WorldWideScience

Sample records for monocytogenes expressing specific

  1. Analytical bioconjugates, aptamers, enable specific quantitative detection of Listeria monocytogenes.

    Science.gov (United States)

    Lee, Sang-Hee; Ahn, Ji-Young; Lee, Kyeong-Ah; Um, Hyun-Ju; Sekhon, Simranjeet Singh; Sun Park, Tae; Min, Jiho; Kim, Yang-Hoon

    2015-06-15

    As a major human pathogen in the Listeria genus, Listeria monocytogenes causes the bacterial disease listeriosis, which is a serious infection caused by eating food contaminated with the bacteria. We have developed an aptamer-based sandwich assay (ABSA) platform that demonstrates a promising potential for use in pathogen detection using aptamers as analytical bioconjugates. The whole-bacteria SELEX (WB-SELEX) strategy was adopted to generate aptamers with high affinity and specificity against live L. monocytogenes. Of the 35 aptamer candidates tested, LMCA2 and LMCA26 reacted to L. monocytogenes with high binding, and were consequently chosen as sensing probes. The ABSA platform can significantly enhance the sensitivity by employing a very specific aptamer pair for the sandwich complex. The ABSA platform exhibited a linear response over a wide concentration range of L. monocytogenes from 20 to 2×10(6) CFU per mL and was closely correlated with the following relationship: y=9533.3x+1542.3 (R(2)=0.99). Our proposed ABSA platform also provided excellent specificity for the tests to distinguish L. monocytogenes from other Listeria species and other bacterial genera (3 Listeria spp., 4 Salmonella spp., 2 Vibrio spp., 3 Escherichia coli and 3 Shigella spp.). Improvements in the sensitivity and specificity have not only facilitated the reliable detection of L. monocytogenes at extremely low concentrations, but also allowed for the development of a 96-well plate-based routine assay platform for multivalent diagnostics. Copyright © 2015 Elsevier B.V. All rights reserved.

  2. Recombinant Probiotic Expressing Listeria Adhesion Protein Attenuates Listeria monocytogenes Virulence In Vitro

    Science.gov (United States)

    Koo, Ok Kyung; Amalaradjou, Mary Anne Roshni; Bhunia, Arun K.

    2012-01-01

    Background Listeria monocytogenes, an intracellular foodborne pathogen, infects immunocompromised hosts. The primary route of transmission is through contaminated food. In the gastrointestinal tract, it traverses the epithelial barrier through intracellular or paracellular routes. Strategies to prevent L. monocytogenes entry can potentially minimize infection in high-risk populations. Listeria adhesion protein (LAP) aids L. monocytogenes in crossing epithelial barriers via the paracellular route. The use of recombinant probiotic bacteria expressing LAP would aid targeted clearance of Listeria from the gut and protect high-risk populations from infection. Methodology/Principal Findings The objective was to investigate the ability of probiotic bacteria or LAP-expressing recombinant probiotic Lactobacillus paracasei (LbpLAP) to prevent L. monocytogenes adhesion, invasion, and transwell-based transepithelial translocation in a Caco-2 cell culture model. Several wild type probiotic bacteria showed strong adhesion to Caco-2 cells but none effectively prevented L. monocytogenes infection. Pre-exposure to LbpLAP for 1, 4, 15, or 24 h significantly (Pmonocytogenes in Caco-2 cells, whereas pre-exposure to parental Lb. paracasei had no significant effect. Similarly, LbpLAP pre-exposure reduced L. monocytogenes translocation by as much as 46% after 24 h. LbpLAP also prevented L. monocytogenes-mediated cell damage and compromise of tight junction integrity. Furthermore, LbpLAP cells reduced L. monocytogenes-mediated cell cytotoxicity by 99.8% after 1 h and 79% after 24 h. Conclusions/Significance Wild type probiotic bacteria were unable to prevent L. monocytogenes infection in vitro. In contrast, LbpLAP blocked adhesion, invasion, and translocation of L. monocytogenes by interacting with host cell receptor Hsp60, thereby protecting cells from infection. These data show promise for the use of recombinant probiotics in preventing L. monocytogenes infection in high

  3. L-glutamine Induces Expression of Listeria monocytogenes Virulence Genes

    Science.gov (United States)

    Lobel, Lior; Burg-Golani, Tamar; Sigal, Nadejda; Rose, Jessica; Livnat-Levanon, Nurit; Lewinson, Oded; Herskovits, Anat A.

    2017-01-01

    The high environmental adaptability of bacteria is contingent upon their ability to sense changes in their surroundings. Bacterial pathogen entry into host poses an abrupt and dramatic environmental change, during which successful pathogens gauge multiple parameters that signal host localization. The facultative human pathogen Listeria monocytogenes flourishes in soil, water and food, and in ~50 different animals, and serves as a model for intracellular infection. L. monocytogenes identifies host entry by sensing both physical (e.g., temperature) and chemical (e.g., metabolite concentrations) factors. We report here that L-glutamine, an abundant nitrogen source in host serum and cells, serves as an environmental indicator and inducer of virulence gene expression. In contrast, ammonia, which is the most abundant nitrogen source in soil and water, fully supports growth, but fails to activate virulence gene transcription. We demonstrate that induction of virulence genes only occurs when the Listerial intracellular concentration of L-glutamine crosses a certain threshold, acting as an on/off switch: off when L-glutamine concentrations are below the threshold, and fully on when the threshold is crossed. To turn on the switch, L-glutamine must be present, and the L-glutamine high affinity ABC transporter, GlnPQ, must be active. Inactivation of GlnPQ led to complete arrest of L-glutamine uptake, reduced type I interferon response in infected macrophages, dramatic reduction in expression of virulence genes, and attenuated virulence in a mouse infection model. These results may explain observations made with other pathogens correlating nitrogen metabolism and virulence, and suggest that gauging of L-glutamine as a means of ascertaining host localization may be a general mechanism. PMID:28114430

  4. Lineage specific recombination rates and microevolution in Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Nightingale Kendra K

    2008-10-01

    Full Text Available Abstract Background The bacterium Listeria monocytogenes is a saprotroph as well as an opportunistic human foodborne pathogen, which has previously been shown to consist of at least two widespread lineages (termed lineages I and II and an uncommon lineage (lineage III. While some L. monocytogenes strains show evidence for considerable diversification by homologous recombination, our understanding of the contribution of recombination to L. monocytogenes evolution is still limited. We therefore used STRUCTURE and ClonalFrame, two programs that model the effect of recombination, to make inferences about the population structure and different aspects of the recombination process in L. monocytogenes. Analyses were performed using sequences for seven loci (including the house-keeping genes gap, prs, purM and ribC, the stress response gene sigB, and the virulence genes actA and inlA for 195 L. monocytogenes isolates. Results Sequence analyses with ClonalFrame and the Sawyer's test showed that recombination is more prevalent in lineage II than lineage I and is most frequent in two house-keeping genes (ribC and purM and the two virulence genes (actA and inlA. The relative occurrence of recombination versus point mutation is about six times higher in lineage II than in lineage I, which causes a higher genetic variability in lineage II. Unlike lineage I, lineage II represents a genetically heterogeneous population with a relatively high proportion (30% average of genetic material imported from external sources. Phylograms, constructed with correcting for recombination, as well as Tajima's D data suggest that both lineages I and II have suffered a population bottleneck. Conclusion Our study shows that evolutionary lineages within a single bacterial species can differ considerably in the relative contributions of recombination to genetic diversification. Accounting for recombination in phylogenetic studies is critical, and new evolutionary models that

  5. Characterization of a Mutant Listeria monocytogenes Strain Expressing Green Fluorescent Protein

    Institute of Scientific and Technical Information of China (English)

    Ling-Li JIANG; Hou-Hui SONG; Xue-Yan CHEN; Chun-Lin KE; Jing-Jing XU; Ning CHEN; Wei-Huan FANG

    2005-01-01

    To construct a recombinant strain of Listeria monocytogenes for the expression of heterologous genes, homologous recombination was utilized for insertional mutation, targeting its listeriolysin O gene(hly). The gene encoding green fluorescent protein (GFP) was used as the indicator of heterologous gene expression. The gene gfp was inserted into hly downstream from its promoter and signal sequence by an overlapping extension polymerase chain reaction, and was then cloned into the shuttle plasmid pKSV7 for allelic exchange with the L. monocytogenes chromosome. Homologous recombination was achieved by growing the electro-transformed L. monocytogenes cells on chloramphenicol plates at a non-permissive temperature.Sequencing analysis indicated correct insertion of the target gene in-frame with the signal sequence. The recombinant strain expressed GFP constitutively as revealed by fluorescence microscopy. The mutant strain L. monocytogenes hly-gfp lost its hemolytic activity as visualized on the blood agar or when analyzed with the culture supernatant samples. Such insertional mutation resulted in a reduced virulence of about 2 logs less than its parent strain L. monocytogenes 10403s as shown by the 50%-lethal-dose assays in the mouse and embryonated chicken egg models. These results thus demonstrate that mutated L. monocytogenes could be a potential carrier for the expression of heterologous passenger genes or could act as an indicator organism in the food industry.

  6. Specific antibody-receptor interactions trigger InlAB-independent uptake of listeria monocytogenes into tumor cell lines

    Directory of Open Access Journals (Sweden)

    Hotz Christian

    2011-07-01

    Full Text Available Abstract Background Specific cell targeting is an important, yet unsolved problem in bacteria-based therapeutic applications, like tumor or gene therapy. Here, we describe the construction of a novel, internalin A and B (InlAB-deficient Listeria monocytogenes strain (Lm-spa+, which expresses protein A of Staphylococcus aureus (SPA and anchors SPA in the correct orientation on the bacterial cell surface. Results This listerial strain efficiently binds antibodies allowing specific interaction of the bacterium with the target recognized by the antibody. Binding of Trastuzumab (Herceptin® or Cetuximab (Erbitux® to Lm-spa+, two clinically approved monoclonal antibodies directed against HER2/neu and EGFR/HER1, respectively, triggers InlAB-independent internalization into non-phagocytic cancer cell lines overexpressing the respective receptors. Internalization, subsequent escape into the host cell cytosol and intracellular replication of these bacteria are as efficient as of the corresponding InlAB-positive, SPA-negative parental strain. This specific antibody/receptor-mediated internalization of Lm-spa+ is shown in the murine 4T1 tumor cell line, the isogenic 4T1-HER2 cell line as well as the human cancer cell lines SK-BR-3 and SK-OV-3. Importantly, this targeting approach is applicable in a xenograft mouse tumor model after crosslinking the antibody to SPA on the listerial cell surface. Conclusions Binding of receptor-specific antibodies to SPA-expressing L. monocytogenes may represent a promising approach to target L. monocytogenes to host cells expressing specific receptors triggering internalization.

  7. Deregulation of Listeria monocytogenes virulence gene expression by two distinct and semi-independent pathways.

    Science.gov (United States)

    Milenbachs Lukowiak, Andrea; Mueller, Kimberly J; Freitag, Nancy E; Youngman, Philip

    2004-02-01

    Expression of the major virulence cluster in Listeria monocytogenes is positively regulated by the transcription factor PrfA and is influenced by several environmental factors, including the presence of readily metabolized carbohydrates such as cellobiose and glucose. Although little is understood about the mechanisms through which environmental factors influence expression of the PrfA regulon, evidence for structural and functional similarities of PrfA to the CRP-FNR family of regulatory proteins suggests the possibility that PrfA activity could be modulated by a small molecule ligand. The identity of components of the PrfA-associated regulatory pathway was sought through the isolation of mutants that exhibit high levels of PrfA-controlled gene expression in the presence of cellobiose or glucose. Here are described the properties and preliminary genetic analysis in two different genetic loci, gcr and csr, both unlinked by general transduction to the major virulence cluster. A mutation in gcr deregulates the expression of PrfA-controlled genes in the presence of several repressing sugars and other environmental conditions, a phenotype similar to that of a G145S substitution in PrfA itself. A mutation in the csr locus, within csrA, results in a cellobiose-specific defect in virulence gene regulation. Gene products encoded by the csr locus share homology with proteins involved in the sensing and transport of beta-glucosides in other bacteria. Mutations in both gcr and csr are required for full relief of cellobiose-mediated repression of the PrfA regulon. These results suggest the existence of two semi-independent pathways for cellobiose-mediated repression and further reconcile conflicting reports in previous literature concerning the repressive effects of carbohydrates on virulence gene expression in L. monocytogenes.

  8. Changes in Gene Expression during Adaptation of Listeria monocytogenes to the Soil Environment

    Science.gov (United States)

    Piveteau, Pascal; Depret, Géraldine; Pivato, Barbara; Garmyn, Dominique; Hartmann, Alain

    2011-01-01

    Listeria monocytogenes is a ubiquitous opportunistic pathogen responsible for listeriosis. In order to study the processes underlying its ability to adapt to the soil environment, whole-genome arrays were used to analyse transcriptome modifications 15 minutes, 30 minutes and 18 h after inoculation of L. monocytogenes EGD-e in soil extracts. Growth was observed within the first day of incubation and large numbers were still detected in soil extract and soil microcosms one year after the start of the experiment. Major transcriptional reprofiling was observed. Nutrient acquisition mechanisms (phosphoenolpyruvate-dependent phosphotransferase systems and ABC transporters) and enzymes involved in catabolism of specific carbohydrates (β-glucosidases; chitinases) were prevalent. This is consistent with the overrepresentation of the CodY regulon that suggests that in a nutrient depleted environment, L. monocytogenes recruits its extensive repertoire of transporters to acquire a range of substrates for energy production. PMID:21966375

  9. Influence of sublethal concentrations of common disinfectants on expression of virulence genes in Listeria monocytogenes

    DEFF Research Database (Denmark)

    Kastbjerg, Vicky Gaedt; Larsen, M. H.; Gram, Lone

    2010-01-01

    Listeria monocytogenes is a food-borne human pathogen that causes listeriosis, a relatively rare infection with a high fatality rate. The regulation of virulence gene expression is influenced by several environmental factors, and the aim of the present study was to determine how disinfectants used...... routinely in the food industry affect the expression of different virulence genes in L. monocytogenes when added at sublethal concentrations. An agar-based assay was developed to screen the effect of disinfectants on virulence gene promoter expression and was validated at the transcriptional level...... by Northern blot analysis. Eleven disinfectants representing four different groups of active components were evaluated in this study. Disinfectants with the same active ingredients had a similar effect on gene expression. Peroxy and chlorine compounds reduced the expression of the virulence genes...

  10. RNA- and protein-mediated control of Listeria monocytogenes virulence gene expression

    Science.gov (United States)

    Lebreton, Alice; Cossart, Pascale

    2017-01-01

    ABSTRACT The model opportunistic pathogen Listeria monocytogenes has been the object of extensive research, aiming at understanding its ability to colonize diverse environmental niches and animal hosts. Bacterial transcriptomes in various conditions reflect this efficient adaptability. We review here our current knowledge of the mechanisms allowing L. monocytogenes to respond to environmental changes and trigger pathogenicity, with a special focus on RNA-mediated control of gene expression. We highlight how these studies have brought novel concepts in prokaryotic gene regulation, such as the ‘excludon’ where the 5′-UTR of a messenger also acts as an antisense regulator of an operon transcribed in opposite orientation, or the notion that riboswitches can regulate non-coding RNAs to integrate complex metabolic stimuli into regulatory networks. Overall, the Listeria model exemplifies that fine RNA tuners act together with master regulatory proteins to orchestrate appropriate transcriptional programmes. PMID:27217337

  11. Highly specific fiber optic immunosensor coupled with immunomagnetic separation for detection of low levels of Listeria monocytogenes and L. ivanovii

    Science.gov (United States)

    2012-01-01

    Background Immunomagnetic separation (IMS) and immunoassays are widely used for pathogen detection. However, novel technology platforms with highly selective antibodies are essential to improve detection sensitivity, specificity and performance. In this study, monoclonal antibodies (MAbs) against Internalin A (InlA) and p30 were generated and used on paramagnetic beads of varying diameters for concentration, as well as on fiber-optic sensor for detection. Results Anti-InlA MAb-2D12 (IgG2a subclass) was specific for Listeria monocytogenes and L. ivanovii, and p30-specific MAb-3F8 (IgM) was specific for the genus Listeria. At all bacterial concentrations (103–108 CFU/mL) tested in the IMS assay; the 1-μm diameter MyOne beads had significantly higher capture efficiency (P Listeria antibody (9 %). Furthermore, capture efficiency for MyOne-2D12 was highly specific for L. monocytogenes and L. ivanovii. Subsequently, we captured L. monocytogenes by MyOne-2D12 and MyOne-3F8 from hotdogs inoculated with mono- or co-cultures of L. monocytogenes and L. innocua (10–40 CFU/g), enriched for 18 h and detected by fiber-optic sensor and confirmed by plating, light-scattering, and qPCR assays. The detection limit for L. monocytogenes and L. ivanovii by the fiber-optic immunosensor was 3 × 102 CFU/mL using MAb-2D12 as capture and reporter antibody. Selective media plating, light-scattering, and qPCR assays confirmed the IMS and fiber-optic results. Conclusions IMS coupled with a fiber-optic sensor using anti-InlA MAb is highly specific for L. monocytogenes and L. ivanovii and enabled detection of these pathogens at low levels from buffer or food. PMID:23176167

  12. Identification of Conserved and Species-Specific Functions of the Listeria monocytogenes PrsA2 Secretion Chaperone

    Science.gov (United States)

    Cahoon, Laty A.

    2015-01-01

    The Gram-positive bacterium Listeria monocytogenes is a facultative intracellular pathogen that relies on the regulated secretion and activity of a variety of proteins that sustain life within diverse environments. PrsA2 has recently been identified as a secreted peptidyl-prolyl cis/trans isomerase and chaperone that is dispensable for bacterial growth in broth culture but essential for L. monocytogenes virulence. Following host infection, PrsA2 contributes to the proper folding and activity of secreted proteins that are required for bacterial replication within the host cytosol and for bacterial spread to adjacent cells. PrsA2 is one member of a family of Gram-positive secretion chaperones that appear to play important roles in bacterial physiology; however, it is not known how these proteins recognize their substrate proteins or the degree to which their function is conserved across diverse Gram-positive species. We therefore examined PrsA proteins encoded by a variety of Gram-positive bacteria for functional complementation of L. monocytogenes mutants lacking prsA2. PrsA homologues encoded by Bacillus subtilis, Streptococcus pyogenes, Streptococcus pneumoniae, Streptococcus mutans, Staphylococcus aureus, and Lactococcus lactis were examined for functional complementation of a variety of L. monocytogenes PrsA2-associated phenotypes central to L. monocytogenes pathogenesis and bacterial cell physiology. Our results indicate that while selected aspects of PrsA2 function are broadly conserved among diverse Gram-positive bacteria, PrsA2 exhibits unique specificity for L. monocytogenes target proteins required for pathogenesis. The L. monocytogenes PrsA2 chaperone thus appears evolutionarily optimized for virulence factor secretion within the host cell cytosol while still maintaining aspects of activity relevant to more general features of Gram-positive protein translocation. PMID:26216425

  13. Development and validation of an antigen capture ELISA based on monoclonal antibodies specific for Listeria monocytogenes in food

    Directory of Open Access Journals (Sweden)

    Rossella Lelli

    2011-09-01

    Full Text Available A capture enzyme-linked immunosorbent assay (ELISA for the identification of Listeria monocytogenes in food was standardised and validated. The assay was refined by analysing samples of meat, seafood, dairy products, pasta and flour. The method was found to be 100% specific for Listeria spp. tested, with a limit of sensitivity of 6.6 × 10(3 colony-forming units (cfu/ml. Comparison of L. monocytogenes capture ELISA against the official International Organization for Standardization (ISO method 11290-1:1996 for the isolation and identification of L. monocytogenes in food matrices produced a significant concordance index. The assay was validated on food matrices including meat, seafood and dairy products in line with ISO 16140:2003 concerning qualitative analytical methods. The assay was found to be accurate, specific, sensitive, selective, reproducible and fast, resulting in lower costs and faster turnaround in microbiological screening of foods.

  14. Chitinase expression in Listeria monocytogenes is positively regulated by the Agr system.

    Directory of Open Access Journals (Sweden)

    Dafni Katerina Paspaliari

    Full Text Available The food-borne pathogen Listeria monocytogenes encodes two chitinases, ChiA and ChiB, which allow the bacterium to hydrolyze chitin, the second most abundant polysaccharide in nature. Intriguingly, despite the absence of chitin in human and mammalian hosts, both of the chitinases have been deemed important for infection, through a mechanism that, at least in the case of ChiA, involves modulation of host immune responses. In this study, we show that the expression of the two chitinases is subject to regulation by the listerial agr system, a homologue of the agr quorum-sensing system of Staphylococcus aureus, that has so far been implicated in virulence and biofilm formation. We demonstrate that in addition to these roles, the listerial agr system is required for efficient chitin hydrolysis, as deletion of agrD, encoding the putative precursor of the agr autoinducer, dramatically decreased chitinolytic activity on agar plates. Agr was specifically induced in response to chitin addition in stationary phase and agrD was found to regulate the amount of chiA, but not chiB, transcripts. Although the transcript levels of chiB did not depend on agrD, the extracellular protein levels of both chitinases were reduced in the ΔagrD mutant. The regulatory effect of agr on chiA is potentially mediated through the small RNA LhrA, which we show here to be negatively regulated by agr. LhrA is in turn known to repress chiA translation by binding to the chiA transcript and interfering with ribosome recruitment. Our results highlight a previously unrecognized role of the agr system and suggest that autoinducer-based regulation of chitinolytic systems may be more commonplace than previously thought.

  15. Gene expression in Listeria monocytogenes exposed to sublethal concentration of benzalkonium chloride.

    Science.gov (United States)

    Tamburro, Manuela; Ripabelli, Giancarlo; Vitullo, Monia; Dallman, Timothy James; Pontello, Mirella; Amar, Corinne Francoise Laurence; Sammarco, Michela Lucia

    2015-06-01

    In this study, tolerance at sublethal concentration of benzalkonium chloride and transcription levels of mdrL, ladR, lde, sigB and bcrABC genes in Listeria monocytogenes strains were evaluated. Viable cells reduction occurred in 45% of strains and clinical isolates showed lower sensitivity than isolates from foods. An increased transcription of an efflux system encoding gene was found in 60% of strains, and simultaneous mdrL overexpression and ladR underexpression occurred in 30% of isolates. A significant association between reduced benzalkonium chloride activity and both mdrL and sigB overexpression was observed; sigB expression also correlated with both mdrL and ladR genes. The bcrABC gene was only found in six strains, all isolated from foods and sensitive to benzalkonium chloride, and in four strains an underexpression was observed. Disinfection at sublethal concentration was less effective in clinical isolates, and mdrL and sigB expression was significantly affected by disinfection. Further insights are needed to understand the adaptation to benzalkonium chloride and to evaluate whether changes in gene expression could affect the L. monocytogenes virulence traits and persistence in the environment.

  16. Genome-wide analyses reveal lineage specific contributions of positive selection and recombination to the evolution of Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Sun Qi

    2008-08-01

    Full Text Available Abstract Background The genus Listeria includes two closely related pathogenic and non-pathogenic species, L. monocytogenes and L. innocua. L. monocytogenes is an opportunistic human foodborne and animal pathogen that includes two common lineages. While lineage I is more commonly found among human listeriosis cases, lineage II appears to be overrepresented among isolates from foods and environmental sources. This study used the genome sequences for one L. innocua strain and four L. monocytogenes strains representing lineages I and II, to characterize the contributions of positive selection and recombination to the evolution of the L. innocua/L. monocytogenes core genome. Results Among the 2267 genes in the L. monocytogenes/L. innocua core genome, 1097 genes showed evidence for recombination and 36 genes showed evidence for positive selection. Positive selection was strongly associated with recombination. Specifically, 29 of the 36 genes under positive selection also showed evidence for recombination. Recombination was more common among isolates in lineage II than lineage I; this trend was confirmed by sequencing five genes in a larger isolate set. Positive selection was more abundant in the ancestral branch of lineage II (20 genes as compared to the ancestral branch of lineage I (9 genes. Additional genes under positive selection were identified in the branch separating the two species; for this branch, genes in the role category "Cell wall and membrane biogenesis" were significantly more likely to have evidence for positive selection. Positive selection of three genes was confirmed in a larger isolate set, which also revealed occurrence of multiple premature stop codons in one positively selected gene involved in flagellar motility (flaR. Conclusion While recombination and positive selection both contribute to evolution of L. monocytogenes, the relative contributions of these evolutionary forces seem to differ by L. monocytogenes lineages and

  17. Highly specific fiber optic immunosensor coupled with immunomagnetic separation for detection of low levels of Listeria monocytogenes and L. ivanovii

    Directory of Open Access Journals (Sweden)

    Mendonça Marcelo

    2012-11-01

    Full Text Available Abstract Background Immunomagnetic separation (IMS and immunoassays are widely used for pathogen detection. However, novel technology platforms with highly selective antibodies are essential to improve detection sensitivity, specificity and performance. In this study, monoclonal antibodies (MAbs against Internalin A (InlA and p30 were generated and used on paramagnetic beads of varying diameters for concentration, as well as on fiber-optic sensor for detection. Results Anti-InlA MAb-2D12 (IgG2a subclass was specific for Listeria monocytogenes and L. ivanovii, and p30-specific MAb-3F8 (IgM was specific for the genus Listeria. At all bacterial concentrations (103–108 CFU/mL tested in the IMS assay; the 1-μm diameter MyOne beads had significantly higher capture efficiency (P 5 CFU/mL was significantly higher (P Listeria antibody (9 %. Furthermore, capture efficiency for MyOne-2D12 was highly specific for L. monocytogenes and L. ivanovii. Subsequently, we captured L. monocytogenes by MyOne-2D12 and MyOne-3F8 from hotdogs inoculated with mono- or co-cultures of L. monocytogenes and L. innocua (10–40 CFU/g, enriched for 18 h and detected by fiber-optic sensor and confirmed by plating, light-scattering, and qPCR assays. The detection limit for L. monocytogenes and L. ivanovii by the fiber-optic immunosensor was 3 × 102 CFU/mL using MAb-2D12 as capture and reporter antibody. Selective media plating, light-scattering, and qPCR assays confirmed the IMS and fiber-optic results. Conclusions IMS coupled with a fiber-optic sensor using anti-InlA MAb is highly specific for L. monocytogenes and L. ivanovii and enabled detection of these pathogens at low levels from buffer or food.

  18. The MogR Transcriptional Repressor Regulates Nonhierarchal Expression of Flagellar Motility Genes and Virulence in Listeria monocytogenes.

    Directory of Open Access Journals (Sweden)

    2006-04-01

    Full Text Available Flagella are surface structures critical for motility and virulence of many bacterial species. In Listeria monocytogenes, MogR tightly represses expression of flagellin (FlaA during extracellular growth at 37 degrees C and during intracellular infection. MogR is also required for full virulence in a murine model of infection. Using in vitro and in vivo infection models, we determined that the severe virulence defect of MogR-negative bacteria is due to overexpression of FlaA. Specifically, overproduction of FlaA in MogR-negative bacteria caused pleiotropic defects in bacterial division (chaining phenotype, intracellular spread, and virulence in mice. DNA binding and microarray analyses revealed that MogR represses transcription of all known flagellar motility genes by binding directly to a minimum of two TTTT-N(5-AAAA recognition sites positioned within promoter regions such that RNA polymerase binding is occluded. Analysis of MogR protein levels demonstrated that modulation of MogR repression activity confers the temperature-specificity to flagellar motility gene expression. Epistasis analysis revealed that MogR repression of transcription is antagonized in a temperature-dependent manner by the DegU response regulator and that DegU further regulates FlaA levels through a posttranscriptional mechanism. These studies provide the first known example to our knowledge of a transcriptional repressor functioning as a master regulator controlling nonhierarchal expression of flagellar motility genes.

  19. Expression of virulence-related genes in Listeria monocytogenes grown on Danish hard cheese as affected by NaCl content

    DEFF Research Database (Denmark)

    Larsen, Nadja; Jespersen, Lene

    2015-01-01

    Expression of virulence-related genes in Listeria monocytogenes incubated on cheese was assessed by real-time quantitative polymerase chain reaction. The objective of the study was to investigate the impact of sodium chloride concentration in cheese on transcription of virulence genes and, thereby......, virulence potential of L. monocytogenes. The expression studies were performed with L. monocytogenes strains characterized by different tolerance to salt stress. Strains ATCC(®) 51779 and DSMZ 15675 were incubated on the Danish hard-cheese type Samsoe, with low (high (3.6% [wt....../wt]) content of NaCl. Genes differentially expressed (p

  20. Differential gene expression and filamentation of Listeria monocytogenes 08-5923 exposed to sodium lactate and sodium diacetate.

    Science.gov (United States)

    Liu, Xiaoji; Basu, Urmila; Miller, Petr; McMullen, Lynn M

    2017-05-01

    This study reports the gene expression and filamentation in Listeria monocytogenes 08-5923 following exposure to food preservatives sodium lactate (NaL) and sodium diacetate (SD). L. monocytogenes 08-5923 was challenged with a mixture of NaL/SD, NaL or sodium acetate at 37 °C in tryptic soy broth. In the initial study, L. monocytogenes 08-5923 was exposed to NaL/SD for 24 h. The transcriptome was investigated by RNA sequencing. A stress response network was discovered in L. monocytogenes 08-5923, which is mediated by genes encoding two-component systems (hisJ, lisK, OmpR family gene, resE) and RNA polymerase factors (sigC, sigH). NaL/SD resulted in the down-regulation of genes in glycolysis (pykA, eno, fbaA, pgm) and up-regulation of genes in DNA repair (radC), cell division (ftsE) and cell structure synthesis (flagella synthesis: flgK, fliF, fliD). Filamentation was monitored by flow cytometry. NaL/SD mixture resulted in filamentation in L. monocytogenes 08-5923. Longer exposure was required to induce filamentation in L. monocytogenes for SD (24 h) than for NaL (8 h) when cells were exposed to individual salt. The quantitative real time PCR analysis revealed the down-regulation of ftsE in filamented cells of Listeria exposed to NaL or sodium acetate. Copyright © 2016 Elsevier Ltd. All rights reserved.

  1. Receptor binding proteins of Listeria monocytogenes bacteriophages A118 and P35 recognize serovar-specific teichoic acids

    Energy Technology Data Exchange (ETDEWEB)

    Bielmann, Regula; Habann, Matthias; Eugster, Marcel R. [Institute of Food, Nutrition and Health, ETH Zurich, Schmelzbergstrasse 7, 8092 Zurich (Switzerland); Lurz, Rudi [Max-Planck Institute for Molecular Genetics, 14195 Berlin (Germany); Calendar, Richard [Department of Molecular and Cell Biology, University of California, Berkeley, CA 94720-3202 (United States); Klumpp, Jochen, E-mail: jochen.klumpp@hest.ethz.ch [Institute of Food, Nutrition and Health, ETH Zurich, Schmelzbergstrasse 7, 8092 Zurich (Switzerland); Loessner, Martin J. [Institute of Food, Nutrition and Health, ETH Zurich, Schmelzbergstrasse 7, 8092 Zurich (Switzerland)

    2015-03-15

    Adsorption of a bacteriophage to the host requires recognition of a cell wall-associated receptor by a receptor binding protein (RBP). This recognition is specific, and high affinity binding is essential for efficient virus attachment. The molecular details of phage adsorption to the Gram-positive cell are poorly understood. We present the first description of receptor binding proteins and a tail tip structure for the siphovirus group infecting Listeria monocytogenes. The host-range determining factors in two phages, A118 and P35 specific for L. monocytogenes serovar 1/2 have been determined. Two proteins were identified as RBPs in phage A118. Rhamnose residues in wall teichoic acids represent the binding ligands for both proteins. In phage P35, protein gp16 could be identified as RBP and the role of both rhamnose and N-acetylglucosamine in phage adsorption was confirmed. Immunogold-labeling and transmission electron microscopy allowed the creation of a topological model of the A118 phage tail. - Highlights: • We present the first description of receptor binding proteins and a tail tip structure for the Siphovirus group infecting Listeria monocytogenes. • The host-range determining factors in two phages, A118 and P35 specific for L. monocytogenes serovar 1/2 have been determined. • Rhamnose residues in wall teichoic acids represent the binding ligands for both receptor binding proteins in phage A118. • Rhamnose and N-acetylglucosamine are required for adsorption of phage P35. • We preset a topological model of the A118 phage tail.

  2. Metabolic Genetic Screens Reveal Multidimensional Regulation of Virulence Gene Expression in Listeria monocytogenes and an Aminopeptidase That Is Critical for PrfA Protein Activation.

    Science.gov (United States)

    Friedman, Sivan; Linsky, Marika; Lobel, Lior; Rabinovich, Lev; Sigal, Nadejda; Herskovits, Anat A

    2017-06-01

    Listeria monocytogenes is an environmental saprophyte and intracellular bacterial pathogen. Upon invading mammalian cells, the bacterium senses abrupt changes in its metabolic environment, which are rapidly transduced to regulation of virulence gene expression. To explore the relationship between L. monocytogenes metabolism and virulence, we monitored virulence gene expression dynamics across a library of genetic mutants grown under two metabolic conditions known to activate the virulent state: charcoal-treated rich medium containing glucose-1-phosphate and minimal defined medium containing limiting concentrations of branched-chain amino acids (BCAAs). We identified over 100 distinct mutants that exhibit aberrant virulence gene expression profiles, the majority of which mapped to nonessential metabolic genes. Mutants displayed enhanced, decreased, and early and late virulence gene expression profiles, as well as persistent levels, demonstrating a high plasticity in virulence gene regulation. Among the mutants, one was noteworthy for its particularly low virulence gene expression level and mapped to an X-prolyl aminopeptidase (PepP). We show that this peptidase plays a role in posttranslational activation of the major virulence regulator, PrfA. Specifically, PepP mediates recruitment of PrfA to the cytoplasmic membrane, a step identified as critical for PrfA protein activation. This study establishes a novel step in the complex mechanism of PrfA activation and further highlights the cross regulation of metabolism and virulence. Copyright © 2017 American Society for Microbiology.

  3. Development of multiple strain competitive index assays for Listeria monocytogenes using pIMC; a new site-specific integrative vector

    Directory of Open Access Journals (Sweden)

    Cronin Michael

    2008-06-01

    Full Text Available Abstract Background The foodborne, gram-positive pathogen, Listeria monocytogenes, is capable of causing lethal infections in compromised individuals. In the post genomic era of L. monocytogenes research, techniques are required to identify and validate genes involved in the pathogenicity and environmental biology of the organism. The aim here was to develop a widely applicable method to tag L. monocytogenes strains, with a particular emphasis on the development of multiple strain competitive index assays. Results We have constructed a new site-specific integrative vector, pIMC, based on pPL2, for the selection of L. monocytogenes from complex samples. The pIMC vector was further modified through the incorporation of IPTG inducible markers (antibiotic and phenotypic to produce a suite of four vectors which allowed the discrimination of multiple strains from a single sample. We were able to perform murine infection studies with up to four EGDe isolates within a single mouse and showed that the tags did not impact upon growth rate or virulence. The system also allowed the identification of subtle differences in virulence between strains of L. monocytogenes commonly used in laboratory studies. Conclusion This study has developed a competitive index assay that can be broadly applied to all L. monocytogenes strains. Improved statistical robustness of the data was observed, resulting in fewer mice being required for virulence assays. The competitive index assays provide a powerful method to analyse the virulence or fitness of L. monocytogenes in complex biological samples.

  4. PXI Express specification tutorial

    Institute of Scientific and Technical Information of China (English)

    National Instruments

    2007-01-01

    @@ Introduction The PXI industry standard has quickly gained adoption and grown in prevalence in automated test systems since its release in 1998. PXI is being selected as the platform of choice for thousands of applications, from areas such as military and aerospace, consumer electronics, and communications, to process control and industrial automation. One of the key elements driving the rapid adoption of PXI is its use of PCI in the communication backplane. Now, as the commercial PC industry drastically improves the available bus bandwidth by evolving PCI to PCI Express, PXI has the ability to meet even more application needs by integrating PCI Express into the PXI standard.

  5. A small RNA controls expression of the chitinase ChiA in Listeria monocytogenes

    DEFF Research Database (Denmark)

    Nielsen, Jesper S; Larsen, Marianne Halberg; Lillebæk, Eva Maria Sternkopf

    2011-01-01

    role of LhrA in L. monocytogenes. To this end, we determined the effects of LhrA on global-wide gene expression. We observed that nearly 300 genes in L. monocytogenes are either positively or negatively affected by LhrA. Among these genes, we identified lmo0302 and chiA as direct targets of LhrA, thus......, and we provide evidence that both LhrA and Hfq act to down-regulate the expression of lmo0302 and chiA. Furthermore, in vitro binding experiments show that Hfq stimulates the base pairing of LhrA to chiA mRNA. Finally, we demonstrate that LhrA has a negative effect on the chitinolytic activity of L......In recent years, more than 60 small RNAs (sRNAs) have been identified in the gram-positive human pathogen Listeria monocytogenes, but their putative roles and mechanisms of action remain largely unknown. The sRNA LhrA was recently shown to be a post-transcriptional regulator of a single gene, lmo...

  6. Listeria monocytogenes Mutants Carrying Newcastle Disease Virus F Gene Fused to its actA and plcB: In vitro Expression and Immunogenicity in Chickens

    Institute of Scientific and Technical Information of China (English)

    Lingli JIANG; Chunlin KE; Jingjing XU; Jianshun CHEN; Xueyan CHEN; Ning CHEN; Jiangbing SHUAI; Weihuan FANG

    2007-01-01

    Recombinant Listeria monocytogenes mutants carrying Newcastle disease virus (NDV) fusion protein gene F were constructed by homologous recombination. NDV F or its truncated fragment Fa was used as the model heterologous gene to be integrated into actA or plcB downstream of their signal sequences.Correct orientation of the inserted genes was verified by polymerase chain reaction amplification of F or Fa.The inserted F and Fa were expressed in the two recombinants Lm-ΔactA-F and Lm-ΔplcB-Fa as shown by sodium dodecylsulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and Western blot. Both recombinants exhibited reduced virulence to embryonated eggs and mice by about 1.5-2.5 logs as compared with the parent wild strain 10403S. They were also less invasive than strain 10403S (P<0.05). Chickens receiving the recombinant strains orally or intraperitoneally were partially protected from virulent NDV challenge possibly due to enhancement of non-specific immunity because the antibody titers against the homologous virus strain or the recombinant truncated fusion protein were marginal. Further research is needed in other animal models to see if the low antibody response results from insufficient expression of the heterologous genes as a result of failure of L. monocytogenes or its recombinants to persist or replicate in chickens.

  7. Restriction fragment differential display of pediocin-resistant Listeria monocytogenes 412 mutants shows consistent overexpression of a putative beta-glucoside-specific PTS system.

    Science.gov (United States)

    Gravesen, A; Warthoe, P; Knochel, S; Thirstrup, K

    2000-06-01

    Pediocin PA-1, which is a bacteriocin produced by lactic acid bacteria, has potential as a biopreservative of food. However, such use may lead to the development of resistance in the target organism. Gene expression in two independent pediocin-resistant mutants of Listeria monocytogenes 412 was compared to the original isolate by restriction fragment differential display PCR (RFDD-PCR). This method amplifies cDNA restriction fragments under stringent PCR conditions, enabled by the use of specific primers complementary to ligated adaptor sequences. RFDD-PCR was very well suited for analysis of listerial gene expression, giving reproducible PCR product profiles. Three gene fragments having increased expression in both resistant mutants were identified. All three had homology to components of beta-glucoside-specific phosphoenolpyruvate-dependent phosphotransferase systems (PTS), one fragment having homology to enzyme II permeases, and the two others to phospho-beta-glucosidases. Overexpression of the putative PTS system was consistently observed in 10 additional pediocin-resistant mutants, isolated at different pH, salt content and temperature. The results suggest that RFDD-PCR is a strong approach for the analysis of prokaryotic gene expression and that the putative beta-glucoside-specific PTS system is involved in mediating pediocin resistance.

  8. Phage display-derived binders able to distinguish Listeria monocytogenes from other Listeria species.

    Directory of Open Access Journals (Sweden)

    Josephine Morton

    Full Text Available The objective of this study was to produce phage display-derived binders with the ability to distinguish Listeria monocytogenes from other Listeria spp., which may have potential utility to enhance detection of Listeria monocytogenes. To obtain binders with the desired binding specificity a series of surface and solution phage-display biopannings were performed. Initially, three rounds of surface biopanning against gamma-irradiated L. monocytogenes serovar 4b cells were performed followed by an additional surface biopanning round against L. monocytogenes 4b which included prior subtraction biopanning against gamma-irradiated L. innocua cells. In an attempt to further enhance binder specificity for L. monocytogenes 4b two rounds of solution biopanning were performed, both rounds included initial subtraction solution biopanning against L. innocua. Subsequent evaluations were performed on the phage clones by phage binding ELISA. All phage clones tested from the second round of solution biopanning had higher specificity for L. monocytogenes 4b than for L. innocua and three other foodborne pathogens (Salmonella spp., Escherichia coli and Campylobacter jejuni. Further evaluation with five other Listeria spp. revealed that one phage clone in particular, expressing peptide GRIADLPPLKPN, was highly specific for L. monocytogenes with at least 43-fold more binding capability to L. monocytogenes 4b than to any other Listeria sp. This proof-of-principle study demonstrates how a combination of surface, solution and subtractive biopanning was used to maximise binder specificity. L. monocytogenes-specific binders were obtained which could have potential application in novel detection tests for L. monocytogenes, benefiting both the food and medical industries.

  9. Phage display-derived binders able to distinguish Listeria monocytogenes from other Listeria species.

    Science.gov (United States)

    Morton, Josephine; Karoonuthaisiri, Nitsara; Charlermroj, Ratthaphol; Stewart, Linda D; Elliott, Christopher T; Grant, Irene R

    2013-01-01

    The objective of this study was to produce phage display-derived binders with the ability to distinguish Listeria monocytogenes from other Listeria spp., which may have potential utility to enhance detection of Listeria monocytogenes. To obtain binders with the desired binding specificity a series of surface and solution phage-display biopannings were performed. Initially, three rounds of surface biopanning against gamma-irradiated L. monocytogenes serovar 4b cells were performed followed by an additional surface biopanning round against L. monocytogenes 4b which included prior subtraction biopanning against gamma-irradiated L. innocua cells. In an attempt to further enhance binder specificity for L. monocytogenes 4b two rounds of solution biopanning were performed, both rounds included initial subtraction solution biopanning against L. innocua. Subsequent evaluations were performed on the phage clones by phage binding ELISA. All phage clones tested from the second round of solution biopanning had higher specificity for L. monocytogenes 4b than for L. innocua and three other foodborne pathogens (Salmonella spp., Escherichia coli and Campylobacter jejuni). Further evaluation with five other Listeria spp. revealed that one phage clone in particular, expressing peptide GRIADLPPLKPN, was highly specific for L. monocytogenes with at least 43-fold more binding capability to L. monocytogenes 4b than to any other Listeria sp. This proof-of-principle study demonstrates how a combination of surface, solution and subtractive biopanning was used to maximise binder specificity. L. monocytogenes-specific binders were obtained which could have potential application in novel detection tests for L. monocytogenes, benefiting both the food and medical industries.

  10. Expression of mptC of Listeria monocytogenes induces sensitivity to class IIa bacteriocins in Lactococcus lactis.

    Science.gov (United States)

    Ramnath, Manilduth; Arous, Safia; Gravesen, Anne; Hastings, John W; Héchard, Yann

    2004-08-01

    Sensitivity to class IIa bacteriocins from lactic acid bacteria was recently associated with the mannose phosphotransferase system (PTS) permease, in Listeria monocytogenes. To assess the involvement of this protein complex in class IIa bacteriocin activity, the mptACD operon, encoding, was heterologously expressed in an insensitive species, namely Lactococcus lactis, using the NICE double plasmid system. Upon induction of the cloned operon, the recombinant Lc. lactis became sensitive to leucocin A. Pediocin PA-1 and enterocin A also showed inhibitory activity against Lc. lactis cultures expressing mptACD. Furthermore, the role of the three genes of the mptACD operon was investigated. Derivative plasmids containing various combinations of these three genes were made from the parental mptACD plasmid by divergent PCR. The results showed that expression of mptC alone is sufficient to confer sensitivity to class IIa bacteriocins in Lc. lactis.

  11. The expression of superoxide dismutase (SOD) and a putative ABC transporter permease is inversely correlated during biofilm formation in Listeria monocytogenes 4b G

    Science.gov (United States)

    Little is known about the molecular basis of biofilm formation in Listeria monocytogenes. The superoxide dismutase (SOD) of the deletion mutant of lm.G_1771 gene, which encodes for a putative ABC_transporter permease, is highly expressed in biofilm. In this study, the sod gene deletion mutant delta ...

  12. Differential Gene Expression of Three Gene Targets among Persistent and Nonpersistent Listeria monocytogenes Strains in the Presence or Absence of Benzethonium Chloride.

    Science.gov (United States)

    Mazza, Roberta; Mazzette, Rina; McAuliffe, Olivia; Jordan, Kieran; Fox, Edward M

    2015-08-01

    Persistence of Listeria monocytogenes strains in food processing environments remains relatively common but is difficult to control. Understanding the basis for such persistence represents an important step in the potential control or eradication of this pathogen from these environments. In this study, reverse transcription PCR was used to determine the relative and absolute expression of selected gene targets (pocR, eutJ, and qacH) among five persistent and four presumed nonpersistent L. monocytogenes strains. The quantification of these genes as markers for the persistent phenotype and the effect of benzethonium chloride (BZT) on their expression was investigated. Although no markers correlated with the ability of strains to persist in food processing facilities were found, expression of pocR was upregulated in three of the five persistent strains, in contrast to the four presumed nonpersistent strains, which showed down-regulation of this gene. These results provide further knowledge of the differential expression of genes of persistent and presumed nonpersistent strains of L. monocytogenes grown in the presence or absence of BZT and identifies upregulation of pocR as a potential response of persistent strains of L. monocytogenes to exposure to BZT.

  13. Interleukin-22-Induced Antimicrobial Phospholipase A2 Group IIA Mediates Protective Innate Immunity of Nonhematopoietic Cells against Listeria monocytogenes.

    Science.gov (United States)

    Okita, Yamato; Shiono, Takeru; Yahagi, Ayano; Hamada, Satoru; Umemura, Masayuki; Matsuzaki, Goro

    2015-12-07

    Listeria monocytogenes is a bacterial pathogen which establishes intracellular parasitism in various cells, including macrophages and nonhematopoietic cells, such as hepatocytes. It has been reported that several proinflammatory cytokines have pivotal roles in innate protection against L. monocytogenes infection. We found that a proinflammatory cytokine, interleukin 22 (IL-22), was expressed by CD3(+) CD4(+) T cells at an early stage of L. monocytogenes infection in mice. To assess the influence of IL-22 on L. monocytogenes infection in hepatocytes, cells of a human hepatocellular carcinoma line, HepG2, were treated with IL-22 before L. monocytogenes infection in vitro. Gene expression analysis of the IL-22-treated HepG2 cells identified phospholipase A2 group IIA (PLA2G2A) as an upregulated antimicrobial molecule. Addition of recombinant PLA2G2A to the HepG2 culture significantly suppressed L. monocytogenes infection. Culture supernatant of the IL-22-treated HepG2 cells contained bactericidal activity against L. monocytogenes, and the activity was abrogated by a specific PLA2G2A inhibitor, demonstrating that HepG2 cells secreted PLA2G2A, which killed extracellular L. monocytogenes. Furthermore, colocalization of PLA2G2A and L. monocytogenes was detected in the IL-22-treated infected HepG2 cells, which suggests involvement of PLA2G2A in the mechanism of intracellular killing of L. monocytogenes by HepG2 cells. These results suggest that IL-22 induced at an early stage of L. monocytogenes infection enhances innate immunity against L. monocytogenes in the liver by stimulating hepatocytes to produce an antimicrobial molecule, PLA2G2A.

  14. Spontaneous nisin-resistant Listeria monocytogenes mutants with increased expression of a putative penicillin-binding protein and their sensitivity to various antibiotics.

    Science.gov (United States)

    Gravesen, A; Sørensen, K; Aarestrup, F M; Knøchel, S

    2001-01-01

    A concern regarding the use of bacteriocins, as for example the lantibiotic nisin, for biopreservation of certain food products is the possibility of resistance development and potential cross-resistance to antibiotics in the target organism. The genetic basis for nisin resistance development is as yet unknown. We analyzed changes in gene expression following nisin resistance development in Listeria monocytogenes 412 by restriction fragment differential display. The mutant had increased expression of a protein with strong homology to the glycosyltransferase domain of high-molecular-weight penicillin-binding proteins (PBPs), a histidine protein kinase, a protein of unknown function, and ClpB (putative functions from homology). The three former proteins had increased expression in a total of six out of 10 independent mutants originating from five different wild-type strains, indicating a prevalent nisin resistance mechanism under the employed isolation conditions. Increased expression of the putative PBP may affect the cell wall composition and thereby alter the sensitivity to cell wall-targeting compounds. The mutants had an isolate-specific increase in sensitivity to different beta-lactams and a slight decrease in sensitivity to another lantibiotic, mersacidin. A model incorporating these observations is proposed based on current knowledge of nisin's mode of action.

  15. The species-specific mode of action of the antimicrobial peptide subtilosin against Listeria monocytogenes Scott A

    NARCIS (Netherlands)

    Kuijk, van S.J.A.; Noll, K.S.; Chikindas, M.L.

    2012-01-01

    Aims: To elucidate the molecular mechanism of action of the antimicrobial peptide subtilosin against the foodborne pathogen Listeria monocytogenes Scott A. Methods and Results: Subtilosin was purified from a culture of Bacillus amylliquefaciens. The minimal inhibitory concentration of subtilosin aga

  16. Strand specific RNA-sequencing and membrane lipid profiling reveals growth phase-dependent cold stress response mechanisms in Listeria monocytogenes

    Science.gov (United States)

    Hingston, Patricia; Chen, Jessica; Allen, Kevin; Truelstrup Hansen, Lisbeth

    2017-01-01

    The human pathogen Listeria monocytogenes continues to pose a challenge in the food industry, where it is known to contaminate ready-to-eat foods and grow during refrigerated storage. Increased knowledge of the cold-stress response of this pathogen will enhance the ability to control it in the food-supply-chain. This study utilized strand-specific RNA sequencing and whole cell fatty acid (FA) profiling to characterize the bacterium’s cold stress response. RNA and FAs were extracted from a cold-tolerant strain at five time points between early lag phase and late stationary-phase, both at 4°C and 20°C. Overall, more genes (1.3×) were suppressed than induced at 4°C. Late stationary-phase cells exhibited the greatest number (n = 1,431) and magnitude (>1,000-fold) of differentially expressed genes (>2-fold, pmonocytogenes, the growth-phase dependency of its cold-stress regulon, and the active roles of antisense transcripts in regulating its cold stress response. PMID:28662112

  17. Gene expression profiling of a nisin-sensitive Listeria monocytogenes Scott A CtsR deletion mutant

    Science.gov (United States)

    Listeria monocytogenes is a food-borne pathogen of significant threat to public health. Nisin is the only bacteriocin that can be used as a food preservative. Due to its antimicrobial activity, it can be used to control Listeria monocytogenes in food; however, the antimicrobial mechanism of nisin ...

  18. Broad substrate specificity of phosphotransbutyrylase from Listeria monocytogenes: A potential participant in an alternative pathway for provision of acyl CoA precursors for fatty acid biosynthesis.

    Science.gov (United States)

    Sirobhushanam, Sirisha; Galva, Charitha; Sen, Suranjana; Wilkinson, Brian J; Gatto, Craig

    2016-09-01

    Listeria monocytogenes, the causative organism of the serious food-borne disease listeriosis, has a membrane abundant in branched-chain fatty acids (BCFAs). BCFAs are normally biosynthesized from branched-chain amino acids via the activity of branched chain α-keto acid dehydrogenase (Bkd), and disruption of this pathway results in reduced BCFA content in the membrane. Short branched-chain carboxylic acids (BCCAs) added as media supplements result in incorporation of BCFAs arising from the supplemented BCCAs in the membrane of L. monocytogenes bkd mutant MOR401. High concentrations of the supplements also effect similar changes in the membrane of the wild type organism with intact bkd. Such carboxylic acids clearly act as fatty acid precursors, and there must be an alternative pathway resulting in the formation of their CoA thioester derivatives. Candidates for this are the enzymes phosphotransbutyrylase (Ptb) and butyrate kinase (Buk), the products of the first two genes of the bkd operon. Ptb from L. monocytogenes exhibited broad substrate specificity, a strong preference for branched-chain substrates, a lack of activity with acetyl CoA and hexanoyl CoA, and strict chain length preference (C3-C5). Ptb catalysis involved ternary complex formation. Additionally, Ptb could utilize unnatural branched-chain substrates such as 2-ethylbutyryl CoA, albeit with lower efficiency, consistent with a potential involvement of this enzyme in the conversion of the carboxylic acid additives into CoA primers for BCFA biosynthesis. Published by Elsevier B.V.

  19. A Novel Mutation within the Central Listeria monocytogenes Regulator PrfA That Results in Constitutive Expression of Virulence Gene Products

    OpenAIRE

    Wong, Kendy K. Y.; Freitag, Nancy E.

    2004-01-01

    The PrfA protein of Listeria monocytogenes functions as a key regulatory factor for the coordinated expression of many virulence genes during bacterial infection of host cells. PrfA activity is controlled by multiple regulatory mechanisms, including an apparent requirement for either the presence of a cofactor or some form of posttranslational modification that regulates the activation of PrfA. In this study, we describe the identification and characterization of a novel PrfA mutation that re...

  20. Listeria monocytogenes and Salmonella enterica enteritidis biofilms susceptibility to different disinfectants and stress-response and virulence gene expression of surviving cells.

    Science.gov (United States)

    Rodrigues, Diana; Cerca, Nuno; Teixeira, Pilar; Oliveira, Rosário; Ceri, Howard; Azeredo, Joana

    2011-06-01

    Disinfection of food contact surfaces is a challenging task, aggravated by bacteria's capacity to survive and/or resist antimicrobials by means of mechanisms not yet completely understood. This work evaluated the susceptibility of Listeria monocytogenes and Salmonella enterica biofilms to four disinfectants, and analyzed how those chemical agents influenced stress-response and virulence genes expression by surviving cells. Three strains of each bacterial species mentioned were used, and their biofilms were treated with sodium hypochlorite, benzalkonium chloride, hydrogen peroxide, and triclosan using the Calgary Biofilm Device. Expression of L. monocytogenes and S. enterica stress-response genes cplC and ropS, and virulence genes prfA and avrA, respectively, was analyzed through quantitative real-time polymerase chain reaction. Results showed sodium hypochlorite to have the lowest minimum biofilm eradication concentration values (3.125 μg/ml), whereas triclosan had the worst performance since no S. enterica biofilm eradication was achieved even at the maximum concentration used (4,000 μg/ml). L. monocytogenes stress-response gene and S. enterica virulence gene were significantly upregulated in surviving cells compared with controls. In general, this work points out sodium hypochlorite as the most effective disinfectant against biofilms of both species used, and L. monocytogenes biofilms to be more susceptible to disinfection than S. enterica biofilms. Moreover, it was found that disinfection surviving biofilm cells seem to develop a stress response and/or become more virulent, which may compromise food safety and potentiate public health risk.

  1. Quantitative microbiological risk assessment as a tool to obtain useful information for risk managers--specific application to Listeria monocytogenes and ready-to-eat meat products.

    Science.gov (United States)

    Mataragas, M; Zwietering, M H; Skandamis, P N; Drosinos, E H

    2010-07-31

    The presence of Listeria monocytogenes in a sliced cooked, cured ham-like meat product was quantitatively assessed. Sliced cooked, cured meat products are considered as high risk products. These ready-to-eat, RTE, products (no special preparation, e.g. thermal treatment, before eating is required), support growth of pathogens (high initial pH=6.2-6.4 and water activity=0.98-0.99) and has a relatively long period of storage at chilled temperatures with a shelf life equal to 60 days based on manufacturer's instructions. Therefore, in case of post-process contamination, even with low number of cells, the microorganism is able to reach unacceptable levels at the time of consumption. The aim of this study was to conduct a Quantitative Microbiological Risk Assessment (QMRA) on the risk of L. monocytogenes presence in RTE meat products. This may help risk managers to make decisions and apply control measures with ultimate objective the food safety assurance. Examples are given to illustrate the development of practical risk management strategies based on the results obtained from the QMRA model specifically developed for this pathogen/food product combination.

  2. Chitinase expression in Listeria monocytogenes is positively regulated by the Agr system

    DEFF Research Database (Denmark)

    Paspaliari, Dafni Katerina; Mollerup, Maria Storm; Kallipolitis, Birgitte H.;

    2014-01-01

    The food-borne pathogen Listeria monocytogenes encodes two chitinases, ChiA and ChiB, which allow the bacterium to hydrolyze chitin, the second most abundant polysaccharide in nature. Intriguingly, despite the absence of chitin in human and mammalian hosts, both of the chitinases have been deemed...

  3. Tumor-specific gene expression patterns with gene expression profiles

    Institute of Scientific and Technical Information of China (English)

    RUAN Xiaogang; LI Yingxin; LI Jiangeng; GONG Daoxiong; WANG Jinlian

    2006-01-01

    Gene expression profiles of 14 common tumors and their counterpart normal tissues were analyzed with machine learning methods to address the problem of selection of tumor-specific genes and analysis of their differential expressions in tumor tissues. First, a variation of the Relief algorithm, "RFE_Relief algorithm" was proposed to learn the relations between genes and tissue types. Then, a support vector machine was employed to find the gene subset with the best classification performance for distinguishing cancerous tissues and their counterparts. After tissue-specific genes were removed, cross validation experiments were employed to demonstrate the common deregulated expressions of the selected gene in tumor tissues. The results indicate the existence of a specific expression fingerprint of these genes that is shared in different tumor tissues, and the hallmarks of the expression patterns of these genes in cancerous tissues are summarized at the end of this paper.

  4. Cardiac specific expression of Xenopus Popeye-1.

    Science.gov (United States)

    Hitz, Marc P; Pandur, Petra; Brand, Thomas; Kühl, Michael

    2002-07-01

    Popeye genes code for putative transmembrane proteins that are predominantly expressed in heart and skeletal muscle. Here we report on the isolation and expression of a previously unknown Xenopus member of this family, Xenopus Popeye-1 (Xpop-1). Xpop-1 is 60-65% identical to other vertebrate Pop-1 genes at the protein level. Whole-mount in situ hybridization studies revealed a highly specific expression of Xpop-1 whose transcripts are restricted to the embryonic heart and become enriched in the forming ventricle. Interestingly, unlike other known vertebrate Popeye genes, Xpop-1 is exclusively expressed in cardiac tissue and absent from skeletal muscle.

  5. Listeria monocytogenes CadC Regulates Cadmium Efflux and Fine-tunes Lipoprotein Localization to Escape the Host Immune Response and Promote Infection.

    Science.gov (United States)

    Pombinho, Rita; Camejo, Ana; Vieira, Ana; Reis, Olga; Carvalho, Filipe; Almeida, Maria Teresa; Pinheiro, Jorge Campos; Sousa, Sandra; Cabanes, Didier

    2017-05-01

    Listeria monocytogenes is a major intracellular human foodborne bacterial pathogen. We previously revealed L. monocytogenes cadC as highly expressed during mouse infection. Here we show that L. monocytogenes CadC is a sequence-specific, DNA-binding and cadmium-dependent regulator of CadA, an efflux pump conferring cadmium resistance. CadC but not CadA is required for L. monocytogenes infection in vivo. Interestingly, CadC also directly represses lspB, a gene encoding a lipoprotein signal peptidase whose expression appears detrimental for infection. lspB overexpression promotes the release of the LpeA lipoprotein to the extracellular medium, inducing tumor necrosis factor α and interleukin 6 expression, thus impairing L. monocytogenes survival in macrophages. We propose that L. monocytogenes uses CadC to repress lspB expression during infection to avoid LpeA exposure to the host immune system, diminishing inflammatory cytokine expression and promoting intramacrophagic survival and virulence. CadC appears as the first metal efflux pump regulator repurposed during infection to fine-tune lipoprotein processing and host responses. © The Author 2017. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail: journals.permissions@oup.com.

  6. 单核李斯特菌溶血素蛋白的原核表达及纯化%Prokaryotic Expression and Purification of Listeriolysin O from Listeria Monocytogenes

    Institute of Scientific and Technical Information of China (English)

    郭建巍; 马骢; 王珍光; 钱扬会; 张云; 郝秀红

    2011-01-01

    Objective To express the listeriolysion O (LLO) from Listeria monocytogenes (LM) in prokaryotic cells and purify the expressed product. Methods LLO gene was amplified from the genomic RNA of LM by PCR using a pair of specific primers and inserted into vector pET-30a (+). The constructed recombinant plasmid pET-30a (+)/rLLO was transformed to E. coli BL21 (DE3) for expression under induction of IPTG. The expressed product was purified by Ni2+-NTA chromatography and identified by SDS-PAGE and mass spectrum. Results PCR, restriction analysis and sequencing proved that recombinant plasmid pET-30a (+)/rLLO was constructed correctly. The expressed rLLO fusion protein, with a relative molecular mass of about 78 000, mainly existed in a form of inclusion body. Mass spectrum proved that the two protein fragments, with relative molecular masses of 35 000 and 45 000 respectively, were also LLO. Conclusion Recombinant LLO protein was successfully expressed in E. coli and purified, which laid a foundation of further study on biological function of LLO and preparation of LLO-based specific diagnostic kit.[英文关鍵词Listeria monocytogenes (LM); Hemolysin factor; Prokaryotic cells; Gene expression%目的 原核表达并纯化单核李斯特菌(Listeria monocytogenes,LM)溶血素(Listeriolysin O,LLO)蛋白.方法 用1对LM LLO基因特异性引物从LM基因组DNA中扩增LLO基因,并构建重组原核表达质粒pET-30a(+)/rLLO,转化大肠杆菌BL21(DE3),IPTG诱导表达.表达的rLLO蛋白经镍离子金属鳌合柱纯化后,进行SDS-PAGE及质谱分析.结果 重组表达质粒pET-30a(+)/rLLO经PCR、双酶切及测序,证明构建正确.表达的rLLO融合蛋白相对分子质量约为78 000,主要以包涵体形式表达.质谱分析显示,两个相对分子质量分别为35 000和45 000的小分子也均为LLO蛋白.结论 已成功地在大肠杆菌中表达了rLL0蛋白,并进行了纯化,为进一步研究LLO蛋白的生物学功能及研制基于LLO蛋白的特

  7. Antimicrobial peptides effectively kill a broad spectrum of Listeria monocytogenes and Staphylococcus aureus strains independently of origin, sub-type, or virulence factor expression

    DEFF Research Database (Denmark)

    Gottlieb, Caroline Trebbien; Thomsen, L.E.; Ingmer, H.;

    2008-01-01

    ) to the human β-defensin 3 (HBD-3). All strains were inhibited by concentrations of hydrogen peroxide between 0.1% – 1.0%. Sub-selections of both species differed in expression of several virulence-related factors and in their ability to survive in human whole blood and kill the nematode virulence model...... Caenorhabditis elegans. For L. monocytogenes, proliferation in whole blood was paralleled by high invasion in Caco-2 cells and fast killing of C. elegans, however, no such pattern in phenotypic behavior was observed for S. aureus and none of the phenotypic differences were correlated to sensitivity to HDPs......Background Host defense peptides (HDPs), or antimicrobial peptides (AMPs), are important components of the innate immune system that bacterial pathogens must overcome to establish an infection and HDPs have been suggested as novel antimicrobial therapeutics in treatment of infectious diseases...

  8. Combined Poisson and soft-particle DLVO analysis of the specific and nonspecific adhesion forces measured between L. monocytogenes grown at various temperatures and silicon nitride.

    Science.gov (United States)

    Gordesli, F Pinar; Abu-Lail, Nehal I

    2012-09-18

    Adhesion forces between pathogenic L. monocytogenes EGDe and silicon nitride (Si(3)N(4)) were measured using atomic force microscopy (AFM) under water and at room temperature for cells grown at five different temperatures (10, 20, 30, 37, and 40 °C). Adhesion forces were then decoupled into specific (hydrogen bonding) and nonspecific (electrostatic and Lifshitz-van der Waals) force components using Poisson statistical analysis. The strongest specific and nonspecific attraction forces were observed for cells grown at 30 °C, compared to those observed for cells grown at higher or lower temperatures, respectively. By combining the results of Poisson analysis with the results obtained through soft-particle Derjaguin-Landau-Verwey-Overbeek (DLVO) analysis, the contributions of the Lifshitz-van der Waals and electrostatic forces to the overall nonspecific interaction forces were determined. Our results showed that the Lifshitz-van der Waals attraction forces dominated the total nonspecific adhesion forces for all investigated thermal conditions. However, irrespective of the temperature of growth investigated, hydrogen bonding forces were always stronger than the nonspecific forces. Finally, by combining Poisson analysis with soft-particle analysis of DLVO forces, the closest separation distances where the irreversible bacterial adhesion takes place can be determined relatively easily. For all investigated thermal conditions, the closest separation distances were <1 nm.

  9. Towards a systemic understanding of Listeria monocytogenes metabolism during infection

    Directory of Open Access Journals (Sweden)

    Thilo M Fuchs

    2012-02-01

    Full Text Available Listeria monocytogenes is a foodborne human pathogen that can cause invasive infection in susceptible animals and humans. For proliferation within hosts, this facultative intracellular pathogen uses a reservoir of specific metabolic pathways, transporter and enzymatic functions whose expression requires the coordinated activity of a complex regulatory network. The highly adapted metabolism of L. monocytogenes strongly depends on the nutrient composition of various milieus encountered during infection. Transcriptomic and proteomic studies revealed the spatial-temporal dynamic of gene expression of this pathogen during replication within cultured cells or in vivo. Metabolic clues are the utilization of unusual C2- and C3-bodies, the metabolism of pyruvate, thiamine availability, the uptake of peptides, the acquisition or biosynthesis of certain amino acids, and the degradation of glucose-phosphate via the pentose phosphate pathway. These examples illustrate the interference of in vivo conditions with energy, carbon and nitrogen metabolism, thus affecting listerial growth. The exploitation, analysis and modelling of the available data sets served as a first attempt to a systemic understanding of listerial metabolism during infection. L. monocytogenes might serve as a model organism for systems biology of a Gram-positive, facultative intracellular bacterium.

  10. Recombinant Expression of a Genome-encoded N-acetylmuramoyl-L-alanine Amidase that Synergistically Lyses Listeria monocytogenes Biofilms with a Protease

    Science.gov (United States)

    Listeria monocytogenes plays a significant role in human food-borne disease caused by eating food contaminated with the bacterium and although incidence is low it is a leading cause of life-threatening, bacterial food-borne disease in humans. L. monocytogenes serotypes 1/2a and 4b can form mixed-cu...

  11. Expression of Listeria monocytogenes key virulence genes during growth in liquid medium, on rocket and melon at 4, 10 and 30 °C.

    Science.gov (United States)

    Hadjilouka, Agni; Molfeta, Christina; Panagiotopoulou, Olga; Paramithiotis, Spiros; Mataragas, Marios; Drosinos, Eleftherios H

    2016-05-01

    The aim of the present study was to assess the expression of key virulence genes, during growth of a Listeria monocytogenes isolate in liquid medium, on melon and rocket at different temperatures and time. For that purpose, BHI broth, rocket and melon were inoculated at 7.0-7.5 log CFU mL(-1) or g(-1)and stored at 4, 10 and 30 °C. Sampling took place upon inoculation and after 0.5, 6 and 24 h of incubation. The RNA was stabilized and the expression of hly, plcA, plcB, sigB, inlA, inlB, inlC, inlJ, lmo2672 and lmo2470 was assessed by RT-qPCR. The results obtained were summarized into two observations; the first one referring to the interactive effect of incubation temperature and type of substrate and the second one to the effect of time on gene expression. Regarding the latter, nearly all genes were regulated upon inoculation and exhibited differential expression in the subsequent sampling times indicating the existence of additional regulatory mechanisms yet to be explored.

  12. Polyandry and sex-specific gene expression.

    Science.gov (United States)

    Mank, Judith E; Wedell, Nina; Hosken, David J

    2013-03-05

    Polyandry is widespread in nature, and has important evolutionary consequences for the evolution of sexual dimorphism and sexual conflict. Although many of the phenotypic consequences of polyandry have been elucidated, our understanding of the impacts of polyandry and mating systems on the genome is in its infancy. Polyandry can intensify selection on sexual characters and generate more intense sexual conflict. This has consequences for sequence evolution, but also for sex-biased gene expression, which acts as a link between mating systems, sex-specific selection and the evolution of sexual dimorphism. We discuss this and the remarkable confluence of sexual-conflict theory and patterns of gene expression, while also making predictions about transcription patterns, mating systems and sexual conflict. Gene expression is a key link in the genotype-phenotype chain, and although in its early stages, understanding the sexual selection-transcription relationship will provide significant insights into this critical association.

  13. Quantitative microbiological risk assessment as a tool to obtain useful information for risk managers - specific application to Listeria monocytogenes and ready-to-eat meat products

    NARCIS (Netherlands)

    Mataragas, M.; Zwietering, M.H.; Skandamis, P.N.; Drosinos, E.H.

    2010-01-01

    The presence of Listeria monocytogenes in a sliced cooked, cured ham-like meat product was quantitatively assessed. Sliced cooked, cured meat products are considered as high risk products. These ready-to-eat, RTE, products (no special preparation, e.g. thermal treatment, before eating is required),

  14. Modulation of innate and antigen-specific immune functions directed against Listeria monocytogenes by fungal toxins in vitro.

    Science.gov (United States)

    Herter, I; Geginat, G; Hof, H; Kupfahl, C

    2014-05-01

    Mycotoxins, a large group of secondary fungal metabolites, are ubiquitously present in the environment and are potentially harmful to exposed humans and animals. Despite increasing interest in this group of fungal metabolites it is still difficult to estimate the relative toxic potential of one individual mycotoxin compared with others. We therefore compared the effects of some of the most important mycotoxins on effector cells of the innate and adaptive immune system in an in vitro model. Our data show clear differences of various mycotoxins in regard of their immunotoxic potential on mouse macrophages and T cells. Our results also indicate differences in the susceptibility of specific immune effector functions of macrophages and T cells exposed to mycotoxins. Thus, our results enhance the understanding of role of mycotoxins in the pathogenesis of human and animal diseases.

  15. Oral immunization with recombinant listeria monocytogenes controls virus load after vaginal challenge with feline immunodeficiency virus.

    Science.gov (United States)

    Stevens, Rosemary; Howard, Kristina E; Nordone, Sushila; Burkhard, MaryJo; Dean, Gregg A

    2004-08-01

    Recombinant Listeria monocytogenes has many attractive characteristics as a vaccine vector against human immunodeficiency virus (HIV). Wild-type and attenuated Listeria strains expressing HIV Gag have been shown to induce long-lived mucosal and systemic T-cell responses in mice. Using the feline immunodeficiency virus (FIV) model of HIV we evaluated recombinant L. monocytogenes in a challenge system. Five cats were immunized with recombinant L. monocytogenes that expresses the FIV Gag and delivers an FIV Env-expressing DNA vaccine (LMgag/pND14-Lc-env). Control cats were either sham immunized or immunized with wild-type L. monocytogenes (LM-wt). At 1 year after vaginal challenge, provirus could not be detected in any of the nine tissues evaluated from cats immunized with the recombinant bacteria but was detected in at least one tissue in 8 of 10 control animals. Virus was isolated from bone marrow of four of five LMgag/pND14-Lc-env-immunized cats by use of a stringent coculture system but required CD8(+) T-cell depletion, indicating CD8(+) T-cell suppression of virus replication. Control animals had an inverted CD4:CD8 ratio in mesenteric lymph node and were depleted of both CD4(+) and CD8(+) intestinal epithelial T cells, while LMgag/pND14-Lc-env-immunized animals showed no such abnormalities. Vaginal FIV-specific immunoglobulin A was present at high titer in three LMgag/pND14-Lc-env-immunized cats before challenge and in all five at 1 year postchallenge. This study demonstrates that recombinant L. monocytogenes conferred some control of viral load after vaginal challenge with FIV.

  16. Allele specific expression and methylation in the bumblebee, Bombus terrestris

    Directory of Open Access Journals (Sweden)

    Zoë Lonsdale

    2017-09-01

    Full Text Available The social hymenoptera are emerging as models for epigenetics. DNA methylation, the addition of a methyl group, is a common epigenetic marker. In mammals and flowering plants methylation affects allele specific expression. There is contradictory evidence for the role of methylation on allele specific expression in social insects. The aim of this paper is to investigate allele specific expression and monoallelic methylation in the bumblebee, Bombus terrestris. We found nineteen genes that were both monoallelically methylated and monoallelically expressed in a single bee. Fourteen of these genes express the hypermethylated allele, while the other five express the hypomethylated allele. We also searched for allele specific expression in twenty-nine published RNA-seq libraries. We found 555 loci with allele-specific expression. We discuss our results with reference to the functional role of methylation in gene expression in insects and in the as yet unquantified role of genetic cis effects in insect allele specific methylation and expression.

  17. Application Progress of Recombinant Attenuated Listeria monocytogenes in Tumor Immunotherapy

    Institute of Scientific and Technical Information of China (English)

    Yin Xiaojiao; Bai Lin; Yang Xu

    2015-01-01

    Much progress of application of bacterial vaccine in treatment and prevention of tumor was acquired,which showed broad prospect in clinical study of animals and humans. Listeria monocytogenes( L. monocytogenes) was considered much important by virtue of its special characteristic of biology and immunology.L. monocytogenes was ingested by professional or part-time phagocytes,survived and proliferated in the phagocytes under synergism of toxic factor secreted by itself,meanwhile,the cellular and humoral immune response was induced. Antigenic gene of specific tumor was loaded in the attenuated L. monocytogenes,which can enhance immune response of host cells. Effective cell targeted to enter tumor tissue and acted on tumor cells to induce apoptosis of tumor cells. Tumor degenerated not easy to reappear. Therefore,recombinant attenuated L. monocytogenes was a safe and effective anti-cancer vaccine vector. Now the work of researchers mainly focuses on solving practical problem in clinical application. Biological characteristics of L. monocytogenes,feasibility and superiority of L. monocytogenes as targeted vaccine vector,problem and prospect of L. monocytogenes in clinical application of anti-tumor were reviewed in this paper.

  18. A Dual Microscopy-Based Assay To Assess Listeria monocytogenes Cellular Entry and Vacuolar Escape.

    Science.gov (United States)

    Quereda, Juan J; Pizarro-Cerdá, Javier; Balestrino, Damien; Bobard, Alexandre; Danckaert, Anne; Aulner, Nathalie; Shorte, Spencer; Enninga, Jost; Cossart, Pascale

    2015-10-23

    Listeria monocytogenes is a Gram-positive bacterium and a facultative intracellular pathogen that invades mammalian cells, disrupts its internalization vacuole, and proliferates in the host cell cytoplasm. Here, we describe a novel image-based microscopy assay that allows discrimination between cellular entry and vacuolar escape, enabling high-content screening to identify factors specifically involved in these two steps. We first generated L. monocytogenes and Listeria innocua strains expressing a β-lactamase covalently attached to the bacterial cell wall. These strains were then incubated with HeLa cells containing the Förster resonance energy transfer (FRET) probe CCF4 in their cytoplasm. The CCF4 probe was cleaved by the bacterial surface β-lactamase only in cells inoculated with L. monocytogenes but not those inoculated with L. innocua, thereby demonstrating bacterial access to the host cytoplasm. Subsequently, we performed differential immunofluorescence staining to distinguish extracellular versus total bacterial populations in samples that were also analyzed by the FRET-based assay. With this two-step analysis, bacterial entry can be distinguished from vacuolar rupture in a single experiment. Our novel approach represents a powerful tool for identifying factors that determine the intracellular niche of L. monocytogenes.

  19. Identification of Surface Protein Biomarkers of Listeria monocytogenes via Bioinformatics and Antibody-Based Protein Detection Tools

    Science.gov (United States)

    Zhang, Cathy X. Y.; Brooks, Brian W.; Huang, Hongsheng; Pagotto, Franco

    2016-01-01

    ABSTRACT The Gram-positive bacterium Listeria monocytogenes causes a significant percentage of the fatalities among foodborne illnesses in humans. Surface proteins specifically expressed in a wide range of L. monocytogenes serotypes under selective enrichment culture conditions could serve as potential biomarkers for detection and isolation of this pathogen via antibody-based methods. Our study aimed to identify such biomarkers. Interrogation of the L. monocytogenes serotype 4b strain F2365 genome identified 130 putative or known surface proteins. The homologues of four surface proteins, LMOf2365_0578, LMOf2365_0581, LMOf2365_0639, and LMOf2365_2117, were assessed as biomarkers due to the presence of conserved regions among strains of L. monocytogenes which are variable among other Listeria species. Rabbit polyclonal antibodies against the four recombinant proteins revealed the expression of only LMOf2365_0639 on the surface of serotype 4b strain LI0521 cells despite PCR detection of mRNA transcripts for all four proteins in the organism. Three of 35 monoclonal antibodies (MAbs) to LMOf2365_0639, MAbs M3643, M3644, and M3651, specifically recognized 42 (91.3%) of 46 L. monocytogenes lineage I and II isolates grown in nonselective brain heart infusion medium. While M3644 and M3651 reacted with 14 to 15 (82.4 to 88.2%) of 17 L. monocytogenes lineage I and II isolates, M3643 reacted with 22 (91.7%) of 24 lineage I, II, and III isolates grown in selective enrichment media (UVM1, modified Fraser, Palcam, and UVM2 media). The three MAbs exhibited only weak reactivities (the optical densities at 414 nm were close to the cutoff value) to some other Listeria species grown in selective enrichment media. Collectively, the data indicate the potential of LMOf2365_0639 as a surface biomarker of L. monocytogenes, with the aid of specific MAbs, for pathogen detection, identification, and isolation in clinical, environmental, and food samples. IMPORTANCE L. monocytogenes is

  20. Oral Immunization with Recombinant Listeria monocytogenes Controls Virus Load after Vaginal Challenge with Feline Immunodeficiency Virus

    OpenAIRE

    Stevens, Rosemary; Howard, Kristina E.; Nordone, Sushila; Burkhard, MaryJo; Dean, Gregg A

    2004-01-01

    Recombinant Listeria monocytogenes has many attractive characteristics as a vaccine vector against human immunodeficiency virus (HIV). Wild-type and attenuated Listeria strains expressing HIV Gag have been shown to induce long-lived mucosal and systemic T-cell responses in mice. Using the feline immunodeficiency virus (FIV) model of HIV we evaluated recombinant L. monocytogenes in a challenge system. Five cats were immunized with recombinant L. monocytogenes that expresses the FIV Gag and del...

  1. Staphylococcus aureus but not Listeria monocytogenes adapt to triclosan and adaptation correlates with increased fabI expression and agr deficiency

    DEFF Research Database (Denmark)

    Nielsen, Lene Nørby; Larsen, Marianne Halberg; Skovgaard, Sissel

    2013-01-01

    Background. The ability of pathogens to adapt to the widely used biocide, triclosan, varies substantially. The purpose of the study was to examine bacterial adaptation over an extended period of time to low increments of triclosan concentrations. Focus was two human pathogens, S. aureus and L....... monocytogenes that previously have displayed inherent high and low adaptability, respectively. Results. Three strains of L. monocytogenes and two strains of S. aureus including the community-acquired USA300 were exposed to increasing, sub-lethal concentrations of triclosan in triclosan-containing agar gradients....... Following 25 days of exposure on agar plates to sub-lethal concentrations of triclosan with a twofold concentration increase every second day, minimum inhibitory concentration (MIC) for S. aureus increased from 0.125 (8325-4) and 0.0625 (USA 300) mg/L to 4 mg/L. The MIC of all three L. monocytogenes strains...

  2. Listeria monocytogenes as a vector for anti-cancer therapies.

    LENUS (Irish Health Repository)

    Tangney, Mark

    2012-01-31

    The intracellular pathogen Listeria monocytogenes represents a promising therapeutic vector for the delivery of DNA, RNA or protein to cancer cells or to prime immune responses against tumour-specific antigens. A number of biological properties make L. monocytogenes a promising platform for development as a vector for either gene therapy or as an anti-cancer vaccine vector. L. monocytogenes is particularly efficient in mediating internalization into host cells. Once inside cells, the bacterium produces specific virulence factors which lyse the vaculolar membrane and allow escape into the cytoplasm. Once in the cytosol, L. monocytogenes is capable of actin-based motility and cell-to-cell spread without an extracellular phase. The cytoplasmic location of L. monocytogenes is significant as this potentiates entry of antigens into the MHC Class I antigen processing pathway leading to priming of specific CD8(+) T cell responses. The cytoplasmic location is also beneficial for the delivery of DNA (bactofection) by L. monocytogenes whilst cell-to-cell spread may facilitate access of the vector to cells throughout the tumour. Several preclinical studies have demonstrated the ability of L. monocytogenes for intracellular gene or protein delivery in vitro and in vivo, and this vector has also displayed safety and efficacy in clinical trial. Here, we review the features of the L. monocytogenes host-pathogen interaction that make this bacterium such an attractive candidate with which to induce appropriate therapeutic responses. We focus primarily upon work that has led to attenuation of the pathogen, demonstrated DNA, RNA or protein delivery to tumour cells as well as research that shows the efficacy of L. monocytogenes as a vector for tumour-specific vaccine delivery.

  3. Characterization of specific alleles in InlA and PrfA of Listeria monocytogenes isolated from foods in Osaka, Japan and their ability to invade Caco-2 cells.

    Science.gov (United States)

    Kanki, Masashi; Naruse, Hisayo; Taguchi, Masumi; Kumeda, Yuko

    2015-10-15

    Listeria monocytogenes expresses the surface protein internalin A (InlA), enabling the invasion of human intestinal epithelial cells to cause severe food-borne diseases. Full-length sequence analysis of inlA of 114 food isolates resulted in the detection of 29 isolates with a premature stop codon (PMSC) mutation and 6 isolates with 3-codon deletion mutations (aa 738 to 740) in inlA. The isolates with inlA PMSCs demonstrated a significantly lower level of invasion than the other food isolates in a Caco-2 cell invasion assay (P0.05). According to analysis of the positive regulatory factor A (PrfA) sequences of 114 L. monocytogenes isolates, 7 isolates of serotype 1/2a from chicken samples contained a PrfA protein with a 5-nucleotide deletion from 712 to 716, including a stop codon. Although the isolates with a 5-nucleotide deletion in prfA demonstrated invasion comparable to the isolates with non-truncated InlA and PrfA after growth at 30 °C (P>0.05), they exhibited a significantly higher level of invasion than the other isolates after growth at 20 °C (Pmonocytogenes isolates with the stop-codon deletion of PrfA. Copyright © 2015 Elsevier B.V. All rights reserved.

  4. In vitro and in vivo characterization of DNA delivery using recombinant Lactococcus lactis expressing a mutated form of L. monocytogenes Internalin A

    Directory of Open Access Journals (Sweden)

    de Azevedo Marcela

    2012-12-01

    Full Text Available Abstract Background The use of food-grade Lactic Acid Bacteria (LAB as DNA delivery vehicles represents an attractive strategy to deliver DNA vaccines at the mucosal surfaces as they are generally regarded as safe (GRAS. We previously showed that either native Lactococcus lactis (LL or recombinant invasive LL expressing Fibronectin Binding Protein A of Staphylococcus aureus (LL-FnBPA+ or Internalin A of Listeria monocytogenes (LL-InlA+, were able to deliver and trigger DNA expression by epithelial cells, either in vitro or in vivo. InlA does not bind to its receptor, the murine E-cadherin, thus limiting the use of LL-InlA+ in in vivo murine models. Moreover, FnBPA binds to its receptors, integrins, via fibronectin introducing another limiting factor. In order to avoid the limitations of LL-InlA+ and LL-FnBPA+, a new L. lactis strain was engineered to produce a previously described mutated form of InlA (LL-mInlA+ allowing the binding of mInlA on murine E-cadherin. Results After showing the expression of mInLA at the surface of LL-mInlA+ strain, in vitro gentamycin survival assay in Caco-2 cells showed that LL-mInlA+ is 1000 times more invasive than LL. LL-mInlA+ invasivity was also validated by fluorescence microscopy. LL and LL-mInlA+ were transformed with pValacBLG, a plasmid containing the cDNA of bovine β-Lactoglobulin (BLG, resulting in strains LL-BLG and LL-mInlA+BLG. The plasmid transfer in vitro using LL-mInlA+BLG was increased 10 times compared to LL-BLG. Moreover, the number of mice producing BLG in isolated enterocytes after oral administration of LL-mInlA+BLG in vivo was slightly higher than after oral administration of LL-BLG. Conclusions We confirmed in this study that the production of mInlA at the surface of L. lactis is a promising strategy for plasmid transfer in vitro and in vivo.

  5. Dissecting specific and global transcriptional regulation of bacterial gene expression

    NARCIS (Netherlands)

    Gerosa, Luca; Kochanowski, Karl; Heinemann, Matthias; Sauer, Uwe

    2013-01-01

    Gene expression is regulated by specific transcriptional circuits but also by the global expression machinery as a function of growth. Simultaneous specific and global regulation thus constitutes an additional-but often neglected-layer of complexity in gene expression. Here, we develop an experiment

  6. Impact of sod on the expression of stress-related genes in Listeria monocytogenes 4b G with/without paraquat treatment

    Science.gov (United States)

    Listeria monocytogenes is a food-borne pathogen that causes listeriosis. Paraquat can generate reactive oxygen species (ROS) in cells, which results in oxidative stress. It was firstly shown that 1 mM of paraquat inhibited the growth rate of a superoxide dismutase (sod)-deletion mutant (delta sod) g...

  7. Recombinant expression of a putative prophage amidase cloned from the genome of Listeria monocytogenes that lyses the bacterium and its biofilm

    Science.gov (United States)

    Listeria monocytogenes is a Gram-positive, non-sporeforming, catalase-positive rod that is a major bacterial food-borne disease agent, causing listeriosis. Listeria can be associated with uncooked meats including poultry, uncooked vegetables, soft cheeses and unpasteurized milk. The bacterium can be...

  8. Quantitative microbiological risk assessment as a tool to obtain useful information for risk managers - specific application to Listeria monocytogenes and ready-to-eat meat products

    OpenAIRE

    Mataragas, M.; Zwietering, M. H.; Skandamis, P. N.; Drosinos, E. H.

    2010-01-01

    The presence of Listeria monocytogenes in a sliced cooked, cured ham-like meat product was quantitatively assessed. Sliced cooked, cured meat products are considered as high risk products. These ready-to-eat, RTE, products (no special preparation, e.g. thermal treatment, before eating is required), support growth of pathogens (high initial pH = 6.2–6.4 and water activity = 0.98–0.99) and has a relatively long period of storage at chilled temperatures with a shelf life equal to 60 days based o...

  9. Incorporation of Listeria monocytogenes strains in raw milk biofilms.

    Science.gov (United States)

    Weiler, Christiane; Ifland, Andrea; Naumann, Annette; Kleta, Sylvia; Noll, Matthias

    2013-02-01

    Biofilms develop successively on devices of milk production without sufficient cleaning and originate from the microbial community of raw milk. The established biofilm matrices enable incorporation of pathogens like Listeria monocytogenes, which can cause a continuous contamination of food processing plants. L. monocytogenes is frequently found in raw milk and non-pasteurized raw milk products and as part of a biofilm community in milk meters and bulk milk tanks. The aim of this study was to analyze whether different L. monocytogenes strains are interacting with the microbial community of raw milk in terms of biofilm formation in the same manner, and to identify at which stage of biofilm formation a selected L. monocytogenes strain settles best. Bacterial community structure and composition of biofilms were analyzed by a cloning and sequencing approach and terminal restriction fragment length polymorphism analysis (T-RFLP) based on the bacterial 16S rRNA gene. The chemical composition of biofilms was analyzed by Fourier transform infrared spectroscopy (FTIR), while settled L. monocytogenes cells were quantified by fluorescence in situ hybridization (FISH). Addition of individual L. monocytogenes strains to raw milk caused significant shifts in the biofilm biomass, in the chemical as well as in the bacterial community composition. Biofilm formation and attachment of L. monocytogenes cells were not serotype but strain specific. However, the added L. monocytogenes strains were not abundant since mainly members of the genera Citrobacter and Lactococcus dominated the bacterial biofilm community. Overall, added L. monocytogenes strains led to a highly competitive interaction with the raw milk community and triggered alterations in biofilm formation.

  10. Listeria monocytogenes: diagnostic problems

    NARCIS (Netherlands)

    Beumer, R.R.; Hazeleger, W.C.

    2003-01-01

    The first isolation methods for the detection of Listeria spp. were generally based on the direct culture of samples on simple agar media, but isolation of the pathogenic Listeria monocytogenes was difficult. In time, new techniques were developed, based on a variety of selective and elective agents

  11. Listeria monocytogenes endocarditis.

    Science.gov (United States)

    Sheinman, B D; Evans, T; Sage, R

    1985-01-01

    A fatal case of endocarditis due to Listeria monocytogenes is reported. Case reports of endocarditis due to this organism are rare but indicate a higher mortality than with many other causes of bacterial endocarditis. The size of the problem may be underestimated because the organism has a "diphtheroid' appearance and may be incorrectly dismissed as a contaminant.

  12. Listeria monocytogenes infection in macrophages induces vacuolar-dependent host miRNA response.

    Directory of Open Access Journals (Sweden)

    Anna K D Schnitger

    Full Text Available Listeria monocytogenes is a gram-positive facultative intracellular pathogen, causing serious illness in immunocompromised individuals and pregnant women. Upon detection by macrophages, which are key players of the innate immune response against infection, L. monocytogenes induces specific host cell responses which need to be tightly controlled at transcriptional and post-transcriptional levels. Here, we ask whether and how host miRNAs, which represent an important mechanism of post-transcriptional regulation in a wide array of biological processes, are altered by a model pathogen upon live infection of murine bone marrow derived macrophages. We first report that L. monocytogenes subverts the host genome-wide miRNA profile of macrophages in vitro. Specifically, we show that miR-155, miR-146a, miR-125a-3p/5p and miR-149 were amongst the most significantly regulated miRNAs in infected macrophages. Strikingly, these miRNAs were highly upregulated upon infection with the Listeriolysin-deficient L. monocytogenes mutant Δhly, that cannot escape from the phagosome thus representing a vacuolar-contained infection. The vacuolar miRNA response was significantly reduced in macrophages deficient for MyD88. In addition, miR-146a and miR-125a-3p/5p were regulated at transcriptional levels upon infection, and miR-125a-3p/5p were found to be TLR2 responsive. Furthermore, miR-155 transactivation in infection was regulated by NF-κB p65, while miR-146a and miR-125a-3p/5p expression was unaffected in p65-deficient primary macrophages upon L. monocytogenes infection. Our results demonstrate that L. monocytogenes promotes significant changes in the miRNA expression profile in macrophages, and reveal a vacuolar-dependent miRNA signature, listeriolysin-independent and MyD88-dependent. These miRNAs are predicted to target immune genes and are therefore most likely involved in regulation of the macrophage innate immune response against infection at post

  13. Predicting tissue-specific expressions based on sequence characteristics

    KAUST Repository

    Paik, Hyojung

    2011-04-30

    In multicellular organisms, including humans, understanding expression specificity at the tissue level is essential for interpreting protein function, such as tissue differentiation. We developed a prediction approach via generated sequence features from overrepresented patterns in housekeeping (HK) and tissue-specific (TS) genes to classify TS expression in humans. Using TS domains and transcriptional factor binding sites (TFBSs), sequence characteristics were used as indices of expressed tissues in a Random Forest algorithm by scoring exclusive patterns considering the biological intuition; TFBSs regulate gene expression, and the domains reflect the functional specificity of a TS gene. Our proposed approach displayed better performance than previous attempts and was validated using computational and experimental methods.

  14. Lack of PPARγ in myeloid cells confers resistance to Listeria monocytogenes infection.

    Directory of Open Access Journals (Sweden)

    Zeinab Abdullah

    Full Text Available The peroxisomal proliferator-activated receptor γ (PPARγ is a nuclear receptor that controls inflammation and immunity. Innate immune defense against bacterial infection appears to be compromised by PPARγ. The relevance of PPARγ in myeloid cells, that organize anti-bacterial immunity, for the outcome of immune responses against intracellular bacteria such as Listeria monocytogenes in vivo is unknown. We found that Listeria monocytogenes infection of macrophages rapidly led to increased expression of PPARγ. This prompted us to investigate whether PPARγ in myeloid cells influences innate immunity against Listeria monocytogenes infection by using transgenic mice with myeloid-cell specific ablation of PPARγ (LysMCre×PPARγ(flox/flox. Loss of PPARγ in myeloid cells results in enhanced innate immune defense against Listeria monocytogenes infection both, in vitro and in vivo. This increased resistance against infection was characterized by augmented levels of bactericidal factors and inflammatory cytokines: ROS, NO, IFNγ TNF IL-6 and IL-12. Moreover, myeloid cell-specific loss of PPARγ enhanced chemokine and adhesion molecule expression leading to improved recruitment of inflammatory Ly6C(hi monocytes to sites of infection. Importantly, increased resistance against Listeria infection in the absence of PPARγ was not accompanied by enhanced immunopathology. Our results elucidate a yet unknown regulatory network in myeloid cells that is governed by PPARγ and restrains both listeriocidal activity and recruitment of inflammatory monocytes during Listeria infection, which may contribute to bacterial immune escape. Pharmacological interference with PPARγ activity in myeloid cells might represent a novel strategy to overcome intracellular bacterial infection.

  15. Inflammasome-Mediated Inhibition of Listeria monocytogenes-Stimulated Immunity Is Independent of Myelomonocytic Function

    Science.gov (United States)

    Williams, Cassandra R.; Dustin, Michael L.; Sauer, John-Demian

    2013-01-01

    Activation of the Nlrc4 inflammasome results in the secretion of IL-1β and IL-18 through caspase-1 and induction of pyroptosis. L. monocytogenes engineered to activate Nlrc4 by expression of Legionella pneumophilia flagellin (L. monocytogenes L.p.FlaA) are less immunogenic for CD8+ T cell responses than wt L. monocytogenes. It is also known that IL-1β orchestrates recruitment of myelomonocytic cells (MMC), which have been shown to interfere with T cell-dendritic cells (DC) interactions in splenic white pulp (WP), limiting T cell priming and protective immunity. We have further analyzed the role of MMCs in the immunogenicity of L. monocytogenes L.p.FlaA. We confirmed that MMCs infiltrate the WP between 24–48 hours in response to wt L. monocytogenes infection and that depletion of MMCs enhances CD8+ T cell priming and protective memory. L. monocytogenes L.p.FlaA elicited accelerated recruitment of MMCs into the WP. While MMCs contribute to control of L. monocytogenes L.p.FlaA, MMC depletion did not increase immunogenicity of L.p.FlaA expressing strains. There was a significant decrease in L. monocytogenes L.p.FlaA in CD8α+ DCs independent of MMCs. These findings suggest that limiting inflammasome activation is important for bacterial accumulation in CD8α+ DCs, which are known to be critical for T cell response to L. monocytogenes. PMID:24349458

  16. Inflammasome-mediated inhibition of Listeria monocytogenes-stimulated immunity is independent of myelomonocytic function.

    Directory of Open Access Journals (Sweden)

    Cassandra R Williams

    Full Text Available Activation of the Nlrc4 inflammasome results in the secretion of IL-1β and IL-18 through caspase-1 and induction of pyroptosis. L. monocytogenes engineered to activate Nlrc4 by expression of Legionella pneumophilia flagellin (L. monocytogenes L.p.FlaA are less immunogenic for CD8(+ T cell responses than wt L. monocytogenes. It is also known that IL-1β orchestrates recruitment of myelomonocytic cells (MMC, which have been shown to interfere with T cell-dendritic cells (DC interactions in splenic white pulp (WP, limiting T cell priming and protective immunity. We have further analyzed the role of MMCs in the immunogenicity of L. monocytogenes L.p.FlaA. We confirmed that MMCs infiltrate the WP between 24-48 hours in response to wt L. monocytogenes infection and that depletion of MMCs enhances CD8(+ T cell priming and protective memory. L. monocytogenes L.p.FlaA elicited accelerated recruitment of MMCs into the WP. While MMCs contribute to control of L. monocytogenes L.p.FlaA, MMC depletion did not increase immunogenicity of L.p.FlaA expressing strains. There was a significant decrease in L. monocytogenes L.p.FlaA in CD8α(+ DCs independent of MMCs. These findings suggest that limiting inflammasome activation is important for bacterial accumulation in CD8α(+ DCs, which are known to be critical for T cell response to L. monocytogenes.

  17. Listeria monocytogenes DNA glycosylase AdiP affects flagellar motility, biofilm formation, virulence, and stress responses

    Science.gov (United States)

    The temperature-dependent alteration of flagellar motility gene expression is critical for the foodborne pathogen Listeria monocytogenes to respond to a changing environment. In this study, a genetic determinant, L. monocytogenes f2365_0220 (lmof2365_0220), encoding a putative protein that is struct...

  18. The intracellular sRNA transcriptome of Listeria monocytogenes during growth in macrophages

    Science.gov (United States)

    Mraheil, Mobarak A.; Billion, André; Mohamed, Walid; Mukherjee, Krishnendu; Kuenne, Carsten; Pischimarov, Jordan; Krawitz, Christian; Retey, Julia; Hartsch, Thomas; Chakraborty, Trinad; Hain, Torsten

    2011-01-01

    Small non-coding RNAs (sRNAs) are widespread effectors of post-transcriptional gene regulation in bacteria. Currently extensive information exists on the sRNAs of Listeria monocytogenes expressed during growth in extracellular environments. We used deep sequencing of cDNAs obtained from fractioned RNA (<500 nt) isolated from extracellularly growing bacteria and from L. monocytogenes infected macrophages to catalog the sRNA repertoire during intracellular bacterial growth. Here, we report on the discovery of 150 putative regulatory RNAs of which 71 have not been previously described. A total of 29 regulatory RNAs, including small non-coding antisense RNAs, are specifically expressed intracellularly. We validated highly expressed sRNAs by northern blotting and demonstrated by the construction and characterization of isogenic mutants of rli31, rli33-1 and rli50* for intracellular expressed sRNA candidates, that their expression is required for efficient growth of bacteria in macrophages. All three mutants were attenuated when assessed for growth in mouse and insect models of infection. Comparative genomic analysis revealed the presence of lineage specific sRNA candidates and the absence of sRNA loci in genomes of naturally occurring infection-attenuated bacteria, with additional loss in non-pathogenic listerial genomes. Our analyses reveal extensive sRNA expression as an important feature of bacterial regulation during intracellular growth. PMID:21278422

  19. Tissue-specificity of proteoglycans expression in different cancers

    Directory of Open Access Journals (Sweden)

    A. V. Suhovskih

    2016-01-01

    Full Text Available Background. Proteoglycans (PGs are complex glycosylated molecules playing an important role in cell-cell and cell-matrix interactions and signaling. Expression of PGs and their expression pattern change considerably during malignant transformation of mammalian cells and tissues.Objective. The aim of our work was to investigate tissue-specificity of main PGs expression (glypican-1, perlecan, syndecan-1, aggrecan, versican, CSPG4/NG2, brevican, decorin, lumican in normal cells (fibroblasts and normal epithelial prostate cells PNT2 and in different human cancer cell lines (prostate, breast, lung, brain, kidney. Expression patterns of main PGs were determined in these cells using reverse transcription polymerase chain reaction analysis and immunocytochemical staining.Results. It was shown that fibroblasts actively expressed PGs, and PNT2 cells had lower (5–6-fold expression levels of a limited set of PG. In different cancer cell lines, overall transcriptional activities of PGs varied up to 10-fold, although their expression patterns had tissue-specific properties (for example, expression of syndecan-1 is more specific for prostate cancer cells, while perlecan is typical for lung cancer cell lines.Conclusions. Along with this, variability of the PG expression patterns in cell lines of the same tissue of origin was shown, suggesting a possible contribution of the variable PGs expression to intratumoural heterogeneity of cancer cells and their potential as perspective biomarker (s for personalised cancer diagnostics.

  20. Adenovirus-based vaccine against Listeria monocytogenes

    DEFF Research Database (Denmark)

    Jensen, Søren; Steffensen, Maria Abildgaard; Jensen, Benjamin Anderschou Holbech

    2013-01-01

    The use of replication-deficient adenoviruses as vehicles for transfer of foreign genes offers many advantages in a vaccine setting, eliciting strong cellular immune responses involving both CD8(+) and CD4(+) T cells. Further improving the immunogenicity, tethering of the inserted target Ag to MHC...... class II-associated invariant chain (Ii) greatly enhances both the presentation of most target Ags, as well as overall protection against viral infection, such as lymphocytic choriomeningitis virus (LCMV). The present study extends this vaccination concept to include protection against intracellular...... bacteria, using Listeria monocytogenes as a model organism. Protection in C57BL/6 mice against recombinant L. monocytogenes expressing an immunodominant epitope of the LCMV glycoprotein (GP33) was greatly accelerated, augmented, and prolonged following vaccination with an adenoviral vaccine encoding GP...

  1. Evolutionary dynamics of the accessory genome of Listeria monocytogenes.

    Directory of Open Access Journals (Sweden)

    Henk C den Bakker

    Full Text Available Listeria monocytogenes, a foodborne bacterial pathogen, is comprised of four phylogenetic lineages that vary with regard to their serotypes and distribution among sources. In order to characterize lineage-specific genomic diversity within L. monocytogenes, we sequenced the genomes of eight strains from several lineages and serotypes, and characterized the accessory genome, which was hypothesized to contribute to phenotypic differences across lineages. The eight L. monocytogenes genomes sequenced range in size from 2.85-3.14 Mb, encode 2,822-3,187 genes, and include the first publicly available sequenced representatives of serotypes 1/2c, 3a and 4c. Mapping of the distribution of accessory genes revealed two distinct regions of the L. monocytogenes chromosome: an accessory-rich region in the first 65° adjacent to the origin of replication and a more stable region in the remaining 295°. This pattern of genome organization is distinct from that of related bacteria Staphylococcus aureus and Bacillus cereus. The accessory genome of all lineages is enriched for cell surface-related genes and phosphotransferase systems, and transcriptional regulators, highlighting the selective pressures faced by contemporary strains from their hosts, other microbes, and their environment. Phylogenetic analysis of O-antigen genes and gene clusters predicts that serotype 4 was ancestral in L. monocytogenes and serotype 1/2 associated gene clusters were putatively introduced through horizontal gene transfer in the ancestral population of L. monocytogenes lineage I and II.

  2. Repressor-mediated tissue-specific gene expression in plants

    Science.gov (United States)

    Meagher, Richard B.; Balish, Rebecca S.; Tehryung, Kim; McKinney, Elizabeth C.

    2009-02-17

    Plant tissue specific gene expression by way of repressor-operator complexes, has enabled outcomes including, without limitation, male sterility and engineered plants having root-specific gene expression of relevant proteins to clean environmental pollutants from soil and water. A mercury hyperaccumulation strategy requires that mercuric ion reductase coding sequence is strongly expressed. The actin promoter vector, A2pot, engineered to contain bacterial lac operator sequences, directed strong expression in all plant vegetative organs and tissues. In contrast, the expression from the A2pot construct was restricted primarily to root tissues when a modified bacterial repressor (LacIn) was coexpressed from the light-regulated rubisco small subunit promoter in above-ground tissues. Also provided are analogous repressor operator complexes for selective expression in other plant tissues, for example, to produce male sterile plants.

  3. Allele-specific KRT1 expression is a complex trait.

    Directory of Open Access Journals (Sweden)

    Heng Tao

    2006-06-01

    Full Text Available The differential expression of alleles occurs commonly in humans and is likely an important genetic factor underlying heritable differences in phenotypic traits. Understanding the molecular basis of allelic expression differences is thus an important challenge. Although many genes have been shown to display differential allelic expression, this is the first study to examine in detail the cumulative effects of multiple cis-regulatory polymorphisms responsible for allele-specific expression differences. We have used a variety of experimental approaches to identify and characterize cis-regulatory polymorphisms responsible for the extreme allele-specific expression differences of keratin-1 (KRT1 in human white blood cells. The combined data from our analyses provide strong evidence that the KRT1 allelic expression differences result from the haplotypic combinations and interactions of five cis-regulatory single nucleotide polymorphisms (SNPs whose alleles differ in their affinity to bind transcription factors and modulate KRT1 promoter activity. Two of these cis-regulatory SNPs bind transcriptional activators with the alleles on the high-expressing KRT1 haplotype pattern having a higher affinity than the alleles on the low-expressing haplotype pattern. In contrast, the other three cis-regulatory SNPs bind transcriptional inhibitors with the alleles on the low-expressing haplotype pattern having a higher affinity than the alleles on the high-expressing haplotype pattern. Our study provides important new insights into the degree of complexity that the cis-regulatory sequences responsible for allele-specific transcriptional regulation have. These data suggest that allelic expression differences result from the cumulative contribution of multiple DNA sequence polymorphisms, with each having a small effect, and that allele-specific expression can thus be viewed as a complex trait.

  4. Recombinant phage probes for Listeria monocytogenes

    Energy Technology Data Exchange (ETDEWEB)

    Carnazza, S; Gioffre, G; Felici, F; Guglielmino, S [Department of Microbiological, Genetic and Molecular Sciences, University of Messina, Messina (Italy)

    2007-10-03

    Monitoring of food and environmental samples for biological threats, such as Listeria monocytogenes, requires probes that specifically bind biological agents and ensure their immediate and efficient detection. There is a need for robust and inexpensive affinity probes as an alternative to antibodies. These probes may be recruited from random peptide libraries displayed on filamentous phage. In this study, we selected from two phage peptide libraries phage clones displaying peptides capable of specific and strong binding to the L. monocytogenes cell surface. The ability of isolated phage clones to interact specifically with L. monocytogenes was demonstrated using enzyme-linked immunosorbent assay (ELISA) and confirmed by co-precipitation assay. We also assessed the sensitivity of phage-bacteria binding by PCR on phage-captured Listeria cells, which could be detected at a concentration of 10{sup 4} cells ml{sup -1}. In addition, as proof-of-concept, we tested the possibility of immobilizing the affinity-selected phages to a putative biosensor surface. The quality of phage deposition was monitored by ELISA and fluorescent microscopy. Phage-bacterial binding was confirmed by high power optical phase contrast microscopy. Overall, the results of this work validate the concept of affinity-selected recombinant filamentous phages as probes for detecting and monitoring bacterial agents under any conditions that warrant their recognition, including in food products.

  5. Recombinant phage probes for Listeria monocytogenes

    Science.gov (United States)

    Carnazza, S.; Gioffrè, G.; Felici, F.; Guglielmino, S.

    2007-10-01

    Monitoring of food and environmental samples for biological threats, such as Listeria monocytogenes, requires probes that specifically bind biological agents and ensure their immediate and efficient detection. There is a need for robust and inexpensive affinity probes as an alternative to antibodies. These probes may be recruited from random peptide libraries displayed on filamentous phage. In this study, we selected from two phage peptide libraries phage clones displaying peptides capable of specific and strong binding to the L. monocytogenes cell surface. The ability of isolated phage clones to interact specifically with L. monocytogenes was demonstrated using enzyme-linked immunosorbent assay (ELISA) and confirmed by co-precipitation assay. We also assessed the sensitivity of phage-bacteria binding by PCR on phage-captured Listeria cells, which could be detected at a concentration of 104 cells ml-1. In addition, as proof-of-concept, we tested the possibility of immobilizing the affinity-selected phages to a putative biosensor surface. The quality of phage deposition was monitored by ELISA and fluorescent microscopy. Phage-bacterial binding was confirmed by high power optical phase contrast microscopy. Overall, the results of this work validate the concept of affinity-selected recombinant filamentous phages as probes for detecting and monitoring bacterial agents under any conditions that warrant their recognition, including in food products.

  6. Small RNA expression and strain specificity in the rat

    Directory of Open Access Journals (Sweden)

    de Bruijn Ewart

    2010-04-01

    Full Text Available Abstract Background Digital gene expression (DGE profiling has become an established tool to study RNA expression. Here, we provide an in-depth analysis of small RNA DGE profiles from two different rat strains (BN-Lx and SHR from six different rat tissues (spleen, liver, brain, testis, heart, kidney. We describe the expression patterns of known and novel micro (miRNAs and piwi-interacting (piRNAs. Results We confirmed the expression of 588 known miRNAs (54 in antisense orientation and identified 56 miRNAs homologous to known human or mouse miRNAs, as well as 45 new rat miRNAs. Furthermore, we confirmed specific A to I editing in brain for mir-376a/b/c and identified mir-377 as a novel editing target. In accordance with earlier findings, we observed a highly tissue-specific expression pattern for all tissues analyzed. The brain was found to express the highest number of tissue-specific miRNAs, followed by testis. Notably, our experiments also revealed robust strain-specific differential miRNA expression in the liver that is caused by genetic variation between the strains. Finally, we identified two types of germline-specific piRNAs in testis, mapping either to transposons or in strand-specific clusters. Conclusions Taken together, the small RNA compendium described here advances the annotation of small RNAs in the rat genome. Strain and tissue-specific expression patterns furthermore provide a strong basis for studying the role of small RNAs in regulatory networks as well as biological process like physiology and neurobiology that are extensively studied in this model system.

  7. Lab-specific gene expression signatures in pluripotent stem cells.

    Science.gov (United States)

    Newman, Aaron M; Cooper, James B

    2010-08-06

    Pluripotent stem cells derived from both embryonic and reprogrammed somatic cells have significant potential for human regenerative medicine. Despite similarities in developmental potential, however, several groups have found fundamental differences between embryonic stem cell (ESC) and induced-pluripotent stem cell (iPSC) lines that may have important implications for iPSC-based medical therapies. Using an unsupervised clustering algorithm, we further studied the genetic homogeneity of iPSC and ESC lines by reanalyzing microarray gene expression data from seven different laboratories. Unexpectedly, this analysis revealed a strong correlation between gene expression signatures and specific laboratories in both ESC and iPSC lines. Nearly one-third of the genes with lab-specific expression signatures are also differentially expressed between ESCs and iPSCs. These data are consistent with the hypothesis that in vitro microenvironmental context differentially impacts the gene expression signatures of both iPSCs and ESCs.

  8. [Listeria monocytogenes in food].

    Science.gov (United States)

    Mícková, V

    1992-12-01

    As in recent years laboratory diagnostics of listeria has become part of food microbiology, the frequency of occurrence of the bacteria Listeria monocytogenes has been followed in various kinds of foods for a year. A total of 51 strains of L. monocytogenes (7.2%) was isolated from 700 kinds of samples (raw milk, pasteurized milk, meat surface, poultry, cheeses, thermally not treated meat products, food--industry machinery). As can be seen in Tab. I, the highest number of strains was isolated from meat surfaces (13.5%), followed by meat--industry machinery (12.72%), poultry (10%) and cheeses (5%). The lower numbers of strains were found out in thermally not treated meat products (3.8%) and in raw milk (3.3%). Pasteurized milk did not contain any strains. Our findings in raw milk (3.3%) and in pasteurized milk (0) are in agreement with the data cited e. g. by authors from the USA (Lovett et al., 1987), who mention the value of 4.2% in raw milk and the zero value in pasteurized milk. The percentage of strains monitored in cheeses (5%) can be evaluated as low as the assortment of investigated cheeses was small (all strains were isolated from soft ripening cheeses). German authors (Tham et al., 1988) speak about the 2.5% percentage of L. monocytogenes strains; this is in keeping with our findings. The findings in thermally not treated meat products (3.8%) can be evaluated as low although the number of strains found in raw meat was high.(ABSTRACT TRUNCATED AT 250 WORDS)

  9. pbp2229-mediated nisin resistance mechanism in Listeria monocytogenes confers cross-protection to class IIa bacteriocins and affects virulence gene expression.

    Science.gov (United States)

    Gravesen, Anne; Kallipolitis, Birgitte; Holmstrøm, Kim; Høiby, Poul Erik; Ramnath, Manilduth; Knøchel, Susanne

    2004-03-01

    It was previously shown that enhanced nisin resistance in some mutants was associated with increased expression of three genes, pbp2229, hpk1021, and lmo2487, encoding a penicillin-binding protein, a histidine kinase, and a protein of unknown function, respectively. In the present work, we determined the direct role of the three genes in nisin resistance. Interruption of pbp2229 and hpk1021 eliminated the nisin resistance phenotype. Interruption of hpk1021 additionally abolished the increase in pbp2229 expression. The results indicate that this nisin resistance mechanism is caused directly by the increase in pbp2229 expression, which in turn is brought about by the increase in hpk1021 expression. We also found a degree of cross-protection between nisin and class IIa bacteriocins and investigated possible mechanisms. The expression of virulence genes in one nisin-resistant mutant and two class IIa bacteriocin-resistant mutants of the same wild-type strain was analyzed, and each mutant consistently showed either an increase or a decrease in the expression of virulence genes (prfA-regulated as well as prfA-independent genes). Although the changes mostly were moderate, the consistency indicates that a mutant-specific change in virulence may occur concomitantly with bacteriocin resistance development.

  10. Recruitment of the major vault protein by InlK: a Listeria monocytogenes strategy to avoid autophagy.

    Directory of Open Access Journals (Sweden)

    Laurent Dortet

    2011-08-01

    Full Text Available L. monocytogenes is a facultative intracellular bacterium responsible for listeriosis. It is able to invade, survive and replicate in phagocytic and non-phagocytic cells. The infectious process at the cellular level has been extensively studied and many virulence factors have been identified. Yet, the role of InlK, a member of the internalin family specific to L. monocytogenes, remains unknown. Here, we first show using deletion analysis and in vivo infection, that InlK is a bona fide virulence factor, poorly expressed in vitro and well expressed in vivo, and that it is anchored to the bacterial surface by sortase A. We then demonstrate by a yeast two hybrid screen using InlK as a bait, validated by pulldown experiments and immunofluorescence analysis that intracytosolic bacteria via an interaction with the protein InlK interact with the Major Vault Protein (MVP, the main component of cytoplasmic ribonucleoproteic particules named vaults. Although vaults have been implicated in several cellular processes, their role has remained elusive. Our analysis demonstrates that MVP recruitment disguises intracytosolic bacteria from autophagic recognition, leading to an increased survival rate of InlK over-expressing bacteria compared to InlK(- bacteria. Together these results reveal that MVP is hijacked by L. monocytogenes in order to counteract the autophagy process, a finding that could have major implications in deciphering the cellular role of vault particles.

  11. Freedom of expression: cell-type-specific gene profiling.

    Science.gov (United States)

    Otsuki, Leo; Cheetham, Seth W; Brand, Andrea H

    2014-01-01

    Cell fate and behavior are results of differential gene regulation, making techniques to profile gene expression in specific cell types highly desirable. Many methods now enable investigation at the DNA, RNA and protein level. This review introduces the most recent and popular techniques, and discusses key issues influencing the choice between these such as ease, cost and applicability of information gained. Interdisciplinary collaborations will no doubt contribute further advances, including not just in single cell type but single-cell expression profiling.

  12. Laminin Mediates Tissue-specific Gene Expression in Mammary Epithelia

    Energy Technology Data Exchange (ETDEWEB)

    Streuli, Charles H; Schmidhauser, Christian; Bailey, Nina; Yurchenco, Peter; Skubitz, Amy P. N.; Roskelley, Calvin; Bissell, Mina J

    1995-04-01

    Tissue-specific gene expression in mammary epithelium is dependent on the extracellular matrix as well as hormones. There is good evidence that the basement membrane provides signals for regulating beta-casein expression, and that integrins are involved in this process. Here, we demonstrate that in the presence of lactogenic hormones, laminin can direct expression of the beta-casein gene. Mouse mammary epithelial cells plated on gels of native laminin or laminin-entactin undergo functional differentiation. On tissue culture plastic, mammary cells respond to soluble basement membrane or purified laminin, but not other extracellular matrix components, by synthesizing beta-casein. In mammary cells transfected with chloramphenicol acetyl transferase reporter constructs, laminin activates transcription from the beta-casein promoter through a specific enhancer element. The inductive effect of laminin on casein expression was specifically blocked by the E3 fragment of the carboxy terminal region of the alpha 1 chain of laminin, by antisera raised against the E3 fragment, and by a peptide corresponding to a sequence within this region. Our results demonstrate that laminin can direct tissue-specific gene expression in epithelial cells through its globular domain.

  13. Comparative experimental infection of Listeria monocytogenes and Listeria ivanovii in bovine trophoblasts.

    Science.gov (United States)

    Rocha, Cláudia E; Mol, Juliana P S; Garcia, Luize N N; Costa, Luciana F; Santos, Renato L; Paixão, Tatiane A

    2017-01-01

    Listeria monocytogenes is a Gram-positive, facultative intracellular and invasive bacterium that has tropism to the placenta, and causes fetal morbidity and mortality in several mammalian species. While infection with L. monocytogenes and L. ivanovii are known as important causes of abortion and reproductive failure in cattle, the pathogenesis of maternal-fetal listeriosis in this species is poorly known. This study used the bovine chorioallantoic membrane explant model to investigate the kinetics of L. monocytogenes, L. ivanovii, and L. innocua infections in bovine trophoblastic cells for up to 8 h post infection. L. monocytogenes and L. ivanovii were able to invade and multiply in trophoblastic cells without causing cell death or inducing expression of pro-inflammatory genes. Although L. innocua was unable to multiply in bovine trophoblastic cells, it induced transcription of the pro-inflammatory mediator CXCL6. This study demonstrated for the first time the susceptibility of bovine trophoblastic cells to L. monocytogenes and L. ivanovii infection.

  14. Specific small nucleolar RNA expression profiles in acute leukemia.

    Science.gov (United States)

    Valleron, W; Laprevotte, E; Gautier, E-F; Quelen, C; Demur, C; Delabesse, E; Agirre, X; Prósper, F; Kiss, T; Brousset, P

    2012-09-01

    Apart from microRNAs, little is known about the regulation of expression of non-coding RNAs in cancer. We investigated whether small nucleolar RNAs (snoRNAs) accumulation displayed specific signatures in acute myeloblastic and acute lymphoblastic leukemias. Using microarrays and high-throughput quantitative PCR (qPCR), we demonstrate here that snoRNA expression patterns are negatively altered in leukemic cells compared with controls. Interestingly, a specific signature was found in acute promyelocytic leukemia (APL) with ectopic expression of SNORD112-114 snoRNAs located at the DLK1-DIO3 locus. In vitro experiments carried out on APL blasts demonstrate that transcription of these snoRNAs was lost under all-trans retinoic acid-mediated differentiation and induced by enforced expression of the PML-RARalpha fusion protein in negative leukemic cell lines. Further experiments revealed that the SNORD114-1 (14q(II-1)) variant promoted cell growth through cell cycle modulation; its expression was implicated in the G0/G1 to S phase transition mediated by the Rb/p16 pathways. This study thus reports three important observations: (1) snoRNA regulation is different in normal cells compared with cancer cells; (2) a relationship exists between a chromosomal translocation and expression of snoRNA loci; and (3) snoRNA expression can affect Rb/p16 cell cycle regulation. Taken together, these data strongly suggest that snoRNAs have a role in cancer development.

  15. Listeria monocytogenes 10403S Arginine Repressor ArgR Finely Tunes Arginine Metabolism Regulation under Acidic Conditions

    Science.gov (United States)

    Cheng, Changyong; Dong, Zhimei; Han, Xiao; Sun, Jing; Wang, Hang; Jiang, Li; Yang, Yongchun; Ma, Tiantian; Chen, Zhongwei; Yu, Jing; Fang, Weihuan; Song, Houhui

    2017-01-01

    Listeria monocytogenes is able to colonize human and animal intestinal tracts and to subsequently cross the intestinal barrier, causing systemic infection. For successful establishment of infection, L. monocytogenes must survive the low pH environment of the stomach. L. monocytogenes encodes a functional ArgR, a transcriptional regulator belonging to the ArgR/AhrC arginine repressor family. We aimed at clarifying the specific functions of ArgR in arginine metabolism regulation, and more importantly, in acid tolerance of L. monocytogenes. We showed that ArgR in the presence of 10 mM arginine represses transcription and expression of the argGH and argCJBDF operons, indicating that L. monocytogenes ArgR plays the classical role of ArgR/AhrC family proteins in feedback inhibition of the arginine biosynthetic pathway. Notably, transcription and expression of arcA (encoding arginine deiminase) and sigB (encoding an alternative sigma factor B) were also markedly repressed by ArgR when bacteria were exposed to pH 5.5 in the absence of arginine. However, addition of arginine enabled ArgR to derepress the transcription and expression of these two genes. Electrophoretic mobility shift assays showed that ArgR binds to the putative ARG boxes in the promoter regions of argC, argG, arcA, and sigB. Reporter gene analysis with gfp under control of the argG promoter demonstrated that ArgR was able to activate the argG promoter. Unexpectedly, deletion of argR significantly increased bacterial survival in BHI medium adjusted to pH 3.5 with lactic acid. We conclude that this phenomenon is due to activation of arcA and sigB. Collectively, our results show that L. monocytogenes ArgR finely tunes arginine metabolism through negative transcriptional regulation of the arginine biosynthetic operons and of the catabolic arcA gene in an arginine-independent manner during lactic acid-induced acid stress. ArgR also appears to activate catabolism as well as sigB transcription by anti

  16. Specificity of Facial Expression Labeling Deficits in Childhood Psychopathology

    Science.gov (United States)

    Guyer, Amanda E.; McClure, Erin B.; Adler, Abby D.; Brotman, Melissa A.; Rich, Brendan A.; Kimes, Alane S.; Pine, Daniel S.; Ernst, Monique; Leibenluft, Ellen

    2007-01-01

    Background: We examined whether face-emotion labeling deficits are illness-specific or an epiphenomenon of generalized impairment in pediatric psychiatric disorders involving mood and behavioral dysregulation. Method: Two hundred fifty-two youths (7-18 years old) completed child and adult facial expression recognition subtests from the Diagnostic…

  17. Eugenol in combination with lactic acid bacteria attenuates Listeria monocytogenes virulence in vitro and in invertebrate model Galleria mellonella.

    Science.gov (United States)

    Upadhyay, Abhinav; Upadhyaya, Indu; Mooyottu, Shankumar; Venkitanarayanan, Kumar

    2016-06-01

    Listeria monocytogenes is a human enteric pathogen that causes severe foodborne illness in high-risk populations. Crossing the intestinal barrier is the first critical step for Listeria monocytogenes infection. Therefore, reducing L. monocytogenes colonization and invasion of intestinal epithelium and production of virulence factors could potentially control listeriosis in humans. This study investigated the efficacy of sub-inhibitory concentration (SIC) of the plant-derived antimicrobial eugenol, either alone, or in combination with five lactic acid bacteria (LAB), namely Bifidobacterium bifidum (NRRL-B41410), Lactobacillus reuteri (B-14172), Lactobacillus fermentum (B-1840), Lactobacillus plantarum (B-4496) and Lactococcus lactis subspecies lactis (B-633) in reducing Listeria monocytogenes adhesion to and invasion of human intestinal epithelial cells (Caco-2). Additionally, the effect of the aforementioned treatments on Listeria monocytogenes listeriolysin production, epithelial E-cadherin binding and expression of virulence genes was investigated. Moreover, the in vivo efficacy of eugenol-LAB treatments in reducing Listeria monocytogenes virulence in the invertebrate model Galleria mellonella was studied. Eugenol and LAB, either alone or in combination, significantly reduced Listeria monocytogenes adhesion to and invasion of intestinal cells (P eugenol-LAB treatments decreased Listeria monocytogenes haemolysin production, E-cadherin binding and virulence gene expression (P eugenol-LAB treatments significantly enhanced the survival rates of G. mellonella infected with lethal doses of Listeria monocytogenes (P eugenol either alone or in combination with LAB, and justify further investigations in a mammalian model.

  18. Listeria monocytogenes in Fresh Produce: Outbreaks, Prevalence and Contamination Levels

    Directory of Open Access Journals (Sweden)

    Qi Zhu

    2017-03-01

    Full Text Available Listeria monocytogenes, a member of the genus Listeria, is widely distributed in agricultural environments, such as soil, manure and water. This organism is a recognized foodborne pathogenic bacterium that causes many diseases, from mild gastroenteritis to severe blood and/or central nervous system infections, as well as abortion in pregnant women. Generally, processed ready-to-eat and cold-stored meat and dairy products are considered high-risk foods for L. monocytogenes infections that cause human illness (listeriosis. However, recently, several listeriosis outbreaks have been linked to fresh produce contamination around the world. Additionally, many studies have detected L. monocytogenes in fresh produce samples and even in some minimally processed vegetables. Thus L. monocytogenes may contaminate fresh produce if present in the growing environment (soil and water. Prevention of biofilm formation is an important control measure to reduce the prevalence and survival of L. monocytogenes in growing environments and on fresh produce. This article specifically focuses on fresh produce–associated listeriosis outbreaks, prevalence in growing environments, contamination levels of fresh produce, and associated fresh produce safety challenges.

  19. Listeria monocytogenes in Fresh Produce: Outbreaks, Prevalence and Contamination Levels

    Science.gov (United States)

    Zhu, Qi; Gooneratne, Ravi; Hussain, Malik Altaf

    2017-01-01

    Listeria monocytogenes, a member of the genus Listeria, is widely distributed in agricultural environments, such as soil, manure and water. This organism is a recognized foodborne pathogenic bacterium that causes many diseases, from mild gastroenteritis to severe blood and/or central nervous system infections, as well as abortion in pregnant women. Generally, processed ready-to-eat and cold-stored meat and dairy products are considered high-risk foods for L. monocytogenes infections that cause human illness (listeriosis). However, recently, several listeriosis outbreaks have been linked to fresh produce contamination around the world. Additionally, many studies have detected L. monocytogenes in fresh produce samples and even in some minimally processed vegetables. Thus L. monocytogenes may contaminate fresh produce if present in the growing environment (soil and water). Prevention of biofilm formation is an important control measure to reduce the prevalence and survival of L. monocytogenes in growing environments and on fresh produce. This article specifically focuses on fresh produce–associated listeriosis outbreaks, prevalence in growing environments, contamination levels of fresh produce, and associated fresh produce safety challenges. PMID:28282938

  20. Study on the Specific Gene Expression during Spermatogenesis of Rat

    Institute of Scientific and Technical Information of China (English)

    吴燕婉; 王春梅; 黄海燕; 石心泉; 邢志军; 刘德瑜

    2001-01-01

    Objective To explore specific gene expression for regulating meiosis of germ cells during spermatogenesis of rat testis Materials & Methods Male SD rats, aged 1, 3 and 8 weeks, were observed in this study. The methods of morphological observation on testicular tissues embedded by resin and mRNA differential display (DDRT-PCR) were combined to obtain specific mRNA expression gene fragments during the testicular development. Reverse dot blot hybridization was operated to further screen the positive differential DNA fragments.The positive DNA segments were sub-cloned in pGEM-T-Easy vector and transformed into the competent E-coli 109 straint. Northern blot analysis and in situ hybridization were also carried out for identifying tissue-specific expression as well as cell-specific expression DNA fragments. To screen λ-ZAP-II rat testicular gene library was searched for the original gene.Results Eighty two differential cDNA fragments were obtained through primary DDRT-PCR, among which 40 differential cDNA fragments were selected for further screening with reverse dot blot hybridization. After the reverse dot blot hybridization,12 primary differential DNA fragments were obtained. The size of DNA fragments ranged from 250 to 500 bp. The in situ hybridization of the testicular tissue showed that a specific DNA fragment derived from 8-week old rat testis, named CG14, was hybridized in adult rat testicular section, in which the positive nucleic acid signals were distributed specifically in the primary spermatocytes. Another DNA fragment derived from 1-week old rat testis, named AA 1 1, was hybridized specifically in Sertoli cell of 1-week old rat testis. Northern blot hybridization with [α-32P] dCTP labeled CG 1 4 probe, including cardiac, liver, kidney, brain, testis, and epididymis tissue mRNAs of rat, showed that an mRNA specific hybridization band, size of 1. 258 kb, was found in testis tissue and size of 1. 531 kb of another hybridization band present in epididymis

  1. [Hematometra & Listeria monocytogenes].

    Science.gov (United States)

    Gómez Arzapalo, E; Pérez Mendizábal, A; Herrera Avalos, I; Gorozpe Calvillo, J I

    2001-05-01

    The hematometra is a nosological entity that may not always be attributed to an embryonic defect of the paramesonefros; cervical-vaginal infections such as etiological possibilities due to Listeria monocytogenes (Lm), cervix malignant neoplasias, iatrogenias due to endometrial ablation with Lasser, traumatic bloody uterine curetage and because of cervical cryocoagulation or electrocoagulation are also mentioned. The case to be reported is from a woman in reproductive stage, who is 32 years old, and had menarca at the age of 13, starting her sexual life at 31, not using any method to control her fertility. When having an eight-week amenorrhea after 8 months of marriage, she visited the doctor for assumed pregnancy, within the prenatal analysis a pelvic echographic study was requested, finding out images that we concluded as hematometra, having been drained and demonstrated the presence of LM by anti-Lm antibodies, being administered Azitromicina and Espiramicina.

  2. Acanthamoeba feature a unique backpacking strategy to trap and feed on Listeria monocytogenes and other motile bacteria

    DEFF Research Database (Denmark)

    Doyscher, Dominik; Fieseler, Lars; Dons, Lone Elisabet

    2013-01-01

    Despite its prominent role as an intracellular human pathogen, Listeria monocytogenes normally features a saprophytic lifestyle, and shares many environmental habitats with predatory protozoa. Earlier studies claimed that Acanthamoeba may act as environmental reservoirs for L.?monocytogenes, wher......Despite its prominent role as an intracellular human pathogen, Listeria monocytogenes normally features a saprophytic lifestyle, and shares many environmental habitats with predatory protozoa. Earlier studies claimed that Acanthamoeba may act as environmental reservoirs for L.......?monocytogenes, whereas others failed to confirm this hypothesis. Our findings support the latter and provide clear evidence that L.?monocytogenes is unable to persist in Acanthamoeba castellanii and A.?polyphaga. Instead, external Listeria cells are rapidly immobilized on the surface of Acanthamoeba trophozoites...... that formation of backpacks is not specific for L.?monocytogenes, and independent of bacterial pathogenicity or virulence. Hence, backpacking appears to represent a unique and highly effective strategy of Acanthamoeba to trap and feed on motile bacteria....

  3. Role of Extracellular DNA during Biofilm Formation by Listeria monocytogenes

    DEFF Research Database (Denmark)

    Harmsen, Morten; Lappann, Martin; Knøchel, S

    2010-01-01

    Listeria monocytogenes is a food-borne pathogen that is capable of living in harsh environments. It is believed to do this by forming biofilms, which are surface-associated multicellular structures encased in a self-produced matrix. In this paper we show that in L. monocytogenes extracellular DNA...... (eDNA) may be the only central component of the biofilm matrix and that it is necessary for both initial attachment and early biofilm formation for 41 L. monocytogenes strains that were tested. DNase I treatment resulted in dispersal of biofilms, not only in microtiter tray assays but also in flow...... cell biofilm assays. However, it was also demonstrated that in a culture without eDNA, neither Listeria genomic DNA nor salmon sperm DNA by itself could restore the capacity to adhere. A search for additional necessary components revealed that peptidoglycan (PG), specifically N-acetylglucosamine (NAG...

  4. Site-specific gene expression patterns in oral cancer.

    Science.gov (United States)

    Frohwitter, Gesche; Buerger, Horst; Korsching, Eberhard; van Diest, Paul J; Kleinheinz, Johannes; Fillies, Thomas

    2017-05-10

    Squamous cell carcinomas (SCCs) are the most prevalent malignant tumours within the head and neck. Evidence exists that distinct genes are differentially regulated in SCCs of the oral cavity compared to other head and neck regions. Given this background, the aim of this study was to investigate whether such tumour site-specific gene expression can also be observed in different localizations within the oral cavity. Using tissue microarrays (TMAs), we investigated 76 SCCs of the floor of the mouth, 49 SCCs of the tongue and 68 SCCs of other anatomic regions within the oral cavity. The expression of 17 genes involved in cell cycle and growth control (p16, p21, p27, p53, cyclin D1, EGFR, c-kit, bcl-6), cell adhesion (alpha-, beta-, and gamma-catenin), and apoptosis/stress response genes (Hif-1-alpha, Glut 1, CA IX, caspase, hsp70, XIAP) were investigated by means of immunohistochemistry. The data were subjected to chi(2), interdependency and Kaplan-Meier analysis. Our study suggests a remote difference in the site-specific gene expression patterns of oral cancer. X-linked inhibitor of apoptosis (XIAP) showed a significantly higher expression (p oral cavity. The increased XIAP expression was further associated with significantly decreased overall survival in all cases of SCCs of the oral cavity (p Expression levels of p53, CA IX, beta-catenin, Hif-1-alpha, and c-kit were also observed to be inversely related between SCCs of the floor of the mouth and those of the tongue respectively, although these differences did not reach statistical significance. Overall and event-free survival did not differ in patients with T1/T2/N0 SCCs according to tumour localization. In summary, the protein expression patterns of SCCs of the oral cavity suggest the existence of a molecular and morphological spectrum of SCCs in the oral cavity. In particular the expression pattern of XIAP indicates distinct gene expression patterns between carcinomas of the floor of the mouth and oral tongue

  5. The survival of Listeria monocytogenes during long term desiccation is facilitated by sodium chloride and organic material

    DEFF Research Database (Denmark)

    Vogel, Birte Fonnesbech; Hansen, Lisbeth Truelstrup; Mordhorst, Hanne

    2010-01-01

    One specific DNA-subtype, as determined by RAPD, of Listeria monocytogenes persisted in a fish slaughterhouse for years, even during months with no production where the plant was cleaned and kept dry. We hypothesised that tolerance to desiccation could be a factor in explaining the persistence of L...... monocytogenes in food processing environments and the purpose of the present study was to determine ability of L monocytogenes to survive desiccation on stainless steel under simulated food processing conditions. Viable counts of eight different L. monocytogenes strains exposed to different soils and relative...... humidities (RHs) during desiccation decreased significantly (p...

  6. 单核细胞增生性李斯特菌iap基因的原核表达%Prokaryotic Expression of iap Gene from Listeria monocytogenes

    Institute of Scientific and Technical Information of China (English)

    区燕宜; 徐成刚; 叶贺佳; 吴晓薇; 廖明

    2008-01-01

    该研究利用自行设计的引物通过PCR方法扩增出单核细胞增生性李斯特菌 Listeria monocytogenes C5305 株的iap基因,在iap基因的5'端和3'端分别引入EcoR Ⅰ和Xho Ⅰ 2 个酶切位点并将其克隆到pET-28a表达载体上,经PCR鉴定、酶切鉴定和核苷酸序列测定后获得重组质粒 pET-28a-iap,将该重组质粒转化人大肠杆菌BL21 (DE3)pLysS,经1 mmol/LIPTG诱导4~6 h后,通过SDS-PAGE及Western-blotting鉴定,证明该基因得到表达,表达产物相对分子质量约为60 000,以可溶形式存在.

  7. Nucleus- and cell-specific gene expression in monkey thalamus.

    Science.gov (United States)

    Murray, Karl D; Choudary, Prabhakara V; Jones, Edward G

    2007-02-06

    Nuclei of the mammalian thalamus are aggregations of neurons with unique architectures and input-output connections, yet the molecular determinants of their organizational specificity remain unknown. By comparing expression profiles of thalamus and cerebral cortex in adult rhesus monkeys, we identified transcripts that are unique to dorsal thalamus or to individual nuclei within it. Real-time quantitative PCR and in situ hybridization analyses confirmed the findings. Expression profiling of individual nuclei microdissected from the dorsal thalamus revealed additional subsets of nucleus-specific genes. Functional annotation using Gene Ontology (GO) vocabulary and Ingenuity Pathways Analysis revealed overrepresentation of GO categories related to development, morphogenesis, cell-cell interactions, and extracellular matrix within the thalamus- and nucleus-specific genes, many involved in the Wnt signaling pathway. Examples included the transcription factor TCF7L2, localized exclusively to excitatory neurons; a calmodulin-binding protein PCP4; the bone extracellular matrix molecules SPP1 and SPARC; and other genes involved in axon outgrowth and cell matrix interactions. Other nucleus-specific genes such as CBLN1 are involved in synaptogenesis. The genes identified likely underlie nuclear specification, cell phenotype, and connectivity during development and their maintenance in the adult thalamus.

  8. Fødevarebetinget listeria monocytogenes endokarditis

    DEFF Research Database (Denmark)

    Frydland, Martin; Bundgaard, Henning; Moser, Claus

    2014-01-01

    Infection with Listeria monocytogenes is rare and mainly seen in immunosuppressed patients. Infection with L. monocytogenes has a mortality rate of 30%. We present a case report of L. monocytogenes bacteraemia and endocarditis in a 70-year-old man with several co-morbidities and following four...... major surgical procedures. This illustrates the findings and characteristics in one of the 16 patients who died in 2013 and 2014 this summer due to sausage-related L. monocytogenes infection....

  9. An Entamoeba cysteine peptidase specifically expressed during encystation.

    Science.gov (United States)

    Ebert, Frank; Bachmann, Anna; Nakada-Tsukui, Kumiko; Hennings, Ina; Drescher, Babette; Nozaki, Tomoyoshi; Tannich, Egbert; Bruchhaus, Iris

    2008-12-01

    Protozoan parasites of the genus Entamoeba possess a considerable number of cysteine peptidases (CPs), the function of most of these molecules for amoeba biology needs to be established. In order to determine whether CPs may play a role during Entamoeba stage conversion from trophozoites into cysts and vice versa, expression of cp genes was analysed in the reptilian parasite Entamoeba invadens, a model organism for studying Entamoeba cyst development. By homology search, 28 papain-like cp genes were identified in public E. invadens genome databases. For eight of these genes the expression profiles during stage conversion was determined. By Northern blot analysis, transcripts for eicp-a9, -b7, -b8 and -c2, respectively, were detected neither in trophozoites or cysts nor at any of the point of times analysed during stage conversion. On the other hand, eicp-a5 is constitutively expressed during all developmental stages, whereas eicp-a3 and eicp-a11, respectively, are trophozoite-specific. Only eicp-b9 was found to be cyst-specific as it is expressed exclusively 18 to 28 h after cyst induction. Cyst-specific expression was confirmed by immunofluorescence microscopy of the corresponding protein EiCP-B9. In immature cysts, the molecule is located in structures that accumulate near the cyst wall, but which are uniformly distributed in mature cysts. The precise function of EiCP-B9 during Entamoeba encystation remains to be determined. However, colocalisation studies with an Entamoeba marker for autophagosomes suggest that EiCP-B9 is not associated with Entamoeba autophagy.

  10. Global expression differences and tissue specific expression differences in rice evolution result in two contrasting types of differentially expressed genes

    KAUST Repository

    Horiuchi, Youko

    2015-12-23

    Background Since the development of transcriptome analysis systems, many expression evolution studies characterized evolutionary forces acting on gene expression, without explicit discrimination between global expression differences and tissue specific expression differences. However, different types of gene expression alteration should have different effects on an organism, the evolutionary forces that act on them might be different, and different types of genes might show different types of differential expression between species. To confirm this, we studied differentially expressed (DE) genes among closely related groups that have extensive gene expression atlases, and clarified characteristics of different types of DE genes including the identification of regulating loci for differential expression using expression quantitative loci (eQTL) analysis data. Results We detected differentially expressed (DE) genes between rice subspecies in five homologous tissues that were verified using japonica and indica transcriptome atlases in public databases. Using the transcriptome atlases, we classified DE genes into two types, global DE genes and changed-tissues DE genes. Global type DE genes were not expressed in any tissues in the atlas of one subspecies, however changed-tissues type DE genes were expressed in both subspecies with different tissue specificity. For the five tissues in the two japonica-indica combinations, 4.6 ± 0.8 and 5.9 ± 1.5 % of highly expressed genes were global and changed-tissues DE genes, respectively. Changed-tissues DE genes varied in number between tissues, increasing linearly with the abundance of tissue specifically expressed genes in the tissue. Molecular evolution of global DE genes was rapid, unlike that of changed-tissues DE genes. Based on gene ontology, global and changed-tissues DE genes were different, having no common GO terms. Expression differences of most global DE genes were regulated by cis-eQTLs. Expression

  11. Heart-specific expression of laminopathic mutations in transgenic zebrafish.

    Science.gov (United States)

    Verma, Ajay D; Parnaik, Veena K

    2017-07-01

    Lamins are key determinants of nuclear organization and function in the metazoan nucleus. Mutations in human lamin A cause a spectrum of genetic diseases that affect cardiac muscle and skeletal muscle as well as other tissues. A few laminopathies have been modeled using the mouse. As zebrafish is a well established model for the study of cardiac development and disease, we have investigated the effects of heart-specific lamin A mutations in transgenic zebrafish. We have developed transgenic lines of zebrafish expressing conserved lamin A mutations that cause cardiac dysfunction in humans. Expression of zlamin A mutations Q291P and M368K in the heart was driven by the zebrafish cardiac troponin T2 promoter. Homozygous mutant embryos displayed nuclear abnormalities in cardiomyocyte nuclei. Expression analysis showed the upregulation of genes involved in heart regeneration in transgenic mutant embryos and a cell proliferation marker was increased in adult heart tissue. At the physiological level, there was deviation of up to 20% from normal heart rate in transgenic embryos expressing mutant lamins. Adult homozygous zebrafish were fertile and did not show signs of early mortality. Our results suggest that transgenic zebrafish models of heart-specific laminopathies show cardiac regeneration and moderate deviations in heart rate during embryonic development. © 2017 International Federation for Cell Biology.

  12. Quantifying Listeria monocytogenes prevalence and concentration in minced pork meat and estimating performance of three culture media from presence/absence microbiological testing using a deterministic and stochastic approach.

    Science.gov (United States)

    Andritsos, Nikolaos D; Mataragas, Marios; Paramithiotis, Spiros; Drosinos, Eleftherios H

    2013-12-01

    Listeria monocytogenes poses a serious threat to public health, and the majority of cases of human listeriosis are associated with contaminated food. Reliable microbiological testing is needed for effective pathogen control by food industry and competent authorities. The aims of this work were to estimate the prevalence and concentration of L. monocytogenes in minced pork meat by the application of a Bayesian modeling approach, and also to determine the performance of three culture media commonly used for detecting L. monocytogenes in foods from a deterministic and stochastic perspective. Samples (n = 100) collected from local markets were tested for L. monocytogenes using in parallel the PALCAM, ALOA and RAPID'L.mono selective media according to ISO 11290-1:1996 and 11290-2:1998 methods. Presence of the pathogen was confirmed by conducting biochemical and molecular tests. Independent experiments (n = 10) for model validation purposes were performed. Performance attributes were calculated from the presence-absence microbiological test results by combining the results obtained from the culture media and confirmative tests. Dirichlet distribution, the multivariate expression of a Beta distribution, was used to analyze the performance data from a stochastic perspective. No L. monocytogenes was enumerated by direct-plating (concentration was estimated at 14-17 CFU/kg. Validation showed good agreement between observed and predicted prevalence (error = -2.17%). The results showed that all media were best at ruling in L. monocytogenes presence than ruling it out. Sensitivity and specificity varied depending on the culture-dependent method. None of the culture media was perfect in detecting L. monocytogenes in minced pork meat alone. The use of at least two culture media in parallel enhanced the efficiency of L. monocytogenes detection. Bayesian modeling may reduce the time needed to draw conclusions regarding L. monocytogenes presence and the uncertainty of the results

  13. Quantifying strain variability in modeling growth of Listeria monocytogenes

    NARCIS (Netherlands)

    Aryani, D.; Besten, den H.M.W.; Hazeleger, W.C.; Zwietering, M.H.

    2015-01-01

    Prediction of microbial growth kinetics can differ from the actual behavior of the target microorganisms. In the present study, the impact of strain variability on maximum specific growth rate (µmax) (h- 1) was quantified using twenty Listeria monocytogenes strains. The µmax was determined as functi

  14. Differential Expression of Specific Dermatan Sulfate Domains in Renal Pathology.

    Science.gov (United States)

    Lensen, Joost F M; van der Vlag, Johan; Versteeg, Elly M M; Wetzels, Jack F M; van den Heuvel, Lambert P W J; Berden, Jo H M; van Kuppevelt, Toin H; Rops, Angelique L W M M

    2015-01-01

    Dermatan sulfate (DS), also known as chondroitin sulfate (CS)-B, is a member of the linear polysaccharides called glycosaminoglycans (GAGs). The expression of CS/DS and DS proteoglycans is increased in several fibrotic renal diseases, including interstitial fibrosis, diabetic nephropathy, mesangial sclerosis and nephrosclerosis. Little, however, is known about structural alterations in DS in renal diseases. The aim of this study was to evaluate the renal expression of two different DS domains in renal transplant rejection and glomerular pathologies. DS expression was evaluated in normal renal tissue and in kidney biopsies obtained from patients with acute interstitial or vascular renal allograft rejection, patients with interstitial fibrosis and tubular atrophy (IF/TA), and from patients with focal segmental glomerulosclerosis (FSGS), membranous glomerulopathy (MGP) or systemic lupus erythematosus (SLE), using our unique specific anti-DS antibodies LKN1 and GD3A12. Expression of the 4/2,4-di-O-sulfated DS domain recognized by antibody LKN1 was decreased in the interstitium of transplant kidneys with IF/TA, which was accompanied by an increased expression of type I collagen, decorin and transforming growth factor beta (TGF-β), while its expression was increased in the interstitium in FSGS, MGP and SLE. Importantly, all patients showed glomerular LKN1 staining in contrast to the controls. Expression of the IdoA-Gal-NAc4SDS domain recognized by GD3A12 was similar in controls and patients. Our data suggest a role for the DS domain recognized by antibody LKN1 in renal diseases with early fibrosis. Further research is required to delineate the exact role of different DS domains in renal fibrosis.

  15. Differential Expression of Specific Dermatan Sulfate Domains in Renal Pathology.

    Directory of Open Access Journals (Sweden)

    Joost F M Lensen

    Full Text Available Dermatan sulfate (DS, also known as chondroitin sulfate (CS-B, is a member of the linear polysaccharides called glycosaminoglycans (GAGs. The expression of CS/DS and DS proteoglycans is increased in several fibrotic renal diseases, including interstitial fibrosis, diabetic nephropathy, mesangial sclerosis and nephrosclerosis. Little, however, is known about structural alterations in DS in renal diseases. The aim of this study was to evaluate the renal expression of two different DS domains in renal transplant rejection and glomerular pathologies. DS expression was evaluated in normal renal tissue and in kidney biopsies obtained from patients with acute interstitial or vascular renal allograft rejection, patients with interstitial fibrosis and tubular atrophy (IF/TA, and from patients with focal segmental glomerulosclerosis (FSGS, membranous glomerulopathy (MGP or systemic lupus erythematosus (SLE, using our unique specific anti-DS antibodies LKN1 and GD3A12. Expression of the 4/2,4-di-O-sulfated DS domain recognized by antibody LKN1 was decreased in the interstitium of transplant kidneys with IF/TA, which was accompanied by an increased expression of type I collagen, decorin and transforming growth factor beta (TGF-β, while its expression was increased in the interstitium in FSGS, MGP and SLE. Importantly, all patients showed glomerular LKN1 staining in contrast to the controls. Expression of the IdoA-Gal-NAc4SDS domain recognized by GD3A12 was similar in controls and patients. Our data suggest a role for the DS domain recognized by antibody LKN1 in renal diseases with early fibrosis. Further research is required to delineate the exact role of different DS domains in renal fibrosis.

  16. Growth kinetics of Listeria monocytogenes and spoilage microorganisms in fresh-cut cantaloupe.

    Science.gov (United States)

    Fang, Ting; Liu, Yanhong; Huang, Lihan

    2013-05-01

    The main objective of this study was to investigate the growth kinetics of Listeria monocytogenes and background microorganisms in fresh-cut cantaloupe. Fresh-cut cantaloupe samples, inoculated with three main serotypes (1/2a, 1/2b, and 4b) of L. monocytogenes, were incubated at different temperatures, ranging from 4 to 43 °C, to develop kinetic growth models. During storage studies, the population of both background microorganisms and L. monocytogenes began to increase almost immediately, with little or no lag phase for most growth curves. All growth curves, except for two growth curves of L. monocytogenes 1/2a at 4 °C, developed to full curves (containing exponential and stationary phases), and can be described by a 3-parameter logistic model. There was no significant difference (P = 0.28) in the growth behaviors and the specific growth rates of three different serotypes of L. monocytogenes inoculated to fresh-cut cantaloupe. The effect of temperature on the growth of L. monocytogenes and spoilage microorganisms was evaluated using three secondary models. For L. monocytogenes, the minimum and maximum growth temperatures were estimated by both the Ratkowsky square-root and Cardinal parameter models, and the optimum temperature and the optimum specific growth rate by the Cardinal parameter model. An Arrhenius-type model provided more accurate estimation of the specific growth rate of L. monocytogenes at temperatures <4 °C. The kinetic models developed in this study can be used by regulatory agencies and food processors for conducting risk assessment of L. monocytogenes in fresh-cut cantaloupe, and for estimating the shelf-life of fresh-cut products.

  17. Ultra deep sequencing of Listeria monocytogenes sRNA transcriptome revealed new antisense RNAs.

    Directory of Open Access Journals (Sweden)

    Sebastian Behrens

    Full Text Available Listeria monocytogenes, a gram-positive pathogen, and causative agent of listeriosis, has become a widely used model organism for intracellular infections. Recent studies have identified small non-coding RNAs (sRNAs as important factors for regulating gene expression and pathogenicity of L. monocytogenes. Increased speed and reduced costs of high throughput sequencing (HTS techniques have made RNA sequencing (RNA-Seq the state-of-the-art method to study bacterial transcriptomes. We created a large transcriptome dataset of L. monocytogenes containing a total of 21 million reads, using the SOLiD sequencing technology. The dataset contained cDNA sequences generated from L. monocytogenes RNA collected under intracellular and extracellular condition and additionally was size fractioned into three different size ranges from 150 nt. We report here, the identification of nine new sRNAs candidates of L. monocytogenes and a reevaluation of known sRNAs of L. monocytogenes EGD-e. Automatic comparison to known sRNAs revealed a high recovery rate of 55%, which was increased to 90% by manual revision of the data. Moreover, thorough classification of known sRNAs shed further light on their possible biological functions. Interestingly among the newly identified sRNA candidates are antisense RNAs (asRNAs associated to the housekeeping genes purA, fumC and pgi and potentially their regulation, emphasizing the significance of sRNAs for metabolic adaptation in L. monocytogenes.

  18. Ultra Deep Sequencing of Listeria monocytogenes sRNA Transcriptome Revealed New Antisense RNAs

    Science.gov (United States)

    Behrens, Sebastian; Widder, Stefanie; Mannala, Gopala Krishna; Qing, Xiaoxing; Madhugiri, Ramakanth; Kefer, Nathalie; Mraheil, Mobarak Abu; Rattei, Thomas; Hain, Torsten

    2014-01-01

    Listeria monocytogenes, a gram-positive pathogen, and causative agent of listeriosis, has become a widely used model organism for intracellular infections. Recent studies have identified small non-coding RNAs (sRNAs) as important factors for regulating gene expression and pathogenicity of L. monocytogenes. Increased speed and reduced costs of high throughput sequencing (HTS) techniques have made RNA sequencing (RNA-Seq) the state-of-the-art method to study bacterial transcriptomes. We created a large transcriptome dataset of L. monocytogenes containing a total of 21 million reads, using the SOLiD sequencing technology. The dataset contained cDNA sequences generated from L. monocytogenes RNA collected under intracellular and extracellular condition and additionally was size fractioned into three different size ranges from 150 nt. We report here, the identification of nine new sRNAs candidates of L. monocytogenes and a reevaluation of known sRNAs of L. monocytogenes EGD-e. Automatic comparison to known sRNAs revealed a high recovery rate of 55%, which was increased to 90% by manual revision of the data. Moreover, thorough classification of known sRNAs shed further light on their possible biological functions. Interestingly among the newly identified sRNA candidates are antisense RNAs (asRNAs) associated to the housekeeping genes purA, fumC and pgi and potentially their regulation, emphasizing the significance of sRNAs for metabolic adaptation in L. monocytogenes. PMID:24498259

  19. RNA-FISH to analyze allele-specific expression.

    Science.gov (United States)

    Braidotti, G

    2001-01-01

    One of the difficulties associated with the analysis of imprinted gene expression is the need to distinguish RNA synthesis occurring at the maternal vs the paternally inherited copy of the gene. Most of the techniques used to examine allele-specific expression exploit naturally occurring polymorphisms and measure steady-state levels of RNA isolated from a pool of cells. Hence, a restriction fragment length polymorphism (RFLP) an be exploited in a heterozygote, by a reverse transcriptase polymerase chain reaction (RT-PCR)- based procedure, to analyze maternal vs paternal gene expression. The human IGF2R gene was analyzed in this way. Smrzka et al. (1) were thus able to show that the IGF2R gene possesses a hemimethylated, intronic CpG island analogous to the mouse imprinting box. However, IGF2R mRNA was detected that possessed the RFLP from both the maternal and paternal alleles in all but one of the 70 lymphoblastoid samples. (The one monoallelic sample reactivated its paternal allele with continued cell culturing.) It was concluded that monoallelic expression of the human gene is a polymorphic trait occurring in a small minority of all tested samples (reviewed in refs. 2,3). Although this is a sound conclusion, the question remains: Is the human IGF2R gene imprinted?

  20. Strand specific RNA-sequencing and membrane lipid profiling reveals growth phase-dependent cold stress response mechanisms in Listeria monocytogenes

    DEFF Research Database (Denmark)

    Hingston, Patricia; Chen, Jessica; Allen, Kevin

    2017-01-01

    -supply-chain. This study utilized strand-specific RNA sequencing and whole cell fatty acid (FA) profiling to characterize the bacterium’s cold stress response. RNA and FAs were extracted from a cold-tolerant strain at five time points between early lag phase and late stationary-phase, both at 4°C and 20°C. Overall, more...

  1. MHC class Jb-restricted cell responses to Listeria monocytogenes infection.

    Science.gov (United States)

    Kerksiek, K M; Pamer, E G

    1999-12-01

    Murine infection with Listeria monocytogenes induces CD8+ T cell responses specific for bacterial peptides that are presented on the infected cell surface by MHC class Ia and MHC class Ib molecules. We have used MHC tetramers to demonstrate that CD8+ T cells restricted by the H2-M3 MHC class Ib molecules constitute a substantial portion of the T cell response to L. monocytogenes infection. The in vivo size and kinetics of MHC class Ib-restricted T cell populations suggests that they play a prominent role in bacterial clearance following primary L. monocytogenes infection.

  2. Functional impact of mutational activation on the Listeria monocytogenes central virulence regulator PrfA

    OpenAIRE

    Miner, Maurine D.; Port, Gary C.; Freitag, Nancy E.

    2008-01-01

    The transcriptional activator PrfA is required for the expression of virulence factors necessary for Listeria monocytogenes pathogenesis. PrfA is believed to become activated following L. monocytogenes entry into the cytosol of infected host cells resulting in the induction of target genes whose products are required for bacterial intracellular growth and cell-to-cell spread. Several mutations have been identified that appear to lock PrfA into its highly activated cytosolic form (known as prf...

  3. A hierarchy of ECM-mediated signalling tissue-specific gene expression regulates tissue-specific gene expression

    Energy Technology Data Exchange (ETDEWEB)

    Roskelley, Calvin D; Srebrow, Anabella; Bissell, Mina J

    1995-10-07

    A dynamic and reciprocal flow of information between cells and the extracellular matrix contributes significantly to the regulation of form and function in developing systems. Signals generated by the extracellular matrix do not act in isolation. Instead, they are processed within the context of global signalling hierarchies whose constituent inputs and outputs are constantly modulated by all the factors present in the cell's surrounding microenvironment. This is particularly evident in the mammary gland, where the construction and subsequent destruction of such a hierarchy regulates changes in tissue-specific gene expression, morphogenesis and apoptosis during each developmental cycle of pregnancy, lactation and involution.

  4. Specific expression of bioluminescence reporter gene in cardiomyocyte regulated by tissue specific promoter

    Energy Technology Data Exchange (ETDEWEB)

    Nguyen, Vu Hong; Tae, Seong Ho; Le, Nguyen Uyen Chi; Min, Jung Joon [Chonnam National University Medical School, Gwangju (Korea, Republic of)

    2007-07-01

    As the human heart is not capable of regenerating the great numbers of cardiac cells that are lost after myocardial infarction, impaired cardiac function is the inevitable result of ischemic disease. Recently, human embryonic stem cells (hESCs) have gained popularity as a potentially ideal cell candidate for tissue regeneration. In particular, hESCs are capable of cardiac lineage-specific differentiation and confer improvement of cardiac function following transplantation into animal models. Although such data are encouraging, the specific strategy for in vivo and non-invasive detection of differentiated cardiac lineage is still limited. Therefore, in the present study, we established the gene construction in which the optical reporter gene Firefly luciferase was controlled by Myosin Heavy Chain promoter for specific expressing in heart cells. The vector consisting of - MHC promoter and a firefly luciferase coding sequence flanked by full-length bovine growth hormone (BGH) 3'-polyadenylation sequence based on pcDNA3.1- vector backbone. To test the specific transcription of this promoter in g of MHC-Fluc or CMV-Flue (for control) plasmid DNA in myocardial tissue, 20 phosphate-buffered saline was directly injected into mouse myocardium through a midline sternotomy and liver. After 1 week of injection, MHC-Fluc expression was detected from heart region which was observed under cooled CCD camera of in vivo imaging system but not from liver. In control group injected with CMV-Flue, the bioluminescence was detected from all these organs. The expression of Flue under control of Myosin Heavy Chain promoter may become a suitable optical reporter gene for stem cell-derived cardiac lineage differentiation study.

  5. Resistance to Biocides in Listeria monocytogenes Collected in Meat-Processing Environments

    Science.gov (United States)

    Conficoni, Daniele; Losasso, Carmen; Cortini, Enzo; Di Cesare, Andrea; Cibin, Veronica; Giaccone, Valerio; Corno, Gianluca; Ricci, Antonia

    2016-01-01

    The emergence of microorganisms exerting resistance to biocides is a challenge to meat-processing environments. Bacteria can be intrinsically resistant to biocides but resistance can also be acquired by adaptation to their sub-lethal concentrations. Moreover, the presence of biocide resistance determinants, which is closely linked to antibiotic resistance determinants, could lead to co-selection during disinfection practices along the food chain, and select cross-resistant foodborne pathogens. The purpose of this work was to test the resistance of wild strains of Listeria monocytogenes, isolated from pork meat processing plants, toward benzalkonium chloride (BC), used as proxy of quaternary ammonium compounds. Furthermore, the expression of two non-specific efflux pumps genes (lde and mdrL) under biocide exposure was evaluated. L. monocytogenes were isolated from five processing plants located in the Veneto region (northeast of Italy) before and after cleaning and disinfection (C&D) procedures. A total of 45 strains were collected: 36 strains before and nine after the C&D procedures. Collected strains were typed according to MLST and ERIC profiles. Strains sampled in the same site, isolated before, and after the C&D procedures and displaying the same MLST and ERIC profiles were tested for their sensitivity to different concentrations of BC, in a time course assay. The expression of non-specific efflux pumps was evaluated at each time point by qPCR using tufA gene as housekeeping. A differential expression of the two investigated genes was observed: lde was found to be more expressed by the strains isolated before C&D procedures while its expression was dose-dependent in the case of the post C&D procedures strain. On the contrary, the expression of mdrL was inhibited under low biocidal stress (10 ppm BC) and enhanced in the presence of high stress (100 ppm BC). These findings suggests a possible role for C&D procedures to select L. monocytogenes persisters, pointing

  6. Resistance to biocides in Listeria monocytogenes collected in meat-processing environments

    Directory of Open Access Journals (Sweden)

    Daniele Conficoni

    2016-10-01

    Full Text Available The emergence of microorganisms exerting resistance to biocides is a challenge to meat-processing environments. Bacteria can be intrinsically resistant to biocides but resistance can also be acquired by adaptation to their sub-lethal concentrations. Moreover the presence of biocide resistance determinants, which is closely linked to antibiotic resistance determinants, could lead to co-selection during disinfection practices along the food chain and select cross-resistant foodborne pathogens. The purpose of this work was to test the resistance of wild strains of Listeria monocytogenes, isolated from pork meat processing plants, towards benzalkonium chloride (BC, used as proxy of quaternary ammonium compounds. Furthermore, the expression of two non-specific efflux pumps genes (lde and mdrL under biocide exposure was evaluated. Listeria monocytogenes were isolated from five processing plants located in the Veneto region (northeast of Italy before and after cleaning and disinfection (C&D procedures. A total of 45 strains were collected: 36 strains before and 9 after the C&D procedures. Collected strains were typed according to MLST and ERIC profiles. Strains sampled in the same site, isolated before and after the C&D procedures and displaying the same MLST and ERIC profiles were tested for their sensitivity to different concentrations of BC, in a time course assay. The expression of non-specific efflux pumps was evaluated at each time point by qPCR using tufA gene as housekeeping. A differential expression of the two investigated genes was observed: lde was found to be more expressed by the strains isolated before C&D procedures while its expression was dose-dependent in the case of the post C&D procedures strain. On the contrary, the expression of mdrL was inhibited under low biocidal stress (10 ppm BC and enhanced in the presence of high stress (100 ppm BC. These findings suggests a possible role for C&D procedures to select Listeria monocytogenes

  7. Neuroinfections due to Listeria monocytogenes.

    Science.gov (United States)

    Streharova, A; Babjakova, A; Moravcikova, A; Harnicarova, A; Holeckova, K; Lesnakova, A; Sladeckova, V; Seckova, S; Kisac, P; Beno, P

    2007-11-01

    Listeria monocytogenes is not a rare pathogen causing meningitis, mainly in small children and in close contacts to livestock. The pathogen is naturally resistant to cephalosporins and some glycopeptides as well, therefore despite of syndromologic diagnosis of meningitis and initial therapy with 3rd generation cephalosporins according to the guidelines therapeutic failures with clinical consequences may occur.

  8. PRÉVALENCE DE LISTERIA MONOCYTOGENES DANS LE LAIT CRU DE VACHE AU LIBAN NORD

    Directory of Open Access Journals (Sweden)

    Imad al Kassaa

    2016-06-01

    Full Text Available Al Kassaa Imad, Khaled el Omari, Marwa Saati, Bachar Ismail and Monzer Hamze. 2016. Prevalence of Listeria monocytogenes in raw cow milk in north Lebanon. Lebanese Science Journal, 17(1: 39-45. Listeriosis, although a zoonosis, is an invasive disease that can affect newborns, pregnant women and immunocompromised adults. Clinical manifestations can be expressed by febrile gastroenteritis, invasive forms including severe sepsis, meningitis, rhombencephalitis, prenatal infections and abortions. Species of Listeria bacteria are ubiquitous and adaptable to the environment in animal and plant foods. This study aimed to determine the prevalence of Listeria monocytogenes in 100 samples of fresh cow milk collected from different areas of North Lebanon. Listeria monocytogenes was detected by using the Grand VIDAS technique (Biomérieux France. The results obtained revealed the absence of Listeria monocytogenes in all analyzed samples.

  9. Cell-surface alterations in class IIa bacteriocin-resistant Listeria monocytogenes strains.

    Science.gov (United States)

    Vadyvaloo, Viveka; Arous, Safia; Gravesen, Anne; Héchard, Yann; Chauhan-Haubrock, Ramola; Hastings, John W; Rautenbach, Marina

    2004-09-01

    Strains of the food-borne pathogen Listeria monocytogenes, showing either intermediate or high-level resistance to class IIa bacteriocins, were investigated to determine characteristics that correlated with their sensitivity levels. Two intermediate and one highly resistant spontaneous mutant of L. monocytogenes B73, a highly resistant mutant of L. monocytogenes 412, and a highly resistant, defined (mptA) mutant of L. monocytogenes EGDe were compared with their respective wild-type strains in order to investigate the contribution of different factors to resistance. Decreased mannose-specific phosphotransferase system gene expression (mptA, EIIAB(Man) component) was implicated in all levels of resistance, confirming previous studies by the authors' group. However, a clear correlation between d-alanine content in teichoic acid (TA), in particular the alanine : phosphorus ratio, and a more positive cell surface, as determined by cytochrome c binding, were found for the highly resistant strains. Furthermore, two of the three highly resistant strains showed a significant increase in sensitivity towards d-cycloserine (DCS). However, real-time PCR of the dltA (d-alanine esterification), and dal and ddlA genes (peptidoglycan biosynthesis) showed no change in transcriptional levels. The link between DCS sensitivity and increased d-alanine esterification of TA may be that DCS competes with alanine for transport via the alanine transporter. A possible tendency towards increased lysinylation of membrane phospholipid in the highly resistant strains was also found. A previous study reported that cell membranes of all the resistant strains, including the intermediate resistant strains, contained more unsaturated phosphatidylglycerol, which is an indication of a more fluid cell membrane. The results of that study correlate with the possible lysinylation, decreased mptA expression, d-alanine esterification of TA and more positive cell surface charge found in this study for

  10. Listeria monocytogenes incidence changes and diversity in some Brazilian dairy industries and retail products

    DEFF Research Database (Denmark)

    Oxaran, Virginie; In Lee, Sarah Hwa; Chaul, Luiza Toubas

    2017-01-01

    Listeria monocytogenes can cause listeriosis, a severe foodborne disease. In Brazil, despite very few reported cases of listeriosis, the pathogen has been repeatedly isolated from dairies. This has led the government to implement specific legislation to reduce the hazard. Here, we determined the ....... monocytogenes in dairies and retail products emphasize the need for continuous surveillance of this pathogen in the Brazilian dairy industry. (C) 2017 Elsevier Ltd. All rights reserved....

  11. Presence of Listeria monocytogenes in silage products of Shahrekord city

    Directory of Open Access Journals (Sweden)

    Ali Sharifzadeh

    2015-06-01

    Full Text Available Objective: To investigate the presence of Listeria monocytogenes in the silage samples. Methods: Silage samples obtained from 150 different farms in Shahrekord city (Iran and after DNA extraction, all samples were analyzed by PCR technique using one pair of primers for presence of this pathogen. The amplified products were detected on 1.5% agarose gel electrophoresis. Results: Listeria monocytogenes was isolated in 4 (2% of the 150 samples. The detection of this bacterium from silage samples in Shahrekord city indicated that these products could create a serious risk in public health of animal and human. The findings showed that in positive silage samples for Listeria monocytogenes, the pH value was about five and it was due to bacterial activity in these products. Conclusions: The quality of silage and hygiene parameters and good herd health management play an important role in the microbiological quality of herd and farm. Considering the high specificity and sensitivity of the employed PCR technique, it is recommended to be useful technique for identification of Listeria monocytogenes.

  12. Specific regulatory motifs predict glucocorticoid responsiveness of hippocampal gene expression.

    Science.gov (United States)

    Datson, N A; Polman, J A E; de Jonge, R T; van Boheemen, P T M; van Maanen, E M T; Welten, J; McEwen, B S; Meiland, H C; Meijer, O C

    2011-10-01

    The glucocorticoid receptor (GR) is an ubiquitously expressed ligand-activated transcription factor that mediates effects of cortisol in relation to adaptation to stress. In the brain, GR affects the hippocampus to modulate memory processes through direct binding to glucocorticoid response elements (GREs) in the DNA. However, its effects are to a high degree cell specific, and its target genes in different cell types as well as the mechanisms conferring this specificity are largely unknown. To gain insight in hippocampal GR signaling, we characterized to which GRE GR binds in the rat hippocampus. Using a position-specific scoring matrix, we identified evolutionary-conserved putative GREs from a microarray based set of hippocampal target genes. Using chromatin immunoprecipitation, we were able to confirm GR binding to 15 out of a selection of 32 predicted sites (47%). The majority of these 15 GREs are previously undescribed and thus represent novel GREs that bind GR and therefore may be functional in the rat hippocampus. GRE nucleotide composition was not predictive for binding of GR to a GRE. A search for conserved flanking sequences that may predict GR-GRE interaction resulted in the identification of GC-box associated motifs, such as Myc-associated zinc finger protein 1, within 2 kb of GREs with GR binding in the hippocampus. This enrichment was not present around nonbinding GRE sequences nor around proven GR-binding sites from a mesenchymal stem-like cell dataset that we analyzed. GC-binding transcription factors therefore may be unique partners for DNA-bound GR and may in part explain cell-specific transcriptional regulation by glucocorticoids in the context of the hippocampus.

  13. Evidence that PrfA, the pleiotropic activator of virulence genes in Listeria monocytogenes, can be present but inactive.

    OpenAIRE

    Renzoni, A; Klarsfeld, A; Dramsi, S.; Cossart, P

    1997-01-01

    All virulence genes of Listeria monocytogenes identified to date are positively regulated by PrfA, a transcriptional activator belonging to the Crp-Fnr family. Low temperature and cellobiose are two environmental signals known to repress expression of virulence genes in L. monocytogenes. In the present work, we analyzed the effect of temperature and cellobiose on the expression of the PrfA protein. At low temperature, PrfA was undetected, although prfA monocistronic transcripts are present. I...

  14. Tumor immunity within the central nervous system stimulated by recombinant Listeria monocytogenes vaccination.

    Science.gov (United States)

    Liau, Linda M; Jensen, Eric R; Kremen, Thomas J; Odesa, Sylvia K; Sykes, Steven N; Soung, Michael C; Miller, Jeff F; Bronstein, Jeff M

    2002-04-15

    Tumors arising within the central nervous system (CNS) present the immune system with a challenging target, given the heterogeneous nature of these neoplasms and their location within an "immunologically privileged" site. We used the lymphocytic choriomeningitis virus nucleoprotein (LCMV-NP) as a pseudotumor antigen to investigate recombinant Listeria monocytogenes as a tumor vaccine against s.c. and intracerebral challenges with a NP-expressing glioma, 9L-NP. Using Fischer 344 rats, we demonstrate that vaccination with recombinant L. monocytogenes-NP stimulates protection against s.c., but not intracerebral, 9L-NP tumor challenge in an antigen-specific, CD8(+) T-cell-dependent manner. After s.c. tumor rejection, enhanced antitumor immunity is achieved via epitope spreading that permits complete resistance against lethal intracerebral challenge with 9L-NP and with the untransfected parental 9L tumor. Unlike the CD8(+)-dependent immune responses against s.c. 9L-NP tumors, this expanded intracerebral immunity against endogenous tumor-associated antigens is dependent on both CD4(+) and CD8(+) T cells. Taken together, these results demonstrate that the mechanisms of tumor immunity within the brain are different from those elicited against non-CNS tumors. Furthermore, vaccination approaches exploiting the concept of epitope spreading may enhance the efficacy of antitumor immune responses within the immunologically privileged CNS, potentially mediating tumor cell killing through both CD4(+)- and CD8(+)-dependent effector pathways.

  15. Transcriptional and phenotypic responses of Listeria monocytogenes to chlorine dioxide.

    Science.gov (United States)

    Pleitner, Aaron M; Trinetta, Valentina; Morgan, Mark T; Linton, Richard L; Oliver, Haley F

    2014-05-01

    Significant food-borne disease outbreaks have occurred from consumption of ready-to-eat foods, including produce, contaminated with Listeria monocytogenes. Challenging food matrices (e.g., cantaloupe, sprouts) with limited processing steps postharvest to reduce pathogen loads have underscored a need for new mitigation strategies. Chlorine dioxide (ClO2) is increasingly being used in produce and other food systems to reduce food-borne pathogen levels. The goal of this study was to characterize the transcriptional response and survival of L. monocytogenes 10403S exposed to ClO2. The transcriptional profile of log-phase cells exposed to 300 mg/liter ClO2 for 15 min was defined by whole-genome microarray. A total of 340 genes were significantly differentially expressed. Among the differentially expressed genes, 223 were upregulated (fold change ≥ 1.5; adjusted P value < 0.05) in role categories responsible for protein fate, cellular processes, and energy metabolism. There were 113 and 16 genes differentially expressed belonging to regulatory networks of σ(B) and CtsR, respectively. We assessed L. monocytogenes 10403S survival after exposure to 100, 300, and 500 mg/liter aqueous ClO2 in brain heart infusion (BHI) broth; there was a significant difference between cells exposed to 500 mg/liter ClO2 and those exposed to all other conditions over time (P value < 0.05). Isogenic ΔsigB and ΔctsR mutants exposed to 300 mg/liter ClO2 were more sensitive to ClO2 than the wild type under the same conditions. These results provide an initial insight into the mechanisms that L. monocytogenes employs to survive sublethal ClO2 and further our understanding of the inactivation mechanisms of this increasingly used sanitizer.

  16. Cancer-specific binary expression system activated in mice by bacteriophage HK022 Integrase

    DEFF Research Database (Denmark)

    Elias, Amer; Spector, Itay; Sogolovsky-Bard, Ilana

    2016-01-01

    Binary systems based on site-specific recombination have been used for tumor specific transcription targeting of suicide genes in animal models. In these binary systems a site specific recombinase or integrase that is expressed from a tumor specific promoter drives tumor specific expression of a ...

  17. Cancer-specific binary expression system activated in mice by bacteriophage HK022 Integrase

    DEFF Research Database (Denmark)

    Elias, Amer; Spector, Itay; Sogolovsky-Bard, Ilana;

    2016-01-01

    Binary systems based on site-specific recombination have been used for tumor specific transcription targeting of suicide genes in animal models. In these binary systems a site specific recombinase or integrase that is expressed from a tumor specific promoter drives tumor specific expression...

  18. Shedding light on betL*: pPL2-lux mediated real-time analysis of betL* expression in Listeria monocytogenes.

    Science.gov (United States)

    Keane, Shauna M; Culligan, Eamonn P; Hoffmann, Roland F; Gahan, Cormac G M; Hill, Colin; Snelling, William J; Sleator, Roy D

    2016-04-02

    We propose a mechanism of action for the betL* mutation which is based on DNA topology. Removing a single thymine residue from the betL σ(A) promoter's -10 and -35 spacer results in a 'twist'-mediated activation of transcription which accounts for the osmotolerance phenotype observed for strains expressing betL*.

  19. A maize-specifically expressed gene cluster in Ustilago maydis.

    Science.gov (United States)

    Basse, Christoph W; Kolb, Sebastian; Kahmann, Regine

    2002-01-01

    The corn pathogen Ustilago maydis requires its host plant maize for development and completion of its sexual cycle. We have identified the fungal mig2-1 gene as being specifically expressed during this biotrophic stage. Intriguingly, mig2-1 is part of a gene cluster comprising five highly homologous and similarly regulated genes designated mig2-1 to mig2-5. Deletion analysis of the mig2-1 promoter provides evidence for negative and positive regulation. The predicted polypeptides of all five genes lack significant homologies to known genes but have characteristic N-terminal secretion sequences. The secretion signals of mig2-1 and mig2-5 were shown to be functional, and secretion of a full length Mig2-1-eGFP fusion protein to the extracellular space was demonstrated. The central domains of the Mig2 proteins are highly variable whereas the C-termini are strongly conserved and share a characteristic pattern of eight cysteine residues. The mig2 gene cluster was conserved in a wide collection of U. maydis strains. Interestingly, some U. maydis isolates from South America had lost the mig2-4 gene as a result of a homologous recombination event. Furthermore, the related Ustilago scitaminea strain, which is pathogenic on sugar cane, appears to lack the mig2 cluster. We describe a model of how the mig2 cluster might have evolved and discuss its possible role in governing host interaction.

  20. Antimicrobial Tolerance in Listeria monocytogenes

    DEFF Research Database (Denmark)

    Curtis, Thomas Darwin

    There are two ways in which bacteria survive killing by antibiotics. The most well-known, is antibiotic resistance, which results from the acquisition of a resistance gene or mutation that allows bacteria to grow and divide in the presence of antibiotic concentrations that would normally kill other...... that are completely refractory to antibiotics due to the inactivity of cellular processes. Persister cells have been linked to treatment failures in several bacterial infections including Mycobacterium tuberculosis, Pseudomonas aeruginosa, Staphylococcus aureus and Escherichia coli. Preceding the start of this Ph......D project, Listeria monocytogenes was observed to form these antibiotic tolerant persister cells. L. monocytogenes is a Gram-positive, foodborne pathogen that causes listeriosis, a rare, but often lethal disease, even with antibiotic treatment. It typically affects pregnant women, neonates, the elderly...

  1. Endothelium specific matrilysin (MMP-7) expression in human cancers

    NARCIS (Netherlands)

    Sier, C.F.M.; Hawinkels, L.J.A.C.; Zijlmans, H.J.M.A.A.; Zuidwijk, K.; Jonge de; Muller, E.S.M.; Ferreira, V.; Hanemaaijer, R.; Mulder-Stapel, A.A.; Kenter, G.G.; Verspaget, H.W.; Gorter, A.

    2008-01-01

    Over-expression of matrilysin (MMP-7) is predominantly associated with epithelial (pre)malignant cells. In the present study MMP-7 expression is also found in endothelial cells in various human cancer types. Endothelial MMP-7 was associated with CD34 and/or CD105 expression. These immunohistochemica

  2. Organ-specific gene expression: the bHLH protein Sage provides tissue specificity to Drosophila FoxA.

    Science.gov (United States)

    Fox, Rebecca M; Vaishnavi, Aria; Maruyama, Rika; Andrew, Deborah J

    2013-05-01

    FoxA transcription factors play major roles in organ-specific gene expression, regulating, for example, glucagon expression in the pancreas, GLUT2 expression in the liver, and tyrosine hydroxylase expression in dopaminergic neurons. Organ-specific gene regulation by FoxA proteins is achieved through cooperative regulation with a broad array of transcription factors with more limited expression domains. Fork head (Fkh), the sole Drosophila FoxA family member, is required for the development of multiple distinct organs, yet little is known regarding how Fkh regulates tissue-specific gene expression. Here, we characterize Sage, a bHLH transcription factor expressed exclusively in the Drosophila salivary gland (SG). We show that Sage is required for late SG survival and normal tube morphology. We find that many Sage targets, identified by microarray analysis, encode SG-specific secreted cargo, transmembrane proteins, and the enzymes that modify these proteins. We show that both Sage and Fkh are required for the expression of Sage target genes, and that co-expression of Sage and Fkh is sufficient to drive target gene expression in multiple cell types. Sage and Fkh drive expression of the bZip transcription factor Senseless (Sens), which boosts expression of Sage-Fkh targets, and Sage, Fkh and Sens colocalize on SG chromosomes. Importantly, expression of Sage-Fkh target genes appears to simply add to the tissue-specific gene expression programs already established in other cell types, and Sage and Fkh cannot alter the fate of most embryonic cell types even when expressed early and continuously.

  3. Cardiomyocyte expression and cell-specific processing of procholecystokinin

    DEFF Research Database (Denmark)

    Gøtze, Jens P.; Johnsen, Anders H.; Kistorp, Caroline

    2015-01-01

    has only been suggested using transcriptional measures or methods, with the post-translational phase of gene expression unaddressed. In this study, we examined the cardiac expression of the CCK gene in adult mammals and its expression at the protein level. Using quantitative PCR, a library of sequence......Heart muscle cells produce peptide hormones such as natriuretic peptides. Developing hearts also express the gene for the classic intestinal hormone cholecystokinin (CCK) in amounts similar to those in the intestine and brain. However, cardiac expression of peptides other than natriuretic peptides...

  4. An insight into the isolation, enumeration and molecular detection of Listeria monocytogenes in food

    Directory of Open Access Journals (Sweden)

    Jodi Woan-Fei Law

    2015-11-01

    Full Text Available Listeria monocytogenes, a foodborne pathogen that can cause listeriosis through the consumption of food contaminated with this pathogen. The ability of L. monocytogenes to survive in extreme conditions and cause food contaminations have become a major concern. Hence, routine microbiological food testing is necessary to prevent food contamination and outbreaks of foodborne illness. This review provides insight into the methods for cultural detection, enumeration and molecular identification of L. monocytogenes in various food samples. There are a number of enrichment and plating media that can be used for the isolation of L. monocytogenes from food samples. Enrichment media such as buffered Listeria Enrichment Broth (BLEB, Fraser broth and University of Vermont Medium (UVM Listeria enrichment broth are recommended by regulatory agencies such as FDA-BAM, USDA-FSIS and ISO. Many plating media are available for the isolation of L. monocytogenes, for instance, PALCAM, Oxford and other chromogenic media. Besides, reference methods like FDA-BAM, ISO 11290 method and USDA-FSIS method are usually applied for the cultural detection or enumeration of L. monocytogenes. MPN technique is applied for the enumeration of L. monocytogenes in the case of low level contamination. Molecular methods including polymerase chain reaction (PCR, multiplex polymerase chain reaction (mPCR, real-time/quantitative polymerase chain reaction (qPCR, nucleic acid sequence-based amplification (NASBA, loop-mediated isothermal amplification (LAMP, DNA microarray and Next Generation Sequencing (NGS technology for the detection and identification of L. monocytogenes are discussed in this review. Overall, molecular methods are rapid, sensitive, specific, time- and labour-saving. In future, there are chances for the development of new techniques for the detection and identification of foodborne with improved features.

  5. An insight into the isolation, enumeration, and molecular detection of Listeria monocytogenes in food

    Science.gov (United States)

    Law, Jodi Woan-Fei; Ab Mutalib, Nurul-Syakima; Chan, Kok-Gan; Lee, Learn-Han

    2015-01-01

    Listeria monocytogenes, a foodborne pathogen that can cause listeriosis through the consumption of food contaminated with this pathogen. The ability of L. monocytogenes to survive in extreme conditions and cause food contaminations have become a major concern. Hence, routine microbiological food testing is necessary to prevent food contamination and outbreaks of foodborne illness. This review provides insight into the methods for cultural detection, enumeration, and molecular identification of L. monocytogenes in various food samples. There are a number of enrichment and plating media that can be used for the isolation of L. monocytogenes from food samples. Enrichment media such as buffered Listeria enrichment broth, Fraser broth, and University of Vermont Medium (UVM) Listeria enrichment broth are recommended by regulatory agencies such as Food and Drug Administration-bacteriological and analytical method (FDA-BAM), US Department of Agriculture-Food and Safety (USDA-FSIS), and International Organization for Standardization (ISO). Many plating media are available for the isolation of L. monocytogenes, for instance, polymyxin acriflavin lithium-chloride ceftazidime aesculin mannitol, Oxford, and other chromogenic media. Besides, reference methods like FDA-BAM, ISO 11290 method, and USDA-FSIS method are usually applied for the cultural detection or enumeration of L. monocytogenes. most probable number technique is applied for the enumeration of L. monocytogenes in the case of low level contamination. Molecular methods including polymerase chain reaction, multiplex polymerase chain reaction, real-time/quantitative polymerase chain reaction, nucleic acid sequence-based amplification, loop-mediated isothermal amplification, DNA microarray, and next generation sequencing technology for the detection and identification of L. monocytogenes are discussed in this review. Overall, molecular methods are rapid, sensitive, specific, time- and labor-saving. In future, there are

  6. Longitudinal monitoring of Listeria monocytogenes and Listeria phages in seafood processing environments in Thailand.

    Science.gov (United States)

    Vongkamjan, Kitiya; Benjakul, Soottawat; Kim Vu, Hue Thi; Vuddhakul, Varaporn

    2017-09-01

    Listeria monocytogenes is a foodborne pathogen commonly found in environments of seafood processing, thus presenting a challenge for eradication from seafood processing facilities. Monitoring the prevalence and subtype diversity of L. monocytogenes together with phages that are specific to Listeria spp. ("Listeria phages") will provide knowledge on the bacteria-phage ecology in food processing plants. In this work, a total of 595 samples were collected from raw material, finished seafood products and environmental samples from different sites of a seafood processing plant during 17 sampling visits in 1.5 years of study. L. monocytogenes and Listeria spp. (non-monocytogenes) were found in 22 (3.7%) and 43 (7.2%) samples, respectively, whereas 29 Listeria phages were isolated from 9 (1.5%) phage-positive samples. DNA fingerprint analysis of L. monocytogenes isolates revealed 11 Random Amplified Polymorphic DNA (RAPD) profiles, with two subtypes were frequently observed over time. Our data reveal a presence of Listeria phages within the same seafood processing environments where a diverse set of L. monocytogenes subtypes was also found. Although serotype 4b was observed at lower frequency, data indicate that isolates from this seafood processing plant belonged to both epidemiologically important serotypes 1/2a and 4b, which may suggest a potential public health risk. Phages (all showed a unique genome size of 65 ± 2 kb) were classified into 9 host range groups, representing both broad- and narrow-host range. While most L. monocytogenes isolates from this facility were susceptible to phages, five isolates showed resistance to 12-20 phages. Variations in phage host range among Listeria phages isolated from food processing plant may affect a presence of a diverse set of L. monocytogenes isolates derived from the same processing environment in Thailand. Copyright © 2017 Elsevier Ltd. All rights reserved.

  7. Prevalence of Listeria monocytogenes in raw bovine milk and milk products from central highlands of Ethiopia.

    Science.gov (United States)

    Seyoum, Eyasu Tigabu; Woldetsadik, Daniel Asrat; Mekonen, Tesfu Kassa; Gezahegn, Haile Alemayehu; Gebreyes, Wondwossen Abebe

    2015-11-30

    Listeria monocytogenes is of major significance in human and veterinary medicine. Most human Listeria infections are foodborne and the association of contaminated milk and dairy produce consumption with human listeriosis is noteworthy. In Ethiopia, there is limited data regarding the prevalence of L. monocytogenes in raw bovine milk and dairy products. The aim of this study was, therefore, to determine the prevalence of L. monocytogenes in raw bovine milk and dairy produce. A total of 443 milk and milk product samples were microbiologically analyzed following methods recommended by the U.S. Food and Drug Administration Bacteriological Analytical Manual to isolate Listeria spp. The overall prevalence of Listeria spp. was 28.4% and specifically that of L. monocytogenes was 5.6%. Taking the prevalence of Listeria spp. into consideration, cheese was found to be highly contaminated at 60%, followed by pasteurized milk samples (40%), raw milk (18.9%) and yoghurt (5%). Considering the prevalence of Listeria monocytogenes only, raw milk had the lowest contamination while cheese had the highest, followed by pasteurized milk and yoghurt. Raw milk and milk products produced in urban and peri-urban areas of central Ethiopia were contaminated with pathogenic bacteria, L. monocytogenes. The detection of this pathogen in raw milk and milk products warrants an urgent regulatory mechanism to be put in place and also the potential role of milk processing plants in the contamination of dairy products should be investigated.

  8. Rapid and sensitive detection of Listeria monocytogenes by loop-mediated isothermal amplification.

    Science.gov (United States)

    Tang, Meng-Jun; Zhou, Sheng; Zhang, Xiao-Yan; Pu, Jun-Hua; Ge, Qing-Lian; Tang, Xiu-Jun; Gao, Yu-Shi

    2011-12-01

    Loop-mediated isothermal amplification (LAMP) was designed for detection of Listeria monocytogenes, which is an important food-borne kind of pathogenic bacteria causing human and animal disease. The primers set for the hlyA gene consist of six primers targeting eight regions on specific gene. The LAMP assay could be performed within 40 min at 65°C in a water bath. Amplification products were visualized by calcein and manganous ion and agarose gel electrophoresis. Sensitivity of the LAMP assay for detection of L. monocytogenes in pure cultures was 2.0 CFU per reaction. The LAMP assay was 100-fold higher sensitive than that of the conventional PCR assay. Taking this way, 60 chicken samples were investigated for L. monocytogenes. The accuracy of LAMP was shown to be 100% when compared to the "gold standard" culture-biotechnical, while the PCR assay failed to detect L. monocytogenes in two of the positive samples. It is shown that LAMP assay can be used as a sensitive, rapid, and simple detection tool for the detection of L. monocytogenes and will facilitate the surveillance for contamination of L. monocytogenes in food.

  9. Antimicrobial peptides effectively kill a broad spectrum of Listeria monocytogenes and Staphylococcus aureus strains independently of origin, sub-type, or virulence factor expression

    DEFF Research Database (Denmark)

    Gottlieb, Caroline Trebbien; Thomsen, L.E.; Ingmer, H.

    2008-01-01

    -type, and phenotypic behavior. Strains within each species were equally sensitive to HDPs and oxidative stress representing important components of the innate immune defense system. Four non-human peptides (protamine, plectasin, novicidin, and novispirin G10) were similar in activity profile (MIC value spectrum......) to the human β-defensin 3 (HBD-3). All strains were inhibited by concentrations of hydrogen peroxide between 0.1% – 1.0%. Sub-selections of both species differed in expression of several virulence-related factors and in their ability to survive in human whole blood and kill the nematode virulence model...

  10. Small RNA expression and strain specificity in the rat

    NARCIS (Netherlands)

    Linsen, S.E.V.; de Wit, E.; de Bruijn, E.; Cuppen, E.

    2010-01-01

    BACKGROUND: Digital gene expression (DGE) profiling has become an established tool to study RNA expression. Here, we provide an in-depth analysis of small RNA DGE profiles from two different rat strains (BN-Lx and SHR) from six different rat tissues (spleen, liver, brain, testis, heart, kidney). We

  11. Phloretin Attenuates Listeria monocytogenes Virulence Both In vitro and In vivo by Simultaneously Targeting Listeriolysin O and Sortase A.

    Science.gov (United States)

    Wang, Jianfeng; Liu, Bowen; Teng, Zihao; Zhou, Xuan; Wang, Xiyan; Zhang, Bing; Lu, Gejin; Niu, Xiaodi; Yang, Yongjun; Deng, Xuming

    2017-01-01

    The critical roles of sortase A (SrtA) and listeriolysin O (LLO) in Listeria monocytogenes pathogenicity render these two virulence factors as ideal targets for the development of anti-virulence agents against L. monocytogenes infection. Additionally, the structures of SrtA and LLO are highly conserved among the members of sortase enzyme family and cholesterol dependent toxin family. Here, phloretin, a natural polyphenolic compound derived from apples and pears that has little anti-L. monocytogenes activity, was identified to simultaneously inhibit LLO expression and neutralize SrtA catalytic activity. Phloretin neutralized SrtA activity by causing a conformational change in the protein's active pocket, which prevented engagement with its substrate. Treatment with phloretin simultaneously reduced L. monocytogenes invasion into host cells and blocked the escape of vacuole-entrapped L. monocytogenes into cytoplasm. Further, L. monocytogenes-infected mice that received phloretin showed lower mortality, decreased bacterial burden and reduced pathological injury. Our results demonstrate that phloretin is a promising anti-infective therapeutic for infections caused by L. monocytogenes due to its simultaneous targeting of SrtA and LLO, which may result in fewer side effects than those caused by other antibiotics.

  12. The quorum sensing luxS gene is induced in Lactobacillus acidophilus NCFM in response to Listeria monocytogenes.

    Science.gov (United States)

    Moslehi-Jenabian, Saloomeh; Vogensen, Finn Kvist; Jespersen, Lene

    2011-10-03

    The luxS gene involved in quorum sensing has been shown to control different behaviour of probiotic lactobacilli. In this study we investigated if luxS in Lactobacillus acidophilus NCFM was up-regulated in response to Listeria monocytogenes EGD-e. The two bacterial strains were grown in mono- and co-culture and the growth of both bacteria and the transcriptional level of luxS in L. acidophilus cells were monitored. Contrary to L. acidophilus, the growth of L. monocytogenes was significantly affected by co-cultivation. Transcriptional analysis showed that the expression of luxS increased during exponential growth in L. acidophilus cells with the highest level in the late-exponential growth phase, decreasing in the stationary phase. Following co-cultivation with L. monocytogenes, the transcriptional level of luxS increased significantly in mid-exponential growing cells of L. acidophilus after incubation with viable L. monocytogenes cells and by addition of cell-free culture supernatant of L. monocytogenes, whereas incubation with heat killed cells of L. monocytogenes had no effect on the transcriptional level. This could indicate that the up-regulation of luxS is due to a response to a secreted compound produced by L. monocytogenes cells.

  13. Listeria monocytogenes: survival and adaptation in the gastrointestinal tract

    Directory of Open Access Journals (Sweden)

    Cormac G.M. Gahan

    2014-02-01

    Full Text Available The foodborne pathogen Listeria monocytogenes has the capacity to survive and grow in a diverse range of natural environments. The transition from a food environment to the gastrointestinal tract begins a process of adaptation that may culminate in invasive systemic disease. Here we describe recent advances in our understanding of how L. monocytogenes adapts to the gastrointestinal environment prior to initiating systemic infection. We will discuss mechanisms used by the pathogen to survive encounters with acidic environments (which include the glutamate decarboxylase and arginine deiminase systems, and those which enable the organism to cope with bile acids (including bile salt hydrolase and competition with the resident microbiota. An increased understanding of how the pathogen survives in this environment is likely to inform the future design of novel prophylactic approaches that exploit specific pharmabiotics; including probiotics, prebiotics or phages.

  14. Cell-specific expression of TLR9 isoforms in inflammation.

    Science.gov (United States)

    McKelvey, Kelly J; Highton, John; Hessian, Paul A

    2011-02-01

    Toll-like receptors (TLRs) are key pattern recognition receptors during an immune response. With five isoforms of human TLR9 described, we hypothesised that differential expression of TLR9 isoforms in different cell types would result in variable contributions to the overall input from TLR9 during inflammation. We assessed the molecular expression of the TLR9 isoforms, TLR9-A, -C and -D. In normal peripheral blood mononuclear cells, B-lymphocytes express ∼100-fold more TLR9-A transcript than monocytes or T-lymphocytes, which predominantly express the TLR9-C transcript. Switches in isoform predominance accompany B-lymphocyte development. TLR9 protein expression in rheumatoid inflammatory lesions reflected the TLR9 isoform expression by immune cells. Herein we suggest that B-lymphocytes and plasmacytoid dendritic cells contribute the ∼3-fold higher TLR9-A transcript levels observed in inflamed synovium when compared to subcutaneous rheumatoid nodules. In contrast, macrophages and T-lymphocytes contribute the ∼4-fold higher TLR9-C transcript levels seen in nodules, compared to synovia. From protein sequence, predictions of subcellular localisation suggest TLR9-B may locate to the mitochondria, whereas TLR9-D adopts an opposing orientation in the endoplasmic reticulum. Consistent with this, structure models raise the possibility of alternative ligands for the TLR9-B and TLR9-D variants. Our results highlight differences in the expression of human TLR9 isoforms in normal and inflamed tissues, with differing contributions to inflammation.

  15. Tissue-Specific Expression of the Chicken Calpain2 Gene

    Directory of Open Access Journals (Sweden)

    Zeng-Rong Zhang

    2010-01-01

    Full Text Available We quantified chicken calpain 2 (CAPN2 expression in two Chinese chicken breeds (mountainous black-bone chicken breed [MB] and a commercial meat type chicken breed [S01] to discern the tissue and ontogenic expression pattern and its effect on muscle metabolism. Real-time quantitative PCR assay was developed for accurate measurement of the CAPN2 mRNA expression in various tissues from chickens of different ages (0, 2, 4, 6, 8, 10, and 12 weeks. Results showed that the breast muscle and leg muscle tissues had the highest expression of CAPN2 compared to the other tissues from the same individual (P<.05. Overall, the CAPN2 mRNA level exhibited a “rise” developmental change in all tissues. The S01 chicken had a higher expression of the CAPN2 mRNA in all tissues than the MB chicken. Our results suggest that chicken CAPN2 expression may be related to chicken breeds and tissues.

  16. Role of Efflux Pumps in Adaptation and Resistance of Listeria monocytogenes to Benzalkonium Chloride

    Science.gov (United States)

    Romanova, N. A.; Wolffs, P. F. G.; Brovko, L. Y.; Griffiths, M. W.

    2006-01-01

    In this study, potential mechanisms underlying resistance and adaptation to benzalkonium chloride (BC) in Listeria monocytogenes were investigated. Two groups of strains were studied. The first group consisted of strains naturally sensitive to BC which could be adapted to BC. The second group consisted of naturally resistant strains. For all adapted isolates, there was a correlation between the resistance to BC and ethidium bromide, but this was not the case for the naturally resistant isolates. To investigate the role of efflux pumps in adaptation or resistance, reserpine, an efflux pump inhibitor, was added to the strains. Addition of reserpine to the sensitive and adapted strains resulted in a decrease in the MIC for BC, whereas no such decrease was observed for the resistant strains, indicating that efflux pumps played no role in the innate resistance of certain strains of L. monocytogenes to this compound. Two efflux pumps (MdrL and Lde) have been described in L. monocytogenes. Studies showed low and intermediate levels of expression of the genes encoding the efflux pumps for two selected resistant strains, H7764 and H7962, respectively. Adaptation to BC of sensitive isolates of L. monocytogenes resulted in significant increases in expression of mdrl (P < 0.05), but no such increase was observed for lde for two adapted strains of L. monocytogenes, LJH 381 (P = 0.91) and C719 (P = 0.11). This indicates that the efflux pump Mdrl is at least partly responsible for the adaptation to BC. PMID:16672496

  17. Allele specific expression in worker reproduction genes in the bumblebee Bombus terrestris

    Directory of Open Access Journals (Sweden)

    Harindra E. Amarasinghe

    2015-07-01

    Full Text Available Methylation has previously been associated with allele specific expression in ants. Recently, we found methylation is important in worker reproduction in the bumblebee Bombus terrestris. Here we searched for allele specific expression in twelve genes associated with worker reproduction in bees. We found allele specific expression in Ecdysone 20 monooxygenase and IMP-L2-like. Although we were unable to confirm a genetic or epigenetic cause for this allele specific expression, the expression patterns of the two genes match those predicted for imprinted genes.

  18. Stochastic modelling of Listeria monocytogenes single cell growth in cottage cheese with mesophilic lactic acid bacteria from aroma producing cultures.

    Science.gov (United States)

    Østergaard, Nina Bjerre; Christiansen, Lasse Engbo; Dalgaard, Paw

    2015-07-02

    A stochastic model was developed for simultaneous growth of low numbers of Listeria monocytogenes and populations of lactic acid bacteria from the aroma producing cultures applied in cottage cheese. During more than two years, different batches of cottage cheese with aroma culture were analysed for pH, lactic acid concentration and initial concentration of lactic acid bacteria. These data and bootstrap sampling were used to represent product variability in the stochastic model. Lag time data were estimated from observed growth data (lactic acid bacteria) and from literature on L. monocytogenes single cells. These lag time data were expressed as relative lag times and included in growth models. A stochastic model was developed from an existing deterministic growth model including the effect of five environmental factors and inter-bacterial interaction [Østergaard, N.B, Eklöw, A and Dalgaard, P. 2014. Modelling the effect of lactic acid bacteria from starter- and aroma culture on growth of Listeria monocytogenes in cottage cheese. International Journal of Food Microbiology. 188, 15-25]. Growth of L. monocytogenes single cells, using lag time distributions corresponding to three different stress levels, was simulated. The simulated growth was subsequently compared to growth of low concentrations (0.4-1.0 CFU/g) of L. monocytogenes in cottage cheese, exposed to similar stresses, and in general a good agreement was observed. In addition, growth simulations were performed using population relative lag time distributions for L. monocytogenes as reported in literature. Comparably good predictions were obtained as for the simulations performed using lag time data for individual cells of L. monocytogenes. Therefore, when lag time data for individual cells are not available, it was suggested that relative lag time distributions for L. monocytogenes can be used as a qualified default assumption when simulating growth of low concentrations of L. monocytogenes.

  19. Listeria monocytogenes en comidas preparadas

    OpenAIRE

    Vila Brugalla, Montserrat

    2013-01-01

    Tradicionalmente Listeria monocytogenes no era considerado como un importante patógeno transmitido a través de los alimentos y, en consecuencia, no había recibido mucha atención por parte de la industria alimentaria. Los índices de listeriosis en la población humana siempre habían estado enormemente ensombrecidos por otras enfermedades transmitidas por los alimentos como la salmonelosis o la campilobacterosis, y la confirmación de brotes era poco frecuente. Sin embargo, los brotes de listerio...

  20. Differential Expression of Specific Dermatan Sulfate Domains in Renal Pathology

    NARCIS (Netherlands)

    Lensen, J.F.M.; Vlag, J. van der; Versteeg, E.M.M.; Wetzels, J.F.M.; Heuvel, L.P.W.J. van den; Berden, J.H.M.; Kuppevelt, T.H. van; Rops, A.

    2015-01-01

    Dermatan sulfate (DS), also known as chondroitin sulfate (CS)-B, is a member of the linear polysaccharides called glycosaminoglycans (GAGs). The expression of CS/DS and DS proteoglycans is increased in several fibrotic renal diseases, including interstitial fibrosis, diabetic nephropathy, mesangial

  1. Various Ready-to-Eat Products from Retail Stores Linked to Occurrence of Diverse Listeria monocytogenes and Listeria spp. Isolates.

    Science.gov (United States)

    Vongkamjan, Kitiya; Fuangpaiboon, Janejira; Turner, Matthew P; Vuddhakul, Varaporn

    2016-02-01

    Listeriosis outbreaks have been associated with a variety of foods. This study investigated the prevalence and diversity of Listeria monocytogenes and Listeria spp. in ready-to-eat (RTE) products and evaluated the performance of a rapid detection method, the 3M molecular detection assay for L. monocytogenes (MDA-LM), for detection of L. monocytogenes. Assay results were compared with those obtained using the U.S. Food and Drug Administration standard culture method described in the Bacteriological Analytical Manual. Products (n = 200) were purchased from retail stores: 122 aquatic products, 22 products of animal origin, 18 vegetarian products, 15 deli meat products, 13 salad and vegetable products, 4 desserts, 2 egg-based products, and 4 other products. L. monocytogenes prevalence was comparable with both methods. Overall, 15 (7.5%) of 200 samples were positive for L. monocytogenes: 3% of aquatic products, 1.5% of products of animal origin, 1% of vegetarian products, and 2% of deli meat products. Compared with the standard culture method, the sensitivity, specificity, and the accuracy of the MDA-LM were 86.7% (95% confidence interval, 58.4 to 97.7%), 98.4% (95% confidence interval, 95.0 to 99.6%), and 97.5%, respectively. Using the culture-based method, 18 (9%) of 200 samples were positive for Listeria species other than L. monocytogenes. Listeria isolates from these samples were classified into nine allelic types (ATs). The majority of isolates were classified as ATs 58 and 74, which were identified as L. monocytogenes lineages I and IV, respectively. Listeria innocua and Listeria welshimeri also were represented by isolates of multiple ATs. The MDA-LM is a rapid and reliable technique for detecting L. monocytogenes in various RTE foods. Further study is needed to develop effective control strategies to reduce L. monocytogenes contamination in RTE foods.

  2. Rapid and visual detection of Listeria monocytogenes based on nanoparticle cluster catalyzed signal amplification.

    Science.gov (United States)

    Zhang, Lisha; Huang, Ru; Liu, Weipeng; Liu, Hongxing; Zhou, Xiaoming; Xing, Da

    2016-12-15

    Foodborne pathogens pose a significant threat to human health worldwide. The identification of foodborne pathogens needs to be rapid, accurate and convenient. Here, we constructed a nanoparticle cluster (NPC) catalyzed signal amplification biosensor for foodborne pathogens visual detection. In this work, vancomycin (Van), a glycopeptide antibiotic for Gram-positive bacteria, was used as the first molecular recognition agent to capture Listeria monocytogenes (L. monocytogenes). Fe3O4 NPC modified aptamer, was used as the signal amplification nanoprobe, specifically recognize to the cell wall of L. monocytogenes. As vancomycin and aptamer recognize L. monocytogenes at different sites, the sandwich recognition showed satisfied specificity. Compared to individual Fe3O4 nanoparticle (NP), NPC exhibit collective effect-enhanced catalytic activity for the color reaction of chromogenic substrate. The change in absorbance or color could represent the concentration of target. Using the Fe3O4 NPC-based signal amplification method, L. monocytogenes whole cells could be directly assayed within a linear range of 5.4×10(3)-10(8) cfu/mL and a visual limit of detection of 5.4×10(3) cfu/mL. Fe3O4 NPC-based method was more sensitive than the Fe3O4 NP-based method. All these attractive characteristics of highly sensitivity, visual and labor-saving, make the biosensor possess a potential application for foodborne pathogenic bacteria detection. Copyright © 2016 Elsevier B.V. All rights reserved.

  3. Tissue Specific and Hormonal Regulation of Gene Expression

    Science.gov (United States)

    1998-07-01

    cAMP responsive region located at -200 to -99 bp in CRH. 14. SUBJECT TERMS 15. NUMfER OF PAGES Breast Cancer gene regulation, transcription, placenta...known mediators of labor, and it may also the stress response. The peptide sequence and expression of potentiate the effect of oxytocin on uterine...regulation of other rodent trophoblast genes has 220 not yet been investigated. 2. Robinson BG, Arbiser JL, Emanuel RL, Majzoub JA 1989 Species- 3008

  4. Rapid detection of Listeria monocytogenes by real-time PCR in processed meat and dairy products.

    Science.gov (United States)

    Heo, Eun Jeong; Song, Bo Ra; Park, Hyun Jung; Kim, Young Jo; Moon, Jin San; Wee, Sung Hwan; Kim, Jin-Seok; Yoon, Yohan

    2014-03-01

    The objectives of this study were to evaluate the detection of Listeria monocytogenes in different ready-to-eat foods using real-time PCR (RT-PCR). Various concentrations (10(0) to 10(5) CFU/ml) of L. monocytogenes ATCC 19115 were inoculated into ham, sausage, ground meat, processed milk, cheese, and infant formula. L. monocytogenes ATCC 19115 in the samples was then enumerated on Oxford agar, and DNA was extracted from the samples before and after incubation at 36°C for 4 h. A set of primers and hybridization probe designed in this study was then used to detect the pathogen. The standard curve was then prepared by plotting cycle threshold values for each dilution versus L. monocytogenes cell counts (log CFU). The specificity of the set of primers and hybridization probe was appropriate. A 4-h incubation at 36°C before DNA extraction produced optimum standard curves in comparison to the results for a 0-h incubation. Thus, a 4-h incubation at 36°C was applied for monitoring L. monocytogenes in collected food samples. To monitor L. monocytogenes in foods, 533 samples (ham, 129; sausage, 226; ground meat, 72; processed cheese, 54; processed milk, 42; and infant formula, 10) were collected from retail markets and from the step before pasteurization in plants. Of all 533 samples, 4 samples (0.8%) showed positive signals in RT-PCR. Two samples from hams (1.6%) and two samples from sausages (0.9%) were determined to be positive for L. monocytogenes at processed meat and milk products.

  5. Evolution and Diversity of Listeria monocytogenes from Clinical and Food Samples in Shanghai, China

    Directory of Open Access Journals (Sweden)

    Jianmin Zhang

    2016-07-01

    Full Text Available Listeria monocytogenes is a significant foodborne pathogen causing severe systemic infections in humans with high mortality rates. The objectives of this work were to establish a phylogenetic framework of L. monocytogenes from China and to investigate sequence diversity among different serotypes. We selected 17 L. monocytogenes strains recovered from patients and foods in China representing serotypes 1/2a, 1/2b, and 1/2c. Draft genome sequences were determined using Illumina MiSeq technique and associated protocols. Open reading frames were assigned using prokaryotic genome annotation pipeline by NCBI. Twenty-four published genomes were included for comparative genomic and phylogenetic analysis. More than 154,000 single nucleotide polymorphisms (SNPs were identified from multiple genome alignment and used to reconstruct maximum likelihood phylogenetic tree. The 41 genomes were differentiated into lineages I and II, which consisted of 4 and 11 subgroups, respectively. A clinical strain from China (SHL009 contained significant SNP differences compared to the rest genomes, whereas clinical strain SHL001 shared most recent common ancestor with strain SHL017 from food. Moreover, clinical strains SHL004 and SHL015 clustered together with two strains (08-5578 and 08-5923 recovered from an outbreak in Canada. Partial sequences of a plasmid found in the Canadian strain were also present in SHL004. We investigated the presence of various genes and gene clusters associated with virulence and subgroup-specific genes, including internalins, L. monocytogenes pathogenicity islands (LIPIs, L. monocytogenes genomic islands (LGIs, stress survival islet 1 (SSI-1, and clustered regularly interspaced short palindromic repeats (CRISPR/cas system. A novel genomic island, denoted as LGI-2 was identified. Comparative sequence analysis revealed differences among the L. monocytogenes strains related to virulence, survival abilities, and attributes against foreign genetic

  6. Coat protein promoter from cotton leaf curl virus is not a tissue-specifically expressed promoter

    Institute of Scientific and Technical Information of China (English)

    2000-01-01

    Geminivirus is a kind of single-stranded DNA virus. Experimental results from tomato golden mosaic virus (TGMV) showed that expression pattern of coat protein gene (cp) promoter was phloem specifically expressed. In this note, the studies on cp promoter of cotton leaf curl virus (CLCuV) which is found and identified recently suggest that the promoter is not phloem specifically expressed. The expressing activity of gus gene driven by the promoter exists not only in phloem but also in mesophyll tissues and root tip meristem. Transient expression suggests that cp promoter transactivated by AC2 shows expressing activity in mesophyll and vascular tissue of leaf vein.

  7. Isolation and Identification of Listeria monocytogenes in Processed Meat by a Combined Cultural-molecular Method

    Directory of Open Access Journals (Sweden)

    Angela Ingianni

    2007-01-01

    Full Text Available The isolation and identification of Listeria monocytogenes in processed meat samples by a combined cultural-molecular method is described. It allows the identification of Listeria strains by means of a hybridization technique with a specific DNA probe directed to the listerial internalin gene. The specificity of this method was found to be 100% and sensitivity was as low as 1 CFU/2.5 g of food sample. A total of 278 meat samples were tested in comparison with PCR and conventional cultural assays. A total of 42 (15.4% L. monocytogenes were detected. PCR analysis gave 3 false negative results and culture failed to detect the Listeria in 5 cases. With this cultural-molecular method the identification and quantitative detection of L. monocytogenes were achieved within 36 hours and no false positive or negative tests were obtained, thus fitting most food industry requirements.

  8. Effect of gamma-irradiation on the survival of Listeria monocytogenes and allergenicity of cherry tomatoes

    Science.gov (United States)

    Todoriki, Setsuko; Bari, Latiful; Kitta, Kazumi; Ohba, Mika; Ito, Yasuhiro; Tsujimoto, Yuka; Kanamori, Norihito; Yano, Erika; Moriyama, Tatsuya; Kawamura, Yukio; Kawamoto, Shinichi

    2009-07-01

    The presence of Listeria monocytogenes in fresh produce is a growing concern because of the possibility of food-borne illness. Ionizing radiation is an effective non-thermal means of eliminating pathogenic bacteria in fresh produce; however, the effect of ionizing irradiation on the allergenic properties of the host commodities remains unknown. This study aimed (i) to determine the effective dose of gamma-irradiation in eliminating L. monocytogenes on whole cherry tomatoes and (ii) to evaluate the effect of gamma-irradiation on the allergenic properties of tomato proteins. Cherry tomatoes that were inoculated with a mixture of five L. monocytogenes strains were treated with gamma-rays from a 60Co source. A 1.25 kGy dose of gamma-irradiation was found to be sufficient to eliminate L. monocytogenes on whole cherry tomatoes. The immunoblot profile of serum samples obtained from two patients with tomato allergy revealed that gamma-irradiation did not affect the allergenicity of tomato proteins for up to 7 days after irradiation when the tomatoes were stored at 20 °C. Additionally, the m-RNA levels of β-fructofuranosidase, polygalacturonase, pectin esterase, and superoxide dismutase, the main allergenic proteins in tomato, were not affected by the applied irradiation dose. Thus, this study demonstrated that a 1.25 kGy dose of gamma-irradiation effectively eliminates L. monocytogenes on cherry tomatoes without affecting the expression of allergenic proteins in the fruits.

  9. Effect of gamma-irradiation on the survival of Listeria monocytogenes and allergenicity of cherry tomatoes

    Energy Technology Data Exchange (ETDEWEB)

    Todoriki, Setsuko [National Food Research Institute, Tsukuba, Ibaraki 305-8642 (Japan)], E-mail: setsuko@affrc.go.jp; Bari, Latiful; Kitta, Kazumi; Ohba, Mika; Ito, Yasuhiro; Tsujimoto, Yuka [National Food Research Institute, Tsukuba, Ibaraki 305-8642 (Japan); Kanamori, Norihito [Japan International Research Center for Agricultural Science, Tsukuba, Ibaraki 305-8686 (Japan); Yano, Erika; Moriyama, Tatsuya; Kawamura, Yukio [School of Agriculture, Kinki University, Nara-city, Nara 631-8505 (Japan); Kawamoto, Shinichi [National Food Research Institute, Tsukuba, Ibaraki 305-8642 (Japan)

    2009-07-15

    The presence of Listeria monocytogenes in fresh produce is a growing concern because of the possibility of food-borne illness. Ionizing radiation is an effective non-thermal means of eliminating pathogenic bacteria in fresh produce; however, the effect of ionizing irradiation on the allergenic properties of the host commodities remains unknown. This study aimed (i) to determine the effective dose of gamma-irradiation in eliminating L. monocytogenes on whole cherry tomatoes and (ii) to evaluate the effect of gamma-irradiation on the allergenic properties of tomato proteins. Cherry tomatoes that were inoculated with a mixture of five L. monocytogenes strains were treated with gamma-rays from a {sup 60}Co source. A 1.25 kGy dose of gamma-irradiation was found to be sufficient to eliminate L. monocytogenes on whole cherry tomatoes. The immunoblot profile of serum samples obtained from two patients with tomato allergy revealed that gamma-irradiation did not affect the allergenicity of tomato proteins for up to 7 days after irradiation when the tomatoes were stored at 20 deg. C. Additionally, the m-RNA levels of {beta}-fructofuranosidase, polygalacturonase, pectin esterase, and superoxide dismutase, the main allergenic proteins in tomato, were not affected by the applied irradiation dose. Thus, this study demonstrated that a 1.25 kGy dose of gamma-irradiation effectively eliminates L. monocytogenes on cherry tomatoes without affecting the expression of allergenic proteins in the fruits.

  10. Identification of a Peptide-Pheromone that Enhances Listeria monocytogenes Escape from Host Cell Vacuoles

    Science.gov (United States)

    Xayarath, Bobbi; Alonzo, Francis; Freitag, Nancy E.

    2015-01-01

    Listeria monocytogenes is a Gram-positive facultative intracellular bacterial pathogen that invades mammalian cells and escapes from membrane-bound vacuoles to replicate within the host cell cytosol. Gene products required for intracellular bacterial growth and bacterial spread to adjacent cells are regulated by a transcriptional activator known as PrfA. PrfA becomes activated following L. monocytogenes entry into host cells, however the signal that stimulates PrfA activation has not yet been defined. Here we provide evidence for L. monocytogenes secretion of a small peptide pheromone, pPplA, which enhances the escape of L. monocytogenes from host cell vacuoles and may facilitate PrfA activation. The pPplA pheromone is generated via the proteolytic processing of the PplA lipoprotein secretion signal peptide. While the PplA lipoprotein is dispensable for pathogenesis, bacteria lacking the pPplA pheromone are significantly attenuated for virulence in mice and have a reduced efficiency of bacterial escape from the vacuoles of nonprofessional phagocytic cells. Mutational activation of PrfA restores virulence and eliminates the need for pPplA-dependent signaling. Experimental evidence suggests that the pPplA peptide may help signal to L. monocytogenes its presence within the confines of the host cell vacuole, stimulating the expression of gene products that contribute to vacuole escape and facilitating PrfA activation to promote bacterial growth within the cytosol. PMID:25822753

  11. Caste-Specific and Sex-Specific Expression of Chemoreceptor Genes in a Termite.

    Directory of Open Access Journals (Sweden)

    Yuki Mitaka

    Full Text Available The sophisticated colony organization of eusocial insects is primarily maintained through the utilization of pheromones. The regulation of these complex social interactions requires intricate chemoreception systems. The recent publication of the genome of Zootermopsis nevadensis opened a new avenue to study molecular basis of termite caste systems. Although there has been a growing interest in the termite chemoreception system that regulates their sophisticated caste system, the relationship between division of labor and expression of chemoreceptor genes remains to be explored. Using high-throughput mRNA sequencing (RNA-seq, we found several chemoreceptors that are differentially expressed among castes and between sexes in a subterranean termite Reticulitermes speratus. In total, 53 chemoreception-related genes were annotated, including 22 odorant receptors, 7 gustatory receptors, 12 ionotropic receptors, 9 odorant-binding proteins, and 3 chemosensory proteins. Most of the chemoreception-related genes had caste-related and sex-related expression patterns; in particular, some chemoreception genes showed king-biased or queen-biased expression patterns. Moreover, more than half of the genes showed significant age-dependent differences in their expression in female and/or male reproductives. These results reveal a strong relationship between the evolution of the division of labor and the regulation of chemoreceptor gene expression, thereby demonstrating the chemical communication and underlining chemoreception mechanism in social insects.

  12. Caste-Specific and Sex-Specific Expression of Chemoreceptor Genes in a Termite.

    Science.gov (United States)

    Mitaka, Yuki; Kobayashi, Kazuya; Mikheyev, Alexander; Tin, Mandy M Y; Watanabe, Yutaka; Matsuura, Kenji

    2016-01-01

    The sophisticated colony organization of eusocial insects is primarily maintained through the utilization of pheromones. The regulation of these complex social interactions requires intricate chemoreception systems. The recent publication of the genome of Zootermopsis nevadensis opened a new avenue to study molecular basis of termite caste systems. Although there has been a growing interest in the termite chemoreception system that regulates their sophisticated caste system, the relationship between division of labor and expression of chemoreceptor genes remains to be explored. Using high-throughput mRNA sequencing (RNA-seq), we found several chemoreceptors that are differentially expressed among castes and between sexes in a subterranean termite Reticulitermes speratus. In total, 53 chemoreception-related genes were annotated, including 22 odorant receptors, 7 gustatory receptors, 12 ionotropic receptors, 9 odorant-binding proteins, and 3 chemosensory proteins. Most of the chemoreception-related genes had caste-related and sex-related expression patterns; in particular, some chemoreception genes showed king-biased or queen-biased expression patterns. Moreover, more than half of the genes showed significant age-dependent differences in their expression in female and/or male reproductives. These results reveal a strong relationship between the evolution of the division of labor and the regulation of chemoreceptor gene expression, thereby demonstrating the chemical communication and underlining chemoreception mechanism in social insects.

  13. Heterologous Expression of Three Plant Serpins with Distinct Inhibitory Specificities

    DEFF Research Database (Denmark)

    Dahl, Søren Weis; Rasmussen, Søren Kjærsgård; Hejgaard, Jørn

    1996-01-01

    For the first time, inhibitory plant serpins, including WSZ1 from wheat, BSZ4, and the previously unknown protein BSZx from barley, have been expressed in Escherichia coli, and a procedure for fast purification of native plant serpins has been developed, BSZx, BSZ4, and WSZ1 were assayed for inhi...... favorable P-2 Leu. BSZ4 inhibited cathepsin G (k(a) = 2.7 x 10(4) M(-1) s(-1)) at P-1 Met but was hydrolyzed by trypsin and chymotrypsin. The three plant serpins formed stable SDS-resistant complexes with the proteinases in accordance with the kinetic data.......For the first time, inhibitory plant serpins, including WSZ1 from wheat, BSZ4, and the previously unknown protein BSZx from barley, have been expressed in Escherichia coli, and a procedure for fast purification of native plant serpins has been developed, BSZx, BSZ4, and WSZ1 were assayed......, the apparent rate constant for chymotrypsin inhibition at P-2 (k(a) = 9.4 x 10(5) M(-1) s(-1)) was only four times lower than for trypsin at P-1 (k(a) = 3.9 X 10(6) M(-1) s(-1)), and the apparent inhibition stoichiometries were close to 1. Furthermore, our data suggest that cathepsin G was inhibited by BSZx (k...

  14. Symbiont modulates expression of specific gene categories in Angomonas deanei

    Directory of Open Access Journals (Sweden)

    Luciana Loureiro Penha

    Full Text Available Trypanosomatids are parasites that cause disease in humans, animals, and plants. Most are non-pathogenic and some harbor a symbiotic bacterium. Endosymbiosis is part of the evolutionary process of vital cell functions such as respiration and photosynthesis. Angomonas deanei is an example of a symbiont-containing trypanosomatid. In this paper, we sought to investigate how symbionts influence host cells by characterising and comparing the transcriptomes of the symbiont-containing A. deanei (wild type and the symbiont-free aposymbiotic strains. The comparison revealed that the presence of the symbiont modulates several differentially expressed genes. Empirical analysis of differential gene expression showed that 216 of the 7625 modulated genes were significantly changed. Finally, gene set enrichment analysis revealed that the largest categories of genes that downregulated in the absence of the symbiont were those involved in oxidation-reduction process, ATP hydrolysis coupled proton transport and glycolysis. In contrast, among the upregulated gene categories were those involved in proteolysis, microtubule-based movement, and cellular metabolic process. Our results provide valuable information for dissecting the mechanism of endosymbiosis in A. deanei.

  15. In vitro activity of naturally occurring peptides (defensins against Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Nascimento Maria da Graça F.

    1994-01-01

    Full Text Available Autoclaved distilled water samples were inoculated with L. monocytogenes strain V7 and strain VPH-1, and incubated aerobically, at 30 C for 48 hours. Each strain was tested individually, and growth curves were determined at 1, 2, 3, 4, 5, 21, 24, and 48 hours. The growth or survival of L. monocytogenes was similar for both strains, with survivors at 24 hour-incubation. The microbicidal activity of one synthetic cationic peptide (NP-2 was examined against L. monocytogenes strain V7, in a water system. Antibacterial activity of NP-2 (1, 5, and 10 g/ml was best expressed at 60 minute-incubation, with 10 g/ml of peptide, at 30 C.

  16. The use of Listeria monocytogenes as a DNA delivery vector for cancer gene therapy.

    LENUS (Irish Health Repository)

    Tangney, Mark

    2012-01-31

    Listeria monocytogenes is an intracellular pathogen that lyses the phagosomal vacuole of infected cells, proliferates in the host cell cytoplasm and can actively enter adjacent cells. The pathogen is therefore well suited to exploitation as a vector for the delivery of DNA to target cells as the lifecycle favors cellular targeting with vector amplification and the potential for cell-to-cell spread. We have recently demonstrated DNA transfer by L. monocytogenes in growing tumors in murine models. Our approach exploited an ampicillin sensitive stain of L. monocytogenes which can be lysed through systemic administration of ampicillin to facilitate release of plasmid DNA for expression by infected mammalian cells. Here, we discuss the implications of this technology and the potential for future improvements of the system.

  17. Antibiotic therapy for Listeria monocytogenes bacteremia.

    Science.gov (United States)

    Hung, C C; Chang, S C; Chen, Y C; Hsieh, W C; Luh, K T

    1995-01-01

    Listeria monocytogenes has been recognized as an important pathogen in immunocompromised patients, but it has been rarely reported in Taiwan. We reviewed 13 cases of L. monocytogenes bacteremia at National Taiwan University Hospital over a 12-year period. All of the patients had underlying diseases. Fever was the most common presenting symptom, and neurologic signs were found in 6 patients. Most of the patients received penicillin G, ampicillin or piperacillin with an aminoglycoside. Corticosteroids were used in 9 of 13 patients. The overall mortality directly due to L. monocytogenes bacteremia was 31%. However, patients treated with cephalosporins or oxacillin had higher mortality than those treated with penicillin G, ampicillin or piperacillin (p = 0.05). Given the increasing number of immunosuppressed patients in Taiwan, it is likely that more cases will be encountered. Physicians in Taiwan should be aware of L. monocytogenes bacteremia and its treatment.

  18. Prevalence of Listeria monocytogenes in European cheeses

    DEFF Research Database (Denmark)

    Martinez Rios, Veronica; Dalgaard, Paw

    2017-01-01

    Both in Europe and worldwide cheese has caused important outbreaks of listeriosis and can be a vehicle for transmission of Listeria monocytogenes to consumers. A systematic review and meta-analysis were conducted using scientific literature and European Food Safety Authority (EFSA) reports...... understanding of L. monocytogenes prevalence in different types of cheeses and provided results that can be useful as input for quantitative microbiological risk assessment modelling....

  19. A novel C-terminal mutation resulting in constitutive activation of the Listeria monocytogenes central virulence regulatory factor PrfA

    OpenAIRE

    Xayarath, Bobbi; Smart, Jennifer I.; Mueller, Kimberly J.; Freitag, Nancy E.

    2011-01-01

    The environmental bacterium Listeria monocytogenes survives and replicates in a variety of diverse ecological niches that range from the soil to the cytosol of infected mammalian cells. The ability of L. monocytogenes to replicate within an infected host requires the expression of a number of secreted bacterial gene products whose expression is regulated by the transcriptional activator PrfA. PrfA becomes activated following bacterial entry into host cells; however, the mechanism by which thi...

  20. A novel mammal-specific three partite enhancer element regulates node and notochord-specific Noto expression.

    Directory of Open Access Journals (Sweden)

    Leonie Alten

    Full Text Available The vertebrate organizer and notochord have conserved, essential functions for embryonic development and patterning. The restricted expression of developmental regulators in these tissues is directed by specific cis-regulatory modules (CRMs whose sequence conservation varies considerably. Some CRMs have been conserved throughout vertebrates and likely represent ancestral regulatory networks, while others have diverged beyond recognition but still function over a wide evolutionary range. Here we identify and characterize a mammalian-specific CRM required for node and notochord specific (NNC expression of NOTO, a transcription factor essential for node morphogenesis, nodal cilia movement and establishment of laterality in mouse. A 523 bp enhancer region (NOCE upstream the Noto promoter was necessary and sufficient for NNC expression from the endogenous Noto locus. Three subregions in NOCE together mediated full activity in vivo. Binding sites for known transcription factors in NOCE were functional in vitro but dispensable for NOCE activity in vivo. A FOXA2 site in combination with a novel motif was necessary for NOCE activity in vivo. Strikingly, syntenic regions in non-mammalian vertebrates showed no recognizable sequence similarities. In contrast to its activity in mouse NOCE did not drive NNC expression in transgenic fish. NOCE represents a novel, mammal-specific CRM required for the highly restricted Noto expression in the node and nascent notochord and thus regulates normal node development and function.

  1. Tissue Specificity and Sex-Specific Regulatory Variation Permit the Evolution of Sex-Biased Gene Expression.

    Science.gov (United States)

    Dean, Rebecca; Mank, Judith E

    2016-09-01

    Genetic correlations between males and females are often thought to constrain the evolution of sexual dimorphism. However, sexually dimorphic traits and the underlying sexually dimorphic gene expression patterns are often rapidly evolving. We explore this apparent paradox by measuring the genetic correlation in gene expression between males and females (Cmf) across broad evolutionary timescales, using two RNA-sequencing data sets spanning multiple populations and multiple species. We find that unbiased genes have higher Cmf than sex-biased genes, consistent with intersexual genetic correlations constraining the evolution of sexual dimorphism. However, we found that highly sex-biased genes (both male and female biased) also had higher tissue specificity, and unbiased genes had greater expression breadth, suggesting that pleiotropy may constrain the breakdown of intersexual genetic correlations. Finally, we show that genes with high Cmf showed some degree of sex-specific changes in gene expression in males and females. Together, our results suggest that genetic correlations between males and females may be less important in constraining the evolution of sex-biased gene expression than pleiotropy. Sex-specific regulatory variation and tissue specificity may resolve the paradox of widespread sex bias within a largely shared genome.

  2. Internalization of Listeria monocytogenes in Whole Avocado.

    Science.gov (United States)

    Chen, Yi; Evans, Peter; Hammack, Thomas S; Brown, Eric W; Macarisin, Dumitru

    2016-08-01

    In recent years, tree fruits have emerged as a new concern for Listeria monocytogenes contamination. The objective of the current study was to evaluate the potential internalization of L. monocytogenes from the surface of avocados into the edible portions of the fruit during certain postharvest practices simulated in a laboratory setting. One set of intact avocados was spot inoculated with L. monocytogenes on the stem scar, and the second set was hydrocooled in water contaminated with L. monocytogenes. Under these experimental conditions, L. monocytogenes internalized into the avocado pulp through the stem or stem scar after both spot inoculation and hydrocooling. In avocados spot inoculated with 50, 130, 500, and 1,300 CFU per fruit, bacteria were detected in the edible portion adjacent to the stem scar within 15 days postinoculation during storage at 4°C. In avocados hydrocooled in water containing L. monocytogenes at 10(6) and 10(8) CFU/ml, bacteria reached the bottom end of the fruit, and the populations in the edible portion adjacent to the stem scar reached up to 5.90 to 7.19 log CFU/g within 10 to 15 days during storage at 4°C. Dye mixed with inoculum was useful for guiding subsequent sampling, but dye penetration patterns were not always consistent with bacterial penetration.

  3. An outbreak of an unusual strain of Listeria monocytogenes infection in North-East Scotland.

    Science.gov (United States)

    Okpo, Emmanuel; Leith, Jayne; Smith-Palmer, Alison; Bell, John; Parks, Duncan; Browning, Fiona; Byers, Lynn; Corrigan, Helen; Webster, Diana; Karcher, Anne M; Murray, Andrew; Storey, Tom

    2015-01-01

    Listeria monocytogenes infection is an important cause of illness and hospitalization in vulnerable individuals. In the present study, we describe a community outbreak of Listeria monocytogenes in the North-East region of Scotland, which was epidemiologically, environmentally and microbiologically linked to a local meat product and ready-to-eat product manufacturer. Infected individuals were interviewed, and an environmental investigation was conducted. Clinical and environmental samples were tested by culture, and isolates were typed by fluorescent amplified fragment length polymorphism (fAFLP). Three cases of Listeria monocytogenes were linked geographically, had the same serotype (1/2a) and were indistinguishable by fAFLP type XII.6. The human, food and environmental isolates were of the same serotype and were indistinguishable by molecular typing. This is the first community outbreak of L. monocytogenes reported in Scotland since the current outbreak surveillance was established in 1996. Epidemiological and laboratory evidence indicated poor hand hygiene, unhygienic practices and cross-contamination throughout the manufacturing process of ready-to-eat foods as a possible cause of the outbreak. More stringent control of commercial food establishments that provide ready-to-eat food and the need to advise specifically vulnerable groups, e.g., pregnant women, of the risk of L. monocytogenes in ready-to-eat food is urgently needed. Copyright © 2015 King Saud Bin Abdulaziz University for Health Sciences. Published by Elsevier Ltd. All rights reserved.

  4. An ecological perspective of Listeria monocytogenes biofilms in food processing facilities.

    Science.gov (United States)

    Valderrama, Wladir B; Cutter, Catherine N

    2013-01-01

    Listeria monocytogenes can enter the food chain at virtually any point. However, food processing environments seem to be of particular importance. From an ecological point of view, food processing facilities are microbial habitats that are constantly disturbed by cleaning and sanitizing procedures. Although L. monocytogenes is considered ubiquitous in nature, it is important to recognize that not all L. monocytogenes strains appear to be equally distributed; the distribution of the organism seems to be related to certain habitats. Currently, no direct evidence exists that L. monocytogenes-associated biofilms have played a role in food contamination or foodborne outbreaks, likely because biofilm isolation and identification are not part of an outbreak investigation, or the definition of biofilm is unclear. Because L. monocytogenes is known to colonize surfaces, we suggest that contamination patterns may be studied in the context of how biofilm formation is influenced by the environment within food processing facilities. In this review, direct and indirect epidemiological and phenotypic evidence of lineage-related biofilm formation capacity to specific ecological niches will be discussed. A critical view on the development of the biofilm concept, focused on the practical implications, strengths, and weaknesses of the current definitions also is discussed. The idea that biofilm formation may be an alternative surrogate for microbial fitness is proposed. Furthermore, current research on the influence of environmental factors on biofilm formation is discussed.

  5. Cancer-specific binary expression system activated in mice by bacteriophage HK022 Integrase.

    Science.gov (United States)

    Elias, Amer; Spector, Itay; Sogolovsky-Bard, Ilana; Gritsenko, Natalia; Rask, Lene; Mainbakh, Yuli; Zilberstein, Yael; Yagil, Ezra; Kolot, Mikhail

    2016-04-27

    Binary systems based on site-specific recombination have been used for tumor specific transcription targeting of suicide genes in animal models. In these binary systems a site specific recombinase or integrase that is expressed from a tumor specific promoter drives tumor specific expression of a cytotoxic gene. In the present study we developed a new cancer specific binary expression system activated by the Integrase (Int) of the lambdoid phage HK022. We demonstrate the validity of this system by the specific expression of a luciferase (luc) reporter in human embryonic kidney 293T (HEK293T) cells and in a lung cancer mouse model. Due to the absence viral vectors and of cytotoxicity the Int based binary system offers advantages over previously described counterparts and may therefore be developed into a safer cancer cell killing system.

  6. Prevalence, enumeration and pheno- and genotypic characteristics of Listeria monocytogenes isolated from raw foods in South China

    Directory of Open Access Journals (Sweden)

    Moutong eChen

    2015-09-01

    Full Text Available Listeria monocytogenes is an important foodborne pathogen that can cause serious illness in immunocompromised individuals, pregnant women, the elderly, and newborns. The aim of this study was to: (i evaluate the prevalence and contamination level (most probable number, MPN of L. monocytogenes in 567 retail raw foods (fishery products, n=154; raw/fresh meat, n=123; frozen foods, n=110; edible fungi, n=108; vegetables, n=72 collected from South China and (ii to gain further knowledge on the phenotype and genotype distributions of this important foodborne pathogen. Approximately 22% of the samples were positive for L. monocytogenes. The contamination levels were between 0.3 and 10 MPN/g in 75.0%, between 10 and 100 MPN/g in 11.0% and less than 100 MPN/g in 14.0% of the countable samples. Five serogroups were identified among the177 foodborne L. monocytogenes isolates, with1/2a-3a (42.4% and1/2b-3b (26.0% serogroups being the most dominant. Serogroup I.1 and II.2 were only found in the edible mushrooms, while serogroup III was dominant in the fishery products, suggesting that specific serogroups of L. monocytogenes may have distinct ecological niches. Ten (5.6% L. monocytogenes isolates exhibited multidrug resistance. Genetic relatedness analysis revealed the absence of distinct associations between specific food types, antibiotic resistance, serogroups, and genetic diversity. The present study provided the first baseline data on the prevalence, contamination level, and characteristics of L. monocytogenes isolated from raw foods in South China. Some multidrug resistant strains belonged to the epidemiologically important serogroups (I.1 and II.1, implying a potential public health risk. In addition, these findings also provide basic information for the Chinese food safety associated authorities to draft appropriate standards to control L. monocytogenes contamination and improve microbiological safety of raw foods.

  7. Phosphatidylinositol 5-phosphatase oculocerebrorenal syndrome of Lowe protein (OCRL) controls actin dynamics during early steps of Listeria monocytogenes infection.

    Science.gov (United States)

    Kühbacher, Andreas; Dambournet, Daphné; Echard, Arnaud; Cossart, Pascale; Pizarro-Cerdá, Javier

    2012-04-13

    Listeria monocytogenes is a bacterial pathogen that induces its own entry into a broad range of mammalian cells through interaction of the bacterial surface protein InlB with the cellular receptor Met, promoting an actin polymerization/depolymerization process that leads to pathogen engulfment. Phosphatidylinositol bisphosphate (PI[4,5]P(2)) and trisphosphate (PI[3,4,5]P(3)) are two major phosphoinositide species that function as molecular scaffolds, recruiting cellular effectors that regulate actin dynamics during L. monocytogenes infection. Because the phosphatidylinositol 5'-phosphatase OCRL dephosphorylates PI(4,5)P(2) and to a lesser extent PI(3,4,5)P(3), we investigated whether this phosphatase modulates cell invasion by L. monocytogenes. Inactivation of OCRL by small interfering RNA (siRNA) leads to an increase in the internalization levels of L. monocytogenes in HeLa cells. Interestingly, OCRL depletion does not increase but rather decreases the surface expression of the receptor Met, suggesting that OCRL controls bacterial internalization by modulating signaling cascades downstream of Met. Immuno-fluorescence microscopy reveals that endogenous and overexpressed OCRL are present at L. monocytogenes invasion foci; live-cell imaging additionally shows that actin depolymerization coincides with EGFP-OCRL-a accumulation around invading bacteria. Together, these observations suggest that OCRL promotes actin depolymerization during L. monocytogenes infection; in agreement with this hypothesis, OCRL depletion leads to an increase in actin, PI(4,5)P(2), and PI(3,4,5)P(3) levels at bacterial internalization foci. Furthermore, in cells knocked down for OCRL, transfection of enzymatically active EGFP-OCRL-a (but not of a phosphatase-dead enzyme) decreases the levels of intracellular L. monocytogenes and of actin associated with invading bacteria. These results demonstrate that through its phosphatase activity, OCRL restricts L. monocytogenes invasion by modulating

  8. Laterality of Facial Expressions of Emotion: Universal and Culture-Specific Influences

    OpenAIRE

    Manas K. Mandal; Nalini Ambady

    2004-01-01

    Recent research indicates that (a) the perception and expression of facial emotion are lateralized to a great extent in the right hemisphere, and, (b) whereas facial expressions of emotion embody universal signals, culture-specific learning moderates the expression and interpretation of these emotions. In the present article, we review the literature on laterality and universality, and propose that, although some components of facial expressions of emotion are governed biologically, others ar...

  9. A comparative approach to understanding tissue-specific expression of uncoupling protein 1 expression in adipose tissue

    Directory of Open Access Journals (Sweden)

    Andrew eShore

    2013-01-01

    Full Text Available The thermoregulatory function of brown adipose tissue (BAT is due to the tissue-specific expression of uncoupling protein 1 (UCP1 which is thought to have evolved in early mammals. We report that a CpG island close to the UCP1 transcription start site is highly conserved in all 29 vertebrates examined apart from the mouse and xenopus. Using methylation sensitive restriction digest and bisulphite mapping we show that the CpG island in both the bovine and human is largely un-methylated and is not related to differences in UCP1 expression between white and brown adipose tissue. Tissue-specific expression of UCP1 has been proposed to be regulated by a conserved 5’ distal enhancer which has been reported to be absent in marsupials. We demonstrate that the enhancer, is also absent in 5 eutherians as well as marsupials, monotremes, amphibians and fish, is present in pigs despite UCP1 having become a pseudogene, and that absence of the enhancer element does not relate to brown adipose tissue-specific UCP1 expression. We identify an additional putative 5’ regulatory unit which is conserved in 14 eutherian species but absent in other eutherians and vertebrates, but again unrelated to UCP1 expression. We conclude that despite clear evidence of conservation of regulatory elements in the UCP1 5’ untranslated region, this does not appear to be related to species or tissues-specific expression of UCP1.

  10. Carbon dioxide and nisin act synergistically on Listeria monocytogenes

    DEFF Research Database (Denmark)

    Nilsson, Lilian; Chen, Y.H.; Chikindas, M.L.

    2000-01-01

    This paper examines the synergistic action of carbon dioxide and nisin on Listeria monocytogenes Scott A wild-type and nisin-resistant (Nis(r)) cells grown in broth at 4 degrees C. Carbon dioxide extended the lag phase and decreased the specific growth rate of both strains, but to a greater degree...... for cultures in CO2. This synergism between nisin and CO2 was examined mechanistically by following the leakage of carboxyfluorescein (CF) from listerial liposomes. Carbon dioxide enhanced nisin-induced CF leakage, indicating that the synergistic action of CO2 and nisin occurs at the cytoplasmic membrane...

  11. Implementation of statistical tools to support identification and management of persistent Listeria monocytogenes contamination in smoked fish processing plants.

    Science.gov (United States)

    Malley, Thomas J V; Stasiewicz, Matthew J; Gröhn, Yrjö T; Roof, Sherry; Warchocki, Steven; Nightingale, Kendra; Wiedmann, Martin

    2013-05-01

    Listeria monocytogenes persistence in food processing plants is a key source of postprocessing contamination of ready-to-eat foods. Thus, identification and elimination of sites where L. monocytogenes persists (niches) is critical. Two smoked fish processing plants were used as models to develop and implement environmental sampling plans (i) to identify persistent L. monocytogenes subtypes (EcoRI ribotypes) using two statistical approaches and (ii) to identify and eliminate likely L. monocytogenes niches. The first statistic, a binomial test based on ribotype frequencies, was used to evaluate L. monocytogenes ribotype recurrences relative to reference distributions extracted from a public database; the second statistic, a binomial test based on previous positives, was used to measure ribotype occurrences as a risk factor for subsequent isolation of the same ribotype. Both statistics revealed persistent ribotypes in both plants based on data from the initial 4 months of sampling. The statistic based on ribotype frequencies revealed persistence of particular ribotypes at specific sampling sites. Two adaptive sampling strategies guided plant interventions during the study: sampling multiple times before and during processing and vector swabbing (i.e., sampling of additional sites in different directions [vectors] relative to a given site). Among sites sampled for 12 months, a Poisson model regression revealed borderline significant monthly decreases in L. monocytogenes isolates at both plants (P = 0.026 and 0.076). Our data indicate elimination of an L. monocytogenes niche on a food contact surface; niches on nonfood contact surfaces were not eliminated. Although our data illustrate the challenge of identifying and eliminating L. monocytogenes niches, particularly at nonfood contact sites in small and medium plants, the methods for identification of persistence we describe here should broadly facilitate science-based identification of microbial persistence.

  12. Real-time PCR detection of Listeria monocytogenes in infant formula and lettuce following macrophage-based isolation and enrichment.

    Science.gov (United States)

    Day, J B; Basavanna, U

    2015-01-01

    To develop a rapid detection procedure for Listeria monocytogenes in infant formula and lettuce using a macrophage-based enrichment protocol and real-time PCR. A macrophage cell culture system was employed for the isolation and enrichment of L. monocytogenes from infant formula and lettuce for subsequent identification using real-time PCR. Macrophage monolayers were exposed to infant formula and lettuce contaminated with a serial dilution series of L. monocytogenes. As few as approx. 10 CFU ml(-1) or g(-1) of L. monocytogenes were detected in infant formula and lettuce after 16 h postinfection by real-time PCR. Internal positive PCR controls were utilized to eliminate the possibility of false-negative results. Co-inoculation with Listeria innocua did not reduce the L. monocytogenes detection sensitivity. Intracellular L. monocytogenes could also be isolated on Listeria selective media from infected macrophage lysates for subsequent confirmation. The detection method is highly sensitive and specific for L. monocytogenes in infant formula and lettuce and establishes a rapid identification time of 20 and 48 h for presumptive and confirmatory identification, respectively. The method is a promising alternative to many currently used q-PCR detection methods which employ traditional selective media for enrichment of contaminated food samples. Macrophage enrichment of L. monocytogenes eliminates PCR inhibitory food elements and contaminating food microflora which produce cleaner samples that increase the rapidity and sensitivity of detection. Published 2014. This article is a U.S. Government work and is in the public domain in the USA.

  13. Allele Workbench: transcriptome pipeline and interactive graphics for allele-specific expression.

    Directory of Open Access Journals (Sweden)

    Carol A Soderlund

    Full Text Available Sequencing the transcriptome can answer various questions such as determining the transcripts expressed in a given species for a specific tissue or condition, evaluating differential expression, discovering variants, and evaluating allele-specific expression. Differential expression evaluates the expression differences between different strains, tissues, and conditions. Allele-specific expression evaluates expression differences between parental alleles. Both differential expression and allele-specific expression have been studied for heterosis (hybrid vigor, where the hybrid has improved performance over the parents for one or more traits. The Allele Workbench software was developed for a heterosis study that evaluated allele-specific expression for a mouse F1 hybrid using libraries from multiple tissues with biological replicates. This software has been made into a distributable package, which includes a pipeline, a Java interface to build the database, and a Java interface for query and display of the results. The required input is a reference genome, annotation file, and one or more RNA-Seq libraries with optional replicates. It evaluates allelic imbalance at the SNP and transcript level and flags transcripts with significant opposite directional allele-specific expression. The Java interface allows the user to view data from libraries, replicates, genes, transcripts, exons, and variants, including queries on allele imbalance for selected libraries. To determine the impact of allele-specific SNPs on protein folding, variants are annotated with their effect (e.g., missense, and the parental protein sequences may be exported for protein folding analysis. The Allele Workbench processing results in transcript files and read counts that can be used as input to the previously published Transcriptome Computational Workbench, which has a new algorithm for determining a trimmed set of gene ontology terms. The software with demo files is available

  14. Listeria monocytogenes infection in pregnancy and neonatal sepsis

    Directory of Open Access Journals (Sweden)

    Francesca Pascale

    2008-06-01

    Full Text Available Authors report a fatal neonatal sepsis caused by Listeria monocytogenes. While the diagnostic procedure aimed to identify the microrganism is described, it is emphasized the importance to recover Streptococcus agalactiae (GBS and L. monocytogenes by means of vaginal-rectal swab culture. The intrapartum screening for L. monocytogenes, by Polymerase Chain Reaction (PCR providing results in 75 minutes is also evaluated.

  15. BIOTECON diagnostics foodproof Listeria monocytogenes Detection Kit, 5' nuclease in combination with the foodproof ShortPrep II Kit.

    Science.gov (United States)

    Junge, Benjamin; Grönewald, Cordt; Berghof-Jäger, Kornelia

    2012-01-01

    A method was developed for the detection of Listeria monocytogenes in food. The method is based on real-time PCR using hydrolysis probes (5' Nuclease). This advanced PCR method was designed to reduce the time necessary to achieve results from PCR reactions and to enable the user to monitor the amplification of the PCR product simultaneously, in real-time. After DNA isolation using the BIOTECON foodproof ShortPrep II Kit designed for the rapid preparation of L. monocytogenes DNA for direct use in PCR, the real-time detection of L. monocytogenes DNA is carried out using the foodproof Listeria monocytogenes Detection Kit. The kit provides primers and hydrolysis probes for sequence-specific detection, convenient premixed reagents, and controls for reliable interpretation of results. For the internal comparison study, three different foods (soft cheese, coalfish, and smoked ham) were analyzed, chosen from the 15 food groups recommended by the AOAC Research Institute for detection of L. monocytogenes. From each food, 20 samples were inoculated with a low level (1-10 CFU/25 g) and 20 samples with a high level (10-50 CFU/25 g) of L. monocytogenes. Additionally, five nonspiked samples were prepared from each food. Depending on the matrix, the food samples were examined with the test kits and compared with the cultural methods according to the U.S. Food and Drug Administration's Bacteriological Analytical Manual or the U.S. Department of Agriculture/Food Safety and Inspection Service Microbiology Laboratory Guidebook.

  16. In vitro detection of pathogenic Listeria monocytogenes from food sources by conventional, molecular and cell culture method

    Directory of Open Access Journals (Sweden)

    J.A. Khan

    2013-09-01

    Full Text Available Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO. A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG; R: CCTCCAGAGTGATCGATGTT complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR. PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%, followed by fish meat (4.0%, and then beef (2.5%. Among various milk and milk products, curd (2.0% showed the highest prevalence, followed by raw milk (1.3%. The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 µL and 50 µL of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro resulted positive in twenty four

  17. Long ncRNA expression associates with tissue-specific enhancers.

    Science.gov (United States)

    Vučićević, Dubravka; Corradin, Olivia; Ntini, Evgenia; Scacheri, Peter C; Ørom, Ulf Andersson

    2015-01-01

    Long non-coding RNAs (ncRNA) have recently been demonstrated to be expressed from a subset of enhancers and to be required for the distant regulation of gene expression. Several approaches to predict enhancers have been developed based on various chromatin marks and occupancy of enhancer-binding proteins. Despite the rapid advances in the field, no consensus how to define tissue specific enhancers yet exists. Here, we identify 2,695 long ncRNAs annotated by ENCODE (corresponding to 28% of all ENCODE annotated long ncRNAs) that overlap tissue-specific enhancers. We use a recently developed algorithm to predict tissue-specific enhancers, PreSTIGE, that is based on the H3K4me1 mark and tissue specific expression of mRNAs. The expression of the long ncRNAs overlapping enhancers is significantly higher when the enhancer is predicted as active in a specific cell line, suggesting a general interdependency of active enhancers and expression of long ncRNAs. This dependency is not identified using previous enhancer prediction algorithms that do not account for expression of their downstream targets. The predicted enhancers that overlap annotated long ncRNAs generally have a lower ratio of H3K4me1 to H3K4me3, suggesting that enhancers expressing long ncRNAs might be associated with specific epigenetic marks. In conclusion, we demonstrate the tissue-specific predictive power of PreSTIGE and provide evidence for thousands of long ncRNAs that are expressed from active tissue-specific enhancers, suggesting a particularly important functional relationship between long ncRNAs and enhancer activity in determining tissue-specific gene expression.

  18. Supplementary Material for: Global expression differences and tissue specific expression differences in rice evolution result in two contrasting types of differentially expressed genes

    KAUST Repository

    Horiuchi, Youko

    2015-01-01

    Abstract Background Since the development of transcriptome analysis systems, many expression evolution studies characterized evolutionary forces acting on gene expression, without explicit discrimination between global expression differences and tissue specific expression differences. However, different types of gene expression alteration should have different effects on an organism, the evolutionary forces that act on them might be different, and different types of genes might show different types of differential expression between species. To confirm this, we studied differentially expressed (DE) genes among closely related groups that have extensive gene expression atlases, and clarified characteristics of different types of DE genes including the identification of regulating loci for differential expression using expression quantitative loci (eQTL) analysis data. Results We detected differentially expressed (DE) genes between rice subspecies in five homologous tissues that were verified using japonica and indica transcriptome atlases in public databases. Using the transcriptome atlases, we classified DE genes into two types, global DE genes and changed-tissues DE genes. Global type DE genes were not expressed in any tissues in the atlas of one subspecies, however changed-tissues type DE genes were expressed in both subspecies with different tissue specificity. For the five tissues in the two japonica-indica combinations, 4.6 ± 0.8 and 5.9 ± 1.5 % of highly expressed genes were global and changed-tissues DE genes, respectively. Changed-tissues DE genes varied in number between tissues, increasing linearly with the abundance of tissue specifically expressed genes in the tissue. Molecular evolution of global DE genes was rapid, unlike that of changed-tissues DE genes. Based on gene ontology, global and changed-tissues DE genes were different, having no common GO terms. Expression differences of most global DE genes were regulated by cis

  19. Genome comparison of Listeria monocytogenes serotype 4a strain HCC23 with selected lineage I and lineage II L. monocytogenes strains and other Listeria strains

    Directory of Open Access Journals (Sweden)

    Debarati Paul

    2014-12-01

    Full Text Available More than 98% of reported human listeriosis cases are caused by specific serotypes within genetic lineages I and II. The genome sequence of Listeria monocytogenes lineage III strain HCC23 (serotype 4a enables whole genomic comparisons across all three L. monocytogenes lineages. Protein cluster analysis indicated that strain HCC23 has the most unique protein pairs with nonpathogenic species Listeria innocua. Orthology analysis of the genome sequences of representative strains from the three L. monocytogenes genetic lineages and L. innocua (CLIP11262 identified 319 proteins unique to nonpathogenic strains HCC23 and CLIP11262 and 58 proteins unique to pathogenic strains F2365 and EGD-e. BLAST comparison of these proteins with all the sequenced L. monocytogenes and L. innocua revealed 126 proteins unique to serotype 4a and/or L. innocua; 14 proteins were only found in pathogenic serotypes. Some of the 58 proteins unique to pathogenic strains F2365 and EGD-e were previously published and are already known to contribute to listerial virulence.

  20. RAPID DNA EXTRACTION AND PCR VALIDATION FOR DIRECT DETECTION OF Listeria monocytogenes IN RAW MILK

    Directory of Open Access Journals (Sweden)

    Edith Burbano

    2006-05-01

    Full Text Available Objective. The aim of this study was to validate a method for detecting L. monocytogenes in raw milk.Materials and methods. The extraction procedure carried out using a chaotropic agent like NaI, toreduce fat in the sample to 0.2% w/v, which is the lowest limit for detection in the Gerber method, toavoid the polymerization. The raw milk samples were analyzed by using the traditional gold standardmethod for L. monocytogenes. Detection PCR was done on the specificity of primers that recognize theListeria genus by amplifying a specific fragment of about 938bp of the 16S rDNA. Several primer setswere use: L1 (CTCCATAAAGGTGACCCT, U1 (CAGCMGCCGCGGTAATWC, LF (CAAACGTTAACAACGCAGTAand LR (TCCAGAGTGATCGATGTTAA that recognize the hlyA gene of L. monocytogenes, amplifying a 750bpfragment. Results. The DNA of 39 strains evidenced high specificity of the technique since all the strainsof L. monocytogenes amplified the fragments 938bp and 750bp, specifically for genus and species,respectively. The detection limit of the PCR was 101 CFU/ml. T he PCR reproducibility showed a Kappa of0.85; the specificity and sensitivity of 100% were found, predictive positive and negative values were of100% respectively. Conclusions. These results demonstrate that is possible to detect of Listeria spp. byusing any of the three methods since they share the same sensitivity and specificity. One hundred percentof the predictive value for PCR (alternative method provides high reliability, and allows the detection ofthe positive samples. The extraction procedure combined with a PCR method can reduce in 15 days thetime of identification of L. monocytogenes in raw milk. This PCR technique could be adapted and validatedto be use for other types of food such as poultry, meat products and cheeses

  1. Allelic-specific expression in relation to Bombyx mori resistance to Bt toxin.

    Science.gov (United States)

    Chen, Yazhou; Li, Muwang; Islam, Iftakher; You, Lang; Wang, Yueqiang; Li, Zhiqian; Ling, Lin; Zeng, Baosheng; Xu, Jun; Huang, Yongping; Tan, Anjiang

    2014-11-01

    Understanding the mechanism of Bt resistance is one of the key elements of the effective application of Bt in pest control. The lepidopteran model insect, the silkworm, demonstrates qualities that make it an ideal species to use in achieving this understanding. We screened 45 strains of silkworm (Bombyx mori) using a Cry1Ab toxin variant. The sensitivity levels of the strains varied over a wide range. A resistant strain (P50) and a phylogenetically related susceptible strain (Dazao) were selected to profile the expressions of 12 Bt resistance-related genes. The SNPs in these genes were detected based on EST analysis and were validated by allelic-specific PCR. A comparison of allelic-specific expression between P50 and Dazao showed that the transcript levels of heterozygous genes containing two alleles rather than an imbalanced allelic expression contribute more to the resistance of P50 against Bt. The responses of the allelic-specific expression to Bt in hybrid larvae were then investigated. The results showed that the gene expression pattern of an ATP-binding cassette transporter C2 (ABCC2) and an aminopeptidase N (APN3), changed in an allelic-specific manner, with the increase of the resistant allele expression correlated with larval survival. The results suggest that a trans-regulatory mechanism in ABCC2 and APN3 allelic-specific expression is involved in the insect's response to the Bt toxin. The potential role of allelic-specific gene regulation in insect resistance to Bt toxins is discussed.

  2. Analysis of cell-type-specific gene expression during mouse spermatogenesis

    DEFF Research Database (Denmark)

    Almstrup, Kristian; Nielsen, John E; Hansen, Martin Asser

    2004-01-01

    In rodents, changes in gene expression during spermatogenesis can be monitored by sampling testis from each day during postnatal development. However, changes in gene expression at the tissue level can reflect changes in the concentration of an mRNA in a specific cell type, changes in volume...... was gradually extinguished in the later spermatid stages but was followed by another cluster of genes expressed in spermatids. Finally, a group of genes was downregulated during spermatogenesis and probably expressed in nongerm cells. We believe that expression of most genes can be described by a combination...

  3. PCR experion automated electrophoresis system to detect Listeria monocytogenes in foods.

    Science.gov (United States)

    Delibato, Elisabetta; Gattuso, Antonietta; Minucci, Angelo; Auricchio, Bruna; De Medici, Dario; Toti, Laura; Castagnola, Massimo; Capoluongo, Ettore; Gianfranceschi, Monica Virginia

    2009-11-01

    Listeria monocytogenes is frequently found as a contaminant in raw and ready-to-eat foods. The ability of L. monocytogenes to multiply at refrigeration temperatures and to grow in a wide range of pH values is of particular concern for food safety. According to the European Union regulation on microbiological criteria for foodstuffs, L. monocytogenes must be absent in some categories of ready-to-eat foods. The standard microbiological method for L. monocytogenes detection in foods (ISO 11290-1: 1996 (ISO, International Organization for Standardization)) is cost and time consuming. Developments of rapid, cost-effective and automated diagnostic methods to detect food-borne pathogens in foods continue to be a major concern for the industry and public health. The aim of this study was the development of a rapid, sensitive and specific molecular detection method for L. monocytogenes. To this purpose, we have applied a capillary electrophoresis method to a PCR protocol (PCR-EES (EES, experion automated electrophoresis system)) for detecting L. monocytogenes in food. In particular, a microfluidic chip-based automated electrophoresis system (experion automated electrophoresis system, Bio-Rad Laboratories, USA) was used for the rapid and automatic analysis of the amplicons. Fifty naturally contaminated samples were analysed with this method and the results were compared with those obtained with ISO method. Moreover, the microfluidic chip-based automated electrophoresis system was compared with classical gel electrophoresis (PCR-CGE). The results showed that after 24 h of culture enrichment, the PCR-EES showed a relative accuracy of 100% with ISO, while using PCR-CGE decreased it down to 96%. After 48 h of enrichment, both PCR-EES and PCR-CGE showed an accuracy of 100% with ISO.

  4. Extraction of Subject-Specific Facial Expression Categories and Generation of Facial Expression Feature Space using Self-Mapping

    Directory of Open Access Journals (Sweden)

    Masaki Ishii

    2008-06-01

    Full Text Available This paper proposes a generation method of a subject-specific Facial Expression Map (FEMap using the Self-Organizing Maps (SOM of unsupervised learning and Counter Propagation Networks (CPN of supervised learning together. The proposed method consists of two steps. In the first step, the topological change of a face pattern in the expressional process of facial expression is learned hierarchically using the SOM of a narrow mapping space, and the number of subject-specific facial expression categories and the representative images of each category are extracted. Psychological significance based on the neutral and six basic emotions (anger, sadness, disgust, happiness, surprise, and fear is assigned to each extracted category. In the latter step, the categories and the representative images described above are learned using the CPN of a large mapping space, and a category map that expresses the topological characteristics of facial expression is generated. This paper defines this category map as an FEMap. Experimental results for six subjects show that the proposed method can generate a subject-specific FEMap based on the topological characteristics of facial expression appearing on face images.

  5. In vitro activity of naturally occurring peptides (defensins against Listeria monocytogenes Ação in vitro de peptídeos naturais (defensinas sobre Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Maria da Graça F. Nascimento

    1994-12-01

    Full Text Available Autoclaved distilled water samples were inoculated with L. monocytogenes strain V7 and strain VPH-1, and incubated aerobically, at 30 C for 48 hours. Each strain was tested individually, and growth curves were determined at 1, 2, 3, 4, 5, 21, 24, and 48 hours. The growth or survival of L. monocytogenes was similar for both strains, with survivors at 24 hour-incubation. The microbicidal activity of one synthetic cationic peptide (NP-2 was examined against L. monocytogenes strain V7, in a water system. Antibacterial activity of NP-2 (1, 5, and 10 g/ml was best expressed at 60 minute-incubation, with 10 g/ml of peptide, at 30 C.Amostras de água destilada, autoclavadas, foram inoculadas com L. monocytogenes cepa V7 e cepa VPH-1, e incubadas, aerobicamente, a 30ºC por 48 horas. Cada cepa foi testada individualmente, e determinou-se curvas de crescimento a 1, 2, 3, 4, 5, 21, 24, e 48 horas. O crescimento ou sobrevivência das duas cepas foi semelhante e encontrou-se sobreviventes em 24 horas de incubação. Examinou-se a atividade bactericida de um dos peptídeos catiônicos sintéticos (NP-2 contra L. monocytogenes cepa V7, em sistema aquoso. A atividade antibacteriana de NP-2 (1, 5, and 10µg/ml foi melhor aos 60 minutos de incubação, com 10µg/ml de peptídeo, a 30 C.

  6. Tn6188 - a novel transposon in Listeria monocytogenes responsible for tolerance to benzalkonium chloride.

    Directory of Open Access Journals (Sweden)

    Anneliese Müller

    Full Text Available Controlling the food-borne pathogen Listeria (L. monocytogenes is of great importance from a food safety perspective, and thus for human health. The consequences of failures in this regard have been exemplified by recent large listeriosis outbreaks in the USA and Europe. It is thus particularly notable that tolerance to quaternary ammonium compounds such as benzalkonium chloride (BC has been observed in many L. monocytogenes strains. However, the molecular determinants and mechanisms of BC tolerance of L. monocytogenes are still largely unknown. Here we describe Tn6188, a novel transposon in L. monocytogenes conferring tolerance to BC. Tn6188 is related to Tn554 from Staphylococcus (S. aureus and other Tn554-like transposons such as Tn558, Tn559 and Tn5406 found in various Firmicutes. Tn6188 comprises 5117 bp, is integrated chromosomally within the radC gene and consists of three transposase genes (tnpABC as well as genes encoding a putative transcriptional regulator and QacH, a small multidrug resistance protein family (SMR transporter putatively associated with export of BC that shows high amino acid identity to Smr/QacC from S. aureus and to EmrE from Escherichia coli. We screened 91 L. monocytogenes strains for the presence of Tn6188 by PCR and found Tn6188 in 10 of the analyzed strains. These isolates were from food and food processing environments and predominantly from serovar 1/2a. L. monocytogenes strains harboring Tn6188 had significantly higher BC minimum inhibitory concentrations (MICs (28.5 ± 4.7 mg/l than strains without Tn6188 (14 ± 3.2 mg/l. Using quantitative reverse transcriptase PCR we could show a significant increase in qacH expression in the presence of BC. QacH deletion mutants were generated in two L. monocytogenes strains and growth analysis revealed that ΔqacH strains had lower BC MICs than wildtype strains. In conclusion, our results provide evidence that Tn6188 is responsible for BC tolerance in various L

  7. Tn6188 - a novel transposon in Listeria monocytogenes responsible for tolerance to benzalkonium chloride.

    Science.gov (United States)

    Müller, Anneliese; Rychli, Kathrin; Muhterem-Uyar, Meryem; Zaiser, Andreas; Stessl, Beatrix; Guinane, Caitriona M; Cotter, Paul D; Wagner, Martin; Schmitz-Esser, Stephan

    2013-01-01

    Controlling the food-borne pathogen Listeria (L.) monocytogenes is of great importance from a food safety perspective, and thus for human health. The consequences of failures in this regard have been exemplified by recent large listeriosis outbreaks in the USA and Europe. It is thus particularly notable that tolerance to quaternary ammonium compounds such as benzalkonium chloride (BC) has been observed in many L. monocytogenes strains. However, the molecular determinants and mechanisms of BC tolerance of L. monocytogenes are still largely unknown. Here we describe Tn6188, a novel transposon in L. monocytogenes conferring tolerance to BC. Tn6188 is related to Tn554 from Staphylococcus (S.) aureus and other Tn554-like transposons such as Tn558, Tn559 and Tn5406 found in various Firmicutes. Tn6188 comprises 5117 bp, is integrated chromosomally within the radC gene and consists of three transposase genes (tnpABC) as well as genes encoding a putative transcriptional regulator and QacH, a small multidrug resistance protein family (SMR) transporter putatively associated with export of BC that shows high amino acid identity to Smr/QacC from S. aureus and to EmrE from Escherichia coli. We screened 91 L. monocytogenes strains for the presence of Tn6188 by PCR and found Tn6188 in 10 of the analyzed strains. These isolates were from food and food processing environments and predominantly from serovar 1/2a. L. monocytogenes strains harboring Tn6188 had significantly higher BC minimum inhibitory concentrations (MICs) (28.5 ± 4.7 mg/l) than strains without Tn6188 (14 ± 3.2 mg/l). Using quantitative reverse transcriptase PCR we could show a significant increase in qacH expression in the presence of BC. QacH deletion mutants were generated in two L. monocytogenes strains and growth analysis revealed that ΔqacH strains had lower BC MICs than wildtype strains. In conclusion, our results provide evidence that Tn6188 is responsible for BC tolerance in various L. monocytogenes

  8. Production of IFN-β during Listeria monocytogenes infection is restricted to monocyte/macrophage lineage.

    Directory of Open Access Journals (Sweden)

    Evgenia Solodova

    Full Text Available The family of type I interferons (IFN, which consists of several IFN-α and one IFN-β, are produced not only after stimulation by viruses, but also after infection with non-viral pathogens. In the course of bacterial infections, these cytokines could be beneficial or detrimental. IFN-β is the primary member of type I IFN that initiates a cascade of IFN-α production. Here we addressed the question which cells are responsible for IFN-β expression after infection with the intracellular pathogen Listeria monocytogenes by using a genetic approach. By means of newly established reporter mice, maximum of IFN-β expression was observed at 24 hours post infection in spleen and, surprisingly, 48 hours post infection in colonized cervical and inguinal lymph nodes. Colonization of lymph nodes was independent of the type I IFN signaling, as well as bacterial dose and strain. Using cell specific reporter function and conditional deletions we could define cells expressing LysM as the major IFN-β producers, with cells formerly defined as Tip-DCs being the highest. Neutrophilic granulocytes, dendritic cells and plasmacytoid dendritic cells did not significantly contribute to type I IFN production.

  9. Comparative genomics and transcriptomics of lineages I, II, and III strains of Listeria monocytogenes

    Science.gov (United States)

    2012-01-01

    Background Listeria monocytogenes is a food-borne pathogen that causes infections with a high-mortality rate and has served as an invaluable model for intracellular parasitism. Here, we report complete genome sequences for two L. monocytogenes strains belonging to serotype 4a (L99) and 4b (CLIP80459), and transcriptomes of representative strains from lineages I, II, and III, thereby permitting in-depth comparison of genome- and transcriptome -based data from three lineages of L. monocytogenes. Lineage III, represented by the 4a L99 genome is known to contain strains less virulent for humans. Results The genome analysis of the weakly pathogenic L99 serotype 4a provides extensive evidence of virulence gene decay, including loss of several important surface proteins. The 4b CLIP80459 genome, unlike the previously sequenced 4b F2365 genome harbours an intact inlB invasion gene. These lineage I strains are characterized by the lack of prophage genes, as they share only a single prophage locus with other L. monocytogenes genomes 1/2a EGD-e and 4a L99. Comparative transcriptome analysis during intracellular growth uncovered adaptive expression level differences in lineages I, II and III of Listeria, notable amongst which was a strong intracellular induction of flagellar genes in strain 4a L99 compared to the other lineages. Furthermore, extensive differences between strains are manifest at levels of metabolic flux control and phosphorylated sugar uptake. Intriguingly, prophage gene expression was found to be a hallmark of intracellular gene expression. Deletion mutants in the single shared prophage locus of lineage II strain EGD-e 1/2a, the lma operon, revealed severe attenuation of virulence in a murine infection model. Conclusion Comparative genomics and transcriptome analysis of L. monocytogenes strains from three lineages implicate prophage genes in intracellular adaptation and indicate that gene loss and decay may have led to the emergence of attenuated lineages

  10. Differential internalin A levels in biofilms of Listeria monocytogenes grown on different surfaces and nutrient conditions.

    Science.gov (United States)

    Gilmartin, Niamh; Gião, Maria S; Keevil, Charles W; O'Kennedy, Richard

    2016-02-16

    Listeria monoctyogenes is a foodborne pathogen containing the surface protein, internalin A (InlA). The expression of this protein permits the invasion of L. monocytogenes into intestinal epithelial cells expressing the receptor E-cadherin, thus crossing the intestinal barrier and resulting in listerosis. The main aim of this work was to investigate InlA levels in different L. monocytogenes strains in both planktonic and sessile states using an anti-InlA antibody. Biofilms were grown in high and low nutrient environments on glass, stainless steel and polytetrafluoroethylene (PTFE). This study demonstrated that InlA levels varied greatly between strains and serotypes of L. monocytogenes. However, the serotypes 1/2a, 1/2b and 4b, associated with the largest number of outbreaks of listerosis consistently showed the highest InlA levels, regardless of nutrient content or planktonic or sessile state. Differences in InlA levels were also observed in biofilms grown on different surfaces such as glass, stainless steel and PTFE, with a significant reduction in InlA levels observed in biofilms on PTFE. Interestingly, although a large number of the total cells observed in biofilms formed in tap-water were non-cultivable, the virulence factor, InlA, was expressed at levels between 78 and 85%, thus indicating that these cells may still be virulent. A greater understanding of the factors that affect the levels of InlA on the surface of L. monocytogenes, is essential in the appreciation of the role of InlA in the persistence of biofilms containing L. monocytogenes and their potential to cause food borne disease.

  11. Comparative genomics and transcriptomics of lineages I, II, and III strains of Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Hain Torsten

    2012-04-01

    Full Text Available Abstract Background Listeria monocytogenes is a food-borne pathogen that causes infections with a high-mortality rate and has served as an invaluable model for intracellular parasitism. Here, we report complete genome sequences for two L. monocytogenes strains belonging to serotype 4a (L99 and 4b (CLIP80459, and transcriptomes of representative strains from lineages I, II, and III, thereby permitting in-depth comparison of genome- and transcriptome -based data from three lineages of L. monocytogenes. Lineage III, represented by the 4a L99 genome is known to contain strains less virulent for humans. Results The genome analysis of the weakly pathogenic L99 serotype 4a provides extensive evidence of virulence gene decay, including loss of several important surface proteins. The 4b CLIP80459 genome, unlike the previously sequenced 4b F2365 genome harbours an intact inlB invasion gene. These lineage I strains are characterized by the lack of prophage genes, as they share only a single prophage locus with other L. monocytogenes genomes 1/2a EGD-e and 4a L99. Comparative transcriptome analysis during intracellular growth uncovered adaptive expression level differences in lineages I, II and III of Listeria, notable amongst which was a strong intracellular induction of flagellar genes in strain 4a L99 compared to the other lineages. Furthermore, extensive differences between strains are manifest at levels of metabolic flux control and phosphorylated sugar uptake. Intriguingly, prophage gene expression was found to be a hallmark of intracellular gene expression. Deletion mutants in the single shared prophage locus of lineage II strain EGD-e 1/2a, the lma operon, revealed severe attenuation of virulence in a murine infection model. Conclusion Comparative genomics and transcriptome analysis of L. monocytogenes strains from three lineages implicate prophage genes in intracellular adaptation and indicate that gene loss and decay may have led to the emergence

  12. Differential expression of immune defences is associated with specific host-parasite interactions in insects.

    Directory of Open Access Journals (Sweden)

    Carolyn Riddell

    Full Text Available Recent ecological studies in invertebrates show that the outcome of an infection is dependent on the specific pairing of host and parasite. Such specificity contrasts the long-held view that invertebrate innate immunity depends on a broad-spectrum recognition system. An important question is whether this specificity is due to the immune response rather than some other interplay between host and parasite genotypes. By measuring the expression of putative bumblebee homologues of antimicrobial peptides in response to infection by their gut trypanosome Crithidia bombi, we demonstrate that expression differences are associated with the specific interactions.

  13. Expression of lactate dehydrogenases A and B during chicken spermatogenesis: characterization of testis specific transcripts.

    Science.gov (United States)

    Arias, W M; Mezquita, C; Mezquita, J

    2000-07-19

    The substrates required for glycolysis change markedly at successive stages of spermatogenesis suggesting a considerable plasticity in the expression of glycolytic enzymes. Lactate dehydrogenase (LDH) isoenzymes, LDH-A and LDH-B, are expressed in premeiotic, meiotic cells, and early spermatids, both in avian and mammalian spermatogenesis. Highly polyadenylated forms, particularly of LDH-A, were detected in chicken testis. While mammals and columbid birds express the testis specific LDH-C gene in meiotic and postmeiotic cells, several LDH-B testis specific transcripts were detected in the corresponding cells during chicken spermatogenesis. These testis specific transcripts and the mRNA of mammalian LDH-C show several properties in common, such as temporal correlation of expression, mRNA stability, and repression of premature translation. These observations suggest that the testis specific transcripts could perform during chicken spermatogenesis the functions of the LDH-C mRNA in mammalian testis. Copyright 2000 Wiley-Liss, Inc.

  14. Prokaryotic expression of Listeria monocytogene (LM) hly and development of monoclonal antibodies against listeriolysin O (LLO)%单核增生性李氏杆菌溶血素的原核表达及其单克隆抗体的制备

    Institute of Scientific and Technical Information of China (English)

    罗正; 刘若尘; 郑世军

    2009-01-01

    为了深入研究单核增生性李氏杆菌(LM)致病机理,从其基因组中克隆李氏杆菌溶血素基因hly,并将其与原核表达载体连接在大肠杆菌BL21中表达携带His标签的李氏杆菌溶血素(LLO)融合蛋白,经镍柱纯化得到重组LLO蛋白作为免疫原并免疫小鼠.取免疫小鼠的脾细胞与骨髓瘤细胞(Sp2/0)进行融合,经过3次亚克隆后获得3株稳定分泌针对LLO蛋白单抗的杂交瘤细胞株,分别命名为Anti-LLO1、Anti-LLO2、Anti-LLO3;经ELISA测定其细胞培养上清效价分别为1:3.6×10~4、1:6.4×10~4、1:1.6×10~4,腹水效价分别为1:2×10~7、1:2×10~7、1:1×10~7;亲和力解离常数(Kd)分别为6.18×10~(-11)、7.50×10~(-11)、6.27×10~(-11):3株单抗的IgG亚类均为IgG1.经Western blotting鉴定证明,该3株抗体均能特异地识别李氏杆菌LLO蛋白,该单抗的制备为深入研究LM的致病机理奠定了基础.%In order to study the pathogenesis of Listeria monocytogenes (LM), we cloned listeriolysin gene into prokaryotic expression vector PET21 a.The expression vector was transformed into Escherichia coli BL21 for expression of listeriolysin O (LLO).LLO-His tag fusion protein was purified with a Ni-NTA affinity colunm and was used as an immunogen to vaccinate BALB/C mice.Hybridomas were developed by fusing mouse myeioma cells Sp2/0 and spleuocytes from the immunized mice and screened with purified LLO.Three hybridomas secreting antibodies against listcriolysin O were obtained and named anti-LLOI, anti-LLO2 and anti-LLO3, respectively.Western blotting analysis showed that all of them could specifically bind to the LLO secreted by the LM.The titers of anti-LLO monoclonal antibodies in the supernatants of three hybridomas cultures were 1:3.6×10~(4), 1:6.4×10~(4) and 1:1.6×10~(4), respectively, and the titers of ascites from the hybridoma-injected mice were 1:2 x 10~(7), 1:2x 10~(7) and 1:1 x 10~(7), respectively, based on ELISA test.The isotypes of the monoclonal

  15. Prevalence and growth of Listeria monocytogenes in naturally contaminated seafood

    DEFF Research Database (Denmark)

    Jørgensen, Lasse Vigel; Huss, Hans Henrik

    1998-01-01

    Listeria monocytogenes contamination of seafood varies with product category. The highest prevalence was found in cold- smoked fish (34-60%), while the lowest was found in heat- treated and cured seafood (4-12%). The prevalence of L. monocytogenes differed greatly in cold-smoked salmon between...... production sites, ranging from monocytogenes. The organism showed moderate growth...... in naturally contaminated cold-smoked, and 'gravad', fish while the growth appeared faster in hot smoked fish. Thus L. monocytogenes is not under control in these products. Finally, the prevalence and growth of L. monocytogenes in naturally contaminated cold-smoked salmon are discussed in relation...

  16. Prevalence and growth of Listeria monocytogenes in naturally contaminated seafood

    DEFF Research Database (Denmark)

    Jørgensen, Lasse Vigel; Huss, Hans Henrik

    1998-01-01

    Listeria monocytogenes contamination of seafood varies with product category. The highest prevalence was found in cold- smoked fish (34-60%), while the lowest was found in heat- treated and cured seafood (4-12%). The prevalence of L. monocytogenes differed greatly in cold-smoked salmon between...... production sites, ranging from monocytogenes. The organism showed moderate growth...... in naturally contaminated cold-smoked, and 'gravad', fish while the growth appeared faster in hot smoked fish. Thus L. monocytogenes is not under control in these products. Finally, the prevalence and growth of L. monocytogenes in naturally contaminated cold-smoked salmon are discussed in relation...

  17. The cell specificity of gene expression in the response to heat stress in corals.

    Science.gov (United States)

    Traylor-Knowles, N; Rose, N H; Palumbi, S R

    2017-03-02

    Previous transcriptional studies in heat stressed corals have shown that many genes are responsive to generalized heat stress whereas the expression patterns of specific gene networks after heat stress show strong correlations with variation in bleaching outcomes. However, where these specific genes are expressed is unknown. Here we employed in situ hybridization to identify patterns of spatial gene expression of genes previously predicted to be involved in general stress response and bleaching. We found that Tumor Necrosis Factor Receptors (TNFRs), known to be strong responders to heat stress, were not expressed in gastrodermal symbiont-containing cells but were widely expressed in specific cells of the epidermal layer. The transcription factors AP-1 and FosB implicated as early signals of heat stress and were widely expressed throughout the oral gastrodermis and epidermis. By contrast, a G-protein coupled receptor gene (GPCR), and a fructose bisphosphate aldolase C gene (Aldolase), previously implicated in bleaching, was expressed in symbiont containing gastrodermal cells, and in epidermal tissue. Finally, Chordin-like/Kielin (Chordin-like) a gene highly correlated to bleaching was expressed solely in the oral gastrodermis. From this study we confirm that heat responsive genes occur widely in coral tissues outside of symbiont containing cells, and that gene expression in response to heat stress that causes bleaching does not signal by itself that a gene is expressed in the symbiotic cells where bleaching occurs. Joint information about expression patterns in response to heat and cell specificity will allow greater dissection of the regulatory pathways and specific cell reactions that lead to coral bleaching.

  18. Large Scale Gene Expression Meta-Analysis Reveals Tissue-Specific, Sex-Biased Gene Expression in Humans

    Science.gov (United States)

    Mayne, Benjamin T.; Bianco-Miotto, Tina; Buckberry, Sam; Breen, James; Clifton, Vicki; Shoubridge, Cheryl; Roberts, Claire T.

    2016-01-01

    The severity and prevalence of many diseases are known to differ between the sexes. Organ specific sex-biased gene expression may underpin these and other sexually dimorphic traits. To further our understanding of sex differences in transcriptional regulation, we performed meta-analyses of sex biased gene expression in multiple human tissues. We analyzed 22 publicly available human gene expression microarray data sets including over 2500 samples from 15 different tissues and 9 different organs. Briefly, by using an inverse-variance method we determined the effect size difference of gene expression between males and females. We found the greatest sex differences in gene expression in the brain, specifically in the anterior cingulate cortex, (1818 genes), followed by the heart (375 genes), kidney (224 genes), colon (218 genes), and thyroid (163 genes). More interestingly, we found different parts of the brain with varying numbers and identity of sex-biased genes, indicating that specific cortical regions may influence sexually dimorphic traits. The majority of sex-biased genes in other tissues such as the bladder, liver, lungs, and pancreas were on the sex chromosomes or involved in sex hormone production. On average in each tissue, 32% of autosomal genes that were expressed in a sex-biased fashion contained androgen or estrogen hormone response elements. Interestingly, across all tissues, we found approximately two-thirds of autosomal genes that were sex-biased were not under direct influence of sex hormones. To our knowledge this is the largest analysis of sex-biased gene expression in human tissues to date. We identified many sex-biased genes that were not under the direct influence of sex chromosome genes or sex hormones. These may provide targets for future development of sex-specific treatments for diseases.

  19. Large scale gene expression meta-analysis reveals tissue-specific, sex-biased gene expression in humans

    Directory of Open Access Journals (Sweden)

    Benjamin Mayne

    2016-10-01

    Full Text Available The severity and prevalence of many diseases are known to differ between the sexes. Organ specific sex-biased gene expression may underpin these and other sexually dimorphic traits. To further our understanding of sex differences in transcriptional regulation, we performed meta-analyses of sex biased gene expression in multiple human tissues. We analysed 22 publicly available human gene expression microarray data sets including over 2500 samples from 15 different tissues and 9 different organs. Briefly, by using an inverse-variance method we determined the effect size difference of gene expression between males and females. We found the greatest sex differences in gene expression in the brain, specifically in the anterior cingulate cortex, (1818 genes, followed by the heart (375 genes, kidney (224 genes, colon (218 genes and thyroid (163 genes. More interestingly, we found different parts of the brain with varying numbers and identity of sex-biased genes, indicating that specific cortical regions may influence sexually dimorphic traits. The majority of sex-biased genes in other tissues such as the bladder, liver, lungs and pancreas were on the sex chromosomes or involved in sex hormone production. On average in each tissue, 32% of autosomal genes that were expressed in a sex-biased fashion contained androgen or estrogen hormone response elements. Interestingly, across all tissues, we found approximately two-thirds of autosomal genes that were sex-biased were not under direct influence of sex hormones. To our knowledge this is the largest analysis of sex-biased gene expression in human tissues to date. We identified many sex-biased genes that were not under the direct influence of sex chromosome genes or sex hormones. These may provide targets for future development of sex-specific treatments for diseases.

  20. Expression analysis of four flower-specific promoters of Brassica spp ...

    African Journals Online (AJOL)

    STORAGESEVER

    2009-10-19

    Oct 19, 2009 ... African Journal of Biotechnology Vol. 8 (20), pp. ... flower-specific expression, and the region -181 to -161 played a key role in maintaining strong driving .... This gave rise to 4 recombinant plant expression vectors (pBnfs,.

  1. Detection of Listeria monocytogenes by direct colony hybridization on hydrophobic grid-membrane filters by using a chromogen-labeled DNA probe.

    Science.gov (United States)

    Peterkin, P I; Idziak, E S; Sharpe, A N

    1991-02-01

    A DNA probe specific for Listeria monocytogenes was isolated from a beta-hemolytic recombinant clone of an L. monocytogenes gene bank. It was labeled with horseradish peroxidase and used in a direct colony hybridization method on hydrophobic grid-membrane filters for the detection of the organism. Following color development of the chromogen, a commercial counter (HGMF Interpreter) was able to detect and count the organisms electronically. The method gave a positive reaction with 70 L. monocytogenes strains, while showing a negative reaction with 10 strains of other Listeria spp. and with 20 organisms of other genera.

  2. Listeria monocytogenes survival in refrigerator dill pickles.

    Science.gov (United States)

    Kim, Jin Kyung; D'Sa, Elaine M; Harrison, Mark A; Harrison, Judy A; Andress, Elizabeth L

    2005-11-01

    Listeria monocytogenes can survive and grow in refrigerated foods with pH values of approximately 4.0 to 5.0 and salt concentrations of 3 to 4%. Home-fermented refrigerator dill pickles fit this description. Contamination of this product with L. monocytogenes could cause serious problems because these items are not heated prior to consumption. L. monocytogenes survival and growth patterns were investigated in refrigerator dill pickles at 1.3, 3.8, and 7.6% salt concentrations. Pickling cucumbers were dipped into an inoculum of L. monocytogenes, brine mixtures were added, and cucumbers were held at room temperature for 1 week and then refrigerated for up to 3 months. The pH, NaCl percentage, titratable acidity percentage, and total populations of Listeria and aerobic, psychrotrophic, and lactic acid bacteria were measured at the addition of brine, after 2, 4, and 7 days of storage at room temperature, and then weekly during refrigerated storage. The initial Listeria population was 5.4 to 5.6 log CFU/cm2 on cucumber surfaces and 3.9 to 4.6 log CFU/g internally. There was an approximate 0.3- to 1-log increase during room temperature fermentation followed by a population decline during refrigerator storage, with a greater decrease in the brines with the highest NaCl concentration. Up to 49 days, the internal tissue of pickles with 1.3, 3.8, or 7.6% salt concentrations were presumptively positive for L. monocytogenes by the enrichment method, and at 91 days the surfaces of such pickles were still positive for L. monocytogenes. Populations of total aerobes and lactic acid bacteria increased during room temperature storage and decreased gradually during refrigerated storage.

  3. Tissue-specific RNA expression marks distant-acting developmental enhancers.

    Directory of Open Access Journals (Sweden)

    Han Wu

    2014-09-01

    Full Text Available Short non-coding transcripts can be transcribed from distant-acting transcriptional enhancer loci, but the prevalence of such enhancer RNAs (eRNAs within the transcriptome, and the association of eRNA expression with tissue-specific enhancer activity in vivo remain poorly understood. Here, we investigated the expression dynamics of tissue-specific non-coding RNAs in embryonic mouse tissues via deep RNA sequencing. Overall, approximately 80% of validated in vivo enhancers show tissue-specific RNA expression that correlates with tissue-specific enhancer activity. Globally, we identified thousands of tissue-specifically transcribed non-coding regions (TSTRs displaying various genomic hallmarks of bona fide enhancers. In transgenic mouse reporter assays, over half of tested TSTRs functioned as enhancers with reproducible activity in the predicted tissue. Together, our results demonstrate that tissue-specific eRNA expression is a common feature of in vivo enhancers, as well as a major source of extragenic transcription, and that eRNA expression signatures can be used to predict tissue-specific enhancers independent of known epigenomic enhancer marks.

  4. Tissue Non-Specific Genes and Pathways Associated with Diabetes: An Expression Meta-Analysis.

    Science.gov (United States)

    Mei, Hao; Li, Lianna; Liu, Shijian; Jiang, Fan; Griswold, Michael; Mosley, Thomas

    2017-01-21

    We performed expression studies to identify tissue non-specific genes and pathways of diabetes by meta-analysis. We searched curated datasets of the Gene Expression Omnibus (GEO) database and identified 13 and five expression studies of diabetes and insulin responses at various tissues, respectively. We tested differential gene expression by empirical Bayes-based linear method and investigated gene set expression association by knowledge-based enrichment analysis. Meta-analysis by different methods was applied to identify tissue non-specific genes and gene sets. We also proposed pathway mapping analysis to infer functions of the identified gene sets, and correlation and independent analysis to evaluate expression association profile of genes and gene sets between studies and tissues. Our analysis showed that PGRMC1 and HADH genes were significant over diabetes studies, while IRS1 and MPST genes were significant over insulin response studies, and joint analysis showed that HADH and MPST genes were significant over all combined data sets. The pathway analysis identified six significant gene sets over all studies. The KEGG pathway mapping indicated that the significant gene sets are related to diabetes pathogenesis. The results also presented that 12.8% and 59.0% pairwise studies had significantly correlated expression association for genes and gene sets, respectively; moreover, 12.8% pairwise studies had independent expression association for genes, but no studies were observed significantly different for expression association of gene sets. Our analysis indicated that there are both tissue specific and non-specific genes and pathways associated with diabetes pathogenesis. Compared to the gene expression, pathway association tends to be tissue non-specific, and a common pathway influencing diabetes development is activated through different genes at different tissues.

  5. Stage-specific embryonic antigen: determining expression in canine glioblastoma, melanoma, and mammary cancer cells

    Science.gov (United States)

    Ito, Daisuke

    2017-01-01

    The expression of stage-specific embryonic antigens (SSEAs) was determined in several types of canine cancer cells. Flow cytometry showed SSEA-1 expression in glioblastoma, melanoma, and mammary cancer cells, although none expressed SSEA-3 or SSEA-4. Expression of SSEA-1 was not detected in lymphoma, osteosarcoma, or hemangiosarcoma cell lines. Relatively stable SSEA-1 expression was observed between 24 and 72 h of culture. After 8 days in culture, sorted SSEA-1− and SSEA-1+ cells re-established SSEA-1 expression to levels comparable to those observed in unsorted cells. Our results document, for the first time, the expression of SSEA-1 in several canine cancer cell lines. PMID:27456773

  6. Optical immunosensors for detection of Listeria monocytogenes and Salmonella enteritidis from food

    Science.gov (United States)

    Bhunia, Arun K.; Geng, Tao; Lathrop, Amanda; Valadez, Angela; Morgan, Mark T.

    2004-03-01

    Listeria monocytogenes and Salmonella are two major foodborne pathogens of significant concern. Two optical evanescent wave immunosensors were evaluated for detection: Antibody-coupled fiber-optic biosensor and a surface plasmon resonant (SPR) immunosensor. In the fiber-optic sensor, polyclonal antibodies for the test organisms were immobilized on polystyrene fiber wave -guides using streptavidin - biotin chemistry. Cyanine 5 -labeled monoclonal antibodies C11E9 (for L. monocytogenes) and SF-11 (for Salmonella Enteritidis) were used to generate a specific fluorescent signal. Signal acquisition was performed by launching a laser-light (635 nm) from an Analyte-2000. This immunosensor was able to detect 103 - 109 cfu/ml of L. monocytogenes or 106-109 cfu/ml of Salmonella Enteritidis and the assays were conducted at near real-time with results obtained within one hour of sampling. The assays were specific and showed signal even in the presence of other microorganisms such as E. coli, Enterococcus faecalis or Salmonella Typhimurium. In the SPR system, IAsys instrument (resonant mirror sensor) was used. Monoclonal antibody-C11E9 was directly immobilized onto a carboxylate cuvette. Whole Listeria cells at various concentrations did not yield any signal while surface protein extracts did. Crude protein extracts from L. monocytogenes and L. innocua had average binding responses of around 150 arc sec (0.25 ng/mm2), which was significantly different from L. grayi, L. ivanovii, or L. welshimeri with average responses of Salmonella Enteritidis.

  7. Detection of Listeria monocytogenes in cheese with the magnetic immuno-polymerase chain reaction assay.

    Science.gov (United States)

    Fluit, A C; Torensma, R; Visser, M J; Aarsman, C J; Poppelier, M J; Keller, B H; Klapwijk, P; Verhoef, J

    1993-05-01

    A new detection system, the magnetic immuno-polymerase chain reaction (PCR) assay (MIPA) has been developed to detect Listeria monocytogenes in food. This method separates Listeria cells from PCR-inhibitory factors present in enrichment broths containing food samples by using magnetic beads coated with specific monoclonal antibodies (MAbs). The separated bacteria were lysed, and the supernatant containing the bacterial DNA was subjected to the PCR. Detection of L. monocytogenes in three naturally contaminated cheese samples with two different MAbs and PCR primers specific for the gene encoding the delayed-hypersensitivity factor showed that with MAb 55 all three samples were positive whereas with MAb A two samples were positive. A further improvement of the method was obtained by using a PCR step based on the listeriolysin O gene. A MIPA employing MAb 55 and the listeriolysin O gene primer set detected L. monocytogenes after 24 h of culture in Listeria Enrichment Broth samples from Port Salut artificially contaminated with 40 CFU/25 g. We could detect 1 CFU of L. monocytogenes per g of cheese after a second enrichment for 24 h in Fraser broth. The analysis time including both enrichments is approximately 55 h.

  8. Lineage-specific expression of bestrophin-2 and bestrophin-4 in human intestinal epithelial cells.

    Directory of Open Access Journals (Sweden)

    Go Ito

    Full Text Available Intestinal epithelial cells (IECs regulate the absorption and secretion of anions, such as HCO3(- or Cl(-. Bestrophin genes represent a newly identified group of calcium-activated Cl(- channels (CaCCs. Studies have suggested that, among the four human bestrophin-family genes, bestrophin-2 (BEST2 and bestrophin-4 (BEST4 might be expressed within the intestinal tissue. Consistently, a study showed that BEST2 is expressed by human colonic goblet cells. However, their precise expression pattern along the gastrointestinal tract, or the lineage specificity of the cells expressing these genes, remains largely unknown. Here, we show that BEST2 and BEST4 are expressed in vivo, each in a distinct, lineage-specific manner, in human IECs. While BEST2 was expressed exclusively in colonic goblet cells, BEST4 was expressed in the absorptive cells of both the small intestine and the colon. In addition, we found that BEST2 expression is significantly down-regulated in the active lesions of ulcerative colitis, where goblet cells were depleted, suggesting that BEST2 expression is restricted to goblet cells under both normal and pathologic conditions. Consistently, the induction of goblet cell differentiation by a Notch inhibitor, LY411575, significantly up-regulated the expression of not BEST4 but BEST2 in MUC2-positive HT-29 cells. Conversely, the induction of absorptive cell differentiation up-regulated the expression of BEST4 in villin-positive Caco-2 cells. In addition, we found that the up- or down-regulation of Notch activity leads to the preferential expression of either BEST4 or BEST2, respectively, in LS174T cells. These results collectively confirmed that BEST2 and BEST4 could be added to the lineage-specific genes of humans IECs due to their abilities to clearly identify goblet cells of colonic origin and a distinct subset of absorptive cells, respectively.

  9. Identification of imprinted genes subject to parent-of-origin specific expression in Arabidopsis thaliana seeds

    LENUS (Irish Health Repository)

    McKeown, Peter C

    2011-08-12

    Abstract Background Epigenetic regulation of gene dosage by genomic imprinting of some autosomal genes facilitates normal reproductive development in both mammals and flowering plants. While many imprinted genes have been identified and intensively studied in mammals, smaller numbers have been characterized in flowering plants, mostly in Arabidopsis thaliana. Identification of additional imprinted loci in flowering plants by genome-wide screening for parent-of-origin specific uniparental expression in seed tissues will facilitate our understanding of the origins and functions of imprinted genes in flowering plants. Results cDNA-AFLP can detect allele-specific expression that is parent-of-origin dependent for expressed genes in which restriction site polymorphisms exist in the transcripts derived from each allele. Using a genome-wide cDNA-AFLP screen surveying allele-specific expression of 4500 transcript-derived fragments, we report the identification of 52 maternally expressed genes (MEGs) displaying parent-of-origin dependent expression patterns in Arabidopsis siliques containing F1 hybrid seeds (3, 4 and 5 days after pollination). We identified these MEGs by developing a bioinformatics tool (GenFrag) which can directly determine the identities of transcript-derived fragments from (i) their size and (ii) which selective nucleotides were added to the primers used to generate them. Hence, GenFrag facilitates increased throughput for genome-wide cDNA-AFLP fragment analyses. The 52 MEGs we identified were further filtered for high expression levels in the endosperm relative to the seed coat to identify the candidate genes most likely representing novel imprinted genes expressed in the endosperm of Arabidopsis thaliana. Expression in seed tissues of the three top-ranked candidate genes, ATCDC48, PDE120 and MS5-like, was confirmed by Laser-Capture Microdissection and qRT-PCR analysis. Maternal-specific expression of these genes in Arabidopsis thaliana F1 seeds was

  10. Comparison of two multiplex PCR assays for the detection of Listeria spp. and Listeria monocytogenes in biological samples

    Directory of Open Access Journals (Sweden)

    Budniak Sylwia

    2016-12-01

    Full Text Available Introduction: The aim of the study was to optimise and compare two multiplex PCR assays for the detection of Listeria spp. and Listeria monocytogenes in biological samples including the liver, brain, and blood. Material and Methods: Three strains of L. monocytogenes and single strains of each of the species: L. ivanovii, L. innocua, L. grayi, L. welshimeri, and L. seeligeri were used. Additionally, five other species of bacterium were used to evaluate the specificity of the tests. Results: Specific amplification products were obtained for both multiplex PCR assays, which confirmed the tested strains as Listeria spp. and L. monocytogenes, respectively. Isolates of other species did not yield PCR products. Conclusion: Both multiplex PCR assays proved to be significantly sensitive and highly-specific methods for the detection of Listeria strains.

  11. Quantitative analysis of cell-type specific gene expression in the green alga Volvox carteri

    Directory of Open Access Journals (Sweden)

    Hallmann Armin

    2006-12-01

    Full Text Available Abstract Background The multicellular alga Volvox carteri possesses only two cell types: mortal, motile somatic cells and potentially immortal, immotile reproductive cells. It is therefore an attractive model system for studying how cell-autonomous cytodifferentiation is programmed within a genome. Moreover, there are ongoing genome projects both in Volvox carteri and in the closely related unicellular alga Chlamydomonas reinhardtii. However, gene sequencing is only the beginning. To identify cell-type specific expression and to determine relative expression rates, we evaluate the potential of real-time RT-PCR for quantifying gene transcript levels. Results Here we analyze a diversified pool of 39 target genes by real-time RT-PCR for each cell type. This gene pool contains previously known genes with unknown localization of cellular expression, 28 novel genes which are described in this study for the first time, and a few known, cell-type specific genes as a control. The respective gene products are, for instance, part of photosynthesis, cellular regulation, stress response, or transport processes. We provide expression data for all these genes. Conclusion The results show that quantitative real-time RT-PCR is a favorable approach to analyze cell-type specific gene expression in Volvox, which can be extended to a much larger number of genes or to developmental or metabolic mutants. Our expression data also provide a basis for a detailed analysis of individual, previously unknown, cell-type specifically expressed genes.

  12. The transcription factor TEAD1 represses smooth muscle-specific gene expression by abolishing myocardin function.

    Science.gov (United States)

    Liu, Fang; Wang, Xiaobo; Hu, Guoqing; Wang, Yong; Zhou, Jiliang

    2014-02-07

    The TEAD (transcriptional enhancer activator domain) proteins share an evolutionarily conserved DNA-binding TEA domain, which binds to the MCAT cis-acting regulatory element. Previous studies have shown that TEAD proteins are involved in regulating the expression of smooth muscle α-actin. However, it remains undetermined whether TEAD proteins play a broader role in regulating expression of other genes in vascular smooth muscle cells. In this study, we show that the expression of TEAD1 is significantly induced during smooth muscle cell phenotypic modulation and negatively correlates with smooth muscle-specific gene expression. We further demonstrate that TEAD1 plays a novel role in suppressing expression of smooth muscle-specific genes, including smooth muscle α-actin, by abolishing the promyogenic function of myocardin, a key mediator of smooth muscle differentiation. Mechanistically, we found that TEAD1 competes with myocardin for binding to serum response factor (SRF), resulting in disruption of myocardin and SRF interactions and thereby attenuating expression of smooth muscle-specific genes. This study provides the first evidence demonstrating that TEAD1 is a novel general repressor of smooth muscle-specific gene expression through interfering with myocardin binding to SRF.

  13. Context Specific and Differential Gene Co-expression Networks via Bayesian Biclustering.

    Science.gov (United States)

    Gao, Chuan; McDowell, Ian C; Zhao, Shiwen; Brown, Christopher D; Engelhardt, Barbara E

    2016-07-01

    Identifying latent structure in high-dimensional genomic data is essential for exploring biological processes. Here, we consider recovering gene co-expression networks from gene expression data, where each network encodes relationships between genes that are co-regulated by shared biological mechanisms. To do this, we develop a Bayesian statistical model for biclustering to infer subsets of co-regulated genes that covary in all of the samples or in only a subset of the samples. Our biclustering method, BicMix, allows overcomplete representations of the data, computational tractability, and joint modeling of unknown confounders and biological signals. Compared with related biclustering methods, BicMix recovers latent structure with higher precision across diverse simulation scenarios as compared to state-of-the-art biclustering methods. Further, we develop a principled method to recover context specific gene co-expression networks from the estimated sparse biclustering matrices. We apply BicMix to breast cancer gene expression data and to gene expression data from a cardiovascular study cohort, and we recover gene co-expression networks that are differential across ER+ and ER- samples and across male and female samples. We apply BicMix to the Genotype-Tissue Expression (GTEx) pilot data, and we find tissue specific gene networks. We validate these findings by using our tissue specific networks to identify trans-eQTLs specific to one of four primary tissues.

  14. Sharing and Specificity of Co-expression Networks across 35 Human Tissues.

    Science.gov (United States)

    Pierson, Emma; Koller, Daphne; Battle, Alexis; Mostafavi, Sara; Ardlie, Kristin G; Getz, Gad; Wright, Fred A; Kellis, Manolis; Volpi, Simona; Dermitzakis, Emmanouil T

    2015-05-01

    To understand the regulation of tissue-specific gene expression, the GTEx Consortium generated RNA-seq expression data for more than thirty distinct human tissues. This data provides an opportunity for deriving shared and tissue specific gene regulatory networks on the basis of co-expression between genes. However, a small number of samples are available for a majority of the tissues, and therefore statistical inference of networks in this setting is highly underpowered. To address this problem, we infer tissue-specific gene co-expression networks for 35 tissues in the GTEx dataset using a novel algorithm, GNAT, that uses a hierarchy of tissues to share data between related tissues. We show that this transfer learning approach increases the accuracy with which networks are learned. Analysis of these networks reveals that tissue-specific transcription factors are hubs that preferentially connect to genes with tissue specific functions. Additionally, we observe that genes with tissue-specific functions lie at the peripheries of our networks. We identify numerous modules enriched for Gene Ontology functions, and show that modules conserved across tissues are especially likely to have functions common to all tissues, while modules that are upregulated in a particular tissue are often instrumental to tissue-specific function. Finally, we provide a web tool, available at mostafavilab.stat.ubc.ca/GNAT, which allows exploration of gene function and regulation in a tissue-specific manner.

  15. Sharing and Specificity of Co-expression Networks across 35 Human Tissues.

    Directory of Open Access Journals (Sweden)

    Emma Pierson

    2015-05-01

    Full Text Available To understand the regulation of tissue-specific gene expression, the GTEx Consortium generated RNA-seq expression data for more than thirty distinct human tissues. This data provides an opportunity for deriving shared and tissue specific gene regulatory networks on the basis of co-expression between genes. However, a small number of samples are available for a majority of the tissues, and therefore statistical inference of networks in this setting is highly underpowered. To address this problem, we infer tissue-specific gene co-expression networks for 35 tissues in the GTEx dataset using a novel algorithm, GNAT, that uses a hierarchy of tissues to share data between related tissues. We show that this transfer learning approach increases the accuracy with which networks are learned. Analysis of these networks reveals that tissue-specific transcription factors are hubs that preferentially connect to genes with tissue specific functions. Additionally, we observe that genes with tissue-specific functions lie at the peripheries of our networks. We identify numerous modules enriched for Gene Ontology functions, and show that modules conserved across tissues are especially likely to have functions common to all tissues, while modules that are upregulated in a particular tissue are often instrumental to tissue-specific function. Finally, we provide a web tool, available at mostafavilab.stat.ubc.ca/GNAT, which allows exploration of gene function and regulation in a tissue-specific manner.

  16. A BAC-based transgenic mouse specifically expresses an inducible Cre in the urothelium.

    Directory of Open Access Journals (Sweden)

    Tian Huai Shen

    Full Text Available Cre-loxp mediated conditional knockout strategy has played critical roles for revealing functions of many genes essential for development, as well as the causal relationships between gene mutations and diseases in the postnatal adult mice. One key factor of this strategy is the availability of mice with tissue- or cell type-specific Cre expression. However, the success of the traditional molecular cloning approach to generate mice with tissue specific Cre expression often depends on luck. Here we provide a better alternative by using bacterial artificial chromosome (BAC-based recombineering to insert iCreERT2 cDNA at the ATG start of the Upk2 gene. The BAC-based transgenic mice express the inducible Cre specifically in the urothelium as demonstrated by mRNA expression and staining for LacZ expression after crossing with a Rosa26 reporter mouse. Taking into consideration the size of the gene of interest and neighboring genes included in a BAC, this method should be widely applicable for generation of mice with tissue specific gene expression or deletions in a more specific manner than previously reported.

  17. Sex-Specific Selection and Sex-Biased Gene Expression in Humans and Flies.

    Science.gov (United States)

    Cheng, Changde; Kirkpatrick, Mark

    2016-09-01

    Sexual dimorphism results from sex-biased gene expression, which evolves when selection acts differently on males and females. While there is an intimate connection between sex-biased gene expression and sex-specific selection, few empirical studies have studied this relationship directly. Here we compare the two on a genome-wide scale in humans and flies. We find a distinctive "Twin Peaks" pattern in humans that relates the strength of sex-specific selection, quantified by genetic divergence between male and female adults at autosomal loci, to the degree of sex-biased expression. Genes with intermediate degrees of sex-biased expression show evidence of ongoing sex-specific selection, while genes with either little or completely sex-biased expression do not. This pattern apparently results from differential viability selection in males and females acting in the current generation. The Twin Peaks pattern is also found in Drosophila using a different measure of sex-specific selection acting on fertility. We develop a simple model that successfully recapitulates the Twin Peaks. Our results suggest that many genes with intermediate sex-biased expression experience ongoing sex-specific selection in humans and flies.

  18. Sex-Specific Selection and Sex-Biased Gene Expression in Humans and Flies.

    Directory of Open Access Journals (Sweden)

    Changde Cheng

    2016-09-01

    Full Text Available Sexual dimorphism results from sex-biased gene expression, which evolves when selection acts differently on males and females. While there is an intimate connection between sex-biased gene expression and sex-specific selection, few empirical studies have studied this relationship directly. Here we compare the two on a genome-wide scale in humans and flies. We find a distinctive "Twin Peaks" pattern in humans that relates the strength of sex-specific selection, quantified by genetic divergence between male and female adults at autosomal loci, to the degree of sex-biased expression. Genes with intermediate degrees of sex-biased expression show evidence of ongoing sex-specific selection, while genes with either little or completely sex-biased expression do not. This pattern apparently results from differential viability selection in males and females acting in the current generation. The Twin Peaks pattern is also found in Drosophila using a different measure of sex-specific selection acting on fertility. We develop a simple model that successfully recapitulates the Twin Peaks. Our results suggest that many genes with intermediate sex-biased expression experience ongoing sex-specific selection in humans and flies.

  19. Concordance of gene expression in human protein complexes reveals tissue specificity and pathology

    DEFF Research Database (Denmark)

    Börnigen, Daniela; Pers, Tune Hannes; Thorrez, Lieven

    2013-01-01

    Disease-causing variants in human genes usually lead to phenotypes specific to only a few tissues. Here, we present a method for predicting tissue specificity based on quantitative deregulation of protein complexes. The underlying assumption is that the degree of coordinated expression among...... proteins in a complex within a given tissue may pinpoint tissues that will be affected by a mutation in the complex and coordinated expression may reveal the complex to be active in the tissue. We identified known disease genes and their protein complex partners in a high-quality human interactome. Each...... susceptibility gene's tissue involvement was ranked based on coordinated expression with its interaction partners in a non-disease global map of human tissue-specific expression. The approach demonstrated high overall area under the curve (0.78) and was very successfully benchmarked against a random model...

  20. MAZ drives tumor-specific expression of PPAR gamma 1 in breast cancer cells.

    Science.gov (United States)

    Wang, Xin; Southard, R Chase; Allred, Clinton D; Talbert, Dominique R; Wilson, Melinda E; Kilgore, Michael W

    2008-09-01

    The peroxisome proliferator-activated receptor gamma 1 (PPARgamma1) is a nuclear receptor that plays a pivotal role in breast cancer and is highly over-expressed relative to normal epithelia. We have previously reported that the expression of PPARgamma1 is mediated by at least six distinct promoters and expression in breast cancer is driven by a tumor-specific promoter (pA1). Deletional analysis of this promoter fragment revealed that the GC-rich, 263 bp sequence proximal to the start of exon A1, is sufficient to drive expression in breast cancer cells but not in normal, human mammary epithelial cells (HMEC). By combining the disparate technologies of microarray and computer-based transcription factor binding site analyses on this promoter sequence the myc-associated zinc finger protein (MAZ) was identified as a candidate transcription factor mediating tumor-specific expression. Western blot analysis and chromatin immunoprecipitation assays verify that MAZ is overexpressed in MCF-7 cells and is capable of binding to the 263 bp promoter fragment, respectively. Furthermore, the over-expression of MAZ in HMEC is sufficient to drive the expression of PPARgamma1 and does so by recruiting the tumor-specific promoter. This results in an increase in the amount of PPARgamma1 capable of binding to its DNA response element. These findings help to define the molecular mechanism driving the high expression of PPARgamma1 in breast cancer and raise new questions regarding the role of MAZ in cancer progression.

  1. Laterality of Facial Expressions of Emotion: Universal and Culture-Specific Influences

    Directory of Open Access Journals (Sweden)

    Manas K. Mandal

    2004-01-01

    Full Text Available Recent research indicates that (a the perception and expression of facial emotion are lateralized to a great extent in the right hemisphere, and, (b whereas facial expressions of emotion embody universal signals, culture-specific learning moderates the expression and interpretation of these emotions. In the present article, we review the literature on laterality and universality, and propose that, although some components of facial expressions of emotion are governed biologically, others are culturally influenced. We suggest that the left side of the face is more expressive of emotions, is more uninhibited, and displays culture-specific emotional norms. The right side of face, on the other hand, is less susceptible to cultural display norms and exhibits more universal emotional signals.

  2. Laterality of facial expressions of emotion: Universal and culture-specific influences.

    Science.gov (United States)

    Mandal, Manas K; Ambady, Nalini

    2004-01-01

    Recent research indicates that (a) the perception and expression of facial emotion are lateralized to a great extent in the right hemisphere, and, (b) whereas facial expressions of emotion embody universal signals, culture-specific learning moderates the expression and interpretation of these emotions. In the present article, we review the literature on laterality and universality, and propose that, although some components of facial expressions of emotion are governed biologically, others are culturally influenced. We suggest that the left side of the face is more expressive of emotions, is more uninhibited, and displays culture-specific emotional norms. The right side of face, on the other hand, is less susceptible to cultural display norms and exhibits more universal emotional signals. Copyright 2004 IOS Press

  3. Lineage-specific expression of bestrophin-2 and bestrophin-4 in human intestinal epithelial cells

    DEFF Research Database (Denmark)

    Ito, Go; Okamoto, Ryuichi; Murano, Tatsuro

    2013-01-01

    Intestinal epithelial cells (IECs) regulate the absorption and secretion of anions, such as HCO3(-) or Cl(-). Bestrophin genes represent a newly identified group of calcium-activated Cl(-) channels (CaCCs). Studies have suggested that, among the four human bestrophin-family genes, bestrophin-2...... (BEST2) and bestrophin-4 (BEST4) might be expressed within the intestinal tissue. Consistently, a study showed that BEST2 is expressed by human colonic goblet cells. However, their precise expression pattern along the gastrointestinal tract, or the lineage specificity of the cells expressing these genes...

  4. Genetic dissection of DivIVA functions in Listeria monocytogenes.

    Science.gov (United States)

    Kaval, Karan Gautam; Hauf, Samuel; Rismondo, Jeanine; Hahn, Birgitt; Halbedel, Sven

    2017-10-02

    DivIVA is a membrane binding protein that clusters at curved membrane regions such as the cell poles and the membrane invaginations occurring during cell division. DivIVA proteins recruit many other proteins to these subcellular sites through direct protein-protein interactions. DivIVA-dependent functions are typically associated with cell growth and division, even though species-specific differences in the spectrum of DivIVA functions and their causative interaction partners exist. DivIVA from the Gram-positive human pathogen Listeria monocytogenes has at least three different functions. In this bacterium, DivIVA is required for precise positioning of the septum at mid-cell, it contributes to secretion of autolysins required for breakdown of peptidoglycan at the septum after completion of cell division, and it is essential for flagellar motility. While the DivIVA interaction partners for control of division site selection are well-established, the proteins connecting DivIVA with autolysin secretion or swarming motility are completely unknown. We set out to identify divIVA alleles, in which these three DivIVA functions could be separated, since the question of the degree to which the three functions of L. monocytogenes DivIVA are interlinked could not be answered before. Here, we identify such alleles, and our results show that division site selection, autolysin secretion, and swarming represent three discrete pathways that are independently influenced by DivIVA. These findings provide the required basis for the identification of DivIVA interaction partners controlling autolysin secretion and swarming in the future.IMPORTANCE DivIVA of the pathogenic bacterium Listeria monocytogenes is a central scaffold protein that influences at least three different cellular processes, namely cell division, protein secretion and bacterial motility. How DivIVA coordinates these rather unrelated processes is not known. We here identify variants of L. monocytogenes DivIVA, in which

  5. High expression of testes-specific protease 50 is associated with poor prognosis in colorectal carcinoma.

    Directory of Open Access Journals (Sweden)

    Lei Zheng

    Full Text Available BACKGROUND: Testes-specific protease 50 (TSP50 is normally expressed in testes and abnormally expressed in breast cancer, but whether TSP50 is expressed in colorectal carcinoma (CRC and its clinical significance is unclear. We aimed to detect TSP50 expression in CRC, correlate it with clinicopathological factors, and assess its potential diagnostic and prognostic value. METHODOLOGY/PRINCIPAL FINDINGS: TSP50 mRNAs and proteins were detected in 7 CRC cell lines and 8 CRC specimens via RT-PCR and Western blot analysis. Immunohistochemical analysis of TSP50, p53 and carcinoembryonic antigen (CEA with tissue microarrays composed of 95 CRCs, 20 colorectal adenomas and 20 normal colorectal tissues were carried out and correlated with clinicopathological characteristics and disease-specific survival for CRC patients. There was no significant correlation between the expression levels of TSP50 and p53 (P = 0.751 or CEA (P = 0.663. Abundant expression of TSP50 protein was found in CRCs (68.4% while it was poorly expressed in colorectal adenomas and normal tissues (P<0.0001. Thus, CRCs can be distinguished from them with high specificity (92.5% and positive predictive value (PPV, 95.6%. The survival of CRC patients with high TSP50 expression was significantly shorter than that of the patients with low TSP50 expression (P = 0.010, specifically in patients who had early-stage tumors (stage I and II; P = 0.004. Multivariate Cox regression analysis indicated that high TSP50 expression was a statistically significant independent risk factor (hazard ratio  = 2.205, 95% CI = 1.214-4.004, P = 0.009. CONCLUSION: Our data demonstrate that TSP50 is a potential effective indicator of poor survival for CRC patients, especially for those with early-stage tumors.

  6. In silico analysis of stomach lineage specific gene set expression pattern in gastric cancer

    Energy Technology Data Exchange (ETDEWEB)

    Pandi, Narayanan Sathiya, E-mail: sathiyapandi@gmail.com; Suganya, Sivagurunathan; Rajendran, Suriliyandi

    2013-10-04

    Highlights: •Identified stomach lineage specific gene set (SLSGS) was found to be under expressed in gastric tumors. •Elevated expression of SLSGS in gastric tumor is a molecular predictor of metabolic type gastric cancer. •In silico pathway scanning identified estrogen-α signaling is a putative regulator of SLSGS in gastric cancer. •Elevated expression of SLSGS in GC is associated with an overall increase in the survival of GC patients. -- Abstract: Stomach lineage specific gene products act as a protective barrier in the normal stomach and their expression maintains the normal physiological processes, cellular integrity and morphology of the gastric wall. However, the regulation of stomach lineage specific genes in gastric cancer (GC) is far less clear. In the present study, we sought to investigate the role and regulation of stomach lineage specific gene set (SLSGS) in GC. SLSGS was identified by comparing the mRNA expression profiles of normal stomach tissue with other organ tissue. The obtained SLSGS was found to be under expressed in gastric tumors. Functional annotation analysis revealed that the SLSGS was enriched for digestive function and gastric epithelial maintenance. Employing a single sample prediction method across GC mRNA expression profiles identified the under expression of SLSGS in proliferative type and invasive type gastric tumors compared to the metabolic type gastric tumors. Integrative pathway activation prediction analysis revealed a close association between estrogen-α signaling and SLSGS expression pattern in GC. Elevated expression of SLSGS in GC is associated with an overall increase in the survival of GC patients. In conclusion, our results highlight that estrogen mediated regulation of SLSGS in gastric tumor is a molecular predictor of metabolic type GC and prognostic factor in GC.

  7. Specific expression of channelrhodopsin-2 in single neurons of Caenorhabditis elegans.

    Directory of Open Access Journals (Sweden)

    Cornelia Schmitt

    Full Text Available Optogenetic approaches using light-activated proteins like Channelrhodopsin-2 (ChR2 enable investigating the function of populations of neurons in live Caenorhabditis elegans (and other animals, as ChR2 expression can be targeted to these cells using specific promoters. Sub-populations of these neurons, or even single cells, can be further addressed by restricting the illumination to the cell of interest. However, this is technically demanding, particularly in free moving animals. Thus, it would be helpful if expression of ChR2 could be restricted to single neurons or neuron pairs, as even wide-field illumination would photostimulate only this particular cell. To this end we adopted the use of Cre or FLP recombinases and conditional ChR2 expression at the intersection of two promoter expression domains, i.e. in the cell of interest only. Success of this method depends on precise knowledge of the individual promoters' expression patterns and on relative expression levels of recombinase and ChR2. A bicistronic expression cassette with GFP helps to identify the correct expression pattern. Here we show specific expression in the AVA reverse command neurons and the aversive polymodal sensory ASH neurons. This approach shall enable to generate strains for optogenetic manipulation of each of the 302 C. elegans neurons. This may eventually allow to model the C. elegans nervous system in its entirety, based on functional data for each neuron.

  8. Identification and target prediction of miRNAs specifically expressed in rat neural tissue

    Directory of Open Access Journals (Sweden)

    Tu Kang

    2009-05-01

    Full Text Available Abstract Background MicroRNAs (miRNAs are a large group of RNAs that play important roles in regulating gene expression and protein translation. Several studies have indicated that some miRNAs are specifically expressed in human, mouse and zebrafish tissues. For example, miR-1 and miR-133 are specifically expressed in muscles. Tissue-specific miRNAs may have particular functions. Although previous studies have reported the presence of human, mouse and zebrafish tissue-specific miRNAs, there have been no detailed reports of rat tissue-specific miRNAs. In this study, Home-made rat miRNA microarrays which established in our previous study were used to investigate rat neural tissue-specific miRNAs, and mapped their target genes in rat tissues. This study will provide information for the functional analysis of these miRNAs. Results In order to obtain as complete a picture of specific miRNA expression in rat neural tissues as possible, customized miRNA microarrays with 152 selected miRNAs from miRBase were used to detect miRNA expression in 14 rat tissues. After a general clustering analysis, 14 rat tissues could be clearly classified into neural and non-neural tissues based on the obtained expression profiles with p values Conclusion Our work provides a global view of rat neural tissue-specific miRNA profiles and a target map of miRNAs, which is expected to contribute to future investigations of miRNA regulatory mechanisms in neural systems.

  9. Murinization of internalin extends its receptor repertoire, altering Listeria monocytogenes cell tropism and host responses.

    Directory of Open Access Journals (Sweden)

    Yu-Huan Tsai

    Full Text Available Listeria monocytogenes (Lm is an invasive foodborne pathogen that leads to severe central nervous system and maternal-fetal infections. Lm ability to actively cross the intestinal barrier is one of its key pathogenic properties. Lm crosses the intestinal epithelium upon the interaction of its surface protein internalin (InlA with its host receptor E-cadherin (Ecad. InlA-Ecad interaction is species-specific, does not occur in wild-type mice, but does in transgenic mice expressing human Ecad and knock-in mice expressing humanized mouse Ecad. To study listeriosis in wild-type mice, InlA has been "murinized" to interact with mouse Ecad. Here, we demonstrate that, unexpectedly, murinized InlA (InlA(m mediates not only Ecad-dependent internalization, but also N-cadherin-dependent internalization. Consequently, InlA(m-expressing Lm targets not only goblet cells expressing luminally-accessible Ecad, as does Lm in humanized mice, but also targets villous M cells, which express luminally-accessible N-cadherin. This aberrant Lm portal of entry results in enhanced innate immune responses and intestinal barrier damage, both of which are not observed in wild-type Lm-infected humanized mice. Murinization of InlA therefore not only extends the host range of Lm, but also broadens its receptor repertoire, providing Lm with artifactual pathogenic properties. These results challenge the relevance of using InlA(m-expressing Lm to study human listeriosis and in vivo host responses to this human pathogen.

  10. Comparative evaluation of the VIDAS Listeria monocytogenes Xpress (LMX) for the detection of Listeria monocytogenes in a variety of foods.

    Science.gov (United States)

    Johnson, Ronald; Mills, John; Pittet, Jean-Louis; Hughes, Denise

    2013-01-01

    The VIDAS Listeria monocytogenes Xpress (LMX) test is an enzyme-linked fluorescent immunoassay designed for use with the automated VIDAS or mini-VIDAS instruments for the specific detection of L. monocytogenes using a 26 h proprietary enrichment broth. The VIDAS LMX method was validated according to harmonized AOAC Research Institute (RI) and Official Methods of Analysis guidelines in both the AOAC Performance Tested Method (PTM) and GovVal programs. In the PTM comparison studies, the VIDAS LMX method was compared to the U.S. Department of Agriculture-Food Safety and Inspection Service Microbiology Laboratory Guidebook, the U.S. Food and Drug Administration Bacteriological Analytical Manual, and AOAC Official Methods. The comparative food studies consisted of two main parts: internal testing and AOAC independent laboratory testing, which included seven food matrixes (deli ham, processed cheese, vanilla ice cream, cooked shrimp, smoked white fish, frozen spinach, and peanut butter). As part of the AOAC R1 GovVal program, the VIDAS LMX method was compared to the Health Canada MFHPB-30 method for the detection of L. monocytogenes in five ready-to-eat (RTE) meats (hot dogs, deli turkey, deli ham, fermented sausage, and liver paté). Twenty replicates of each inoculation level and five uninoculated controls were evaluated in each study. The LMX method also included the use ofchromogenic media, chromID Ottaviani Agosti agar and chromID L. mono. agar, for confirmation of LMX presumptive results. In both the PTM and GovVal evaluations, there were no significant differences in the Chi-square values for the LMX method when compared to reference methods. The additional parameters tested in the PTM evaluation (inclusivity, exclusivity, ruggedness, stability, and lot-to-lot) satisfied the AOAC RI performance requirements. In both the PTM and GovVal validation studies, the VIDAS LMX method demonstrated reliability as a rapid qualitative method for next-day detection of L

  11. Human population-specific gene expression and transcriptional network modification with polymorphic transposable elements.

    Science.gov (United States)

    Wang, Lu; Rishishwar, Lavanya; Mariño-Ramírez, Leonardo; Jordan, I King

    2016-12-19

    Transposable element (TE) derived sequences are known to contribute to the regulation of the human genome. The majority of known TE-derived regulatory sequences correspond to relatively ancient insertions, which are fixed across human populations. The extent to which human genetic variation caused by recent TE activity leads to regulatory polymorphisms among populations has yet to be thoroughly explored. In this study, we searched for associations between polymorphic TE (polyTE) loci and human gene expression levels using an expression quantitative trait loci (eQTL) approach. We compared locus-specific polyTE insertion genotypes to B cell gene expression levels among 445 individuals from 5 human populations. Numerous human polyTE loci correspond to both cis and trans eQTL, and their regulatory effects are directly related to cell type-specific function in the immune system. PolyTE loci are associated with differences in expression between European and African population groups, and a single polyTE loci is indirectly associated with the expression of numerous genes via the regulation of the B cell-specific transcription factor PAX5 The polyTE-gene expression associations we found indicate that human TE genetic variation can have important phenotypic consequences. Our results reveal that TE-eQTL are involved in population-specific gene regulation as well as transcriptional network modification.

  12. Human population-specific gene expression and transcriptional network modification with polymorphic transposable elements

    Science.gov (United States)

    Wang, Lu; Mariño-Ramírez, Leonardo

    2017-01-01

    Abstract Transposable element (TE) derived sequences are known to contribute to the regulation of the human genome. The majority of known TE-derived regulatory sequences correspond to relatively ancient insertions, which are fixed across human populations. The extent to which human genetic variation caused by recent TE activity leads to regulatory polymorphisms among populations has yet to be thoroughly explored. In this study, we searched for associations between polymorphic TE (polyTE) loci and human gene expression levels using an expression quantitative trait loci (eQTL) approach. We compared locus-specific polyTE insertion genotypes to B cell gene expression levels among 445 individuals from 5 human populations. Numerous human polyTE loci correspond to both cis and trans eQTL, and their regulatory effects are directly related to cell type-specific function in the immune system. PolyTE loci are associated with differences in expression between European and African population groups, and a single polyTE loci is indirectly associated with the expression of numerous genes via the regulation of the B cell-specific transcription factor PAX5. The polyTE-gene expression associations we found indicate that human TE genetic variation can have important phenotypic consequences. Our results reveal that TE-eQTL are involved in population-specific gene regulation as well as transcriptional network modification. PMID:27998931

  13. In silico analysis of stomach lineage specific gene set expression pattern in gastric cancer.

    Science.gov (United States)

    Pandi, Narayanan Sathiya; Suganya, Sivagurunathan; Rajendran, Suriliyandi

    2013-10-04

    Stomach lineage specific gene products act as a protective barrier in the normal stomach and their expression maintains the normal physiological processes, cellular integrity and morphology of the gastric wall. However, the regulation of stomach lineage specific genes in gastric cancer (GC) is far less clear. In the present study, we sought to investigate the role and regulation of stomach lineage specific gene set (SLSGS) in GC. SLSGS was identified by comparing the mRNA expression profiles of normal stomach tissue with other organ tissue. The obtained SLSGS was found to be under expressed in gastric tumors. Functional annotation analysis revealed that the SLSGS was enriched for digestive function and gastric epithelial maintenance. Employing a single sample prediction method across GC mRNA expression profiles identified the under expression of SLSGS in proliferative type and invasive type gastric tumors compared to the metabolic type gastric tumors. Integrative pathway activation prediction analysis revealed a close association between estrogen-α signaling and SLSGS expression pattern in GC. Elevated expression of SLSGS in GC is associated with an overall increase in the survival of GC patients. In conclusion, our results highlight that estrogen mediated regulation of SLSGS in gastric tumor is a molecular predictor of metabolic type GC and prognostic factor in GC. Copyright © 2013 Elsevier Inc. All rights reserved.

  14. Control options for Listeria monocytogenes in seafoods

    DEFF Research Database (Denmark)

    Huss, Hans Henrik; Jørgensen, Lasse Vigel; Vogel, Birte Fonnesbech

    2000-01-01

    At least three outbreaks of listeriosis associated with seafood have been reported. Listeria monocytogenes is widely distributed in the general environment including fresh water, coastal water and live fish from these areas. Contamination or recontamination of seafood may also take place during...

  15. Listeria monocytogenes : nog steeds een probleem?

    NARCIS (Netherlands)

    Beumer, R.R.

    2011-01-01

    Listeria monocytogenes is net als vele andere bacteriële voedselpathogenen al tientallen jaren bekend. De meeste grondstoffen voor voedingsmiddelen komen uit de akker- en tuinbouw, de veehouderij en de visserij. Besmetting vindt daar plaats met micro-organismen afkomstig uit grond, fecaliën, water,

  16. Prevalence of Listeria monocytogenes in poultry meat

    Directory of Open Access Journals (Sweden)

    Mehmet ELMALI

    2015-01-01

    Full Text Available AbstractThe objectives of this study were i to isolate Listeria spp. and Listeria monocytogenes in broiler wing meat samples, ii to confirm the isolates by PCR, based on prs and hly A gene sequences, iii to determine the seasonal and monthly distribution of the isolates. A total of 120 broiler wing meat samples (60 packaged pieces wrapped using strech film in styrofoam plates and 60 unpackaged pieces bought from different markets in Hatay province were analysed. Listeria spp. was isolated from 57 (47.5% out of 120 samples. Fifty-four, out of 57 Listeria spp. isolates were identified as L. monocytogenes. L. monocytogenes was isolated from the samples collected during the spring, winter, summer, and autumn at the levels of 26.6%, 40%, 53.3%, 60%, respectively. In this study, the isolation rates were found to be the highest in autumn, while the isolation rates were found to be the lowest in spring. As a consequence, high prevalence of Listeria spp. and L. monocytogenes in poultry wing meat samples may pose a risk for human health. We consider that with obeying the rules of good hygiene practices (GHP, good manufacturing practices (GMP and HACCP can minimize the contamination with Listeria spp.

  17. Listeria monocytogenes : nog steeds een probleem?

    NARCIS (Netherlands)

    Beumer, R.R.

    2011-01-01

    Listeria monocytogenes is net als vele andere bacteriële voedselpathogenen al tientallen jaren bekend. De meeste grondstoffen voor voedingsmiddelen komen uit de akker- en tuinbouw, de veehouderij en de visserij. Besmetting vindt daar plaats met micro-organismen afkomstig uit grond, fecaliën, water,

  18. Expression-based functional investigation of the organ-specific microRNAs in Arabidopsis.

    Directory of Open Access Journals (Sweden)

    Yijun Meng

    Full Text Available MicroRNAs (miRNAs play a pivotal role in plant development. The expression patterns of the miRNA genes significantly influence their regulatory activities. By utilizing small RNA (sRNA high-throughput sequencing (HTS data, the miRNA expression patterns were investigated in four organs (flowers, leaves, roots and seedlings of Arabidopsis. Based on a set of criteria, dozens of organ-specific miRNAs were discovered. A dominant portion of the organ-specific miRNAs identified from the ARGONAUTE 4-enriched sRNA HTS libraries were highly expressed in flowers. Additionally, the expression of the precursors of the organ-specific miRNAs was analyzed. Degradome sequencing data-based approach was employed to identify the targets of the organ-specific miRNAs. The miRNA-target interactions were used for network construction. Subnetwork analysis unraveled some novel regulatory cascades, such as the feedback regulation mediated by miR161, the potential self-regulation of the genes miR172, miR396, miR398 and miR860, and the miR863-guided cleavage of the SERRATE transcript. Our bioinformatics survey expanded the organ-specific miRNA-target list in Arabidopsis, and could deepen the biological view of the miRNA expression and their regulatory roles.

  19. Comparative Study of the Effects of Citral on the Growth and Injury of Listeria innocua and Listeria monocytogenes Cells

    Science.gov (United States)

    Silva-Angulo, Angela B.; Zanini, Surama F.; Rosenthal, Amauri; Rodrigo, Dolores; Klein, Günter; Martínez, Antonio

    2015-01-01

    This study investigates the effect of citral on growth and on the occurrence of sublethal damage in Listeria innocua Serovar 6a (CECT 910) and Listeria monocytogenes Serovar 4b (CECT 4032) cells that were exposed to citral as a natural antimicrobial agent. Two initial inoculum concentrations were considered in this investigation: 102 and 106 cfu/mL. Citral exhibited antilisterial activity against L. innocua and L. monocytogenes, and the observed effects were dependent on the concentration of citral present in the culture medium (0, 0.150 and 0.250 μL/mL) (p ≤ 0.05). L. innocua had a shorter lag phase than L. monocytogenes, and the two species had nearly identical maximum specific growth rates. These results indicate that L. innocua could be used as surrogate for L. monocytogenes when testing the effects of this antimicrobial. Significant differences in the lag phase and growth rate were observed between the small and large inoculum concentration (p ≤ 0.05). Citral-treated L. innocua and L. monocytogenes that were recovered on selective medium (i.e., TSA-YE-SC) had a shorter lag phase and a higher maximum specific growth rate than cells that were recovered on non-selective medium (i.e., TSA-YE) (p ≤ 0.05). This result suggests that damage occurs at sublethal concentrations of citral. PMID:25643164

  20. Validation of the Applied Biosystems 7500 Fast Instrument for Detection of Listeria monocytogenes with the SureTect Listeria monocytogenes PCR Assay.

    Science.gov (United States)

    2016-03-31

    In 2013, the Thermo Scientific™ SureTect™ Listeria monocytogenes Real-Time PCR Assay was certified by the AOAC Research Institute (RI) Performance Tested Methods (SM) program as a rapid method for the detection of L. monocytogenes from a wide range of food matrixes and surface samples. This report details the method modification studies undertaken to extend the analysis of this PCR assay to the Applied Biosystems™ 7500 Fast PCR Instrument and Applied Biosystems RapidFinder™ Express 2.0 software allowing the use of the SureTect assay on a 96 well format PCR cycler in addition to the current workflow, which uses the 24 well Thermo Scientific PikoReal™ PCR Instrument and Thermo Scientific SureTect software. Because this study was deemed by AOAC-RI to be a level 2 method modification study, a representative range of food matrixes covering raw ground turkey, 2% fat pasteurized milk, and bagged lettuce as well as stainless steel surface samples were analyzed with the Applied Biosystems 7500 Fast PCR Instrument and RapidFinder Express 2.0 software. All testing was conducted in comparison to the reference method detailed in International Organization for Standardization (ISO) 6579:2002. No significant difference by probability of detection statistical analysis was found between the SureTect Listeria monocytogenes PCR Assay or the ISO reference method methods for any of the matrixes analyzed during the study.

  1. Validation of the Applied Biosystems 7500 Fast Instrument for Detection of Listeria monocytogenes with the SureTect Listeria monocytogenes PCR Assay.

    Science.gov (United States)

    Cloke, Jonathan; Arizanova, Julia; Crabtree, David; Simpson, Helen; Evans, Katharine; Vaahtoranta, Laura; Palomäki, Jukka-Pekka; Artimo, Paulus; Huang, Feng; Liikanen, Maria; Koskela, Suvi

    2016-05-01

    In 2013, the Thermo Scientific™ SureTect™ Listeria monocytogenes Real-Time PCR Assay was certified by the AOAC Research Institute (RI) Performance Tested Methods(SM) program as a rapid method for the detection of L. monocytogenes from a wide range of food matrixes and surface samples. This report details the method modification studies undertaken to extend the analysis of this PCR assay to the Applied Biosystems™ 7500 Fast PCR Instrument and Applied Biosystems RapidFinder™ Express 2.0 software allowing the use of the SureTect assay on a 96 well format PCR cycler in addition to the current workflow, which uses the 24 well Thermo Scientific PikoReal™ PCR Instrument and Thermo Scientific SureTect software. Because this study was deemed by AOAC-RI to be a level 2 method modification study, a representative range of food matrixes covering raw ground turkey, 2% fat pasteurized milk, and bagged lettuce as well as stainless steel surface samples were analyzed with the Applied Biosystems 7500 Fast PCR Instrument and RapidFinder Express 2.0 software. All testing was conducted in comparison to the reference method detailed in International Organization for Standardization (ISO) 6579:2002. No significant difference by probability of detection statistical analysis was found between the SureTect Listeria monocytogenes PCR Assay or the ISO reference method methods for any of the matrixes analyzed during the study.

  2. Analysis of Stage-Specific Gene Expression Profiles in the Uterine Endometrium during Pregnancy in Pigs.

    Science.gov (United States)

    Kim, Mingoo; Seo, Heewon; Choi, Yohan; Yoo, Inkyu; Seo, Minseok; Lee, Chang-Kyu; Kim, Heebal; Ka, Hakhyun

    2015-01-01

    The uterine endometrium plays a critical role in regulating the estrous cycle and the establishment and maintenance of pregnancy in mammalian species. Many studies have investigated the expression and function of genes in the uterine endometrium, but the global expression pattern of genes and relationships among genes differentially expressed in the uterine endometrium during gestation in pigs remain unclear. Thus, this study investigated global gene expression profiles using microarray in pigs. Diverse transcriptome analyses including clustering, network, and differentially expressed gene (DEG) analyses were performed to detect endometrial gene expression changes during the different gestation stages. In total, 6,991 genes were found to be differentially expressed by comparing genes expressed on day (D) 12 of pregnancy with those on D15, D30, D60, D90 and D114 of pregnancy, and clustering analysis of detected DEGs distinguished 8 clusters. Furthermore, several pregnancy-related hub genes such as ALPPL2, RANBP17, NF1B, SPP1, and CST6 were discovered through network analysis. Finally, detected hub genes were technically validated by quantitative RT-PCR. These results suggest the complex network characteristics involved in uterine endometrial gene expression during pregnancy and indicate that diverse patterns of stage-specific gene expression and network connections may play a critical role in endometrial remodeling and in placental and fetal development to establish and maintenance of pregnancy in pigs.

  3. Analysis of Stage-Specific Gene Expression Profiles in the Uterine Endometrium during Pregnancy in Pigs.

    Directory of Open Access Journals (Sweden)

    Mingoo Kim

    Full Text Available The uterine endometrium plays a critical role in regulating the estrous cycle and the establishment and maintenance of pregnancy in mammalian species. Many studies have investigated the expression and function of genes in the uterine endometrium, but the global expression pattern of genes and relationships among genes differentially expressed in the uterine endometrium during gestation in pigs remain unclear. Thus, this study investigated global gene expression profiles using microarray in pigs. Diverse transcriptome analyses including clustering, network, and differentially expressed gene (DEG analyses were performed to detect endometrial gene expression changes during the different gestation stages. In total, 6,991 genes were found to be differentially expressed by comparing genes expressed on day (D 12 of pregnancy with those on D15, D30, D60, D90 and D114 of pregnancy, and clustering analysis of detected DEGs distinguished 8 clusters. Furthermore, several pregnancy-related hub genes such as ALPPL2, RANBP17, NF1B, SPP1, and CST6 were discovered through network analysis. Finally, detected hub genes were technically validated by quantitative RT-PCR. These results suggest the complex network characteristics involved in uterine endometrial gene expression during pregnancy and indicate that diverse patterns of stage-specific gene expression and network connections may play a critical role in endometrial remodeling and in placental and fetal development to establish and maintenance of pregnancy in pigs.

  4. Genotypes Associated with Listeria monocytogenes Isolates Displaying Impaired or Enhanced Tolerances to Cold, Salt, Acid, or Desiccation Stress

    Science.gov (United States)

    Hingston, Patricia; Chen, Jessica; Dhillon, Bhavjinder K.; Laing, Chad; Bertelli, Claire; Gannon, Victor; Tasara, Taurai; Allen, Kevin; Brinkman, Fiona S. L.; Truelstrup Hansen, Lisbeth; Wang, Siyun

    2017-01-01

    The human pathogen Listeria monocytogenes is a large concern in the food industry where its continuous detection in food products has caused a string of recalls in North America and Europe. Most recognized for its ability to grow in foods during refrigerated storage, L. monocytogenes can also tolerate several other food-related stresses with some strains possessing higher levels of tolerances than others. The objective of this study was to use a combination of phenotypic analyses and whole genome sequencing to elucidate potential relationships between L. monocytogenes genotypes and food-related stress tolerance phenotypes. To accomplish this, 166 L. monocytogenes isolates were sequenced and evaluated for their ability to grow in cold (4°C), salt (6% NaCl, 25°C), and acid (pH 5, 25°C) stress conditions as well as survive desiccation (33% RH, 20°C). The results revealed that the stress tolerance of L. monocytogenes is associated with serotype, clonal complex (CC), full length inlA profiles, and the presence of a plasmid which was identified in 55% of isolates. Isolates with full length inlA exhibited significantly (p elements. A whole genome single-nucleotide-variants phylogeny revealed sporadic distribution of tolerant isolates and closely related sensitive and tolerant isolates, highlighting that minor genetic differences can influence the stress tolerance of L. monocytogenes. Specifically, a number of cold and desiccation sensitive isolates contained PMSCs in σB regulator genes (rsbS, rsbU, rsbV). Collectively, the results suggest that knowing the sequence type of an isolate in addition to screening for the presence of full-length inlA and a plasmid, could help food processors and food agency investigators determine why certain isolates might be persisting in a food processing environment. Additionally, increased sequencing of L. monocytogenes isolates in combination with stress tolerance profiling, will enhance the ability to identify genetic elements

  5. Chicken FTO gene: tissue-specific expression, brain distribution, breed difference and effect of fasting.

    Science.gov (United States)

    Wang, Yufeng; Rao, Kaiqing; Yuan, Lixia; Everaert, Nadia; Buyse, Johan; Grossmann, Roland; Zhao, Ruqian

    2012-11-01

    Fat mass and obesity-associated (FTO) gene is widely expressed in central and peripheral tissues of mammals, and exhibits a range of functions, especially in energy balance. However, basic knowledge of FTO in the chicken is lacking. Therefore, we studied the tissue distribution, age and breed dependent changes, brain localization, as well as the impact of fasting on FTO mRNA expression in the chicken. FTO mRNA was expressed in all the tissues studied, and generally, with high expression in hypothalamus, liver, visceral fat and cerebellum. However it exhibited breed-specific patterns: in broilers, the highest expression was seen in the liver, while in layers, hypothalamus and cerebellum showed relatively higher FTO mRNA expression. One-week-old broilers expressed markedly higher FTO mRNA in liver compared with the layers of the same age (Pbreed difference was reversed in visceral fat and cerebellum (PBreed-specific expression of FTO mRNA was shown in PVN, but not in VMN, with higher abundance in broilers compared to layers. The decrease in FTO mRNA levels after 24h of fasting was seen only in VMN of layer chickens. These results may provide some intriguing hints for further investigation of FTO function in the chicken. Copyright © 2012 Elsevier Inc. All rights reserved.

  6. Anatomical specificity of vascular endothelial growth factor expression in glioblastomas: a voxel-based mapping analysis

    Energy Technology Data Exchange (ETDEWEB)

    Fan, Xing [Capital Medical University, Department of Neurosurgery, Beijing Tiantan Hospital, Beijing (China); Wang, Yinyan [Capital Medical University, Department of Neurosurgery, Beijing Tiantan Hospital, Beijing (China); Capital Medical University, Department of Neuropathology, Beijing Neurosurgical Institute, Beijing (China); Wang, Kai; Ma, Jun; Li, Shaowu [Capital Medical University, Department of Neuroradiology, Beijing Tiantan Hospital, Beijing (China); Liu, Shuai [Chinese Academy of Medical Sciences and Peking Union Medical College, Departments of Neurosurgery, Peking Union Medical College Hospital, Beijing (China); Liu, Yong [Chinese Academy of Sciences, Brainnetome Center, Institute of Automation, Beijing (China); Jiang, Tao [Capital Medical University, Department of Neurosurgery, Beijing Tiantan Hospital, Beijing (China); Beijing Academy of Critical Illness in Brain, Department of Clinical Oncology, Beijing (China)

    2016-01-15

    The expression of vascular endothelial growth factor (VEGF) is a common genetic alteration in malignant gliomas and contributes to the angiogenesis of tumors. This study aimed to investigate the anatomical specificity of VEGF expression levels in glioblastomas using voxel-based neuroimaging analysis. Clinical information, MR scans, and immunohistochemistry stains of 209 patients with glioblastomas were reviewed. All tumor lesions were segmented manually and subsequently registered to standard brain space. Voxel-based regression analysis was performed to correlate the brain regions of tumor involvement with the level of VEGF expression. Brain regions identified as significantly associated with high or low VEGF expression were preserved following permutation correction. High VEGF expression was detected in 123 (58.9 %) of the 209 patients. Voxel-based statistical analysis demonstrated that high VEGF expression was more likely in tumors located in the left frontal lobe and the right caudate and low VEGF expression was more likely in tumors that occurred in the posterior region of the right lateral ventricle. Voxel-based neuroimaging analysis revealed the anatomic specificity of VEGF expression in glioblastoma, which may further our understanding of genetic heterogeneity during tumor origination. This finding provides primary theoretical support for potential future application of customized antiangiogenic therapy. (orig.)

  7. REAL-TIME PCR DETECTION OF LISTERIA MONOCYTOGENES IN FOOD SAMPLES OF ANIMAL ORIGIN

    Directory of Open Access Journals (Sweden)

    Jaroslav Pochop

    2013-02-01

    Full Text Available The aim of this study was to follow the contamination of food with Listeria monocytogenes by using Step One real time polymerase chain reaction (PCR. We used the PrepSEQ Rapid Spin Sample Preparation Kit for isolation of DNA and SensiFAST SYBR Hi-ROX Kit for the real-time PCR performance. In 24 samples of food of animal origin without incubation were detected strains of Listeria monocytogenes in 15 samples (swabs. Nine samples were negative. Our results indicated that the real-time PCR assay developed in this study could sensitively detect Listeria monocytogenes in food of animal origin without incubation. This could prevent infection caused by Listeria monocytogenes, and also could benefit food manufacturing companies by extending their product’s shelf-life as well as saving the cost of warehousing their food products while awaiting pathogen testing results. The rapid real-time PCR-based method performed very well compared to the conventional method. It is a fast, simple, specific and sensitive way to detect nucleic acids, which could be used in clinical diagnostic tests in the future.

  8. QUANTIFICATION OF LISTERIA MONOCYTOGENES IN MILK BY MPN-PCR AND MPN-CULTURE METHODS

    Directory of Open Access Journals (Sweden)

    Mahzad Hosseini

    2014-10-01

    Full Text Available The aim of this study was to compare the MPN-PCR (Most Probable Number- Polymerase Chain Reaction and MPN-Culture methods in enumerating of Listeria monocytogenes in milk. In order to compare the accuracy of these methods, 103 cell/ml Listeria monocytogenes and different background bacteria which may be present in raw milk, were inoculated in sterilized milk. After preparing serial dilutions, three replicates per dilution were inoculated in tubes containing listeria enrichment broth. After 48 hours of incubation, for MPN-Culture three inoculated replicates were subcultured on Oxford agar and suspected colonies were confirmed by performing by biochemical tests. For MPN-PCR assay, the DNA extraction was performed from the three inoculated replicates which were already used for MPN-Culture and PCR assay was performed using primers specific for Listeria monocytogenes. The experiment was repeated three times and the average of enumerated bacteria was calculated by each method separately. Statistical analysis using one sample Wilcoxon signed rank test showed that enumeration by MPN-PCR method was more accurate than enumeration by MPN-Culture method. The result of this study showed that MPN-PCR method in comparision with MPN-Culture even in the presence of different background microorganisms is more rapid and reliable. It is concluded that MPN-PCR method facilitates the enumeration of Listeria monocytogenes without excessive work and could be considered as an alternative to MPN-Culture technique.

  9. The evolution and epidemiology of Listeria monocytogenes in Europe and the United States.

    Science.gov (United States)

    Lomonaco, Sara; Nucera, Daniele; Filipello, Virginia

    2015-10-01

    Listeria monocytogenes is an opportunistic food-borne pathogen responsible for listeriosis, a disease associated with high mortality rates. L. monocytogenes causes invasive syndromes and case-fatality can be as high as 30%, in specific high-risk population groups such as the elderly, immuno-compromised individuals, fetuses and newborns. Acquisition of the disease is mainly due to consumption of contaminated (predominantly ready-to-eat) food. We aimed to provide a state-of-the-art collection of different likely evolutionary models, based on recombination and positive selection, and the phylogenetic relationship between lineages of L. monocytogenes and between them and other Listeria species. We described the most recent findings in comparative pan-genomics, considering the core and accessory genome in relation to virulence and adaptation to different environments. Finally, this review illustrates L. monocytogenes epidemiology and transmission in humans, foods and animals, the surveillance systems of the European Union and United States and the application of molecular techniques as a core tool in epidemiological investigation. Copyright © 2015 Elsevier B.V. All rights reserved.

  10. The human P-glycoprotein transporter enhances the type I interferon response to Listeria monocytogenes infection.

    Science.gov (United States)

    Sigal, Nadejda; Kaplan Zeevi, Millie; Weinstein, Shiri; Peer, Dan; Herskovits, Anat A

    2015-06-01

    Human multidrug efflux transporters are known for their ability to extrude antibiotics and toxic compounds out of cells, yet accumulating data indicate they have additional functions in diverse physiological processes not related to drug efflux. Here, we show that the human multidrug transporter P-glycoprotein (P-gp) (also named MDR1 and ABCB1) is transcriptionally induced in the monocytic cell line THP-1 upon infection with the human intracellular bacterial pathogen Listeria monocytogenes. Notably, we found that P-gp is important for full activation of the type I interferon response elicited against L. monocytogenes bacteria. Both inhibition of P-gp function by verapamil and inhibition of its transcription using mRNA silencing led to a reduction in the magnitude of the type I response in infected cells. This function of P-gp was specific to type I interferon cytokines elicited against cytosolic replicating bacteria and was not observed in response to cyclic di-AMP (c-di-AMP), a molecule that was shown to be secreted by L. monocytogenes during infection and to trigger type I interferons. Moreover, P-gp was not involved in activation of other proinflammatory cytokines, such as those triggered by vacuolar-restricted L. monocytogenes or lipopolysaccharide (LPS). Taken together, these findings demonstrate a role for P-gp in proper development of an innate immune response against intracellular pathogens, highlighting the complexity in employing therapeutic strategies that involve inhibition of multidrug resistance (MDR) efflux pumps.

  11. Isolation and detection of Listeria monocytogenes in poultry meat by standard culture methods and PCR

    Science.gov (United States)

    Kureljušić, J.; Rokvić, N.; Jezdimirović, N.; Kureljušić, B.; Pisinov, B.; Karabasil, N.

    2017-09-01

    Listeria is the genus of a bacteria found in soil and water and some animals, including poultry and cattle. It can be present in raw milk and food made from raw milk. It can also live in food processing plants and contaminate a variety of processed meats. Microscopically, Listeria species appear as small, Gram-positive rods, which are sometimes arranged in short chains. In direct smears, they can be coccoid, so they can be mistaken for streptococci. Longer cells can resemble corynebacteria. Flagella are produced at room temperature but not at 37°C. Haemolytic activity on blood agar has been used as a marker to distinguish Listeria monocytogenes among other Listeria species, but it is not an absolutely definitive criterion. Further biochemical characterization is necessary to distinguish between the different Listeria species. The objective of this study was to detect, isolate and identify Listeria monocytogenes from poultry meat. Within a period of six months from January to June 2017, a total of 15 samples were collected. Three samples were positive for the presence of Listeria monocytogenes. Biochemical and microbiological tests as well as PCR technique using specific primers were used to confirm L. Monocytogenes in the samples.

  12. Erythroid-specific Expression of β-globin by Sleeping Beauty Transposon for Sickle Cell Disease

    Science.gov (United States)

    Zhu, Jianhui; Kren, Betsy T.; Park, Chang Won; Bilgim, Rasim; Wong, Phillip Y-P.; Steer, Clifford J.

    2013-01-01

    Sickle cell disease (SCD) results predominately from a single monogenic mutation that affects thousands of individuals worldwide. Gene therapy approaches have focused on using viral vectors to transfer wild type β- or γ-globin transgenes into hematopoietic stem cells for long-term expression of the recombinant globins. In this study, we investigated the use of a novel non-viral vector system, the Sleeping Beauty (SB) transposon (Tn) to insert a wild type β-globin expression cassette into the human genome for sustained expression of β-globin. We initially constructed a β-globin expression vector composed of the hybrid cytomegalovirus (CMV) enhancer: chicken β-actin promoter (CAGGS) and full length β-globin cDNA, as well as truncated forms lacking either the 3′ or 5′ untranslated regions (UTRs), to optimize efficient expression of β-globin. β-globin with its 5′ UTR was efficiently expressed from its cDNA in K-562 cells induced with hemin. However, expression was constitutive and not erythroid-specific. We then constructed cis SB-Tn-β-globin plasmids using a minimal β-globin gene driven by the hybrid promoters; IHK (human ALAS2 intron 8 erythroid-specific enhancer, HS40 core element from human αLCR, ankyrin-1 promoter); IHβp (human ALAS2 intron 8 erythroid-specific enhancer, HS40 core element from human αLCR, β-globin promoter;) or HS3βp (HS3 core element from human βLCR, β-globin promoter) to establish erythroid-specific expression of β-globin. Stable genomic insertion of the minimal gene and expression of the β-globin transgene for > 5 months at a level comparable to the endogenous γ-globin gene were achieved using a SB-Tn β-globin cis construct. Interestingly, erythroid-specific expression of β-globin driven by IHK was regulated primarily at the translational level, in contrast to post-transcriptional regulation in non-erythroid cells. The SB-Tn system is a promising nonviral vector for efficient genomic insertion conferring stable

  13. VIDAS Listeria monocytogenes II (LMO2).

    Science.gov (United States)

    Johnson, Ronald; Mills, John

    2013-01-01

    This AOAC GovVal study compared the VIDAS Listeria monocytogenes II (LMO2) to the Health Products and Food Branch MFHPB-30 reference method for detection of L. monocytogenes in ready-to-eat (RTE) meats. The VIDAS LMO2 test is an automated enzyme-linked fluorescent immunoassay for the detection of L. monocytogenes in foods. The LMO2 test, following the enrichment procedure from the MFLP-33 method, also included use of the chromogenic media, chromID Ottaviani Agosti Agar (OAA) and chromID Lmono for confirmation of LMO2 presumptive results. In previous AOAC validation studies comparing the VIDAS LMO2 method to the U.S. Food and Drug Administration Bacteriological Analytical Manual and U.S. Department of Agriculture-Food Safety and Inspection Service reference methods, LMO2 was approved as AOAC Official Method 2004.02 for the detection of L. monocytogenes in dairy products, vegetables, seafood, raw meats and poultry, and processed meats and poultry. The GovVal comparative study included 20 replicate test portions, each at two contamination levels for each matrix, where fractionally positive results (5-15 positive results/20 replicate portions tested) were obtained by at least one method at one level. Five uncontaminated controls were included. Chi-square analysis of the comparative data in this study indicates no statistical differences between the VIDAS LMO2 and the MFHPB-30 standard methods at the 5% level of significance. Confirmation of presumptive LMO2 results with the chromogenic OAA and Lmono media was shown to be equivalent to the appropriate reference method agars. The data demonstrate that the VIDAS LMO2 method is an acceptable alternative method to the MFHPB-30 standard culture method for the detection of L. monocytogenes in RTE meats, including liver paté, hot dogs, raw fermented sausage, sliced deli turkey, and sliced deli ham.

  14. A detailed view of the intracellular transcriptome of Listeria monocytogenes in murine macrophages using RNA-seq

    Directory of Open Access Journals (Sweden)

    Tilman Gunter Schultze

    2015-10-01

    Full Text Available Listeria monocytogenes is a bacterial pathogen and causative agent for the foodborne infection listeriosis, which is mainly a threat for pregnant, elderly or immunocompromised individuals. Due to its ability to invade and colonize diverse eukaryotic cell types including cells from invertebrates, L. monocytogenes has become a well-established model organism for intracellular growth. Almost ten years ago, we and others presented the first whole-genome microarray-based intracellular transcriptome of L. monocytogenes. With the advent of newer technologies addressing transcriptomes in greater detail, we revisit this work, and analyze the intracellular transcriptome of L. monocytogenes during growth in murine macrophages using a deep sequencing based approach.We detected 656 differentially expressed genes of which 367 were upregulated during intracellular growth in macrophages compared to extracellular growth in BHI. This study confirmed ~64% of all regulated genes previously identified by microarray analysis. Many of the regulated genes that were detected in the current study involve transporters for various metals, ions as well as complex sugars such as mannose. We also report changes in antisense transcription, especially upregulations during intracellular bacterial survival. A notable finding was the detection of regulatory changes for a subset of temperate A118-like prophage genes, thereby shedding light on the transcriptional profile of this bacteriophage during intracellular growth. In total, our study provides an updated genome-wide view of the transcriptional landscape of L. monocytogenes during intracellular growth and represents a rich resource for future detailed analysis.

  15. Cloning, Characterization and Effect of TmPGRP-LE Gene Silencing on Survival of Tenebrio Molitor against Listeria monocytogenes Infection

    Directory of Open Access Journals (Sweden)

    Yeon Soo Han

    2013-11-01

    Full Text Available Peptidoglycan recognition proteins (PGRPs are a family of innate immune molecules that recognize bacterial peptidoglycan. PGRP-LE, a member of the PGRP family, selectively binds to diaminopimelic acid (DAP-type peptidoglycan to activate both the immune deficiency (Imd and proPhenoloxidase (proPO pathways in insects. A PGRP-LE-dependent induction of autophagy to control Listeria monocytogenes has also been reported. We identified and partially characterized a novel PGRP-LE homologue, from Tenebrio molitor and analyzed its functional role in the survival of the insect against infection by a DAP-type PGN containing intracellular pathogen, L. monocytogenes. The cDNA is comprised of an open reading frame (ORF of 990 bp and encodes a polypeptide of 329 residues. TmPGRP-LE contains one PGRP domain, but lacks critical residues for amidase activity. Quantitative RT-PCR analysis showed a broad constitutive expression of the transcript at various stages of development spanning from larva to adult. RNAi mediated knockdown of the transcripts, followed by a challenge with L. monocytogenes, showed a significant reduction in survival rate of the larvae, suggesting a putative role of TmPGRP-LE in sensing and control of L. monocytogenes infection in T. molitor. These results implicate PGRP-LE as a defense protein necessary for survival of T. molitor against infection by L. monocytogenes.

  16. A five-gene stress survival islet (SSI-1) that contributes to the growth of Listeria monocytogenes in suboptimal conditions.

    Science.gov (United States)

    Ryan, S; Begley, M; Hill, C; Gahan, C G M

    2010-09-01

    The aim of this study was to examine the contribution of a five-gene islet (lmo0444 - lmo0448) to the growth of Listeria monocytogenes under suboptimal conditions. Bioinformatics and PCR analyses revealed that a five-gene islet is present in c. half of all L. monocytogenes strains examined (66 in total). A deletion mutant that lacks the entire c. 8·7-kb islet was created in L. monocytogenes strain LO28. This mutant was impaired in growth at low pH and at high salt concentrations and demonstrated a decreased ability to survive and grow in a model food system (frankfurters). Transcriptional analysis revealed that the islet is self-regulated in that the product of lmo0445 regulates the expression of the other four genes. A role of the alternative stress sigma factor SigB in regulating the islet was also uncovered. The five-gene islet (herein designated as SSI-1; stress survival islet 1) contributes to the growth of L. monocytogenes under suboptimal conditions. SSI-1 may contribute to the survival of certain strains of L. monocytogenes in food environments. © 2010 The Authors. Journal compilation © 2010 The Society for Applied Microbiology.

  17. Cloning, characterization and effect of TmPGRP-LE gene silencing on survival of Tenebrio molitor against Listeria monocytogenes infection.

    Science.gov (United States)

    Tindwa, Hamisi; Patnaik, Bharat Bhusan; Kim, Dong Hyun; Mun, Seulgi; Jo, Yong Hun; Lee, Bok Luel; Lee, Yong Seok; Kim, Nam Jung; Han, Yeon Soo

    2013-11-14

    Peptidoglycan recognition proteins (PGRPs) are a family of innate immune molecules that recognize bacterial peptidoglycan. PGRP-LE, a member of the PGRP family, selectively binds to diaminopimelic acid (DAP)-type peptidoglycan to activate both the immune deficiency (Imd) and proPhenoloxidase (proPO) pathways in insects. A PGRP-LE-dependent induction of autophagy to control Listeria monocytogenes has also been reported. We identified and partially characterized a novel PGRP-LE homologue, from Tenebrio molitor and analyzed its functional role in the survival of the insect against infection by a DAP-type PGN containing intracellular pathogen, L. monocytogenes. The cDNA is comprised of an open reading frame (ORF) of 990 bp and encodes a polypeptide of 329 residues. TmPGRP-LE contains one PGRP domain, but lacks critical residues for amidase activity. Quantitative RT-PCR analysis showed a broad constitutive expression of the transcript at various stages of development spanning from larva to adult. RNAi mediated knockdown of the transcripts, followed by a challenge with L. monocytogenes, showed a significant reduction in survival rate of the larvae, suggesting a putative role of TmPGRP-LE in sensing and control of L. monocytogenes infection in T. molitor. These results implicate PGRP-LE as a defense protein necessary for survival of T. molitor against infection by L. monocytogenes.

  18. Functional analysis of cis-acting sequences regulating root-specific expression in transgenic tobacco

    Institute of Scientific and Technical Information of China (English)

    2002-01-01

    Two different length fragments, RSF1 and RSF2 which contained the cis-acting sequences of root-spe- cific gene TobRB7, were isolated from tobacco genome. The abilities of these fragments to direct root-specific expression were studied by fusing them to the β-glucuronidase (GUS) report gene with different directions. After the recombined vectors were transformed into tobacco, the expression pattern was performed by histochemical staining and the quantitative analysis of GUS activity. The data suggested that the cis-acting element of TobRB7 gene direct GUS expression not only as root-specific but also as bidirectional. In our studies, the short fragment, RSF2, performed stronger activity than RSF1 with any direction. The stronger activity of GUS expression was determined by reverse inserting of RSF1 or RSF2 than positive inserting.

  19. Expression Patterns of Glucose Transporter-1 Gene and Thyroid Specific Genes in Human Papillary Thyroid Carcinoma

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Sungeun; Chung, Junekey; Min Haesook and others

    2014-06-15

    The expression of glucose transporter-1 (Glut-1) gene and those of major thyroid-specific genes were examined in papillary carcinoma tissues, and the expressions of these genes were compared with cancer differentiation grades. Twenty-four human papillary carcinoma tissues were included in this study. The expressions of Glut-1- and thyroid-specific genes [sodium/iodide symporter (NIS), thyroid peroxidase, thyroglobulin, TSH receptor and pendrin] were analyzed by RT-PCR. Expression levels were expressed as ratios versus the expression of beta-actin. Pathologic differentiation of papillary carcinoma was classified into a relatively well-differentiated group (n=13) and relatively less differentiated group (n=11). Glut-1 gene expression was significantly higher in the less differentiated group (0.66±0.04) than in the well-differentiated group (0.59±0.07). The expression levels of the NIS, PD and TG genes were significantly higher in the well-differentiated group (NIS: 0.67±0.20, PD: 0.65±0.21, TG: 0.74±0.16) than in the less differentiated group (NIS: 0.36±0.05, PD: 0.49±0.08, TG: 0.60±0.11), respectively. A significant negative correlation was found between Glut-1 and NIS expression, and positive correlations were found between NIS and TG, and between NIS and PD. The NIS, PD and TG genes were highly expressed in well-differentiated thyroid carcinomas, whereas the Glut-1 gene was highly expressed in less differentiated thyroid carcinomas. These findings provide a molecular rationale for the management of papillary carcinoma, especially in the selection of FDG PET or radioiodine whole-body scan and I-131-based therapy.

  20. Genome-wide tissue-specific gene expression, co-expression and regulation of co-expressed genes in adult nematode Ascaris suum.

    Directory of Open Access Journals (Sweden)

    Bruce A Rosa

    2014-02-01

    Full Text Available BACKGROUND: Caenorhabditis elegans has traditionally been used as a model for studying nematode biology, but its small size limits the ability for researchers to perform some experiments such as high-throughput tissue-specific gene expression studies. However, the dissection of individual tissues is possible in the parasitic nematode Ascaris suum due to its relatively large size. Here, we take advantage of the recent genome sequencing of Ascaris suum and the ability to physically dissect its separate tissues to produce a wide-scale tissue-specific nematode RNA-seq datasets, including data on three non-reproductive tissues (head, pharynx, and intestine in both male and female worms, as well as four reproductive tissues (testis, seminal vesicle, ovary, and uterus. We obtained fundamental information about the biology of diverse cell types and potential interactions among tissues within this multicellular organism. METHODOLOGY/PRINCIPAL FINDINGS: Overexpression and functional enrichment analyses identified many putative biological functions enriched in each tissue studied, including functions which have not been previously studied in detail in nematodes. Putative tissue-specific transcriptional factors and corresponding binding motifs that regulate expression in each tissue were identified, including the intestine-enriched ELT-2 motif/transcription factor previously described in nematode intestines. Constitutively expressed and novel genes were also characterized, with the largest number of novel genes found to be overexpressed in the testis. Finally, a putative acetylcholine-mediated transcriptional network connecting biological activity in the head to the male reproductive system is described using co-expression networks, along with a similar ecdysone-mediated system in the female. CONCLUSIONS/SIGNIFICANCE: The expression profiles, co-expression networks and co-expression regulation of the 10 tissues studied and the tissue-specific analysis

  1. Changes of Clinical Features of a Infant who Ended in Specific Expressive language Disorder

    OpenAIRE

    Kawasaki, Chisato; Siromaru, Misato

    1994-01-01

    A left-handed boy with developmental expressive language disorder was observed from the age of 4 months old to 9 years old. The chief complaint was motor delay and mild hypotonia at first. Transient mild right hemiplegia was observed from the age od six months to the age of three years. His clinical features gradually changed from those of motor delay to severe mental retardation with hyperactivity, and then to specific expressive language disorder. Neuropsychological tests which were repeate...

  2. Sex-Specificity of Mineralocorticoid Target Gene Expression during Renal Development, and Long-Term Consequences

    Science.gov (United States)

    Dumeige, Laurence; Storey, Caroline; Decourtye, Lyvianne; Nehlich, Melanie; Lhadj, Christophe; Viengchareun, Say; Kappeler, Laurent; Lombès, Marc; Martinerie, Laetitia

    2017-01-01

    Sex differences have been identified in various biological processes, including hypertension. The mineralocorticoid signaling pathway is an important contributor to early arterial hypertension, however its sex-specific expression has been scarcely studied, particularly with respect to the kidney. Basal systolic blood pressure (SBP) and heart rate (HR) were measured in adult male and female mice. Renal gene expression studies of major players of mineralocorticoid signaling were performed at different developmental stages in male and female mice using reverse transcription quantitative PCR (RT-qPCR), and were compared to those of the same genes in the lung, another mineralocorticoid epithelial target tissue that regulates ion exchange and electrolyte balance. The role of sex hormones in the regulation of these genes was also investigated in differentiated KC3AC1 renal cells. Additionally, renal expression of the 11 β-hydroxysteroid dehydrogenase type 2 (11βHSD2) protein, a regulator of mineralocorticoid specificity, was measured by immunoblotting and its activity was indirectly assessed in the plasma using liquid-chromatography coupled to mass spectrometry in tandem (LC-MSMS) method. SBP and HR were found to be significantly lower in females compared to males. This was accompanied by a sex- and tissue-specific expression profile throughout renal development of the mineralocorticoid target genes serum and glucocorticoid-regulated kinase 1 (Sgk1) and glucocorticoid-induced leucine zipper protein (Gilz), together with Hsd11b2, Finally, the implication of sex hormones in this sex-specific expression profile was demonstrated in vitro, most notably for Gilz mRNA expression. We demonstrate a tissue-specific, sex-dependent and developmentally-regulated pattern of expression of the mineralocorticoid pathway that could have important implications in physiology and pathology. PMID:28230786

  3. The Novel Multiple Inner Primers-Loop-Mediated Isothermal Amplification (MIP-LAMP) for Rapid Detection and Differentiation of Listeria monocytogenes.

    Science.gov (United States)

    Wang, Yi; Wang, Yan; Ma, Aijing; Li, Dongxun; Luo, Lijuan; Liu, Dongxin; Hu, Shoukui; Jin, Dong; Liu, Kai; Ye, Changyun

    2015-12-03

    Here, a novel model of loop-mediated isothermal amplification (LAMP), termed multiple inner primers-LAMP (MIP-LAMP), was devised and successfully applied to detect Listeria monocytogenes. A set of 10 specific MIP-LAMP primers, which recognized 14 different regions of target gene, was designed to target a sequence in the hlyA gene. The MIP-LAMP assay efficiently amplified the target element within 35 min at 63 °C and was evaluated for sensitivity and specificity. The templates were specially amplified in the presence of the genomic DNA from L. monocytogenes. The limit of detection (LoD) of MIP-LAMP assay was 62.5 fg/reaction using purified L. monocytogenes DNA. The LoD for DNA isolated from serial dilutions of L. monocytogenes cells in buffer and in milk corresponded to 2.4 CFU and 24 CFU, respectively. The amplified products were analyzed by real-time monitoring of changes in turbidity, and visualized by adding Loop Fluorescent Detection Reagent (FD), or as a ladder-like banding pattern on gel electrophoresis. A total of 48 pork samples were investigated for L. monocytogenes by the novel MIP-LAMP method, and the diagnostic accuracy was shown to be 100% when compared to the culture-biotechnical method. In conclusion, the MIP-LAMP methodology was demonstrated to be a reliable, sensitive and specific tool for rapid detection of L. monocytogenes strains.

  4. The Novel Multiple Inner Primers-Loop-Mediated Isothermal Amplification (MIP-LAMP for Rapid Detection and Differentiation of Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Yi Wang

    2015-12-01

    Full Text Available Here, a novel model of loop-mediated isothermal amplification (LAMP, termed multiple inner primers-LAMP (MIP-LAMP, was devised and successfully applied to detect Listeria monocytogenes. A set of 10 specific MIP-LAMP primers, which recognized 14 different regions of target gene, was designed to target a sequence in the hlyA gene. The MIP-LAMP assay efficiently amplified the target element within 35 min at 63 °C and was evaluated for sensitivity and specificity. The templates were specially amplified in the presence of the genomic DNA from L. monocytogenes. The limit of detection (LoD of MIP-LAMP assay was 62.5 fg/reaction using purified L. monocytogenes DNA. The LoD for DNA isolated from serial dilutions of L. monocytogenes cells in buffer and in milk corresponded to 2.4 CFU and 24 CFU, respectively. The amplified products were analyzed by real-time monitoring of changes in turbidity, and visualized by adding Loop Fluorescent Detection Reagent (FD, or as a ladder-like banding pattern on gel electrophoresis. A total of 48 pork samples were investigated for L. monocytogenes by the novel MIP-LAMP method, and the diagnostic accuracy was shown to be 100% when compared to the culture-biotechnical method. In conclusion, the MIP-LAMP methodology was demonstrated to be a reliable, sensitive and specific tool for rapid detection of L. monocytogenes strains.

  5. Survival of Listeria monocytogenes in simulated gastrointestinal system and transcriptional profiling of stress- and adhesion-related genes

    DEFF Research Database (Denmark)

    Jiang, Lingli; Olesen, Inger; Andersen, Thomas;

    2010-01-01

    survival of L. monocytogenes serotypes 4b and 1=2a strains were higher than that of serotype 1=2c, suggesting that pathogenicity might be related to the viability in the gastrointestinal tract.The transcription levels of prfA and the general stress-related genes clpC, clpE, and clpP were upregulated...... afterpassing through the simulated gastrointestinal tract, whereas that of the adhesion-related gene ami was downregulated. Taken together, this study revealed that L. monocytogenes strains enhanced the expression of stressrelated genes and decreased the transcription of adhesion-related gene in order...

  6. Highly Invasive Listeria monocytogenes Strains Have Growth and Invasion Advantages in Strain Competition.

    Science.gov (United States)

    Zilelidou, Evangelia A; Rychli, Kathrin; Manthou, Evanthia; Ciolacu, Luminita; Wagner, Martin; Skandamis, Panagiotis N

    2015-01-01

    Multiple Listeria monocytogenes strains can be present in the same food sample; moreover, infection with more than one L. monocytogenes strain can also occur. In this study we investigated the impact of strain competition on the growth and in vitro virulence potential of L. monocytogenes. We identified two strong competitor strains, whose growth was not (or only slightly) influenced by the presence of other strains and two weak competitor strains, which were outcompeted by other strains. Cell contact was essential for growth inhibition. In vitro virulence assays using human intestinal epithelial Caco2 cells showed a correlation between the invasion efficiency and growth inhibition: the strong growth competitor strains showed high invasiveness. Moreover, invasion efficiency of the highly invasive strain was further increased in certain combinations by the presence of a low invasive strain. In all tested combinations, the less invasive strain was outcompeted by the higher invasive strain. Studying the effect of cell contact on in vitro virulence competition revealed a complex pattern in which the observed effects depended only partially on cell-contact suggesting that competition occurs at two different levels: i) during co-cultivation prior to infection, which might influence the expression of virulence factors, and ii) during infection, when bacterial cells compete for the host cell. In conclusion, we show that growth of L. monocytogenes can be inhibited by strains of the same species leading potentially to biased recovery during enrichment procedures. Furthermore, the presence of more than one L. monocytogenes strain in food can lead to increased infection rates due to synergistic effects on the virulence potential.

  7. Identification and preliminary characterization of a SigB regulated small non-coding RNA in Listeria monocytogenes

    DEFF Research Database (Denmark)

    Nielsen, Jesper Sejrup; Olsen, Anders Steno; Bonde, Mette;

    by an alternative sigma factor. Using this approach we have successfully identified a novel sRNA of ~75 nucleotides in L. monocytogenes that is specifically regulated by SigB. This sRNA, which we have termed SigB1 is expressed from the 3'-UTR of a large operon. SigB1 is expressed in a SigB dependant manner only...... in response to known SigB associated stresses such as salt- and ethanol-stress or entrance into stationary phase. Using transcriptional promoter-lacZ reporter assays, we have confirmed that SigB1 is not the result of an RNA-processing event. Interestingly, SigB1 does not contain any obvious Hfq binding sites...

  8. Tissue-Specific Immune Gene Expression in the Migratory Locust, Locusta Migratoria

    Directory of Open Access Journals (Sweden)

    Tamara Pulpitel

    2015-04-01

    Full Text Available The ability of hosts to respond to infection involves several complex immune recognition pathways. Broadly conserved pathogen-associated molecular patterns (PAMPs allow individuals to target a range of invading microbes. Recently, studies on insect innate immunity have found evidence that a single pathogen can activate different immune pathways across species. In this study, expression changes in immune genes encoding peptidoglycan-recognition protein SA (PGRP-SA, gram-negative binding protein 1 (GNBP1 and prophenoloxidase (ProPO were investigated in Locusta migratoria, following an immune challenge using injected lipopolysaccharide (LPS solution from Escherichia coli. Since immune activation might also be tissue-specific, gene expression levels were followed across a range of tissue types. For PGRP-SA, expression increased in response to LPS within all seven of the tissue-types assayed and differed significantly between tissues. Expression of GNBP1 similarly varied across tissue types, yet showed no clear expression difference between LPS-injected and uninfected locusts. Increases in ProPO expression in response to LPS, however, could only be detected in the gut sections. This study has revealed tissue-specific immune response to add a new level of complexity to insect immune studies. In addition to variation in recognition pathways identified in previous works, tissue-specificity should be carefully considered in similar works.

  9. A transgenic approach to control hemipteran insects by expressing insecticidal genes under phloem-specific promoters

    Science.gov (United States)

    Javaid, Shaista; Amin, Imran; Jander, Georg; Mukhtar, Zahid; Saeed, Nasir A.; Mansoor, Shahid

    2016-01-01

    The first generation transgenic crops used strong constitutive promoters for transgene expression. However, tissue-specific expression is desirable for more precise targeting of transgenes. Moreover, piercing/sucking insects, which are generally resistant to insecticidal Bacillus thuringiensis (Bt) proteins, have emerged as a major pests since the introduction of transgenic crops expressing these toxins. Phloem-specific promoters isolated from Banana bunchy top virus (BBTV) were used for the expression of two insecticidal proteins, Hadronyche versuta (Blue Mountains funnel-web spider) neurotoxin (Hvt) and onion leaf lectin, in tobacco (Nicotiana tabacum). Here we demonstrate that transgenic plants expressing Hvt alone or in combination with onion leaf lectin are resistant to Phenacoccus solenopsis (cotton mealybug), Myzus persicae (green peach aphids) and Bemisia tabaci (silver leaf whitefly). The expression of both proteins under different phloem-specific promoters resulted in close to 100% mortality and provided more rapid protection than Hvt alone. Our results suggest the employment of the Hvt and onion leaf lectin transgenic constructs at the commercial level will reduce the use of chemical pesticides for control of hemipteran insect pests. PMID:27708374

  10. Expression of maturation-specific nuclear antigens in differentiating human myeloid leukemia cells

    Energy Technology Data Exchange (ETDEWEB)

    Murao, S.; Epstein, A.L.; Clevenger, C.V.; Huberman, E.

    1985-02-01

    The expression of three myeloid-specific nuclear antigens was studied by indirect immunofluorescence with murine monoclonal antibodies in human myeloid (HL-60, ML-2, KG-1, and B-II) leukemia cells treated with chemical inducers of cell differentiation. Treatment of the promyelocytic HL-60 cells with dimethyl sulfoxide or 1,25-dihydroxyvitamin DT induced the cells to acquire a phenotype that resembled that of granulocytes and monocytesmacrophages, respectively. These phenotypes were characterized by changes in cell growth, cell morphology, expression of specific cell surface antigens, and activities of lysozyme and nonspecific esterase enzymes. Induction of these differentiation markers in the HL-60 cells was associated with induction of the myeloid-specific nuclear antigens. The ML-2 cells, which are arrested at the myeloblast-promyelocyte stage, were also susceptible to the induction of cell differentiation and to changes in the expression of the nuclear antigens, but the degree of susceptibility was less than in the HL-60 cells. The less-differentiated KG-1 and B-II myeloid cells were either not responsive or responded only in a limited degree to the induction of cell differentiation or to changes in the expression of the nuclear antigens. The authors suggest that the reactivity of cells with monoclonal antibodies to specific nuclear antigens can be used as a maturational marker in cell differentiation studies. Furthermore, nuclear antigens expressed early in cellular differentiation may provide information about changes in regulatory elements in normal and malignant cells. 40 references, 2 figures, 1 table.

  11. Phenotypic, Proteomic, and Genomic Characterization of a Putative ABC-Transporter Permease Involved in Listeria monocytogenes Biofilm Formation

    DEFF Research Database (Denmark)

    Zhu, Xinna; Liu, Weibing; Lametsch, René

    2011-01-01

    enhanced ability for biofilm formation as the LM-49 strain using a crystal violet staining assay. DNA microarrays and two-dimensional gel electrophoresis revealed 49 and 11 differentially expressed (twofold or more) genes or proteins in Δ1771, respectively. The transcriptomics study indicated that lm......The foodborne pathogen Listeria monocytogenes is able to form biofilms in food processing environments. Previously, we have reported that an lm.G_1771 gene (encoding a putative ABC-transporter permease) was involved in negative regulation of L. monocytogenes biofilm formation using LM-49, a biofilm......-enhanced mutant isolated on Tn917 mutagenesis (AEM 2008 p.7675–7683). Here, the possible action of this ABC-transporter permease in L. monocytogenes biofilm formation was characterized by phenotypic, proteomic, and genomic analyses using an lm.G_1771 gene deletant (Δ1771). The Δ1771 mutant exhibited the same...

  12. The quorum sensing luxS gene is induced in Lactobacillus acidophilus NCFM in response to Listeria monocytogenes

    DEFF Research Database (Denmark)

    Moslehi Jenabian, Saloomeh; Vogensen, Finn Kvist; Jespersen, Lene

    2011-01-01

    The luxS gene involved in quorum sensing has been shown to control different behaviour of probiotic lactobacilli. In this study we investigated if luxS in Lactobacillus acidophilus NCFM was up-regulated in response to Listeria monocytogenes EGD-e. The two bacterial strains were grown in mono......- and co-culture and the growth of both bacteria and the transcriptional level of luxS in L. acidophilus cells were monitored. Contrary to L. acidophilus, the growth of L. monocytogenes was significantly affected by co-cultivation. Transcriptional analysis showed that the expression of luxS increased...... during exponential growth in L. acidophilus cells with the highest level in the late-exponential growth phase, decreasing in the stationary phase. Following co-cultivation with L. monocytogenes, the transcriptional level of luxS increased significantly in mid-exponential growing cells of L. acidophilus...

  13. Stochastic modelling of Listeria monocytogenes single cell growth in cottage cheese with mesophilic lactic acid bacteria from aroma producing cultures

    DEFF Research Database (Denmark)

    Østergaard, Nina Bjerre; Christiansen, Lasse Engbo; Dalgaard, Paw

    2015-01-01

    for pH, lactic acid concentration and initial concentration of lactic acid bacteria. These data and bootstrap sampling were used to represent product variability in the stochastic model. Lag time data were estimated from observed growth data (lactic acid bacteria) and from literature on L. monocytogenes...... single cells. These lag time data were expressed as relative lag times and included in growth models. A stochastic model was developed from an existing deterministic growth model including the effect of five environmental factors and inter-bacterial interaction [Østergaard, N.B, Eklöw, A and Dalgaard, P....... 2014. Modelling the effect of lactic acid bacteria from starter- and aroma culture on growth of Listeria monocytogenes in cottage cheese. International Journal of Food Microbiology. 188, 15-25]. Growth of L. monocytogenes single cells, using lag time distributions corresponding to three different...

  14. Stage-specific expression of ankyrin and SOCS box protein-4 (Asb-4) during spermatogenesis.

    Science.gov (United States)

    Kim, Soo-Kyoung; Rhim, Si Youn; Lee, Man Ryul; Kim, Jong Soo; Kim, Hyung Jun; Lee, Dong Ryul; Kim, Kye-Seong

    2008-04-30

    Members of the large family of Asb proteins are ubiquitously expressed in mammalian tissues; however, the roles of individual Asb and their function in the developmental testes have not been reported. In this report, we isolated a murine Asb4 from mouse testis. Northern blot analysis revealed that mAsb-4 was expressed only in testes and produced in a stage-specific manner during spermatogenesis. It was expressed in murine testes beginning in the fourth week after birth and extending into adulthood. Pachytene spermatocytes had the highest level of expression. Interestingly, the human homologue of mAsb-4, ASB-4 (hASB-4) was also expressed in human testis. These results suggest that ASB-4 plays pivotal roles in mammalian testis development and spermatogenesis.

  15. Gender and obesity specific MicroRNA expression in adipose tissue from lean and obese pigs

    DEFF Research Database (Denmark)

    Mentzel, Caroline M. Junker; Anthon, Christian; Jacobsen, Mette Juul

    2015-01-01

    Obesity is a complex condition that increases the risk of life threatening diseases such as cardiovascular disease and diabetes. Studying the gene regulation of obesity is important for understanding the molecular mechanisms behind the obesity derived diseases and may lead to better intervention...... expressed miRNAs in subcutaneous adipose tissue by RNA sequencing (RNAseq). Both male and female pigs are included to explore gender differences. The RNAseq study shows that the most highly expressed miRNAs are in accordance with comparable studies in pigs and humans. A total of six mi......RNAs are differentially expressed in subcutaneous adipose tissue between the lean and obese group of pigs, and in addition gender specific significant differential expression is observed for a number of miRNAs. The differentially expressed miRNAs have been verified using qPCR. The results of these studies in general...

  16. Regional differences in expression of specific markers for human embryonic stem cells

    DEFF Research Database (Denmark)

    Laursen, Steen B; Møllgård, Kjeld; Olesen, Christian

    2007-01-01

    Characterization of human embryonic stem cell (hESC) lines derived from the inner cell masses of blastocysts generally includes expression analysis of markers such as OCT4, NANOG, SSEA3, SSEA4, TRA-1-60 and TRA-1-81. Expression is usually detected by immunocytochemical staining of entire colonies...... staining to weak or absent NANOG staining, and vice versa. SSEA4 staining was only observed in small clusters or single cells and not confined to the TRA territory. Co-expression of all markers was only detected in small areas. SSEA1 expression was found exclusively outside the TRA territory. In conclusion......, pronounced regional differences in the expression of markers considered specific for undifferentiated hESC may suggest the existence of different cell populations....

  17. Gender and obesity specific MicroRNA expression in adipose tissue from lean and obese pigs

    DEFF Research Database (Denmark)

    Mentzel, Caroline M. Junker; Anthon, Christian; Jacobsen, Mette Juul;

    2015-01-01

    Obesity is a complex condition that increases the risk of life threatening diseases such as cardiovascular disease and diabetes. Studying the gene regulation of obesity is important for understanding the molecular mechanisms behind the obesity derived diseases and may lead to better intervention ...... expressed miRNAs in subcutaneous adipose tissue by RNA sequencing (RNAseq). Both male and female pigs are included to explore gender differences. The RNAseq study shows that the most highly expressed miRNAs are in accordance with comparable studies in pigs and humans. A total of six mi......RNAs are differentially expressed in subcutaneous adipose tissue between the lean and obese group of pigs, and in addition gender specific significant differential expression is observed for a number of miRNAs. The differentially expressed miRNAs have been verified using qPCR. The results of these studies in general...

  18. Analysis of DNA strand-specific differential expression with high density tiling microarrays

    Directory of Open Access Journals (Sweden)

    Antequera Francisco

    2010-03-01

    Full Text Available Abstract Background DNA microarray technology allows the analysis of genome structure and dynamics at genome-wide scale. Expression microarrays (EMA contain probes for annotated open reading frames (ORF and are widely used for the analysis of differential gene expression. By contrast, tiling microarrays (TMA have a much higher probe density and provide unbiased genome-wide coverage. The purpose of this study was to develop a protocol to exploit the high resolution of TMAs for quantitative measurement of DNA strand-specific differential expression of annotated and non-annotated transcripts. Results We extensively filtered probes present in Affymetrix Genechip Yeast Genome 2.0 expression and GeneChip S. pombe 1.0FR tiling microarrays to generate custom Chip Description Files (CDF in order to compare their efficiency. We experimentally tested the potential of our approach by measuring the differential expression of 4904 genes in the yeast Schizosaccharomyces pombe growing under conditions of oxidative stress. The results showed a Pearson correlation coefficient of 0.943 between both platforms, indicating that TMAs are as reliable as EMAs for quantitative expression analysis. A significant advantage of TMAs over EMAs is the possibility of detecting non-annotated transcripts generated only under specific physiological conditions. To take full advantage of this property, we have used a target-labelling protocol that preserves the original polarity of the transcripts and, therefore, allows the strand-specific differential expression of non-annotated transcripts to be determined. By using a segmentation algorithm prior to generating the corresponding custom CDFs, we identified and quantitatively measured the expression of 510 transcripts longer than 180 nucleotides and not overlapping previously annotated ORFs that were differentially expressed at least 2-fold under oxidative stress. Conclusions We show that the information derived from TMA

  19. Thyroid-Specific Genes Expression Uncovered Age-Related Differences in Pediatric Thyroid Carcinomas

    Directory of Open Access Journals (Sweden)

    Maria Isabel Cunha Vieira Cordioli

    2016-01-01

    Full Text Available Despite a more advanced stage of disease at presentation, a better response to radioiodine (RAI therapy and a reduced overall mortality have been reported in pediatric differentiated thyroid cancer (DTC in comparison to adult DTC. Few studies suggested that the better response to RAI therapy in pediatric patients might be associated with an increased expression of NIS. However, a marked heterogeneity within the pediatric group has been recognized. Children (<10 years old usually present a more aggressive disease than adolescents (≥10–18 years old. By analyzing the expression of thyroid-specific genes in 38 sporadic pediatric tumors, we show that the expression of NIS, PDS, and TSHR was lower in children than adolescents (P<0.05. A linear regression confirmed the association between NIS expression and age. Most significantly, NIS was expressed at similar levels in DTC from children and adults, whereas PDS and TSHR expression was even lower in DTC from children, compared to adolescents and adults. Our data suggest that biological behaviors of DTC in adolescents might differ from those in children and adults. Therefore, the premise that the expression of thyroid-specific genes is higher in tumors from pediatric patients than in adults is not entirely true and might be too oversimplified.

  20. Conservation of position-specific gene expression in axolotl limb skin.

    Science.gov (United States)

    Satoh, Akira; Makanae, Aki

    2014-01-01

    Urodele amphibians can regenerate their limbs after amputation. After amputation, undifferentiated cells appear on the amputation plane and form regeneration blastema. A limb blastema recreates a complete replica of the original limb. It is well known that disturbance of the location of limb tissues prior to amputation perturbs limb patterning, suggesting that different intact limb tissues carry different location information despite their identical appearance. The cause of such differences in intact tissues remains unknown. In this study, we found that Lmx1b, Tbx2, and Tbx3 genes, which are expressed in developing limb in a region specific manner, remained detectable in a mature axolotl limb. Furthermore, those position-specific gene expression patterns were conserved in mature limbs. Treatment with retinoic acid (RA), which is known to have ventralizing activity, changed Lmx1b expression in intact dorsal skin and dorsal character to ventral, indicating that conserved Lmx1b expression was due to the dorsal character and not leaky gene expression. Furthermore, we found that such conserved gene expression was rewritable in regeneration blastemas. These results suggest that axolotl limb cells can recognize their locations and maintain limbness via conserved expression profiles of developmental genes.

  1. Regulation of mouse stomach development and Barx1 expression by specific microRNAs

    Science.gov (United States)

    Kim, Byeong-Moo; Woo, Janghee; Kanellopoulou, Chryssa; Shivdasani, Ramesh A.

    2011-01-01

    Although microRNAs (miRNAs) are postulated to fine-tune many developmental processes, their relationships with specific targets and tissues remain largely undefined. The mesenchymal transcription factor Barx1 controls spleen and stomach morphogenesis and is required to specify stomach-specific epithelium in adjacent endoderm. Barx1 expression is precisely regulated in space and time, with a sharp drop in stomach levels after epithelial specification. We tested the hypothesis that specific miRNAs mediate this marked decline in Barx1 levels. Depletion of the miRNA-processing enzyme Dicer in cultured stomach mesenchyme and conditional Dicer gene deletion in mice significantly increased Barx1 levels, disrupted stomach and intestine development and caused spleen agenesis. Computational and experimental studies identified miR-7a and miR-203 as candidate miRNAs that regulate Barx1 and are expressed in inverse proportion to it in the fetal mouse stomach. Through specific interactions with cognate sequences in the Barx1 3′ untranslated region, miR-7a and miR-203 repress Barx1 expression in stomach mesenchymal cells and its function in inducing gastric epithelium. These results indicate that miRNAs are required for proper digestive tract organogenesis and that miR-7a and miR-203 control expression of the stomach homeotic regulator Barx1. PMID:21307095

  2. Expression of phosphoinositide-specific phospholipase C isoforms in native endothelial cells.

    Directory of Open Access Journals (Sweden)

    Delphine M Béziau

    Full Text Available Phospholipase C (PLC comprises a superfamily of enzymes that play a key role in a wide array of intracellular signalling pathways, including protein kinase C and intracellular calcium. Thirteen different mammalian PLC isoforms have been identified and classified into 6 families (PLC-β, γ, δ, ε, ζ and η based on their biochemical properties. Although the expression of PLC isoforms is tissue-specific, concomitant expression of different PLC has been reported, suggesting that PLC family is involved in multiple cellular functions. Despite their critical role, the PLC isoforms expressed in native endothelial cells (ECs remains undetermined. A conventional PCR approach was initially used to elucidate the mRNA expression pattern of PLC isoforms in 3 distinct murine vascular beds: mesenteric (MA, pulmonary (PA and middle cerebral arteries (MCA. mRNA encoding for most PLC isoforms was detected in MA, MCA and PA with the exception of η2 and β2 (only expressed in PA, δ4 (only expressed in MCA, η1 (expressed in all but MA and ζ (not detected in any vascular beds tested. The endothelial-specific PLC expression was then sought in freshly isolated ECs. Interestingly, the PLC expression profile appears to differ across the investigated arterial beds. While mRNA for 8 of the 13 PLC isoforms was detected in ECs from MA, two additional PLC isoforms were detected in ECs from PA and MCA. Co-expression of multiple PLC isoforms in ECs suggests an elaborate network of signalling pathways: PLC isoforms may contribute to the complexity or diversity of signalling by their selective localization in cellular microdomains. However in situ immunofluorescence revealed a homogeneous distribution for all PLC isoforms probed (β3, γ2 and δ1 in intact endothelium. Although PLC isoforms play a crucial role in endothelial signal transduction, subcellular localization alone does not appear to be sufficient to determine the role of PLC in the signalling microdomains found

  3. Contribution of distinct homeodomain DNA binding specificities to Drosophila embryonic mesodermal cell-specific gene expression programs.

    Directory of Open Access Journals (Sweden)

    Brian W Busser

    Full Text Available Homeodomain (HD proteins are a large family of evolutionarily conserved transcription factors (TFs having diverse developmental functions, often acting within the same cell types, yet many members of this family paradoxically recognize similar DNA sequences. Thus, with multiple family members having the potential to recognize the same DNA sequences in cis-regulatory elements, it is difficult to ascertain the role of an individual HD or a subclass of HDs in mediating a particular developmental function. To investigate this problem, we focused our studies on the Drosophila embryonic mesoderm where HD TFs are required to establish not only segmental identities (such as the Hox TFs, but also tissue and cell fate specification and differentiation (such as the NK-2 HDs, Six HDs and identity HDs (I-HDs. Here we utilized the complete spectrum of DNA binding specificities determined by protein binding microarrays (PBMs for a diverse collection of HDs to modify the nucleotide sequences of numerous mesodermal enhancers to be recognized by either no or a single subclass of HDs, and subsequently assayed the consequences of these changes on enhancer function in transgenic reporter assays. These studies show that individual mesodermal enhancers receive separate transcriptional input from both I-HD and Hox subclasses of HDs. In addition, we demonstrate that enhancers regulating upstream components of the mesodermal regulatory network are targeted by the Six class of HDs. Finally, we establish the necessity of NK-2 HD binding sequences to activate gene expression in multiple mesodermal tissues, supporting a potential role for the NK-2 HD TF Tinman (Tin as a pioneer factor that cooperates with other factors to regulate cell-specific gene expression programs. Collectively, these results underscore the critical role played by HDs of multiple subclasses in inducing the unique genetic programs of individual mesodermal cells, and in coordinating the gene regulatory

  4. Contribution of distinct homeodomain DNA binding specificities to Drosophila embryonic mesodermal cell-specific gene expression programs.

    Science.gov (United States)

    Busser, Brian W; Gisselbrecht, Stephen S; Shokri, Leila; Tansey, Terese R; Gamble, Caitlin E; Bulyk, Martha L; Michelson, Alan M

    2013-01-01

    Homeodomain (HD) proteins are a large family of evolutionarily conserved transcription factors (TFs) having diverse developmental functions, often acting within the same cell types, yet many members of this family paradoxically recognize similar DNA sequences. Thus, with multiple family members having the potential to recognize the same DNA sequences in cis-regulatory elements, it is difficult to ascertain the role of an individual HD or a subclass of HDs in mediating a particular developmental function. To investigate this problem, we focused our studies on the Drosophila embryonic mesoderm where HD TFs are required to establish not only segmental identities (such as the Hox TFs), but also tissue and cell fate specification and differentiation (such as the NK-2 HDs, Six HDs and identity HDs (I-HDs)). Here we utilized the complete spectrum of DNA binding specificities determined by protein binding microarrays (PBMs) for a diverse collection of HDs to modify the nucleotide sequences of numerous mesodermal enhancers to be recognized by either no or a single subclass of HDs, and subsequently assayed the consequences of these changes on enhancer function in transgenic reporter assays. These studies show that individual mesodermal enhancers receive separate transcriptional input from both I-HD and Hox subclasses of HDs. In addition, we demonstrate that enhancers regulating upstream components of the mesodermal regulatory network are targeted by the Six class of HDs. Finally, we establish the necessity of NK-2 HD binding sequences to activate gene expression in multiple mesodermal tissues, supporting a potential role for the NK-2 HD TF Tinman (Tin) as a pioneer factor that cooperates with other factors to regulate cell-specific gene expression programs. Collectively, these results underscore the critical role played by HDs of multiple subclasses in inducing the unique genetic programs of individual mesodermal cells, and in coordinating the gene regulatory networks

  5. Analysing and modelling the growth behaviour of Listeria monocytogenes on RTE cooked meat products after a high pressure treatment at 400 MPa

    DEFF Research Database (Denmark)

    Hereu, A.; Dalgaard, Paw; Garriga, M.

    2014-01-01

    Various predictive models are available for high pressure inactivation of Listeria monocytogenes in food, but currently available models do not consider the growth kinetics of surviving cells during the subsequent storage of products. Therefore, we characterised the growth of L. monocytogenes......) and subsequently stored at 4,8 and 12 degrees C. The Logistic model with delay was used to estimate lag phase (lambda) and maximum specific growth rate (mu(max)) values from the obtained growth curves. The effect of storage temperature on mu(max) and lambda was modelled using the Ratkowsky square root model...... of L. monocytogenes 100-fold (2-log) higher than the cell concentration prior to the pressure treatment was similar for the two studied physiological states of the inoculum. Two secondary models were necessary to describe the different growth behaviour of L. monocytogenes on ready-to-eat cooked ham...

  6. Listeria monocytogenes that lyse in the macrophage cytosol trigger AIM2-mediated pyroptosis

    OpenAIRE

    Sauer, John-Demian; Witte, Chelsea E.; Zemansky, Jason; Hanson, Bill; Lauer, Peter; Portnoy, Daniel A.

    2010-01-01

    To gain insight into the mechanisms by which host cells detect cytosolic invasion by intracellular pathogens, a genetic screen was performed to identify Listeria monocytogenes mutants that induced altered levels of host cell death. A mutation in lmo2473 resulted in hyper-stimulation of host cell death and IL-1β secretion (pyroptosis) following bacteriolysis in the macrophage cytosol. In addition, strains engineered to lyse in the cytosol by expression of both bacteriophage holin and lysin or ...

  7. Listeria monocytogenes that lyse in the macrophage cytosol trigger AIM2-mediated pyroptosis

    OpenAIRE

    Sauer, John-Demian; Witte, Chelsea E.; Zemansky, Jason; Hanson, Bill; Lauer, Peter; Portnoy, Daniel A.

    2010-01-01

    To gain insight into the mechanisms by which host cells detect cytosolic invasion by intracellular pathogens, a genetic screen was performed to identify Listeria monocytogenes mutants that induced altered levels of host cell death. A mutation in lmo2473 resulted in hyper-stimulation of host cell death and IL-1β secretion (pyroptosis) following bacteriolysis in the macrophage cytosol. In addition, strains engineered to lyse in the cytosol by expression of both bacteriophage holin and lysin or ...

  8. Analysis of two novel midgut-specific promoters driving transgene expression in Anopheles stephensi mosquitoes.

    Directory of Open Access Journals (Sweden)

    Tony Nolan

    Full Text Available BACKGROUND: Tissue-specific promoters controlling the expression of transgenes in Anopheles mosquitoes represent a valuable tool both for studying the interaction between these malaria vectors and the Plasmodium parasites they transmit and for novel malaria control strategies based on developing Plasmodium-refractory mosquitoes by expressing anti-parasitic genes. With this aim we have studied the promoter regions of two genes from the most important malaria vector, Anopheles gambiae, whose expression is strongly induced upon blood feeding. RESULTS: We analysed the A. gambiae Antryp1 and G12 genes, which we have shown to be midgut-specific and maximally expressed at 24 hours post-bloodmeal (PBM. Antryp1, required for bloodmeal digestion, encodes one member of a family of 7 trypsin genes. The G12 gene, of unknown function, was previously identified in our laboratory in a screen for genes induced in response to a bloodmeal. We fused 1.1 kb of the upstream regions containing the putative promoter of these genes to reporter genes and transformed these into the Indian malaria vector A. stephensi to see if we could recapitulate the expression pattern of the endogenous genes. Both the Antryp1 and G12 upstream regions were able to drive female-predominant, midgut-specific expression in transgenic mosquitoes. Expression of the Antryp1-driven reporter in transgenic A. stephensi lines was low, undetectable by northern blot analysis, and failed to fully match the induction kinetics of the endogenous Antryp1 gene in A. gambiae. This incomplete conservation of expression suggests either subtle differences in the transcriptional machinery between A. stephensi and A. gambiae or that the upstream region chosen lacked all the control elements. In contrast, the G12 upstream region was able to faithfully reproduce the expression profile of the endogenous A. gambiae gene, showing female midgut specificity in the adult mosquito and massive induction PBM, peaking at 24

  9. 17β-Estradiol suppresses visceral adipogenesis and activates brown adipose tissue-specific gene expression.

    Science.gov (United States)

    Al-Qahtani, Saad Misfer; Bryzgalova, Galyna; Valladolid-Acebes, Ismael; Korach-André, Marion; Dahlman-Wright, Karin; Efendić, Suad; Berggren, Per-Olof; Portwood, Neil

    2017-01-01

    Both functional ovaries and estrogen replacement therapy (ERT) reduce the risk of type 2 diabetes (T2D). Understanding the mechanisms underlying the antidiabetic effects of 17β-estradiol (E2) may permit the development of a molecular targeting strategy for the treatment of metabolic disease. This study examines how the promotion of insulin sensitivity and weight loss by E2 treatment in high-fat-diet (HFD)-fed mice involve several anti-adipogenic processes in the visceral adipose tissue. Magnetic resonance imaging (MRI) revealed specific reductions in visceral adipose tissue volume in HFD+E2 mice, compared with HFD mice. This loss of adiposity was associated with diminished visceral adipocyte size and reductions in expression of lipogenic genes, adipokines and of the nuclear receptor nr2c2/tr4. Meanwhile, expression levels of adipose triglyceride lipase/pnpla2 and leptin receptor were increased. As mRNA levels of stat3, a transcription factor involved in brown adipose tissue differentiation, were also increased in visceral adipose, the expression of other brown adipose-specific markers was assessed. Both expression and immunohistochemical staining of ucp-1 were increased, and mRNA levels of dio-2, and of adrβ3, a regulator of ucp-1 expression during the thermogenic response, were increased. Furthermore, expression of cpt-1b, a brown adipose-specific gene involved in fatty acid utilization, was also increased. Methylation studies demonstrated that the methylation status of both dio-2 and adrβ3 was significantly reduced. These results show that improved glycemic control and weight loss due to E2 involve anti-adipogenic mechanisms which include suppressed lipogenesis and augmented fatty acid utilization, and in addition, the activation of brown adipose tissue-specific gene expression in association with E2-dependent epigenetic modifications in these genes.

  10. The ability of Listeria monocytogenes PI-PLC to facilitate escape from the macrophage phagosome is dependent on host PKCbeta.

    Science.gov (United States)

    Poussin, Mathilde A; Leitges, Michael; Goldfine, Howard

    2009-01-01

    Listeria monocytogenes are facultative intracellular pathogenic bacteria that can infect macrophages as well as non-professional phagocytes. After entry in the host cell, the bacteria escape from the phagosome into the cytoplasm. In murine macrophages and in cell lines derived from these cells, escape of L. monocytogenes from the phagosome is absolutely dependent on listeriolysin O (LLO) and facilitated by a secreted phosphatidylinositol-specific phospholipase C (PI-PLC). Work in this laboratory has previously demonstrated a LLO and PI-PLC-dependent translocation of host PKCbeta isoforms. Pharmacological inhibition of PKCbeta resulted in a significant reduction in permeabilization of the phagosome, and in the number of bacteria reaching the cytosol. These findings led to the prediction that the bacterial PI-PLC promotes escape through the production of diacylglycerol leading to the activation of host PKCbeta. To test this hypothesis, bone marrow-derived macrophages (BMMf) obtained from PKCbeta knockout (PKCbetaKO) or C57Bl/6 mice were infected with L. monocytogenes. We observed that wild-type L. monocytogenes escapes from the phagosome of PKCbetaKO BMMf as well as from C57Bl/6 BMMf. However, in PKCbetaKO BMMf, L. monocytogenes uses a PI-PLC-independent, but phosphatidylcholine-preferring PLC (PC-PLC)-dependent pathway to facilitate escape. These findings strongly support the hypothesis that PI-PLC promotes escape through mobilization of host PKCbeta.

  11. Phenotypic and Genotypic Characterization of Atypical Listeria monocytogenes and Listeria innocua Isolated from Swine Slaughterhouses and Meat Markets

    Directory of Open Access Journals (Sweden)

    Luisa Zanolli Moreno

    2014-01-01

    Full Text Available In the last decade, atypical Listeria monocytogenes and L. innocua strains have been detected in food and the environment. Because of mutations in the major virulence genes, these strains have different virulence intensities in eukaryotic cells. In this study, we performed phenotypic and genotypic characterization of atypical L. monocytogenes and L. innocua isolates obtained from swine slaughterhouses and meat markets. Forty strains were studied, including isolates of L. monocytogenes and L. innocua with low-hemolytic activity. The isolates were characterized using conventional phenotypic Listeria identification tests and by the detection and analysis of L. monocytogenes-specific genes. Analysis of 16S rRNA was used for the molecular identification of the Listeria species. The L. monocytogenes isolates were positive for all of the virulence genes studied. The atypical L. innocua strains were positive for hly, plcA, and inlC. Mutations in the InlC, InlB, InlA, PI-PLC, PC-PLC, and PrfA proteins were detected in the atypical isolates. Further in vitro and transcriptomic studies are being developed to confirm the role of these mutations in Listeria virulence.

  12. Acanthamoeba feature a unique backpacking strategy to trap and feed on Listeria monocytogenes and other motile bacteria.

    Science.gov (United States)

    Doyscher, Dominik; Fieseler, Lars; Dons, Lone; Loessner, Martin J; Schuppler, Markus

    2013-02-01

    Despite its prominent role as an intracellular human pathogen, Listeria monocytogenes normally features a saprophytic lifestyle, and shares many environmental habitats with predatory protozoa. Earlier studies claimed that Acanthamoeba may act as environmental reservoirs for L. monocytogenes, whereas others failed to confirm this hypothesis. Our findings support the latter and provide clear evidence that L. monocytogenes is unable to persist in Acanthamoeba castellanii and A. polyphaga. Instead, external Listeria cells are rapidly immobilized on the surface of Acanthamoeba trophozoites, forming large aggregates of densely packed bacteria that we termed backpacks. While the assembly of backpacks is dependent on bacterial motility, flagellation alone is not sufficient. Electron micrographs showed that the aggregates are held together by filaments of likely amoebal origin. Time-lapse microscopy revealed that shortly after the bacteria are collected, the amoeba can change direction of movement, phagocytose the backpack and continue to repeat the process. The phenomenon was also observed with avirulent L. monocytogenes mutants, non-pathogenic Listeria, and other motile bacteria, indicating that formation of backpacks is not specific for L. monocytogenes, and independent of bacterial pathogenicity or virulence. Hence, backpacking appears to represent a unique and highly effective strategy of Acanthamoeba to trap and feed on motile bacteria.

  13. CHALLENGE TESTS WITH LISTERIA MONOCYTOGENES IN SALAMI: PRELIMINARY RESULTS

    Directory of Open Access Journals (Sweden)

    R. Mioni

    2013-02-01

    Full Text Available Challenge tests are the preferable methodology to study the behaviour of Listeria monocytogenes on ready to eat foods, according to Regulation (EC 2073/2005. Challenge testing using L. monocytogenes in seasoned salami from different food business operators showed, after seasoning of the product, a count reduction of the inoculated organisms without any further growth of the pathogen; however differences of L. monocytogenes behaviour could be observed according to different production protocols.

  14. Listeria monocytogenes en alimentos: ¿son todos los aislamientos igual de virulentos? Foodborne Listeria monocytogenes: are all the isolates equally virulent?

    Directory of Open Access Journals (Sweden)

    V. López

    2006-12-01

    Full Text Available Listeria monocytogenes es un patógeno humano que se transmite a través de los alimentos y que causa infecciones graves, con una alta tasa de mortalidad. A pesar de la ubicuidad del microorganismo, la tasa real de la enfermedad es bastante baja y se asocia casi siempre a condiciones predisponentes. Tradicionalmente se consideraba que los aislamientos presentes en los alimentos y en el ambiente tenían la misma capacidad patogénica que los aislamientos de origen clínico. Pero el análisis de mutaciones en los genes de determinados factores de virulencia (internalina, hemolisina, fosfolipasas, proteína de superficie ActA y proteína reguladora PrfA, los estudios cuantitativos realizados con cultivos celulares y la genética de poblaciones, están replanteando la discusión sobre la variabilidad de la virulencia de L. monocytogenes. A pesar de todos estos avances, no existe un único marcador que permita comprobar la virulencia de los aislamientos naturales de esta especie. Probablemente en el futuro, la combinación de diferentes marcadores moleculares permitirá detectar los alimentos contaminados sólo por los clones virulentos de L. monocytogenes, con lo que se mejorará la prevención de la listeriosis humana transmitida por alimentos.Listeria monocytogenes is a foodborne human pathogen responsible for invasive infections presenting overall a high mortality. Despite the ubiquity of the microorganism, the actual disease rate is quite low and the disease is most often associated with an underlying predisposition. Foodborne and environmental isolates were traditionally considered of similar pathogenicity compared to clinical isolates. But the analysis of mutations in the genes encoding specific virulence factors (internalin, hemolysin, phospholipases, surface protein ActA and regulator protein PrfA, quantitative studies with cell cultures and population genetics have raised considerable concerns about virulence differences among L

  15. Visualization of gold and platinum nanoparticles interacting with Salmonella Enteritidis and Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Ewa Sawosz

    2010-08-01

    Full Text Available Ewa Sawosz1, André Chwalibog2, Jacek Szeliga3, Filip Sawosz2, Marta Grodzik1, Marlena Rupiewicz1, Tomasz Niemiec1, Katarzyna Kacprzyk11Division of Biotechnology and Biochemistry of Nutrition, Warsaw University of Life Sciences, Warsaw, Poland; 2Department of Basic Animal and Veterinary Sciences, University of Copenhagen, Copenhagen, Denmark; 3Division of Microbiology of Analytical Centre, Warsaw University of Life Sciences, Warsaw, PolandPurpose: Rapid development of nanotechnology has recently brought significant attention to the extraordinary biological features of nanomaterials. The objective of the present ­investigation was to evaluate morphological characteristics of the assembles of gold and platinum nanoparticles (nano-Au and nano-Pt respectively, with Salmonella Enteritidis (Gram-negative and Listeria monocytogenes (Gram-positive, to reveal possibilities of constructing bacteria-nanoparticle vehicles.Methods: Hydrocolloids of nano-Au or nano-Pt were added to two bacteria suspensions in the following order: nano-Au + Salmonella Enteritidis; nano-Au + Listeria monocytogenes; nano-Pt + Salmonella Enteritidis; nano-Pt + Listeria monocytogenes. Samples were inspected by transmission electron microscope.Results: Visualization of morphological interaction between nano-Au and Salmonella Enteritidis and Listeria monocytogenes, showed that nano-Au were aggregated within flagella or biofilm network and did not penetrate the bacterial cell. The analysis of morphological effects of interaction of nano-Pt with bacteria revealed that nano-Pt entered cells of Listeria monocytogenes and were removed from the cells. In the case of Salmonella Enteritidis, nano-Pt were seen inside bacteria cells, probably bound to DNA and partly left bacterial cells. After washing and centrifugation, some of the nano-Pt-DNA complexes were observed within Salmonella Enteritidis.Conclusion: The results indicate that the bacteria could be used as a vehicle to deliver nano

  16. Listeria monocytogenes meningoencephalitis: molecular methods for diagnosis and for monitoring the response to chemotherapy

    Directory of Open Access Journals (Sweden)

    Andrea Piana

    2005-03-01

    Full Text Available

    Background. Listeria monocytogenes is one of the most important human foodborne pathogens; it may be responsible for several disorders, like meningoencephalitis. Listerial isolation in cerebrospinal fluid (CSF is often difficult using microbiologic traditional assays. The aim of this study is to evaluate the reliability of molecular techniques as an alternative tool in order to identify Listeria monocytogenes meningitis and in particular, to evaluate a real-time PCR and a conventional PCR for the target hlyA gene.

    Methods. In 2000-2004, 145 patients, without T-cell immunodeficiency, affected by meningoencephalitis of unknown origin were admitted to the Infectious Diseases Institute of Sassari, Italy; a lumbar puncture was performed at the time of hospital admission. Two different PCR techniques, i.e. RT-PCR and a conventional PCR, were performed in order to detect CNS listerial infection, in conjunction with traditional microbiologic assays.

    Results. We identified fourteen patients affected by listerial meningitis using RT-PCR and conventional PCR. All but one of the CSF cultures were negative for L. monocytogenes. Molecular techniques were performed on the CSF samples collected during follow-up revealing that signal intensity decreased by 40%, 80% and 100% at day 15, 30 and 55 respectively, from the start of antibiotic treatment.

    Conclusions. Considering the seriousness of CNS involvement caused by L. monocytogenes infection, prompt diagnosis is necessary in order to rapidly start specific treatment. Conventional PCR and RT-PCR are rapid assays for L. monocytogenes diagnosis and they might be useful for monitoring the efficacy of antibiotic therapy

  17. Recognizing dynamic facial expressions of emotion: Specificity and intensity effects in event-related brain potentials.

    Science.gov (United States)

    Recio, Guillermo; Schacht, Annekathrin; Sommer, Werner

    2014-02-01

    Emotional facial expressions usually arise dynamically from a neutral expression. Yet, most previous research focused on static images. The present study investigated basic aspects of processing dynamic facial expressions. In two experiments, we presented short videos of facial expressions of six basic emotions and non-emotional facial movements emerging at variable and fixed rise times, attaining different intensity levels. In event-related brain potentials (ERP), effects of emotion but also for non-emotional movements appeared as early posterior negativity (EPN) between 200 and 350ms, suggesting an overall facilitation of early visual encoding for all facial movements. These EPN effects were emotion-unspecific. In contrast, relative to happiness and neutral expressions, negative emotional expressions elicited larger late positive ERP components (LPCs), indicating a more elaborate processing. Both EPN and LPC amplitudes increased with expression intensity. Effects of emotion and intensity were additive, indicating that intensity (understood as the degree of motion) increases the impact of emotional expressions but not its quality. These processes can be driven by all basic emotions, and there is little emotion-specificity even when statistical power is considerable (N (Experiment 2)=102). Copyright © 2013 Elsevier B.V. All rights reserved.

  18. Prostate-specific antigen and hormone receptor expression in male and female breast carcinoma

    Directory of Open Access Journals (Sweden)

    Cohen Cynthia

    2010-09-01

    Full Text Available Abstract Background Prostate carcinoma is among the most common solid tumors to secondarily involve the male breast. Prostate specific antigen (PSA and prostate-specific acid phosphatase (PSAP are expressed in benign and malignant prostatic tissue, and immunohistochemical staining for these markers is often used to confirm the prostatic origin of metastatic carcinoma. PSA expression has been reported in male and female breast carcinoma and in gynecomastia, raising concerns about the utility of PSA for differentiating prostate carcinoma metastasis to the male breast from primary breast carcinoma. This study examined the frequency of PSA, PSAP, and hormone receptor expression in male breast carcinoma (MBC, female breast carcinoma (FBC, and gynecomastia. Methods Immunohistochemical staining for PSA, PSAP, AR, ER, and PR was performed on tissue microarrays representing six cases of gynecomastia, thirty MBC, and fifty-six FBC. Results PSA was positive in two of fifty-six FBC (3.7%, focally positive in one of thirty MBC (3.3%, and negative in the five examined cases of gynecomastia. PSAP expression was absent in MBC, FBC, and gynecomastia. Hormone receptor expression was similar in males and females (AR 74.1% in MBC vs. 67.9% in FBC, p = 0.62; ER 85.2% vs. 68.5%, p = 0.18; and PR 51.9% vs. 48.2%, p = 0.82. Conclusions PSA and PSAP are useful markers to distinguish primary breast carcinoma from prostate carcinoma metastatic to the male breast. Although PSA expression appeared to correlate with hormone receptor expression, the incidence of PSA expression in our population was too low to draw significant conclusions about an association between PSA expression and hormone receptor status in breast lesions.

  19. Determination of Listeria monocytogenes Growth during Mushroom Production and Distribution

    Directory of Open Access Journals (Sweden)

    Dara Leong

    2013-11-01

    Full Text Available In the EU, food is considered safe with regard to Listeria monocytogenes if its numbers do not exceed 100 CFU/g throughout the shelf-life of the food. Therefore, it is important to determine if a food supports growth of L. monocytogenes. Challenge studies to determine the ability of a food to support growth of L. monocytogenes are essential as predictive modelling often overestimates the growth ability of L. monocytogenes. The aim of this study was to determine if growth of L. monocytogenes was supported during the production and distribution of mushrooms. A three-strain mixture of L. monocytogenes was inoculated onto three independent batches of whole mushrooms, sliced mushrooms, mushroom casing and mushroom substrate at a concentration of about 100–1000 CFU/g. The batches were incubated at potential abuse temperatures, as a worst case scenario, and at intervals during storage L. monocytogenes numbers, % moisture and pH were determined. The results showed that the sliced and whole mushrooms had the ability to support growth, while mushroom casing allowed survival but did not support growth. Mushroom substrate showed a rich background microflora that grew on Listeria selective media and this hindered enumeration of L. monocytogenes. In the case of this study, Combase predictions were not always accurate, indicating that challenge studies may be a necessary part of growth determination of L. monocytogenes.

  20. Regulatory elements controlling pituitary-specific expression of the human prolactin gene.

    Science.gov (United States)

    Peers, B; Voz, M L; Monget, P; Mathy-Hartert, M; Berwaer, M; Belayew, A; Martial, J A

    1990-09-01

    We have performed transfection and DNase I footprinting experiments to investigate pituitary-specific expression of the human prolactin (hPRL) gene. When fused to the chloramphenicol acetyltransferase (CAT) reporter gene, 5,000 base pairs of the 5'-flanking sequences of the hPRL gene were able to drive high cat gene expression in prolactin-expressing GH3B6 cells specifically. Deletion analysis indicated that this pituitary-specific expression was controlled by three main positive regulatory regions. The first was located just upstream from the TATA box between coordinates -40 and -250 (proximal region). We have previously shown that three motifs of this region bind the pituitary-specific Pit-1 factor. The second positive region was located in the vicinity of coordinates -1300 to -1750 (distal region). DNase I footprinting assays revealed that eight DNA motifs of this distal region bound protein Pit-1 and that two other motifs were recognized by ubiquitous factors, one of which seems to belong to the AP-1 (jun) family. The third positive region was located further upstream, between -3500 and -5000 (superdistal region). This region appears to enhance transcription only in the presence of the distal region.

  1. Expression of liver-specific functions in rat hepatocytes following sublethal and lethal acetaminophen poisoning

    DEFF Research Database (Denmark)

    Tygstrup, N; Jensen, S A; Krog, B

    1996-01-01

    AIM: In order to study the short-term effect of moderate and severe reduction of liver function by acetaminophen poisoning of different severity on gene expression for liver-specific functions, rats were given 3.75 and 7.5 g per kg body weight acetaminophen intragastrically. The lower dose...

  2. Gene recovery microdissection (GRM) a process for producing chromosome region-specific libraries of expressed genes

    Energy Technology Data Exchange (ETDEWEB)

    Christian, A T; Coleman, M A; Tucker, J D

    2001-02-08

    Gene Recovery Microdissection (GRM) is a unique and cost-effective process for producing chromosome region-specific libraries of expressed genes. It accelerates the pace, reduces the cost, and extends the capabilities of functional genomic research, the means by which scientists will put to life-saving, life-enhancing use their knowledge of any plant or animal genome.

  3. Tissue-specific Regulation of Porcine Prolactin Receptor Expression by Estrogen, Progesterone and Prolactin

    Science.gov (United States)

    Prolactin (PRL) acts through its receptor (PRLR) via both endocrine and local paracrine/autocrine pathways to regulate biological processes including reproduction and lactation. We analyzed the tissue and stage of gestation-specific regulation of PRL and PRLR expression in various tissues of pigs. ...

  4. Sex-specific gonadal and gene expression changes throughout development in fathead minnow

    Science.gov (United States)

    Although fathead minnows (Pimephales promelas) are commonly used as a model fish in endocrine disruption studies, none have characterized sex-specific baseline expression of genes involved in sex differentiation during development in this species. Using a sex-linked DNA marker t...

  5. Tissue-specific alternative splicing and expression of ATP1B2 gene ...

    African Journals Online (AJOL)

    Tissue-specific alternative splicing and expression of ATP1B2 gene. ... It also balances metabolism and body temperature. ... In the study, ATP1B2-AS2 showed that many of the amino acid residues were in an unfavorable energy environment.

  6. Variation of prostate-specific antigen expression in different tumour growth patterns present in prostatectomy specimens

    NARCIS (Netherlands)

    M.P.W. Gallee; E. Visser-de Jong (E.); J.A.G.M. van der Korput (J. A G M); Th.H. van der Kwast (Theo); F.J.W. ten Kate (Fiebo); F.H. Schröder (Fritz); J. Trapman (Jan)

    1990-01-01

    textabstractA series of 55 randomly chosen radical prostatectomy specimens was analyzed for expression of prostate-specific antigen (PSA) by immunohistochemical techniques. Tissue sections were selected in such a manner that in addition to glandular benign prostatic hyperplasia (BPH), one or more di

  7. Human uroporphyrinogen-III synthase: genomic organization, alternative promoters, and erythroid-specific expression.

    Science.gov (United States)

    Aizencang, G; Solis, C; Bishop, D F; Warner, C; Desnick, R J

    2000-12-01

    Uroporphyrinogen-III (URO) synthase is the heme biosynthetic enzyme defective in congenital erythropoietic porphyria. The approximately 34-kb human URO-synthase gene (UROS) was isolated, and its organization and tissue-specific expression were determined. The gene had two promoters that generated housekeeping and erythroid-specific transcripts with unique 5'-untranslated sequences (exons 1 and 2A) followed by nine common coding exons (2B to 10). Expression arrays revealed that the housekeeping transcript was present in all tissues, while the erythroid transcript was only in erythropoietic tissues. The housekeeping promoter lacked TATA and SP1 sites, consistent with the observed low level expression in most cells, whereas the erythroid promoter contained GATA1 and NF-E2 sites for erythroid specificity. Luciferase reporter assays demonstrated that the housekeeping promoter was active in both erythroid K562 and HeLa cells, while the erythroid promoter was active only in erythroid cells and its activity was increased during hemin-induced erythroid differentiation. Thus, human URO-synthase expression is regulated during erythropoiesis by an erythroid-specific alternative promoter.

  8. Regulation of endothelial-specific transgene expression by the LacI repressor protein in vivo.

    Directory of Open Access Journals (Sweden)

    Susan K Morton

    Full Text Available Genetically modified mice have played an important part in elucidating gene function in vivo. However, conclusions from transgenic studies may be compromised by complications arising from the site of transgene integration into the genome and, in inducible systems, the non-innocuous nature of inducer molecules. The aim of the present study was to use the vascular system to validate a technique based on the bacterial lac operon system, in which transgene expression can be repressed and de-repressed by an innocuous lactose analogue, IPTG. We have modified an endothelium specific promoter (TIE2 with synthetic LacO sequences and made transgenic mouse lines with this modified promoter driving expression of mutant forms of connexin40 and an independently translated reporter, EGFP. We show that tissue specificity of this modified promoter is retained in the vasculature of transgenic mice in spite of the presence of LacO sequences, and that transgene expression is uniform throughout the endothelium of a range of adult systemic and cerebral arteries and arterioles. Moreover, transgene expression can be consistently down-regulated by crossing the transgenic mice with mice expressing an inhibitor protein LacI(R, and in one transgenic line, transgene expression could be de-repressed rapidly by the innocuous inducer, IPTG. We conclude that the modified bacterial lac operon system can be used successfully to validate transgenic phenotypes through a simple breeding schedule with mice homozygous for the LacI(R protein.

  9. Heart-specific expression of FGF-16 and a potential role in postnatal cardioprotection.

    Science.gov (United States)

    Wang, Jie; Sontag, David; Cattini, Peter A

    2015-02-01

    Fibroblast growth factor 16 (FGF-16) was originally cloned from rat heart. Subsequent investigation of mouse FGF-16, including generation of null mice, revealed a specific pattern of expression in the endocardium and epicardium, and role for FGF-16 during embryonic heart development. FGF-16 is expressed mainly in brown adipose tissue during rat embryonic development, but is expressed mainly in the murine heart after birth. There is also an apparent switch from limited endocardial and epicardial expression in the embryo to the myocardium in the perinatal period. The FGF-16 gene and its location on the X chromosome are conserved between human and murine species, and no other member of the FGF family shows this pattern of spatial and temporal expression. The human and murine FGF-16 gene promoter regions also share an equivalent location for TATA sequences, as well as adjacent putative binding sites for transcription factors linked to cardiac expression and response to stress. Recent evidence has implicated nonsense mutation of FGF-16 with increased cardiovascular risk, and FGF-16 supplementation with cardioprotection. Here we review the important role of FGF-16 in embryonic heart development, its gene regulation, and evidence for FGF-16 as an endogenous and exogenous cardiac-specific and protective factor in the postnatal heart. Moreover, given the conservation of the FGF-16 gene and its chromosomal location between species, the question of support for a cardiac role in the human population is also considered.

  10. Gene expression profiles of hepatic cell-type specific marker genes in progression of liver fibrosis

    Institute of Scientific and Technical Information of China (English)

    Yoshiyuki Takahara; Mitsuo Takahashi; Hiroki Wagatsuma; Fumihiko Yokoya; Qing-Wei Zhang; Mutsuyo Yamaguchi; Hiroyuki Aburatani; Norifumi Kawada

    2006-01-01

    AIM: To determine the gene expression profile data for the whole liver during development of dimethylnitrosamine (DMN)-induced hepatic fibrosis.METHODS: Marker genes were identified for different types of hepatic cells, including hepatic stellate cells (HSCs), Kupffer cells (including other inflammatory cells),and hepatocytes, using independent temporal DNA microarray data obtained from isolated hepatic cells.RESULTS: The cell-type analysis of gene expression gave several key results and led to formation of three hypotheses: (1) changes in the expression of HSCspecific marker genes during fibrosis were similar to gene expression data in in vitro cultured HSCs, suggesting a major role of the self-activating characteristics of HSCs in formation of fibrosis; (2) expression of mast cell-specific marker genes reached a peak during liver fibrosis,suggesting a possible role of mast cells in formation of fibrosis; and (3) abnormal expression of hepatocytespecific marker genes was found across several metabolic pathways during fibrosis, including sulfur-containing amino acid metabolism, fatty acid metabolism, and drug metabolism, suggesting a mechanistic relationship between these abnormalities and symptoms of liver fibrosis.CONCLUSION: Analysis of marker genes for specific hepatic cell types can identify the key aspects of fibrogenesis. Sequential activation of inflammatory cells and the self-supporting properties of HSCs play an important role in development of fibrosis.

  11. Expression of Pigment Cell-Specific Genes in the Ontogenesis of the Sea Urchin Strongylocentrotus intermedius

    Directory of Open Access Journals (Sweden)

    Natalya V. Ageenko

    2011-01-01

    Full Text Available One of the polyketide compounds, the naphthoquinone pigment echinochrome, is synthesized in sea urchin pigment cells. We analyzed polyketide synthase (pks and sulfotransferase (sult gene expression in embryos and larvae of the sea urchin Strongylocentrotus intermedius from various stages of development and in specific tissues of the adults. We observed the highest level of expression of the pks and sult genes at the gastrula stage. In unfertilized eggs, only trace amounts of the pks and sult transcripts were detected, whereas no transcripts of these genes were observed in spermatozoids. The addition of shikimic acid, a precursor of naphthoquinone pigments, to zygotes and embryos increased the expression of the pks and sult genes. Our findings, including the development of specific conditions to promote pigment cell differentiation of embryonic sea urchin cells in culture, represent a definitive study on the molecular signaling pathways that are involved in the biosynthesis of pigments during sea urchin development.

  12. Adaptive growth responses of Listeria monocytogenes to acid and osmotic shifts above and across the growth boundaries.

    Science.gov (United States)

    Belessi, C-I A; Le Marc, Y; Merkouri, S I; Gounadaki, A S; Schvartzman, S; Jordan, K; Drosinos, E H; Skandamis, P N

    2011-01-01

    The effect of acid and osmotic shifts on the growth of Listeria monocytogenes was evaluated at 10°C. Two types of shifts were tested: (i) within the range of pH and water activity (a(w)) levels that allow growth of L. monocytogenes and (ii) after habituation at no-growth conditions back to growth-permitting conditions. A L. monocytogenes cheese isolate, with high survival capacity during cheesemaking, was inoculated (10(2) CFU/ml) in tryptic soy broth supplemented with 0.6% yeast extract at six pH levels (5.1 to 7.2; adjusted with lactic acid) and 0.5% NaCl (a(w) 0.995), or four a(w) levels (0.995 to 0.93, adjusted with 0.5 to 10.5% NaCl) at pH 7.2 and grown to early stationary phase. L. monocytogenes was then shifted (at 10(2) CFU/ml) to each of the aforementioned growth-permitting pH and a(w) levels and incubated at 10°C. Shifts from no-growth to growth-permitting conditions were carried out by transferring L. monocytogenes habituated at pH 4.9 or a(w) 0.90 (12.5% NaCl) for 1, 5, and 10 days to all pH and a(w) levels permitting growth. Reducing a(w) or pH at different levels in the range of 0.995 to 0.93 and 7.2 to 5.1, respectively, decreased the maximum specific growth rate of L. monocytogenes. The lag time of the organism increased with all osmotic downshifts, as well as by the reduction of pH to 5.1. Conversely, any type of shift within pH 5.5 to 7.2 did not markedly affect the lag times of L. monocytogenes. The longer the cells were incubated at no-growth a(w) (0.90), the faster they initiated growth subsequently, suggesting adaptation to osmotic stress. Conversely, extended habituation at pH 4.9 had the opposite effect on subsequent growth of L. monocytogenes, possibly due to cell injury. These results suggest that there is an adaptation or injury rate induced at conditions inhibiting the growth of the pathogen. Thus, quantifying adaptation phenomena under growth-limiting environments, such as in fermented dairy and meat products or products preserved in

  13. Genes expressed in specific areas of the human fetal cerebral cortex display distinct patterns of evolution.

    Directory of Open Access Journals (Sweden)

    Nelle Lambert

    Full Text Available The developmental mechanisms through which the cerebral cortex increased in size and complexity during primate evolution are essentially unknown. To uncover genetic networks active in the developing cerebral cortex, we combined three-dimensional reconstruction of human fetal brains at midgestation and whole genome expression profiling. This novel approach enabled transcriptional characterization of neurons from accurately defined cortical regions containing presumptive Broca and Wernicke language areas, as well as surrounding associative areas. We identified hundreds of genes displaying differential expression between the two regions, but no significant difference in gene expression between left and right hemispheres. Validation by qRTPCR and in situ hybridization confirmed the robustness of our approach and revealed novel patterns of area- and layer-specific expression throughout the developing cortex. Genes differentially expressed between cortical areas were significantly associated with fast-evolving non-coding sequences harboring human-specific substitutions that could lead to divergence in their repertoires of transcription factor binding sites. Strikingly, while some of these sequences were accelerated in the human lineage only, many others were accelerated in chimpanzee and/or mouse lineages, indicating that genes important for cortical development may be particularly prone to changes in transcriptional regulation across mammals. Genes differentially expressed between cortical regions were also enriched for transcriptional targets of FoxP2, a key gene for the acquisition of language abilities in humans. Our findings point to a subset of genes with a unique combination of cortical areal expression and evolutionary patterns, suggesting that they play important roles in the transcriptional network underlying human-specific neural traits.

  14. The expression of pregnancy-specific {beta}1-glycoprotein genes in Meckel-Gruber syndrome fibroblasts

    Energy Technology Data Exchange (ETDEWEB)

    Wu, Shao-Ming; Cham, Wai-Yee [Georgetown Univ. Medical Center, Washington, DC (United States)

    1994-09-01

    Meckel-Gruber syndrome (MS) is an autosomal recessive disorder with multiple congenital malformations. The only available prenatal diagnostic marker for this disorder is the amniotic fluid level of pregnancy-specific {beta}1-glycoprotein (PSG). PSG is a family of proteins which are expressed at high levels during pregnancy. Increasing maternal serum PSG levels correlate with the progression of pregnancy and can be used as indicators for pregnancy outcome and fetal well-being. The amniotic fluid PSG level is about one-tenth of that of the maternal serum level in normal pregnancy, but are elevated in all cases of MS examined so far. On the other hand, the maternal serum PSG level and third trimester placental PSG content are normal in most cases of MS. This study aims at comparing the expression of PSG in fibroblasts derived from a fetus afflicted with MS. Total cellular RNA was extracted from two MS cultured fibroblast lines (M3206 and GM7817) and four age- and sex-matched control fibroblast lines obtained from the Human Genetic Mutant Cell Repository, Camden, NJ. The expression of eight PSG genes namely, PSG1, PSG2, PSG3, PSG4, PSG5, PSG6, PSG9 and PSG11, were examined with reverse transcription-polymerase chain reaction (RT-PCR). All PSG transcripts present in the cell were first amplified using universal primers in a 28-cycle PCR. Specific PSG gene products were then amplified with PSG gene-specific primers. Results showed that there is no significant difference in PSG expression between control and disease fibroblasts. In both cases, the most abundant transcript was the type II transcript of PSG5 followed by the type I transcripts of PSG1 and PG4. PSG9, PSG11 and PSG 3 were expressed at very low levels or not expressed at all in MS as well as in normal control fibroblasts. These results showed that PSG gene expression was not altered in MS fibroblasts.

  15. Key metalloproteinases are expressed by specific cell types in experimental autoimmune encephalomyelitis

    DEFF Research Database (Denmark)

    Toft-Hansen, Henrik; Nuttall, Robert K; Edwards, Dylan R

    2004-01-01

    animal model, experimental autoimmune encephalomyelitis (EAE). We used real-time RT-PCR to profile the expression of all 22 known mouse MMPs, seven ADAMs, and all four known TIMPs in spinal cord from SJL/J mice and mice with adoptively transferred myelin basic protein (MBP)-specific EAE. A significant...... cellular sources of these strongly affected proteins in the inflamed CNS, we isolated macrophages, granulocytes, microglia, and T cells by cell sorting from the CNS of mice with EAE and analyzed their expression by real-time RT-PCR. This identified macrophages as a major source of MMP-12 and TIMP-1....... Granulocytes were a major source of MMP-8. ADAM-12 was expressed primarily by T cells. Cellular localization of MMP-10, TIMP-1, and ADAM-12 in perivascular infiltrates was confirmed by immunostaining or in situ hybridization. Microglia from control mice expressed strong signal for MMP-15. Strikingly...

  16. Expression in Arabidopsis of a nucellus-specific promoter from watermelon (Citrullus lanatus).

    Science.gov (United States)

    Dwivedi, Krishna K; Roche, Dominique; Carman, John G

    2010-11-01

    Though many tissue-specific promoters have been identified, few have been associated specifically with the angiospermous megasporangium (nucellus). In the present study the 2000-bp regulatory region upstream to the watermelon, Citrullus lanatus (Thunb.) Matsum & Nakai, gene WM403 (GenBank accession no. AF008925), which shows nucellus-specific expression, was cloned from watermelon gDNA and fused to the β-glucuronidase reporter gene (GUS). The resulting plasmid, WM403 Prom::GUS(+), which also contained NPTII, was transformed into Arabidopsis thaliana ecotype Co1-0. Seedlings were selected on kanamycin-containing medium, and transformants were confirmed by PCR. GUS assays of T(3) transformants revealed weak promoter activation in epidermal layers of the placenta and locule septum during premeiotic ovule development but strong activation in the nucellus, embryo sac and early embryo, from early embryo sac formation to early globular embryo formation. Expression in seeds was absent thereafter. These results indicate that the WM403 promoter may be useful in driving nucellus-specific gene expression in plants including candidate genes for important nucellus-specific traits such as apospory or adventitious embryony. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.

  17. Silk gene expression of theridiid spiders: implications for male-specific silk use.

    Science.gov (United States)

    Correa-Garhwal, Sandra M; Chaw, R Crystal; Clarke, Thomas H; Ayoub, Nadia A; Hayashi, Cheryl Y

    2017-06-01

    Spiders (order Araneae) rely on their silks for essential tasks, such as dispersal, prey capture, and reproduction. Spider silks are largely composed of spidroins, members of a protein family that are synthesized in silk glands. As needed, silk stored in silk glands is extruded through spigots on the spinnerets. Nearly all studies of spider silks have been conducted on females; thus, little is known about male silk biology. To shed light on silk use by males, we compared silk gene expression profiles of mature males to those of females from three cob-web weaving species (Theridiidae). We de novo assembled species-specific male transcriptomes from Latrodectus hesperus, Latrodectus geometricus, and Steatoda grossa followed by differential gene expression analyses. Consistent with their complement of silk spigots, male theridiid spiders express appreciable amounts of aciniform, major ampullate, minor ampullate, and pyriform spidroin genes but not tubuliform spidroin genes. The relative expression levels of particular spidroin genes varied between sexes and species. Because mature males desert their prey-capture webs and become cursorial in their search for mates, we anticipated that major ampullate (dragline) spidroin genes would be the silk genes most highly expressed by males. Indeed, major ampullate spidroin genes had the highest expression in S. grossa males. However, minor ampullate spidroin genes were the most highly expressed spidroin genes in L. geometricus and L. hesperus males. Our expression profiling results suggest species-specific adaptive divergence of silk use by male theridiids. Copyright © 2017 The Authors. Published by Elsevier GmbH.. All rights reserved.

  18. High-level resistance to class IIa bacteriocins is associated with one general mechanism in Listeria monocytogenes.

    Science.gov (United States)

    Gravesen, Anne; Ramnath, Manilduth; Rechinger, K Björn; Andersen, Natalie; Jänsch, Lothar; Héchard, Yann; Hastings, John W; Knøchel, Susanne

    2002-08-01

    Class IIa bacteriocins may be used as natural food preservatives, yet resistance development in the target organisms is still poorly understood. In this study, the understanding of class IIa resistance development in Listeria monocytogenes is extended, linking the seemingly diverging results previously reported. Eight resistant mutants having a high resistance level (at least a 10(3)-fold increase in MIC), originating from five wild-type listerial strains, were independently isolated following exposure to four different class IIa bacteriocin-producing lactic acid bacteria (including pediocin PA-1 and leucocin A producers). Two of the mutants were isolated from food model systems (a saveloy-type sausage at 10 degrees C, and salmon juice at 5 degrees C). Northern blot analysis showed that the eight mutants all had increased expression of EII(Bgl) and a phospho-beta-glucosidase homologue, both originating from putative beta-glucoside-specific phosphoenolpyruvate-dependent phosphotransferase systems (PTSs). However, disruption of these genes in a resistant mutant did not confer pediocin sensitivity. Comparative two-dimensional gel analysis of proteins isolated from mutant and wild-type strains showed that one spot was consistently missing in the gels from mutant strains. This spot corresponded to the MptA subunit of the mannose-specific PTS, found only in the gels of wild-type strains. The mptACD operon was recently shown to be regulated by the sigma(54) transcription factor in conjunction with the activator ManR. Class IIa bacteriocin-resistant mutants having defined mutations in mpt or manR also exhibited the two diverging PTS expression changes. It is suggested here that high-level class IIa resistance in L. monocytogenes and at least some other Gram-positive bacteria is developed by one prevalent mechanism, irrespective of wild-type strain, class IIa bacteriocin, or the tested environmental conditions. The changes in expression of the beta-glucoside-specific and

  19. Different expression and subcellular localization of Phosphoinositide-specific Phospholipase C enzymes in differently polarized macrophages.

    Science.gov (United States)

    Di Raimo, Tania; Leopizzi, Martina; Mangino, Giorgio; Rocca, Carlo Della; Businaro, Rita; Longo, Lucia; Lo Vasco, Vincenza Rita

    2016-12-01

    Macrophages' phenotypic and functional diversity depends on differentiating programs related to local environmental factors. Recent interest was deserved to the signal transduction pathways acting in macrophage polarization, including the phosphoinositide (PI) system and related phospholipase C (PLC) family of enzymes. The expression panel of PLCs and the subcellular localization differs in quiescent cells compared to the pathological counterpart. We analyzed the expression of PLC enzymes in unpolarized (M0), as well as in M1 and M2 macrophages to list the expressed isoforms and their subcellular localization. Furthermore, we investigated whether inflammatory stimulation modified the basal panel of PLCs' expression and subcellular localization. All PLC enzymes were detected within both M1 and M2 cells, but not in M0 cells. M0, as well as M1 and M2 cells own a specific panel of expression, different for both genes' mRNA expression and intracellular localization of PLC enzymes. The panel of PLC genes' expression and PLC proteins' presence slightly changes after inflammatory stimulation. PLC enzymes might play a complex role in macrophages during inflammation and probably also during polarization.

  20. Colovesical fistula presenting as Listeria monocytogenes bacteraemia.

    Science.gov (United States)

    Hobbs, Mark

    2015-03-31

    We present a case of colovesical fistula presenting with a clinical syndrome of urosepsis subsequently demonstrated to be due to Listeria monocytogenes bacteraemia. The patient had a history of previous rectal cancer with a low anterior resection and a covering ileostomy that had been reversed 6 months prior to this presentation. L. monocytogenes was also isolated among mixed enteric organisms on urine culture. There were no symptoms or signs of acute gastrointestinal listeriosis or meningoencephalitis. This unusual scenario prompted concern regarding the possibility of communication between bowel and bladder, which was subsequently confirmed with CT and a contrast enema. The patient recovered well with intravenous amoxicillin and to date has declined surgical management of his colovesical fistula. This case illustrates the importance of considering bowel pathology when enteric organisms such as Listeria are isolated from unusual sites.

  1. Listeria monocytogenes virulence factor Listeriolysin O favors bacterial growth in co-culture with the ciliate Tetrahymena pyriformis, causes protozoan encystment and promotes bacterial survival inside cysts

    Directory of Open Access Journals (Sweden)

    Ermolaeva Svetlana A

    2010-01-01

    Full Text Available Abstract Background The gram-positive pathogenic bacterium Listeria monocytogenes is widely spread in the nature. L. monocytogenes was reported to be isolated from soil, water, sewage and sludge. Listeriolysin O (LLO is a L. monocytogenes major virulence factor. In the course of infection in mammals, LLO is required for intracellular survival and apoptosis induction in lymphocytes. In this study, we explored the potential of LLO to promote interactions between L. monocytogenes and the ubiquitous inhabitant of natural ecosystems bacteriovorous free-living ciliate Tetrahymena pyriformis. Results Wild type L. monocytogenes reduced T. pyriformis trophozoite counts and stimulated encystment. The effects were observed starting from 48 h of co-incubation. On the day 14, trophozoites were eliminated from the co-culture while about 5 × 104 cells/ml remained in the axenic T. pyriformis culture. The deficient in the LLO-encoding hly gene L. monocytogenes strain failed to cause mortality among protozoa and to trigger protozoan encystment. Replenishment of the hly gene in the mutant strain restored toxicity towards protozoa and induction of protozoan encystment. The saprophytic non-haemolytic species L. innocua transformed with the LLO-expressing plasmid caused extensive mortality and encystment in ciliates. During the first week of co-incubation, LLO-producing L. monocytogenes demonstrated higher growth rates in association with T. pyriformis than the LLO-deficient isogenic strain. At latter stages of co-incubation bacterial counts were similar for both strains. T. pyriformis cysts infected with wild type L. monocytogenes caused listerial infection in guinea pigs upon ocular and oral inoculation. The infection was proved by bacterial plating from the internal organs. Conclusions The L. monocytogenes virulence factor LLO promotes bacterial survival and growth in the presence of bacteriovorous ciliate T. pyriformis. LLO is responsible for L. monocytogenes

  2. Noninvasive monitoring of placenta-specific transgene expression by bioluminescence imaging.

    Directory of Open Access Journals (Sweden)

    Xiujun Fan

    Full Text Available BACKGROUND: Placental dysfunction underlies numerous complications of pregnancy. A major obstacle to understanding the roles of potential mediators of placental pathology has been the absence of suitable methods for tissue-specific gene manipulation and sensitive assays for studying gene functions in the placentas of intact animals. We describe a sensitive and noninvasive method of repetitively tracking placenta-specific gene expression throughout pregnancy using lentivirus-mediated transduction of optical reporter genes in mouse blastocysts. METHODOLOGY/PRINCIPAL FINDINGS: Zona-free blastocysts were incubated with lentivirus expressing firefly luciferase (Fluc and Tomato fluorescent fusion protein for trophectoderm-specific infection and transplanted into day 3 pseudopregnant recipients (GD3. Animals were examined for Fluc expression by live bioluminescence imaging (BLI at different points during pregnancy, and the placentas were examined for tomato expression in different cell types on GD18. In another set of experiments, blastocysts with maximum photon fluxes in the range of 2.0E+4 to 6.0E+4 p/s/cm(2/sr were transferred. Fluc expression was detectable in all surrogate dams by day 5 of pregnancy by live imaging, and the signal increased dramatically thereafter each day until GD12, reaching a peak at GD16 and maintaining that level through GD18. All of the placentas, but none of the fetuses, analyzed on GD18 by BLI showed different degrees of Fluc expression. However, only placentas of dams transferred with selected blastocysts showed uniform photon distribution with no significant variability of photon intensity among placentas of the same litter. Tomato expression in the placentas was limited to only trophoblast cell lineages. CONCLUSIONS/SIGNIFICANCE: These results, for the first time, demonstrate the feasibility of selecting lentivirally-transduced blastocysts for uniform gene expression in all placentas of the same litter and early

  3. Quantification of allele-specific expression of a gene encoding strawberry polygalacturonase-inhibiting protein (PGIP) using Pyrosequencing((TM))

    NARCIS (Netherlands)

    Schaart, J.G.; Mehli, L.; Schouten, H.J.

    2005-01-01

    Recent studies indicate that allele-specific differences in gene expression are a common phenomenon. The extent to which differential allelic expression exists might be underestimated, due to the limited accuracy of the methods used so far. To demonstrate allele-specific expression, we investigated

  4. TOPAZ1, a novel germ cell-specific expressed gene conserved during evolution across vertebrates.

    Directory of Open Access Journals (Sweden)

    Adrienne Baillet

    Full Text Available BACKGROUND: We had previously reported that the Suppression Subtractive Hybridization (SSH approach was relevant for the isolation of new mammalian genes involved in oogenesis and early follicle development. Some of these transcripts might be potential new oocyte and granulosa cell markers. We have now characterized one of them, named TOPAZ1 for the Testis and Ovary-specific PAZ domain gene. PRINCIPAL FINDINGS: Sheep and mouse TOPAZ1 mRNA have 4,803 bp and 4,962 bp open reading frames (20 exons, respectively, and encode putative TOPAZ1 proteins containing 1,600 and 1653 amino acids. They possess PAZ and CCCH domains. In sheep, TOPAZ1 mRNA is preferentially expressed in females during fetal life with a peak during prophase I of meiosis, and in males during adulthood. In the mouse, Topaz1 is a germ cell-specific gene. TOPAZ1 protein is highly conserved in vertebrates and specifically expressed in mouse and sheep gonads. It is localized in the cytoplasm of germ cells from the sheep fetal ovary and mouse adult testis. CONCLUSIONS: We have identified a novel PAZ-domain protein that is abundantly expressed in the gonads during germ cell meiosis. The expression pattern of TOPAZ1, and its high degree of conservation, suggests that it may play an important role in germ cell development. Further characterization of TOPAZ1 may elucidate the mechanisms involved in gametogenesis, and particularly in the RNA silencing process in the germ line.

  5. Specific expression of a β-tubulin gene (GhTub1) in developing cotton fibers

    Institute of Scientific and Technical Information of China (English)

    LI; Yuanli; (李园莉); SUN; Jie; (孙杰); LI; Chunhong; (李春红); ZHU; Yongqing; (朱勇清); XIA; Guixian; (夏桂先)

    2003-01-01

    A cDNA library was constructed using poly (A)+ RNA isolated from -1-15 DPA fibers of upland cotton (Gossypium hirsutum). The cDNA encoding a β-tubulin isoform (designated as GhTub1) was identified through EST search. Northern blot analysis using 3′-UTR of the cDNA as a gene-specific probe was performed to investigate the expression levels of GhTub1 in various organs and in the developing fibers. The results showed that GhTub1 gene was specifically expressed in cotton fiber cells. During fiber development, GhTub1 transcripts accumulated highlyat the stage of cell rapid elongation with the highest expression appearing at the time when fiber expansion reaches the peak rate. To probe the in vivo function of GhTub1, its cDNA was cloned in the yeast expression vector pREP1 and transformed into the fission yeast Schizosaccharomyces pombe. Overexpression of GhTub1 in yeast cells caused severe changes in the cell morphology. These results suggest that GhTub1 may play a role in the polar elongation of cotton fibers. To our knowledge, this is the first report on the fiber-specific transcript accumulation of a cotton β-tubulin gene.

  6. Targeted expression of Cre recombinase provokes placental-specific DNA recombination in transgenic mice.

    Directory of Open Access Journals (Sweden)

    Cissy Chenyi Zhou

    Full Text Available BACKGROUND: Inadequate placental development is associated with a high incidence of early embryonic lethality and serious pregnancy disorders in both humans and mice. However, the lack of well-defined trophoblast-specific gene regulatory elements has hampered investigations regarding the role of specific genes in placental development and fetal growth. PRINCIPAL FINDINGS: By random assembly of placental enhancers from two previously characterized genes, trophoblast specific protein α (Tpbpa and adenosine deaminase (Ada, we identified a chimeric Tpbpa/Ada enhancer that when combined with the basal Ada promoter provided the highest luciferase activity in cultured human trophoblast cells, in comparison with non-trophoblast cell lines. We used this chimeric enhancer arrangement to drive the expression of a Cre recombinase transgene in the placentas of transgenic mice. Cre transgene expression occurred throughout the placenta but not in maternal organs examined or in the fetus. SIGNIFICANCE: In conclusion, we have provided both in vitro and in vivo evidence for a novel genetic system to achieve placental transgene expression by the use of a chimeric Tpbpa/Ada enhancer driven transgene. The availability of this expression vector provides transgenic opportunities to direct the production of desired proteins to the placenta.

  7. From Specificity to Sensitivity: Affective states modulate visual working memory for emotional expressive faces

    Directory of Open Access Journals (Sweden)

    Thomas eMaran

    2015-08-01

    Full Text Available Previous findings suggest that visual working memory preferentially remembers angry looking faces. However, the meaning of facial actions is construed in relation to context. To date, there are no studies investigating the role of perceiver-based context when processing emotional cues in visual working memory. To explore the influence of affective context on visual working memory for faces, we conducted two experiments using both a visual working memory task for emotionally expressive faces and a mood induction procedure. Affective context was manipulated by unpleasant (Experiment 1 and pleasant (Experiment 2 IAPS pictures in order to induce an affect high in motivational intensity (defensive or appetitive, respectively compared to a low arousal control condition. Results indicated specifically increased sensitivity of visual working memory for angry looking faces in the neutral condition. Enhanced visual working memory for angry faces was prevented by inducing affects of high motivational intensity. In both experiments, affective states led to a switch from specific enhancement of angry expressions in visual working memory to an equally sensitive representation of all emotional expressions. Our findings demonstrate that emotional expressions are of different behavioral relevance for the receiver depending on the affective context, supporting a functional organization of visual working memory along with flexible resource allocation. In visual working memory, stimulus processing adjusts to situational requirements and transitions from a specifically prioritizing default mode in predictable environments to a sensitive, hypervigilant mode in exposure to emotional events.

  8. Immune signatures and disorder-specific patterns in a cross-disorder gene expression analysis

    Science.gov (United States)

    de Jong, Simone; Newhouse, Stephen J.; Patel, Hamel; Lee, Sanghyuck; Dempster, David; Curtis, Charles; Paya-Cano, Jose; Murphy, Declan; Wilson, C. Ellie; Horder, Jamie; Mendez, M. Andreina; Asherson, Philip; Rivera, Margarita; Costello, Helen; Maltezos, Stefanos; Whitwell, Susannah; Pitts, Mark; Tye, Charlotte; Ashwood, Karen L.; Bolton, Patrick; Curran, Sarah; McGuffin, Peter; Dobson, Richard; Breen, Gerome

    2016-01-01

    Background Recent studies point to overlap between neuropsychiatric disorders in symptomatology and genetic aetiology. Aims To systematically investigate genomics overlap between childhood and adult attention-deficit hyperactivity disorder (ADHD), autism spectrum disorder (ASD) and major depressive disorder (MDD). Method Analysis of whole-genome blood gene expression and genetic risk scores of 318 individuals. Participants included individuals affected with adult ADHD (n = 93), childhood ADHD (n = 17), MDD (n = 63), ASD (n = 51), childhood dual diagnosis of ADHD–ASD (n = 16) and healthy controls (n = 78). Results Weighted gene co-expression analysis results reveal disorder-specific signatures for childhood ADHD and MDD, and also highlight two immune-related gene co-expression modules correlating inversely with MDD and adult ADHD disease status. We find no significant relationship between polygenic risk scores and gene expression signatures. Conclusions Our results reveal disorder overlap and specificity at the genetic and gene expression level. They suggest new pathways contributing to distinct pathophysiology in psychiatric disorders and shed light on potential shared genomic risk factors. PMID:27151072

  9. Screening the stage-specific expression gene from different germ cells of rat

    Institute of Scientific and Technical Information of China (English)

    贾孟春; 娄利霞; 裴开颜; 赵龙梅; 石心泉

    2002-01-01

    Objective: To screen the stage-specific expression genes from rat spermatogonia, pachytene spermatocytes and round spermatids. Methods: Highly purified spermatogonia were isolated from 9-day-old rats, pachytene spermatocytes and round spermatids from adult rats by sedimentation velocity at unit gravity, using 2%-4% BSA gradient in DMEM/F12 medium. A mRNA differential display method was used for screening the stage-specific expression gene. Results: Nineteen differentially expressed cDNA fragments were obtained. After excluding the false positive cDNA fragments by dot blot, 13 cDNAs were selected to clone and sequence. To obtain longer cDNAs, six ESTs were used to screen the rat testis λ-zap II cDNA library. Two longer cDNA fragments, designated as LY21 and LM66, were obtained. The analysis with DNAMAN software indicated that LY21 had a long open reading frame coding 372 amino acids while LM66 had no long open reading frame. LY21 were highly homologous with hnRNP H1. To observe the expression patterns of LY21 gene in the testicular cells, we performed in situ hybridization on testis sections from adult rats. The LY21 gene expression was found in the spermatogonia and primary spermatocytes.Conclusion: This study indicated that LY21 gene was associated with spermatogenesis. Further studies will be needed to explore the function of LY21.

  10. Functional annotation of novel lineage-specific genes using co-expression and promoter analysis

    Directory of Open Access Journals (Sweden)

    Loor Juan J

    2010-03-01

    Full Text Available Abstract Background The diversity of placental architectures within and among mammalian orders is believed to be the result of adaptive evolution. Although, the genetic basis for these differences is unknown, some may arise from rapidly diverging and lineage-specific genes. Previously, we identified 91 novel lineage-specific transcripts (LSTs from a cow term-placenta cDNA library, which are excellent candidates for adaptive placental functions acquired by the ruminant lineage. The aim of the present study was to infer functions of previously uncharacterized lineage-specific genes (LSGs using co-expression, promoter, pathway and network analysis. Results Clusters of co-expressed genes preferentially expressed in liver, placenta and thymus were found using 49 previously uncharacterized LSTs as seeds. Over-represented composite transcription factor binding sites (TFBS in promoters of clustered LSGs and known genes were then identified computationally. Functions were inferred for nine previously uncharacterized LSGs using co-expression analysis and pathway analysis tools. Our results predict that these LSGs may function in cell signaling, glycerophospholipid/fatty acid metabolism, protein trafficking, regulatory processes in the nucleus, and processes that initiate parturition and immune system development. Conclusions The placenta is a rich source of lineage-specific genes that function in the adaptive evolution of placental architecture and functions. We have shown that co-expression, promoter, and gene network analyses are useful methods to infer functions of LSGs with heretofore unknown functions. Our results indicate that many LSGs are involved in cellular recognition and developmental processes. Furthermore, they provide guidance for experimental approaches to validate the functions of LSGs and to study their evolution.

  11. Functional annotation of novel lineage-specific genes using co-expression and promoter analysis.

    Science.gov (United States)

    Kumar, Charu G; Everts, Robin E; Loor, Juan J; Lewin, Harris A

    2010-03-09

    The diversity of placental architectures within and among mammalian orders is believed to be the result of adaptive evolution. Although, the genetic basis for these differences is unknown, some may arise from rapidly diverging and lineage-specific genes. Previously, we identified 91 novel lineage-specific transcripts (LSTs) from a cow term-placenta cDNA library, which are excellent candidates for adaptive placental functions acquired by the ruminant lineage. The aim of the present study was to infer functions of previously uncharacterized lineage-specific genes (LSGs) using co-expression, promoter, pathway and network analysis. Clusters of co-expressed genes preferentially expressed in liver, placenta and thymus were found using 49 previously uncharacterized LSTs as seeds. Over-represented composite transcription factor binding sites (TFBS) in promoters of clustered LSGs and known genes were then identified computationally. Functions were inferred for nine previously uncharacterized LSGs using co-expression analysis and pathway analysis tools. Our results predict that these LSGs may function in cell signaling, glycerophospholipid/fatty acid metabolism, protein trafficking, regulatory processes in the nucleus, and processes that initiate parturition and immune system development. The placenta is a rich source of lineage-specific genes that function in the adaptive evolution of placental architecture and functions. We have shown that co-expression, promoter, and gene network analyses are useful methods to infer functions of LSGs with heretofore unknown functions. Our results indicate that many LSGs are involved in cellular recognition and developmental processes. Furthermore, they provide guidance for experimental approaches to validate the functions of LSGs and to study their evolution.

  12. Rapid expression of transgenes driven by seed-specific constructs in leaf tissue: DHA production

    Directory of Open Access Journals (Sweden)

    Zhou Xue-Rong

    2010-03-01

    Full Text Available Abstract Background Metabolic engineering of seed biosynthetic pathways to diversify and improve crop product quality is a highly active research area. The validation of genes driven by seed-specific promoters is time-consuming since the transformed plants must be grown to maturity before the gene function can be analysed. Results In this study we demonstrate that genes driven by seed-specific promoters contained within complex constructs can be transiently-expressed in the Nicotiana benthamiana leaf-assay system by co-infiltrating the Arabidopsis thaliana LEAFY COTYLEDON2 (LEC2 gene. A real-world case study is described in which we first assembled an efficient transgenic DHA synthesis pathway using a traditional N. benthamiana Cauliflower Mosaic Virus (CaMV 35S-driven leaf assay before using the LEC2-extended assay to rapidly validate a complex seed-specific construct containing the same genes before stable transformation in Arabidopsis. Conclusions The LEC2-extended N. benthamiana assay allows the transient activation of seed-specific promoters in leaf tissue. In this study we have used the assay as a rapid preliminary screen of a complex seed-specific transgenic construct prior to stable transformation, a feature that will become increasingly useful as genetic engineering moves from the manipulation of single genes to the engineering of complex pathways. We propose that the assay will prove useful for other applications wherein rapid expression of transgenes driven by seed-specific constructs in leaf tissue are sought.

  13. FE65 binds Teashirt, inhibiting expression of the primate-specific caspase-4.

    Directory of Open Access Journals (Sweden)

    Yuji Kajiwara

    Full Text Available The Alzheimer disease (AD amyloid protein precursor (APP can bind the FE65 adaptor protein and this complex can regulate gene expression. We carried out yeast two-hybrid studies with a PTB domain of FE65, focusing on those genes that might be involved in nuclear signaling, and identified and validated Teashirt proteins as FE65 interacting proteins in neurons. Using reporter systems, we observed that FE65 could simultaneously recruit SET, a component of the inhibitor of acetyl transferase, and Teashirt, which in turn recruited histone deacetylases, to produce a powerful gene-silencing complex. We screened stable cell lines with a macroarray focusing on AD-related genes and identified CASP4, encoding caspase-4, as a target of this silencing complex. Chromatin immunoprecipitation showed a direct interaction of FE65 and Teashirt3 with the promoter region of CASP4. Expression studies in postmortem samples demonstrated decreasing expression of Teashirt and increasing expression of caspase-4 with progressive cognitive decline. Importantly, there were significant increases in caspase-4 expression associated with even the earliest neuritic plaque changes in AD. We evaluated a case-control cohort and observed evidence for a genetic association between the Teashirt genes TSHZ1 and TSHZ3 and AD, with the TSHZ3 SNP genotype correlating with expression of Teashirt3. The results were consistent with a model in which reduced expression of Teashirt3, mediated by genetic or other causes, increases caspase-4 expression, leading to progression of AD. Thus the cell biological, gene expression and genetic data support a role for Teashirt/caspase-4 in AD biology. As caspase-4 shows evidence of being a primate-specific gene, current models of AD and other neurodegenerative conditions may be incomplete because of the absence of this gene in the murine genome.

  14. Multilineage differentiation of porcine bone marrow stromal cells associated with specific gene expression pattern

    DEFF Research Database (Denmark)

    Zou, Lijin; Zou, Xuenong; Chen, Li;

    2007-01-01

    genes along those three mesenchymal lineages during a particular lineage differentiation of porcine BMSC by means of real-time PCR measurement. In an osteogenic medium, the mRNA levels of cbfa1, osterix, alkaline phosphatase, type 1 collagen, osteonectin, bone sialoprotein, and osteocalcin were induced...... differentiation was induced in cell pellet culture by expression of sox9, type 2 collagen, and aggrecan. Cbfa1 and PPARgamma2 were inhibited in chondrogenic medium. These results indicate that the differentiation potential of BMSC to a particular mesenchymal lineage relies upon specific gene expression pattern...

  15. Multilineage differentiation of porcine bone marrow stromal cells associated with specific gene expression pattern

    DEFF Research Database (Denmark)

    Zou, Lijin; Zou, Xuenong; Chen, Li;

    2008-01-01

    genes along those three mesenchymal lineages during a particular lineage differentiation of porcine BMSC by means of real-time PCR measurement. In an osteogenic medium, the mRNA levels of cbfa1, osterix, alkaline phosphatase, type 1 collagen, osteonectin, bone sialoprotein, and osteocalcin were induced...... differentiation was induced in cell pellet culture by expression of sox9, type 2 collagen, and aggrecan. Cbfa1 and PPARγ2 were inhibited in chondrogenic medium. These results indicate that the differentiation potential of BMSC to a particular mesenchymal lineage relies upon specific gene expression pattern...

  16. Expression of genes encoding multi-transmembrane proteins in specific primate taste cell populations.

    Directory of Open Access Journals (Sweden)

    Bryan D Moyer

    Full Text Available BACKGROUND: Using fungiform (FG and circumvallate (CV taste buds isolated by laser capture microdissection and analyzed using gene arrays, we previously constructed a comprehensive database of gene expression in primates, which revealed over 2,300 taste bud-associated genes. Bioinformatics analyses identified hundreds of genes predicted to encode multi-transmembrane domain proteins with no previous association with taste function. A first step in elucidating the roles these gene products play in gustation is to identify the specific taste cell types in which they are expressed. METHODOLOGY/PRINCIPAL FINDINGS: Using double label in situ hybridization analyses, we identified seven new genes expressed in specific taste cell types, including sweet, bitter, and umami cells (TRPM5-positive, sour cells (PKD2L1-positive, as well as other taste cell populations. Transmembrane protein 44 (TMEM44, a protein with seven predicted transmembrane domains with no homology to GPCRs, is expressed in a TRPM5-negative and PKD2L1-negative population that is enriched in the bottom portion of taste buds and may represent developmentally immature taste cells. Calcium homeostasis modulator 1 (CALHM1, a component of a novel calcium channel, along with family members CALHM2 and CALHM3; multiple C2 domains; transmembrane 1 (MCTP1, a calcium-binding transmembrane protein; and anoctamin 7 (ANO7, a member of the recently identified calcium-gated chloride channel family, are all expressed in TRPM5 cells. These proteins may modulate and effect calcium signalling stemming from sweet, bitter, and umami receptor activation. Synaptic vesicle glycoprotein 2B (SV2B, a regulator of synaptic vesicle exocytosis, is expressed in PKD2L1 cells, suggesting that this taste cell population transmits tastant information to gustatory afferent nerve fibers via exocytic neurotransmitter release. CONCLUSIONS/SIGNIFICANCE: Identification of genes encoding multi-transmembrane domain proteins

  17. Expression characteristics and specific antibody reactivity of diverse cathepsin F members of Paragonimus westermani.

    Science.gov (United States)

    Ahn, Chun-Seob; Na, Byoung-Kuk; Chung, Dong-Ll; Kim, Jeong-Geun; Kim, Jin-Taek; Kong, Yoon

    2015-02-01

    Paragonimiasis, caused by the lung fluke Paragonimus, is a major food-borne helminthic disease. Differential diagnosis of paragonimiasis from tuberculosis and other infectious granulomas in the lung is a prerequisite to proper management of patients. Cysteine proteases of Paragonimus westermani (PwCPs) invoke specific antibody responses against patient sera, while antibody capturing activity of different PwCPs has not been comparatively analyzed. In this study, we observed the expressional regulation of 11 species of different PwCPs (PwCP1-11). We expressed recombinant PwCPs and assessed diagnostic reliability employing sera from patients with P. westermani (n=138), other trematodiases (n=80), cestodiases (n=60) and pulmonary tuberculosis (n=20), and those of normal controls (n=20). PwCPs formed a monophyletic clade into cathepsin F and showed differential expression patterns along with developmental stages of worm. Bacterially expressed recombinant PwCPs (rPwCPs) exhibited variable sensitivity of 38.4-84.5% and specificity of 87.2-100% in diagnosing homologous infection. rPwCPs recognized specific antibodies of experimental cat sera as early as 3 or 6weeks after infection. Patient sera of fascioliasis, Schistosomiasis japonicum and clonorchiasis demonstrated weak cross-reactions. Our results demonstrate that diverse PwCPs of the cathepsin F family participate in inducing specific antibody responses. Most P. westermani cathepsin F, except for PwCP2 (AAF21461), which showed negligible antibody responses, might be applicable for paragonimiasis serodiagnosis.

  18. Identification of Hyaloperonospora arabidopsidis transcript sequences expressed during infection reveals isolate-specific effectors.

    Directory of Open Access Journals (Sweden)

    Adriana Cabral

    Full Text Available Biotrophic plant pathogens secrete effector proteins that are important for infection of the host. The aim of this study was to identify effectors of the downy mildew pathogen Hyaloperonospora arabidopsidis (Hpa that are expressed during infection of its natural host Arabidopsis thaliana. Infection-related transcripts were identified from Expressed Sequence Tags (ESTs derived from leaves of the susceptible Arabidopsis Ws eds1-1 mutant inoculated with the highly virulent Hpa isolate Waco9. Assembly of 6364 ESTs yielded 3729 unigenes, of which 2164 were Hpa-derived. From the translated Hpa unigenes, 198 predicted secreted proteins were identified. Of these, 75 were found to be Hpa-specific and six isolate Waco9-specific. Among 42 putative effectors identified there were three Elicitin-like proteins, 16 Cysteine-rich proteins and 18 host-translocated RXLR effectors. Sequencing of alleles in different Hpa isolates revealed that five RXLR genes show signatures of diversifying selection. Thus, EST analysis of Hpa-infected Arabidopsis is proving to be a powerful method for identifying pathogen effector candidates expressed during infection. Delivery of the Waco9-specific protein RXLR29 in planta revealed that this effector can suppress PAMP-triggered immunity and enhance disease susceptibility. We propose that differences in host colonization can be conditioned by isolate-specific effectors.

  19. Cell-specific dysregulation of microRNA expression in obese white adipose tissue.

    Science.gov (United States)

    Oger, Frédérik; Gheeraert, Celine; Mogilenko, Denis; Benomar, Yacir; Molendi-Coste, Olivier; Bouchaert, Emmanuel; Caron, Sandrine; Dombrowicz, David; Pattou, François; Duez, Hélène; Eeckhoute, Jérome; Staels, Bart; Lefebvre, Philippe

    2014-08-01

    Obesity is characterized by the excessive accumulation of dysfunctional white adipose tissue (WAT), leading to a strong perturbation of metabolic regulations. However, the molecular events underlying this process are not fully understood. MicroRNAs (miRNAs) are small noncoding RNAs acting as posttranscriptional regulators of gene expression in multiple tissues and organs. However, their expression and roles in WAT cell subtypes, which include not only adipocytes but also immune, endothelial, and mesenchymal stem cells as well as preadipocytes, have not been characterized. Design/Results: By applying differential miRNome analysis, we demonstrate that the expression of several miRNAs is dysregulated in epididymal WAT from ob/ob and high-fat diet-fed mice. Adipose tissue-specific down-regulation of miR-200a and miR-200b and the up-regulation of miR-342-3p, miR-335-5p, and miR-335-3p were observed. Importantly, a similarly altered expression of miR-200a and miR-200b was observed in obese diabetic patients. Furthermore, cell fractionation of mouse adipose tissue revealed that miRNAs are differentially expressed in adipocytes and in subpopulations from the stromal vascular fraction. Finally, integration of transcriptomic data showed that bioinformatically predicted miRNA target genes rarely showed anticorrelated expression with that of targeting miRNA, in contrast to experimentally validated target genes. Taken together, our data indicate that the dysregulated expression of miRNAs occurs in distinct cell types and is likely to affect cell-specific function(s) of obese WAT.

  20. Human breast cancer associated fibroblasts exhibit subtype specific gene expression profiles

    Directory of Open Access Journals (Sweden)

    Tchou Julia

    2012-09-01

    Full Text Available Abstract Background Breast cancer is a heterogeneous disease for which prognosis and treatment strategies are largely governed by the receptor status (estrogen, progesterone and Her2 of the tumor cells. Gene expression profiling of whole breast tumors further stratifies breast cancer into several molecular subtypes which also co-segregate with the receptor status of the tumor cells. We postulated that cancer associated fibroblasts (CAFs within the tumor stroma may exhibit subtype specific gene expression profiles and thus contribute to the biology of the disease in a subtype specific manner. Several studies have reported gene expression profile differences between CAFs and normal breast fibroblasts but in none of these studies were the results stratified based on tumor subtypes. Methods To address whether gene expression in breast cancer associated fibroblasts varies between breast cancer subtypes, we compared the gene expression profiles of early passage primary CAFs isolated from twenty human breast cancer samples representing three main subtypes; seven ER+, seven triple negative (TNBC and six Her2+. Results We observed significant expression differences between CAFs derived from Her2+ breast cancer and CAFs from TNBC and ER + cancers, particularly in pathways associated with cytoskeleton and integrin signaling. In the case of Her2+ breast cancer, the signaling pathways found to be selectively up regulated in CAFs likely contribute to the enhanced migration of breast cancer cells in transwell assays and may contribute to the unfavorable prognosis of Her2+ breast cancer. Conclusions These data demonstrate that in addition to the distinct molecular profiles that characterize the neoplastic cells, CAF gene expression is also differentially regulated in distinct subtypes of breast cancer.

  1. Two-dimensional fluorescence difference gel electrophoresis analysis of Listeria monocytogenes submitted to a redox shock.

    Science.gov (United States)

    Ignatova, Maria; Guével, Blandine; Com, Emmanuelle; Haddad, Nabila; Rossero, Albert; Bogard, Philippe; Prévost, Hervé; Guillou, Sandrine

    2013-02-21

    The influence of redox alteration on the growth and proteomic pattern of Listeria monocytogenes was investigated. A redox shock was induced in cultures by addition of 3mM ferricyanide (FeCN) and 6mM dithiothreitol (DTT) to increase or to decrease respectively the redox potential naturally occurring at the beginning of growth. In both conditions, the reducing and oxidizing redox shock had a strong influence, decreasing the maximum growth rate by half compared to a control culture. The proteomic analysis of L. monocytogenes performed by two-dimensional difference gel electrophoresis (2D-DIGE) exhibited twenty-three proteins differentially expressed (P<0.05), among these, many were oxidoreductases, and proteins involved in cellular metabolism (glycolysis, protein synthesis), detoxification (kat) or adhesion (Lmo1634).

  2. Listeria monocytogenes that lyse in the macrophage cytosol trigger AIM2-mediated pyroptosis

    Science.gov (United States)

    Sauer, John-Demian; Witte, Chelsea E.; Zemansky, Jason; Hanson, Bill; Lauer, Peter; Portnoy, Daniel A.

    2010-01-01

    Summary To gain insight into the mechanisms by which host cells detect cytosolic invasion by intracellular pathogens, a genetic screen was performed to identify Listeria monocytogenes mutants that induced altered levels of host cell death. A mutation in lmo2473 resulted in hyper-stimulation of host cell death and IL-1β secretion (pyroptosis) following bacteriolysis in the macrophage cytosol. In addition, strains engineered to lyse in the cytosol by expression of both bacteriophage holin and lysin or induced to lyse by treatment with ampicillin stimulated pyroptosis. Pyroptosis was independent of the Nlrp3 and Nlrc4 receptors, but dependent on ASC and AIM2. Importantly, wild type L. monocytogenes were also found to lyse, albeit at low levels, and trigger AIM2-dependent pyroptosis. Since AIM2 is activated by DNA, these data suggested that pyroptosis is triggered by bacterial DNA released during lysis. PMID:20417169

  3. The Response Regulator ResD Plays a Role in Metabolism of Listeria monocytogenes

    DEFF Research Database (Denmark)

    Larsen, Marianne Halberg; Sørensen, Martine; Ingmer, Hanne

    conditions in a resD mutant strain compared to the wild type. The majority of these were involved in motility and chemotaxis and in carbohydrate uptake such as mannose and cellobiose specific PTS uptake systems. The role of ResD for metabolism in L. monocytogenes was also studied by northern blot analysis...

  4. InlA Promotes Dissemination of Listeria monocytogenes to the Mesenteric Lymph Nodes during Food Borne Infection of Mice

    Science.gov (United States)

    Bou Ghanem, Elsa N.; Jones, Grant S.; Myers-Morales, Tanya; Patil, Pooja D.; Hidayatullah, Achmad N.; D'Orazio, Sarah E. F.

    2012-01-01

    Intestinal Listeria monocytogenes infection is not efficient in mice and this has been attributed to a low affinity interaction between the bacterial surface protein InlA and E-cadherin on murine intestinal epithelial cells. Previous studies using either transgenic mice expressing human E-cadherin or mouse-adapted L. monocytogenes expressing a modified InlA protein (InlAm) with high affinity for murine E-cadherin showed increased efficiency of intragastric infection. However, the large inocula used in these studies disseminated to the spleen and liver rapidly, resulting in a lethal systemic infection that made it difficult to define the natural course of intestinal infection. We describe here a novel mouse model of oral listeriosis that closely mimics all phases of human disease: (1) ingestion of contaminated food, (2) a distinct period of time during which L. monocytogenes colonize only the intestines, (3) varying degrees of systemic spread in susceptible vs. resistant mice, and (4) late stage spread to the brain. Using this natural feeding model, we showed that the type of food, the time of day when feeding occurred, and mouse gender each affected susceptibility to L. monocytogenes infection. Co-infection studies using L. monocytogenes strains that expressed either a high affinity ligand for E-cadherin (InlAm), a low affinity ligand (wild type InlA from Lm EGDe), or no InlA (ΔinlA) showed that InlA was not required to establish intestinal infection in mice. However, expression of InlAm significantly increased bacterial persistence in the underlying lamina propria and greatly enhanced dissemination to the mesenteric lymph nodes. Thus, these studies revealed a previously uncharacterized role for InlA in facilitating systemic spread via the lymphatic system after invasion of the gut mucosa. PMID:23166492

  5. Roles of a novel Crp/Fnr family transcription factor Lmo0753 in soil survival, biofilm production and surface attachment to fresh produce of Listeria monocytogenes.

    Directory of Open Access Journals (Sweden)

    Joelle K Salazar

    Full Text Available Listeria monocytogenes is a foodborne bacterial pathogen and the causative agent of an infectious disease, listeriosis. L. monocytogenes is ubiquitous in nature and has the ability to persist in food processing environments for extended periods of time by forming biofilms and resisting industrial sanitization. Human listeriosis outbreaks are commonly linked to contaminated dairy products, ready-to-eat meats, and in recent years, fresh produce such as lettuce and cantaloupes. We identified a putative Crp/Fnr family transcription factor Lmo0753 that is highly specific to human-associated genetic lineages of L. monocytogenes. Lmo0753 possesses two conserved functional domains similar to the major virulence regulator PrfA in L. monocytogenes. To determine if Lmo0753 is involved in environmental persistence-related mechanisms, we compared lmo0753 deletion mutants with respective wild type and complementation mutants of two fully sequenced L. monocytogenes genetic lineage II strains 10403S and EGDe for the relative ability of growth under different nutrient availability and temperatures, soil survival, biofilm productivity and attachment to select fresh produce surfaces including romaine lettuce leaves and cantaloupe rinds. Our results collectively suggested that Lmo0753 plays an important role in L. monocytogenes biofilm production and attachment to fresh produce, which may contribute to the environmental persistence and recent emergence of this pathogen in human listeriosis outbreaks linked to fresh produce.

  6. Identification and Characterization of a Rat Novel Gene RSEP4 Expressed Specifically in Central Nervous System

    Institute of Scientific and Technical Information of China (English)

    Xi-Dao WANG; Ling-Wei KONG; Zhi-Qin XIE; Yu-Qiu ZHANG; Zhi-Xin LIN; Zhi-Qi ZHAO; Lei YU; Nai-He JING

    2004-01-01

    The low-abundantly expressed genes composed the majorities of the mRNAs expressed in the central nervous system (CNS), and were thought to be important for the normal brain functions. Through differential screening a low-abundance cDNA sublibrary with mRNA from neuropathic pain of chronic constriction injury (CCI) model, we have identified a novel rat gene, rat spinal-cord expression protein 4 gene (RSEP4). The total length ofRSEP4 cDNA is 2006 bp, with a 501 nucleotide open reading frame (ORF) that encodes a 167 amino acid polypeptide. Northern blot revealed that RSEP4 was expressed specifically in the CNS. In situ hybridization showed that the mRNA of RSEP4 was strongly expressed in the CA1, CA2, CA3 and DG regions of hippocampus, the Purkinje cells of cerebellum, and the small sensory neurons of dorsal horn and large motor neurons of ventral horn of spinal cord. Over-expression of RSEP4-EGFP fusion protein in the human embryonic kidney 293T cells showed that RSEP4 protein was mainly localized in the cell cytoplasm. These results suggest that RSEP4 may play some roles in the CNS.

  7. Tissue Specific Expression of Cre in Rat Tyrosine Hydroxylase and Dopamine Active Transporter-Positive Neurons.

    Directory of Open Access Journals (Sweden)

    Zhenyi Liu

    Full Text Available The rat is a preferred model system over the mouse for neurological studies, and cell type-specific Cre expression in the rat enables precise ablation of gene function in neurons of interest, which is especially valuable for neurodegenerative disease modeling and optogenetics. Yet, few such Cre rats are available. Here we report the characterization of two Cre rats, tyrosine hydroxylase (TH-Cre and dopamine active transporter (DAT or Slc6a3-Cre, by using a combination of immunohistochemistry (IHC and mRNA fluorescence in situ hybridization (FISH as well as a fluorescent reporter for Cre activity. We detected Cre expression in expected neurons in both Cre lines. Interestingly, we also found that in Th-Cre rats, but not DAT-Cre rats, Cre is expressed in female germ cells, allowing germline excision of the floxed allele and hence the generation of whole-body knockout rats. In summary, our data demonstrate that targeted integration of Cre cassette lead to faithful recapitulation of expression pattern of the endogenous promoter, and mRNA FISH, in addition to IHC, is an effective method for the analysis of the spatiotemporal gene expression patterns in the rat brain, alleviating the dependence on high quality antibodies that are often not available against rat proteins. The Th-Cre and the DAT-Cre rat lines express Cre in selective subsets of dopaminergic neurons and should be particularly useful for researches on Parkinson's disease.

  8. Expression of human skin-specific genes defined by transcriptomics and antibody-based profiling.

    Science.gov (United States)

    Edqvist, Per-Henrik D; Fagerberg, Linn; Hallström, Björn M; Danielsson, Angelika; Edlund, Karolina; Uhlén, Mathias; Pontén, Fredrik

    2015-02-01

    To increase our understanding of skin, it is important to define the molecular constituents of the cell types and epidermal layers that signify normal skin. We have combined a genome-wide transcriptomics analysis, using deep sequencing of mRNA from skin biopsies, with immunohistochemistry-based protein profiling to characterize the landscape of gene and protein expression in normal human skin. The transcriptomics and protein expression data of skin were compared to 26 (RNA) and 44 (protein) other normal tissue types. All 20,050 putative protein-coding genes were classified into categories based on patterns of expression. We found that 417 genes showed elevated expression in skin, with 106 genes expressed at least five-fold higher than that in other tissues. The 106 genes categorized as skin enriched encoded for well-known proteins involved in epidermal differentiation and proteins with unknown functions and expression patterns in skin, including the C1orf68 protein, which showed the highest relative enrichment in skin. In conclusion, we have applied a genome-wide analysis to identify the human skin-specific proteome and map the precise localization of the corresponding proteins in different compartments of the skin, to facilitate further functional studies to explore the molecular repertoire of normal skin and to identify biomarkers related to various skin diseases.

  9. Tissue Specific Expression of Cre in Rat Tyrosine Hydroxylase and Dopamine Active Transporter-Positive Neurons.

    Science.gov (United States)

    Liu, Zhenyi; Brown, Andrew; Fisher, Dan; Wu, Yumei; Warren, Joe; Cui, Xiaoxia

    2016-01-01

    The rat is a preferred model system over the mouse for neurological studies, and cell type-specific Cre expression in the rat enables precise ablation of gene function in neurons of interest, which is especially valuable for neurodegenerative disease modeling and optogenetics. Yet, few such Cre rats are available. Here we report the characterization of two Cre rats, tyrosine hydroxylase (TH)-Cre and dopamine active transporter (DAT or Slc6a3)-Cre, by using a combination of immunohistochemistry (IHC) and mRNA fluorescence in situ hybridization (FISH) as well as a fluorescent reporter for Cre activity. We detected Cre expression in expected neurons in both Cre lines. Interestingly, we also found that in Th-Cre rats, but not DAT-Cre rats, Cre is expressed in female germ cells, allowing germline excision of the floxed allele and hence the generation of whole-body knockout rats. In summary, our data demonstrate that targeted integration of Cre cassette lead to faithful recapitulation of expression pattern of the endogenous promoter, and mRNA FISH, in addition to IHC, is an effective method for the analysis of the spatiotemporal gene expression patterns in the rat brain, alleviating the dependence on high quality antibodies that are often not available against rat proteins. The Th-Cre and the DAT-Cre rat lines express Cre in selective subsets of dopaminergic neurons and should be particularly useful for researches on Parkinson's disease.

  10. Muscle fiber type specific induction of slow myosin heavy chain 2 gene expression by electrical stimulation

    Energy Technology Data Exchange (ETDEWEB)

    Crew, Jennifer R.; Falzari, Kanakeshwari [Department of Cell Biology and Anatomy, Chicago Medical School, Rosalind Franklin University of Medicine and Science, 3333 Green Bay Road, North Chicago, IL 60064 (United States); DiMario, Joseph X., E-mail: joseph.dimario@rosalindfranklin.edu [Department of Cell Biology and Anatomy, Chicago Medical School, Rosalind Franklin University of Medicine and Science, 3333 Green Bay Road, North Chicago, IL 60064 (United States)

    2010-04-01

    Vertebrate skeletal muscle fiber types are defined by a broad array of differentially expressed contractile and metabolic protein genes. The mechanisms that establish and maintain these different fiber types vary throughout development and with changing functional demand. Chicken skeletal muscle fibers can be generally categorized as fast and fast/slow based on expression of the slow myosin heavy chain 2 (MyHC2) gene in fast/slow muscle fibers. To investigate the cellular and molecular mechanisms that control fiber type formation in secondary or fetal muscle fibers, myoblasts from the fast pectoralis major (PM) and fast/slow medial adductor (MA) muscles were isolated, allowed to differentiate in vitro, and electrically stimulated. MA muscle fibers were induced to express the slow MyHC2 gene by electrical stimulation, whereas PM muscle fibers did not express the slow MyHC2 gene under identical stimulation conditions. However, PM muscle fibers did express the slow MyHC2 gene when electrical stimulation was combined with inhibition of inositol triphosphate receptor (IP3R) activity. Electrical stimulation was sufficient to increase nuclear localization of expressed nuclear-factor-of-activated-T-cells (NFAT), NFAT-mediated transcription, and slow MyHC2 promoter activity in MA muscle fibers. In contrast, both electrical stimulation and inhibitors of IP3R activity were required for these effects in PM muscle fibers. Electrical stimulation also increased levels of peroxisome-proliferator-activated receptor-{gamma} co-activator-1 (PGC-1{alpha}) protein in PM and MA muscle fibers. These results indicate that MA muscle fibers can be induced by electrical stimulation to express the slow MyHC2 gene and that fast PM muscle fibers are refractory to stimulation-induced slow MyHC2 gene expression due to fast PM muscle fiber specific cellular mechanisms involving IP3R activity.

  11. 78 FR 23901 - Interagency Risk Assessment-Listeria monocytogenes

    Science.gov (United States)

    2013-04-23

    ... Food Safety and Inspection Service Interagency Risk Assessment--Listeria monocytogenes in Retail... risk assessment (QRA), ``Interagency Risk Assessment--Listeria monocytogenes in Retail Delicatessens... and on the FSIS Web site at http://www.fsis.usda.gov/PDF/Listeria-Transcript_062309.pdf ). II....

  12. Incidence and control of Listeria monocytogenes in foods in Denmark

    DEFF Research Database (Denmark)

    Nørrung, Birgit; Andersen, Jens Kirk; Schlundt, Jørgen

    1999-01-01

    The Danish regulatory policy on Listeria monocytogenes in foods is based on the principles of HACCP and was developed using a health risk assessment approach. The Danish policy focuses examinations and criteria for L. monocytogenes in ready-to-eat foods and is based on a combination of inspection...

  13. Resistance of Listeria monocytogenes biofilms to sanitizing agents

    Science.gov (United States)

    Listeria monocytogenes is notorious for its capacity to colonize the environment and equipment of food processing facilities and to persist in the processing plant ecosystem, sometimes for decades. Such persistence is mediated by multiple attributes of L. monocytogenes, including the pathogen’s capa...

  14. Listeria monocytogenes growth limits and stress resistance mechanisms

    NARCIS (Netherlands)

    Veen, van der S.

    2008-01-01

    The food-borne pathogen Listeria monocytogenes is a Gram-positive facultative anaerobic rod, which is the causative agent of listeriosis. Due to the severity of the disease and the fact that its incidence is increasing in numerous European countries, L. monocytogenes is of great public health concer

  15. Genome sequences of Listeria monocytogenes strains with resistance to arsenic

    Science.gov (United States)

    Listeria monocytogenes frequently exhibits resistance to arsenic. We report here the draft genome sequences of eight genetically diverse arsenic-resistant L. monocytogenes strains from human listeriosis and food-associated environments. Availability of these genomes would help to elucidate the role ...

  16. Listeria monocytogenes internalizes in Romaine Lettuce grown in greenhouse conditions

    Science.gov (United States)

    Listeria monocytogenes has been implicated in a number of outbreaks involving fresh produce, including an outbreak in 2016 resulting from contaminated packaged salads. The persistence and internalization potential of L. monocytogenes in romaine lettuce was evaluated, and the persistence of two L. mo...

  17. Survival strategies of Listeria monocytogenes - roles of regulators and transporters

    NARCIS (Netherlands)

    Wemekamp-Kamphuis, H.H.

    2003-01-01

    Outbreaks of the food-borne pathogen Listeria monocytogenes are mainly associated with ready-to-eatfoods. Survival strategies of L. monocytogenes in relation to minimally processed foods were studied.

  18. Advances in plant cell type-specific genome-wide studies of gene expression

    Institute of Scientific and Technical Information of China (English)

    Ying WANG; Yuling JIAO

    2011-01-01

    Cell is the functional unit of life.To study the complex interactions of systems of biological molecules,it is crucial to dissect these molecules at the cell level.In recent years,major progresses have been made by plant biologists to profile gene expression in specific cell types at the genome-wide level.Approaches based on the isolation of cells,polysomes or nuclei have been developed and successfully used for studying the cell types from distinct organs of several plant species.These cell-level data sets revealed previously unrecognized cellular properties,such as cell-specific gene expression modules and hormone response centers,and should serve as essential resources for functional genomic analyses.Newly developed technologies are more affordable to many laboratories and should help to provide new insights at the cellular resolution in the near future.

  19. Cell-specific information processing in segregating populations of Eph receptor ephrin-expressing cells

    DEFF Research Database (Denmark)

    Jørgensen, Claus; Sherman, Andrew; Chen, Ginny I

    2009-01-01

    Cells have self-organizing properties that control their behavior in complex tissues. Contact between cells expressing either B-type Eph receptors or their transmembrane ephrin ligands initiates bidirectional signals that regulate cell positioning. However, simultaneously investigating how...... information is processed in two interacting cell types remains a challenge. We implemented a proteomic strategy to systematically determine cell-specific signaling networks underlying EphB2- and ephrin-B1-controlled cell sorting. Quantitative mass spectrometric analysis of mixed populations of EphB2......- and ephrin-B1-expressing cells that were labeled with different isotopes revealed cell-specific tyrosine phosphorylation events. Functional associations between these phosphotyrosine signaling networks and cell sorting were established with small interfering RNA screening. Data-driven network modeling...

  20. Differential mouse-strain specific expression of Junctional Adhesion Molecule (JAM)-B in placental structures.

    Science.gov (United States)

    Stelzer, Ina Annelies; Mori, Mayumi; DeMayo, Francesco; Lydon, John; Arck, Petra Clara; Solano, Maria Emilia

    2016-03-03

    The junctional adhesion molecule (JAM)-B, a member of the immunoglobulin superfamily, is involved in stabilization of interendothelial cell-cell contacts, formation of vascular tubes, homeostasis of stem cell niches and promotion of leukocyte adhesion and transmigration. In the human placenta, JAM-B protein is abundant and mRNA transcripts are enriched in first-trimester extravillous trophoblast in comparison to the villous trophoblast. We here aimed to elucidate the yet unexplored spatio-temporal expression of JAM-B in the mouse placenta. We investigated and semi-quantified JAM-B protein expression by immunohistochemistry in early post-implantation si tes and in mid- to late gestation placentae of various murine mating combinations. Surprisingly, the endothelium of the placental labyrinth was devoid of JAM-B expression. JAM-B was mainly present in spongiotrophoblast cells of the junctional zone, as well as in the fetal vessels of the chorionic plate, the umbilical cord and in maternal myometrial smooth muscle. We observed a strain-specific placental increase of JAM-B protein expression from mid- to late gestation in Balb/c-mated C57BL/6 females, which was absent in DBA/2J-mated Balb/c females. Due to the essential role of progesterone during gestation, we further assessed a possible modulation of JAM-B in mid-gestational placentae deficient in the progesterone receptor (Pgr(-/-)) and observed an increased expression of JAM-B in Pgr(-/-) placentae, compared to Pgr(+/+) tissue samples. We propose that JAM-B is an as yet underappreciated trophoblast lineage-specific protein, which is modulated via the progesterone receptor and shows unique strain-specific kinetics. Future work is needed to elucidate its possible contribution to placental processes necessary to ensuring its integrity, ultimately facilitating placental development and fetal growth.

  1. Identification and expression of a novel human testis-specific gene by digital differential display

    Institute of Scientific and Technical Information of China (English)

    李丹; 卢光琇

    2004-01-01

    Background Evidence for the importance of genetic factors in male infertility is accumulating. This study was designed to identify a novel testis-specific gene related to spermatogenesis by a new strategy of digital differential display (DDD).Methods Based on the generation of expressed sequenced tags (ESTs), comparing the testis libraries with other tissue or cell line libraries by the DDD program, we identified a new contig of the ESTs which were derived from testis libraries and represented a novel gene. Multi-tissue RT-PCR was performed to analyse its tissue-specific expression. The full-length cDNA of the new gene was obtained using the BLAST program. Sequencing was performed and the result was analysed. Semi-quantitative RT-PCR and Northern blot analyseis of mRNA from differential normal tissues were performed to clarify the expression pattern of the new gene. The sequence of the opening reading frame was integrated into the pQE-30 vector expressed in Escherichia coil strain M15(pREP4). With IPTG induction, the target protein was detected.Conclusions DDD can be confirmed by SPATA12 as a novel computational biology-based approach for identification of the testis-specific expression genes. SPATA12 may function as a testicular germ cell associated gene that plays some roles in spermatogenesis. Moreover, a great amount of SPATA12 protein could be obtained by the gene recombination technique, thus providing a reliable foundation for investigating the biological function of this new protein.

  2. Tissue- Specific Expression Analysis of Anthocyanin Biosynthetic Genes in White- and Red-Fleshed Grape Cultivars

    Directory of Open Access Journals (Sweden)

    Sha Xie

    2015-12-01

    Full Text Available Yan73, a teinturier (dyer grape variety in China, is one of the few Vitis vinifera cultivars with red-coloured berry flesh. To examine the tissue-specific expression of genes associated with berry colour in Yan73, we analysed the differential accumulation of anthocyanins in the skin and flesh tissues of two red-skinned grape varieties with either red (Yan73 or white flesh (Muscat Hamburg based on HPLC-MS analysis, as well as the differential expression of 18 anthocyanin biosynthesis genes in both varieties by quantitative RT-PCR. The results revealed that the transcripts of GST, OMT, AM3, CHS3, UFGT, MYBA1, F3′5′H, F3H1 and LDOX were barely detectable in the white flesh of Muscat Hamburg. In particular, GST, OMT, AM3, CHS3 and F3H1 showed approximately 50-fold downregulation in the white flesh of Muscat Hamburg compared to the red flesh of Yan73. A correlation analysis between the accumulation of different types of anthocyanins and gene expression indicated that the cumulative expression of GST, F3′5′H, LDOX and MYBA1 was more closely associated with the acylated anthocyanins and the 3′5′-OH anthocyanins, while OMT and AM3 were more closely associated with the total anthocyanins and methoxylated anthocyanins. Therefore, the transcripts of OMT, AM3, GST, F3′5′H, LDOX and MYBA1 explained most of the variation in the amount and composition of anthocyanins in skin and flesh of Yan73. The data suggest that the specific localization of anthocyanins in the flesh tissue of Yan73 is most likely due to the tissue-specific expression of OMT, AM3, GST, F3′5′H, LDOX and MYBA1 in the flesh.

  3. Characterization of virulent Listeria monocytogenes isolates recovered from ready-to-eat meat products and consumers in Cairo, Egypt

    Directory of Open Access Journals (Sweden)

    Maysa A. I. Awadallah

    2014-10-01

    Full Text Available Aim: This study aimed to investigate the occurrence of some virulence genes distributed in Listeria monocytogenes isolated from ready-to-eat (RTE meat products and consumers in Cairo province, Egypt. Materials and Methods: A total of 120 beef luncheon, chicken luncheon and frankfurter beef (40 samples, each were collected from 10 different local shops situated in Al-salam city, Cairo province, Egypt. Stool samples were collected from 40 people who had the habit of consuming RTE meat. The suspected L. monocytogenes isolates were subjected to a multiplex polymerase chain reaction (PCR for rapid speciation and virulence determination using primers specific for inIA, inIC, and inIJ genes. Results: Culture examination of all samples on Oxford media revealed presence of colonies characteristic to L. monocytogenes in 6 beef luncheon (15%, 4 chicken luncheon (10%, 1 frankfurter beef (2.5% and 1 human stool (2.5% samples. Species identity of L. monocytogenes was verified through the amplification of a 800 bp fragment with inIA primers in 2 out of 6 culture isolates from beef luncheon (5%, and 1 out 4 culture isolates from chicken luncheon (2.5% samples. Statistical analysis revealed no significant difference between the occurrence of L. monocytogenes in different food samples examined (p>0.05. The virulence of these strains was ascertained by the presence of 517 bp and 238 bp fragments of inIC and inIJ genes, respectively in the isolates that contained the 800 bp fragment. The culture isolates obtained from one frankfurter beef sample, and one human stool sample were found negative by multiplex PCR for the presence of L. monocytogenes and its virulence specific genes. Conclusion: It could be concluded that L. monocytogenes are circulating in beef and chicken luncheon sold in Cairo, Egypt. Multiplex PCR is reliable for confirmation of L. monocytogenes. This study suggests the implementation of hygienic measures at all levels from production to consumption

  4. Common and specific signatures of gene expression and protein-protein interactions in autoimmune diseases.

    Science.gov (United States)

    Tuller, T; Atar, S; Ruppin, E; Gurevich, M; Achiron, A

    2013-03-01

    The aim of this study is to understand intracellular regulatory mechanisms in peripheral blood mononuclear cells (PBMCs), which are either common to many autoimmune diseases or specific to some of them. We incorporated large-scale data such as protein-protein interactions, gene expression and demographical information of hundreds of patients and healthy subjects, related to six autoimmune diseases with available large-scale gene expression measurements: multiple sclerosis (MS), systemic lupus erythematosus (SLE), juvenile rheumatoid arthritis (JRA), Crohn's disease (CD), ulcerative colitis (UC) and type 1 diabetes (T1D). These data were analyzed concurrently by statistical and systems biology approaches tailored for this purpose. We found that chemokines such as CXCL1-3, 5, 6 and the interleukin (IL) IL8 tend to be differentially expressed in PBMCs of patients with the analyzed autoimmune diseases. In addition, the anti-apoptotic gene BCL3, interferon-γ (IFNG), and the vitamin D receptor (VDR) gene physically interact with significantly many genes that tend to be differentially expressed in PBMCs of patients with the analyzed autoimmune diseases. In general, similar cellular processes tend to be differentially expressed in PBMC in the analyzed autoimmune diseases. Specifically, the cellular processes related to cell proliferation (for example, epidermal growth factor, platelet-derived growth factor, nuclear factor-κB, Wnt/β-catenin signaling, stress-activated protein kinase c-Jun NH2-terminal kinase), inflammatory response (for example, interleukins IL2 and IL6, the cytokine granulocyte-macrophage colony-stimulating factor and the B-cell receptor), general signaling cascades (for example, mitogen-activated protein kinase, extracellular signal-regulated kinase, p38 and TRK) and apoptosis are activated in most of the analyzed autoimmune diseases. However, our results suggest that in each of the analyzed diseases, apoptosis and chemotaxis are activated via

  5. Somatic expression of the testis-specific PDHA2 gene : mechanisms of activation/silencing

    OpenAIRE

    Pinheiro, Ana Sofia da Costa, 1981-

    2012-01-01

    Tese de doutoramento, Farmácia (Biologia Celular e Molecular), Universidade de Lisboa, Faculdade de Farmácia, 2012 During spermatogenesis, germ cells undergo a complex process of cell differentiation and morphological restructuring, which depends on the coordinated expression of different genes. Some vital examples are those involved in cell energy metabolism, namely the genes encoding the E1α subunit of pyruvate dehydrogenase complex: the somatic PDHA1 (X-linked) and the testis-specific P...

  6. Gene expression analysis distinguishes tissue specific and gender related functions among adult Ascaris suum tissues

    Science.gov (United States)

    Wang, Zhengyuan; Gao, Xin; Martin, John; Yin, Yong; Abubucker, Sahar; Rash, Amy C.; Li, Ben-Wen; Nash, Bill; Hallsworth-Pepin, Kym; Jasmer, Douglas P.; Mitreva, Makedonka

    2013-01-01

    Over a billion people are infected by Ascaris spp. intestinal parasites. To clarify functional differences among tissues of adult A. suum, we compared gene expression by various tissues of these worms by expression microarray methods.. The A. suum genome was sequenced and assembled to allow generation of microarray elements. Expression of over 40,000 60-mer elements was investigated in a variety of tissues from both male and female adult worms. Nearly 50 percent of the elements for which signal was detected exhibited differential expression among different tissues. The unique profile of transcripts identified for each tissue clarified functional distinctions among tissues, such as chitin binding in the ovary and peptidase activity in the intestines. Interestingly, hundreds of gender-specific elements were characterized in multiple non-reproductive tissues of female or male worms, with most prominence of gender differences in intestinal tissue. A. suum genes from the same family were frequently expressed differently among tissues. Transcript abundance for genes specific to A. suum, by comparison to Caenorhabditis elegans, varied to a greater extent among tissues than for genes conserved between A. suum and C. elegans. Analysis using C. elegans protein interaction data identified functional modules conserved between these two nematodes, resulting in identification of functional predictions of essential subnetworks of protein interactions and how these networks may vary among nematode tissues. A notable finding was very high module similarity between adult reproductive tissues and intestine. Our results provide the most comprehensive assessment of gene expression among tissues of a parasitic nematode to date. PMID:23572074

  7. Expression of phosphoinositide-specific phospholipase C isoenzymes in cultured astrocytes activated after stimulation with lipopolysaccharide.

    Science.gov (United States)

    Lo Vasco, Vincenza Rita; Fabrizi, Cinzia; Fumagalli, Lorenzo; Cocco, L

    2010-04-01

    Signal transduction pathways, involved in cell cycle and activities, depend on various components including lipid signalling molecules, such as phosphoinositides and related enzymes. Many evidences support the hypothesis that inositol lipid cycle is involved in astrocytes activation during neurodegeneration. Previous studies investigated the pattern of expression of phosphoinositide-specific phospholipase C (PI-PLC) family isoforms in astrocytes, individuating in cultured neonatal rat astrocytes, supposed to be quiescent cells, the absence of some isoforms, accordingly to their well known tissue specificity. The same study was conducted in cultured rat astrocytoma C6 cells and designed a different pattern of expression of PI-PLCs in the neoplastic counterpart, accordingly to literature suggesting a PI signalling involvement in tumour progression. It is not clear the role of PI-PLC isoforms in inflammation; recent data demonstrate they are involved in cytokines production, with special regard to IL-6. PI-PLCs expression in LPS treated neonatal rat astrocytes performed by using RT-PCR, observed at 3, 6, 18 and 24 h intervals, expressed: PI-PLC beta1, beta4 and gamma1 in all intervals analysed; PI-PLC delta1 at 6, 18 and 24 h; PI-PLC delta3 at 6 h after treatment. PI-PLC beta3, delta4 and epsilon, present in untreated astrocytes, were not detected after LPS treatment. Immunocytochemical analysis, performed to visualize the sub-cellular distribution of the expressed isoforms, demonstrated different patterns of localisation at different times of exposure. These observations suggest that PI-PLCs expression and distribution may play a role in ongoing inflammation process of CNS. Copyright 2010 Wiley-Liss, Inc.

  8. Liver-specific expression of a phosphoenolpyruvate carboxykinase-neo gene in genetically modified chickens.

    Science.gov (United States)

    Cook, R F; Cook, S J; Savon, S; McGrane, M; Hartitz, M; Hanson, R W; Hodgson, C P

    1993-03-01

    In order to investigate the potential of the avian liver for the expression of recombinant proteins in vivo, replication-competent retroviral vectors were used to introduce a recombinant rat phosphoenolpyruvate carboxykinase promoter-driven neomycin resistance gene (PEPCKneo) into early Line 11 Leghorn embryos. After hatching, these birds possessed apparently intact PEPCKneo sequences in most tissues examined, however, the neo protein was expressed preferentially in the liver (up to .45% of total cellular protein). Therefore, the tissue specificity of the PEPCK promoter from the rat was retained in the chicken, although hormone responsiveness was not observed. Retroviral vectors used to transmit the genes were more stable during passage in either fibroblast cells or in the animal if the inserted genes were oriented in the same (sense) direction as the viral genome. After Geneticin drug selection in cultured cells, PEPCKneo mRNA was the predominant recombinant species observed on Northern blots, whereas embryos expressed mostly the RNA species originating in the retroviral long terminal repeats. The results demonstrate the potential usefulness of liver-specific gene expression in chickens, as well as the transcriptional effects observed when a foreign promoter is introduced into the replication-competent vector.

  9. Cloning and characterization of zebra fish SPATA4 gene and analysis of its gonad specific expression.

    Science.gov (United States)

    Liu, Shangfeng; Liu, Bowen; He, Shan; Zhao, Ying; Wang, Zhao

    2005-06-01

    The spermatogenesis associated 4 gene (SPATA4, previously named TSARG2) was first cloned in human tissues and was reported to be a candidate spermatocyte apoptosis-related gene that is expressed specifically in testis. Analysis of SPATA4 expression and regulation in zebra fish may provide insight into the understanding of the complicated process of gonadogenesis. In this study, we cloned and characterized the SPATA4 gene from zebra fish (Danio rerio), which is homologous to human and mouse SPATA4. Zebra fish SPATA4 consists of six exons separated by five introns, as all SPATA4 genes in vertebrates. A promoter region was predicted using homologous blast and cloned for further study, and possible transcription factors were analyzed in this region. The putative protein encoded by this gene was analyzed using bioinformatics methods. Multi-tissue RT-PCR results demonstrated that the zebra fish SPATA4 gene is expressed specifically in testis and slightly in ovary. Analysis of the SPATA4 sequence and its spatial expression pattern indicate that this gene is highly conserved and may play an important role in the process of zebra fish gonadogenesis.

  10. Taproot promoters cause tissue specific gene expression within the storage root of sugar beet.

    Science.gov (United States)

    Oltmanns, Heiko; Kloos, Dorothee U; Briess, Waltraud; Pflugmacher, Maike; Stahl, Dietmar J; Hehl, Reinhard

    2006-08-01

    The storage root (taproot) of sugar beet (Beta vulgaris L.) originates from hypocotyl and primary root and contains many different tissues such as central xylem, primary and secondary cambium, secondary xylem and phloem, and parenchyma. It was the aim of this work to characterize the promoters of three taproot-expressed genes with respect to their tissue specificity. To investigate this, promoters for the genes Tlp, His1-r, and Mll were cloned from sugar beet, linked to reporter genes and transformed into sugar beet and tobacco. Reporter gene expression analysis in transgenic sugar beet plants revealed that all three promoters are active in the storage root. Expression in storage root tissues is either restricted to the vascular zone (Tlp, His1-r) or is observed in the whole organ (Mll). The Mll gene is highly organ specific throughout different developmental stages of the sugar beet. In tobacco, the Tlp and Mll promoters drive reporter gene expression preferentially in hypocotyl and roots. The properties of the Mll promoter may be advantageous for the modification of sucrose metabolism in storage roots.

  11. Gender- and stressor-specific microRNA expression in Tribolium castaneum.

    Science.gov (United States)

    Freitak, Dalial; Knorr, Eileen; Vogel, Heiko; Vilcinskas, Andreas

    2012-10-23

    MicroRNAs (miRNAs) are small non-coding RNAs mediating post-transcriptional regulation of gene expression in eukaryotes. Addressing their role in regulation of physiological adaptations to environmental stress in insects, we selected the red flour beetle Tribolium castaneum as a model. Beetles were fed with the bacterial entomopathogen Pseudomonas entomophila (to mimic natural infection), injected with peptidoglycan (experimental setting of strong immune responses) or subjected to either mild heat shock or starvation. Differential expression of selected immunity- and stress-related genes was quantified using real-time PCR, and expression and induction of 455 mature arthropod miRNAs were determined using proprietary microarrays. We found that Tribolium exhibits both gender- and stressor-specific adjustment of immune gene and miRNA expression. Strikingly, we discovered that the number of stressor-induced miRNAs in females is remarkably higher than in males. This observation could support the hypothesis called Bateman's principle in immunity that predicts gender-specific immune responses because females gain fitness through increased longevity, whereas males gain fitness by increasing mating rates. Our results suggest that Tribolium males and females display differential regulatory elements, both pre- and post-transcriptional, likely resulting from different investment strategies in life-history traits.

  12. Analysis of multilocus sequence typing and virulence characterization of Listeria monocytogenes isolates from Chinese retail ready-to-eat food

    Directory of Open Access Journals (Sweden)

    Shi eWu

    2016-02-01

    Full Text Available Eighty Listeria monocytogenes isolates were obtained from Chinese retail ready-to-eat (RTE food and were previously characterized with serotyping and antibiotic susceptibility tests. The aim of this study was to characterize the subtype and virulence potential of these L. monocytogenes isolates by multilocus sequence typing (MLST, virulence-associate genes, epidemic clones (ECs and sequence analysis of the important virulence factor: internalin A (inlA. The result of MLST revealed that these L. monocytogenes isolates belonged to 14 different sequence types (STs. With the exception of four new STs (ST804, ST805, ST806 and ST807, all other STs observed in this study have been associated with human listeriosis and outbreaks to varying extents. Six virulence-associate genes (inlA, inlB, inlC, inlJ, hly and llsX were selected and their presence was investigated using PCR. All strains carried inlA, inlB, inlC, inlJ, and hly, whereas 38.8% (31/80 of strains harbored the listeriolysin S genes (llsX. A multiplex PCR assay was used to evaluate the presence of markers specific to epidemic clones of L. monocytogenes and identified 26.3% (21/80 of ECI in the 4b-4d-4e strains. Further study of inlA sequencing revealed that most strains contained the full-length InlA required for host cell invasion, whereas three mutations lead to premature stop codons (PMSC within a novel PMSCs at position 326 (GAA→TAA. MLST and inlA sequence analysis results were concordant, and different virulence potentials within isolates were observed. These findings suggest that L. monocytogenes isolates from RTE food in China could be virulent and be capable of causing human illness. Furthermore, the STs and virulence profiles of L. monocytogenes isolates have significant implications for epidemiological and public health studies of this pathogen.

  13. Detection of premature stop codons leading to truncated internalin A among food and clinical strains of Listeria monocytogenes.

    Science.gov (United States)

    Ferreira da Silva, Margarida; Ferreira, Vânia; Magalhães, Rui; Almeida, Gonçalo; Alves, Artur; Teixeira, Paula

    2017-05-01

    Listeria monocytogenes is a food-borne pathogen responsible for outbreaks and sporadic cases of listeriosis, a severe invasive disease. Internalin A (InlA) a protein encoded by inlA has a key role in the mechanism of pathogenesis in L. monocytogenes infection, specifically in the invasion of human intestinal epithelial cells. Studies on inlA have shown that mutations leading to premature stop codons (PMSCs) occur naturally and are associated with impaired virulence of L. monocytogenes strains. Increasing evidence suggests that inlA PMSCs mutations are frequent in strains from foods, but rare among clinical isolates. In this study, 22 L. monocytogenes strains collected in Portugal from the processing environment of a bakery industry (n = 1), different food products (n = 10) and human clinical cases (n = 11) were analysed for mutations in inlA and invasion efficiency in Caco-2 cells. Sequencing revealed previously reported mutations types leading to PMSCs in three food and one clinical strain presenting different molecular serotypes (i.e., IIa, IIb and IIc). The remaining 18 isolates did not show PMSCs in inlA. The four strains with PMSCs in inlA presented lower invasiveness efficiencies in Caco-2 cells (below 8.9%) when compared to the control strain (full-length InlA). In addition, one clinical isolate showed reduced invasion efficiency but no PMSCs in inlA. This isolate showed increased inlA transcript levels to that obtained for the laboratory control strain. Our data support the hypothesis that L. monocytogenes isolated from food have attenuated invasion due to the presence of inlA PMSCs. This information would be critically needed for adequate risk-assessments of the foodborne illness burden associated with L. monocytogenes strains. Copyright © 2016 Elsevier Ltd. All rights reserved.

  14. The survival of Listeria monocytogenes during long term desiccation is facilitated by sodium chloride and organic material.

    Science.gov (United States)

    Vogel, Birte Fonnesbech; Hansen, Lisbeth Truelstrup; Mordhorst, Hanne; Gram, Lone

    2010-06-15

    One specific DNA-subtype, as determined by RAPD, of Listeria monocytogenes persisted in a fish slaughterhouse for years, even during months with no production where the plant was cleaned and kept dry. We hypothesised that tolerance to desiccation could be a factor in explaining the persistence of L. monocytogenes in food processing environments and the purpose of the present study was to determine ability of L. monocytogenes to survive desiccation on stainless steel under simulated food processing conditions. Viable counts of eight different L. monocytogenes strains exposed to different soils and relative humidities (RHs) during desiccation decreased significantly (pDesiccation in physiological peptone saline (PPS) reduced survivors by 3-5 log units whereas bacterial cells suspended in bacteriological growth substrates (tryptone soy broth with 1% glucose, TSB-glu) or PPS with 5% NaCl only were reduced by 1-3 log units. At RHs of 2, 43 and 75%, surfaces were visibly dry after 1, 3 and 5days of incubation, respectively. The lowest RH resulted in the most significant loss of viability, however, 10(3)-10(4)CFU/cm(2) remained viable regardless of the desiccation treatment (i.e., presence of TSB-glu and/or salt). At 75% RH, the bacterial counts remained almost constant when desiccated in TSB-glu. When bacteria were grown and desiccated (15 degrees C, 43% RH) in salmon or smoked salmon juice, survivors decreased slowly resulting in low numbers (10(2)-10(3)CFU/cm(2)) from all eight strains remaining viable after 3months. Whilst conditions during desiccation had a pronounced influence on inactivation kinetics and the number of survivors, persistent L. monocytogenes were not more tolerant to desiccation than presumed non-persistent isolates. Our study shows that the ability to survive for months during desiccated conditions may be a factor explaining the ability of L. monocytogenes to persist in food processing environments. Copyright 2010 Elsevier B.V. All rights reserved.

  15. Expression of porcine sapovirus VP1 gene and VP1 specific monoclonal antibody production.

    Science.gov (United States)

    Ryu, Min-Sang; Jung, Eun-Hye; Cho, Kyoung-Oh; Kang, Shien-Young

    2012-06-01

    Sapovirus (SaV) is an agent of human and porcine gastroenteritis and a member of the family Caliciviridae. SaV has been classified based on VP1 full gene nucleotide sequences into five genogroups (GI-GV), among which GIII is known to infect pigs. The VP1 folds into two major domains designated S and P for the shell and protruding domain, respectively. The P domain is divided into two subdomains, P1 and P2. In this study, the VP1 full gene and the S, P, and P2 regions of the VP1 gene of porcine SaV were expressed using a baculovirus expression system. Expressed proteins in the recombinant virus were confirmed by polymerase chain reaction, indirect fluorescence antibody (IFA) testing, and Western blot analysis. Four hybridomas secreting VP1-specific monoclonal antibodies (MAbs) against porcine sapovirus were generated. Four MAbs were characterized according to their IFA and Western blot analysis results. All of the hybridomas produced in this study secreted MAbs binding to S domain of VP1 protein specifically. The MAbs produced in this study can be used as specific diagnostic reagents for detecting porcine SaV.

  16. Widely predicting specific protein functions based on protein-protein interaction data and gene expression profile

    Institute of Scientific and Technical Information of China (English)

    GAO Lei; LI Xia; GUO Zheng; ZHU MingZhu; LI YanHui; RAO ShaoQi

    2007-01-01

    GESTs (gene expression similarity and taxonomy similarity), a gene functional prediction approach previously proposed by us, is based on gene expression similarity and concept similarity of functional classes defined in Gene Ontology (GO). In this paper, we extend this method to protein-protein interaction data by introducing several methods to filter the neighbors in protein interaction networks for a protein of unknown function(s). Unlike other conventional methods, the proposed approach automatically selects the most appropriate functional classes as specific as possible during the learning process, and calls on genes annotated to nearby classes to support the predictions to some small-sized specific classes in GO. Based on the yeast protein-protein interaction information from MIPS and a dataset of gene expression profiles, we assess the performances of our approach for predicting protein functions to "biology process" by three measures particularly designed for functional classes organized in GO. Results show that our method is powerful for widely predicting gene functions with very specific functional terms. Based on the GO database published in December 2004, we predict some proteins whose functions were unknown at that time, and some of the predictions have been confirmed by the new SGD annotation data published in April, 2006.

  17. Widely predicting specific protein functions based on protein-protein interaction data and gene expression profile

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    GESTs (gene expression similarity and taxonomy similarity), a gene functional prediction approach previously proposed by us, is based on gene expression similarity and concept similarity of functional classes defined in Gene Ontology (GO). In this paper, we extend this method to protein-protein interac-tion data by introducing several methods to filter the neighbors in protein interaction networks for a protein of unknown function(s). Unlike other conventional methods, the proposed approach automati-cally selects the most appropriate functional classes as specific as possible during the learning proc-ess, and calls on genes annotated to nearby classes to support the predictions to some small-sized specific classes in GO. Based on the yeast protein-protein interaction information from MIPS and a dataset of gene expression profiles, we assess the performances of our approach for predicting protein functions to “biology process” by three measures particularly designed for functional classes organ-ized in GO. Results show that our method is powerful for widely predicting gene functions with very specific functional terms. Based on the GO database published in December 2004, we predict some proteins whose functions were unknown at that time, and some of the predictions have been confirmed by the new SGD annotation data published in April, 2006.

  18. Sex-specific DoublesexM expression in subsets of Drosophila somatic gonad cells

    Directory of Open Access Journals (Sweden)

    Oliver Brian

    2007-10-01

    Full Text Available Abstract Background In Drosophila melanogaster, a pre-mRNA splicing hierarchy controls sexual identity and ultimately leads to sex-specific Doublesex (DSX transcription factor isoforms. The male-specific DSXM represses genes involved in female development and activates genes involved in male development. Spatial and temporal control of dsx during embryogenesis is not well documented. Results Here we show that DSXM is specifically expressed in subsets of male somatic gonad cells during embryogenesis. Following testis formation, germ cells remain in contact with DSXM-expressing cells, including hub cells and premeiotic somatic cyst cells that surround germ cells during spermatogenesis in larval and adult testes. Conclusion We show that dsx is transcriptionally regulated in addition to being regulated at the pre-mRNA splicing level by the sex determination hierarchy. The dsx locus is spatially controlled by somatic gonad identity. The continuous expression of DSXM in cells contacting the germline suggests an ongoing short-range influence of the somatic sex determination pathway on germ cell development.

  19. Myogenic factors that regulate expression of muscle-specific microRNAs.

    Science.gov (United States)

    Rao, Prakash K; Kumar, Roshan M; Farkhondeh, Mina; Baskerville, Scott; Lodish, Harvey F

    2006-06-01

    Since their discovery as key regulators of early animal development, microRNAs now are recognized as widespread regulators of gene expression. Despite their abundance, little is known regarding the regulation of microRNA biogenesis. We show that three highly conserved muscle-specific microRNAs, miR-1, miR-133 and miR-206, are robustly induced during the myoblast-myotube transition, both in primary human myoblasts and in the mouse mesenchymal C2C12 stem cell line. These microRNAs were not induced during osteogenic conversion of C2C12 cells. Moreover, both loci encoding miR-1, miR-1-1, and miR-1-2, and two of the three encoding miR-133, miR-133a-1 and miR-133a-2, are strongly induced during myogenesis. Some of the induced microRNAs are in intergenic regions, whereas two are transcribed in the opposite direction to the nonmuscle-specific gene in which they are embedded. By using CHIP analysis, we demonstrate that the myogenic factors Myogenin and MyoD bind to regions upstream of these microRNAs and, therefore, are likely to regulate their expression. Because miR-1 and miR-206 are predicted to repress similar mRNA targets, our work suggests that induction of these microRNAs is important in regulating the expression of muscle-specific proteins.

  20. Recombinant Listeria monocytogenes as a Live Vaccine Vehicle for the Induction of Protective Anti-Viral Cell-Mediated Immunity

    Science.gov (United States)

    Shen, Hao; Slifka, Mark K.; Matloubian, Mehrdad; Jensen, Eric R.; Ahmed, Rafi; Miller, Jeff F.

    1995-04-01

    Listeria monocytogenes (LM) is a Gram-positive bacterium that is able to enter host cells, escape from the endocytic vesicle, multiply within the cytoplasm, and spread directly from cell to cell without encountering the extracellular milieu. The ability of LM to gain access to the host cell cytosol allows proteins secreted by the bacterium to efficiently enter the pathway for major histocompatibility complex class I antigen processing and presentation. We have established a genetic system for expression and secretion of foreign antigens by recombinant strains, based on stable site-specific integration of expression cassettes into the LM genome. The ability of LM recombinants to induce protective immunity against a heterologous pathogen was demonstrated with lymphocytic choriomeningitis virus (LCMV). LM strains expressing the entire LCMV nucleoprotein or an H-2L^d-restricted nucleoprotein epitope (aa 118-126) were constructed. Immunization of mice with LM vaccine strains conferred protection against challenge with virulent strains of LCMV that otherwise establish chronic infection in naive adult mice. In vivo depletion of CD8^+ T cells from vaccinated mice abrogated their ability to clear viral infection, showing that protective anti-viral immunity was due to CD8^+ T cells.

  1. Identification of a Novel Gene SRG4 Expressed at Specific Stages of Mouse Spermatogenesis

    Institute of Scientific and Technical Information of China (English)

    Xiao-Wei XING; Lu-Yun LI; Gang LIU; Jun-Jiang FU; Xiao-Jun TAN; Guang-Xiu LU

    2004-01-01

    Spermatogenesis is a complex process. Two spermatocytes expression sequence tags (ESTs)BG101130 and BG100990 were found. Their putative amino acid sequences have high homology with rat Spag4 (sperm antigen 4). By electrical hybridization, a novel cDNA encoding polypeptide of 348 amino acid residues was identified from a mouse testis cDNA library. The new gene was designated as SRG4(Spermatogenesis related gene 4) (GenBank accession No. AY307077). Results of Northern blot and RT-PCR revealed that SRG4 expressed specifically in mouse testis. Changes of SRG4 expression in mouse dif-ferent development stages were observed by RT-PCR. The SRG4 mRNA was hardly detected in 2 weeks postpartum, and expressed abundantly from 3 weeks later, reaching top lever at 4-5 weeks, while slightly down in aging mouse testis. Results of in situ hybridization showed that SRG4 gene expressed abundantly in spermatocytes, round spermatids. This indicated SRG4 gene may play an important role in mouse meiotic divisions of spermatocytes.

  2. Substrate-specific gene expression in Batrachochytrium dendrobatidis, the chytrid pathogen of amphibians.

    Directory of Open Access Journals (Sweden)

    Erica Bree Rosenblum

    Full Text Available Determining the mechanisms of host-pathogen interaction is critical for understanding and mitigating infectious disease. Mechanisms of fungal pathogenicity are of particular interest given the recent outbreaks of fungal diseases in wildlife populations. Our study focuses on Batrachochytrium dendrobatidis (Bd, the chytrid pathogen responsible for amphibian declines around the world. Previous studies have hypothesized a role for several specific families of secreted proteases as pathogenicity factors in Bd, but the expression of these genes has only been evaluated in laboratory growth conditions. Here we conduct a genome-wide study of Bd gene expression under two different nutrient conditions. We compare Bd gene expression profiles in standard laboratory growth media and in pulverized host tissue (i.e., frog skin. A large proportion of genes in the Bd genome show increased expression when grown in host tissue, indicating the importance of studying pathogens on host substrate. A number of gene classes show particularly high levels of expression in host tissue, including three families of secreted proteases (metallo-, serine- and aspartyl-proteases, adhesion genes, lipase-3 encoding genes, and a group of phylogenetically unusual crinkler-like effectors. We discuss the roles of these different genes as putative pathogenicity factors and discuss what they can teach us about Bd's metabolic targets, host invasion, and pathogenesis.

  3. Assessing allele-specific expression across multiple tissues from RNA-seq read data

    Science.gov (United States)

    Pirinen, Matti; Lappalainen, Tuuli; Zaitlen, Noah A.; Dermitzakis, Emmanouil T.; Donnelly, Peter; McCarthy, Mark I.; Rivas, Manuel A.

    2015-01-01

    Motivation: RNA sequencing enables allele-specific expression (ASE) studies that complement standard genotype expression studies for common variants and, importantly, also allow measuring the regulatory impact of rare variants. The Genotype-Tissue Expression (GTEx) project is collecting RNA-seq data on multiple tissues of a same set of individuals and novel methods are required for the analysis of these data. Results: We present a statistical method to compare different patterns of ASE across tissues and to classify genetic variants according to their impact on the tissue-wide expression profile. We focus on strong ASE effects that we are expecting to see for protein-truncating variants, but our method can also be adjusted for other types of ASE effects. We illustrate the method with a real data example on a tissue-wide expression profile of a variant causal for lipoid proteinosis, and with a simulation study to assess our method more generally. Availability and implementation: http://www.well.ox.ac.uk/~rivas/mamba/. R-sources and data examples http://www.iki.fi/mpirinen/ Contact: matti.pirinen@helsinki.fi or rivas@well.ox.ac.uk Supplementary information: Supplementary data are available at Bioinformatics online. PMID:25819081

  4. Tissue-specific expression of monocarboxylate transporters during fasting in mice.

    Science.gov (United States)

    Schutkowski, Alexandra; Wege, Nicole; Stangl, Gabriele I; König, Bettina

    2014-01-01

    Monocarboxylates such as pyruvate, lactate and ketone bodies are crucial for energy supply of all tissues, especially during energy restriction. The transport of monocarboxylates across the plasma membrane of cells is mediated by monocarboxylate transporters (MCTs). Out of 14 known mammalian MCTs, six isoforms have been functionally characterized to transport monocarboxylates and short chain fatty acids (MCT1-4), thyroid hormones (MCT8, -10) and aromatic amino acids (MCT10). Knowledge on the regulation of the different MCT isoforms is rare. In an attempt to get more insights in regulation of MCT expression upon energy deprivation, we carried out a comprehensive analysis of tissue specific expression of five MCT isoforms upon 48 h of fasting in mice. Due to the crucial role of peroxisome proliferator-activated receptor (PPAR)-α as a central regulator of energy metabolism and as known regulator of MCT1 expression, we included both wildtype (WT) and PPARα knockout (KO) mice in our study. Liver, kidney, heart, small intestine, hypothalamus, pituitary gland and thyroid gland of the mice were analyzed. Here we show that the expression of all examined MCT isoforms was markedly altered by fasting compared to feeding. Expression of MCT1, MCT2 and MCT10 was either increased or decreased by fasting dependent on the analyzed tissue. MCT4 and MCT8 were down-regulated by fasting in all examined tissues. However, PPARα appeared to have a minor impact on MCT isoform regulation. Due to the fundamental role of MCTs in transport of energy providing metabolites and hormones involved in the regulation of energy homeostasis, we assumed that the observed fasting-induced adaptations of MCT expression seem to ensure an adequate energy supply of tissues during the fasting state. Since, MCT isoforms 1-4 are also necessary for the cellular uptake of drugs, the fasting-induced modifications of MCT expression have to be considered in future clinical care algorithms.

  5. Nidogen-1 regulates laminin-1-dependent mammary-specific gene expression

    Energy Technology Data Exchange (ETDEWEB)

    Pujuguet, Philippe; Simian, Marina; Liaw, Jane; Timpl, Rupert; Werb, Zena; Bissell, Mina J..

    2000-02-01

    Nidogen-1 (entactin) acts as a bridge between the extracellular matrix molecules laminin-1 and type IV collagen, and thus participates in the assembly of basement membranes. To investigate the role of nidogen-1 in regulating cell-type-specific gene expression in mammary epithelium, we designed a culture microecosystem in which each component, including epithelial cells, mesenchymal cells, lactogenic hormones and extracellular matrix, could be controlled. We found that primary and established mesenchymal and myoepithelial cells synthesized and secreted nidogen-1, whereas expression was absent in primary and established epithelial cells. In an epithelial cell line containing mesenchymal cells, nidogen-1 was produced by the mesenchymal cells but deposited between the epithelial cells. In this mixed culture, mammary epithelial cells express b-casein in the presence of lactogenic hormones. Addition of either laminin-1 plus nidogen-1, or laminin-1 alone to mammary epithelial cells induced b- casein production. We asked whether recombinant nidogen-1 alone could signal directly for b-casein. Nidogen-1 did not induce b-casein synthesis in epithelial cells, but it augmented the inductive capacity of laminin-1. These data suggest that nidogen-1 can cooperate with laminin-1 to regulate b-casein expression. Addition of full length nidogen-1 to the mixed cultures had no effect on b-casein gene expression; however, a nidogen-1 fragment containing the laminin-1 binding domain, but lacking the type IV collagen-binding domain, had a dominant negative effect on b-casein expression. These data point to a physiological role for nidogen-1 in the basement membrane-induced gene expression by epithelial cells.

  6. Tissue-specific expression of monocarboxylate transporters during fasting in mice.

    Directory of Open Access Journals (Sweden)

    Alexandra Schutkowski

    Full Text Available Monocarboxylates such as pyruvate, lactate and ketone bodies are crucial for energy supply of all tissues, especially during energy restriction. The transport of monocarboxylates across the plasma membrane of cells is mediated by monocarboxylate transporters (MCTs. Out of 14 known mammalian MCTs, six isoforms have been functionally characterized to transport monocarboxylates and short chain fatty acids (MCT1-4, thyroid hormones (MCT8, -10 and aromatic amino acids (MCT10. Knowledge on the regulation of the different MCT isoforms is rare. In an attempt to get more insights in regulation of MCT expression upon energy deprivation, we carried out a comprehensive analysis of tissue specific expression of five MCT isoforms upon 48 h of fasting in mice. Due to the crucial role of peroxisome proliferator-activated receptor (PPAR-α as a central regulator of energy metabolism and as known regulator of MCT1 expression, we included both wildtype (WT and PPARα knockout (KO mice in our study. Liver, kidney, heart, small intestine, hypothalamus, pituitary gland and thyroid gland of the mice were analyzed. Here we show that the expression of all examined MCT isoforms was markedly altered by fasting compared to feeding. Expression of MCT1, MCT2 and MCT10 was either increased or decreased by fasting dependent on the analyzed tissue. MCT4 and MCT8 were down-regulated by fasting in all examined tissues. However, PPARα appeared to have a minor impact on MCT isoform regulation. Due to the fundamental role of MCTs in transport of energy providing metabolites and hormones involved in the regulation of energy homeostasis, we assumed that the observed fasting-induced adaptations of MCT expression seem to ensure an adequate energy supply of tissues during the fasting state. Since, MCT isoforms 1-4 are also necessary for the cellular uptake of drugs, the fasting-induced modifications of MCT expression have to be considered in future clinical care algorithms.

  7. Tissue-Specific Expression of Monocarboxylate Transporters during Fasting in Mice

    Science.gov (United States)

    Schutkowski, Alexandra; Wege, Nicole; Stangl, Gabriele I.; König, Bettina

    2014-01-01

    Monocarboxylates such as pyruvate, lactate and ketone bodies are crucial for energy supply of all tissues, especially during energy restriction. The transport of monocarboxylates across the plasma membrane of cells is mediated by monocarboxylate transporters (MCTs). Out of 14 known mammalian MCTs, six isoforms have been functionally characterized to transport monocarboxylates and short chain fatty acids (MCT1-4), thyroid hormones (MCT8, -10) and aromatic amino acids (MCT10). Knowledge on the regulation of the different MCT isoforms is rare. In an attempt to get more insights in regulation of MCT expression upon energy deprivation, we carried out a comprehensive analysis of tissue specific expression of five MCT isoforms upon 48 h of fasting in mice. Due to the crucial role of peroxisome proliferator-activated receptor (PPAR)-α as a central regulator of energy metabolism and as known regulator of MCT1 expression, we included both wildtype (WT) and PPARα knockout (KO) mice in our study. Liver, kidney, heart, small intestine, hypothalamus, pituitary gland and thyroid gland of the mice were analyzed. Here we show that the expression of all examined MCT isoforms was markedly altered by fasting compared to feeding. Expression of MCT1, MCT2 and MCT10 was either increased or decreased by fasting dependent on the analyzed tissue. MCT4 and MCT8 were down-regulated by fasting in all examined tissues. However, PPARα appeared to have a minor impact on MCT isoform regulation. Due to the fundamental role of MCTs in transport of energy providing metabolites and hormones involved in the regulation of energy homeostasis, we assumed that the observed fasting-induced adaptations of MCT expression seem to ensure an adequate energy supply of tissues during the fasting state. Since, MCT isoforms 1–4 are also necessary for the cellular uptake of drugs, the fasting-induced modifications of MCT expression have to be considered in future clinical care algorithms. PMID:25390336

  8. Specificity in suppression of SOS expression by recA4162 and uvrD303.

    Science.gov (United States)

    Massoni, Shawn C; Sandler, Steven J

    2013-12-01

    Detection and repair of DNA damage is essential in all organisms and depends on the ability of proteins recognizing and processing specific DNA substrates. In E. coli, the RecA protein forms a filament on single-stranded DNA (ssDNA) produced by DNA damage and induces the SOS response. Previous work has shown that one type of recA mutation (e.g., recA4162 (I298V)) and one type of uvrD mutation (e.g., uvrD303 (D403A, D404A)) can differentially decrease SOS expression depending on the type of inducing treatments (UV damage versus RecA mutants that constitutively express SOS). Here it is tested using other SOS inducing conditions if there is a general feature of ssDNA generated during these treatments that allows recA4162 and uvrD303 to decrease SOS expression. The SOS inducing conditions tested include growing cells containing temperature-sensitive DNA replication mutations (dnaE486, dnaG2903, dnaN159, dnaZ2016 (at 37°C)), a del(polA)501 mutation and induction of Double-Strand Breaks (DSBs). uvrD303 could decrease SOS expression under all conditions, while recA4162 could decrease SOS expression under all conditions except in the polA strain or when DSBs occur. It is hypothesized that recA4162 suppresses SOS expression best when the ssDNA occurs at a gap and that uvrD303 is able to decrease SOS expression when the ssDNA is either at a gap or when it is generated at a DSB (but does so better at a gap).

  9. Tissue-specific alterations of PRL-1 and PRL-2 expression in cancer.

    Science.gov (United States)

    Dumaual, Carmen M; Sandusky, George E; Soo, Han Weng; Werner, Sean R; Crowell, Pamela L; Randall, Stephen K

    2012-01-01

    The PRL-1 and PRL-2 phosphatases have been implicated as oncogenic, however the involvement of these molecules in human neoplasms is not well understood. To increase understanding of the role PRL-1 and PRL-2 play in the neoplastic process, in situ hybridization was used to examine PRL-1 and PRL-2 mRNA expression in 285 normal, benign, and malignant human tissues of diverse origin. Immunohistochemical analysis was performed on a subset of these. PRL-1 and PRL-2 mRNA expression was also assessed in a small set of samples from a variety of diseases other than cancer. Where possible, associations with clinicopathological characteristics were evaluated. Alterations in PRL-1 or -2 expression were a frequent event, but the nature of those alterations was highly tumor type specific. PRL-1 was significantly overexpressed in 100% of hepatocellular and gastric carcinomas, but significantly under-expressed in 100% of ovarian, 80% of breast, and 75% of lung tumors. PRL-2 expression was significantly increased in 100% of hepatocellular carcinomas, yet significantly downregulated in 54% of kidney carcinomas. PRL-1 expression was correlated to patient gender in the bladder and to patient age in the brain and skeletal muscle. PRL-1 expression was also associated with tumor grade in the prostate, ovary, and uterus. These results suggest a pleiotropic role for PRL-1 and PRL-2 in the neoplastic process. These molecules may associate with tumor progression and serve as clinical markers of tumor aggressiveness in some tissues, but be involved in inhibition of tumor formation or growth in others.

  10. Triclosan-Induced Aminoglycoside-Tolerant Listeria monocytogenes Isolates Can Appear as Small-Colony Variants

    DEFF Research Database (Denmark)

    Kastbjerg, Vicky Gaedt; Hein-Kristensen, Line; Gram, Lone

    2014-01-01

    Exposure of the human food-borne pathogen Listeria monocytogenes to sublethal concentrations of triclosan can cause resistance to several aminoglycosides. Aminoglycoside-resistant isolates exhibit two colony morphologies: normal-size and pinpoint colonies. The purposes of the present study were...... to characterize the small colonies of L. monocytogenes and to determine if specific genetic changes could explain the triclosan-induced aminoglycoside resistance in both pinpoint and normal-size isolates. Isolates from the pinpoint colonies grew poorly under aerated conditions, but growth was restored by addition......, and addition of heme caused the pinpoint isolates to revert to normal colony size. Triclosan-induced gentamicin-resistant isolates had mutations in several different genes, and it cannot be directly concluded how the different mutations caused gentamicin resistance. However, since many of the mutations...

  11. Bactericidal Antibiotics Do Not Appear To Cause Oxidative Stress in Listeria monocytogenes

    DEFF Research Database (Denmark)

    Feld, Louise; Knudsen, Gitte Maegaard; Gram, Lone

    2012-01-01

    self-destruction by internal production of hydroxyl radicals. The purpose of the present study was to determine if a similar mechanism is involved in antibiotic killing of the infectious human pathogen, Listeria monocytogenes. We treated wild-type L. monocytogenes and oxidative stress mutants (Δsod......Oxidative stress can be an important contributor to the lethal effect of bactericidal antibiotics in some bacteria, such as Escherichia coli and Staphylococcus aureus. Thus, despite the different target-specific actions of bactericidal antibiotics, they have a common mechanism leading to bacterial...... and Δfri) with three different bactericidal antibiotics and found no difference in killing kinetics. In contrast, wild-type E. coli and an oxidative stress mutant (ΔsodA ΔsodB) differed significantly in their sensitivity to bactericidal antibiotics. We conclude that bactericidal antibiotics did not appear...

  12. Prevalence of Listeria monocytogenes in Idiazabal cheese Prevalencia de Listeria monocytogenes en queso Idiazabal

    Directory of Open Access Journals (Sweden)

    E. Arrese

    2012-12-01

    Full Text Available Introduction: Raw-milk cheese has been identified in risk assessment as a food of greater concern to public health due to listeriosis. Objective: To determine the prevalence and levels of Listeria monocytogenes in semi-hard Idiazabal cheese manufactured by different producers in the Basque Country at consumer level. Methodology: A total of 51 Idiazabal cheese samples were obtained from 10 separate retail establishments, chosen by stratified random sampling. Samples were tested using the official standard ISO procedure 11290-1 for detection and enumeration methods. Results and conclusion: All cheese samples tested negative for L. monocytogenes. However, 9.8% tested positive for Listeria spp., different from L. monocytogenes. Positive samples came from two brands, two were natural and three were smoked. The presence of Listeria spss. suggests that the cheese making process and the hygiene whether at milking or during cheese making could be insufficient.Introducción: Listeria monocytogenes se ha asociado a quesos elaborados a partir de leche cruda, lo que supone un importante riesgo de salud pública debido a la listeriosis. Objetivo: Estudiar la prevalencia y los niveles de L. monocytogenes en quesos Idiazabal semi-curados de distintos productores del País Vasco, a nivel de consumidor. Metodología: Se analizaron 51 muestras de queso Idiazabal procedentes de 10 establecimientos de venta al público; el muestreo fue aleatorio y estratificado. Los análisis se hicieron según el método de detección y de enumeración del procedimiento estandarizado ISO 11290-1. Resultados y conclusión: Todas las muestras dieron negativo para L. monocytogenes. Sin embargo, el 9,8% dio positivo para Listeria spp., distinta de L. monocytogenes. Las muestras positivas procedían de dos marcas, dos eran quesos naturales y tres ahumados. La presencia de Listeria spss. sugiere que el procesado del queso y la higiene durante el ordeño o durante la fabricación podr

  13. Evolution of New cis-Regulatory Motifs Required for Cell-Specific Gene Expression in Caenorhabditis.

    Directory of Open Access Journals (Sweden)

    Michalis Barkoulas

    2016-09-01

    Full Text Available Patterning of C. elegans vulval cell fates relies on inductive signaling. In this induction event, a single cell, the gonadal anchor cell, secretes LIN-3/EGF and induces three out of six competent precursor cells to acquire a vulval fate. We previously showed that this developmental system is robust to a four-fold variation in lin-3/EGF genetic dose. Here using single-molecule FISH, we find that the mean level of expression of lin-3 in the anchor cell is remarkably conserved. No change in lin-3 expression level could be detected among C. elegans wild isolates and only a low level of change-less than 30%-in the Caenorhabditis genus and in Oscheius tipulae. In C. elegans, lin-3 expression in the anchor cell is known to require three transcription factor binding sites, specifically two E-boxes and a nuclear-hormone-receptor (NHR binding site. Mutation of any of these three elements in C. elegans results in a dramatic decrease in lin-3 expression. Yet only a single E-box is found in the Drosophilae supergroup of Caenorhabditis species, including C. angaria, while the NHR-binding site likely only evolved at the base of the Elegans group. We find that a transgene from C. angaria bearing a single E-box is sufficient for normal expression in C. elegans. Even a short 58 bp cis-regulatory fragment from C. angaria with this single E-box is able to replace the three transcription factor binding sites at the endogenous C. elegans lin-3 locus, resulting in the wild-type expression level. Thus, regulatory evolution occurring in cis within a 58 bp lin-3 fragment, results in a strict requirement for the NHR binding site and a second E-box in C. elegans. This single-cell, single-molecule, quantitative and functional evo-devo study demonstrates that conserved expression levels can hide extensive change in cis-regulatory site requirements and highlights the evolution of new cis-regulatory elements required for cell-specific gene expression.

  14. Detection of Listeria monocytogenes with short peptide fragments from class IIa bacteriocins as recognition elements.

    Science.gov (United States)

    Azmi, Sarfuddin; Jiang, Keren; Stiles, Michael; Thundat, Thomas; Kaur, Kamaljit

    2015-03-09

    We employed a direct peptide-bacteria binding assay to screen peptide fragments for high and specific binding to Listeria monocytogenes. Peptides were screened from a peptide array library synthesized on cellulose membrane. Twenty four peptide fragments (each a 14-mer) were derived from three potent anti-listerial peptides, Leucocin A, Pediocin PA1, and Curvacin A, that belong to class IIa bacteriocins. Fragment Leu10 (GEAFSAGVHRLANG), derived from the C-terminal region of Leucocin A, displayed the highest binding among all of the library fragments toward several pathogenic Gram-positive bacteria, including L. monocytogenes, Enterococcus faecalis, and Staphylococcus aureus. The specific binding of Leu10 to L. monocytogenes was further validated using microcantilever (MCL) experiments. Microcantilevers coated with gold were functionalized with peptides by chemical conjugation using a cysteamine linker to yield a peptide density of ∼4.8×10(-3) μmol/cm2 for different peptide fragments. Leu10 (14-mer) functionalized MCL was able to detect Listeria with same sensitivity as that of Leucocin A (37-mer) functionalized MCL, validating the use of short peptide fragments in bacterial detection platforms. Fragment Leu10 folded into a helical conformation in solution, like that of native Leucocin A, suggesting that both Leu10 and Leucocin A may employ a similar mechanism for binding target bacteria. The results show that peptide-conjugated microcantilevers can function as highly sensitive platforms for Listeria detection and hold potential to be developed as biosensors for pathogenic bacteria.

  15. Antigen-specific monoclonal antibodies isolated from B cells expressing constitutively active STAT5.

    Directory of Open Access Journals (Sweden)

    Ferenc A Scheeren

    Full Text Available BACKGROUND: Fully human monoclonal antibodies directed against specific pathogens have a high therapeutic potential, but are difficult to generate. METHODOLOGY/PRINCIPAL FINDINGS: Memory B cells were immortalized by expressing an inducible active mutant of the transcription factor Signal Transducer and Activator of Transcription 5 (STAT5. Active STAT5 inhibits the differentiation of B cells while increasing their replicative life span. We obtained cloned B cell lines, which produced antibodies in the presence of interleukin 21 after turning off STAT5. We used this method to obtain monoclonal antibodies against the model antigen tetanus toxin. CONCLUSIONS/SIGNIFICANCE: Here we describe a novel and relatively simple method of immortalizing antigen-specific human B cells for isolation of human monoclonal antibodies. These results show that STAT5 overexpression can be employed to isolate antigen specific antibodies from human memory B cells.

  16. NANOPARTICLE AS A NEW GENE TRANSFERRING VECTOR IN SPECIFIC EXPRESSION GENE

    Institute of Scientific and Technical Information of China (English)

    管珩; 李拥军; 郑曰宏; 刘昌伟; 杨菁; 宋存先; 王彭延; 赵三妹; 王宗立; 佘铭鹏

    2002-01-01

    Objective. To evaluate the possibility and efficiency of nanoparticle as a new vector in specific gene transference.Methods. Nanoparticle-DNA complex was prepared with Poly- dl-lactic-co-glycolic acid (PLGA) beating antisense monocyte chemotactic protein-1 (A-MCP-1), a specific expression gene, and the package efficiency, release progress in vitro, and the size of the complex were determined. The possibility of the new vector was evaluated with genomic DNA PCR by transferring gene into cultured smooth muscle cells (SMC), cationic lipids as a control. For study in vivo, jugular vein-to-artery bypass grafting procedures were performed on 20 New Zealand white rabbits, of which 6 grafts were transferred with nanoparticle-A-MCP-1 (200 μg), 6 with A - MCP - 1(200 μ g) by cationic liposome, 4 with LNCX plasmid, and 4 as control. Fourteen days after the grafts were harvested, the expression of A-MCP-1 and its effect on MCP-1 in vein grafts were detected by dot blot, and the morphologic evaluation of grafts was performed.Results. The package efficiency of the nanoparticle-DNA complex was 0. 9%, release progress in vitro lasted 2 weeks, and the size ranged from 150 to 300nm. SMC genomic DNA PCR showed that A-MCP-1 gene could be successfully transfected into cells by nanoparticle. The study in vivo indicated that A-MCP-1 mRNA was expressed in both local gene delivery groups, nanoparticle and liposome, meanwhile, MCP-1 expression in vein grafts was significantly inhibited and neointimal hyperplasia was notably reduced.Conclusion. Nanoparticle can act as a vector to transfect specific gene.

  17. Effective intervention for expressive grammar in children with specific language impairment.

    Science.gov (United States)

    Smith-Lock, Karen M; Leitao, Suze; Lambert, Lara; Nickels, Lyndsey

    2013-01-01

    Children with specific language impairment are known to struggle with expressive grammar. While some studies have shown successful intervention under laboratory conditions, there is a paucity of evidence for the effectiveness of grammar treatment in young children in community settings. To evaluate the effectiveness of a school-based intervention programme for expressive grammar in 5-year-olds with specific language impairment. Thirty-four 5-year-old children attending a specialized school for children with language impairment participated in the study. Nineteen children received treatment for expressive grammar (experimental group) and 15 children received a control treatment. Treatment consisted of weekly 1-h sessions of small group activities in a classroom setting for 8 weeks. Techniques included direct instruction, focused stimulation, recasting and imitation. Results were analysed at the group level and as a case series with each child as their own control in a single-subject design. There was a significant difference in grammatical performance pre- and post-treatment for children who received grammar treatment (Cohen's d = 1.24), but not for a group of children who received a control treatment. Further, no difference in performance was found in the equivalent time period prior to treatment, nor for an untreated target. Treatment success was more pronounced in children without articulation difficulties which interfered with their ability to produce the grammatical targets (Cohen's d = 1.66). Individual analyses indicated the treatment effect was significant for the majority of children. Individually targeted intervention delivered in small groups in a classroom setting was effective in improving production of expressive grammatical targets in 5-year-old children with specific language impairment. © 2013 Royal College of Speech and Language Therapists.

  18. Potent and specific inhibition of SARS-CoV antigen expression by RNA interference

    Institute of Scientific and Technical Information of China (English)

    TAO Peng; ZHANG Jun; TANG Ni; ZHANG Bing-qiang; HE Tong-chuan; HUANG Ai-long

    2005-01-01

    Background Severe acute respiratory syndrome (SARS) is an infectious disease caused by SARS-CoV. There are no effective antiviral drugs for SARS although the epidemic of SARS was controlled. The aim of this study was to develop an RNAi (RNA interference) approach that specifically targeted the N gene sequence of severe acute respiratory syndrome associated coronavirus (SARS-CoV) by synthesizing short hairpin RNA (shRNA) in vivo, and to assess the inhibitory effect of this shRNA on SARS-CoV N antigen expression. Methods The eukaryotic expression plasmid pEGFP-C1-N, containing SARS-CoV N gene, was co-transfected into 293 cells with either the RNAi plasmid pshRNA-N or unrelated control plasmid pshRNA-HBV-C4. At 24, 48 and 72 hours post transfection, the green fluorescence was observed through a fluorescence microscope. The RNA levels of SARS-CoV N were determined by reverse transcription polymerase chain reaction (RT-PCR). The expression of Green Fluorescent Protein (GFP) and protein N were detected using Western blot.Results The vector, pshRNA-N expressing shRNA which targeted the N gene of SARS-CoV, was successfully constructed. The introduction of RNAi plasmid efficiently and specifically inhibited the synthesis of protein N. RT-PCR showed that RNAs of N gene were clearly reduced when the pEGFP-C1-N was cotransfected with pshRNA-N, whereas the control vector did not exhibit inhibitory effect on N gene transcription.Conclusions Our results demonstrate that RNAi mediated silencing of SARS-CoV gene could effectively inhibit expression of SARS-CoV antigen, hence RNAi based strategy should be further explored as a more efficacious antiviral therapy of SARS-CoV infection.

  19. Methylphenidate (Ritalin) induces Homer 1a and zif 268 expression in specific corticostriatal circuits.

    Science.gov (United States)

    Yano, M; Steiner, H

    2005-01-01

    Corticostriatal circuits participate in limbic, attentional, motor and other networks, and are implicated in psychostimulant addiction. The psychostimulant methylphenidate is used in the treatment of attention-deficit hyperactivity disorder and for recreational purposes. Recent studies indicate that methylphenidate alters gene expression in striatal neurons. We investigated whether methylphenidate affects gene regulation in specific corticostriatal circuits, by comparing drug-induced molecular changes in different functional domains of the striatum with changes in their cortical input regions. In order to assess the potential functional significance of methylphenidate-induced molecular changes, we examined members of two different classes of plasticity-related molecules, the transcription factor zif 268 and the synaptic plasticity factor Homer 1a. Acute methylphenidate administration in adult rats increased the expression of Homer 1a and zif 268 in both cortex and striatum in a dose-dependent and regionally selective manner. These changes in gene expression occurred after doses of 2 mg/kg (i.p.) and higher, and were highly correlated between cortical regions and their striatal targets. In the cortex, increases were maximal in the medial agranular (premotor) and cingulate cortex, followed by motor and somatosensory cortex, and were minimal in the insular cortex. Correspondingly, in the striatum, increases were most robust in sensorimotor sectors that receive medial agranular input, and were weaker or absent in ventral sectors. The methylphenidate-induced increases in cortical Homer 1a and zif 268 expression were also correlated with increases in striatal substance P and dynorphin expression (direct pathway). Overall, the regional distribution of methylphenidate-induced molecular changes in the striatum was similar to that of changes induced by psychostimulants such as cocaine. These findings demonstrate that methylphenidate affects transcription and synaptic

  20. Chronic social isolation is associated with metabolic gene expression changes specific to mammary adipose tissue.

    Science.gov (United States)

    Volden, Paul A; Wonder, Erin L; Skor, Maxwell N; Carmean, Christopher M; Patel, Feenalie N; Ye, Honggang; Kocherginsky, Masha; McClintock, Martha K; Brady, Matthew J; Conzen, Suzanne D

    2013-07-01

    Chronic social isolation is linked to increased mammary tumor growth in rodent models of breast cancer. In the C3(1)/SV40 T-antigen FVB/N (TAg) mouse model of "triple-negative" breast cancer, the heightened stress response elicited by social isolation has been associated with increased expression of metabolic genes in the mammary gland before invasive tumors develop (i.e., during the in situ carcinoma stage). To further understand the mechanisms underlying how accelerated mammary tumor growth is associated with social isolation, we separated the mammary gland adipose tissue from adjacent ductal epithelial cells and analyzed individual cell types for changes in metabolic gene expression. Specifically, increased expression of the key metabolic genes Acaca, Hk2, and Acly was found in the adipocyte, rather than the epithelial fraction. Surprisingly, metabolic gene expression was not significantly increased in visceral adipose depots of socially isolated female mice. As expected, increased metabolic gene expression in the mammary adipocytes of socially isolated mice coincided with increased glucose metabolism, lipid synthesis, and leptin secretion from this adipose depot. Furthermore, application of media that had been cultured with isolated mouse mammary adipose tissue (conditioned media) resulted in increased proliferation of mammary cancer cells relative to group-housed-conditioned media. These results suggest that exposure to a chronic stressor (social isolation) results in specific metabolic reprogramming in mammary gland adipocytes that in turn contributes to increased proliferation of adjacent preinvasive malignant epithelial cells. Metabolites and/or tumor growth-promoting proteins secreted from adipose tissue could identify biomarkers and/or targets for preventive intervention in breast cancer.

  1. Mesoderm-specific Stat3 deletion affects expression of Sox9 yielding Sox9-dependent phenotypes

    Science.gov (United States)

    Hall, Michael D.; Murray, Caroline A.; Perantoni, Alan O.

    2017-01-01

    To date, mutations within the coding region and translocations around the SOX9 gene both constitute the majority of genetic lesions underpinning human campomelic dysplasia (CD). While pathological coding-region mutations typically result in a non-functional SOX9 protein, little is known about what mechanism(s) controls normal SOX9 expression, and subsequently, which signaling pathways may be interrupted by alterations occurring around the SOX9 gene. Here, we report the identification of Stat3 as a key modulator of Sox9 expression in nascent cartilage and developing chondrocytes. Stat3 expression is predominant in tissues of mesodermal origin, and its conditional ablation using mesoderm-specific TCre, in vivo, causes dwarfism and skeletal defects characteristic of CD. Specifically, Stat3 loss results in the expansion of growth plate hypertrophic chondrocytes and deregulation of normal endochondral ossification in all bones examined. Conditional deletion of Stat3 with a Sox9Cre driver produces palate and tracheal irregularities similar to those described in Sox9+/- mice. Furthermore, mesodermal deletion of Stat3 causes global embryonic down regulation of Sox9 expression and function in vivo. Mechanistic experiments ex vivo suggest Stat3 can directly activate the expression of Sox9 by binding to its proximal promoter following activation. These findings illuminate a novel role for Stat3 in chondrocytes during skeletal development through modulation of a critical factor, Sox9. Importantly, they further provide the first evidence for the modulation of a gene product other than Sox9 itself which is capable of modeling pathological aspects of CD and underscore a potentially valuable therapeutic target for patients with the disorder. PMID:28166224

  2. Internalin profiling and multilocus sequence typing suggest four Listeria innocua subgroups with different evolutionary distances from Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Wang Jun

    2010-03-01

    Full Text Available Abstract Background Ecological, biochemical and genetic resemblance as well as clear differences of virulence between L. monocytogenes and L. innocua make this bacterial clade attractive as a model to examine evolution of pathogenicity. This study was attempted to examine the population structure of L. innocua and the microevolution in the L. innocua-L. monocytogenes clade via profiling of 37 internalin genes and multilocus sequence typing based on the sequences of 9 unlinked genes gyrB, sigB, dapE, hisJ, ribC, purM, gap, tuf and betL. Results L. innocua was genetically monophyletic compared to L. monocytogenes, and comprised four subgroups. Subgroups A and B correlated with internalin types 1 and 3 (except the strain 0063 belonging to subgroup C and internalin types 2 and 4 respectively. The majority of L. innocua strains belonged to these two subgroups. Subgroup A harbored a whole set of L. monocytogenes-L. innocua common and L. innocua-specific internalin genes, and displayed higher recombination rates than those of subgroup B, including the relative frequency of occurrence of recombination versus mutation (ρ/θ and the relative effect of recombination versus point mutation (r/m. Subgroup A also exhibited a significantly smaller exterior/interior branch length ratio than expected under the coalescent model, suggesting a recent expansion of its population size. The phylogram based on the analysis with correction for recombination revealed that the time to the most recent common ancestor (TMRCA of L. innocua subgroups A and B were similar. Additionally, subgroup D, which correlated with internalin type 5, branched off from the other three subgroups. All L. innocua strains lacked seventeen virulence genes found in L. monocytogenes (except for the subgroup D strain L43 harboring inlJ and two subgroup B strains bearing bsh and were nonpathogenic to mice. Conclusions L. innocua represents a young species descending from L. monocytogenes and

  3. Exoproteome analysis reveals higher abundance of proteins linked to alkaline stress in persistent Listeria monocytogenes strains.

    Science.gov (United States)

    Rychli, Kathrin; Grunert, Tom; Ciolacu, Luminita; Zaiser, Andreas; Razzazi-Fazeli, Ebrahim; Schmitz-Esser, Stephan; Ehling-Schulz, Monika; Wagner, Martin

    2016-02-02

    The foodborne pathogen Listeria monocytogenes, responsible for listeriosis a rare but severe infection disease, can survive in the food processing environment for month or even years. So-called persistent L. monocytogenes strains greatly increase the risk of (re)contamination of food products, and are therefore a great challenge for food safety. However, our understanding of the mechanism underlying persistence is still fragmented. In this study we compared the exoproteome of three persistent strains with the reference strain EGDe under mild stress conditions using 2D differential gel electrophoresis. Principal component analysis including all differentially abundant protein spots showed that the exoproteome of strain EGDe (sequence type (ST) 35) is distinct from that of the persistent strain R479a (ST8) and the two closely related ST121 strains 4423 and 6179. Phylogenetic analyses based on multilocus ST genes showed similar grouping of the strains. Comparing the exoproteome of strain EGDe and the three persistent strains resulted in identification of 22 differentially expressed protein spots corresponding to 16 proteins. Six proteins were significantly increased in the persistent L. monocytogenes exoproteomes, among them proteins involved in alkaline stress response (e.g. the membrane anchored lipoprotein Lmo2637 and the NADPH dehydrogenase NamA). In parallel the persistent strains showed increased survival under alkaline stress, which is often provided during cleaning and disinfection in the food processing environments. In addition, gene expression of the proteins linked to stress response (Lmo2637, NamA, Fhs and QoxA) was higher in the persistent strain not only at 37 °C but also at 10 °C. Invasion efficiency of EGDe was higher in intestinal epithelial Caco2 and macrophage-like THP1 cells compared to the persistent strains. Concurrently we found higher expression of proteins involved in virulence in EGDe e.g. the actin-assembly-inducing protein ActA and the

  4. Cancer cell specific cytotoxic gene expression mediated by ARF tumor suppressor promoter constructs

    Energy Technology Data Exchange (ETDEWEB)

    Kurayoshi, Kenta [Department of Bioscience, School of Science and Technology, Kwansei Gakuin University, 2-1 Gakuen, Sanda, Hyogo 669-1337 (Japan); Ozono, Eiko [Centre for Molecular Oncology, Barts Cancer Institute, Queen Mary, University of London, John Vane Science Centre, Charterhouse Square, London EC1M 6BQ (United Kingdom); Iwanaga, Ritsuko; Bradford, Andrew P. [Department of Obstetrics and Gynecology, University of Colorado School of Medicine, Anschutz Medical Campus, 12800 East 19th Avenue, Aurora, CO 80045 (United States); Komori, Hideyuki [Center for Stem Cell Biology, Life Sciences Institute, University of Michigan, Ann Arbor, MI 48109 (United States); Ohtani, Kiyoshi, E-mail: btm88939@kwansei.ac.jp [Department of Bioscience, School of Science and Technology, Kwansei Gakuin University, 2-1 Gakuen, Sanda, Hyogo 669-1337 (Japan)

    2014-07-18

    Highlights: • ARF promoter showed higher responsiveness to deregulated E2F activity than the E2F1 promoter. • ARF promoter showed higher cancer cell-specificity than E2F1 promoter to drive gene expression. • HSV-TK driven by ARF promoter showed higher cancer cell-specific cytotoxicity than that driven by E2F1 promoter. - Abstract: In current cancer treatment protocols, such as radiation and chemotherapy, side effects on normal cells are major obstacles to radical therapy. To avoid these side effects, a cancer cell-specific approach is needed. One way to specifically target cancer cells is to utilize a cancer specific promoter to express a cytotoxic gene (suicide gene therapy) or a viral gene required for viral replication (oncolytic virotherapy). For this purpose, the selected promoter should have minimal activity in normal cells to avoid side effects, and high activity in a wide variety of cancers to obtain optimal therapeutic efficacy. In contrast to the AFP, CEA and PSA promoters, which have high activity only in a limited spectrum of tumors, the E2F1 promoter exhibits high activity in wide variety of cancers. This is based on the mechanism of carcinogenesis. Defects in the RB pathway and activation of the transcription factor E2F, the main target of the RB pathway, are observed in almost all cancers. Consequently, the E2F1 promoter, which is mainly regulated by E2F, has high activity in wide variety of cancers. However, E2F is also activated by growth stimulation in normal growing cells, suggesting that the E2F1 promoter may also be highly active in normal growing cells. In contrast, we found that the tumor suppressor ARF promoter is activated by deregulated E2F activity, induced by forced inactivation of pRB, but does not respond to physiological E2F activity induced by growth stimulation. We also found that the deregulated E2F activity, which activates the ARF promoter, is detected only in cancer cell lines. These observations suggest that ARF promoter

  5. A novel Listeria monocytogenes-based DNA delivery system for cancer gene therapy.

    LENUS (Irish Health Repository)

    van Pijkeren, Jan Peter

    2012-01-31

    Bacteria-mediated transfer of plasmid DNA to mammalian cells (bactofection) has been shown to have significant potential as an approach to express heterologous proteins in various cell types. This is achieved through entry of the entire bacterium into cells, followed by release of plasmid DNA. In a murine model, we show that Listeria monocytogenes can invade and spread in tumors, and establish the use of Listeria to deliver genes to tumors in vivo. A novel approach to vector lysis and release of plasmid DNA through antibiotic administration was developed. Ampicillin administration facilitated both plasmid transfer and safety control of vector. To further improve on the gene delivery system, we selected a Listeria monocytogenes derivative that is more sensitive to ampicillin, and less pathogenic than the wild-type strain. Incorporation of a eukaryotic-transcribed lysin cassette in the plasmid further increased bacterial lysis. Successful gene delivery of firefly luciferase to growing tumors in murine models and to patient breast tumor samples ex vivo was achieved. The model described encompasses a three-phase treatment regimen, involving (1) intratumoral administration of vector followed by a period of vector spread, (2) systemic ampicillin administration to induce vector lysis and plasmid transfer, and (3) systemic administration of combined moxifloxacin and ampicillin to eliminate systemic vector. For the first time, our results reveal the potential of Listeria monocytogenes for in vivo gene delivery.

  6. Simvastatin enhances protection against Listeria monocytogenes infection in mice by counteracting Listeria-induced phagosomal escape.

    Directory of Open Access Journals (Sweden)

    Suraj P Parihar

    Full Text Available Statins are well-known cholesterol lowering drugs targeting HMG-CoA-reductase, reducing the risk of coronary disorders and hypercholesterolemia. Statins are also involved in immunomodulation, which might influence the outcome of bacterial infection. Hence, a possible effect of statin treatment on Listeriosis was explored in mice. Statin treatment prior to subsequent L. monocytogenes infection strikingly reduced bacterial burden in liver and spleen (up to 100-fold and reduced histopathological lesions. Statin-treatment in infected macrophages resulted in increased IL-12p40 and TNF-α and up to 4-fold reduced bacterial burden within 6 hours post infection, demonstrating a direct effect of statins on limiting bacterial growth in macrophages. Bacterial uptake was normal investigated in microbeads and GFP-expressing Listeria experiments by confocal microscopy. However, intracellular membrane-bound cholesterol level was decreased, as analyzed by cholesterol-dependent filipin staining and cellular lipid extraction. Mevalonate supplementation restored statin-inhibited cholesterol biosynthesis and reverted bacterial growth in Listeria monocytogenes but not in listeriolysin O (LLO-deficient Listeria. Together, these results suggest that statin pretreatment increases protection against L. monocytogenes infection by reducing membrane cholesterol in macrophages and thereby preventing effectivity of the cholesterol-dependent LLO-mediated phagosomal escape of bacteria.

  7. Listeriolysin S, a novel peptide haemolysin associated with a subset of lineage I Listeria monocytogenes.

    Directory of Open Access Journals (Sweden)

    Paul D Cotter

    Full Text Available Streptolysin S (SLS is a bacteriocin-like haemolytic and cytotoxic virulence factor that plays a key role in the virulence of Group A Streptococcus (GAS, the causative agent of pharyngitis, impetigo, necrotizing fasciitis and streptococcal toxic shock syndrome. Although it has long been thought that SLS and related peptides are produced by GAS and related streptococci only, there is evidence to suggest that a number of the most notorious Gram-positive pathogenic bacteria, including Listeria monocytogenes, Clostridium botulinum and Staphylococcus aureus, produce related peptides. The distribution of the L. monocytogenes cluster is particularly noteworthy in that it is found exclusively among a subset of lineage I strains; i.e., those responsible for the majority of outbreaks of listeriosis. Expression of these genes results in the production of a haemolytic and cytotoxic factor, designated Listeriolysin S, which contributes to virulence of the pathogen as assessed by murine- and human polymorphonuclear neutrophil-based studies. Thus, in the process of establishing the existence of an extended family of SLS-like modified virulence peptides (MVPs, the genetic basis for the enhanced virulence of a proportion of lineage I L. monocytogenes may have been revealed.

  8. Sex specific gene regulation and expression QTLs in mouse macrophages from a strain intercross.

    Directory of Open Access Journals (Sweden)

    Jeffrey M Bhasin

    Full Text Available BACKGROUND: A powerful way to identify genes for complex traits it to combine genetic and genomic methods. Many trait quantitative trait loci (QTLs for complex traits are sex specific, but the reason for this is not well understood. METHODOLOGY/PRINCIPAL FINDINGS: RNA was prepared from bone marrow derived macrophages of 93 female and 114 male F(2 mice derived from a strain intercross between apoE-deficient mice on the AKR and DBA/2 genetic backgrounds, and was subjected to transcriptome profiling using microarrays. A high density genome scan was performed using a mouse SNP chip, and expression QTLs (eQTLs were located for expressed transcripts. Using suggestive and significant LOD score cutoffs of 3.0 and 4.3, respectively, thousands of eQTLs in the female and male cohorts were identified. At the suggestive LOD threshold the majority of the eQTLs were trans eQTLs, mapping unlinked to the position of the gene. Cis eQTLs, which mapped to the location of the gene, had much higher LOD scores than trans eQTLs, indicating their more direct effect on gene expression. The majority of cis eQTLs were common to both males and females, but only approximately 1% of the trans eQTLs were shared by both sexes. At the significant LOD threshold, the majority of eQTLs were cis eQTLs, which were mostly sex-shared, while the trans eQTLs were overwhelmingly sex-specific. Pooling the male and female data, 31% of expressed transcripts were expressed at different levels in males vs. females after correction for multiple testing. CONCLUSIONS/SIGNIFICANCE: These studies demonstrate a large sex effect on gene expression and trans regulation, under conditions where male and female derived cells were cultured ex vivo and thus without the influence of endogenous sex steroids. These data suggest that eQTL data from male and female mice should be analyzed separately, as many effects, such as trans regulation are sex specific.

  9. Presence and expression of hydrogenase specific C-terminal endopeptidases in cyanobacteria

    Directory of Open Access Journals (Sweden)

    Lindblad Peter

    2003-05-01

    Full Text Available Abstract Background Hydrogenases catalyze the simplest of all chemical reactions: the reduction of protons to molecular hydrogen or vice versa. Cyanobacteria can express an uptake, a bidirectional or both NiFe-hydrogenases. Maturation of those depends on accessory proteins encoded by hyp-genes. The last maturation step involves the cleavage of a ca. 30 amino acid long peptide from the large subunit by a C-terminal endopeptidase. Until know, nothing is known about the maturation of cyanobacterial NiFe-hydrogenases. The availability of three complete cyanobacterial genome sequences from strains with either only the uptake (Nostoc punctiforme ATCC 29133/PCC 73102, only the bidirectional (Synechocystis PCC 6803 or both NiFe-hydrogenases (Anabaena PCC 7120 prompted us to mine these genomes for hydrogenase maturation related genes. In this communication we focus on the presence and the expression of the NiFe-hydrogenases and the corresponding C-terminal endopeptidases, in the three strains mentioned above. Results We identified genes encoding putative cyanobacterial hydrogenase specific C-terminal endopeptidases in all analyzed cyanobacterial genomes. The genes are not part of any known hydrogenase related gene cluster. The derived amino acid sequences show only low similarity (28–41% to the well-analyzed hydrogenase specific C-terminal endopeptidase HybD from Escherichia coli, the crystal structure of which is known. However, computational secondary and tertiary structure modeling revealed the presence of conserved structural patterns around the highly conserved active site. Gene expression analysis shows that the endopeptidase encoding genes are expressed under both nitrogen-fixing and non-nitrogen-fixing conditions. Conclusion Anabaena PCC 7120 possesses two NiFe-hydrogenases and two hydrogenase specific C-terminal endopeptidases but only one set of hyp-genes. Thus, in contrast to the Hyp-proteins, the C-terminal endopeptidases are the only known

  10. Tissue-specific mRNA expression profiles of human solute carrier 35 transporters.

    Science.gov (United States)

    Nishimura, Masuhiro; Suzuki, Satoshi; Satoh, Tetsuo; Naito, Shinsaku

    2009-01-01

    Pairs of forward and reverse primers and TaqMan probes specific to each of 23 human solute carrier 35 (SLC35) transporters were prepared. The mRNA expression level of each target transporter was analyzed in total RNA from single and pooled specimens of adult human tissues (adipose tissue, adrenal gland, bladder, bone marrow, brain, cerebellum, colon, heart, kidney, liver, lung, mammary gland, ovary, pancreas, peripheral leukocytes, placenta, prostate, retina, salivary gland, skeletal muscle, small intestine, smooth muscle, spinal cord, spleen, stomach, testis, thymus, thyroid gland, tonsil, trachea, and uterus), from pooled specimens of fetal human tissues (brain, heart, kidney, liver, spleen, and thymus), and from three human cell lines (HeLa cell line ATCC#: CCL-2, human cell line Hep G2, and human breast carcinoma cell line MDA-435) by real-time reverse transcription PCR using an Applied Biosystems 7500 Fast Real-Time PCR System. The mRNA expression of SLC35As, SLC35Bs, SLC35Cs, SLC35D1, SLC35D2, SLC35Es, and SLC35F5 was found to be ubiquitous in both adult and fetal tissues. SLC35D3 mRNA was expressed at the highest levels in the adult retina. SLC35F1 mRNA was expressed at high levels in the adult and fetal brain. SLC35F2 mRNA was expressed at the highest levels in the adult salivary gland. Both SLC35F3 and SLC35F4 mRNAs were expressed at the highest levels in the adult cerebellum. Further, individual differences in the mRNA expression levels of human SLC35 transporters in the liver were also evaluated. Our newly determined expression profiles were used to study the gene expression in 31 adult human tissues, 6 fetal human tissues, and 3 cell lines, and tissues with high transcriptional activity for human SLC35 transporters were identified. These results are expected to be valuable for research concerning the clinical diagnosis of disease.

  11. Gender-Associated Differential Expression of Cytokines in Specific Areas of the Brain During Helminth Infection

    Science.gov (United States)

    López-Griego, Lorena; Nava-Castro, Karen Elizabeth; López-Salazar, Valeria; Hernández-Cervantes, Rosalía; Tiempos Guzmán, Nelly; Muñiz-Hernández, Saé; Hernández-Bello, Romel; Besedovsky, Hugo O.; Pavón, Lenin; Becerril Villanueva, Luis Enrique

    2015-01-01

    Intraperitoneal infection with Taenia crassiceps cysticerci in mice alters several behaviors, including sexual, aggressive, and cognitive function. Cytokines and their receptors are produced in the central nervous system (CNS) by specific neural cell lineages under physiological and pathological conditions, regulating such processes as neurotransmission. This study is aimed to determine the expression patterns of cytokines in various areas of the brain in normal and T. crassiceps-infected mice in both genders and correlate them with the pathology of the CNS and parasite counts. IL-4, IFN-γ, and TNF-α levels in the hippocampus and olfactory bulb increased significantly in infected male mice, but IL-6 was downregulated in these regions in female mice. IL-1β expression in the hippocampus was unaffected by infection in either gender. Our novel findings demonstrate a clear gender-associated pattern of cytokine expression in specific areas of the brain in mammals that parasitic infection can alter. Thus, we hypothesize that intraperitoneal infection is sensed by the CNS of the host, wherein cytokines are important messengers in the host–parasite neuroimmunoendocrine network. PMID:25495255

  12. Epigenetic regulation of cell type-specific expression patterns in the human mammary epithelium.

    Directory of Open Access Journals (Sweden)

    Reo Maruyama

    2011-04-01

    Full Text Available Differentiation is an epigenetic program that involves the gradual loss of pluripotency and acquisition of cell type-specific features. Understanding these processes requires genome-wide analysis of epigenetic and gene expression profiles, which have been challenging in primary tissue samples due to limited numbers of cells available. Here we describe the application of high-throughput sequencing technology for profiling histone and DNA methylation, as well as gene expression patterns of normal human mammary progenitor-enriched and luminal lineage-committed cells. We observed significant differences in histone H3 lysine 27 tri-methylation (H3K27me3 enrichment and DNA methylation of genes expressed in a cell type-specific manner, suggesting their regulation by epigenetic mechanisms and a dynamic interplay between the two processes that together define developmental potential. The technologies we developed and the epigenetically regulated genes we identified will accelerate the characterization of primary cell epigenomes and the dissection of human mammary epithelial lineage-commitment and luminal differentiation.

  13. Tissue-specific alterations in expression and function of P-glycoprotein in streptozotocininduced diabetic rats

    Institute of Scientific and Technical Information of China (English)

    Lu-lu ZHANG; Guang-ji WANG; Lin XIE; Liang LU; Shi JIN; Xin-yue JING; Dan YAO; Nan HU; Li LIU; Ru DUAN; Xiao-dong LIU

    2011-01-01

    Aim: To investigate the changes of expression and function of P-glycoprotein (P-GP) in cerebral cortex, hippocampus, liver, intestinal mucosa and kidney of streptozocin-induced diabetic rats.Methods: Diabetic rats were prepared via a single dose of streptozocin (65 mg/kg, ip). Abcb1/P-GP mRNA and protein expression levels in tissues were evaluated using quantitative real time polymerase chain reaction (QRT-PCR) analysis and Western blot, respectively.P-GP function was investigated via measuring tissue-to-plasma concentration ratios and body fluid excretion percentages of rhodamine 123.Results: In 5- and 8-week diabetic rats, Abcb1a mRNA levels were significantly decreased in cerebral cortices and intestinal mucosa,but dramatically increased in hippocampus and kidney. In liver, the level was increased in 5-week diabetic rats, and decreased in 8-week diabetic rats. Abcb1b mRNA levels were increased in cerebral cortex, hippocampus and kidney, but reduced in liver and intestinal mucosa in the diabetic rats. Western blot results were in accordance with the alterations of Abcb1a mRNA levels in most tissues examined. P-GP activity was markedly decreased in most tissues of diabetic rats, except kidney tissues.Conclusion: Alterations in the expression and function of Abcb1/P-GP under diabetic conditions are tissue specific, Abcb1 specific and diabetic duration-dependent.

  14. A highly sensitive and specific system for large-scale gene expression profiling

    Directory of Open Access Journals (Sweden)

    Wang Hui-Yun

    2008-01-01

    Full Text Available Abstract Background Rapid progress in the field of gene expression-based molecular network integration has generated strong demand on enhancing the sensitivity and data accuracy of experimental systems. To meet the need, a high-throughput gene profiling system of high specificity and sensitivity has been developed. Results By using specially designed primers, the new system amplifies sequences in neighboring exons separated by big introns so that mRNA sequences may be effectively discriminated from other highly related sequences including their genes, unprocessed transcripts, pseudogenes and pseudogene transcripts. Probes used for microarray detection consist of sequences in the two neighboring exons amplified by the primers. In conjunction with a newly developed high-throughput multiplex amplification system and highly simplified experimental procedures, the system can be used to analyze >1,000 mRNA species in a single assay. It may also be used for gene expression profiling of very few (n = 100 or single cells. Highly reproducible results were obtained from duplicate samples with the same number of cells, and from those with a small number (100 and a large number (10,000 of cells. The specificity of the system was demonstrated by comparing results from a breast cancer cell line, MCF-7, and an ovarian cancer cell line, NCI/ADR-RES, and by using genomic DNA as starting material. Conclusion Our approach may greatly facilitate the analysis of combinatorial expression of known genes in many important applications, especially when the amount of RNA is limited.

  15. Consistent metagenes from cancer expression profiles yield agent specific predictors of chemotherapy response

    Directory of Open Access Journals (Sweden)

    Pusztai Lajos

    2011-07-01

    Full Text Available Abstract Background Genome scale expression profiling of human tumor samples is likely to yield improved cancer treatment decisions. However, identification of clinically predictive or prognostic classifiers can be challenging when a large number of genes are measured in a small number of tumors. Results We describe an unsupervised method to extract robust, consistent metagenes from multiple analogous data sets. We applied this method to expression profiles from five "double negative breast cancer" (DNBC (not expressing ESR1 or HER2 cohorts and derived four metagenes. We assessed these metagenes in four similar but independent cohorts and found strong associations between three of the metagenes and agent-specific response to neoadjuvant therapy. Furthermore, we applied the method to ovarian and early stage lung cancer, two tumor types that lack reliable predictors of outcome, and found that the metagenes yield predictors of survival for both. Conclusions These results suggest that the use of multiple data sets to derive potential biomarkers can filter out data set-specific noise and can increase the efficiency in identifying clinically accurate biomarkers.

  16. Developmentally sensitive markers of personality functioning in adolescents: Age-specific and age-neutral expressions.

    Science.gov (United States)

    Debast, Inge; Rossi, Gina; Feenstra, Dineke; Hutsebaut, Joost

    2017-04-01

    Criterion D of the Diagnostic and Statistical Manual of Mental Disorders (5th ed.; DSM-5; American Psychiatric Association [APA], 2013) refers to a possible onset of personality disorders (PDs) in adolescence and in Section II the development/course in adolescence is described by some typical characteristics for several PDs. Yet, age-specific expressions of PDs are lacking in Section III. We urgently need a developmentally sensitive assessment instrument that differentiates developmental and contextual changes on the one hand from expressions of personality pathology on the other hand. Therefore we investigated which items of the Severity Indices for Personality Problems-118 (SIPP-118) were developmentally sensitive throughout adolescence and adulthood and which could be considered more age-specific markers requiring other content or thresholds over age groups. Applying item response theory (IRT) we detected differential item functioning (DIF) in 36% of the items in matched samples of 639 adolescents versus 639 adults. The DIF across age groups mainly reflected a different degree of symptom expressions for the same underlying level of functioning. The threshold for exhibiting symptoms given a certain degree of personality dysfunction was lower in adolescence for areas of personality functioning related to the Self and Interpersonal domains. Some items also measured a latent construct of personality functioning differently across adolescents and adults. This suggests that several facets of the SIPP-118 do not solely measure aspects of personality pathology in adolescents, but likely include more developmental issues. (PsycINFO Database Record (c) 2017 APA, all rights reserved).

  17. Prostate specific antigen gene expression in androgen insensitive prostate carcinoma subculture cell line.

    Science.gov (United States)

    Tsui, Ke-Hung; Feng, Tsui-Hsia; Chung, Li-Chuan; Chao, Chun-Hsiang; Chang, Phei-Lang; Juang, Horng-Heng

    2008-01-01

    A novel prostate cancer cell line (PC-J) was isolated from an androgen independent non-prostate specific antigen (non-PSA) producing carcinoma cell line. The homologous correlation between PC-J and PC-3 was determined by short tandem repeat analysis. The PSA promoter activity was detected by transient expression assay in the PC-J and LNCaP cells but not in androgen insensitive PC-3 cells. When the PC-J cells were cotransfected with androgen receptor, androgen receptor coactivators and PSA reporter vector cells, the reporter assays indicated that nuclear receptor coactivator 4 (NCOA4) but not androgen receptor activator 24 (ARA24) increased the sensitivity and maximum stimulation of dihydrotestosterone (DHT)-inducing PSA promoter activity. The RT-PCR assays revealed that the expression of several tumor markers, including interleukin-6, prostate stem cell antigen (PSCA), prostate epithelium-specific Ets transcription factor (PDEF) and matriptase, was lower in the PC-J cells than in the PC-3 cells. This cell model elucidated the regulation of PSA expression and enabled comparison of the gene profile at different stages of metastasis in prostatic carcinoma.

  18. Effects of specific expression of iaaL gene in tobacco tapetum on pollen embryogenesis

    Institute of Scientific and Technical Information of China (English)

    杨洪全; 卫志明; 许智宏

    1997-01-01

    The indoleacetic-acid-lysine synthetase (iaaL) gene from Pseudomonas syringae subsp. savastanoi was fused to tobacco tapetum-specific expression promoter TA29, and introduced into tobacco. The expression pattern of this chimeric gene was studied, and the endogenous indoleacetic acid (IAA) levels in different organs were assayed. The results demonstrated that TA29 promoter was only able to direct the specific expression of iaaL gene in transgenic tobacco anther, and resulted in the decrease of endogenous IAA levels in transgenic tobacco anther. No significant phe-notype variation was observed among the transgenic plants at the whole plant level. However, the percentage of pollen embryogenesis was reduced to 11 % when anthers of the transgenic plants were cultured on the modified hormone-free Nistch H (NH) medium, while those of both CK1 and CK2 (see sec. 1.2.2) were more than 50% ; when the an-thers were cultured on NH medium supplemented with 0. 2 mg/L IAA, the percentage of pollen embryogenesis re-stor

  19. Oral neutrophils display a site-specific phenotype characterized by expression of T-cell receptors.

    Science.gov (United States)

    Lakschevitz, Flavia S; Aboodi, Guy M; Glogauer, Michael

    2013-10-01

    Neutrophils, key cells of the innate immune system, were previously thought to be terminally differentiated cells, incapable of altering their gene expression after differentiation and maturation in the bone marrow. Only recently has it been shown that neutrophils perform rapid and complex changes in gene expression during inflammatory responses. Previous work by the authors has demonstrated differences in reactive oxygen species production between oral and peripheral blood neutrophils isolated from patients with chronic periodontitis, suggesting that oral neutrophils present with a unique oral phenotype. Understanding differences in the neutrophil transcriptome after transit from circulation into the site of inflammation will give new insights into how these innate immune cells function during inflammation. Venous blood and oral rinse samples were obtained from five healthy participants. Blood neutrophils were isolated using a standard gradient method. Oral neutrophils were isolated through nylon mesh filters of different pore sizes (40 to 10 μm). RNA was purified from isolated neutrophils, and gene expression microarray analysis was completed. Results were confirmed by quantitative reverse transcription-polymerase chain reaction and immunofluorescence microscopy. Oral neutrophil isolation, which is critical when analyzing gene expression with samples clear of epithelial cell contamination, was optimized. It was also demonstrated that oral neutrophils present with a significant increase in T-cell receptor expression compared with circulating neutrophils, suggesting a role for oral neutrophils in crosstalk between the innate and adaptive immune system in the mouth. To the best of the authors' knowledge, it is demonstrated for the first time that, compared with circulating neutrophils, oral neutrophils present a site-specific gene expression profile in healthy individuals.

  20. Optimized over-expression of [FeFe] hydrogenases with high specific activity in Clostridium acetobutylicum

    Energy Technology Data Exchange (ETDEWEB)

    von Abendroth, Gregory; Stripp, Sven; Happe, Thomas [Ruhr-Universitaet Bochum, Lehrstuhl fuer Biochemie der Pflanzen, AG Photobiotechnologie, 44780 Bochum (Germany); Silakov, Alexey [Max-Planck-Institut fuer Bioanorganische Chemie, 45470 Muelheim an der Ruhr (Germany); Croux, Christian; Soucaille, Philippe; Girbal, Laurence [UMR5504, UMR792 Ingenierie des Systemes Biologiques et des Procedes, CNRS, INRA, INSA, 31400 Toulouse (France)

    2008-11-15

    It was previously shown that Clostridium acetobutylicum is capable to over-express various [FeFe] hydrogenases although the protein yield was low. In this study we report on doubling the yield of the clostridial hydrogenase by replacing the native gene hydA1{sub Ca} with a recombinant one via homologous recombination. The purified protein HydA1{sub Ca} shows an unexpected high specific activity (up to 2257 {mu}mol H{sub 2} min{sup -1} mg{sup -1}) for hydrogen evolution. Furthermore, the highly active green algal hydrogenase HydA1{sub Cr} from Chlamydomonas reinhardtii was heterologously expressed in C. acetobutylicum, and purified with increased yield (1 mg protein per liter of cells) and high activity (625 {mu}mol H{sub 2} min{sup -1} mg{sup -1}). EPR studies demonstrate intact H-clusters for homologously and heterologously expressed [FeFe] hydrogenases in the CO-inhibited oxidized redox state, and prove the high efficiency of the C. acetobutylicum expression system. (author)

  1. Specific expression of human intelectin-1 in malignant pleural mesothelioma and gastrointestinal goblet cells.

    Directory of Open Access Journals (Sweden)

    Kota Washimi

    Full Text Available Malignant pleural mesothelioma (MPM is a fatal tumor. It is often hard to discriminate MPM from metastatic tumors of other types because currently, there are no reliable immunopathological markers for MPM. MPM is differentially diagnosed by some immunohistochemical tests on pathology specimens. In the present study, we investigated the expression of intelectin-1, a new mesothelioma marker, in normal tissues in the whole body and in many cancers, including MPM, by immunohistochemical analysis. We found that in normal tissues, human intelectin-1 was mainly secreted from gastrointestinal goblet cells along with mucus into the intestinal lumen, and it was also expressed, to a lesser extent, in mesothelial cells and urinary epithelial cells. Eighty-eight percent of epithelioid-type MPMs expressed intelectin-1, whereas sarcomatoid-type MPMs, biphasic MPMs, and poorly differentiated MPMs were rarely positive for intelectin-1. Intelectin-1 was not expressed in other cancers, except in mucus-producing adenocarcinoma. These results suggest that intelectin-1 is a better marker for epithelioid-type MPM than other mesothelioma markers because of its specificity and the simplicity of pathological assessment. Pleural intelectin-1 could be a useful diagnostic marker for MPM with applications in histopathological identification of MPM.

  2. Expression of specific inflammasome gene modules stratifies older individuals into two extreme clinical and immunological states

    Science.gov (United States)

    Furman, David; Chang, Junlei; Lartigue, Lydia; Bolen, Christopher R; Haddad, François; Gaudilliere, Brice; Ganio, Edward A; Fragiadakis, Gabriela K; Spitzer, Matthew H; Douchet, Isabelle; Daburon, Sophie; Moreau, Jean-François; Nolan, Garry P; Blanco, Patrick; Déchanet-Merville, Julie; Dekker, Cornelia L; Jojic, Vladimir; Kuo, Calvin J; Davis, Mark M; Faustin, Benjamin

    2017-01-01

    Low-grade, chronic inflammation has been associated with many diseases of aging, but the mechanisms responsible for producing this inflammation remain unclear. Inflammasomes can drive chronic inflammation in the context of an infectious disease or cellular stress, and they trigger the maturation of interleukin-1β (IL-1β). Here we find that the expression of specific inflammasome gene modules stratifies older individuals into two extremes: those with constitutive expression of IL-1β, nucleotide metabolism dysfunction, elevated oxidative stress, high rates of hypertension and arterial stiffness; and those without constitutive expression of IL-1β, who lack these characteristics. Adenine and N4-acetylcytidine, nucleotide-derived metabolites that are detectable in the blood of the former group, prime and activate the NLRC4 inflammasome, induce the production of IL-1β, activate platelets and neutrophils and elevate blood pressure in mice. In individuals over 85 years of age, the elevated expression of inflammasome gene modules was associated with all-cause mortality. Thus, targeting inflammasome components may ameliorate chronic inflammation and various other age-associated conditions. PMID:28092664

  3. Lysine-specific demethylase 1 expression in zebrafish during the early stages of neuronal development

    Institute of Scientific and Technical Information of China (English)

    Aihong Li; Yong Sun; Changming Dou; Jixian Chen; Jie Zhang

    2012-01-01

    Lysine-specific demethylase 1 (Lsd1) is associated with transcriptional coregulation via the modulation of histone methylation. The expression pattern and function of zebrafish Lsd1 has not, however, been studied. Here, we describe the pattern of zebrafish Lsd1 expression during different development stages. In the zebrafish embryo, lsd1 mRNA was present during the early cleavage stage, indicating that maternally derived Lsd1 protein is involved in embryonic patterning. During embryogenesis from 0 to 48 hours post-fertilization (hpf), the expression of lsd1 mRNA in the embryo was ubiquitous before 12 hpf and then became restricted to the anterior of the embryo (particularly in the brain) from 24 hpf to 72 hpf. Inhibition of Lsd1 activity (by exposure to tranylcypromine) or knockdown of lsd1 expression (by morpholino antisense oligonucleotide injection) led to the loss of cells in the brain and to a dramatic downregulation of neural genes, including gad65, gad75, and reelin, but not hey1. These findings indicate an important role of Lsd1 during nervous system development in zebrafish.

  4. Hodgkin Lymphoma Cell Lines Are Characterized by a Specific miRNA Expression Profile

    Directory of Open Access Journals (Sweden)

    Johan H. Gibcus

    2009-02-01

    Full Text Available Hodgkin lymphoma (HL is derived from preapoptotic germinal center B cells, although a general loss of B cell phenotype is noted. Using quantitative reverse transcription-polymerase chain reaction and miRNA microarray, we determined the microRNA (miRNA profile of HL and compared this with the profile of a panel of B-cell non-Hodgkin lymphomas. The two methods showed a strong correlation for the detection of miRNA expression levels. The HL-specific miRNA included miR-17-92 cluster members, miR-16, miR-21, miR-24, and miR-155. Using a large panel of cell lines, we found differential expression between HL and other B-cell lymphoma-derived cell lines for 27 miRNA. A significant down-regulation in HL compared to non-Hodgkin lymphoma was observed only for miR-150. Next, we performed target gene validation of predicted target genes for miR-155, which is highly expressed in HL and is differentially expressed between HL and Burkitt lymphoma. Using luciferase reporter assays, we validated 11 predicted miR-155 target genes in three different HL cell lines. We demonstrated that AGTR1, FGF7, ZNF537, ZIC3, and IKBKE are true miR-155 target genes in HL.

  5. Transgene expression in Penaeus monodon cells: evaluation of recombinant baculoviral vectors with shrimp specific hybrid promoters.

    Science.gov (United States)

    Puthumana, Jayesh; Philip, Rosamma; Bright Singh, I S

    2016-08-01

    It has been realized that shrimp cell immortalization may not be accomplished without in vitro transformation by expressing immortalizing gene in cells. In this process, efficiency of transgene expression is confined to the ability of vectors to transmit gene of interests to the genome. Over the years, unavailability of such vectors has been hampering application of such a strategy in shrimp cells. We report the use of recombinant baculovirus mediated transduction using hybrid promoter system for transgene expression in lymphoid cells of Penaeus monodon. Two recombinant baculovirus vectors with shrimp viral promoters (WSSV-Ie1 and IHHNV-P2) were constructed (BacIe1-GFP and BacP2-GFP) and green fluorescent protein (GFP) used as the transgene. The GFP expression in cells under the control of hybrid promoters, PH-Ie1 or PH-P2, were analyzed and confirmed in shrimp cells. The results indicate that the recombinant baculovirus with shrimp specific viral promoters (hybrid) can be employed for delivery of foreign genes to shrimp cells for in vitro transformation.

  6. Nuclear Compartmentalization Contributes to Stage-Specific Gene Expression Control in Trypanosoma cruzi

    Science.gov (United States)

    Pastro, Lucía; Smircich, Pablo; Di Paolo, Andrés; Becco, Lorena; Duhagon, María A.; Sotelo-Silveira, José; Garat, Beatriz

    2017-01-01

    In the protozoan parasite Trypanosoma cruzi, as in other trypanosomatids, transcription of protein coding genes occurs in a constitutive fashion, producing large polycistronic transcription units. These units are composed of non-functionally related genes which are pervasively processed to yield each mRNA. Therefore, post-transcriptional processes are crucial to regulate gene expression. Considering that nuclear compartmentalization could contribute to gene expression regulation, we comparatively studied the nuclear, cytoplasmic and whole cell transcriptomes of the non-infective epimastigote stage of T. cruzi, using RNA-Seq. We found that the cytoplasmic transcriptome tightly correlates with the whole cell transcriptome and both equally correlate with the proteome. Nonetheless, 1,200 transcripts showed differential abundance between the nuclear and cytoplasmic fractions. For the genes with transcript content augmented in the nucleus, significant structural and compositional differences were found. The analysis of the reported epimastigote translatome and proteome, revealed scarce ribosome footprints and encoded proteins for them. Ontology analyses unveiled that many of these genes are distinctive of other parasite life-cycle stages. Finally, the relocalization of transcript abundance in the metacyclic trypomastigote infective stage was confirmed for specific genes. While gene expression is strongly dependent on transcript steady-state level, we here highlight the importance of the distribution of transcripts abundance between compartments in T. cruzi. Particularly, we show that nuclear compartmentation is playing an active role in the developmental stage determination preventing off-stage expression. PMID:28243589

  7. PATOGENESIS DE Listeria monocytogenes, MICROORGANISMO ZOONOTICO EMERGENTE.

    OpenAIRE

    Torres, Kirvis; Sierra, Sara; Potou, Raul; Carrascal, Ana; Mercado, Marcela

    2005-01-01

    Listeria monocytogenes además de ser un paradigma para la investigación inmunológica se ha convertido en sistema modelo apropiado para el análisis de los mecanismos moleculares del parasitismo intracelular de otras bacterias. Investigadores en el área de la inmunología se interesaron en este microorganismo cuando se reconoció el riesgo que representaba para la salud pública y la seguridad en la industria de alimentos. Desde mediados de los años 80’s se ha investigado la biología molecular de ...

  8. A cucumber mosaic virus based expression system for the production of porcine circovirus specific vaccines.

    Directory of Open Access Journals (Sweden)

    Akos Gellért

    Full Text Available Potential porcine circovirus type 2 (PCV2 capsid protein epitopes, suitable for expression on the surface of cucumber mosaic virus (CMV particles were determined by a thorough analysis of the predicted PCV capsid protein structure. The ab initio protein structure prediction was carried out with fold recognition and threading methods. The putative PCV epitopes were selected on the basis of PCV virion models and integrated into the plant virus coat protein, after amino acid position 131. The recombinants were tested for infectivity and stability on different Nicotiana species and stable recombinant virus particles were purified. The particles were tested for their ability to bind to PCV induced porcine antibodies and used for specific antibody induction in mice and pigs. The results showed that PCV epitopes expressed on the CMV surface were recognized by the porcine antibodies and they were also able to induce PCV specific antibody response. Challenge experiment with PCV2 carried out in immunized pigs showed partial protection against the infection. Based on these results it was concluded that specific antiviral vaccine production for the given pathogen was feasible, offering an inexpensive way for the mass production of such vaccines.

  9. Identification of specific sensory neuron populations for study of expressed ion channels.

    Science.gov (United States)

    Ramachandra, Renuka; McGrew, Stephanie; Elmslie, Keith

    2013-12-24

    Sensory neurons transmit signals from various parts of the body to the central nervous system. The soma for these neurons are located in the dorsal root ganglia that line the spinal column. Understanding the receptors and channels expressed by these sensory afferent neurons could lead to novel therapies for disease. The initial step is to identify the specific subset of sensory neurons of interest. Here we describe a method to identify afferent neurons innervating the muscles by retrograde labeling using a fluorescent dye DiI (1,1'-dioctadecyl-3,3,3',3'-tetramethylindocarbocyanine perchlorate). Understanding the contribution of ion channels to excitation of muscle afferents could help to better control excessive excitability induced by certain disease states such as peripheral vascular disease or heart failure. We used two approaches to identify the voltage dependent ion channels expressed by these neurons, patch clamp electrophysiology and immunocytochemistry. While electrophysiology plus pharmacological blockers can identify functional ion channel types, we used immunocytochemistry to identify channels for which specific blockers were unavailable and to better understand the ion channel distribution pattern in the cell population. These techniques can be applied to other areas of the nervous system to study specific neuronal groups.

  10. Early meiotic-specific protein expression in post-natal rat ovaries.

    Science.gov (United States)

    Zhang, P; Lv, L X; Xing, W J

    2010-12-01

    Recent studies in mice challenged the basic doctrine that most mammalian females lose neo-oogenesis in post-natal ovaries. In order to provide more information in other species, we examined post-natal rat ovaries by histological sections and detected the germline cell marker protein RVLG (rat vasa-like gene), BrdU (5-bromodeoxyuridine) incorporation in RVLG-expressing cells, for identification of germline cells undergoing mitosis and meiosis in the ovarian surface epithelium (OSE). We also detected the expression of early meiotic-specific proteins disruption of meiotic control 1 (DMC1), stimulated by retinoic acid gene 8 (STRA8) and synaptonemal complex protein 3 (SCP3) by immunohistochemical analysis and Western blotting, and the transcript of SCP1, SCP3 and Sporulation-specific protein 11 (SPO11) by RT-PCR in the post-natal ovarian cortex. However we failed in detecting large ovoid cells in the OSE, which may represent the putative germline stem cells (GSCs) that are supposed to sustain neo-oogenesis, and the transcription of the meiotic-specific genes SCP1, SCP3 and SPO11 by RT-PCR as well as the translation of DMC1, STRA8 and SCP3 by Western blotting. Our data support the postulation that there is no neo-oogenesis occurring in the OSE of rat post-natal ovary through meiosis of GSCs.

  11. Atrogin-1, a muscle-specific F-box protein highly expressed during muscle atrophy

    Science.gov (United States)

    Gomes, M. D.; Lecker, S. H.; Jagoe, R. T.; Navon, A.; Goldberg, A. L.

    2001-01-01

    Muscle wasting is a debilitating consequence of fasting, inactivity, cancer, and other systemic diseases that results primarily from accelerated protein degradation by the ubiquitin-proteasome pathway. To identify key factors in this process, we have used cDNA microarrays to compare normal and atrophying muscles and found a unique gene fragment that is induced more than ninefold in muscles of fasted mice. We cloned this gene, which is expressed specifically in striated muscles. Because this mRNA also markedly increases in muscles atrophying because of diabetes, cancer, and renal failure, we named it atrogin-1. It contains a functional F-box domain that binds to Skp1 and thereby to Roc1 and Cul1, the other components of SCF-type Ub-protein ligases (E3s), as well as a nuclear localization sequence and PDZ-binding domain. On fasting, atrogin-1 mRNA levels increase specifically in skeletal muscle and before atrophy occurs. Atrogin-1 is one of the few examples of an F-box protein or Ub-protein ligase (E3) expressed in a tissue-specific manner and appears to be a critical component in the enhanced proteolysis leading to muscle atrophy in diverse diseases.

  12. Sarcoidosis Th17 Cells are ESAT-6 Antigen Specific but Demonstrate Reduced IFN-γ Expression

    Science.gov (United States)

    Richmond, Bradley W.; Ploetze, Kristen; Isom, Joan; Chambers-Harris, Isfahan; Braun, Nicole A.; Taylor, Thyneice; Abraham, Susamma; Mageto, Yolanda; Culver, Dan A.; Oswald-Richter, Kyra A.; Drake, Wonder P.

    2013-01-01

    Rationale Sarcoidosis is a granulomatous disease of unknown etiology. Many patients with sarcoidosis demonstrate antigen-specific immunity to mycobacterial virulence factors. Th-17 cells are crucial to the immune response in granulomatous inflammation, and have recently been shown to be present in greater numbers in the peripheral blood and bronchoalveolar lavage (BAL) fluid (BALF) of sarcoidosis patients than healthy controls. It is unclear whether Th-17 cells in sarcoidosis are specific for mycobacterial antigens, or whether they have similar functionality to control Th-17 cells. Methods Flow cytometry was used to determine the numbers of Th-17 cells present in the peripheral blood and BALF of patients with sarcoidosis, the percentage of Th-17 cells that were specific to the mycobacterial virulence factor ESAT-6, and as well as to assess IFN-γ expression in Th-17 cells following polyclonal stimulation. Results Patients with sarcoidosis had greater numbers of Th-17 cells in the peripheral blood and BALF than controls and produced significantly more extracellular IL-17A (p=0.03 and p=0.02, respectively). ESAT-6 specific Th-17 cells were present in both peripheral blood and BALF of sarcoidosis patients (psarcoidosis patients produced less IFN-γ than healthy controls. Conclusions Patients with sarcoidosis have mycobacterial antigen-specific Th-17 cells peripherally and in sites of active sarcoidosis involvement. Despite the Th1 immunophenotype of sarcoidosis immunology, the Th-17 cells have reduced IFN-γ expression, compared to healthy controls. This reduction in immunity may contribute to sarcoidosis pathogenesis. PMID:23073617

  13. Stomatin-related olfactory protein, SRO, specifically expressed in the murine olfactory sensory neurons.

    Science.gov (United States)

    Kobayakawa, Ko; Hayashi, Reiko; Morita, Kenji; Miyamichi, Kazunari; Oka, Yuichiro; Tsuboi, Akio; Sakano, Hitoshi

    2002-07-15

    We identified a stomatin-related olfactory protein (SRO) that is specifically expressed in olfactory sensory neurons (OSNs). The mouse sro gene encodes a polypeptide of 287 amino acids with a calculated molecular weight of 32 kDa. SRO shares 82% sequence similarity with the murine stomatin, 78% with Caenorhabditis elegans MEC-2, and 77% with C. elegans UNC-1. Unlike other stomatin-family genes, the sro transcript was present only in OSNs of the main olfactory epithelium. No sro expression was seen in vomeronasal neurons. SRO was abundant in most apical dendrites of OSNs, including olfactory cilia. Immunoprecipitation revealed that SRO associates with adenylyl cyclase type III and caveolin-1 in the low-density membrane fraction of olfactory cilia. Furthermore, anti-SRO antibodies stimulated cAMP production in fractionated cilia membrane. SRO may play a crucial role in modulating odorant signals in the lipid rafts of olfactory cilia.

  14. MudPIT analysis of alkaline tolerance by Listeria monocytogenes strains recovered as persistent food factory contaminants.

    Science.gov (United States)

    Nilsson, Rolf E; Latham, Roger; Mellefont, Lyndal; Ross, Tom; Bowman, John P

    2012-05-01

    Alkaline solutions are used to clean food production environments but the role of alkaline resistance in persistent food factory contamination by Listeria monocytogenes is unknown. We used shotgun proteomics to characterise alkaline adapted L. monocytogenes recovered as persistent and transient food factory contaminants. Three unrelated strains were studied including two persistent and a transient food factory contaminant determined using multilocus sequence typing (MLST). The strains were adapted to growth at pH 8.5 and harvested in exponential phase. Protein extracts were analysed using multidimensional protein identification technology (MudPIT) and protein abundance compared by spectra counting. The strains elicited core responses to alkaline growth including modulation of intracellular pH, stabilisation of cellular processes and reduced cell-division, independent to lineage, MLST or whether the strains were transient or persistent contaminants. Alkaline adaptation by all strains corresponded to that expected in stringent-response induced cells, with protein expression supporting metabolic shifts concordant with elevated alarmone production and indicating that the alkaline-stringent response results from energy rather than nutrient limitation. We believe this is the first report describing induction of a stringent response in different L. monocytogenes strains by alkaline pH under non-limiting growth conditions. The work emphasises the need for early intervention to avoid persistent food factory contamination by L. monocytogenes.

  15. Improved adhesive properties of recombinant bifidobacteria expressing the Bifidobacterium bifidum-specific lipoprotein BopA

    Directory of Open Access Journals (Sweden)

    Gleinser Marita

    2012-06-01

    Full Text Available Abstract Background Bifidobacteria belong to one of the predominant bacterial groups in the intestinal microbiota of infants and adults. Several beneficial effects on the health status of their human hosts have been demonstrated making bifidobacteria interesting candidates for probiotic applications. Adhesion of probiotics to the intestinal epithelium is discussed as a prerequisite for colonisation of and persistence in the gastrointestinal tract. Results In the present study, 15 different strains of bifidobacteria were tested for adhesion. B. bifidum was identified as the species showing highest adhesion to all tested intestinal epithelial cell (IEC lines. Adhesion of B. bifidum S17 to IECs was strongly reduced after treatment of bacteria with pronase. These results strongly indicate that a proteinaceous cell surface component mediates adhesion of B. bifidum S17 to IECs. In silico analysis of the currently accessible Bifidobacterium genomes identified bopA encoding a lipoprotein as a B. bifidum-specific gene previously shown to function as an adhesin of B. bifidum MIMBb75. The in silico results were confirmed by Southern Blot analysis. Furthermore, Northern Blot analysis demonstrated that bopA is expressed in all B. bifidum strains tested under conditions used to cultivate bacteria for adhesion assays. The BopA gene was successfully expressed in E. coli and purified by Ni-NTA affinity chromatography as a C-terminal His6-fusion. Purified BopA had an inhibitory effect on adhesion of B. bifidum S17 to IECs. Moreover, bopA was successfully expressed in B. bifidum S17 and B. longum/infantis E18. Strains overexpressing bopA showed enhanced adhesion to IECs, clearly demonstrating a role of BopA in adhesion of B. bifidum strains. Conclusions BopA was identified as a B. bifidum-specific protein involved in adhesion to IECs. Bifidobacterium strains expressing bopA show enhanced adhesion. Our results represent the first report on recombinant

  16. Lineage specific expression of Polycomb Group Proteins in human embryonic stem cells in vitro.

    Science.gov (United States)

    Pethe, Prasad; Pursani, Varsha; Bhartiya, Deepa

    2015-05-01

    Human embryonic (hES) stem cells are an excellent model to study lineage specification and differentiation into various cell types. Differentiation necessitates repression of specific genes not required for a particular lineage. Polycomb Group (PcG) proteins are key histone modifiers, whose primary function is gene repression. PcG proteins form complexes called Polycomb Repressive Complexes (PRCs), which catalyze histone modifications such as H2AK119ub1, H3K27me3, and H3K9me3. PcG proteins play a crucial role during differentiation of stem cells. The expression of PcG transcripts during differentiation of hES cells into endoderm, mesoderm, and ectoderm lineage is yet to be shown. In-house derived hES cell line KIND1 was differentiated into endoderm, mesoderm, and ectoderm lineages; followed by characterization using RT-PCR for HNF4A, CDX2, MEF2C, TBX5, SOX1, and MAP2. qRT-PCR and western blotting was performed to compare expression of PcG transcripts and proteins across all the three lineages. We observed that cells differentiated into endoderm showed upregulation of RING1B, BMI1, EZH2, and EED transcripts. Mesoderm differentiation was characterized by significant downregulation of all PcG transcripts during later stages. BMI1 and RING1B were upregulated while EZH2, SUZ12, and EED remained low during ectoderm differentiation. Western blotting also showed distinct expression of BMI1 and EZH2 during differentiation into three germ layers. Our study shows that hES cells differentiating into endoderm, mesoderm, and ectoderm lineages show distinct PcG expression profile at transcript and protein level.

  17. Enteroendocrine cells are specifically marked by cell surface expression of claudin-4 in mouse small intestine.

    Directory of Open Access Journals (Sweden)

    Takahiro Nagatake

    Full Text Available Enteroendocrine cells are solitary epithelial cells scattered throughout the gastrointestinal tract and produce various types of hormones, constituting one of the largest endocrine systems in the body. The study of these rare epithelial cells has been hampered by the difficulty in isolating them because of the lack of specific cell surface markers. Here, we report that enteroendocrine cells selectively express a tight junction membrane protein, claudin-4 (Cld4, and are efficiently isolated with the use of an antibody specifi