WorldWideScience

Sample records for monocytogenes cultures relative

  1. Viable but non-culturable Listeria monocytogenes on parsley leaves and absence of recovery to a culturable state.

    Science.gov (United States)

    Dreux, N; Albagnac, C; Federighi, M; Carlin, F; Morris, C E; Nguyen-the, C

    2007-10-01

    To investigate the presence of viable but non-culturable Listeria monocytogenes during survival on parsley leaves under low relative humidity (RH) and to evaluate the ability of L. monocytogenes to recover from VBNC to culturable state under satured humidity. Under low RH (47-69%) on parsley leaves, the initial number of L. monocytogenes populations counted on non selective media (10(9) L. monocytogenes per leaf on TSA) was reduced by 6 log10 scales in 15 days, whereas number of viable L. monocytogenes counted under the microscope was reduced by 3-4 log10 scales, indicating the presence of VBNC cells. This was demonstrated on three L. monocytogenes strains (EGDe, Bug 1995 and LmP60). Changing from low to 100% RH permitted an increase of the culturable counts of L. monocytogenes and this growth was observed only when residual culturable cells were present. Moreover, VBNC L. monocytogenes inoculated on parsley leaves did not become culturable after incubation under 100% RH. Dry conditions induced VBNC L. monocytogenes on parsley leaves but these VBNC were likely unable to recover culturability after transfer to satured humidity. Enumeration on culture media presumably under-estimates the number of viable L. monocytogenes on fresh produce after exposure to low RH.

  2. Effect of starter cultures on survival of Listeria monocytogenes in Čajna sausage

    Science.gov (United States)

    Bošković, M.; Tadić, V.; Đorđević, J.; Glišić, M.; Lakićević, B.; Dimitrijević, M.; Baltić, M. Ž.

    2017-09-01

    The aim of the study was to evaluate the survival of Listeria monocytogenes during the production of Čajna sausage with short maturation time. Sausage batter was inoculated with three different serotypes 4b and serotype 1/2a of L. monocytogenes. Control sausages were without any starter culture added; the second batch was inoculated with strains of Lactobacillus sakei, Staphylococcus carnosus and Staphylococcus xylosus, and the third batch was inoculated with strains of Debaryomyces hansenii, Lactobacillus sakei, Pediococcus acidilactici, Pediococcus pentosaceus, Staphylococcus carnosus and Staphylococcus xylosus. After 18 days of ripening, L. monocytogenes was not detected in any of the sausages, but during this fermentation and drying, the numbers of this pathogen was lower in the sausages inoculated with starter cultures.

  3. Stochastic modelling of Listeria monocytogenes single cell growth in cottage cheese with mesophilic lactic acid bacteria from aroma producing cultures

    DEFF Research Database (Denmark)

    Østergaard, Nina Bjerre; Christiansen, Lasse Engbo; Dalgaard, Paw

    2015-01-01

    . 2014. Modelling the effect of lactic acid bacteria from starter- and aroma culture on growth of Listeria monocytogenes in cottage cheese. International Journal of Food Microbiology. 188, 15-25]. Growth of L. monocytogenes single cells, using lag time distributions corresponding to three different......A stochastic model was developed for simultaneous growth of low numbers of Listeria monocytogenes and populations of lactic acid bacteria from the aroma producing cultures applied in cottage cheese. During more than two years, different batches of cottage cheese with aroma culture were analysed...

  4. Enhanced biofilm formation in dual-species culture of Listeria monocytogenes and Ralstonia insidiosa

    Directory of Open Access Journals (Sweden)

    Yunfeng Xu

    2017-09-01

    Full Text Available In the natural environments microorganisms coexist in communities as biofilms. Since foodborne pathogens have varying abilities to form biofilms, investigation of bacterial interactions in biofilm formation may enhance our understanding of the persistence of these foodborne pathogens in the environment. Thus the objective of this study was to investigate the interactions between Listeria monocytogenes and Ralstonia insidiosa in dual species biofilms. Biofilm development after 24 h was measured using crystal violet in 96-well microtiter plate. Scanning electron microscopy and cell enumeration were employed after growth on stainless steel coupons. When compared with their single species counterparts, the dual species biofilms exhibited a significant increase in biofilm biomass. The number of L. monocytogenes in co-culture biofilms on stainless steel also increased significantly. However, there was no effect on the biofilm formation of L. monocytogenes when cultured with R. insidiosa separated by a semi-permeable membrane-linked compartment or cultured in R. insidiosa cell-free supernatant, indicating that direct cell-cell contact is critical for this interaction.

  5. Fate of viable but non-culturable Listeria monocytogenes in pig manure microcosms

    Directory of Open Access Journals (Sweden)

    Jeremy eDesneux

    2016-03-01

    Full Text Available The fate of two strains of L. monocytogenes and their ability to become viable but non-culturable (VBNC was investigated in microcosms containing piggery effluents (two raw manures and two biologically treated manures stored for two months at 8°C and 20°C. Levels of L. monocytogenes were estimated using the culture method, qPCR, and propidium monoazide treatment combined with qPCR (qPCRPMA. The chemical composition and the microbial community structure of the manures were also analysed. The strains showed similar decline rates and persisted up to 63 days. At day zero, the percentage of VBNC cells among viable cells was higher in raw manures (81.5-94.8% than in treated manures (67.8-79.2%. The changes in their proportion over time depended on the temperature and on the type of effluent: the biggest increase was observed in treated manures at 20°C and the smallest increase in raw manures at 8°C. The chemical parameters had no influence on the behaviour of the strains, but decrease of the persistence of viable cells was associated with an increase in the microbial richness of the manures. This study demonstrated that storing manure altered the culturability of L. monocytogenes, which rapidly entered the VBNC state, and underlines the importance of including VBNC cells when estimating the persistence of the pathogens in farm effluents.

  6. Leucocins 4010 from Leuconostoc carnosum cause a matrix related decrease in intracellular pH of Listeria monocytogenes

    DEFF Research Database (Denmark)

    Fang, Weihuan; Budde, Birgitte Bjørn; Siegumfeldt, Henrik

    2006-01-01

    A mixed culture of single cells of Listeria monocytogenes and the bacteriocin producing Leuconostoc carnosum 4010 showed growth inhibition of L. monocytogenes, although the intracellular pH (pHi) of L. monocytogenes followed by fluorescence ratio imaging microscopy was not affected. Furthermore, L...

  7. In vitro detection of pathogenic Listeria monocytogenes from food sources by conventional, molecular and cell culture method

    Directory of Open Access Journals (Sweden)

    J.A. Khan

    2013-09-01

    Full Text Available Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO. A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG; R: CCTCCAGAGTGATCGATGTT complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR. PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%, followed by fish meat (4.0%, and then beef (2.5%. Among various milk and milk products, curd (2.0% showed the highest prevalence, followed by raw milk (1.3%. The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 µL and 50 µL of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro resulted positive in twenty four

  8. Effect of co-culture with enterocinogenic E. faecium on L. monocytogenes key virulence gene expression

    Directory of Open Access Journals (Sweden)

    Eleftherios H. Drosinos

    2016-08-01

    Full Text Available The aim of the present study was to assess the expression of key virulence genes during co-culture of L. monocytogenes with a bacteriocinogenic E. faecium strain in liquid growth medium. For that purpose, BHI broth was inoculated with 7 log CFU·mL–1 L. monocytogenes and 4, 5 or 6 log CFU·mL–1 E. faecium. Sampling took place after 8 and 24 h of incubation, corresponding to the maximum and minimum of enterocin production, respectively. The RNA was extracted, stabilized and expression of prfA, sigB, hly, plcA, plcB, inlA, inlB, inlC and inlJ, was assessed by RT-qPCR. Most of the genes were downregulated during co-culture at 5 °C. Moreover, a statistically significant effect of the inoculum level was evident in most of the cases. On the contrary, no effect on the transcription level of most of the genes was observed during co-culture at 37 °C.

  9. Radio sensibility of listeria monocytogenes in pure culture and frozen contaminated shrimps and stored them at -18 deg C

    International Nuclear Information System (INIS)

    Rubio M V, T.; Espinoza, J.; L Sanchez, M.V.

    1997-01-01

    Full text: Listeria monocytogenes has been recognized for a number of years as a food pathogen bacteria. Ionizing radiation is a new technology and an excellent method to eliminate this microorganism form frozen food. The sensitivity of Listeria monocytogenes serotype 01 and 04 to irradiation, in pure culture and frozen shrimps was investigated. The D 10 values were of 0,26-0,37 kGy in pure culture and frozen shrimps, respectively. The D 10 founded were similar to those reported by the literature under similar conditions. Doses of 6 kGy were enough to eliminate a contamination of 10 6 -10 7 ufc/ml of L. Monocytogenes in frozen shrimps and storage them during 200 days at 18 deg C

  10. Impact of environmental factors on the culturability and viability of Listeria monocytogenes under conditions encountered in food processing plants.

    Science.gov (United States)

    Overney, Anaïs; Jacques-André-Coquin, Joséphine; Ng, Patricia; Carpentier, Brigitte; Guillier, Laurent; Firmesse, Olivier

    2017-03-06

    The ability of Listeria monocytogenes to adhere to and persist on surfaces for months or even years may be responsible for its transmission from contaminated surfaces to food products. Hence the necessity to find effective means to prevent the establishment of L. monocytogenes in food processing environments. The aim of this study was to assess, through a fractional experimental design, the environmental factors that could affect the survival of L. monocytogenes cells on surfaces to thereby prevent the persistence of this pathogen in conditions mimicking those encountered in food processing plants: culture with smoked salmon juice or meat exudate, use of two materials with different hygiene status, biofilm of L. monocytogenes in pure-culture or dual-culture with a Pseudomonas fluorescens strain, application of a drying step after cleaning and disinfection (C&D) and comparison of two strains of L. monocytogenes. Bacterial survival was assessed by culture, qPCR to quantify total cells, and propidium monoazide coupled with qPCR to quantify viable cells and highlight viable but non-culturable (VBNC) cells. Our results showed that failure to apply C&D causes cell persistence on surfaces. Moreover, the sanitation procedure leads only to a loss of culturability and appearance of VBNC populations. However, an additional daily drying step after C&D optimises the effectiveness of these procedures to reduce culturable populations. Our results reinforce the importance to use molecular tools to monitor viable pathogens in food processing plants to avoid underestimating the amounts of cells using only methods based on cell culture. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. Listeria monocytogenes strains show large variations in competitive growth in mixed culture biofilms and suspensions with bacteria from food processing environments.

    Science.gov (United States)

    Heir, Even; Møretrø, Trond; Simensen, Andreas; Langsrud, Solveig

    2018-06-20

    Interactions and competition between resident bacteria in food processing environments could affect their ability to survive, grow and persist in microhabitats and niches in the food industry. In this study, the competitive ability of L. monocytogenes strains grown together in separate culture mixes with other L. monocytogenes (L. mono mix), L. innocua (Listeria mix), Gram-negative bacteria (Gram- mix) and with a multigenera mix (Listeria + Gram- mix) was investigated in biofilms on stainless steel and in suspensions at 12 °C. The mixed cultures included resident bacteria from processing surfaces in meat and salmon industry represented by L. monocytogenes (n = 6), L. innocua (n = 5) and Gram-negative bacteria (n = 6; Acinetobacter sp., Pseudomonas fragi, Pseudomonas fluorescens, Serratia liquefaciens, Stenotrophomonas maltophilia). Despite hampered in growth in mixed cultures, L. monocytogenes established in biofilms with counts at day nine between 7.3 and 9.0 log per coupon with the lowest counts in the Listeria + G- mix that was dominated by Pseudomonas. Specific L. innocua inhibited growth of L. monocytogenes strains differently; inhibition that was further enhanced by the background Gram-negative microbiota. In these multispecies and multibacteria cultures, the growth competitive effects lead to the dominance of a strong competitor L. monocytogenes strain that was only slightly inhibited by L. innocua and showed strong competitive abilities in mixed cultures with resident Gram-negative bacteria. The results indicates complex patterns of bacterial interactions and L. monocytogenes inhibition in the multibacteria cultures that only partially depend on cell contact and likely involve various antagonistic and bacterial tolerance mechanisms. The study indicates large variations among L. monocytogenes in their competitiveness under multibacterial culture conditions that should be considered in further studies towards understanding of L

  12. Survival of Listeria monocytogenes in simulated gastrointestinal system and transcriptional profiling of stress- and adhesion-related genes

    DEFF Research Database (Denmark)

    Jiang, Lingli; Olesen, Inger; Andersen, Thomas

    2010-01-01

    -related genes after exposure to the conditions similar to those encountered in the mouth, stomach, and small intestine. None of the L. monocytogenes strains investigated could survive in the gastric juice at pH 2.5 or 3.0. Their survival increased at higher pH (3.5 and 4.0) in the gastric stress. Relative...... afterpassing through the simulated gastrointestinal tract, whereas that of the adhesion-related gene ami was downregulated. Taken together, this study revealed that L. monocytogenes strains enhanced the expression of stressrelated genes and decreased the transcription of adhesion-related gene in order...

  13. Aging and cellular defense mechanisms: age-related changes in resistance of mice to Listeria monocytogenes.

    OpenAIRE

    Patel, P J

    1981-01-01

    Age-related changes in resistance of mice to infection with Listeria monocytogenes were investigated. One-month-old mice exhibited the least resistance, and the resistance level increased over the first few months to reach a maximum by 8 months. Increase in age thereafter was accompanied by a slow but progressive decrease in resistance. Thus, 50% lethal doses for 1-, 8-, and 24-month-old mice were 10(4.2), 10(6.6), and 10(5.2), respectively. In spite of differences in resistance, the growth o...

  14. Enhanced biofilm formation in dual-species culture of Listeria monocytogenes and Ralstonia insidiosa

    Science.gov (United States)

    In the environment, many microorganisms coexist in communities as biofilms. The objective of this study was to investigate the interactions between Listeria monocytogenes and Ralstonia insidiosa in dual species biofilms. Biofilm development was measured using crystal violet in 96-well microtiter pla...

  15. Isolation and detection of Listeria monocytogenes in poultry meat by standard culture methods and PCR

    Science.gov (United States)

    Kureljušić, J.; Rokvić, N.; Jezdimirović, N.; Kureljušić, B.; Pisinov, B.; Karabasil, N.

    2017-09-01

    Listeria is the genus of a bacteria found in soil and water and some animals, including poultry and cattle. It can be present in raw milk and food made from raw milk. It can also live in food processing plants and contaminate a variety of processed meats. Microscopically, Listeria species appear as small, Gram-positive rods, which are sometimes arranged in short chains. In direct smears, they can be coccoid, so they can be mistaken for streptococci. Longer cells can resemble corynebacteria. Flagella are produced at room temperature but not at 37°C. Haemolytic activity on blood agar has been used as a marker to distinguish Listeria monocytogenes among other Listeria species, but it is not an absolutely definitive criterion. Further biochemical characterization is necessary to distinguish between the different Listeria species. The objective of this study was to detect, isolate and identify Listeria monocytogenes from poultry meat. Within a period of six months from January to June 2017, a total of 15 samples were collected. Three samples were positive for the presence of Listeria monocytogenes. Biochemical and microbiological tests as well as PCR technique using specific primers were used to confirm L. Monocytogenes in the samples.

  16. The Distribution of Listeria in Pasture-Raised Broiler Farm Soils Is Potentially Related to University of Vermont Medium Enrichment Bias toward Listeria innocua over Listeria monocytogenes

    Science.gov (United States)

    Locatelli, Aude; Lewis, Micah A.; Rothrock, Michael J.

    2017-01-01

    The occurrence of Listeria monocytogenes has been widely investigated in the poultry production chain from the processing plant to the final product. However, limited data are available on Listeria species, including Listeria monocytogenes, in the poultry farm environment. Therefore, fecal and soil samples from 37 pastured poultry flocks from 10 all-natural farms over 3 years were assessed to determine the prevalence and diversity of Listeria within these alternative poultry farm environments using standard cultural and molecular methods. Listeria species were isolated in 15% of poultry farm samples and included Listeria innocua (65.7%), L. monocytogenes (17.4%), and Listeria welshimeri (15.1%). Additional multiplex PCR serotyping showed group 1/2a-3a to be the most dominant L. monocytogenes serovar group. Based on these results, monoculture growth experiments were conducted on four Listeria soil isolates (three L. monocytogenes isolates representing the three recovered serovar groups and one L. innocua isolate) to determine if culture medium [tripticase soy broth (TSB) and University of Vermont modified Listeria enrichment broth (UVM)], inoculum concentration (102 or 105 CFU/ml), or incubation temperature (20, 30, and 42°C) differentially affected these Listeria species. Overall, very few significant growth differences were observed between the behavior of the three L. monocytogenes isolates (representing the three recovered serovar groups) under the growth conditions tested. Alternatively, at 30°C in UVM with the lower inoculum concentration, the L. innocua isolate had a significantly shorter lag phase than the L. monocytogenes isolates. In coculture growth studies under these same incubation conditions, the lag phase of L. innocua and L. monocytogenes was similar, but the final concentration of L. innocua was significantly higher than L. monocytogenes. However, cocultures in UVM for high inoculum concentration did not show preferential growth of L. innocua

  17. The Distribution of Listeria in Pasture-Raised Broiler Farm Soils Is Potentially Related to University of Vermont Medium Enrichment Bias toward Listeria innocua over Listeria monocytogenes.

    Science.gov (United States)

    Locatelli, Aude; Lewis, Micah A; Rothrock, Michael J

    2017-01-01

    The occurrence of Listeria monocytogenes has been widely investigated in the poultry production chain from the processing plant to the final product. However, limited data are available on Listeria species, including Listeria monocytogenes , in the poultry farm environment. Therefore, fecal and soil samples from 37 pastured poultry flocks from 10 all-natural farms over 3 years were assessed to determine the prevalence and diversity of Listeria within these alternative poultry farm environments using standard cultural and molecular methods. Listeria species were isolated in 15% of poultry farm samples and included Listeria innocua (65.7%), L. monocytogenes (17.4%), and Listeria welshimeri (15.1%). Additional multiplex PCR serotyping showed group 1/2a-3a to be the most dominant L. monocytogenes serovar group. Based on these results, monoculture growth experiments were conducted on four Listeria soil isolates (three L. monocytogenes isolates representing the three recovered serovar groups and one L. innocua isolate) to determine if culture medium [tripticase soy broth (TSB) and University of Vermont modified Listeria enrichment broth (UVM)], inoculum concentration (10 2 or 10 5  CFU/ml), or incubation temperature (20, 30, and 42°C) differentially affected these Listeria species. Overall, very few significant growth differences were observed between the behavior of the three L. monocytogenes isolates (representing the three recovered serovar groups) under the growth conditions tested. Alternatively, at 30°C in UVM with the lower inoculum concentration, the L. innocua isolate had a significantly shorter lag phase than the L. monocytogenes isolates. In coculture growth studies under these same incubation conditions, the lag phase of L. innocua and L. monocytogenes was similar, but the final concentration of L. innocua was significantly higher than L. monocytogenes . However, cocultures in UVM for high inoculum concentration did not show preferential growth of L

  18. Hispanic Culture and Relational Cultural Theory

    Science.gov (United States)

    Ruiz, Elizabeth

    2005-01-01

    Traditional personality theories do not consider the impact of culture on personality development. Yet, to provide culturally relevant services to the increasing Hispanic population in the U.S., more culturally relevant theories must be identified. This paper presents Relational Cultural Theory (RCT) as an alternative model to understanding…

  19. Biochemical and molecular characteristics of Listeria monocytogenes isolates from a prosthetic mitral heart valve-bearing patient´s blood cultures

    Directory of Open Access Journals (Sweden)

    Nilma Cintra Leal

    2013-09-01

    Full Text Available Background: In Brazil, listeriosis is not a notifiable disease; thus, the incidence of Brazilian cases remains unknown. Listeria monocytogenes is not always included in automated systems, and its detection depends on the high skill level of microbiology laboratory professionals. This paper describes the characteristics of L. monocytogenes isolates fortuitously obtained from an endocarditis case in Recife, PE, Brazil. Methods: Six bacterial isolates obtained from six blood cultures from a 28-year-old male bearing a prosthetic mitral heart valve were analyzed by PCR using primers specific of L. monocytogenes to confirm a presumptive identification, determine the serotype and presence of the virulence genes (inlA, inlB, inlC, inlJ, hly, plcA, actA, prfA in an attempt to determine the Listeria genotype by PCR-ribotyping. Results: The samples were identified as L. monocytogenes 4b. All investigated virulence genes were amplified by PCR, and the identity of the amplified segments was confirmed by sequencing. A deletion of 105 base pairs was detected in the actA gene. All of the samples generated the same PCR-ribotype pattern, clustered into a single ribotype, and were considered a single strain. Conclusion: L. monocytogenes infection should be considered in endocarditis differential diagnoses, especially among high-risk groups, due to its high pathogenicity and the environmental ubiquity.

  20. BIOCHEMICAL AND MOLECULAR CHARACTERISTICS OF LISTERIA MONOCYTOGENES ISOLATES FROM A PROSTHETIC MITRAL HEART VALVE-BEARING PATIENT´S BLOOD CULTURES

    Directory of Open Access Journals (Sweden)

    Nilma Cintra Lea

    2013-09-01

    Full Text Available Background: In Brazil, listeriosis is not a notifiable disease; thus, the incidence of Brazilian cases remains unknown. Listeria monocytogenes is not always included in automated systems, and its detection depends on the high skill level of microbiology laboratory professionals. This paper describes the characteristics of L. monocytogenes isolates fortuitously obtained from an endocarditis case in Recife, PE, Brazil. Methods: Six bacterial isolates obtained from six blood cultures from a 28-year-old male bearing a prosthetic mitral heart valve were analyzed by PCR using primers specific of L. monocytogenes to confirm a presumptive identification, determine the serotype and presence of the virulence genes (inlA, inlB, inlC, inlJ, hly, plcA, actA, prfA in an attempt to determine the Listeria genotype by PCR-ribotyping. Results: The samples were identified as L. monocytogenes 4b. All investigated virulence genes were amplified by PCR, and the identity of the amplified segments was confirmed by sequencing. A deletion of 105 base pairs was detected in the actA gene. All of the samples generated the same PCR-ribotype pattern, clustered into a single ribotype, and were considered a single strain. Conclusion: L. monocytogenes infection should be considered in endocarditis differential diagnoses, especially among high-risk groups, due to its high pathogenicity and the environmental ubiquity.

  1. Co-Culture with Listeria monocytogenes within a Dual-Species Biofilm Community Strongly Increases Resistance of Pseudomonas putida to Benzalkonium Chloride

    Science.gov (United States)

    Giaouris, Efstathios; Chorianopoulos, Nikos; Doulgeraki, Agapi; Nychas, George-John

    2013-01-01

    Biofilm formation is a phenomenon occurring almost wherever microorganisms and surfaces exist in close proximity. This study aimed to evaluate the possible influence of bacterial interactions on the ability of Listeria monocytogenes and Pseudomonas putida to develop a dual-species biofilm community on stainless steel (SS), as well as on the subsequent resistance of their sessile cells to benzalkonium chloride (BC) used in inadequate (sub-lethal) concentration (50 ppm). The possible progressive adaptability of mixed-culture biofilms to BC was also investigated. To accomplish these, 3 strains per species were left to develop mixed-culture biofilms on SS coupons, incubated in daily renewable growth medium for a total period of 10 days, under either mono- or dual-species conditions. Each day, biofilm cells were exposed to disinfection treatment. Results revealed that the simultaneous presence of L. monocytogenes strongly increased the resistance of P. putida biofilm cells to BC, while culture conditions (mono-/dual-species) did not seem to significantly influence the resistance of L. monocytogenes biofilm cells. BC mainly killed L. monocytogenes cells when this was applied against the dual-species sessile community during the whole incubation period, despite the fact that from the 2nd day this community was mainly composed (>90%) of P. putida cells. No obvious adaptation to BC was observed in either L. monocytogenes or P. putida biofilm cells. Pulsed field gel electrophoresis (PFGE) analysis showed that the different strains behaved differently with regard to biofilm formation and antimicrobial resistance. Such knowledge on the physiological behavior of mixed-culture biofilms could provide the information necessary to control their formation. PMID:24130873

  2. Co-culture with Listeria monocytogenes within a dual-species biofilm community strongly increases resistance of Pseudomonas putida to benzalkonium chloride.

    Directory of Open Access Journals (Sweden)

    Efstathios Giaouris

    Full Text Available Biofilm formation is a phenomenon occurring almost wherever microorganisms and surfaces exist in close proximity. This study aimed to evaluate the possible influence of bacterial interactions on the ability of Listeria monocytogenes and Pseudomonas putida to develop a dual-species biofilm community on stainless steel (SS, as well as on the subsequent resistance of their sessile cells to benzalkonium chloride (BC used in inadequate (sub-lethal concentration (50 ppm. The possible progressive adaptability of mixed-culture biofilms to BC was also investigated. To accomplish these, 3 strains per species were left to develop mixed-culture biofilms on SS coupons, incubated in daily renewable growth medium for a total period of 10 days, under either mono- or dual-species conditions. Each day, biofilm cells were exposed to disinfection treatment. Results revealed that the simultaneous presence of L. monocytogenes strongly increased the resistance of P. putida biofilm cells to BC, while culture conditions (mono-/dual-species did not seem to significantly influence the resistance of L. monocytogenes biofilm cells. BC mainly killed L. monocytogenes cells when this was applied against the dual-species sessile community during the whole incubation period, despite the fact that from the 2nd day this community was mainly composed (>90% of P. putida cells. No obvious adaptation to BC was observed in either L. monocytogenes or P. putida biofilm cells. Pulsed field gel electrophoresis (PFGE analysis showed that the different strains behaved differently with regard to biofilm formation and antimicrobial resistance. Such knowledge on the physiological behavior of mixed-culture biofilms could provide the information necessary to control their formation.

  3. Dynamics of biofilm formation by Listeria monocytogenes on stainless steel under mono-species and mixed-culture simulated fish processing conditions and chemical disinfection challenges.

    Science.gov (United States)

    Papaioannou, Eleni; Giaouris, Efstathios D; Berillis, Panagiotis; Boziaris, Ioannis S

    2018-02-21

    The progressive ability of a six-strains L. monocytogenes cocktail to form biofilm on stainless steel (SS), under fish-processing simulated conditions, was investigated, together with the biocide tolerance of the developed sessile communities. To do this, the pathogenic bacteria were left to form biofilms on SS coupons incubated at 15°C, for up to 240h, in periodically renewable model fish juice substrate, prepared by aquatic extraction of sea bream flesh, under both mono-species and mixed-culture conditions. In the latter case, L. monocytogenes cells were left to produce biofilms together with either a five-strains cocktail of four Pseudomonas species (fragi, savastanoi, putida and fluorescens), or whole fish indigenous microflora. The biofilm populations of L. monocytogenes, Pseudomonas spp., Enterobacteriaceae, H 2 S producing and aerobic plate count (APC) bacteria, both before and after disinfection, were enumerated by selective agar plating, following their removal from surfaces through bead vortexing. Scanning electron microscopy was also applied to monitor biofilm formation dynamics and anti-biofilm biocidal actions. Results revealed the clear dominance of Pseudomonas spp. bacteria in all the mixed-culture sessile communities throughout the whole incubation period, with the in parallel sole presence of L. monocytogenes cells to further increase (ca. 10-fold) their sessile growth. With respect to L. monocytogenes and under mono-species conditions, its maximum biofilm population (ca. 6logCFU/cm 2 ) was reached at 192h of incubation, whereas when solely Pseudomonas spp. cells were also present, its biofilm formation was either slightly hindered or favored, depending on the incubation day. However, when all the fish indigenous microflora was present, biofilm formation by the pathogen was greatly hampered and never exceeded 3logCFU/cm 2 , while under the same conditions, APC biofilm counts had already surpassed 7logCFU/cm 2 by the end of the first 96h of

  4. Quantifying Listeria monocytogenes prevalence and concentration in minced pork meat and estimating performance of three culture media from presence/absence microbiological testing using a deterministic and stochastic approach.

    Science.gov (United States)

    Andritsos, Nikolaos D; Mataragas, Marios; Paramithiotis, Spiros; Drosinos, Eleftherios H

    2013-12-01

    Listeria monocytogenes poses a serious threat to public health, and the majority of cases of human listeriosis are associated with contaminated food. Reliable microbiological testing is needed for effective pathogen control by food industry and competent authorities. The aims of this work were to estimate the prevalence and concentration of L. monocytogenes in minced pork meat by the application of a Bayesian modeling approach, and also to determine the performance of three culture media commonly used for detecting L. monocytogenes in foods from a deterministic and stochastic perspective. Samples (n = 100) collected from local markets were tested for L. monocytogenes using in parallel the PALCAM, ALOA and RAPID'L.mono selective media according to ISO 11290-1:1996 and 11290-2:1998 methods. Presence of the pathogen was confirmed by conducting biochemical and molecular tests. Independent experiments (n = 10) for model validation purposes were performed. Performance attributes were calculated from the presence-absence microbiological test results by combining the results obtained from the culture media and confirmative tests. Dirichlet distribution, the multivariate expression of a Beta distribution, was used to analyze the performance data from a stochastic perspective. No L. monocytogenes was enumerated by direct-plating (media were best at ruling in L. monocytogenes presence than ruling it out. Sensitivity and specificity varied depending on the culture-dependent method. None of the culture media was perfect in detecting L. monocytogenes in minced pork meat alone. The use of at least two culture media in parallel enhanced the efficiency of L. monocytogenes detection. Bayesian modeling may reduce the time needed to draw conclusions regarding L. monocytogenes presence and the uncertainty of the results obtained. Furthermore, the problem of observing zero counts may be overcome by applying Bayesian analysis, making the determination of a test performance feasible

  5. Listeria monocytogenes: diagnostic problems

    NARCIS (Netherlands)

    Beumer, R.R.; Hazeleger, W.C.

    2003-01-01

    The first isolation methods for the detection of Listeria spp. were generally based on the direct culture of samples on simple agar media, but isolation of the pathogenic Listeria monocytogenes was difficult. In time, new techniques were developed, based on a variety of selective and elective agents

  6. Fødevarebetinget listeria monocytogenes endokarditis

    DEFF Research Database (Denmark)

    Frydland, Martin; Bundgaard, Henning; Moser, Claus

    2014-01-01

    Infection with Listeria monocytogenes is rare and mainly seen in immunosuppressed patients. Infection with L. monocytogenes has a mortality rate of 30%. We present a case report of L. monocytogenes bacteraemia and endocarditis in a 70-year-old man with several co-morbidities and following four...... major surgical procedures. This illustrates the findings and characteristics in one of the 16 patients who died in 2013 and 2014 this summer due to sausage-related L. monocytogenes infection....

  7. Studies on the pathogenesis and survival of different culture forms of Listeria monocytogenes to pulsed UV-light irradiation after exposure to mild-food processing stresses.

    Science.gov (United States)

    Bradley, Derek; McNeil, Brian; Laffey, John G; Rowan, Neil J

    2012-06-01

    The effects of mild conventional food-processing conditions on Listeria monocytogenes survival to pulsed UV (PUV) irradiation and virulence-associated characteristics were investigated. Specifically, this study describes the inability of 10 strains representative of 3 different culture forms or morphotypes of L. monocytogenes to adapt to normally lethal levels of PUV-irradiation after exposure to sub-lethal concentrations of salt (7.5% (w/v) NaCl for 1 h), acid (pH 5.5 for 1 h), heating (48 °C for 1 h) or PUV (UV dose 0.08 μJ/cm(2)). Findings showed that the order of increasing sensitivity of L. monocytogenes of non-adapted and stressed morphotypes to low pH (pH 3.5 for 5 h, adjusted with lactic), high salt (17.5% w/v NaCl for 5 h), heating (60 °C for 1 h) and PUV-irradiation (100 pulses at 7.2 J and 12.8 J, equivalent to UV doses of 2.7 and 8.4 μJ/cm(2) respectively) was typical wild-type smooth (S/WT), atypical filamentous rough (FR) and atypical multiple-cell-chain (MCR) variants. Exposure of L. monocytogenes cells to sub-lethal acid, salt or heating conditions resulted in similar or increased susceptibility to PUV treatments. Only prior exposure to mild heat stressing significantly enhanced invasion of Caco-2 cells, whereas subjection of L. monocytogenes cells to combined sub-lethal salt, acid and heating conditions produced the greatest reduction in invasiveness. Implications of these findings are discussed. This constitutes the first study to show that pre-exposure to mild conventional food-processing stresses enhances sensitivity of different culture morphotypes of L. monocytogenes to PUV, which is growing in popularity as an alternative or complementary approach for decontamination in the food environment. Copyright © 2011 Elsevier Ltd. All rights reserved.

  8. Prevalence and relative risk of Cronobacter spp., Salmonella spp., and Listeria monocytogenes associated with the body surfaces and guts of individual filth flies.

    Science.gov (United States)

    Pava-Ripoll, Monica; Pearson, Rachel E Goeriz; Miller, Amy K; Ziobro, George C

    2012-11-01

    Although flies are important vectors of food-borne pathogens, there is little information to accurately assess the food-related health risk of the presence of individual flies, especially in urban areas. This study quantifies the prevalence and the relative risk of food-borne pathogens associated with the body surfaces and guts of individual wild flies. One hundred flies were collected from the dumpsters of 10 randomly selected urban restaurants. Flies were identified using taxonomic keys before being individually dissected. Cronobacter spp., Salmonella spp., and Listeria monocytogenes were detected using the PCR-based BAX system Q7. Positive samples were confirmed by culture on specific media and through PCR amplification and sequencing or ribotyping. Among collected flies were the housefly, Musca domestica (47%), the blowflies, Lucilia cuprina (33%) and Lucilia sericata (14%), and others (6%). Cronobacter species were detected in 14% of flies, including C. sakazakii, C. turicensis, and C. universalis, leading to the proposal of flies as a natural reservoir of this food-borne pathogen. Six percent of flies carried Salmonella enterica, including the serovars Poona, Hadar, Schwarzengrund, Senftenberg, and Brackenridge. L. monocytogenes was detected in 3% of flies. Overall, the prevalence of food-borne pathogens was three times greater in the guts than on the body surfaces of the flies. The relative risk of flies carrying any of the three pathogens was associated with the type of pathogen, the body part of the fly, and the ambient temperature. These data enhance the ability to predict the microbiological risk associated with the presence of individual flies in food and food facilities.

  9. Culture Negative Listeria monocytogenes Meningitis Resulting in Hydrocephalus and Severe Neurological Sequelae in a Previously Healthy Immunocompetent Man with Penicillin Allergy

    Directory of Open Access Journals (Sweden)

    Shahin Gaini

    2015-01-01

    Full Text Available A previously healthy 74-year-old Caucasian man with penicillin allergy was admitted with evolving headache, confusion, fever, and neck stiffness. Treatment for bacterial meningitis with dexamethasone and monotherapy ceftriaxone was started. The cerebrospinal fluid showed negative microscopy for bacteria, no bacterial growth, and negative polymerase chain reaction for bacterial DNA. The patient developed hydrocephalus on a second CT scan of the brain on the 5th day of admission. An external ventricular catheter was inserted and Listeria monocytogenes grew in the cerebrospinal fluid from the catheter. The patient had severe neurological sequelae. This case report emphasises the importance of covering empirically for Listeria monocytogenes in all patients with penicillin allergy with suspected bacterial meningitis. The case also shows that it is possible to have significant infection and inflammation even with negative microscopy, negative cultures, and negative broad range polymerase chain reaction in cases of Listeria meningitis. Follow-up spinal taps can be necessary to detect the presence of Listeria monocytogenes.

  10. Listeria monocytogenes infection in pregnancy and neonatal sepsis

    Directory of Open Access Journals (Sweden)

    Francesca Pascale

    2008-06-01

    Full Text Available Authors report a fatal neonatal sepsis caused by Listeria monocytogenes. While the diagnostic procedure aimed to identify the microrganism is described, it is emphasized the importance to recover Streptococcus agalactiae (GBS and L. monocytogenes by means of vaginal-rectal swab culture. The intrapartum screening for L. monocytogenes, by Polymerase Chain Reaction (PCR providing results in 75 minutes is also evaluated.

  11. EU-Russia Cultural Relations

    Directory of Open Access Journals (Sweden)

    Elena Sidorova

    2014-05-01

    Full Text Available This article analyzes the link between culture and diplomacy between Russia and the European Union, and shows the importance of cultural relations. It examines the common space of science, education and culture introduced at the 2003 EU-Russia Summit in St. Petersburg and the application of the principles of this concept that were established at the 2005 EU-Russia Summit in Moscow. It then considers EU-Russia collaboration on humanitarian action and the challenges that both parties face in this sphere. It also explains the formation of EU domestic and foreign cultural policy, and the role of European institutions and states in cultural affairs and diplomacy, as well as key elements and mechanisms of contemporary Russian foreign cultural policy. In addition, the article focuses on the European side of post-Soviet EU-Russia cultural relations. This cultural collaboration is defined as a competitive neighbourhood. EU and Russian interests collide: while Europeans try to promote their values, norms and standards within the framework of the European Neighbourhood Policy, Russia seeks to culturally influence and engage in this region for geostrategic and historical reasons. Finally, the article assesses the prospects for the EU-Russia cultural relations and emphasizes the role of ideology in improving such relations.

  12. Prevalence and methodologies for detection, characterization and subtyping of Listeria monocytogenes and L. ivanovii in foods and environmental sources

    Directory of Open Access Journals (Sweden)

    Jin-Qiang Chen

    2017-09-01

    Full Text Available Listeria monocytogenes, one of the most important foodborne pathogens, can cause listeriosis, a lethal disease for humans. L. ivanovii, which is closely related to L. monocytogenes, is also widely distributed in nature and infects mainly warm-blooded ruminants, causing economic loss. Thus, there are high priority needs for methodologies for rapid, specific, cost-effective and accurate detection, characterization and subtyping of L. monocytogenes and L. ivanovii in foods and environmental sources. In this review, we (A described L. monocytogenes and L. ivanovii, world-wide incidence of listeriosis, and prevalence of various L. monocytogenes strains in food and environmental sources; (B comprehensively reviewed different types of traditional and newly developed methodologies, including culture-based, antigen/antibody-based, LOOP-mediated isothermal amplification, matrix-assisted laser desorption ionization-time of flight-mass spectrometry, DNA microarray, and genomic sequencing for detection and characterization of L. monocytogenes in foods and environmental sources; (C comprehensively summarized different subtyping methodologies, including pulsed-field gel electrophoresis, multi-locus sequence typing, ribotyping, and phage-typing, and whole genomic sequencing etc. for subtyping of L. monocytogenes strains from food and environmental sources; and (D described the applications of these methodologies in detection and subtyping of L. monocytogenes in foods and food processing facilities.

  13. Listeria monocytogenes endophthalmitis following keratoconjunctivitis.

    Science.gov (United States)

    Shoughy, Samir S; Tabbara, Khalid F

    2014-01-01

    Endophthalmitis due to endogenous or exogenous bacteria is a rare infection of the eye. We report a case of endophthalmitis following Listeria monocytogenes keratoconjunctivitis in a 27-year-old healthy white male presenting with hand motion visual acuity, right eye mucopurulent conjunctivitis, elevated intraocular pressure, and pigmented hypopyon 6 months post-keratectomy. The conjunctivitis was unresponsive to a 5-day course of topical tobramycin eye drops, and the patient developed keratitis with pain that progressed to endophthalmitis after 21 days. Diagnostic B-scan revealed vitreous exudates. Intraocular fluid specimen showed Gram-positive organisms and the aqueous culture grew penicillin-/aminoglycoside-sensitive L. monocytogenes. The patient was given intravitreal and systemic vancomycin and ceftazidime. The eye was unresponsive to intravenous penicillin and gentamicin; the anterior chamber progressively flattened and developed phthisis bulbi. L. monocytogenes keratoconjunctivitis may lead to bacterial endophthalmitis. Prompt culture and early antibiotic therapy are recommended.

  14. Comparative inhibitory effects of Thymus vulgaris L. essential oil against Staphylococcus aureus, Listeria monocytogenes and mesophilic starter co-culture in cheese-mimicking models.

    Science.gov (United States)

    de Carvalho, Rayssa Julliane; de Souza, Geanny Targino; Honório, Vanessa Gonçalves; de Sousa, Jossana Pereira; da Conceição, Maria Lúcia; Maganani, Marciane; de Souza, Evandro Leite

    2015-12-01

    In the present study, we assessed the effects of Thymus vulgaris L. essential oil (TVEO) on Staphylococcus aureus and Listeria monocytogenes, pathogenic bacteria frequently associated with fresh or low-ripened cheeses (e.g., Brazilian coalho cheese), and on a starter co-culture comprising Lactococcus lactis subsp. lactis and L. lactis subsp. cremoris, which are commonly used for the production of different cheeses. To measure these effects, we determined the minimum inhibitory concentration (MIC) and assessed bacterial cell viability over time in (coalho) cheese-based broth and in a semi-solid (coalho) cheese model at 10 °C. The MIC for TVEO was 2.5 μL/mL against S. aureus and L. monocytogenes, while the MIC was 1.25 μL/mL against the starter co-culture. The TVEO (5 and 2.5 μL/mL) sharply reduced the viable counts of all assayed bacteria in cheese broth over 24 h; although, at 5 μL/mL, TVEO more severely affected the viability of the starter co-culture compared with pathogenic bacteria. The addition of 1.25 μL/g of TVEO in the semi-solid cheese model did not reduce the viable counts of all assayed bacteria. At 2.5 μL/g, TVEO slightly decreased the viable counts of S. aureus, L. monocytogenes and Lactococcus spp. in the semi-solid cheese model over 72 h. The final counts of Lactococcus spp. in a semi-solid cheese model containing 2.5 μL/mL TVEO were lower than those of pathogenic bacteria under the same conditions. These results suggest that the doses of TVEO used to control pathogenic bacteria in fermented dairy products, especially in low-ripened cheeses, should be cautiously considered for potential negative effects on the growth and survival of starter cultures. Copyright © 2015 Elsevier Ltd. All rights reserved.

  15. Listeria monocytogenes endophthalmitis following keratoconjunctivitis

    Directory of Open Access Journals (Sweden)

    Shoughy SS

    2014-01-01

    Full Text Available Samir S Shoughy,1 Khalid F Tabbara1–31The Eye Center and The Eye Foundation for Research in Ophthalmology, Riyadh, Saudi Arabia; 2Department of Ophthalmology, College of Medicine, King Saud University, Riyadh, Saudi Arabia; 3The Wilmer Ophthalmological Institute of The Johns Hopkins University School of Medicine, Baltimore, MD, USAAbstract: Endophthalmitis due to endogenous or exogenous bacteria is a rare infection of the eye. We report a case of endophthalmitis following Listeria monocytogenes keratoconjunctivitis in a 27-year-old healthy white male presenting with hand motion visual acuity, right eye mucopurulent conjunctivitis, elevated intraocular pressure, and pigmented hypopyon 6 months post-keratectomy. The conjunctivitis was unresponsive to a 5-day course of topical tobramycin eye drops, and the patient developed keratitis with pain that progressed to endophthalmitis after 21 days. Diagnostic B-scan revealed vitreous exudates. Intraocular fluid specimen showed Gram-positive organisms and the aqueous culture grew penicillin-/aminoglycoside-sensitive L. monocytogenes. The patient was given intravitreal and systemic vancomycin and ceftazidime. The eye was unresponsive to intravenous penicillin and gentamicin; the anterior chamber progressively flattened and developed phthisis bulbi. L. monocytogenes keratoconjunctivitis may lead to bacterial endophthalmitis. Prompt culture and early antibiotic therapy are recommended.Keywords: conjunctivitis, L. monocytogenes, endophthalmitis

  16. Prevalence and growth of Listeria monocytogenes in naturally contaminated seafood

    DEFF Research Database (Denmark)

    Jørgensen, Lasse Vigel; Huss, Hans Henrik

    1998-01-01

    Listeria monocytogenes contamination of seafood varies with product category. The highest prevalence was found in cold- smoked fish (34-60%), while the lowest was found in heat- treated and cured seafood (4-12%). The prevalence of L. monocytogenes differed greatly in cold-smoked salmon between...... production sites, ranging from monocytogenes. The organism showed moderate growth...... in naturally contaminated cold-smoked, and 'gravad', fish while the growth appeared faster in hot smoked fish. Thus L. monocytogenes is not under control in these products. Finally, the prevalence and growth of L. monocytogenes in naturally contaminated cold-smoked salmon are discussed in relation...

  17. Current Knowledge on Listeria monocytogenes Biofilms in Food-Related Environments: Incidence, Resistance to Biocides, Ecology and Biocontrol

    Directory of Open Access Journals (Sweden)

    Pedro Rodríguez-López

    2018-06-01

    Full Text Available Although many efforts have been made to control Listeria monocytogenes in the food industry, growing pervasiveness amongst the population over the last decades has made this bacterium considered to be one of the most hazardous foodborne pathogens. Its outstanding biocide tolerance capacity and ability to promiscuously associate with other bacterial species forming multispecies communities have permitted this microorganism to survive and persist within the industrial environment. This review is designed to give the reader an overall picture of the current state-of-the-art in L. monocytogenes sessile communities in terms of food safety and legislation, ecological aspects and biocontrol strategies.

  18. Inhibition of Listeria monocytogenes in deli-style turkey breast formulated with cultured celery powder and/or cultured sugar-vinegar blend during storage at 4°c.

    Science.gov (United States)

    Golden, Max C; McDonnell, Lindsey M; Sheehan, Vivien; Sindelar, Jeffrey J; Glass, Kathleen A

    2014-10-01

    Fermentation-derived nitrite (NO2) from vegetable sources is increasingly used as a "clean label" alternative to conventional NaNO2. Previous results suggested that processed meats cured with NO2 derived from a "natural" source had lower antimicrobial activity than did meats produced with chemical NaNO2; however, the differences were likely due to NO2 concentration rather than source. The objective of this study was to compare the antilisterial properties of traditional and clean label alternative curing approaches when combined with antimicrobials in deli-style turkey. Listeria monocytogenes inhibition by NO2 from synthetic and natural sources was validated in deli-style turkey (73 to 74% moisture, 1.8% salt, pH 6.4). Products were prepared with 0, 80, or 120 mg/kg NO2 using purified NaNO2 or cultured celery powder. Additional treatments were supplemented with 3.8% lactate-diacetate blend (LD) or 1% cultured sugar-vinegar blend (DF). Sliced cooked products were surface inoculated with L. monocytogenes at 3 log CFU/g, vacuum packaged, and stored at 4°C for 12 weeks. Results revealed an average 2.4-log increase in L. monocytogenes at 3 weeks in the control without antimicrobials, a 1.3-log increase at 4 weeks for both 80 mg/kg NO2 treatments, and a 1.5-log increase at 6 weeks for the 120 mg/kg NO2 treatments. No significant difference (P > 0.05) in growth inhibition was found between NO2 sources when equivalent concentrations were added. In uncured turkey with 3.8% LD or 1% DF, growth was delayed until 6 weeks, whereas supplementation with LD or DF and 80 mg/kg NO2 from either source delayed listerial growth through 12 weeks. This study confirmed that the concentration of NO2, rather than the source, is a primary factor in enhancing the safety of ready-to-eat meats. Both conventional NO2 treatments and a clean label solution consisting of a fermentation-derived antimicrobial combined with 80 mg/kg naturally derived NO2 inhibited L. monocytogenes through 12 weeks of

  19. Comparison of the Prevalences and Diversities of Listeria Species and Listeria monocytogenes in an Urban and a Rural Agricultural Watershed.

    Science.gov (United States)

    Stea, Emma C; Purdue, Laura M; Jamieson, Rob C; Yost, Chris K; Truelstrup Hansen, Lisbeth

    2015-06-01

    Foods and related processing environments are commonly contaminated with the pathogenic Listeria monocytogenes. To investigate potential environmental reservoirs of Listeria spp. and L. monocytogenes, surface water and point source pollution samples from an urban and a rural municipal water supply watershed in Nova Scotia, Canada, were examined over 18 months. Presumptive Listeria spp. were cultured from 72 and 35% of rural and urban water samples, respectively, with 24% of the positive samples containing two or three different Listeria spp. The L. innocua (56%) and L. welshimeri (43%) groups were predominant in the rural and urban watersheds, respectively. Analysis by the TaqMan assay showed a significantly (P monocytogenes of 62% versus 17% by the culture-based method. Both methods revealed higher prevalences in the rural watershed and during the fall and winter seasons. Elevated Escherichia coli (≥ 100 CFU/100 ml) levels were not associated with the pathogen regardless of the detection method. Isolation of Listeria spp. were associated with 70 times higher odds of isolating L. monocytogenes (odds ratio = 70; P monocytogenes isolates, followed by IVb (16.1%), IIb (15.8%), and IIc (0.4%). L. monocytogenes was detected in cow feces and raw sewage but not in septic tank samples. Pulsotyping of representative water (n = 54) and local human (n = 19) isolates suggested genetic similarities among some environmental and human L. monocytogenes isolates. In conclusion, temperate surface waters contain a diverse Listeria species population and could be a potential reservoir for L. monocytogenes, especially in rural agricultural watersheds. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  20. Listeria monocytogenes impact on mature or old Pseudomonas fluorescens biofilms during growth at 4 and 20ºC

    Directory of Open Access Journals (Sweden)

    Puga eCH

    2016-02-01

    Full Text Available Changes in spatial organization, as observed by confocal laser scanning microscopy (CLSM, viable cell content, biovolume and substratum surface coverage of the biofilms formed on glass by Pseudomonas fluorescens resulting from co-culture with Listeria monocytogenes, were examined. Two strains of L. monocytogenes, two culture temperatures and two biofilm developmental stages were investigated. Both L. monocytogenes strains, a persistently sampled isolate (collected repeatedly along 3 years from a meat factory and Scott A, induced shrinkage in matrix volume, both at 20ºC and 4ºC, in mature or old biofilms, without loss of P. fluorescens cell count per surface unit. The nearly homogeneous pattern of surface coverage shown by mono-species P. fluorescens biofilms, turned into more irregular layouts in co-culture with L. monocytogenes. The upper layer of both mono and dual-species biofilms turned to predominantly consist of matrix, with plenty of viable cells underneath, in old biofilms cultured at 20ºC, but not in those grown at 4ºC. Between 15 and 56% of the substratum area was covered by biofilm, the extent depending on temperature, time and L. monocytogenes strain. Real biofilms in food-related surfaces may thus be very heterogeneous regarding their superficial components, i.e. those more accessible to disinfectants. It is therefore a hygienic challenge to choose an adequate agent to disrupt them.

  1. A Meta-analysis of the Rates of Listeria monocytogenes and Enterococcus in Febrile Infants.

    Science.gov (United States)

    Leazer, Rianna; Perkins, Amy M; Shomaker, Kyrie; Fine, Bryan

    2016-04-01

    A change in the epidemiology of pathogens causing serious bacterial infection (SBI) has been noted since original recommendations were made for the empirical antibiotic choices for young infants with fever. To assess the prevalence of SBI caused by Listeria monocytogenes and Enterococcus species. A literature search was conducted on keywords related to SBI, L. monocytogenes, and Enterococcus spp. infections. Eligible studies were those conducted in the United States and published between January 1998 and June 2014 focusing on SBI in infants≤90 days of age. The rates of urinary tract infection, bacteremia, and meningitis for each pathogen were recorded for each study. Meta-analysis was performed to calculate the prevalence for each pathogen in a random effects model with 0.5 continuity correction added to studies with zero events. Sixteen studies were included. A total of 20,703 blood cultures were included, with weighted prevalences for L. monocytogenes and Enterococcus spp. bacteremia of 0.03% and 0.09%, respectively. A total of 13,775 cerebrospinal fluid cultures were included with event rates (unweighted prevalences) for L. monocytogenes and Enterococcus spp. meningitis of 0.02% and 0.03%, respectively. A total of 18,283 urine cultures were included, with no cases of L. monocytogenes and a weighted prevalence for Enterococcus spp. urinary tract infection of 0.28%. There may have been reporting bias or incomplete retrieval or inadvertent exclusion of relevant studies. SBI caused by L. monocytogenes and Enterococcus spp. in febrile infants is rare, and therefore clinicians may consider a change in empirical antibiotic choices. Copyright © 2016 by the American Academy of Pediatrics.

  2. Occurrence of Listeria monocytogenes in smoked fish in Sokoto ...

    African Journals Online (AJOL)

    The present study was conducted to determine the prevalence of Listeria monocytogenes in smoked fish in Sokoto, Nigeria. A total of 115 different species of smoked fish from the various retail outlets and market places within the metropolis were analysed for the presence of L. monocytogenes using ISO culture method.

  3. Diversity Assessment of Heat Resistance of Listeria monocytogenes Strains in a Continuous-Flow Heating System

    NARCIS (Netherlands)

    Veen, van der S.; Wagendorp, A.; Abee, T.; Wells-Bennik, M.H.J.

    2009-01-01

    Listeria monocytogenes is a foodborne pathogen that has the ability to survive relatively high temperatures compared with other nonsporulating foodborne pathogens. This study was performed to determine whether L. monocytogenes strains with relatively high heat resistances are adequately inactivated

  4. Survival strategies of Listeria monocytogenes - roles of regulators and transporters

    NARCIS (Netherlands)

    Wemekamp-Kamphuis, H.H.

    2003-01-01

    Outbreaks of the food-borne pathogen Listeria monocytogenes are mainly associated with ready-to-eatfoods. Survival strategies of L. monocytogenes in relation to minimally processed foods were studied.

  5. Cultivating cultural differences in aymmetric power relations

    NARCIS (Netherlands)

    Ybema, S.B.; Buyn, H.

    2009-01-01

    In this article we integrate findings from interviews and ethnographic case studies to explore issues of culture and identity in Japanese-Dutch work relations in two different contexts: Japanese firms in the Netherlands and Dutch firms in Japan. It is suggested that cultural identities do not carry

  6. Is Information Ethics Culture-Relative?

    NARCIS (Netherlands)

    Brey, Philip A.E.; Zaphiris, P.; Ang, C.

    2009-01-01

    In this article, I examine whether information ethics is culture relative. If it is, different approaches to information ethics are required in different cultures and societies. This would have major implications for the current, predominantly Western approach to information ethics. If it is not,

  7. Impact of growth conditions and role of sigB on Listeria monocytogenes fitness in single and mixed biofilms cultured with Lactobacillus plantarum

    NARCIS (Netherlands)

    Saa Ibusquiza, P.; Nierop Groot, M.N.; Deban Valles, A.; Abee, T.; Besten, den H.M.W.

    2015-01-01

    The role of sigB, a major transcriptional regulator of stress response genes, was assessed in formation of single and mixed species biofilms of Listeria monocytogenes EGD-e and Lactobacillus plantarum WCFS1 as secondary species at 20 °C and 30 °C using different medium compositions (nutrient-rich

  8. Growth inhibition of Listeria monocytogenes by a nonbacteriocinogenic Carnobacterium piscicola

    DEFF Research Database (Denmark)

    Nilsson, Lilian; Bech Hansen, T.; Garrido, P.

    2005-01-01

    Aims: This study elucidates the mechanisms by which a nonbacteriocinogenic Carnobacterium piscicola inhibits growth of Listeria monocytogenes. Methods and Results: Listeria monocytogenes was exposed to live cultures of a bacteriocin-negative variant of C. piscicola A9b in co-culture, in a diffusion...... chamber system, and to a cell-free supernatant. Suppression of maximum cell density (0-3.5 log units) of L. monocytogenes was proportional to initial levels of C. pisciola (10(3)-10(7) CFU ml(-1)). Cell-to-cell contact was not required to cause inhibition. The cell-free C. piscicola supernatant caused...... a decrease in L. monocytogenes maximum cell density, which was abolished by glucose addition but not by amino acid, vitamin or mineral addition. The fermentate also gave rise to a longer lag phase and a reduction in growth rate. These effects were independent of glucose and may have been caused by acetate...

  9. The relation between language, culture, and thought.

    Science.gov (United States)

    Imai, Mutsumi; Kanero, Junko; Masuda, Takahiko

    2016-04-01

    The relationship between culture, language, and thought has long been one of the most important topics for those who wish to understand the nature of human cognition. This issue has been investigated for decades across a broad range of research disciplines. However, there has been scant communication across these different disciplines, a situation largely arising through differences in research interests and discrepancies in the definitions of key terms such as 'culture,' 'language,' and 'thought.' This article reviews recent trends in research on the relation between language, culture and thought to capture how cognitive psychology and cultural psychology have defined 'language' and 'culture,' and how this issue was addressed within each research discipline. We then review recent research conducted in interdisciplinary perspectives, which directly compared the roles of culture and language. Finally, we highlight the importance of considering the complex interplay between culture and language to provide a comprehensive picture of how language and culture affect thought. Copyright © 2015 Elsevier Ltd. All rights reserved.

  10. Microbiological criteria for Listeria monocytogenes in foods under special consideration of risk assessment approaches

    DEFF Research Database (Denmark)

    Nørrung, Birgit

    2000-01-01

    This paper shortly summarizes data related to risk assessment of Listeria monocytogenes. From available data on risk assessment, it is concluded that the levels of L. monocytogenes consumed is an important factor affecting the incidence of listeriosis. Foods that do not support the growth of L....... monocytogenes are unlikely to be a source of listeriosis, whereas foods that support the growth to high levels, should be the target of risk management efforts. Based on current epidemiological information from several countries, a concentration of L. monocytogenes not exceeding 100/g of food at the time...... of L. monocytogenes in the food during prevailing storage and distribution conditions is needed....

  11. Culture Negative Listeria monocytogenes Meningitis Resulting in Hydrocephalus and Severe Neurological Sequelae in a Previously Healthy Immunocompetent Man with Penicillin Allergy

    DEFF Research Database (Denmark)

    Gaini, Shahin; Karlsen, Gunn Hege; Nandy, Anirban

    2015-01-01

    A previously healthy 74-year-old Caucasian man with penicillin allergy was admitted with evolving headache, confusion, fever, and neck stiffness. Treatment for bacterial meningitis with dexamethasone and monotherapy ceftriaxone was started. The cerebrospinal fluid showed negative microscopy...... the catheter. The patient had severe neurological sequelae. This case report emphasises the importance of covering empirically for Listeria monocytogenes in all patients with penicillin allergy with suspected bacterial meningitis. The case also shows that it is possible to have significant infection...

  12. Bifidobacterium breve IPLA20005 affects in vitro the expression of hly and luxS genes, related to the virulence of Listeria monocytogenes Lm23.

    Science.gov (United States)

    Rios-Covian, David; Nogacka, Alicja; Salazar, Nuria; Hernández-Barranco, A M; Cuesta, Isabel; Gueimonde, Miguel; de Los Reyes Gavilán, Clara G

    2018-03-01

    Mechanistic features that characterize the interaction and inhibition of the food-borne pathogen Listeria monocytogenes by members of the genus Bifidobacterium still remain unclear. In the present work, we tried to shed light on the influence that co-cultivation of L. monocytogenes with Bifidobacterium breve may exert on both microorganisms and on virulence of the pathogen. Production of acetate and lactate was measured by gas chromatography and high-performance liquid chromatography, respectively; bacterial counts were obtained by plate count; gene expression was determined by RT-qPCR; and haemolytic activity was analyzed against goat erythrocytes. We found slightly but significantly lower final counts of Listeria and Bifidobacterium (p monocytogenes cells from cocultures than in those from monocultures. In contrast, the hly and luxS genes, which code for the cytolysin listeriolysin O and participate in biofilm formation, respectively, were overexpressed when L. monocytogenes was grown in coculture. This indicates that the presence of Bifidobacterium is able to modify the gene expression and haemolytic activity of L. monocytogenes when both microorganisms grow together.

  13. The biofilm formation ability of Listeria monocytogenes isolated from meat, poultry, fish and processing plant environments is related to serotype and pathogenic profile of the strains

    Directory of Open Access Journals (Sweden)

    Domenico Meloni

    2012-10-01

    Full Text Available In the present study, the relationships between serotype, pathogenic profile and in vitro biofilm formation of 106 Listeria monocytogenes strains, having no epidemiological correlation and isolated from different environmental and food sources, were analyzed. The quantitative assessment of the in vitro biofilm formation was carried out by using a microtiter plate assay with spectrophotometric reading (OD620. The isolates were also submitted to serogrouping using the target genes lmo0737, lmo1118, ORF2819, ORF2110, prs, and to the evaluation of the presence of the following virulence genes: prfA, hlyA, rrn, inlA, inlB, iap, plcA, plcB, actA and mpl, by multiplex PCRs. The 62% of the strains showed weak or moderate in vitro ability in biofilm formation, in particular serotypes 1/2b and 4b, frequently associated with sporadic or epidemic listeriosis cases. The 25% of these isolates showed polymorphism for the actA gene, producing a fragment of 268-bp instead of the expected 385-bp. The deletion of nucleotides in this gene seems to be related to enhanced virulence properties among these strains. Strains belonging to serotypes associated with human infections and characterized by pathogenic potential are capable to persist within the processing plants forming biofilm.

  14. Evaluation of the performance of quantitative detection of the Listeria monocytogenes prfA locus with droplet digital PCR.

    Science.gov (United States)

    Witte, Anna Kristina; Fister, Susanne; Mester, Patrick; Schoder, Dagmar; Rossmanith, Peter

    2016-11-01

    Fast and reliable pathogen detection is an important issue for human health. Since conventional microbiological methods are rather slow, there is growing interest in detection and quantification using molecular methods. The droplet digital polymerase chain reaction (ddPCR) is a relatively new PCR method for absolute and accurate quantification without external standards. Using the Listeria monocytogenes specific prfA assay, we focused on the questions of whether the assay was directly transferable to ddPCR and whether ddPCR was suitable for samples derived from heterogeneous matrices, such as foodstuffs that often included inhibitors and a non-target bacterial background flora. Although the prfA assay showed suboptimal cluster formation, use of ddPCR for quantification of L. monocytogenes from pure bacterial cultures, artificially contaminated cheese, and naturally contaminated foodstuff was satisfactory over a relatively broad dynamic range. Moreover, results demonstrated the outstanding detection limit of one copy. However, while poorer DNA quality, such as resulting from longer storage, can impair ddPCR, internal amplification control (IAC) of prfA by ddPCR, that is integrated in the genome of L. monocytogenes ΔprfA, showed even slightly better quantification over a broader dynamic range. Graphical Abstract Evaluating the absolute quantification potential of ddPCR targeting Listeria monocytogenes prfA.

  15. Inhibition of sortase A by chalcone prevents Listeria monocytogenes infection.

    Science.gov (United States)

    Li, Hongen; Chen, Yutao; Zhang, Bing; Niu, Xiaodi; Song, Meng; Luo, Zhaoqing; Lu, Gejin; Liu, Bowen; Zhao, Xiaoran; Wang, Jianfeng; Deng, Xuming

    2016-04-15

    The critical role of sortase A in gram-positive bacterial pathogenicity makes this protein a good potential target for antimicrobial therapy. In this study, we report for the first time the crystal structure of Listeria monocytogenes sortase A and identify the active sites that mediate its transpeptidase activity. We also used a sortase A (SrtA) enzyme activity inhibition assay, simulation, and isothermal titration calorimetry analysis to discover that chalcone, an agent with little anti-L. monocytogenes activity, could significantly inhibit sortase A activity with an IC50 of 28.41 ± 5.34 μM by occupying the active site of SrtA. The addition of chalcone to a co-culture of L. monocytogenes and Caco-2 cells significantly inhibited bacterial entry into the cells and L. monocytogenes-mediated cytotoxicity. Additionally, chalcone treatment decreased the mortality of infected mice, the bacterial burden in target organs, and the pathological damage to L. monocytogenes-infected mice. In conclusion, these findings suggest that chalcone is a promising candidate for the development of treatment against L. monocytogenes infection. Copyright © 2016 Elsevier Inc. All rights reserved.

  16. Recombinant probiotic expressing Listeria adhesion protein attenuates Listeria monocytogenes virulence in vitro.

    Directory of Open Access Journals (Sweden)

    Ok Kyung Koo

    Full Text Available BACKGROUND: Listeria monocytogenes, an intracellular foodborne pathogen, infects immunocompromised hosts. The primary route of transmission is through contaminated food. In the gastrointestinal tract, it traverses the epithelial barrier through intracellular or paracellular routes. Strategies to prevent L. monocytogenes entry can potentially minimize infection in high-risk populations. Listeria adhesion protein (LAP aids L. monocytogenes in crossing epithelial barriers via the paracellular route. The use of recombinant probiotic bacteria expressing LAP would aid targeted clearance of Listeria from the gut and protect high-risk populations from infection. METHODOLOGY/PRINCIPAL FINDINGS: The objective was to investigate the ability of probiotic bacteria or LAP-expressing recombinant probiotic Lactobacillus paracasei (Lbp(LAP to prevent L. monocytogenes adhesion, invasion, and transwell-based transepithelial translocation in a Caco-2 cell culture model. Several wild type probiotic bacteria showed strong adhesion to Caco-2 cells but none effectively prevented L. monocytogenes infection. Pre-exposure to Lbp(LAP for 1, 4, 15, or 24 h significantly (P<0.05 reduced adhesion, invasion, and transepithelial translocation of L. monocytogenes in Caco-2 cells, whereas pre-exposure to parental Lb. paracasei had no significant effect. Similarly, Lbp(LAP pre-exposure reduced L. monocytogenes translocation by as much as 46% after 24 h. Lbp(LAP also prevented L. monocytogenes-mediated cell damage and compromise of tight junction integrity. Furthermore, Lbp(LAP cells reduced L. monocytogenes-mediated cell cytotoxicity by 99.8% after 1 h and 79% after 24 h. CONCLUSIONS/SIGNIFICANCE: Wild type probiotic bacteria were unable to prevent L. monocytogenes infection in vitro. In contrast, Lbp(LAP blocked adhesion, invasion, and translocation of L. monocytogenes by interacting with host cell receptor Hsp60, thereby protecting cells from infection. These data show promise

  17. Genome Analysis of Listeria monocytogenes Sequence Type 8 Strains Persisting in Salmon and Poultry Processing Environments and Comparison with Related Strains

    Science.gov (United States)

    Fagerlund, Annette; Langsrud, Solveig; Schirmer, Bjørn C. T.; Møretrø, Trond; Heir, Even

    2016-01-01

    Listeria monocytogenes is an important foodborne pathogen responsible for the disease listeriosis, and can be found throughout the environment, in many foods and in food processing facilities. The main cause of listeriosis is consumption of food contaminated from sources in food processing environments. Persistence in food processing facilities has previously been shown for the L. monocytogenes sequence type (ST) 8 subtype. In the current study, five ST8 strains were subjected to whole-genome sequencing and compared with five additionally available ST8 genomes, allowing comparison of strains from salmon, poultry and cheese industry, in addition to a human clinical isolate. Genome-wide analysis of single-nucleotide polymorphisms (SNPs) confirmed that almost identical strains were detected in a Danish salmon processing plant in 1996 and in a Norwegian salmon processing plant in 2001 and 2011. Furthermore, we show that L. monocytogenes ST8 was likely to have been transferred between two poultry processing plants as a result of relocation of processing equipment. The SNP data were used to infer the phylogeny of the ST8 strains, separating them into two main genetic groups. Within each group, the plasmid and prophage content was almost entirely conserved, but between groups, these sequences showed strong divergence. The accessory genome of the ST8 strains harbored genetic elements which could be involved in rendering the ST8 strains resilient to incoming mobile genetic elements. These included two restriction-modification loci, one of which was predicted to show phase variable recognition sequence specificity through site-specific domain shuffling. Analysis indicated that the ST8 strains harbor all important known L. monocytogenes virulence factors, and ST8 strains are commonly identified as the causative agents of invasive listeriosis. Therefore, the persistence of this L. monocytogenes subtype in food processing facilities poses a significant concern for food safety

  18. Depletion of autophagy-related genes ATG3 and ATG5 in Tenebrio molitor leads to decreased survivability against an intracellular pathogen, Listeria monocytogenes.

    Science.gov (United States)

    Tindwa, Hamisi; Jo, Yong Hun; Patnaik, Bharat Bhusan; Noh, Mi Young; Kim, Dong Hyun; Kim, Iksoo; Han, Yeon Soo; Lee, Yong Seok; Lee, Bok Luel; Kim, Nam Jung

    2015-01-01

    Macroautophagy (autophagy) is an evolutionarily conserved catabolic process involved in physiological and developmental processes including cell survival, death, and innate immunity. Homologues of most of 36 originally discovered autophagy-related (ATG) genes in yeast have been characterized in higher eukaryotes including insects. In this study, the homologues of ATG3 (TmATG3) and ATG5 (TmATG5) were isolated from the coleopteran beetle, Tenebrio molitor by expressed sequence tag and RNAseq approaches. The cDNA of TmATG3 and TmATG5 comprise open-reading frame sizes of 963 and 792 bp encoding polypeptides of 320 and 263 amino acid residues, respectively. TmATG3 and TmATG5 mRNA are expressed in all developmental stages, and mainly in fat body and hemocytes of larvae. TmATG3 and TmATG5 showed an overall sequence identity of 58-95% to other insect Atg proteins. There exist clear one-to-one orthologs of TmATG3 and TmATG5 in Tribolium and that they clustered together in the gene tree. Depletion of TmATG3 and TmATG5 by RNA interference led to a significant reduction in survival ability of T. molitor larvae against an intracellular pathogen, Listeria monocytogenes. Six days post-Listeria challenge, the survival rate in the dsEGFP-injected (where EGFP is enhanced green fluorescent protein) control larvae was significantly higher (55%) compared to 4 and 3% for TmATG3 and TmATG5 double-stranded RNA injected larvae, respectively. These data suggested that TmATG3 and TmATG5 may play putative role in mediating autophagy-based clearance of Listeria in T. molitor model. © 2014 Wiley Periodicals, Inc.

  19. Listeria monocytogenes Monographic Study

    Directory of Open Access Journals (Sweden)

    Emil Tirziu

    2010-05-01

    Full Text Available Listeria monocytogenes is a ubiquitous bacteria with a remarkable resistance in discordant condition which produce listeriosis, an infectious disease that affects multiple domestic and wild animals’ species, but also humans. Receptive to listeriosis are the majority of domestic or wild mammals and birds, in the last years being registered an increase of receptivity in humans. The concept of listeriosis in human pathology, a disease caused by eating or drinking contaminated food and water, appeared for the first time in 1981, during an outbreak in Canada with seven cases in adults and 34 cases of maternalfetal listeriosis. The alimentary origin of human listeriosis can be easily explained if considered some general characteristics of the bacteria. Thus, resistance in various conditions, especially at lower temperatures, justifies its dissemination and food contamination, particularly when is conserved by refrigeration. Also, L. monocytogenes has a significant presence in alimentary products. Some studies showed that 4% of the milk products, 29% of the meat products, 5% of the vegetable products and 26% of the products obtained from fishes and shell fishes are positive for L. monocytogenes, which allows us to say that battle against these bacteria is a war against microbial contamination.

  20. Cultural Competence and Related Factors Among Taiwanese Nurses.

    Science.gov (United States)

    Lin, Chin-Nu; Mastel-Smith, Beth; Alfred, Danita; Lin, Yu-Hua

    2015-12-01

    Taiwan is a multicultural and multiethnic society with a growing number of immigrants who have diverse ethnic, racial, and cultural needs. Although this diversity highlights the pressing need for culturally competent healthcare providers, cultural competence is a concept that is little understood and implemented only sporadically in Taiwan. This study investigates the cultural competence of Taiwanese nurses and the related factors of influence. An online self-report survey was used to collect data from 221 Taiwanese nurses from December 2012 through January 2013. Data from the demographic questionnaire, the Nurses' Cultural Competence Scale, and the Perceived Nurses' Cultural Competence Rating were analyzed using descriptive statistics, Pearson correlation, independent sample t tests, and multiple regressions. The cultural competence of the participants was in the "low to moderate" range, with relatively higher mean scores for the subscales of cultural awareness and cultural sensitivity and relatively lower scores for the subscales of cultural knowledge and cultural skills. Participants generally perceived themselves as being "not culturally competent." Variables found to predict cultural competence included years of work experience, hours of continuing education related to cultural nursing care, and frequency of caring for clients from culturally and ethnically diverse backgrounds. Participating Taiwanese nurses rated their level of cultural competence as in the low-to-moderate range and self-perceived as being not culturally competent. These findings support the need to further expand and enhance cultural-competence-related continuing education and to address the topic of cultural care in the nursing curricula.

  1. First Trimester Listeria monocytogenes Septicemia

    NARCIS (Netherlands)

    Goddijn, M.; Schipper, H. G.; Spanjaard, L.; Wolf, H.

    1997-01-01

    Background: Little is known about fetal outcome after Listeria monocytogenes septicemia in the first trimester of pregnancy.Case: A primigravida with L. monocytogenes septicemia at 9 weeks gestation was treated with amoxicillin. At 40 weeks gestation a healthy female infant was born.Conclusion: This

  2. Assessment of Listeria sp. Interference Using a Molecular Assay To Detect Listeria monocytogenes in Food.

    Science.gov (United States)

    Zittermann, Sandra I; Stanghini, Brenda; See, Ryan Soo; Melano, Roberto G; Boleszczuk, Peter; Murphy, Allana; Maki, Anne; Mallo, Gustavo V

    2016-01-01

    Detection of Listeria monocytogenes in food is currently based on enrichment methods. When L. monocytogenes is present with other Listeria species in food, the species compete during the enrichment process. Overgrowth competition of the nonpathogenic Listeria species might result in false-negative results obtained with the current reference methods. This potential issue was noted when 50 food samples artificially spiked with L. monocytogenes were tested with a real-time PCR assay and Canada's current reference method, MFHPB-30. Eleven of the samples studied were from foods naturally contaminated with Listeria species other than those used for spiking. The real-time PCR assay detected L. monocytogenes in all 11 of these samples; however, only 6 of these samples were positive by the MFHPB-30 method. To determine whether L. monocytogenes detection can be affected by other species of the same genus due to competition, an L. monocytogenes strain and a Listeria innocua strain with a faster rate of growth in the enrichment broth were artificially coinoculated at different ratios into ground pork meat samples and cultured according to the MFHPB-30 method. L. monocytogenes was detected only by the MFHPB-30 method when L. monocytogenes/L. innocua ratios were 6.0 or higher. In contrast, using the same enrichments, the real-time PCR assay detected L. monocytogenes at ratios as low as 0.6. Taken together, these findings support the hypothesis that L. monocytogenes can be outcompeted by L. innocua during the MFHPB-30 enrichment phase. However, more reliable detection of L. monocytogenes in this situation can be achieved by a PCR-based method mainly because of its sensitivity.

  3. Survival of Bactericidal Antibiotic Treatment by a Persister Subpopulation of Listeria monocytogenes

    DEFF Research Database (Denmark)

    Knudsen, Gitte Maegaard; Ng, Yin; Gram, Lone

    2013-01-01

    Listeria monocytogenes can cause the serious infection listeriosis, which despite antibiotic treatment has a high mortality. Understanding the response of L. monocytogenes to antibiotic exposure is therefore important to ensure treatment success. Some bacteria survive antibiotic treatment...... by formation of persisters, which are a dormant antibiotic-tolerant subpopulation. The purpose of this study was to determine whether L. monocytogenes can form persisters and how bacterial physiology affects the number of persisters in the population. A stationary-phase culture of L. monocytogenes was adjusted...... that eradication of persisters is possible. Our study adds L. monocytogenes to the list of bacterial species capable of surviving bactericidal antibiotics in a dormant stage, and this persister phenomenon should be borne in mind when developing treatment regimens....

  4. Prevalence and antibiotic susceptibility of Listeria monocytogenes in ...

    African Journals Online (AJOL)

    One hundred and ninety two raw milk samples were collected from lactating cows identified in Fulani herds and small scale dairy farms within Sokoto metropolis in order to investigate the presence and determine the antibiotic susceptibility of Listeria monocytogenes in the milk. Selective culture and identification method ...

  5. Role of Extracellular DNA during Biofilm Formation by Listeria monocytogenes

    DEFF Research Database (Denmark)

    Harmsen, Morten; Lappann, Martin; Knøchel, S

    2010-01-01

    (eDNA) may be the only central component of the biofilm matrix and that it is necessary for both initial attachment and early biofilm formation for 41 L. monocytogenes strains that were tested. DNase I treatment resulted in dispersal of biofilms, not only in microtiter tray assays but also in flow......Listeria monocytogenes is a food-borne pathogen that is capable of living in harsh environments. It is believed to do this by forming biofilms, which are surface-associated multicellular structures encased in a self-produced matrix. In this paper we show that in L. monocytogenes extracellular DNA...... cell biofilm assays. However, it was also demonstrated that in a culture without eDNA, neither Listeria genomic DNA nor salmon sperm DNA by itself could restore the capacity to adhere. A search for additional necessary components revealed that peptidoglycan (PG), specifically N-acetylglucosamine (NAG...

  6. Assessing the capacity of growth, survival, and acid adaptive response of Listeria monocytogenes during storage of various cheeses and subsequent simulated gastric digestion.

    Science.gov (United States)

    Kapetanakou, Anastasia E; Gkerekou, Maria A; Vitzilaiou, Eirini S; Skandamis, Panagiotis N

    2017-04-04

    Different physicochemical and microbiological characteristics of cheeses may affect Listeria monocytogenes potential to grow, survive, or exhibit an acid adaptive response during storage and digestion. The objectives of the present study were to assess: i) the survival or growth potential of L.monocytogenes on various cheeses during storage, ii) the effect of initial indigenous microbiota on pathogen growth in comparison to expected growth curves retrieved by existing predictive models, and iii) the impact of habituation on/in cheeses surfaces on the subsequent acid resistance during simulated gastric digestion. Portions of cream (Cottage and Mascarpone), soft (Anthotyros, Camembert, Mastelo®, Manouri, Mozzarella, Ricotta), and semi-hard (Edam, Halloumi, Gouda) cheeses were inoculated with ca. 100CFU/g or cm 2 of L.monocytogenes and stored under vacuum or aerobic conditions at 7°C (n=4). The impact of varying (initial) levels of starter culture or indigenous spoilage microbiota on pathogen growth was evaluated by purchasing cheese packages on different dates in relation to production and expiration date (subsequently reflecting to different batches) mimicking a potential situation of cheese contamination with L.monocytogenes during retail display. Values of pH and a w were also monitored and used to simulate growth of L. monocytogenes by existing models and compare it with the observed data of the study. Survival in simulated gastric fluid (SGF) (pH1.5; HCl; max. 120min) was assessed at three time points during storage. Mascarpone, Ricotta, Mozzarella, Camembert, and Halloumi supported L.monocytogenes growth by 0.5-0.8logCFU/g or cm 2 per day, since low initial levels of total viable counts (TVC) (1.8-3.8logCFU/g or cm 2 ) and high pH/a w values (ca. 6.23-6.64/0.965-0.993) were recorded. On Cottage, Anthotyros, Manouri, Mastelo®, Edam, and Gouda, the pathogen survived at populations similar or lower than the inoculation level due to the high reported competition

  7. Research in use – cultures of relating

    DEFF Research Database (Denmark)

    Holck, Ulla; Stige, Brynjulf; Skrudland, Hilde

    time be part of the interdisciplinary clinical culture found in institutions with a main focus on a certain client group. Here the music therapy clinicians can be the golden link between the research culture and the local clinical culture. At the same time, music therapy clinicians are not (usually...... documentation Locally based projects involving clinical music therapists as well as researchers are an effective way of spreading the use of and knowledge about music therapy, and can also be a basis for later data collection on a greater scale. Starting from web-based examples, this round table will present...

  8. Listeria monocytogenes serovar 4a is a possible evolutionary intermediate between L. monocytogenes serovars 1/2a and 4b and L. innocua.

    Science.gov (United States)

    Chen, Jianshun; Jiang, Lingli; Chen, Xueyan; Luo, Xiaokai; Chen, Yang; Yu, Ying; Tian, Guoming; Liu, Dongyou; Fang, Weihuan

    2009-03-01

    The genus Listeria consists of six closely related species and forms three phylogenetic groups: L. monocytogenes- L. innocua, L. ivanovii-L. seeligeri-L. welshimeri, and L. grayi. In this report, we attempted to examine the evolutionary relationship in the L. monocytogenes-L. innocua group by probing the nucleotide sequences of 23S rRNA and 16S rRNA, and the gene clusters lmo0029-lmo0042, ascBdapE, rplS-infC, and prs-ldh in L. monocytogenes serovars 1/2a, 4a, and 4b, and L. innocua. Additionally, we assessed the status of L. monocytogenes-specific inlA and inlB genes and 10 L. innocua-specific genes in these species/serovars, together with phenotypic characterization by using in vivo and in vitro procedures. The results indicate that L. monocytogenes serovar 4a strains are genetically similar to L. innocua in the lmo0035-lmo0042, ascB-dapE, and rplS-infC regions and also possess L. innocua-specific genes lin0372 and lin1073. Furthermore, both L. monocytogenes serovar 4a and L. innocua exhibit impaired intercellular spread ability and negligible pathogenicity in mouse model. On the other hand, despite resembling L. monocytogenes serovars 1/2a and 4b in having a nearly identical virulence gene cluster, and inlA and inlB genes, these serovar 4a strains differ from serovars 1/2a and 4b by harboring notably altered actA and plcB genes, displaying strong phospholipase activity and subdued in vivo and in vitro virulence. Thus, by possessing many genes common to L. monocytogenes serovars 1/2a and 4b, and sharing many similar gene deletions with L. innocua, L. monocytogenes serovar 4a represents a possible evolutionary intermediate between L. monocytogenes serovars 1/2a and 4b and L. innocua.

  9. Cultural relativity in perceiving emotion from vocalizations.

    Science.gov (United States)

    Gendron, Maria; Roberson, Debi; van der Vyver, Jacoba Marieta; Barrett, Lisa Feldman

    2014-04-01

    A central question in the study of human behavior is whether certain emotions, such as anger, fear, and sadness, are recognized in nonverbal cues across cultures. We predicted and found that in a concept-free experimental task, participants from an isolated cultural context (the Himba ethnic group from northwestern Namibia) did not freely label Western vocalizations with expected emotion terms. Responses indicate that Himba participants perceived more basic affective properties of valence (positivity or negativity) and to some extent arousal (high or low activation). In a second, concept-embedded task, we manipulated whether the target and foil on a given trial matched in both valence and arousal, neither valence nor arousal, valence only, or arousal only. Himba participants achieved above-chance accuracy only when foils differed from targets in valence only. Our results indicate that the voice can reliably convey affective meaning across cultures, but that perceptions of emotion from the voice are culturally variable.

  10. Cultural intelligence and work-related outcomes

    DEFF Research Database (Denmark)

    Schlaegel, Christopher; Richter, Nicole Franziska; Taras, Vas

    2017-01-01

    ) the results of the bivariate metaanalyses indicate that CQ and its underlying dimensions are positively associated with expatriation intention, job satisfaction, cultural adjustment, transformational leadership, and different performance outcomes (task performance, contextual performance, and team performance...

  11. Rapid colorimetric assay for detection of Listeria monocytogenes in food samples using LAMP formation of DNA concatemers and gold nanoparticle-DNA probe complex

    Science.gov (United States)

    Wachiralurpan, Sirirat; Sriyapai, Thayat; Areekit, Supatra; Sriyapai, Pichapak; Augkarawaritsawong, Suphitcha; Santiwatanakul, Somchai; Chansiri, Kosum

    2018-04-01

    ABSTRACT Listeria monocytogenes is a major foodborne pathogen of global health concern. Herein, the rapid diagnosis of L. monocytogenes has been achieved using loop-mediated isothermal amplification (LAMP) based on the phosphatidylcholine-phospholipase C gene (plcB). Colorimetric detection was then performed through the formation of DNA concatemers and a gold nanoparticle/DNA probe complex (GNP/DNA probe). The overall detection process was accomplished within approximately 1 h with no need for complicated equipment. The limits of detection for L. monocytogenes in the forms of purified genomic DNA and pure culture were 800 fg and 2.82 CFU mL-1, respectively. No cross reactions were observed from closely related bacteria species. The LAMP-GNP/DNA probe assay was applied to the detection of 200 raw chicken meat samples and compared to routine standard methods. The data revealed that the specificity, sensitivity and accuracy were 100%, 90.20% and 97.50%, respectively. The present assay was 100% in conformity with LAMP-agarose gel electrophoresis assay. Five samples that were negative by both assays appeared to have the pathogen at below the level of detection. The assay can be applied as a rapid direct screening method for L. monocytogenes.

  12. Analysis of process factors of dry fermented salami to control Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Enrico Novelli

    2017-01-01

    Full Text Available Challenge tests are a clear opportunity for manufacturers interested in the evaluation of their management system with the aim to reduce the spread of foodborne pathogens. This is a main concern especially in ready-to-eat food in relation to the risk associated with Listeria monocytogenes. For small and medium-scale food industry the manufacturing practices and products formulation are characterised by a wider variability and poor repeatability. The use of ad hoc challenge test and the comparison among different processing systems are strongly required. This paper reports a preliminary comparison among different challenge tests (n=12 commissioned by three manufacturers of raw-fermented salami during a period of three years (2013-2016. The challenge tests were designed to evaluate the growth potential (δ of L. monocytogenes during the whole processing period of the salami. The doughs were prepared according to different formulations: the simplest formulation was represented by the use of salt, potassium nitrate, black pepper and starter cultures, while the most composited formulations also included the use of sugars and ascorbic acid in addition to nitrite salt. All the processing steps were conducted within an experimental laboratory dedicated for the processing of meat. After stuffing, the salami were dried and ripened under temperature and relative humidity control. The sugar inclusion can be considered as a protective factor, while the drying step at high temperature (above 20°C was associated with higher δ values (δ>0.5 log10 cfu/g. The addition of starter cultures, and the subsequent acidification highlighted the importance of pH as the parameter able to affect the L. monocytogenes growth.

  13. Analysis of Process Factors of Dry Fermented Salami to Control Listeria Monocytogenes

    Science.gov (United States)

    Novelli, Enrico; Dal Santo, Lucia; Balzan, Stefania; Cardazzo, Barbara; Spolaor, Dino; Lombardi, Angiolella; Carraro, Lisa; Fasolato, Luca

    2017-01-01

    Challenge tests are a clear opportunity for manufacturers interested in the evaluation of their management system with the aim to reduce the spread of foodborne pathogens. This is a main concern especially in ready-to-eat food in relation to the risk associated with Listeria monocytogenes. For small and medium-scale food industry the manufacturing practices and products formulation are characterised by a wider variability and poor repeatability. The use of ad hoc challenge test and the comparison among different processing systems are strongly required. This paper reports a preliminary comparison among different challenge tests (n=12) commissioned by three manufacturers of raw-fermented salami during a period of three years (2013-2016). The challenge tests were designed to evaluate the growth potential (δ) of L. monocytogenes during the whole processing period of the salami. The doughs were prepared according to different formulations: the simplest formulation was represented by the use of salt, potassium nitrate, black pepper and starter cultures, while the most composited formulations also included the use of sugars and ascorbic acid in addition to nitrite salt. All the processing steps were conducted within an experimental laboratory dedicated for the processing of meat. After stuffing, the salami were dried and ripened under temperature and relative humidity control. The sugar inclusion can be considered as a protective factor, while the drying step at high temperature (above 20°C) was associated with higher δ values (δ>0.5 log10 cfu/g). The addition of starter cultures, and the subsequent acidification highlighted the importance of pH as the parameter able to affect the L. monocytogenes growth. PMID:28462203

  14. Between Culture and Cultural Heritage: Curriculum Historical Preconditions as Constitutive for Cultural Relations--The Swedish Case

    Science.gov (United States)

    Brantefors, Lotta

    2015-01-01

    The aim here is to describe and discuss how different cultural meanings, offered in education, can contribute to unjust cultural relations such as othering and xenophobia. By analysing the cultural and discursive content in curricula using a (neo)pragmatic curriculum theory research method, dominating ideas, values and discourses between 1948 and…

  15. Acoustic concerns related to multi cultural societies

    DEFF Research Database (Denmark)

    Gade, Anders Christian

    2001-01-01

    will be presented. Another project was conducted by students at the Danish Technical University, who found that speech intelligibility for non-native listeners is much more sensitive to poor speech conditions than for native listeners. Also discussed are the unique features of culturally based urban soundscapes....... It is suggested that these soundscapes can provide comfort to recent immigrants by increasing their sense of being ``at home.''...

  16. Fate of Listeria spp. on parsley leaves grown in laboratory and field cultures.

    Science.gov (United States)

    Dreux, N; Albagnac, C; Carlin, F; Morris, C E; Nguyen-The, C

    2007-11-01

    To investigate the population dynamics of Listeria monocytogenes and Listeria innocua on the aerial surfaces of parsley. Under 100% relative humidity (RH) in laboratory and regardless of the inoculum tested (10(3)-10(8) CFU per leaf), counts of L. monocytogenes EGDe, LO28, LmP60 and L. innocua CIP 80-12 tended towards approx. 10(5) CFU per leaf. Under low RH, Listeria spp. populations declined regardless to the inoculum size (10(4)-10(8) CFU per leaf). L. innocua CIP 80-12 survived slightly better than L. monocytogenes in the laboratory and was used in field cultures. Under field cultures, counts of L. innocua decreased more rapidly than in the laboratory, representing a decrease of 9 log(10) in 2 days in field conditions compared to a decrease of 4.5 log(10) in 8 days in the laboratory. Counts of L. innocua on tunnel parsley cultures were always higher (at least by 100 times) than those on unprotected parsley culture. Even with a high inoculum and under protected conditions (i.e. plastic tunnels), population of L. monocytogenes on the surface of parsley on the field would decrease by several log(10) scales within 2 days. Direct contamination of aerial surfaces of parsley with L. monocytogenes (i.e. through contaminated irrigation water) will not lead to contaminated produce unless it occurs very shortly before harvest.

  17. Use of a genetically enhanced, pediocin-producing starter culture, Lactococcus lactis subsp. lactis MM217, to control Listeria monocytogenes in cheddar cheese

    NARCIS (Netherlands)

    Buyong, N; Kok, J; Luchansky, JB

    1998-01-01

    Cheddar cheese was prepared with Lactococcus lactis subsp, lactis MM217, a starter culture which contains pMC117 coding for pediocin PA-1, About 75 liters of pasteurized milk (containing ca, 3.6% fat) was inoculated with strain MM217 (ca, 10(6) CFU per ml) and a mixture of three Listeria

  18. Silver as antibacterial towards Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Simone eBelluco

    2016-03-01

    Full Text Available Listeria monocytogenes is a serious foodborne pathogen that can contaminate food during processing and can grow during food shelf-life. New types of safe and effective food contact materials embedding antimicrobial agents, like silver, can play an important role in the food industry. The present work aimed at evaluating the in vitro growth kinetics of different strains of L. monocytogenes in the presence of silver, both in its ionic and nano form. The antimicrobial effect was determined by assaying the number of culturable bacterial cells, which formed colonies after incubation in the presence of silver nanoparticles (AgNPs or silver nitrate (AgNO3. Ionic release experiments were performed in parallel. A different reduction of bacterial viability between silver ionic and nano forms was observed, with a time delayed effect exerted by AgNPs. An association between antimicrobial activity and ions concentration was shown by both silver chemical forms, suggesting the major role of ions in the antimicrobial mode of action.

  19. Growth characteristics of Listeria monocytogenes as affected by a native microflora in cooked ham under refrigerated and temperature abuse conditions.

    Science.gov (United States)

    Hwang, Cheng-An; Sheen, Shiowshuh

    2011-05-01

    This study examined the growth characteristics of Listeria monocytogenes as affected by a native microflora in cooked ham at refrigerated and abuse temperatures. A five-strain mixture of L. monocytogenes and a native microflora, consisting of Brochothrix spp., isolated from cooked meat were inoculated alone (monocultured) or co-inoculated (co-cultured) onto cooked ham slices. The growth characteristics, lag phase duration (LPD, h), growth rate (GR, log(10) cfu/h), and maximum population density (MPD, log(10) cfu/g), of L. monocytogenes and the native microflora in vacuum-packed ham slices stored at 4, 6, 8, 10, and 12 °C for up to 5 weeks were determined. At 4-12 °C, the LPDs of co-cultured L. monocytogenes were not significantly different from those of monocultured L. monocytogenes in ham, indicating the LPDs of L. monocytogenes at 4-12 °C were not influenced by the presence of the native microflora. At 4-8 °C, the GRs of co-cultured L. monocytogenes (0.0114-0.0130 log(10) cfu/h) were statistically but marginally lower than those of monocultured L. monocytogenes (0.0132-0.0145 log(10) cfu/h), indicating the GRs of L. monocytogenes at 4-8 °C were reduced by the presence of the native microflora. The GRs of L. monocytogenes were reduced by 8-7% with the presence of the native microflora at 4-8 °C, whereas there was less influence of the native microflora on the GRs of L. monocytogenes at 10 and 12 °C. The MPDs of L. monocytogenes at 4-8 °C were also reduced by the presence of the native microflora. Data from this study provide additional information regarding the growth suppression of L. monocytogenes by the native microflora for assessing the survival and growth of L. monocytogenes in ready-to-eat meat products. Published by Elsevier Ltd.

  20. What Culture Should Represent for International Relations

    Directory of Open Access Journals (Sweden)

    Constantin Frosin

    2011-06-01

    Full Text Available This paper is not a conventional one, on the contrary, is an atypical one. It doesn’t presentthe author’s points of view (except the conclusions, but, to be more persuasive, he quotes some veryimportant personalities of the world of arts, culture and literature. Everything appears to be so clear,that he could say: No comment ! But the author of this article goes away, he concludes everyquotation of the most important personalities invited to speak (so to say and puts away some veryinteresting ideas, very rarely expressed. One could say it took a certain amount of courage for him todo it…, but someone has to do it, finally! The style of this paper is remarkably colloquial andattractive, it’s worth reading it.

  1. Psychology of group relations: cultural and social dimensions.

    Science.gov (United States)

    Berry, J W

    2004-07-01

    Cross-cultural psychology attempts to understand the development and expression of human behavior in relation to the cultural contexts in which it occurs. It adopts the perspective of "universalism," which assumes that all human beings share basic psychological processes, but which are then shaped by cultural influences. This perspective allows for the comparison of individuals from different cultures (based on the process commonality), but also accepts behavioral variability (based on the cultural shaping). In the case of behavior that takes place during interactions between individuals coming from two (or more) cultures, the task is more complex; we now need to understand at least two sets of culture-behavior phenomena, as well as a third set--those that arise at the intersection of their relationships. In cross-cultural psychology, we have adopted concepts and methods from sociology and political science to inform work on "ethnic relations," and from cultural anthropology we have been informed in our work on the process and outcomes of "acculturation." In the former domain are phenomena such as prejudice and discrimination; in the latter are the strategies people use when in daily contact with people from other cultures (such as assimilation, integration, separation, and marginalization). These phenomena take place in cultural contexts, which need to be understood in terms of the core dimensions of cultural difference (such as diversity, equality, and conformity). During prolonged and intimate contact between persons of different cultural backgrounds, all these psychological concepts and processes, and cultural influences need to be taken into account when selecting, training, and monitoring individuals during their intercultural interactions.

  2. Work related learning, Identities, and Culture

    DEFF Research Database (Denmark)

    Olesen, Henning Salling

    2005-01-01

    which reflects the societal transitions. The aim of this article is to consider the connection between these theoretical and methodological questions: Studies into subjective processes (individual and collective learning and identity processes) helps us theorise the contradictory and asynchronous nature...... of individuals’ subjective relation to work and work related learning have revealed a close connection between gender relations and societal work organisation. This observation has become particularly pointed in studies of a number of professions dealing with traditional ‘women’s work’, in which the close links...... of individual and collective learning and identity processes....

  3. The role of cultural diplomacy in international relations

    Directory of Open Access Journals (Sweden)

    Said Saddiki

    2009-12-01

    Full Text Available Cultural diplomacy, as a cornerstone of public diplomacy, plays an important role in today’s international relations, which are characterised by so-called culture shocks, and it should represent a decisive tool not only for transmitting culture and national values, but also for listening to what the cultures from the rest the world are saying to us. The main role of cultural diplomacy is to promote transnational dialogue between cultures and nations, especially between the West and the Muslim world. Cultural diplomacy, just like other new dimensions in diplomacy, is not exclusively controlled by nation-states, given that at present they are not the only actors on the international stage, since other non-state actors (civil society, NGOs, universities, academics, etc. are playing an important role in this field. The aim of this article is to analyse the role of culture in modern diplomacy and its impact on relations between peoples and nations. It also attempts to focus on the positive aspects of the influence of culture on contemporary international relations.

  4. An insight into the isolation, enumeration and molecular detection of Listeria monocytogenes in food

    Directory of Open Access Journals (Sweden)

    Jodi Woan-Fei Law

    2015-11-01

    Full Text Available Listeria monocytogenes, a foodborne pathogen that can cause listeriosis through the consumption of food contaminated with this pathogen. The ability of L. monocytogenes to survive in extreme conditions and cause food contaminations have become a major concern. Hence, routine microbiological food testing is necessary to prevent food contamination and outbreaks of foodborne illness. This review provides insight into the methods for cultural detection, enumeration and molecular identification of L. monocytogenes in various food samples. There are a number of enrichment and plating media that can be used for the isolation of L. monocytogenes from food samples. Enrichment media such as buffered Listeria Enrichment Broth (BLEB, Fraser broth and University of Vermont Medium (UVM Listeria enrichment broth are recommended by regulatory agencies such as FDA-BAM, USDA-FSIS and ISO. Many plating media are available for the isolation of L. monocytogenes, for instance, PALCAM, Oxford and other chromogenic media. Besides, reference methods like FDA-BAM, ISO 11290 method and USDA-FSIS method are usually applied for the cultural detection or enumeration of L. monocytogenes. MPN technique is applied for the enumeration of L. monocytogenes in the case of low level contamination. Molecular methods including polymerase chain reaction (PCR, multiplex polymerase chain reaction (mPCR, real-time/quantitative polymerase chain reaction (qPCR, nucleic acid sequence-based amplification (NASBA, loop-mediated isothermal amplification (LAMP, DNA microarray and Next Generation Sequencing (NGS technology for the detection and identification of L. monocytogenes are discussed in this review. Overall, molecular methods are rapid, sensitive, specific, time- and labour-saving. In future, there are chances for the development of new techniques for the detection and identification of foodborne with improved features.

  5. An insight into the isolation, enumeration, and molecular detection of Listeria monocytogenes in food

    Science.gov (United States)

    Law, Jodi Woan-Fei; Ab Mutalib, Nurul-Syakima; Chan, Kok-Gan; Lee, Learn-Han

    2015-01-01

    Listeria monocytogenes, a foodborne pathogen that can cause listeriosis through the consumption of food contaminated with this pathogen. The ability of L. monocytogenes to survive in extreme conditions and cause food contaminations have become a major concern. Hence, routine microbiological food testing is necessary to prevent food contamination and outbreaks of foodborne illness. This review provides insight into the methods for cultural detection, enumeration, and molecular identification of L. monocytogenes in various food samples. There are a number of enrichment and plating media that can be used for the isolation of L. monocytogenes from food samples. Enrichment media such as buffered Listeria enrichment broth, Fraser broth, and University of Vermont Medium (UVM) Listeria enrichment broth are recommended by regulatory agencies such as Food and Drug Administration-bacteriological and analytical method (FDA-BAM), US Department of Agriculture-Food and Safety (USDA-FSIS), and International Organization for Standardization (ISO). Many plating media are available for the isolation of L. monocytogenes, for instance, polymyxin acriflavin lithium-chloride ceftazidime aesculin mannitol, Oxford, and other chromogenic media. Besides, reference methods like FDA-BAM, ISO 11290 method, and USDA-FSIS method are usually applied for the cultural detection or enumeration of L. monocytogenes. most probable number technique is applied for the enumeration of L. monocytogenes in the case of low level contamination. Molecular methods including polymerase chain reaction, multiplex polymerase chain reaction, real-time/quantitative polymerase chain reaction, nucleic acid sequence-based amplification, loop-mediated isothermal amplification, DNA microarray, and next generation sequencing technology for the detection and identification of L. monocytogenes are discussed in this review. Overall, molecular methods are rapid, sensitive, specific, time- and labor-saving. In future, there are

  6. Inhibition of Listeria monocytogenes by piscicolin 126 in milk and Camembert cheese manufactured with a thermophilic starter.

    Science.gov (United States)

    Wan, J; Harmark, K; Davidson, B E; Hillier, A J; Gordon, J B; Wilcock, A; Hickey, M W; Coventry, M J

    1997-03-01

    The effect of bacteriocin, piscicolin 126, on the growth of Listeria monocytogenes and cheese starter bacteria was investigated in milk and in Camembert cheese manufactured from milk challenged with 10(2) cfu ml(-1) L. monocytogenes. In milk incubated at 30 degrees C, piscicolin 126 added in the range of 512-2,048 AU ml(-1) effectively inhibited growth of L. monocytogenes for more than 20 d when challenged with approximately 10(2) cfu ml(-1) L. monocytogenes. At higher challenge levels (10(4) and 10(6) cfu ml(-1)), piscicolin 126 reduced the viable count of L. monocytogenes by 4-5 log units immediately after addition of the bacteriocin; however, growth of Listeria occurred within 24 h. The minimum inhibitory concentration (MIC) of piscicolin 126 against lactic acid cheese starter bacteria was generally greater than 204,800 AU ml(-1) , and the viable count and acid production of these starter cultures in milk were not affected by the addition of 2,048 AU ml(-1) piscicolin 126. Camembert cheeses made from milk challenged with L. monocytogenes and with added piscicolin 126 showed a viable count of L. monocytogenes 3-4 log units lower than those without piscicolin 126. Inactivation of piscicolin 126 by proteolytic enzymes from cheese starter bacteria and mould together with the emergence of piscicolin 126-resistant isolates was responsible for the recovery of L. monocytogenes in the cheeses during ripening.

  7. Investigating Culture-related Aspects of Behavior for Virtual Characters

    DEFF Research Database (Denmark)

    Endrass, Birgit; André, Elisabeth; Rehm, Matthias

    2013-01-01

    In this paper, culture-related behaviors are investigated on several channels of communication for virtual characters. Prototypical behaviors were formalized in computational models based on a literature review as well as a corpus analysis, exemplifying the German and Japanese cultures. Therefore...

  8. A Cross-Cultural Examination of Semantic Relations.

    Science.gov (United States)

    Raybeck, Douglas; Herrmann, Douglas

    1990-01-01

    Reports on a cross-cultural investigation of semantic relations, including antonyms, synonyms, and class inclusion, among bilingual adult subjects in the United States, England, Italy, Greece, Yugoslavia, Pakistan, and Hong Kong. Found significant agreement across cultures, especially for antinomy. Results in general support theories of linguistic…

  9. What Cultural Values Influence American Public Relations Practitioners?

    Science.gov (United States)

    Vasquez, Gabriel M.; Taylor, Maureen

    1999-01-01

    Examines the role of culture as a key variable in public relations research and practice. Finds (1) American practitioners continue to practice one-way models of public relations; and (2) public relations practitioners who have collectivistic values tend to practice two-way models of public relations. Discusses implications for theory and…

  10. Sensitivity of Listeria monocytogenes to irradiation

    International Nuclear Information System (INIS)

    Tarjan, Veronika

    1990-01-01

    Irradiation of Listeria monocytogenes (L.m.) was carried out in culture media and pork meat paste at room temperature with 60 Co radiation source of 6.6 kGy h -1 dose rate. The employed doses were 0, 0.5, 1, 2, 3, 4 and 6 kGy. One strain out of 3 survived as high as 4 kGy irradiation. Radiation with 2 kGy resulted 7 log cycles reduction of cell count. After lower irradiation doses the L.m. count decreased in proportion to increasing doses. It has been concluded that L.m. compared with Gram-negative pathogens, are less sensitive to irradiation. (author) 6 refs.; 4 figs

  11. Culture of Honour and Emotional Intelligence: Incompatible or related concepts?

    Directory of Open Access Journals (Sweden)

    Esther López-Zafra

    2013-11-01

    Full Text Available In this study we relate two concepts, Emotional Intelligence and Culture of Honour; in both cases the emotional aspect is very important and we believe they may have a role in couple relations. We propose that both concepts would relate in reverse, so that an individual with a high level of Emotional Intelligence would give less importance to the Culture of Honor and vice versa. A sample of 203 heterosexual couples completed a questionnaire. Our results show that the dimension Attention to emotions is associated with the culture of honor. Among our fi ndings we propose that the two concepts are related in some way and that congruency in the valuation of the Culture of Honor between the two partners will also deal with a level of Emotional Intelligence higher than in couples where there is not this congruence.

  12. Corrigendum: Cultural Relativity in Perceiving Emotion From Vocalizations.

    Science.gov (United States)

    2014-12-01

    Gendron, M., Roberson, D., van der Vyver, J. M., & Barrett, L. F. (2014). Cultural relativity in perceiving emotion from vocalizations. Psychological Science, 25, 911-920. (Original DOI: 10.1177/0956797613517239 ).

  13. Validation of the ANSR(®) Listeria monocytogenes Method for Detection of Listeria monocytogenes in Selected Food and Environmental Samples.

    Science.gov (United States)

    Caballero, Oscar; Alles, Susan; Le, Quynh-Nhi; Gray, R Lucas; Hosking, Edan; Pinkava, Lisa; Norton, Paul; Tolan, Jerry; Mozola, Mark; Rice, Jennifer; Chen, Yi; Ryser, Elliot; Odumeru, Joseph

    2016-01-01

    Work was conducted to validate performance of the ANSR(®) for Listeria monocytogenes method in selected food and environmental matrixes. This DNA-based assay involves amplification of nucleic acid via an isothermal reaction based on nicking enzyme amplification technology. Following single-step sample enrichment for 16-24 h for most matrixes, the assay is completed in 40 min using only simple instrumentation. When 50 distinct strains of L. monocytogenes were tested for inclusivity, 48 produced positive results, the exceptions being two strains confirmed by PCR to lack the assay target gene. Forty-seven nontarget strains (30 species), including multiple non-monocytogenes Listeria species as well as non-Listeria, Gram-positive bacteria, were tested, and all generated negative ANSR assay results. Performance of the ANSR method was compared with that of the U.S. Department of Agriculture, Food Safety and Inspection Service Microbiology Laboratory Guidebook reference culture procedure for detection of L. monocytogenes in hot dogs, pasteurized liquid egg, and sponge samples taken from an inoculated stainless steel surface. In addition, ANSR performance was measured against the U.S. Food and Drug Administration Bacteriological Analytical Manual reference method for detection of L. monocytogenes in Mexican-style cheese, cantaloupe, sprout irrigation water, and guacamole. With the single exception of pasteurized liquid egg at 16 h, ANSR method performance as quantified by the number of positives obtained was not statistically different from that of the reference methods. Robustness trials demonstrated that deliberate introduction of small deviations to the normal assay parameters did not affect ANSR method performance. Results of accelerated stability testing conducted using two manufactured lots of reagents predicts stability at the specified storage temperature of 4°C of more than 1 year.

  14. Intercultural Interpretations: Making Public Relations Education Culturally Relevant

    Science.gov (United States)

    Chia, Joy

    2009-01-01

    Public relations educators delivering courses to international students find that each cohort of students interprets and understands public relations theory and its application to practice according to their respective cultures. The premise of this paper is to reflect on some of the interpretations and expectations of public relations students…

  15. Various Ready-to-Eat Products from Retail Stores Linked to Occurrence of Diverse Listeria monocytogenes and Listeria spp. Isolates.

    Science.gov (United States)

    Vongkamjan, Kitiya; Fuangpaiboon, Janejira; Turner, Matthew P; Vuddhakul, Varaporn

    2016-02-01

    Listeriosis outbreaks have been associated with a variety of foods. This study investigated the prevalence and diversity of Listeria monocytogenes and Listeria spp. in ready-to-eat (RTE) products and evaluated the performance of a rapid detection method, the 3M molecular detection assay for L. monocytogenes (MDA-LM), for detection of L. monocytogenes. Assay results were compared with those obtained using the U.S. Food and Drug Administration standard culture method described in the Bacteriological Analytical Manual. Products (n = 200) were purchased from retail stores: 122 aquatic products, 22 products of animal origin, 18 vegetarian products, 15 deli meat products, 13 salad and vegetable products, 4 desserts, 2 egg-based products, and 4 other products. L. monocytogenes prevalence was comparable with both methods. Overall, 15 (7.5%) of 200 samples were positive for L. monocytogenes: 3% of aquatic products, 1.5% of products of animal origin, 1% of vegetarian products, and 2% of deli meat products. Compared with the standard culture method, the sensitivity, specificity, and the accuracy of the MDA-LM were 86.7% (95% confidence interval, 58.4 to 97.7%), 98.4% (95% confidence interval, 95.0 to 99.6%), and 97.5%, respectively. Using the culture-based method, 18 (9%) of 200 samples were positive for Listeria species other than L. monocytogenes. Listeria isolates from these samples were classified into nine allelic types (ATs). The majority of isolates were classified as ATs 58 and 74, which were identified as L. monocytogenes lineages I and IV, respectively. Listeria innocua and Listeria welshimeri also were represented by isolates of multiple ATs. The MDA-LM is a rapid and reliable technique for detecting L. monocytogenes in various RTE foods. Further study is needed to develop effective control strategies to reduce L. monocytogenes contamination in RTE foods.

  16. An outbreak of an unusual strain of Listeria monocytogenes infection in North-East Scotland

    Directory of Open Access Journals (Sweden)

    Emmanuel Okpo

    2015-11-01

    Full Text Available Summary: Listeria monocytogenes infection is an important cause of illness and hospitalization in vulnerable individuals. In the present study, we describe a community outbreak of Listeria monocytogenes in the North-East region of Scotland, which was epidemiologically, environmentally and microbiologically linked to a local meat product and ready-to-eat product manufacturer. Infected individuals were interviewed, and an environmental investigation was conducted. Clinical and environmental samples were tested by culture, and isolates were typed by fluorescent amplified fragment length polymorphism (fAFLP. Three cases of Listeria monocytogenes were linked geographically, had the same serotype (1/2a and were indistinguishable by fAFLP type XII.6. The human, food and environmental isolates were of the same serotype and were indistinguishable by molecular typing.This is the first community outbreak of L. monocytogenes reported in Scotland since the current outbreak surveillance was established in 1996. Epidemiological and laboratory evidence indicated poor hand hygiene, unhygienic practices and cross-contamination throughout the manufacturing process of ready-to-eat foods as a possible cause of the outbreak. More stringent control of commercial food establishments that provide ready-to-eat food and the need to advise specifically vulnerable groups, e.g., pregnant women, of the risk of L. monocytogenes in ready-to-eat food is urgently needed. Keywords: Listeria monocytogenes, Outbreak, Foodborne, Community acquired infection, Listeriosis

  17. Glycerol metabolism induces Listeria monocytogenes biofilm formation at the air-liquid interface.

    Science.gov (United States)

    Crespo Tapia, Natalia; den Besten, Heidy M W; Abee, Tjakko

    2018-05-20

    Listeria monocytogenes is a food-borne pathogen that can grow as a biofilm on surfaces. Biofilm formation in food-processing environments is a big concern for food safety, as it can cause product contamination through the food-processing line. Although motile aerobic bacteria have been described to form biofilms at the air-liquid interface of cell cultures, to our knowledge, this type of biofilm has not been described in L. monocytogenes before. In this study we report L. monocytogenes biofilm formation at the air-liquid interface of aerobically grown cultures, and that this phenotype is specifically induced when the media is supplemented with glycerol as a carbon and energy source. Planktonic growth, metabolic activity assays and HPLC measurements of glycerol consumption over time showed that glycerol utilization in L. monocytogenes is restricted to growth under aerobic conditions. Gene expression analysis showed that genes encoding the glycerol transporter GlpF, the glycerol kinase GlpK and the glycerol 3-phosphate dehydrogenase GlpD were upregulated in the presence of oxygen, and downregulated in absence of oxygen. Additionally, motility assays revealed the induction of aerotaxis in the presence of glycerol. Our results demonstrate that the formation of biofilms at the air-liquid interface is dependent on glycerol-induced aerotaxis towards the surface of the culture, where L. monocytogenes has access to higher concentrations of oxygen, and is therefore able to utilize this compound as a carbon source. Copyright © 2018 Elsevier B.V. All rights reserved.

  18. How culture gets embrained: Cultural differences in event-related potentials of social norm violations.

    Science.gov (United States)

    Mu, Yan; Kitayama, Shinobu; Han, Shihui; Gelfand, Michele J

    2015-12-15

    Humans are unique among all species in their ability to develop and enforce social norms, but there is wide variation in the strength of social norms across human societies. Despite this fundamental aspect of human nature, there has been surprisingly little research on how social norm violations are detected at the neurobiological level. Building on the emerging field of cultural neuroscience, we combine noninvasive electroencephalography (EEG) with a new social norm violation paradigm to examine the neural mechanisms underlying the detection of norm violations and how they vary across cultures. EEG recordings from Chinese and US participants (n = 50) showed consistent negative deflection of event-related potential around 400 ms (N400) over the central and parietal regions that served as a culture-general neural marker of detecting norm violations. The N400 at the frontal and temporal regions, however, was only observed among Chinese but not US participants, illustrating culture-specific neural substrates of the detection of norm violations. Further, the frontal N400 predicted a variety of behavioral and attitudinal measurements related to the strength of social norms that have been found at the national and state levels, including higher culture superiority and self-control but lower creativity. There were no cultural differences in the N400 induced by semantic violation, suggesting a unique cultural influence on social norm violation detection. In all, these findings provided the first evidence, to our knowledge, for the neurobiological foundations of social norm violation detection and its variation across cultures.

  19. Relation of Astronomy to other Sciences, Culture and Society

    Science.gov (United States)

    Harutyunian, H. A.; Mickaelian, A. M.; Farmanyan, S. V.

    2015-07-01

    The book contains the Proceedings of XIII Annual Meeting of the Armenian Astronomical Society "Relation of Astronomy to other Sciences, Culture and Society". It consists of 9 main sections: "Introductory", "Astronomy and Philosophy", "Astrobiology", "Space-Earth Connections", "Astrostatistics and Astroinformatics", "Astronomy and Culture, Astrolinguistics", "Archaeoastronomy", "Scientific Tourism and Scientific Journalism", and "Armenian Astronomy". The book may be interesting to astronomers, philosophers, biologists, culturologists, linguists, historians, archaeologists and to other specialists, as well as to students.

  20. Teaching Culture: The Challenges and Opportunities of International Public Relations.

    Science.gov (United States)

    George, Amiso M.

    2003-01-01

    Focuses on the challenges and opportunities for international public relations practice. Looks at current United States-Arab relations issues in international crisis communication. Discusses those issues, especially the role of culture and media. Proposes strategies including a case study that teachers can use to help students become effective…

  1. Romer Labs RapidChek®Listeria monocytogenes Test System for the Detection of L. monocytogenes on Selected Foods and Environmental Surfaces.

    Science.gov (United States)

    Juck, Gregory; Gonzalez, Verapaz; Allen, Ann-Christine Olsson; Sutzko, Meredith; Seward, Kody; Muldoon, Mark T

    2018-04-27

    The Romer Labs RapidChek ® Listeria monocytogenes test system (Performance Tested Method ℠ 011805) was validated against the U.S. Department of Agriculture-Food Safety and Inspection Service Microbiology Laboratory Guidebook (USDA-FSIS/MLG), U.S. Food and Drug Association Bacteriological Analytical Manual (FDA/BAM), and AOAC Official Methods of Analysis ℠ (AOAC/OMA) cultural reference methods for the detection of L. monocytogenes on selected foods including hot dogs, frozen cooked breaded chicken, frozen cooked shrimp, cured ham, and ice cream, and environmental surfaces including stainless steel and plastic in an unpaired study design. The RapidChek method uses a proprietary enrichment media system, a 44-48 h enrichment at 30 ± 1°C, and detects L. monocytogenes on an immunochromatographic lateral flow device within 10 min. Different L. monocytogenes strains were used to spike each of the matrixes. Samples were confirmed based on the reference method confirmations and an alternate confirmation method. A total of 140 low-level spiked samples were tested by the RapidChek method after enrichment for 44-48 h in parallel with the cultural reference method. There were 88 RapidChek presumptive positives. One of the presumptive positives was not confirmed culturally. Additionally, one of the culturally confirmed samples did not exhibit a presumptive positive. No difference between the alternate confirmation method and reference confirmation method was observed. The respective cultural reference methods (USDA-FSIS/MLG, FDA/BAM, and AOAC/OMA) produced a total of 63 confirmed positive results. Nonspiked samples from all foods were reported as negative for L. monocytogenes by all methods. Probability of detection analysis demonstrated no significant differences in the number of positive samples detected by the RapidChek method and the respective cultural reference method.

  2. Post-processing application of chemical solutions for control of Listeria monocytogenes, cultured under different conditions, on commercial smoked sausage formulated with and without potassium lactate-sodium diacetate.

    Science.gov (United States)

    Geornaras, Ifigenia; Skandamis, Panagiotis N; Belk, Keith E; Scanga, John A; Kendall, Patricia A; Smith, Gary C; Sofos, John N

    2006-12-01

    This study evaluated post-processing chemical solutions for their antilisterial effects on commercial smoked sausage formulated with or without 1.5% potassium lactate plus 0.05% sodium diacetate, and contaminated (approximately 3-4 log cfu/cm(2)) with 10-strain composite Listeria monocytogenes inocula prepared under various conditions. Inoculated samples were left untreated, or were immersed (2 min, 25 +/- 2 degrees C) in solutions of acetic acid (2.5%), lactic acid (2.5%), potassium benzoate (5%) or Nisaplin (0.5%, equivalent to 5000 IU/ml of nisin) alone, and in sequence (Nisaplin followed by acetic acid, lactic acid or potassium benzoate), before vacuum packaging and storage at 10 degrees C (48 days). Acetic acid, lactic acid or potassium benzoate applied alone reduced initial L. monocytogenes populations by 0.4-1.5 log cfu/cm(2), while treatments including Nisaplin caused reductions of 2.1-3.3 log cfu/cm(2). L. monocytogenes on untreated sausage formulated with antimicrobials had a lag phase duration of 10.2 days and maximum specific growth rate (mu(max)) of 0.089 per day, compared to no lag phase and mu(max) of 0.300 per day for L. monocytogenes on untreated product that did not contain antimicrobials in the formulation. The immersion treatments inhibited growth of the pathogen for 4.9-14.8 days on sausage formulated without potassium lactate-sodium diacetate; however, in all cases significant (P meat processors in their efforts to select required regulatory alternatives for control of post-processing contamination in meat products.

  3. Occurrence and antimicrobial resistance patterns of Listeria monocytogenes isolated from vegetables

    OpenAIRE

    Byrne,Vanessa de Vasconcelos; Hofer,Ernesto; Vallim,Deyse Christina; Almeida,Rogeria Comastri de Castro

    2016-01-01

    Abstract Although the consumption of fresh and minimally processed vegetables is considered healthy, outbreaks related to the contamination of these products are frequently reported. Among the food-borne pathogens that contaminate vegetables is Listeria monocytogenes, a ubiquitous organism that exhibits the ability to survive and multiply at refrigerated temperatures. This study aimed to evaluate the occurrence of L. monocytogenes in vegetables as well as the antimicrobial resistance of isola...

  4. Phenotypic and Genotypic Characteristics of Listeria monocytogenes Isolated From Dairy and Meat Products

    OpenAIRE

    Bahador; Sadeghi Kalani; Valian; Irajian; Lotfollahi

    2015-01-01

    Background Listeria monocytogenes is a foodborne pathogen and a serious threat to the public health in the world. Consumption of traditional foods such as dairy and meat products can be a major reason for relative abundance and isolation of these bacteria. Objectives The purpose of this study was to determine the phenotypic and genotypic characteristics of L. monocytogenes strains isolated from dairy and meat products. ...

  5. [Occurrence and typing of Listeria monocytogenes isolated from raw cow's milk collected on farms and from vending machines].

    Science.gov (United States)

    Gelbícová, T; Karpísková, R

    2012-04-01

    Evaluation of the incidence and characteristics of L. monocytogenes in samples of raw cow's milk collected on farms (bulk tank milk samples) and from vending machines. Detection of L. monocytogenes and enumeration were carried out according to EN/ISO 11290--1, 2. Strains were characterised by serotyping and macrorestriction analysis using pulsed-field gel electrophoresis. The presence of L. monocytogenes was detected in 3,2 % (11/346) of bulk tank milk samples and 1,8 % (4/219) samples of raw cow's milk from vending machines. Findings of L. monocytogenes in raw milk were sporadic. Only on one farm strains of L. monocytogenes were detected repeatedly. Thirteen strains of L. monocytogenes belonged to serotype 1/2a, two strains to serotype 1/2b and one to serotype 4b. Macrorestriction analysis revealed considerable heterogeinity of profiles, with nine different pulsotypes being detected. Pulsotype 711 was the most frequent. This pulsotype was found on three different farms. The incidence of L. monocytogenes in raw cow's milk is relatively low in the Czech Republic. The results confirmed that some clones of L. monocytogenes from raw milk are identical with food and human strains.

  6. Psychiatric diagnosis – is it universal or relative to culture?

    Science.gov (United States)

    Canino, Glorisa; Alegría, Margarita

    2009-01-01

    Background There is little consensus on the extent to which psychiatric disorders or syndromes are universal or the extent to which they differ on their core definitions and constellation of symptoms as a result of cultural or contextual factors. This controversy continues due to the lack of biological markers, imprecise measurement and the lack of a gold standard for validating most psychiatric conditions. Method Empirical studies were used to present evidence in favor of or against a universalist or relativistic view of child psychiatric disorders using a model developed by Robins and Guze to determine the validity of psychiatric disorders. Results The prevalence of some of the most common specific disorders and syndromes as well as its risk and protective factors vary across cultures, yet comorbid patterns and response to treatments vary little across cultures. Cross-cultural longitudinal data on outcomes is equivocal. Conclusions The cross-cultural validity of child disorders may vary drastically depending on the disorder, but empirical evidence that attests for the cross-cultural validity of diagnostic criteria for each child disorder is lacking. There is a need for studies that investigate the extent to which gene–environment interactions are related to specific disorders across cultures. Clinicians are urged to consider culture and context in determining the way in which children’s psychopathology may be manifested independent of their views. Recommendations for the upcoming classificatory system are provided so that practical or theoretical considerations are addressed about how culture and ethnic issues affect the assessment or treatment of specific disorders in children. PMID:18333929

  7. Culture related to road traffic safety: a comparison of eight countries using two conceptualizations of culture.

    Science.gov (United States)

    Nordfjærn, Trond; Şimşekoğlu, Özlem; Rundmo, Torbjorn

    2014-01-01

    The majority of previous cross-country studies of human factors relevant to traffic safety have not operationalized and measured culture. Also studies in this vein have mostly been carried out in Europe and the United States. The aim of the study was to examine country cluster differences, based on the Culture's Consequences framework, in road traffic risk perception, attitudes towards traffic safety and driver behaviour in samples from Norway, Russia, India, Ghana, Tanzania, Uganda, Turkey and Iran. An additional aim was to examine cluster differences in road traffic culture as symbol use and to investigate whether this theoretical cultural framework predicts risk perception, attitudes towards traffic safety and driver behaviour in the country clusters. The sample consisted of a total of 2418 individuals who were obtained by convenience sampling in the different countries. The countries segmented into four Culture's Consequences clusters; Norway, Russia and India, Sub-Saharan Africa, and Near East countries. The findings showed that Norwegians reported overall safer attitudes towards traffic safety and driver behaviour than the remaining country clusters. Individuals in Africa reported the highest risk perception. The countries also differed substantially in road traffic culture as symbol use. Contrary to established cultural theory, prediction models revealed that cultural factors were stronger predictors of driver behaviour than of risk perception. Also, the social cognitive risk constructs (i.e. risk perception and attitudes) solely explained variance in driver behaviour in the Norwegian and Russia/India clusters. Previous empirical efforts, which aimed to demonstrate that culture is important for the risk perception criterion, may have focused on a criterion variable that is not strongly related to driver behaviour. Furthermore, countermeasures aimed to influence social cognition may have stronger applicability in countries with a more individualistic western

  8. Growth, viability and architecture of biofilms of Listeria monocytogenes formed on abiotic surfaces

    Directory of Open Access Journals (Sweden)

    Fernanda Barbosa dos Reis-Teixeira

    Full Text Available Abstract The pathogenic bacterium Listeria monocytogenes can persist in food processing plants for many years, even when appropriate hygienic measures are in place, with potential for contaminating ready-to-eat products and, its ability to form biofilms on abiotic surfaces certainly contributes for the environmental persistence. In this research, L. monocytogenes was grown in biofilms up 8 days attached to stainless steel and glass surfaces, contributing for advancing the knowledge on architecture of mature biofilms, since many literature studies carried out on this topic considered only early stages of cell adhesion. In this study, biofilm populations of two strains of L. monocytogenes (serotypes 1/2a and 4b on stainless steel coupons and glass were examined using regular fluorescence microscopy, confocal laser scanning microscopy and classic culture method. The biofilms formed were not very dense and microscopic observations revealed uneven biofilm structures, with presence of exopolymeric matrix surrounding single cells, small aggregates and microcolonies, in a honeycomb-like arrangement. Moreover, planktonic population of L. monocytogenes (present in broth media covering the abiotic surface remained stable throughout the incubation time, which indicates an efficient dispersal mechanism, since the culture medium was replaced daily. In conclusion, even if these strains of L. monocytogenes were not able to form thick multilayer biofilms, it was noticeable their high persistence on abiotic surfaces, reinforcing the need to focus on measures to avoid biofilm formation, instead of trying to eradicate mature biofilms.

  9. Growth, viability and architecture of biofilms of Listeria monocytogenes formed on abiotic surfaces.

    Science.gov (United States)

    Reis-Teixeira, Fernanda Barbosa Dos; Alves, Virgínia Farias; de Martinis, Elaine Cristina Pereira

    The pathogenic bacterium Listeria monocytogenes can persist in food processing plants for many years, even when appropriate hygienic measures are in place, with potential for contaminating ready-to-eat products and, its ability to form biofilms on abiotic surfaces certainly contributes for the environmental persistence. In this research, L. monocytogenes was grown in biofilms up 8 days attached to stainless steel and glass surfaces, contributing for advancing the knowledge on architecture of mature biofilms, since many literature studies carried out on this topic considered only early stages of cell adhesion. In this study, biofilm populations of two strains of L. monocytogenes (serotypes 1/2a and 4b) on stainless steel coupons and glass were examined using regular fluorescence microscopy, confocal laser scanning microscopy and classic culture method. The biofilms formed were not very dense and microscopic observations revealed uneven biofilm structures, with presence of exopolymeric matrix surrounding single cells, small aggregates and microcolonies, in a honeycomb-like arrangement. Moreover, planktonic population of L. monocytogenes (present in broth media covering the abiotic surface) remained stable throughout the incubation time, which indicates an efficient dispersal mechanism, since the culture medium was replaced daily. In conclusion, even if these strains of L. monocytogenes were not able to form thick multilayer biofilms, it was noticeable their high persistence on abiotic surfaces, reinforcing the need to focus on measures to avoid biofilm formation, instead of trying to eradicate mature biofilms. Copyright © 2017. Published by Elsevier Editora Ltda.

  10. Effect of citral and carvacrol on the susceptibility of Listeria monocytogenes and Listeria innocua to antibiotics.

    Science.gov (United States)

    Zanini, S F; Silva-Angulo, A B; Rosenthal, A; Rodrigo, D; Martínez, A

    2014-05-01

    The aim of this study was to evaluate the antibiotic susceptibility of Listeria innocua (L. innocua) and Listeria monocytogenes (L. monocytogenes) cells in the presence of citral and carvacrol at sublethal concentrations in an agar medium. The presence of terpenes in the L. monocytogenes and L. innocua culture medium provided a reduction in the minimal inhibitory concentration (MIC) of all the antibiotics tested. These effects were dependent on the concentration of terpenes present in the culture medium. The combination of citral and carvacrol potentiated antibiotic activity by reducing the MIC values of bacitracin and colistin from 32.0 and 128.0 μg ml⁻¹ to 1.0 and 2.0 μg ml⁻¹, respectively. Thus, both Listeria species became more susceptible to these drugs. In this way, the colistin and bacitracin resistance of L. monocytogenes and L. innocua was reversed in the presence of terpenes. Results obtained in this study show that the phytochemicals citral and carvacrol potentiate antibiotic activity, reducing the MIC values of cultured L. monocytogenes and L. innocua. Phytochemicals citral and carvacrol potentiate antibiotic activity of erythromycin, bacitracin and colistin by reducing the MIC values of cultured Listeria monocytogenes and Listeria innocua. This effect in reducing the MIC values of the antibiotics tested in both micro-organisms was increased when natural antimicrobials were combined. This finding indicated that the combination among terpenes and antibiotic may contribute in reducing the required dosage of antibiotics due to the possible effect of terpenes on permeation barrier of the micro-organism cell membrane. © 2014 The Society for Applied Microbiology.

  11. Career, Migration and the Life CV: A Relational Cultural Analysis

    Science.gov (United States)

    Schultheiss, Donna E.; Watts, Jane; Sterland, Ljaja; O'Neill, Maggie

    2011-01-01

    In response to the precarious and disadvantaged position of forced migrants in the United States and the UK, marked by unemployment, under employment and loss of career capital, this paper draws upon a relational cultural paradigm and a life design career model in order to understand migrant work life, shape the career intervention process and…

  12. MicroRNA-146a Deficiency Protects against Listeria monocytogenes Infection by Modulating the Gut Microbiota

    Directory of Open Access Journals (Sweden)

    Chong-Tao Du

    2018-03-01

    Full Text Available The gut microbiota and microRNAs play important roles in the defense against infection. However, the role of miR-146a in L. monocytogenes infection and gut microbiota remains unclear. We tried to determine whether miR-146a controlled L. monocytogenes infection by regulating the gut microbiota. Wild-type and miR-146a-deficient mice or macrophages were used to characterize the impact of miR-146a on animal survival, cell death, bacterial clearance, and gut microbiota following L. monocytogenes challenge. We found that L. monocytogenes infection induced miR-146a expression both in vitro and in vivo. When compared to wild-type mice, miR-146a-deficient mice were more resistant to L. monocytogenes infection. MiR-146a deficiency in macrophages resulted in reduced invasion and intracellular survival of L. monocytogenes. High-throughput sequencing of 16S rRNA revealed that the gut microbiota composition differed between miR-146a-deficient and wild-type mice. Relative to wild-type mice, miR-146a-deficient mice had decreased levels of the Proteobacteria phylum, Prevotellaceae family, and Parasutterella genus, and significantly increased short-chain fatty acid producing bacteria, including the genera Alistipes, Blautia, Coprococcus_1, and Ruminococcus_1. Wild-type mice co-housed with miR-146a-deficient mice had increased resistance to L. monocytogenes, indicating that miR-146a deficiency guides the gut microbiota to alleviate infection. Together, these results suggest that miR-146a deficiency protects against L. monocytogenes infection by regulating the gut microbiota.

  13. MicroRNA-146a Deficiency Protects against Listeria monocytogenes Infection by Modulating the Gut Microbiota.

    Science.gov (United States)

    Du, Chong-Tao; Gao, Wei; Ma, Ke; Yu, Shui-Xing; Li, Na; Yan, Shi-Qing; Zhou, Feng-Hua; Liu, Zhen-Zhen; Chen, Wei; Lei, Lian-Cheng; Yang, Yong-Jun; Han, Wen-Yu

    2018-03-26

    The gut microbiota and microRNAs play important roles in the defense against infection. However, the role of miR-146a in L. monocytogenes infection and gut microbiota remains unclear. We tried to determine whether miR-146a controlled L. monocytogenes infection by regulating the gut microbiota. Wild-type and miR-146a-deficient mice or macrophages were used to characterize the impact of miR-146a on animal survival, cell death, bacterial clearance, and gut microbiota following L. monocytogenes challenge. We found that L. monocytogenes infection induced miR-146a expression both in vitro and in vivo. When compared to wild-type mice, miR-146a-deficient mice were more resistant to L. monocytogenes infection. MiR-146a deficiency in macrophages resulted in reduced invasion and intracellular survival of L. monocytogenes . High-throughput sequencing of 16S rRNA revealed that the gut microbiota composition differed between miR-146a-deficient and wild-type mice. Relative to wild-type mice, miR-146a-deficient mice had decreased levels of the Proteobacteria phylum, Prevotellaceae family, and Parasutterella genus, and significantly increased short-chain fatty acid producing bacteria, including the genera Alistipes , Blautia , Coprococcus_1, and Ruminococcus_1 . Wild-type mice co-housed with miR-146a-deficient mice had increased resistance to L. monocytogenes , indicating that miR-146a deficiency guides the gut microbiota to alleviate infection. Together, these results suggest that miR-146a deficiency protects against L. monocytogenes infection by regulating the gut microbiota.

  14. Lineage specific recombination rates and microevolution in Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Nightingale Kendra K

    2008-10-01

    Full Text Available Abstract Background The bacterium Listeria monocytogenes is a saprotroph as well as an opportunistic human foodborne pathogen, which has previously been shown to consist of at least two widespread lineages (termed lineages I and II and an uncommon lineage (lineage III. While some L. monocytogenes strains show evidence for considerable diversification by homologous recombination, our understanding of the contribution of recombination to L. monocytogenes evolution is still limited. We therefore used STRUCTURE and ClonalFrame, two programs that model the effect of recombination, to make inferences about the population structure and different aspects of the recombination process in L. monocytogenes. Analyses were performed using sequences for seven loci (including the house-keeping genes gap, prs, purM and ribC, the stress response gene sigB, and the virulence genes actA and inlA for 195 L. monocytogenes isolates. Results Sequence analyses with ClonalFrame and the Sawyer's test showed that recombination is more prevalent in lineage II than lineage I and is most frequent in two house-keeping genes (ribC and purM and the two virulence genes (actA and inlA. The relative occurrence of recombination versus point mutation is about six times higher in lineage II than in lineage I, which causes a higher genetic variability in lineage II. Unlike lineage I, lineage II represents a genetically heterogeneous population with a relatively high proportion (30% average of genetic material imported from external sources. Phylograms, constructed with correcting for recombination, as well as Tajima's D data suggest that both lineages I and II have suffered a population bottleneck. Conclusion Our study shows that evolutionary lineages within a single bacterial species can differ considerably in the relative contributions of recombination to genetic diversification. Accounting for recombination in phylogenetic studies is critical, and new evolutionary models that

  15. Phenotypic and Genotypic Characteristics of Listeria monocytogenes Isolated From Dairy and Meat Products

    Directory of Open Access Journals (Sweden)

    Bahador

    2015-08-01

    Full Text Available Background Listeria monocytogenes is a foodborne pathogen and a serious threat to the public health in the world. Consumption of traditional foods such as dairy and meat products can be a major reason for relative abundance and isolation of these bacteria. Objectives The purpose of this study was to determine the phenotypic and genotypic characteristics of L. monocytogenes strains isolated from dairy and meat products. Materials and Methods A total of 317 dairy products and meat-processed samples were collected. Antibiotic susceptibility test was performed on each sample by the disk diffusion method (Kirby Bauer. Five reference loci were used for typing of L. monocytogenes strains by MLVA (Multiple Locus VNTR Analysis Technique. Results A total of 24 L. monocytogenes isolates were collected from the dairy and meat products. Resistance of isolated L. monocytogenes strains to penicillin G were 54.54% (from dairy products and 46.15% (from processed meat. Genetic relatedness of isolates were assessed by MLVA. Out of 13 different types, type 2 with 6 strains and type 3 with 4 strains, were the most common types. Conclusions MLVA analysis showed that samples obtained from different sources could have similar genetic profile. As a result, administration of penicillin in patients with listeriosis (especially pregnant women and antibiotic susceptibility test are recommended. The fast and accurate methods such as MLVA for tracking of pollution sources of L. monocytogenes are recommended during outbreaks.

  16. The Concept of Cultural Relativity in Moral Judgments Concerning Gender-Related Issues.

    Science.gov (United States)

    Boyd, D. R.; And Others

    The comparative study was designed to determine whether cultural relativism and ethical reasoning develop in a hierarchical manner when applied to culturally different phenomena. The phenomena investigated were moral judgments concerning gender-related issues. Thirty-six first through sixth-grade students from two private schools and 130…

  17. The Place of Culture in the Current International Relations

    Directory of Open Access Journals (Sweden)

    Constantin Frosin

    2011-05-01

    Full Text Available Culture and international relations easily appear to be mutually contradictory terms. To speak of "culture" is to invoke the creative capacities of human beings, to point, for example, to the constitutive role of values and visions, to the power of language and aesthetic expression, to communities great and small engaged in reconstructing normative aspirations and reshaping the possibilities for a decent way of life. To speak of "international relations," by contrast, is to draw upon an altogether bleaker account of the human condition, to refer to missiles and bombs, trade figures and debts, statesmanship and diplomacy, intrigue and force. It is to echo assertions about naked power and the sacrifice of cultural creativity and normative aspiration to the supposedly more enduring determinations of survival or supremacy. From the dark depths of international relations, the term culture takes on an aura of frivolity. It appears to refer to the idealistic and utopian, to the veneer of civilized decency that is always stripped away by the harsh realities of power politics and international conflict. This work aims at showing the contrary.

  18. Inhibitory Effect of Nisin on Listeria monocytogenes Inoculated into Surimi and Minced Meat

    Directory of Open Access Journals (Sweden)

    Masoud Rezaei

    2012-02-01

    Full Text Available Background & Objective: Listeria monocytogenes has already established as an important food born pathogen which induce listeriosis in human. Use of bacteriocins to provide food safety has been increased dramatically. Nisin has a wide spectrum inhibitory effect than the other bacteriocins and inhibits food-borne pathogens such as L. monocytogenes and many other Gram-positive spoilage microorganisms. The purpose of this study was to investigate the inhibitory effect of Nisin on population of Listeria monocytogenes and the role of changes in food components on the antilisterial properties of Nisin. Materials & Methods: The minced meat and surimi samples were inoculated by 1×104 cfu/g of L. monocytogenes. Then samples exposed to Nisin at the levels of 500 or 1000 IU/g were prepared. All treatments after packaging in plastic bags were kept for 12 days at refrigerator temperature. Samples were cultured on CHROMagarTM Listeria every 2 days and the number of listeria monocytogenes was counted. Results: two different concentrations of Nisin (500 or 1000 IU/g was not able to inhibit L. monocytogenes below the acceptable level for raw food (100 cells per g in minced meat and surimi of silver carp. But the number of bacteria reduces more in fish surimi as compared to the mince meal. Also, antilisterial activity of Nisin was reduced during the storage period. Conclusion: Inhibitory property of Nisin against L. monocytogenes in surimi significantly was higher than the minced (P<0.05. So it is possible the antilisterial properties of Nisin will increase by elimination of some enzymes during processing.

  19. Combined action of S-carvone and mild heat treatment on Listeria monocytogenes Scott A

    NARCIS (Netherlands)

    Karatzas, A.K.; Bennik, M.H.J.; Smid, E.J.; Kets, E.P.W.

    2000-01-01

    The combined action of the plant-derived volatile, S-carvone, and mild heat treatment on the food-borne pathogen, Listeria monocytogenes, was evaluated. The viability of exponential phase cultures grown at 8 °C could be reduced by 1.3 log units after exposure to S-carvone (5 mmol 1-1) for 30 min at

  20. Characterization and antibiotic susceptibility of Listeria monocytogenes isolated from poultry and red meat in Morocco

    Directory of Open Access Journals (Sweden)

    Hayat Ennaji

    2008-09-01

    Full Text Available Hayat Ennaji1,2, Mohammed Timinouni2, My Mustapha Ennaji3, Mohammed Hassar1, Nozha Cohen11Laboratoire de Microbiologie et Hygiène des Aliments et de l’Environnement, Institut Pasteur du Maroc., Casablanca, Morocco; 2Laboratoire de Microbiologie et Biologie Moléculaire, Institut Pasteur du Maroc., Casablanca, Morocco; 3Laboratoire de Virologie et Hygiène and Microbiologie., Faculté des Sciences et Techniques - Mohammedia, Université Hassan II, Mohammedia, MoroccoAbstract: This study was carried out on 426 samples of raw meats collected from butcheries and supermarkets in Casablanca, Morocco. The samples were examined for the occurrence of Listeria species. Strains of Listeria monocytogenes were characterized by several biochemical tests and confirmed by polymerase chain reaction (PCR. β-hemolytic cultures and nonhemolytic isolates were tested for biochemical properties with the Listeria API test. Among the 43 Listeria species isolates; we identified 10 strains for L. monocytogenes (23.3%, 31 strains for L. innocua (72.1% and 2 strains for L. welshimeri (4.6%. Strains of L. monocytogenes were separated by multiplex PCR; two serogroups IIb and IVb were thus differentiated. Antibiotic susceptibility of L. monocytogenes to 21 antibiotics was determined by the disk diffusion method. All isolates were susceptible to a wide range of the tested antibiotics with the exception of nalidixic acid, colistine and cephalosporins second and third generation for which they were all resistant.Keywords: antibiotic susceptibility, Listeria monocytogenes, meat, PCR

  1. An outbreak of an unusual strain of Listeria monocytogenes infection in North-East Scotland.

    Science.gov (United States)

    Okpo, Emmanuel; Leith, Jayne; Smith-Palmer, Alison; Bell, John; Parks, Duncan; Browning, Fiona; Byers, Lynn; Corrigan, Helen; Webster, Diana; Karcher, Anne M; Murray, Andrew; Storey, Tom

    2015-01-01

    Listeria monocytogenes infection is an important cause of illness and hospitalization in vulnerable individuals. In the present study, we describe a community outbreak of Listeria monocytogenes in the North-East region of Scotland, which was epidemiologically, environmentally and microbiologically linked to a local meat product and ready-to-eat product manufacturer. Infected individuals were interviewed, and an environmental investigation was conducted. Clinical and environmental samples were tested by culture, and isolates were typed by fluorescent amplified fragment length polymorphism (fAFLP). Three cases of Listeria monocytogenes were linked geographically, had the same serotype (1/2a) and were indistinguishable by fAFLP type XII.6. The human, food and environmental isolates were of the same serotype and were indistinguishable by molecular typing. This is the first community outbreak of L. monocytogenes reported in Scotland since the current outbreak surveillance was established in 1996. Epidemiological and laboratory evidence indicated poor hand hygiene, unhygienic practices and cross-contamination throughout the manufacturing process of ready-to-eat foods as a possible cause of the outbreak. More stringent control of commercial food establishments that provide ready-to-eat food and the need to advise specifically vulnerable groups, e.g., pregnant women, of the risk of L. monocytogenes in ready-to-eat food is urgently needed. Copyright © 2015 King Saud Bin Abdulaziz University for Health Sciences. Published by Elsevier Ltd. All rights reserved.

  2. Adhesion to the host cell surface is sufficient to mediate Listeria monocytogenes entry into epithelial cells

    Science.gov (United States)

    Ortega, Fabian E.; Rengarajan, Michelle; Chavez, Natalie; Radhakrishnan, Prathima; Gloerich, Martijn; Bianchini, Julie; Siemers, Kathleen; Luckett, William S.; Lauer, Peter; Nelson, W. James; Theriot, Julie A.

    2017-01-01

    The intestinal epithelium is the first physiological barrier breached by the Gram-positive facultative pathogen Listeria monocytogenes during an in vivo infection. Listeria monocytogenes binds to the epithelial host cell receptor E-cadherin, which mediates a physical link between the bacterium and filamentous actin (F-actin). However, the importance of anchoring the bacterium to F-actin through E-cadherin for bacterial invasion has not been tested directly in epithelial cells. Here we demonstrate that depleting αE-catenin, which indirectly links E-cadherin to F-actin, did not decrease L. monocytogenes invasion of epithelial cells in tissue culture. Instead, invasion increased due to increased bacterial adhesion to epithelial monolayers with compromised cell–cell junctions. Furthermore, expression of a mutant E-cadherin lacking the intracellular domain was sufficient for efficient L. monocytogenes invasion of epithelial cells. Importantly, direct biotin-mediated binding of bacteria to surface lipids in the plasma membrane of host epithelial cells was sufficient for uptake. Our results indicate that the only requirement for L. monocytogenes invasion of epithelial cells is adhesion to the host cell surface, and that E-cadherin–mediated coupling of the bacterium to F-actin is not required. PMID:28877987

  3. Carbon dioxide and nisin act synergistically on Listeria monocytogenes

    DEFF Research Database (Denmark)

    Nilsson, Lilian; Chen, Y.H.; Chikindas, M.L.

    2000-01-01

    This paper examines the synergistic action of carbon dioxide and nisin on Listeria monocytogenes Scott A wild-type and nisin-resistant (Nis(r)) cells grown in broth at 4 degrees C. Carbon dioxide extended the lag phase and decreased the specific growth rate of both strains, but to a greater degree...... for cultures in CO2. This synergism between nisin and CO2 was examined mechanistically by following the leakage of carboxyfluorescein (CF) from listerial liposomes. Carbon dioxide enhanced nisin-induced CF leakage, indicating that the synergistic action of CO2 and nisin occurs at the cytoplasmic membrane...

  4. Assessment of Listeria monocytogenes virulence in the Galleria mellonella insect larvae model.

    Science.gov (United States)

    Rakic Martinez, Mira; Wiedmann, Martin; Ferguson, Martine; Datta, Atin R

    2017-01-01

    Several animal models have been used to understand the molecular basis of the pathogenicity, infectious dose and strain to strain variation of Listeria monocytogenes. The greater wax worm Galleria mellonella, as an alternative model, provides some useful advantages not available with other models and has already been described as suitable for the virulence assessment of various pathogens including L. monocytogenes. The objectives of this study are: 1) confirming the usefulness of this model with a wide panel of Listeria spp. including non-pathogenic L. innocua, L. seeligeri, L. welshimeri and animal pathogen L. ivanovii; 2) assessment of virulence of several isogenic in-frame deletion mutants in virulence and stress related genes of L. monocytogenes and 3) virulence assessment of paired food and clinical isolates of L. monocytogenes from 14 major listeriosis outbreaks occurred worldwide between 1980 and 2015. Larvae injected with different concentrations of Listeria were incubated at 37°C and monitored over seven days for time needed to kill 50% of larvae (LT50) and to determine change of bacterial population in G. mellonella, 2 and 24 hours post-inoculation. Non-pathogenic members of Listeria and L. ivanovii showed significantly (P monocytogenes strains. Isogenic mutants of L. monocytogenes with the deletions in prfA, plcA, hly, actA and virR genes, also showed significantly (P monocytogenes strains related to non-invasive (gastroenteritis) outbreaks of listeriosis showed significantly (P < 0.05) lower virulence than isolates of the same serotype obtained from outbreaks with invasive symptoms. The difference, however, was dose and strain- dependent. No significant differences in virulence were observed among the serotype tested in this study.

  5. Real-time PCR detection of Listeria monocytogenes in infant formula and lettuce following macrophage-based isolation and enrichment.

    Science.gov (United States)

    Day, J B; Basavanna, U

    2015-01-01

    To develop a rapid detection procedure for Listeria monocytogenes in infant formula and lettuce using a macrophage-based enrichment protocol and real-time PCR. A macrophage cell culture system was employed for the isolation and enrichment of L. monocytogenes from infant formula and lettuce for subsequent identification using real-time PCR. Macrophage monolayers were exposed to infant formula and lettuce contaminated with a serial dilution series of L. monocytogenes. As few as approx. 10 CFU ml(-1) or g(-1) of L. monocytogenes were detected in infant formula and lettuce after 16 h postinfection by real-time PCR. Internal positive PCR controls were utilized to eliminate the possibility of false-negative results. Co-inoculation with Listeria innocua did not reduce the L. monocytogenes detection sensitivity. Intracellular L. monocytogenes could also be isolated on Listeria selective media from infected macrophage lysates for subsequent confirmation. The detection method is highly sensitive and specific for L. monocytogenes in infant formula and lettuce and establishes a rapid identification time of 20 and 48 h for presumptive and confirmatory identification, respectively. The method is a promising alternative to many currently used q-PCR detection methods which employ traditional selective media for enrichment of contaminated food samples. Macrophage enrichment of L. monocytogenes eliminates PCR inhibitory food elements and contaminating food microflora which produce cleaner samples that increase the rapidity and sensitivity of detection. Published 2014. This article is a U.S. Government work and is in the public domain in the USA.

  6. Differentiation of different mixed Listeria strains and also acid-injured, heat-injured, and repaired cells of Listeria monocytogenes using fourier transform infrared spectroscopy.

    Science.gov (United States)

    Nyarko, Esmond; Donnelly, Catherine

    2015-03-01

    Fourier transform infrared (FT-IR) spectroscopy was used to differentiate mixed strains of Listeria monocytogenes and mixed strains of L. monocytogenes and Listeria innocua. FT-IR spectroscopy was also applied to investigate the hypothesis that heat-injured and acid-injured cells would return to their original physiological integrity following repair. Thin smears of cells on infrared slides were prepared from cultures for mixed strains of L. monocytogenes, mixed strains of L. monocytogenes and L. innocua, and each individual strain. Heat-injured and acid-injured cells were prepared by exposing harvested cells of L. monocytogenes strain R2-764 to a temperature of 56 ± 0.2°C for 10 min or lactic acid at pH 3 for 60 min, respectively. Cellular repair involved incubating aliquots of acid-injured and heat-injured cells separately in Trypticase soy broth supplemented with 0.6% yeast extract for 22 to 24 h; bacterial thin smears on infrared slides were prepared for each treatment. Spectral collection was done using 250 scans at a resolution of 4 cm(-1) in the mid-infrared wavelength region. Application of multivariate discriminant analysis to the wavelength region from 1,800 to 900 cm(-1) separated the individual L. monocytogenes strains. Mixed strains of L. monocytogenes and L. monocytogenes cocultured with L. innocua were successfully differentiated from the individual strains when the discriminant analysis was applied. Different mixed strains of L. monocytogenes were also successfully separated when the discriminant analysis was applied. A data set for injury and repair analysis resulted in the separation of acid-injured, heat-injured, and intact cells; repaired cells clustered closer to intact cells when the discriminant analysis (1,800 to 600 cm(-1)) was applied. FT-IR spectroscopy can be used for the rapid source tracking of L. monocytogenes strains because it can differentiate between different mixed strains and individual strains of the pathogen.

  7. Cultural and gender differences in emotion regulation: relation to depression.

    Science.gov (United States)

    Kwon, Hoin; Yoon, K Lira; Joormann, Jutta; Kwon, Jung-Hye

    2013-01-01

    In the last decade, studies have shown that the use of specific emotion regulation strategies contributes to an increased risk for depression. Past research, however, has overlooked potential cultural and gender differences in emotion regulation. The present study examined the relation between the use of emotion regulation strategies and depressive symptoms among college students in two different cultures (n=380 in Seoul, Korea; n=384 in Miami, USA). Koreans, compared with American students, reported more frequent use of brooding, whereas Americans reported more anger suppression than Koreans. Women were more likely than men to use both types of rumination (i.e., reflective pondering and brooding) and anger suppression in both countries, but these gender differences disappeared once levels of depressive symptoms were controlled for. In addition, the association between the use of reappraisal and depressive symptoms was significantly stronger in the Korean compared to the US sample. In contrast, the association between anger suppression and depressive symptoms was significantly stronger in the American compared to the Korean sample. These findings highlight the importance of considering the role of culture in emotion regulation.

  8. Viable-but-Nonculturable Listeria monocytogenes and Salmonella enterica Serovar Thompson Induced by Chlorine Stress Remain Infectious

    Directory of Open Access Journals (Sweden)

    Callum J. Highmore

    2018-04-01

    Full Text Available The microbiological safety of fresh produce is monitored almost exclusively by culture-based detection methods. However, bacterial food-borne pathogens are known to enter a viable-but-nonculturable (VBNC state in response to environmental stresses such as chlorine, which is commonly used for fresh produce decontamination. Here, complete VBNC induction of green fluorescent protein-tagged Listeria monocytogenes and Salmonella enterica serovar Thompson was achieved by exposure to 12 and 3 ppm chlorine, respectively. The pathogens were subjected to chlorine washing following incubation on spinach leaves. Culture data revealed that total viable L. monocytogenes and Salmonella Thompson populations became VBNC by 50 and 100 ppm chlorine, respectively, while enumeration by direct viable counting found that chlorine caused a <1-log reduction in viability. The pathogenicity of chlorine-induced VBNC L. monocytogenes and Salmonella Thompson was assessed by using Caenorhabditis elegans. Ingestion of VBNC pathogens by C. elegans resulted in a significant life span reduction (P = 0.0064 and P < 0.0001, and no significant difference between the life span reductions caused by the VBNC and culturable L. monocytogenes treatments was observed. L. monocytogenes was visualized beyond the nematode intestinal lumen, indicating resuscitation and cell invasion. These data emphasize the risk that VBNC food-borne pathogens could pose to public health should they continue to go undetected.

  9. Genotypes Associated with Listeria monocytogenes Isolates Displaying Impaired or Enhanced Tolerances to Cold, Salt, Acid, or Desiccation Stress

    DEFF Research Database (Denmark)

    Hingston, Patricia A.; Chen, Jessica; Dhillon, Bhavjinder K

    2017-01-01

    elements. A whole genome single-nucleotide-variants phylogeny revealed sporadic distribution of tolerant isolates and closely related sensitive and tolerant isolates, highlighting that minor genetic differences can influence the stress tolerance of L. monocytogenes. Specifically, a number of cold......The human pathogen Listeria monocytogenes is a large concern in the food industry where its continuous detection in food products has caused a string of recalls in North America and Europe. Most recognized for its ability to grow in foods during refrigerated storage, L. monocytogenes can also...... tolerate several other food-related stresses with some strains possessing higher levels of tolerances than others. The objective of this study was to use a combination of phenotypic analyses and whole genome sequencing to elucidate potential relationships between L. monocytogenes genotypes and food...

  10. An ecological perspective of Listeria monocytogenes biofilms in food processing facilities.

    Science.gov (United States)

    Valderrama, Wladir B; Cutter, Catherine N

    2013-01-01

    Listeria monocytogenes can enter the food chain at virtually any point. However, food processing environments seem to be of particular importance. From an ecological point of view, food processing facilities are microbial habitats that are constantly disturbed by cleaning and sanitizing procedures. Although L. monocytogenes is considered ubiquitous in nature, it is important to recognize that not all L. monocytogenes strains appear to be equally distributed; the distribution of the organism seems to be related to certain habitats. Currently, no direct evidence exists that L. monocytogenes-associated biofilms have played a role in food contamination or foodborne outbreaks, likely because biofilm isolation and identification are not part of an outbreak investigation, or the definition of biofilm is unclear. Because L. monocytogenes is known to colonize surfaces, we suggest that contamination patterns may be studied in the context of how biofilm formation is influenced by the environment within food processing facilities. In this review, direct and indirect epidemiological and phenotypic evidence of lineage-related biofilm formation capacity to specific ecological niches will be discussed. A critical view on the development of the biofilm concept, focused on the practical implications, strengths, and weaknesses of the current definitions also is discussed. The idea that biofilm formation may be an alternative surrogate for microbial fitness is proposed. Furthermore, current research on the influence of environmental factors on biofilm formation is discussed.

  11. Diamond like carbon Ag nanocomposites as a control measure against Campylobacter jejuni and Listeria monocytogenes on food preparation surfaces

    DEFF Research Database (Denmark)

    Tamulevičius, Sigitas; Zakarienė, Gintarė; Novoslavskij, Aleksandr

    2018-01-01

    on selective agars and quantitative real-time PCR (qPCR) including staining with propidium monoazide (PMA). It was determined, that DLC:Ag film was the most efficient coating in the reduction of C. jejuni and L. monocytogenes numbers. Culture-based enumeration revealed that C. jejuni numbers were reduced......:Ag antimicrobial surface showed a reduced ability to grow on culture media, but maintained viability during the whole experiment. Nonetheless, DLC:Ag antimicrobial surface could be further considered for the reduction of cross-contamination risk from food preparation surfaces due to their contamination with C....... jejuni and L. monocytogenes in domestic and commercial kitchens or food establishments....

  12. Sepsis and meningoencephalitis due to Listeria monocytogenes in patients with liver cirrhosis: a case of nonhepatic encephalopathy?

    Directory of Open Access Journals (Sweden)

    Federico Lari

    2012-10-01

    Full Text Available Introduction The appearance of neurological disorders in a patient with liver cirrhosis initially suggests hepatic encephalopathy, but other causes should be considered, including bacterial infections.Materials and methods An 80-year-old woman suffering from HCV-related cirrhosis was admitted for fever, confusion, and stupor. No improvement was seen after treatment with cephalosporins, lactulose, and fluids.Results Listeria monocytogenes was isolated from blood cultures and subsequently from a cerebrospinal fluid specimen as well. On the basis of the antibiogram, the antibiotic therapy was modified to include ampicillin, but shock and multiorgan failure developed and the patient died one week later.Discussion Bacterial infections are more common and more aggressive in patients with liver cirrhosis, probably because of the immune dysfunction associated with this disorder. The presence of neurological disorders in a patient with liver cirrhosis may be a sign of hepatic encephalopathy, but it is important to recall that there are other potential causes as well, including bacterial infections. In this case, it is possible that the patient's symptoms were the result of the CNS infection with L. monocytogenes, which was particularly aggressive as a result of her cirrhosis.

  13. Chitinase Expression in Listeria monocytogenes Is Influenced by lmo0327, Which Encodes an Internalin-Like Protein.

    Science.gov (United States)

    Paspaliari, Dafni Katerina; Kastbjerg, Vicky Gaedt; Ingmer, Hanne; Popowska, Magdalena; Larsen, Marianne Halberg

    2017-11-15

    The chitinolytic system of Listeria monocytogenes thus far comprises two chitinases, ChiA and ChiB, and a lytic polysaccharide monooxygenase, Lmo2467. The role of the system in the bacterium appears to be pleiotropic, as besides mediating the hydrolysis of chitin, the second most ubiquitous carbohydrate in nature, the chitinases have been deemed important for the colonization of unicellular molds, as well as mammalian hosts. To identify additional components of the chitinolytic system, we screened a transposon mutant library for mutants exhibiting impaired chitin hydrolysis. The screening yielded a mutant with a transposon insertion in a locus corresponding to lmo0327 of the EGD-e strain. lmo0327 encodes a large (1,349 amino acids [aa]) cell wall-associated protein that has been proposed to possess murein hydrolase activity. The single inactivation of lmo0327 , as well as of lmo0325 that codes for a putative transcriptional regulator functionally related to lmo0327 , led to an almost complete abolishment of chitinolytic activity. The effect could be traced at the transcriptional level, as both chiA and chiB transcripts were dramatically decreased in the lmo0327 mutant. In accordance with that, we could barely detect ChiA and ChiB in the culture supernatants of the mutant strain. Our results provide new information regarding the function of the lmo0325-lmo0327 locus in L. monocytogenes and link it to the expression of chitinolytic activity. IMPORTANCE Many bacteria from terrestrial and marine environments express chitinase activities enabling them to utilize chitin as the sole source of carbon and nitrogen. Interestingly, several bacterial chitinases may also be involved in host pathogenesis. For example, in the important foodborne pathogen Listeria monocytogenes , the chitinases ChiA and ChiB and the lytic polysaccharide monooxygenase Lmo2467 are implicated in chitin assimilation but also act as virulence factors during the infection of mammalian hosts. Therefore

  14. Enrichment dynamics of Listeria monocytogenes and the associated microbiome from naturally contaminated ice cream linked to a listeriosis outbreak.

    Science.gov (United States)

    Ottesen, Andrea; Ramachandran, Padmini; Reed, Elizabeth; White, James R; Hasan, Nur; Subramanian, Poorani; Ryan, Gina; Jarvis, Karen; Grim, Christopher; Daquiqan, Ninalynn; Hanes, Darcy; Allard, Marc; Colwell, Rita; Brown, Eric; Chen, Yi

    2016-11-16

    Microbiota that co-enrich during efforts to recover pathogens from foodborne outbreaks interfere with efficient detection and recovery. Here, dynamics of co-enriching microbiota during recovery of Listeria monocytogenes from naturally contaminated ice cream samples linked to an outbreak are described for three different initial enrichment formulations used by the Food and Drug Administration (FDA), the International Organization of Standardization (ISO), and the United States Department of Agriculture (USDA). Enrichment cultures were analyzed using DNA extraction and sequencing from samples taken every 4 h throughout 48 h of enrichment. Resphera Insight and CosmosID analysis tools were employed for high-resolution profiling of 16S rRNA amplicons and whole genome shotgun data, respectively. During enrichment, other bacterial taxa were identified, including Anoxybacillus, Geobacillus, Serratia, Pseudomonas, Erwinia, and Streptococcus spp. Surprisingly, incidence of L. monocytogenes was proportionally greater at hour 0 than when tested 4, 8, and 12 h later with all three enrichment schemes. The corresponding increase in Anoxybacillus and Geobacillus spp.indicated these taxa co-enriched in competition with L. monocytogenes during early enrichment hours. L. monocytogenes became dominant after 24 h in all three enrichments. DNA sequences obtained from shotgun metagenomic data of Listeria monocytogenes at 48 h were assembled to produce a consensus draft genome which appeared to have a similar tracking utility to pure culture isolates of L. monocytogenes. All three methods performed equally well for enrichment of Listeria monocytogenes. The observation of potential competitive exclusion of L. mono by Anoxybacillus and Geobacillus in early enrichment hours provided novel information that may be used to further optimize enrichment formulations. Application of Resphera Insight for high-resolution analysis of 16S amplicon sequences accurately identified L. monocytogenes

  15. Relative transcription of Listeria monocytogenes virulence genes in liver pâtés with varying NaCl content

    DEFF Research Database (Denmark)

    Olesen, Inger; Thorsen, Line; Jespersen, Lene

    2010-01-01

    three liver pâtés with reduced NaCl content of which one also has been supplied with organic acids (Ca-acetate and Ca-lactate). The three strains (EGD-e: reference strain; O57: more NaCl sensitive; 6896: more NaCl tolerant) were selected out of twelve strains based on their growth in BHI broth adjusted......B for both O57 and 6896 were significantly higher when the strains were grown in BHI compared to the standard liver pâté. Reducing the NaCl content of the standard liver pâté did not change relative transcription levels of prfA, inlA, sigB or clpC (except for prfA in O57 and sigB in 6896). However......, the presence of Ca-acetate and Ca-lactate induced relative transcription of the stress response gene, clpC, for all three strains. This study demonstrates that relative microbial gene transcription can be measured in complex food matrices and points to the need for designing experimental set-ups in real food...

  16. Listeria monocytogenes-carrying consortia in food industry. Composition, subtyping and numerical characterisation of mono-species biofilm dynamics on stainless steel.

    Science.gov (United States)

    Rodríguez-López, Pedro; Saá-Ibusquiza, Paula; Mosquera-Fernández, Maruxa; López-Cabo, Marta

    2015-08-03

    In order to find out how real Listeria monocytogenes-carrying biofilms are in industrial settings, a total of 270 environmental samples belonging to work surfaces from fish (n = 123), meat (n = 75) and dairy industries (n = 72) were analysed in order to detect L. monocytogenes. 12 samples were positive for L. monocytogenes and a total of 18 different species were identified as accompanying microbiota in fish and meat industry. No L. monocytogenes was found in samples from dairy industry. Molecular characterisation combining results of AscI and ApaI macrorestriction PFGE assays yielded 7 different subtypes of L. monocytogenes sharing in 71.43% of cases the same serogroup (1/2a-3a). Results from dynamic numerical characterisation between L. monocytogenes monospecies biofilms on stainless steel (SS) using MATLAB-based tool BIOFILMDIVER demonstrated that except in isolate A1, in which a significant increase in the percentage of covered area (CA), average diffusion distance (ADD) and maximum diffusion distance (MDD) was observed after 120 h of culture, no significant differences were observed in the dynamics of the rest of the L. monocytogenes isolates. Quantitative dual-species biofilm association experiments performed on SS indicated that L. monocytogenes cell counts presented lower values in mixed-species cultures with certain species at 24 and 48 h compared with mono-species culture. However, they remained unaltered after 72 h except when co-cultured with Serratia fonticola which presented differences in all sampling times and was also the dominant species within the dual-species biofilm. When considering frequency of appearance of accompanying species, an ecological distribution was demonstrated as Escherichia coli appeared to be the most abundant in fish industry and Carnobacterium spp. in meat industry. Copyright © 2015 Elsevier B.V. All rights reserved.

  17. Prevalence and serotype distribution of Listeria monocytogenes isolated from foods in Montevideo-Uruguay

    Directory of Open Access Journals (Sweden)

    Valeria Braga

    Full Text Available ABSTRACT The aim of this work was to study the prevalence of Listeria monocytogenes in foods obtained in retail shops and food industries located in Montevideo-Uruguay, and to identify the serogroups of the obtained isolates. Three-thousand one-hundred and seventy-five food samples (frozen, deli meats, ready-to-eat and cheese were analyzed. The obtained isolates were serogrouped by multiplex PCR and serotyped by conventional procedure. Genetic comparisons were performed using pulsed-field gel electrophoresis on a sub-set of isolates belonging to the same serotype successively recovered from the same establishment. L. monocytogenes was isolated from 11.2% of samples. The highest prevalence was observed in frozen foods (38%, followed by cheese (10%. 1/2b and 4b were the most frequently identified serotypes. In six of 236 analyzed establishments we successively recovered L. monocytogenes isolates belonging to the same serotype. Most of them corresponded to serotype 1/2b. Pulsed-field gel electrophoresis profiles suggest that at least 33% of L. monocytogenes 1/2b isolates are genetically related and that may remain viable for prolonged periods. The observed prevalence of L. monocytogenes was lower than reported in neighboring countries. Our findings highlight the role that frozen foods may play in the spread of this pathogen, and the relevance of serotypes 1/2b and 4b.

  18. Effect of pulmonary irradiation from inhaled 90Y on immunity to Listeria monocytogenes in mice

    International Nuclear Information System (INIS)

    Sanchez, A.; Lundgren, D.L.; McClellan, R.O.

    1976-01-01

    The immunological response of mice subjected to irradiation from particles deposited in the lungs and challenged with Listeria monocytogenes was investigated. Mice, exposed by inhalation to 90 Y (a beta-emitting radionuclide) in relatively insoluble fused aluminosilicate particles, were immunized with L. monocytogenes either before or after exposure. Two additional groups of mice were either immunized or irradiated only. A group of control mice received no irradiation or immunization. The beta radiation dose absorbed by the lungs of each mouse at time of challenge averaged 10,000 rads. Fourteen days after immunization, all mice were challenged with 2 LD 50 doses of L. monocytogenes via the respiratory route. Survival of all immunized mice either with or without exposure to 90 Y varied from 90 to 100% as compared to 10 to 20% for the mice irradiated only and for control mice through 14 days after challenge. Pulmonary clearance of inhaled L. monocytogenes during the first 4 hr after challenge was suppressed in the mice irradiated only but not in those immunized only, or in the immunized and irradiated groups, and control mice. There appeared to be a suppression of proliferation of L. monocytogenes in lungs and spleen in the immunized groups 72 hr after challenge, whereas the lungs and spleens of the mice irradiated only and the control mice had extensive bacterial invasion. It was concluded that the 10,000 rads of beta radiation absorbed by the lungs did not suppress the immune mechanisms of the immunized mice

  19. Rapid detection of Listeria monocytogenes in milk using confocal micro-Raman spectroscopy and chemometric analysis.

    Science.gov (United States)

    Wang, Junping; Xie, Xinfang; Feng, Jinsong; Chen, Jessica C; Du, Xin-jun; Luo, Jiangzhao; Lu, Xiaonan; Wang, Shuo

    2015-07-02

    Listeria monocytogenes is a facultatively anaerobic, Gram-positive, rod-shape foodborne bacterium causing invasive infection, listeriosis, in susceptible populations. Rapid and high-throughput detection of this pathogen in dairy products is critical as milk and other dairy products have been implicated as food vehicles in several outbreaks. Here we evaluated confocal micro-Raman spectroscopy (785 nm laser) coupled with chemometric analysis to distinguish six closely related Listeria species, including L. monocytogenes, in both liquid media and milk. Raman spectra of different Listeria species and other bacteria (i.e., Staphylococcus aureus, Salmonella enterica and Escherichia coli) were collected to create two independent databases for detection in media and milk, respectively. Unsupervised chemometric models including principal component analysis and hierarchical cluster analysis were applied to differentiate L. monocytogenes from Listeria and other bacteria. To further evaluate the performance and reliability of unsupervised chemometric analyses, supervised chemometrics were performed, including two discriminant analyses (DA) and soft independent modeling of class analogies (SIMCA). By analyzing Raman spectra via two DA-based chemometric models, average identification accuracies of 97.78% and 98.33% for L. monocytogenes in media, and 95.28% and 96.11% in milk were obtained, respectively. SIMCA analysis also resulted in satisfied average classification accuracies (over 93% in both media and milk). This Raman spectroscopic-based detection of L. monocytogenes in media and milk can be finished within a few hours and requires no extensive sample preparation. Copyright © 2015 Elsevier B.V. All rights reserved.

  20. Cultural Studies and Sociology of Culture in Germany: Relations and Interrelations

    Directory of Open Access Journals (Sweden)

    Udo Göttlich

    2013-06-01

    Full Text Available Over the last three decades, attitudes towards cultural studies in Germany have developed within contexts of contact and conflict with a variety of disciplines, e.g. ethnology, anthropology, sociology, as well as the sociology of culture, liter-ary studies and Kulturwissenschaft(en. On the one hand there is a strong academ-ic interest in how cultural studies perceives and analyzes media culture, popular culture and everyday life. On the other hand boundaries with humanities and so-cial science remain, which leads to criticism and conflicts with cultural studies and its achievements.I will discuss some of the problems concerning the perception and reception of cultural studies among representatives of Kulturwissenschaft(en and sociology of culture. Furthermore I will draw on the role of cultural studies in thematizing cul-tural change and conflicts, and its ability to do so in a way that shows the im-portance of culture and politics.

  1. 78 FR 27939 - Draft Interagency Risk Assessment-Listeria monocytogenes

    Science.gov (United States)

    2013-05-13

    ... Listeria (L.) monocytogenes contamination of certain ready-to-eat (RTE) foods, for example cheese, deli... Scott, V.N., Survey of Listeria monocytogenes in ready-to-eat foods. Journal of Food Protection, 2003... monocytogenes in ready-to-eat processed meat and poultry collected in four FoodNet states in International...

  2. Occurrence of Listeria monocytogenes in smoked fish in Sokoto ...

    African Journals Online (AJOL)

    STORAGESEVER

    2008-09-03

    Sep 3, 2008 ... monocytogenes and other Listeria species are common contaminant of smoked fish, and this may pose serious public health implications. Key words: Smoked fish, Listeria monocytogenes, contamination, public health. INTRODUCTION ... L. monocytogenes belong to the recently emerging psychrotrophic ...

  3. Reconcilable differences? Human diversity, cultural relativity, and sense of community.

    Science.gov (United States)

    Townley, Greg; Kloos, Bret; Green, Eric P; Franco, Margarita M

    2011-03-01

    Sense of community (SOC) is one of the most widely used and studied constructs in community psychology. As proposed by Sarason in (The Psychological sense of community: prospects for a community psychology, Jossey-Bass, San Francisco, 1974), SOC represents the strength of bonding among community members. It is a valuable component of community life, and it has been linked to positive mental health outcomes, citizen participation, and community connectedness. However, promotion of SOC can become problematic in community psychology praxis when it conflicts with other core values proposed to define the field, namely values of human diversity, cultural relativity, and heterogeneity of experience and perspective. Several commentators have noted that promotion of SOC can conflict with multicultural diversity because it tends to emphasize group member similarity and appears to be higher in homogeneous communities. In this paper, we introduce the idea of a community-diversity dialectic as part of praxis and research in community psychology. We argue that systematic consideration of cultural psychology perspectives can guide efforts to address a community-diversity dialectic and revise SOC formulations that ultimately will invigorate community research and action. We provide a working agenda for addressing this dialectic, proposing that systematic consideration of the creative tension between SOC and diversity can be beneficial to community psychology.

  4. Listeria monocytogenes cross-contamination of cheese: risk throughout the food supply chain.

    Science.gov (United States)

    Sauders, B D; D'Amico, D J

    2016-10-01

    Listeria monocytogenes has been the most common microbial cause of cheese-related recalls in both the United States and Canada in recent years. Since L. monocytogenes is inactivated by pasteurization, the majority of these cases have been linked to environmental and cross-contamination of fresh-soft, soft-ripened, and semi-soft cheeses. Cross-contamination of foods with L. monocytogenes is a continuous risk throughout the food supply chain and presents unique challenges for subsequent illness and outbreak investigations. Reports on outbreaks of listeriosis attributed to cross-contamination downstream from primary processing help highlight the critical role of epidemiological investigation coupled with coordinated molecular subtyping and surveillance in the recognition and investigation of complex foodborne outbreaks. Despite their complexity, environmental sampling throughout the supply chain coupled with improved genotyping approaches and concomitant analysis of foodborne illness epidemiological exposure data are needed to help resolve these and similar cases more rapidly and with greater confidence.

  5. Microbial diversity and structure are drivers of the biological barrier effect against Listeria monocytogenes in soil.

    Science.gov (United States)

    Vivant, Anne-Laure; Garmyn, Dominique; Maron, Pierre-Alain; Nowak, Virginie; Piveteau, Pascal

    2013-01-01

    Understanding the ecology of pathogenic organisms is important in order to monitor their transmission in the environment and the related health hazards. We investigated the relationship between soil microbial diversity and the barrier effect against Listeria monocytogenes invasion. By using a dilution-to-extinction approach, we analysed the consequence of eroding microbial diversity on L. monocytogenes population dynamics under standardised conditions of abiotic parameters and microbial abundance in soil microcosms. We demonstrated that highly diverse soil microbial communities act as a biological barrier against L. monocytogenes invasion and that phylogenetic composition of the community also has to be considered. This suggests that erosion of diversity may have damaging effects regarding circulation of pathogenic microorganisms in the environment.

  6. Desiccation of adhering and biofilm Listeria monocytogenes on stainless steel: Survival and transfer to salmon products

    DEFF Research Database (Denmark)

    Hansen, Lisbeth Truelstrup; Vogel, Birte Fonnesbech

    2011-01-01

    The foodborne bacterial pathogen, Listeria monocytogenes, commonly contaminates foods during processing, where the microorganisms are potentially subjected to low relative humidity (RH) conditions for extended periods of time. The objective of this study was to examine survival during desiccation...... (43% RH and 15°C) of biofilm L. monocytogenes N53-1 cells on stainless steel coupons and to assess subsequent transfer to salmon products. Formation of static biofilm (2days at 100% RH and 15°C) prior to desiccation for 23days significantly (P...

  7. Kinetics of biofilm formation and desiccation survival of Listeria monocytogenes in single and dual species biofilms with Pseudomonas fluorescens, Serratia proteamaculans or Shewanella baltica on food-grade stainless steel surfaces.

    Science.gov (United States)

    Daneshvar Alavi, Hessam Edin; Truelstrup Hansen, Lisbeth

    2013-01-01

    This study investigated the dynamics of static biofilm formation (100% RH, 15 °C, 48-72 h) and desiccation survival (43% RH, 15 °C, 21 days) of Listeria monocytogenes, in dual species biofilms with the common spoilage bacteria, Pseudomonas fluorescens, Serratia proteamaculans and Shewanella baltica, on the surface of food grade stainless steel. The Gram-negative bacteria reduced the maximum biofilm population of L. monocytogenes in dual species biofilms and increased its inactivation during desiccation. However, due to the higher desiccation resistance of Listeria relative to P. fluorescens and S. baltica, the pathogen survived in greater final numbers. In contrast, S. proteamaculans outcompeted the pathogen during the biofilm formation and exhibited similar desiccation survival, causing the N21 days of Serratia to be ca 3 Log10(CFU cm(-2)) greater than that of Listeria in the dual species biofilm. Microscopy revealed biofilm morphologies with variable amounts of exopolymeric substance and the presence of separate microcolonies. Under these simulated food plant conditions, the fate of L. monocytogenes during formation of mixed biofilms and desiccation depended on the implicit characteristics of the co-cultured bacterium.

  8. Irrigation Is Significantly Associated with an Increased Prevalence of Listeria monocytogenes in Produce Production Environments in New York State.

    Science.gov (United States)

    Weller, Daniel; Wiedmann, Martin; Strawn, Laura K

    2015-06-01

    Environmental (i.e., meteorological and landscape) factors and management practices can affect the prevalence of foodborne pathogens in produce production environments. This study was conducted to determine the prevalence of Listeria monocytogenes, Listeria species (including L. monocytogenes), Salmonella, and Shiga toxin-producing Escherichia coli (STEC) in produce production environments and to identify environmental factors and management practices associated with their isolation. Ten produce farms in New York State were sampled during a 6-week period in 2010, and 124 georeferenced samples (80 terrestrial, 33 water, and 11 fecal) were collected. L. monocytogenes, Listeria spp., Salmonella, and STEC were detected in 16, 44, 4, and 5% of terrestrial samples, 30, 58, 12, and 3% of water samples, and 45, 45, 27, and 9% of fecal samples, respectively. Environmental factors and management practices were evaluated for their association with terrestrial samples positive for L. monocytogenes or other Listeria species by univariate logistic regression; analysis was not conducted for Salmonella or STEC because the number of samples positive for these pathogens was low. Although univariate analysis identified associations between isolation of L. monocytogenes or Listeria spp. from terrestrial samples and various water-related factors (e.g., proximity to wetlands and precipitation), multivariate analysis revealed that only irrigation within 3 days of sample collection was significantly associated with isolation of L. monocytogenes (odds ratio = 39) and Listeria spp. (odds ratio = 5) from terrestrial samples. These findings suggest that intervention at the irrigation level may reduce the risk of produce contamination.

  9. Effekt av ulike desinfeksjonsstrategier mot Listeria monocytogenes

    OpenAIRE

    Fossmo, Sabine

    2013-01-01

    Kontroll med bakterier som Listeria utgjør en stor utfordring for mange matprodusenter. Listeria monocytogenes er hovedsakelig et produksjonshygienisk problem, forbedret hygiene kan derfor være tiltak for å redusere overlevelse og smitteoverføring av bakterien i produksjonsmiljø. Hensikten med forsøkene i oppgaven var å undersøke effekten av ulike desinfeksjonsstrategier på drap av L. monocytogenes, både når bakteriene var i biofilm og i suspensjon. Dette inkluderte bruk av tradisjonelle desi...

  10. Cultural regulation of emotion: Individual, relational, and structural sources

    Directory of Open Access Journals (Sweden)

    Jozefien eDe Leersnyder

    2013-02-01

    Full Text Available The most prevalent and intense emotional experiences differ across cultures. These differences in emotional experience can be understood as the outcomes of emotion regulation, because emotions that fit the valued relationships within a culture tend to be most common and intense. We review evidence suggesting that emotion regulation underlying cultural differences in emotional experience often takes place at the point of emotion elicitation through the promotion of situations and appraisals that are consistent with culturally valued relationships. These regulatory processes depend on individual tendencies, but are also co-regulated within relationships—close others shape people’s environment and help them appraise events in culturally valued ways—and are afforded by structural conditions—people’s daily lives limit the opportunities for emotion, and afford certain appraisals. The combined evidence suggests that cultural differences in emotion regulation go well beyond the effortful regulation based on display rules.

  11. Cultural regulation of emotion: individual, relational, and structural sources.

    Science.gov (United States)

    De Leersnyder, Jozefien; Boiger, Michael; Mesquita, Batja

    2013-01-01

    The most prevalent and intense emotional experiences differ across cultures. These differences in emotional experience can be understood as the outcomes of emotion regulation, because emotions that fit the valued relationships within a culture tend to be most common and intense. We review evidence suggesting that emotion regulation underlying cultural differences in emotional experience often takes place at the point of emotion elicitation through the promotion of situations and appraisals that are consistent with culturally valued relationships. These regulatory processes depend on individual tendencies, but are also co-regulated within relationships-close others shape people's environment and help them appraise events in culturally valued ways-and are afforded by structural conditions-people's daily lives "limit" the opportunities for emotion, and afford certain appraisals. The combined evidence suggests that cultural differences in emotion regulation go well beyond the effortful regulation based on display rules.

  12. Inhibition of Listeria monocytogenes by propionic acid-based ingredients in cured deli-style Turkey.

    Science.gov (United States)

    Glass, Kathleen A; McDonnell, Lindsey M; Von Tayson, Roxanne; Wanless, Brandon; Badvela, Mani

    2013-12-01

    Listeria monocytogenes growth can be controlled on ready-to-eat meats through the incorporation of antimicrobial ingredients into the formulation or by postlethality kill steps. However, alternate approaches are needed to provide options that reduce sodium content but maintain protection against pathogen growth in meats after slicing. The objective of this study was to determine the inhibition of L. monocytogenes by propionic acid-based ingredients in high-moisture, cured turkey stored at 4 or 7°C. Six formulations of sliced, cured (120 ppm of NaNO2 ), deli-style turkey were tested, including control without antimicrobials, 3.2% lactate-diacetate blend (LD), 0.4% of a liquid propionate-benzoate-containing ingredient, or 0.3, 0.4, and 0.5% of a liquid propionate-containing ingredient. Products were inoculated with 5 log CFU L. monocytogenes per 100-g package (3 log CFU/ml rinsate), vacuum-sealed, and stored at 4 or 7°C for up to 12 weeks; and populations were enumerated by plating on modified Oxford agar. As expected, the control without antimicrobials supported rapid growth, with >2 log average per ml rinsate increase within 4 weeks of storage at 4°C, whereas growth was observed at 6 weeks for the LD treatment. For both replicate trials, all treatments that contained liquid propionate or propionate-benzoate limited L. monocytogenes growth to an increase of 1-log increase) was observed in individual samples for all propionate-containing treatments at weeks 10, 11, and 12. As expected, L. monocytogenes grew more rapidly when products were stored at 7°C, but trends in relative inhibition were similar to those observed at 4°C. These results verify that propionate-based ingredients inhibit growth of L. monocytogenes on sliced, high-moisture, cured turkey and can be considered as an alternative to reduce sodium-based salts while maintaining food safety.

  13. Cultural regulation of emotion: Individual, relational, and structural sources

    OpenAIRE

    De Leersnyder, Jozefien; Boiger, Michael; Mesquita, Batja

    2013-01-01

    The most prevalent and intense emotional experiences differ across cultures. These differences in emotional experience can be understood as the outcomes of emotion regulation, because emotions that fit the valued relationships within a culture tend to be most common and intense. We review evidence suggesting that emotion regulation underlying cultural differences in emotional experience often takes place at the point of emotion elicitation through the promotion of situations and appraisals th...

  14. Characterization of virulent Listeria monocytogenes isolates recovered from ready-to-eat meat products and consumers in Cairo, Egypt

    Directory of Open Access Journals (Sweden)

    Maysa A. I. Awadallah

    2014-10-01

    Full Text Available Aim: This study aimed to investigate the occurrence of some virulence genes distributed in Listeria monocytogenes isolated from ready-to-eat (RTE meat products and consumers in Cairo province, Egypt. Materials and Methods: A total of 120 beef luncheon, chicken luncheon and frankfurter beef (40 samples, each were collected from 10 different local shops situated in Al-salam city, Cairo province, Egypt. Stool samples were collected from 40 people who had the habit of consuming RTE meat. The suspected L. monocytogenes isolates were subjected to a multiplex polymerase chain reaction (PCR for rapid speciation and virulence determination using primers specific for inIA, inIC, and inIJ genes. Results: Culture examination of all samples on Oxford media revealed presence of colonies characteristic to L. monocytogenes in 6 beef luncheon (15%, 4 chicken luncheon (10%, 1 frankfurter beef (2.5% and 1 human stool (2.5% samples. Species identity of L. monocytogenes was verified through the amplification of a 800 bp fragment with inIA primers in 2 out of 6 culture isolates from beef luncheon (5%, and 1 out 4 culture isolates from chicken luncheon (2.5% samples. Statistical analysis revealed no significant difference between the occurrence of L. monocytogenes in different food samples examined (p>0.05. The virulence of these strains was ascertained by the presence of 517 bp and 238 bp fragments of inIC and inIJ genes, respectively in the isolates that contained the 800 bp fragment. The culture isolates obtained from one frankfurter beef sample, and one human stool sample were found negative by multiplex PCR for the presence of L. monocytogenes and its virulence specific genes. Conclusion: It could be concluded that L. monocytogenes are circulating in beef and chicken luncheon sold in Cairo, Egypt. Multiplex PCR is reliable for confirmation of L. monocytogenes. This study suggests the implementation of hygienic measures at all levels from production to consumption

  15. Ikwerre Intergroup Relations and its Impact on Their Culture

    African Journals Online (AJOL)

    Nneka Umera-Okeke

    Geographical factors aided the movement of people from one ecological zone ... Consequently, no human group, its level of development notwithstanding, ..... war between him and the community took some of his children – Amme, Ijinda, ... Dance, music and displays from hinterland cultures penetrated into Kalabari culture.

  16. Combination of endolysins and high pressure to inactivate Listeria monocytogenes.

    Science.gov (United States)

    van Nassau, Tomas J; Lenz, Christian A; Scherzinger, Anna S; Vogel, Rudi F

    2017-12-01

    Outbreaks of listeriosis are often related to the consumption of low-processed ready-to-eat food products (e.g. soft cheeses or smoked fish) contaminated with Listeria monocytogenes. Traditional preservation techniques, such as heat treatment, cannot eliminate Listeria from these products without strongly affecting the quality of the foods. We therefore investigated the use of endolysin (PlyP40, Ply511, or PlyP825) in combination with high hydrostatic pressure processing to kill L. monocytogenes in buffer. The results demonstrated a more than additive effect when both treatments were combined. For example, whereas 0.16 μg/mL PlyP825 or 300 MPa (1 min, 30 °C) applied individually reduced the cell count by 0.2 and 0.3 log cfu, respectively, a combined treatment resulted in a reduction of 5.5 log cfu. Similar results were obtained for the other endolysins combined with high pressure processing. We also showed that the synergistic inactivation of cells by endolysin and HHP is possible at a pressure level of only 200 MPa (2 min, 30 °C). Thus, the application of endolysins did not only substantially increase the bactericidal effect of high pressure, but it also enabled the inactivation of bacterial cells at much lower pressure levels. This shows the potential of using such combined processes for the inactivation of L. monocytogenes and food preservation. Copyright © 2017 Elsevier Ltd. All rights reserved.

  17. Chitinase Expression in Listeria monocytogenes Is Influenced by lmo0327, Which Encodes an InternalinLike Protein

    DEFF Research Database (Denmark)

    Paspaliari, Dafni Katerina; Kastbjerg, Vicky Gaedt; Ingmer, Hanne

    2017-01-01

    The chitinolytic system of Listeria monocytogenes thus far comprises two chitinases, ChiA and ChiB, and a lytic polysaccharide monooxygenase, Lmo2467. The role of the system in the bacterium appears to be pleiotropic, as besides mediating hydrolysis of chitin, the second most ubiquitous...... chitinase activities enabling them to utilize chitin as the sole source of carbon and nitrogen. Interestingly, several bacterial chitinases may also be involved in host pathogenesis. For example, in the important food borne pathogen Listeria monocytogenes, the chitinases ChiA and ChiB, and the lytic...... ChiA and ChiB in the culture supernatants of the mutant strain. Our results provide new information regarding the function of the lmo0325-lmo0327 locus in L. monocytogenes and link it to the expression of chitinolytic activity.Importance: Many bacteria from terrestrial and marine environments express...

  18. Functional clustering in hippocampal cultures: relating network structure and dynamics

    International Nuclear Information System (INIS)

    Feldt, S; Dzakpasu, R; Olariu, E; Żochowski, M; Wang, J X; Shtrahman, E

    2010-01-01

    In this work we investigate the relationship between gross anatomic structural network properties, neuronal dynamics and the resultant functional structure in dissociated rat hippocampal cultures. Specifically, we studied cultures as they developed under two conditions: the first supporting glial cell growth (high glial group), and the second one inhibiting it (low glial group). We then compared structural network properties and the spatio-temporal activity patterns of the neurons. Differences in dynamics between the two groups could be linked to the impact of the glial network on the neuronal network as the cultures developed. We also implemented a recently developed algorithm called the functional clustering algorithm (FCA) to obtain the resulting functional network structure. We show that this new algorithm is useful for capturing changes in functional network structure as the networks evolve over time. The FCA detects changes in functional structure that are consistent with expected dynamical differences due to the impact of the glial network. Cultures in the high glial group show an increase in global synchronization as the cultures age, while those in the low glial group remain locally synchronized. We additionally use the FCA to quantify the amount of synchronization present in the cultures and show that the total level of synchronization in the high glial group is stronger than in the low glial group. These results indicate an interdependence between the glial and neuronal networks present in dissociated cultures

  19. Prevalence of Listeria monocytogenes in poultry meat

    Directory of Open Access Journals (Sweden)

    Mehmet ELMALI

    2015-01-01

    Full Text Available AbstractThe objectives of this study were i to isolate Listeria spp. and Listeria monocytogenes in broiler wing meat samples, ii to confirm the isolates by PCR, based on prs and hly A gene sequences, iii to determine the seasonal and monthly distribution of the isolates. A total of 120 broiler wing meat samples (60 packaged pieces wrapped using strech film in styrofoam plates and 60 unpackaged pieces bought from different markets in Hatay province were analysed. Listeria spp. was isolated from 57 (47.5% out of 120 samples. Fifty-four, out of 57 Listeria spp. isolates were identified as L. monocytogenes. L. monocytogenes was isolated from the samples collected during the spring, winter, summer, and autumn at the levels of 26.6%, 40%, 53.3%, 60%, respectively. In this study, the isolation rates were found to be the highest in autumn, while the isolation rates were found to be the lowest in spring. As a consequence, high prevalence of Listeria spp. and L. monocytogenes in poultry wing meat samples may pose a risk for human health. We consider that with obeying the rules of good hygiene practices (GHP, good manufacturing practices (GMP and HACCP can minimize the contamination with Listeria spp.

  20. Control options for Listeria monocytogenes in seafoods

    DEFF Research Database (Denmark)

    Huss, Hans Henrik; Jørgensen, Lasse Vigel; Vogel, Birte Fonnesbech

    2000-01-01

    At least three outbreaks of listeriosis associated with seafood have been reported. Listeria monocytogenes is widely distributed in the general environment including fresh water, coastal water and live fish from these areas. Contamination or recontamination of seafood may also take place during...

  1. Listeria monocytogenes : nog steeds een probleem?

    NARCIS (Netherlands)

    Beumer, R.R.

    2011-01-01

    Listeria monocytogenes is net als vele andere bacteriële voedselpathogenen al tientallen jaren bekend. De meeste grondstoffen voor voedingsmiddelen komen uit de akker- en tuinbouw, de veehouderij en de visserij. Besmetting vindt daar plaats met micro-organismen afkomstig uit grond, fecaliën, water,

  2. Listeria monocytogenes en alimentos: ¿son todos los aislamientos igual de virulentos? Foodborne Listeria monocytogenes: are all the isolates equally virulent?

    Directory of Open Access Journals (Sweden)

    V. López

    2006-12-01

    Full Text Available Listeria monocytogenes es un patógeno humano que se transmite a través de los alimentos y que causa infecciones graves, con una alta tasa de mortalidad. A pesar de la ubicuidad del microorganismo, la tasa real de la enfermedad es bastante baja y se asocia casi siempre a condiciones predisponentes. Tradicionalmente se consideraba que los aislamientos presentes en los alimentos y en el ambiente tenían la misma capacidad patogénica que los aislamientos de origen clínico. Pero el análisis de mutaciones en los genes de determinados factores de virulencia (internalina, hemolisina, fosfolipasas, proteína de superficie ActA y proteína reguladora PrfA, los estudios cuantitativos realizados con cultivos celulares y la genética de poblaciones, están replanteando la discusión sobre la variabilidad de la virulencia de L. monocytogenes. A pesar de todos estos avances, no existe un único marcador que permita comprobar la virulencia de los aislamientos naturales de esta especie. Probablemente en el futuro, la combinación de diferentes marcadores moleculares permitirá detectar los alimentos contaminados sólo por los clones virulentos de L. monocytogenes, con lo que se mejorará la prevención de la listeriosis humana transmitida por alimentos.Listeria monocytogenes is a foodborne human pathogen responsible for invasive infections presenting overall a high mortality. Despite the ubiquity of the microorganism, the actual disease rate is quite low and the disease is most often associated with an underlying predisposition. Foodborne and environmental isolates were traditionally considered of similar pathogenicity compared to clinical isolates. But the analysis of mutations in the genes encoding specific virulence factors (internalin, hemolysin, phospholipases, surface protein ActA and regulator protein PrfA, quantitative studies with cell cultures and population genetics have raised considerable concerns about virulence differences among L

  3. Spontaneous Bacterial Peritonitis Caused by Infection with Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Michael Vincent F. Tablang

    2008-11-01

    Full Text Available Spontaneous bacterial peritonitis is a severe and life-threatening complication in patients with ascites caused by advanced liver disease. The organisms most commonly involved are coliform bacteria and third-generation cephalosporins are the empiric antibiotics of choice. This is an uncommon case of spontaneous bacterial peritonitis caused by Listeria monocytogenes in a female patient with liver cirrhosis from autoimmune hepatitis. She did not improve with ceftriaxone and her course was complicated by hepatic encephalopathy, seizures and multi-organ failure. This case emphasizes that a high index of suspicion should be maintained for timely diagnosis and treatment. Listerial peritonitis should be suspected in patients with end-stage liver disease and inadequate response to conventional antibiotics within 48–72 h. Ampicillin/sulbactam should be initiated while awaiting results of ascitic fluid or blood culture.

  4. Identification of Measures Related to Cross-Cultural Competence

    National Research Council Canada - National Science Library

    Ross, K. G; Thornson, C. A

    2008-01-01

    This task, the first of five tasks in a project to support Cultural Readiness for the Department of Defense, represents the first step in the development of a "paper and pencil" questionnaire measure...

  5. Cultural dimensions in population related issues in Nigeria ...

    African Journals Online (AJOL)

    ... population policy implementation strategies and implications for planning. Cultural practices, norms, values, beliefs and religion negatively influence procreation, population control measures, immunization, child survival transmission, management, child survival transmission, management and care of HIV and AIDS.

  6. Comparative genomics analyses revealed two virulent Listeria monocytogenes strains isolated from ready-to-eat food.

    Science.gov (United States)

    Lim, Shu Yong; Yap, Kien-Pong; Thong, Kwai Lin

    2016-01-01

    Listeria monocytogenes is an important foodborne pathogen that causes considerable morbidity in humans with high mortality rates. In this study, we have sequenced the genomes and performed comparative genomics analyses on two strains, LM115 and LM41, isolated from ready-to-eat food in Malaysia. The genome size of LM115 and LM41 was 2,959,041 and 2,963,111 bp, respectively. These two strains shared approximately 90% homologous genes. Comparative genomics and phylogenomic analyses revealed that LM115 and LM41 were more closely related to the reference strains F2365 and EGD-e, respectively. Our virulence profiling indicated a total of 31 virulence genes shared by both analysed strains. These shared genes included those that encode for internalins and L. monocytogenes pathogenicity island 1 (LIPI-1). Both the Malaysian L. monocytogenes strains also harboured several genes associated with stress tolerance to counter the adverse conditions. Seven antibiotic and efflux pump related genes which may confer resistance against lincomycin, erythromycin, fosfomycin, quinolone, tetracycline, and penicillin, and macrolides were identified in the genomes of both strains. Whole genome sequencing and comparative genomics analyses revealed two virulent L. monocytogenes strains isolated from ready-to-eat foods in Malaysia. The identification of strains with pathogenic, persistent, and antibiotic resistant potentials from minimally processed food warrant close attention from both healthcare and food industry.

  7. Listeria Spp. and Listeria Monocytogenes Contamination in Ready-To-Eat Sandwiches Collected from Vending Machines.

    Science.gov (United States)

    Cossu, Francesca; Spanu, Carlo; Deidda, Silvia; Mura, Erica; Casti, Daniele; Pala, Carlo; Lamon, Sonia; Spanu, Vincenzo; Ibba, Michela; Marrocu, Elena; Scarano, Christian; Piana, Andrea; De Santis, Enrico Pietro Luigi

    2016-04-19

    Ready-to-eat (RTE) food is characterised by a long shelf-life at refrigerated temperature and can be consumed as such, without any treatment. The aim of the work was to evaluate the presence of Listeria spp. and Listeria monocytogenes in RTEs collected from refrigerated vending machines placed in hospital environment and accessible to the hospitalised patients. In 4 different sampling, 55 RTEs were collected from vending machines of six hospitals located in different areas of Sardinia region. All the samples were characterised by similar manufacturing process, such as the use of modified atmosphere packaging and belonged to 5 different producers. Listeria spp. was not countable using the enumeration method in all of the analysed samples. Using the detection method, Listeria spp. was recovered from 9 sandwich samples. Interestingly, 3 of these samples (5.5%) made by the manufacturer, were positive for L. monocytogenes contamination. The risk related to the L. monocytogenes presence in RTEs proportionally increases when food is introduced in susceptible environments , such as hospitals and consumed by susceptible people . Although the RTEs analysed showed values that complied with the European microbiological criteria for foodstuffs, the availability of these products in a susceptible environment should be carefully checked. Therefore, in order to limit the possible exposition to L. monocytogenes , more information on the risk related to RTE consumption should be provided to the hospitalised patients.

  8. Listeria spp. and Listeria monocytogenes contamination in ready-to-eat sandwiches collected from vending machines

    Directory of Open Access Journals (Sweden)

    Francesca Cossu

    2016-05-01

    Full Text Available Ready-to-eat (RTE food is characterised by a long shelf-life at refrigerated temperature and can be consumed as such, without any treatment. The aim of the work was to evaluate the presence of Listeria spp. and Listeria monocytogenes in RTEs collected from refrigerated vending machines placed in hospital environment and accessible to the hospitalised patients. In 4 different sampling, 55 RTEs were collected from vending machines of six hospitals located in different areas of Sardinia region. All the samples were characterised by similar manufacturing process, such as the use of modified atmosphere packaging and belonged to 5 different producers. Listeria spp. was not countable using the enumeration method in all of the analysed samples. Using the detection method, Listeria spp. was recovered from 9 sandwich samples. Interestingly, 3 of these samples (5.5% made by the manufacturer, were positive for L. monocytogenes contamination. The risk related to the L. monocytogenes presence in RTEs proportionally increases when food is introduced in susceptible environments, such as hospitals and consumed by susceptible people. Although the RTEs analysed showed values that complied with the European microbiological criteria for foodstuffs, the availability of these products in a susceptible environment should be carefully checked. Therefore, in order to limit the possible exposition to L. monocytogenes, more information on the risk related to RTE consumption should be provided to the hospitalised patients.

  9. Effect of humidity and temperature on the survival of Listeria monocytogenes on surfaces.

    Science.gov (United States)

    Redfern, J; Verran, J

    2017-04-01

    Listeria monocytogenes is a pathogenic bacterium, with human disease and infection linked to dairy products, seafood, ready-to-eat meat and raw & undercooked meats. Stainless steel is the most common food preparation surface and therefore, it is important to understand how food storage conditions such as surface materials, temperature and relative humidity can affect survival of L. monocytogenes. In this study, survival of L. monocytogenes on stainless steel was investigated at three temperatures (4, 10 and 21°C), each approx. 11, 50 and 85% humidity. Results indicate that the lower the temperature, the more cells were recovered in all three humidity environments, while medium humidity enhances survival, irrespective of temperature. Lower humidity decreases recovery at all temperatures. These data support the guidance noted above that humidity control is important, and that lower humidity environments are less likely to support retention of viable L. monocytogenes on a stainless steel surface. Understanding survival of potential food-borne pathogens is essential for the safe production and preparation of food. While it has long been 'common knowledge' that relative humidity can affect the growth and survival of micro-organisms, this study systematically describes the survival of L. monocytogenes on stainless steel under varying humidity and temperatures for the first time. The outcomes from this paper will allow those involved with food manufacture and preparation to make informed judgement on environmental conditions relating to humidity control, which is lacking in the food standards guidelines. © 2017 The Society for Applied Microbiology.

  10. Listeria monocytogenes in RTE foods marketed in Italy: prevalence and automated EcoRI ribotyping of the isolates.

    Science.gov (United States)

    Meloni, Domenico; Galluzzo, Pietro; Mureddu, Anna; Piras, Francesca; Griffiths, Mansel; Mazzette, Rina

    2009-02-15

    The aims of the present study were: (a) to investigate the prevalence and the enumeration of Listeria monocytogenes in 200 samples of ready to eat (RTE) foods of animal and vegetal origin collected from different outlets and processing plants in Sardinia; (b) to characterize the isolates by phenotypical and molecular methods; (c) to analyze a subset of 42 L. monocytogenes by automated EcoRI ribotyping in order to predict the strain's potential virulence for humans. The strains were isolated from: smoked fish products, cooked marinated products, meat products and pre-packaged mixed vegetable salads. Of the samples tested, 22% were positive for Listeria spp. The prevalence of L. monocytogenes was 9.5%, while the level of L. monocytogenes in the positive samples was 93%), belonging to 17 different DuPont Identification Library Codes (DUP-IDs) clones. The Simpson's numerical index of discrimination was 0.911. Cluster analysis pointed out a high similarity among strains isolated from meat, fish, and vegetables of different origin. These results confirmed the existence of a widespread population of L. monocytogenes, characterized by highly related strains existing in different geographical areas. 65% of these strains belonged to lineage II (serotypes 1/2a and 1/2c), subtypes known to be associated with sporadic human listeriosis outbreaks. The remaining 35% of the isolates (serotypes 1/2b, 3b and 4b) were allocated to lineage I and belong to distinct clonal groups (DUP-ID 1038 and 1042), which again have been associated with several outbreaks of human listeriosis. Neither atypical profiles nor lineage III strains were found. EcoRI ribotyping was confirmed as a rapid and reliable method for L. monocytogenes typing, providing useful data for epidemiologic and clonality surveys of L. monocytogenes strains isolated from RTE foods.

  11. Adaptation of Listeria monocytogenes in a simulated cheese medium: effects on virulence using the Galleria mellonella infection model.

    Science.gov (United States)

    Schrama, D; Helliwell, N; Neto, L; Faleiro, M L

    2013-06-01

    The aim of this study was to evaluate the effect of the acid and salt adaptation in a cheese-based medium on the virulence potential of Listeria monocytogenes strains isolated from cheese and dairy processing environment using the Galleria mellonella model. Four L. monocytogenes strains were exposed to a cheese-based medium in conditions of induction of an acid tolerance response and osmotolerance response (pH 5·5 and 3·5% w/v NaCl) and injected in G. mellonella insects. The survival of insects and the L. monocytogenes growth kinetics in insects were evaluated. The gene expression of hly, actA and inlA genes was determined by real-time PCR. The adapted cells of two dairy strains showed reduced insect mortality (P 0·05) was found between adapted and nonadapted cells. The gene expression results evidenced an overexpression of virulence genes in cheese-based medium, but not in simulated insect-induced conditions. Our results suggest that adaptation to low pH and salt in a cheese-based medium can affect the virulence of L. monocytogenes, but this effect is strain dependent. In this study, the impact of adaptation to low pH and salt in a cheese-based medium on L. monocytogenes virulence was tested using the Wax Moth G. mellonella model. This model allowed the differentiation of the virulence potential between the L. monocytogenes strains. The effect of adaptation on virulence is strain dependent. The G. mellonella model revealed to be a prompt method to test food-related factors on L. monocytogenes virulence. © 2013 The Society for Applied Microbiology.

  12. Identification of Listeria monocytogenes on Green Mussels and Cockle Shell

    Directory of Open Access Journals (Sweden)

    Winiati Puji Rahayu

    2017-02-01

    Full Text Available AbstractGreen mussel (Perna viridis and cockle shell (Anadara granosa are one of many sources of animal protein which is many cultivated in Indonesia because their price is relatively affordable. This study was conducted to identify the presence of Listeria monocytogenes in 27 samples of green mussels and 3 samples of cockle shells using real-time Polymerase Chain Reaction (real-time PCR and biochemical methods. The target gene for amplification in real-time PCR was an hlyA gene because this gene was a determinant of virulence genes that produce listeriolysin O. Primers used in this study were forward primer DG69 (GTG CCG GGT AAA AGA CCA TA and reverse primer DG74 (CGC CAC TGA GAT ACT AT and fluorescence signals indicator using SYBR Green I. The results of analysis using real-time PCR were negative Listeria monocytogenes in all samples, while using biochemical methods there was one of 30 samples contaminated by Listeria welshimeri.

  13. Engineering approach to relative quantitative assessment of safety culture and related social issues in NPP operation

    International Nuclear Information System (INIS)

    Sivokon, V.; Gladyshev, M.; Malkin, S.

    2005-01-01

    The report is devoted to presentation of engineering approach and software tool developed for Safety Culture (SC) assessment as well as to the results of their implementation at Smolensk NPP. The engineering approach is logic evolution of the IAEA ASSET method broadly used at European NPPs in 90-s. It was implemented at Russian and other plants including Olkiluoto NPP in Finland. The approach allows relative quantitative assessing and trending the aspects of SC by the analysis of evens features and causes, calculation and trending corresponding indicators. At the same time plant's operational performances and related social issues, including efficiency of plant operation and personnel reliability, can be monitored. With the help of developed tool the joint team combined from personnel of Smolensk NPP and RRC 'Kurchatov Institute' ('KI') issued the SC self-assessment report, which identifies: families of recurrent events, main safety and operational problems ; their trends and importance to SC and plant efficiency; recommendations to enhance SC and operational performance

  14. Efflux pump-mediated benzalkonium chloride resistance in Listeria monocytogenes isolated from retail food.

    Science.gov (United States)

    Jiang, Xiaobing; Yu, Tao; Liang, Yu; Ji, Shengdong; Guo, Xiaowei; Ma, Jianmin; Zhou, Lijun

    2016-01-18

    In this study, efflux pump-mediated benzalkonium chloride (BC) resistance, including plasmid-encoded (Qac protein family and BcrABC) and chromosome-borne efflux pumps, was investigated in Listeria monocytogenes from retail food in China. Among the 59 L. monocytogenes strains, 13 (22.0%) strains were resistant to BC. The PCR results showed that bcrABC was harbored by 2 of 13 BC resistant strains. However, none of the qac genes were detected among the 59 strains. The bcrABC was absent in both of the plasmid cured strains, indicating that this BC resistance determinant was plasmid-encoded in the two bcrABC-positive strains. In the presence of reserpine, most of the bcrABC-negative strains had decreases in the MICs of BC, suggesting the existence of other efflux pumps and their role in BC resistance. After exposed to reserpine, the reduction in BC MICs was observed in the two cured strains, indicating that efflux pumps located on chromosome was also involved in BC resistance. Our findings suggest that food products may act as reservoirs for BC resistant isolates of L. monocytogenes and plasmid- and chromosome-encoded efflux pumps could mediate the BC resistance of L. monocytogenes, which is especially relevant to the adaption of this organism in food-related environments with frequent BC use. Copyright © 2015 Elsevier B.V. All rights reserved.

  15. [Risk assessment of Listeria monocytogenes in deli meats and vegetable salads].

    Science.gov (United States)

    Tian, Jing; Liu, Xiu-mei

    2009-09-01

    To analysis risk from Listeria monocytogenes in deli meats and vegetable salads. Use Risk Ranger which is a software programme developed by the University of Hobart, Australia and answer 11 questions on affecting the risk from hazards in the specific foods by combining data from national foodborne diseases surveillance network and some references to make semi-quantitative risk assessment for the specific food. Relative risk from Listeria monocytogenes in deli meats and vegetable salads is 61 and 52, respectively. Incidence of listeriosis caused by deli meats-Listeria monocytogenes pairs and vegetable salads-Listeria monocytogenes pairs is 5.4 and 0.2 cases per million people, respectively. Risk from the former is 32 times than that from the latter. By changing the selection for some risk factors in the model, it was known that the risks from two food-hazard combinations could decrease 10 times, if taking necessary actions after processing. Deli meats is a kind of high risk food for listeriosis.

  16. CHALLENGE TESTS WITH LISTERIA MONOCYTOGENES IN SALAMI: PRELIMINARY RESULTS

    Directory of Open Access Journals (Sweden)

    R. Mioni

    2013-02-01

    Full Text Available Challenge tests are the preferable methodology to study the behaviour of Listeria monocytogenes on ready to eat foods, according to Regulation (EC 2073/2005. Challenge testing using L. monocytogenes in seasoned salami from different food business operators showed, after seasoning of the product, a count reduction of the inoculated organisms without any further growth of the pathogen; however differences of L. monocytogenes behaviour could be observed according to different production protocols.

  17. Novel Cadmium Resistance Determinant in Listeria monocytogenes.

    Science.gov (United States)

    Parsons, Cameron; Lee, Sangmi; Jayeola, Victor; Kathariou, Sophia

    2017-03-01

    Listeria monocytogenes is a foodborne pathogen that can cause severe disease (listeriosis) in susceptible individuals. It is ubiquitous in the environment and often exhibits resistance to heavy metals. One of the determinants that enables Listeria to tolerate exposure to cadmium is the cadAC efflux system, with CadA being a P-type ATPase. Three different cadA genes (designated cadA1 to cadA3 ) were previously characterized in L. monocytogenes A novel putative cadmium resistance gene ( cadA4 ) was recently identified through whole-genome sequencing, but experimental confirmation for its involvement in cadmium resistance is lacking. In this study, we characterized cadA4 in L. monocytogenes strain F8027, a cadmium-resistant strain of serotype 4b. By screening a mariner-based transposon library of this strain, we identified a mutant with reduced tolerance to cadmium and that harbored a single transposon insertion in cadA4 The tolerance to cadmium was restored by genetic complementation with the cadmium resistance cassette ( cadA4C ), and enhanced cadmium tolerance was conferred to two unrelated cadmium-sensitive strains via heterologous complementation with cadA4C Cadmium exposure induced cadA4 expression, even at noninhibitory levels. Virulence assessments in the Galleria mellonella model suggested that a functional cadA4 suppressed virulence, potentially promoting commensal colonization of the insect larvae. Biofilm assays suggested that cadA4 inactivation reduced biofilm formation. These data not only confirm cadA4 as a novel cadmium resistance determinant in L. monocytogenes but also provide evidence for roles in virulence and biofilm formation. IMPORTANCE Listeria monocytogenes is an intracellular foodborne pathogen causing the disease listeriosis, which is responsible for numerous hospitalizations and deaths every year. Among the adaptations that enable the survival of Listeria in the environment are the abilities to persist in biofilms, grow in the cold, and

  18. Cultural interpretation of menstruation in relation to adolescent girls ...

    African Journals Online (AJOL)

    Information derived from researching cultural information on menstruation and other forms of blood flow in adolescent girls in Nigeria can contribute extensively to existing knowledge about the female world in general and on adolescent girls in particular. This will further encourage ongoing advocacy programmes in ...

  19. Assessment of Listeria monocytogenes virulence in the Galleria mellonella insect larvae model.

    Directory of Open Access Journals (Sweden)

    Mira Rakic Martinez

    Full Text Available Several animal models have been used to understand the molecular basis of the pathogenicity, infectious dose and strain to strain variation of Listeria monocytogenes. The greater wax worm Galleria mellonella, as an alternative model, provides some useful advantages not available with other models and has already been described as suitable for the virulence assessment of various pathogens including L. monocytogenes. The objectives of this study are: 1 confirming the usefulness of this model with a wide panel of Listeria spp. including non-pathogenic L. innocua, L. seeligeri, L. welshimeri and animal pathogen L. ivanovii; 2 assessment of virulence of several isogenic in-frame deletion mutants in virulence and stress related genes of L. monocytogenes and 3 virulence assessment of paired food and clinical isolates of L. monocytogenes from 14 major listeriosis outbreaks occurred worldwide between 1980 and 2015. Larvae injected with different concentrations of Listeria were incubated at 37°C and monitored over seven days for time needed to kill 50% of larvae (LT50 and to determine change of bacterial population in G. mellonella, 2 and 24 hours post-inoculation. Non-pathogenic members of Listeria and L. ivanovii showed significantly (P < 0.05 higher LT50 (lower virulence than the wild type L. monocytogenes strains. Isogenic mutants of L. monocytogenes with the deletions in prfA, plcA, hly, actA and virR genes, also showed significantly (P < 0.05 higher LT50 than the wild type strain at the inoculum of 106CFU/larva. Food isolates had significantly (P < 0.05 lower virulence than the paired clinical isolates, at all three inoculum concentrations. L. monocytogenes strains related to non-invasive (gastroenteritis outbreaks of listeriosis showed significantly (P < 0.05 lower virulence than isolates of the same serotype obtained from outbreaks with invasive symptoms. The difference, however, was dose and strain- dependent. No significant differences in

  20. Listeria spp. E Listeria monocytogenes NA PRODUÇÃO DE SALSICHAS TIPO HOT DOG

    Directory of Open Access Journals (Sweden)

    ALESSANDRA PARO RODRIGUES CESAR

    2011-06-01

    Full Text Available Listeria monocytogenes is widely distributed in the environment and it has been isolated from food that were associated to outbreaks of high lethality in many countries. Thus, this bacterium represents an important pathogen to the public health. Ready-to-eat products, likecooked stuffed food, within them, frankfurters, are associated to human listeriosis in many countries. Taking into consideration the importance of the subject and the need of more data about it, the occurrence of Listeria spp. and L. monocytogenes in industrial plants, in meat raw materials, in slurry and frankfurters was investigated.These samples were collected in two production plants with SIF (Federal Inspection Service; in one of them GMP, HACCP and SOP were implemented. The results of the 1 06 microbiological analysis were submitted to the program @Risk to obtain the risk analysis; the meanvalues results showed that 7 to 9% of the frankfurters in the market may have L. monocytogenes. The analysis indicated that 88 strains of L. monocytogenes were obtained from 1 06 samples; among them, 76 werecollected in the industrial plants that participate in the experiment, and 30 were collected in the market. In serological typification, 95% of these strains were classified as serotypes 4b, 1 /2a and 1 /2b. Besides the presence of the bacterium in frankfurthers consumed inBrazil and the risk factors associated to this pathogen, the situation concerns because of the lack of epidemiological data, absence of patterns and the deficient information given to the consumer, specially information related to the presence of L. monocytogenes, particularly important to the groups at risk, as well as information related to the importance of heating the product

  1. Highly specific fiber optic immunosensor coupled with immunomagnetic separation for detection of low levels of Listeria monocytogenes and L. ivanovii

    Science.gov (United States)

    2012-01-01

    Background Immunomagnetic separation (IMS) and immunoassays are widely used for pathogen detection. However, novel technology platforms with highly selective antibodies are essential to improve detection sensitivity, specificity and performance. In this study, monoclonal antibodies (MAbs) against Internalin A (InlA) and p30 were generated and used on paramagnetic beads of varying diameters for concentration, as well as on fiber-optic sensor for detection. Results Anti-InlA MAb-2D12 (IgG2a subclass) was specific for Listeria monocytogenes and L. ivanovii, and p30-specific MAb-3F8 (IgM) was specific for the genus Listeria. At all bacterial concentrations (103–108 CFU/mL) tested in the IMS assay; the 1-μm diameter MyOne beads had significantly higher capture efficiency (P Listeria antibody (9 %). Furthermore, capture efficiency for MyOne-2D12 was highly specific for L. monocytogenes and L. ivanovii. Subsequently, we captured L. monocytogenes by MyOne-2D12 and MyOne-3F8 from hotdogs inoculated with mono- or co-cultures of L. monocytogenes and L. innocua (10–40 CFU/g), enriched for 18 h and detected by fiber-optic sensor and confirmed by plating, light-scattering, and qPCR assays. The detection limit for L. monocytogenes and L. ivanovii by the fiber-optic immunosensor was 3 × 102 CFU/mL using MAb-2D12 as capture and reporter antibody. Selective media plating, light-scattering, and qPCR assays confirmed the IMS and fiber-optic results. Conclusions IMS coupled with a fiber-optic sensor using anti-InlA MAb is highly specific for L. monocytogenes and L. ivanovii and enabled detection of these pathogens at low levels from buffer or food. PMID:23176167

  2. A test of the culture-performance related distress hypothesis among employees in a collectivistic culture

    Directory of Open Access Journals (Sweden)

    Pheko, M.M

    2013-06-01

    Full Text Available To test the notions that people from collectivist cultures may experience more intense Sensitivity Towards being the Target of Upward Comparison (STTUC responses the current study investigated the relationships between traditional gender role orientation and STTUC, and collectivistic cultural orientation and STTUC. Using a quantitative, cross-sectional survey approach, a convenient sample of 464 participants from various organizations in Botswana completed the questionnaire. The participants were mostly female (59.9%, in a dating relationship (67.9%, and between the ages of 20 and 57 (M = 32.69, SD = 7.43. In the main, the hypotheses were not supported as the correlation results indicated that neither collectivistic cultural orientation nor traditional gender role orientation were linked to STTUC experiences. Discussions center on the importance of reporting and suggesting theoretical justifications for the so called ‘”nonsignificant findings.” Implications of the empirical findings and the future research directions are also discussed.

  3. Culture-Sustainability Relation: Towards a Conceptual Framework

    Directory of Open Access Journals (Sweden)

    Katriina Soini

    2016-02-01

    Full Text Available Several individual scholars and international organizations have attempted to conceptualize “culture” in its different meanings in sustainability. Despite those efforts, a tangle of different approaches are being used, reflecting the various disciplines and policy aims. In this paper we propose an interdisciplinary framework for identifying the different roles of culture in sustainability in an attempt to guide the research and policy activities in this complex field. The framework is comprised of three representations defined by a literature review on “cultural sustainability”, which are further explored through eight organizing dimensions that mark the similarities and differences between the three representations. The article reveals that the three representations are partly interlinked and that they also reveal gradients in the dynamics of the system, as well as in the human/nature interface.

  4. Filipinos in the Navy: Service, Interpersonal Relations, and Cultural Adaptation

    Science.gov (United States)

    1977-01-01

    self i:age involves racial identity. Not only do they make - heavy references to Malaysian , Filipino, Asian, and other labels with ethnic-racial...example, the responses in the various food categories elicited by the stimulus words HUNGRY and TO EAT reflect the main items of the group’s diet ...cultural groups’ diet . For example, the Korean group receives a high score for RICE, the U. S. group a very much lower score, and the Colombian group

  5. Food-related lifestyles: Cross-cultural validity and intra-cultural stability

    DEFF Research Database (Denmark)

    Scholderer, Joachim; Brunsø, Karen; Bredahl, Lone

    in terms of factor pattern, factor loadings, factor covariances and factor variances. In the second factor part of the analysis, replication samples from France (N1 = 1000, N2 = 1000), Germany (N1 = 1000, N2 = 1042), and the UK (N1 = 1000, N2 = 1000) are examined for intra-cultural stability using the same...

  6. Recombinant phage probes for Listeria monocytogenes

    Energy Technology Data Exchange (ETDEWEB)

    Carnazza, S; Gioffre, G; Felici, F; Guglielmino, S [Department of Microbiological, Genetic and Molecular Sciences, University of Messina, Messina (Italy)

    2007-10-03

    Monitoring of food and environmental samples for biological threats, such as Listeria monocytogenes, requires probes that specifically bind biological agents and ensure their immediate and efficient detection. There is a need for robust and inexpensive affinity probes as an alternative to antibodies. These probes may be recruited from random peptide libraries displayed on filamentous phage. In this study, we selected from two phage peptide libraries phage clones displaying peptides capable of specific and strong binding to the L. monocytogenes cell surface. The ability of isolated phage clones to interact specifically with L. monocytogenes was demonstrated using enzyme-linked immunosorbent assay (ELISA) and confirmed by co-precipitation assay. We also assessed the sensitivity of phage-bacteria binding by PCR on phage-captured Listeria cells, which could be detected at a concentration of 10{sup 4} cells ml{sup -1}. In addition, as proof-of-concept, we tested the possibility of immobilizing the affinity-selected phages to a putative biosensor surface. The quality of phage deposition was monitored by ELISA and fluorescent microscopy. Phage-bacterial binding was confirmed by high power optical phase contrast microscopy. Overall, the results of this work validate the concept of affinity-selected recombinant filamentous phages as probes for detecting and monitoring bacterial agents under any conditions that warrant their recognition, including in food products.

  7. Recombinant phage probes for Listeria monocytogenes

    Science.gov (United States)

    Carnazza, S.; Gioffrè, G.; Felici, F.; Guglielmino, S.

    2007-10-01

    Monitoring of food and environmental samples for biological threats, such as Listeria monocytogenes, requires probes that specifically bind biological agents and ensure their immediate and efficient detection. There is a need for robust and inexpensive affinity probes as an alternative to antibodies. These probes may be recruited from random peptide libraries displayed on filamentous phage. In this study, we selected from two phage peptide libraries phage clones displaying peptides capable of specific and strong binding to the L. monocytogenes cell surface. The ability of isolated phage clones to interact specifically with L. monocytogenes was demonstrated using enzyme-linked immunosorbent assay (ELISA) and confirmed by co-precipitation assay. We also assessed the sensitivity of phage-bacteria binding by PCR on phage-captured Listeria cells, which could be detected at a concentration of 104 cells ml-1. In addition, as proof-of-concept, we tested the possibility of immobilizing the affinity-selected phages to a putative biosensor surface. The quality of phage deposition was monitored by ELISA and fluorescent microscopy. Phage-bacterial binding was confirmed by high power optical phase contrast microscopy. Overall, the results of this work validate the concept of affinity-selected recombinant filamentous phages as probes for detecting and monitoring bacterial agents under any conditions that warrant their recognition, including in food products.

  8. A bioengineered nisin derivative, M21A, in combination with food grade additives eradicates biofilms of Listeria monocytogenes.

    Directory of Open Access Journals (Sweden)

    Lorraine Anne Draper

    2016-11-01

    Full Text Available The burden of foodborne disease has large economic and social consequences worldwide. Despite strict regulations, a number of pathogens persist within the food environment, which is greatly contributed to by a build-up of resistance mechanisms and also through the formation of biofilms. Biofilms have been shown to be highly resistant to a number of antimicrobials and can be extremely difficult to remove once they are established. In parallel, the growing concern of consumers regarding the use of chemically derived antimicrobials within food has led to a drive towards more natural products. As a consequence, the use of naturally derived antimicrobials has become of particular interest. In this study we investigated the efficacy of nisin A and its bioengineered derivative M21A in combination with food grade additives to treat biofilms of a representative strain of Listeria monocytogenes. Investigations revealed the enhanced antimicrobial effects, in liquid culture, of M21A in combination with citric acid or cinnamaldehyde over its wild type nisin A counterpart. Subsequently, an investigation was conducted into the effects of these combinations on an established biofilm of the same strain. Nisin M21A (0.1 µg/ml alone or in combination with cinnamaldehyde (35 µg/ml or citric acid (175 µg/ml performed significantly better than combinations involving nisin A. All combinations of M21A with either citric acid or cinnamaldehyde eradicated the L. monocytogenes biofilm (in relation to a non-biofilm control. We conclude that M21A in combination with available food additives could further enhance the antimicrobial treatment of biofilms within the food industry, simply by substituting nisin A with M21A in current commercial products such as Nisaplin (Danisco, DuPont.

  9. Predicting growth rates and growth boundary of Listeria monocytogenes - An international validation study with focus on processed and ready-to-eat meat and seafood

    DEFF Research Database (Denmark)

    Mejlholm, Ole; Gunvig, A.; Borggaard, C.

    2010-01-01

    The performance of six predictive models for Listeria monocytogenes was evaluated using 1014 growth responses of the pathogen in meat, seafood, poultry and dairy products. The performance of the growth models was closely related to their complexity i.e. the number of environmental parameters they...... be accurate. The successfully validated models are useful for assessment and management of L monocytogenes in processed and ready-to-eat (RTE) foods....... to accurately predict growth responses of L. monocytogenes in the wide range of food evaluated in the present study. When complexity of L monocytogenes growth models matches the complexity of foods of interest. i.e. the number of hurdles to microbial growth, then predicted growth responses of the pathogen can...

  10. Impact of Culture on Meat and Related Food Preferences in Akwa ...

    African Journals Online (AJOL)

    The effectiveness of meat and related food products marketing in Akwa Ibom State is conditioned by the specifics of culture. In this study, cultural effect on meat consumption is examined. A sample of 568 respondents were analysed with OLS regression. The results reveal that meat consumption and preferences for related ...

  11. Analysis of the sphere of health related physical culture in Palestine

    OpenAIRE

    Xадер, Самер

    2015-01-01

    Analysis of scientific literature dealing with health related physical culture status in Palestine has been made in order to determine the factors influencing fitness-technologies implementation. Historical, sociocultural, political, religious, economic conditions determining the current level and the prospects of health related physical culture development in Palestine have been determined.

  12. Alteration of the phospho- or neutral lipid content and fatty acid composition in Listeria monocytogenes due to acid adaptation mechanisms for hydrochloric, acetic and lactic acids at pH 5.5 or benzoic acid at neutral pH.

    Science.gov (United States)

    Mastronicolis, Sofia K; Berberi, Anita; Diakogiannis, Ioannis; Petrova, Evanthia; Kiaki, Irene; Baltzi, Triantafillia; Xenikakis, Polydoros

    2010-10-01

    This study provides a first approach to observe the effects on Listeria monocytogenes of cellular exposure to acid stress at low or neutral pH, notably how phospho- or neutral lipids are involved in this mechanism, besides the fatty acid profile alteration. A thorough investigation of the composition of polar and neutral lipids from L. monocytogenes grown at pH 5.5 in presence of hydrochloric, acetic and lactic acids, or at neutral pH 7.3 in presence of benzoic acid, is described relative to cells grown in acid-free medium. The results showed that only low pH values enhance the antimicrobial activity of an acid. We suggest that, irrespective of pH, the acid adaptation response will lead to a similar alteration in fatty acid composition [decreasing the ratio of branched chain/saturated straight fatty acids of total lipids], mainly originating from the neutral lipid class of adapted cultures. Acid adaptation in L. monocytogenes was correlated with a decrease in total lipid phosphorus and, with the exception of cells adapted to benzoic acid, this change in the amount of phosphorus reflected a higher content of the neutral lipid class. Upon acetic or benzoic acid stress the lipid phosphorus proportion was analysed in the main phospholipids present: cardiolipin, phosphatidylglycerol, phosphoaminolipid and phosphatidylinositol. Interestingly only benzoic acid had a dramatic effect on the relative quantities of these four phospholipids.

  13. Cleaning and Disinfection of Biofilms Composed of Listeria monocytogenes and Background Microbiota from Meat Processing Surfaces

    Science.gov (United States)

    Møretrø, Trond; Heir, Even; Briandet, Romain; Langsrud, Solveig

    2017-01-01

    ABSTRACT Surfaces of food processing premises are exposed to regular cleaning and disinfection (C&D) regimes, using biocides that are highly effective against bacteria growing as planktonic cells. However, bacteria growing in surface-associated communities (biofilms) are typically more tolerant toward C&D than their individual free-cell counterparts, and survival of pathogens such as Listeria monocytogenes may be affected by interspecies interactions within biofilms. In this study, Pseudomonas and Acinetobacter were the most frequently isolated genera surviving on conveyor belts subjected to C&D in meat processing plants. In the laboratory, Pseudomonas, Acinetobacter, and L. monocytogenes dominated the community, both in suspensions and in biofilms formed on conveyor belts, when cultures were inoculated with eleven-genus cocktails of representative bacterial strains from the identified background flora. When biofilms were exposed to daily C&D cycles mimicking treatments used in food industry, the levels of Acinetobacter and Pseudomonas mandelii diminished, and biofilms were instead dominated by Pseudomonas putida (65 to 76%), Pseudomonas fluorescens (11 to 15%) and L. monocytogenes (3 to 11%). The dominance of certain species after daily C&D correlated with high planktonic growth rates at 12°C and tolerance to C&D. In single-species biofilms, L. monocytogenes developed higher tolerance to C&D over time, for both the peracetic acid and quaternary ammonium disinfectants, indicating that a broad-spectrum mechanism was involved. Survival after C&D appeared to be a common property of L. monocytogenes strains, as persistent and sporadic subtypes showed equal survival rates in complex biofilms. Biofilms established preferentially in surface irregularities of conveyor belts, potentially constituting harborage sites for persistent contamination. IMPORTANCE In the food industry, efficient production hygiene is a key measure to avoid the accumulation of spoilage bacteria and

  14. Cleaning and disinfection of biofilms composed of Listeria monocytogenes and background microbiota from meat processing surfaces.

    Science.gov (United States)

    Fagerlund, Annette; Møretrø, Trond; Heir, Even; Briandet, Romain; Langsrud, Solveig

    2017-06-30

    Surfaces of food processing premises are exposed to regular cleaning and disinfection (C&D) regimes, using biocides that are highly effective against bacteria growing as planktonic cells. However, bacteria growing in surface associated communities (biofilms) are typically more tolerant towards C&D than their individual free cells counterparts, and survival of pathogens such as Listeria monocytogenes may be affected by interspecies interactions within biofilms. In this study, Pseudomonas and Acinetobacter were the most frequently isolated genera surviving on conveyor belts subjected to C&D in meat processing plants. In the laboratory, Pseudomonas , Acinetobacter and L. monocytogenes dominated the community both in suspensions and in biofilms formed on conveyor belts, when cultures were inoculated with eleven-genera cocktails of representative bacterial strains from the identified background flora. When biofilms were exposed to daily C&D cycles, mimicking treatments used in food industry, the levels of Acinetobacter and Pseudomonas mandelii diminished, and biofilms were instead dominated by Pseudomonas putida (65-76%), Pseudomonas fluorescens (11-15%) and L. monocytogenes (3-11%). The dominance of certain species after daily C&D correlated with high planktonic growth rates at 12°C and tolerance to C&D. In single-species biofilms, L. monocytogenes developed higher tolerance to C&D over time, both for the peracetic acid and quaternary ammonium disinfectant, indicating that a broad-spectrum mechanism was involved. Survival after C&D appeared to be a common property of L. monocytogenes strains, as both persistent and sporadic subtypes showed equal survival in complex biofilms. Biofilms established preferentially in surface irregularities of conveyor belts, potentially constituting harborage sites for persistent contamination. IMPORTANCE In food industry, efficient production hygiene is a key measure to avoid accumulation of spoilage bacteria and eliminate pathogens

  15. Identification of Surface Protein Biomarkers of Listeria monocytogenes via Bioinformatics and Antibody-Based Protein Detection Tools

    Science.gov (United States)

    Zhang, Cathy X. Y.; Brooks, Brian W.; Huang, Hongsheng; Pagotto, Franco

    2016-01-01

    ABSTRACT The Gram-positive bacterium Listeria monocytogenes causes a significant percentage of the fatalities among foodborne illnesses in humans. Surface proteins specifically expressed in a wide range of L. monocytogenes serotypes under selective enrichment culture conditions could serve as potential biomarkers for detection and isolation of this pathogen via antibody-based methods. Our study aimed to identify such biomarkers. Interrogation of the L. monocytogenes serotype 4b strain F2365 genome identified 130 putative or known surface proteins. The homologues of four surface proteins, LMOf2365_0578, LMOf2365_0581, LMOf2365_0639, and LMOf2365_2117, were assessed as biomarkers due to the presence of conserved regions among strains of L. monocytogenes which are variable among other Listeria species. Rabbit polyclonal antibodies against the four recombinant proteins revealed the expression of only LMOf2365_0639 on the surface of serotype 4b strain LI0521 cells despite PCR detection of mRNA transcripts for all four proteins in the organism. Three of 35 monoclonal antibodies (MAbs) to LMOf2365_0639, MAbs M3643, M3644, and M3651, specifically recognized 42 (91.3%) of 46 L. monocytogenes lineage I and II isolates grown in nonselective brain heart infusion medium. While M3644 and M3651 reacted with 14 to 15 (82.4 to 88.2%) of 17 L. monocytogenes lineage I and II isolates, M3643 reacted with 22 (91.7%) of 24 lineage I, II, and III isolates grown in selective enrichment media (UVM1, modified Fraser, Palcam, and UVM2 media). The three MAbs exhibited only weak reactivities (the optical densities at 414 nm were close to the cutoff value) to some other Listeria species grown in selective enrichment media. Collectively, the data indicate the potential of LMOf2365_0639 as a surface biomarker of L. monocytogenes, with the aid of specific MAbs, for pathogen detection, identification, and isolation in clinical, environmental, and food samples. IMPORTANCE L. monocytogenes is

  16. Educations of Vision - relational strategies in visual culture

    DEFF Research Database (Denmark)

    Illeris, Helene

    2004-01-01

    redescriptions? employs poststructuralist and feminist thinking about visual culture in an attempt to explore alternative understandings of visual education. In the final part ?Educations of vision in late modernity? socialization and self creation are proposed as two different, but supplementary, educational......The article is divided into three parts. Through examples from twentieth century Scandinavian visual arts education the first part ?Epistemological inquiries? discusses how the historical and social construction of dominant modern strategies of vision has occurred. The second part ?Experimentalist...... functions which contemporary visual education inspired by epistemological and experimentalist approaches should aim to fulfill....

  17. Emotional fit with culture: a predictor of individual differences in relational well-being.

    Science.gov (United States)

    De Leersnyder, Jozefien; Mesquita, Batja; Kim, Heejung; Eom, Kimin; Choi, Hyewon

    2014-04-01

    There is increasing evidence for emotional fit in couples and groups, but also within cultures. In the current research, we investigated the consequences of emotional fit at the cultural level. Given that emotions reflect people's view on the world, and that shared views are associated with good social relationships, we expected that an individual's fit to the average cultural patterns of emotion would be associated with relational well-being. Using an implicit measure of cultural fit of emotions, we found across 3 different cultural contexts (United States, Belgium, and Korea) that (1) individuals' emotional fit is associated with their level of relational well-being, and that (2) the link between emotional fit and relational well-being is particularly strong when emotional fit is measured for situations pertaining to relationships (rather than for situations that are self-focused). Together, the current studies suggest that people may benefit from emotionally "fitting in" to their culture.

  18. Cultural relations between Hungary and Albania during the period of Humanism and Renaissance

    Directory of Open Access Journals (Sweden)

    Muhamet Mala

    2016-07-01

    Full Text Available Cultural Hungarian-Albanian relations during the Middle Ages are characterized by a relatively poor intensity. Actually, relations between these two countries are more intense in the political field and especially through the partnership between Gjergj Kastrioti Skanderbeg and John Hunyadi. Regarding the origin, the Hungarian culture identity is rather distinct from the Albanian one. Lack of cultural contacts, among others, was conditioned also by the fact that these relations were held under war circumstances and their primary aim was the common defense from Ottoman attacks. Actually, the Albanian medieval culture remained a Mediterranean culture with elements of Byzantine influence in the continental and southern areas. Meanwhile, Hungary belonged to Central Europe, which, even though far away from Mediterranean cultural mainstream, sought to be influenced by this culture, namely by the Renaissance that emanated exactly in the Mediterranean region. It was Matthias Corvinus effort, regarding the cultural influence of the Mediterranean and Renaissance in Hungary but also the fact that Hungary possessed some of the most important towns of the Adriatic coast and particularly Ragusa. This city was the center where cultural relations between Albanian and Hungary started and became intensified in the religious, intellectual and human field.

  19. Detection of Listeria monocytogenes from selective enrichment broth using MALDI-TOF Mass Spectrometry.

    Science.gov (United States)

    Jadhav, Snehal; Sevior, Danielle; Bhave, Mrinal; Palombo, Enzo A

    2014-01-31

    Conventional methods used for primary detection of Listeria monocytogenes from foods and subsequent confirmation of presumptive positive samples involve prolonged incubation and biochemical testing which generally require four to five days to obtain a result. In the current study, a simple and rapid proteomics-based MALDI-TOF MS approach was developed to detect L. monocytogenes directly from selective enrichment broths. Milk samples spiked with single species and multiple species cultures were incubated in a selective enrichment broth for 24h, followed by an additional 6h secondary enrichment. As few as 1 colony-forming unit (cfu) of L. monocytogenes per mL of initial selective broth culture could be detected within 30h. On applying the same approach to solid foods previously implicated in listeriosis, namely chicken pâté, cantaloupe and Camembert cheese, detection was achieved within the same time interval at inoculation levels of 10cfu/mL. Unlike the routine application of MALDI-TOF MS for identification of bacteria from solid media, this study proposes a cost-effective and time-saving detection scheme for direct identification of L. monocytogenes from broth cultures.This article is part of a Special Issue entitled: Trends in Microbial Proteomics. Globally, foodborne diseases are major causes of illness and fatalities in humans. Hence, there is a continual need for reliable and rapid means for pathogen detection from food samples. Recent applications of MALDI-TOF MS for diagnostic microbiology focused on detection of microbes from clinical specimens. However, the current study has emphasized its use as a tool for detecting the major foodborne pathogen, Listeria monocytogenes, directly from selective enrichment broths. This proof-of-concept study proposes a detection scheme that is more rapid and simple compared to conventional methods of Listeria detection. Very low levels of the pathogen could be identified from different food samples post-enrichment in

  20. Roles of a novel Crp/Fnr family transcription factor Lmo0753 in soil survival, biofilm production and surface attachment to fresh produce of Listeria monocytogenes.

    Directory of Open Access Journals (Sweden)

    Joelle K Salazar

    Full Text Available Listeria monocytogenes is a foodborne bacterial pathogen and the causative agent of an infectious disease, listeriosis. L. monocytogenes is ubiquitous in nature and has the ability to persist in food processing environments for extended periods of time by forming biofilms and resisting industrial sanitization. Human listeriosis outbreaks are commonly linked to contaminated dairy products, ready-to-eat meats, and in recent years, fresh produce such as lettuce and cantaloupes. We identified a putative Crp/Fnr family transcription factor Lmo0753 that is highly specific to human-associated genetic lineages of L. monocytogenes. Lmo0753 possesses two conserved functional domains similar to the major virulence regulator PrfA in L. monocytogenes. To determine if Lmo0753 is involved in environmental persistence-related mechanisms, we compared lmo0753 deletion mutants with respective wild type and complementation mutants of two fully sequenced L. monocytogenes genetic lineage II strains 10403S and EGDe for the relative ability of growth under different nutrient availability and temperatures, soil survival, biofilm productivity and attachment to select fresh produce surfaces including romaine lettuce leaves and cantaloupe rinds. Our results collectively suggested that Lmo0753 plays an important role in L. monocytogenes biofilm production and attachment to fresh produce, which may contribute to the environmental persistence and recent emergence of this pathogen in human listeriosis outbreaks linked to fresh produce.

  1. Some relations among cultural traditions, nuptiality and fertility.

    Science.gov (United States)

    Coale, A J

    1991-01-01

    Demographic transition is a period characterized by changes in mortality and fertility that accompany modernization and economic development. Typical features of age at first marriage among populations in different stages of demographic transition are described including the changes in age at marriage, the association between marriage age changes and fertility control, and the role of cultural and traditional behavior in influencing age at marriage and initiation of fertility control. In the Western model, there was a late age of marriage for women between 23 and 28 years old, and a high proportion of women who remain single until 50 years old (10-25%). The Eastern European model was one of moderately early marriage (mean age 19-22) and a small proportion remaining single (2-5%). The third model was Asian and African with early (mean age of 18 years) and universal marriage (1% unmarried). The reduction in number married was associated with reduced fertility. The differences between the Eastern and Western models were in household composition. In premodern societies, any fertility control present was governed by custom and limited biomedical influences such as duration of breast feeding and sexual abstention following a birth. These practices were not considered deliberate fertility control. The mean age of marriage in India was 14 years until 1941 and slowly reached 18.4 years in 1981. Fertility did not begin to decline until after 1960. Examples are given of the close association between marital fertility that is voluntary controlled and mean age at marriage. The influences of culture and traditions on the association between mean age of marriage and voluntary fertility control are shown by examples from the Soviet Union. The eastern part of the Soviet Union experienced a rise in mean age of marriage and an unsustained decline in marital fertility similar to that in China. There were also similarities in nuptiality and fertility between other areas in the Soviet

  2. Incidence and control of Listeria monocytogenes in foods in Denmark

    DEFF Research Database (Denmark)

    Nørrung, Birgit; Andersen, Jens Kirk; Schlundt, Jørgen

    1999-01-01

    The Danish regulatory policy on Listeria monocytogenes in foods is based on the principles of HACCP and was developed using a health risk assessment approach. The Danish policy focuses examinations and criteria for L. monocytogenes in ready-to-eat foods and is based on a combination of inspection...

  3. Listeria monocytogenes internalizes in Romaine Lettuce grown in greenhouse conditions

    Science.gov (United States)

    Listeria monocytogenes has been implicated in a number of outbreaks involving fresh produce, including an outbreak in 2016 resulting from contaminated packaged salads. The persistence and internalization potential of L. monocytogenes in romaine lettuce was evaluated, and the persistence of two L. mo...

  4. Detection of Listeria Spp. and Listeria monocytogenes in vegetables ...

    African Journals Online (AJOL)

    This paper aimed to study the prevalence and antibiotic resistance pattern among Listeria monocytogenes in raw vegetables sourced from commercial farms and local farms in Terengganu. Thirteen types of vegetables investigated for the presence of L. monocytogenes using multiplex PCR and LAMP methods. Isolation of ...

  5. Genome sequences of Listeria monocytogenes strains with resistance to arsenic

    Science.gov (United States)

    Listeria monocytogenes frequently exhibits resistance to arsenic. We report here the draft genome sequences of eight genetically diverse arsenic-resistant L. monocytogenes strains from human listeriosis and food-associated environments. Availability of these genomes would help to elucidate the role ...

  6. Listeria monocytogenes growth limits and stress resistance mechanisms

    NARCIS (Netherlands)

    Veen, van der S.

    2008-01-01

    The food-borne pathogen Listeria monocytogenes is a Gram-positive facultative anaerobic rod, which is the causative agent of listeriosis. Due to the severity of the disease and the fact that its incidence is increasing in numerous European countries, L. monocytogenes is of great public health

  7. Resistance of Listeria monocytogenes biofilms to sanitizing agents

    Science.gov (United States)

    Listeria monocytogenes is notorious for its capacity to colonize the environment and equipment of food processing facilities and to persist in the processing plant ecosystem, sometimes for decades. Such persistence is mediated by multiple attributes of L. monocytogenes, including the pathogen’s capa...

  8. Effects of prebiotics on the infective potential of Listeria monocytogenes

    DEFF Research Database (Denmark)

    Ebersbach, Tine

    % xylooligosaccharides (XOS), galactooligosaccharides (GOS), inulin, apple pectin or polydextrose for three weeks before oral challenge with L. monocytogenes. XOS and GOS significantly improved resistance of guinea pigs to L. monocytogenes, while inulin and apple pectin decreased the resistance. No significant effect...

  9. Monitoring paneer for Listeria monocytogenes - A high risk food ...

    African Journals Online (AJOL)

    A multiplex polymerase chain reaction (PCR) assay was developed and applied to spiked and natural paneer samples to detect Listeria monocytogenes, a high risk food pathogen. The sensitivity of the assay on L. monocytogenes spiked paneer samples was 104 cells prior to enrichment, was improved to 103 cells after 4 h ...

  10. Genes involved in Listeria monocytogenes biofilm formation at a simulated food processing plant temperature of 15 °C

    DEFF Research Database (Denmark)

    Piercey, Marta J.; Hingston, Patricia A.; Hansen, Lisbeth Truelstrup

    2016-01-01

    proteins. Deficient mutants (n=5) contained interruptions in genes related to peptidoglycan,teichoic acid, or lipoproteins. Enhanced mutants produced significantly (p b 0.05) higher cell densities in biofilm formed on stainless steel (SS) coupons at 15 °C (48 h) than deficient mutants, which were also more......Listeria monocytogenes is a pathogenic foodborne bacterium whose persistence in food processing environments is in part attributed to its biofilm formation. Most biofilm studies have been carried out at 30–37 °C rather than at temperatures found in the food processing plants (i.e., 10–20 °C......). The objective of the present study was to mine for novel genes that contribute to L. monocytogenes biofilm formation at 15 °C using the random insertional mutagenesisapproach. A library of 11,024 L. monocytogenes 568 (serotype 1/2a) Himar1 insertional mutants wascreated. Mutants with reduced or enhanced biofilm...

  11. The high prevalence of Listeria monocytogenes peritonitis in cirrhotic patients of an Egyptian Medical Center.

    Science.gov (United States)

    El Sayed Zaki, Maysaa; El Shabrawy, Walaa Othman; El-Eshmawy, Mervat M; Aly Eletreby, Shahera

    2011-09-01

    Spontaneous bacterial peritonitis (SBP) is a potentially lethal complication of cirrhosis. It is probably the most characteristic infectious complication of cirrhosis. The aim of this study was to evaluate the bacterial and fungal causes of SBP in Egyptian population. Furthermore to predict the occurrence of rare pathogen like Listeria monocytogenes in those patients. The study included 100 patients with end stage liver disease associated with ascites. Patients were suspected to have SBP. The ascitic fluids were subjected to full cytological and microbiological study. The peritoneal fluid cytological study revealed that 50 samples had cell counts >250 cells/mm(3). 37 samples had growth and 13 samples had no growth (CNNA). The distribution of isolated pathogens was Gram positive cocci 48.8% followed by L. monocytogenes 24.4%, Gram negative bacilli 12.2% and Mycobacterium tuberculosis 7.3. The cells counts associated with listeria culture were 475 cells/mm(3) with sensitivity 70% and specificity 68%. The study highlights the prevalence of microorganisms in Egyptian patients with liver cirrhosis associated with ascites. It reflects the occurrence of L. monocytogenes as an important pathogen of such clinical situation. Other rare pathogens like M. tuberculosis are not uncommon in those patients. Copyright © 2011 King Saud Bin Abdulaziz University for Health Sciences. Published by Elsevier Ltd. All rights reserved.

  12. Rapid detection of Listeria monocytogenes in foods, by a combination of PCR and DNA probe.

    Science.gov (United States)

    Ingianni, A; Floris, M; Palomba, P; Madeddu, M A; Quartuccio, M; Pompei, R

    2001-10-01

    Listeria monocytogenes is a frequent contaminant of water and foods. Its rapid detection is needed before some foods can be prepared for marketing. In this work L. monocytogenes has been searched for in foods, by a combination of polymerase chain reaction (PCR) and a DNA probe. Both PCR and the probe were prepared for recognizing a specific region of the internalin gene, which is responsible for the production of one of the most important pathogenic factors of Listeria. The combined use of PCR and the DNA probe was used for the detection of L. monocytogenes in over 180 environmental and food samples. Several detection methods were compared in this study, namely conventional culture methods; direct PCR; PCR after an enrichment step; a DNA probe alone; a DNA probe after enrichment and another commercially available gene-probe. Finally PCR and the DNA probe were used in series on all the samples collected. When the DNA probe was associated with the PCR, specific and accurate detection of listeria in the samples could be obtained in about a working-day. The present molecular method showed some advantages in terms of rapidity and specificity in comparison to the other aforementioned tests. In addition, it resulted as being easy to handle, even for non-specialized personnel in small diagnostic microbiology laboratories. Copyright 2001 Academic Press.

  13. Survival of bioluminescent Listeria monocytogenes and Escherichia coli O157:H7 in soft cheeses.

    Science.gov (United States)

    Ramsaran, H; Chen, J; Brunke, B; Hill, A; Griffiths, M W

    1998-07-01

    Pasteurized and raw milks that had been inoculated at 10(4) cfu/ml with bioluminescent strains of Listeria monocytogenes and Escherichia coli O157:H7 were used in the manufacture of Camembert and Feta cheeses with or without nisin-producing starter culture. Survival of both organisms was determined during the manufacture and storage of Camembert and Feta cheeses at 2 +/- 1 degree C for 65 and 75 d, respectively. Bacterial bioluminescence was used as an indicator to enumerate the colonies plated on selective Listeria agar and on MacConkey agar. Escherichia coli O157:H7 survived the manufacturing process of both cheeses and was present at the end of the storage period in greater numbers than in the initial inoculum. At the end of 75 d of storage, E. coli O157:H7 was found in the brine of Feta cheese. The counts of L. monocytogenes increased as the pH of the Camembert cheese increased, and there were significant differences between the counts from samples taken from the inside and the counts from samples obtained near the surface of the cheese. The Feta cheese that contained nisin was the only cheese in which L. monocytogenes was at the level of the initial inoculum after 75 d of storage.

  14. Petiveria alliacea L. extract protects mice against Listeria monocytogenes infection--effects on bone marrow progenitor cells.

    Science.gov (United States)

    Quadros, M R; Souza Brito, A R; Queiroz, M L

    1999-02-01

    In this study we have investigated the effects of Petiveria alliacea on the hematopoietic response of mice infected with Listeria monocytogenes. Our results demonstrate a protective effect of the crude extract of P. alliacea since the survival of the treated/infected was higher than that in the infected group. Moreover, the number of granulocyte/macrophage colonies (CFU-GM) and the serum colony stimulating activity levels were increased in the treated/infected mice in relation to the infected group. These results suggest an immunomodulation of Petiveria alliacea extract on hematopoiesis, which may be responsible, at least in part, for the increased resistance of mice to Listeria monocytogenes infection.

  15. 2-deoxy-D-glucose-induced metabolic stress enhances resistance to Listeria monocytogenes infection in mice

    Science.gov (United States)

    Miller, E. S.; Bates, R. A.; Koebel, D. A.; Fuchs, B. B.; Sonnenfeld, G.

    1998-01-01

    Exposure to different forms of psychological and physiological stress can elicit a host stress response, which alters normal parameters of neuroendocrine homeostasis. The present study evaluated the influence of the metabolic stressor 2-deoxy-D-glucose (2-DG; a glucose analog, which when administered to rodents, induces acute periods of metabolic stress) on the capacity of mice to resist infection with the facultative intracellular bacterial pathogen Listeria monocytogenes. Female BDF1 mice were injected with 2-DG (500 mg/kg b. wt.) once every 48 h prior to, concurrent with, or after the onset of a sublethal dose of virulent L. monocytogenes. Kinetics of bacterial growth in mice were not altered if 2-DG was applied concurrently or after the start of the infection. In contrast, mice exposed to 2-DG prior to infection demonstrated an enhanced resistance to the listeria challenge. The enhanced bacterial clearance in vivo could not be explained by 2-DG exerting a toxic effect on the listeria, based on the results of two experiments. First, 2-DG did not inhibit listeria replication in trypticase soy broth. Second, replication of L. monocytogenes was not inhibited in bone marrow-derived macrophage cultures exposed to 2-DG. Production of neopterin and lysozyme, indicators of macrophage activation, were enhanced following exposure to 2-DG, which correlated with the increased resistance to L. monocytogenes. These results support the contention that the host response to 2-DG-induced metabolic stress can influence the capacity of the immune system to resist infection by certain classes of microbial pathogens.

  16. Prevalence and risk factors for Listeria monocytogenes in broiler flocks in Shiraz, southern Iran.

    Science.gov (United States)

    Hosseinzadeh, Saeid; Shekarforoush, Seyed Shahram; Ansari-Lari, Maryam; EsalatPanah-Fard Jahromi, Mehdi; Berizi, Enayat; Abdollahi, Mostafa

    2012-06-01

    Listeria monocytogenes has been identified as an important foodborne pathogen in recent years. In humans, it most commonly affects pregnant women, neonates, children, elderly people, and persons with a suppressed immune system. It could contaminate both raw and cooked meat and poultry products. Studies regarding prevalence and risk factors of L. monocytogenes in broilers flocks are limited. Therefore, the present study was conducted to determine the prevalence and risk factors for L. monocytogenes in poultry flocks in Shiraz, southern Iran. During August to September 2009, in total, 100 broiler flocks were selected at slaughter, and 21 specimens were collected from cloacal samples from each flock. Polymerase chain reaction (PCR) was performed on the samples enriched in buffered Listeria enrichment broth (BLEB), using specific primers. Furthermore, enriched samples in BLEB and/or BLEB treated with 5% KOH were subcultured on Palcam medium. Data about farm and flocks were collected using a structured questionnaire. The prevalence of L. monocytogenes was 7% (95% CI, 2-12%) and 1% using PCR and culture, respectively. Results showed that using antibiotics during rearing period was dramatically reduced the rate of isolation (odds ratio [OR]=0.07, p=0.03), whereas house capacity of more than 10,000 birds (OR=24.03, p=0.04) and number of houses (OR=2, p=0.02) significantly increased the prevalence. The correlation between poor management of large poultry flocks and increasing the risk of contamination was more likely due to the recontamination of cooked poultry/undercooking or cross-contamination of other ready-to-eat foods.

  17. Reinscribing the Goddess into the Culturally Relative Minutiae of Tantric Texts and Practices: A Perennialist Response to Tantric Visual Culture

    Directory of Open Access Journals (Sweden)

    Jeffrey S. Lidke

    2017-10-01

    Full Text Available A celebration and critical evaluation of Sthaneshwar Timalsina’s brilliant book, Tantric Visual Culture: A Cognitive Approach. In this groundbreaking work, Timalsina utilizes the lens of cognitive studies to shed interpretive light on the Tantric visualization practices that he knows both as a scholar and lifetime practitioner. Timalsina argues that mastery of Tantric practice requires immersion in the culturally relative metonymic and holographic logic framed by the Tantric ritual texts. The conclusion that arises from his analysis is that Tantric “truths” are bound to the linguistic and cultural systems that frame them. In response, I herewith offer a perennialist critique and argument for a more nuanced consideration of the transcendent “truth” or “being” that is the stated aim of Tantric practice.

  18. Cultural styles, relational schemas, and prejudice against out-groups.

    Science.gov (United States)

    Sanchez-Burks, J; Nisbett, R E; Ybarra, O

    2000-08-01

    Two studies provide evidence that Latins (i.e., Mexicans and Mexican Americans) are guided by a concern with socioemotional aspects of workplace relations to a far greater degree than are Anglo-Americans. The focus on socioemotional considerations results in Latins having a relatively greater preference for workgroups having a strong interpersonal orientation. Preferred relational style had a far greater impact on preferences for workgroups and judgments about their likely success than did the ethnic composition of the workgroups for both Latins and Anglo-Americans. Evidence that the two groups differ markedly in relational schemas comes from examination of suggestions about how group performance could be improved, judgments about whether a focus on socioemotional concerns necessarily entails a reduction in task focus, and recall for socioemotional aspects of workgroup interactions. Implications for the dynamics of intercultural contact are discussed.

  19. Behavior of Escherichia coli O157:H7 and Listeria monocytogenes during fermentation and storage of camel yogurt.

    Science.gov (United States)

    Al-Nabulsi, Anas A; Olaimat, Amin N; Osaili, Tareq M; Ayyash, Mutamed M; Abushelaibi, Aisha; Jaradat, Ziad W; Shaker, Reyad; Al-Taani, Mahmoud; Holley, Richard A

    2016-03-01

    In addition to its nutritional and therapeutic properties, camel milk has the ability to suppress the growth of a wide range of foodborne pathogens, but there is a lack of information regarding the behavior of these pathogens in products such as yogurt produced from camel milk. The objective of the current study was to investigate the behavior of Listeria monocytogenes and Escherichia coli O157:H7 during manufacture and storage of camel yogurt. Camel milk inoculated with L. monocytogenes and E. coli O157:H7 was fermented at 43° C for 5h using freeze-dried lactic acid bacteria (LAB) starter cultures (Streptococcus thermophilus and Lactobacillus bulgaricus) and stored at 4 or 10 °C for 14 d. Camel milk inoculated with L. monocytogenes and E. coli O157:H7 without starter culture was also prepared. During fermentation, the numbers of L. monocytogenes and E. coli O157:H7 increased 0.3 and 1.6 log cfu/mL, respectively, in the presence of LAB, and by 0.3 and 2.7 log cfu/mL in the absence of LAB. During storage at 4 or 10 °C, L. monocytogenes increased 0.8 to 1.2 log cfu/mL by 14 d in camel milk without LAB, but in the presence of LAB, the numbers of L. monocytogenes were reduced by 1.2 to 1.7 log cfu/mL by 14 d. Further, E. coli O157:H7 numbers in camel milk were reduced by 3.4 to 3.5 log cfu/mL in the absence of LAB, but E. coli O157:H7 was not detected (6.3 log cfu/mL reduction) by 7d in camel yogurt made with LAB and stored at either temperature. Although camel milk contains high concentrations of natural antimicrobials, L. monocytogenes was able to tolerate these compounds in camel yogurt stored at refrigerator temperatures. Therefore, appropriate care should be taken during production of yogurt from camel milk to minimize the potential for postprocess contamination by this and other foodborne pathogens. Copyright © 2016 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  20. Elongated cells of Listeria monocytogenes in biofilms in the presence of sucrose and bacteriocin-producing Leuconostoc mesenteroides A11

    Directory of Open Access Journals (Sweden)

    Regiane Priscilla Ratti

    2010-12-01

    Full Text Available Listeria monocytogenes is a foodborne pathogen which may survive in biofilms and persist in food processing plants. In this study, the ability of Leuconostoc mesenteroides (bac+ and bac- to inhibit biofilm formation by L. monocytogenes ATCC 19115 was studied with stainless steel coupons immersed in BHI broth and BHI broth plus sucrose in combination with the Lactic Acid Bacteria (LAB. Adhered cells were collected with swabs and enumerated on selective agars (Oxford for listeria and MRS for leuconostoc. Leuconostoc mesenteroides bac+ in co-culture with L. monocytogenes was effective to inhibit biofilm formation by listeria for up to 3 hours of incubation, but at 24 hours, biofilm was present in all conditions tested, as confirmed by observations of stainless steel coupons under Scanning Electron Microscopy (SEM. It was also observed that in the presence of L. mesenteroides bac+ in BHI plus sucrose, a high number of elongated cells of L. monocytogenes was present, which may indicate an adaptation response of the pathogen to stress conditions with important implications for food safety.

  1. Control of Listeria monocytogenes in goat's milk and goat's jben by the bacteriocinogenic Enterococcus faecium F58 strain.

    Science.gov (United States)

    Achemchem, Fouad; Abrini, Jamal; Martínez-Bueno, Manuel; Valdivia, Eva; Maqueda, Mercedes

    2006-10-01

    The bacteriocinogenic Enterococcus faecium F58 strain, a natural goat's jben cheese isolate, lacks decarboxylase activity involved in most biogenic amine formation. It was also sensitive to 13 antibiotics assayed and free of virulence and vancomycin resistance genes. The F58 strain reached the stationary phase after 12 h of growth in sterile goat's milk, and the production of enterocin F-58 (Ent L50) was first detected after 48 h (400 AU/ml), thereafter remaining stable up to 5 days. The effectiveness of the F58 strain in controlling Listeria monocytogenes serovar 4b in reduced fat and whole goat's milk, and in goat's jben has been examined. Coculture experiments of F58-L. monocytogenes in both types of milk demonstrated that listeriae were not eliminated, although reductions by 1 to 4 log units were found. Nevertheless, when the F58 strain was previously inoculated in whole milk and left to grow for 12 h before contamination, the pathogen was completely eliminated after 130 h of coculture. Production of jben cheese contaminated with L. monocytogenes prior to packaging, using preparations of F58-producer strain, caused a significant decrease in the number of viable listeriae, which were undetectable after 1 week of cheese storage at 22 degrees C. Altogether, results from this study suggest that E. faecium F58 strain may be used as an adjunct culture in cheese to control contamination and growth of L. monocytogenes by in situ enterocin production, thus providing an additional hurdle to enhance control of this pathogen.

  2. Growth of Listeria monocytogenes on a RTE-meat matrix enhances cell invasiveness to mouse J774A.1 macrophages.

    Science.gov (United States)

    Lin, Chen-Si; Wang, Chinling; Tsai, Hsiang-Jung; Chou, Chung-Hsi

    2010-11-15

    It remains unclear whether the growth of Listeria monocytogenes on a ready-to-eat (RTE) meat matrix has an impact on the bacterium's pathogenic abilities. In this study, we investigated the impact of environments on virulence by growing L. monocytogenes (F2365 strain) on brain heart infusion agar (BHI), tryptic soy agar (TSA), and RTE turkey meat matrices. Bacteria cultured from these media were harvested and used to infect mouse macrophage cell line J774A.1 with different MOIs to examine their invasion ability. At MOI=10 and 50, the numbers of bacteria recovered from cells infected with turkey-meat-grown Listeria were significantly higher than those from the two nutrient-rich growth media. Additionally, MOI played a role in determining L. monocytogenes recovery rates, since significant differences were found amongst all three groups at low MOI, while no significant differences were found between BHI and TSA groups at high MOI. These results indicate that environmental changes affect the ability of L. monocytogenes to invade and survive intracellularly while grown on RTE-meat matrix. Copyright © 2010 Elsevier B.V. All rights reserved.

  3. Culture and religious beliefs in relation to reproductive health.

    Science.gov (United States)

    Arousell, Jonna; Carlbom, Aje

    2016-04-01

    An increasing number of contemporary research publications acknowledge the influence of religion and culture on sexual and reproductive behavior and health-care utilization. It is currently hypothesized that religious influences can partly explain disparities in sexual and reproductive health outcomes. In this paper, we will pay particular attention to Muslims in sexual and reproductive health care. This review reveals that knowledge about devout Muslims' own experience of sexual and reproductive health-care matters is limited, thus providing weak evidence for modeling of efficient practical guidelines for sexual and reproductive health care directed at Muslim patients. Successful outcomes in sexual and reproductive health of Muslims require both researchers and practitioners to acknowledge religious heterogeneity and variability, and individuals' possibilities to negotiate Islamic edicts. Failure to do so could lead to inadequate health-care provision and, in the worst case, to suboptimal encounters between migrants with Muslim background and the health-care providers in the receiving country. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.

  4. Comments on "Some Relations Among Cultural Traditions, Nuptiality and Fertility".

    Science.gov (United States)

    Krotki, K J

    1991-01-01

    Facts employed in formulating Ansley Coale's interpretation of European historical demographic transition have largely been in the public domain for a long time. Coale's achievement, however, in bringing pertinent information together to form a theoretical framework is applauded, and is acknowledged as being an important contribution to the traditional use of demographic transition. Beyond this general interest and broad approval, the author critiques various points of Coale's thesis. First, he notes the need to be suspicious of high correlations found between mean age at 1st marriage and total fertility rate. Second, he is unsure of the role played by servants in explaining the comparatively later marriage age of western Europeans. Finally, the author considers marked fertility declines in China, Taiwan, and Korea. These declines run strongly counter to the traditional cultures of these countries. Moreover, the high life expectations at birth, strong episodic economic development in Taiwan and Korea, and serious autocratic government interference in China are atypical of experiences in most developing countries. Traditional family planning in these 3 countries was simply a facilitator of demographic transition. The experiences of China, Taiwan, Korea, and Bangladesh support the ineffectiveness of imposing programs from either within or outside of a country.

  5. The pathogenic potential of different pulsed-field gel electrophoresis types of Listeria monocytogenes strains isolated from food in Northeast Bosnia and Herzegovina.

    Science.gov (United States)

    Hodžić, Snjezana; Hukić, Mirsada; Franciosa, Giovanna; Aureli, Paolo

    2011-09-01

    Listeria monocytogenes is often present in meat and meat products that are sold in the area of northeast Bosnia and Herzegovina. The major objective of this study was to examine the virulence of L. monocytogenes strains isolated from these types of food in that geographic area. Polymerase chain reaction was used to detect eight genes responsible for virulence of this pathogen, namely, prfA, inlA, inlB, hly, plcA, plcB, actA, and mpl. All examined isolates were confirmed to possess the eight virulence genes. Ten different pulsed-field gel electrophoresis (PFGE) macrorestriction profiles were recognized among 19 L. monocytogenes strains after restriction with two different endonucleases (ApaI and AscI). The pathogenicity of three different PFGE types of L. monocytogenes was confirmed through in vivo tests, which were performed on female white mice (Pasteur strain), and it ranged from 3.55 × 10(8) LD50 to 1.58 × 10(10) LD50. All of the three different PFGE types of L. monocytogenes were regarded as moderately virulent in relation to the reference strain L. monocytogenes Scott A. This result might be one of the reasons for the absence of reported listeriosis in northeast Bosnia and Herzegovina, despite the high degree of food contamination with this pathogen.

  6. Genotypes Associated with Listeria monocytogenes Isolates Displaying Impaired or Enhanced Tolerances to Cold, Salt, Acid, or Desiccation Stress

    Science.gov (United States)

    Hingston, Patricia; Chen, Jessica; Dhillon, Bhavjinder K.; Laing, Chad; Bertelli, Claire; Gannon, Victor; Tasara, Taurai; Allen, Kevin; Brinkman, Fiona S. L.; Truelstrup Hansen, Lisbeth; Wang, Siyun

    2017-01-01

    The human pathogen Listeria monocytogenes is a large concern in the food industry where its continuous detection in food products has caused a string of recalls in North America and Europe. Most recognized for its ability to grow in foods during refrigerated storage, L. monocytogenes can also tolerate several other food-related stresses with some strains possessing higher levels of tolerances than others. The objective of this study was to use a combination of phenotypic analyses and whole genome sequencing to elucidate potential relationships between L. monocytogenes genotypes and food-related stress tolerance phenotypes. To accomplish this, 166 L. monocytogenes isolates were sequenced and evaluated for their ability to grow in cold (4°C), salt (6% NaCl, 25°C), and acid (pH 5, 25°C) stress conditions as well as survive desiccation (33% RH, 20°C). The results revealed that the stress tolerance of L. monocytogenes is associated with serotype, clonal complex (CC), full length inlA profiles, and the presence of a plasmid which was identified in 55% of isolates. Isolates with full length inlA exhibited significantly (p monocytogenes sequence types, a new inlA PMSC, and several connections between CCs and the presence/absence or variations of specific genetic elements. A whole genome single-nucleotide-variants phylogeny revealed sporadic distribution of tolerant isolates and closely related sensitive and tolerant isolates, highlighting that minor genetic differences can influence the stress tolerance of L. monocytogenes. Specifically, a number of cold and desiccation sensitive isolates contained PMSCs in σB regulator genes (rsbS, rsbU, rsbV). Collectively, the results suggest that knowing the sequence type of an isolate in addition to screening for the presence of full-length inlA and a plasmid, could help food processors and food agency investigators determine why certain isolates might be persisting in a food processing environment. Additionally, increased

  7. Atlas(®) Listeria monocytogenes LmG2 Detection Assay Using Transcription Mediated Amplification to Detect Listeria monocytogenes in Selected Foods and Stainless Steel Surface.

    Science.gov (United States)

    Bres, Vanessa; Yang, Hua; Hsu, Ernie; Ren, Yan; Cheng, Ying; Wisniewski, Michele; Hanhan, Maesa; Zaslavsky, Polina; Noll, Nathan; Weaver, Brett; Campbell, Paul; Reshatoff, Michael; Becker, Michael

    2014-01-01

    The Atlas Listeria monocytogenes LmG2 Detection Assay, developed by Roka Bioscience Inc., was compared to a reference culture method for seven food types (hot dogs, cured ham, deli turkey, chicken salad, vanilla ice cream, frozen chocolate cream pie, and frozen cheese pizza) and one surface (stainless steel, grade 316). A 125 g portion of deli turkey was tested using a 1:4 food:media dilution ratio, and a 25 g portion for all other foods was tested using 1:9 food:media dilution ratio. The enrichment time and media for Roka's method was 24 to 28 h for 25 g food samples and environmental surfaces, and 44 to 48 h for 125 g at 35 ± 2°C in PALCAM broth containing 0.02 g/L nalidixic acid. Comparison of the Atlas Listeria monocytogenes LmG2 Detection Assay to the reference method required an unpaired approach. For each matrix, 20 samples inoculated at a fractional level and five samples inoculated at a high level with a different strain of Listeria monocytogenes were tested by each method. The Atlas Listeria monocytogenes LmG2 Detection Assay was compared to the Official Methods of Analysis of AOAC INTERNATIONAL 993.12 method for dairy products, the U.S. Department of Agriculture, Food Safety and Inspection Service, Microbiology Laboratory Guidebook 8.08 method for ready-to-eat meat and environmental samples, and the U.S. Food and Drug Administration Bacteriological Analytical Manual, Chapter 10 method for frozen foods. In the method developer studies, Roka's method, at 24 h (or 44 h for 125 g food samples), had 126 positives out of 200 total inoculated samples, compared to 102 positives for the reference methods at 48 h. In the independent laboratory studies, vanilla ice cream, deli turkey and stainless steel grade 316 were evaluated. Roka's method, at 24 h (or 44 h for 125 g food samples), had 64 positives out of 75 total inoculated samples compared to 54 positives for the reference methods at 48 h. The Atlas Listeria monocytogenes LmG2 Detection Assay detected all 50

  8. Counter cross-cultural priming and relative deprivation: The role of individualism-collectivism.

    NARCIS (Netherlands)

    Van den Bos, K.; van Veldhuizen, Tanja; Au, A.K.C.

    2015-01-01

    This paper uses cross-cultural comparisons and comparisons obtained by experimental manipulation to examine how cultural and contextual factors influence responses to personal and group relative deprivation. Two studies were conducted, one in an individualistic country (The Netherlands) and one in a

  9. Social Errors in Four Cultures: Evidence about Universal Forms of Social Relations.

    Science.gov (United States)

    Fiske, Alan Page

    1993-01-01

    To test the cross-cultural generality of relational-models theory, 4 studies with 70 adults examined social errors of substitution of persons for Bengali, Korean, Chinese, and Vai (Liberia and Sierra Leone) subjects. In all four cultures, people tend to substitute someone with whom they have the same basic relationship. (SLD)

  10. Teaching Culture as a Relational Process through a Multiliteracies-Based Global Simulation

    Science.gov (United States)

    Michelson, Kristen

    2018-01-01

    Recent scholarship in second and foreign language (FL) pedagogy has advocated for approaches to teaching culture that move beyond static notions of culture-as-fact, construed in terms of national traditions, towards relational approaches that foster strategies for interaction within discourse communities, where members embody and express a range…

  11. Cultural Influences on Toddlers' Prosocial Behavior: How Maternal Task Assignment Relates to Helping Others

    Science.gov (United States)

    Köster, Moritz; Cavalcante, Lilia; Vera Cruz de Carvalho, Rafael; Dôgo Resende, Briseida; Kärtner, Joscha

    2016-01-01

    This cross-cultural study investigates how maternal task assignment relates to toddlers' requested behavior and helping between 18 and 30 months. One hundred seven mother-child dyads were assessed in three different cultural contexts (rural Brazil, urban Germany, and urban Brazil). Brazilian mothers showed assertive scaffolding (serious and…

  12. Evolution of cultural traits occurs at similar relative rates in different world regions.

    Science.gov (United States)

    Currie, Thomas E; Mace, Ruth

    2014-11-22

    A fundamental issue in understanding human diversity is whether or not there are regular patterns and processes involved in cultural change. Theoretical and mathematical models of cultural evolution have been developed and are increasingly being used and assessed in empirical analyses. Here, we test the hypothesis that the rates of change of features of human socio-cultural organization are governed by general rules. One prediction of this hypothesis is that different cultural traits will tend to evolve at similar relative rates in different world regions, despite the unique historical backgrounds of groups inhabiting these regions. We used phylogenetic comparative methods and systematic cross-cultural data to assess how different socio-cultural traits changed in (i) island southeast Asia and the Pacific, and (ii) sub-Saharan Africa. The relative rates of change in these two regions are significantly correlated. Furthermore, cultural traits that are more directly related to external environmental conditions evolve more slowly than traits related to social structures. This is consistent with the idea that a form of purifying selection is acting with greater strength on these more environmentally linked traits. These results suggest that despite contingent historical events and the role of humans as active agents in the historical process, culture does indeed evolve in ways that can be predicted from general principles.

  13. ON HEALTH PROTECTION AND HEALTH RELATED PHYSICAL CULTURE TRAININGS OF FIRST YEAR STUDENTS

    Directory of Open Access Journals (Sweden)

    V.G. Fotynyuk

    2017-01-01

    Full Text Available Purpose: to assess health protection and health related physical culture trainings of first year students. Material: in the research first year students (n=121; 86 boys and 35girls of age 16 - 19 years, participated. Results: components of students’ individual health were found. Situation with health related physical culture trainings, ensuring students’ sound health and optimal functional potentials of their organisms were determined. It was found that leading role shall be played by formation of health world vision values, knowledge about formation of practical skills in healthy life style. Motivation tendency for realization of intentions and practicing of health related physical culture trainings were found in students. Conclusions: the received results prove students’ tendency to pay insufficient attention to individual health. It was found that health related physical culture trainings require modern renewal of education’s content, forms and methods of physical education. The basis of such trainings shall be health related orientation.

  14. Changing gender relations in Thailand: a historical and cultural analysis.

    Science.gov (United States)

    Tantiwiramanond, D

    1997-01-01

    In response to the stereotyping of Thai women in the media as either modern businesswomen or victims of male oppression, this article studies the changing gender roles and status of women in Thailand to identify the various roles played by Thai women and the ways these roles are linked to key cultural, economic, and political mechanisms in Thai society. After an introduction, the first section of the paper analyzes pre-modern Thai history from the mid-13th century with a look at the traditional social, political, and economic structure of feudal society to determine how women's status was affected by Thai Buddhism, absolute monarchy (the affect of the legal system on upper-class women), and matrifocal kinship (the effect of subsistence agriculture on lower-class women). This section also compares the historic status of upper- and lower-class Thai women. The second section of the article considers the effects of 1) the encroachment of Western colonialism in Southeast Asia during the period 1850-1925 and attendant criticisms of polygamy, 2) the post-1932 revolution that resulted in a constitutional monarchy, and 3) the post 1950s period of economic nationalism that has resulted in globalization. The article concludes that lower-class women have certain rights under the feudal system (before 1932) but were forced into certain roles by economic necessity and motherhood. Upper-class women enjoyed high status, but all women were victims of the Buddhist patriarchy and hierarchical systems. Western modernization caused a decline in polygamy and new opportunities for educated women but the status of Thai women has not changed substantially, and class-specific forms of female oppression continues unabated making lower-class women vulnerable to sexual exploitation.

  15. Culture-Related Topic Selection in Small Talk Conversations across Germany and Japan

    DEFF Research Database (Denmark)

    Endrass, Birgit; Nakano, Yukiko; Lipi, Afia Akhter

    2011-01-01

    Small talk can be used in order to build a positive relationship towards a virtual character. However the choice of topics in a conversation can be dependent on social backgrounds such as culture. In this paper, we explore culture-related differences in small talk for the German and Japanese...... cultures. Based on findings from the literature and verified by a corpus analysis, we integrated prototypical German and Japanese small talk conversations into a multiagent system. In evaluation studies conducted in the two target cultures, we investigated whether participants prefer agent dialogs...

  16. Organizational culture and work-related attitudes among staff in assisted living.

    Science.gov (United States)

    Sikorska-Simmons, Elzbieta

    2006-02-01

    In this study, the author examines the relationship between staff perceptions of organizational culture and their work-related attitudes in assisted living. Data were collected from 317 staff in 61 facilities using self-administered questionnaires. Staff who had more favorable perceptions of organizational culture reported greater job satisfaction, coworker satisfaction, and organizational commitment. Among the dimensions of organizational culture, perceptions of teamwork had the strongest influence on satisfaction with coworkers, and perceptions of organizational morale had the strongest influence on job satisfaction and organizational commitment. Those who want to improve staff attitudes should focus on creating organizational cultures that promote teamwork and high organizational morale.

  17. Rapid identification and source-tracking of Listeria monocytogenes using MALDI-TOF mass spectrometry.

    Science.gov (United States)

    Jadhav, Snehal; Gulati, Vandana; Fox, Edward M; Karpe, Avinash; Beale, David J; Sevior, Danielle; Bhave, Mrinal; Palombo, Enzo A

    2015-06-02

    Listeria monocytogenes is an important foodborne pathogen responsible for the sometimes fatal disease listeriosis. Public health concerns and stringent regulations associated with the presence of this pathogen in food and food processing environments underline the need for rapid and reliable detection and subtyping techniques. In the current study, the application of matrix assisted laser desorption/ionisation-time-of-flight mass spectrometry (MALDI-TOF MS) as a single identification and source-tracking tool for a collection of L. monocytogenes isolates, obtained predominantly from dairy sources within Australia, was explored. The isolates were cultured on different growth media and analysed using MALDI-TOF MS at two incubation times (24 and 48 h). Whilst reliable genus-level identification was achieved from most media, identification at the species level was found to be dependent on culture conditions. Successful speciation was highest for isolates cultured on the chromogenic Agar Listeria Ottaviani Agosti agar (ALOA, 91% of isolates) and non-selective horse blood agar (HBA, 89%) for 24h. Chemometric statistical analysis of the MALDI-TOF MS data enabled source-tracking of L. monocytogenes isolates obtained from four different dairy sources. Strain-level discrimination was also observed to be influenced by culture conditions. In addition, t-test/analysis of variance (ANOVA) was used to identify potential biomarker peaks that differentiated the isolates according to their source of isolation. Source-tracking using MALDI-TOF MS was compared and correlated with the gold standard pulsed-field gel electrophoresis (PFGE) technique. The discriminatory index and the congruence between both techniques were compared using the Simpsons Diversity Index and adjusted Rand and Wallace coefficients. Overall, MALDI-TOF MS based source-tracking (using data obtained by culturing the isolates on HBA) and PFGE demonstrated good congruence with a Wallace coefficient of 0.71 and

  18. Internalin profiling and multilocus sequence typing suggest four Listeria innocua subgroups with different evolutionary distances from Listeria monocytogenes.

    Science.gov (United States)

    Chen, Jianshun; Chen, Qiaomiao; Jiang, Lingli; Cheng, Changyong; Bai, Fan; Wang, Jun; Mo, Fan; Fang, Weihuan

    2010-03-31

    Ecological, biochemical and genetic resemblance as well as clear differences of virulence between L. monocytogenes and L. innocua make this bacterial clade attractive as a model to examine evolution of pathogenicity. This study was attempted to examine the population structure of L. innocua and the microevolution in the L. innocua-L. monocytogenes clade via profiling of 37 internalin genes and multilocus sequence typing based on the sequences of 9 unlinked genes gyrB, sigB, dapE, hisJ, ribC, purM, gap, tuf and betL. L. innocua was genetically monophyletic compared to L. monocytogenes, and comprised four subgroups. Subgroups A and B correlated with internalin types 1 and 3 (except the strain 0063 belonging to subgroup C) and internalin types 2 and 4 respectively. The majority of L. innocua strains belonged to these two subgroups. Subgroup A harbored a whole set of L. monocytogenes-L. innocua common and L. innocua-specific internalin genes, and displayed higher recombination rates than those of subgroup B, including the relative frequency of occurrence of recombination versus mutation (rho/theta) and the relative effect of recombination versus point mutation (r/m). Subgroup A also exhibited a significantly smaller exterior/interior branch length ratio than expected under the coalescent model, suggesting a recent expansion of its population size. The phylogram based on the analysis with correction for recombination revealed that the time to the most recent common ancestor (TMRCA) of L. innocua subgroups A and B were similar. Additionally, subgroup D, which correlated with internalin type 5, branched off from the other three subgroups. All L. innocua strains lacked seventeen virulence genes found in L. monocytogenes (except for the subgroup D strain L43 harboring inlJ and two subgroup B strains bearing bsh) and were nonpathogenic to mice. L. innocua represents a young species descending from L. monocytogenes and comprises four subgroups: two major subgroups A and B

  19. Internalin profiling and multilocus sequence typing suggest four Listeria innocua subgroups with different evolutionary distances from Listeria monocytogenes

    Science.gov (United States)

    2010-01-01

    Background Ecological, biochemical and genetic resemblance as well as clear differences of virulence between L. monocytogenes and L. innocua make this bacterial clade attractive as a model to examine evolution of pathogenicity. This study was attempted to examine the population structure of L. innocua and the microevolution in the L. innocua-L. monocytogenes clade via profiling of 37 internalin genes and multilocus sequence typing based on the sequences of 9 unlinked genes gyrB, sigB, dapE, hisJ, ribC, purM, gap, tuf and betL. Results L. innocua was genetically monophyletic compared to L. monocytogenes, and comprised four subgroups. Subgroups A and B correlated with internalin types 1 and 3 (except the strain 0063 belonging to subgroup C) and internalin types 2 and 4 respectively. The majority of L. innocua strains belonged to these two subgroups. Subgroup A harbored a whole set of L. monocytogenes-L. innocua common and L. innocua-specific internalin genes, and displayed higher recombination rates than those of subgroup B, including the relative frequency of occurrence of recombination versus mutation (ρ/θ) and the relative effect of recombination versus point mutation (r/m). Subgroup A also exhibited a significantly smaller exterior/interior branch length ratio than expected under the coalescent model, suggesting a recent expansion of its population size. The phylogram based on the analysis with correction for recombination revealed that the time to the most recent common ancestor (TMRCA) of L. innocua subgroups A and B were similar. Additionally, subgroup D, which correlated with internalin type 5, branched off from the other three subgroups. All L. innocua strains lacked seventeen virulence genes found in L. monocytogenes (except for the subgroup D strain L43 harboring inlJ and two subgroup B strains bearing bsh) and were nonpathogenic to mice. Conclusions L. innocua represents a young species descending from L. monocytogenes and comprises four subgroups: two

  20. Internalin profiling and multilocus sequence typing suggest four Listeria innocua subgroups with different evolutionary distances from Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Wang Jun

    2010-03-01

    Full Text Available Abstract Background Ecological, biochemical and genetic resemblance as well as clear differences of virulence between L. monocytogenes and L. innocua make this bacterial clade attractive as a model to examine evolution of pathogenicity. This study was attempted to examine the population structure of L. innocua and the microevolution in the L. innocua-L. monocytogenes clade via profiling of 37 internalin genes and multilocus sequence typing based on the sequences of 9 unlinked genes gyrB, sigB, dapE, hisJ, ribC, purM, gap, tuf and betL. Results L. innocua was genetically monophyletic compared to L. monocytogenes, and comprised four subgroups. Subgroups A and B correlated with internalin types 1 and 3 (except the strain 0063 belonging to subgroup C and internalin types 2 and 4 respectively. The majority of L. innocua strains belonged to these two subgroups. Subgroup A harbored a whole set of L. monocytogenes-L. innocua common and L. innocua-specific internalin genes, and displayed higher recombination rates than those of subgroup B, including the relative frequency of occurrence of recombination versus mutation (ρ/θ and the relative effect of recombination versus point mutation (r/m. Subgroup A also exhibited a significantly smaller exterior/interior branch length ratio than expected under the coalescent model, suggesting a recent expansion of its population size. The phylogram based on the analysis with correction for recombination revealed that the time to the most recent common ancestor (TMRCA of L. innocua subgroups A and B were similar. Additionally, subgroup D, which correlated with internalin type 5, branched off from the other three subgroups. All L. innocua strains lacked seventeen virulence genes found in L. monocytogenes (except for the subgroup D strain L43 harboring inlJ and two subgroup B strains bearing bsh and were nonpathogenic to mice. Conclusions L. innocua represents a young species descending from L. monocytogenes and

  1. The Propeptide of the Metalloprotease of Listeria monocytogenes Controls Compartmentalization of the Zymogen during Intracellular Infection▿

    OpenAIRE

    O'Neil, Heather S.; Forster, Brian M.; Roberts, Kari L.; Chambers, Andrew J.; Bitar, Alan Pavinski; Marquis, Hélène

    2009-01-01

    Integral to the virulence of the intracellular bacterial pathogen Listeria monocytogenes is its metalloprotease (Mpl). Mpl regulates the activity and compartmentalization of the bacterial broad-range phospholipase C (PC-PLC). Mpl is secreted as a proprotein that undergoes intramolecular autocatalysis to release its catalytic domain. In related proteases, the propeptide serves as a folding catalyst and can act either in cis or in trans. Propeptides can also influence protein compartmentalizati...

  2. Culture.

    Science.gov (United States)

    Smith, Timothy B; Rodríguez, Melanie Domenech; Bernal, Guillermo

    2011-02-01

    This article summarizes the definitions, means, and research of adapting psychotherapy to clients' cultural backgrounds. We begin by reviewing the prevailing definitions of cultural adaptation and providing a clinical example. We present an original meta-analysis of 65 experimental and quasi-experimental studies involving 8,620 participants. The omnibus effect size of d = .46 indicates that treatments specifically adapted for clients of color were moderately more effective with that clientele than traditional treatments. The most effective treatments tended to be those with greater numbers of cultural adaptations. Mental health services targeted to a specific cultural group were several times more effective than those provided to clients from a variety of cultural backgrounds. We recommend a series of research-supported therapeutic practices that account for clients' culture, with culture-specific treatments being more effective than generally culture-sensitive treatments. © 2010 Wiley Periodicals, Inc.

  3. Listeriolysin S, a novel peptide haemolysin associated with a subset of lineage I Listeria monocytogenes.

    Directory of Open Access Journals (Sweden)

    Paul D Cotter

    Full Text Available Streptolysin S (SLS is a bacteriocin-like haemolytic and cytotoxic virulence factor that plays a key role in the virulence of Group A Streptococcus (GAS, the causative agent of pharyngitis, impetigo, necrotizing fasciitis and streptococcal toxic shock syndrome. Although it has long been thought that SLS and related peptides are produced by GAS and related streptococci only, there is evidence to suggest that a number of the most notorious Gram-positive pathogenic bacteria, including Listeria monocytogenes, Clostridium botulinum and Staphylococcus aureus, produce related peptides. The distribution of the L. monocytogenes cluster is particularly noteworthy in that it is found exclusively among a subset of lineage I strains; i.e., those responsible for the majority of outbreaks of listeriosis. Expression of these genes results in the production of a haemolytic and cytotoxic factor, designated Listeriolysin S, which contributes to virulence of the pathogen as assessed by murine- and human polymorphonuclear neutrophil-based studies. Thus, in the process of establishing the existence of an extended family of SLS-like modified virulence peptides (MVPs, the genetic basis for the enhanced virulence of a proportion of lineage I L. monocytogenes may have been revealed.

  4. Comparative proteomic analysis of Listeria monocytogenes exposed to enterocin AS-48 in planktonic and sessile states.

    Science.gov (United States)

    Caballero Gómez, Natacha; Abriouel, Hikmate; Ennahar, Said; Gálvez, Antonio

    2013-10-15

    Enterocin AS-48 is a cyclic peptide of great interest for application in food preservation and sanitation. In the present study, the proteome response of Listeria monocytogenes to purified enterocin AS-48 was studied under two different conditions: planktonic cells and sessile cells grown on polystyrene plates. Ten different proteins were differentially expressed in planktonic L. monocytogenes cells treated with 0.1 μg/ml enterocin AS-48 compared to the untreated controls. Overexpressed proteins were related to stress response (DnaK) or carbohydrate transport and metabolism, while underexpressed and unexpressed proteins were related to metabolism (such as glyceraldehyde-3-phosphate dehydrogenase, pyruvate oxidase, glutamate dehydrogenase or glutamate decarboxylase) or stress (GroEL). In the sessile state, L. monocytogenes cells tolerated up to 10 μg/ml bacteriocin, and the treated biofilm cells overexpressed a set of 11 proteins, some of which could be related to stress response (DnaK, GroEL), protein synthesis and carbohydrate metabolism, while glyceraldehyde-3-phosphate dehydrogenase was the only unexpressed protein. Some of the overexpressed proteins (such as elongation factor Tu and GroEL) could also be implicated in cell adhesion. These results suggest different cell responses of L. monocytogenes to enterocin AS-48 in the planktonic and in the sessile state, including stress response and cell metabolism proteins. While in the planktonic state the bacterium may tend to compensate for the cytoplasmic cell permeability changes induced by AS-48 by reinforcing carbohydrate transport and metabolism, sessile cells seem to respond by shifting carbohydrate metabolism and reinforcing protein synthesis. Stress response proteins also seem to be important in the response to AS-48, but the stress response seems to be different in planktonic and in sessile cells. © 2013.

  5. Age related changes in steroid receptors on cultured lung fibroblasts

    International Nuclear Information System (INIS)

    Barile, F.A.; Bienkowski, R.S.

    1986-01-01

    The number of high affinity glucocorticoid receptors (Ro) on human fetal lung fibroblasts decreases as the cells age in vitro, and it has been suggested that these cell systems may be useful models of age-related changes in vivo. They examined the relation between change in Ro with in vitro aging and donor age. Confluent monolayers of lung fibroblasts at various population doubling levels (PDL), were incubated with ( 3 H)-dexamethasone (( 3 H)Dex) either alone or with excess (.01 mM) Dex. Specific binding was calculated as the difference between radioactivity in cells incubated with and without unlabeled Dex; Scatchard plots were used to analyze the data. Ro, measured as fmol ( 3 H)Dex/10 6 cells, for two lines of human fetal cells (HFL-1 and MRC-5) decreased with increasing age in vitro. However, human newborn (CRL-1485) and adult (CCL-201) cells and fetal rabbit cells (FAB-290), showed increases in Ro with continuous passage. For each cell line, the affinity constant (K/sub d/) did not change significantly with passage. They conclude that the direction of changes in steroid receptor levels on cells aging in vitro is influenced by donor age and species. Caution should be used in applying results obtained from model systems to aging organisms

  6. ON HEALTH PROTECTION AND HEALTH RELATED PHYSICAL CULTURE TRAININGS OF FIRST YEAR STUDENTS

    OpenAIRE

    V.G. Fotynyuk

    2017-01-01

    Purpose: to assess health protection and health related physical culture trainings of first year students. Material: in the research first year students (n=121; 86 boys and 35girls of age 16 - 19 years, participated. Results: components of students’ individual health were found. Situation with health related physical culture trainings, ensuring students’ sound health and optimal functional potentials of their organisms were determined. It was found that leading role shall be played by formati...

  7. Prevalence and location of Listeria monocytogenes in farmed rainbow trout.

    Science.gov (United States)

    Miettinen, Hanna; Wirtanen, Gun

    2005-10-15

    A total of 510 rainbow trout originating from fish farms in lakes and sea areas around Finland were studied for the presence of Listeria monocytogenes. Samples were studied as pools from five fish. Gill, viscera, and skin from the pooled samples were analysed separately. The individual samples were analysed later if the pooled sample was found to be Listeria positive. The prevalence of Listeria spp. and L. monocytogenes in pooled unprocessed fresh rainbow trout was on average 35.0% and 14.6%, respectively. On the other hand, the prevalence of Listeria spp. and L. monocytogenes in individual thawed fish was found to be 14.3% and 8.8%, respectively. These numbers tend to overestimate and underestimate the real situation because not all fish in pooled samples were necessarily contaminated and in some of the Listeria positive pooled samples all individual samples turned out to be Listeria free. The prevalence of L. monocytogenes varied greatly between different fish farms from zero to 100% in pooled samples and from zero to 75% according to individually studied fish samples. Some indications of the influence of weather conditions and seasonal variations that strongly affected the Listeria contamination of fish were also noticed. The location of Listeria spp. and L. monocytogenes in different parts of the fish differed with statistical significance in rainbow trout. Up to 95.6% of the L. monocytogenes and 84.5% of Listeria spp. positive samples were gill samples. Only 4.4% (2/45) of the L. monocytogenes positive samples were obtained from skin or viscera. Closer study at one fish farm revealed that there was only one L. monocytogenes ribotype present in the contaminated fish, although water and surfaces were heavily contaminated with six other L. monocytogenes ribotypes.

  8. Incorporation of Listeria monocytogenes strains in raw milk biofilms.

    Science.gov (United States)

    Weiler, Christiane; Ifland, Andrea; Naumann, Annette; Kleta, Sylvia; Noll, Matthias

    2013-02-01

    Biofilms develop successively on devices of milk production without sufficient cleaning and originate from the microbial community of raw milk. The established biofilm matrices enable incorporation of pathogens like Listeria monocytogenes, which can cause a continuous contamination of food processing plants. L. monocytogenes is frequently found in raw milk and non-pasteurized raw milk products and as part of a biofilm community in milk meters and bulk milk tanks. The aim of this study was to analyze whether different L. monocytogenes strains are interacting with the microbial community of raw milk in terms of biofilm formation in the same manner, and to identify at which stage of biofilm formation a selected L. monocytogenes strain settles best. Bacterial community structure and composition of biofilms were analyzed by a cloning and sequencing approach and terminal restriction fragment length polymorphism analysis (T-RFLP) based on the bacterial 16S rRNA gene. The chemical composition of biofilms was analyzed by Fourier transform infrared spectroscopy (FTIR), while settled L. monocytogenes cells were quantified by fluorescence in situ hybridization (FISH). Addition of individual L. monocytogenes strains to raw milk caused significant shifts in the biofilm biomass, in the chemical as well as in the bacterial community composition. Biofilm formation and attachment of L. monocytogenes cells were not serotype but strain specific. However, the added L. monocytogenes strains were not abundant since mainly members of the genera Citrobacter and Lactococcus dominated the bacterial biofilm community. Overall, added L. monocytogenes strains led to a highly competitive interaction with the raw milk community and triggered alterations in biofilm formation. Copyright © 2012 Elsevier B.V. All rights reserved.

  9. Listeria monocytogenes as a vector for anti-cancer therapies.

    LENUS (Irish Health Repository)

    Tangney, Mark

    2012-01-31

    The intracellular pathogen Listeria monocytogenes represents a promising therapeutic vector for the delivery of DNA, RNA or protein to cancer cells or to prime immune responses against tumour-specific antigens. A number of biological properties make L. monocytogenes a promising platform for development as a vector for either gene therapy or as an anti-cancer vaccine vector. L. monocytogenes is particularly efficient in mediating internalization into host cells. Once inside cells, the bacterium produces specific virulence factors which lyse the vaculolar membrane and allow escape into the cytoplasm. Once in the cytosol, L. monocytogenes is capable of actin-based motility and cell-to-cell spread without an extracellular phase. The cytoplasmic location of L. monocytogenes is significant as this potentiates entry of antigens into the MHC Class I antigen processing pathway leading to priming of specific CD8(+) T cell responses. The cytoplasmic location is also beneficial for the delivery of DNA (bactofection) by L. monocytogenes whilst cell-to-cell spread may facilitate access of the vector to cells throughout the tumour. Several preclinical studies have demonstrated the ability of L. monocytogenes for intracellular gene or protein delivery in vitro and in vivo, and this vector has also displayed safety and efficacy in clinical trial. Here, we review the features of the L. monocytogenes host-pathogen interaction that make this bacterium such an attractive candidate with which to induce appropriate therapeutic responses. We focus primarily upon work that has led to attenuation of the pathogen, demonstrated DNA, RNA or protein delivery to tumour cells as well as research that shows the efficacy of L. monocytogenes as a vector for tumour-specific vaccine delivery.

  10. Making sense of (exceptional) causal relations. A cross-cultural and cross-linguistic study.

    Science.gov (United States)

    Le Guen, Olivier; Samland, Jana; Friedrich, Thomas; Hanus, Daniel; Brown, Penelope

    2015-01-01

    In order to make sense of the world, humans tend to see causation almost everywhere. Although most causal relations may seem straightforward, they are not always construed in the same way cross-culturally. In this study, we investigate concepts of "chance," "coincidence," or "randomness" that refer to assumed relations between intention, action, and outcome in situations, and we ask how people from different cultures make sense of such non-law-like connections. Based on a framework proposed by Alicke (2000), we administered a task that aims to be a neutral tool for investigating causal construals cross-culturally and cross-linguistically. Members of four different cultural groups, rural Mayan Yucatec and Tseltal speakers from Mexico and urban students from Mexico and Germany, were presented with a set of scenarios involving various types of causal and non-causal relations and were asked to explain the described events. Three links varied as to whether they were present or not in the scenarios: Intention-to-Action, Action-to-Outcome, and Intention-to-Outcome. Our results show that causality is recognized in all four cultural groups. However, how causality and especially non-law-like relations are interpreted depends on the type of links, the cultural background and the language used. In all three groups, Action-to-Outcome is the decisive link for recognizing causality. Despite the fact that the two Mayan groups share similar cultural backgrounds, they display different ideologies regarding concepts of non-law-like relations. The data suggests that the concept of "chance" is not universal, but seems to be an explanation that only some cultural groups draw on to make sense of specific situations. Of particular importance is the existence of linguistic concepts in each language that trigger ideas of causality in the responses from each cultural group.

  11. Making sense of (exceptional) causal relations. A cross-cultural and cross-linguistic study

    Science.gov (United States)

    Le Guen, Olivier; Samland, Jana; Friedrich, Thomas; Hanus, Daniel; Brown, Penelope

    2015-01-01

    In order to make sense of the world, humans tend to see causation almost everywhere. Although most causal relations may seem straightforward, they are not always construed in the same way cross-culturally. In this study, we investigate concepts of “chance,” “coincidence,” or “randomness” that refer to assumed relations between intention, action, and outcome in situations, and we ask how people from different cultures make sense of such non-law-like connections. Based on a framework proposed by Alicke (2000), we administered a task that aims to be a neutral tool for investigating causal construals cross-culturally and cross-linguistically. Members of four different cultural groups, rural Mayan Yucatec and Tseltal speakers from Mexico and urban students from Mexico and Germany, were presented with a set of scenarios involving various types of causal and non-causal relations and were asked to explain the described events. Three links varied as to whether they were present or not in the scenarios: Intention-to-Action, Action-to-Outcome, and Intention-to-Outcome. Our results show that causality is recognized in all four cultural groups. However, how causality and especially non-law-like relations are interpreted depends on the type of links, the cultural background and the language used. In all three groups, Action-to-Outcome is the decisive link for recognizing causality. Despite the fact that the two Mayan groups share similar cultural backgrounds, they display different ideologies regarding concepts of non-law-like relations. The data suggests that the concept of “chance” is not universal, but seems to be an explanation that only some cultural groups draw on to make sense of specific situations. Of particular importance is the existence of linguistic concepts in each language that trigger ideas of causality in the responses from each cultural group. PMID:26579028

  12. Sublethal Triclosan Exposure Decreases Susceptibility to Gentamicin and Other Aminoglycosides in Listeria monocytogenes

    DEFF Research Database (Denmark)

    Christensen, Ellen Gerd; Gram, Lone; Kastbjerg, Vicky Gaedt

    2011-01-01

    (containing quaternary ammonium compound) in four consecutive cultures did not alter the frequency of antibiotic-tolerant isolates, as determined by plating on 2x the MIC for a range of antibiotics. Exposure of eight strains of L. monocytogenes to 1 and 4 µg/ml triclosan did not alter triclosan sensitivity...... resistance remained at a high level also after five subcultures without triclosan or gentamicin. Aminoglycoside resistance can be caused by mutations in the target site, the 16S rRNA gene. However, such mutations were not detected in the N53-1-resistant isolates. A combination of gentamicin and ampicillin...

  13. Cellular and molecular investigations of the adhesion and mechanics of Listeria monocytogenes

    Science.gov (United States)

    Eskhan, Asma Omar

    Atomic force microscopy has been used to quantify the adherence and mechanical properties of an array of L. monocytogenes strains and their surface biopolymers. First, eight L. monocytogenes strains that represented the two major lineages of the species were compared for their adherence and mechanics at cellular and molecular levels. Our results indicated that strains of lineage' II were characterized by higher adhesion and Young's moduli, longer and more rigid surface biopolymers and lower specific and nonspecific forces when compared to lineage' I strains. Additionally, adherence and mechanical properties of eight L. monocytogenes epidemic and environmental strains were probed. Our results pointed to that environmental and epidemic strains representative of a given lineage were similar in their adherence and mechanical properties when investigated at a cellular level. However, when the molecular properties of the strains were considered, epidemic strains were characterized by higher specific and nonspecific forces, shorter, denser and more flexible biopolymers compared to environmental strains. Second, the role of environmental pH conditions of growth on the adhesion and mechanics of a pathogenic L. monocytogenes EGDe was investigated. Our results pointed to a transition in the adhesion energies for cells cultured at pH 7. In addition, when the types of molecular forces that govern the adhesion were quantified using Poisson statistical approach and using a new proposed method, specific hydrogen-bond energies dominated the bacterial adhesion process. Such a finding is instrumental to researchers designing methods to control bacterial adhesion. Similarly, bacterial cells underwent a transition in their mechanical properties. We have shown that cells cultured at pH 7 were the most rigid compared to those cultured in lower or higher pH conditions of growth. Due to transitions observed in adherence and mechanics when cells were cultured at pH 7, we hypothesized that

  14. Peritonitis with Listeria monocytogenes in a patient on automated peritoneal dialysis

    DEFF Research Database (Denmark)

    Poulsen, Hanna Bjarkhamar; Á Steig, Torkil; Björkman, Jonas T

    2018-01-01

    We present a case where Listeria monocytogenesserotype 1/2a was determined to be the causative agent of peritonitis in a patient on automated peritoneal dialysis. The patient, a 53-year-old Caucasian woman from the Faroe Islands was admitted to the National Hospital reporting of constant abdominal...... pain and a fever. Peritoneal cultures were positive for growth of L. monocytogenes. The patient was successfully treated with oral amoxicillin for 2 weeks and intraperitoneal vancomycin for 3 weeks. To date, the patient has not been readmitted due to peritonitis. The Faroese salmon was the suspected...

  15. Targeting and crossing of the human maternofetal barrier by Listeria monocytogenes: role of internalin interaction with trophoblast E-cadherin.

    Science.gov (United States)

    Lecuit, Marc; Nelson, D Michael; Smith, Steve D; Khun, Huot; Huerre, Michel; Vacher-Lavenu, Marie-Cécile; Gordon, Jeffrey I; Cossart, Pascale

    2004-04-20

    Listeria monocytogenes produces severe fetoplacental infections in humans. How it targets and crosses the maternofetal barrier is unknown. We used immunohistochemistry to examine the location of L. monocytogenes in placental and amniotic tissue samples obtained from women with fetoplacental listeriosis. The results raised the possibility that L. monocytogenes crosses the maternofetal barrier through the villous syncytiotrophoblast, with secondary infection occurring via the amniotic epithelium. Because epidemiological studies indicate that the bacterial surface protein, internalin (InlA), may play a role in human fetoplacental listeriosis, we investigated the cellular patterns of expression of its host receptor, E-cadherin, at the maternofetal interface. E-cadherin was found on the basal and apical plasma membranes of syncytiotrophoblasts and in villous cytotrophoblasts. Established trophoblastic cell lines, primary trophoblast cultures, and placental villous explants were each exposed to isogenic InlA+ or InlA- strains of L. monocytogenes, and to L. innocua expressing or not InlA. Quantitative assays of cellular invasion demonstrated that bacterial entry into syncytiotrophoblasts occurs via the apical membrane in an InlA-E-cadherin dependent manner. In human placental villous explants, bacterial invasion of the syncytiotrophoblast barrier and underlying villous tissue and subsequent replication produces histopathological lesions that mimic those seen in placentas of women with listeriosis. Thus, the InlA-E-cadherin interaction that plays a key role in the crossing of the intestinal barrier in humans is also exploited by L. monocytogenes to target and cross the placental barrier. Such a ligand-receptor interaction allowing a pathogen to specifically cross the placental villous trophoblast barrier has not been reported previously.

  16. Microbial background flora in small-scale cheese production facilities does not inhibit growth and surface attachment of Listeria monocytogenes.

    Science.gov (United States)

    Schirmer, B C T; Heir, E; Møretrø, T; Skaar, I; Langsrud, S

    2013-10-01

    The background microbiota of 5 Norwegian small-scale cheese production sites was examined and the effect of the isolated strains on the growth and survival of Listeria monocytogenes was investigated. Samples were taken from the air, food contact surfaces (storage surfaces, cheese molds, and brine) and noncontact surfaces (floor, drains, and doors) and all isolates were identified by sequencing and morphology (mold). A total of 1,314 isolates were identified and found to belong to 55 bacterial genera, 1 species of yeast, and 6 species of mold. Lactococcus spp. (all of which were Lactococcus lactis), Staphylococcus spp., Microbacterium spp., and Psychrobacter sp. were isolated from all 5 sites and Rhodococcus spp. and Chryseobacterium spp. from 4 sites. Thirty-two genera were only found in 1 out of 5 facilities each. Great variations were observed in the microbial background flora both between the 5 producers, and also within the various production sites. The greatest diversity of bacteria was found in drains and on rubber seals of doors. The flora on cheese storage shelves and in salt brines was less varied. A total of 62 bacterial isolates and 1 yeast isolate were tested for antilisterial activity in an overlay assay and a spot-on-lawn assay, but none showed significant inhibitory effects. Listeria monocytogenes was also co-cultured on ceramic tiles with bacteria dominating in the cheese production plants: Lactococcus lactis, Pseudomonas putida, Staphylococcus equorum, Rhodococcus spp., or Psychrobacter spp. None of the tested isolates altered the survival of L. monocytogenes on ceramic tiles. The conclusion of the study was that no common background flora exists in cheese production environments. None of the tested isolates inhibited the growth of L. monocytogenes. Hence, this study does not support the hypothesis that the natural background flora in cheese production environments inhibits the growth or survival of L. monocytogenes. Copyright © 2013 American

  17. Prevalence of Listeria monocytogenes in raw milk in North Lebanon

    International Nuclear Information System (INIS)

    Al Kassaa, I; El Omari, Kh.; Esmail, B.; Hamze, M; Saati, M.

    2016-01-01

    Listeriosis, although a zoonosis, is an invasive disease that can affect newborns, pregnant women and immunocompromised adults. Clinical manifestations can be expressedby febrile gastroenteritis, invasive forms including severe sepsis, meningitis, rhombencephalitis, prenatal infections and abortions. Species of Listeria bacteria are ubiquitous and adaptableto the environment in animal and plant foods. This study aimed to determine the prevalence of Listeria monocytogenes in 100 samples of fresh cow milk collected from different areas of North Lebanon. Listeria monocytogenes was detected by using the Grand VIDAS technique (Biomérieux France). The results obtained revealed the absence of Listeria monocytogenes inall analyzed samples. (Author)

  18. LACTIC FLORA-LISTERIA MONOCYTOGENES INTERACTION

    Directory of Open Access Journals (Sweden)

    S. Colombo

    2012-08-01

    Full Text Available The EC Regulation 2073/2005 (1 requires that food processors evaluate the capability of ready-to-use (RTE products to support the development of Listeria monocytogenes when their pH and aW values are favourable to the growth of this microorganism. It is renown that the lactic flora plays an important role in many different foods, both from a technological and a food safety standpoint. This study was aimed to observe the behaviour and the potential anti-Listeria effect of some natural lactic flora present in Italian liver patè crostini (chicken heart and liver, anchovies, onions, capers, starch, no added preservatives through the Combase Predictor – Max Growth Rate predictive software. The natural lactic flora of the crostini demonstrated a variable capability to inhibit the growth of Listeria monocytogenes which depends upon : the concentration of the lactic flora at the beginning of the shelf life period and the subsequent lag phase, the possible release of anti-Listeria substances, and the maximum growth rate.

  19. REALIS: Postgenomic Analysis of Listeria Monocytogenes

    Directory of Open Access Journals (Sweden)

    The REALIS Consortium

    2006-04-01

    Full Text Available Listeria monocytogenes is a remarkably successful food-borne pathogen. It is capable a of surviving and proliferating under conditions that exist within the food chain, such as at low temperatures, high salt and low pH and b of colonizing animal host tissues after ingestion of contaminated food, causing opportunistic infections mainly, but not exclusively, in immunocompromised hosts. The ultimate goals of REALIS are two fold: Firstly, it aims to completely decipher all genes required for survival in and adaptation of Listeria monocytogenes to two very different environments, ie., the infected host and the external environment. Secondly, using genomics and postgenomic tools, REALIS seeks to precisely address fundamental questions regarding evolutionary relationships between pathogenic and non-pathogenic Listeria and to define qualities of particularly successful clonal pathovariants in causing disease. This project will provide both industry and health care managers with rational approaches to curbing food-borne contamination, minimising risks of infection and providing novel pharmacological approaches for halting the fulminant course of infection.

  20. Elimination of Listeria monocytogenes in sausage meat by combination treatment: Radiation and radiation-resistant bacteriocins

    International Nuclear Information System (INIS)

    Turgis, Mélanie; Stotz, Viviane; Dupont, Claude; Salmieri, Stéphane; Khan, Ruhul A.; Lacroix, Monique

    2012-01-01

    Two new bacteria were isolated from human feces and were designated MT 104 and MT 162. They were able to produce bacteriocins that are active against five strains of Listeria monocytogenes. Bacteriocins produced by these isolated strains had 100% and 82.35% residual activity when they were treated by gamma radiation at doses of 4 and 40 kGy, respectively. A reduction of 1.0, 1.5 and 3 log CFU/g of L. monocytogenes was observed in sausage meat when treated with bacteriocins from MT 104, MT 162, and nisin, respectively. For synergic effect, the D 10 value in presence of the bacteriocins produced by MT 104 showed a 1.08 fold increased relative sensitivity of L. monocytogenes as compared to control after 5 days. The highest synergic effect was observed in presence of nisin which led to 1.61 fold increased relative sensitivity. Combined treatments with nisin and γ-irradiation showed a synergic antimicrobial effect in meat after 24 h and 5 days of storage. A synergic effect was observed only after 5 days at 4 °C for the bacteriocin from MT 104, as compared to the bacteriocin produced by MT 162 that had only an additive antimicrobial effect in all conditions.

  1. Elimination of Listeria monocytogenes in sausage meat by combination treatment: Radiation and radiation-resistant bacteriocins

    Science.gov (United States)

    Turgis, Mélanie; Stotz, Viviane; Dupont, Claude; Salmieri, Stéphane; Khan, Ruhul A.; Lacroix, Monique

    2012-08-01

    Two new bacteria were isolated from human feces and were designated MT 104 and MT 162. They were able to produce bacteriocins that are active against five strains of Listeria monocytogenes. Bacteriocins produced by these isolated strains had 100% and 82.35% residual activity when they were treated by gamma radiation at doses of 4 and 40 kGy, respectively. A reduction of 1.0, 1.5 and 3 log CFU/g of L. monocytogenes was observed in sausage meat when treated with bacteriocins from MT 104, MT 162, and nisin, respectively. For synergic effect, the D10 value in presence of the bacteriocins produced by MT 104 showed a 1.08 fold increased relative sensitivity of L. monocytogenes as compared to control after 5 days. The highest synergic effect was observed in presence of nisin which led to 1.61 fold increased relative sensitivity. Combined treatments with nisin and γ-irradiation showed a synergic antimicrobial effect in meat after 24 h and 5 days of storage. A synergic effect was observed only after 5 days at 4 °C for the bacteriocin from MT 104, as compared to the bacteriocin produced by MT 162 that had only an additive antimicrobial effect in all conditions.

  2. Serovar 4b complex predominates among Listeria monocytogenes isolates from imported aquatic products in China.

    Science.gov (United States)

    Chen, Jianshun; Chen, Qiaomiao; Jiang, Jianjun; Hu, Hongxia; Ye, Jiangbo; Fang, Weihuan

    2010-01-01

    Listeria monocytogenes, the causative organism of listeriosis, is primarily transmitted to humans through contaminated food. In this study, we examined 1275 batches of aquatic products imported from 29 countries and found that 36 batches from 8 countries were contaminated by Listeria (2.8%), with L. monocytogenes accounting for 2.6% (33/1275) and L. innocua for 0.2% (3/1275). Of the 23 selected L. monocytogenes isolates (from the 33 identified), 15 (65.2%) were of serovar 4b complex (4b, 4d, or 4e), three (13.0%) of 1/2a or 3a, four (17.4%) of 1/2b or 3b, and one (4.4%) of 1/2c or 3c. Notably, four of the 23 isolates belonged to epidemic clone I (ECI) and another four were associated with epidemic clone II (ECII), two highly clonal 4b clusters responsible for most of the documented listeriosis outbreaks. In the multilocus sequence typing scheme based on the concatenated genes gyrB-dapE-hisJ-sigB-ribC-purM-betL-gap-tuf, serovar 4b complex isolates from imported aquatic products exhibited significant genetic diversity. While the four ECI isolates were genetically related to those from Chinese diseased animals, both lacking one proline-rich repeat of ActA, the four ECII isolates were located between 1/2b or 3b strains. As the L. monocytogenes isolates from imported aquatic products possessed a nearly complete set of major infection-related genes, they demonstrated virulence potential in mouse model.

  3. Behavior of Listeria monocytogenes in a multi-species biofilm with Enterococcus faecalis and Enterococcus faecium and control through sanitation procedures.

    Science.gov (United States)

    da Silva Fernandes, Meg; Kabuki, Dirce Yorika; Kuaye, Arnaldo Yoshiteru

    2015-05-04

    The formation of mono-species biofilm (Listeria monocytogenes) and multi-species biofilms (Enterococcus faecium, Enterococcus faecalis, and L. monocytogenes) was evaluated. In addition, the effectiveness of sanitation procedures for the control of the multi-species biofilm also was evaluated. The biofilms were grown on stainless steel coupons at various incubation temperatures (7, 25 and 39°C) and contact times (0, 1, 2, 4, 6 and 8 days). In all tests, at 7°C, the microbial counts were below 0.4 log CFU/cm(2) and not characteristic of biofilms. In mono-species biofilm, the counts of L. monocytogenes after 8 days of contact were 4.1 and 2.8 log CFU/cm(2) at 25 and 39°C, respectively. In the multi-species biofilms, Enterococcus spp. were present at counts of 8 log CFU/cm(2) at 25 and 39°C after 8 days of contact. However, the L. monocytogenes in multi-species biofilms was significantly affected by the presence of Enterococcus spp. and by temperature. At 25°C, the growth of L. monocytogenes biofilms was favored in multi-species cultures, with counts above 6 log CFU/cm(2) after 8 days of contact. In contrast, at 39°C, a negative effect was observed for L. monocytogenes biofilm growth in mixed cultures, with a significant reduction in counts over time and values below 0.4 log CFU/cm(2) starting at day 4. Anionic tensioactive cleaning complemented with another procedure (acid cleaning, disinfection or acid cleaning+disinfection) eliminated the multi-species biofilms under all conditions tested (counts of all micro-organismsbiofilms under all tested conditions (counts of the all microorganisms biofilms under all the test conditions. Copyright © 2015 Elsevier B.V. All rights reserved.

  4. Thiamine plays a critical role in the acid tolerance of Listeria monocytogenes.

    Science.gov (United States)

    Madeo, Moira; O'Riordan, Niamh; Fuchs, Thilo M; Utratna, Marta; Karatzas, Kimon Andreas G; O'Byrne, Conor P

    2012-01-01

    Understanding the molecular basis of acid tolerance in the food-borne pathogen Listeria monocytogenes is important as this property contributes to survival in the food-chain and enhances survival within infected hosts. The aim of this study was to identify genes contributing to acid tolerance in L. monocytogenes using transposon mutagenesis and subsequently to elucidate the physiological role of these genes in acid tolerance. One mutant harboring a Tn917 insertion in the thiT gene (formerly lmo1429), which encodes a thiamine (vitamin B1) uptake system, was found to be highly sensitive to acid. The acid-sensitive phenotype associated with loss of this gene was confirmed with an independently isolated mutant, from which the thiT gene was deleted (∆thiT). Cells of both wild-type and ∆thiT mutant that were thiamine depleted were found to be significantly more acid sensitive than control cultures. Thiamine-depleted cultures failed to produce significant concentrations of acetoin, consistent with the known thiamine dependence of acetolactate synthase, an enzyme required for acetoin synthesis from pyruvate. As acetoin synthesis is a proton-consuming process, we suggest that the acid sensitivity observed in thiamine-depleted cultures may be owing to an inability to produce acetoin. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  5. Quantification of Listeria monocytogenes in minimally processed leafy vegetables using a combined method based on enrichment and 16S rRNA real-time PCR.

    Science.gov (United States)

    Aparecida de Oliveira, Maria; Abeid Ribeiro, Eliana Guimarães; Morato Bergamini, Alzira Maria; Pereira De Martinis, Elaine Cristina

    2010-02-01

    Modern lifestyle markedly changed eating habits worldwide, with an increasing demand for ready-to-eat foods, such as minimally processed fruits and leafy greens. Packaging and storage conditions of those products may favor the growth of psychrotrophic bacteria, including the pathogen Listeria monocytogenes. In this work, minimally processed leafy vegetables samples (n = 162) from retail market from Ribeirão Preto, São Paulo, Brazil, were tested for the presence or absence of Listeria spp. by the immunoassay Listeria Rapid Test, Oxoid. Two L. monocytogenes positive and six artificially contaminated samples of minimally processed leafy vegetables were evaluated by the Most Probable Number (MPN) with detection by classical culture method and also culture method combined with real-time PCR (RTi-PCR) for 16S rRNA genes of L. monocytogenes. Positive MPN enrichment tubes were analyzed by RTi-PCR with primers specific for L. monocytogenes using the commercial preparation ABSOLUTE QPCR SYBR Green Mix (ABgene, UK). Real-time PCR assay presented good exclusivity and inclusivity results and no statistical significant difference was found in comparison with the conventional culture method (p < 0.05). Moreover, RTi-PCR was fast and easy to perform, with MPN results obtained in ca. 48 h for RTi-PCR in comparison to 7 days for conventional method.

  6. Modeling the survival of Escherichia coli O157:H7, Listeria monocytogenes, and Salmonella Typhimurium during fermentation, drying, and storage of soudjouk-style fermented sausage.

    Science.gov (United States)

    Hwang, Cheng-An; Porto-Fett, Anna C S; Juneja, Vijay K; Ingham, Steven C; Ingham, Barbara H; Luchansky, John B

    2009-02-28

    This study quantified and modeled the survival of Escherichia coli O157:H7, Listeria monocytogenes and Salmonella Typhimurium in soudjouk-style fermented sausage during fermentation, drying, and storage. Batter prepared from ground beef (20% fat), seasonings, starter culture, and dextrose was separately inoculated with a multi-strain mixture of each pathogen to an initial inoculum of ca. 6.5 log(10) CFU/g in the batter. The sausages were subsequently fermented at 24 degrees C with a relative humidity (RH) of 90% to 95% for 3 to 5 days to ca. pH 5.2, pH 4.9 or pH 4.6, then dried at 22 degrees C to a(w) 0.92, a(w) 0.89, or a(w) 0.86, respectively, and then stored at 4, 21, or 30 degrees C for up to 60 days. Lethality of the three pathogens was modeled as a function of pH, a(w) and/or storage temperature. During fermentation to pH 5.2 to pH 4.6, cell reductions ranged from 0 to 0.9 log(10) CFU/g for E. coli O157:H7, 0.1 to 0.5 log(10) CFU/g for L. monocytogenes, and 0 to 2.2 log(10) CFU/g for S. Typhimurium. Subsequent drying of sausages of pH 5.2 to pH 4.6 at 22 degrees C with 80% to 85% RH for 3 to 7 days to a(w) of 0.92 to a(w) 0.86 resulted in additional reductions that ranged from 0 to 3.5 log(10) CFU/g for E. coli O157:H7, 0 to 0.4 log(10) CFU/g for L. monocytogenes, and 0.3 to 2.4 log(10) CFU/g for S. Typhimurium. During storage at 4, 21, or 30 degrees C the reduction rates of the three pathogens were generally higher (pfermentation, drying, and storage. The applicability of the resulting models for fermented sausage was evaluated by comparing model predictions with published data. Pathogen reductions estimated by the models for E. coli O157:H7 and S. Typhimurium were comparable to 67% and 73% of published data, respectively. Due to limited published data for L. monocytogenes, the models for L. monocytogenes would need additional validations. Results of pathogen reductions from this study may be used as a reference to assist manufacturers of soudjouk

  7. The role of defeathering in the contamination of turkey skin by Salmonella species and Listeria monocytogenes.

    Science.gov (United States)

    Clouser, C S; Doores, S; Mast, M G; Knabel, S J

    1995-04-01

    This study was undertaken to determine whether the incidence of either Salmonella spp. or Listeria monocytogenes on turkeys at three commercial processors could be related to the type of defeathering system: 1) conventional, 58 C common bath scald; 2) kosher, 7 C common bath scald; or 3) steam-spray, 62 C nonimmersion scald. Flocks were sampled before defeathering, after defeathering, and after chill at each facility. The incidence of Salmonella-positive turkeys significantly increased subsequent to conventional defeathering (10 positive out of 14) as compared with before defeathering (3/14). The number of Salmonella-positive carcasses following kosher (0/14) and steam-spray (2/14) defeathering were similar to the number of Salmonella-positive carcasses found prior to defeathering (1/14 and 3/14, respectively). The incidence of Salmonella-positive carcasses following chill was slightly lower, but not significantly different than the number of Salmonella-positive carcasses found immediately following defeathering at all processors (8/14, 0/14, 1/14 for conventional, kosher, and steam-spray processors, respectively). Although L. monocytogenes was detected on turkeys sampled before chilling (2/10, kosher) and after chilling (8/14, kosher; 1/14, conventional), no L. monocytogenes was detected on turkeys at any of the processors prior to the evisceration process. Flocks with high aerobic plate counts prior to processing were more likely to contain Salmonella-positive birds throughout processing. Aerobic plate counts of all flocks were similar after chill whether or not Salmonella spp. and L. monocytogenes were detected.

  8. PEDAGIGOCAL TECHNIQUE OF BUILDING THE CULTURE OF INTERPERSONAL RELATIONS IN PRESCHOOL CHILDREN AT ART CLASSES

    Directory of Open Access Journals (Sweden)

    Svetlana Vyacheslavovna Kahnovich

    2013-10-01

    Full Text Available The article looks at the pedagogical technique of building the culture of interpersonal relations in preschool children at the local and modular level. Interpersonal relations are viewed as the module and art classes as the local level. The research is timely as it can assist in studying the problem of moral development of preschool children by building the culture of interpersonal relations by artistic education means. The study presents novelty concluding from the survey of scientific literature. The process of building the culture of interpersonal relations in children has not been properly studied by preschool pedagogy. The task of the present study is to elaborate a pedagogical technique to build the culture of interpersonal relations between children at art classes. The article discusses ‘technological’ criteria (term by G.K. Selevko and presents interactive principles of the pedagogical technique. Group activities alongside with individual ones were viewed as organizational forms of art classes. Building the culture of interpersonal relations in preschool children at art classes is closely connected with the development of their personality, a child’s  consciousness, their motivational and conceptual spheres during their gradual moral development at various levels - emotional (attitude, axiological level, psychic (intentional cognitive processes, activity (artistic and interpersonal literacy. Graphic (projective methods were used to analyze age dynamics of ethical and moral development. The conclusion describes a set of pedagogical conditions for efficient building of the culture of interpersonal relations in children at art classes.  Goal. To elaborate a pedagogical technique for building the culture of interpersonal relations in preschool children at art classes. The technique can be applied at local and modular level.Methods and Methodology. The pedagogical technique is aimed at building the culture of interpersonal relations

  9. An outbreak of febrile gastroenteritis associated with corn contaminated by Listeria monocytogenes.

    Science.gov (United States)

    Aureli, P; Fiorucci, G C; Caroli, D; Marchiaro, G; Novara, O; Leone, L; Salmaso, S

    2000-04-27

    On May 21, 1997, numerous cases of febrile gastrointestinal illness were reported among the students and staff of two primary schools in northern Italy, all of whom had eaten at cafeterias served by the same caterer. We interviewed people who ate at the cafeterias about symptoms and foods consumed on May 20. There were no samples of foods left at the cafeterias, but we tested routine samples taken on May 20 by the caterer and environmental specimens at the catering plant. The hospitalized patients were tested for common enteropathogens and toxins. Of the 2189 persons interviewed (82 percent of those exposed), 1566 (72 percent) reported symptoms; of these, 292 (19 percent) were hospitalized. Among samples obtained from hospitalized patients, all but two of the stool specimens and all blood specimens were negative for common enteropathogens. Listeria monocytogenes was isolated from one blood specimen and from 123 of the 141 stool specimens. Consumption of a cold salad of corn and tuna was associated with the development of symptoms (relative risk, 6.19; 95 percent confidence interval, 4.81 to 7.98; Pcaterer's sample of the salad and from environmental specimens collected from the catering plant. All listeria isolates were serotype 4b and were found to be identical on DNA analysis. Experimental contamination of sterile samples of the implicated foods showed that L. monocytogenes grew on corn when kept for at least 10 hours at 25 degrees C. Food-borne infection with L. monocytogenes can cause febrile illness with gastroenteritis in immunocompetent persons.

  10. Occurrence and antimicrobial resistance patterns of Listeria monocytogenes isolated from vegetables

    Directory of Open Access Journals (Sweden)

    Vanessa de Vasconcelos Byrne

    2016-06-01

    Full Text Available Abstract Although the consumption of fresh and minimally processed vegetables is considered healthy, outbreaks related to the contamination of these products are frequently reported. Among the food-borne pathogens that contaminate vegetables is Listeria monocytogenes, a ubiquitous organism that exhibits the ability to survive and multiply at refrigerated temperatures. This study aimed to evaluate the occurrence of L. monocytogenes in vegetables as well as the antimicrobial resistance of isolates. The results showed that 3.03% of samples were contaminated with L. monocytogenes, comprising 2.22% of raw vegetables and 5.56% of ready-to-eat vegetables. Multiplex PCR confirmed the virulence potential of the isolates. Antimicrobial resistance profiling showed that 50% of the isolates were susceptible to the antibiotics used. The resistance of one isolate to penicillin G, a commonly employed therapeutic agent, and the presence of serotype 4b, a serotype commonly associated with food-borne outbreaks, could be potential health hazards for consumers.

  11. Pregnancy - associated human listeriosis: Virulence and genotypic analysis of Listeria monocytogenes from clinical samples.

    Science.gov (United States)

    Soni, Dharmendra Kumar; Singh, Durg Vijai; Dubey, Suresh Kumar

    2015-09-01

    Listeria monocytogenes, a life-threatening pathogen, poses severe risk during pregnancy, may cause abortion, fetal death or neonatal morbidity in terms of septicemia and meningitis. The present study aimed at characterizing L. monocytogenes isolated from pregnant women based on serotyping, antibiotic susceptibility, virulence genes, in vivo pathogenicity test and ERIC- and REP-PCR fingerprint analyses. The results revealed that out of 3700 human clinical samples, a total of 30 (0.81%) isolates [12 (0.80%) from placental bit (1500), 18 (0.81%) from vaginal swab (2200)] were positive for L. monocytogenes. All the isolates belonged to serogroup 4b, and were + ve for virulence genes tested i.e. inlA, inlC, inlJ, plcA, prfA, actA, hlyA, and iap. Based on the mice inoculation tests, 20 isolates showed 100% and 4 isolates 60% relative virulence while 6 isolates were non-pathogenic. Moreover, 2 and 10 isolates were resistant to ciprofloxacin and cefoxitin, respectively, while the rest susceptible to other antibiotics used in this study. ERIC- and REP-PCR collectively depicted that the isolates from placental bit and vaginal swab had distinct PCR fingerprints except a few isolates with identical patterns. This study demonstrates prevalence of pathogenic strains mostly resistant to cefoxitin and/or ciprofloxacin. The results indicate the importance of isolating and characterizing the pathogen from human clinical samples as the pre-requisite for accurate epidemiological investigations.

  12. Occurrence and antimicrobial resistance patterns of Listeria monocytogenes isolated from vegetables.

    Science.gov (United States)

    de Vasconcelos Byrne, Vanessa; Hofer, Ernesto; Vallim, Deyse Christina; de Castro Almeida, Rogeria Comastri

    2016-01-01

    Although the consumption of fresh and minimally processed vegetables is considered healthy, outbreaks related to the contamination of these products are frequently reported. Among the food-borne pathogens that contaminate vegetables is Listeria monocytogenes, a ubiquitous organism that exhibits the ability to survive and multiply at refrigerated temperatures. This study aimed to evaluate the occurrence of L. monocytogenes in vegetables as well as the antimicrobial resistance of isolates. The results showed that 3.03% of samples were contaminated with L. monocytogenes, comprising 2.22% of raw vegetables and 5.56% of ready-to-eat vegetables. Multiplex PCR confirmed the virulence potential of the isolates. Antimicrobial resistance profiling showed that 50% of the isolates were susceptible to the antibiotics used. The resistance of one isolate to penicillin G, a commonly employed therapeutic agent, and the presence of serotype 4b, a serotype commonly associated with food-borne outbreaks, could be potential health hazards for consumers. Copyright © 2016 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.

  13. Desiccation of adhering and biofilm Listeria monocytogenes on stainless steel: Survival and transfer to salmon products.

    Science.gov (United States)

    Hansen, Lisbeth Truelstrup; Vogel, Birte Fonnesbech

    2011-03-15

    The foodborne bacterial pathogen, Listeria monocytogenes, commonly contaminates foods during processing, where the microorganisms are potentially subjected to low relative humidity (RH) conditions for extended periods of time. The objective of this study was to examine survival during desiccation (43% RH and 15 °C) of biofilm L. monocytogenes N53-1 cells on stainless steel coupons and to assess subsequent transfer to salmon products. Formation of static biofilm (2 days at 100% RH and 15 °C) prior to desiccation for 23 days significantly (Pbiofilm cells also desiccated in low salt, indicating the protective effect of the biofilm matrix. Osmoadaptation of cells in 5% NaCl before formation of the static biofilm significantly (Pbiofilm cells was significantly (Pbiofilm bacteria, however, as biofilm formation enhanced desiccation survival more bacteria were still transferred to smoked and fresh salmon. In conclusion, the current work shows the protective effect of biofilm formation, salt and osmoadaptation on the desiccation survival of L. monocytogenes, which in turn increases the potential for cross-contamination during food processing. Copyright © 2011 Elsevier B.V. All rights reserved.

  14. Single cell swimming dynamics of Listeria monocytogenes using a nanoporous microfluidic platform

    Energy Technology Data Exchange (ETDEWEB)

    Wright, Evan [University of Guelph, Canada; Neethirajan, Suresh [University of Guelph; Warriner, Keith [University of Guelph; Retterer, Scott T [ORNL; Srijanto, Bernadeta R [ORNL

    2014-01-01

    Listeria monocytogenes remains a significant foodborne pathogen due to its virulence and ability to become established in food processing facilities. The pathogen is characterized by its ability to grow over a wide temperature range and withstand a broad range of stresses. The following reports on the chemotaxis and motility of the L. monocytogenes when exposed to relatively small concentrations of acetic acid. Using the developed nanoporous microfluidic device to precisely modulate the cellular environment, we exposed the individual Listeria cells to acetic acid and, in real time and with high resolution, observed how the cells reacted to the change in their surroundings. Our results showed that concentrations of acetic acid below 10 mM had very little, if any, effect on the motility. However, when exposed to 100 mM acetic acid, the cells exhibited a sharp drop in velocity and displayed a more random pattern of motion. These results indicate that at appropriate concentrations, acetic acid has the ability to disable the flagellum of the cells, thus impairing their motility. This drop in motility has numerous effects on the cell; its main effects being the obstruction of the cell's ability to properly form biofilms and a reduction in the overall infectivity of the cells. Since these characteristics are especially useful in controlling the proliferation of L. monocytogenes, acetic acid shows potential for application in the food industry as an active compound in designing a food packaging environment and as an antimicrobial agent.

  15. Adolescents’ willingness for intergenerational support: Relations to maternal expectations and mothers’ life satisfaction in 14 cultures

    OpenAIRE

    Mayer, Boris; Schwarz, Beate; Trommsdorff, Gisela

    2015-01-01

    How is adolescents’ willingness for intergenerational support affected by parents’ expectations and parenting behavior? Does youths’ willingness for intergenerational support in turn affect parents’ well-being? The current study addresses these questions from a cross-cultural perspective, using data from connected samples of mother-adolescent dyads (N = 4162) from 14 diverse cultural contexts as part of the “Value of Children and Intergenerational Relations Study” (Trommsdorff & Nauck, 2005)....

  16. Promotional Cultures: The Rise and Spread of Advertising, Public Relations, Marketing and Branding

    OpenAIRE

    Davis, Aeron

    2013-01-01

    In the twenty-first century, promotion is everywhere and everything has become promotable: everyday goods and organizations, people and ideas, cultures and futures. This engaging book looks at the rise of advertising, public relations, branding, marketing and lobbying, and explores where our promotional times have taken us.\\ud \\ud Promotional Cultures documents how the professions and practices of promotion have interacted with and reshaped so much in our world, from commodities, celebrities ...

  17. Relational Mobility Explains Between- and Within-Culture Differences in Self-Disclosure to Close Friends

    OpenAIRE

    Schug, Joanna; Yuki, Masaki; Maddux, William W.

    2010-01-01

    The current research proposes a novel explanation for previously demonstrated findings that East Asians disclose less personal information to others than do Westerners. We propose that both between- and within-culture differences in self-disclosure toward close friends may be explained by the construct of "relational mobility" - the general degree to which individuals in the society have the opportunities to form new and terminate old relationships. In Study 1, we found that cross-cultural di...

  18. Influence of milk product type and its initial contamination on the efficiency of different methods for detection of Salmonella Enteritidis, Listeria monocytogenes and Escherichia coli O157:H7

    Directory of Open Access Journals (Sweden)

    Boris Antunović

    2018-01-01

    Full Text Available This paper investigates differences in efficacy of isolating pathogenic bacteria Salmonella Enteritidis, Listeria monocytogenes and Escherichia coli O157:H7 between conventional cultivation (ISO method and immunomagnetic separation (IMS method related to the types of dairy products and initial numbers of bacteria. Different milk products (dairy pudding- vanilla or chocolate; a mixture of yoghurt and pudding; solid, liquid and fruit yoghurt; AB culture - with or without fruit; cheese spread were intentionally contaminated with different numbers (≈10 and ≈30 of live cells of the observed bacteria per mL. The obtained results showed that the classical ISO procedure still represents an equally adequate method for the detection of S. Enteritidis and L. monocytogenes in dairy products as well as the IMS method. However, the ISO method was found to be inefficient for determination of E. coli O157:H7 when the initial contamination was low (≈10 live cells per mL. In such cases, even the IMS method appeared to be inefficient when used for fermented dairy product analysis. Fermented dairy products in contrast to the non-fermented ones, still represent a challenge for the development of routine detection methods, especially for S. Enteritidis, whilst the detection of L. monocytogenes and E. coli O157:H7 has improved by introducing the IMS method. The largest difference in the ability to detect bacteria in dairy product samples with reference to the initial number of bacteria by both methods was in the detection of E. coli O157:H7. The choice of broth (non-selective fluid broth vs. selective fluid broth did not matter in the in the detection of S. Enteritidis and L. monocytogenes by applying the IMS procedure. However, for the detection of E. coli O157:H7 the application of modified tripton-soya broth with novobiocin (mTSB+Nb has proved to be superior when compared to using the buffered peptone water (BPW. The presented results may be of importance as

  19. Using Relational-Cultural Theory to Conceptualize Couple Interventions in the Treatment of Sex Addiction

    Science.gov (United States)

    Vogel, Joanne E.

    2007-01-01

    Sex addictions have become an increasing concern since the growth of the sex industry, sex in advertising, and the ease of Internet access to sex. This article uses the foundational principles of Relational-Cultural Theory (RCT) to conceptualize sexual addiction and its relational impact. Particular attention is paid to the principles of…

  20. Belief, Knowledge and Understanding: How to Deal with the Relations between Different Cultural Perspectives in Classrooms

    Science.gov (United States)

    Moreira-dos-Santos, Frederik; El-Hani, Charbel N.

    2017-01-01

    This article discusses how to deal with the relations between different cultural perspectives in classrooms, based on a proposal for considering understanding and knowledge as goals of science education, inspired by Dewey's naturalistic humanism. It thus combines educational and philosophical interests. In educational terms, our concerns relate to…

  1. The Relation Between Valence and Arousal in Subjective Experience Varies With Personality and Culture.

    Science.gov (United States)

    Kuppens, Peter; Tuerlinckx, Francis; Yik, Michelle; Koval, Peter; Coosemans, Joachim; Zeng, Kevin J; Russell, James A

    2017-08-01

    While in general arousal increases with positive or negative valence (a so-called V-shaped relation), there are large differences among individuals in how these two fundamental dimensions of affect are related in people's experience. In two studies, we examined two possible sources of this variation: personality and culture. In Study 1, participants (Belgian university students) recalled a recent event that was characterized by high or low valence or arousal and reported on their feelings and their personality in terms of the Five-Factor Model. In Study 2, participants from Canada, China/Hong Kong, Japan, Korea, and Spain reported on their feelings in a thin slice of time and on their personality. In Study 1, we replicated the V-shape as characterizing the relation between valence and arousal, and identified personality correlates of experiencing particular valence-arousal combinations. In Study 2, we documented how the V-shaped relation varied as a function of Western versus Eastern cultural background and personality. The results showed that the steepness of the V-shaped relation between valence and arousal increases with Extraversion within cultures, and with a West-East distinction between cultures. Implications for the personality-emotion link and research on cultural differences in affect are discussed. © 2016 Wiley Periodicals, Inc.

  2. LISTERIA MONOCYTOGENES RISK EVALUATION IN READY TO EAT DELI PRODUCTS

    Directory of Open Access Journals (Sweden)

    T Civera

    2013-02-01

    Full Text Available Listeria monocytogenes has become one of the major concerns for food safety. Its ability to survive and replicate at low temperature, pH and high salt concentration, makes the bacterium a threat, mostly for RTE products. For these reasons, the present research was aimed at detecting the ability of growth of L. monocytogenes in RTE products retrieved from one deli store. Samples were analysed for L. monocytogenes detection, then inoculated with the pathogen (105cell/ml and stored at refrigeration temperature for the duration of their shelf-life (15-60 days. In all the products L. monocytogenes was not detected before experimental contamination. The challenge test evidenced that experimentally inoculated L. monocytogenes was not able to multiply for the duration of the entire shelf-life. These results indicated that the tested products could be considered as foods which are not able to support the growth of L. monocytogenes, as indicated by E.C. Regulation 2073/05. However, in order to guarantee consumer’s safety, it needs to be emphasized the need of a correct application of the GMPs, required for lowering the risk of initial contamination.

  3. Behaviour of Listeria monocytogenes in packaged fresh mushrooms (Agaricus bisporus).

    Science.gov (United States)

    González-Fandos, E; Olarte, C; Giménez, M; Sanz, S; Simón, A

    2001-11-01

    The aim of this study was to evaluate the potential of Listeria monocytogenes to grow in mushrooms packaged in two different types of PVC films when stored at 4 degrees C and 10 degrees C. Mushrooms were packed in two polymeric films (perforated and nonperforated PVC) and stored at 4 degrees C and 10 degrees C. The carbon dioxide and oxygen content inside the packages, aerobic mesophiles, psychrotrophs, Pseudomonas spp., Listeria monocytogenes, faecal coliforms, Escherichia coli, anaerobic spores and major sensory factors were determined. The mushrooms packaged in nonperforated film and stored at 4 degrees C had the most desirable quality parameters (texture, development stage and absence of moulds). Listeria monocytogenes was able to grow at 4 degrees C and 10 degrees C in inoculated mushrooms packaged in perforated and nonperforated films between 1 and 2 log units during the first 48 h. After 10 d of storage, the populations of L. monocytogenes were higher in mushrooms packaged in nonperforated film and stored at 10 degrees C. MAP followed by storage at 4 degrees C or 10 degrees C extends the shelf life by maintaining an acceptable appearance, but allows the growth and survival of L. monocytogenes. According to this study additional hurdles must be studied in order to prevent the growth of L. monocytogenes.

  4. Listeria monocytogenes, a down-to-earth pathogen.

    Science.gov (United States)

    Vivant, Anne-Laure; Garmyn, Dominique; Piveteau, Pascal

    2013-01-01

    Listeria monocytogenes is the causative agent of the food-borne life threatening disease listeriosis. This pathogenic bacterium received much attention in the endeavor of deciphering the cellular mechanisms that underlie the onset of infection and its ability to adapt to the food processing environment. Although information is available on the presence of L. monocytogenes in many environmental niches including soil, water, plants, foodstuff and animals, understanding the ecology of L. monocytogenes in outdoor environments has received less attention. Soil is an environmental niche of pivotal importance in the transmission of this bacterium to plants and animals. Soil composition, microbial communities and macrofauna are extrinsic edaphic factors that direct the fate of L. monocytogenes in the soil environment. Moreover, farming practices may further affect its incidence. The genome of L. monocytogenes presents an extensive repertoire of genes encoding transport proteins and regulators, a characteristic of the genome of ubiquitous bacteria. Postgenomic analyses bring new insights in the process of soil adaptation. In the present paper focussing on soil, we review these extrinsic and intrinsic factors that drive environmental adaptation of L. monocytogenes.

  5. Biofilm Formation of Listeria monocytogenes on Various Surfaces

    Directory of Open Access Journals (Sweden)

    M Mahdavi

    2007-10-01

    Full Text Available Introduction & Objective: Listeria monocytogenes is considered as a ubiquitous foodborne pathogen which can lead to serious infections, especially in newborns, elderly, pregnant, and immunocompromised people. The organism has been isolated from many foods and may cause meningitis, septicemia and abortion in pregnant women. Also L. monocytogenes forms biofilms on many food contact surface materials and medical devices. Development of biofilms on many surfaces is a potential source of contamination of foods that may lead to spoilage or transmission of foodborne pathogens. Materials & Methods: Biofilm formation of L. monocytogenes (RITCC 1293 serotype 4a was investigated. Hydrophobicity of L. monocytogenes was measured by MATH method. Then biofilm formation of the organism was assessed at 2, 4, 8, 16 and 20 hours on stainless steel (type 304 no 2B, polyethylene and glass by drop plate method. Results: Results indicated that L. monocytogenes with 85% of hydrophobicity formed biofilm on each of three surfaces. Biofilm formation on stainless steel surfaces was significantly more than other surfaces (p<0.05. Conclusion: The ability of biofilm formation of L. monocytogenes on medical devices and food containers is very important as far as hygiene and disease outbreaks are concerned.

  6. A case of bovine raw milk contamination with Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Hunt Karen

    2012-07-01

    Full Text Available Abstract During routine sampling of bulk raw milk on a dairy farm, the pathogenic bacteria Listeria monocytogenes was found to be a contaminant, at numbers L. monocytogenes, indicating a possible case of excretion of the L. monocytogenes directly into the milk. Milk samples were collected from the individual cows and analysed, resulting in the identification of L. monocytogenes excretion (at 280 cfu/ml from one of the 4 mammary quarters of one dairy cow out of 180. When the infected cow was isolated from the herd, no L. monocytogenes was detected from the remaining herd. The pulsed-field gel electrophoresis pattern of the strain from the individual cow was indistinguishable from that originally isolated from the bulk milk. The infected cow did not show any clinical signs of disease, nor did the appearance of the milk have any physical abnormalities. Antibiotic treatment of the infected mammary quarter was found to be ineffective. This study shows that there can be risks associated with direct contamination of raw milk with L. monocytogenes.

  7. Prevalence of Listeria monocytogenes in European cheeses

    DEFF Research Database (Denmark)

    Martinez Rios, Veronica; Dalgaard, Paw

    2017-01-01

    , respectively, pasteurized or un-pasteurized milk. Data from a total of 130,604 samples were analysed. Mean prevalence for presence during 2005-2015 estimated from scientific literature (2.3% with confidence interval (CI): 1.4-3.8%) was more than three times higher than results from EFSA reports (0.7%; CI: 0.......05) for cheeses produced from pasteurized (0.9%; CI: 0.4-1.9%) or un-pasteurized (1.0%; CI: 0.4-2.2%) milk. For cheese samples reported by EFSA 0.2% CI: 0.1-0.4% had concentration of L. monocytogenes above the critical European limits of 100 cfu/g. In addition, this systematic review focused on groups...

  8. Chitinase Expression in Listeria monocytogenes Is Influenced by lmo0327, Which Encodes an InternalinLike Protein

    DEFF Research Database (Denmark)

    Paspaliari, Dafni Katerina; Kastbjerg, Vicky Gaedt; Ingmer, Hanne

    2017-01-01

    carbohydrate in nature, the chitinases have been deemed important for colonization of unicellular moulds, as well as mammalian hosts. In order to identify additional components of the chitinolytic system, we screened a transposon mutant library for mutants exhibiting impaired chitin hydrolysis. The screening...... ChiA and ChiB in the culture supernatants of the mutant strain. Our results provide new information regarding the function of the lmo0325-lmo0327 locus in L. monocytogenes and link it to the expression of chitinolytic activity.Importance: Many bacteria from terrestrial and marine environments express...... chitinase activities enabling them to utilize chitin as the sole source of carbon and nitrogen. Interestingly, several bacterial chitinases may also be involved in host pathogenesis. For example, in the important food borne pathogen Listeria monocytogenes, the chitinases ChiA and ChiB, and the lytic...

  9. Habitus and Flow in Primary School Musical Practice: Relations between Family Musical Cultural Capital, Optimal Experience and Music Participation

    Science.gov (United States)

    Valenzuela, Rafael; Codina, Nuria

    2014-01-01

    Based on Bourdieu's idea that cultural capital is strongly related to family context, we describe the relations between family musical cultural capital and optimal experience during compulsory primary school musical practice. We analyse whether children from families with higher levels of musical cultural capital, and specifically with regard to…

  10. Cultural factors and social support related to breastfeeding among immigrant mothers in Taipei City, Taiwan.

    Science.gov (United States)

    Chen, Tzu-Ling; Tai, Chen-Jei; Chu, Yu-Roo; Han, Kuo-Chiang; Lin, Kuan-Chia; Chien, Li-Yin

    2011-02-01

    The objectives of this study were to identify cultural factors (including acculturation and breastfeeding cultures in subjects' native countries and those in mainstream Taiwanese society) and social support related to breastfeeding among immigrant mothers in Taiwan. This study was a cross-sectional survey performed from October 2007 through January 2008. The study participants were 210 immigrant mothers living in Taipei City. The prevalence of exclusive and partial breastfeeding at 3 months postpartum was 59.0% and 14.3%, respectively. Logistic regression analysis revealed that breastfeeding experience among mothers-in-law and the perceived level of acceptance of breastfeeding in Taiwan were positively associated with breastfeeding at 3 months postpartum. Immigrant women with a higher level of household activity support were less likely to breastfeed. Immigrant mothers in Taiwan usually come from cultures with a higher acceptance level for breastfeeding; however, their breastfeeding practices are more likely to be influenced by the mainstream culture in Taiwan.

  11. The Agr communication system provides a benefit to the populations of Listeria monocytogenes in soil.

    Science.gov (United States)

    Vivant, Anne-Laure; Garmyn, Dominique; Gal, Laurent; Piveteau, Pascal

    2014-01-01

    In this study, we investigated whether the Agr communication system of the pathogenic bacterium Listeria monocytogenes was involved in adaptation and competitiveness in soil. Alteration of the ability to communicate, either by deletion of the gene coding the response regulator AgrA (response-negative mutant) or the signal pro-peptide AgrD (signal-negative mutant), did not affect population dynamics in soil that had been sterilized but survival was altered in biotic soil suggesting that the Agr system of L. monocytogenes was involved to face the complex soil biotic environment. This was confirmed by a set of co-incubation experiments. The fitness of the response-negative mutant was lower either in the presence or absence of the parental strain but the fitness of the signal-negative mutant depended on the strain with which it was co-incubated. The survival of the signal-negative mutant was higher when co-cultured with the parental strain than when co-cultured with the response-negative mutant. These results showed that the ability to respond to Agr communication provided a benefit to listerial cells to compete. These results might also indicate that in soil, the Agr system controls private goods rather than public goods.

  12. Synergistic effect of high pressure processing and Lactobacillus casei antimicrobial activity against pressure resistant Listeria monocytogenes.

    Science.gov (United States)

    Chung, Hyun-Jung; Yousef, Ahmed E

    2010-09-30

    The purpose of this study was to evaluate combinations of high pressure processing (HPP) and Lactobacillus casei antimicrobial activity against Listeria monocytogenes strains with variation in pressure resistance in culture and in a food model. In culture, combination of HPP (350 MPa, for 1-20 min) and Lb. casei cell extract (CE, 32 CEAU/ml) showed a significant synergistic bactericidal effect (P5 log(10)CFU/ml. Synergy between CE and HPP was most evident in the pressure-resistant strain, OSY-8578. Similar result was observed in meat products where high pressure (500 MPa for 1 min), and high-activity CE (100 CEAU/g) caused >5 log reduction in the viability of L. monocytogenes Scott A. The combination treatment resulted in the absence of peaks associated with cellular components in DSC thermogram suggesting that the presence of CE may have caused a considerable damage to cellular components during the high pressure treatment. Copyright 2010 Elsevier B.V. All rights reserved.

  13. The frequency of Listeria monocytogenes strains recovered from clinical and non-clinical samples using phenotypic methods and confirmed by PCR

    Directory of Open Access Journals (Sweden)

    abazar pournajaf

    2013-09-01

    Full Text Available Background: Listeria monocytogenes is a facultative intracellular pathogen that causes listeriosis which has extensive clinical manifestations. Infections with L. monocytogenes are a serious threat to immunocompromised persons. The aim of this study was to determine the frequency of L. monocytogenes strains recovered from clinical and non-clinical samples using phenotypic methods and confirmed by PCR. Materials and Methods: In this study, 617 specimens were analyzed. All specimens were cultured in the specific PALCAM agar. Colonies were initially identified by routine biochemical tests. Finally, PCR assays using primers specific for inlA gene were performed. Results: In all, 46 (8.2% L. monocytogenes isolates were recovered from 617 specimens. Fourteen (8.2% strains, including 4 (7.5%, 2 (5.7%, 5 (14.2% and 3 (8.5% isolates were obtained from placental tissue, urine, vaginal and rectal swabs, respectively. In addition, 9 (7.4% strains of L. monocytogenes which were isolated from 107 different dairy products originated from cheese 5 (7.1%, cream 2 (10% and kashk 2 (11.7%, respectively. Among 11 (5.2% strains isolated from 210 different meat products, 5 (5.5%, 4 (7.2% and 2 (3% strains belonged to sausage, meat and poultry extracts, respectively. Finally, 12 (9.2% Listeria strains were recovered from 130 animal specimens that included 6 (10%, 4 (8% and 2 (10% strains from goat, sheep and cattle, respectively. Furthermore, all Listeria isolates (100% were found to be carriers of  inlA gene in PCR assay. Conclusion: The present study showed that the clinical and non-clinical specimens were contaminated with L. monocytogenes. So, it seems necessary to use a simple and standard technique such as PCR for rapid detection of this organism from various sources.

  14. Monoassociation with probiotic Lactobacillus delbrueckii UFV-H2b20 stimulates the immune system and protects germfree mice against Listeria monocytogenes infection.

    Science.gov (United States)

    dos Santos, Liliane Martins; Santos, Mônica Morais; de Souza Silva, Humberto Pereira; Arantes, Rosa Maria Esteves; Nicoli, Jacques Robert; Vieira, Leda Quercia

    2011-02-01

    In the present study, we investigated the protective effects of Lactobacillus delbrueckii UFV-H2b20 on the resistance to Listeria monocytogenes infection in gnotobiotic mice. Germfree mice or monoassociated mice were infected with L. monocytogenes, and the microbiological and immunological responses were evaluated after 1, 3, and 5 days of infection. Monoassociation with L. delbrueckii was capable of protecting mice against death caused by L. monocytogenes and induced a faster clearance of the bacteria in the liver, spleen, and peritoneal cavity at days 1, 3, and 5 post-infection. Also, monoassociated mice displayed less liver injury than germfree mice. The production of TNF-α in the serum, peritoneal cavity, and gut was augmented in monoassociated mice. Likewise, the levels of IFN-γ found on supernatants of spleen cells cultures were higher after the monoassociation. In addition, increased production of nitric oxide in peritoneal cell cultures supernatants and in serum was observed in mice that received L. delbrueckii. The monoassociation with L. delbrueckii induced higher production of IL-10 in the mucosal immune system. We conclude that monoassociation with L. delbrueckii UFV-H2b20 protects mice from death caused by L. monocytogenes infection by favoring effector responses while preventing their immunopathological consequences.

  15. A Multiplex RT-PCR Assay for S. aureus, L. monocytogenes, and Salmonella spp. Detection in Raw Milk with Pre-enrichment

    Directory of Open Access Journals (Sweden)

    Tian Ding

    2017-05-01

    Full Text Available This study firstly developed a multiplex real-time PCR (RT-PCR technique combined with a pre-enrichment step to simultaneously detect Staphylococcus aureus (S. aureus, Listeria monocytogenes (L. monocytogenes and Salmonella spp. in raw milk and the dairy farm environment (feces, soil, feed, water in one reaction. Brain heart infusion (BHI broth was selected for the enrichment step to increase the density of the target bacteria by using an incubation of 4 h before multiplex RT-PCR. The results showed that the detection limit of the multiplex real-time assay was approximately 102 CFU/mL for pure cultures and artificially contaminated milk without enrichment, while 12, 14, and 10 CFU/25 mL, respectively, for S. aureus, L. monocytogenes, and Salmonella spp. after pre-enrichment. The newly developed multiplex RT-PCR assay was applied to 46 dairy farm environmental samples and raw milk samples covering a wide variety of sample types. The results demonstrated that the multiplex RT-PCR assay coupled with the BHI enrichment broth was suitable for the simultaneous screening of S. aureus, L. monocytogenes, and Salmonella spp. in the pasture environment and in raw milk. The multiplex RT-PCR assay clearly and successfully shortened the total detection time and reduced labor compared to conventional culture-based methods for testing natural samples.

  16. Evaluation of the thin agar layer method for the recovery of pressure-injured and heat-injured Listeria monocytogenes.

    Science.gov (United States)

    Lavieri, Nicolas A; Sebranek, Joseph G; Cordray, Joseph C; Dickson, James S; Jung, Stephanie; Manu, David K; Mendonça, Aubrey F; Brehm-Stecher, Byron F; Stock, Joseph; Stalder, Kenneth J

    2014-05-01

    A sublethally injured bacterial cell has been defined as a cell that survives a stress such as heating, freezing, acid treatment, or other antimicrobial intervention but can repair the cellular damage exerted by the stressor and later regain its original ability to grow. Consequently, sublethally injured cells are not likely to be included in conventional enumeration procedures, which could result in unrealistically low counts unless efforts are made to encourage recovery of the injured cells before enumeration. The objective of this study was to evaluate the use of the thin agar layer (TAL) method for the recovery of pressure-injured and heat-injured Listeria monocytogenes in a tryptic soy broth with 0.6% yeast extract system. Pressure injury consisted of treatment of a culture of mixed L. monocytogenes strains with high hydrostatic pressure at 400 or 600 MPa for 1 s, 2 min, 4 min, or 6 min at a process temperature of 12±2 °C. Heat injury consisted of treatment of a culture of mixed L. monocytogenes strains at 60±1 °C for 3, 6, or 9 min. Growth media were tryptic soy agar (TSA) with 0.6% yeast extract, modified Oxford medium (MOX), and TAL, which consisted of a 7-ml layer of TSA overlaid onto solidified MOX. Counts of viable L. monocytogenes on TAL were higher than those on MOX in the heat-injury experiment but not in the pressure-injury experiment. Therefore, the effectiveness of the TAL method may be specific to the type of injury applied to the microorganism and should be investigated in a variety of cellular injury scenarios.

  17. Cultural intelligence and work-related outcomes: A meta-analytic review

    DEFF Research Database (Denmark)

    Schlaegel, Christopher; Richter, Nicole Franziska; Taras, Vas

    2017-01-01

    -cultural work context. Tests of the relative incremental validity show that CQ and its dimensions explain desirable work outcomes beyond the effect of personality traits and emotional intelligence. The results of commonality analysis reveal the unique and shared contribution of CQ dimensions in explaining......Over the last 15 years the research on cultural intelligence (CQ) has grown to a point that a quantitative synthesis of the existing empirical evidence on the relationship between CQ and work-related outcomes is needed to provide a foundation for future research in this direction. Based on 110...

  18. Outcome study of brief relational-cultural therapy in a women's mental health center.

    Science.gov (United States)

    Oakley, M Anne; Addison, Shirley C; Piran, Niva; Johnston, Gary J; Damianakis, Mary; Curry, Joyce; Dunbar, Christine; Weigeldt, Almuth

    2013-01-01

    The current study is the first to evaluate the effectiveness of a brief relational-cultural model of therapy in a community-based mental health center for women. The study was distinctive in its use of a hybrid model that employed elements of randomized control and naturalistic design. Results showed that the entire treatment group of 91 women improved significantly on all eight outcome measures. Therapeutic gains were maintained at 3- and 6-month follow-ups. The results lend support to the importance of including relational-cultural factors in the treatment of women. An adherence scale/manual was developed and implemented and will allow for replication.

  19. The relationship between relational models and individualism and collectivism: evidence from culturally diverse work groups.

    Science.gov (United States)

    Vodosek, Markus

    2009-04-01

    Relational models theory (Fiske, 1991 ) proposes that all thinking about social relationships is based on four elementary mental models: communal sharing, authority ranking, equality matching, and market pricing. Triandis and his colleagues (e.g., Triandis, Kurowski, & Gelfand, 1994 ) have suggested a relationship between the constructs of horizontal and vertical individualism and collectivism and Fiske's relational models. However, no previous research has examined this proposed relationship empirically. The objective of the current study was to test the association between the two frameworks in order to further our understanding of why members of culturally diverse groups may prefer different relational models in interactions with other group members. Findings from this study support a relationship between Triandis' constructs and Fiske's four relational models and uphold Fiske's ( 1991 ) claim that the use of the relational models is culturally dependent. As hypothesized, horizontal collectivism was associated with a preference for equality matching and communal sharing, vertical individualism was related to a preference for authority ranking, and vertical collectivism was related to a preference for authority ranking and communal sharing. However, contrary to expectations, horizontal individualism was not related to a preference for equality matching and market pricing, and vertical individualism was not associated with market pricing. By showing that there is a relationship between Triandis' and Fiske's frameworks, this study closes a gap in relational models theory, namely how culture relates to people's preferences for relational models. Thus, the findings from this study will enable future researchers to explain and predict what relational models are likely to be used in a certain cultural context.

  20. Listeria monocytogenes - Danger for health safety vegetable production.

    Science.gov (United States)

    Kljujev, Igor; Raicevic, Vera; Jovicic-Petrovic, Jelena; Vujovic, Bojana; Mirkovic, Milica; Rothballer, Michael

    2018-04-22

    The microbiologically contaminated vegetables represent a risk for consumers, especially vegetables without thermal processing. It is known that human pathogen bacteria, such as Listeria monocytogenes, could exist on fresh vegetables. The fresh vegetables could become Listeria-contaminated if they come in touch with contaminated soil, manure, irrigation water. The aim of this work was to investigate the presence of Listeria spp. and L. monocytogenes in different kind of vegetables grown in field and greenhouse condition as well as surface and endophytic colonization plant roots of different vegetables species by L. monocytogenes in laboratory conditions. The detection of Listeria spp. and L. monocytogenes in vegetable samples was done using ISO and PCR methods. The investigation of colonization vegetable roots and detection Listeria-cells inside plant root tissue was done using Fluorescence in situ hybridization (FISH) method in combination with confocal laser scanning microscopy (CLSM). The results showed that 25.58% vegetable samples were positive for Listeria spp. and only one sample (carrot) was positive for L. monocytogenes out of 43 samples in total collected from field and greenhouse. The strain L. monocytogenes EGD-E surface and endophytic colonized carrot root in highest degree while strain L. monocytogenes SV4B was the most represented at leafy vegetable plants, such at lettuce (1.68 × 10 6  cells/mm 3 absolutely dry root) and spinach (1.39 × 10 6  cells/mm 3 absolutely dry root) root surface. The cells of L. monocytogenes SV4B were visible as single cells in interior tissue of plant roots (celery and sweet corn roots) as well as in the interior of the plant root cell at sweet corn root. The cells of L. monocytogenes EGD-E bind to the surface of the plant root and they were less commonly found out on root hair. In the inner layers of the root, those bacterial cells were inhabited intercellular spaces mainly as single cells very close to the

  1. Fate of Escherichia coli O157:H7, Salmonella Enteritidis and Listeria monocytogenes during storage of fermented green table olives in brine.

    Science.gov (United States)

    Argyri, Anthoula A; Lyra, Efstathia; Panagou, Efstathios Z; Tassou, Chrysoula C

    2013-10-01

    The survival of Escherichia coli O157:H7, Salmonella Enteritidis and Listeria monocytogenes during the storage of fermented green table olives cv. Halkidiki in brine was studied in parallel with the evolution of lactic acid bacteria (LAB), yeasts and pH. The olives were previously fermented with a starter culture (a potential probiotic strain of Lactobacillus pentosus B281--starter process) or with the indigenous microbiota (control). After the end of fermentation, olives were placed in brine, inoculated with a cocktail of 5 strains of E. coli O157:H7, 5 strains of L. monocytogenes and 4 strains of S. Enteritidis, with a final concentration in the brine of ca. 7.0 log CFU/ml, and subsequently packaged in polyethylene pouches and stored at 20 °C. The population of E. coli O157:H7 reduced gradually and was detected in the brine until the 27th day of storage in both cases (i.e., starter and control process), and on olive fruits until the 19th and 16th days of storage in the starter and control process, respectively. S. Enteritidis population showed also a decrease and it was detected until the 21st day of storage in both brine and olive fruits in both cases. The population of L. monocytogenes declined during storage and it was detected until the 31st day of storage in both brine and olive fruits in both cases, showing a longer survival period in comparison to the other two studied pathogens. The presence of the potential probiotic starter did not affect the pathogen survival. The results demonstrated that even though the growth of the pathogenic strains was not supported, they may survive for a long period in a stressful environment of a fermented product with low pH value (4.2) and high salt concentration (6.0%). These results are a valuable contribution to risk assessment studies related to ready to eat foods in general. Copyright © 2013 Elsevier Ltd. All rights reserved.

  2. Examining cultural, social, and self-related aspects of stigma in relation to sexual assault and trauma symptoms.

    Science.gov (United States)

    Deitz, Mandi F; Williams, Stacey L; Rife, Sean C; Cantrell, Peggy

    2015-05-01

    The current study investigated a model explaining sexual assault victims' severity of trauma symptoms that incorporated multiple stigma constructs. Integrating the sexual assault literature with the stigma literature, this study sought to better understand trauma-related outcomes of sexual assault by examining three levels of stigma-cultural, social, and self. Results showed self-stigma was significantly and positively related to trauma symptom severity. Thus, results revealed that the internalized aspect of stigma served as a mechanism in the relation between sexual assault severity and increased levels of trauma symptom severity, highlighting the importance of assessing self-stigma in women reporting sexual assault experiences. © The Author(s) 2015.

  3. Associations between health culture, health behaviors, and health-related outcomes: A cross-sectional study.

    Science.gov (United States)

    Jia, Yingnan; Gao, Junling; Dai, Junming; Zheng, Pinpin; Fu, Hua

    2017-01-01

    To examine the associations between demographic characteristics, health behaviors, workplace health culture, and health-related outcomes in Chinese workplaces. A total of 1508 employees from 10 administrative offices and 6 enterprises were recruited for a cross-sectional survey. Self-administered questionnaires mainly addressed demographic characteristics, health behaviors, workplace health culture, and health-related outcomes including self-rated health, mental health, and happiness. The proportion of participants who reported good health-related outcomes was significantly higher in those working in administrative offices than those working in enterprises. The result of the potential factors related to self-rated health (SRH), mental health, and happiness by logistic regression analyses showed that age and income were associated with SRH; type of workplace, age, smoking, and health culture at the workplace level were associated with mental health; and beneficial health effects of direct leadership was positively associated with happiness. Moreover, there were some similar results among 3 multivariate regression models. Firstly, good SRH (Odds Ratio (OR) = 1.744), mental health (OR = 1.891), and happiness (OR = 1.736) were more common among highly physically active participants compared with those physical inactive. Furthermore, passive smoking was negatively correlated with SRH (OR = 0.686), mental health (OR = 0.678), and happiness (OR = 0.616), while health culture at the individual level was positively correlated with SRH (OR = 1.478), mental health (OR = 1.654), and happiness (OR = 2.916). The present study indicated that workplace health culture, health behaviors, and demographic characteristics were associated with health-related outcomes. Furthermore, individual health culture, physical activity, and passive smoking might play a critical role in workplace health promotion.

  4. Chinese American immigrant parents' emotional expression in the family: Relations with parents' cultural orientations and children's emotion-related regulation.

    Science.gov (United States)

    Chen, Stephen H; Zhou, Qing; Main, Alexandra; Lee, Erica H

    2015-10-01

    The present study examined 2 measures of Chinese American immigrant parents' emotional expression in the family context: self-reported emotional expressivity and observed emotional expression during a parent-child interaction task. Path analyses were conducted to examine the concurrent associations between measures of emotional expression and (a) parents' American and Chinese cultural orientations in language proficiency, media use, and social affiliation domains, and (b) parents' and teachers' ratings of children's emotion-related regulation. Results suggested that cultural orientations were primarily associated with parents' self-reported expressivity (rather than observed emotional expression), such that higher American orientations were generally associated with higher expressivity. Although parents' self-reported expressivity was only related to their own reports of children's regulation, parents' observed emotional expression was related to both parents' and teachers' reports of children's regulation. These results suggest that self-reported expressivity and observed emotional expression reflect different constructs and have differential relations to parents' cultural orientations and children's regulation. (c) 2015 APA, all rights reserved).

  5. Bourdieu’s Cultural Capital in Relation to Food Choices: A Systematic Review of Cultural Capital Indicators and an Empirical Proof of Concept

    Science.gov (United States)

    Kamphuis, Carlijn B. M.; Jansen, Tessa; Mackenbach, Johan P.; van Lenthe, Frank J.

    2015-01-01

    Objective Unhealthy food choices follow a socioeconomic gradient that may partly be explained by one’s ‘cultural capital’, as defined by Bourdieu. We aim 1) to carry out a systematic review to identify existing quantitative measures of cultural capital, 2) to develop a questionnaire to measure cultural capital for food choices, and 3) to empirically test associations of socioeconomic position with cultural capital and food choices, and of cultural capital with food choices. Design We systematically searched large databases for the key-word ‘cultural capital’ in title or abstract. Indicators of objectivised cultural capital and family institutionalised cultural capital, as identified by the review, were translated to food choice relevant indicators. For incorporated cultural capital, we used existing questionnaires that measured the concepts underlying the variety of indicators as identified by the review, i.e. participation, skills, knowledge, values. The questionnaire was empirically tested in a postal survey completed by 2,953 adults participating in the GLOBE cohort study, The Netherlands, in 2011. Results The review yielded 113 studies that fulfilled our inclusion criteria. Several indicators of family institutionalised (e.g. parents’ education completed) and objectivised cultural capital (e.g. possession of books, art) were consistently used. Incorporated cultural capital was measured with a large variety of indicators (e.g. cultural participation, skills). Based on this, we developed a questionnaire to measure cultural capital in relation to food choices. An empirical test of the questionnaire showed acceptable overall internal consistency (Cronbach’s alpha of .654; 56 items), and positive associations between socioeconomic position and cultural capital, and between cultural capital and healthy food choices. Conclusions Cultural capital may be a promising determinant for (socioeconomic inequalities in) food choices. PMID:26244763

  6. Bourdieu's Cultural Capital in Relation to Food Choices: A Systematic Review of Cultural Capital Indicators and an Empirical Proof of Concept.

    Directory of Open Access Journals (Sweden)

    Carlijn B M Kamphuis

    Full Text Available Unhealthy food choices follow a socioeconomic gradient that may partly be explained by one's 'cultural capital', as defined by Bourdieu. We aim 1 to carry out a systematic review to identify existing quantitative measures of cultural capital, 2 to develop a questionnaire to measure cultural capital for food choices, and 3 to empirically test associations of socioeconomic position with cultural capital and food choices, and of cultural capital with food choices.We systematically searched large databases for the key-word 'cultural capital' in title or abstract. Indicators of objectivised cultural capital and family institutionalised cultural capital, as identified by the review, were translated to food choice relevant indicators. For incorporated cultural capital, we used existing questionnaires that measured the concepts underlying the variety of indicators as identified by the review, i.e. participation, skills, knowledge, values. The questionnaire was empirically tested in a postal survey completed by 2,953 adults participating in the GLOBE cohort study, The Netherlands, in 2011.The review yielded 113 studies that fulfilled our inclusion criteria. Several indicators of family institutionalised (e.g. parents' education completed and objectivised cultural capital (e.g. possession of books, art were consistently used. Incorporated cultural capital was measured with a large variety of indicators (e.g. cultural participation, skills. Based on this, we developed a questionnaire to measure cultural capital in relation to food choices. An empirical test of the questionnaire showed acceptable overall internal consistency (Cronbach's alpha of .654; 56 items, and positive associations between socioeconomic position and cultural capital, and between cultural capital and healthy food choices.Cultural capital may be a promising determinant for (socioeconomic inequalities in food choices.

  7. Cultural and Intellectual Openness Differentially Relate to Social Judgments of Potential Work Partners.

    Science.gov (United States)

    Porter, Caitlin M; Parrigon, Scott E; Woo, Sang Eun; Saef, Rachel M; Tay, Louis

    2017-10-01

    This study investigates the differential functioning of cultural and intellectual openness (the two aspects of Openness to Experience) in relation to social cognitive processes by examining how they influence people's perceptions and interpretations of social information when deciding to initiate working relationships. Using a policy-capturing design, 681 adult participants were asked to rate their similarity to and preference to work with potential work partners characterized by varying nationalities and levels of work-related competence. Multilevel moderated mediation was conducted to simultaneously evaluate whether the indirect effects of potential work partners' characteristics (i.e., nationalities and levels of work-related competence) on work partner preference through perceived similarity were moderated by cultural and intellectual openness. Perceived similarity mediated the relationships between work partner nationality and work-related competence and participants' work partner preferences. Furthermore, the negative indirect effect of work partner nationality on work partner preference via perceived similarity was attenuated by cultural openness, and the positive indirect effect of work partner work-related competence on work partner preference via perceived similarity was strengthened by intellectual openness. Cultural and intellectual openness may have distinct functions that influence how people perceive, evaluate, and appreciate social information when making social judgments. © 2016 Wiley Periodicals, Inc.

  8. Exoproteome analysis reveals higher abundance of proteins linked to alkaline stress in persistent Listeria monocytogenes strains.

    Science.gov (United States)

    Rychli, Kathrin; Grunert, Tom; Ciolacu, Luminita; Zaiser, Andreas; Razzazi-Fazeli, Ebrahim; Schmitz-Esser, Stephan; Ehling-Schulz, Monika; Wagner, Martin

    2016-02-02

    The foodborne pathogen Listeria monocytogenes, responsible for listeriosis a rare but severe infection disease, can survive in the food processing environment for month or even years. So-called persistent L. monocytogenes strains greatly increase the risk of (re)contamination of food products, and are therefore a great challenge for food safety. However, our understanding of the mechanism underlying persistence is still fragmented. In this study we compared the exoproteome of three persistent strains with the reference strain EGDe under mild stress conditions using 2D differential gel electrophoresis. Principal component analysis including all differentially abundant protein spots showed that the exoproteome of strain EGDe (sequence type (ST) 35) is distinct from that of the persistent strain R479a (ST8) and the two closely related ST121 strains 4423 and 6179. Phylogenetic analyses based on multilocus ST genes showed similar grouping of the strains. Comparing the exoproteome of strain EGDe and the three persistent strains resulted in identification of 22 differentially expressed protein spots corresponding to 16 proteins. Six proteins were significantly increased in the persistent L. monocytogenes exoproteomes, among them proteins involved in alkaline stress response (e.g. the membrane anchored lipoprotein Lmo2637 and the NADPH dehydrogenase NamA). In parallel the persistent strains showed increased survival under alkaline stress, which is often provided during cleaning and disinfection in the food processing environments. In addition, gene expression of the proteins linked to stress response (Lmo2637, NamA, Fhs and QoxA) was higher in the persistent strain not only at 37 °C but also at 10 °C. Invasion efficiency of EGDe was higher in intestinal epithelial Caco2 and macrophage-like THP1 cells compared to the persistent strains. Concurrently we found higher expression of proteins involved in virulence in EGDe e.g. the actin-assembly-inducing protein ActA and the

  9. Potential Impact of the Resistance to Quaternary Ammonium Disinfectants on the Persistence of Listeria monocytogenes in Food Processing Environments.

    Science.gov (United States)

    Martínez-Suárez, Joaquín V; Ortiz, Sagrario; López-Alonso, Victoria

    2016-01-01

    The persistence of certain strains of Listeria monocytogenes, even after the food processing environment has been cleaned and disinfected, suggests that this may be related to phenomena that reduce the concentration of the disinfectants to subinhibitory levels. This includes (i) the existence of environmental niches or reservoirs that are difficult for disinfectants to reach, (ii) microorganisms that form biofilms and create microenvironments in which adequate concentrations of disinfectants cannot be attained, and (iii) the acquisition of resistance mechanisms in L. monocytogenes, including those that lead to a reduction in the intracellular concentration of the disinfectants. The only available data with regard to the resistance of L. monocytogenes to disinfectants applied in food production environments refer to genotypic resistance to quaternary ammonium compounds (QACs). Although there are several well-characterized efflux pumps that confer resistance to QACs, it is a low-level resistance that does not generate resistance to QACs at the concentrations applied in the food industry. However, dilution in the environment and biodegradation result in QAC concentration gradients. As a result, the microorganisms are frequently exposed to subinhibitory concentrations of QACs. Therefore, the low-level resistance to QACs in L. monocytogenes may contribute to its environmental adaptation and persistence. In fact, in certain cases, the relationship between low-level resistance and the environmental persistence of L. monocytogenes in different food production chains has been previously established. The resistant strains would have survival advantages in these environments over sensitive strains, such as the ability to form biofilms in the presence of increased biocide concentrations.

  10. Meningoencefalite por Listeria monocytogenes em ovinos Meningoencephalitis in sheep caused by Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Daniel R. Rissi

    2010-01-01

    Full Text Available São descritos sete casos de doença neurológica em ovinos por Listeria monocytogenes no Rio Grande do Sul e Paraná entre 2000 e 2007. Foram afetados ovinos com idades entre 12-24 meses. Os casos ocorreram no verão e início da primavera e os índices gerais de morbidade e letalidade foram de 3,15% e 100%, respectivamente. Quando essa informação estava disponível, nenhum dos ovinos afetados era alimentado com silagem. Em três propriedades havia contato próximo dos ovinos afetados com outras espécies. A evolução do quadro clínico foi de 12 horas a três dias e os sinais clínicos foram caracterizados por decúbito (7/7, desvio da cabeça (4/7, incoordenação (3/7, depressão (3/7, andar em círculos (2/7, cegueira unilateral, emagrecimento progressivo, febre, midríase, movimentos de pedalagem, nistagmo lateral, opistótono, paralisia flácida dos membros pélvicos ou dos quatro membros, salivação excessiva e tremores (1/7 cada. Histologicamente observou-se encefalite com microabscessos, predominantemente unilateral com variáveis graus de gliose e alterações degenerativas como esferóides axonais e infiltração de células Gitter. As lesões se estendiam desde a medula oblonga até o mesencéfalo. Antígenos de Listeria monocytogenes foram detectados por imuno-histoquímica em seções de tronco encefálico de todos os ovinos afetados. O diagnóstico foi realizado com base nos achados epidemiológicos e clinico-patológicos, e confirmado pela imuno-histoquímica (IHQ utilizando anticorpo policlonal anti-L. monocytogenes.Seven cases of neurological disease in sheep caused by Listeria monocytogenes in Rio Grande do Sul and Paraná state, southern Brazil are described. The cases occurred between 2000 and 2007 and 12-24-month-old sheep were affected. Overall morbidity and lethality rates were 3.15% and 100%, respectively. Cases occurred in the summer and early spring. When this information was available, affected sheep had not been

  11. Identifying ingredients that delay outgrowth of Listeria monocytogenes in natural, organic, and clean-label ready-to-eat meat and poultry products.

    Science.gov (United States)

    McDonnell, Lindsey M; Glass, Kathleen A; Sindelar, Jeffrey J

    2013-08-01

    The objective of this study was to identify ingredients that inhibit Listeria monocytogenes in natural, organic, or clean-label ready-to-eat meat and poultry products. Fourteen ingredients were screened in uncured (no-nitrate-or-nitrite-added), traditional-cured (156 ppm of purified sodium nitrite), cultured (alternative cured, natural nitrate source, and Staphylococcus carnosus), or preconverted (alternative cured, natural nitrite source) turkey slurries. Slurries were cooked, cooled, inoculated to yield 3 log CFU/ml L. monocytogenes, stored at 4°C, and tested weekly for 4 weeks. Three antimicrobial ingredients, 1.5 % vinegar-lemon-cherry powder blend, 2.5 % buffered vinegar, and 3.0 % cultured sugar-vinegar blend, were incorporated into alternative-cured ham and uncured roast beef and deli-style turkey breast. Controls included all three meat products without antimicrobial ingredients and a traditional-cured ham with 2.8 % sodium lactate-diacetate. Cooked, sliced products were inoculated with 3 log CFU/g L. monocytogenes, vacuum packed, and stored at 4 or 7°C, for up to 12 weeks. For control products without antimicrobial agents stored at 4°C, a 2-log L. monocytogenes increase was observed at 2 weeks for ham and turkey and at 4 weeks for roast beef. Growth (>1-log increase) in the sodium lactate-diacetate was delayed until week 6. Compared with the control, the addition of either vinegar-lemon-cherry powder blend or buffered vinegar delayed L. monocytogenes growth for an additional 2 weeks, while the addition of cultured sugar-vinegar blend delayed growth for an additional 4 weeks for both ham and turkey. The greatest L. monocytogenes delay was observed in roast beef containing any of the three antimicrobial ingredients, with no growth detected through 12 weeks at 4°C for all the treatments. As expected, L. monocytogenes grew substantially faster in products stored at 7°C than at 4°C. These data suggest that antimicrobial ingredients from a natural source

  12. Cultural differences in self-recognition: the early development of autonomous and related selves?

    Science.gov (United States)

    Ross, Josephine; Yilmaz, Mandy; Dale, Rachel; Cassidy, Rose; Yildirim, Iraz; Suzanne Zeedyk, M

    2017-05-01

    Fifteen- to 18-month-old infants from three nationalities were observed interacting with their mothers and during two self-recognition tasks. Scottish interactions were characterized by distal contact, Zambian interactions by proximal contact, and Turkish interactions by a mixture of contact strategies. These culturally distinct experiences may scaffold different perspectives on self. In support, Scottish infants performed best in a task requiring recognition of the self in an individualistic context (mirror self-recognition), whereas Zambian infants performed best in a task requiring recognition of the self in a less individualistic context (body-as-obstacle task). Turkish infants performed similarly to Zambian infants on the body-as-obstacle task, but outperformed Zambians on the mirror self-recognition task. Verbal contact (a distal strategy) was positively related to mirror self-recognition and negatively related to passing the body-as-obstacle task. Directive action and speech (proximal strategies) were negatively related to mirror self-recognition. Self-awareness performance was best predicted by cultural context; autonomous settings predicted success in mirror self-recognition, and related settings predicted success in the body-as-obstacle task. These novel data substantiate the idea that cultural factors may play a role in the early expression of self-awareness. More broadly, the results highlight the importance of moving beyond the mark test, and designing culturally sensitive tests of self-awareness. © 2016 John Wiley & Sons Ltd.

  13. Strategies for North American Missionaries' Relational Language-Culture Learning in the Japanese Context

    Science.gov (United States)

    Manabe-Kim, Rie

    2012-01-01

    This study focused on presenting the fieldwork findings derived from studying North-American missionaries' relational dynamics with the Japanese people, and the strategies that impacted their language-culture learning. This study also focused on applying the fieldwork findings towards the creation of a coaching model designed to help missionaries…

  14. Cultural validation of a new instrument to measure leprosy-related stigma: the SARI Stigma Scale

    NARCIS (Netherlands)

    Dadun,; Peters, Ruth M. H.; Van Brakel, Wim H.; Lusli, Mimi; Damayanti, Rita; Irwanto, A.; Bunders- Aelen, J.G.F.

    Background: There is a need for comprehensive, valid and reliable instruments to assess leprosy-related stigma. This paper presents the process of the cross-cultural validation of an instrument in Cirebon District, Indonesia initiated by the Stigma Assessment and Reduction of Impact (SARI) project.

  15. Exploring a Relational Cultural Group Trainee Model for Master's Level Counseling Students

    Science.gov (United States)

    Hall, Brenda S.; Harper, Irene; Korcuska, James

    2018-01-01

    We explored students' experiences of a graduate level group course infused with components of the Relational Cultural Theory (RCT). During the didactic and experiential aspects of 2 semester-long group courses, the faculty instructors and students focused on creating an environment of safety, connection, and empowerment. The instructor and…

  16. Evolution of public relations in the activity of organizations of ukrainian socio-cultural sphere

    Directory of Open Access Journals (Sweden)

    Євгенія Олегівна Кияниця

    2015-04-01

    Full Text Available The article traces the evolution of public relations in various fields of life including socio-cultural and found creative and social potential of this activity. Analysis of historical experience of using the PR-technologies in the field of sociocultural institutions promotes understanding of importance of this activity for the efficient work of organizations of this sphere

  17. The Familial Socialization of Culturally Related Values in Mexican American Families

    Science.gov (United States)

    Knight, George P.; Berkel, Cady; Umana-Taylor, Adriana J.; Gonzales, Nancy A.; Ettekal, Idean; Jaconis, Maryanne; Boyd, Brenna M.

    2011-01-01

    Research has documented a relation between parents' ethnic socialization and youth's ethnic identity, yet there has been little research examining the transmission of cultural values from parents to their children through ethnic socialization and ethnic identity. This study examines a prospective model in which mothers' and fathers' Mexican…

  18. Education-Related Factors in Cultural Intelligence Development: A Colombian Study

    Science.gov (United States)

    Robledo-Ardila, Cristina; Aguilar-Barrientos, Sara; Román-Calderón, Juan Pablo

    2016-01-01

    This article reports the results of a study inquiring about the role of education-related factors in the development of cultural intelligence. Five hundred fifty-seven students of a Colombian international business (IB) undergraduate program participated in the study. The psychometric properties of the measures were assessed by conducting…

  19. A Relational Cultural Approach to Working with Clients with Eating Disorders

    Science.gov (United States)

    Trepal, Heather C.; Boie, Ioana; Kress, Victoria E.

    2012-01-01

    The authors examine eating disorders through the conceptual framework of relational cultural theory (RCT). Taking into account the importance of relationships and connection, it is suggested that RCT may be a useful lens for conceptualizing and working with people who are experiencing eating disorders. Ways that RCT can be applied to enhance…

  20. Cross-Cultural Differences in Cognitive Development: Attention to Relations and Objects

    Science.gov (United States)

    Kuwabara, Megumi; Smith, Linda B.

    2012-01-01

    Growing evidence indicates a suite of generalized differences in the attentional and cognitive processing of adults from Eastern and Western cultures. Cognition in Eastern adults is often more relational and in Western adults is more object focused. Three experiments examined whether these differences characterize the cognition of preschool…

  1. Vietnamese Americans' Attitudes toward Seeking Mental Health Services: Relation to Cultural Variables

    Science.gov (United States)

    Nguyen, Quang Charles X.; Anderson, Louis P.

    2005-01-01

    This study examined the relation between culturally based variables and attitudes toward seeking mental health services among a community sample of Vietnamese Americans (N = 148) with at least 8 years' residence in the United States (U.S.). Variables included Stigma, Traditional Beliefs about Mental Illness, Help-Seeking Preferences, Problem…

  2. A Cross-Cultural Examination of SNS Usage Intensity and Managing Interpersonal Relationships Online: The Role of Culture and the Autonomous-Related Self-Construal

    OpenAIRE

    Lee, Soon Li; Kim, Jung-Ae; Golden, Karen Jennifer; Kim, Jae-Hwi; Park, Miriam Sang-Ah

    2016-01-01

    Perception of the autonomy and relatedness of the self may be influenced by one's experiences and social expectations within a particular cultural setting. The present research examined the role of culture and the Autonomous-Related self-construal in predicting for different aspects of Social Networking Sites (SNS) usage in three Asian countries, especially focusing on those aspects serving interpersonal goals. Participants in this cross-cultural study included 305 university students from Ma...

  3. PASTEURISASI HIGH TEMPERATURE SHORT TIME (HTST) SUSU TERHADAP Listeria monocytogenes PADA PENYIMPANAN REFRIGERATOR

    OpenAIRE

    SABIL, SYAHRIANA

    2015-01-01

    2015 SYAHRIANA SABIL (I 111 11 273). Pasteurisasi High Temperature Short Time (HTST) Susu terhadap Listeria monocytogenes pada Penyimpanan Refrigerator. Dibimbing oleh RATMAWATI MALAKA dan FARIDA NUR YULIATI. Pasteurisasi High Temperature Short Time (HTST) merupakan proses pemanasan susu di bawah titik didih yang diharapkan dapat membunuh Listeria monocytogenes (L. monocytogenes) karena bersifat patogen dan mengakibatkan listeriosis yang merupakan penyakit zoonosis. Tu...

  4. Industrial disinfectants do not select for resistance in Listeria monocytogenes following long term exposure

    DEFF Research Database (Denmark)

    Kastbjerg, Vicky Gaedt; Gram, Lone

    2012-01-01

    or tolerance would evolve in L. monocytogenes under continued selection in three industrial disinfectants. L. monocytogenes EGD was exposed to Desinfect CL (hypochlorite) and Incimaxx DES (peracedic acid and hydrogen peroxide) for several hundred generations. This caused no increase in the minimal inhibitory......, and that the disinfectants are still efficient for controlling microorganisms such as L. monocytogenes....

  5. Tracking of Listeria monocytogenes in meat establishment using Whole Genome Sequencing as a food safety management tool: A proof of concept.

    Science.gov (United States)

    Nastasijevic, Ivan; Milanov, Dubravka; Velebit, Branko; Djordjevic, Vesna; Swift, Craig; Painset, Anais; Lakicevic, Brankica

    2017-09-18

    and dispatch) originated from the slaughter line. Further, all eight L. monocytogenes isolates were confirmed to be biofilm producers on glass and stainless steel surfaces. The identification of the main entry routes of L. monocytogenes into meat establishments and tracking the routes for spread of the pathogen are of essential importance to define appropriate risk mitigation strategies for L. monocytogenes in meat production environment. The routine use of WGS for bacterial characterization, as a strong support of food safety management system in meat establishments, will require the cost-effective approach. It may encompass in-house sequencing when sequencing equipment is used for multiple applications (e.g. WGS of pathogens, starter cultures and spoilage organisms). Copyright © 2017 Elsevier B.V. All rights reserved.

  6. The Impact of Organizational Culture and Job Related Affective Well Being on Employees’ Conflict Resolution Styles

    Directory of Open Access Journals (Sweden)

    Nurdan Özarallı

    2015-06-01

    Full Text Available This study aims to investigate the impact of cooperative or competitive organizational culture and employees’ job related affective well being on their preferred conflict resolution styles. A total of 236 white collar employees in the private sector completed questionnaires on “Organizational Culture“, “Job Related Affective Well Being“and “Conflict Resolution Styles“. Results indicated that employees working in a cooperative organizational culture would choose problem solving, compromising and accomodating conflict resolution styles while those working in a competitive work environment would choose forcing and avoiding strategies. Results also showed that while positive job related affective well being is a major predictor o problem solving, compromising, accomodating and avoiding conflict resolution styles, negative job related affective well being significantly predicts forcing and avoiding strategies. Overall, the results draw attention to the preferred conflict resolution strategies assumed by Turkish employees, the role of the conflict environment as well as actors’ affective well being

  7. Influence of culture medium composition on relative mRNA abundances in domestic cat embryos.

    Science.gov (United States)

    Hribal, R; Jewgenow, K; Braun, B C; Comizzoli, P

    2013-04-01

    Different culture conditions have been used to produce domestic cat embryos. As part of the in vitro procedures, the medium composition significantly affects the quality of the embryo development also. Quality assessments based on cleavage kinetics and blastomere symmetry are useful, but embryos also can differ in their relative gene expression patterns despite similar morphological characteristics. The aim of this study was to compare cat embryos produced with two different in vitro culture systems routinely used in two different laboratories [Smithsonian Conservation Biology Institute, Washington D.C., USA (SCBI) and Leibniz Institute for Zoo and Wildlife Research, Berlin, Germany (IZW)]. Specifically, relative mRNA expression patterns of critical genes for pre-implantation embryo development were assessed in both conditions. Embryos were produced in parallel in both culture systems by IVF using frozen-thawed ejaculated semen in the United States and fresh epididymal sperm in Germany. Success of embryo development in vitro was recorded as well as relative mRNA abundances [DNA methyltransferases 1 and 3A (DNMT1, DNMT3A), gap junction protein alpha 1 (GJA1), octamer-binding transcription factor 4 [OCT4], insulin-like growth factors 1 and 2 receptors (IGF1R, IGF2R), beta-actin (ACTB)] in pools of days 4-5 morulae by semi-quantitative RT-PCR assay. Percentages of cleaved embryos were similar (p > 0.05) between both culture systems, regardless of the location. OCT4 mRNA abundance was higher (p culture system compared with those from the IZW system when epididymal sperm was used for IVF. No clear correlation between the expression pattern and the culture system could be found for all other genes. It is suggested that OCT4 expression might be affected by the media composition in some conditions and can be the indicator of a better embryo quality. © 2012 Blackwell Verlag GmbH.

  8. Identifying food-related life style segments by a cross-culturally valid scaling device

    DEFF Research Database (Denmark)

    Brunsø, Karen; Grunert, Klaus G.

    1994-01-01

    -related life style in a cross-culturally valid way. To this end, we have col-lected a pool of 202 items, collected data in three countries, and have con-structed scales based on cross-culturally stable patterns. These scales have then been subjected to a number of tests of reliability and vali-dity. We have...... then applied the set of scales to a fourth country, Germany, based on a representative sample of 1000 respondents. The scales had, with a fe exceptions, moderately good reliabilities. A cluster ana-ly-sis led to the identification of 5 segments, which differed on all 23 scales....

  9. Health, supervisory support, and workplace culture in relation to work-family conflict and synergy.

    Science.gov (United States)

    Beutell, Nicholas J

    2010-08-01

    This research examined health, supervisory support, and workplace culture as predictors of work interfering with family, family interfering with work, and work-family synergy. The analysis of data from 2,796 respondents from the 2002 National Study of the Changing Workforce yielded significant relations among measures of mental health, self-rated health, supervisory support, and work-family culture with a focus on career concerns. Support was found for a measure of work-family synergy. Implications and directions for research are discussed.

  10. STUDIES RELATED TO THE PRESENCE AFRICAN IN THE CULTURAL IDENTITY OF BAHIA HONDA

    Directory of Open Access Journals (Sweden)

    Silfredo Rodríguez-Basso

    2016-01-01

    Full Text Available The present article refers to a qualitative analysis of the main reference authors and works related to the studies about the presence of the African legacy in the cultural identity of Bahia Honda based on a continuing historical- cultural conception. This study has a systematized theoretical character and includes methods like the dialectic- materialistic and documental analysis. The results indicated a wide diffusion of information, the variety of disciplinary directions and also a lack of this kind of qualitative evaluation in the previous studies carried out.

  11. Listeria monocytogenes in Fresh Produce: Outbreaks, Prevalence and Contamination Levels

    Directory of Open Access Journals (Sweden)

    Qi Zhu

    2017-03-01

    Full Text Available Listeria monocytogenes, a member of the genus Listeria, is widely distributed in agricultural environments, such as soil, manure and water. This organism is a recognized foodborne pathogenic bacterium that causes many diseases, from mild gastroenteritis to severe blood and/or central nervous system infections, as well as abortion in pregnant women. Generally, processed ready-to-eat and cold-stored meat and dairy products are considered high-risk foods for L. monocytogenes infections that cause human illness (listeriosis. However, recently, several listeriosis outbreaks have been linked to fresh produce contamination around the world. Additionally, many studies have detected L. monocytogenes in fresh produce samples and even in some minimally processed vegetables. Thus L. monocytogenes may contaminate fresh produce if present in the growing environment (soil and water. Prevention of biofilm formation is an important control measure to reduce the prevalence and survival of L. monocytogenes in growing environments and on fresh produce. This article specifically focuses on fresh produce–associated listeriosis outbreaks, prevalence in growing environments, contamination levels of fresh produce, and associated fresh produce safety challenges.

  12. Prebiotic Oligosaccharides Potentiate Host Protective Responses against L. Monocytogenes Infection

    Directory of Open Access Journals (Sweden)

    Poyin Chen

    2017-12-01

    Full Text Available Prebiotic oligosaccharides are used to modulate enteric pathogens and reduce pathogen shedding. The interactions with prebiotics that alter Listeria monocytogenes infection are not yet clearly delineated. L. monocytogenes cellular invasion requires a concerted manipulation of host epithelial cell membrane receptors to initiate internalization and infection often via receptor glycosylation. Bacterial interactions with host glycans are intimately involved in modulating cellular responses through signaling cascades at the membrane and in intracellular compartments. Characterizing the mechanisms underpinning these modulations is essential for predictive use of dietary prebiotics to diminish pathogen association. We demonstrated that human milk oligosaccharide (HMO pretreatment of colonic epithelial cells (Caco-2 led to a 50% decrease in Listeria association, while Biomos pretreatment increased host association by 150%. L. monocytogenes-induced gene expression changes due to oligosaccharide pretreatment revealed global alterations in host signaling pathways that resulted in differential subcellular localization of L. monocytogenes during early infection. Ultimately, HMO pretreatment led to bacterial clearance in Caco-2 cells via induction of the unfolded protein response and eIF2 signaling, while Biomos pretreatment resulted in the induction of host autophagy and L. monocytogenes vacuolar escape earlier in the infection progression. This study demonstrates the capacity of prebiotic oligosaccharides to minimize infection through induction of host-intrinsic protective responses.

  13. Low prevalence of Listeria monocytogenes in cull sows and pork.

    Science.gov (United States)

    Wesley, Irene V; Larsen, Steven; Hurd, H Scott; McKean, James D; Griffith, Ronald; Rivera, Fernando; Nannapaneni, Ramakrishna; Cox, Mandy; Johnson, Michael; Wagner, Dean; de Martino, Mary

    2008-03-01

    The goal of this study was to determine the prevalence of Listeria monocytogenes in sows slaughtered at a single Midwestern plant on two occasions (trial 1, n = 179 sows; trial 2, n = 160 sows). Fecal samples collected antemortem (trial 1) as well as animal tissues, and carcass swabs collected at the abattoir (trials 1 and 2) were analyzed. Eight isolates of L. monocytogenes were recovered from five samples that represented 0.18% of the total samples (n = 2,775). In trial 1, L. monocytogenes was detected in a tonsil sample (0.6%; 1 positive of 181 tonsils), in a carcass (0.6%; 1 positive of 179 carcasses), which was sampled prior to the organic rinse, and in two chopped meat block samples (1.2%; 2 positive of 165 samples). In trial 2, L. monocytogenes was only detected in a single chopped meat block sample (0.15%; 1 positive of 688 total samples). These data indicate the low prevalence of L. monocytogenes in the cull sow.

  14. Commensal microbes provide first line defense against Listeria monocytogenes infection

    Science.gov (United States)

    Littmann, Eric R.; Kim, Sohn G.; Morjaria, Sejal M.; Ling, Lilan; Gyaltshen, Yangtsho; Taur, Ying; Leiner, Ingrid M.

    2017-01-01

    Listeria monocytogenes is a foodborne pathogen that causes septicemia, meningitis and chorioamnionitis and is associated with high mortality. Immunocompetent humans and animals, however, can tolerate high doses of L. monocytogenes without developing systemic disease. The intestinal microbiota provides colonization resistance against many orally acquired pathogens, and antibiotic-mediated depletion of the microbiota reduces host resistance to infection. Here we show that a diverse microbiota markedly reduces Listeria monocytogenes colonization of the gut lumen and prevents systemic dissemination. Antibiotic administration to mice before low dose oral inoculation increases L. monocytogenes growth in the intestine. In immunodeficient or chemotherapy-treated mice, the intestinal microbiota provides nonredundant defense against lethal, disseminated infection. We have assembled a consortium of commensal bacteria belonging to the Clostridiales order, which exerts in vitro antilisterial activity and confers in vivo resistance upon transfer into germ free mice. Thus, we demonstrate a defensive role of the gut microbiota against Listeria monocytogenes infection and identify intestinal commensal species that, by enhancing resistance against this pathogen, represent potential probiotics. PMID:28588016

  15. Deciphering the landscape of host barriers to Listeria monocytogenes infection.

    Science.gov (United States)

    Zhang, Ting; Abel, Sören; Abel Zur Wiesch, Pia; Sasabe, Jumpei; Davis, Brigid M; Higgins, Darren E; Waldor, Matthew K

    2017-06-13

    Listeria monocytogenes is a common food-borne pathogen that can disseminate from the intestine and infect multiple organs. Here, we used sequence tag-based analysis of microbial populations (STAMP) to investigate L monocytogenes population dynamics during infection. We created a genetically barcoded library of murinized L monocytogenes and then used deep sequencing to track the pathogen's dissemination routes and quantify its founding population ( N b ) sizes in different organs. We found that the pathogen disseminates from the gastrointestinal tract to distal sites through multiple independent routes and that N b sizes vary greatly among tissues, indicative of diverse host barriers to infection. Unexpectedly, comparative analyses of sequence tags revealed that fecally excreted organisms are largely derived from the very small number of L. monocytogenes cells that colonize the gallbladder. Immune depletion studies suggest that distinct innate immune cells restrict the pathogen's capacity to establish replicative niches in the spleen and liver. Finally, studies in germ-free mice suggest that the microbiota plays a critical role in the development of the splenic, but not the hepatic, barriers that prevent L. monocytogenes from seeding these organs. Collectively, these observations illustrate the potency of the STAMP approach to decipher the impact of host factors on population dynamics of pathogens during infection.

  16. Influence of flow direction and flow rate on the initial adhesion of seven Listeria monocytogenes strains to fine polished stainless steel

    DEFF Research Database (Denmark)

    Skovager, Anne; Whitehead, Kathryn; Siegumfeldt, Henrik

    2012-01-01

    The effects of flow direction and shear stress on the adhesion of different strains of Listeria monocytogenes to fine polished stainless steel under liquid flow conditions were investigated. Furthermore, the relationship between cell surface properties and cell size and the initial adhesion rate...... (IAR) was studied. A method, including fluorescence microscopy and a flow perfusion system, was developed and used to examine the real-time initial cell adhesion of different L. monocytogenes species in situ to opaque surfaces under flow conditions. The results demonstrated that shear stress...... was the determining factor for the initial adhesion of L. monocytogenes under flow conditions. The flow direction in relation to the orientation of surface features (the scratches) could be disregarded. IARs were dependent on the shear stress and strain type. The strain EGDe, which had the lowest IAR, had the largest...

  17. Evaluation of bacteriocin-producing Lactobacillus sakei 1 against Listeria monocytogenes 1/2a growth and haemolytic activity Avaliação de Lactobacillus sakei 1 produtor de bacteriocina frente a Listeria monocytogenes 1/2a e sua atividade hemolítica

    Directory of Open Access Journals (Sweden)

    Rafael C.R. Martinez

    2005-03-01

    Full Text Available Bacteriocin-producing Lactobacillus sakei 1 was cultivated in Brain-Heart Infusion broth (24 h at 25ºC. The culture supernatant was neutralized, filter sterilized and used to test the activity of bacteriocin against Listeria monocytogenes 1/2a, at 8ºC and 15ºC. Non-bacteriocinogenic Lactobacillus sakei ATCC 15521 was used as a negative control. L. monocytogenes 1/2a was inoculated in culture supernatant medium from L. sakei 1 and L. sakei ATCC 15521 and the listerial populations were determined after 0, 5 and 10 days. The bacteriocin production was quantified as arbitrary units per mL (AU/mL using agar antagonism test. Additionally, to investigate if L. monocytogenes virulence pattern could be changed after bactericion exposure, the ability of L. monocytogenes to cause haemolysis in sheep red blood cells was determined, before and after exposure to bacteriocin at 8ºC. In the presence of the antimicrobial peptide, at 8ºC, L. monocytogenes population decreased, but growth of resistant cells was observed. At 15ºC, there was no difference between test and control. Furthermore, the haemolytic activity of L. monocytogenes 1/2a was not altered by exposure to L. sakei 1 bacteriocin, which suggests no change in its virulence pattern.Lactobacillus sakei 1 produtor de bacteriocina foi cultivado em caldo Infusão Cérebro-Coração por 24h a 25ºC. O sobrenadante da cultura foi neutralizado, esterilizado por filtração e usado para testar a atividade da bacteriocina frente a Listeria monocytogenes 1/2a, a 8ºC e 15ºC. Lactobacillus sakei ATCC 15521 não bacteriocinogênico, foi utilizado como controle negativo. L. monocytogenes 1/2a foi inoculada no sobrenadante da cultura de L.sakei 1 e L. sakei ATCC 15521 e as populações listeriais foram determinadas após 0, 5 e 10 dias. A produção de bacteriocina foi quantificada como unidades arbitrárias por mL (UA/mL, utilizando-se o teste de antagonismo em ágar. Adicionalmente, para investigar se o padr

  18. [The current problems and cross-cultural perspectives of patient-doctor relation: an overview].

    Science.gov (United States)

    Koch, Eckhardt; Turgut, Tolga

    2004-01-01

    The success of the treatment in medicine, especially in psychiatry is based on the form and the strength of the patient-doctor relation. This complex and dynamic relation is changing in accordance with the social and technological development of the society. The context of the patient-doctor relation is determined by the present day culture as well as the traditional background. An overview of current patient-doctor relation and of problems that physicians and in particular psychiatrists meet is presented. Physicians have responsibilities in building patient-doctor relation. The ethical and legal aspects of these responsibilities are presented. The former paternalistic type of patient-doctor relation is evolving into a more equal and democratic relation. New problems are being encountered continuously in the changing process. Beside the of the process itself, the effects of progress in medical technology and communication systems on patient-doctor relation and the pressure, put from the insurance companies and/or authorities on physicians, which impair the trust between the physician and his patient, are making the process more difficult. The issues of compliance, sexual harassment and unique problems of patient-doctor relations in psychiatry are the other subtopics in the article. The cross-cultural aspects of patient-doctor relations and encountered clinical problems are discussed with case examples particularly about Turkish immigrants, who live in Germany. Suggestions for psychiatrists in Germany to work out the challenges facing them are presented in the conclusion.

  19. Optimization of a Real Time PCR based method for the detection of Listeria monocytogenes in pork meat.

    Science.gov (United States)

    Gattuso, Antonietta; Gianfranceschi, Monica Virginia; Sonnessa, Michele; Delibato, Elisabetta; Marchesan, Massimo; Hernandez, Marta; De Medici, Dario; Rodriguez-Lazaro, David

    2014-08-01

    The aim of this study was to optimize a Real-Time PCR protocol for a rapid detection of Listeria monocytogenes in pork meat, using reduced volumes of primary selective enrichment broth and times of incubation to decrease the cost and time for analysis. Forty-five samples of pork meat were artificially contaminated with two different levels of L. monocytogenes (1-10 CFU per sample and 10-100 CFU per sample), homogenized in three different volumes of Half Fraser Broth (1:3; 1:5 and 1:10) and incubated at 30°C ± 1°C for 5h, 8h and 24h. The detection was conducted in parallel by Real-Time PCR and the ISO standard 11290-1 methods. L. monocytogenes was detected in all the samples after 24h by Real-Time PCR method, also using reduced volumes of Half Fraser Broth. This represents a clear advantage as the time to final detection and the inherent costs were significantly reduced compared to the ISO reference method. All samples artificially contaminated were correctly detected also after 8 of incubation at 30°C ± 1°C in Half Fraser Broth and 24h in Fraser Broth at 37°C ± 1°C using cultural method. Copyright © 2014 Elsevier B.V. All rights reserved.

  20. Isolation of a bacteriocin-producing Lactococcus lactis subsp. lactis and application to control Listeria monocytogenes in Moroccan jben.

    Science.gov (United States)

    Benkerroum, N; Oubel, H; Zahar, M; Dlia, S; Filali-Maltouf, A

    2000-12-01

    Use of a bacteriocin-producing lactococcal strain to control Listeria monocytogenes in jben. A Lactococcus lactis strain isolated from lben was shown, by the spot technique, to produce a bacteriocin different from nisin. Inhibitory activity of the bacteriocin-producing strain against Listeria monocytogenes was investigated in jben, made from cow's milk fermented with the producer organism and contaminated with 104 or 107 cfu ml-1. Listeria counts were monitored during manufacture, and during conservation at room and at refrigeration temperatures. Results showed that the pathogen was reduced by 2.7 logarithmic units after 30 h of jben processing when the initial inoculum of 107 cfu ml(-1) was used. For the initial inoculum of 104 cfu ml(-1), the bacterium was completely eliminated at 24 h. Furthermore, the use of the bacteriocin-producing starter culture extended the shelf-life of jben by 5 days. In situ production of the lactococcal bacteriocin is an efficient biological means of controlling L. monocytogenes in jben and of allowing shelf-life extension. The proposed technology will essentially benefit minimally processed dairy products and those made with raw milk.

  1. Relations, interactions and networks of cultural tourism stakeholders in rural areas of Vojvodina

    Directory of Open Access Journals (Sweden)

    Pavlović Nataša

    2015-01-01

    Full Text Available Contemporary trends, which are characterized by a very strong level of competition and the maturity of the market, become more than ever essential for success of tourist destinations. Rural areas in Vojvodina, because of its authentic atmosphere and multiculturalism, have significant advantages for cultural tourism. Each participant who creates a tourism product in toda y's competitive environment aims to have a strong focus on customer satisfaction, which indicates the necessity of adopting the concept of total relationship marketing. The aim of this paper is to show how cultural institutions, souvenir craftsmen, tourism organizations, travel agencies and other stakeholders achieve cooperation and apply modern concept of total relationship marketing for the purposes of satisfying the needs of tourists. The paper will explore the fundamental postulates of relationship marketing applied by key stakeholders of cultural tourism in rural areas, and will get reference results on relations, interactions and networks.

  2. European food cultures: An exploratory analysis of food related preferences and behaviour in European regions

    DEFF Research Database (Denmark)

    Askegaard, Søren; Madsen, Tage Koed

    and its potential expansion, the relative importance of national boundaries must be expected to diminish whereas other boundaries will become more apparent. One type of boundaries of vital impo to international marketing is the cultural boundaries dividing Europe into regions with individual cultural...... to the point where some people ta about a 'world cuisine'. However, local, national, and regional differences continue to play a decisive role in the way elements, products, and ingredients are combined, and when, how, with what, and with whom they are eaten. 4. This paper explores information about...... such cultural patterns of food consumption based on information from an exisiting database originating from a 1989 pan-European lifestyle survey questioning around 20.000 people in 16 European countries divided into 79 regions. 5. A factor analysis reduced the number of variables from 138 to 41, discovering...

  3. Oral health-related cultural beliefs for four racial/ethnic groups: Assessment of the literature.

    Science.gov (United States)

    Butani, Yogita; Weintraub, Jane A; Barker, Judith C

    2008-09-15

    The purpose of this study was to assess information available in the dental literature on oral health-related cultural beliefs. In the US, as elsewhere, many racial/ethnic minority groups shoulder a disproportionate burden of oral disease. Cultural beliefs, values and practices are often implicated as causes of oral health disparities, yet little is known about the breadth or adequacy of literature about cultural issues that could support these assertions. Hence, this rigorous assessment was conducted of work published in English on cultural beliefs and values in relation to oral health status and dental practice. Four racial/ethnic groups in the US (African-American, Chinese, Filipino and Hispanic/Latino) were chosen as exemplar populations. The dental literature published in English for the period 1980-2006 noted in the electronic database PUBMED was searched, using keywords and MeSH headings in different combinations for each racial/ethnic group to identify eligible articles. To be eligible the title and abstract when available had to describe the oral health-related cultural knowledge or orientation of the populations studied. Overall, the majority of the literature on racial/ethnic groups was epidemiologic in nature, mainly demonstrating disparities in oral health rather than the oral beliefs or practices of these groups. A total of 60 relevant articles were found: 16 for African-American, 30 for Chinese, 2 for Filipino and 12 for Hispanic/Latino populations. Data on beliefs and practices from these studies has been abstracted, compiled and assessed. Few research-based studies were located. Articles lacked adequate identification of groups studied, used limited methods and had poor conceptual base. The scant information available from the published dental and medical literature provides at best a rudimentary framework of oral health related ideas and beliefs for specific populations.

  4. Oral health-related cultural beliefs for four racial/ethnic groups: Assessment of the literature

    Directory of Open Access Journals (Sweden)

    Barker Judith C

    2008-09-01

    Full Text Available Abstract Background The purpose of this study was to assess information available in the dental literature on oral health-related cultural beliefs. In the US, as elsewhere, many racial/ethnic minority groups shoulder a disproportionate burden of oral disease. Cultural beliefs, values and practices are often implicated as causes of oral health disparities, yet little is known about the breadth or adequacy of literature about cultural issues that could support these assertions. Hence, this rigorous assessment was conducted of work published in English on cultural beliefs and values in relation to oral health status and dental practice. Four racial/ethnic groups in the US (African-American, Chinese, Filipino and Hispanic/Latino were chosen as exemplar populations. Methods The dental literature published in English for the period 1980–2006 noted in the electronic database PUBMED was searched, using keywords and MeSH headings in different combinations for each racial/ethnic group to identify eligible articles. To be eligible the title and abstract when available had to describe the oral health-related cultural knowledge or orientation of the populations studied. Results Overall, the majority of the literature on racial/ethnic groups was epidemiologic in nature, mainly demonstrating disparities in oral health rather than the oral beliefs or practices of these groups. A total of 60 relevant articles were found: 16 for African-American, 30 for Chinese, 2 for Filipino and 12 for Hispanic/Latino populations. Data on beliefs and practices from these studies has been abstracted, compiled and assessed. Few research-based studies were located. Articles lacked adequate identification of groups studied, used limited methods and had poor conceptual base. Conclusion The scant information available from the published dental and medical literature provides at best a rudimentary framework of oral health related ideas and beliefs for specific populations.

  5. cultural

    Directory of Open Access Journals (Sweden)

    Irene Kreutz

    2006-01-01

    Full Text Available Es un estudio cualitativo que adoptó como referencial teorico-motodológico la antropología y la etnografía. Presenta las experiencias vivenciadas por mujeres de una comunidad en el proceso salud-enfermedad, con el objetivo de comprender los determinantes sócio-culturales e históricos de las prácticas de prevención y tratamiento adoptados por el grupo cultural por medio de la entrevista semi-estructurada. Los temas que emergieron fueron: la relación entre la alimentación y lo proceso salud-enfermedad, las relaciones con el sistema de salud oficial y el proceso salud-enfermedad y lo sobrenatural. Los dados revelaron que los moradores de la comunidad investigada tienen un modo particular de explicar sus procedimientos terapéuticos. Consideramos que es papel de los profesionales de la salud en sus prácticas, la adopción de abordajes o enfoques que consideren al individuo en su dimensión sócio-cultural e histórica, considerando la enorme diversidad cultural en nuestro país.

  6. Parental influences on weight-related health behaviors in western and eastern cultures.

    Science.gov (United States)

    Niemeier, B S; Duan, Y P; Shang, B R; Yang, J

    2017-03-01

    Excessive bodyweight contributes to a myriad of risk factors for chronic diseases, and multiple reports have demonstrated that parents influence the development of their children's behaviors that contribute to bodyweight. However, studies that include considerations for cultural influences are limited, and methodology that considers direct reports from young adults and their parents across cultures does not exist. A sample of young adults (N = 327) and their parents in the U.S. and in China were recruited and completed a series of questionnaires in two cycles (2010 and 2014). With correlation and multiple regression analyses, parents' characteristics, behaviors, and parental authority styles were examined and compared to weight-related health behaviors and bodyweight of their young-adult children. Additionally, similarities and differences of parental influences between the two cultures were explored. Parents' body mass indexes (BMIs) and dietary behaviors were positively associated with those of their young adult children in the mixed-culture sample (P permissive parental authority, the relationships between young adults' and their parents' BMIs were negative for U.S. participants and positive for Chinese participants (P parenting, the relationship between young adults' and their parents' dietary consumption behaviors was negative for U.S. participants and positive for Chinese participants (P development of life-long health behaviors that contribute to BMI are significantly influenced by parents' behaviors and parenting styles. Moreover, an interaction of parental characteristics and cultural norms is indicated. © 2017 John Wiley & Sons Ltd.

  7. Institutional comunication and cultural marketing: Peculiarities in museum communication within the framework of public relations

    Directory of Open Access Journals (Sweden)

    Camelia BURGHELE

    2011-01-01

    Full Text Available Cultural management theoreticians believe that the main target of museum communication is gaining knowledge on specific messages by as large a number of people as possible. Museum public relation practice – intensified and upgraded at the same time with the revolution of the new communication technologies – is both science and art which analyse certain tendences (in attitude, taste and informal of anticipating their consequences for implementing certain museum offer programs to appeal to the public.As an institution with a decisive role in guarding cultural heritage and in outlining cultural identity – as it keeps the necessary instruments for this, the specialists and also the motivation through its own purposes – the museum in its dynamic, modern, enhanced shape must provide an attractive cultural product to the public, based on a anthropological approach to cultural fact.Modern museum-ology is built upon the concept that museum is a story and modern museums stimulate to a high degree participative learning, generated by a productive dialogue.

  8. Relational mobility explains between- and within-culture differences in self-disclosure to close friends.

    Science.gov (United States)

    Schug, Joanna; Yuki, Masaki; Maddux, William

    2010-10-01

    In the current research, we tested a novel explanation for previously demonstrated findings that East Asians disclose less personal information to other people than do Westerners. We propose that both between- and within-culture differences in self-disclosure to close friends may be explained by the construct of relational mobility, the general degree to which individuals in a society have opportunities to form new relationships and terminate old ones. In Study 1, we found that cross-cultural differences (Japan vs. United States) in self-disclosure to a close friend were mediated by individuals' perceptions of relational mobility. In Study 2, two separate measures of relational mobility predicted self-disclosure within a single culture (Japan), and this relationship was mediated by the motivation to engage in self-disclosure to strengthen personal relationships. We conclude that societies and social contexts higher in relational mobility (in which relationships can be formed and dissolved relatively easily) produce stronger incentives for self-disclosure as a social-commitment device.

  9. Culture-related differences in default network activity during visuo-spatial judgments.

    Science.gov (United States)

    Goh, Joshua O S; Hebrank, Andrew C; Sutton, Bradley P; Chee, Michael W L; Sim, Sam K Y; Park, Denise C

    2013-02-01

    Studies on culture-related differences in cognition have shown that Westerners attend more to object-related information, whereas East Asians attend more to contextual information. Neural correlates of these different culture-related visual processing styles have been reported in the ventral-visual and fronto-parietal regions. We conducted an fMRI study of East Asians and Westerners on a visuospatial judgment task that involved relative, contextual judgments, which are typically more challenging for Westerners. Participants judged the relative distances between a dot and a line in visual stimuli during task blocks and alternated finger presses during control blocks. Behaviorally, East Asians responded faster than Westerners, reflecting greater ease of the task for East Asians. In response to the greater task difficulty, Westerners showed greater neural engagement compared to East Asians in frontal, parietal, and occipital areas. Moreover, Westerners also showed greater suppression of the default network-a brain network that is suppressed under condition of high cognitive challenge. This study demonstrates for the first time that cultural differences in visual attention during a cognitive task are manifested both by differences in activation in fronto-parietal regions as well as suppression in default regions.

  10. Development of multiple cross displacement amplification label-based gold nanoparticles lateral flow biosensor for detection of Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Wang Y

    2017-01-01

    Full Text Available Yi Wang,1 Hui Li,1,2 Yan Wang,1 Hua Li,1 Lijuan Luo,1 Jianguo Xu,1 Changyun Ye1 1State Key Laboratory of Infectious Disease Prevention and Control, National Institute for Communicable Disease Control and Prevention, Collaborative Innovation Center for Diagnosis and Treatment of Infectious Diseases, Chinese Center for Disease Control and Prevention, Changping, Beijing, 2Department of Microbiology, GuiZhou Medical University, Guiyang, Guizhou, People’s Republic of China Abstract: Listeria monocytogenes, one of most problematic foodborne pathogens, is responsible for listeriosis in both humans and animals and mainly transmitted through the food chain. In this report, we propose a simple, rapid, and nearly instrument-free molecular technique using multiple cross displacement amplification (MCDA label-based gold nanoparticles lateral flow biosensor (LFB for specific, sensitive, and visual detection of L. monocytogenes. The MCDA-LFB method was carried out at a constant temperature (61°C for only 20 min during the reaction stage, and then the amplification mixtures were directly detected by using LFB, eliminating the use of an electrophoresis instrument, special reagents, or amplicon analysis equipment. The whole procedure, from sample processing to result indicating, was finished within 1 h. The analytical specificity of MCDA-LFB method was successfully determined by distinguishing the target bacterium from other pathogens. The analytical sensitivity of the MCDA-LFB assay was 10 fg of genomic templates per reaction in pure culture, which was in complete accordance with MCDA by gel electrophoresis, real-time turbidity, and colorimetric indicator. The assay was also successfully applied to detecting L. monocytogenes in pork samples. Therefore, the rapidity, simplicity, and nearly equipment-free platform of the MCDA-LFB technique make it possible for food control, clinical diagnosis, and more. The proof-of-concept assay can be reconfigured to detect

  11. Controlling Listeria monocytogenes and Leuconostoc mesenteroides in Uncured Deli-style Turkey Breast Using a Clean Label Antimicrobial.

    Science.gov (United States)

    Weyker, Robert E; Glass, Kathleen A; Milkowski, Andrew L; Seman, Dennis L; Sindelar, Jeffrey J

    2016-03-01

    Interest in natural/organic meat products has resulted in the need to validate the effectiveness of clean label antimicrobials to increase safety and shelf life of these products. A Response Surface Methodology (RSM) was used to investigate the effects of varying levels of moisture, pH, and a commercial "clean-label" antimicrobial (cultured sugar-vinegar blend; CSVB) on the growth rate of Listeria monocytogenes and Leuconostoc mesenteroides in uncured turkey stored at 4 °C for 16 wk. Twenty treatment combinations of moisture (60% to 80%), pH (5.8 to 6.4), and CSVB (2.5% to 5.0%) were evaluated during phase I to develop growth curves for both microbe types, whereas the interactive effects of pH (5.8 to 6.4) and CSVB (0.0 to 4.75) were tested in 16 treatment combinations during Phase II at a single moisture level using L. monocytogenes only. CSVB inhibited L. monocytogenes growth in 14 of the 20 treatments tested in Phase I and in 12 of the 16 treatments in Phase II through 16 and 8 wk, respectively. In contrast, CSVB had little effect on L. mesenteroides, with growth inhibited in only 4 of 20 treatments in Phase I and was therefore not tested further in Phase II. Significant interactions of the RSM design coefficients yielded a predictive model for L. mesenteroides growth rate, but due to lack of growth, no growth rate model was developed for L. monocytogenes. CSVB was found to be an effective antilisteral antimicrobial, while having little effect on a spoilage microorganism. © 2016 Institute of Food Technologists®

  12. A cross-cultural comparison of the coexistence and domain superiority of individuating and relating autonomy.

    Science.gov (United States)

    Yeh, Kuang-Hui; Bedford, Olwen; Yang, Yung-Jui

    2009-06-01

    The consensus definition of autonomy in the psychological literature emphasizes self-governance through free volition, not separation or independence from others. Since the concept of self may differ cross-culturally, several researchers have tried to incorporate types of self into the notion of autonomy; however, only the dual model of autonomy has been able to do this while retaining an emphasis on volition. The dual model describes two distinct forms of autonomy-individuating and relating-each with superior function in a specific domain of individual functioning. Individuating autonomy represents a volitional capacity to act against social constraints and offers a route to achieve an independent self-identity by expressing individualistic attributes and distinctions. Relating autonomy represents a volitional capacity to act by emphasizing the harmony of self-in-relation-to-others, the quality of interpersonal relationships, and self-transcendence. These two forms of autonomy have been shown to coexist at the individual level in a Taiwanese sample. This study takes the next step, with a cross-cultural test of the coexistence and domain superiority hypotheses of individuating and relating autonomy. Participants included 306 college students from Taiwan and 183 college students from the United States. Structural equation modelling by multigroup analyses confirmed the cross-cultural equivalence of the two-factor individuating autonomy and relating autonomy measurement model. Across both samples the two forms of autonomy were shown to be mutually inclusive and not exclusive or independent. The domain-superior function of each form of autonomy was also confirmed cross-culturally; each form of autonomy has a dominant, but not necessarily exclusive, domain of functioning. Specifically, individuating autonomy was more associated with intrapersonal than interpersonal domain dependent variables, while relating autonomy was more associated with interpersonal than

  13. Listeria monocytogenes: Overview and Targeting Advances

    Directory of Open Access Journals (Sweden)

    Mostafa F.N. Abushahba

    2016-04-01

    Full Text Available Listeria monocytogenes is a serious foodborne zoonotic pathogen capable of causing gastroenteritis and severe systemic infections such as septicemia, meningitis or abortion in the infected individuals what is called listeriosis. The bacterium is reported as the third leading cause of death among the foodborne pathogens preceded by nontyphoidal Salmonella spp. and Toxoplasma gondii. The power to tolerate a wide range of temperatures is considered the most prominent trait distinguishing it from the other foodborne pathogens. Within the infected host, the bacteria harbor inside macrophages and jump from cell to another without leaving the safeguarding milieu of the host's cells utilizing a set of genes including hly (listeriolysin O, plcA (phosphatidylinositol-specific phospholipase c, plcB (phosphatidylcholine-phospholipase C and actA (actin-assembly inducing protein. In addition to the health concerns associated with antibiotics, treatment failure likely occurs among listeriosis-infected persons especially with the inability of most antibiotics to access intracellular replicative niches and achieve the optimum therapeutic concentrations within the infected cells. Recently, one novel choice, peptide nucleic acid (PNA, has been emerged to target this bacterium as a model of targeting intracellular pathogens with anti-sense agents. PNA is a one of the DNA analogues which works via specific inhibition of bacterial gene expression.

  14. Prevalence and antimicrobial susceptibility of Listeria monocytogenes on chicken carcasses in Bandung, Indonesia.

    Science.gov (United States)

    Sugiri, Yoni Darmawan; Gölz, Greta; Meeyam, Tongkorn; Baumann, Maximilian P O; Kleer, Josef; Chaisowwong, Warangkhana; Alter, Thomas

    2014-08-01

    This study was conducted to determine the prevalence and quantify the number of Listeria monocytogenes in fresh chicken carcasses sold in traditional markets and supermarkets in Bandung, West Java, Indonesia, and to determine the antimicrobial resistance patterns of the isolated L. monocytogenes strains. The overall prevalence of L. monocytogenes in chicken carcasses was 15.8% (29/184). When comparing samples from traditional markets and supermarkets, no significant difference in the L. monocytogenes prevalence was detectable (15.2 versus 16.3%). Of the samples, 97.3% had L. monocytogenes counts study were grouped into the molecular serogroup IIb, comprising the serovars 1/2b, 3b, and 7.

  15. Behaviour of Listeria monocytogenes in artisanal raw milk Pecorino Umbro cheese: a microbiological challenge test

    Directory of Open Access Journals (Sweden)

    Roberta Ortenzi

    2015-09-01

    Full Text Available In the present study, a microbiological challenge test in artificially contaminated raw milk Pecorino Umbro cheese during cheese-making was carried out. Raw ewe milk was contaminated by a suspension of particular Listeria monocytogenes strains. The number of L. monocytogenes and L. monocytogenes dynamic growth were evaluated during cheese-making and storage. A significant decrease of the viable count of L. monocytogenes was observed during ripening and L. monocytogenes viable count was below the limit of quantification during storage. The results show that the product is unable to support the growth of the pathogen.

  16. Early trigeminal nerve involvement in Listeria monocytogenes rhombencephalitis

    DEFF Research Database (Denmark)

    Karlsson, William K; Harboe, Zitta Barrella; Roed, Casper

    2017-01-01

    dysfunction on that side. In addition, we identified another 120 cases of Listeria rhombencephalitis following a systematic review. Cranial nerves VII, V, IX, and X, respectively, medulla oblongata, cerebellum and pons, were the most frequently involved brain structures. The present clinical and radiological...... findings corroborate earlier data from animal experiments, indicating that L. monocytogenes may be capable of retrograde intra-axonal migration along the cranial nerves. We suggest that in a subset of patients with rhombencephalitis L. monocytogenes enters the cerebellopontine angle through the trigeminal......Listeria monocytogenes is associated with rhombencephalitis. However, the exact mechanisms of brainstem invasion remains poorly understood. Here, we demonstrate clinical and radiological data suggesting that Listeria may invade the brainstem via the trigeminal nerve. Three females (41, 64 and 70...

  17. COMPARISON OF TWO METHODS FOR THE DETECTION OF LISTERIA MONOCYTOGENES

    Directory of Open Access Journals (Sweden)

    G. Tantillo

    2013-02-01

    Full Text Available The aim of this study was to compare the performance of the conventional methods for detection of Listeria monocytogenes in food using media Oxford and ALOA (Agar Listeria acc. to Ottaviani & Agosti in according to the ISO 11290-1 to a new chromogenic medium “CHROMagar Listeria” standardized in 2005 AFNOR ( CHR – 21/1-12/01. A total of 40 pre-packed ready-to-eat food samples were examined. Using two methods six samples were found positive for Listeria monocytogenes but the medium “CHROMagar Listeria” was more selective in comparison with the others. In conclusion this study has demonstrated that isolation medium able to target specifically the detection of L. monocytogenes such as “CHROMagar Listeria” is highly recommendable because of that detection time is significantly reduced and the analysis cost is less expensive.

  18. [Analysis of antibiotic susceptibility of foodborne Listeria monocytogenes in China].

    Science.gov (United States)

    Yang, Yang; Fu, Ping; Guo, Yunchang; Liu, Xiurmei

    2008-03-01

    To study the antibiotic susceptibility of foodborne Listeria monocytogenes in China. The susceptibilities of 476 strains of foodborne Listeria monocytogenes to antibiotics were determined in Broth Microdilution Susceptibility Testing in Clinical and Laboratory Standards Institute. The antibiotics of gentamicin, ampicillin, penicillin, tetracycline, doxycycline, imipenem, erythromycin, ciprofloxacin, levofloxacin, cephalothin, rifampin, vancomycin, chloramphenicol, Trimethoprim-sulfamethoxazole, ampicillin-sulbactam were used. The rates of antibiotic resistance in 467 is olates were 4.5%. Tetracycline resistance was most prevalent, accouting for 4.07% . The foods that the rates of antibiotic resistance were highest were vegetable (10%). Among 14 provinces, Jilin, Hubei and Hebei were the third top, the rate of which were 19.6% and 9.1% and 8%, respectively. It was suggested that antibiotic resistance exists in foodborne Listeria monocytogenes to a certain extent in China. It should pay more attention to the use of drugs in prevention and clinic treatment to reduce the antibiotic resistant strains.

  19. Inactivation of Listeria monocytogenes in milk by pulsed electric field.

    Science.gov (United States)

    Reina, L D; Jin, Z T; Zhang, Q H; Yousef, A E

    1998-09-01

    Pasteurized whole, 2%, and skim milk were inoculated with Listeria monocytogenes Scott A and treated with high-voltage pulsed electric field (PEF). The effects of milk composition (fat content) and PEF parameters (electric field strength, treatment time, and treatment temperature) on the inactivation of the bacterium were studied. No significant differences were observed in the inactivation of L. monocytogenes Scott A in three types of milk by PEF treatment. With treatment at 25 degrees C, 1- to 3-log reductions of L. monocytogenes were observed. PEF lethal effect was a function of field strength and treatment time. Higher field strength or longer treatment time resulted in a greater reduction of viable cells. A 4-log reduction of the bacterium was obtained by increasing the treatment temperature to 50 degrees C. Results indicate that the use of a high-voltage PEF is a promising technology for inactivation of foodborne pathogens.

  20. Listeria spp., y L. monocytogenes EN LECHE CRUDA DE CABRA

    Directory of Open Access Journals (Sweden)

    Yolanda Albarracín C

    2008-08-01

    Full Text Available Objective. To test non-pasteurized goat’s milk from the village of ‘la Garita’, Northern Santander, for Listeria monocytogenes. Material and methods. 90 samples of non-pasteurized goat’s milk were obtained over a 4 month period; pH and temperature of each sample were measured. The INVIMA technique was used to isolate L. monocytogenes; the species was confirmed by PCR. Results. The study showed that eight goat milk providers of the zone neither had refrigeration nor pasteurized the milk. The prevalence of L. monocytogenes was 3%; 15% of the samples had other species of Listeria. The milk obtained from this zone contained the pathogen that may cause listeriosis in children less than 5 years of age, pregnant women, adults and immunologically compromised patients. Conclusions. This study shows the occurrence of this pathogen in goat’s milk and identified areas of risk for those people who drink goat’s milk.

  1. Review of Prosthetic Joint Infection from Listeria monocytogenes.

    Science.gov (United States)

    Bader, Gilbert; Al-Tarawneh, Mohammed; Myers, James

    2016-12-01

    Prosthetic joint infection from Listeria monocytogenes is rare. We decided to shed light on this illness and review the reported cases to better understand its characteristics. We conducted a comprehensive review of the English literature using PubMed. We also included one case that we had managed. We found 25 cases of prosthetic joint infection from L. monocytogenes reported individually and a retrospective study of 43 cases of joint and bone listerial infection, including 34 with prosthetic joint infection, conducted in France. We have described their clinical and para-clinical features and tried to elaborate on the pathophysiology, treatment, and prevention. Prosthetic joint infection from L. monocytogenes is mainly late. Systemic inflammation may be absent. Although rare, it must be suspected in patients at high risk for both prosthetic joint and listerial infections. In addition, those patients must be instructed on appropriate preventive measures.

  2. Listeria monocytogenes response regulators important for stress tolerance and pathogenesis

    DEFF Research Database (Denmark)

    Kallipolitis, B H; Ingmer, H

    2001-01-01

    Environmental sensing by two-component signal transduction systems is likely to play a role for growth and survival of Listeria monocytogenes both during transmission in food products and within a host organism. Two-component systems typically consist of a membrane-associated sensor histidine...... kinase and a gene regulatory protein, the response regulator (RR). We have identified seven putative RR genes in L. monocytogenes LO28 by PCR using degenerate oligonucleotide primers. By insertional inactivation we obtained data suggesting that three of the putative RRs contribute to the pathogenicity...... of L. monocytogenes in mice. Strikingly, the mutants that were attenuated in virulence also had a decreased ability to grow in the presence of various stress conditions potentially encountered in an infection process. Thus, our data point to a connection between the ability of the putative two...

  3. Animal models for oral transmission of Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Sarah E F D'Orazio

    2014-02-01

    Full Text Available Listeria monocytogenes has been recognized as a food borne pathogen in humans since the 1980s, but we still understand very little about oral transmission of L. monocytogenes or the host factors that determine susceptibility to gastrointestinal infection, due to the lack of an appropriate small animal model of oral listeriosis. Early feeding trials suggested that many animals were highly resistant to oral infection, and the more reproducible intravenous or intraperitoneal routes of inoculation soon came to be favored. There are a fair number of previously published studies using an oral infection route, but the work varies widely in terms of bacterial strain choice, the methods used for oral transmission, and various manipulations used to enhance infectivity. This mini review will summarize the published literature using oral routes of L. monocytogenes infection and will highlight recent technological advances that have made oral infection a more attractive model system.

  4. INFLUENCE OF GENDER RELATIONS ON THE CULTURE OF THE WORKERS AT THE COMPANY

    Directory of Open Access Journals (Sweden)

    Vladimir Yurevich Pripoten

    2015-11-01

    Full Text Available This article is devoted to a discover of gender relations of main managers of industrial companies and their subordinate groups. We have used a technique that is based on the effective head of the list as the «Сycle of control skills», that are identified to the major gender differences in management, based on the check of the possibility of a business and personal qualities of leaders, as we take to a consider the influence of gender on the culture of main control managers.Purpose. To study the influence of main relations on the culture of the workers, check and research a way for the companies to develop.Method and methodology of work. Expert survey, the use of methods of Clark L. Wilson «Сycle management skills», «The level of progress of the organizational culture», V. Snetkova.Results. The basic personal and business qualities of men and women leaders. The influence of gender on the culture of the staff of presented companies.Practical implications. Companies of all possible kinds and their specialization.

  5. Relative biological effectiveness (RBE) of alpha radiation in cultured porcine aortic endothelial cells.

    Science.gov (United States)

    Thomas, Patricia; Tracy, Bliss; Ping, Tilly; Baweja, Anar; Wickstrom, Mark; Sidhu, Narinder; Hiebert, Linda

    2007-03-01

    Northern peoples can receive elevated radiation doses (1- 10 mSv/y) from transfer of polonium-210 (210Po) through the lichen-caribou-human food chain. Ingested 210Po is primarily blood-borne and thus many of its short range alpha particles irradiate the endothelial cells lining the blood vessels. The relative biological effectiveness (RBE) of alpha particles vs. x-rays was examined in porcine aortic endothelial cells as a surrogate for understanding what might happen to human endothelial cells in northern populations consuming traditional foods. Cultured porcine aortic endothelial cells were exposed to x-ray and 210Po alpha particle radiation. Alpha irradiation was applied to the cell cultures internally via the culture medium and externally, using thin-bottomed culture dishes. The results given here are based on the external irradiation method, which was found to be more reliable. Dose-response curves were compared for four lethal endpoints (cell viability, live cell fraction, release of lactate dehydrogenase [LDH] and clonogenic survival) to determine the relative biological effectiveness (RBE) of alpha radiation. The alpha RBE for porcine cells varied from 1.6-21, depending on the endpoint: 21.2+/-4.5 for cell viability, 12.9+/-2.7 for decrease in live cell number, 5.3+/-0.4 for LDH release to the medium but only 1.6 +/-0.1 for clonogenic survival. The low RBE of 1.6 was due to x-ray hypersensitivity of endothelial cells at low doses.

  6. Enterocin B3A-B3B produced by LAB collected from infant faeces: potential utilization in the food industry for Listeria monocytogenes biofilm management.

    Science.gov (United States)

    Al-Seraih, Alaa; Belguesmia, Yanath; Baah, John; Szunerits, Sabine; Boukherroub, Rabah; Drider, Djamel

    2017-02-01

    Enterococcus faecalis B3A-B3B produces the bacteriocin B3A-B3B with activity against Listeria monocytogenes, Staphylococcus aureus, methicillin-resistant Staphylococcus aureus (MRSA) and Clostridium perfringens, but apparently not against fungi or Gram-negative bacteria, except for Salmonella Newport. B3A-B3B enterocin has two different nucleotides but similar amino acid composition to the class IIb MR10A-MR10B enterocin. B3A-B3B consists of two peptides of predicted molecular mass of 5176.31 Da (B3A) and 5182.21 Da (B3B). Importantly, B3A-B3B impeded biofilm formation of the foodborne pathogen L. monocytogenes 162 grown on stainless steel. The antimicrobial treatment of stainless steel with nisin (1 or 16 mg ml -1 ) decreased the cell numbers by about 2 log CFU ml -1 , thereby impeding the biofilm formation by L. monocytogenes 162 or its nisin-resistant derivative strain L. monocytogenes 162R. Furthermore, the combination of nisin and B3A-B3B enterocin reduced the MIC required to inhibit this pathogen grown in planktonic or biofilm cultures.

  7. Magnetic bead based immuno-detection of Listeria monocytogenes and Listeria ivanovii from infant formula and leafy green vegetables using the Bio-Plex suspension array system.

    Science.gov (United States)

    Day, J B; Basavanna, U

    2015-04-01

    Listeriosis, a disease contracted via the consumption of foods contaminated with pathogenic Listeria species, can produce severe symptoms and high mortality in susceptible people and animals. The development of molecular methods and immuno-based techniques for detection of pathogenic Listeria in foods has been challenging due to the presence of assay inhibiting food components. In this study, we utilize a macrophage cell culture system for the isolation and enrichment of Listeria monocytogenes and Listeria ivanovii from infant formula and leafy green vegetables for subsequent identification using the Luminex xMAP technique. Macrophage monolayers were exposed to infant formula, lettuce and celery contaminated with L. monocytogenes or L. ivanovii. Magnetic microspheres conjugated to Listeria specific antibody were used to capture Listeria from infected macrophages and then analyzed using the Bio-Plex 200 analyzer. As few as 10 CFU/mL or g of L. monocytogenes was detected in all foods tested. The detection limit for L. ivanovii was 10 CFU/mL in infant formula and 100 CFU/g in leafy greens. Microsphere bound Listeria obtained from infected macrophage lysates could also be isolated on selective media for subsequent confirmatory identification. This method presumptively identifies L. monocytogenes and L. ivanovii from infant formula, lettuce and celery in less than 28 h with confirmatory identifications completed in less than 48 h. Published by Elsevier Ltd.

  8. Simultaneous Detection of Escherichia coli O157:H7, Salmonella enteritidis, and Listeria monocytogenes at a Very Low Level Using Simultaneous Enrichment Broth and Multichannel SPR Biosensor.

    Science.gov (United States)

    Zhang, Xiaoguang; Tsuji, Sachiko; Kitaoka, Hayato; Kobayashi, Hiroshi; Tamai, Mitsuru; Honjoh, Ken-Ichi; Miyamoto, Takahisa

    2017-10-01

    Detection of foodborne pathogens at very low levels is still a challenge. A custom-built multichannel surface plasmon resonance (SPR) biosensor and simultaneous enrichment broth (SEB) were used to develop a simultaneous detection method for 3 important foodborne pathogens, Escherichia coli O157:H7 (O157:H7), Salmonella enteritidis, and Listeria monocytogenes, at a very low level. These 3 foodborne pathogens at a very low level (14, 6, and 28 CFU/25 g (mL) for O157:H7, S. enteritidis, and L. monocytogenes, respectively) were inoculated in SEB and incubated at 37 ˚C for 24 h. Sample prepared from the simultaneous enrichment culture was analyzed using the multichannel SPR biosensor and sensor chip immobilized with polyclonal antibodies specific to each of the target pathogens. O157:H7, S. enteritidis, and L. monocytogenes in chicken were detected simultaneously at an inoculum dose of 14, 6, and 28 CFU/25 g, respectively. Our method using a custom-built multichannel SPR biosensor and enrichment in SEB is expected as a rapid and simultaneous detection method for low levels of O157:H7, S. enteritidis, and L. monocytogenes in food. Our method is expected as a rapid and simultaneous detection method for pathogens at very low levels. It has great potential for safety control of food and microbiological detection applications. © 2017 Institute of Food Technologists®.

  9. Oxygen restriction increases the infective potential of Listeria monocytogenes in vitro in Caco-2 cells and in vivo in guinea pigs

    Directory of Open Access Journals (Sweden)

    Licht Tine

    2007-06-01

    Full Text Available Abstract Background Listeria monocytogenes has been implicated in several food borne outbreaks as well as sporadic cases of disease. Increased understanding of the biology of this organism is important in the prevention of food borne listeriosis. The infectivity of Listeria monocytogenes ScottA, cultivated with and without oxygen restriction, was compared in vitro and in vivo. Fluorescent protein labels were applied to allow certain identification of Listeria cells from untagged bacteria in in vivo samples, and to distinguish between cells grown under different conditions in mixed infection experiments. Results Infection of Caco-2 cells revealed that Listeria cultivated under oxygen-restricted conditions were approximately 100 fold more invasive than similar cultures grown without oxygen restriction. This was observed for exponentially growing bacteria, as well as for stationary-phase cultures. Oral dosage of guinea pigs with Listeria resulted in a significantly higher prevalence (p Listeria in fecal samples was observed after dosage with oxygen-restricted bacteria. These differences were seen after challenge with single Listeria cultures, as well as with a mixture of two cultures grown with and without oxygen restriction. Conclusion Our results show for the first time that the environmental conditions to which L. monocytogenes is exposed prior to ingestion are decisive for its in vivo infective potential in the gastrointestinal tract after passage of the gastric barrier. This is highly relevant for safety assessment of this organism in food.

  10. Legal and Ethical Issues Related to the Management of Cultural Heritage in Space

    Science.gov (United States)

    Walsh, Justin

    The recent discovery of water in darkened craters of the Moon's south pole is only the latest development drawing public and corporate interest to the possibilities of research and travel in outer space. Scientists pursuing fusion-generated power as a solution to global energy needs have also noted the relative abundance of Helium-3, an efficient fuel, on the Moon's surface, and there is the promise of other precious resources there as well. The implantation of colonies on the Moon or Mars, discussed for many decades as science fiction, therefore seems increasingly likely to happen. Some private companies and members of the public are even looking forward to the days when tourists will be able to travel for leisure beyond the earth's atmosphere. Most notably, the X Prize Foundation and Google are sponsoring a prize for the first private group to send an unmanned rover to the Moon as a way of advancing these agendas; 22 teams have registered for the competition, with some scheduled to launch by the end of 2010. Increased attention to outer space travel, exploration, and commercial exploitation has been paralleled by a rise in interest in the protection of cultural resources on Earth, such as ar-chaeological sites and historic monuments. Such sites and monuments already exist in outer space and on extraterrestrial planetary bodies. The Apollo 11 landing site, Tranquility Base, is only the most obvious example of a cultural site of outstanding significance in space. Satellites orbiting the earth -even defunct ones such as Vanguard 1, the oldest man-made object still in orbit, might be considered to have extraordinary historic and cultural value, too. As archae-ologists working on Earth have long recognized, once a site or object is damaged, it can never be perfectly restored to its original condition. Unfortunately, there are so far only a few vague guidelines, drafted in the 1960's and agreed upon by the international community, protecting mankind's cultural heritage

  11. The Use of Social Networking Sites in Job Related Activities: A Cross-cultural Comparison

    Directory of Open Access Journals (Sweden)

    Małgorzata Bartosik-Purgat

    2017-06-01

    Full Text Available Objective: The main objective of the paper is to identify the use of Social Networking Sites (SNSs in job related activities and indicate the interdependencies between these activities and age, gender, as well as education in culturally diversified markets (China, Poland, Turkey, the United States. Research Design & Methods: In the exploratory empirical study the authors used two research methods: PAPI (Paper and Pen Personal Interview and CAWI (Computer Assisted Web Interview. The empirical data were collected in 2016 and the total number of respondents from four culturally diversified countries was 1246. Findings: The analysis with the use of Kruskal-Wallis and Dunn post-hoc tests showed that the Turkish respondents most often use SNSs for job related activities, while it is the least often done by the studied Americans. Moreover, from among the studied factors (gender, age and education level that differentiate the SNSs usage for job related activities in a statistically significant way age is of greatest importance. Implications & Recommendations: The results of the research provide implications for the recruitment policy of multinational enterprises (MNEs. Since more and more enterprises use SNSs in order to look for new employees and advertise themselves as employers (employer branding, the identified interdependencies between the SNSs activities and the analysed factors can support firm attempts to develop the proper recruitment policy taking into account the cultural diversity of potential workers. Contribution & Value Added: There are not many studies in the literature which present the usage of SNSs for job related activities from the perspective of individual users in the cross-cultural approach. The majority of studies are related to the usage of SNSs by enterprises in the recruitment process.

  12. Listeria monocytogenes in retailed raw chicken meat in Turkey.

    Science.gov (United States)

    Siriken, Belgin; Ayaz, Naim Deniz; Erol, Irfan

    2014-01-01

    The objectives of this study were, to find the prevalence and antimicrobial resistance of L. monocytogenes from a total of 116 chicken meat samples including 50 carcasses and 66 meat parts marketed in Turkey between 2008 and 2009 using immunomagnetic separation (IMS) based cultivation technique, to detect the hlyA gene for the verification of the isolates by PCR, and to identify the genoserotypes of the L. monocytogenes isolates by multiplex PCR assay. In the study, 51 L. monocytogenes colonies were isolated from 34 (29.3%) chicken meat samples (eleven [22.0%] carcasses and 23 [34.8%] pieces of meat) by IMS based cultivation technique and confirmed by PCR. According to the multiplex PCR results, all the 51 isolates were identified as genoserotype IIa (1/2a or 3a). L. monocytogenes isolates were also tested for their susceptibility to eight antibiotic (gentamicin, vancomycin, chloramphenicol, streptomycin, tetracycline, ampicillin, penicillin G, erythromycin) agents using the disk diffusion method. 14 isolates (27.45%) were susceptible to all eight antimicrobials drugs tested and the remaining 37 isolates (72.54%) were resistant to gentamicin (one isolate, 1.96%), vancomycin (four isolates, 7.84%), penicillin G (six isolates, 11.76%), streptomycin (nine isolates, 17.64%; resistant or intermediate), tetracycline (seven isolates, 13.72%) and ampicillin (six isolates, 11.76%). This study showed that antimicrobial resistance is not highly prevalent in L. monocytogenes isolated from chicken carcasses and pieces of meat. The presence of L. monocytogenes in chicken samples suggests an importance of this pathogen in chicken.

  13. Aerosol studies with Listeria innocua and Listeria monocytogenes.

    Science.gov (United States)

    Zhang, Guodong; Ma, Li; Oyarzabal, Omar A; Doyle, Michael P

    2007-08-01

    Aerosol studies of Listeria monocytogenes in food processing plants have been limited by lack of a suitable surrogate microorganism. The objective of this study was to investigate the potential of using green fluorescent protein-labeled strains of Listeria innocua as a surrogate for L. monocytogenes for aerosol studies. These studies were conducted in a laboratory bioaerosol chamber and a pilot food-processing facility. Four strains of L. innocua and five strains of L. monocytogenes were used. In the laboratory chamber study, Listeria cells were released into the environment at two different cell numbers and under two airflow conditions. Trypticase soy agar (TSA) plates and oven-roasted breasts of chicken and turkey were placed in the chamber to monitor Listeria cell numbers deposited from aerosols. A similar experimental design was used in the pilot plant study; however, only L. innocua was used. Results showed that L. monocytogenes and L. innocua survived equally well on chicken and turkey breast meats and TSA plates. No-fan and continuous fan applications, which affected airflow, had no significant effect on settling rates of aerosolized L. monocytogenes and L. innocua in the bioaerosol chamber or L. innocua in the pilot plant study. Listeriae cell numbers in the air decreased rapidly during the first 1.5 h following release, with few to no listeriae detected in the air at 3 h. Aerosol particles with diameters of 1 and 2 microM correlated directly with the number of Listeria cells in the aerosol but not with particles that were 0.3, 0.5, and 5 microM in diameter. Results indicate that L. innocua can be used as a surrogate for L. monocytogenes in an aerosol study.

  14. Spontaneous Loss of Virulence in Natural Populations of Listeria monocytogenes.

    Science.gov (United States)

    Maury, Mylène M; Chenal-Francisque, Viviane; Bracq-Dieye, Hélène; Han, Lei; Leclercq, Alexandre; Vales, Guillaume; Moura, Alexandra; Gouin, Edith; Scortti, Mariela; Disson, Olivier; Vázquez-Boland, José A; Lecuit, Marc

    2017-11-01

    The pathogenesis of Listeria monocytogenes depends on the ability of this bacterium to escape from the phagosome of the host cells via the action of the pore-forming toxin listeriolysin O (LLO). Expression of the LLO-encoding gene ( hly ) requires the transcriptional activator PrfA, and both hly and prfA genes are essential for L. monocytogenes virulence. Here, we used the hemolytic activity of LLO as a phenotypic marker to screen for spontaneous virulence-attenuating mutations in L. monocytogenes Sixty nonhemolytic isolates were identified among a collection of 57,820 confirmed L. monocytogenes strains isolated from a variety of sources (0.1%). In most cases (56/60; 93.3%), the nonhemolytic phenotype resulted from nonsense, missense, or frameshift mutations in prfA Five strains carried hly mutations leading to a single amino acid substitution (G299V) or a premature stop codon causing strong virulence attenuation in mice. In one strain, both hly and gshF (encoding a glutathione synthase required for full PrfA activity) were missing due to genomic rearrangements likely caused by a transposable element. The PrfA/LLO loss-of-function (PrfA - /LLO - ) mutants belonged to phylogenetically diverse clades of L. monocytogenes , and most were identified among nonclinical strains (57/60). Consistent with the rare occurrence of loss-of-virulence mutations, we show that prfA and hly are under purifying selection. Although occurring at a low frequency, PrfA - /LLO - mutational events in L. monocytogenes lead to niche restriction and open an evolutionary path for obligate saprophytism in this facultative intracellular pathogen. Copyright © 2017 Maury et al.

  15. Enhanced Control of Listeria monocytogenes by Enterococcus faecium KE82, a Multiple Enterocin-Producing Strain, in Different Milk Environments.

    Science.gov (United States)

    Vandera, Elpiniki; Lianou, Alexandra; Kakouri, Athanasia; Feng, Jinbo; Koukkou, Anna-Irini; Samelis, John

    2017-01-01

    Enterococcus faecium KE82, isolated from traditional Greek Graviera cheese, was identified in pure broth cultures in vitro as a multiple enterocin-producing bacterial strain possessing the structural entA, entB, and entP enterocin genes. E. faecium KE82 was further assessed for in situ antilisterial activity in raw milk (RM) and commercially thermized milk (TM; 63°C for 30 s) in the presence of the indigenous microbiota and in sterile raw milk (SRM; 121°C for 5 min) with or without the addition of two commercial starter culture (CSC) strains Streptococcus thermophilus and Lactococcus lactis . Growth of Listeria monocytogenes was completely inhibited in RM incubated at 37°C for 6 h, whereas the pathogen was significantly inactivated in RM+KE82 samples during further incubation at 18°C for 66 h. In contrast, L. monocytogenes levels increased by approximately 2 log CFU/ml in TM, but in TM+KE82 samples, pathogen growth was retarded during the first 6 h at 37°C followed by growth cessation and partial inactivation at 18°C. After 48 to 72 h, growth of L. monocytogenes in SRM+CSC samples decreased by 4 to 5 log CFU/ml compared with the SRM control, whereas additional 10-fold decreases in the pathogen were observed in SRM+CSC+KE82 samples. Reverse transcription PCR analysis of SRM+KE82 and SRM+CSC+KE82 samples confirmed that the entA and entB genes were transcribed, but entP gene transcription was not detected. All RM and SRM samples inoculated with E. faecium KE82 displayed strong in situ inhibitory activity against L. monocytogenes in well diffusion bioassays, whereas activity was weaker to undetectable in comparable or additional TM+KE82 samples; no milk sample without E. faecium KE82 had activity against L. monocytogenes . The findings of this study indicate that E. faecium KE82 is an antilisterial agent that could be used in traditional dairy foods because it concomitantly produces enterocins A and B in situ in milk.

  16. Influence of sublethal concentrations of common disinfectants on expression of virulence genes in Listeria monocytogenes

    DEFF Research Database (Denmark)

    Kastbjerg, Vicky Gaedt; Larsen, M. H.; Gram, Lone

    2010-01-01

    Listeria monocytogenes is a food-borne human pathogen that causes listeriosis, a relatively rare infection with a high fatality rate. The regulation of virulence gene expression is influenced by several environmental factors, and the aim of the present study was to determine how disinfectants use......, such as antibiotic resistance....... by Northern blot analysis. Eleven disinfectants representing four different groups of active components were evaluated in this study. Disinfectants with the same active ingredients had a similar effect on gene expression. Peroxy and chlorine compounds reduced the expression of the virulence genes...

  17. Listeria monocytogenes in poultry and poultry products: Epidemiological investigations in seven Danish abattoirs

    DEFF Research Database (Denmark)

    Ojeniyi, B.; Wegener, Henrik Caspar; Jensen, N.E.

    1996-01-01

    Listeria monocytogenes was isolated from 11/236 (4 . 7%) caecal samples from parent flocks, providing broilers to the abattoirs investigated. Caecal samples from 2078 broilers representing 90 randomly selected broiler flocks were negative for L. monocytogenes. A total of 3080 samples from seven...... abattoirs including poultry processing line samples, and final products were also examined for L. monocytogenes. Listeria monocytogenes was isolated in 0 . 3% to 18 . 7% of the samples collected in the different abattoirs. Epidemiological typing of 247 L. monocytogenes isolates, including serotyping, phage...... isolates of L. monocytogenes since only 120/247 (48 . 6%) isolates were typable by phage typing and 230/247 (93 . 1%) L. monocytogenes belonged to serotype 01 while 6/247 (2 . 4%) belonged to 04. The discovery of a few dominating clones in each abattoir might indicate an endemic occurrence of L...

  18. Cultural Dimension of International Relations During Interwar Period: International Institute for Intellectual Cooperation and the Scientific Study of International Relations

    Directory of Open Access Journals (Sweden)

    Anişoara Popa

    2014-12-01

    Full Text Available Our understanding of the past is highly influenced/leaded by the “lens” (readings, ideologies, etc. that have guided us through approaching realities of a specific period of time. In this article, we will discuss the cultural dimension of international relations characteristic for the interwar period , emphasizing , while tracing back on Romanian historiography, the aspects regarding the role that the International Institute of Intellectual Cooperation had in organizing the scientifically study of IR and the specific participation of Romania within this League of Nations‘ body activity.

  19. Variations in virulence between different electrophoretic types of Listeria monocytogenes

    DEFF Research Database (Denmark)

    Nørrung, Birgit; Andersen, Jens Kirk

    2000-01-01

    A total of 245 strains of Listeria monocytogenes, representing 33 different electrophoretic types (ETs), were examined quantitatively for haemolytic activity. No significant difference was observed in the mean haemolytic activity between different ETs. Eighty four out of 91 strains examined were...... compared with 3.64 among food isolates). The explanation for this may be that more virulent strains are more prone to cause human infection. It is, however, also possible that strains oft. monocytogenes may become more virulent while multiplying in a living organism compared with multiplying in foods....

  20. The double-eyelid operation in Japan: its evolution as related to cultural changes.

    Science.gov (United States)

    Shirakabe, Y; Kinugasa, T; Kawata, M; Kishimoto, T; Shirakabe, T

    1985-09-01

    Of the many aspects of aesthetic surgery, the double-eyelid operation generates the most interest for Japanese surgeons, as there has been an enormous demand for it by patients who are fashion-conscious. It has been possible to locate 32 operative procedures that have been published in the Japanese literature over the past ninety years. Some of these procedures have been reviewed here in relation to the cultural and social changes which are important factors determining the extent of the demand for the operation and which correlate with various changes in surgical technique. This study chronologically describes each of the principal methods related to these social changes and also considers the influence of cultural fads and fashions.

  1. Sensitivity to acetic acid, ability to colonize abiotic surfaces and virulence potential of Listeria monocytogenes EGD-e after incubation on parsley leaves.

    Science.gov (United States)

    Rieu, A; Guzzo, J; Piveteau, P

    2010-02-01

    To investigate how the survival of Listeria monocytogenes on parsley leaves may affect its ability to sustain process-related harsh conditions and its virulence. Parsley seedlings were spot inoculated with stationary phase cells of L. monocytogenes EGD-e and incubated for 15 days. Each day, bacterial cells were harvested and enumerated, and their ability to survive acetic acid challenge (90 min, pH 4.0), to colonize abiotic surfaces and to grow as biofilms was assessed. After a 3-log decrease over the first 48 h, the population stabilized to about 10(6) CFU g(-1) until the sixth day. After the sixth day, L. monocytogenes was no longer detected, even after specific enrichment. Incubation on parsley leaves affected the ability of L. monocytogenes to survive acetic acid challenge (90 min, pH 4.0) and to adhere to stainless steel although the ability to grow as biofilm was preserved. To further investigate these physiological alterations, the mRNA levels of six target genes (bsh, clpC, groEL, inlA, opuC, prfA) was quantified using reverse transcription qPCR after 5 h of incubation on parsley leaves. A decrease was observed in all but one (bsh) target, including groEL and clpC which are involved in resistance to salt and acid. Moreover, the decrease in the levels of inlA, prfA and opuC transcripts after incubation on parsley suggested a repression of some genes involved in pathogenicity. In vitro assessment of mammalian cell adherence and invasion using Caco-2 cells confirmed the repression of the virulence factor InlA; however, the virulence potential in vivo in the chick embryo model was not affected. Listeria monocytogenes did undergo rapid changes to adapt its physiology to the phyllosphere. This study highlights the physiological changes undergone by L. monocytogenes during/after survival on parsley leaves.

  2. A review of the incidence and transmission of Listeria monocytogenes in ready-to-eat products in retail and food service environments.

    Science.gov (United States)

    Lianou, Alexandra; Sofos, John N

    2007-09-01

    Contamination of ready-to-eat products with Listeria monocytogenes may occur at several stages before consumption. Accessibility to the public and relatively limited control interventions at retail and food service establishments (compared with the processing sector of the food industry) and the lack of a specific regulatory framework increase the likelihood of introduction of this pathogen into some foods in these establishments. This review is a compilation of available information on the incidence and transmission of L. monocytogenes through ready-to-eat products at the retail and food service level. The potential transmission of L. monocytogenes within retail and food service operations has been indicated in epidemiological investigations and by survey data. Potential sources of the organism in these operations include the environment, food handlers, and incoming raw ingredients or processed products that have become contaminated after the lethality treatment at the manufacturing facility. L. monocytogenes may be present at retail and food service establishments in various ready-to-eat products, both prepackaged and those packaged in the store, and occasionally at high concentrations. This issue dictates the need for development and application of effective control measures, and potential control approaches are discussed here. Good manufacturing practices, appropriate cleaning, sanitation and hygiene programs, and temperature control required for prevention or inhibition of growth of the pathogen to high levels are critical for control of L. monocytogenes in the retail and food service sector. A comprehensive food safety system designed to be functional in retail and food service operations and based on the philosophy of hazard analysis and critical control point systems and a series of sound prerequisite programs can provide effective control of L. monocytogenes in these environments. However, competent delivery of food safety education and training to retail

  3. Inhibiting Listeria monocytogenes, Vibrio parahaemolyticus and Morganella morganii with Aqueous Methanol Extracts of Punica granatum and Galla chinensis

    OpenAIRE

    Wu, Jian

    2014-01-01

    Listeria monocytogenes, Vibrio parahaemolyticus and Morganella morganii are closely related to foodborne illnesses caused by the consumption of seafood and ready-to-eat (RTE) food. Traditional Chinese medicines (TCM) have been widely studied as complementary and alternative medicines, and many of them have been verified to have antimicrobial properties. The purpose of this research was to study antimicrobial effects of plant extracts as potential preservatives in seafood products and to ident...

  4. Crystal Structure of the Substrate-Binding Domain from Listeria monocytogenes Bile-Resistance Determinant BilE

    OpenAIRE

    Stephanie J. Ruiz; Gea K. Schuurman-Wolters; Bert Poolman

    2016-01-01

    BilE has been reported as a bile resistance determinant that plays an important role in colonization of the gastrointestinal tract by Listeria monocytogenes, the causative agent of listeriosis. The mechanism(s) by which BilE mediates bile resistance are unknown. BilE shares significant sequence similarity with ATP-binding cassette (ABC) importers that contribute to virulence and stress responses by importing quaternary ammonium compounds that act as compatible solutes. Assays using related co...

  5. Listeria spp. in broiler flocks: recovery rates and species distribution investigated by conventional culture and the EiaFoss method

    DEFF Research Database (Denmark)

    Petersen, Line Hedegård; Madsen, Mogens

    2000-01-01

    The occurrence of Listeria monocytogenes in samples from broiler houses and cloacal swabs taken at the abattoir was investigated. An automated immunobased method (EiaFoss) was used, and 42 samples were also analysed by conventional culture; both methods were based on a two-step selective enrichment....... monocytogenes in enrichment broths may lead to an underestimation of the prevalence of L. monocytogenes. Furthermore, as L. inocua was also detected by the EiaFoss method, a significant amount of bacterial confirmation work had to be done. Of 42 samples analysed by conventional culture, four yielded L. inocua......, of which two were not positive by EiaFoss....

  6. [Innovative culture and diagnosis related groups in a high complexity hospital, Colombia].

    Science.gov (United States)

    Gorbanev, Iouri; Agudelo-Londoño, Sandra; Cortes, Ariel; Yepes, Francisco J

    2016-04-01

    Objectives To characterize the perception of Diagnosis-Related Groups (DRGs) as an innovation among physicians, nurses and administrative staff in a hospital in Colombia. Methods A case study of innovative culture in a hospital. Surveys and focus groups were carried out with the medical, nursing and administrative staff. Descriptive statistics were calculated for the perceptions of innovative culture. Comparative analysis was done between professional groups. The results of the focus groups were transcribed and analyzed to deepen the findings of the surveys. Results Significant differences were found in perceptions of the innovative culture. The nursing staff were more enthusiastic than doctors when evaluating the innovative culture and leadership. Physicians felt more autonomy when discussing professional issues. Administrative staff assessed the Hospital's disposition to acquire new medical technologies as higher than that of physicians. The three groups know little about DRG's. Conclusions When implementing a health innovation it is advisable to analyze its effect on the professionals who participate in the implementation. Physicians perceive DRGs as a threat to their professional autonomy, while nurses see it as a pro-innovation force. It is important to involve nursing and administrative staff when implementing this kind of innovation.

  7. Identity-related autobiographical memories and cultural life scripts in patients with Borderline Personality Disorder.

    Science.gov (United States)

    Jørgensen, Carsten René; Berntsen, Dorthe; Bech, Morten; Kjølbye, Morten; Bennedsen, Birgit E; Ramsgaard, Stine B

    2012-06-01

    Disturbed identity is one of the defining characteristics of Borderline Personality Disorder manifested in a broad spectrum of dysfunctions related to the self, including disturbances in meaning-generating self-narratives. Autobiographical memories are memories of personal events that provide crucial building-blocks in our construction of a life-story, self-concept, and a meaning-generating narrative identity. The cultural life script represents culturally shared expectations as to the order and timing of life events in a prototypical life course within a given culture. It is used to organize one's autobiographical memories. Here, 17 BPD-patients, 14 OCD-patients, and 23 non-clinical controls generated three important autobiographical memories and their conceptions of the cultural life script. BPD-patients reported substantially more negative memories, fewer of their memories were of prototypical life script events, their memory narratives were less coherent and more disoriented, and the overall typicality of their life scripts was lower as compared with the other two groups. Copyright © 2012 Elsevier Inc. All rights reserved.

  8. A moveable feast: Contemporary relational food cultures emerging from local food networks.

    Science.gov (United States)

    O'Kane, Gabrielle

    2016-10-01

    Although the globalised food system delivers unparalleled food variety and quantity to most in the developed world it also disconnects consumers from where, how and by whom food is grown. This change in the food system has resulted in an acceptance of an anonymous and homogeneous food supply, which has contributed to over-consumption and the rise in diet-related diseases. 'Nutritionism' responds to this issue by maintaining that a 'healthy diet' can be achieved by consuming the correct balance of energy and nutrients, but with limited success. Yet, some food cultures can moderate the effects of the environmental drivers of increasing global obesity rates. This paper draws on this premise and presents an alternative eco-dietetic response, exploring people's meaning-making of food and food culture through local food networks. This research used narrative inquiry methodology and purposive sampling to gather stories through focus group conversations. Twenty people attended focus groups comprised of food procurers from one of three local food networks in the Canberra region: community gardens, a modified Community Supported Agriculture (CSA) and farmers' markets. The findings showed that those using local food networks enjoyed a 'contemporary relational food culture' that highlighted the importance of people, place and time, in their visceral experiences of food. The community gardeners made meaning of food through their connections to the earth and to others. The farmers' market and CSA food procurers valued the seasonal, local and ethical food produced by their beloved farmer(s). This paper provides qualitative evidence that local food networks enable people to enjoy multi-dimensional relationships to food. Further research is required to examine whether experiencing a contemporary relational food culture can lead to improved health outcomes for people and the planet. Copyright © 2016 Elsevier Ltd. All rights reserved.

  9. Crowdfunding and Cultural Industry: The new relations between production and consumption based on the culture of participation and collective funding

    Directory of Open Access Journals (Sweden)

    Vanessa Amália Dalpizol Valiati

    2013-04-01

    Full Text Available The configuration of a new standard of consumption and cultural production based on the participation of consumers through the Internet has become a feature of modern society (Jenkins, 2009; Shirky, 2011. Based on this premise, we intend to analyze the process of crowd funding, in which a mass of staff is united in the realization of cultural projects and to create a unique product, under the bias of the culturological theory. This work is also raising questions as to the timeliness of the concept of cultural industry in the face of new practices allowed by digital networks and a potential democratization, focusing the brazilian website Catarse.

  10. Modelling the growth of Listeria monocytogenes on the surface of smear- or mould-ripened cheese

    Directory of Open Access Journals (Sweden)

    Sol eSchvartzman

    2014-07-01

    Full Text Available Surface-ripened cheeses are matured by means of manual or mechanical technologies posing a risk of cross-contamination, if any cheeses are contaminated with Listeria monocytogenes. In predictive microbiology, primary models are used to describe microbial responses, such as growth rate over time and secondary models explain how those responses change with environmental factors. In this way, primary models were used to assess the growth rate of L. monocytogenes during ripening of the cheeses and the secondary models to test how much the growth rate was affected by either the pH and/or the water activity (aw of the cheeses. The two models combined can be used to predict outcomes. The purpose of these experiments was to test three primary (the modified Gompertz equation, the Baranyi and Roberts model and the Logistic model and three secondary (the Cardinal model, the Ratowski model and the Presser model mathematical models in order to define which combination of models would best predict the growth of L. monocytogenes on the surface of artificially contaminated surface-ripened cheeses. Growth on the surface of the cheese was assessed and modelled. The primary models were firstly fitted to the data and the effects of pH and aw on the growth rate (μmax were incorporated and assessed one by one with the secondary models. The Logistic primary model by itself did not show a better fit of the data among the other primary models tested, but the inclusion of the Cardinal secondary model improved the final fit. The aw was not related to the growth of Listeria. This study suggests that surface-ripened cheese should be separately regulated within EU microbiological food legislation and results expressed as counts per surface area rather than per gram.

  11. Modeling the growth of Listeria monocytogenes on the surface of smear- or mold-ripened cheese.

    Science.gov (United States)

    Schvartzman, M Sol; Gonzalez-Barron, Ursula; Butler, Francis; Jordan, Kieran

    2014-01-01

    Surface-ripened cheeses are matured by means of manual or mechanical technologies posing a risk of cross-contamination, if any cheeses are contaminated with Listeria monocytogenes. In predictive microbiology, primary models are used to describe microbial responses, such as growth rate over time and secondary models explain how those responses change with environmental factors. In this way, primary models were used to assess the growth rate of L. monocytogenes during ripening of the cheeses and the secondary models to test how much the growth rate was affected by either the pH and/or the water activity (aw) of the cheeses. The two models combined can be used to predict outcomes. The purpose of these experiments was to test three primary (the modified Gompertz equation, the Baranyi and Roberts model, and the Logistic model) and three secondary (the Cardinal model, the Ratowski model, and the Presser model) mathematical models in order to define which combination of models would best predict the growth of L. monocytogenes on the surface of artificially contaminated surface-ripened cheeses. Growth on the surface of the cheese was assessed and modeled. The primary models were firstly fitted to the data and the effects of pH and aw on the growth rate (μmax) were incorporated and assessed one by one with the secondary models. The Logistic primary model by itself did not show a better fit of the data among the other primary models tested, but the inclusion of the Cardinal secondary model improved the final fit. The aw was not related to the growth of Listeria. This study suggests that surface-ripened cheese should be separately regulated within EU microbiological food legislation and results expressed as counts per surface area rather than per gram.

  12. Survival of Listeria monocytogenes on fresh blueberries (Vaccinium corymbosum) stored under controlled atmosphere and ozone.

    Science.gov (United States)

    Concha-Meyer, Anibal; Eifert, Joseph; Williams, Robert; Marcy, Joseph; Welbaum, Gregory

    2014-05-01

    Listeria monocytogenes is a foodborne pathogen that represents a high risk for consumers because it can grow under refrigeration conditions and can also develop acid tolerance. Fresh blueberries are hand-picked, packed, and transported under refrigeration without receiving a microbial inactivation treatment. The aim of this work was to study the survival of L. monocytogenes in fresh highbush blueberries stored at 4 or 12 °C under different controlled atmosphere conditions, including air (control); 5% O2, 15% CO2, 80% N2 (controlled atmosphere storage [CAS]); or ozone gas (O3), 4 ppm at 4 °C or 2.5 ppm at 12 °C, at high relative humidity (90 to 95%) for a total of 10 days. Fresh blueberries inside a plastic clamshell were spot inoculated with the bacteria and were stored at 4 or 12 °C in isolated cabinets under air, CAS, and O3 atmospheric conditions. Samples were evaluated on days 0, 1, 4, 7, and 10 for microbial growth using modified Oxford agar. CAS did not delay or inhibit L. monocytogenes growth in fresh blueberries after 10 days. O3 achieved 3- and 2-log reductions when compared with air treatment at 4 and 12 °C, respectively. Low concentrations of O3 together with proper refrigeration temperature can ensure product safety throughout transportation. O3 is a strong antimicrobial that safely decomposes to oxygen and water without leaving residues and can be used as an alternative method to prevent bacterial growth during a long transport period.

  13. Variations in biofilm formation, desiccation resistance and Benzalkonium chloride susceptibility among Listeria monocytogenes strains isolated in Canada

    DEFF Research Database (Denmark)

    Piercey, Marta J.; C. Ells, Timothy; Macintosh, Andrew J.

    2017-01-01

    needed to inhibit the formation of biofilm by LGI1/CC8 strains during incubation for 48 h and 6 days compared to other strains. Formation of biofilm on stainless steel was not significantly (p > 0.05) different among the strains. Analysis of genetic sequence data from desiccation and BAC sensitive (CP4 5......Listeria monocytogenes is a pathogenic foodborne microorganism noted for its ability to survive in the environment and food processing facilities. Survival may be related to the phenotype of individual strains including the ability to form biofilms and resist desiccation and/or sanitizer exposure....... The objectives of this research were to compare 14 L. monocytogenes strains isolated from blood (3), food (6) and water (5) with respect to their benzalkonium chloride (BAC) sensitivity, desiccation resistance, and ability to form biofilm. Correlations were tested between those responses, and the presence...

  14. Sensitivity of PCR IS6110 in relation to culture and staining in Pott′s disease

    Directory of Open Access Journals (Sweden)

    Manoj Kumar

    2013-01-01

    Full Text Available Background: Rapid diagnosis is essential to decrease the morbidity and mortality of Pott′s disease. The bacteriological methods are time-consuming or insensitive. Polymerase chain reaction (PCR provides a rapid diagnostic tool and hope for early diagnosis of this disease. The aim of this study was to compare and assess of a rapid and effective method among diagnostic battery (Ziehl-Neelsen (ZN microscopy, BACTEC culture and PCR of Pott′s disease. Materials and Methods: Sixty-five specimens from clinico-radiological suspected cases of Pott′s disease were included in this study. They were processed for ZN microscopy, BACTEC culture, and PCR IS6110. The tests tool′s efficiency, positive agreement Kc (Kappa coefficient, and significance level (P value were calculated for correlation between PCR and performed tests. Results: The PCR sensitivity reached to 96% and 46.3% among positive and negative specimens on ZN microscopy. Further, 94% and 36.4% sensitivity were found among positive and negative specimens by BACTEC culture. The total 38 (58.5% specimens were detected either ZN microscopy or by BACTEC culture. Thus, the overall sensitivity and specificity of PCR were 95% and 74.1%. The kappa coefficient and P value, calculated for PCR against BACTEC culture and combined results of performed bacteriological tests were (Kc=0.60, (P<0.001 and (Kc=0.70, (P<0.001, respectively. Above statistical relations showed a fair agreement with significant differences. Conclusion: The PCR IS6110 may be useful in rapid detection of clinico-radiological suspected cases of Pott′s disease and those that are negative with bacteriological methods.

  15. Health-related quality of life of irritable bowel syndrome patients in different cultural settings.

    Science.gov (United States)

    Faresjö, Ashild; Anastasiou, Foteini; Lionis, Christos; Johansson, Saga; Wallander, Mari-Ann; Faresjö, Tomas

    2006-03-27

    Persons with Irritable bowel syndrome (IBS) are seriously affected in their everyday life. The effect across different cultural settings of IBS on their quality of life has been little studied. The aim was to compare health-related quality of life (HRQOL) of individuals suffering from IBS in two different cultural settings; Crete, Greece and Linköping, Sweden. This study is a sex and age-matched case-control study, with n = 30 Cretan IBS cases and n = 90 Swedish IBS cases and a Swedish control group (n = 300) randomly selected from the general population. Health-related quality of life, measured by SF-36 and demographics, life style indicators and co-morbidity, was measured. Cretan IBS cases reported lower HRQOL on most dimensions of SF-36 in comparison to the Swedish IBS cases. Significant differences were found for the dimensions mental health (p cultural environments could perceive their disease differently and that the disease might affect their everyday life and quality of life in a different way. The Cretan population, and especially women, are more seriously affected mentally by their disease than Swedish IBS cases. Coping with IBS in everyday life might be more problematic in the Cretan environment than in the Swedish setting.

  16. Health-related quality of life of irritable bowel syndrome patients in different cultural settings

    Science.gov (United States)

    Faresjö, Åshild; Anastasiou, Foteini; Lionis, Christos; Johansson, Saga; Wallander, Mari-Ann; Faresjö, Tomas

    2006-01-01

    Background Persons with Irritable bowel syndrome (IBS) are seriously affected in their everyday life. The effect across different cultural settings of IBS on their quality of life has been little studied. The aim was to compare health-related quality of life (HRQOL) of individuals suffering from IBS in two different cultural settings; Crete, Greece and Linköping, Sweden. Methods This study is a sex and age-matched case-control study, with n = 30 Cretan IBS cases and n = 90 Swedish IBS cases and a Swedish control group (n = 300) randomly selected from the general population. Health-related quality of life, measured by SF-36 and demographics, life style indicators and co-morbidity, was measured. Results Cretan IBS cases reported lower HRQOL on most dimensions of SF-36 in comparison to the Swedish IBS cases. Significant differences were found for the dimensions mental health (p cultural environments could perceive their disease differently and that the disease might affect their everyday life and quality of life in a different way. The Cretan population, and especially women, are more seriously affected mentally by their disease than Swedish IBS cases. Coping with IBS in everyday life might be more problematic in the Cretan environment than in the Swedish setting. PMID:16566821

  17. Health-related quality of life of irritable bowel syndrome patients in different cultural settings

    Directory of Open Access Journals (Sweden)

    Johansson Saga

    2006-03-01

    Full Text Available Abstract Background Persons with Irritable bowel syndrome (IBS are seriously affected in their everyday life. The effect across different cultural settings of IBS on their quality of life has been little studied. The aim was to compare health-related quality of life (HRQOL of individuals suffering from IBS in two different cultural settings; Crete, Greece and Linköping, Sweden. Methods This study is a sex and age-matched case-control study, with n = 30 Cretan IBS cases and n = 90 Swedish IBS cases and a Swedish control group (n = 300 randomly selected from the general population. Health-related quality of life, measured by SF-36 and demographics, life style indicators and co-morbidity, was measured. Results Cretan IBS cases reported lower HRQOL on most dimensions of SF-36 in comparison to the Swedish IBS cases. Significant differences were found for the dimensions mental health (p Conclusion The results from this study tentatively support that the claim that similar individuals having the same disease, e.g. IBS, but living in different cultural environments could perceive their disease differently and that the disease might affect their everyday life and quality of life in a different way. The Cretan population, and especially women, are more seriously affected mentally by their disease than Swedish IBS cases. Coping with IBS in everyday life might be more problematic in the Cretan environment than in the Swedish setting.

  18. Transcription factor σB plays an important role in the production of extracellular membrane-derived vesicles in Listeria monocytogenes.

    Directory of Open Access Journals (Sweden)

    Jung Hwa Lee

    Full Text Available Gram-negative bacteria produce extracellular outer membrane vesicles (OMVs that interact with host cells. Unlike Gram-negative bacteria, less is known about the production and role of extracellular membrane vesicles (MVs in Gram-positive bacteria. The food-borne pathogen Listeria monocytogenes can survive under extreme environmental and energy stress conditions and the transcription factor σ(B is involved in this survival ability. Here, we first determined the production of MVs from L. monocytogenes and evaluated whether general stress transcription factor σ(B affected production of MVs in L. monocytogenes. L. monocytogenes secreted MVs during in vitro broth culture. The wild-type strain actively produced MVs approximately nine times more and also produced more intact shapes of MVs than those of the isogenic ΔsigB mutant. A proteomic analysis showed that 130 and 89 MV proteins were identified in the wild-type and ΔsigB mutant strains, respectively. Wild-type strain-derived MVs contained proteins regulated by σ(B such as transporters (OpuCA and OpuCC, stress response (Kat, metabolism (LacD, translation (InfC, and cell division protein (FtsZ. Gene Ontology (GO enrichment analysis showed that wild-type-derived MV proteins corresponded to several GO terms, including response to stress (heat, acid, and bile resistance and extracellular polysaccharide biosynthetic process, but not the ΔsigB mutant. Internalin B (InlB was almost three times more contained in MVs derived from the wild-type strain than in MVs derived from the ΔsigB mutant. Taken together, these results suggest that σ(B plays a pivotal role in the production of MVs and protein profiles contained in MVs. L. monocytogenes MVs may contribute to host infection and survival ability under various stressful conditions.

  19. Is Openness to Using Empirically Supported Treatments Related to Organizational Culture and Climate?

    Science.gov (United States)

    Patterson Silver Wolf Adelv Unegv Waya, David A; Dulmus, Catherine N; Maguin, Eugene

    2013-01-01

    The overall purpose of this study is to investigate workers' openness towards implementing a new empirically supported treatment (EST) and whether the workers' openness scores relate to their workplace culture and climate scores. Participants in this study (N=1273) worked in a total of 55 different programs in a large child and family services organization and completed a survey measuring their attitudes toward ESTs. Results indicate that work groups that measure themselves as being more open to using ESTs rated their organizational cultures as being significantly more proficient and significantly less resistant to change. With ESTs becoming the gold standard for professional social work practices, it is important to have accessible pathways to EST implementation.

  20. Overlevingsstrategieën Listeria monocytogenes bij lage temperatuur

    NARCIS (Netherlands)

    Wemekamp-Kamphuis, H.H.; Abee, T.

    2004-01-01

    Listeria monocytogenes is an important food-borne pathogen that may cause severe infections in humans. Many outbreaks caused by this organism have been associated with ready-to-eat foods wich may have undergone some form of minimal processing, or have been contaminated after processing. Ready-to-eat

  1. Effect of Listeria monocytogenes inoculation, sodium acetate and ...

    African Journals Online (AJOL)

    Jane

    2011-08-08

    Aug 8, 2011 ... monocytogenes has been isolated from surface fresh waters and ... been reported that contamination of aquatic products with ..... In fish sausage treated with nisin, the peroxide value was lower in comparison with that of control (Raju et al., 2003). TBA assay is usually used as indicator for the assessment of.

  2. Listeria monocytogenes serotype prevalence and biodiversity in diverse food products.

    Science.gov (United States)

    Hadjilouka, Agni; Andritsos, Nikolaos D; Paramithiotis, Spiros; Mataragas, Marios; Drosinos, Eleftherios H

    2014-12-01

    The aim of this study was to assess serotype prevalence and biodiversity of Listeria monocytogenes strains isolated from diverse food products, i.e., minced pork, fruits, and vegetables. Three hundred twenty-six samples previously purchased from supermarkets and street markets within the Athens area were studied for L. monocytogenes prevalence. A total of 121 strains were isolated from the 36 samples that were positive for L. monocytogenes. Serotyping was performed with multiplex PCR, and biodiversity was assessed with random amplified polymorphic DNA (RAPD) PCR analysis using M13, UBC155, and HLWL85 as primers and with repetitive element palindromic (rep) PCR analysis using (GTG)5 as the primer. The majority (17 of 22) of the contaminated minced pork samples contained strains identified as serotype 1/2a, either alone or in combination with strains belonging to serotypes 1/2b, 4a, 4c, or 4ab. However, all L. monocytogenes isolates from fruits and vegetables belonged to serotype 4b. Rep-PCR provided better differentiation of the isolates than did RAPD PCR and resulted in discrimination of the isolates into a larger number of unique profiles. Complete differentiation was achieved only with the combination of these subtyping techniques.

  3. Listeria monocytogenes repellence by enzymatically modified PES surfaces

    NARCIS (Netherlands)

    Veen, van der S.; Nady, N.; Franssen, M.C.R.; Zuilhof, H.; Boom, R.M.; Abee, T.; Schroën, C.G.P.H.

    2015-01-01

    : The effect of enzyme-catalyzed modification of poly(ethersulfone) (PES) on the adhesion and biofilm formation of two Listeria monocytogenes strains is evaluated under static and dynamic flow conditions. PES has been modified with gallic acid, ferulic acid and 4-hydroxybenzoic acid. The surfaces

  4. LISTERIA MONOCYTOGENES IN THE CONTEXT OF THE NEW COMMUNITY REGULATIONS

    Directory of Open Access Journals (Sweden)

    A. Bragagnolo

    2008-02-01

    Full Text Available In recent years in the countries of the European Union have occurred profound and radical changes regarding the safety and hygiene of foodstuffs. The aim of this work is to highlight the significant changes made by the recent legislation in the control of Listeria monocytogenes.

  5. Incidence of Listeria monocytogenes and Other Bacteria in ...

    African Journals Online (AJOL)

    Prof. Ogunji

    Abstract. The involvement of Listeria monocytogenes in spontaneous abortion in Jos was investigated. One hundred blood and 100 placenta samples were collected from spontaneous abortion patients in Jos. The samples were inoculated first into Listeria enrichment broth. Incubation was at 37o C, followed by cold ...

  6. Influence of temperature on alkali stress adaptation in Listeria monocytogenes

    Science.gov (United States)

    Listeria monocytogenes cells may induce alkali stress adaptation when exposed to sublethal concentrations of alkaline cleaners and sanitizers that may be frequently used in the food processing environment. In the present study, the effect of temperature on the induction and the stability of such alk...

  7. Activity of daptomycin against Listeria monocytogenes isolates from cerebrospinal fluid

    NARCIS (Netherlands)

    Spanjaard, Lodewijk; Vandenbroucke-Grauls, Christina M. J. E.

    2008-01-01

    We tested the activity of daptomycin against 76 Listeria monocytogenes isolates from cerebrospinal fluid by broth dilution and Etest methods. For the broth dilution method, the MIC range was 1.0 to 8.0 and the MIC at which 90% of the isolates tested were inhibited (MIC(90)) was 4.0 mg/liter. For the

  8. Listeria monocytogenes response regulators important for stress tolerance and pathogenesis

    DEFF Research Database (Denmark)

    Kallipolitis, B. H.; Ingmer, H.

    2001-01-01

    of L. monocytogenes in mice. Strikingly, the mutants that were attenuated in virulence also had a decreased ability to grow in the presence of various stress conditions potentially encountered in an infection process. Thus, our data point to a connection between the ability of the putative two...

  9. Formation of biofilm by strains of Listeria monocytogenes isolated ...

    African Journals Online (AJOL)

    Quantification of biofilm formation by 40 Listeria monocytogenes strains from wara soft cheese and its processing environment was assessed on glass vials surfaces. Attachement to glass surface was quantified using a crystal violet binding assay. All the 40 strains produced biofilms after 48 and 72 h incubation at 37oC.

  10. Pathogenic potential of Listeria monocytogenes isolated from cattle ...

    African Journals Online (AJOL)

    Listeria monocytogenes is an opportunistic food-borne pathogen causing listeriosis especially among immune-compromised persons. Its high rate of morbidity and mortality has classed the organism among the top watch list in foods. It is known to produce several virulence factors which aid its survival in harsh conditions ...

  11. Carrier status for Listeria monocytogenes and other Listeria species ...

    African Journals Online (AJOL)

    Background: Listeria organisms are documented to be zoonotic; one of the sources of infection is the domestic fowl where it could occur as in apparent infection. The carriage of Listeria monocytogenes and other Listeria in indigenous birds has not been documented in Kenya. Objective: To establish whether healthy looking ...

  12. Incidence of Listeria monocytogenes and Other Bacteria in ...

    African Journals Online (AJOL)

    The involvement of Listeria monocytogenes in spontaneous abortion in Jos was investigated. One hundred blood and 100 placenta samples were collected from spontaneous abortion patients in Jos. The samples were inoculated first into Listeria enrichment broth. Incubation was at 37o C, followed by cold enrichment at ...

  13. Cross-Cultural Differences in the Experience of Grandparent-Grandchild Relationships and Related Psychosocial Outcomes.

    Science.gov (United States)

    Hayslip, Bert; Toledo, Ray M; Henderson, Craig E; Rodriguez, R Mishelle; Caballero Vela, Daniela M

    2018-01-01

    This study examined grandchildren's perceptions of the quality of their relationship with their grandmothers and how these perceptions relate to psychosocial outcomes. Eighty-two youth from Mexico and 99 youth from the United States aged between 13 and 16 participated. Results suggested that both cultures benefit in unique ways from positive relationship with their grandmothers. Yet, there were also differences in the relational experience of grandmother-grandchild relationships across cultures. Specifically, grandchildren in the U.S. sample reported higher relationship quality, relational competency, and self-efficacy than the grandchildren in the Mexico sample. Within the U.S. sample, relationship quality was associated with grandchildren's relational competence, while in the Mexico sample, relationship quality was associated with self-efficacy. Limitations of the present study include restricted generalizability to other age groups and to grandfathers and that only one element of the grandparent-grandchild dyad was sampled. Longitudinal research will improve our understanding of the causal dynamics of grandparent-grandchild relationships.

  14. Listeria monocytogenes following orthotopic liver transplantation: Central nervous system involvement and review of the literature

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    Listeria monocytogene is a well-recognized cause of bacteremia in immunocompromised individuals, including solid organ transplant recipients, but has been rarely reported following orthotopic liver transplantation. We describe a case of listeria meningitis that occurred within a week after liver transplantation. The patient developed a severe headache that mimicked tacrolimus encephalopathy, and was subsequently diagnosed with listeria meningitis by cerebrospinal fluid culture. The infection was successfully treated with three-week course of intravenous ampicillin. Recurrent hepatitis C followed and was successfully treated with interferon alfa and ribavirin. Fourteen cases of listeriosis after orthotopic liver transplantation have been reported in the English literature. Most reported cases were successfully treated with intravenous ampicillin. There were four cases of listeria meningitis, and the mortality of them was 50%.Early detection and treatment of listeria meningitis are the key to obtaining a better prognosis.

  15. INFLUENCE DE LA TEMPÉRATURE DU MILIEU DE CULTURE ...

    African Journals Online (AJOL)

    AISA

    DE CULTURE SUR LA CROISSANCE DE QUELQUES ... EFFECT OF CULTURE MEDIUM TEMPERATURE ON THE GROWTH OF Listeria SP; STAINS ..... Microbiol., 14th Oslo, Norwegian university. Press p.97-98. . BRACKETT (R.E.). 1988. Presence and persistence of Listeria monocytogenes in food and water. Food.

  16. Comparative usefulness of inflammatory markers to indicate bacterial infection-analyzed according to blood culture results and related clinical factors.

    Science.gov (United States)

    Nishikawa, Hirokazu; Shirano, Michinori; Kasamatsu, Yu; Morimura, Ayumi; Iida, Ko; Kishi, Tomomi; Goto, Tetsushi; Okamoto, Saki; Ehara, Eiji

    2016-01-01

    To assess relationships of inflammatory markers and 2 related clinical factors with blood culture results, we retrospectively investigated inpatients' blood culture and blood chemistry findings that were recorded from January to December 2014 using electronic medical records and analyzed the data of 852 subjects (426 culture-positive and 426 culture-negative). Results suggested that the risk of positive blood culture statistically increased as inflammatory marker levels and the number of related factors increased. Concerning the effectiveness of inflammatory markers, when the outcome definition was also changed for C-reactive protein (CRP), the odds ratio had a similar value, whereas when the outcome definition of blood culture positivity was used for procalcitonin (PCT), the greatest effectiveness of that was detected. Therefore, the current results suggest that PCT is more useful than CRP as an auxiliary indication of bacterial infection. Copyright © 2016 Elsevier Inc. All rights reserved.

  17. Prevalence of Listeria monocytogenes in poultry production in France.

    Science.gov (United States)

    Chemaly, Marianne; Toquin, Marie-Therese; Le Nôtre, Yolene; Fravalo, Philippe

    2008-10-01

    This study aimed to update and create a data set from laying hens and broilers regarding contamination by Listeria monocytogenes. Two hundred laying-hen flocks were sampled, with 88 flocks reared in cages and 112 reared on the floor. One hundred forty-five broiler flocks were sampled, with 85 conventional and 60 free-range flocks. A total of 774 and 725 samples were analyzed from laying hens and broilers, respectively. L. monocytogenes was detected in 31 of 200 flocks, yielding an estimated prevalence of 15.5% in laying-hen flocks. Among positive flocks, there appeared a significant (P = 0.004) difference between caged and floor-reared hens, with a higher detection in dust samples from floor-reared hens. In positive caged hen flocks, significant (P = 0.028) differences between dust and fecal samples appeared, with a higher detection in feces than in dust samples. In broiler flocks, L. monocytogenes was isolated in 46 of 145 flocks, yielding an estimated prevalence of 32% (28% in conventional flocks versus 37% in the free-range flocks). L. monocytogenes was isolated in samples taken from conventional flocks with a lower frequency than in free-range flocks (13 versus 18%, respectively). The serotyping of L. monocytogenes strains showed that the majority belonged to type 1/2a in laying-hen flocks (74.3%) and in broiler flocks (40.5%). A significant difference (P = 0.007) between laying hens and broilers was shown for serogroup 4 and for serovar 1/2b (P = 0.007); these serogroups were more prevalent in broilers (40%) than in laying hens (5.7%).

  18. Antimicrobial treatments to control Listeria monocytogenes in queso fresco.

    Science.gov (United States)

    Lourenço, António; Kamnetz, Mary B; Gadotti, Camila; Diez-Gonzalez, Francisco

    2017-06-01

    Queso fresco, is a Hispanic non-fermented cheese highly susceptible to contamination with L. monocytogenes. This research was aimed to determine the effect of GRAS antimicrobial ingredients to control L. monocytogenes. Antimicrobials included caprylic acid (CA), Nisaplin ® (N, 2.5% nisin), a mixture of sodium lactate and sodium diacetate (SL/SD), Lactococcus lactis sbp. lactis DPC 3147, monolaurin, and lactic acid (LA). Batches of queso fresco curds were inoculated with 10 4  CFU/g and stored at 4 °C for three weeks. During storage the count of L. monocytogenes reached 7 to 8 Log CFU/g in control samples. Most individual antimicrobial treatments resulted in less than 1 Log CFU/g reductions in final counts, with the exception of N (0.5 g/kg) and CA (2.9 g/kg) that caused more than 3 and 5 Log CFU/g differences with controls, respectively. Mixtures of ingredients were more effective in inhibiting L. monocytogenes growth, and treatments with N and CA consistently delivered 6 Log CFU/g less counts than controls. Supplementation of 12 g/kg LA to treatments with SL/SD (3%/0.22%) caused differences of more than 4 Log CFU/g in final Listeria populations. Samples treated with the binary mixtures of N and CA (0.5 and 0.7 g/kg, respectively) were evaluated in a consumer panel (n = 67). Panelists slightly preferred control and commercial over treated samples, but all samples were in average rated between "slightly liking" and "moderately liking." These experiments indicated that combined use of antimicrobial ingredients may be an effective way to control the population of Listeria monocytogenes in queso fresco. Copyright © 2016 Elsevier Ltd. All rights reserved.

  19. Attached and planktonic Listeria monocytogenes global proteomic responses and associated influence of strain genetics and temperature.

    Science.gov (United States)

    Mata, Marcia M; da Silva, Wladimir P; Wilson, Richard; Lowe, Edwin; Bowman, John P

    2015-02-06

    Contamination of industrial and domestic food usage environments by the attachement of bacterial food-borne pathogen Listeria monocytogenes has public health and economic implications. Comprehensive proteomics experiments using label-free liquid chromatography/tandem mass spectrometry were used to compare the proteomes of two different L. monocytogenes strains (Siliken_1/2c and F2365_4b), which show very different capacities to attach to surfaces. Growth temperature and strain type were highly influential on the proteomes in both attached and planktonic cells. On the basis of the proteomic data, it is highly unlikely that specific surface proteins play a direct role in adherence to inanimate surfaces. Instead, strain-dependent responses related to cell envelope polymer biosynthesis and stress response regulation likely contribute to a different ability to attach and also to survive external stressors. Collectively, the divergent proteome-level responses observed define strain- and growth-temperature-dependent differences relevant to attachment efficacy, highlight relevant proteins involved in stress protection in attached cells, and suggest that strain differences and growth conditions are important in relation to environmental persistence.

  20. Is the value of oral health related to culture and environment, or function and aesthetics?

    Science.gov (United States)

    Nassani, M Z; Kay, E J; Al-Nahhal, T I; Okşayan, R; Usumez, A; Mohammadi, T M

    2015-12-01

    To examine the disutility of tooth loss. It compared how people value their teeth in two countries which are culturally similar in order to explore the effect of culture on self-perceptions of oral health. Cross sectional study. Participants were recruited from subjects attending two hospitals in Turkey and in Iran. Nineteen descriptions of mouths with varying degrees and types of tooth loss were presented to the participants. They were shown mouth models of partially edentate dentitions and the teeth missing were explained in relation to the participants own mouth. The participants were specifically asked to consider the role their teeth played in function (chewing), communication (speech) and aesthetics (looks) along with "all the other things that make your mouth important". The participants were asked to indicate on a visual analogue scale how they would value the health of their mouth if they lost the tooth/teeth described and the resultant space was left unrestored. Overall 152 subjects participated, 78 in Turkey and 74 in Iran with 83 being female and 69 male. Their mean age was 29.5 years (SD 9.3), 62.5% had experienced tooth loss and 37.5% had complete (or completely restored) dentitions. Although there were no differences between the two countries in the degree of utility people attached to anterior teeth, Turkish participants attached significantly more disutility than Iranians to the loss of premolar and molar teeth (p health are influenced by prevalent cultural attitudes more than by function.

  1. Water relations in culture media influence maturation of avocado somatic embryos.

    Science.gov (United States)

    Márquez-Martín, Belén; Sesmero, Rafael; Quesada, Miguel A; Pliego-Alfaro, Fernando; Sánchez-Romero, Carolina

    2011-11-15

    Application of transformation and other biotechnological tools in avocado (Persea americana Mill.) is hampered by difficulties in obtaining mature somatic embryos capable of germination at an acceptable rate. In this work, we evaluated the effect of different compounds affecting medium water relations on maturation of avocado somatic embryos. Culture media were characterized with respect to gel strength, water potential and osmotic potential. Improved production of mature somatic embryos was achieved with gelling agent concentrations higher than those considered standard. The osmotic agents such as sorbitol and PEG did not have positive effects on embryo maturation. The number of w-o mature somatic embryos per culture was positively correlated with medium gel strength. Gel strength was significantly affected by gelling agent type as well as by gelling agent and PEG concentration. Medium water potential was influenced by sorbitol concentration; incorporation of PEG to a culture medium did not affect medium water potential. The highest maturation results were achieved on a medium gelled with 10 gl(-1) agar. Moreover, these somatic embryos had improved germination rates. These results corroborate the role of water restriction as a key factor controlling maturation of somatic embryos. Copyright © 2011 Elsevier GmbH. All rights reserved.

  2. Social Mobilization and Reaffirmation of Democratic Participation : The Brotherhood as Expression of a New Relational Culture

    Directory of Open Access Journals (Sweden)

    Helen Crystine Corrêa Sanches

    2016-05-01

    Full Text Available Democracy represents a fundamental right for citizens. Democracy and citizen par- ticipation are developing and they complement each other, given that there is no demo- cracy without the active and conscious participation of citizens in the political process. This democratic participation occurs through tools that enable the practice of citizenship, and, among them, the social movements stand out. There is a direct relationship between the social movements and democracy: whilst the social movements exist only in demo- cratic systems, democracy requires the participation of civil society with the state. The social movements consist on a structured organization that has the purpose of uniting people to defend and promote rights, containing social identity and a particular way of thinking and acting collectively to achieve the common good and a new sort of life. The particularities of the social movements let one glimpse that the major expression of civic participation contributes to a cultural change in society, given that, with common goals, the differences are overcome, encouraging a relatedness which looks for ethics, sharing and fraternity. The understanding of fraternity in its various forms – historical, political, legal and ethical – contributes to a development in respect among people, acceptance of socio-economic and cultural differences, emphasizing the feeling of a group belonging. This way, this article aims to analyse social movements and its cooperation in building a new relational culture, more Humane, Fair And Fraternal.

  3. Italian translation and cross-cultural comparison with the Childhood Attachment and Relational Trauma Screen (CARTS).

    Science.gov (United States)

    Simonelli, A; Sacchi, C; Cantoni, L; Brown, M; Frewen, P

    2017-01-01

    Background : The Childhood Attachment and Relational Trauma Screen (CARTS) is a computer-administered survey designed to assess retrospectively the socio-ecological context in which instances of child abuse may have occurred. To date, studies supporting the validity of the CARTS have only been undertaken in English-speaking North American populations. Validation projects in other countries and cross-cultural comparisons are therefore warranted. Objective : Develop and preliminarily evaluate the psychometric properties of an Italian version of the CARTS on college students and compare such observations to data acquired from Canadian students. Method : Seventy-nine undergraduate students from the University of Padua (Italy) completed an Italian translation of the CARTS as well as measures of childhood experiences, mental health and attachment, responses to which were compared to those obtained in 288 Canadian students who completed the CARTS in English. Results : Internal consistency and convergent validity with the Childhood Trauma Questionnaire and Parental Bonding Instrument were found to be acceptable for the Italian translation. Within the Italian sample, correlation analyses suggested that CARTS Mother ratings referring to attachment and abuse were associated with romantic attachment, whereas CARTS Father ratings were significantly correlated to PTSD symptoms and other symptoms of psychopathology-distress. Significant differences between Italian and Canadian students across the relationship types for the CARTS abuse and attachment scales were found, indicating that Italian students rated their mothers and fathers as simultaneously less abusive, but also less as a source of secure attachment. Conclusions : The results of this preliminary study seem to suggest convergent validity of the Italian CARTS and the association between childhood attachment-related experiences and romantic attachment. Cultural variations were identified between Canadian and Italian

  4. Cross-cultural variation in disease-related concerns among patients with inflammatory bowel disease.

    Science.gov (United States)

    Levenstein, S; Li, Z; Almer, S; Barbosa, A; Marquis, P; Moser, G; Sperber, A; Toner, B; Drossman, D A

    2001-06-01

    The aim of this work was to study cross-cultural variations in the impact of inflammatory bowel disease (IBD) on health-related quality of life by an international comparison of disease-related concerns. Item and factor scores on the Rating Form of Inflammatory Bowel Disease Patient Concerns and overall mean concern levels were compared by analysis of variance among 2002 IBD patients in eight countries. The overall level of concern varied from 51 out of 100 in Portugal to 19 in Sweden, with intermediate scores for Italy (43), Canada (40), United States (39), France (39), Austria (33), and Israel (25). Having surgery, an ostomy, the uncertain nature of the disease, and medication side effects were each rated among the first five in importance in six countries. Other items varied considerably. For example, concern regarding pain and suffering was high in Israel and low in Portugal, whereas concern over developing cancer was low in Italy. Concern over financial issues and access to high-quality health care were inversely associated with measures of national economic prosperity. 1) Cross-cultural comparisons of patient concerns related to IBD are feasible using translated scales. 2) Reporting tendencies vary greatly; within Europe, patients from southern countries report greater overall concern. 3) The complications and the variable evolution of disease elicit general concern, but the importance of specific issues varies among countries. 4) The reasons for national differences may have social, cultural, and/or economic determinants with relevance to the patient-physician relationship, patient education, and therapeutic decision making.

  5. Morphological, Cultural, Biochemical, and Serological Comparison of Japanese Strains of Vibrio parahemolyticus with Related Cultures Isolated in the United States

    Science.gov (United States)

    Twedt, Robert M.; Spaulding, Procter L.; Hall, Herbert E.

    1969-01-01

    Morphological, cultural, biochemical, and serological characteristics of 79 strains of Vibrio parahemolyticus isolated from patients suffering from gastroenteric disease in Japan were compared with 17 suspected V. parahemolyticus cultures isolated from wound infections and 14 nonpathogenic vibrios isolated from an estuarine environment in the United States. These groups were differentiated on the basis of several key reactions which included: the range of growth temperature and salt tolerance; the production of catalase and acetoin; the hydrolysis of starch; the fermentation and utilization as single carbon source of sucrose, cellobiose, and arabinose; and the ability to swarm on 1% agar. The separation of the groups on the basis of cultural and biochemical analyses was confirmed by means of slide agglutinations with specific anti-K antisera. The results of this study strongly suggest that the wound infection isolates are V. parahemolyticus species which are easily distinguished from the nonpathogenic estuarine vibrios. PMID:5784207

  6. Morphological, cultural, biochemical, and serological comparison of Japanese strains of Vibrio parahemolyticus with related cultures isolated in the United States.

    Science.gov (United States)

    Twedt, R M; Spaulding, P L; Hall, H E

    1969-05-01

    Morphological, cultural, biochemical, and serological characteristics of 79 strains of Vibrio parahemolyticus isolated from patients suffering from gastroenteric disease in Japan were compared with 17 suspected V. parahemolyticus cultures isolated from wound infections and 14 nonpathogenic vibrios isolated from an estuarine environment in the United States. These groups were differentiated on the basis of several key reactions which included: the range of growth temperature and salt tolerance; the production of catalase and acetoin; the hydrolysis of starch; the fermentation and utilization as single carbon source of sucrose, cellobiose, and arabinose; and the ability to swarm on 1% agar. The separation of the groups on the basis of cultural and biochemical analyses was confirmed by means of slide agglutinations with specific anti-K antisera. The results of this study strongly suggest that the wound infection isolates are V. parahemolyticus species which are easily distinguished from the nonpathogenic estuarine vibrios.

  7. [Trans-Cultural Prevention of Alcohol-Related Disorders in Elderly Immigrants].

    Science.gov (United States)

    Bermejo, I; Frank, F

    2015-09-01

    In migrants alcohol-related problems increase with increasing age. This group, in particular, is hardly reached by alcohol-specific care offers. Thus our project aimed at the identification of target group-specific barriers to health-care use by means of a cross-sectional study (n=435). Based on these results a trans-cultural concept for alcohol prevention among elderly migrants was developed and evaluated in a cluster-randomised controlled trial (n=176). © Georg Thieme Verlag KG Stuttgart · New York.

  8. Cultural repertoires and food-related household technology within colonia households under conditions of material hardship

    Directory of Open Access Journals (Sweden)

    Dean Wesley R

    2012-05-01

    Full Text Available Abstract Introduction Mexican-origin women in the U.S. living in colonias (new-destination Mexican-immigrant communities along the Texas-Mexico border suffer from a high incidence of food insecurity and diet-related chronic disease. Understanding environmental factors that influence food-related behaviors among this population will be important to improving the well-being of colonia households. This article focuses on cultural repertoires that enable food choice and the everyday uses of technology in food-related practice by Mexican-immigrant women in colonia households under conditions of material hardship. Findings are presented within a conceptual framework informed by concepts drawn from sociological accounts of technology, food choice, culture, and material hardship. Methods Field notes were provided by teams of promotora-researchers (indigenous community health workers and public-health professionals trained as participant observers. They conducted observations on three separate occasions (two half-days during the week and one weekend day within eight family residences located in colonias near the towns of Alton and San Carlos, Texas. English observations were coded inductively and early observations stressed the importance of technology and material hardship in food-related behavior. These observations were further explored and coded using the qualitative data package Atlas.ti. Results Technology included kitchen implements used in standard and adapted configurations and household infrastructure. Residents employed tools across a range of food-related activities identified as forms of food acquisition, storage, preparation, serving, feeding and eating, cleaning, and waste processing. Material hardships included the quality, quantity, acceptability, and uncertainty dimensions of food insecurity, and insufficient consumption of housing, clothing and medical care. Cultural repertoires for coping with material hardship included reliance on

  9. Cultural repertoires and food-related household technology within colonia households under conditions of material hardship.

    Science.gov (United States)

    Dean, Wesley R; Sharkey, Joseph R; Johnson, Cassandra M; St John, Julie

    2012-05-15

    BSTRACT: Mexican-origin women in the U.S. living in colonias (new-destination Mexican-immigrant communities) along the Texas-Mexico border suffer from a high incidence of food insecurity and diet-related chronic disease. Understanding environmental factors that influence food-related behaviors among this population will be important to improving the well-being of colonia households. This article focuses on cultural repertoires that enable food choice and the everyday uses of technology in food-related practice by Mexican-immigrant women in colonia households under conditions of material hardship. Findings are presented within a conceptual framework informed by concepts drawn from sociological accounts of technology, food choice, culture, and material hardship. Field notes were provided by teams of promotora-researchers (indigenous community health workers) and public-health professionals trained as participant observers. They conducted observations on three separate occasions (two half-days during the week and one weekend day) within eight family residences located in colonias near the towns of Alton and San Carlos, Texas. English observations were coded inductively and early observations stressed the importance of technology and material hardship in food-related behavior. These observations were further explored and coded using the qualitative data package Atlas.ti. Technology included kitchen implements used in standard and adapted configurations and household infrastructure. Residents employed tools across a range of food-related activities identified as forms of food acquisition, storage, preparation, serving, feeding and eating, cleaning, and waste processing. Material hardships included the quality, quantity, acceptability, and uncertainty dimensions of food insecurity, and insufficient consumption of housing, clothing and medical care. Cultural repertoires for coping with material hardship included reliance on inexpensive staple foods and dishes, and

  10. Acute Fetal Demise with First Trimester Maternal Infection Resulting from Listeria monocytogenes in a Nonhuman Primate Model

    Science.gov (United States)

    Wolfe, Bryce; Wiepz, Gregory J.; Schotzko, Michele; Bondarenko, Gennadiy I.; Durning, Maureen; Simmons, Heather A.; Mejia, Andres; Faith, Nancy G.; Sampene, Emmanuel; Suresh, Marulasiddappa; Kathariou, Sophia; Czuprynski, Charles J.

    2017-01-01

    ABSTRACT Infection with Listeria monocytogenes during pregnancy is associated with miscarriage, preterm birth, and neonatal complications, including sepsis and meningitis. While the risk of these conditions is thought to be greatest during the third trimester of pregnancy, the determinants of fetoplacental susceptibility to infection, the contribution of gestational age, and the in vivo progression of disease at the maternal-fetal interface are poorly understood. We developed a nonhuman primate model of listeriosis to better understand antecedents of adverse pregnancy outcomes in early pregnancy. Four pregnant cynomolgus macaques (Macaca fascicularis) received a single intragastric inoculation between days 36 and 46 of gestation with 107 CFU of an L. monocytogenes strain isolated from a previous cluster of human listeriosis cases that resulted in adverse pregnancy outcomes. Fecal shedding, maternal bacteremia, and fetal demise were consistently noted within 7 to 13 days. Biopsy specimens of maternal liver, spleen, and lymph node displayed variable inflammation and relatively low bacterial burden. In comparison, we observed greater bacterial burden in the decidua and placenta and the highest burden in fetal tissues. Histopathology indicated vasculitis, fibrinoid necrosis, and thrombosis of the decidual spiral arteries, acute chorioamnionitis and villitis in the placenta, and hematogenous infection of the fetus. Vascular pathology suggests early impact of L. monocytogenes infection on spiral arteries in the decidua, which we hypothesize precipitates subsequent placentitis and fetal demise. These results demonstrate that L. monocytogenes tropism for the maternal reproductive tract results in infection of the decidua, placenta, and the fetus itself during the first trimester of pregnancy. PMID:28223455

  11. Related and autonomous: Cultural perspectives on self, acculturation and adjustment:Verbonden en autonoom: Culturele perspectieven op het zelf, acculturatie en aanpassing

    OpenAIRE

    Coskan, Canan

    2016-01-01

    How are culturally valued ways of being and relating reflected in different self-construals across individualistic and collectivistic cultural contexts? What happens to the self-construal of acculturating persons from a collectivistic cultural background who either migrate to, or who are born into, individualistic mainstream cultures? Self-construals – how people define themselves in relation to others – differ between cultures. I conceive of the self as culturally informed and socially groun...

  12. Applicability of the EN ISO 11290-1 standard method for Listeria monocytogenes detection in presence of new Listeria species.

    Science.gov (United States)

    Barre, Léna; Angelidis, Apostolos S; Boussaid, Djouher; Brasseur, Emilie Decourseulles; Manso, Eléonore; Gnanou Besse, Nathalie

    2016-12-05

    During the past six years, new species of the genus Listeria have been isolated from foods and other environmental niches worldwide. The Standard method EN ISO 11290-1 that is currently under revision will include in its scope all Listeria species in addition to L. monocytogenes. The objective of this project was to evaluate the ability of the Standard EN ISO 11290-1 method to detect and identify the newly discovered Listeria spp., and to assess potential over-growth effects of the new species in mixed cultures with L. monocytogenes during each step of the enrichment process. This objective was addressed by the generation of necessary data on the behavior of the new species during the pre-enrichment and the enrichment steps of the reference method as well as data on their phenotypic characteristics on rich and selective media used for isolation and identification. Most of the new Listeria species developed well on selective agar media for Listeria, however the recovery of some species was difficult due to poor growth in Half Fraser and Fraser broth. Good results (consistently positive) were obtained for confirmation at the genus level via the catalase test, the Gram test and the blueish appearance test on non-selective medium, but not with the VP test, as most of the new species yielded a negative result. In the light of results obtained in co-culture experiments and inhibition tests, and considering the growth rates in Half Fraser and Fraser broths, the new species do not seem to interfere with the detection of L. monocytogenes. Copyright © 2016 Elsevier B.V. All rights reserved.

  13. Listeria monocytogenes differential transcriptome analysis reveals temperature-dependent Agr regulation and suggests overlaps with other regulons.

    Science.gov (United States)

    Garmyn, Dominique; Augagneur, Yoann; Gal, Laurent; Vivant, Anne-Laure; Piveteau, Pascal

    2012-01-01

    Listeria monocytogenes is a ubiquitous, opportunistic pathogenic organism. Environmental adaptation requires constant regulation of gene expression. Among transcriptional regulators, AgrA is part of an auto-induction system. Temperature is an environmental cue critical for in vivo adaptation. In order to investigate how temperature may affect AgrA-dependent transcription, we compared the transcriptomes of the parental strain L. monocytogenes EGD-e and its ΔagrA mutant at the saprophytic temperature of 25°C and in vivo temperature of 37°C. Variations of transcriptome were higher at 37°C than at 25°C. Results suggested that AgrA may be involved in the regulation of nitrogen transport, amino acids, purine and pyrimidine biosynthetic pathways and phage-related functions. Deregulations resulted in a growth advantage at 37°C, but affected salt tolerance. Finally, our results suggest overlaps with PrfA, σB, σH and CodY regulons. These overlaps may suggest that through AgrA, Listeria monocytogenes integrates information on its biotic environment.

  14. The Influence of the Toxin/Antitoxin mazEF on Growth and Survival of Listeria monocytogenes under Stress.

    Science.gov (United States)

    Curtis, Thomas D; Takeuchi, Ippei; Gram, Lone; Knudsen, Gitte M

    2017-01-13

    A major factor in the resilience of Listeria monocytogenes is the alternative sigma factor B (σ B ). Type II Toxin/Antitoxin (TA) systems are also known to have a role in the bacterial stress response upon activation via the ClpP or Lon proteases. Directly upstream of the σ B operon in L. monocytogenes is the TA system mazEF , which can cleave mRNA at UACMU sites. In this study, we showed that the mazEF TA locus does not affect the level of persister formation during treatment with antibiotics in lethal doses, but exerts different effects according to the sub-inhibitory stress added. Growth of a Δ mazEF mutant was enhanced relative to the wildtype in the presence of sub-inhibitory norfloxacin and at 42 °C, but was decreased when challenged with ampicillin and gentamicin. In contrast to studies in Staphylococcus aureus , we found that the mazEF locus did not affect transcription of genes within the σ B operon, but MazEF effected the expression of the σ B -dependent genes opuCA and lmo0880 , with a 0.22 and 0.05 fold change, respectively, compared to the wildtype under sub-inhibitory norfloxacin conditions. How exactly this system operates remains an open question, however, our data indicates it is not analogous to the system of S. aureus , suggesting a novel mode of action for MazEF in L. monocytogenes.

  15. Examining How Proactive Management and Culturally Responsive Teaching Relate to Student Behavior: Implications for Measurement and Practice

    Science.gov (United States)

    Larson, Kristine E.; Pas, Elise T.; Bradshaw, Catherine P.; Rosenberg, Michael S.; Day-Vines, Norma L.

    2018-01-01

    The discipline gap between White students and African American students has increased demand for teacher training in culturally responsive and behavior management practices. Extant research, however, is inconclusive about how culturally responsive teaching practices relate to student behavior or how to assess using such practices in the classroom.…

  16. An Organizational Culture Study of Missouri State University Faculty/Staff in Relation to the University's Public Affair Mission

    Science.gov (United States)

    Weaver, Marissa LeClaire

    2012-01-01

    The purpose of the study was to address a problem of practice of the public affairs mission through the perceptions of faculty and staff members at Missouri State University of the University's organizational culture. The design included a phenomenological study with a set of organizational culture procedural questions related to the perceptions…

  17. Genotyping of Listeria monocytogenes isolates from poultry carcasses using high resolution melting (HRM) analysis.

    Science.gov (United States)

    Sakaridis, Ioannis; Ganopoulos, Ioannis; Madesis, Panagiotis; Tsaftaris, Athanasios; Argiriou, Anagnostis

    2014-01-02

    An outbreak situation of human listeriosis requires a fast and accurate protocol for typing Listeria monocytogenes . Existing techniques are either characterized by low discriminatory power or are laborious and require several days to give a final result. Polymerase chain reaction (PCR) coupled with high resolution melting (HRM) analysis was investigated in this study as an alternative tool for a rapid and precise genotyping of L. monocytogenes isolates. Fifty-five isolates of L. monocytogenes isolated from poultry carcasses and the environment of four slaughterhouses were typed by HRM analysis using two specific markers, internalin B and ssrA genes. The analysis of genotype confidence percentage of L. monocytogenes isolates produced by HRM analysis generated dendrograms with two major groups and several subgroups. Furthermore, the analysis of the HRM curves revealed that all L. monocytogenes isolates could easily be distinguished. In conclusion, HRM was proven to be a fast and powerful tool for genotyping isolates of L. monocytogenes .

  18. Restraining reactive oxygen species in Listeria monocytogenes promotes the apoptosis of glial cells.

    Science.gov (United States)

    Li, Sen; Li, Yixuan; Chen, Guowei; Zhang, Jingchen; Xu, Fei; Wu, Man

    2017-07-01

    Listeria monocytogenes is a facultative anaerobic foodborne pathogen that can traverse the blood-brain barrier and cause brain infection. L. monocytogenes infection induces host cell apoptosis in several cell types. In this study, we investigated the apoptosis of human glioma cell line U251 invaded by L. monocytogenes and evaluated the function of bacterial reactive oxygen species (ROS) during infection. Bacterial ROS level was reduced by carrying out treatment with N-acetyl cysteine (NAC) and diphenyleneiodonium chloride (DPI). After infection, the apoptosis of U251 cells was examined by flow cytometry assay and propidium iodide staining. DPI and NAC efficiently decreased ROS level in L. monocytogenes without affecting bacterial growth. Moreover, the apoptosis of glial cells was enhanced upon invasion of DPI- and NAC-pretreated L. monocytogenes. Results indicate that the apoptosis of glial cells can be induced by L. monocytogenes, and that the inhibition of bacterial ROS increases the apoptosis of host cells.

  19. Leadership, Peer Relationship, and Transformational Organizational Culture: A Relational Approach to a Taiwan College Music Faculty Sample

    Science.gov (United States)

    Ji, Chang-Ho C.; Chuang, Ching-Mien

    2012-01-01

    This paper explores how leadership and peer relation relate to the propensity of college music departments to develop transformational organizational culture. Our theory of relational leadership and peer relation has initially allowed us to formulate expectations for the affirmative impacts of professional and personal leadership and peer relation…

  20. Tracking Listeria monocytogenes contamination and virulence-associated characteristics in the ready-to-eat meat-based food products industry according to the hygiene level.

    Science.gov (United States)

    Henriques, A R; Gama, L T; Fraqueza, M J

    2017-02-02

    Listeria monocytogenes isolates collected from final products and food contact surfaces of 10 ready-to-eat meat-based food products (RTEMP) producing industries were analyzed to relate their virulence-associated characteristics and genetic profiles with the hygiene assessment of those industries. Together with sample collection, an audit was performed to evaluate the implemented food safety management system and to investigate the specific audit requisites more associated to the occurrence of those L. monocytogenes serogroups frequently related with human disease. L. monocytogenes was present in 18% of the samples. The isolates (n=62) were serogrouped and detection of virulence-associated genes inlA, inlB, inlC and inlJ, and also plcA, hlyA, actA and iap was done by multiplex PCR. After this initial characterization, selected isolates (n=31) were submitted to antibiotic resistance testing by the disk diffusion method for the currently most used human and veterinary antibiotics and resistance was low. These isolates were also subtyped by pulsed-field gel electrophoresis. Genotyping and serogrouping of L. monocytogenes isolates revealed a genetically diverse population. Our data indicate that contamination of final products does not seem to be uniquely related to the sampled food surfaces. The occurrence of those L. monocytogenes serogroups more commonly associated with human disease in industries with a high hygienic audit classification could be the result of a previous identification of the pathogen, with an enforcement of the hygiene program without recognizing the real source of contamination. This reinforces the importance of a conjoined diagnosis using audit data and microbiological testing. Food safety management systems of those industries need improvement, particularly in cleaning and sanitizing operations, analytical control, preventive maintenance, personal hygiene and root cause analysis. Copyright © 2016. Published by Elsevier B.V.

  1. Estimation of Listeria monocytogenes and Escherichia coli O157:H7 prevalence and levels in naturally contaminated rocket and cucumber samples by deterministic and stochastic approaches.

    Science.gov (United States)

    Hadjilouka, Agni; Mantzourani, Kyriaki-Sofia; Katsarou, Anastasia; Cavaiuolo, Marina; Ferrante, Antonio; Paramithiotis, Spiros; Mataragas, Marios; Drosinos, Eleftherios H

    2015-02-01

    The aims of the present study were to determine the prevalence and levels of Listeria monocytogenes and Escherichia coli O157:H7 in rocket and cucumber samples by deterministic (estimation of a single value) and stochastic (estimation of a range of values) approaches. In parallel, the chromogenic media commonly used for the recovery of these microorganisms were evaluated and compared, and the efficiency of an enzyme-linked immunosorbent assay (ELISA)-based protocol was validated. L. monocytogenes and E. coli O157:H7 were detected and enumerated using agar Listeria according to Ottaviani and Agosti plus RAPID' L. mono medium and Fluorocult plus sorbitol MacConkey medium with cefixime and tellurite in parallel, respectively. Identity was confirmed with biochemical and molecular tests and the ELISA. Performance indices of the media and the prevalence of both pathogens were estimated using Bayesian inference. In rocket, prevalence of both L. monocytogenes and E. coli O157:H7 was estimated at 7% (7 of 100 samples). In cucumber, prevalence was 6% (6 of 100 samples) and 3% (3 of 100 samples) for L. monocytogenes and E. coli O157:H7, respectively. The levels derived from the presence-absence data using Bayesian modeling were estimated at 0.12 CFU/25 g (0.06 to 0.20) and 0.09 CFU/25 g (0.04 to 0.170) for L. monocytogenes in rocket and cucumber samples, respectively. The corresponding values for E. coli O157:H7 were 0.59 CFU/25 g (0.43 to 0.78) and 1.78 CFU/25 g (1.38 to 2.24), respectively. The sensitivity and specificity of the culture media differed for rocket and cucumber samples. The ELISA technique had a high level of cross-reactivity. Parallel testing with at least two culture media was required to achieve a reliable result for L. monocytogenes or E. coli O157:H7 prevalence in rocket and cucumber samples.

  2. Influence of Cultural Belief and Values on Secondary School Students' Understanding of Atmospheric Related Physics Concepts

    Science.gov (United States)

    Bello, Theodora Olufunke

    2015-01-01

    The study identified the different cultural concepts that secondary school students' believe in and determined the belief and idea of students about the cultural concepts. It also investigated students' source of information about the cultural concepts and determined the influence of these cultural believes on students' academic performance in…

  3. Exploring the diversity of Listeria monocytogenes biofilm architecture by high-throughput confocal laser scanning microscopy and the predominance of the honeycomb-like morphotype.

    Science.gov (United States)

    Guilbaud, Morgan; Piveteau, Pascal; Desvaux, Mickaël; Brisse, Sylvain; Briandet, Romain

    2015-03-01

    Listeria monocytogenes is involved in food-borne illness with a high mortality rate. The persistence of the pathogen along the food chain can be associated with its ability to form biofilms on inert surfaces. While most of the phenotypes associated with biofilms are related to their spatial organization, most published data comparing biofilm formation by L. monocytogenes isolates are based on the quantitative crystal violet assay, which does not give access to structural information. Using a high-throughput confocal-imaging approach, the aim of this work was to decipher the structural diversity of biofilms formed by 96 L. monocytogenes strains isolated from various environments. Prior to large-scale analysis, an experimental design was created to improve L. monocytogenes biofilm formation in microscopic-grade microplates, with special emphasis on the growth medium composition. Microscopic analysis of biofilms formed under the selected conditions by the 96 isolates revealed only weak correlation between the genetic lineages of the isolates and the structural properties of the biofilms. However, a gradient in their geometric descriptors (biovolume, mean thickness, and roughness), ranging from flat multilayers to complex honeycomb-like structures, was shown. The dominant honeycomb-like morphotype was characterized by hollow voids hosting free-swimming cells and localized pockets containing mixtures of dead cells and extracellular DNA (eDNA). Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  4. Transcriptomic Analysis of the Adaptation of Listeria monocytogenes to Lagoon and Soil Matrices Associated with a Piggery Environment: Comparison of Expression Profiles.

    Science.gov (United States)

    Vivant, Anne-Laure; Desneux, Jeremy; Pourcher, Anne-Marie; Piveteau, Pascal

    2017-01-01

    Understanding how Listeria monocytogenes , the causative agent of listeriosis, adapts to the environment is crucial. Adaptation to new matrices requires regulation of gene expression. To determine how the pathogen adapts to lagoon effluent and soil, two matrices where L. monocytogenes has been isolated, we compared the transcriptomes of L. monocytogenes CIP 110868 20 min and 24 h after its transfer to effluent and soil extract. Results showed major variations in the transcriptome of L. monocytogenes in the lagoon effluent but only minor modifications in the soil. In both the lagoon effluent and in the soil, genes involved in mobility and chemotaxis and in the transport of carbohydrates were the most frequently represented in the set of genes with higher transcript levels, and genes with phage-related functions were the most represented in the set of genes with lower transcript levels. A modification of the cell envelop was only found in the lagoon environment. Finally, the differential analysis included a large proportion of regulators, regulons, and ncRNAs.

  5. Transcriptomic Analysis of the Adaptation of Listeria monocytogenes to Lagoon and Soil Matrices Associated with a Piggery Environment: Comparison of Expression Profiles

    Science.gov (United States)

    Vivant, Anne-Laure; Desneux, Jeremy; Pourcher, Anne-Marie; Piveteau, Pascal

    2017-01-01

    Understanding how Listeria monocytogenes, the causative agent of listeriosis, adapts to the environment is crucial. Adaptation to new matrices requires regulation of gene expression. To determine how the pathogen adapts to lagoon effluent and soil, two matrices where L. monocytogenes has been isolated, we compared the transcriptomes of L. monocytogenes CIP 110868 20 min and 24 h after its transfer to effluent and soil extract. Results showed major variations in the transcriptome of L. monocytogenes in the lagoon effluent but only minor modifications in the soil. In both the lagoon effluent and in the soil, genes involved in mobility and chemotaxis and in the transport of carbohydrates were the most frequently represented in the set of genes with higher transcript levels, and genes with phage-related functions were the most represented in the set of genes with lower transcript levels. A modification of the cell envelop was only found in the lagoon environment. Finally, the differential analysis included a large proportion of regulators, regulons, and ncRNAs. PMID:29018416

  6. Collection of Listeria monocytogenes Isolates from Milk, Dairy Products and Food Processing Environments in Slovakia for the Purposes of European Molecular Database

    Directory of Open Access Journals (Sweden)

    Kubicová Z.

    2017-03-01

    Full Text Available The molecular typing of Listeria monocytogenes isolates is an important tool for monitoring the spread of the strains in food chains, providing evidence for epidemiological investigations and for the detection of out-breaks. The demand of European typing data centralization, collection and sharing stimulated the generation of “EURL L. monocytogenes Database (EURL Lm DB” in 2012 led by the European Union Reference Laboratory (EURL for L. monocytogenes (ANSES Maisons-Alfort Laboratory for Food Safety, France in close collaboration with Applied Maths. This database includes the typing results and epidemiological information on strains isolated from food, environmental or animal samples and it is in connection with human strains database TESSy (The European Surveillance System led by the ECDC (European Centre for Disease Prevention and Control. In total 147 L. monocytogenes isolates were examined by PFGE (pulsed field gel electrophoresis in 2014—2015 in VFI Dolny Kubin from different sources. Nearly half (68 of the 147 isolates in the national Slovak database came from milk or dairy products samples and the related manufacturing environment. In this work, 68 isolates associated with milk were selected and divided into 27 clusters (95 % similarity level after combined comparison analysis (AscI and ApaI by BioNumerics 6.6 software. Eight clusters included three or more similar PFGE profiles.

  7. L. monocytogenes in a cheese processing facility: Learning from contamination scenarios over three years of sampling.

    Science.gov (United States)

    Rückerl, I; Muhterem-Uyar, M; Muri-Klinger, S; Wagner, K-H; Wagner, M; Stessl, B

    2014-10-17

    The aim of this study was to analyze the changing patterns of Listeria monocytogenes contamination in a cheese processing facility manufacturing a wide range of ready-to-eat products. Characterization of L. monocytogenes isolates included genotyping by pulsed-field gel electrophoresis (PFGE) and multi-locus sequence typing (MLST). Disinfectant-susceptibility tests and the assessment of L. monocytogenes survival in fresh cheese were also conducted. During the sampling period between 2010 and 2013, a total of 1284 environmental samples were investigated. Overall occurrence rates of Listeria spp. and L. monocytogenes were 21.9% and 19.5%, respectively. Identical L. monocytogenes genotypes were found in the food processing environment (FPE), raw materials and in products. Interventions after the sampling events changed contamination scenarios substantially. The high diversity of globally, widely distributed L. monocytogenes genotypes was reduced by identifying the major sources of contamination. Although susceptible to a broad range of disinfectants and cleaners, one dominant L. monocytogenes sequence type (ST) 5 could not be eradicated from drains and floors. Significantly, intense humidity and steam could be observed in all rooms and water residues were visible on floors due to increased cleaning strategies. This could explain the high L. monocytogenes contamination of the FPE (drains, shoes and floors) throughout the study (15.8%). The outcome of a challenge experiment in fresh cheese showed that L. monocytogenes could survive after 14days of storage at insufficient cooling temperatures (8 and 16°C). All efforts to reduce L. monocytogenes environmental contamination eventually led to a transition from dynamic to stable contamination scenarios. Consequently, implementation of systematic environmental monitoring via in-house systems should either aim for total avoidance of FPE colonization, or emphasize a first reduction of L. monocytogenes to sites where

  8. Internalization of Listeria monocytogenes in cantaloupes during dump tank washing and hydrocooling.

    Science.gov (United States)

    Macarisin, Dumitru; Wooten, Anna; De Jesus, Antonio; Hur, Minji; Bae, Seonjae; Patel, Jitendra; Evans, Peter; Brown, Eric; Hammack, Thomas; Chen, Yi

    2017-09-18

    Recent listeriosis outbreaks and recalls associated with cantaloupes urge for studies to understand the mechanisms of cantaloupe contamination by Listeria monocytogenes. Postharvest practices such as washing and hydrocooling were suggested to facilitate the contamination of fresh fruits by human pathogens. This study assessed the potential of L. monocytogenes internalization into cantaloupes during dump tank washing and immersion-type hydrocooling in water contaminated with L. monocytogenes. The effect of cantaloupe cultivar, water temperature, and harvesting technique on L. monocytogenes internalization was also evaluated. Full slip (cantaloupe without any residual stem) Western and Eastern cultivar cantaloupes were pre-warmed to 42°C (to imitate peak-high field temperatures of freshly harvested cantaloupes) and then immersed in water at 6°C and 18°C containing 4 and 6logCFU/ml of L. monocytogenes. Clipped (cantaloupe with short stem residues obtained by clipping the stem at harvest) Western and Eastern cantaloupes were pre-warmed to 42°C and then immersed in water at 6°C containing 6logCFU/ml of L. monocytogenes. Additionally, full slip and clipped Western cantaloupes were equilibrated to 18°C and then immersed in water at 18°C containing 6logCFU/ml of L. monocytogenes (isothermal immersion without temperature differential). Water containing L. monocytogenes infiltrated both full slip and clipped cantaloupes through the stems/stem scars and was then distributed along the vascular system in hypodermal mesocarp reaching the calyx area of the fruit. The current study demonstrated that, under experimental conditions, L. monocytogenes can internalize into cantaloupes during immersion in water contaminated by L. monocytogenes, both in the presence and absence of temperature differential, and that temperature differential moderately enhanced the internalization of L. monocytogenes. The incidence and levels of L. monocytogenes internalized in the middle

  9. Prevalence of Listeria monocytogenes, Yersinia enterocolitica, Staphylococcus aureus, and Salmonella enterica Typhimurium in meat and meat products using multiplex polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    C. Latha

    2017-08-01

    Full Text Available Aim: The objective of the study was to investigate the occurrence of Listeria monocytogenes, Yersinia enterocolitica, Staphylococcus aureus, and Salmonella enterica Typhimurium in meat and meat products using the multiplex polymerase chain reaction (PCR method. Materials and Methods: The assay combined an enrichment step in tryptic soy broth with yeast extract formulated for the simultaneous growth of target pathogens, DNA isolation and multiplex PCR. A total of 1134 samples including beef (n=349, chicken (n=325, pork (n=310, chevon (n=50, and meat products (n=100 were collected from different parts of Kerala, India. All the samples were subjected to multiplex PCR analysis and culture-based detection for the four pathogens in parallel. Results: Overall occurrence of L. monocytogenes was 0.08 % by cultural method. However, no L. monocytogenes was obtained by multiplex PCR method. Yersinia enterocolitica was obtained from beef and pork samples. A high prevalence of S. aureus (46.7% was found in all types of meat samples tested. None of the samples was positive for S. Typhimurium. Conclusion: Multiplex PCR assay used in this study can detect more than one pathogen simultaneously by amplifying more than one target gene in a single reaction, which can save time and labor cost.

  10. Apoptosis related genes expressed in cultured Fallopian tube epithelial cells infected in vitro with Neisseria gonorrhoeae

    Directory of Open Access Journals (Sweden)

    PAZ A REYES

    2007-01-01

    Full Text Available Background: Infection of the Fallopian tubes (FT by Neisseria gonorrhoeae (Ngo can lead to acute salpingitis, an inflammatory condition resulting in damage primarily to the ciliated cells, with loss of ciliary activity and sloughing of the cells from the epithelium. Recently, we have shown that Ngo infection induced apoptosis in FT epithelium cells by a TNF-alpha dependent mechanism that could contribute to the cell and tissue damage observed in gonococcal salpingitis. Aim: To investigate the apoptosis-related genes expressed during apoptosis induction in cultured FT epithelial cells infected in vitro by Ngo. Materials and Methods: In the current study, we used cDNA macroarrays and real time PCR to identify and determine the expression levels of apoptosis related genes during the in vitro gonococci infection of FT epithelial cells. Results: Significant apoptosis was induced following infection with Ngo. Macroarray analysis identified the expression of multiple genes of the TNF receptor family (TNFRSF1B, -4, -6, -10A, -10B and -10D and the Bcl-2 family (BAK1, BAX, BLK, HRK and MCL-1 without differences between controls and infected cells. This lack of difference was confirmed by RT-PCR of BAX, Bcl-2, TNFRS1A (TNFR-I and TNFRSF1B (TNFR-II. Conclusion: Several genes related to apoptosis are expressed in primary cultures of epithelial cells of the human Fallopian tube. Infection with Ngo induces apoptosis without changes in the pattern of gene expression of several apoptosis-related genes. Results strongly suggest that Ngo regulates apoptosis in the FT by post-transcriptional mechanisms that need to be further addressed

  11. Listeria monocytogenes Strains Underrepresented during Selective Enrichment with an ISO Method Might Dominate during Passage through Simulated Gastric Fluid and In Vitro Infection of Caco-2 Cells

    Science.gov (United States)

    Zilelidou, Evangelia; Karmiri, Christina-Vasiliki; Zoumpopoulou, Georgia; Mavrogonatou, Eleni; Kletsas, Dimitris; Tsakalidou, Effie; Papadimitriou, Konstantinos; Drosinos, Eleftherios

    2016-01-01

    ABSTRACT Various Listeria monocytogenes strains may contaminate a single food product, potentially resulting in simultaneous exposure of consumers to multiple strains. However, due to bias in strain recovery, L. monocytogenes strains isolated from foods by selective enrichment (SE) might not always represent those that can better survive the immune system of a patient. We investigated the effect of cocultivation in tryptic soy broth with 0.6% yeast extract (TSB-Y) at 10°C for 8 days on (i) the detection of L. monocytogenes strains during SE with the ISO 11290-1:1996/Amd 1:2004 protocol and (ii) the in vitro virulence of strains toward the Caco-2 human colon epithelial cancer cell line following exposure to simulated gastric fluid (SGF; pH 2.0)-HCl (37°C). We determined whether the strains which were favored by SE would be effective competitors under the conditions of challenges related to gastrointestinal passage of the pathogen. Interstrain competition of L. monocytogenes in TSB-Y determined the relative population of each strain at the beginning of SE. This in turn impacted the outcome of SE (i.e., favoring survival of competitors with better fitness) and the levels exposed subsequently to SGF. However, strong growth competitors could be outcompeted after SGF exposure and infection of Caco-2 cells by strains outgrown in TSB-Y and underdetected (or even missed) during enrichment. Our data demonstrate a preferential selection of certain L. monocytogenes strains during enrichments, often not reflecting a selective advantage of strains during infection. These findings highlight a noteworthy scenario associated with the difficulty of matching the source of infection (food) with the L. monocytogenes isolate appearing to be the causative agent during listeriosis outbreak investigations. IMPORTANCE This report is relevant to understanding the processes involved in selection and prevalence of certain L. monocytogenes strains in different environments (i.e., foods or

  12. Diferenciação entre Listeria monocytogenes e Erysipelothrix rhusiopathiae com o clorêto de Trifeniltetrazólio

    Directory of Open Access Journals (Sweden)

    Vinicius Moreira Dias

    1958-12-01

    Full Text Available Experiências foram realizadas com bactérias dos gêneros Listeria e Erysipelothrix, em meios líquido e sólido, utilizando o clorêto de 2, 3, 5 - trifeniltetrazólio. A atividade enzimática redutora das listérias para o TTC foi diferente da do E. rhusiopathiae, principalmente em meio líquido e nas horas iniciais de observação. Preparações feitas para microscopia ótica e electrônica dos germes tratados com TTC revelaram a presença de granulações polares, bipolares e centrais dentro do corpo das listérias. A evidenciação de granulações coradas de formazana, intracelulares nas listérias, confirma estudos anteriores quanto à possibilidade da existência de mitocôndrias nas bactérias.Based on a similarity of cultural and biochemical properties, WILSON and MILLES (6 compared the microorganisms of listeriosis with those of swine erysipelas including them in the genus Erysipelothrix with the species E. monocytogenes and E. rhusiopathiae. However, BARBER (1 and JULIANELLE (4, in a comparative study of both microorganisms, do not admit that possibility. Observing the morphological and citochemical characteristics of L. monocytogenes (N.º 7 973, 5 348, 5 105, 5 214, of the Seeliger collection and E. ehusiopathiae cultures (N.º 1, 7, 11, 27, 37, of the WIX collection, both in phase "S", we were able to verify their comparative behavior when in contact with 2-3-5-triphenyltetrazolium chloride (TTC, "Synthetical Laboratories, Chicago, U.S.A". 1. To 1,0 ml of cultures of both microorganisms grown in plain broth plus 5% horse serum for 24 hours at 37ºC, 0.1 ml of sterilized 1% aqueous solution of TTC was added. The tubes were left at room temperature (± 25ºC or in the incubator (37ºC. In the tubes with L. monocytogenes immediately appeared a red coloration (fig. 1 characteristic of formazan production, that became gradually more pronounced, from bottom to top (figs. 2, 3, 4, 5; at the and of 24 hours the color was intense the tube

  13. Presence of Listeria monocytogenes in Mediterranean-Style Dry Fermented Sausages

    Directory of Open Access Journals (Sweden)

    Domenico Meloni

    2015-03-01

    Full Text Available The morphological, physiological and epidemiological features of L. monocytogenes, together with the severity of human listeriosis infections, make L. monocytogenes of particular concern for manufacturers of cold-stored “ready to eat” (RTE foods. L. monocytogenes has been isolated from a wide variety of RTE foods and is responsible for several outbreaks associated with the consumption of RTE meat, poultry, dairy, fish and vegetable products. Although L. monocytogenes is among the most frequently-detected pathogens in dry fermented sausages, these products could be included in the category of RTE products in which the growth of L. monocytogenes is not favored and have rarely been implicated in listeriosis outbreaks. However, L. monocytogenes is highly difficult to control in fermented sausage processing environments due to its high tolerance to low pH and high salt concentration. In many Mediterranean-style dry fermented sausages, an empirical application of the hurdle technology often occurs and the frequent detection of L. monocytogenes in these products at the end of ripening highlights the need for food business operators to properly apply hurdle technology and to control the contamination routes of L. monocytogenes in the processing plants. In the following, through an up-to-date review of (personal and un- published data, the main aspects of the presence of L. monocytogenes in Mediterranean-style dry fermented sausages will be discussed.

  14. Presence of Listeria monocytogenes in Mediterranean-Style Dry Fermented Sausages.

    Science.gov (United States)

    Meloni, Domenico

    2015-03-12

    The morphological, physiological and epidemiological features of L. monocytogenes , together with the severity of human listeriosis infections, make L. monocytogenes of particular concern for manufacturers of cold-stored "ready to eat" (RTE) foods. L. monocytogenes has been isolated from a wide variety of RTE foods and is responsible for several outbreaks associated with the consumption of RTE meat, poultry, dairy, fish and vegetable products. Although L. monocytogenes is among the most frequently-detected pathogens in dry fermented sausages, these products could be included in the category of RTE products in which the growth of L. monocytogenes is not favored and have rarely been implicated in listeriosis outbreaks. However, L. monocytogenes is highly difficult to control in fermented sausage processing environments due to its high tolerance to low pH and high salt concentration. In many Mediterranean-style dry fermented sausages, an empirical application of the hurdle technology often occurs and the frequent detection of L. monocytogenes in these products at the end of ripening highlights the need for food business operators to properly apply hurdle technology and to control the contamination routes of L. monocytogenes in the processing plants. In the following, through an up-to-date review of (personal and un-) published data, the main aspects of the presence of L. monocytogenes in Mediterranean-style dry fermented sausages will be discussed.

  15. Analysing and modelling the growth behaviour of Listeria monocytogenes on RTE cooked meat products after a high pressure treatment at 400 MPa.

    Science.gov (United States)

    Hereu, A; Dalgaard, P; Garriga, M; Aymerich, T; Bover-Cid, S

    2014-09-01

    Various predictive models are available for high pressure inactivation of Listeria monocytogenes in food, but currently available models do not consider the growth kinetics of surviving cells during the subsequent storage of products. Therefore, we characterised the growth of L. monocytogenes in sliced cooked meat products after a pressurization treatment. Two inoculum levels (10(7) or 10(4) CFU/g) and two physiological states before pressurization (freeze-stressed or cold-adapted) were evaluated. Samples of cooked ham and mortadella were inoculated, high pressure processed (400 MPa, 5 min) and subsequently stored at 4, 8 and 12 °C. The Logistic model with delay was used to estimate lag phase (λ) and maximum specific growth rate (μmax) values from the obtained growth curves. The effect of storage temperature on μmax and λ was modelled using the Ratkowsky square root model and the relative lag time (RLT) concept. Compared with cold-adapted cells the freeze-stressed cells were more pressure-resistant and showed a much longer lag phase during growth after the pressure treatment. Interestingly, for high-pressure inactivation and subsequent growth, the time to achieve a concentration of L. monocytogenes 100-fold (2-log) higher than the cell concentration prior to the pressure treatment was similar for the two studied physiological states of the inoculum. Two secondary models were necessary to describe the different growth behaviour of L. monocytogenes on ready-to-eat cooked ham (lean product) and mortadella (fatty product). This supported the need of a product-oriented approach to assess growth after high pressure processing. The performance of the developed predictive models for the growth of L. monocytogenes in high-pressure processed cooked ham and mortadella was evaluated by comparison with available data from the literature and by using the Acceptable Simulation Zone approach. Overall, 91% of the relative errors fell into the Acceptable Simulation Zone

  16. Designing and Using an Organisational Culture Inquiry Tool to Glimpse the Relational Nature of Leadership and Organisational Culture within a South Australian Primary School

    Science.gov (United States)

    Giles, David; Bills, Andrew

    2017-01-01

    This case study research found that the relational leadership and organisational culture at a public primary school situated in a high poverty location in South Australia was built upon the strength of the inter-relationships between the teachers, teachers and leadership, and between teachers and students. Supported by what we called "dynamic…

  17. Biocontrol of Listeria monocytogenes in a meat model using a combination of a bacteriocinogenic strain with curing additives.

    Science.gov (United States)

    Orihuel, Alejandra; Bonacina, Julieta; Vildoza, María José; Bru, Elena; Vignolo, Graciela; Saavedra, Lucila; Fadda, Silvina

    2018-05-01

    The aim of this work was to evaluate the effect of meat curing agents on the bioprotective activity of the bacteriocinogenic strain, Enterococcus (E.) mundtii CRL35 against Listeria (L.) monocytogenes during meat fermentation. The ability of E. mundtii CRL35 to grow, acidify and produce bacteriocin in situ was assayed in a meat model system in the presence of curing additives (CA). E. mundtii CRL35 showed optimal growth and acidification rates in the presence of CA. More importantly, the highest bacteriocin titer was achieved in the presence of these food agents. In addition, the CA produced a statistical significant enhancement of the enterocin CRL35 activity. This positive effect was demonstrated in vitro in a meat based culture medium, by time-kill kinetics and finally by using a beaker sausage model with a challenge experiment with the pathogenic L. monocytogenes FBUNT strain. E. mundtii CRL35 was found to be a promising strain of use as a safety adjunct culture in meat industry and a novel functional supplement for sausage fermentation, ensuring hygiene and quality of the final product. Copyright © 2018 Elsevier Ltd. All rights reserved.

  18. A Cross-cultural Examination of SNS Usage Intensity and Managing Interpersonal Relationships Online: The Role of Culture and the Autonomous-Related Self-Construal

    Directory of Open Access Journals (Sweden)

    Lee eSoon Li

    2016-04-01

    Full Text Available Perception of the autonomy and relatedness of the self may be influenced by one’s experiences and social expectations within a particular cultural setting. The present research examined the role of culture and the Autonomous-Related self-construal in predicting for different aspects of Social Networking Sites (SNS usage in three Asian countries, especially focusing on those aspects serving interpersonal goals. Participants in this cross-cultural study included 305 university students from Malaysia (n = 105, South Korea (n = 113, and China (n = 87. The study explored specific social and interpersonal behaviors on SNS, such as browsing the contacts’ profiles, checking for updates, and improving contact with SNS contacts, as well as the intensity of SNS use, hypothesizing that those with high intensity of use in the Asian context may be doing so to achieve the social goal of maintaining contact and keeping updated with friends. Two scales measuring activities on other users’ profiles and contact with friends’ profiles were developed and validated. As predicted, some cross-cultural differences were found. Koreans were more likely to use SNS to increase contact but tended to spend less time browsing contacts’ profiles than the Malaysians and Chinese. The intensity of SNS use differed between the countries as well, where Malaysians reported higher intensity than Koreans and Chinese. Consistent with study predictions, Koreans were found with the highest Autonomous-Related self-construal scores. The Autonomous-Related self-construal predicted SNS intensity. The findings suggest that cultural contexts, along with the way the self is construed in different cultures, may encourage different types of SNS usage. The authors discuss study implications and suggest future research directions.

  19. A Cross-Cultural Examination of SNS Usage Intensity and Managing Interpersonal Relationships Online: The Role of Culture and the Autonomous-Related Self-Construal.

    Science.gov (United States)

    Lee, Soon Li; Kim, Jung-Ae; Golden, Karen Jennifer; Kim, Jae-Hwi; Park, Miriam Sang-Ah

    2016-01-01

    Perception of the autonomy and relatedness of the self may be influenced by one's experiences and social expectations within a particular cultural setting. The present research examined the role of culture and the Autonomous-Related self-construal in predicting for different aspects of Social Networking Sites (SNS) usage in three Asian countries, especially focusing on those aspects serving interpersonal goals. Participants in this cross-cultural study included 305 university students from Malaysia (n = 105), South Korea (n = 113), and China (n = 87). The study explored specific social and interpersonal behaviors on SNS, such as browsing the contacts' profiles, checking for updates, and improving contact with SNS contacts, as well as the intensity of SNS use, hypothesizing that those with high intensity of use in the Asian context may be doing so to achieve the social goal of maintaining contact and keeping updated with friends. Two scales measuring activities on other users' profiles and contact with friends' profiles were developed and validated. As predicted, some cross-cultural differences were found. Koreans were more likely to use SNS to increase contact but tended to spend less time browsing contacts' profiles than the Malaysians and Chinese. The intensity of SNS use differed between the countries as well, where Malaysians reported higher intensity than Koreans and Chinese. Consistent with study predictions, Koreans were found with the highest Autonomous-Related self-construal scores. The Autonomous-Related self-construal predicted SNS intensity. The findings suggest that cultural contexts, along with the way the self is construed in different cultures, may encourage different types of SNS usage. The authors discuss study implications and suggest future research directions.

  20. A Cross-Cultural Examination of SNS Usage Intensity and Managing Interpersonal Relationships Online: The Role of Culture and the Autonomous-Related Self-Construal

    Science.gov (United States)

    Lee, Soon Li; Kim, Jung-Ae; Golden, Karen Jennifer; Kim, Jae-Hwi; Park, Miriam Sang-Ah

    2016-01-01

    Perception of the autonomy and relatedness of the self may be influenced by one's experiences and social expectations within a particular cultural setting. The present research examined the role of culture and the Autonomous-Related self-construal in predicting for different aspects of Social Networking Sites (SNS) usage in three Asian countries, especially focusing on those aspects serving interpersonal goals. Participants in this cross-cultural study included 305 university students from Malaysia (n = 105), South Korea (n = 113), and China (n = 87). The study explored specific social and interpersonal behaviors on SNS, such as browsing the contacts' profiles, checking for updates, and improving contact with SNS contacts, as well as the intensity of SNS use, hypothesizing that those with high intensity of use in the Asian context may be doing so to achieve the social goal of maintaining contact and keeping updated with friends. Two scales measuring activities on other users' profiles and contact with friends' profiles were developed and validated. As predicted, some cross-cultural differences were found. Koreans were more likely to use SNS to increase contact but tended to spend less time browsing contacts' profiles than the Malaysians and Chinese. The intensity of SNS use differed between the countries as well, where Malaysians reported higher intensity than Koreans and Chinese. Consistent with study predictions, Koreans were found with the highest Autonomous-Related self-construal scores. The Autonomous-Related self-construal predicted SNS intensity. The findings suggest that cultural contexts, along with the way the self is construed in different cultures, may encourage different types of SNS usage. The authors discuss study implications and suggest future research directions. PMID:27148100

  1. Uncovering Listeria monocytogenes hypervirulence by harnessing its biodiversity

    Science.gov (United States)

    Charlier, Caroline; Touchon, Marie; Chenal-Francisque, Viviane; Leclercq, Alexandre; Criscuolo, Alexis; Gaultier, Charlotte; Roussel, Sophie; Brisabois, Anne; Disson, Olivier; Rocha, Eduardo P. C.; Brisse, Sylvain; Lecuit, Marc

    2016-01-01

    Microbial pathogenesis studies are typically performed with reference strains, thereby overlooking microbial intra-species virulence heterogeneity. Here we integrated human epidemiological and clinical data with bacterial population genomics to harness the biodiversity of the model foodborne pathogen Listeria monocytogenes and decipher the basis of its neural and placental tropisms. Taking advantage of the clonal structure of this bacterial species, we identify clones epidemiologically associated with either food or human central nervous system (CNS) and maternal-neonatal (MN) listeriosis. The latter are also most prevalent in patients without immunosuppressive comorbidities. Strikingly, CNS and MN clones are hypervirulent in a humanized mouse model of listeriosis. By integrating epidemiological data and comparative genomics, we uncovered multiple novel putative virulence factors and demonstrated experimentally the contribution of the first gene cluster mediating Listeria monocytogenes neural and placental tropisms. This study illustrates the exceptional power of harnessing microbial biodiversity to identify clinically relevant microbial virulence attributes. PMID:26829754

  2. Biosensor for the detection of Listeria monocytogenes: emerging trends

    KAUST Repository

    Soni, Dharmendra Kumar

    2018-05-23

    The early detection of Listeria monocytogenes (L. monocytogenes) and understanding the disease burden is of paramount interest. The failure to detect pathogenic bacteria in the food industry may have terrible consequences, and poses deleterious effects on human health. Therefore, integration of methods to detect and trace the route of pathogens along the entire food supply network might facilitate elucidation of the main contamination sources. Recent research interest has been oriented towards the development of rapid and affordable pathogen detection tools/techniques. An innovative and new approach like biosensors has been quite promising in revealing the foodborne pathogens. In spite of the existing knowledge, advanced research is still needed to substantiate the expeditious nature and sensitivity of biosensors for rapid and in situ analysis of foodborne pathogens. This review summarizes recent developments in optical, piezoelectric, cell-based, and electrochemical biosensors for Listeria sp. detection in clinical diagnostics, food analysis, and environmental monitoring, and also lists their drawbacks and advantages.

  3. The study of Relation between Cultural Components and National Attachment among Citizens of Yazd city.

    Directory of Open Access Journals (Sweden)

    M. Farahmand

    2017-03-01

    Full Text Available National attachment sense as one of the components of social Property is a key word in national culture. Any definition of society is Occurred by accepting attachment and commitment sense and the society is existed to some extent because people have positive sense about that. National attachment sense is considered as one the important affairs of any society and its proper recognition and full knowledge of authorities and affair operators about the effective social factors on that can be an effective step in recognizing the existent problems in society. The present research reviewed the relation between cultural components and national attachment among the Yazd citizens. The research statistical society was all of the Yazd’s 15 to 65 years old citizens that 384 people were selected as sample by Cochran formula. The tool of data gathering was researcher-made questionnaire that had appropriate validity and reliability. Sampling method has been multi-stage clustered. Results showed that there was a meaningful relationship between secularization, consumerism and virtual social networks with national attachment has been reverse and meaningful, but the relationship between age and values preferences with national attachment has been direct and meaningful. Independent variables in regression equation managed to explain 39 percent of national attachment variable changes. The greatest impact on dependent variable (national attachment has belonged to the variables of secularization, age, values preferences and consumerism.

  4. Prevalence and challenge tests of Listeria monocytogenes in Belgian produced and retailed mayonnaise-based deli-salads, cooked meat products and smoked fish between 2005 and 2007.

    Science.gov (United States)

    Uyttendaele, M; Busschaert, P; Valero, A; Geeraerd, A H; Vermeulen, A; Jacxsens, L; Goh, K K; De Loy, A; Van Impe, J F; Devlieghere, F

    2009-07-31

    Processed ready-to-eat (RTE) foods with a prolonged shelf-life under refrigeration are at risk products for listeriosis. This manuscript provides an overview of prevalence data (n=1974) and challenge tests (n=299) related to Listeria monocytogenes for three categories of RTE food i) mayonnaise-based deli-salads (1187 presence/absence tests and 182 challenge tests), ii) cooked meat products (639 presence/absence tests and 92 challenge tests), and iii) smoked fish (90 presence/absence tests and 25 challenge tests), based on data records obtained from various food business operators in Belgium in the frame of the validation and verification of their HACCP plans over the period 2005-2007. Overall, the prevalence of L. monocytogenes in these RTE foods in the present study was lower compared to former studies in Belgium. For mayonnaise-based deli-salads, in 80 out of 1187 samples (6.7%) the pathogen was detected in 25 g. L. monocytogenes positive samples were often associated with smoked fish deli-salads. Cooked meat products showed a 1.1% (n=639) prevalence of the pathogen. For both food categories, numbers per gram never exceeded 100 CFU. L. monocytogenes was detected in 27.8% (25/90) smoked fish samples, while 4/25 positive samples failed to comply to the 100 CFU/g limit set out in EU Regulation 2073/2005. Challenge testing showed growth potential in 18/182 (9.9%) deli-salads and 61/92 (66%) cooked meat products. Nevertheless, both for deli-salads and cooked meat products, appropriate product formulation and storage conditions based upon hurdle technology could guarantee no growth of L. monocytogenes throughout the shelf-life as specified by the food business operator. Challenge testing of smoked fish showed growth of L. monocytogenes in 12/25 samples stored for 3-4 weeks at 4 degrees C. Of 45 (non-inoculated) smoked fish samples (13 of which were initially positive in 25 g) which were subjected to shelf-life testing, numbers exceeded 100 CFU/g in only one sample

  5. Culture-related service expectations: a comparative study using the Kano model.

    Science.gov (United States)

    Hejaili, Fayez F; Assad, Lina; Shaheen, Faissal A; Moussa, Dujana H; Karkar, Ayman; AlRukhaimi, Mona; Barhamein, Majdah; Al Suwida, Abdulkareem; Al Alhejaili, Faris F; Al Harbi, Ali S; Al Homrany, Mohamed; Attar, Bisher; Al-Sayyari, Abdulla A

    2009-01-01

    To compare service expectations between Arab and Austrian patients. We used a Kano model-based questionnaire with 20 service attributes of relevance to the dialysis patient. We analyzed 530, 172, 60, and 68 responses from Saudi, Austrian, Syrian, and UAE patients, respectively. We compared the customer satisfaction coefficient and the frequencies of response categories ("must be," "attractive," "one-dimensional," and "indifferent") for each of the 20 service attributes and in each of the 3 national groups of patients. We also investigated whether any differences seen were related to sex, age, literacy rate, or duration on dialysis. We observed higher satisfaction coefficients and "one-directional" responses among Arab patients and higher dissatisfaction coefficients and "must be" and "attractive" responses among Austrian patients. These were not related to age or duration on dialysis but were related to literacy rate. We speculate that these discrepancies between Austrian and Arab patients might be related to underdeveloped sophistication in market competitive forces and to cultural influences.

  6. Mechanistic studies of the agmatine deiminase from Listeria monocytogenes.

    Science.gov (United States)

    Soares, Charles A; Knuckley, Bryan

    2016-06-01

    Listeria monocytogenes is a Gram-positive food-borne pathogen that is capable of living within extreme environments (i.e. low temperatures and pH). This ability to survive in such conditions may arise, at least in part, from agmatine catabolism via the agmatine deiminase system (AgDS). This catabolic pathway utilizes an agmatine deiminase (AgD) to hydrolyse agmatine into N-carbamoylputrescine (NCP), with concomitant release of ammonia, which increases the pH, thus mitigating the ill effects of the acidic environment. Given the potential significance of this pathway for cell survival, we set out to study the catalytic mechanism of the AgD encoded by L. monocytogenes In the present paper, we describe the catalytic mechanism employed by this enzyme based on pH profiles, pKa measurements of the active site cysteine and solvent isotope effects (SIE). In addition, we report inhibition of this enzyme by two novel AgD inhibitors, i.e. N-(4-aminobutyl)-2-fluoro-ethanimidamide (ABFA) and N-(4-aminobutyl)-2-chloro-ethanimidamide (ABCA). In contrast with other orthologues, L. monocytogenes AgD does not use the reverse protonation or substrate-assisted mechanism, which requires an active site cysteine with a high pKa and has been commonly seen in other members of the guanidinium-modifying enzyme (GME) superfamily. Instead, the L. monocytogenes AgD has a low pKa cysteine in the active site leading to an alternative mechanism of catalysis. This is the first time that this mechanism has been observed in the GME superfamily and is significant because it explains why previously developed mechanism-based inactivators of AgDs are ineffective against this orthologue. © 2016 The Author(s). published by Portland Press Limited on behalf of the Biochemical Society.

  7. Encefalitis del tallo cerebral y mielitis por Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Aracelly Castro

    2013-09-01

    Full Text Available La romboencefalitis por Listeria monocytogenes es una presentación poco común de la listeriosis del sistema nervioso central; sin embargo, es la presentación más común en personas inmunocompetentes. Aun más rara es la combinación de romboencefalitis con mielitis causada por L. monocytogenes; no obstante, en este artículo se reporta un caso de encefalitis del tallo y mielitis grave en un paciente sin compromiso del sistema inmunitario. Se presenta un paciente de 21 años de edad, sin deficiencias del sistema inmunitario, que consumió productos lácteos no pasteurizados y, posteriormente, presentó un cuadro de cefalea, vómito, deterioro de su estado general y, finalmente, alteración del estado de conciencia y muerte. Consultó al Instituto Neurológico de Colombia y se hizo diagnóstico de encefalitis del tallo y mielitis por L. monocytogenes. Se discuten las diferencias entre el caso presentado y los reportados en la literatura científica. Ante un paciente con signos de compromiso del tallo cerebral, de posible origen infeccioso, es prudente iniciar tratamiento antibiótico para L. monocytogenes y, en caso de poca respuesta, escalar rápidamente en dicho tratamiento. También lo es extender el estudio radiológico hacia la columna vertebral, con el fin de descartar compromiso de la médula espinal.   doi: http://dx.doi.org/10.7705/biomedica.v33i3.1482

  8. How Listeria monocytogenes organizes its surface for virulence

    Science.gov (United States)

    Carvalho, Filipe; Sousa, Sandra; Cabanes, Didier

    2014-01-01

    Listeria monocytogenes is a Gram-positive pathogen responsible for the manifestation of human listeriosis, an opportunistic foodborne disease with an associated high mortality rate. The key to the pathogenesis of listeriosis is the capacity of this bacterium to trigger its internalization by non-phagocytic cells and to survive and even replicate within phagocytes. The arsenal of virulence proteins deployed by L. monocytogenes to successfully promote the invasion and infection of host cells has been progressively unveiled over the past decades. A large majority of them is located at the cell envelope, which provides an interface for the establishment of close interactions between these bacterial factors and their host targets. Along the multistep pathways carrying these virulence proteins from the inner side of the cytoplasmic membrane to their cell envelope destination, a multiplicity of auxiliary proteins must act on the immature polypeptides to ensure that they not only maturate into fully functional effectors but also are placed or guided to their correct position in the bacterial surface. As the major scaffold for surface proteins, the cell wall and its metabolism are critical elements in listerial virulence. Conversely, the crucial physical support and protection provided by this structure make it an ideal target for the host immune system. Therefore, mechanisms involving fine modifications of cell envelope components are activated by L. monocytogenes to render it less recognizable by the innate immunity sensors or more resistant to the activity of antimicrobial effectors. This review provides a state-of-the-art compilation of the mechanisms used by L. monocytogenes to organize its surface for virulence, with special focus on those proteins that work “behind the frontline”, either supporting virulence effectors or ensuring the survival of the bacterium within its host. PMID:24809022

  9. Effects of curing sodium nitrite additive and natural meat fat on growth control of Listeria monocytogenes by the bacteriocin-producing Lactobacillus curvatus strain CWBI-B28.

    Science.gov (United States)

    Kouakou, P; Ghalfi, H; Destain, J; Dubois-Dauphin, R; Evrard, P; Thonart, P

    2009-09-01

    In realistic model meat systems, the separate and combined effects of fat content and sodium nitrite on the antilisterial activity of the bacteriocin of Lactobacillus curvatus CWBI-B28 were studied. In laboratory fermentations where Listeria monocytogenes was co-cultured at 4 degrees C with bacteriocin-producing CWBI-B28 in lean pork meat (fat content: 13%) without added nitrite, a strong antilisterial effect was observed after one week. The effect was maintained for an additional week, after which a slight and very gradual rebound was observed. Both added nitrite (20 ppm) and a high-fat content (43%) were found to antagonise this antilisterial effect, the Listeria cfu count reached after six weeks being 200 times as high in high-fat meat with added nitrite than in lean meat without nitrite. This antagonism could not be attributed to slower growth of the bacteriocin-producing strain, since CWBI-B28 grew optimally in fat-rich meat with 20 ppm sodium nitrite. Bacteriocin activity was also measured in the samples. The observed activity levels are discussed in relation to the degree of antilisterial protection conferred.

  10. Inhibition of Listeria monocytogenes ATCC 19115 on ham steak by tea bioactive compounds incorporated into chitosan-coated plastic films

    Directory of Open Access Journals (Sweden)

    Vodnar Dan C

    2012-07-01

    Full Text Available Abstract Background The consumer demands for better quality and safety of food products have given rise to the development and implementation of edible films. The use of antimicrobial films can be a promising tool for controlling L. monocytogenes on ready to eat products. The aim of this study was to develop effective antimicrobial films incorporating bioactive compounds from green and black teas into chitosan, for controlling L. monocytogenes ATCC 19115 on vacuum-packaged ham steak. The effectiveness of these antimicrobial films was evaluated at room temperature (20°C for 10 days and at refrigerated temperature (4°C for 8 weeks. Results The HPLC results clearly show that relative concentrations of catechins and caffeine in green tea ranked EGCG>EGC>CAF>ECG>EC>C while in black tea extracts ranked CAF>EGCG>ECG>EGC>EC>C. The chitosan-coated plastic films incorporating green tea and black tea extracts shows specific markers identified by FTIR. Incorporating natural extracts into chitosan showed that the growth of L monocytogenes ATCC 19115 was inhibited. The efficacy of antimicrobial effect of tea extracts incorporated into chitosan-coated plastic film was dose dependent. However, chitosan-coated films without addition of tea extracts did not inhibit the growth of L. monocytogenes ATCC 19115. Chitosan-coated plastic films incorporating 4% Green tea extract was the most effective antimicrobial, reducing the initial counts from 3.2 to 2.65 log CFU/cm2 during room temperature storage and from 3.2 to 1–1.5 log CFU/cm2 during refrigerated storage. Conclusions Incorporation of tea extracts into the chitosan-coated films considerably enhanced their effectiveness against L. monocytogenes ATCC 19115. 4% Green tea incorporated into chitosan-coated plastic film had a better antilisterial effect than 2% green tea or 2% and 4% black tea. Data from this study would provide new formulation options for developing antimicrobial packaging films using tea

  11. Genes involved in Listeria monocytogenes biofilm formation at a simulated food processing plant temperature of 15 °C.

    Science.gov (United States)

    Piercey, Marta J; Hingston, Patricia A; Truelstrup Hansen, Lisbeth

    2016-04-16

    Listeria monocytogenes is a pathogenic foodborne bacterium whose persistence in food processing environments is in part attributed to its biofilm formation. Most biofilm studies have been carried out at 30-37 °C rather than at temperatures found in the food processing plants (i.e., 10-20 °C). The objective of the present study was to mine for novel genes that contribute to L. monocytogenes biofilm formation at 15 °C using the random insertional mutagenesis approach. A library of 11,024 L. monocytogenes 568 (serotype 1/2a) Himar1 insertional mutants was created. Mutants with reduced or enhanced biofilm formation at 15 °C were detected in microtiter plate assays with crystal violet and safranin staining. Fourteen mutants expressed enhanced biofilm phenotypes, and harbored transposon insertions in genes encoding cell wall biosynthesis, motility, metabolism, stress response, and cell surface associated proteins. Deficient mutants (n=5) contained interruptions in genes related to peptidoglycan, teichoic acid, or lipoproteins. Enhanced mutants produced significantly (pbiofilm formed on stainless steel (SS) coupons at 15 °C (48 h) than deficient mutants, which were also more sensitive to benzalkonium chloride. All biofilm deficient mutants and four enhanced mutants in the microtiter plate assay (flaA, cheR, lmo2563 and lmo2488) formed no biofilm in a peg lid assay (Calgary biofilm device) while insertions in lmo1224 and lmo0543 led to excess biofilm in all assays. Two enhanced biofilm formers were more resistant to enzymatic removal with DNase, proteinase K or pectinase than the parent strain. Scanning electron microscopy of individual biofilms made by five mutants and the parent on SS surfaces showed formation of heterogeneous biofilm with dense zones by immotile mutants, while deficient mutants exhibited sparse growth. In conclusion, interruptions of 9 genes not previously linked to biofilm formation in L. monocytogenes (lmo2572, lmo2488 (uvrA), lmo1224, lmo0434

  12. The Role of Stress and Stress Adaptations in Determining the Fate of the Bacterial Pathogen Listeria monocytogenes in the Food Chain

    Science.gov (United States)

    NicAogáin, Kerrie; O’Byrne, Conor P.

    2016-01-01

    The foodborne pathogen Listeria monocytogenes is a highly adaptable organism that can persist in a wide range of environmental and food-related niches. The consumption of contaminated ready-to-eat foods can cause infections, termed listeriosis, in vulnerable humans, particularly those with weakened immune systems. Although these infections are comparatively rare they are associated with high mortality rates and therefore this pathogen has a significant impact on food safety. L. monocytogenes can adapt to and survive a wide range of stress conditions including low pH, low water activity, and low temperature, which makes it problematic for food producers who rely on these stresses for preservation. Stress tolerance in L. monocytogenes can be explained partially by the presence of the general stress response (GSR), a transcriptional response under the control of the alternative sigma factor sigma B (σB) that reconfigures gene transcription to provide homeostatic and protective functions to cope with the stress. Within the host σB also plays a key role in surviving the harsh conditions found in the gastrointestinal tract. As the infection progresses beyond the GI tract L. monocytogenes uses an intracellular infectious cycle to propagate, spread and remain protected from the host’s humoral immunity. Many of the virulence genes that facilitate this infectious cycle are under the control of a master transcriptional regulator called PrfA. In this review we consider the environmental reservoirs that enable L. monocytogenes to gain access to the food chain and discuss the stresses that the pathogen must overcome to survive and grow in these environments. The overlap that exists between stress tolerance and virulence is described. We review the principal measures that are used to control the pathogen and point to exciting new approaches that might provide improved means of control in the future. PMID:27933042

  13. The Role of Stress and Stress Adaptations in Determining the Fate of the Bacterial Pathogen Listeria monocytogenes in the Food Chain.

    Science.gov (United States)

    NicAogáin, Kerrie; O'Byrne, Conor P

    2016-01-01

    The foodborne pathogen Listeria monocytogenes is a highly adaptable organism that can persist in a wide range of environmental and food-related niches. The consumption of contaminated ready-to-eat foods can cause infections, termed listeriosis, in vulnerable humans, particularly those with weakened immune systems. Although these infections are comparatively rare they are associated with high mortality rates and therefore this pathogen has a significant impact on food safety. L. monocytogenes can adapt to and survive a wide range of stress conditions including low pH, low water activity, and low temperature, which makes it problematic for food producers who rely on these stresses for preservation. Stress tolerance in L. monocytogenes can be explained partially by the presence of the general stress response (GSR), a transcriptional response under the control of the alternative sigma factor sigma B (σ B ) that reconfigures gene transcription to provide homeostatic and protective functions to cope with the stress. Within the host σ B also plays a key role in surviving the harsh conditions found in the gastrointestinal tract. As the infection progresses beyond the GI tract L. monocytogenes uses an intracellular infectious cycle to propagate, spread and remain protected from the host's humoral immunity. Many of the virulence genes that facilitate this infectious cycle are under the control of a master transcriptional regulator called PrfA. In this review we consider the environmental reservoirs that enable L. monocytogenes to gain access to the food chain and discuss the stresses that the pathogen must overcome to survive and grow in these environments. The overlap that exists between stress tolerance and virulence is described. We review the principal measures that are used to control the pathogen and point to exciting new approaches that might provide improved means of control in the future.

  14. Shifts in indigenous culture relate to forest tree diversity: a case study from the Tsimane’, Bolivian Amazon

    Science.gov (United States)

    Guèze, Maximilien; Luz, Ana Catarina; Paneque-Gálvez, Jaime; Macía, Manuel J.; Orta-Martínez, Martí; Pino, Joan; Reyes-García, Victoria

    2015-01-01

    Understanding how indigenous peoples’ management practices relate to biological diversity requires addressing contemporary changes in indigenous peoples’ way of life. This study explores the association between cultural change among a Bolivian Amazonian indigenous group, the Tsimane’, and tree diversity in forests surrounding their villages. We interviewed 86 informants in six villages about their level of attachment to traditional Tsimane’ values, our proxy for cultural change. We estimated tree diversity (Fisher’s Alpha index) by inventorying trees in 48 0.1-ha plots in old-growth forests distributed in the territory of the same villages. We used multivariate models to assess the relation between cultural change and alpha tree diversity. Cultural change was associated with alpha tree diversity and the relation showed an inverted U-shape, thus suggesting that tree alpha diversity peaked in villages undergoing intermediate cultural change. Although the results do not allow for testing the direction of the relation, we propose that cultural change relates to tree diversity through the changes in practices and behaviors that affect the traditional ecological knowledge of Tsimane’ communities; further research is needed to determine the causality. Our results also find support in the intermediate disturbance hypothesis, and suggest that indigenous management can be seen as an intermediate form of anthropogenic disturbance affecting forest communities in a subtle, non-destructive way. PMID:26097240

  15. Shifts in indigenous culture relate to forest tree diversity: a case study from the Tsimane', Bolivian Amazon.

    Science.gov (United States)

    Guèze, Maximilien; Luz, Ana Catarina; Paneque-Gálvez, Jaime; Macía, Manuel J; Orta-Martínez, Martí; Pino, Joan; Reyes-García, Victoria

    2015-06-01

    Understanding how indigenous peoples' management practices relate to biological diversity requires addressing contemporary changes in indigenous peoples' way of life. This study explores the association between cultural change among a Bolivian Amazonian indigenous group, the Tsimane', and tree diversity in forests surrounding their villages. We interviewed 86 informants in six villages about their level of attachment to traditional Tsimane' values, our proxy for cultural change. We estimated tree diversity (Fisher's Alpha index) by inventorying trees in 48 0.1-ha plots in old-growth forests distributed in the territory of the same villages. We used multivariate models to assess the relation between cultural change and alpha tree diversity. Cultural change was associated with alpha tree diversity and the relation showed an inverted U-shape, thus suggesting that tree alpha diversity peaked in villages undergoing intermediate cultural change. Although the results do not allow for testing the direction of the relation, we propose that cultural change relates to tree diversity through the changes in practices and behaviors that affect the traditional ecological knowledge of Tsimane' communities; further research is needed to determine the causality. Our results also find support in the intermediate disturbance hypothesis, and suggest that indigenous management can be seen as an intermediate form of anthropogenic disturbance affecting forest communities in a subtle, non-destructive way.

  16. Cultural Relations in the «New Order»: Nazi Germany and Franco’s Spain

    Directory of Open Access Journals (Sweden)

    Marició Janué i Miret

    2015-12-01

    Full Text Available The article analyzes the role that culture played in German-Spanish relations during National-Socialism. This is a relevant historiographical question for two main reasons. The first, that we still lack an overall approach on the cultural relations between the two countries in that period. The second, that when the national-socialists came to power in 1933, culture had already become for a long time an essential part of foreign politics of the most important European powers, and consequently also of Germany. The article explains the motivations for intensifying cultural relations for both countries. Its ultimate objective is to get a clearer idea about the affinities between Nazi Germany and the Francoist regime. We base the analysis in our own research in archives as well as in the already existing literature on partial aspects of the cultural relations between the two countries. We conclude that the tensions between the different political sectors which looked for hegemony inside the francoist regime were not the decisive factor to explain the variations in the intensity of the cultural relations between the two countries. The decisive element was the negative evolution of the Second World War for Germany. Finally, the research proves that the ideological coincidences between the two regimes and the level of fascistization of Franco’s dictatorship in its first stages should not be underestimated.

  17. The Importance of Augustin Hallerstein for Cultural and Political Relations with China and Korea

    Directory of Open Access Journals (Sweden)

    Mitja SAJE

    2015-12-01

    Full Text Available Since symbols of early cultural relations between Europe and East Asia are important, we are striving to restore the image of Augustin Hallerstein (1703–1774 in China and earn his legacy its appropriate position in the history of the Qing dynasty next to other great Jesuits like Adam Shall von Bell (1591–1666, Ferdinand Verbiest (1623–1688, or Ignatius Kogler (1680–1746. A two-year EU project made possible the publication of a monograph in English, which was translated into Chinese and published in China in February 2015. Wider popularization of his achievements should be beneficial to Slovenia as well as to China, where he did his work. Such common heroes of the past could often be used to promote better understanding and cooperation between China and Slovenia. Through strong connections with Korean scholars he gained a high reputation in Korea as well.

  18. Relative biological effectiveness of tritiated water on cultured mammalian cells at molecular and cellular level

    International Nuclear Information System (INIS)

    Okada, S.; Sakai, K.; Nakamura, N.

    1986-01-01

    Factors that affect RBE values have been investigated in cultured cells. It was shown that: (1) Different RBE values were obtained with the same tritiated water treated cells depending upon the biological end-point; this may be related to target size. (2) The RBE value for one end-point (e.g. cell killing) in different cell types was often different. In some cells, the RBE value increased with reducing dose; in other cells, the value remained constant. (3) The RBE value for tritiated water seemed to fit a general RBE-LET relationship. These results suggest that although the RBE value might vary from 1 to 2 when cells are exposed to HTO, there are situations where the value becomes higher than 2; these are associated with low dose and low dose rate exposures in some cell types. (author)

  19. Drive for leanness and health-related behavior within a social/cultural perspective.

    Science.gov (United States)

    Tod, David; Edwards, Christian; Hall, Gareth

    2013-09-01

    We examined relationships between drive for leanness and perceived media pressure to change appearance, internalization of an ideal physique, exercise frequency, and dieting. Men and women (N=353) completed the Drive for Leanness Scale, the Sociocultural Attitudes Toward Appearance Questionnaire-3, the Eating Attitudes Test-26, and a demographic inventory. Drive for leanness was significantly correlated with athletic internalization (.52), pressure to attain an ideal physique (.25), exercise frequency (.36), and dieting (.25). Structural equation modeling revealed a good fitting model (χ(2)=2.85, pdrive for leanness, which in turn predicted dieting and exercise. Results reveal social/cultural theory helps enhance the understanding of the drive for leanness and its relationship with health-related behavior. Copyright © 2013 Elsevier Ltd. All rights reserved.

  20. Cultural adaptation of the Tuberculosis-related stigma scale to Brazil.

    Science.gov (United States)

    Crispim, Juliane de Almeida; Touso, Michelle Mosna; Yamamura, Mellina; Popolin, Marcela Paschoal; Garcia, Maria Concebida da Cunha; Santos, Cláudia Benedita Dos; Palha, Pedro Fredemir; Arcêncio, Ricardo Alexandre

    2016-06-01

    The process of stigmatization associated with TB has been undervalued in national research as this social aspect is important in the control of the disease, especially in marginalized populations. This paper introduces the stages of the process of cultural adaptation in Brazil of the Tuberculosis-related stigma scale for TB patients. It is a methodological study in which the items of the scale were translated and back-translated with semantic validation with 15 individuals of the target population. After translation, the reconciled back-translated version was compared with the original version by the project coordinator in Southern Thailand, who approved the final version in Brazilian Portuguese. The results of the semantic validation conducted with TB patients enable the identification that, in general, the scale was well accepted and easily understood by the participants.

  1. Collaborative open training with serious games: Relations, culture, knowledge, innovation, and desire

    Directory of Open Access Journals (Sweden)

    Oihab Allal-Chérif

    2017-01-01

    Full Text Available This article studies the convergence between MOOCs (massive open online courses and serious games, two new types of information systems designed to improve learning. The aim of this research is to identify the areas of influence in collaborative open training serious games developed by large firms for a significant cost and made available for free to the public and to students according to the same principles as MOOCs. The methodology of this exploratory research is based on Kurt Lewin's (1945 statement “nothing is so practical as a good theory” and takes the opposite view. The deep observation of three serious games from L’Oréal, IBM, and Thales results in a theoretical model with five distinct influence domains of serious games: relations, culture, knowledge, innovation, and desire. This model is then discussed and tested on eight other serious games from major industrial companies such as General Electric, Nestlé, and Cisco.

  2. Cultural expressions of social class and their implications for group-related beliefs and behaviors

    OpenAIRE

    Rheinschmidt-Same, Michelle; Becker, Julia; Kraus, Michael

    2017-01-01

    In the wake of the Great Recession, rising inequality has increased social class disparities between people in society. In this research, we examine how differences in social class shape unique patterns of cultural expression, and how these cultural expressions affirm ingroup beliefs. In Study 1 (N=113), we provide evidence that cultural expressions of social class on an online social network can signal the social class of targets: by simply viewing the cultural practices of individuals captu...

  3. Chinese Cultural Collectivism and Work-Related Stress: Implications for Employment Counselors.

    Science.gov (United States)

    Chiu, Randy K.; Kosinski, Frederick A., Jr.

    1995-01-01

    Employment counselors should take cultural issues into consideration as they provide consultation or counseling services. Stress is influenced by cultural and social variables. Examines the collectivism-individualism construct to measure cultural variables and attempt to explain the differences of some social behaviors between Eastern and Western…

  4. Inhibitory activity of Syzygium aromaticum and Cymbopogon citratus (DC. Stapf. essential oils against Listeria monocytogenes inoculated in bovine ground meat

    Directory of Open Access Journals (Sweden)

    Thales Leandro Coutinho de Oliveira

    2013-01-01

    Full Text Available This research evaluated the antimicrobial effect of the clove (Syzygium aromaticum and lemongrass (Cymbopogon citratus (DC. Stapf. essential oils (EOs against Listeria monocytogenes ATCC 19117 growth added to bovine ground meat stored under refrigeration (5 ± 2 °C for three days. The EOs, extracted by hydrodistillation and analyzed by gas chromatography-mass spectrometry (GC-MS, were tested in vitro using an agar well diffusion methodology for determination of Minimum Inhibitory Concentration (MIC. The MIC concentrations for both essential oils on culture tested of L. monocytogenes were 1.56%. The EOs concentrations applied in contaminated ground beef were 1.56, 3.125 and 6.25% (w/v based on MIC levels and possible activity reductions by food constituents. The bacteria populations were significantly reduced (p < 0.05 after one day of storage in ground meat samples treated with clove and lemongrass EOs at concentrations of 1.56%. There were no significant counts of L. monocytogenes in samples at the other concentrations of the two oils applied after the second day of storage. The sensory acceptability evaluation of the bovine ground meat samples treated with EOs showed that the addition at concentrations higher than 1.56% promote undesirable alterations of taste, odor and characteristic color. The application of EOs at low concentrations in food products can be used in combination with other preservation methods, such as refrigeration, to control pathogens and spoilage bacteria during shelf-life; which goes according to current market trends, where consumers are requesting natural products.

  5. Inhibitory activity of Syzygium aromaticum and Cymbopogon citratus (DC.) Stapf. essential oils against Listeria monocytogenes inoculated in bovine ground meat.

    Science.gov (United States)

    de Oliveira, Thales Leandro Coutinho; das Graças Cardoso, Maria; de Araújo Soares, Rodrigo; Ramos, Eduardo Mendes; Piccoli, Roberta Hilsdorf; Tebaldi, Victor Maximiliano Reis

    2013-01-01

    This research evaluated the antimicrobial effect of the clove (Syzygium aromaticum) and lemongrass (Cymbopogon citratus (DC.) Stapf.) essential oils (EOs) against Listeria monocytogenes ATCC 19117 growth added to bovine ground meat stored under refrigeration (5 ± 2 °C) for three days. The EOs, extracted by hydrodistillation and analyzed by gas chromatography-mass spectrometry (GC-MS), were tested in vitro using an agar well diffusion methodology for determination of Minimum Inhibitory Concentration (MIC). The MIC concentrations for both essential oils on culture tested of L. monocytogenes were 1.56%. The EOs concentrations applied in contaminated ground beef were 1.56, 3.125 and 6.25% (w/v) based on MIC levels and possible activity reductions by food constituents. The bacteria populations were significantly reduced (p ≤ 0.05) after one day of storage in ground meat samples treated with clove and lemongrass EOs at concentrations of 1.56%. There were no significant counts of L. monocytogenes in samples at the other concentrations of the two oils applied after the second day of storage. The sensory acceptability evaluation of the bovine ground meat samples treated with EOs showed that the addition at concentrations higher than 1.56% promote undesirable alterations of taste, odor and characteristic color. The application of EOs at low concentrations in food products can be used in combination with other preservation methods, such as refrigeration, to control pathogens and spoilage bacteria during shelf-life; which goes according to current market trends, where consumers are requesting natural products.

  6. The relations of parental autonomy support to cultural internalization and well-being of immigrants and sojourners.

    Science.gov (United States)

    Downie, Michelle; Chua, Sook Ning; Koestner, Richard; Barrios, Maria-Fernanda; Rip, Blanka; M'Birkou, Sawsan

    2007-07-01

    Previous research has demonstrated that autonomy support is one particularly effective means of promoting internalization and fostering well-being. The present study sought to determine if this would also be the case with regards to culture by testing the relation of perceived parental autonomy support to the cultural internalization and well-being of multicultural students. In Study 1, 105 multicultural participants living in Canada were more likely to have fully internalized their host and heritage cultures and to have higher self-reported well-being when they reported that their parents were autonomy supportive. In Study 2, 125 Chinese-Malaysians sojourners were also more likely to have fully internalized their heritage culture and indicated higher well-being when they perceived their parents as autonomy supportive. In both studies, heritage cultural internalization was also associated with higher well-being. Copyright 2007 APA

  7. Cellular distribution of inorganic mercury and its relation to cytotoxicity in bovine kidney cell cultures

    International Nuclear Information System (INIS)

    Bracken, W.M.; Sharma, R.P.; Bourcier, D.R.

    1984-01-01

    A bovine kidney cell culture system was used to assess what relationship mercuric chloride (HgCl 2 ) uptake and subcellular distribution had to cytotoxicity. Twenty-four-hour incubations with 0.05-50 μM HgCl 2 elicited a concentration-related cytotoxicity. Cellular accumulation of 203 Hg was also concentration-related, with 1.0 nmol/10 6 cells at the IC50. Measurement of Hg uptake over the 24-h exposure period revealed a multiphasic process. Peak accumulation was attained by 1 h and was followed by extrusion and plateauing of intracellular Hg levels. Least-squares regression analysis of the cytotoxicity and cellular uptake data indicated a potential relationship between the Hg uptake and cytotoxicity. However, the subcellular distribution of Hg was not concentration-related. Mitochondria and soluble protein fractions accounted for greater than 65% of the cell-associated Hg at all concentrations. The remaining Hg was distributed between the microsomal (6-10%) and nuclear and cell debris (11-22%) fractions at all concentrations tested. Less than 20% of the total cell-associated Hg was bound with metallothionein-like protein. 31 references, 4 figures, 3 tables

  8. Belief, Knowledge and Understanding. How to Deal with the Relations Between Different Cultural Perspectives in Classrooms

    Science.gov (United States)

    Moreira-dos-Santos, Frederik; El-Hani, Charbel N.

    2017-05-01

    This article discusses how to deal with the relations between different cultural perspectives in classrooms, based on a proposal for considering understanding and knowledge as goals of science education, inspired by Dewey's naturalistic humanism. It thus combines educational and philosophical interests. In educational terms, our concerns relate to how science teachers position themselves in multicultural classrooms. In philosophical terms, we are interested in discussing the relations between belief, understanding, and knowledge under the light of Dewey's philosophy. We present a synthesis of Dewey's theory of inquiry through his naturalistic humanism and discuss its implications for the concepts of belief, understanding, and knowledge, as well as for the goals of science teaching. In particular, we highlight problems arising in the context of possible conflicts between scientific and religious claims in the school environment that result from totalitarian positions. We characterize an individual's position as totalitarian if he or she takes some way of thinking as the only one capable of expressing the truth about all that exists in the world, lacks open-mindedness to understand different interpretative perspectives, and attempts to impose her or his interpretation about the facts to others by violent means or not. From this stance, any other perspective is taken to be false a priori and, accordingly, as a putative target to be suppressed or adapted to the privileged way of thinking. We argue, instead, for a more fallibilist evaluation of our own beliefs and a more respectful appraisal of the diversity of students' beliefs by both students and teachers.

  9. Differential Biofilm Formation and Chemical Disinfection Resistance of Sessile Cells of Listeria monocytogenes Strains under Monospecies and Dual-Species (with Salmonella enterica) Conditions

    Science.gov (United States)

    Kostaki, Maria; Chorianopoulos, Nikos; Braxou, Elli; Nychas, George-John

    2012-01-01

    This study aimed to investigate the possible influence of bacterial intra- and interspecies interactions on the ability of Listeria monocytogenes and Salmonella enterica to develop mixed-culture biofilms on an abiotic substratum, as well as on the subsequent resistance of sessile cells to chemical disinfection. Initially, three strains from each species were selected and left to attach and form biofilms on stainless steel (SS) coupons incubated at 15°C for 144 h, in periodically renewable tryptone soy broth (TSB), under either monoculture or mixed-culture (mono-/dual-species) conditions. Following biofilm formation, mixed-culture sessile communities were subjected to 6-min disinfection treatments with (i) benzalkonium chloride (50 ppm), (ii) sodium hypochlorite (10 ppm), (iii) peracetic acid (10 ppm), and (iv) a mixture of hydrogen peroxide (5 ppm) and peracetic acid (5 ppm). Results revealed that both species reached similar biofilm counts (ca. 105 CFU cm−2) and that, in general, interspecies interactions did not have any significant effect either on the biofilm-forming ability (as this was assessed by agar plating enumeration of the mechanically detached biofilm bacteria) or on the antimicrobial resistance of each individual species. Interestingly, pulsed-field gel electrophoresis (PFGE) analysis clearly showed that the three L. monocytogenes strains did not contribute at the same level either to the formation of mixed-culture sessile communities (mono-/dual species) or to their antimicrobial recalcitrance. Additionally, the simultaneous existence inside the biofilm structure of S. enterica cells seemed to influence the occurrence and resistance pattern of L. monocytogenes strains. In sum, this study highlights the impact of microbial interactions taking place inside a mixed-culture sessile community on both its population dynamics and disinfection resistance. PMID:22307304

  10. Ontology of Iranian-French Cultural Relations: With an Emphasis on Contemporary Iranian History Prior to the Islamic Revolution

    Directory of Open Access Journals (Sweden)

    Foad Pourarian

    2017-12-01

    Full Text Available Culture is one of the most prominent concepts that can also be the source of many changes in the range of action and application, in addition to its theoretical competence. One of the major outcomes of culture in contemporary history is its importance in international relations, insofar as these relations can broaden the level of relations or even create deep political or economic links between countries. In contemporary history, Iran began its experience of cultural relations with the West, especially France; Reza Shah, who put Iran's modernization at the top of his goals, pursued literacy and expanded academic circles, and in this regard, one of the most prominent of his plans was to send students to the West, especially to France, which also contributed to the expansion of the presence of French culture and language in Iran. The second Pahlavi era was accompanied by a change in some of the transboundary equations, including the emergence of the United States as a superpower, a special interest of Mohammad Reza Shah in the United States as well as Washington's agenda for the presence in Iran that slowly diminished French cultural influence in Iran, and the English language and culture were replaced. However, French ideas and thoughts still constituted a significant part of the educated layers of Iran given its strong presence in the Iranian academic circles in the past.

  11. Explaining Differences in Subjective Well-Being Across 33 Nations Using Multilevel Models: Universal Personality, Cultural Relativity, and National Income.

    Science.gov (United States)

    Cheng, Cecilia; Cheung, Mike W-L; Montasem, Alex

    2016-02-01

    This multinational study simultaneously tested three prominent hypotheses--universal disposition, cultural relativity, and livability--that explained differences in subjective well-being across nations. We performed multilevel structural equation modeling to examine the hypothesized relationships at both individual and cultural levels in 33 nations. Participants were 6,753 university students (2,215 men; 4,403 women; 135 did not specify), and the average age of the entire sample was 20.97 years (SD = 2.39). Both individual- and cultural-level analyses supported the universal disposition and cultural relativity hypotheses by revealing significant associations of subjective well-being with Extraversion, Neuroticism, and independent self-construal. In addition, interdependent self-construal was positively related to life satisfaction at the individual level