different stages of development. To investigate whether these differential responses are caused by differential expression of members of the EIN3 family transcription factors, five tobacco family members were isolated. They can be divided into three subgroups, which is probably due to the amphidiploid nature of tobacco. In phylogenetic analysis, each of the subgroups clustered with one of the three tomato EIL proteins and all NtEILs proved to be most homologous to Arabidopsis EIN3 and EIL1. Although organ-specific ethylene responses have been observed before, northern blot analysis showed that all NtEILs were expressed in all organs. To study differential NtEIL expression at the cellular level, in situ hybridization was used on the tobacco ovary. It was found that different ovary tissues displayed variable ethylene-induced expression of two ethylene-responsive marker genes. By contrast, no differences were found in expression level or tissue-specificity for any of the NtEILs in the ovary, before or after ethylene treatment. This indicates that the organ and tissue-specific ethylene responses are not caused by differential expression of NtEIL family members. These results support a model in which the developmental signals that regulate the tissue-specific responses are integrated with the ethylene signal downstream of a common primary ethylene-signalling pathway.

  11. Epstein-Barr virus nuclear antigen 2 specifically induces expression of the B-cell activation antigen CD23

    International Nuclear Information System (INIS)

    Wang, F.; Gregory, C.D.; Rowe, M.; Rickinson, A.B.; Wang, D.; Birkenbach, M.; Kikutani, H.; Kishimoto, T.; Kieff, E.

    1987-01-01

    Epstein-Barr virus (EBV) infection of EBV-negative Burkitt lymphoma (BL) cells includes some changes similar to those seen in normal B lymphocytes that have been growth transformed by EBV. The role of individual EBV genes in this process was evaluated by introducing each of the viral genes that are normally expressed in EBV growth-transformed and latently infected lymphoblasts into an EBV-negative BL cell line, using recombinant retrovirus-mediated transfer. Clones of cells were derived that stably express the EBV nuclear antigen 1 (EBNA-1), EBNA-2, EBNA-3, EBNA-leader protein, or EBV latent membrane protein (LMP). These were compared with control clones infected with the retrovirus vector. All 10 clones converted to EBNA-2 expression differed from control clones or clones expressing other EBV proteins by growth in tight clumps and by markedly increased expression of one particular surface marker of B-cell activation, CD23. Other activation antigens were unaffected by EBNA-2 expression, as were markers already expressed on the parent BL cell line. The results indicate that EBNA-2 is a specific direct or indirect trans-activator of CD23. This establishes a link between an EBV gene and cell gene expression. Since CD23 has been implicated in the transduction of B-cell growth signals, its specific induction by EBNA-2 could be important in EBV induction of B-lymphocyte transformation

  12. Growth inhibition of Listeria monocytogenes by a nonbacteriocinogenic Carnobacterium piscicola

    DEFF Research Database (Denmark)

    Nilsson, Lilian; Bech Hansen, T.; Garrido, P.

    2005-01-01

    Aims: This study elucidates the mechanisms by which a nonbacteriocinogenic Carnobacterium piscicola inhibits growth of Listeria monocytogenes. Methods and Results: Listeria monocytogenes was exposed to live cultures of a bacteriocin-negative variant of C. piscicola A9b in co-culture, in a diffusion...... chamber system, and to a cell-free supernatant. Suppression of maximum cell density (0-3.5 log units) of L. monocytogenes was proportional to initial levels of C. pisciola (10(3)-10(7) CFU ml(-1)). Cell-to-cell contact was not required to cause inhibition. The cell-free C. piscicola supernatant caused...... a decrease in L. monocytogenes maximum cell density, which was abolished by glucose addition but not by amino acid, vitamin or mineral addition. The fermentate also gave rise to a longer lag phase and a reduction in growth rate. These effects were independent of glucose and may have been caused by acetate...

  13. Allele-specific gene expression patterns in primary leukemic cells reveal regulation of gene expression by CpG site methylation

    DEFF Research Database (Denmark)

    Milani, Lili; Lundmark, Anders; Nordlund, Jessica

    2008-01-01

    To identify genes that are regulated by cis-acting functional elements in acute lymphoblastic leukemia (ALL) we determined the allele-specific expression (ASE) levels of 2, 529 genes by genotyping a genome-wide panel of single nucleotide polymorphisms in RNA and DNA from bone marrow and blood...

  14. Brn3a regulates neuronal subtype specification in the trigeminal ganglion by promoting Runx expression during sensory differentiation

    Directory of Open Access Journals (Sweden)

    Raisa Eng S

    2010-01-01

    Full Text Available Abstract The transcription factor Brn3a, product of the pou4f1 gene, is expressed in most sensory neurons throughout embryogenesis. Prior work has demonstrated a role for Brn3a in the repression of early neurogenic genes; here we describe a second major role for Brn3a in the specification of sensory subtypes in the trigeminal ganglion (TG. Sensory neurons initially co-express multiple Trk-family neurotrophin receptors, but are later marked by the unique expression of TrkA, TrkB or TrkC. Maturation of these sensory subtypes is known to depend on the expression of Runx transcription factors. Newborn Brn3a knockout mice fail to express TrkC, which is associated in the TG with mechanoreceptors, plus a set of functional genes associated with nociceptor subtypes. In embryonic Brn3a-/- ganglia, the normal expression of Runx3 is never initiated in TrkC+ neurons, and Runx1 expression is greatly attenuated in TrkA+ nociceptors. These changes are accompanied by expanded expression of TrkB in neurons that abnormally express multiple Trks, followed by the loss of TrkC and TrkA expression. In transgenic embryos expressing a Brn3a-VP16 dominant transactivator, Runx3 mRNA expression is increased, suggesting that it is a direct regulatory target of Brn3a. Chromatin immunoprecipitation confirms that Brn3a binds in vivo to a conserved upstream enhancer element within histone H3-acetylated chromatin in the Runx3 locus. Together these data show that Brn3a acts upstream of the Runx factors, which then repress TrkB expression to allow establishment of the non-overlapping Trk receptor profiles and correct terminally differentiated phenotypes.

  15. A robust approach to identifying tissue-specific gene expression regulatory variants using personalized human induced pluripotent stem cells.

    Directory of Open Access Journals (Sweden)

    Je-Hyuk Lee

    2009-11-01

    Full Text Available Normal variation in gene expression due to regulatory polymorphisms is often masked by biological and experimental noise. In addition, some regulatory polymorphisms may become apparent only in specific tissues. We derived human induced pluripotent stem (iPS cells from adult skin primary fibroblasts and attempted to detect tissue-specific cis-regulatory variants using in vitro cell differentiation. We used padlock probes and high-throughput sequencing for digital RNA allelotyping and measured allele-specific gene expression in primary fibroblasts, lymphoblastoid cells, iPS cells, and their differentiated derivatives. We show that allele-specific expression is both cell type and genotype-dependent, but the majority of detectable allele-specific expression loci remains consistent despite large changes in the cell type or the experimental condition following iPS reprogramming, except on the X-chromosome. We show that our approach to mapping cis-regulatory variants reduces in vitro experimental noise and reveals additional tissue-specific variants using skin-derived human iPS cells.

  16. LISTERIA MONOCYTOGENES RISK EVALUATION IN READY TO EAT DELI PRODUCTS

    Directory of Open Access Journals (Sweden)

    T Civera

    2013-02-01

    Full Text Available Listeria monocytogenes has become one of the major concerns for food safety. Its ability to survive and replicate at low temperature, pH and high salt concentration, makes the bacterium a threat, mostly for RTE products. For these reasons, the present research was aimed at detecting the ability of growth of L. monocytogenes in RTE products retrieved from one deli store. Samples were analysed for L. monocytogenes detection, then inoculated with the pathogen (105cell/ml and stored at refrigeration temperature for the duration of their shelf-life (15-60 days. In all the products L. monocytogenes was not detected before experimental contamination. The challenge test evidenced that experimentally inoculated L. monocytogenes was not able to multiply for the duration of the entire shelf-life. These results indicated that the tested products could be considered as foods which are not able to support the growth of L. monocytogenes, as indicated by E.C. Regulation 2073/05. However, in order to guarantee consumer’s safety, it needs to be emphasized the need of a correct application of the GMPs, required for lowering the risk of initial contamination.

  17. Behaviour of Listeria monocytogenes in packaged fresh mushrooms (Agaricus bisporus).

    Science.gov (United States)

    González-Fandos, E; Olarte, C; Giménez, M; Sanz, S; Simón, A

    2001-11-01

    The aim of this study was to evaluate the potential of Listeria monocytogenes to grow in mushrooms packaged in two different types of PVC films when stored at 4 degrees C and 10 degrees C. Mushrooms were packed in two polymeric films (perforated and nonperforated PVC) and stored at 4 degrees C and 10 degrees C. The carbon dioxide and oxygen content inside the packages, aerobic mesophiles, psychrotrophs, Pseudomonas spp., Listeria monocytogenes, faecal coliforms, Escherichia coli, anaerobic spores and major sensory factors were determined. The mushrooms packaged in nonperforated film and stored at 4 degrees C had the most desirable quality parameters (texture, development stage and absence of moulds). Listeria monocytogenes was able to grow at 4 degrees C and 10 degrees C in inoculated mushrooms packaged in perforated and nonperforated films between 1 and 2 log units during the first 48 h. After 10 d of storage, the populations of L. monocytogenes were higher in mushrooms packaged in nonperforated film and stored at 10 degrees C. MAP followed by storage at 4 degrees C or 10 degrees C extends the shelf life by maintaining an acceptable appearance, but allows the growth and survival of L. monocytogenes. According to this study additional hurdles must be studied in order to prevent the growth of L. monocytogenes.

  18. Listeria monocytogenes, a down-to-earth pathogen.

    Science.gov (United States)

    Vivant, Anne-Laure; Garmyn, Dominique; Piveteau, Pascal

    2013-01-01

    Listeria monocytogenes is the causative agent of the food-borne life threatening disease listeriosis. This pathogenic bacterium received much attention in the endeavor of deciphering the cellular mechanisms that underlie the onset of infection and its ability to adapt to the food processing environment. Although information is available on the presence of L. monocytogenes in many environmental niches including soil, water, plants, foodstuff and animals, understanding the ecology of L. monocytogenes in outdoor environments has received less attention. Soil is an environmental niche of pivotal importance in the transmission of this bacterium to plants and animals. Soil composition, microbial communities and macrofauna are extrinsic edaphic factors that direct the fate of L. monocytogenes in the soil environment. Moreover, farming practices may further affect its incidence. The genome of L. monocytogenes presents an extensive repertoire of genes encoding transport proteins and regulators, a characteristic of the genome of ubiquitous bacteria. Postgenomic analyses bring new insights in the process of soil adaptation. In the present paper focussing on soil, we review these extrinsic and intrinsic factors that drive environmental adaptation of L. monocytogenes.

  19. Biofilm Formation of Listeria monocytogenes on Various Surfaces

    Directory of Open Access Journals (Sweden)

    M Mahdavi

    2007-10-01

    Full Text Available Introduction & Objective: Listeria monocytogenes is considered as a ubiquitous foodborne pathogen which can lead to serious infections, especially in newborns, elderly, pregnant, and immunocompromised people. The organism has been isolated from many foods and may cause meningitis, septicemia and abortion in pregnant women. Also L. monocytogenes forms biofilms on many food contact surface materials and medical devices. Development of biofilms on many surfaces is a potential source of contamination of foods that may lead to spoilage or transmission of foodborne pathogens. Materials & Methods: Biofilm formation of L. monocytogenes (RITCC 1293 serotype 4a was investigated. Hydrophobicity of L. monocytogenes was measured by MATH method. Then biofilm formation of the organism was assessed at 2, 4, 8, 16 and 20 hours on stainless steel (type 304 no 2B, polyethylene and glass by drop plate method. Results: Results indicated that L. monocytogenes with 85% of hydrophobicity formed biofilm on each of three surfaces. Biofilm formation on stainless steel surfaces was significantly more than other surfaces (p<0.05. Conclusion: The ability of biofilm formation of L. monocytogenes on medical devices and food containers is very important as far as hygiene and disease outbreaks are concerned.

  20. Inhibition of sortase A by chalcone prevents Listeria monocytogenes infection.

    Science.gov (United States)

    Li, Hongen; Chen, Yutao; Zhang, Bing; Niu, Xiaodi; Song, Meng; Luo, Zhaoqing; Lu, Gejin; Liu, Bowen; Zhao, Xiaoran; Wang, Jianfeng; Deng, Xuming

    2016-04-15

    The critical role of sortase A in gram-positive bacterial pathogenicity makes this protein a good potential target for antimicrobial therapy. In this study, we report for the first time the crystal structure of Listeria monocytogenes sortase A and identify the active sites that mediate its transpeptidase activity. We also used a sortase A (SrtA) enzyme activity inhibition assay, simulation, and isothermal titration calorimetry analysis to discover that chalcone, an agent with little anti-L. monocytogenes activity, could significantly inhibit sortase A activity with an IC50 of 28.41 ± 5.34 μM by occupying the active site of SrtA. The addition of chalcone to a co-culture of L. monocytogenes and Caco-2 cells significantly inhibited bacterial entry into the cells and L. monocytogenes-mediated cytotoxicity. Additionally, chalcone treatment decreased the mortality of infected mice, the bacterial burden in target organs, and the pathological damage to L. monocytogenes-infected mice. In conclusion, these findings suggest that chalcone is a promising candidate for the development of treatment against L. monocytogenes infection. Copyright © 2016 Elsevier Inc. All rights reserved.

  1. A case of bovine raw milk contamination with Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Hunt Karen

    2012-07-01

    Full Text Available Abstract During routine sampling of bulk raw milk on a dairy farm, the pathogenic bacteria Listeria monocytogenes was found to be a contaminant, at numbers L. monocytogenes, indicating a possible case of excretion of the L. monocytogenes directly into the milk. Milk samples were collected from the individual cows and analysed, resulting in the identification of L. monocytogenes excretion (at 280 cfu/ml from one of the 4 mammary quarters of one dairy cow out of 180. When the infected cow was isolated from the herd, no L. monocytogenes was detected from the remaining herd. The pulsed-field gel electrophoresis pattern of the strain from the individual cow was indistinguishable from that originally isolated from the bulk milk. The infected cow did not show any clinical signs of disease, nor did the appearance of the milk have any physical abnormalities. Antibiotic treatment of the infected mammary quarter was found to be ineffective. This study shows that there can be risks associated with direct contamination of raw milk with L. monocytogenes.

  2. Allele-specific expression in the germline of patients with familial pancreatic cancer: An unbiased approach to cancer gene discovery

    OpenAIRE

    Tan, Aik Choon; Fan, Jian-Bing; Karikari, Collins; Bibikova, Marina; Garcia, Eliza Wickham; Zhou, Lixin; Barker, David; Serre, David; Feldmann, Georg; Hruban, Ralph H.; Klein, Alison P.; Goggins, Michael; Couch, Fergus J.; Hudson, Thomas J.; Winslow, Raimond L.

    2007-01-01

    Physiologic allele-specific expression (ASE) in germline tissues occurs during random X-chromosome inactivation1 and in genomic imprinting,2 wherein the two alleles of a gene in a heterozygous individual are not expressed equally. Recent studies have confirmed the existence of ASE in apparently non-imprinted autosomal genes;3–14 however, the extent of ASE in the human genome is unknown. We explored ASE in lymphoblastoid cell lines of 145 individuals using an oligonucleotide array based assay....

  3. Distinct expression of muscle-specific microRNAs (myomirs) in brown adipocytes

    DEFF Research Database (Denmark)

    Walden, Tomas B; Timmons, James A; Keller, Pernille

    2009-01-01

    MicroRNAs, a novel class of post-transcriptional gene regulators, have been demonstrated to be involved in several cellular processes regulating the expression of protein-coding genes. Here we examine murine white and brown primary cell cultures for differential expression of miRNAs. The adipogen......MicroRNAs, a novel class of post-transcriptional gene regulators, have been demonstrated to be involved in several cellular processes regulating the expression of protein-coding genes. Here we examine murine white and brown primary cell cultures for differential expression of mi...

  4. In the eye of the beholder? Universality and cultural specificity in the expression and perception of emotion.

    Science.gov (United States)

    Scherer, Klaus R; Clark-Polner, Elizabeth; Mortillaro, Marcello

    2011-12-01

    Do members of different cultures express (or "encode") emotions in the same fashion? How well can members of distinct cultures recognize (or "decode") each other's emotion expressions? The question of cultural universality versus specificity in emotional expression has been a hot topic of debate for more than half a century, but, despite a sizeable amount of empirical research produced to date, no convincing answers have emerged. We suggest that this unsatisfactory state of affairs is due largely to a lack of concern with the precise mechanisms involved in emotion expression and perception, and propose to use a modified Brunswikian lens model as an appropriate framework for research in this area. On this basis we provide a comprehensive review of the existing literature and point to research paradigms that are likely to provide the evidence required to resolve the debate on universality vs. cultural specificity of emotional expression. Applying this fresh perspective, our analysis reveals that, given the paucity of pertinent data, no firm conclusions can be drawn on actual expression (encoding) patterns across cultures (although there appear to be more similarities than differences), but that there is compelling evidence for intercultural continuity in decoding, or recognition, ability. We also note a growing body of research on the notion of ingroup advantage due to expression "dialects," above and beyond the general encoding or decoding patterns. We furthermore suggest that these empirical patterns could be explained by both universality in the underlying mechanisms and cultural specificity in the input to, and the regulation of, these expression and perception mechanisms. Overall, more evidence is needed, both to further elucidate these mechanisms and to inventory the patterns of cultural effects. We strongly recommend using more solid conceptual and theoretical perspectives, as well as more ecologically valid approaches, in designing future studies in emotion

  5. Expression of Panton-Valentine leukocidin mRNA among Staphylococcus aureus isolates associates with specific clinical presentations.

    Directory of Open Access Journals (Sweden)

    Fangyou Yu

    Full Text Available Panton-Valentine leukocidin (PVL; gene designation lukF/S-PV is likely an important virulence factor for Staphylococcus aureus (S. aureus, as qualitative expression of the protein correlates with severity for specific clinical presentations, including skin and soft tissue infections (SSTIs. Development of genetic approaches for risk-assessment of patients with S. aureus infections may prove clinically useful, and whether lukF/S-PV gene expression correlates with specific clinical presentations for S. aureus has been largely unexplored. In the present study, we quantified lukS-PV mRNA among 96 S. aureus isolates to determine whether expression levels correlated with specific clinical presentations in adults and children. Expression level of lukS-PV mRNA among isolates from skin and soft tissue infections (SSTIs was significantly greater than among isolates from blood stream infection (BSIs, and expression level of lukS-PV mRNA among BSI isolates from children was significantly greater than for BSI isolates among adults. Moreover, expression level of lukS-PV mRNA among community-acquired (CA isolates was significantly greater than for hospital-acquired (HA isolates. These data justify additional studies to determine the potential clinical utility for lukS-PV mRNA quantification as a predictive tool for severity of S. aureus infection.

  6. How to measure RNA expression in rare senescent cells expressing any specific protein such as p16Ink4a.

    Science.gov (United States)

    Jeyapalan, Jessie C; Sedivy, John M

    2013-02-01

    Here we describe a carefully optimized method for the preparation of high quality RNA by flow sorting of formaldehyde fixed senescent cells immunostained for any intracellular antigen. Replicative cellular senescence is a phenomenon of irreversible growth arrest triggered by the accumulation of a discrete number of cell divisions. The underlying cause of senescence due to replicative exhaustion is telomere shortening. We document here a spontaneous and apparently stochastic process that continuously generates senescent cells in cultures fully immortalized with telomerase. In the course of studying this phenomenon we developed a preparative fluorescence activated flow sorting method based on immunofluorescent staining of intracellular antigens that can also deliver RNA suitable for quantitative analysis of global gene expression. The protocols were developed using normal human diploid fibroblasts (HDF) and up to 5x107 cells could be conveniently processed in a single experiment. The methodology is based on formaldehyde crosslinking of cells, followed by permeabilization, antibody staining, flow sorting, reversal of the crosslinks, and recovery of the RNA. We explored key parameters such as crosslink reversal that affect the fragmentation of RNA. The recovered RNA is of high quality for downstream molecular applications based on short range sequence analysis, such qPCR, hybridization microarrays, and next generation sequencing. The RNA was analyzed by Affymetrix Gene Chip expression profiling and compared to RNA prepared by the direct lysis of cells. The correlation between the data sets was very high, indicating that the procedure does not introduce systematic changes in the mRNA transcriptome. The methods presented in this communication should be of interest to many investigators working in diverse model systems.

  7. Prevalence of Listeria monocytogenes in European cheeses

    DEFF Research Database (Denmark)

    Martinez Rios, Veronica; Dalgaard, Paw

    2017-01-01

    , respectively, pasteurized or un-pasteurized milk. Data from a total of 130,604 samples were analysed. Mean prevalence for presence during 2005-2015 estimated from scientific literature (2.3% with confidence interval (CI): 1.4-3.8%) was more than three times higher than results from EFSA reports (0.7%; CI: 0.......05) for cheeses produced from pasteurized (0.9%; CI: 0.4-1.9%) or un-pasteurized (1.0%; CI: 0.4-2.2%) milk. For cheese samples reported by EFSA 0.2% CI: 0.1-0.4% had concentration of L. monocytogenes above the critical European limits of 100 cfu/g. In addition, this systematic review focused on groups...

  8. Sensitivity of Listeria monocytogenes to irradiation

    International Nuclear Information System (INIS)

    Tarjan, Veronika

    1990-01-01

    Irradiation of Listeria monocytogenes (L.m.) was carried out in culture media and pork meat paste at room temperature with 60 Co radiation source of 6.6 kGy h -1 dose rate. The employed doses were 0, 0.5, 1, 2, 3, 4 and 6 kGy. One strain out of 3 survived as high as 4 kGy irradiation. Radiation with 2 kGy resulted 7 log cycles reduction of cell count. After lower irradiation doses the L.m. count decreased in proportion to increasing doses. It has been concluded that L.m. compared with Gram-negative pathogens, are less sensitive to irradiation. (author) 6 refs.; 4 figs

  9. Use of results of microbiological analyses for risk-based control of Listeria monocytogenes in marinated broiler legs.

    Science.gov (United States)

    Aarnisalo, Kaarina; Vihavainen, Elina; Rantala, Leila; Maijala, Riitta; Suihko, Maija-Liisa; Hielm, Sebastian; Tuominen, Pirkko; Ranta, Jukka; Raaska, Laura

    2008-02-10

    Microbial risk assessment provides a means of estimating consumer risks associated with food products. The methods can also be applied at the plant level. In this study results of microbiological analyses were used to develop a robust single plant level risk assessment. Furthermore, the prevalence and numbers of Listeria monocytogenes in marinated broiler legs in Finland were estimated. These estimates were based on information on the prevalence, numbers and genotypes of L. monocytogenes in 186 marinated broiler legs from 41 retail stores. The products were from three main Finnish producers, which produce 90% of all marinated broiler legs sold in Finland. The prevalence and numbers of L. monocytogenes were estimated by Monte Carlo simulation using WinBUGS, but the model is applicable to any software featuring standard probability distributions. The estimated mean annual number of L. monocytogenes-positive broiler legs sold in Finland was 7.2x10(6) with a 95% credible interval (CI) 6.7x10(6)-7.7x10(6). That would be 34%+/-1% of the marinated broiler legs sold in Finland. The mean number of L. monocytogenes in marinated broiler legs estimated at the sell-by-date was 2 CFU/g, with a 95% CI of 0-14 CFU/g. Producer-specific L. monocytogenes strains were recovered from the products throughout the year, which emphasizes the importance of characterizing the isolates and identifying strains that may cause problems as part of risk assessment studies. As the levels of L. monocytogenes were low, the risk of acquiring listeriosis from these products proved to be insignificant. Consequently there was no need for a thorough national level risk assessment. However, an approach using worst-case and average point estimates was applied to produce an example of single producer level risk assessment based on limited data. This assessment also indicated that the risk from these products was low. The ris