WorldWideScience

Sample records for monocytogenes cultures relative

  1. Stochastic modelling of Listeria monocytogenes single cell growth in cottage cheese with mesophilic lactic acid bacteria from aroma producing cultures.

    Science.gov (United States)

    Østergaard, Nina Bjerre; Christiansen, Lasse Engbo; Dalgaard, Paw

    2015-07-02

    A stochastic model was developed for simultaneous growth of low numbers of Listeria monocytogenes and populations of lactic acid bacteria from the aroma producing cultures applied in cottage cheese. During more than two years, different batches of cottage cheese with aroma culture were analysed for pH, lactic acid concentration and initial concentration of lactic acid bacteria. These data and bootstrap sampling were used to represent product variability in the stochastic model. Lag time data were estimated from observed growth data (lactic acid bacteria) and from literature on L. monocytogenes single cells. These lag time data were expressed as relative lag times and included in growth models. A stochastic model was developed from an existing deterministic growth model including the effect of five environmental factors and inter-bacterial interaction [Østergaard, N.B, Eklöw, A and Dalgaard, P. 2014. Modelling the effect of lactic acid bacteria from starter- and aroma culture on growth of Listeria monocytogenes in cottage cheese. International Journal of Food Microbiology. 188, 15-25]. Growth of L. monocytogenes single cells, using lag time distributions corresponding to three different stress levels, was simulated. The simulated growth was subsequently compared to growth of low concentrations (0.4-1.0 CFU/g) of L. monocytogenes in cottage cheese, exposed to similar stresses, and in general a good agreement was observed. In addition, growth simulations were performed using population relative lag time distributions for L. monocytogenes as reported in literature. Comparably good predictions were obtained as for the simulations performed using lag time data for individual cells of L. monocytogenes. Therefore, when lag time data for individual cells are not available, it was suggested that relative lag time distributions for L. monocytogenes can be used as a qualified default assumption when simulating growth of low concentrations of L. monocytogenes.

  2. [Evaluation of the activity of probiotic cultures over Listeria monocytogenes during the production and storage of yogurt].

    Science.gov (United States)

    Berrocal, Darling; Arias, María Laura; Henderson, Marjorie; Wong, Eric

    2002-12-01

    The effect of probiotic cultures over Listeria monocytogenes during the production and storage of yogurt was evaluated. A yogurt mixture (10.6% non-fat solid liquids, 3% fat and 0.3% gelatin) was prepared, homogenized and pasteurized. Yogurt was inoculated with 0, 10(2), 10(4) and 10(6) CFU/mL of L. monocytogenes and 0.02% of traditional lactic culture YC 180 (Streptococcus thermophilus and Lactobacillus bulgaricus) and probiotic culture ABY-1 (Bifidobacterium longum, B. bifidum, B, infantis, Lactobacillus acidophilus, Streptococcus thermophilus y Lactobacillus delbrueckii subsp. bulgaricus). It was incubated for 3 h at 43 degrees C until pH reached an approximate value of 4.8, followed by refrigeration at 5 degrees C for 21 days. During fermentation, samples were taken every hour, and during storage every 3 days, analyzing pH and lactic, bifidobacteria and pathogen count for each time. It was demonstrated that there was no significant simple effect for the type of culture used (ABY-1 and YC 180) (p = 0.684) over the amount of L. monocytogenes present in yogurt during the fermentation and storage periods. The presence of bifidobacteria in the ABY-1 culture did not present a significant effect over L. monocytogenes. Neither the effect of time presented a significant effect over L. monocytogenes (p = 0.448). In this case, the ABY-1 and YC 180 cultures present a bacteriostatic effect over the pathogen. The probiotic cultures had a bacteriostatic but not bactericidal effect over L. monocytogenes. This is not related to the protective effect of these cultures in bowel, since in-vivo conditions favor the production of antimicrobial substances, such as bacteriocins that act over pathogens.

  3. Stochastic modelling of Listeria monocytogenes single cell growth in cottage cheese with mesophilic lactic acid bacteria from aroma producing cultures

    DEFF Research Database (Denmark)

    Østergaard, Nina Bjerre; Christiansen, Lasse Engbo; Dalgaard, Paw

    2015-01-01

    for pH, lactic acid concentration and initial concentration of lactic acid bacteria. These data and bootstrap sampling were used to represent product variability in the stochastic model. Lag time data were estimated from observed growth data (lactic acid bacteria) and from literature on L. monocytogenes...... single cells. These lag time data were expressed as relative lag times and included in growth models. A stochastic model was developed from an existing deterministic growth model including the effect of five environmental factors and inter-bacterial interaction [Østergaard, N.B, Eklöw, A and Dalgaard, P....... 2014. Modelling the effect of lactic acid bacteria from starter- and aroma culture on growth of Listeria monocytogenes in cottage cheese. International Journal of Food Microbiology. 188, 15-25]. Growth of L. monocytogenes single cells, using lag time distributions corresponding to three different...

  4. Susceptibility of Listeria monocytogenes biofilms and planktonic cultures to hydrogen peroxide in food processing environments.

    Science.gov (United States)

    Yun, Hyun Sun; Kim, Younghoon; Oh, Sejong; Jeon, Woo Min; Frank, Joseph F; Kim, Sae Hun

    2012-01-01

    Recent studies have indicated that Listeria monocytogenes formed biofilms on the surface of food processing equipment, and may survive sanitization treatments. The purpose of this study was to compare the susceptibility of L. monocytogenes grown in either a biofilm or planktonic culture when exposed to hydrogen peroxide (H(2)O(2)). Twelve strains of biofilm-forming L. monocytogenes and their planktonic counterparts were treated with various concentrations of H(2)O(2) (1, 6, and 10%), and the cell survival was then determined at 10-min exposure intervals. When grown as a biofilm, L. monocytogenes was significantly more resistant to H(2)O(2) than under planktonic culture conditions. Planktonic L. monocytogenes strains exhibited significantly different susceptibility to 1% H(2)O(2). Equally interestingly, biofilms of the 12 L. monocytogenes strains also inhibited different survival rates after being treated with 6 and 10% H(2)O(2). However, most of the biofilms recovered to a population of 2-9 log CFU/glass fiber filter (GFF) after a 24-h re-growth period. These results indicate that there was no significant correlation between the H(2)O(2) resistance of biofilm- and planktonic-cultured cells, and suggest that different mechanisms for the resistance to sanitation or disinfection underly the persistence of certain strains in food-processing environments.

  5. Isolation and Identification of Listeria monocytogenes in Processed Meat by a Combined Cultural-molecular Method

    Directory of Open Access Journals (Sweden)

    Angela Ingianni

    2007-01-01

    Full Text Available The isolation and identification of Listeria monocytogenes in processed meat samples by a combined cultural-molecular method is described. It allows the identification of Listeria strains by means of a hybridization technique with a specific DNA probe directed to the listerial internalin gene. The specificity of this method was found to be 100% and sensitivity was as low as 1 CFU/2.5 g of food sample. A total of 278 meat samples were tested in comparison with PCR and conventional cultural assays. A total of 42 (15.4% L. monocytogenes were detected. PCR analysis gave 3 false negative results and culture failed to detect the Listeria in 5 cases. With this cultural-molecular method the identification and quantitative detection of L. monocytogenes were achieved within 36 hours and no false positive or negative tests were obtained, thus fitting most food industry requirements.

  6. QUANTIFICATION OF LISTERIA MONOCYTOGENES IN MILK BY MPN-PCR AND MPN-CULTURE METHODS

    Directory of Open Access Journals (Sweden)

    Mahzad Hosseini

    2014-10-01

    Full Text Available The aim of this study was to compare the MPN-PCR (Most Probable Number- Polymerase Chain Reaction and MPN-Culture methods in enumerating of Listeria monocytogenes in milk. In order to compare the accuracy of these methods, 103 cell/ml Listeria monocytogenes and different background bacteria which may be present in raw milk, were inoculated in sterilized milk. After preparing serial dilutions, three replicates per dilution were inoculated in tubes containing listeria enrichment broth. After 48 hours of incubation, for MPN-Culture three inoculated replicates were subcultured on Oxford agar and suspected colonies were confirmed by performing by biochemical tests. For MPN-PCR assay, the DNA extraction was performed from the three inoculated replicates which were already used for MPN-Culture and PCR assay was performed using primers specific for Listeria monocytogenes. The experiment was repeated three times and the average of enumerated bacteria was calculated by each method separately. Statistical analysis using one sample Wilcoxon signed rank test showed that enumeration by MPN-PCR method was more accurate than enumeration by MPN-Culture method. The result of this study showed that MPN-PCR method in comparision with MPN-Culture even in the presence of different background microorganisms is more rapid and reliable. It is concluded that MPN-PCR method facilitates the enumeration of Listeria monocytogenes without excessive work and could be considered as an alternative to MPN-Culture technique.

  7. Modelling the effect of lactic acid bacteria from starter- and aroma culture on growth of Listeria monocytogenes in cottage cheese

    DEFF Research Database (Denmark)

    Østergaard, Nina Bjerre; Eklöw, Annelie; Dalgaard, Paw

    2014-01-01

    Four mathematical models were developed and validated for simultaneous growth of mesophilic lactic acid bacteria from added cultures and Listeria monocytogenes, during chilled storage of cottage cheese with freshor cultured cream dressing. The mathematical models include the effect of temperature...... cheese to improvemodel performance. The inhibiting effect of mesophilic lactic acid bacteria from added cultures on growth of L. monocytogenes was efficiently modelled using the Jameson approach. The new models appropriately predicted the maximum population density of L. monocytogenes in cottage cheese....... The developed models were successfully validated by using 25 growth rates for L. monocytogenes, 17 growth rates for lactic acid bacteria and a total of 26 growth curves for simultaneous growth of L. monocytogenes and lactic acid bacteria in cottage cheese. These data were used in combination with bias...

  8. [Bacteriostatic and/or bactericidal extract of Aloe vera gel on cultures of Listeria monocytogenes].

    Science.gov (United States)

    Ramírez Mérida, Luis Guillermo; Morón de Salim, Alba; Catinella, Rosangela; Castillo, Luis

    2012-03-01

    Listeria monocytogenes is a bacteria responsible for food borne diseases (FBD). The effect of Aloe vera gel extract as a possible bacteriostatic and/or bactericidal against Listeria monocytogenes, was checked by determined the minimum inhibitory concentration (MIC), the time of minimum inhibition (TMI) and minimum bactericidal concentration (MBC) solutions extract of Aloe vera gel in different concentrations on cultures of Listeria monocytogenes ATCC 7635. We applied the agar diffusion method, using solutions of extract of Aloe vera gel at concentrations of 0 to 100% for the MIC. The TMI was determined by growth curves in trypticase soy broth with an initial inoculum of Listeria monocytogenes ATCC 7635 of 108 CFU/mL in each solution. It was determined that the MIC was 10% extract of Aloe vera gel and TMI was 5 hours at concentrations of 10%, 20% and 30% of Aloe vera, while concentrations of 50, 80, 90 and 100%, the time was 8 hours. It was found that indeed the Aloe vera gel is bacteriostatic power on Listeria monocytogenes (p < 0.001), but yet, no bactericidal effect was obtained in our study.

  9. Fate of viable but non-culturable Listeria monocytogenes in pig manure microcosms

    Directory of Open Access Journals (Sweden)

    Jeremy eDesneux

    2016-03-01

    Full Text Available The fate of two strains of L. monocytogenes and their ability to become viable but non-culturable (VBNC was investigated in microcosms containing piggery effluents (two raw manures and two biologically treated manures stored for two months at 8°C and 20°C. Levels of L. monocytogenes were estimated using the culture method, qPCR, and propidium monoazide treatment combined with qPCR (qPCRPMA. The chemical composition and the microbial community structure of the manures were also analysed. The strains showed similar decline rates and persisted up to 63 days. At day zero, the percentage of VBNC cells among viable cells was higher in raw manures (81.5-94.8% than in treated manures (67.8-79.2%. The changes in their proportion over time depended on the temperature and on the type of effluent: the biggest increase was observed in treated manures at 20°C and the smallest increase in raw manures at 8°C. The chemical parameters had no influence on the behaviour of the strains, but decrease of the persistence of viable cells was associated with an increase in the microbial richness of the manures. This study demonstrated that storing manure altered the culturability of L. monocytogenes, which rapidly entered the VBNC state, and underlines the importance of including VBNC cells when estimating the persistence of the pathogens in farm effluents.

  10. Leucocins 4010 from Leuconostoc carnosum cause a matrix related decrease in intracellular pH of Listeria monocytogenes

    DEFF Research Database (Denmark)

    Fang, Weihuan; Budde, Birgitte Bjørn; Siegumfeldt, Henrik

    2006-01-01

    A mixed culture of single cells of Listeria monocytogenes and the bacteriocin producing Leuconostoc carnosum 4010 showed growth inhibition of L. monocytogenes, although the intracellular pH (pHi) of L. monocytogenes followed by fluorescence ratio imaging microscopy was not affected. Furthermore, L...

  11. In vitro detection of pathogenic Listeria monocytogenes from food sources by conventional, molecular and cell culture method

    Directory of Open Access Journals (Sweden)

    J.A. Khan

    2013-09-01

    Full Text Available Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO. A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG; R: CCTCCAGAGTGATCGATGTT complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR. PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%, followed by fish meat (4.0%, and then beef (2.5%. Among various milk and milk products, curd (2.0% showed the highest prevalence, followed by raw milk (1.3%. The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 µL and 50 µL of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro resulted positive in twenty four

  12. Modelling the effect of lactic acid bacteria from starter- and aroma culture on growth of Listeria monocytogenes in cottage cheese.

    Science.gov (United States)

    Østergaard, Nina Bjerre; Eklöw, Annelie; Dalgaard, Paw

    2014-10-01

    Four mathematical models were developed and validated for simultaneous growth of mesophilic lactic acid bacteria from added cultures and Listeria monocytogenes, during chilled storage of cottage cheese with fresh- or cultured cream dressing. The mathematical models include the effect of temperature, pH, NaCl, lactic- and sorbic acid and the interaction between these environmental factors. Growth models were developed by combining new and existing cardinal parameter values. Subsequently, the reference growth rate parameters (μref at 25°C) were fitted to a total of 52 growth rates from cottage cheese to improve model performance. The inhibiting effect of mesophilic lactic acid bacteria from added cultures on growth of L. monocytogenes was efficiently modelled using the Jameson approach. The new models appropriately predicted the maximum population density of L. monocytogenes in cottage cheese. The developed models were successfully validated by using 25 growth rates for L. monocytogenes, 17 growth rates for lactic acid bacteria and a total of 26 growth curves for simultaneous growth of L. monocytogenes and lactic acid bacteria in cottage cheese. These data were used in combination with bias- and accuracy factors and with the concept of acceptable simulation zone. Evaluation of predicted growth rates of L. monocytogenes in cottage cheese with fresh- or cultured cream dressing resulted in bias-factors (Bf) of 1.07-1.10 with corresponding accuracy factor (Af) values of 1.11 to 1.22. Lactic acid bacteria from added starter culture were on average predicted to grow 16% faster than observed (Bf of 1.16 and Af of 1.32) and growth of the diacetyl producing aroma culture was on average predicted 9% slower than observed (Bf of 0.91 and Af of 1.17). The acceptable simulation zone method showed the new models to successfully predict maximum population density of L. monocytogenes when growing together with lactic acid bacteria in cottage cheese. 11 of 13 simulations of L

  13. Impact of environmental factors on the culturability and viability of Listeria monocytogenes under conditions encountered in food processing plants.

    Science.gov (United States)

    Overney, Anaïs; Jacques-André-Coquin, Joséphine; Ng, Patricia; Carpentier, Brigitte; Guillier, Laurent; Firmesse, Olivier

    2017-03-06

    The ability of Listeria monocytogenes to adhere to and persist on surfaces for months or even years may be responsible for its transmission from contaminated surfaces to food products. Hence the necessity to find effective means to prevent the establishment of L. monocytogenes in food processing environments. The aim of this study was to assess, through a fractional experimental design, the environmental factors that could affect the survival of L. monocytogenes cells on surfaces to thereby prevent the persistence of this pathogen in conditions mimicking those encountered in food processing plants: culture with smoked salmon juice or meat exudate, use of two materials with different hygiene status, biofilm of L. monocytogenes in pure-culture or dual-culture with a Pseudomonas fluorescens strain, application of a drying step after cleaning and disinfection (C&D) and comparison of two strains of L. monocytogenes. Bacterial survival was assessed by culture, qPCR to quantify total cells, and propidium monoazide coupled with qPCR to quantify viable cells and highlight viable but non-culturable (VBNC) cells. Our results showed that failure to apply C&D causes cell persistence on surfaces. Moreover, the sanitation procedure leads only to a loss of culturability and appearance of VBNC populations. However, an additional daily drying step after C&D optimises the effectiveness of these procedures to reduce culturable populations. Our results reinforce the importance to use molecular tools to monitor viable pathogens in food processing plants to avoid underestimating the amounts of cells using only methods based on cell culture. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. Evidence of metabolically active but non-culturable Listeria monocytogenes in long-term growth at 10 °C.

    Science.gov (United States)

    Gurresch, Anna; Gerner, Wilhelm; Pin, Carmen; Wagner, Martin; Hein, Ingeborg

    2016-05-01

    Cultures of Listeria monocytogenes at low temperatures (10 °C) in a broth model revealed long-term survival at about 0.04% cell density in relation to the log phase. In contrast, direct viable counts and PMA real-time PCR data suggested that 50% and 1% of the population retain membrane integrity, respectively. To elucidate the observed difference, the metabolic activity of the bacterial population was investigated by multiparametric flow cytometry, including the assessment of membrane integrity, reductase activity, as well as forward and side scatter properties. These analyses were complemented by 16S rRNA real-time PCR. The majority of the cells retained their membrane integrity and reductase activity until day 29. On day 42, 48.00 ± 4.00% (L. monocytogenes strain 3251) and 68.67 ± 3.74% (L. monocytogenes strain 535) of the cells had intact membranes, whereas 57.23 ± 1.85% (strain 3251) and 74.97 ± 3.01% (strain 535) exhibited high reductase activity. On day 42, mean 16S rRNA copy numbers of 3.98 ± 1.37 (membrane integrity) and 3.86 ± 1.32 (reductase activity) remained per intact or active cell. Our data suggest the transition of L. monocytogenes into a state of metabolic dormancy during long-term culture at low temperature. Copyright © 2016. Published by Elsevier Masson SAS.

  15. Spontaneous bacterial peritonitis due to Listeria monocytogenes: importance of enrichment culture.

    Science.gov (United States)

    Jayasinghe, Saroj; Connor, Martin; Donaldson, Shona; Austin, Hannah; Foster, Adele

    2010-09-01

    A case of Listeria monocytogenes induced spontaneous bacterial peritonitis (SBP) is reported in a patient with primary biliary cirrhosis. It is an indolent illness and may not show a neutrophil reaction in peritoneal fluid. Enrichment broth was required to isolate L monocytogenes in the patient. This is not routinely used in the UK and therefore isolates may be missed. L monocytogenes remains sensitive to ampicillin, penicillin and gentamicin, but is resistant to cephalosporin antibiotics. The rising incidence of listeriosis in the population suggests that the incidence of SBP from L monocytogenes is likely to increase.

  16. Detection and enumeration of viable Listeria monocytogenes cells from ready-to-eat and processed vegetable foods by culture and DVC-FISH

    OpenAIRE

    Moreno Trigos, Mª Yolanda; SÁNCHEZ CONTRERAS, JAVIER; Montes Estellés, Rosa Mª; García Hernández, Jorge.; Ballesteros, Lorena; Ferrús Pérez, Mª Antonia

    2012-01-01

    Listeria monocytogenes is an important agent of foodborne disease, showing low prevalence but high mortality. There is evidence that vegetables are important vehicles of transmission, especially those minimally processed (fresh, fresh-cut vegetables under modified atmosphere packaging (MAP) or frozen) and directly exposed to consumers. The aim of this work was to detect and enumerate viable . L. . monocytogenes cells by culture and molecular methods from vegetable foods.A total of 191 vegetab...

  17. Survival of Listeria monocytogenes in simulated gastrointestinal system and transcriptional profiling of stress- and adhesion-related genes

    DEFF Research Database (Denmark)

    Jiang, Lingli; Olesen, Inger; Andersen, Thomas;

    2010-01-01

    survival of L. monocytogenes serotypes 4b and 1=2a strains were higher than that of serotype 1=2c, suggesting that pathogenicity might be related to the viability in the gastrointestinal tract.The transcription levels of prfA and the general stress-related genes clpC, clpE, and clpP were upregulated...... afterpassing through the simulated gastrointestinal tract, whereas that of the adhesion-related gene ami was downregulated. Taken together, this study revealed that L. monocytogenes strains enhanced the expression of stressrelated genes and decreased the transcription of adhesion-related gene in order...

  18. Listeria monocytogenes virulence factor Listeriolysin O favors bacterial growth in co-culture with the ciliate Tetrahymena pyriformis, causes protozoan encystment and promotes bacterial survival inside cysts

    Directory of Open Access Journals (Sweden)

    Ermolaeva Svetlana A

    2010-01-01

    Full Text Available Abstract Background The gram-positive pathogenic bacterium Listeria monocytogenes is widely spread in the nature. L. monocytogenes was reported to be isolated from soil, water, sewage and sludge. Listeriolysin O (LLO is a L. monocytogenes major virulence factor. In the course of infection in mammals, LLO is required for intracellular survival and apoptosis induction in lymphocytes. In this study, we explored the potential of LLO to promote interactions between L. monocytogenes and the ubiquitous inhabitant of natural ecosystems bacteriovorous free-living ciliate Tetrahymena pyriformis. Results Wild type L. monocytogenes reduced T. pyriformis trophozoite counts and stimulated encystment. The effects were observed starting from 48 h of co-incubation. On the day 14, trophozoites were eliminated from the co-culture while about 5 × 104 cells/ml remained in the axenic T. pyriformis culture. The deficient in the LLO-encoding hly gene L. monocytogenes strain failed to cause mortality among protozoa and to trigger protozoan encystment. Replenishment of the hly gene in the mutant strain restored toxicity towards protozoa and induction of protozoan encystment. The saprophytic non-haemolytic species L. innocua transformed with the LLO-expressing plasmid caused extensive mortality and encystment in ciliates. During the first week of co-incubation, LLO-producing L. monocytogenes demonstrated higher growth rates in association with T. pyriformis than the LLO-deficient isogenic strain. At latter stages of co-incubation bacterial counts were similar for both strains. T. pyriformis cysts infected with wild type L. monocytogenes caused listerial infection in guinea pigs upon ocular and oral inoculation. The infection was proved by bacterial plating from the internal organs. Conclusions The L. monocytogenes virulence factor LLO promotes bacterial survival and growth in the presence of bacteriovorous ciliate T. pyriformis. LLO is responsible for L. monocytogenes

  19. Isolation and detection of Listeria monocytogenes in poultry meat by standard culture methods and PCR

    Science.gov (United States)

    Kureljušić, J.; Rokvić, N.; Jezdimirović, N.; Kureljušić, B.; Pisinov, B.; Karabasil, N.

    2017-09-01

    Listeria is the genus of a bacteria found in soil and water and some animals, including poultry and cattle. It can be present in raw milk and food made from raw milk. It can also live in food processing plants and contaminate a variety of processed meats. Microscopically, Listeria species appear as small, Gram-positive rods, which are sometimes arranged in short chains. In direct smears, they can be coccoid, so they can be mistaken for streptococci. Longer cells can resemble corynebacteria. Flagella are produced at room temperature but not at 37°C. Haemolytic activity on blood agar has been used as a marker to distinguish Listeria monocytogenes among other Listeria species, but it is not an absolutely definitive criterion. Further biochemical characterization is necessary to distinguish between the different Listeria species. The objective of this study was to detect, isolate and identify Listeria monocytogenes from poultry meat. Within a period of six months from January to June 2017, a total of 15 samples were collected. Three samples were positive for the presence of Listeria monocytogenes. Biochemical and microbiological tests as well as PCR technique using specific primers were used to confirm L. Monocytogenes in the samples.

  20. Physiology of Listeria monocytogenes in relation to food components and biopreservation.

    NARCIS (Netherlands)

    Verheul, A.

    1997-01-01

    Listeria monocytogenes is an important foodborne pathogen that has been responsible for severe infections in humans. The ubiquitous distribution of L. monocytogenes in the environment and its ability to grow at refrigeration temperature and at high osmolarity are of paramount importance for its haz

  1. Control of Relative Air Humidity as a Potential Means to Improve Hygiene on Surfaces: A Preliminary Approach with Listeria monocytogenes.

    Science.gov (United States)

    Zoz, Fiona; Iaconelli, Cyril; Lang, Emilie; Iddir, Hayet; Guyot, Stéphane; Grandvalet, Cosette; Gervais, Patrick; Beney, Laurent

    2016-01-01

    Relative air humidity fluctuations could potentially affect the development and persistence of pathogenic microorganisms in their environments. This study aimed to characterize the impact of relative air humidity (RH) variations on the survival of Listeria monocytogenes, a bacterium persisting on food processing plant surfaces. To assess conditions leading to the lowest survival rate, four strains of L. monocytogenes (EGDe, CCL500, CCL128, and LO28) were exposed to different RH conditions (75%, 68%, 43% and 11%) with different drying kinetics and then rehydrated either progressively or instantaneously. The main factors that affected the survival of L. monocytogenes were RH level and rehydration kinetics. Lowest survival rates between 1% and 0.001% were obtained after 3 hours of treatment under optimal conditions (68% RH and instantaneous rehydration). The survival rate was decreased under 0.001% after prolonged exposure (16h) of cells under optimal conditions. Application of two successive dehydration and rehydration cycles led to an additional decrease in survival rate. This preliminary study, performed in model conditions with L. monocytogenes, showed that controlled ambient RH fluctuations could offer new possibilities to control foodborne pathogens in food processing environments and improve food safety.

  2. [Evaluation of the effect of probiotic cultures added to commercial yogurt over a known population of Listeria monocytogenes and Escherichia coli O157:H7].

    Science.gov (United States)

    Barrantes, Xinia; Railey, Dylana; Arias, María Laura; Chaves, Carolina

    2004-09-01

    The effect of probiotic cultures over Listeria monocytogenes and Escherichia coli O157:H7 during yogurt storage was evaluated. Two different yogurt brands, one with additional probiotic cultures (Lactobacillus casei and L. acidophilus) were inoculated with known populations (106 UFC/g) of either L. monocytogenes or E. coli O157:H7 in three different times and stored for 32 days at 5 degrees C. Every four days the count of lactic bacteria, the added pathogens and pH was evaluated, according to the methodology described in the Bacteriological Analytical Manual. The pH and lactic bacteria population were constant during the testing period. Yogurt with additional probiotic cultures reduced the population of L. monocytogenes in 8 days, the population of E. coli O157:H7 in 16; yogurt with no additional probiotics took 20 days to reduce L. monocytogenes to non-detectable levels and even after 28 days of storage, E. coli O157:H7 was cultured. In this work, the beneficial effects of additional probiotic cultures in yogurt is confirmed again.

  3. Comparative Evaluation of Veriflow® Listeria monocytogenes to USDA and AOAC Culture Based Methods for the Detection of Listeria monocytogenes in Food.

    Science.gov (United States)

    Joelsson, Adam C; Brown, Ashley S; Puri, Amrita; Keough, Martin P; Gaudioso, Zara E; Siciliano, Nicholas A; Snook, Adam E

    2015-01-01

    Veriflow® Listeria monocytogenes (LM) is a molecular based assay for the presumptive detection of Listeria monocytogenes from environmental surfaces, dairy, and ready-to-eat (RTE) food matrixes (hot dogs and deli meat). The assay utilizes a PCR detection method coupled with a rapid, visual, flow-based assay that develops in 3 min post PCR amplification and requires only 24 h of enrichment for maximum sensitivity. The Veriflow LM system eliminates the need for sample purification, gel electrophoresis, or fluorophore-based detection of target amplification, and does not require complex data analysis. This Performance Tested Method(SM) validation study demonstrated the ability of the Veriflow LM method to detect low levels of artificially inoculated L. monocytogenes in seven distinct environmental and food matrixes. In each unpaired reference comparison study, probability of detection analysis indicated no significant difference between the Veriflow LM method and the U.S. Department of Agriculture, Food Safety and Inspection Service Microbiology Laboratory Guidebook 8.08 or AOAC 993.12 reference method. Fifty strains of L. monocytogenes were detected in the inclusivity study, while 39 nonspecific organisms were undetected in the exclusivity study. The study results show that Veriflow LM is a sensitive, selective, and robust assay for the presumptive detection of L. monocytogenes sampled from environmental, dairy, or RTE (hot dogs and deli meat) food matrixes.

  4. Use of a genetically enhanced, pediocin-producing starter culture, Lactococcus lactis subsp. lactis MM217, to control Listeria monocytogenes in cheddar cheese

    NARCIS (Netherlands)

    Buyong, N; Kok, J; Luchansky, JB

    1998-01-01

    Cheddar cheese was prepared with Lactococcus lactis subsp, lactis MM217, a starter culture which contains pMC117 coding for pediocin PA-1, About 75 liters of pasteurized milk (containing ca, 3.6% fat) was inoculated with strain MM217 (ca, 10(6) CFU per ml) and a mixture of three Listeria monocytogen

  5. Biochemical and molecular characteristics of Listeria monocytogenes isolates from a prosthetic mitral heart valve-bearing patient´s blood cultures

    Directory of Open Access Journals (Sweden)

    Nilma Cintra Leal

    2013-09-01

    Full Text Available Background: In Brazil, listeriosis is not a notifiable disease; thus, the incidence of Brazilian cases remains unknown. Listeria monocytogenes is not always included in automated systems, and its detection depends on the high skill level of microbiology laboratory professionals. This paper describes the characteristics of L. monocytogenes isolates fortuitously obtained from an endocarditis case in Recife, PE, Brazil. Methods: Six bacterial isolates obtained from six blood cultures from a 28-year-old male bearing a prosthetic mitral heart valve were analyzed by PCR using primers specific of L. monocytogenes to confirm a presumptive identification, determine the serotype and presence of the virulence genes (inlA, inlB, inlC, inlJ, hly, plcA, actA, prfA in an attempt to determine the Listeria genotype by PCR-ribotyping. Results: The samples were identified as L. monocytogenes 4b. All investigated virulence genes were amplified by PCR, and the identity of the amplified segments was confirmed by sequencing. A deletion of 105 base pairs was detected in the actA gene. All of the samples generated the same PCR-ribotype pattern, clustered into a single ribotype, and were considered a single strain. Conclusion: L. monocytogenes infection should be considered in endocarditis differential diagnoses, especially among high-risk groups, due to its high pathogenicity and the environmental ubiquity.

  6. BIOCHEMICAL AND MOLECULAR CHARACTERISTICS OF LISTERIA MONOCYTOGENES ISOLATES FROM A PROSTHETIC MITRAL HEART VALVE-BEARING PATIENT´S BLOOD CULTURES

    Directory of Open Access Journals (Sweden)

    Nilma Cintra Lea

    2013-09-01

    Full Text Available Background: In Brazil, listeriosis is not a notifiable disease; thus, the incidence of Brazilian cases remains unknown. Listeria monocytogenes is not always included in automated systems, and its detection depends on the high skill level of microbiology laboratory professionals. This paper describes the characteristics of L. monocytogenes isolates fortuitously obtained from an endocarditis case in Recife, PE, Brazil. Methods: Six bacterial isolates obtained from six blood cultures from a 28-year-old male bearing a prosthetic mitral heart valve were analyzed by PCR using primers specific of L. monocytogenes to confirm a presumptive identification, determine the serotype and presence of the virulence genes (inlA, inlB, inlC, inlJ, hly, plcA, actA, prfA in an attempt to determine the Listeria genotype by PCR-ribotyping. Results: The samples were identified as L. monocytogenes 4b. All investigated virulence genes were amplified by PCR, and the identity of the amplified segments was confirmed by sequencing. A deletion of 105 base pairs was detected in the actA gene. All of the samples generated the same PCR-ribotype pattern, clustered into a single ribotype, and were considered a single strain. Conclusion: L. monocytogenes infection should be considered in endocarditis differential diagnoses, especially among high-risk groups, due to its high pathogenicity and the environmental ubiquity.

  7. Expression of virulence-related genes in Listeria monocytogenes grown on Danish hard cheese as affected by NaCl content

    DEFF Research Database (Denmark)

    Larsen, Nadja; Jespersen, Lene

    2015-01-01

    Expression of virulence-related genes in Listeria monocytogenes incubated on cheese was assessed by real-time quantitative polymerase chain reaction. The objective of the study was to investigate the impact of sodium chloride concentration in cheese on transcription of virulence genes and, thereby......, virulence potential of L. monocytogenes. The expression studies were performed with L. monocytogenes strains characterized by different tolerance to salt stress. Strains ATCC(®) 51779 and DSMZ 15675 were incubated on the Danish hard-cheese type Samsoe, with low (high (3.6% [wt....../wt]) content of NaCl. Genes differentially expressed (p

  8. Inhibition of Listeria monocytogenes and Escherichia coli O157:H7 in liquid broth medium and during processing of fermented sausage using autochthonous starter cultures.

    Science.gov (United States)

    Pragalaki, T; Bloukas, J G; Kotzekidou, P

    2013-11-01

    The antimicrobial effect of two autochthonous starter cultures of Lactobacillus sakei was evaluated in vitro (in liquid broth medium) and in situ assays. The inactivation of foodborne pathogens Listeria monocytogenes (serotype 4ab No 10) and Escherichia coli O157:H7 ATCC 43888 was investigated during the production of fermented sausage according to a typical Greek recipe using L. sakei strains as starter cultures. The inactivation kinetics were modeled using GInaFiT, a freeware tool to assess microbial survival curves. By the end of the ripening period, the inhibition of L. monocytogenes was significant in treatments with L. sakei 8416 and L. sakei 4413 compared to the control treatment. A 2.2-log reduction of the population of E. coli O157:H7 resulted from the autochthonous starter culture L. sakei 4413 during sausage processing. The use of the autochthonous starter cultures constitutes an additional improvement to the microbial safety by reducing foodborne pathogens.

  9. Co-culture with Listeria monocytogenes within a dual-species biofilm community strongly increases resistance of Pseudomonas putida to benzalkonium chloride.

    Directory of Open Access Journals (Sweden)

    Efstathios Giaouris

    Full Text Available Biofilm formation is a phenomenon occurring almost wherever microorganisms and surfaces exist in close proximity. This study aimed to evaluate the possible influence of bacterial interactions on the ability of Listeria monocytogenes and Pseudomonas putida to develop a dual-species biofilm community on stainless steel (SS, as well as on the subsequent resistance of their sessile cells to benzalkonium chloride (BC used in inadequate (sub-lethal concentration (50 ppm. The possible progressive adaptability of mixed-culture biofilms to BC was also investigated. To accomplish these, 3 strains per species were left to develop mixed-culture biofilms on SS coupons, incubated in daily renewable growth medium for a total period of 10 days, under either mono- or dual-species conditions. Each day, biofilm cells were exposed to disinfection treatment. Results revealed that the simultaneous presence of L. monocytogenes strongly increased the resistance of P. putida biofilm cells to BC, while culture conditions (mono-/dual-species did not seem to significantly influence the resistance of L. monocytogenes biofilm cells. BC mainly killed L. monocytogenes cells when this was applied against the dual-species sessile community during the whole incubation period, despite the fact that from the 2nd day this community was mainly composed (>90% of P. putida cells. No obvious adaptation to BC was observed in either L. monocytogenes or P. putida biofilm cells. Pulsed field gel electrophoresis (PFGE analysis showed that the different strains behaved differently with regard to biofilm formation and antimicrobial resistance. Such knowledge on the physiological behavior of mixed-culture biofilms could provide the information necessary to control their formation.

  10. Co-culture with Listeria monocytogenes within a dual-species biofilm community strongly increases resistance of Pseudomonas putida to benzalkonium chloride.

    Science.gov (United States)

    Giaouris, Efstathios; Chorianopoulos, Nikos; Doulgeraki, Agapi; Nychas, George-John

    2013-01-01

    Biofilm formation is a phenomenon occurring almost wherever microorganisms and surfaces exist in close proximity. This study aimed to evaluate the possible influence of bacterial interactions on the ability of Listeria monocytogenes and Pseudomonas putida to develop a dual-species biofilm community on stainless steel (SS), as well as on the subsequent resistance of their sessile cells to benzalkonium chloride (BC) used in inadequate (sub-lethal) concentration (50 ppm). The possible progressive adaptability of mixed-culture biofilms to BC was also investigated. To accomplish these, 3 strains per species were left to develop mixed-culture biofilms on SS coupons, incubated in daily renewable growth medium for a total period of 10 days, under either mono- or dual-species conditions. Each day, biofilm cells were exposed to disinfection treatment. Results revealed that the simultaneous presence of L. monocytogenes strongly increased the resistance of P. putida biofilm cells to BC, while culture conditions (mono-/dual-species) did not seem to significantly influence the resistance of L. monocytogenes biofilm cells. BC mainly killed L. monocytogenes cells when this was applied against the dual-species sessile community during the whole incubation period, despite the fact that from the 2nd day this community was mainly composed (>90%) of P. putida cells. No obvious adaptation to BC was observed in either L. monocytogenes or P. putida biofilm cells. Pulsed field gel electrophoresis (PFGE) analysis showed that the different strains behaved differently with regard to biofilm formation and antimicrobial resistance. Such knowledge on the physiological behavior of mixed-culture biofilms could provide the information necessary to control their formation.

  11. Comparison of invasiveness among surface-adherent variants of Listeria monocytogenes in Caco-2 cell culture assays.

    Science.gov (United States)

    Kushwaha, Kalpana; Muriana, Peter M

    2010-03-31

    The persistence of Listeria monocytogenes in meat processing plants is believed to be partly linked with their adherence properties to abiotic surfaces that may allow contamination of ready-to-eat (RTE) foods. Isolates of raw meats, RTE meats and environmental samples from RTE meat processing facilities that demonstrated differences in adherence to abiotic surfaces (glass, plastic, stainless steel, and rubber) were tested for cellular adherence and invasion in the Caco-2 human cell line. Strains of L. monocytogenes were classified into strong (CW50, 99-38, CW77, SM5 and CW62) and weakly adherent (CW34, CW35, CW72, SM3, J7 and J126) based on a microplate adherence assay using the fluorescing substrate, 5,6-CFDA. These strains were tested for adherence and invasion in cell culture assays with Caco-2 cells. At long incubation time (2h) and high multiplicity of infection (MOI, 100:1) we observed equivalent cellular adherence and invasiveness. After optimizing conditions for time of infection (15-, 30-, 60-, 90-, and 120-min) and MOI (100:1, 10:1, 1:1, and 0.1:1), we found that under the conditions of 15-min infection time at an MOI of 10:1 (Listeria:Caco-2 cells), we again observed equivalent cellular adherence by the two distinct surface-adherent groups, but we only recovered invading Listeria from the group that was strongly adherent to environmental surfaces. The data indicate that a surface factor that provides for strong environmental surface adherence may also be involved with internal cellular virulence and survival and implicates strongly adherent strains as possibly being of greater invasiveness than weakly adherent strains.

  12. Listeria monocytogenes: diagnostic problems

    NARCIS (Netherlands)

    Beumer, R.R.; Hazeleger, W.C.

    2003-01-01

    The first isolation methods for the detection of Listeria spp. were generally based on the direct culture of samples on simple agar media, but isolation of the pathogenic Listeria monocytogenes was difficult. In time, new techniques were developed, based on a variety of selective and elective agents

  13. Fødevarebetinget listeria monocytogenes endokarditis

    DEFF Research Database (Denmark)

    Frydland, Martin; Bundgaard, Henning; Moser, Claus

    2014-01-01

    Infection with Listeria monocytogenes is rare and mainly seen in immunosuppressed patients. Infection with L. monocytogenes has a mortality rate of 30%. We present a case report of L. monocytogenes bacteraemia and endocarditis in a 70-year-old man with several co-morbidities and following four...... major surgical procedures. This illustrates the findings and characteristics in one of the 16 patients who died in 2013 and 2014 this summer due to sausage-related L. monocytogenes infection....

  14. Corporate Culture and Public Relations

    OpenAIRE

    Korolko, Valentyn; Nekrasova, Oksana

    2009-01-01

    Analyzing American publications dealing with the concept of excellent public relations, the authors trace the development of organizational culture and its connection with societal culture, as well as an alyze theoretical and methodological issues of corporate culture and its impact on public relations in an organization. Special attention is paid to some ways in which professional PR departments can be come the source of progressive counter cultures inside the organization capable of changin...

  15. Studies on the pathogenesis and survival of different culture forms of Listeria monocytogenes to pulsed UV-light irradiation after exposure to mild-food processing stresses.

    Science.gov (United States)

    Bradley, Derek; McNeil, Brian; Laffey, John G; Rowan, Neil J

    2012-06-01

    The effects of mild conventional food-processing conditions on Listeria monocytogenes survival to pulsed UV (PUV) irradiation and virulence-associated characteristics were investigated. Specifically, this study describes the inability of 10 strains representative of 3 different culture forms or morphotypes of L. monocytogenes to adapt to normally lethal levels of PUV-irradiation after exposure to sub-lethal concentrations of salt (7.5% (w/v) NaCl for 1 h), acid (pH 5.5 for 1 h), heating (48 °C for 1 h) or PUV (UV dose 0.08 μJ/cm(2)). Findings showed that the order of increasing sensitivity of L. monocytogenes of non-adapted and stressed morphotypes to low pH (pH 3.5 for 5 h, adjusted with lactic), high salt (17.5% w/v NaCl for 5 h), heating (60 °C for 1 h) and PUV-irradiation (100 pulses at 7.2 J and 12.8 J, equivalent to UV doses of 2.7 and 8.4 μJ/cm(2) respectively) was typical wild-type smooth (S/WT), atypical filamentous rough (FR) and atypical multiple-cell-chain (MCR) variants. Exposure of L. monocytogenes cells to sub-lethal acid, salt or heating conditions resulted in similar or increased susceptibility to PUV treatments. Only prior exposure to mild heat stressing significantly enhanced invasion of Caco-2 cells, whereas subjection of L. monocytogenes cells to combined sub-lethal salt, acid and heating conditions produced the greatest reduction in invasiveness. Implications of these findings are discussed. This constitutes the first study to show that pre-exposure to mild conventional food-processing stresses enhances sensitivity of different culture morphotypes of L. monocytogenes to PUV, which is growing in popularity as an alternative or complementary approach for decontamination in the food environment. Copyright © 2011 Elsevier Ltd. All rights reserved.

  16. EU-Russia Cultural Relations

    Directory of Open Access Journals (Sweden)

    Elena Sidorova

    2014-05-01

    Full Text Available This article analyzes the link between culture and diplomacy between Russia and the European Union, and shows the importance of cultural relations. It examines the common space of science, education and culture introduced at the 2003 EU-Russia Summit in St. Petersburg and the application of the principles of this concept that were established at the 2005 EU-Russia Summit in Moscow. It then considers EU-Russia collaboration on humanitarian action and the challenges that both parties face in this sphere. It also explains the formation of EU domestic and foreign cultural policy, and the role of European institutions and states in cultural affairs and diplomacy, as well as key elements and mechanisms of contemporary Russian foreign cultural policy. In addition, the article focuses on the European side of post-Soviet EU-Russia cultural relations. This cultural collaboration is defined as a competitive neighbourhood. EU and Russian interests collide: while Europeans try to promote their values, norms and standards within the framework of the European Neighbourhood Policy, Russia seeks to culturally influence and engage in this region for geostrategic and historical reasons. Finally, the article assesses the prospects for the EU-Russia cultural relations and emphasizes the role of ideology in improving such relations.

  17. Organizational Culture and Public Relations

    OpenAIRE

    Sezgin, Murat; Bulut, Beyza

    2013-01-01

    The organizational culture of is the total sum of the symbols and myths conveying the basic values to the employees. The cultures that belong to organizations develop in time and exert an effect on the workers of the organization in establishing interactions through the opportunities and threats of the environment. The organizational culture which forms an important system of values on the individuals and decisions also plays a role on public relations. Therefore, the individuals should be aw...

  18. Culture Negative Listeria monocytogenes Meningitis Resulting in Hydrocephalus and Severe Neurological Sequelae in a Previously Healthy Immunocompetent Man with Penicillin Allergy

    Directory of Open Access Journals (Sweden)

    Shahin Gaini

    2015-01-01

    Full Text Available A previously healthy 74-year-old Caucasian man with penicillin allergy was admitted with evolving headache, confusion, fever, and neck stiffness. Treatment for bacterial meningitis with dexamethasone and monotherapy ceftriaxone was started. The cerebrospinal fluid showed negative microscopy for bacteria, no bacterial growth, and negative polymerase chain reaction for bacterial DNA. The patient developed hydrocephalus on a second CT scan of the brain on the 5th day of admission. An external ventricular catheter was inserted and Listeria monocytogenes grew in the cerebrospinal fluid from the catheter. The patient had severe neurological sequelae. This case report emphasises the importance of covering empirically for Listeria monocytogenes in all patients with penicillin allergy with suspected bacterial meningitis. The case also shows that it is possible to have significant infection and inflammation even with negative microscopy, negative cultures, and negative broad range polymerase chain reaction in cases of Listeria meningitis. Follow-up spinal taps can be necessary to detect the presence of Listeria monocytogenes.

  19. Listeria monocytogenes infection in pregnancy and neonatal sepsis

    Directory of Open Access Journals (Sweden)

    Francesca Pascale

    2008-06-01

    Full Text Available Authors report a fatal neonatal sepsis caused by Listeria monocytogenes. While the diagnostic procedure aimed to identify the microrganism is described, it is emphasized the importance to recover Streptococcus agalactiae (GBS and L. monocytogenes by means of vaginal-rectal swab culture. The intrapartum screening for L. monocytogenes, by Polymerase Chain Reaction (PCR providing results in 75 minutes is also evaluated.

  20. Quantifying Listeria monocytogenes prevalence and concentration in minced pork meat and estimating performance of three culture media from presence/absence microbiological testing using a deterministic and stochastic approach.

    Science.gov (United States)

    Andritsos, Nikolaos D; Mataragas, Marios; Paramithiotis, Spiros; Drosinos, Eleftherios H

    2013-12-01

    Listeria monocytogenes poses a serious threat to public health, and the majority of cases of human listeriosis are associated with contaminated food. Reliable microbiological testing is needed for effective pathogen control by food industry and competent authorities. The aims of this work were to estimate the prevalence and concentration of L. monocytogenes in minced pork meat by the application of a Bayesian modeling approach, and also to determine the performance of three culture media commonly used for detecting L. monocytogenes in foods from a deterministic and stochastic perspective. Samples (n = 100) collected from local markets were tested for L. monocytogenes using in parallel the PALCAM, ALOA and RAPID'L.mono selective media according to ISO 11290-1:1996 and 11290-2:1998 methods. Presence of the pathogen was confirmed by conducting biochemical and molecular tests. Independent experiments (n = 10) for model validation purposes were performed. Performance attributes were calculated from the presence-absence microbiological test results by combining the results obtained from the culture media and confirmative tests. Dirichlet distribution, the multivariate expression of a Beta distribution, was used to analyze the performance data from a stochastic perspective. No L. monocytogenes was enumerated by direct-plating (concentration was estimated at 14-17 CFU/kg. Validation showed good agreement between observed and predicted prevalence (error = -2.17%). The results showed that all media were best at ruling in L. monocytogenes presence than ruling it out. Sensitivity and specificity varied depending on the culture-dependent method. None of the culture media was perfect in detecting L. monocytogenes in minced pork meat alone. The use of at least two culture media in parallel enhanced the efficiency of L. monocytogenes detection. Bayesian modeling may reduce the time needed to draw conclusions regarding L. monocytogenes presence and the uncertainty of the results

  1. [Evaluation of the effect of Lactobacillus rhamnosus probiotic culture added to yogurt over Staphylococcus aureus, Escherichia coli O157:H7, Listeria monocytogenes and Salmonella enteritidis populations].

    Science.gov (United States)

    Calderón, Oscar; Padilla, Carolina; Chaves, Carolina; Villalobos, Laura; Arias, María Laura

    2007-03-01

    The effect of different types of probiotics present in yogurt over known populations of Staphylococcus aureus, Escherichia coli O157:H7, Listeria monocytogenes and Salmonella enteritidis was evaluated. The three types of yogurt used were: without added probiotics, with added probiotics (Lactobacillus casei CRL_431 and L. acidophilus CRL_730 CHR HANSEN) and another one with the same probiotics mentioned above and Lactobacillus rhamnosus (LR-35) culture. About 10(9) CFU/ mL of each potentially pathogenic bacteria was added to each type of yogurt tested, and kept in refrigeration at 4 degrees C during its shelf life, about 30 days. Bacterial count was done the initial day and every four days. Results obtained show that there is a difference in the inhibition between yogurts without added probiotics and the commercial yogurt with added probiotics; there is a clear inhibitory effect of the last one over S. aureus, E. coli O157:H7 and Listeria monocytogenes. The yogurt with added probiotics and L. rhamnosus did not show any additional inhibitory effect over the bacteria tested when compared with the yogurt with added probiotics. S. enteritidis could not be evaluated because it was not detectable in any yogurt samples evaluated four days after its inoculation. This study confirms the antagonic effect of probiotic cultures over potentially pathogenic bacteria for human beings and animals that may be present in food. Nevertheless, the use of L. rhamnosus did not produce any additional inhibitory effect.

  2. Paradigm dichotomies of international cultural relations

    OpenAIRE

    Rogač-Mijatović, Ljiljana

    2012-01-01

    International cultural relations are being discussed in terms of both theory and practice, as well as designing terms of reference 'cultural diplomacy' and 'public diplomacy'. The presented analysis shows the development of international cultural relations in a historical perspective, from cultural internationalism and cultural propaganda, to the paradigms of the Cold War post-Cold War cultural relations. The text as a key idea tackles the issue of diverse conceptions of culture in internatio...

  3. Comparative inhibitory effects of Thymus vulgaris L. essential oil against Staphylococcus aureus, Listeria monocytogenes and mesophilic starter co-culture in cheese-mimicking models.

    Science.gov (United States)

    de Carvalho, Rayssa Julliane; de Souza, Geanny Targino; Honório, Vanessa Gonçalves; de Sousa, Jossana Pereira; da Conceição, Maria Lúcia; Maganani, Marciane; de Souza, Evandro Leite

    2015-12-01

    In the present study, we assessed the effects of Thymus vulgaris L. essential oil (TVEO) on Staphylococcus aureus and Listeria monocytogenes, pathogenic bacteria frequently associated with fresh or low-ripened cheeses (e.g., Brazilian coalho cheese), and on a starter co-culture comprising Lactococcus lactis subsp. lactis and L. lactis subsp. cremoris, which are commonly used for the production of different cheeses. To measure these effects, we determined the minimum inhibitory concentration (MIC) and assessed bacterial cell viability over time in (coalho) cheese-based broth and in a semi-solid (coalho) cheese model at 10 °C. The MIC for TVEO was 2.5 μL/mL against S. aureus and L. monocytogenes, while the MIC was 1.25 μL/mL against the starter co-culture. The TVEO (5 and 2.5 μL/mL) sharply reduced the viable counts of all assayed bacteria in cheese broth over 24 h; although, at 5 μL/mL, TVEO more severely affected the viability of the starter co-culture compared with pathogenic bacteria. The addition of 1.25 μL/g of TVEO in the semi-solid cheese model did not reduce the viable counts of all assayed bacteria. At 2.5 μL/g, TVEO slightly decreased the viable counts of S. aureus, L. monocytogenes and Lactococcus spp. in the semi-solid cheese model over 72 h. The final counts of Lactococcus spp. in a semi-solid cheese model containing 2.5 μL/mL TVEO were lower than those of pathogenic bacteria under the same conditions. These results suggest that the doses of TVEO used to control pathogenic bacteria in fermented dairy products, especially in low-ripened cheeses, should be cautiously considered for potential negative effects on the growth and survival of starter cultures.

  4. Characterization of Listeria monocytogenes isolates of food and human origins from Brazil using molecular typing procedures and in vitro cell culture assays.

    Science.gov (United States)

    Bueno, Valter F; Banerjee, Pratik; Banada, Padmapriya P; José de Mesquita, Albenones; Lemes-Marques, Eneida G; Bhunia, Arun K

    2010-02-01

    The spreading of diseases through foods is a worldwide concern. Here, molecular and in vitro cell-culture assays were employed to characterize 63 Brazilian Listeria monocytogenes isolates (food, 47; clinical, 16). Serotype 4b was the most predominant (49%) followed by (1/2)b (30%), (1/2)a (10%), (1/2)c (6%), 3c (3%) and 3b (2%). Ribotyping yielded 17 ribopatterns, which were grouped into four phylogenetic clusters. Cluster A comprised of 39/63 isolates primarily of food origin, and clusters B, C and D contained both food and clinical isolates. Isolates were positive for virulence determinants prfA, hlyA and inlA: clinical isolates were more invasive to Caco-2 cells and expressed high levels of inlA transcripts than the food isolates. Highly invasive isolates also provoked more Ped-2E9 cells to die by apoptosis than the weakly-invasive strains. These data demonstrate a strong genetic relatedness among clinical and food isolates and suggest transmission of a subset of L. monocytogenes strains from food to humans.

  5. The Two-Component System CesRK Controls the Transcriptional Induction of Cell Envelope-Related Genes in Listeria monocytogenes in Response to Cell Wall-Acting Antibiotics▿ †

    Science.gov (United States)

    Gottschalk, Sanne; Bygebjerg-Hove, Iver; Bonde, Mette; Nielsen, Pia Kiil; Nguyen, Thanh Ha; Gravesen, Anne; Kallipolitis, Birgitte H.

    2008-01-01

    The two-component system CesRK of Listeria monocytogenes responds to cell wall-acting antibiotics. We show here that CesRK controls the transcription of several cell envelope-related genes. The CesRK-dependent induction of these genes may be viewed as an attempt by L. monocytogenes to protect itself against the damaging effects of cell wall-acting antibiotics. PMID:18456805

  6. The two-component system CesRK controls the transcriptional induction of cell envelope-related genes in Listeria monocytogenes in response to cell wall-acting antibiotics.

    Science.gov (United States)

    Gottschalk, Sanne; Bygebjerg-Hove, Iver; Bonde, Mette; Nielsen, Pia Kiil; Nguyen, Thanh Ha; Gravesen, Anne; Kallipolitis, Birgitte H

    2008-07-01

    The two-component system CesRK of Listeria monocytogenes responds to cell wall-acting antibiotics. We show here that CesRK controls the transcription of several cell envelope-related genes. The CesRK-dependent induction of these genes may be viewed as an attempt by L. monocytogenes to protect itself against the damaging effects of cell wall-acting antibiotics.

  7. Estimating the non-thermal inactivation of Listeria monocytogenes in fermented sausages relative to temperature, pH and water activity.

    Science.gov (United States)

    Mataragas, M; Rantsioua, K; Alessandria, V; Cocolin, L

    2015-02-01

    Data relative to in situ Listeria monocytogenes inactivation in fermented sausages were collected from 13 individual studies found in the literature. Inactivation rates were extrapolated and used to develop a predictive model to evaluate the relative effects of pH, water activity (a(w)) and temperature on L. monocytogenes fate during fermentation and ripening. Temperature explained ca. 60% of the data variability, while pH and a(w) only a small part. Temperature alone may not be sufficient to cause pathogen's inactivation, but inactivation rate is dominated by temperature when pH and a(w) are in the range which prevent L. monocytogenes growth. A predictive model based on two Arrhenius equations (ln[inactivation rate]=-25.71-[-0.6829 / (8.314 × T)] for fermentation; and ln[inactivation rate]=-44.86-[-1.219/(8.314 × T)] for ripening)was developed. The model can be used to quantify the effect of temperature and/or time changes on fermented sausage safety. The advantages and limitations of the model are discussed.

  8. Comparison of the Prevalences and Diversities of Listeria Species and Listeria monocytogenes in an Urban and a Rural Agricultural Watershed.

    Science.gov (United States)

    Stea, Emma C; Purdue, Laura M; Jamieson, Rob C; Yost, Chris K; Truelstrup Hansen, Lisbeth

    2015-06-01

    Foods and related processing environments are commonly contaminated with the pathogenic Listeria monocytogenes. To investigate potential environmental reservoirs of Listeria spp. and L. monocytogenes, surface water and point source pollution samples from an urban and a rural municipal water supply watershed in Nova Scotia, Canada, were examined over 18 months. Presumptive Listeria spp. were cultured from 72 and 35% of rural and urban water samples, respectively, with 24% of the positive samples containing two or three different Listeria spp. The L. innocua (56%) and L. welshimeri (43%) groups were predominant in the rural and urban watersheds, respectively. Analysis by the TaqMan assay showed a significantly (P Listeria spp. were associated with 70 times higher odds of isolating L. monocytogenes (odds ratio = 70; P Listeria species population and could be a potential reservoir for L. monocytogenes, especially in rural agricultural watersheds.

  9. Comparison of polymerase chain reaction methods and plating for analysis of enriched cultures of Listeria monocytogenes when using the ISO11290-1 method.

    Science.gov (United States)

    Dalmasso, Marion; Bolocan, Andrei Sorin; Hernandez, Marta; Kapetanakou, Anastasia E; Kuchta, Tomáš; Manios, Stavros G; Melero, Beatriz; Minarovičová, Jana; Muhterem, Meryem; Nicolau, Anca Ioana; Rovira, Jordi; Skandamis, Panagiotis N; Stessl, Beatrix; Wagner, Martin; Jordan, Kieran; Rodríguez-Lázaro, David

    2014-03-01

    Analysis for Listeria monocytogenes by ISO11290-1 is time-consuming, entailing two enrichment steps and subsequent plating on agar plates, taking five days without isolate confirmation. The aim of this study was to determine if a polymerase chain reaction (PCR) assay could be used for analysis of the first and second enrichment broths, saving four or two days, respectively. In a comprehensive approach involving six European laboratories, PCR and traditional plating of both enrichment broths from the ISO11290-1 method were compared for the detection of L. monocytogenes in 872 food, raw material and processing environment samples from 13 different dairy and meat food chains. After the first and second enrichments, total DNA was extracted from the enriched cultures and analysed for the presence of L. monocytogenes DNA by PCR. DNA extraction by chaotropic solid-phase extraction (spin column-based silica) combined with real-time PCR (RTi-PCR) was required as it was shown that crude DNA extraction applying sonication lysis and boiling followed by traditional gel-based PCR resulted in fewer positive results than plating. The RTi-PCR results were compared to plating, as defined by the ISO11290-1 method. For first and second enrichments, 90% of the samples gave the same results by RTi-PCR and plating, whatever the RTi-PCR method used. For the samples that gave different results, plating was significantly more accurate for detection of positive samples than RTi-PCR from the first enrichment, but RTi-PCR detected a greater number of positive samples than plating from the second enrichment, regardless of the RTi-PCR method used. RTi-PCR was more accurate for non-food contact surface and food contact surface samples than for food and raw material samples especially from the first enrichment, probably because of sample matrix interference. Even though RTi-PCR analysis of the first enrichment showed less positive results than plating, in outbreak scenarios where a rapid result is

  10. Prevalence and growth of Listeria monocytogenes in naturally contaminated seafood

    DEFF Research Database (Denmark)

    Jørgensen, Lasse Vigel; Huss, Hans Henrik

    1998-01-01

    Listeria monocytogenes contamination of seafood varies with product category. The highest prevalence was found in cold- smoked fish (34-60%), while the lowest was found in heat- treated and cured seafood (4-12%). The prevalence of L. monocytogenes differed greatly in cold-smoked salmon between...... production sites, ranging from monocytogenes. The organism showed moderate growth...... in naturally contaminated cold-smoked, and 'gravad', fish while the growth appeared faster in hot smoked fish. Thus L. monocytogenes is not under control in these products. Finally, the prevalence and growth of L. monocytogenes in naturally contaminated cold-smoked salmon are discussed in relation...

  11. Prevalence and growth of Listeria monocytogenes in naturally contaminated seafood

    DEFF Research Database (Denmark)

    Jørgensen, Lasse Vigel; Huss, Hans Henrik

    1998-01-01

    Listeria monocytogenes contamination of seafood varies with product category. The highest prevalence was found in cold- smoked fish (34-60%), while the lowest was found in heat- treated and cured seafood (4-12%). The prevalence of L. monocytogenes differed greatly in cold-smoked salmon between...... production sites, ranging from monocytogenes. The organism showed moderate growth...... in naturally contaminated cold-smoked, and 'gravad', fish while the growth appeared faster in hot smoked fish. Thus L. monocytogenes is not under control in these products. Finally, the prevalence and growth of L. monocytogenes in naturally contaminated cold-smoked salmon are discussed in relation...

  12. Linguistic Relativity and Cultural Communication

    Science.gov (United States)

    Zhifang, Zhu

    2002-01-01

    A culture is usually with the bias of universalization. Each culture has its ultimate concern, and its answers to the concern make up a worldview. And each culture is inclined to see its worldview as universal. The Christian thinks that Jehovah God is the creator and law-maker of the whole universe; Chinese think that the sage's teaching sheds…

  13. Inhibition of Listeria monocytogenes in deli-style turkey breast formulated with cultured celery powder and/or cultured sugar-vinegar blend during storage at 4°c.

    Science.gov (United States)

    Golden, Max C; McDonnell, Lindsey M; Sheehan, Vivien; Sindelar, Jeffrey J; Glass, Kathleen A

    2014-10-01

    Fermentation-derived nitrite (NO2) from vegetable sources is increasingly used as a "clean label" alternative to conventional NaNO2. Previous results suggested that processed meats cured with NO2 derived from a "natural" source had lower antimicrobial activity than did meats produced with chemical NaNO2; however, the differences were likely due to NO2 concentration rather than source. The objective of this study was to compare the antilisterial properties of traditional and clean label alternative curing approaches when combined with antimicrobials in deli-style turkey. Listeria monocytogenes inhibition by NO2 from synthetic and natural sources was validated in deli-style turkey (73 to 74% moisture, 1.8% salt, pH 6.4). Products were prepared with 0, 80, or 120 mg/kg NO2 using purified NaNO2 or cultured celery powder. Additional treatments were supplemented with 3.8% lactate-diacetate blend (LD) or 1% cultured sugar-vinegar blend (DF). Sliced cooked products were surface inoculated with L. monocytogenes at 3 log CFU/g, vacuum packaged, and stored at 4°C for 12 weeks. Results revealed an average 2.4-log increase in L. monocytogenes at 3 weeks in the control without antimicrobials, a 1.3-log increase at 4 weeks for both 80 mg/kg NO2 treatments, and a 1.5-log increase at 6 weeks for the 120 mg/kg NO2 treatments. No significant difference (P > 0.05) in growth inhibition was found between NO2 sources when equivalent concentrations were added. In uncured turkey with 3.8% LD or 1% DF, growth was delayed until 6 weeks, whereas supplementation with LD or DF and 80 mg/kg NO2 from either source delayed listerial growth through 12 weeks. This study confirmed that the concentration of NO2, rather than the source, is a primary factor in enhancing the safety of ready-to-eat meats. Both conventional NO2 treatments and a clean label solution consisting of a fermentation-derived antimicrobial combined with 80 mg/kg naturally derived NO2 inhibited L. monocytogenes through 12 weeks of

  14. Genome Sequence of Listeria monocytogenes Plasmid pLM-C-273 Carrying Genes Related to Stress Resistance.

    Science.gov (United States)

    Liang, Lindsay; Gnaneshan, Saravanamuttu; Garduño, Rafael A; Mallo, Gustavo V

    2016-10-13

    Mobile genetic elements in bacteria, such as plasmids, act as important vectors for the transfer of antibiotic resistance, virulence, and metal resistance genes. Here, we report the genome sequence of a new plasmid pLM-C-273, identified in a Listeria monocytogenes strain isolated from a clinical sample in Ontario, Canada.

  15. Genome Sequence of Listeria monocytogenes Plasmid pLM-C-273 Carrying Genes Related to Stress Resistance

    Science.gov (United States)

    Liang, Lindsay; Gnaneshan, Saravanamuttu; Garduño, Rafael A.

    2016-01-01

    Mobile genetic elements in bacteria, such as plasmids, act as important vectors for the transfer of antibiotic resistance, virulence, and metal resistance genes. Here, we report the genome sequence of a new plasmid pLM-C-273, identified in a Listeria monocytogenes strain isolated from a clinical sample in Ontario, Canada. PMID:27738039

  16. Listeria monocytogenes impact on mature or old Pseudomonas fluorescens biofilms during growth at 4 and 20ºC

    Directory of Open Access Journals (Sweden)

    Puga eCH

    2016-02-01

    Full Text Available Changes in spatial organization, as observed by confocal laser scanning microscopy (CLSM, viable cell content, biovolume and substratum surface coverage of the biofilms formed on glass by Pseudomonas fluorescens resulting from co-culture with Listeria monocytogenes, were examined. Two strains of L. monocytogenes, two culture temperatures and two biofilm developmental stages were investigated. Both L. monocytogenes strains, a persistently sampled isolate (collected repeatedly along 3 years from a meat factory and Scott A, induced shrinkage in matrix volume, both at 20ºC and 4ºC, in mature or old biofilms, without loss of P. fluorescens cell count per surface unit. The nearly homogeneous pattern of surface coverage shown by mono-species P. fluorescens biofilms, turned into more irregular layouts in co-culture with L. monocytogenes. The upper layer of both mono and dual-species biofilms turned to predominantly consist of matrix, with plenty of viable cells underneath, in old biofilms cultured at 20ºC, but not in those grown at 4ºC. Between 15 and 56% of the substratum area was covered by biofilm, the extent depending on temperature, time and L. monocytogenes strain. Real biofilms in food-related surfaces may thus be very heterogeneous regarding their superficial components, i.e. those more accessible to disinfectants. It is therefore a hygienic challenge to choose an adequate agent to disrupt them.

  17. Bacteriocin like substance production by Carnobacterium piscicola in a continuous system with three culture broths. Study of antagonism against Listeria monocytogenes on vacuum packaged salmon Produção de substâncias semelhantes à bacteriocinas por C. piscicola em um sistema contínuo com três meios de cultura e seu antagonismo contra L. monocytogenes em salmão embalado a vácuo

    Directory of Open Access Journals (Sweden)

    Renate P. Schöbitz

    2006-03-01

    Full Text Available Three culture media were studied for the bacteriocin like substance (BLS production from Carnobacterium piscicola L 103 in a batch and continuous culture system. The efficacy of the antagonistic substance against Listeria monocytogenes was tested on vacuum packaged salmon. BLS was produced in a 1.0 L bioreactor by batch and continuous culture using D-MRS, mod. D-MRS and APT as nutrient broths. Salmon fillets were inoculated with BLS (200 AU mL-1 and 800 AU mL-1 and 8.0 x 10¹ cfu cm-2 of L. monocytogenes and stored at 4ºC. The growth of L. monocytogenes was determined every 5 days during 15 days. After 12 h of batch culture the stationary growth phase of C. piscicola L 103 started, with a BLS activity of 800 AU mL-1 in D-MRS and mod. D-MRS broth, and of 400 AU mL-1 in APT broth. During continuous culture BLS activity increased to 6400 AU mL-1 in both types of MRS broths, while in APT the activity decreased to 50 AU mL-1, indicating a clear advantage of the first two culture media and also of the continuous culture system. BLS had a bacteriostatic effect on L. monocytogenes when inoculated on salmon, with counts of 6.0 x 10³ cfu cm-2 after 15 days. No significant differences were found between the two BLS activities used. In the control without BLS, L. monocytogenes counts increased to 1.0 x 10(6 cfu cm-2 after 15 days of storage.Três meios de cultura foram avaliados quanto a produção de substâncias semelhantes a bacteriocinas (SSB por Carnobacterium piscicola L 103, utilizando um sistema contínuo de cultura. A eficácia da substância antagonista contra Listeria monocytogenes foi testada em salmão embalado a vácuo. As SSB foram produzidas em bioreator de 1.0 L, em cultura contínua e em cultura estacionária, utilizando D-MRS, mod. D-MRS e APT como meios de cultivo. Filés de salmão foram inoculados com SSB (200 AU mL-1 e 800 AU mL-1 e L. monocytogenes (8.0 x 10¹ ufc cm-2 e mantidos a 4ºC. O crescimento de L. monocytogenes foi

  18. Thermal resistance of Listeria monocytogenes Scott A in ultrafiltered milk as related to the effect of different milk components.

    Science.gov (United States)

    Szlachta, Kinga; Keller, Susanne E; Shazer, Arlette; Chirtel, Stuart

    2010-11-01

    Pasteurization parameters for grade A milk are well established and set by regulation. However, as solids levels increase, an increased amount of heat is required to destroy any pathogens present. This effect is not well characterized. In this work, the effect of increased dairy solids levels on the thermal resistance of Listeria monocytogenes was examined through the use of ultrafiltered (UF) milk, reconstituted milk powder, and the milk components lactose and caseinate. From the results obtained, lactose and caseinate did not appear to affect thermal resistance. In addition, the level of milk fat, up to 10% of the total solids in UF whole milk, did not result in statistically significant changes to thermal resistance when compared with UF skim milk. Reconstituted skim milk powder at 27% total solids (D⁶²-value = 1.16 ± 0.2 [SD] min, z = 5.7) did result in increased thermal resistance, as compared with reconstituted skim milk powder at 17.5% (D⁶²-value = 0.86 ± 0.02 min, z = 5.57) and UF whole milk at 27% total solids (D⁶²-value = 0.66 ± 0.07 min, z = 5.16). However, that increase appeared to be due to the increase in salt levels, not to increases in caseinate, fat, or lactose. Consequently, total solids, as a single measure, could not be used to predict increased thermal resistance of L. monocytogenes in concentrated milk.

  19. Is Information Ethics Culture-Relative?

    NARCIS (Netherlands)

    Brey, Philip A.E.; Szewczak, Edward J.

    2009-01-01

    In this article, I examine whether information ethics is culture relative. If it is, different approaches to information ethics are required in different cultures and societies. This would have major implications for the current, predominantly Western approach to information ethics. If it is not,

  20. Is Information Ethics Culture-Relative?

    NARCIS (Netherlands)

    Brey, Philip; Zaphiris, Panayiotis; Ang, Chee Siang

    2009-01-01

    In this article, I examine whether information ethics is culture relative. If it is, different approaches to information ethics are required in different cultures and societies. This would have major implications for the current, predominantly Western approach to information ethics. If it is not, th

  1. PCR experion automated electrophoresis system to detect Listeria monocytogenes in foods.

    Science.gov (United States)

    Delibato, Elisabetta; Gattuso, Antonietta; Minucci, Angelo; Auricchio, Bruna; De Medici, Dario; Toti, Laura; Castagnola, Massimo; Capoluongo, Ettore; Gianfranceschi, Monica Virginia

    2009-11-01

    Listeria monocytogenes is frequently found as a contaminant in raw and ready-to-eat foods. The ability of L. monocytogenes to multiply at refrigeration temperatures and to grow in a wide range of pH values is of particular concern for food safety. According to the European Union regulation on microbiological criteria for foodstuffs, L. monocytogenes must be absent in some categories of ready-to-eat foods. The standard microbiological method for L. monocytogenes detection in foods (ISO 11290-1: 1996 (ISO, International Organization for Standardization)) is cost and time consuming. Developments of rapid, cost-effective and automated diagnostic methods to detect food-borne pathogens in foods continue to be a major concern for the industry and public health. The aim of this study was the development of a rapid, sensitive and specific molecular detection method for L. monocytogenes. To this purpose, we have applied a capillary electrophoresis method to a PCR protocol (PCR-EES (EES, experion automated electrophoresis system)) for detecting L. monocytogenes in food. In particular, a microfluidic chip-based automated electrophoresis system (experion automated electrophoresis system, Bio-Rad Laboratories, USA) was used for the rapid and automatic analysis of the amplicons. Fifty naturally contaminated samples were analysed with this method and the results were compared with those obtained with ISO method. Moreover, the microfluidic chip-based automated electrophoresis system was compared with classical gel electrophoresis (PCR-CGE). The results showed that after 24 h of culture enrichment, the PCR-EES showed a relative accuracy of 100% with ISO, while using PCR-CGE decreased it down to 96%. After 48 h of enrichment, both PCR-EES and PCR-CGE showed an accuracy of 100% with ISO.

  2. Effect of corporate culture on public relations activities interaction between public relations and corporate culture

    OpenAIRE

    DEMİRCİ, FETTAHOĞLU Sevgin

    2010-01-01

    Public relations units which were giving support to efforts to develop and expand a common corporate culture have evolved into units playing an effective role in decision-making mechanisms. Public relations experts should be familiar with and be capable of applying the components of corporate culture. The purpose of this paper is to emphasize the importance of public relations activities which is undeniably crucial for developing the concept of corporate culture and to expose its strengths. I...

  3. Survival strategies of Listeria monocytogenes - roles of regulators and transporters

    NARCIS (Netherlands)

    Wemekamp-Kamphuis, H.H.

    2003-01-01

    Outbreaks of the food-borne pathogen Listeria monocytogenes are mainly associated with ready-to-eatfoods. Survival strategies of L. monocytogenes in relation to minimally processed foods were studied.

  4. Culture Negative Listeria monocytogenes Meningitis Resulting in Hydrocephalus and Severe Neurological Sequelae in a Previously Healthy Immunocompetent Man with Penicillin Allergy

    DEFF Research Database (Denmark)

    Gaini, Shahin; Karlsen, Gunn Hege; Nandy, Anirban

    2015-01-01

    for bacteria, no bacterial growth, and negative polymerase chain reaction for bacterial DNA. The patient developed hydrocephalus on a second CT scan of the brain on the 5th day of admission. An external ventricular catheter was inserted and Listeria monocytogenes grew in the cerebrospinal fluid from...

  5. Rosmarinus officinalis L. essential oil and the related compound 1,8-cineole do not induce direct or cross-protection in Listeria monocytogenes ATCC 7644 cultivated in meat broth.

    Science.gov (United States)

    Gomes Neto, Nelson Justino; Luz, Isabelle Silva; Honório, Wanessa Gonçalves; Tavares, Adassa Gama; de Souza, Evandro Leite

    2012-08-01

    Listeria monocytogenes has the capability of adapting to 1 or more antimicrobial compounds or procedures applied by the food industry to control the growth and survival of microorganisms in foods. In this study, the effects of Rosmarinus officinalis essential oil (EO) and the related compound 1,8-cineole on the inhibition of the growth and survival of L. monocytogenes ATCC 7644 were determined. The ability of the R. officinalis EO and 1,8-cineole to induce direct and cross-protection of bacteria against various stresses (lactic acid, pH 5.2; NaCl, 3 g/100 mL; high temperature, 45 °C) was also determined. At all concentrations tested (minimum inhibitory concentration (MIC), ½ MIC, and ¼ MIC), both compounds inhibited the cell viability of L. monocytogenes over 120 min of exposure. Overnight exposure of L. monocytogenes to sublethal amounts of either the R. officinalis EO or 1,8-cineole in meat broth revealed no induction of direct or cross-protection against lactic acid, NaCl, or high temperature. Similarly, cells subjected to 24 h cycles of adaptation with increasing amounts (½ MIC to 2× MIC) of the EO and 1,8-cineole showed no increase in direct tolerance, as they were able to survive in growth medium containing up to ½ MIC of either substance. These results show the antimicrobial efficacy of R. officinalis EO and 1,8-cineole for use in systems, particularly as anti-L. monocytogenes compounds.

  6. Growth inhibition of Listeria monocytogenes by a nonbacteriocinogenic Carnobacterium piscicola

    DEFF Research Database (Denmark)

    Nilsson, Lilian; Bech Hansen, T.; Garrido, P.

    2005-01-01

    Aims: This study elucidates the mechanisms by which a nonbacteriocinogenic Carnobacterium piscicola inhibits growth of Listeria monocytogenes. Methods and Results: Listeria monocytogenes was exposed to live cultures of a bacteriocin-negative variant of C. piscicola A9b in co-culture, in a diffusion...... chamber system, and to a cell-free supernatant. Suppression of maximum cell density (0-3.5 log units) of L. monocytogenes was proportional to initial levels of C. pisciola (10(3)-10(7) CFU ml(-1)). Cell-to-cell contact was not required to cause inhibition. The cell-free C. piscicola supernatant caused...... a decrease in L. monocytogenes maximum cell density, which was abolished by glucose addition but not by amino acid, vitamin or mineral addition. The fermentate also gave rise to a longer lag phase and a reduction in growth rate. These effects were independent of glucose and may have been caused by acetate...

  7. The effect of bacteriocin-producing Lactobacillus plantarum strains on the intracellular pH of sessile and planktonic Listeria monocytogenes single cells.

    Science.gov (United States)

    Nielsen, Dennis S; Cho, Gyu-Sung; Hanak, Alexander; Huch, Melanie; Franz, Charles M A P; Arneborg, Nils

    2010-07-31

    A wide range of lactic acid bacteria (LAB) produce bacteriocins mainly active against other closely related LAB, but some bacteriocins are also active against the food-borne pathogen Listeria monocytogenes. With the aim of increasing food safety it has thus been considered to utilise bacteriocins and/or bacteriocin-producing LAB as "natural" food preservatives in foods such as cheese, meat and ready-to-eat products. Some strains of Lactobacillus plantarum produce bacteriocins termed plantaricins. Using a single-cell based approach, the effect on the intracellular pH as a measure of the physiological state of sessile and planktonic L. monocytogenes (strains EGDe and N53-1) during co-culturing with plantaricin-producing L. plantarum (strains BFE 5092 and PCS 20) was investigated using fluorescence ratio imaging microscopy (FRIM). Mono-cultures of L. monocytogenes were used as control. Expression levels of plantaricin-encoding genes by sessile and planktonic L. plantarum were determined using qRT-PCR. L.plantarum BFE 5092 possesses the genes for plantaricin EF, JK and N, while L. plantarum PCS 20 contains the genes for plantaricin EF, although determination of the nucleotide sequence of the PCS 20 plantaricin E gene showed that this peptide is probably non-functional. When cultured as mono-culture, both L. monocytogenes strains maintained pH(i) at a constant level around 7.2-7.6 throughout the experiment, independently of the matrix. On a solid surface, L. plantarum BFE 5092 strongly affected pH(i) of L. monocytogenes N53-1 with only 20% of the cells being able to maintain pH(i) in the physiological optimal range with pH>7 and 52% of the cells with pH(i) approximately pH(ex,) showing that the cells had no proton gradient towards the environment. The effect on L. monocytogenes EGDe was less pronounced, but still notable. L.plantarum PCS 20 left both strains of L. monocytogenes virtually unaffected when co-cultured on a solid surface. In liquid, both L. plantarum

  8. Sheep-related Culture of Guizhou

    Institute of Scientific and Technical Information of China (English)

    WuZhengguang

    2003-01-01

    Sheep and goats, major livestock in Guizhou Steppe of southwest China, are of both practical and social value for local dwellers. As sheep is pronounced similar as "auspicious" in Chinese, its image is widely applied to every aspect of local society, including religious rites, calendar calculation, arts creation and architecture. Thus a sheep-related culture has been developed and prospered.

  9. Detection of Listeria monocytogenes in CSF from Three Patients with Meningoencephalitis by Next-Generation Sequencing

    Science.gov (United States)

    Yao, Ming; Zhou, Jiali; Zhu, Yicheng; Zhang, Yinxin; Lv, Xia; Sun, Ruixue; Shen, Ao; Ren, Haitao; Cui, Liying

    2016-01-01

    Background and Purpose Encephalitis caused by Listeria monocytogenes (L. monocytogenes) is rare but sometimes fatal. Early diagnosis is difficult using routine cerebrospinal fluid (CSF) tests, while next-generation sequencing (NGS) is increasingly being used for the detection and characterization of pathogens. Methods This study set up and applied unbiased NGS to detect L. monocytogenes in CSF collected from three cases of clinically suspected listeria meningoencephalitis. Results Three cases of patients with acute/subacute meningoencephalitis are reported. Magnetic resonance imaging and blood cultures led to a suspected diagnosis of L. monocytogenes, while the CSF cultures were negative. Unbiased NGS of CSF identified and sequenced reads corresponding to L. monocytogenes in all three cases. Conclusions This is the first report highlighting the feasibility of applying NGS of CSF as a diagnostic method for central nervous system (CNS) L. monocytogenes infection. Routine application of this technology in clinical microbiology will significantly improve diagnostic methods for CNS infectious diseases.

  10. Acoustic concerns related to multi cultural societies

    DEFF Research Database (Denmark)

    Gade, Anders Christian

    2001-01-01

    Immigration has increased cultural diversity in western societies. The process of integrating immigrants into their host countries can be smoothed if acousticians learn to recognize (1) the acoustic traditions of immigrant cultures and (2) the specific acoustic needs of the new society members. Two...... related projects are discussed. The ``Cahrisma'' project (Conservation of Acoustical Heritage by the Revival and Identification of the Sinan's Mosque Acoustics) is sponsored by the European Commission and carried out in cooperation among researchers in Turkey, Malta, Italy, France, Switzerland...

  11. Cultural intelligence and work-related outcomes

    DEFF Research Database (Denmark)

    Schlaegel, Christopher; Richter, Nicole Franziska; Taras, Vas

    2017-01-01

    Over the last decade the research on cultural intelligence (CQ) has grown to a point that a quantitative synthesis of the existing empirical evidence on the relationship between CQ and various work-related outcomes is needed. Based on 88 studies (100 independent samples, 24,119 individuals......). The results of commonality analysis indicate that while the dimensions of CQ are highly correlated, the CQ dimensions show differential relationships with the different outcome variables, supporting the separability of the CQ dimensions....

  12. Pyelonephritis with bacteremia caused by Listeria monocytogenes: A case report.

    Science.gov (United States)

    Uno, Shunsuke; Hase, Ryota; Toguchi, Akihiro; Otsuka, Yoshihito; Hosokawa, Naoto

    2017-02-01

    Listeria monocytogenes is a well-known cause of meningitis, colitis, and bacteremia; however, obstructive pyelonephritis caused by L. monocytogenes has never been reported. We herein report on a 90-year-old Japanese woman with obstructive pyelonephritis and bacteremia due to uterus carcinoma invading the ureter. She was admitted to our hospital complaining of fever and chills, and her physical examination revealed left costovertebral angle tenderness. Computed tomography showed hydronephrosis and complete ureteral obstruction due to tumor invasion. Blood and urine cultures upon nephrostomy revealed the growth of L. monocytogenes. We treated the patient with two weeks of intravenous ampicillin and an additional one-week treatment of oral sulfamethoxazole/trimethoprim. This case shows the importance to recognize L. monocytogenes as a potential causative agent of urinary tract infection. Copyright © 2016 Japanese Society of Chemotherapy and The Japanese Association for Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  13. Listeria monocytogenes does not survive ingestion by Acanthamoeba polyphaga.

    Science.gov (United States)

    Akya, Alisha; Pointon, Andrew; Thomas, Connor

    2010-03-01

    Listeria monocytogenes is a ubiquitous bacterium capable of infecting humans, particularly pregnant women and immunocompromised individuals. Although the intracellular invasion and pathogenesis of listeriosis in mammalian tissues has been well studied, little is known about the ecology of L. monocytogenes , and in particular the environmental reservoir for this bacterium has not been identified. This study used short-term co-culture at 15, 22 and 37 degrees C to examine the interaction of L. monocytogenes strains with Acanthamoeba polyphaga ACO12. Survival of L. monocytogenes cells phagocytosed by monolayers of trophozoites was assessed by culture techniques and microscopy. A. polyphaga trophozoites eliminated bacterial cells within a few hours post-phagocytosis, irrespective of the incubation temperature used. Wild-type L. monocytogenes and a phenotypic listeriolysin O mutant were unable to either multiply or survive within trophozoites. By contrast, Salmonella enterica serovar Typhimurium C5 cells used as controls were able to survive and multiply within A. polyphaga trophozoites. The data presented indicate that A. polyphaga ACO12 is unlikely to harbour L. monocytogenes, or act as an environmental reservoir for this bacterium.

  14. The biofilm formation ability of Listeria monocytogenes isolated from meat, poultry, fish and processing plant environments is related to serotype and pathogenic profile of the strains

    Directory of Open Access Journals (Sweden)

    Domenico Meloni

    2012-10-01

    Full Text Available In the present study, the relationships between serotype, pathogenic profile and in vitro biofilm formation of 106 Listeria monocytogenes strains, having no epidemiological correlation and isolated from different environmental and food sources, were analyzed. The quantitative assessment of the in vitro biofilm formation was carried out by using a microtiter plate assay with spectrophotometric reading (OD620. The isolates were also submitted to serogrouping using the target genes lmo0737, lmo1118, ORF2819, ORF2110, prs, and to the evaluation of the presence of the following virulence genes: prfA, hlyA, rrn, inlA, inlB, iap, plcA, plcB, actA and mpl, by multiplex PCRs. The 62% of the strains showed weak or moderate in vitro ability in biofilm formation, in particular serotypes 1/2b and 4b, frequently associated with sporadic or epidemic listeriosis cases. The 25% of these isolates showed polymorphism for the actA gene, producing a fragment of 268-bp instead of the expected 385-bp. The deletion of nucleotides in this gene seems to be related to enhanced virulence properties among these strains. Strains belonging to serotypes associated with human infections and characterized by pathogenic potential are capable to persist within the processing plants forming biofilm.

  15. Inhibition of listeriolysin O oligomerization by lutein prevents Listeria monocytogenes infection.

    Science.gov (United States)

    Liu, Bowen; Teng, Zihao; Wang, Jianfeng; Lu, Gejin; Deng, Xuming; Li, Li

    2017-01-01

    The foodborne pathogenic bacterial species Listeria monocytogenes (L. monocytogenes) has caused incalculable damages to public health, and its successful infection requires various virulence factors, including Listeriolysin O (LLO). By forming pores in phagosomal membranes and even in some organelles, LLO plays an indispensable role in the ability of L. monocytogenes to escape from host immune attacks. Because of its critical role, LLO offers an appropriate therapeutic target against L. monocytogenes infection. Here, lutein, a natural small molecule existing widely in fruits and vegetables, is demonstrated as an effective inhibitor of LLO that works by blocking its oligomerization during invasion without showing significant bacteriostatic activity. Further assays applying lutein in cell culture models of invasion and in animal models showed that lutein could effectively inhibit L. monocytogenes infection. Overall, our results indicate that lutein may represent a promising and novel therapeutic agent against L. monocytogenes infection. Copyright © 2016 Elsevier B.V. All rights reserved.

  16. VIDAS Listeria monocytogenes II (LMO2).

    Science.gov (United States)

    Johnson, Ronald; Mills, John

    2013-01-01

    This AOAC GovVal study compared the VIDAS Listeria monocytogenes II (LMO2) to the Health Products and Food Branch MFHPB-30 reference method for detection of L. monocytogenes in ready-to-eat (RTE) meats. The VIDAS LMO2 test is an automated enzyme-linked fluorescent immunoassay for the detection of L. monocytogenes in foods. The LMO2 test, following the enrichment procedure from the MFLP-33 method, also included use of the chromogenic media, chromID Ottaviani Agosti Agar (OAA) and chromID Lmono for confirmation of LMO2 presumptive results. In previous AOAC validation studies comparing the VIDAS LMO2 method to the U.S. Food and Drug Administration Bacteriological Analytical Manual and U.S. Department of Agriculture-Food Safety and Inspection Service reference methods, LMO2 was approved as AOAC Official Method 2004.02 for the detection of L. monocytogenes in dairy products, vegetables, seafood, raw meats and poultry, and processed meats and poultry. The GovVal comparative study included 20 replicate test portions, each at two contamination levels for each matrix, where fractionally positive results (5-15 positive results/20 replicate portions tested) were obtained by at least one method at one level. Five uncontaminated controls were included. Chi-square analysis of the comparative data in this study indicates no statistical differences between the VIDAS LMO2 and the MFHPB-30 standard methods at the 5% level of significance. Confirmation of presumptive LMO2 results with the chromogenic OAA and Lmono media was shown to be equivalent to the appropriate reference method agars. The data demonstrate that the VIDAS LMO2 method is an acceptable alternative method to the MFHPB-30 standard culture method for the detection of L. monocytogenes in RTE meats, including liver paté, hot dogs, raw fermented sausage, sliced deli turkey, and sliced deli ham.

  17. Cultural Competence and Related Factors Among Taiwanese Nurses.

    Science.gov (United States)

    Lin, Chin-Nu; Mastel-Smith, Beth; Alfred, Danita; Lin, Yu-Hua

    2015-12-01

    Taiwan is a multicultural and multiethnic society with a growing number of immigrants who have diverse ethnic, racial, and cultural needs. Although this diversity highlights the pressing need for culturally competent healthcare providers, cultural competence is a concept that is little understood and implemented only sporadically in Taiwan. This study investigates the cultural competence of Taiwanese nurses and the related factors of influence. An online self-report survey was used to collect data from 221 Taiwanese nurses from December 2012 through January 2013. Data from the demographic questionnaire, the Nurses' Cultural Competence Scale, and the Perceived Nurses' Cultural Competence Rating were analyzed using descriptive statistics, Pearson correlation, independent sample t tests, and multiple regressions. The cultural competence of the participants was in the "low to moderate" range, with relatively higher mean scores for the subscales of cultural awareness and cultural sensitivity and relatively lower scores for the subscales of cultural knowledge and cultural skills. Participants generally perceived themselves as being "not culturally competent." Variables found to predict cultural competence included years of work experience, hours of continuing education related to cultural nursing care, and frequency of caring for clients from culturally and ethnically diverse backgrounds. Participating Taiwanese nurses rated their level of cultural competence as in the low-to-moderate range and self-perceived as being not culturally competent. These findings support the need to further expand and enhance cultural-competence-related continuing education and to address the topic of cultural care in the nursing curricula.

  18. Inhibition of Listeria monocytogenes by Enterococcus mundtii isolated from soil.

    Science.gov (United States)

    Bigwood, T; Hudson, J A; Cooney, J; McIntyre, L; Billington, C; Heinemann, J A; Wall, F

    2012-12-01

    Two bacterial isolates with inhibitory activity against Listeria monocytogenes and Enterococcus faecalis were obtained from soil. Genotypic and phenotypic characterization identified them as Enterococcus mundtii, a species whose ability to compete with L. monocytogenes is relatively unexplored compared to other members of the genus. The thermal stability of the inhibitory factor and its sensitivity to proteolytic enzymes indicate that it is most likely a bacteriocin. Both isolates grew at comparable rates to L. monocytogenes at 5 °C and 10 °C in vitro. One isolate killed L. monocytogenes when it reached concentrations of 10(6)-10(8) CFU ml(-1). Minimum inocula of 10(6) and 10(5) CFU ml(-1) of E. mundtii were required to reduce and maintain L. monocytogenes concentrations beneath the level of detection at 5 °C and 10 °C, respectively. In situ experiments at 5 °C showed that E. mundtii inhibited the growth of L. monocytogenes on vacuum-packed cold smoked salmon during its four week shelf life. E. mundtii could, therefore, control the growth of L. monocytogenes at low temperatures, indicating a potential application in controlling this pathogen in chilled foods. To control growth of Listeria, the concentration of E. mundtii needs to be high, but it is possible that a purified bacteriocin could be used to achieve the same effect.

  19. Listeria monocytogenes endocarditis.

    Science.gov (United States)

    Sheinman, B D; Evans, T; Sage, R

    1985-01-01

    A fatal case of endocarditis due to Listeria monocytogenes is reported. Case reports of endocarditis due to this organism are rare but indicate a higher mortality than with many other causes of bacterial endocarditis. The size of the problem may be underestimated because the organism has a "diphtheroid' appearance and may be incorrectly dismissed as a contaminant.

  20. Relaciones Culturales de Mexico: Convenios de Intercambio Cultural y Asistencia Tecnica (Mexican Cultural Relations: Cultural Exchange and Technical Assistance Agreements).

    Science.gov (United States)

    n10 p43-83, 1971

    1971-01-01

    This document is an English-language abstract (approximately 1500 words) describing briefly Mexico's cultural relations with 23 nations with which she has cultural exchange agreements. The reasons for cultural exchange are stated, such as the belief that cultural relations promote good relations among nations. The agreements concluded between…

  1. Relaciones Culturales de Mexico: Convenios de Intercambio Cultural y Asistencia Tecnica (Mexican Cultural Relations: Cultural Exchange and Technical Assistance Agreements).

    Science.gov (United States)

    n10 p43-83, 1971

    1971-01-01

    This document is an English-language abstract (approximately 1500 words) describing briefly Mexico's cultural relations with 23 nations with which she has cultural exchange agreements. The reasons for cultural exchange are stated, such as the belief that cultural relations promote good relations among nations. The agreements concluded between…

  2. Inhibition of sortase A by chalcone prevents Listeria monocytogenes infection.

    Science.gov (United States)

    Li, Hongen; Chen, Yutao; Zhang, Bing; Niu, Xiaodi; Song, Meng; Luo, Zhaoqing; Lu, Gejin; Liu, Bowen; Zhao, Xiaoran; Wang, Jianfeng; Deng, Xuming

    2016-04-15

    The critical role of sortase A in gram-positive bacterial pathogenicity makes this protein a good potential target for antimicrobial therapy. In this study, we report for the first time the crystal structure of Listeria monocytogenes sortase A and identify the active sites that mediate its transpeptidase activity. We also used a sortase A (SrtA) enzyme activity inhibition assay, simulation, and isothermal titration calorimetry analysis to discover that chalcone, an agent with little anti-L. monocytogenes activity, could significantly inhibit sortase A activity with an IC50 of 28.41 ± 5.34 μM by occupying the active site of SrtA. The addition of chalcone to a co-culture of L. monocytogenes and Caco-2 cells significantly inhibited bacterial entry into the cells and L. monocytogenes-mediated cytotoxicity. Additionally, chalcone treatment decreased the mortality of infected mice, the bacterial burden in target organs, and the pathological damage to L. monocytogenes-infected mice. In conclusion, these findings suggest that chalcone is a promising candidate for the development of treatment against L. monocytogenes infection.

  3. Effect of soy and milk protein-related compounds on Listeria monocytogenes infection in human enterocyte Caco-2 cells and A/J mice.

    Science.gov (United States)

    Kuda, Takashi; Nakamura, Shinsuke; An, Choa; Takahashi, Hajime; Kimura, Bon

    2012-10-15

    Listeria monocytogenes causes listeriosis in humans, mainly through the consumption of ready-to-eat foods such as cheese. Immunocompromised persons, the elderly, and pregnant women and their fetuses or newborns are at the highest risk for the infection. We examined the effects of dietary milk-casein (MC) and soy-protein (SP), and their digested compounds tryptone (TP) and phytone peptone (PP), respectively, on L. monocytogenes invasion and infection in human enterocyte-like Caco-2 cells and A/J mice. Invasion into Caco-2 cells tended to be high with TP. In A/J mice orally infected with L. monocytogenes, viable numbers in the liver and spleen showed a tendency of decreasing with the 20% SP diet compared to the 20% MC diet. SP suppressed the inflammation marker tumour necrosis factor-α in spleen tissue. Furthermore, bacteria lipopolysaccharide (LPS)-stimulated nitric oxide (NO) secretion from murine macrophage RAW 264.7 cells was suppressed by PP more than TP. These results suggest that major dietary proteins might affect infection and inflammation by L. monocytogenes.

  4. Impact of sod on the expression of stress-related genes in Listeria monocytogenes 4b G with/without paraquat treatment

    Science.gov (United States)

    Listeria monocytogenes is a food-borne pathogen that causes listeriosis. Paraquat can generate reactive oxygen species (ROS) in cells, which results in oxidative stress. It was firstly shown that 1 mM of paraquat inhibited the growth rate of a superoxide dismutase (sod)-deletion mutant (delta sod) g...

  5. The role of cultural diplomacy in international relations

    OpenAIRE

    Said Saddiki

    2009-01-01

    Cultural diplomacy, as a cornerstone of public diplomacy, plays an important role in today’s international relations, which are characterised by so-called culture shocks, and it should represent a decisive tool not only for transmitting culture and national values, but also for listening to what the cultures from the rest the world are saying to us. The main role of cultural diplomacy is to promote transnational dialogue between cultures and nations, especially between the West and the Muslim...

  6. Colovesical fistula presenting as Listeria monocytogenes bacteraemia.

    Science.gov (United States)

    Hobbs, Mark

    2015-03-31

    We present a case of colovesical fistula presenting with a clinical syndrome of urosepsis subsequently demonstrated to be due to Listeria monocytogenes bacteraemia. The patient had a history of previous rectal cancer with a low anterior resection and a covering ileostomy that had been reversed 6 months prior to this presentation. L. monocytogenes was also isolated among mixed enteric organisms on urine culture. There were no symptoms or signs of acute gastrointestinal listeriosis or meningoencephalitis. This unusual scenario prompted concern regarding the possibility of communication between bowel and bladder, which was subsequently confirmed with CT and a contrast enema. The patient recovered well with intravenous amoxicillin and to date has declined surgical management of his colovesical fistula. This case illustrates the importance of considering bowel pathology when enteric organisms such as Listeria are isolated from unusual sites.

  7. Depletion of autophagy-related genes ATG3 and ATG5 in Tenebrio molitor leads to decreased survivability against an intracellular pathogen, Listeria monocytogenes.

    Science.gov (United States)

    Tindwa, Hamisi; Jo, Yong Hun; Patnaik, Bharat Bhusan; Noh, Mi Young; Kim, Dong Hyun; Kim, Iksoo; Han, Yeon Soo; Lee, Yong Seok; Lee, Bok Luel; Kim, Nam Jung

    2015-01-01

    Macroautophagy (autophagy) is an evolutionarily conserved catabolic process involved in physiological and developmental processes including cell survival, death, and innate immunity. Homologues of most of 36 originally discovered autophagy-related (ATG) genes in yeast have been characterized in higher eukaryotes including insects. In this study, the homologues of ATG3 (TmATG3) and ATG5 (TmATG5) were isolated from the coleopteran beetle, Tenebrio molitor by expressed sequence tag and RNAseq approaches. The cDNA of TmATG3 and TmATG5 comprise open-reading frame sizes of 963 and 792 bp encoding polypeptides of 320 and 263 amino acid residues, respectively. TmATG3 and TmATG5 mRNA are expressed in all developmental stages, and mainly in fat body and hemocytes of larvae. TmATG3 and TmATG5 showed an overall sequence identity of 58-95% to other insect Atg proteins. There exist clear one-to-one orthologs of TmATG3 and TmATG5 in Tribolium and that they clustered together in the gene tree. Depletion of TmATG3 and TmATG5 by RNA interference led to a significant reduction in survival ability of T. molitor larvae against an intracellular pathogen, Listeria monocytogenes. Six days post-Listeria challenge, the survival rate in the dsEGFP-injected (where EGFP is enhanced green fluorescent protein) control larvae was significantly higher (55%) compared to 4 and 3% for TmATG3 and TmATG5 double-stranded RNA injected larvae, respectively. These data suggested that TmATG3 and TmATG5 may play putative role in mediating autophagy-based clearance of Listeria in T. molitor model.

  8. Evolutionary dynamics of the accessory genome of Listeria monocytogenes.

    Directory of Open Access Journals (Sweden)

    Henk C den Bakker

    Full Text Available Listeria monocytogenes, a foodborne bacterial pathogen, is comprised of four phylogenetic lineages that vary with regard to their serotypes and distribution among sources. In order to characterize lineage-specific genomic diversity within L. monocytogenes, we sequenced the genomes of eight strains from several lineages and serotypes, and characterized the accessory genome, which was hypothesized to contribute to phenotypic differences across lineages. The eight L. monocytogenes genomes sequenced range in size from 2.85-3.14 Mb, encode 2,822-3,187 genes, and include the first publicly available sequenced representatives of serotypes 1/2c, 3a and 4c. Mapping of the distribution of accessory genes revealed two distinct regions of the L. monocytogenes chromosome: an accessory-rich region in the first 65° adjacent to the origin of replication and a more stable region in the remaining 295°. This pattern of genome organization is distinct from that of related bacteria Staphylococcus aureus and Bacillus cereus. The accessory genome of all lineages is enriched for cell surface-related genes and phosphotransferase systems, and transcriptional regulators, highlighting the selective pressures faced by contemporary strains from their hosts, other microbes, and their environment. Phylogenetic analysis of O-antigen genes and gene clusters predicts that serotype 4 was ancestral in L. monocytogenes and serotype 1/2 associated gene clusters were putatively introduced through horizontal gene transfer in the ancestral population of L. monocytogenes lineage I and II.

  9. Microbiological criteria for Listeria monocytogenes in foods under special consideration of risk assessment approaches

    DEFF Research Database (Denmark)

    Nørrung, Birgit

    2000-01-01

    This paper shortly summarizes data related to risk assessment of Listeria monocytogenes. From available data on risk assessment, it is concluded that the levels of L. monocytogenes consumed is an important factor affecting the incidence of listeriosis. Foods that do not support the growth of L....... monocytogenes are unlikely to be a source of listeriosis, whereas foods that support the growth to high levels, should be the target of risk management efforts. Based on current epidemiological information from several countries, a concentration of L. monocytogenes not exceeding 100/g of food at the time...

  10. Assessment of Listeria sp. Interference Using a Molecular Assay To Detect Listeria monocytogenes in Food.

    Science.gov (United States)

    Zittermann, Sandra I; Stanghini, Brenda; See, Ryan Soo; Melano, Roberto G; Boleszczuk, Peter; Murphy, Allana; Maki, Anne; Mallo, Gustavo V

    2016-01-01

    Detection of Listeria monocytogenes in food is currently based on enrichment methods. When L. monocytogenes is present with other Listeria species in food, the species compete during the enrichment process. Overgrowth competition of the nonpathogenic Listeria species might result in false-negative results obtained with the current reference methods. This potential issue was noted when 50 food samples artificially spiked with L. monocytogenes were tested with a real-time PCR assay and Canada's current reference method, MFHPB-30. Eleven of the samples studied were from foods naturally contaminated with Listeria species other than those used for spiking. The real-time PCR assay detected L. monocytogenes in all 11 of these samples; however, only 6 of these samples were positive by the MFHPB-30 method. To determine whether L. monocytogenes detection can be affected by other species of the same genus due to competition, an L. monocytogenes strain and a Listeria innocua strain with a faster rate of growth in the enrichment broth were artificially coinoculated at different ratios into ground pork meat samples and cultured according to the MFHPB-30 method. L. monocytogenes was detected only by the MFHPB-30 method when L. monocytogenes/L. innocua ratios were 6.0 or higher. In contrast, using the same enrichments, the real-time PCR assay detected L. monocytogenes at ratios as low as 0.6. Taken together, these findings support the hypothesis that L. monocytogenes can be outcompeted by L. innocua during the MFHPB-30 enrichment phase. However, more reliable detection of L. monocytogenes in this situation can be achieved by a PCR-based method mainly because of its sensitivity.

  11. Recombinant Probiotic Expressing Listeria Adhesion Protein Attenuates Listeria monocytogenes Virulence In Vitro

    Science.gov (United States)

    Koo, Ok Kyung; Amalaradjou, Mary Anne Roshni; Bhunia, Arun K.

    2012-01-01

    Background Listeria monocytogenes, an intracellular foodborne pathogen, infects immunocompromised hosts. The primary route of transmission is through contaminated food. In the gastrointestinal tract, it traverses the epithelial barrier through intracellular or paracellular routes. Strategies to prevent L. monocytogenes entry can potentially minimize infection in high-risk populations. Listeria adhesion protein (LAP) aids L. monocytogenes in crossing epithelial barriers via the paracellular route. The use of recombinant probiotic bacteria expressing LAP would aid targeted clearance of Listeria from the gut and protect high-risk populations from infection. Methodology/Principal Findings The objective was to investigate the ability of probiotic bacteria or LAP-expressing recombinant probiotic Lactobacillus paracasei (LbpLAP) to prevent L. monocytogenes adhesion, invasion, and transwell-based transepithelial translocation in a Caco-2 cell culture model. Several wild type probiotic bacteria showed strong adhesion to Caco-2 cells but none effectively prevented L. monocytogenes infection. Pre-exposure to LbpLAP for 1, 4, 15, or 24 h significantly (Pmonocytogenes in Caco-2 cells, whereas pre-exposure to parental Lb. paracasei had no significant effect. Similarly, LbpLAP pre-exposure reduced L. monocytogenes translocation by as much as 46% after 24 h. LbpLAP also prevented L. monocytogenes-mediated cell damage and compromise of tight junction integrity. Furthermore, LbpLAP cells reduced L. monocytogenes-mediated cell cytotoxicity by 99.8% after 1 h and 79% after 24 h. Conclusions/Significance Wild type probiotic bacteria were unable to prevent L. monocytogenes infection in vitro. In contrast, LbpLAP blocked adhesion, invasion, and translocation of L. monocytogenes by interacting with host cell receptor Hsp60, thereby protecting cells from infection. These data show promise for the use of recombinant probiotics in preventing L. monocytogenes infection in high

  12. Cultural relativity in perceiving emotion from vocalizations.

    Science.gov (United States)

    Gendron, Maria; Roberson, Debi; van der Vyver, Jacoba Marieta; Barrett, Lisa Feldman

    2014-04-01

    A central question in the study of human behavior is whether certain emotions, such as anger, fear, and sadness, are recognized in nonverbal cues across cultures. We predicted and found that in a concept-free experimental task, participants from an isolated cultural context (the Himba ethnic group from northwestern Namibia) did not freely label Western vocalizations with expected emotion terms. Responses indicate that Himba participants perceived more basic affective properties of valence (positivity or negativity) and to some extent arousal (high or low activation). In a second, concept-embedded task, we manipulated whether the target and foil on a given trial matched in both valence and arousal, neither valence nor arousal, valence only, or arousal only. Himba participants achieved above-chance accuracy only when foils differed from targets in valence only. Our results indicate that the voice can reliably convey affective meaning across cultures, but that perceptions of emotion from the voice are culturally variable.

  13. A Method, Computer Program and System for Inferring Relations Between Cultural Specific Concepts in Two Cultures

    DEFF Research Database (Denmark)

    2013-01-01

    The present invention relates to a method, computer program and system for inferring relations between cultural specific concepts (CSC) in two cultures at least comprising the steps of - extracting and listing said cultural specific concepts (CSCs) and features of said CSCs from at least a first...

  14. [Listeria monocytogenes in food].

    Science.gov (United States)

    Mícková, V

    1992-12-01

    As in recent years laboratory diagnostics of listeria has become part of food microbiology, the frequency of occurrence of the bacteria Listeria monocytogenes has been followed in various kinds of foods for a year. A total of 51 strains of L. monocytogenes (7.2%) was isolated from 700 kinds of samples (raw milk, pasteurized milk, meat surface, poultry, cheeses, thermally not treated meat products, food--industry machinery). As can be seen in Tab. I, the highest number of strains was isolated from meat surfaces (13.5%), followed by meat--industry machinery (12.72%), poultry (10%) and cheeses (5%). The lower numbers of strains were found out in thermally not treated meat products (3.8%) and in raw milk (3.3%). Pasteurized milk did not contain any strains. Our findings in raw milk (3.3%) and in pasteurized milk (0) are in agreement with the data cited e. g. by authors from the USA (Lovett et al., 1987), who mention the value of 4.2% in raw milk and the zero value in pasteurized milk. The percentage of strains monitored in cheeses (5%) can be evaluated as low as the assortment of investigated cheeses was small (all strains were isolated from soft ripening cheeses). German authors (Tham et al., 1988) speak about the 2.5% percentage of L. monocytogenes strains; this is in keeping with our findings. The findings in thermally not treated meat products (3.8%) can be evaluated as low although the number of strains found in raw meat was high.(ABSTRACT TRUNCATED AT 250 WORDS)

  15. [Biofilm formation capacity of Listeria monocytogens strains isolated from soft cheese from Costa Rica].

    Science.gov (United States)

    Carrillo Zeledón, Gabriela; Redondo Solano, Mauricio; Arias Echandi, María Laura

    2010-06-01

    Listeria monocytogenes is a bacteria associated with the production of severe infectious disease in human being, but also with the formation of biofilms in different surfaces related to the food production environment. Biofilm represents a serious problem in food industry, since it is a constant and important contamination source and also, bacteria present in it have an increased resistance towards physical and chemical agents of common use. The capacity of biofilm formation of L. monocytogenes strains previously isolated from soft cheese samples from Costa Rica was studied under different temperature and culture conditions. The microplate technique was performed using different culture media (BHIB, TSB 1:20 and cheese serum) and at different incubation temperatures (refrigeration, environmental and 35 degrees C). Biofilm formation capacity was classified according to the optical density obtained at 620 nm. None of the strains evaluated was classified as strong biofilm former under any of the variables studied, nevertheless, weak and moderate formers were detected. The results obtained show the influence of the nutrient content of the culture media used over biofilm formation; BHIB was the only culture media that allowed the expression of moderate biofilm forms, contrary to cheese serum that did not promote biofilm production. Biofilm formation is a multifactorial process, where adsorption level depends on several variables and its study must be promoted in order to develop methodologies that allow its reduction or elimination, so food industries may offer safe food products to consumers.

  16. Role of Extracellular DNA during Biofilm Formation by Listeria monocytogenes

    DEFF Research Database (Denmark)

    Harmsen, Morten; Lappann, Martin; Knøchel, S

    2010-01-01

    Listeria monocytogenes is a food-borne pathogen that is capable of living in harsh environments. It is believed to do this by forming biofilms, which are surface-associated multicellular structures encased in a self-produced matrix. In this paper we show that in L. monocytogenes extracellular DNA...... (eDNA) may be the only central component of the biofilm matrix and that it is necessary for both initial attachment and early biofilm formation for 41 L. monocytogenes strains that were tested. DNase I treatment resulted in dispersal of biofilms, not only in microtiter tray assays but also in flow...... cell biofilm assays. However, it was also demonstrated that in a culture without eDNA, neither Listeria genomic DNA nor salmon sperm DNA by itself could restore the capacity to adhere. A search for additional necessary components revealed that peptidoglycan (PG), specifically N-acetylglucosamine (NAG...

  17. Research in use – cultures of relating

    DEFF Research Database (Denmark)

    Holck, Ulla; Stige, Brynjulf; Skrudland, Hilde

    ) employed to spend time on research, and may also have difficulty translating research results into an understandable language for their colleagues from other professions. Dissemination of research Internationally conducted or published research has a good reputation, but is hardly known by ‘users’ of music......To make music therapy known outside the field, dissemination of the research and collaboration between clinicians and researchers on documentation are both necessary. Some music therapy researchers are active clinicians, but if they have full time positions at universities, they cannot at the same...... time be part of the interdisciplinary clinical culture found in institutions with a main focus on a certain client group. Here the music therapy clinicians can be the golden link between the research culture and the local clinical culture. At the same time, music therapy clinicians are not (usually...

  18. Assessing the capacity of growth, survival, and acid adaptive response of Listeria monocytogenes during storage of various cheeses and subsequent simulated gastric digestion.

    Science.gov (United States)

    Kapetanakou, Anastasia E; Gkerekou, Maria A; Vitzilaiou, Eirini S; Skandamis, Panagiotis N

    2017-04-04

    Different physicochemical and microbiological characteristics of cheeses may affect Listeria monocytogenes potential to grow, survive, or exhibit an acid adaptive response during storage and digestion. The objectives of the present study were to assess: i) the survival or growth potential of L.monocytogenes on various cheeses during storage, ii) the effect of initial indigenous microbiota on pathogen growth in comparison to expected growth curves retrieved by existing predictive models, and iii) the impact of habituation on/in cheeses surfaces on the subsequent acid resistance during simulated gastric digestion. Portions of cream (Cottage and Mascarpone), soft (Anthotyros, Camembert, Mastelo®, Manouri, Mozzarella, Ricotta), and semi-hard (Edam, Halloumi, Gouda) cheeses were inoculated with ca. 100CFU/g or cm(2) of L.monocytogenes and stored under vacuum or aerobic conditions at 7°C (n=4). The impact of varying (initial) levels of starter culture or indigenous spoilage microbiota on pathogen growth was evaluated by purchasing cheese packages on different dates in relation to production and expiration date (subsequently reflecting to different batches) mimicking a potential situation of cheese contamination with L.monocytogenes during retail display. Values of pH and aw were also monitored and used to simulate growth of L. monocytogenes by existing models and compare it with the observed data of the study. Survival in simulated gastric fluid (SGF) (pH1.5; HCl; max. 120min) was assessed at three time points during storage. Mascarpone, Ricotta, Mozzarella, Camembert, and Halloumi supported L.monocytogenes growth by 0.5-0.8logCFU/g or cm(2)per day, since low initial levels of total viable counts (TVC) (1.8-3.8logCFU/g or cm(2)) and high pH/aw values (ca. 6.23-6.64/0.965-0.993) were recorded. On Cottage, Anthotyros, Manouri, Mastelo®, Edam, and Gouda, the pathogen survived at populations similar or lower than the inoculation level due to the high reported competition

  19. Interleukin-22-Induced Antimicrobial Phospholipase A2 Group IIA Mediates Protective Innate Immunity of Nonhematopoietic Cells against Listeria monocytogenes.

    Science.gov (United States)

    Okita, Yamato; Shiono, Takeru; Yahagi, Ayano; Hamada, Satoru; Umemura, Masayuki; Matsuzaki, Goro

    2015-12-07

    Listeria monocytogenes is a bacterial pathogen which establishes intracellular parasitism in various cells, including macrophages and nonhematopoietic cells, such as hepatocytes. It has been reported that several proinflammatory cytokines have pivotal roles in innate protection against L. monocytogenes infection. We found that a proinflammatory cytokine, interleukin 22 (IL-22), was expressed by CD3(+) CD4(+) T cells at an early stage of L. monocytogenes infection in mice. To assess the influence of IL-22 on L. monocytogenes infection in hepatocytes, cells of a human hepatocellular carcinoma line, HepG2, were treated with IL-22 before L. monocytogenes infection in vitro. Gene expression analysis of the IL-22-treated HepG2 cells identified phospholipase A2 group IIA (PLA2G2A) as an upregulated antimicrobial molecule. Addition of recombinant PLA2G2A to the HepG2 culture significantly suppressed L. monocytogenes infection. Culture supernatant of the IL-22-treated HepG2 cells contained bactericidal activity against L. monocytogenes, and the activity was abrogated by a specific PLA2G2A inhibitor, demonstrating that HepG2 cells secreted PLA2G2A, which killed extracellular L. monocytogenes. Furthermore, colocalization of PLA2G2A and L. monocytogenes was detected in the IL-22-treated infected HepG2 cells, which suggests involvement of PLA2G2A in the mechanism of intracellular killing of L. monocytogenes by HepG2 cells. These results suggest that IL-22 induced at an early stage of L. monocytogenes infection enhances innate immunity against L. monocytogenes in the liver by stimulating hepatocytes to produce an antimicrobial molecule, PLA2G2A.

  20. Growth control of Listeria monocytogenes on cold-smoked salmon using a competitive lactic acid bacteria flora

    DEFF Research Database (Denmark)

    Nilsson, Lilian; Gram, Lone; Huss, Hans Henrik

    1999-01-01

    . sake LKE5 caused strong sulfurous off-flavors and was rejected as a culture for biopreservation of cold-smoked salmon. A bacteriocin-producing strain of C. piscicola (A9b) initially caused a 7-day lag phase of L. monocytogenes, followed by a reduction in numbers of L. monocytogenes from 10(3) CFU...

  1. Malaysian Culture and Race Relations in a Dynamic Work Environment

    OpenAIRE

    Dave, Hemish K.

    2009-01-01

    Race Relations in Malaysia have been a sensitive issue since Malaysia’s independence. Cultural factors have also affected Malaysia’s business world. Using Hofstede’s framework on the five dimensions of national culture, and by looking deeper into Air Asia by using Schein’s 3-Level model, this dissertation is an attempt to identify the cultural sources that affect a Malaysian Organisation. Leadership is a vital factor that determines the culture, both nationally and within an organisation, and...

  2. Microbiological criteria for Listeria monocytogenes in foods under special consideration of risk assessment approaches

    DEFF Research Database (Denmark)

    Nørrung, Birgit

    2000-01-01

    This paper shortly summarizes data related to risk assessment of Listeria monocytogenes. From available data on risk assessment, it is concluded that the levels of L. monocytogenes consumed is an important factor affecting the incidence of listeriosis. Foods that do not support the growth of L. m...

  3. Between Culture and Cultural Heritage: Curriculum Historical Preconditions as Constitutive for Cultural Relations--The Swedish Case

    Science.gov (United States)

    Brantefors, Lotta

    2015-01-01

    The aim here is to describe and discuss how different cultural meanings, offered in education, can contribute to unjust cultural relations such as othering and xenophobia. By analysing the cultural and discursive content in curricula using a (neo)pragmatic curriculum theory research method, dominating ideas, values and discourses between 1948 and…

  4. CULTURAL AND SOCIOLOGICAL FACTORS RELATING TO LEARNING DEVELOPMENT. FINAL REPORT.

    Science.gov (United States)

    MACCOBY, MICHAEL; MODIANO, NANCY

    THE PRIMARY PURPOSE OF THIS STUDY WAS TO COMPARE CULTURAL AND CHARACTER VARIABLES AND RELATE THEM TO THE COGNITIVE DEVELOPMENT OF MEXICAN PEASANT CHILDREN. THE CULTURAL VARIABLES STUDIED INCLUDE ECONOMIC LEVELS, MORAL AND AFFECTIVE JUDGMENTS, AND THE RELATIONSHIPS BETWEEN PARENTS AND CHILDREN. MODES OF ASSIMILATION, SOCIAL RELATIONS, FIXATIONS,…

  5. Analysis of process factors of dry fermented salami to control Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Enrico Novelli

    2017-01-01

    Full Text Available Challenge tests are a clear opportunity for manufacturers interested in the evaluation of their management system with the aim to reduce the spread of foodborne pathogens. This is a main concern especially in ready-to-eat food in relation to the risk associated with Listeria monocytogenes. For small and medium-scale food industry the manufacturing practices and products formulation are characterised by a wider variability and poor repeatability. The use of ad hoc challenge test and the comparison among different processing systems are strongly required. This paper reports a preliminary comparison among different challenge tests (n=12 commissioned by three manufacturers of raw-fermented salami during a period of three years (2013-2016. The challenge tests were designed to evaluate the growth potential (δ of L. monocytogenes during the whole processing period of the salami. The doughs were prepared according to different formulations: the simplest formulation was represented by the use of salt, potassium nitrate, black pepper and starter cultures, while the most composited formulations also included the use of sugars and ascorbic acid in addition to nitrite salt. All the processing steps were conducted within an experimental laboratory dedicated for the processing of meat. After stuffing, the salami were dried and ripened under temperature and relative humidity control. The sugar inclusion can be considered as a protective factor, while the drying step at high temperature (above 20°C was associated with higher δ values (δ>0.5 log10 cfu/g. The addition of starter cultures, and the subsequent acidification highlighted the importance of pH as the parameter able to affect the L. monocytogenes growth.

  6. [Hematometra & Listeria monocytogenes].

    Science.gov (United States)

    Gómez Arzapalo, E; Pérez Mendizábal, A; Herrera Avalos, I; Gorozpe Calvillo, J I

    2001-05-01

    The hematometra is a nosological entity that may not always be attributed to an embryonic defect of the paramesonefros; cervical-vaginal infections such as etiological possibilities due to Listeria monocytogenes (Lm), cervix malignant neoplasias, iatrogenias due to endometrial ablation with Lasser, traumatic bloody uterine curetage and because of cervical cryocoagulation or electrocoagulation are also mentioned. The case to be reported is from a woman in reproductive stage, who is 32 years old, and had menarca at the age of 13, starting her sexual life at 31, not using any method to control her fertility. When having an eight-week amenorrhea after 8 months of marriage, she visited the doctor for assumed pregnancy, within the prenatal analysis a pelvic echographic study was requested, finding out images that we concluded as hematometra, having been drained and demonstrated the presence of LM by anti-Lm antibodies, being administered Azitromicina and Espiramicina.

  7. Work related learning, Identities, and Culture

    DEFF Research Database (Denmark)

    Olesen, Henning Salling

    2005-01-01

    The basic societal transformation to a “learning society” presupposes learning and identity processes. In order to understand the conditions and dynamics of work related learning we need to theorize the subjective significance of work and we need to study work related learning processes in a way...

  8. Cross-contamination between processing equipment and deli meats by Listeria monocytogenes.

    Science.gov (United States)

    Lin, Chia-Min; Takeuchi, Kazue; Zhang, Lei; Dohm, Cynthia B; Meyer, Joseph D; Hall, Paul A; Doyle, Michael P

    2006-01-01

    Contamination of luncheon meats by Listeria monocytogenes has resulted in outbreaks of listeriosis and major product recalls. Listeriae can survive on processing equipment such as meat slicers which serve as a potential contamination source. This study was conducted to determine (i) the dynamics of cross-contamination of L. monocytogenes from a commercial slicer and associated equipment onto sliced meat products, (ii) the influence of sample size on the efficacy of the BAX-PCR and U.S. Department of Agriculture-Food Safety and Inspection Service enrichment culture assays to detect L. monocytogenes on deli meat, and (iii) the fate of L. monocytogenes on sliced deli meats of different types during refrigerated storage. Three types of deli meats, uncured oven-roasted turkey, salami, and bologna containing sodium diacetate and potassium lactate, were tested. A five-strain mixture of L. monocytogenes was inoculated at ca.10(3) CFU onto the blade of a commercial slicer. Five consecutive meat slices were packed per package, then vacuum sealed, stored at 4 degrees C, and sampled at 1 and 30 days postslicing. Two sample sizes, 25 g and contents of the entire package of meat, were assayed. Total numbers of L. monocytogenes-positive samples, including the two sample sizes and two sampling times, were 80, 9, and 3 for turkey, salami, and bologna, respectively. A higher percentage of turkey meat samples were L. monocytogenes positive when contents of the entire package were assayed than when the 25-g sample was assayed (12.5 and 7.5%, respectively). Lower inoculum populations of ca. 10(1) or 10(2) CFU of L. monocytogenes on the slicer blade were used for an additional evaluation of oven-roasted turkey using two additional sampling times of 60 and 90 days postslicing. L. monocytogenes-positive samples were not detected until 60 days postslicing, and more positive samples were detected at 90 days than at 60 days postslicing. When BAX-PCR and enrichment culture assays were

  9. Psychology of group relations: cultural and social dimensions.

    Science.gov (United States)

    Berry, J W

    2004-07-01

    Cross-cultural psychology attempts to understand the development and expression of human behavior in relation to the cultural contexts in which it occurs. It adopts the perspective of "universalism," which assumes that all human beings share basic psychological processes, but which are then shaped by cultural influences. This perspective allows for the comparison of individuals from different cultures (based on the process commonality), but also accepts behavioral variability (based on the cultural shaping). In the case of behavior that takes place during interactions between individuals coming from two (or more) cultures, the task is more complex; we now need to understand at least two sets of culture-behavior phenomena, as well as a third set--those that arise at the intersection of their relationships. In cross-cultural psychology, we have adopted concepts and methods from sociology and political science to inform work on "ethnic relations," and from cultural anthropology we have been informed in our work on the process and outcomes of "acculturation." In the former domain are phenomena such as prejudice and discrimination; in the latter are the strategies people use when in daily contact with people from other cultures (such as assimilation, integration, separation, and marginalization). These phenomena take place in cultural contexts, which need to be understood in terms of the core dimensions of cultural difference (such as diversity, equality, and conformity). During prolonged and intimate contact between persons of different cultural backgrounds, all these psychological concepts and processes, and cultural influences need to be taken into account when selecting, training, and monitoring individuals during their intercultural interactions.

  10. Modeling the growth of Listeria monocytogenes on cut cantaloupe, honeydew and watermelon.

    Science.gov (United States)

    Danyluk, Michelle D; Friedrich, Loretta M; Schaffner, Donald W

    2014-04-01

    A recent outbreak linked to whole cantaloupes underscores the importance of understanding growth kinetics of Listeria monocytogenes in cut melons at different temperatures. Whole cantaloupe, watermelon, and honeydew purchased from a local supermarket were cut into 10 ± 1 g cubes. A four-strain cocktail of L. monocytogenes from food related outbreaks was used to inoculate fruit, resulting in ~10(3) CFU/10 g. Samples were stored at 4, 10, 15, 20, or 25 °C and L. monocytogenes were enumerated at appropriate time intervals. The square root model was used to describe L. monocytogenes growth rate as a function of temperature. The model was compared to prior models for Salmonella and Escherichia coli O157:H7 growth on cut melon, as well as models for L. monocytogenes on cantaloupe and L. monocytogenes ComBase models. The current model predicts faster growth of L. monocytogenes vs. Salmonella and E. coli O157:H7 at temperatures below 20 °C, and agrees with estimates from ComBase Predictor, and a corrected published model for L. monocytogenes on cut cantaloupe. The model predicts ~4 log CFU increase following 15 days at 5 °C, and ∼1 log CFU increase following 6 days at 4 °C. The model can also be used in subsequent quantitative microbial risk assessments.

  11. The role of cultural diplomacy in international relations

    Directory of Open Access Journals (Sweden)

    Said Saddiki

    2009-12-01

    Full Text Available Cultural diplomacy, as a cornerstone of public diplomacy, plays an important role in today’s international relations, which are characterised by so-called culture shocks, and it should represent a decisive tool not only for transmitting culture and national values, but also for listening to what the cultures from the rest the world are saying to us. The main role of cultural diplomacy is to promote transnational dialogue between cultures and nations, especially between the West and the Muslim world. Cultural diplomacy, just like other new dimensions in diplomacy, is not exclusively controlled by nation-states, given that at present they are not the only actors on the international stage, since other non-state actors (civil society, NGOs, universities, academics, etc. are playing an important role in this field. The aim of this article is to analyse the role of culture in modern diplomacy and its impact on relations between peoples and nations. It also attempts to focus on the positive aspects of the influence of culture on contemporary international relations.

  12. What Cultural Values Influence American Public Relations Practitioners?

    Science.gov (United States)

    Vasquez, Gabriel M.; Taylor, Maureen

    1999-01-01

    Examines the role of culture as a key variable in public relations research and practice. Finds (1) American practitioners continue to practice one-way models of public relations; and (2) public relations practitioners who have collectivistic values tend to practice two-way models of public relations. Discusses implications for theory and…

  13. Investigating Culture-related Aspects of Behavior for Virtual Characters

    DEFF Research Database (Denmark)

    Endrass, Birgit; André, Elisabeth; Rehm, Matthias

    2013-01-01

    , aspects of verbal behavior, communication management and nonverbal behavior were taken into account. In evaluation studies conducted in the targeted cultures, each aspect's impact on human observers was tested. With it, we investigated for which of the aspects, observers prefer agent behavior......In this paper, culture-related behaviors are investigated on several channels of communication for virtual characters. Prototypical behaviors were formalized in computational models based on a literature review as well as a corpus analysis, exemplifying the German and Japanese cultures. Therefore...... that was designed to resemble their own cultural background....

  14. Keberadaan Bakteri Listeria monocytogenes pada Keju Gouda Produksi Lokal dan Impor (PRESENCE OF LISTERIA MONOCYTOGENES IN LOCAL AND IMPORTED GOUDA CHEESES

    Directory of Open Access Journals (Sweden)

    Debby Fadhilah Pazra

    2014-08-01

    Full Text Available Listeria monocytogenes is included in the foodborne pathogen, which has been associated with severaloutbreaks of human listeriosis especially in high risk groups. Listeria monocytogenes could be found inGouda cheeses because of poor hygienic and sanitation practices. In addition, this bacteria could surviveduring the making of cheese and cheese ripening process. The purpose of this study was to identify thepresence of L. monocytogenes in local and imported Gouda cheeses and how the safety level of the Goudacheese against contamination of L. monocytogenes. This study used the conventional method in accordancewith the Bacteriological Analytical Manual, US Food and Drug Administration and Bergey’s Manual ofDeterminative Bacteriology to detect the presence of L. monocytogenes at 15 samples of local Gouda cheeseand 15 samples of imported Gouda cheese sold in supermarkets in Jakarta and Bogor. The results of thisstudy showed that was not found L. monocytogenes in local and imported Gouda cheese. It could be concludedthat is Gouda cheese relatively safe from L. monocytogenes and meets Indonesian National Standard.

  15. Rhombencephalitis caused by Listeria monocytogenes in a pastured bull.

    Science.gov (United States)

    Matto, Carolina; Varela, Gustavo; Mota, María Inés; Gianneechini, Ruben; Rivero, Rodolfo

    2017-03-01

    A pastured 2-y-old cross-breed bull developed brainstem encephalitis (rhombencephalitis); Listeria monocytogenes was isolated from the brain. In the brainstem, there was perivascular cuffing, multiple microabscesses, and positive immunostaining for L. monocytogenes. Samples of bovine feces, water, feedstuffs, milking parlor soil, and bulk tank milk were collected from the dairy farm. Seven isolates of the genus Listeria were obtained, 6 of L. innocua and 1 of L. monocytogenes, which was found in the pasture where the bull grazed. Both isolates belonged to serotype 4b and were positive for internalins A, C, and J. According to the DNA fragment patterns of pulsed-field gel electrophoresis, the isolates were closely related. The source of infection was the pasture, implying that listeriosis should not be discounted in cases with compatible clinical signs but the absence of silage feeding.

  16. Social learning Processes and Nature-Culture relations of ...

    African Journals Online (AJOL)

    This paper explores social learning processes and nature-culture relations in a context of ..... Extract 14: In this area, it has a lot of impact because you will be politically labelled. ..... Zimbabwe Ministry of Environment and Tourism (2002).

  17. Corrigendum: Cultural Relativity in Perceiving Emotion From Vocalizations.

    Science.gov (United States)

    2014-12-01

    Gendron, M., Roberson, D., van der Vyver, J. M., & Barrett, L. F. (2014). Cultural relativity in perceiving emotion from vocalizations. Psychological Science, 25, 911-920. (Original DOI: 10.1177/0956797613517239 ).

  18. Research in use – cultures of relating

    DEFF Research Database (Denmark)

    Holck, Ulla; Stige, Brynjulf; Skrudland, Hilde

    therapy (broadly seen). In addition, research conducted in another clinical setting than the local/national, as well as the dominance of English publication language, are barriers for spreading knowledge about music therapy – to clients/relatives and professionals, as well as employers. Collaborative...... documentation Locally based projects involving clinical music therapists as well as researchers are an effective way of spreading the use of and knowledge about music therapy, and can also be a basis for later data collection on a greater scale. Starting from web-based examples, this round table will present...

  19. The survival of Listeria monocytogenes during long term desiccation is facilitated by sodium chloride and organic material

    DEFF Research Database (Denmark)

    Vogel, Birte Fonnesbech; Hansen, Lisbeth Truelstrup; Mordhorst, Hanne

    2010-01-01

    One specific DNA-subtype, as determined by RAPD, of Listeria monocytogenes persisted in a fish slaughterhouse for years, even during months with no production where the plant was cleaned and kept dry. We hypothesised that tolerance to desiccation could be a factor in explaining the persistence of L...... monocytogenes in food processing environments and the purpose of the present study was to determine ability of L monocytogenes to survive desiccation on stainless steel under simulated food processing conditions. Viable counts of eight different L. monocytogenes strains exposed to different soils and relative...... humidities (RHs) during desiccation decreased significantly (p...

  20. The species-specific mode of action of the antimicrobial peptide subtilosin against Listeria monocytogenes Scott A

    NARCIS (Netherlands)

    Kuijk, van S.J.A.; Noll, K.S.; Chikindas, M.L.

    2012-01-01

    Aims: To elucidate the molecular mechanism of action of the antimicrobial peptide subtilosin against the foodborne pathogen Listeria monocytogenes Scott A. Methods and Results: Subtilosin was purified from a culture of Bacillus amylliquefaciens. The minimal inhibitory concentration of subtilosin aga

  1. Selling the Internet: A Cultural Studies Approach to Public Relations.

    Science.gov (United States)

    Mickey, Thomas J.

    1998-01-01

    Examines the ideology of Internet public relations. Takes a cultural studies approach to modern public relations, using public relations material as representation. Presents a case study of the MassNetworks Education Partnership, which was set up in 1996 to ensure that the Internet gets into the classroom. (PA)

  2. Intercultural Interpretations: Making Public Relations Education Culturally Relevant

    Science.gov (United States)

    Chia, Joy

    2009-01-01

    Public relations educators delivering courses to international students find that each cohort of students interprets and understands public relations theory and its application to practice according to their respective cultures. The premise of this paper is to reflect on some of the interpretations and expectations of public relations students…

  3. Silver as antibacterial towards Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Simone eBelluco

    2016-03-01

    Full Text Available Listeria monocytogenes is a serious foodborne pathogen that can contaminate food during processing and can grow during food shelf-life. New types of safe and effective food contact materials embedding antimicrobial agents, like silver, can play an important role in the food industry. The present work aimed at evaluating the in vitro growth kinetics of different strains of L. monocytogenes in the presence of silver, both in its ionic and nano form. The antimicrobial effect was determined by assaying the number of culturable bacterial cells, which formed colonies after incubation in the presence of silver nanoparticles (AgNPs or silver nitrate (AgNO3. Ionic release experiments were performed in parallel. A different reduction of bacterial viability between silver ionic and nano forms was observed, with a time delayed effect exerted by AgNPs. An association between antimicrobial activity and ions concentration was shown by both silver chemical forms, suggesting the major role of ions in the antimicrobial mode of action.

  4. Evaluation of Listeria monocytogenes survival in ice cream mixes flavored with herbal tea using Taguchi method.

    Science.gov (United States)

    Ozturk, Ismet; Golec, Adem; Karaman, Safa; Sagdic, Osman; Kayacier, Ahmed

    2010-10-01

    In this study, the effects of the incorporation of some herbal teas at different concentrations into the ice cream mix on the population of Listeria monocytogenes were studied using Taguchi method. The ice cream mix samples flavored with herbal teas were prepared using green tea and sage at different concentrations. Afterward, fresh culture of L. monocytogenes was inoculated into the samples and the L. monocytogenes was counted at different storage periods. Taguchi method was used for experimental design and analysis. In addition, some physicochemical properties of samples were examined. Results suggested that there was some effect, although little, on the population of L. monocytogenes when herbal tea was incorporated into the ice cream mix. Additionally, the use of herbal tea caused a decrease in the pH values of the samples and significant changes in the color values.

  5. Rapid and sensitive detection of Listeria monocytogenes by loop-mediated isothermal amplification.

    Science.gov (United States)

    Tang, Meng-Jun; Zhou, Sheng; Zhang, Xiao-Yan; Pu, Jun-Hua; Ge, Qing-Lian; Tang, Xiu-Jun; Gao, Yu-Shi

    2011-12-01

    Loop-mediated isothermal amplification (LAMP) was designed for detection of Listeria monocytogenes, which is an important food-borne kind of pathogenic bacteria causing human and animal disease. The primers set for the hlyA gene consist of six primers targeting eight regions on specific gene. The LAMP assay could be performed within 40 min at 65°C in a water bath. Amplification products were visualized by calcein and manganous ion and agarose gel electrophoresis. Sensitivity of the LAMP assay for detection of L. monocytogenes in pure cultures was 2.0 CFU per reaction. The LAMP assay was 100-fold higher sensitive than that of the conventional PCR assay. Taking this way, 60 chicken samples were investigated for L. monocytogenes. The accuracy of LAMP was shown to be 100% when compared to the "gold standard" culture-biotechnical, while the PCR assay failed to detect L. monocytogenes in two of the positive samples. It is shown that LAMP assay can be used as a sensitive, rapid, and simple detection tool for the detection of L. monocytogenes and will facilitate the surveillance for contamination of L. monocytogenes in food.

  6. An insight into the isolation, enumeration and molecular detection of Listeria monocytogenes in food

    Directory of Open Access Journals (Sweden)

    Jodi Woan-Fei Law

    2015-11-01

    Full Text Available Listeria monocytogenes, a foodborne pathogen that can cause listeriosis through the consumption of food contaminated with this pathogen. The ability of L. monocytogenes to survive in extreme conditions and cause food contaminations have become a major concern. Hence, routine microbiological food testing is necessary to prevent food contamination and outbreaks of foodborne illness. This review provides insight into the methods for cultural detection, enumeration and molecular identification of L. monocytogenes in various food samples. There are a number of enrichment and plating media that can be used for the isolation of L. monocytogenes from food samples. Enrichment media such as buffered Listeria Enrichment Broth (BLEB, Fraser broth and University of Vermont Medium (UVM Listeria enrichment broth are recommended by regulatory agencies such as FDA-BAM, USDA-FSIS and ISO. Many plating media are available for the isolation of L. monocytogenes, for instance, PALCAM, Oxford and other chromogenic media. Besides, reference methods like FDA-BAM, ISO 11290 method and USDA-FSIS method are usually applied for the cultural detection or enumeration of L. monocytogenes. MPN technique is applied for the enumeration of L. monocytogenes in the case of low level contamination. Molecular methods including polymerase chain reaction (PCR, multiplex polymerase chain reaction (mPCR, real-time/quantitative polymerase chain reaction (qPCR, nucleic acid sequence-based amplification (NASBA, loop-mediated isothermal amplification (LAMP, DNA microarray and Next Generation Sequencing (NGS technology for the detection and identification of L. monocytogenes are discussed in this review. Overall, molecular methods are rapid, sensitive, specific, time- and labour-saving. In future, there are chances for the development of new techniques for the detection and identification of foodborne with improved features.

  7. An insight into the isolation, enumeration, and molecular detection of Listeria monocytogenes in food

    Science.gov (United States)

    Law, Jodi Woan-Fei; Ab Mutalib, Nurul-Syakima; Chan, Kok-Gan; Lee, Learn-Han

    2015-01-01

    Listeria monocytogenes, a foodborne pathogen that can cause listeriosis through the consumption of food contaminated with this pathogen. The ability of L. monocytogenes to survive in extreme conditions and cause food contaminations have become a major concern. Hence, routine microbiological food testing is necessary to prevent food contamination and outbreaks of foodborne illness. This review provides insight into the methods for cultural detection, enumeration, and molecular identification of L. monocytogenes in various food samples. There are a number of enrichment and plating media that can be used for the isolation of L. monocytogenes from food samples. Enrichment media such as buffered Listeria enrichment broth, Fraser broth, and University of Vermont Medium (UVM) Listeria enrichment broth are recommended by regulatory agencies such as Food and Drug Administration-bacteriological and analytical method (FDA-BAM), US Department of Agriculture-Food and Safety (USDA-FSIS), and International Organization for Standardization (ISO). Many plating media are available for the isolation of L. monocytogenes, for instance, polymyxin acriflavin lithium-chloride ceftazidime aesculin mannitol, Oxford, and other chromogenic media. Besides, reference methods like FDA-BAM, ISO 11290 method, and USDA-FSIS method are usually applied for the cultural detection or enumeration of L. monocytogenes. most probable number technique is applied for the enumeration of L. monocytogenes in the case of low level contamination. Molecular methods including polymerase chain reaction, multiplex polymerase chain reaction, real-time/quantitative polymerase chain reaction, nucleic acid sequence-based amplification, loop-mediated isothermal amplification, DNA microarray, and next generation sequencing technology for the detection and identification of L. monocytogenes are discussed in this review. Overall, molecular methods are rapid, sensitive, specific, time- and labor-saving. In future, there are

  8. Investigating Culture-related Aspects of Behavior for Virtual Characters

    DEFF Research Database (Denmark)

    Endrass, Birgit; André, Elisabeth; Rehm, Matthias

    2013-01-01

    , aspects of verbal behavior, communication management and nonverbal behavior were taken into account. In evaluation studies conducted in the targeted cultures, each aspect's impact on human observers was tested. With it, we investigated for which of the aspects, observers prefer agent behavior......In this paper, culture-related behaviors are investigated on several channels of communication for virtual characters. Prototypical behaviors were formalized in computational models based on a literature review as well as a corpus analysis, exemplifying the German and Japanese cultures. Therefore...

  9. Relation of Astronomy to other Sciences, Culture and Society

    Science.gov (United States)

    Harutyunian, H. A.; Mickaelian, A. M.; Farmanyan, S. V.

    2015-07-01

    The book contains the Proceedings of XIII Annual Meeting of the Armenian Astronomical Society "Relation of Astronomy to other Sciences, Culture and Society". It consists of 9 main sections: "Introductory", "Astronomy and Philosophy", "Astrobiology", "Space-Earth Connections", "Astrostatistics and Astroinformatics", "Astronomy and Culture, Astrolinguistics", "Archaeoastronomy", "Scientific Tourism and Scientific Journalism", and "Armenian Astronomy". The book may be interesting to astronomers, philosophers, biologists, culturologists, linguists, historians, archaeologists and to other specialists, as well as to students.

  10. How culture gets embrained: Cultural differences in event-related potentials of social norm violations.

    Science.gov (United States)

    Mu, Yan; Kitayama, Shinobu; Han, Shihui; Gelfand, Michele J

    2015-12-15

    Humans are unique among all species in their ability to develop and enforce social norms, but there is wide variation in the strength of social norms across human societies. Despite this fundamental aspect of human nature, there has been surprisingly little research on how social norm violations are detected at the neurobiological level. Building on the emerging field of cultural neuroscience, we combine noninvasive electroencephalography (EEG) with a new social norm violation paradigm to examine the neural mechanisms underlying the detection of norm violations and how they vary across cultures. EEG recordings from Chinese and US participants (n = 50) showed consistent negative deflection of event-related potential around 400 ms (N400) over the central and parietal regions that served as a culture-general neural marker of detecting norm violations. The N400 at the frontal and temporal regions, however, was only observed among Chinese but not US participants, illustrating culture-specific neural substrates of the detection of norm violations. Further, the frontal N400 predicted a variety of behavioral and attitudinal measurements related to the strength of social norms that have been found at the national and state levels, including higher culture superiority and self-control but lower creativity. There were no cultural differences in the N400 induced by semantic violation, suggesting a unique cultural influence on social norm violation detection. In all, these findings provided the first evidence, to our knowledge, for the neurobiological foundations of social norm violation detection and its variation across cultures.

  11. Teaching Culture: The Challenges and Opportunities of International Public Relations.

    Science.gov (United States)

    George, Amiso M.

    2003-01-01

    Focuses on the challenges and opportunities for international public relations practice. Looks at current United States-Arab relations issues in international crisis communication. Discusses those issues, especially the role of culture and media. Proposes strategies including a case study that teachers can use to help students become effective…

  12. Indian-Iranian Cultural Relations in the Ancient Times

    Directory of Open Access Journals (Sweden)

    Recep ÖZMAN

    2014-12-01

    Full Text Available India-Persia relations go back to prehistoric age. Finds found in archaeological excavations have revealed not only these relations but also the long-distance trade. Indian Iranian cultural relations have increased moreafter the Aryan migrations dated in the middles of second thousand BC. Because the people who migrated to both India and Persia named themselves as Aryan. That two geography have the similarities of language, religion, mythology and social life reveal this relation most clearly with this era. Together with 5th century BC, with the beginning of the historical period in India, relations between these geography have become more concrete, relations in cultural are assuch as writing, literature, coins, architecture, burial customs and art have soared. These relations will contribute to the recognition of India in the Western World

  13. Neuroinfections due to Listeria monocytogenes.

    Science.gov (United States)

    Streharova, A; Babjakova, A; Moravcikova, A; Harnicarova, A; Holeckova, K; Lesnakova, A; Sladeckova, V; Seckova, S; Kisac, P; Beno, P

    2007-11-01

    Listeria monocytogenes is not a rare pathogen causing meningitis, mainly in small children and in close contacts to livestock. The pathogen is naturally resistant to cephalosporins and some glycopeptides as well, therefore despite of syndromologic diagnosis of meningitis and initial therapy with 3rd generation cephalosporins according to the guidelines therapeutic failures with clinical consequences may occur.

  14. Validation of the ANSR(®) Listeria monocytogenes Method for Detection of Listeria monocytogenes in Selected Food and Environmental Samples.

    Science.gov (United States)

    Caballero, Oscar; Alles, Susan; Le, Quynh-Nhi; Gray, R Lucas; Hosking, Edan; Pinkava, Lisa; Norton, Paul; Tolan, Jerry; Mozola, Mark; Rice, Jennifer; Chen, Yi; Ryser, Elliot; Odumeru, Joseph

    2016-01-01

    Work was conducted to validate performance of the ANSR(®) for Listeria monocytogenes method in selected food and environmental matrixes. This DNA-based assay involves amplification of nucleic acid via an isothermal reaction based on nicking enzyme amplification technology. Following single-step sample enrichment for 16-24 h for most matrixes, the assay is completed in 40 min using only simple instrumentation. When 50 distinct strains of L. monocytogenes were tested for inclusivity, 48 produced positive results, the exceptions being two strains confirmed by PCR to lack the assay target gene. Forty-seven nontarget strains (30 species), including multiple non-monocytogenes Listeria species as well as non-Listeria, Gram-positive bacteria, were tested, and all generated negative ANSR assay results. Performance of the ANSR method was compared with that of the U.S. Department of Agriculture, Food Safety and Inspection Service Microbiology Laboratory Guidebook reference culture procedure for detection of L. monocytogenes in hot dogs, pasteurized liquid egg, and sponge samples taken from an inoculated stainless steel surface. In addition, ANSR performance was measured against the U.S. Food and Drug Administration Bacteriological Analytical Manual reference method for detection of L. monocytogenes in Mexican-style cheese, cantaloupe, sprout irrigation water, and guacamole. With the single exception of pasteurized liquid egg at 16 h, ANSR method performance as quantified by the number of positives obtained was not statistically different from that of the reference methods. Robustness trials demonstrated that deliberate introduction of small deviations to the normal assay parameters did not affect ANSR method performance. Results of accelerated stability testing conducted using two manufactured lots of reagents predicts stability at the specified storage temperature of 4°C of more than 1 year.

  15. Various Ready-to-Eat Products from Retail Stores Linked to Occurrence of Diverse Listeria monocytogenes and Listeria spp. Isolates.

    Science.gov (United States)

    Vongkamjan, Kitiya; Fuangpaiboon, Janejira; Turner, Matthew P; Vuddhakul, Varaporn

    2016-02-01

    Listeriosis outbreaks have been associated with a variety of foods. This study investigated the prevalence and diversity of Listeria monocytogenes and Listeria spp. in ready-to-eat (RTE) products and evaluated the performance of a rapid detection method, the 3M molecular detection assay for L. monocytogenes (MDA-LM), for detection of L. monocytogenes. Assay results were compared with those obtained using the U.S. Food and Drug Administration standard culture method described in the Bacteriological Analytical Manual. Products (n = 200) were purchased from retail stores: 122 aquatic products, 22 products of animal origin, 18 vegetarian products, 15 deli meat products, 13 salad and vegetable products, 4 desserts, 2 egg-based products, and 4 other products. L. monocytogenes prevalence was comparable with both methods. Overall, 15 (7.5%) of 200 samples were positive for L. monocytogenes: 3% of aquatic products, 1.5% of products of animal origin, 1% of vegetarian products, and 2% of deli meat products. Compared with the standard culture method, the sensitivity, specificity, and the accuracy of the MDA-LM were 86.7% (95% confidence interval, 58.4 to 97.7%), 98.4% (95% confidence interval, 95.0 to 99.6%), and 97.5%, respectively. Using the culture-based method, 18 (9%) of 200 samples were positive for Listeria species other than L. monocytogenes. Listeria isolates from these samples were classified into nine allelic types (ATs). The majority of isolates were classified as ATs 58 and 74, which were identified as L. monocytogenes lineages I and IV, respectively. Listeria innocua and Listeria welshimeri also were represented by isolates of multiple ATs. The MDA-LM is a rapid and reliable technique for detecting L. monocytogenes in various RTE foods. Further study is needed to develop effective control strategies to reduce L. monocytogenes contamination in RTE foods.

  16. Inhibition of Listeria monocytogenes in cold-smoked salmon by Carnobacterium piscicola CS526 isolated from frozen surimi.

    Science.gov (United States)

    Yamazaki, Koji; Suzuki, Minako; Kawai, Yuji; Inoue, Norio; Montville, Thomas J

    2003-08-01

    Strain CS526 was isolated from frozen surimi and identified as a bacteriocin producer that had strong inhibitory activity against Listeria monocytogenes. Strain CS526 was identified as Carnobacterium piscicola by partial 16S rDNA sequence similarity. The ability of this bacteriocinogenic strain and nonbacteriocinogenic C. piscicola JCM5348 to inhibit the growth of L. monocytogenes was examined in culture broth incubated at 12 degrees C and cold-smoked salmon stored at 4, 12, and 20 degrees C. L. monocytogenes viable counts in the culture broth rapidly declined from 10(6) colony-forming units per ml to less than 10 colony-forming units per ml within 1 day at 12 degrees C in the presence of C. piscicola CS526. At 4 and 12 degrees C, inhibition of L. monocytogenes on salmon depended on the initial inoculum level of C. piscicola CS526. However, C. piscicola CS526 was bactericidal to L. monocytogenes within 21 and 12 days at 4 and 12 degrees C in cold-smoked salmon, respectively, even when the initial inoculum levels were low. C. piscicola CS526 suppressed the maximum cell number of L. monocytogenes by two and three log cycles, even at 20 degrees C. However, C. piscicola JCM5348 did not prevent the growth of the pathogen, except at 4 degrees C. Bacteriocin was detected in the samples coinoculated with C. piscicola CS526. The study shows that C. piscicola CS526 might have potential for biopreservation of refrigerated foods against L. monocytogenes.

  17. The quorum sensing luxS gene is induced in Lactobacillus acidophilus NCFM in response to Listeria monocytogenes.

    Science.gov (United States)

    Moslehi-Jenabian, Saloomeh; Vogensen, Finn Kvist; Jespersen, Lene

    2011-10-03

    The luxS gene involved in quorum sensing has been shown to control different behaviour of probiotic lactobacilli. In this study we investigated if luxS in Lactobacillus acidophilus NCFM was up-regulated in response to Listeria monocytogenes EGD-e. The two bacterial strains were grown in mono- and co-culture and the growth of both bacteria and the transcriptional level of luxS in L. acidophilus cells were monitored. Contrary to L. acidophilus, the growth of L. monocytogenes was significantly affected by co-cultivation. Transcriptional analysis showed that the expression of luxS increased during exponential growth in L. acidophilus cells with the highest level in the late-exponential growth phase, decreasing in the stationary phase. Following co-cultivation with L. monocytogenes, the transcriptional level of luxS increased significantly in mid-exponential growing cells of L. acidophilus after incubation with viable L. monocytogenes cells and by addition of cell-free culture supernatant of L. monocytogenes, whereas incubation with heat killed cells of L. monocytogenes had no effect on the transcriptional level. This could indicate that the up-regulation of luxS is due to a response to a secreted compound produced by L. monocytogenes cells.

  18. Characterization of a Mutant Listeria monocytogenes Strain Expressing Green Fluorescent Protein

    Institute of Scientific and Technical Information of China (English)

    Ling-Li JIANG; Hou-Hui SONG; Xue-Yan CHEN; Chun-Lin KE; Jing-Jing XU; Ning CHEN; Wei-Huan FANG

    2005-01-01

    To construct a recombinant strain of Listeria monocytogenes for the expression of heterologous genes, homologous recombination was utilized for insertional mutation, targeting its listeriolysin O gene(hly). The gene encoding green fluorescent protein (GFP) was used as the indicator of heterologous gene expression. The gene gfp was inserted into hly downstream from its promoter and signal sequence by an overlapping extension polymerase chain reaction, and was then cloned into the shuttle plasmid pKSV7 for allelic exchange with the L. monocytogenes chromosome. Homologous recombination was achieved by growing the electro-transformed L. monocytogenes cells on chloramphenicol plates at a non-permissive temperature.Sequencing analysis indicated correct insertion of the target gene in-frame with the signal sequence. The recombinant strain expressed GFP constitutively as revealed by fluorescence microscopy. The mutant strain L. monocytogenes hly-gfp lost its hemolytic activity as visualized on the blood agar or when analyzed with the culture supernatant samples. Such insertional mutation resulted in a reduced virulence of about 2 logs less than its parent strain L. monocytogenes 10403s as shown by the 50%-lethal-dose assays in the mouse and embryonated chicken egg models. These results thus demonstrate that mutated L. monocytogenes could be a potential carrier for the expression of heterologous passenger genes or could act as an indicator organism in the food industry.

  19. Culture related to road traffic safety: a comparison of eight countries using two conceptualizations of culture.

    Science.gov (United States)

    Nordfjærn, Trond; Şimşekoğlu, Özlem; Rundmo, Torbjorn

    2014-01-01

    The majority of previous cross-country studies of human factors relevant to traffic safety have not operationalized and measured culture. Also studies in this vein have mostly been carried out in Europe and the United States. The aim of the study was to examine country cluster differences, based on the Culture's Consequences framework, in road traffic risk perception, attitudes towards traffic safety and driver behaviour in samples from Norway, Russia, India, Ghana, Tanzania, Uganda, Turkey and Iran. An additional aim was to examine cluster differences in road traffic culture as symbol use and to investigate whether this theoretical cultural framework predicts risk perception, attitudes towards traffic safety and driver behaviour in the country clusters. The sample consisted of a total of 2418 individuals who were obtained by convenience sampling in the different countries. The countries segmented into four Culture's Consequences clusters; Norway, Russia and India, Sub-Saharan Africa, and Near East countries. The findings showed that Norwegians reported overall safer attitudes towards traffic safety and driver behaviour than the remaining country clusters. Individuals in Africa reported the highest risk perception. The countries also differed substantially in road traffic culture as symbol use. Contrary to established cultural theory, prediction models revealed that cultural factors were stronger predictors of driver behaviour than of risk perception. Also, the social cognitive risk constructs (i.e. risk perception and attitudes) solely explained variance in driver behaviour in the Norwegian and Russia/India clusters. Previous empirical efforts, which aimed to demonstrate that culture is important for the risk perception criterion, may have focused on a criterion variable that is not strongly related to driver behaviour. Furthermore, countermeasures aimed to influence social cognition may have stronger applicability in countries with a more individualistic western

  20. In Vitro Evaluation of Bacteriocins Activity Against Listeria monocytogenes Biofilm Formation.

    Science.gov (United States)

    Camargo, Anderson Carlos; de Paula, Otávio Almeida Lino; Todorov, Svetoslav Dimitrov; Nero, Luís Augusto

    2016-03-01

    The present study aimed to assess the activity of cell-free supernatant (CFS) containing bacteriocins on the formation and maintenance of biofilms developed by Listeria monocytogenes, and the associated effect of bacteriocins and ethylene-diamine-tetra-acetic acid (EDTA) on the formed biofilm. CFS from 9 lactic acid bacteria (LAB) strains was tested for inhibitory activity against 85 L. monocytogenes isolates and 21 LAB strains. Then, 12 L. monocytogenes strains were selected based on genetic profiles and sensitivity to CFS and were subjected to an in vitro assay to assess biofilm formation in microtiter plates, considering different culture media and incubation conditions. Based on these results, 6 L. monocytogenes strains were subjected to the same in vitro procedure to assess biofilm formation, being co-inoculated with CFS. In addition, these strains were subjected to the same in vitro procedure, modified by adding the CFS after biofilm formation. Relevant decrease in biofilm formation was observed in the first experiment, but CFS added after biofilm formation did not eliminate them. CFS from Lactobacillus curvatus ET31 were selected due to its anti-biofilm activity, being associated to EDTA at different concentrations and tested for biofilm control of three strains of L. monocytogenes, using the same in vitro procedure described previously. Concentrated bacteriocin presented poor performance in eliminating formed biofilms, and EDTA concentration presented no evident interference on biofilm elimination. Twelve selected L. monocytogenes strains were positive for investigated virulence makers and negative for luxS gene, recognized as being involved in biofilm formation. Selected L. monocytogenes strains were able to produce biofilms under different conditions. CFSs have the potential to prevent biofilm formation, but they were not able to destroy already formed biofilms. Nevertheless, low concentrations of CFS combined with EDTA caused a relevant reduction in

  1. A Relational Cultural Approach to the Broadway Musical "Wicked"

    Science.gov (United States)

    Lane, Ileana

    2009-01-01

    Relational-Cultural Theory (Miller, 1976, 1986) is based on the tenet that people grow through and toward relationships with others, rather than through separation and individuation. In this article, the characters and song lyrics of the Broadway musical, "Wicked" (Schwartz, Holzman, Mantello, & Platt, 2003), are viewed through the lens of…

  2. Cultural Factors Related to Smoking in San Francisco's Irish Bars

    Science.gov (United States)

    Satterlund, Travis D.; Antin, Tamar M. J.; Lee, Juliet P.; Moore, Roland S.

    2009-01-01

    California's Smoke-Free Workplace Act was extended to include bars in 1998. While the majority of bars in the state have become smoke free, in many bars patrons and staff continue to smoke despite the law. The authors present findings from a study which assessed cultural factors related to continued smoking in bars in the city of San Francisco. In…

  3. The Concept of Cultural Relativity in Moral Judgments Concerning Gender-Related Issues.

    Science.gov (United States)

    Boyd, D. R.; And Others

    The comparative study was designed to determine whether cultural relativism and ethical reasoning develop in a hierarchical manner when applied to culturally different phenomena. The phenomena investigated were moral judgments concerning gender-related issues. Thirty-six first through sixth-grade students from two private schools and 130…

  4. The Place of Culture in the Current International Relations

    Directory of Open Access Journals (Sweden)

    Constantin Frosin

    2011-05-01

    Full Text Available Culture and international relations easily appear to be mutually contradictory terms. To speak of "culture" is to invoke the creative capacities of human beings, to point, for example, to the constitutive role of values and visions, to the power of language and aesthetic expression, to communities great and small engaged in reconstructing normative aspirations and reshaping the possibilities for a decent way of life. To speak of "international relations," by contrast, is to draw upon an altogether bleaker account of the human condition, to refer to missiles and bombs, trade figures and debts, statesmanship and diplomacy, intrigue and force. It is to echo assertions about naked power and the sacrifice of cultural creativity and normative aspiration to the supposedly more enduring determinations of survival or supremacy. From the dark depths of international relations, the term culture takes on an aura of frivolity. It appears to refer to the idealistic and utopian, to the veneer of civilized decency that is always stripped away by the harsh realities of power politics and international conflict. This work aims at showing the contrary.

  5. Antimicrobial Tolerance in Listeria monocytogenes

    DEFF Research Database (Denmark)

    Curtis, Thomas Darwin

    There are two ways in which bacteria survive killing by antibiotics. The most well-known, is antibiotic resistance, which results from the acquisition of a resistance gene or mutation that allows bacteria to grow and divide in the presence of antibiotic concentrations that would normally kill other...... that are completely refractory to antibiotics due to the inactivity of cellular processes. Persister cells have been linked to treatment failures in several bacterial infections including Mycobacterium tuberculosis, Pseudomonas aeruginosa, Staphylococcus aureus and Escherichia coli. Preceding the start of this Ph......D project, Listeria monocytogenes was observed to form these antibiotic tolerant persister cells. L. monocytogenes is a Gram-positive, foodborne pathogen that causes listeriosis, a rare, but often lethal disease, even with antibiotic treatment. It typically affects pregnant women, neonates, the elderly...

  6. Teichoic acid is the major polysaccharide present in the Listeria monocytogenes biofilm matrix.

    Science.gov (United States)

    Brauge, Thomas; Sadovskaya, Irina; Faille, Christine; Benezech, Thierry; Maes, Emmanuel; Guerardel, Yann; Midelet-Bourdin, Graziella

    2016-01-01

    The aim of this study was to characterize the Listeria monocytogenes biofilm and particularly the nature of the carbohydrates in the biofilm extracellular matrix and culture supernatant versus to cell wall carbohydrates. Listeria monocytogenes serotype 1/2a and 4b strains were able to form complex biofilms embedded in an extracellular matrix. The soluble carbohydrates from biofilm extracellular matrix and culture supernatant were identified as teichoic acids, structurally identical to cell wall teichoic acids. In addition, the DSS 1130 BFA2 strain had a serotype 1/2a teichoic acid lacking N-acetyl glucosamine glycosylation due to a mutation in the lmo2550 gene. Consequently, we hypothesized that the extracellular teichoic acids in L. monocytogenes biofilms have the same origin as cell wall teichoic acid. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  7. Roche/BIOTECON Diagnostics LightCycler foodproof L. monocytogenes detection kit in combination with ShortPrep foodproof II Kit. Performance-Tested Method 070401.

    Science.gov (United States)

    Junge, Benjamin; Berghof-Jäger, Kornelia

    2006-01-01

    . Stable results were produced at all storage temperatures. The freeze-defrost analysis showed no noteworthy aggravation of test results. The independent validation study examined by Campden and Chorleywood Food Research Association Group (CCFRA) demonstrated again that the LightCycler L. monocytogenes detection system shows a comparable sensitivity to reference methods. With both the LightCycler PCR and BAM methods, 19 out of 20 inoculated food samples were detected. The 24 h PCR results generated by the LightCycler system corresponded directly with the FDA/BAM culture results. However, the 48 h PCR results did not relate exactly to the FDA/BAM results, as one sample found to be positive by the 48 h PCR could not be culturally confirmed and another sample which was negative by the 48 h PCR was culturally positive.

  8. Aerobic plate counts and ATP levels correlate with Listeria monocytogenes detection in retail delis.

    Science.gov (United States)

    Hammons, Susan R; Stasiewicz, Matthew J; Roof, Sherry; Oliver, Haley F

    2015-04-01

    Listeria monocytogenes is a foodborne pathogen that causes an estimated 1,591 cases of illness and 255 deaths annually in the United States, the majority of which are attributed to ready-to-eat deli meats processed in retail delis. Because retail delis distribute product directly to consumers, rapid methods to validate cleaning and sanitation are needed to improve retail food safety. This study investigated the relationships among ATP levels, standard aerobic plate count (APC), and L. monocytogenes presence in fully operational delis. Fifteen full-service delis were concurrently sampled for ATP, APC, and L. monocytogenes during preoperational hours once monthly for 3 months. Fifteen additional delis were recruited for 6 months of operational sampling (n = 30). A 1-log increase in APC was equivalent to a 3.3-fold increase in the odds of detecting L. monocytogenes (P < 0.001) and a 1.9-log increase in L monocytogenes population (P = 0.03). An ATP level increase of 1 log relative light unit correlated to a 0.22-log increase in APC (P < 0.001). A preoperational ATP level mean increase by 1 log relative light unit increased the odds of detecting L. monocytogenes concurrently fourfold. A 0.5-log increase in mean ATP level during preoperational sampling corresponded to a 2% increase in the predicted L. monocytogenes prevalence during operation (P < 0.01). Additionally, 10 statistically representative sites were identified and recommended for use in sanitation monitoring programs. Our data support the use of ATP as a rapid method to validate effective cleaning and sanitation to reduce L. monocytogenes in retail delis.

  9. Effect of citral and carvacrol on the susceptibility of Listeria monocytogenes and Listeria innocua to antibiotics.

    Science.gov (United States)

    Zanini, S F; Silva-Angulo, A B; Rosenthal, A; Rodrigo, D; Martínez, A

    2014-05-01

    The aim of this study was to evaluate the antibiotic susceptibility of Listeria innocua (L. innocua) and Listeria monocytogenes (L. monocytogenes) cells in the presence of citral and carvacrol at sublethal concentrations in an agar medium. The presence of terpenes in the L. monocytogenes and L. innocua culture medium provided a reduction in the minimal inhibitory concentration (MIC) of all the antibiotics tested. These effects were dependent on the concentration of terpenes present in the culture medium. The combination of citral and carvacrol potentiated antibiotic activity by reducing the MIC values of bacitracin and colistin from 32.0 and 128.0 μg ml⁻¹ to 1.0 and 2.0 μg ml⁻¹, respectively. Thus, both Listeria species became more susceptible to these drugs. In this way, the colistin and bacitracin resistance of L. monocytogenes and L. innocua was reversed in the presence of terpenes. Results obtained in this study show that the phytochemicals citral and carvacrol potentiate antibiotic activity, reducing the MIC values of cultured L. monocytogenes and L. innocua. Phytochemicals citral and carvacrol potentiate antibiotic activity of erythromycin, bacitracin and colistin by reducing the MIC values of cultured Listeria monocytogenes and Listeria innocua. This effect in reducing the MIC values of the antibiotics tested in both micro-organisms was increased when natural antimicrobials were combined. This finding indicated that the combination among terpenes and antibiotic may contribute in reducing the required dosage of antibiotics due to the possible effect of terpenes on permeation barrier of the micro-organism cell membrane. © 2014 The Society for Applied Microbiology.

  10. [Science, technique, and culture: relations between risk and health practices].

    Science.gov (United States)

    Czeresnia, Dina

    2004-01-01

    This article discusses the cultural consequences of discourses and practices aimed at training subjects for a rational, informed choice in relation to risks, calculated on the basis of scientific knowledge. The epidemiological risk concept is a central element in this process, especially in the context of health practices. The article begins by briefly characterizing the epidemiological risk concept, emphasizing that as an abstract model, it reduces the complexity of the phenomena it studies. Grasping reality through this abstraction generates values and meanings. Canguilhem's reflection on the relations between science, technique, and life is further discussed from the perspective of deepening an understanding of the cultural consequences of this process, contributing to the transformation of classical concepts of individuality, autonomy, and sociability. Such vital themes as individuality, alterity, and the relationship with death are present (albeit disguised) in issues that involve the central nature of risk in the contemporary world.

  11. Towards a systemic understanding of Listeria monocytogenes metabolism during infection

    Directory of Open Access Journals (Sweden)

    Thilo M Fuchs

    2012-02-01

    Full Text Available Listeria monocytogenes is a foodborne human pathogen that can cause invasive infection in susceptible animals and humans. For proliferation within hosts, this facultative intracellular pathogen uses a reservoir of specific metabolic pathways, transporter and enzymatic functions whose expression requires the coordinated activity of a complex regulatory network. The highly adapted metabolism of L. monocytogenes strongly depends on the nutrient composition of various milieus encountered during infection. Transcriptomic and proteomic studies revealed the spatial-temporal dynamic of gene expression of this pathogen during replication within cultured cells or in vivo. Metabolic clues are the utilization of unusual C2- and C3-bodies, the metabolism of pyruvate, thiamine availability, the uptake of peptides, the acquisition or biosynthesis of certain amino acids, and the degradation of glucose-phosphate via the pentose phosphate pathway. These examples illustrate the interference of in vivo conditions with energy, carbon and nitrogen metabolism, thus affecting listerial growth. The exploitation, analysis and modelling of the available data sets served as a first attempt to a systemic understanding of listerial metabolism during infection. L. monocytogenes might serve as a model organism for systems biology of a Gram-positive, facultative intracellular bacterium.

  12. Polyamines in relation to growth in carrot cell cultures.

    Science.gov (United States)

    Fallon, K M; Phillips, R

    1988-09-01

    Changes in polyamine metabolism were investigated in relation to growth of cell suspension cultures of carrot (Daucus carota, cv Chantenay). Changes in levels of the major amines putrescine and spermidine throughout the culture period correlated poorly with changes in fresh weight, but a closer correlation with the minor component spermine was observed. The arginine decarboxylase (ADC) inhibitor difluoromethylarginine (DFMA) strongly and specifically inhibited ADC activity in the supernatant, reduced the major amine (putrescine) by 95% and the total amine content by 80%. It had no effect on cell number and stimulated fresh weight by over 25% through increased cell expansion. Spermine content, in contrast, increased with DFMA concentration in parallel with fresh weight increases. Difluoromethylornithine strongly inhibited ornithine decarboxylase activity in the pellet, but had little effect on either polyamine levels or culture growth. It was concluded that little evidence for a correlation between free polyamines and cell number in carrot cultures could be detected, but that a possible correlation between spermine content and cell expansion was observed.

  13. Polyamines in Relation to Growth in Carrot Cell Cultures 1

    Science.gov (United States)

    Fallon, Kevin M.; Phillips, Richard

    1988-01-01

    Changes in polyamine metabolism were investigated in relation to growth of cell suspension cultures of carrot (Daucus carota, cv Chantenay). Changes in levels of the major amines putrescine and spermidine throughout the culture period correlated poorly with changes in fresh weight, but a closer correlation with the minor component spermine was observed. The arginine decarboxylase (ADC) inhibitor difluoromethylarginine (DFMA) strongly and specifically inhibited ADC activity in the supernatant, reduced the major amine (putrescine) by 95% and the total amine content by 80%. It had no effect on cell number and stimulated fresh weight by over 25% through increased cell expansion. Spermine content, in contrast, increased with DFMA concentration in parallel with fresh weight increases. Difluoromethylornithine strongly inhibited ornithine decarboxylase activity in the pellet, but had little effect on either polyamine levels or culture growth. It was concluded that little evidence for a correlation between free polyamines and cell number in carrot cultures could be detected, but that a possible correlation between spermine content and cell expansion was observed. PMID:16666271

  14. Material culture: the concrete dimension of social relations

    Directory of Open Access Journals (Sweden)

    Tania Andrade Lima

    2011-04-01

    Full Text Available By investigating the emergence, maintenance and transformation of sociocultural systems, Archaeology basically works with three closely inter-related dimensions: space, time, and form. The latter has seen the greatest diversity in approaches over the course of Archaeology's construction as a discipline. This article presents the conceptions of material culture developed by various schools of archaeological thought. Wrongly understood until the 1980s as an unproblematic dimension, a passive reflection of human behavior, some authors since then have explored its active and transformative role in social negotiations, making it the concrete dimension of relations inside the society.

  15. Lineage specific recombination rates and microevolution in Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Nightingale Kendra K

    2008-10-01

    Full Text Available Abstract Background The bacterium Listeria monocytogenes is a saprotroph as well as an opportunistic human foodborne pathogen, which has previously been shown to consist of at least two widespread lineages (termed lineages I and II and an uncommon lineage (lineage III. While some L. monocytogenes strains show evidence for considerable diversification by homologous recombination, our understanding of the contribution of recombination to L. monocytogenes evolution is still limited. We therefore used STRUCTURE and ClonalFrame, two programs that model the effect of recombination, to make inferences about the population structure and different aspects of the recombination process in L. monocytogenes. Analyses were performed using sequences for seven loci (including the house-keeping genes gap, prs, purM and ribC, the stress response gene sigB, and the virulence genes actA and inlA for 195 L. monocytogenes isolates. Results Sequence analyses with ClonalFrame and the Sawyer's test showed that recombination is more prevalent in lineage II than lineage I and is most frequent in two house-keeping genes (ribC and purM and the two virulence genes (actA and inlA. The relative occurrence of recombination versus point mutation is about six times higher in lineage II than in lineage I, which causes a higher genetic variability in lineage II. Unlike lineage I, lineage II represents a genetically heterogeneous population with a relatively high proportion (30% average of genetic material imported from external sources. Phylograms, constructed with correcting for recombination, as well as Tajima's D data suggest that both lineages I and II have suffered a population bottleneck. Conclusion Our study shows that evolutionary lineages within a single bacterial species can differ considerably in the relative contributions of recombination to genetic diversification. Accounting for recombination in phylogenetic studies is critical, and new evolutionary models that

  16. Phenotypic and Genotypic Characteristics of Listeria monocytogenes Isolated From Dairy and Meat Products

    Directory of Open Access Journals (Sweden)

    Bahador

    2015-08-01

    Full Text Available Background Listeria monocytogenes is a foodborne pathogen and a serious threat to the public health in the world. Consumption of traditional foods such as dairy and meat products can be a major reason for relative abundance and isolation of these bacteria. Objectives The purpose of this study was to determine the phenotypic and genotypic characteristics of L. monocytogenes strains isolated from dairy and meat products. Materials and Methods A total of 317 dairy products and meat-processed samples were collected. Antibiotic susceptibility test was performed on each sample by the disk diffusion method (Kirby Bauer. Five reference loci were used for typing of L. monocytogenes strains by MLVA (Multiple Locus VNTR Analysis Technique. Results A total of 24 L. monocytogenes isolates were collected from the dairy and meat products. Resistance of isolated L. monocytogenes strains to penicillin G were 54.54% (from dairy products and 46.15% (from processed meat. Genetic relatedness of isolates were assessed by MLVA. Out of 13 different types, type 2 with 6 strains and type 3 with 4 strains, were the most common types. Conclusions MLVA analysis showed that samples obtained from different sources could have similar genetic profile. As a result, administration of penicillin in patients with listeriosis (especially pregnant women and antibiotic susceptibility test are recommended. The fast and accurate methods such as MLVA for tracking of pollution sources of L. monocytogenes are recommended during outbreaks.

  17. Effect of honokiol on exotoxin proteins listeriolysin O and p60 secreted by Listeria monocytogenes.

    Science.gov (United States)

    Meng, Rizeng; Zhao, Ziwen; Guo, Na; Liu, Zonghui; Zhao, Xingchen; Li, Wenli; Li, Xiaoxu; Shi, Ce; Nie, Dandan; Wang, Weilin; Liu, Tao; Ma, Wenchen; Yu, Lu; Li, Juan

    2015-12-01

    Listeria monocytogenes is considered one of the most important foodborne pathogens. The virulence-related proteins listeriolysin O (LLO) and p60 are critical factors involved in Listeria pathogenesis. In the present study, we investigated the effect of honokiol on LLO and p60 secreted from L. monocytogenes. A listeriolysin assay was used to investigate the haemolytic activities of L. monocytogenes exposed to honokiol, and the secretion of LLO and p60 was detected by immunoblot analysis. Additionally, the influence of honokiol on the transcription of LLO and p60 genes (hly and iap, respectively) was analysed by real-time reverse transcription PCR. TNF-α release assays were performed to elucidate the biological relevance of changes in LLO and p60 secretion induced by honokiol. According to the data, honokiol showed good anti-L. monocytogenes activity, with MICs of 8-16 μg ml(-1), and the secretion of LLO and p60 was decreased by honokiol. In addition, the transcription of hly and iap was inhibited by honokiol. Our results indicate that TNF-α production by RAW264.7 cells stimulated with L. monocytogenes supernatants was inhibited by honokiol. Based on these data, we propose that honokiol could be used as a promising natural compound against L. monocytogenes and its virulence factors.

  18. Inhibitory Effect of Nisin on Listeria monocytogenes Inoculated into Surimi and Minced Meat

    Directory of Open Access Journals (Sweden)

    Masoud Rezaei

    2012-02-01

    Full Text Available Background & Objective: Listeria monocytogenes has already established as an important food born pathogen which induce listeriosis in human. Use of bacteriocins to provide food safety has been increased dramatically. Nisin has a wide spectrum inhibitory effect than the other bacteriocins and inhibits food-borne pathogens such as L. monocytogenes and many other Gram-positive spoilage microorganisms. The purpose of this study was to investigate the inhibitory effect of Nisin on population of Listeria monocytogenes and the role of changes in food components on the antilisterial properties of Nisin. Materials & Methods: The minced meat and surimi samples were inoculated by 1×104 cfu/g of L. monocytogenes. Then samples exposed to Nisin at the levels of 500 or 1000 IU/g were prepared. All treatments after packaging in plastic bags were kept for 12 days at refrigerator temperature. Samples were cultured on CHROMagarTM Listeria every 2 days and the number of listeria monocytogenes was counted. Results: two different concentrations of Nisin (500 or 1000 IU/g was not able to inhibit L. monocytogenes below the acceptable level for raw food (100 cells per g in minced meat and surimi of silver carp. But the number of bacteria reduces more in fish surimi as compared to the mince meal. Also, antilisterial activity of Nisin was reduced during the storage period. Conclusion: Inhibitory property of Nisin against L. monocytogenes in surimi significantly was higher than the minced (P<0.05. So it is possible the antilisterial properties of Nisin will increase by elimination of some enzymes during processing.

  19. Les relations Sud-Sud : culture et diplomatie

    OpenAIRE

    Abdenur, Adriana Erthal; Boisard, Stéphane; Boito, Armando; Brochier, Christophe; Brun, Élodie; Droulers, Martine; Dumont, Juliette; Forite, Camille; Galvão, Andréia; Lockhart, Nicolás Falomir; Marcelino,Paula; Marques-Pereira, Bérengère; Ramírez Barajas, Arlen Eugenia; Rodríguez Echeverría, María del Rocío; Sarr, Mamadou Lamine

    2016-01-01

    Le dossier central n° 80 des CAL s'intéresse aux relations entre l’Amérique latine et les pays du Sud, à travers le prisme de la culture, jusqu’à présent peu étudié, et pourtant fondamental dans le jeu des influences intergouvernementales. Quels sont les instruments de ce soft power? Quels sont les acteurs et les publics visés? Quelle image les différents pays cherchent-ils à projeter? Révélateurs de l’importance de la culture en politique étrangère, les articles rassemblés ici traitent de la...

  20. Listeria monocytogenes en comidas preparadas

    OpenAIRE

    Vila Brugalla, Montserrat

    2013-01-01

    Tradicionalmente Listeria monocytogenes no era considerado como un importante patógeno transmitido a través de los alimentos y, en consecuencia, no había recibido mucha atención por parte de la industria alimentaria. Los índices de listeriosis en la población humana siempre habían estado enormemente ensombrecidos por otras enfermedades transmitidas por los alimentos como la salmonelosis o la campilobacterosis, y la confirmación de brotes era poco frecuente. Sin embargo, los brotes de listerio...

  1. Characterization and antibiotic susceptibility of Listeria monocytogenes isolated from poultry and red meat in Morocco

    Directory of Open Access Journals (Sweden)

    Hayat Ennaji

    2008-09-01

    Full Text Available Hayat Ennaji1,2, Mohammed Timinouni2, My Mustapha Ennaji3, Mohammed Hassar1, Nozha Cohen11Laboratoire de Microbiologie et Hygiène des Aliments et de l’Environnement, Institut Pasteur du Maroc., Casablanca, Morocco; 2Laboratoire de Microbiologie et Biologie Moléculaire, Institut Pasteur du Maroc., Casablanca, Morocco; 3Laboratoire de Virologie et Hygiène and Microbiologie., Faculté des Sciences et Techniques - Mohammedia, Université Hassan II, Mohammedia, MoroccoAbstract: This study was carried out on 426 samples of raw meats collected from butcheries and supermarkets in Casablanca, Morocco. The samples were examined for the occurrence of Listeria species. Strains of Listeria monocytogenes were characterized by several biochemical tests and confirmed by polymerase chain reaction (PCR. β-hemolytic cultures and nonhemolytic isolates were tested for biochemical properties with the Listeria API test. Among the 43 Listeria species isolates; we identified 10 strains for L. monocytogenes (23.3%, 31 strains for L. innocua (72.1% and 2 strains for L. welshimeri (4.6%. Strains of L. monocytogenes were separated by multiplex PCR; two serogroups IIb and IVb were thus differentiated. Antibiotic susceptibility of L. monocytogenes to 21 antibiotics was determined by the disk diffusion method. All isolates were susceptible to a wide range of the tested antibiotics with the exception of nalidixic acid, colistine and cephalosporins second and third generation for which they were all resistant.Keywords: antibiotic susceptibility, Listeria monocytogenes, meat, PCR

  2. Removal of Listeria monocytogenes dual-species biofilms using combined enzyme-benzalkonium chloride treatments.

    Science.gov (United States)

    Rodríguez-López, Pedro; Carballo-Justo, Alba; Draper, Lorraine A; Cabo, Marta L

    2017-01-01

    The effects of pronase (PRN), cellulase (CEL) or DNaseI alone or combined with benzalkonium chloride (BAC) against Listeria monocytogenes-carrying biofilms were assayed. The best removal activity against L. monocytogenes-Escherichia coli biofilms was obtained using DNaseI followed by PRN and CEL. Subsequently, a modified logistic model was used to quantify the combined effects of PRN or DNaseI with BAC. A better BAC performance after PRN compared to DNaseI eradicating L. monocytogenes was observed. In E. coli the effects were the opposite. Finally, effects of DNaseI and DNaseI-BAC treatments were compared against two different L. monocytogenes-carrying biofilms. DNaseI-BAC was more effective against L. monocytogenes when co-cultured with E. coli. Nonetheless, comparing the removal effects after BAC addition, these were higher in mixed-biofilms with Pseudomonas fluorescens. However, a high number of released viable cells was observed after combined treatments. These results open new perspectives of enzymes as an anti-biofilm strategy for environmental pathogen control.

  3. An outbreak of an unusual strain of Listeria monocytogenes infection in North-East Scotland.

    Science.gov (United States)

    Okpo, Emmanuel; Leith, Jayne; Smith-Palmer, Alison; Bell, John; Parks, Duncan; Browning, Fiona; Byers, Lynn; Corrigan, Helen; Webster, Diana; Karcher, Anne M; Murray, Andrew; Storey, Tom

    2015-01-01

    Listeria monocytogenes infection is an important cause of illness and hospitalization in vulnerable individuals. In the present study, we describe a community outbreak of Listeria monocytogenes in the North-East region of Scotland, which was epidemiologically, environmentally and microbiologically linked to a local meat product and ready-to-eat product manufacturer. Infected individuals were interviewed, and an environmental investigation was conducted. Clinical and environmental samples were tested by culture, and isolates were typed by fluorescent amplified fragment length polymorphism (fAFLP). Three cases of Listeria monocytogenes were linked geographically, had the same serotype (1/2a) and were indistinguishable by fAFLP type XII.6. The human, food and environmental isolates were of the same serotype and were indistinguishable by molecular typing. This is the first community outbreak of L. monocytogenes reported in Scotland since the current outbreak surveillance was established in 1996. Epidemiological and laboratory evidence indicated poor hand hygiene, unhygienic practices and cross-contamination throughout the manufacturing process of ready-to-eat foods as a possible cause of the outbreak. More stringent control of commercial food establishments that provide ready-to-eat food and the need to advise specifically vulnerable groups, e.g., pregnant women, of the risk of L. monocytogenes in ready-to-eat food is urgently needed. Copyright © 2015 King Saud Bin Abdulaziz University for Health Sciences. Published by Elsevier Ltd. All rights reserved.

  4. Inhibition of Listeria monocytogenes biofilms by bacteriocin-producing bacteria isolated from mushroom substrate.

    Science.gov (United States)

    Bolocan, A S; Pennone, V; O'Connor, P M; Coffey, A; Nicolau, A I; McAuliffe, O; Jordan, K

    2017-01-01

    This study was designed to investigate the ability of naturally occurring bacteria isolated from mushroom substrate to prevent biofilm formation by Listeria monocytogenes or to remove existing biofilms in mushroom production facilities. It is generally recognized that L. monocytogenes forms biofilms that can facilitate its survival in food-processing environments. Eleven bacteriocin-producing isolates were identified and the bacteriocins characterized based on heat and enzyme inactivation studies. Further characterization was undertaken by MALDI-TOF mass spectrometry, PCR and sequencing. Production of nisin Z (by Lactococcus lactis isolates), subtilomycin (by Bacillus subtilis isolates) and lichenicidin (by Bacillus licheniformis and Bacillus sonorensis isolates) was detected. In co-culture with L. monocytogenes, the bacteriocin-producing strains could prevent biofilm formation and reduce pre-formed biofilms. Mushroom substrate can be a source of bacteriocin-producing bacteria that can antagonize L. monocytogenes. The results highlight the potential of bacteriocin-producing strains from mushroom substrate to reduce L. monocytogenes biofilm in food production environments, contributing to a reduction in the risk of food contamination from the environment. © 2016 The Society for Applied Microbiology.

  5. A new bovine conjunctiva model shows that Listeria monocytogenes invasion is associated with lysozyme resistance.

    Science.gov (United States)

    Warren, Jessica; Owen, A Rhys; Glanvill, Amy; Francis, Asher; Maboni, Grazieli; Nova, Rodrigo J; Wapenaar, Wendela; Rees, Catherine; Tötemeyer, Sabine

    2015-08-31

    Listerial keratoconjunctivitis ('silage eye') is a wide spread problem in ruminants causing economic losses to farmers and impacts negatively on animal welfare. It results from direct entry of Listeria monocytogenes into the eye, often following consumption of contaminated silage. An isolation protocol for bovine conjunctival swabbing was developed and used to sample both infected and healthy eyes bovine eyes (n=46). L. monocytogenes was only isolated from one healthy eye sample, and suggests that this organism can be present without causing disease. To initiate a study of this disease, an infection model was developed using isolated conjunctiva explants obtained from cattle eyes post slaughter. Conjunctiva were cultured and infected for 20 h with a range of L. monocytogenes isolates (n=11), including the healthy bovine eye isolate and also strains isolated from other bovine sources, such as milk or clinical infections. Two L. monocytogenes isolates (one from a healthy eye and one from a cattle abortion) were markedly less able to invade conjunctiva explants, but one of those was able to efficiently infect Caco2 cells indicating that it was fully virulent. These two isolates were also significantly more sensitive to lysozyme compared to most other isolates tested, suggesting that lysozyme resistance is an important factor when infecting bovine conjunctiva. In conclusion, we present the first bovine conjunctiva explant model for infection studies and demonstrate that clinical L. monocytogenes isolates from cases of bovine keratoconjunctivitis are able to infect these tissues.

  6. Examination of Listeria monocytogenes in Seafood Processing Facilities and Smoked Salmon in the Republic of Ireland.

    Science.gov (United States)

    Leong, Dara; Alvarez-Ordóñez, Avelino; Zaouali, Sarah; Jordan, Kieran

    2015-12-01

    Listeria monocytogenes is a foodborne pathogen that causes listeriosis, a relatively rare but life-threatening disease primarily affecting immunocompromised individuals. The aim of this study was to determine the prevalence of L. monocytogenes in the seafood processing industry in the Republic of Ireland. The occurrence of L. monocytogenes was determined by regular sampling of both food samples and processing environment swabs at eight seafood processing facilities over two calendar years. All samples were analyzed by the International Organization for Standardization 11290-1 standard method, and the isolates were characterized by PCR, pulsed-field gel electrophoresis, serotyping, and the occurrence of some genes related to survival under stress (SSI-1, Tn6188, and bcrABC). A prevalence of 2.5% in 508 samples (433 environmental swabs and 75 food samples) was found. From the isolates obtained, eight different pulsed-field gel electrophoresis profiles were identified, two occurring in more than one facility and one occurring in food and the environment. Five of the eight pulsotypes identified contained at least one of the three stress survival-related genes tested. The tolerance of the isolates to benzalkonium chloride, a representative quaternary ammonium compound, was also examined and ranged from 5.5 ± 0.5 to 8.5 ± 0.5 ppm of benzalkonium chloride. To evaluate the ability of smoked salmon to support the growth of L. monocytogenes, including the T4 widespread pulsotype that was isolated, a challenge test was performed on cold-smoked salmon obtained from two separate producers. The results showed clearly that both types of smoked salmon supported the growth of L. monocytogenes. Although occurrence of L. monocytogenes on seafood was low, this study showed that the smoked salmon used in this study can support the growth of L. monocytogenes; therefore, vigilance is required in the processing facilities to reduce the associated risk.

  7. Carbon dioxide and nisin act synergistically on Listeria monocytogenes

    DEFF Research Database (Denmark)

    Nilsson, Lilian; Chen, Y.H.; Chikindas, M.L.

    2000-01-01

    This paper examines the synergistic action of carbon dioxide and nisin on Listeria monocytogenes Scott A wild-type and nisin-resistant (Nis(r)) cells grown in broth at 4 degrees C. Carbon dioxide extended the lag phase and decreased the specific growth rate of both strains, but to a greater degree...... for cultures in CO2. This synergism between nisin and CO2 was examined mechanistically by following the leakage of carboxyfluorescein (CF) from listerial liposomes. Carbon dioxide enhanced nisin-induced CF leakage, indicating that the synergistic action of CO2 and nisin occurs at the cytoplasmic membrane...

  8. Peptide nucleic acid fluorescence in situ hybridization for identification of Listeria genus, Listeria monocytogenes and Listeria ivanovii.

    Science.gov (United States)

    Zhang, Xiaofeng; Wu, Shan; Li, Ke; Shuai, Jiangbing; Dong, Qiang; Fang, Weihuan

    2012-07-02

    A fluorescent in situ hybridization (FISH) method in conjunction with fluorescin-labeled peptide nucleic acid (PNA) probes (PNA-FISH) for detection of Listeria species was developed. In silico analysis showed that three PNA probes Lis-16S-1, Lm-16S-2 and Liv-16S-5 were suitable for specific identification of Listeria genus, Listeria monocytogenes and Listeria ivanovii, respectively. These probes were experimentally verified by their reactivity against 19 strains of six Listeria species (excluding newly described species Listeria marthii and Listeria rocourtiae) and eight other bacterial species. The PNA-FISH method was optimized as 30 min of hybridization with 0.2% Triton X-100 in the solution and used to identify 85 Listeria strains from individual putative Listeria colonies on PALCAM agar plates streaked from selectively enriched cultures of 780 food or food-related samples. Of the 85 Listeria strains, thirty-seven were identified as L. monocytogenes with the probe Lm-16S-2 and two as L. ivanovii with the probe Liv-16S-5 which was in agreement with the results obtained by the API LISTERIA method. Thus, the PNA-FISH protocol has the potential for identification of pathogenic Listeria spp. from food or food-related samples.

  9. Assessment of Listeria monocytogenes virulence in the Galleria mellonella insect larvae model

    Science.gov (United States)

    Rakic Martinez, Mira; Ferguson, Martine; Datta, Atin R.

    2017-01-01

    Several animal models have been used to understand the molecular basis of the pathogenicity, infectious dose and strain to strain variation of Listeria monocytogenes. The greater wax worm Galleria mellonella, as an alternative model, provides some useful advantages not available with other models and has already been described as suitable for the virulence assessment of various pathogens including L. monocytogenes. The objectives of this study are: 1) confirming the usefulness of this model with a wide panel of Listeria spp. including non-pathogenic L. innocua, L. seeligeri, L. welshimeri and animal pathogen L. ivanovii; 2) assessment of virulence of several isogenic in-frame deletion mutants in virulence and stress related genes of L. monocytogenes and 3) virulence assessment of paired food and clinical isolates of L. monocytogenes from 14 major listeriosis outbreaks occurred worldwide between 1980 and 2015. Larvae injected with different concentrations of Listeria were incubated at 37°C and monitored over seven days for time needed to kill 50% of larvae (LT50) and to determine change of bacterial population in G. mellonella, 2 and 24 hours post-inoculation. Non-pathogenic members of Listeria and L. ivanovii showed significantly (P monocytogenes strains. Isogenic mutants of L. monocytogenes with the deletions in prfA, plcA, hly, actA and virR genes, also showed significantly (P monocytogenes strains related to non-invasive (gastroenteritis) outbreaks of listeriosis showed significantly (P < 0.05) lower virulence than isolates of the same serotype obtained from outbreaks with invasive symptoms. The difference, however, was dose and strain- dependent. No significant differences in virulence were observed among the serotype tested in this study. PMID:28898264

  10. Evolution and Diversity of Listeria monocytogenes from Clinical and Food Samples in Shanghai, China

    Directory of Open Access Journals (Sweden)

    Jianmin Zhang

    2016-07-01

    Full Text Available Listeria monocytogenes is a significant foodborne pathogen causing severe systemic infections in humans with high mortality rates. The objectives of this work were to establish a phylogenetic framework of L. monocytogenes from China and to investigate sequence diversity among different serotypes. We selected 17 L. monocytogenes strains recovered from patients and foods in China representing serotypes 1/2a, 1/2b, and 1/2c. Draft genome sequences were determined using Illumina MiSeq technique and associated protocols. Open reading frames were assigned using prokaryotic genome annotation pipeline by NCBI. Twenty-four published genomes were included for comparative genomic and phylogenetic analysis. More than 154,000 single nucleotide polymorphisms (SNPs were identified from multiple genome alignment and used to reconstruct maximum likelihood phylogenetic tree. The 41 genomes were differentiated into lineages I and II, which consisted of 4 and 11 subgroups, respectively. A clinical strain from China (SHL009 contained significant SNP differences compared to the rest genomes, whereas clinical strain SHL001 shared most recent common ancestor with strain SHL017 from food. Moreover, clinical strains SHL004 and SHL015 clustered together with two strains (08-5578 and 08-5923 recovered from an outbreak in Canada. Partial sequences of a plasmid found in the Canadian strain were also present in SHL004. We investigated the presence of various genes and gene clusters associated with virulence and subgroup-specific genes, including internalins, L. monocytogenes pathogenicity islands (LIPIs, L. monocytogenes genomic islands (LGIs, stress survival islet 1 (SSI-1, and clustered regularly interspaced short palindromic repeats (CRISPR/cas system. A novel genomic island, denoted as LGI-2 was identified. Comparative sequence analysis revealed differences among the L. monocytogenes strains related to virulence, survival abilities, and attributes against foreign genetic

  11. Relative transcription of Listeria monocytogenes virulence genes in liver pâtés with varying NaCl content

    DEFF Research Database (Denmark)

    Olesen, Inger; Thorsen, Line; Jespersen, Lene

    2010-01-01

    , the presence of Ca-acetate and Ca-lactate induced relative transcription of the stress response gene, clpC, for all three strains. This study demonstrates that relative microbial gene transcription can be measured in complex food matrices and points to the need for designing experimental set-ups in real food...

  12. Archaeological culture, please meet yoghurt culture: towards a relational archaeology of milk

    Directory of Open Access Journals (Sweden)

    Dimitrij Mlekuž

    2015-12-01

    Full Text Available Taking milk as a point of departure, we set out on a journey to explore the ‘mutual becomings’ of different bodies, species, and things. We argue that milk should be understood as a component in an assemblage that connects animals, humans, hormones, enzymes, bacteria, food, genes, technologies and material culture. These complex entanglements produced new, unexpected results and effects. Since they form part of this assemblage, all its components are profoundly changed. Focusing on this diversity of relations between humans, other creatures, things and substances is a key to an archaeology that does not radically separate humans and nonhumans.

  13. The influence of mayonnaise pH and storage temperature on the growth of Listeria monocytogenes in seafood salad.

    Science.gov (United States)

    Hwang, Cheng-An; Tamplin, Mark L

    2005-07-25

    Seafood salad has been identified as a ready-to-eat food with a relatively high incidence of contamination by Listeria monocytogenes; however, little is known about the behavior of this pathogen in seafood salad as a function of product pH and storage temperature. To produce data towards the development of a predictive growth model, a 6-strain cocktail of L. monocytogenes was inoculated onto the surface of a shrimp-crabmeat product, mixed with mayonnaise that was previously adjusted with NaOH to pH 3.7, 4.0, 4.4, 4.7 or 5.1, and then stored at 4 degrees , 8 degrees or 12 degrees C under both aerobic and vacuum conditions. At each storage temperature, L. monocytogenes was able to grow in the seafood salad under both aerobic and vacuum conditions. The slowest growth of L. monocytogenes was observed in seafood salad with a mayonnaise pH of 3.7 and a storage temperature of 4 degrees C under vacuum condition. In salad with the same mayonnaise pH, the growth rate (GR, log10 cfu/h) of L. monocytogenes increased as a function of storage temperature. At the same storage temperature, the lag phase duration (LPD, h) of L. monocytogenes decreased as mayonnaise pH increased. At the same mayonnaise pH and temperature, LPD of L. monocytogenes was greater under aerobic than under vacuum conditions. Regression analyses indicated that mayonnaise pH is the main effector on the LPD of L. monocytogenes in seafood salad, and storage temperature was the main effector on the GR. Secondary models that describe LPD and GR of L. monocytogenes in seafood salad as a function of mayonnaise pH and storage temperature were produced.

  14. Cultural Studies and Sociology of Culture in Germany: Relations and Interrelations

    Directory of Open Access Journals (Sweden)

    Udo Göttlich

    2013-06-01

    Full Text Available Over the last three decades, attitudes towards cultural studies in Germany have developed within contexts of contact and conflict with a variety of disciplines, e.g. ethnology, anthropology, sociology, as well as the sociology of culture, liter-ary studies and Kulturwissenschaft(en. On the one hand there is a strong academ-ic interest in how cultural studies perceives and analyzes media culture, popular culture and everyday life. On the other hand boundaries with humanities and so-cial science remain, which leads to criticism and conflicts with cultural studies and its achievements.I will discuss some of the problems concerning the perception and reception of cultural studies among representatives of Kulturwissenschaft(en and sociology of culture. Furthermore I will draw on the role of cultural studies in thematizing cul-tural change and conflicts, and its ability to do so in a way that shows the im-portance of culture and politics.

  15. Reconcilable differences? Human diversity, cultural relativity, and sense of community.

    Science.gov (United States)

    Townley, Greg; Kloos, Bret; Green, Eric P; Franco, Margarita M

    2011-03-01

    Sense of community (SOC) is one of the most widely used and studied constructs in community psychology. As proposed by Sarason in (The Psychological sense of community: prospects for a community psychology, Jossey-Bass, San Francisco, 1974), SOC represents the strength of bonding among community members. It is a valuable component of community life, and it has been linked to positive mental health outcomes, citizen participation, and community connectedness. However, promotion of SOC can become problematic in community psychology praxis when it conflicts with other core values proposed to define the field, namely values of human diversity, cultural relativity, and heterogeneity of experience and perspective. Several commentators have noted that promotion of SOC can conflict with multicultural diversity because it tends to emphasize group member similarity and appears to be higher in homogeneous communities. In this paper, we introduce the idea of a community-diversity dialectic as part of praxis and research in community psychology. We argue that systematic consideration of cultural psychology perspectives can guide efforts to address a community-diversity dialectic and revise SOC formulations that ultimately will invigorate community research and action. We provide a working agenda for addressing this dialectic, proposing that systematic consideration of the creative tension between SOC and diversity can be beneficial to community psychology.

  16. Antibiotic therapy for Listeria monocytogenes bacteremia.

    Science.gov (United States)

    Hung, C C; Chang, S C; Chen, Y C; Hsieh, W C; Luh, K T

    1995-01-01

    Listeria monocytogenes has been recognized as an important pathogen in immunocompromised patients, but it has been rarely reported in Taiwan. We reviewed 13 cases of L. monocytogenes bacteremia at National Taiwan University Hospital over a 12-year period. All of the patients had underlying diseases. Fever was the most common presenting symptom, and neurologic signs were found in 6 patients. Most of the patients received penicillin G, ampicillin or piperacillin with an aminoglycoside. Corticosteroids were used in 9 of 13 patients. The overall mortality directly due to L. monocytogenes bacteremia was 31%. However, patients treated with cephalosporins or oxacillin had higher mortality than those treated with penicillin G, ampicillin or piperacillin (p = 0.05). Given the increasing number of immunosuppressed patients in Taiwan, it is likely that more cases will be encountered. Physicians in Taiwan should be aware of L. monocytogenes bacteremia and its treatment.

  17. BIOTECON diagnostics foodproof Listeria monocytogenes Detection Kit, 5' nuclease in combination with the foodproof ShortPrep II Kit.

    Science.gov (United States)

    Junge, Benjamin; Grönewald, Cordt; Berghof-Jäger, Kornelia

    2012-01-01

    A method was developed for the detection of Listeria monocytogenes in food. The method is based on real-time PCR using hydrolysis probes (5' Nuclease). This advanced PCR method was designed to reduce the time necessary to achieve results from PCR reactions and to enable the user to monitor the amplification of the PCR product simultaneously, in real-time. After DNA isolation using the BIOTECON foodproof ShortPrep II Kit designed for the rapid preparation of L. monocytogenes DNA for direct use in PCR, the real-time detection of L. monocytogenes DNA is carried out using the foodproof Listeria monocytogenes Detection Kit. The kit provides primers and hydrolysis probes for sequence-specific detection, convenient premixed reagents, and controls for reliable interpretation of results. For the internal comparison study, three different foods (soft cheese, coalfish, and smoked ham) were analyzed, chosen from the 15 food groups recommended by the AOAC Research Institute for detection of L. monocytogenes. From each food, 20 samples were inoculated with a low level (1-10 CFU/25 g) and 20 samples with a high level (10-50 CFU/25 g) of L. monocytogenes. Additionally, five nonspiked samples were prepared from each food. Depending on the matrix, the food samples were examined with the test kits and compared with the cultural methods according to the U.S. Food and Drug Administration's Bacteriological Analytical Manual or the U.S. Department of Agriculture/Food Safety and Inspection Service Microbiology Laboratory Guidebook.

  18. Real-time PCR detection of Listeria monocytogenes in infant formula and lettuce following macrophage-based isolation and enrichment.

    Science.gov (United States)

    Day, J B; Basavanna, U

    2015-01-01

    To develop a rapid detection procedure for Listeria monocytogenes in infant formula and lettuce using a macrophage-based enrichment protocol and real-time PCR. A macrophage cell culture system was employed for the isolation and enrichment of L. monocytogenes from infant formula and lettuce for subsequent identification using real-time PCR. Macrophage monolayers were exposed to infant formula and lettuce contaminated with a serial dilution series of L. monocytogenes. As few as approx. 10 CFU ml(-1) or g(-1) of L. monocytogenes were detected in infant formula and lettuce after 16 h postinfection by real-time PCR. Internal positive PCR controls were utilized to eliminate the possibility of false-negative results. Co-inoculation with Listeria innocua did not reduce the L. monocytogenes detection sensitivity. Intracellular L. monocytogenes could also be isolated on Listeria selective media from infected macrophage lysates for subsequent confirmation. The detection method is highly sensitive and specific for L. monocytogenes in infant formula and lettuce and establishes a rapid identification time of 20 and 48 h for presumptive and confirmatory identification, respectively. The method is a promising alternative to many currently used q-PCR detection methods which employ traditional selective media for enrichment of contaminated food samples. Macrophage enrichment of L. monocytogenes eliminates PCR inhibitory food elements and contaminating food microflora which produce cleaner samples that increase the rapidity and sensitivity of detection. Published 2014. This article is a U.S. Government work and is in the public domain in the USA.

  19. Differentiation of different mixed Listeria strains and also acid-injured, heat-injured, and repaired cells of Listeria monocytogenes using fourier transform infrared spectroscopy.

    Science.gov (United States)

    Nyarko, Esmond; Donnelly, Catherine

    2015-03-01

    Fourier transform infrared (FT-IR) spectroscopy was used to differentiate mixed strains of Listeria monocytogenes and mixed strains of L. monocytogenes and Listeria innocua. FT-IR spectroscopy was also applied to investigate the hypothesis that heat-injured and acid-injured cells would return to their original physiological integrity following repair. Thin smears of cells on infrared slides were prepared from cultures for mixed strains of L. monocytogenes, mixed strains of L. monocytogenes and L. innocua, and each individual strain. Heat-injured and acid-injured cells were prepared by exposing harvested cells of L. monocytogenes strain R2-764 to a temperature of 56 ± 0.2°C for 10 min or lactic acid at pH 3 for 60 min, respectively. Cellular repair involved incubating aliquots of acid-injured and heat-injured cells separately in Trypticase soy broth supplemented with 0.6% yeast extract for 22 to 24 h; bacterial thin smears on infrared slides were prepared for each treatment. Spectral collection was done using 250 scans at a resolution of 4 cm(-1) in the mid-infrared wavelength region. Application of multivariate discriminant analysis to the wavelength region from 1,800 to 900 cm(-1) separated the individual L. monocytogenes strains. Mixed strains of L. monocytogenes and L. monocytogenes cocultured with L. innocua were successfully differentiated from the individual strains when the discriminant analysis was applied. Different mixed strains of L. monocytogenes were also successfully separated when the discriminant analysis was applied. A data set for injury and repair analysis resulted in the separation of acid-injured, heat-injured, and intact cells; repaired cells clustered closer to intact cells when the discriminant analysis (1,800 to 600 cm(-1)) was applied. FT-IR spectroscopy can be used for the rapid source tracking of L. monocytogenes strains because it can differentiate between different mixed strains and individual strains of the pathogen.

  20. A Brief Description of the Historical Relations Between Ancient Tibetan Culture and the Chinese Culture

    Institute of Scientific and Technical Information of China (English)

    Gelek

    2004-01-01

    All the ethnic groups of China together have created Chinese culture as a whole over its long historical development. This rich and colourful culture now spread before our eyes is the result of the distinctive cultures of various ethnic groups gradually merging.Without cultural exchange and cross influence between

  1. Prevalence of Listeria monocytogenes in European cheeses

    DEFF Research Database (Denmark)

    Martinez Rios, Veronica; Dalgaard, Paw

    2017-01-01

    Both in Europe and worldwide cheese has caused important outbreaks of listeriosis and can be a vehicle for transmission of Listeria monocytogenes to consumers. A systematic review and meta-analysis were conducted using scientific literature and European Food Safety Authority (EFSA) reports...... understanding of L. monocytogenes prevalence in different types of cheeses and provided results that can be useful as input for quantitative microbiological risk assessment modelling....

  2. WORK-RELATED CULTURAL VALUES OF JAPANESE AND CZECH STUDENTS

    Directory of Open Access Journals (Sweden)

    Tobias Cramer

    2016-04-01

    Full Text Available Companies are very often confronted with external and internal cultural diversity to which they have to respond adequately. We need a deeper understanding of whether national cultures remain divergent in countries such as Japan and the Czech Republic following the pressures of globalization. One can argue that as cultures evolve they should constantly be assessed e.g., with respect to each of Hofstede‟s dimensions. By collecting data from one Eastern-European culture, the Czech Republic, and one Eastern culture, Japan, this study has re-examined Hofstede‟s (1984; 2001 cultural dimensions in these two cultures. Results suggest interesting changes have occurred in these cultures; a trend towards convergence may be derived. Explanations as well as implications are discussed.

  3. Control of Listeria monocytogenes in fresh cheese using protective lactic acid bacteria.

    Science.gov (United States)

    Coelho, M C; Silva, C C G; Ribeiro, S C; Dapkevicius, M L N E; Rosa, H J D

    2014-11-17

    In the past years, there has been a particular focus on the application of bacteriocins produced by lactic acid bacteria (LAB) in controlling the growth of pathogenic bacteria in foods. The aim of this study was to select LAB strains with antimicrobial activity, previously isolated from a traditional Azorean artisanal cheese (Pico cheese), in order to identify those with the greatest potential in reducing Listeria monocytogenes in fresh cheese. Eight bacteriocin producer strains identified as Lactococcus lactis (1) and Enterococcus faecalis (7) were tested. In general, the bacteriocin-producing strains presented a moderate growth in fresh cheese at refrigeration temperatures (4 °C), increasing one log count in three days. They exhibited slow acidification capacity, despite the increased production of lactic acid displayed by some strains after 24h. Bacteriocin activity was only detected in the whey of fresh cheese inoculated with two Enterococcus strains, but all cheeses made with bacteriocin-producing strains inhibited L. monocytogenes growth in the agar diffusion bioassay. No significant differences were found in overall sensory evaluation made by a non-trained panel of 50-52 tasters using the isolates as adjunct culture in fresh cheese, with the exception of one Enterococcus strain. To test the effect of in situ bacteriocin production against L. monocytogenes, fresh cheese was made from pasteurized cows' milk inoculated with bacteriocin-producing LAB and artificially contaminated with approximately 10(6) CFU/mL of L. monocytogenes. The numbers of L. monocytogenes were monitored during storage of fresh cheese at refrigeration temperature (4 °C) for up to 15 days. All strains controlled the growth of L. monocytogenes, although some Enterococcus were more effective in reducing the pathogen counts. After 7 days, this reduction was of approximately 4 log units compared to the positive control. In comparison, an increase of 4 log CFU/mL in pathogen numbers was

  4. Internalization of Listeria monocytogenes in Whole Avocado.

    Science.gov (United States)

    Chen, Yi; Evans, Peter; Hammack, Thomas S; Brown, Eric W; Macarisin, Dumitru

    2016-08-01

    In recent years, tree fruits have emerged as a new concern for Listeria monocytogenes contamination. The objective of the current study was to evaluate the potential internalization of L. monocytogenes from the surface of avocados into the edible portions of the fruit during certain postharvest practices simulated in a laboratory setting. One set of intact avocados was spot inoculated with L. monocytogenes on the stem scar, and the second set was hydrocooled in water contaminated with L. monocytogenes. Under these experimental conditions, L. monocytogenes internalized into the avocado pulp through the stem or stem scar after both spot inoculation and hydrocooling. In avocados spot inoculated with 50, 130, 500, and 1,300 CFU per fruit, bacteria were detected in the edible portion adjacent to the stem scar within 15 days postinoculation during storage at 4°C. In avocados hydrocooled in water containing L. monocytogenes at 10(6) and 10(8) CFU/ml, bacteria reached the bottom end of the fruit, and the populations in the edible portion adjacent to the stem scar reached up to 5.90 to 7.19 log CFU/g within 10 to 15 days during storage at 4°C. Dye mixed with inoculum was useful for guiding subsequent sampling, but dye penetration patterns were not always consistent with bacterial penetration.

  5. Sepsis and meningoencephalitis due to Listeria monocytogenes in patients with liver cirrhosis: a case of nonhepatic encephalopathy?

    Directory of Open Access Journals (Sweden)

    Federico Lari

    2012-10-01

    Full Text Available Introduction The appearance of neurological disorders in a patient with liver cirrhosis initially suggests hepatic encephalopathy, but other causes should be considered, including bacterial infections.Materials and methods An 80-year-old woman suffering from HCV-related cirrhosis was admitted for fever, confusion, and stupor. No improvement was seen after treatment with cephalosporins, lactulose, and fluids.Results Listeria monocytogenes was isolated from blood cultures and subsequently from a cerebrospinal fluid specimen as well. On the basis of the antibiogram, the antibiotic therapy was modified to include ampicillin, but shock and multiorgan failure developed and the patient died one week later.Discussion Bacterial infections are more common and more aggressive in patients with liver cirrhosis, probably because of the immune dysfunction associated with this disorder. The presence of neurological disorders in a patient with liver cirrhosis may be a sign of hepatic encephalopathy, but it is important to recall that there are other potential causes as well, including bacterial infections. In this case, it is possible that the patient's symptoms were the result of the CNS infection with L. monocytogenes, which was particularly aggressive as a result of her cirrhosis.

  6. [Comparative proteomics analysis of extracellular proteins from Listeria monocytogenes and its isogenic prfA deletion mutant].

    Science.gov (United States)

    Yin, Yuelan; Bai, Chunguang; Wang, Guoliang; Jia, Yanyan; Qu, Jin; Fu, Hong; Gao, Yunfei; Jiao, Xin'an

    2013-04-04

    Positive regulatory factor A (PrfA) protein plays a key role in the pathogenicity of Listeria monocytogenes by regulating the expression of virulence genes. We studied the regulation functions of PrfA and its role in Listeria monocytogenes (Lm) virulence. Extracellular proteins were obtained from the supernatants of parental strain LM4 and mutant strain LM4deltaprfA cultured in minimal medium. We used two-dimensional gel electrophoresis and matrix associated laser dissociation/ionization time of flight mass spectrometry (MALDI- TOF-MS) to analyze the differences of secreted proteins between LM4 and LM4deltaprfA. The electrophoresis results show that 31 different spots, 19 spots corresponding 12 proteins were identified by MALDI- TOF-MS. Some virulence related proteins were verified, such as InlC, ActA and LLO. Some new proteins that are regulated by PrfA include D-alanyl-D-alanine carboxypeptidase, dipeptide Glycine and Trytophan (GW) repeat-containing surface protein, transcriptional regulator and some hypothetical proteins with unknown functions. Real-time quantitative PCR was conducted to verify the proteomics results. The mRNA expression level of hly, actA and inlC gene was significantly reduced, and that of D-alanyl-D-alanine carboxypeptidase and GW repeat-containing surface protein's synthesis also had a reduction in LM4deltaprfA strain. PrfA plays key roles on the regulation of genes in LIPI- I and LIPI- II.

  7. An ecological perspective of Listeria monocytogenes biofilms in food processing facilities.

    Science.gov (United States)

    Valderrama, Wladir B; Cutter, Catherine N

    2013-01-01

    Listeria monocytogenes can enter the food chain at virtually any point. However, food processing environments seem to be of particular importance. From an ecological point of view, food processing facilities are microbial habitats that are constantly disturbed by cleaning and sanitizing procedures. Although L. monocytogenes is considered ubiquitous in nature, it is important to recognize that not all L. monocytogenes strains appear to be equally distributed; the distribution of the organism seems to be related to certain habitats. Currently, no direct evidence exists that L. monocytogenes-associated biofilms have played a role in food contamination or foodborne outbreaks, likely because biofilm isolation and identification are not part of an outbreak investigation, or the definition of biofilm is unclear. Because L. monocytogenes is known to colonize surfaces, we suggest that contamination patterns may be studied in the context of how biofilm formation is influenced by the environment within food processing facilities. In this review, direct and indirect epidemiological and phenotypic evidence of lineage-related biofilm formation capacity to specific ecological niches will be discussed. A critical view on the development of the biofilm concept, focused on the practical implications, strengths, and weaknesses of the current definitions also is discussed. The idea that biofilm formation may be an alternative surrogate for microbial fitness is proposed. Furthermore, current research on the influence of environmental factors on biofilm formation is discussed.

  8. Water Relation Parameters of Embryogenic Cultures and Seedlings of Larch

    Science.gov (United States)

    Livingston, Nigel J.; von Aderkas, Patrick; Fuchs, Edgar E.; Reaney, Martin J. T.

    1992-01-01

    Changes in the water relations parameters of developing somatic embryogenic and xygotic European larch (Larix decidua) were studied. Water release curves were generated by suspending tissue samples over unsaturated NaCl solutions until they reached vapor equilibration with the surrounding air. Twenty solutions were used whose water potentials ranged from −0.05 to −10 MPa. Water release curves were obtained by plotting paired values of tissue relative water content (RWC) and solution potential. Curves were derived for embryonic larch at various stages of development and for hypocotyls and roots from germinated zygotic and somatic embryos. The ability to resist dehydration increased markedly with development. Stage 1 tissue, which consisted of clusters of loosely associated nonchlorophyllous cells, had extremely low bulk elastic modulus (ε) (1.91 MPa) and apoplastic water content (A) (0.023), relatively high osmotic potential (Ψπ) (−0.53 MPa), and lost turgor at 0.56 RWC. In contrast, mature embryoids with primary roots, hypocotyl, and cotyledons (stage 3) had an almost 4-fold increase in A (0.089), significantly higher ε (3.49 MPa), and lower Ψπ (−0.88 MPa) and lost turgor at 0.66 RWC. Hypocotyl tissue from germinated somatic embryos lost turgor at 0.74 RWC and had higher ε, A, and solute accumulation than pregerminated tissue. Hypocotyl tissue resisted dehydration more strongly than root tissue, and differences between root and hypocotyl water relation parameters were more pronounced in xygotic than in somatic seedlings. Highest dehydration resistance was in zygotic hypocotyls. The characterization of the water relations of tissue cultures should allow the development of more consistent and reliable desiccation protocols to induce maturation of embryos and produce synchronously germinating seed. PMID:16653121

  9. The study of effect bacteriocin producing Lactoco ccus lactis on Listeria monocytogenes and Bacillus cereus

    Directory of Open Access Journals (Sweden)

    M. Mirhossieni, M.Sc

    2007-01-01

    Full Text Available AbstractBackground and purpose: Dairy products often associated with problems such as short shelf life and poor hygiene control. A novel approach is to utilize bacteriocin or bacteriocin producer strains, to control undesirable micro flora as Listeria monocytogenes and Bacillus cereus in foods. Hence, we studied the effect of nisin like producing Lactococcus lactis against Listeria monocytogenes and Bacillus cereus, in order to compare the isolated strain within different countries.Materials and Methods: In this research we studied the effect of nisin like producing Lactococcus lactis, with producer spot test method. We also used supernatant from 24 h culture of Lactoccus lactis. Moreover, we studied the effect of bacteriocin on Listeria monocytogenes and Bacillus cereus growth curves.Results: The growth of both strains was inhibited by the bacteriocin. Conclusion: According to our results, the bacteriocin could be used in liquid food with bacteriocin added directly or as a starter culture in fermentation. This would inhibit the growth of Listeria monocytogenes; furthermore, Bacillus cereus is used to reduce food poisoning for fermented food products.

  10. The Societal History of Translation in Iran: the Relation between the Cultural History of Iran and its Historical Culture

    Directory of Open Access Journals (Sweden)

    R. Gransayeh

    2015-08-01

    Full Text Available In this article, we declare the preliminary approaches of translation in Iran's history, includes some results of a research about translation trends in Iran’s cultural history, in order to understand any probable relation between the assumed approaches and the socio-cultural changes, in which there is two major historical periods, the ancient Iran and the Islamic cultural period. Then the probable relation between translation approaches and socio-cultural changes has been considered and conceptually used as an index for understanding the social functions of translation in those periods, and also finding out any socio-historical role of translation in the cultural history of Iran. The concept of “translation” in this article has been used in two different, but related conceptual meaning: the first one considers translation as the process of rendering words or texts from one language into another, the second approaches includes any reading and re-reading of a culture by another culture, as an intercultural process. Methodologically, older periods have been studied by pursuing the relations between transitional engravings, scripts and monuments. The newer periods have been studied through historical reports. The final conclusion proposes two different functions of translation; it seems that translation in the ancient period is an inner cultural trait; and in the Islamic era seems to function more as a “necessity for intercultural communications”, and also as a way to provide basic needs for constructing a trans-cultural society.

  11. Enrichment dynamics of Listeria monocytogenes and the associated microbiome from naturally contaminated ice cream linked to a listeriosis outbreak.

    Science.gov (United States)

    Ottesen, Andrea; Ramachandran, Padmini; Reed, Elizabeth; White, James R; Hasan, Nur; Subramanian, Poorani; Ryan, Gina; Jarvis, Karen; Grim, Christopher; Daquiqan, Ninalynn; Hanes, Darcy; Allard, Marc; Colwell, Rita; Brown, Eric; Chen, Yi

    2016-11-16

    Microbiota that co-enrich during efforts to recover pathogens from foodborne outbreaks interfere with efficient detection and recovery. Here, dynamics of co-enriching microbiota during recovery of Listeria monocytogenes from naturally contaminated ice cream samples linked to an outbreak are described for three different initial enrichment formulations used by the Food and Drug Administration (FDA), the International Organization of Standardization (ISO), and the United States Department of Agriculture (USDA). Enrichment cultures were analyzed using DNA extraction and sequencing from samples taken every 4 h throughout 48 h of enrichment. Resphera Insight and CosmosID analysis tools were employed for high-resolution profiling of 16S rRNA amplicons and whole genome shotgun data, respectively. During enrichment, other bacterial taxa were identified, including Anoxybacillus, Geobacillus, Serratia, Pseudomonas, Erwinia, and Streptococcus spp. Surprisingly, incidence of L. monocytogenes was proportionally greater at hour 0 than when tested 4, 8, and 12 h later with all three enrichment schemes. The corresponding increase in Anoxybacillus and Geobacillus spp.indicated these taxa co-enriched in competition with L. monocytogenes during early enrichment hours. L. monocytogenes became dominant after 24 h in all three enrichments. DNA sequences obtained from shotgun metagenomic data of Listeria monocytogenes at 48 h were assembled to produce a consensus draft genome which appeared to have a similar tracking utility to pure culture isolates of L. monocytogenes. All three methods performed equally well for enrichment of Listeria monocytogenes. The observation of potential competitive exclusion of L. mono by Anoxybacillus and Geobacillus in early enrichment hours provided novel information that may be used to further optimize enrichment formulations. Application of Resphera Insight for high-resolution analysis of 16S amplicon sequences accurately identified L. monocytogenes

  12. Performance of stress resistant variants of Listeria monocytogenes in mixed species biofilms with Lactobacillus plantarum.

    Science.gov (United States)

    Metselaar, Karin I; Saá Ibusquiza, Paula; Ortiz Camargo, Angela R; Krieg, Myriam; Zwietering, Marcel H; den Besten, Heidy M W; Abee, Tjakko

    2015-11-20

    Population diversity and the ability to adapt to changing environments allow Listeria monocytogenes to grow and survive under a wide range of environmental conditions. In this study, we aimed to evaluate the performance of a set of acid resistant L. monocytogenes variants in mixed-species biofilms with Lactobacillus plantarum as well as their benzalkonium chloride (BAC) resistance in these biofilms. L. monocytogenes LO28 wild type and acid resistant variants were capable of forming mixed biofilms with L. plantarum at 20°C and 30°C in BHI supplemented with manganese and glucose. Homolactic fermentation of glucose by L. plantarum created an acidic environment with pH values below the growth boundary of L. monocytogenes. Some of the variants were able to withstand the low pH in the mixed biofilms for a longer time than the WT and there were clear differences in survival between the variants which could not be correlated to (lactic) acid resistance alone. Adaptation to mild pH of liquid cultures during growth to stationary phase increased the acid resistance of some variants to a greater extent than of others, indicating differences in adaptive behaviour between the variants. Two variants that showed a high level of acid adaptation when grown in liquid cultures, showed also better performance in mixed species biofilms. There were no clear differences in BAC resistance between the wild type and variants in mixed biofilms. It can be concluded that acid resistant variants of L. monocytogenes show diversity in their adaptation to acidic conditions and their capacity to survive in mixed cultures and biofilms with L. plantarum.

  13. Listeria monocytogenes-carrying consortia in food industry. Composition, subtyping and numerical characterisation of mono-species biofilm dynamics on stainless steel.

    Science.gov (United States)

    Rodríguez-López, Pedro; Saá-Ibusquiza, Paula; Mosquera-Fernández, Maruxa; López-Cabo, Marta

    2015-08-03

    In order to find out how real Listeria monocytogenes-carrying biofilms are in industrial settings, a total of 270 environmental samples belonging to work surfaces from fish (n = 123), meat (n = 75) and dairy industries (n = 72) were analysed in order to detect L. monocytogenes. 12 samples were positive for L. monocytogenes and a total of 18 different species were identified as accompanying microbiota in fish and meat industry. No L. monocytogenes was found in samples from dairy industry. Molecular characterisation combining results of AscI and ApaI macrorestriction PFGE assays yielded 7 different subtypes of L. monocytogenes sharing in 71.43% of cases the same serogroup (1/2a-3a). Results from dynamic numerical characterisation between L. monocytogenes monospecies biofilms on stainless steel (SS) using MATLAB-based tool BIOFILMDIVER demonstrated that except in isolate A1, in which a significant increase in the percentage of covered area (CA), average diffusion distance (ADD) and maximum diffusion distance (MDD) was observed after 120 h of culture, no significant differences were observed in the dynamics of the rest of the L. monocytogenes isolates. Quantitative dual-species biofilm association experiments performed on SS indicated that L. monocytogenes cell counts presented lower values in mixed-species cultures with certain species at 24 and 48 h compared with mono-species culture. However, they remained unaltered after 72 h except when co-cultured with Serratia fonticola which presented differences in all sampling times and was also the dominant species within the dual-species biofilm. When considering frequency of appearance of accompanying species, an ecological distribution was demonstrated as Escherichia coli appeared to be the most abundant in fish industry and Carnobacterium spp. in meat industry.

  14. Rapid detection of Listeria monocytogenes in milk using confocal micro-Raman spectroscopy and chemometric analysis.

    Science.gov (United States)

    Wang, Junping; Xie, Xinfang; Feng, Jinsong; Chen, Jessica C; Du, Xin-jun; Luo, Jiangzhao; Lu, Xiaonan; Wang, Shuo

    2015-07-02

    Listeria monocytogenes is a facultatively anaerobic, Gram-positive, rod-shape foodborne bacterium causing invasive infection, listeriosis, in susceptible populations. Rapid and high-throughput detection of this pathogen in dairy products is critical as milk and other dairy products have been implicated as food vehicles in several outbreaks. Here we evaluated confocal micro-Raman spectroscopy (785 nm laser) coupled with chemometric analysis to distinguish six closely related Listeria species, including L. monocytogenes, in both liquid media and milk. Raman spectra of different Listeria species and other bacteria (i.e., Staphylococcus aureus, Salmonella enterica and Escherichia coli) were collected to create two independent databases for detection in media and milk, respectively. Unsupervised chemometric models including principal component analysis and hierarchical cluster analysis were applied to differentiate L. monocytogenes from Listeria and other bacteria. To further evaluate the performance and reliability of unsupervised chemometric analyses, supervised chemometrics were performed, including two discriminant analyses (DA) and soft independent modeling of class analogies (SIMCA). By analyzing Raman spectra via two DA-based chemometric models, average identification accuracies of 97.78% and 98.33% for L. monocytogenes in media, and 95.28% and 96.11% in milk were obtained, respectively. SIMCA analysis also resulted in satisfied average classification accuracies (over 93% in both media and milk). This Raman spectroscopic-based detection of L. monocytogenes in media and milk can be finished within a few hours and requires no extensive sample preparation. Copyright © 2015 Elsevier B.V. All rights reserved.

  15. Dzhanni Puchcho Activities in the Growth of Cultural Relations between Russia and Italy

    Directory of Open Access Journals (Sweden)

    Т N Kleimenova

    2012-03-01

    Full Text Available The activities of Dzhanni Puchcho, Italian journalist, polyglot and traveler, are considered in the article. He is famous for his investigation of cultural relations between Russia and Italy. He is the author of five books, concerning cultural relations between the two countries, the founder of the Association for Italian and Slavic cultural exchange. He esteems the Russian history and culture and selflessly works for the growth of bilateral relations as a manager and sponsor of various cultural programmes of his Foundation. The main aim of his initiatives is mutual spiritual and cultural exchange and fortifying of the two friendly nations.

  16. Postenrichment population differentials using buffered Listeria enrichment broth: implications of the presence of Listeria innocua on Listeria monocytogenes in food test samples.

    Science.gov (United States)

    Keys, Ashley L; Dailey, Rachel C; Hitchins, Anthony D; Smiley, R Derike

    2013-11-01

    The recovery of low levels of Listeria monocytogenes from foods is complicated by the presence of competing microorganisms. Nonpathogenic species of Listeria pose a particular problem because variation in growth rate during the enrichment step can produce more colonies of these nontarget cells on selective and/or differential media, resulting in a preferential recovery of nonpathogens, especially Listeria innocua. To gauge the extent of this statistical barrier to pathogen recovery, 10 isolates each of L. monocytogenes and L. innocua were propagated together from approximately equal initial levels using the current U. S. Food and Drug Administration's enrichment procedure. In the 100 isolate pairs, an average 1.3-log decrease was found in the 48-h enrichment L. monocytogenes population when L. innocua was present. In 98 of the 100 isolate pairs, L. innocua reached higher levels at 48 h than did L. monocytogenes, with a difference of 0.2 to 2.4 log CFU/ml. The significance of these population differences was apparent by an increase in the difficulty of isolating L. monocytogenes by the streak plating method. L. monocytogenes went completely undetected in 18 of 30 enrichment cultures even after colony isolation was attempted on Oxoid chromogenic Listeria agar. This finding suggests that although both Listeria species were present on the plate, the population differential between them restricted L. monocytogenes to areas of the plate with confluent growth and that isolated individual colonies were only L. innocua.

  17. Postenrichment Population Differentials Using Buffered Listeria Enrichment Broth: Implications of the Presence of Listeria innocua on Listeria monocytogenes in Food Test Samples†

    Science.gov (United States)

    KEYS, ASHLEY L.; DAILEY, RACHEL C.; HITCHINS, ANTHONY D.; SMILEY, R. DERIKE

    2016-01-01

    The recovery of low levels of Listeria monocytogenes from foods is complicated by the presence of competing microorganisms. Nonpathogenic species of Listeria pose a particular problem because variation in growth rate during the enrichment step can produce more colonies of these nontarget cells on selective and/or differential media, resulting in a preferential recovery of nonpathogens, especially Listeria innocua. To gauge the extent of this statistical barrier to pathogen recovery, 10 isolates each of L. monocytogenes and L. innocua were propagated together from approximately equal initial levels using the current U.S. Food and Drug Administration’s enrichment procedure. In the 100 isolate pairs, an average 1.3-log decrease was found in the 48-h enrichment L. monocytogenes population when L. innocua was present. In 98 of the 100 isolate pairs, L. innocua reached higher levels at 48 h than did L. monocytogenes, with a difference of 0.2 to 2.4 log CFU/ml. The significance of these population differences was apparent by an increase in the difficulty of isolating L. monocytogenes by the streak plating method. L. monocytogenes went completely undetected in 18 of 30 enrichment cultures even after colony isolation was attempted on Oxoid chromogenic Listeria agar. This finding suggests that although both Listeria species were present on the plate, the population differential between them restricted L. monocytogenes to areas of the plate with confluent growth and that isolated individual colonies were only L. innocua. PMID:24215687

  18. Implementation of statistical tools to support identification and management of persistent Listeria monocytogenes contamination in smoked fish processing plants.

    Science.gov (United States)

    Malley, Thomas J V; Stasiewicz, Matthew J; Gröhn, Yrjö T; Roof, Sherry; Warchocki, Steven; Nightingale, Kendra; Wiedmann, Martin

    2013-05-01

    Listeria monocytogenes persistence in food processing plants is a key source of postprocessing contamination of ready-to-eat foods. Thus, identification and elimination of sites where L. monocytogenes persists (niches) is critical. Two smoked fish processing plants were used as models to develop and implement environmental sampling plans (i) to identify persistent L. monocytogenes subtypes (EcoRI ribotypes) using two statistical approaches and (ii) to identify and eliminate likely L. monocytogenes niches. The first statistic, a binomial test based on ribotype frequencies, was used to evaluate L. monocytogenes ribotype recurrences relative to reference distributions extracted from a public database; the second statistic, a binomial test based on previous positives, was used to measure ribotype occurrences as a risk factor for subsequent isolation of the same ribotype. Both statistics revealed persistent ribotypes in both plants based on data from the initial 4 months of sampling. The statistic based on ribotype frequencies revealed persistence of particular ribotypes at specific sampling sites. Two adaptive sampling strategies guided plant interventions during the study: sampling multiple times before and during processing and vector swabbing (i.e., sampling of additional sites in different directions [vectors] relative to a given site). Among sites sampled for 12 months, a Poisson model regression revealed borderline significant monthly decreases in L. monocytogenes isolates at both plants (P = 0.026 and 0.076). Our data indicate elimination of an L. monocytogenes niche on a food contact surface; niches on nonfood contact surfaces were not eliminated. Although our data illustrate the challenge of identifying and eliminating L. monocytogenes niches, particularly at nonfood contact sites in small and medium plants, the methods for identification of persistence we describe here should broadly facilitate science-based identification of microbial persistence.

  19. Growth control of Listeria monocytogenes on cold-smoked salmon using a competitive lactic acid bacteria flora.

    Science.gov (United States)

    Nilsson, L; Gram, L; Huss, H H

    1999-04-01

    A Lactobacillus sake strain LKE5 and four strains of Carnobacterium piscicola were evaluated as biopreservation cultures to control the growth of Listeria monocytogenes on vacuum-packed, cold-smoked salmon stored at 5 degrees C. All five strains were antilisterial as live cultures in an agar diffusion assay. Cell-free supernatants of two strains of C. piscicola and L. sake LKE5 were also antilisterial because of the production of bacteriocins. The presence of high cell numbers of strains of C. piscicola had no influence on the sensory quality of cold-smoked salmon stored at 5 degrees C, but L. sake LKE5 caused strong sulfurous off-flavors and was rejected as a culture for biopreservation of cold-smoked salmon. A bacteriocin-producing strain of C. piscicola (A9b) initially caused a 7-day lag phase of L. monocytogenes, followed by a reduction in numbers of L. monocytogenes from 10(3) CFU/ml to below 10 CFU/ml after 32 days of incubation, coinciding with the detection of antilisterial compounds. The presence of a nonbacteriocin-producing strain of C. piscicola (A10a) prevented the growth of L. monocytogenes during the 32-day incubation. The growth of L. monocytogenes was strongly repressed on cold-smoked salmon in the presence of C. piscicola A9b and A 10a, respectively. The initial cell numbers of L. monocytogenes that were found on Oxford plates incubated at 25 degrees C reached low maximum cell counts of 10(4) and 2 x 10(3) after 14 and 20 days of storage in mixed culture with C. piscicola A9b and A10a.

  20. Listeria monocytogenes cross-contamination of cheese: risk throughout the food supply chain.

    Science.gov (United States)

    Sauders, B D; D'Amico, D J

    2016-10-01

    Listeria monocytogenes has been the most common microbial cause of cheese-related recalls in both the United States and Canada in recent years. Since L. monocytogenes is inactivated by pasteurization, the majority of these cases have been linked to environmental and cross-contamination of fresh-soft, soft-ripened, and semi-soft cheeses. Cross-contamination of foods with L. monocytogenes is a continuous risk throughout the food supply chain and presents unique challenges for subsequent illness and outbreak investigations. Reports on outbreaks of listeriosis attributed to cross-contamination downstream from primary processing help highlight the critical role of epidemiological investigation coupled with coordinated molecular subtyping and surveillance in the recognition and investigation of complex foodborne outbreaks. Despite their complexity, environmental sampling throughout the supply chain coupled with improved genotyping approaches and concomitant analysis of foodborne illness epidemiological exposure data are needed to help resolve these and similar cases more rapidly and with greater confidence.

  1. Microbial diversity and structure are drivers of the biological barrier effect against Listeria monocytogenes in soil.

    Science.gov (United States)

    Vivant, Anne-Laure; Garmyn, Dominique; Maron, Pierre-Alain; Nowak, Virginie; Piveteau, Pascal

    2013-01-01

    Understanding the ecology of pathogenic organisms is important in order to monitor their transmission in the environment and the related health hazards. We investigated the relationship between soil microbial diversity and the barrier effect against Listeria monocytogenes invasion. By using a dilution-to-extinction approach, we analysed the consequence of eroding microbial diversity on L. monocytogenes population dynamics under standardised conditions of abiotic parameters and microbial abundance in soil microcosms. We demonstrated that highly diverse soil microbial communities act as a biological barrier against L. monocytogenes invasion and that phylogenetic composition of the community also has to be considered. This suggests that erosion of diversity may have damaging effects regarding circulation of pathogenic microorganisms in the environment.

  2. Desiccation of adhering and biofilm Listeria monocytogenes on stainless steel: Survival and transfer to salmon products

    DEFF Research Database (Denmark)

    Hansen, Lisbeth Truelstrup; Vogel, Birte Fonnesbech

    2011-01-01

    The foodborne bacterial pathogen, Listeria monocytogenes, commonly contaminates foods during processing, where the microorganisms are potentially subjected to low relative humidity (RH) conditions for extended periods of time. The objective of this study was to examine survival during desiccation...... (43% RH and 15°C) of biofilm L. monocytogenes N53-1 cells on stainless steel coupons and to assess subsequent transfer to salmon products. Formation of static biofilm (2days at 100% RH and 15°C) prior to desiccation for 23days significantly (P...

  3. Kinetics of biofilm formation and desiccation survival of Listeria monocytogenes in single and dual species biofilms with Pseudomonas fluorescens, Serratia proteamaculans or Shewanella baltica on food-grade stainless steel surfaces.

    Science.gov (United States)

    Daneshvar Alavi, Hessam Edin; Truelstrup Hansen, Lisbeth

    2013-01-01

    This study investigated the dynamics of static biofilm formation (100% RH, 15 °C, 48-72 h) and desiccation survival (43% RH, 15 °C, 21 days) of Listeria monocytogenes, in dual species biofilms with the common spoilage bacteria, Pseudomonas fluorescens, Serratia proteamaculans and Shewanella baltica, on the surface of food grade stainless steel. The Gram-negative bacteria reduced the maximum biofilm population of L. monocytogenes in dual species biofilms and increased its inactivation during desiccation. However, due to the higher desiccation resistance of Listeria relative to P. fluorescens and S. baltica, the pathogen survived in greater final numbers. In contrast, S. proteamaculans outcompeted the pathogen during the biofilm formation and exhibited similar desiccation survival, causing the N21 days of Serratia to be ca 3 Log10(CFU cm(-2)) greater than that of Listeria in the dual species biofilm. Microscopy revealed biofilm morphologies with variable amounts of exopolymeric substance and the presence of separate microcolonies. Under these simulated food plant conditions, the fate of L. monocytogenes during formation of mixed biofilms and desiccation depended on the implicit characteristics of the co-cultured bacterium.

  4. Health-related quality of life and culture.

    Science.gov (United States)

    Kagawa-Singer, Marjorie; Padilla, Geraldine V; Ashing-Giwa, Kimlin

    2010-02-01

    To clarify the relationship between quality of life (QOL) and culture. Journal articles, proceedings, and clinical experience. QOL is a subjective, multidimensional experience of well-being that is culturally constructed as individuals seek safety and security, a sense of integrity and meaning in life, and a sense of belonging in one's social network. In a society where health disparities between diverse groups are known to exist, it is incumbent upon nurses to consider the impact of ethnicity/culture on the health care they deliver and on the QOL of their patients. Copyright (c) 2010 Elsevier Inc. All rights reserved.

  5. Control of Listeria monocytogenes on cold-smoked salmon using chitosan-based antimicrobial coatings and films.

    Science.gov (United States)

    Jiang, Zheng; Neetoo, Hudaa; Chen, Haiqiang

    2011-01-01

    The relatively high incidence of Listeria monocytogenes in ready-to-eat (RTE) products such as cold-smoked salmon is of serious concern. The objective of this study was to evaluate the efficacy of chitosan-based edible coatings and films incorporating 3 generally recognized as safe (GRAS) antimicrobials, sodium lactate (SL), sodium diacetate (SD), and potassium sorbate (PS), against L. monocytogenes on cold-smoked salmon. Salmon samples were surface-inoculated with a 5-strain cocktail of Listeria monocytogenes to a final concentration of 4.4 log CFU/cm(2) and then either coated with chitosan solutions or wrapped with chitosan films with or without the 3 antimicrobials. The samples were then vacuum packaged and stored at 4 °C for 30 d. The chitosan coatings with or without the antimicrobials consistently showed higher efficacy against L. monocytogenes than chitosan films having the same compositions. The most effective film treatments, chitosan films containing 1.2% SL/0.25% SD or 2.4% SL, achieved ≥ 1.3 log reductions of L. monocytogenes during the 30 d of refrigerated storage, while the most effective coating treatments, chitosan coatings containing 1.2% SL/0.25% SD or 0.15% PS/0.125% SD, achieved ≥ 2.8 log reductions. Practical Application: This study shows that chitosan-based edible coatings and films hold promise and can potentially assist fishery industries in their efforts to control L. monocytogenes.

  6. Cultural dimensions in population related issues in Nigeria ...

    African Journals Online (AJOL)

    Log in or Register to get access to full text downloads. ... It is patterned, learned, shared and adaptive and transmittable from one generation to the other ... Cultural practices, norms, values, beliefs and religion negatively influence procreation, ...

  7. Detection of Listeria monocytogenes in cheese with the magnetic immuno-polymerase chain reaction assay.

    Science.gov (United States)

    Fluit, A C; Torensma, R; Visser, M J; Aarsman, C J; Poppelier, M J; Keller, B H; Klapwijk, P; Verhoef, J

    1993-05-01

    A new detection system, the magnetic immuno-polymerase chain reaction (PCR) assay (MIPA) has been developed to detect Listeria monocytogenes in food. This method separates Listeria cells from PCR-inhibitory factors present in enrichment broths containing food samples by using magnetic beads coated with specific monoclonal antibodies (MAbs). The separated bacteria were lysed, and the supernatant containing the bacterial DNA was subjected to the PCR. Detection of L. monocytogenes in three naturally contaminated cheese samples with two different MAbs and PCR primers specific for the gene encoding the delayed-hypersensitivity factor showed that with MAb 55 all three samples were positive whereas with MAb A two samples were positive. A further improvement of the method was obtained by using a PCR step based on the listeriolysin O gene. A MIPA employing MAb 55 and the listeriolysin O gene primer set detected L. monocytogenes after 24 h of culture in Listeria Enrichment Broth samples from Port Salut artificially contaminated with 40 CFU/25 g. We could detect 1 CFU of L. monocytogenes per g of cheese after a second enrichment for 24 h in Fraser broth. The analysis time including both enrichments is approximately 55 h.

  8. The relation between culture and Vietnamese entrepreneurship in Norway

    OpenAIRE

    NHAT, Le Minh

    2007-01-01

    This study presents an exploratory and quantitative investigation of Norwegian Vietnamese in Norway to explain the Entrepreneurial Orientation and then Entrepreneurship of Vietnamese community in Norway with the emphasis on culture respect. A survey of 190 Norwegian students and 34 Norwegian Vietnamese was conducted online. A comparison between Vietnamese Norwegian and non-immigrant Norwegians was done with reference to the results of previous studies. And from that, the cultur...

  9. Identification of Conserved and Species-Specific Functions of the Listeria monocytogenes PrsA2 Secretion Chaperone

    Science.gov (United States)

    Cahoon, Laty A.

    2015-01-01

    The Gram-positive bacterium Listeria monocytogenes is a facultative intracellular pathogen that relies on the regulated secretion and activity of a variety of proteins that sustain life within diverse environments. PrsA2 has recently been identified as a secreted peptidyl-prolyl cis/trans isomerase and chaperone that is dispensable for bacterial growth in broth culture but essential for L. monocytogenes virulence. Following host infection, PrsA2 contributes to the proper folding and activity of secreted proteins that are required for bacterial replication within the host cytosol and for bacterial spread to adjacent cells. PrsA2 is one member of a family of Gram-positive secretion chaperones that appear to play important roles in bacterial physiology; however, it is not known how these proteins recognize their substrate proteins or the degree to which their function is conserved across diverse Gram-positive species. We therefore examined PrsA proteins encoded by a variety of Gram-positive bacteria for functional complementation of L. monocytogenes mutants lacking prsA2. PrsA homologues encoded by Bacillus subtilis, Streptococcus pyogenes, Streptococcus pneumoniae, Streptococcus mutans, Staphylococcus aureus, and Lactococcus lactis were examined for functional complementation of a variety of L. monocytogenes PrsA2-associated phenotypes central to L. monocytogenes pathogenesis and bacterial cell physiology. Our results indicate that while selected aspects of PrsA2 function are broadly conserved among diverse Gram-positive bacteria, PrsA2 exhibits unique specificity for L. monocytogenes target proteins required for pathogenesis. The L. monocytogenes PrsA2 chaperone thus appears evolutionarily optimized for virulence factor secretion within the host cell cytosol while still maintaining aspects of activity relevant to more general features of Gram-positive protein translocation. PMID:26216425

  10. Listeria monocytogenes survival in refrigerator dill pickles.

    Science.gov (United States)

    Kim, Jin Kyung; D'Sa, Elaine M; Harrison, Mark A; Harrison, Judy A; Andress, Elizabeth L

    2005-11-01

    Listeria monocytogenes can survive and grow in refrigerated foods with pH values of approximately 4.0 to 5.0 and salt concentrations of 3 to 4%. Home-fermented refrigerator dill pickles fit this description. Contamination of this product with L. monocytogenes could cause serious problems because these items are not heated prior to consumption. L. monocytogenes survival and growth patterns were investigated in refrigerator dill pickles at 1.3, 3.8, and 7.6% salt concentrations. Pickling cucumbers were dipped into an inoculum of L. monocytogenes, brine mixtures were added, and cucumbers were held at room temperature for 1 week and then refrigerated for up to 3 months. The pH, NaCl percentage, titratable acidity percentage, and total populations of Listeria and aerobic, psychrotrophic, and lactic acid bacteria were measured at the addition of brine, after 2, 4, and 7 days of storage at room temperature, and then weekly during refrigerated storage. The initial Listeria population was 5.4 to 5.6 log CFU/cm2 on cucumber surfaces and 3.9 to 4.6 log CFU/g internally. There was an approximate 0.3- to 1-log increase during room temperature fermentation followed by a population decline during refrigerator storage, with a greater decrease in the brines with the highest NaCl concentration. Up to 49 days, the internal tissue of pickles with 1.3, 3.8, or 7.6% salt concentrations were presumptively positive for L. monocytogenes by the enrichment method, and at 91 days the surfaces of such pickles were still positive for L. monocytogenes. Populations of total aerobes and lactic acid bacteria increased during room temperature storage and decreased gradually during refrigerated storage.

  11. Inhibition of Listeria monocytogenes by propionic acid-based ingredients in cured deli-style Turkey.

    Science.gov (United States)

    Glass, Kathleen A; McDonnell, Lindsey M; Von Tayson, Roxanne; Wanless, Brandon; Badvela, Mani

    2013-12-01

    Listeria monocytogenes growth can be controlled on ready-to-eat meats through the incorporation of antimicrobial ingredients into the formulation or by postlethality kill steps. However, alternate approaches are needed to provide options that reduce sodium content but maintain protection against pathogen growth in meats after slicing. The objective of this study was to determine the inhibition of L. monocytogenes by propionic acid-based ingredients in high-moisture, cured turkey stored at 4 or 7°C. Six formulations of sliced, cured (120 ppm of NaNO2 ), deli-style turkey were tested, including control without antimicrobials, 3.2% lactate-diacetate blend (LD), 0.4% of a liquid propionate-benzoate-containing ingredient, or 0.3, 0.4, and 0.5% of a liquid propionate-containing ingredient. Products were inoculated with 5 log CFU L. monocytogenes per 100-g package (3 log CFU/ml rinsate), vacuum-sealed, and stored at 4 or 7°C for up to 12 weeks; and populations were enumerated by plating on modified Oxford agar. As expected, the control without antimicrobials supported rapid growth, with >2 log average per ml rinsate increase within 4 weeks of storage at 4°C, whereas growth was observed at 6 weeks for the LD treatment. For both replicate trials, all treatments that contained liquid propionate or propionate-benzoate limited L. monocytogenes growth to an increase of 1-log increase) was observed in individual samples for all propionate-containing treatments at weeks 10, 11, and 12. As expected, L. monocytogenes grew more rapidly when products were stored at 7°C, but trends in relative inhibition were similar to those observed at 4°C. These results verify that propionate-based ingredients inhibit growth of L. monocytogenes on sliced, high-moisture, cured turkey and can be considered as an alternative to reduce sodium-based salts while maintaining food safety.

  12. DEVELOPMENT OF SERS SPECTROSCOPY FOR ROUTINE AND RAPID IDENTIFICATION OF ESCHERICHIA COLI AND LISTERIA MONOCYTOGENES ON SILVER COLLOIDAL NANOPARTICLES

    Science.gov (United States)

    SERS spectra were collected to explore its potential for rapid and routine identification of E. coli and L. monocytogenes cultures. Ratios of SERS peaks from K3PO4 were used to evaluate the reproducibility, stability, and binding effectiveness of citrate-reduced silver colloids over batch and storag...

  13. Two-dimensional fluorescence difference gel electrophoresis analysis of Listeria monocytogenes submitted to a redox shock.

    Science.gov (United States)

    Ignatova, Maria; Guével, Blandine; Com, Emmanuelle; Haddad, Nabila; Rossero, Albert; Bogard, Philippe; Prévost, Hervé; Guillou, Sandrine

    2013-02-21

    The influence of redox alteration on the growth and proteomic pattern of Listeria monocytogenes was investigated. A redox shock was induced in cultures by addition of 3mM ferricyanide (FeCN) and 6mM dithiothreitol (DTT) to increase or to decrease respectively the redox potential naturally occurring at the beginning of growth. In both conditions, the reducing and oxidizing redox shock had a strong influence, decreasing the maximum growth rate by half compared to a control culture. The proteomic analysis of L. monocytogenes performed by two-dimensional difference gel electrophoresis (2D-DIGE) exhibited twenty-three proteins differentially expressed (P<0.05), among these, many were oxidoreductases, and proteins involved in cellular metabolism (glycolysis, protein synthesis), detoxification (kat) or adhesion (Lmo1634).

  14. Characterization of virulent Listeria monocytogenes isolates recovered from ready-to-eat meat products and consumers in Cairo, Egypt

    Directory of Open Access Journals (Sweden)

    Maysa A. I. Awadallah

    2014-10-01

    Full Text Available Aim: This study aimed to investigate the occurrence of some virulence genes distributed in Listeria monocytogenes isolated from ready-to-eat (RTE meat products and consumers in Cairo province, Egypt. Materials and Methods: A total of 120 beef luncheon, chicken luncheon and frankfurter beef (40 samples, each were collected from 10 different local shops situated in Al-salam city, Cairo province, Egypt. Stool samples were collected from 40 people who had the habit of consuming RTE meat. The suspected L. monocytogenes isolates were subjected to a multiplex polymerase chain reaction (PCR for rapid speciation and virulence determination using primers specific for inIA, inIC, and inIJ genes. Results: Culture examination of all samples on Oxford media revealed presence of colonies characteristic to L. monocytogenes in 6 beef luncheon (15%, 4 chicken luncheon (10%, 1 frankfurter beef (2.5% and 1 human stool (2.5% samples. Species identity of L. monocytogenes was verified through the amplification of a 800 bp fragment with inIA primers in 2 out of 6 culture isolates from beef luncheon (5%, and 1 out 4 culture isolates from chicken luncheon (2.5% samples. Statistical analysis revealed no significant difference between the occurrence of L. monocytogenes in different food samples examined (p>0.05. The virulence of these strains was ascertained by the presence of 517 bp and 238 bp fragments of inIC and inIJ genes, respectively in the isolates that contained the 800 bp fragment. The culture isolates obtained from one frankfurter beef sample, and one human stool sample were found negative by multiplex PCR for the presence of L. monocytogenes and its virulence specific genes. Conclusion: It could be concluded that L. monocytogenes are circulating in beef and chicken luncheon sold in Cairo, Egypt. Multiplex PCR is reliable for confirmation of L. monocytogenes. This study suggests the implementation of hygienic measures at all levels from production to consumption

  15. Growth control of Listeria monocytogenes on cold-smoked salmon using a competitive lactic acid bacteria flora

    DEFF Research Database (Denmark)

    Nilsson, Lilian; Gram, Lone; Huss, Hans Henrik

    1999-01-01

    diffusion assay. Cell-free supernatants of two strains of C. piscicola and L. sake LKE5 were also antilisterial because of the production of bacteriocins. The presence of high cell numbers of strains of C. piscicola had no influence on the sensory quality of cold-smoked salmon stored at 5 degrees C, but L....... sake LKE5 caused strong sulfurous off-flavors and was rejected as a culture for biopreservation of cold-smoked salmon. A bacteriocin-producing strain of C. piscicola (A9b) initially caused a 7-day lag phase of L. monocytogenes, followed by a reduction in numbers of L. monocytogenes from 10(3) CFU...

  16. Do Finns Date? Cultural Interpretations of Romantic Relating

    Directory of Open Access Journals (Sweden)

    Saila Poutiainen

    2009-12-01

    Full Text Available Dating, the stage in American romantic relationships, is a popular theme in interpersonal communication research. This article claims that dating is a cultural construct and concept. The claim is supported by two means: (1 by examining the perceptions of relationships, communication, and personhood that are embedded in American women‟s interviews, and (2 by comparing these perceptions with Finnish women‟s interviews about relationship initiation. The cultural meanings of dating should be acknowledged when making generalizations and building theoretical constructs on romantic relationships, as well as in applying American research results in describing Finnish romantic relationships.

  17. Comparative Efficacies of Antibiotics in a Rat Model of Meningoencephalitis Due to Listeria monocytogenes

    OpenAIRE

    Michelet, Christian; Leib, Stephen L.; Bentue-Ferrer, Daniele; Täuber, Martin G.

    1999-01-01

    The antibacterial activities of amoxicillin-gentamicin, trovafloxacin, trimethoprim-sulfamethoxazole (TMP-SMX) and the combination of trovafloxacin with TMP-SMX were compared in a model of meningoencephalitis due to Listeria monocytogenes in infant rats. At 22 h after intracisternal infection, the cerebrospinal fluid was cultured to document meningitis, and the treatment was started. Treatment was instituted for 48 h, and efficacy was evaluated 24 h after administration of the last dose. All ...

  18. Comparative Study of the Effects of Citral on the Growth and Injury of Listeria innocua and Listeria monocytogenes Cells

    Science.gov (United States)

    Silva-Angulo, Angela B.; Zanini, Surama F.; Rosenthal, Amauri; Rodrigo, Dolores; Klein, Günter; Martínez, Antonio

    2015-01-01

    This study investigates the effect of citral on growth and on the occurrence of sublethal damage in Listeria innocua Serovar 6a (CECT 910) and Listeria monocytogenes Serovar 4b (CECT 4032) cells that were exposed to citral as a natural antimicrobial agent. Two initial inoculum concentrations were considered in this investigation: 102 and 106 cfu/mL. Citral exhibited antilisterial activity against L. innocua and L. monocytogenes, and the observed effects were dependent on the concentration of citral present in the culture medium (0, 0.150 and 0.250 μL/mL) (p ≤ 0.05). L. innocua had a shorter lag phase than L. monocytogenes, and the two species had nearly identical maximum specific growth rates. These results indicate that L. innocua could be used as surrogate for L. monocytogenes when testing the effects of this antimicrobial. Significant differences in the lag phase and growth rate were observed between the small and large inoculum concentration (p ≤ 0.05). Citral-treated L. innocua and L. monocytogenes that were recovered on selective medium (i.e., TSA-YE-SC) had a shorter lag phase and a higher maximum specific growth rate than cells that were recovered on non-selective medium (i.e., TSA-YE) (p ≤ 0.05). This result suggests that damage occurs at sublethal concentrations of citral. PMID:25643164

  19. Tn6188 - a novel transposon in Listeria monocytogenes responsible for tolerance to benzalkonium chloride.

    Directory of Open Access Journals (Sweden)

    Anneliese Müller

    Full Text Available Controlling the food-borne pathogen Listeria (L. monocytogenes is of great importance from a food safety perspective, and thus for human health. The consequences of failures in this regard have been exemplified by recent large listeriosis outbreaks in the USA and Europe. It is thus particularly notable that tolerance to quaternary ammonium compounds such as benzalkonium chloride (BC has been observed in many L. monocytogenes strains. However, the molecular determinants and mechanisms of BC tolerance of L. monocytogenes are still largely unknown. Here we describe Tn6188, a novel transposon in L. monocytogenes conferring tolerance to BC. Tn6188 is related to Tn554 from Staphylococcus (S. aureus and other Tn554-like transposons such as Tn558, Tn559 and Tn5406 found in various Firmicutes. Tn6188 comprises 5117 bp, is integrated chromosomally within the radC gene and consists of three transposase genes (tnpABC as well as genes encoding a putative transcriptional regulator and QacH, a small multidrug resistance protein family (SMR transporter putatively associated with export of BC that shows high amino acid identity to Smr/QacC from S. aureus and to EmrE from Escherichia coli. We screened 91 L. monocytogenes strains for the presence of Tn6188 by PCR and found Tn6188 in 10 of the analyzed strains. These isolates were from food and food processing environments and predominantly from serovar 1/2a. L. monocytogenes strains harboring Tn6188 had significantly higher BC minimum inhibitory concentrations (MICs (28.5 ± 4.7 mg/l than strains without Tn6188 (14 ± 3.2 mg/l. Using quantitative reverse transcriptase PCR we could show a significant increase in qacH expression in the presence of BC. QacH deletion mutants were generated in two L. monocytogenes strains and growth analysis revealed that ΔqacH strains had lower BC MICs than wildtype strains. In conclusion, our results provide evidence that Tn6188 is responsible for BC tolerance in various L

  20. Tn6188 - a novel transposon in Listeria monocytogenes responsible for tolerance to benzalkonium chloride.

    Science.gov (United States)

    Müller, Anneliese; Rychli, Kathrin; Muhterem-Uyar, Meryem; Zaiser, Andreas; Stessl, Beatrix; Guinane, Caitriona M; Cotter, Paul D; Wagner, Martin; Schmitz-Esser, Stephan

    2013-01-01

    Controlling the food-borne pathogen Listeria (L.) monocytogenes is of great importance from a food safety perspective, and thus for human health. The consequences of failures in this regard have been exemplified by recent large listeriosis outbreaks in the USA and Europe. It is thus particularly notable that tolerance to quaternary ammonium compounds such as benzalkonium chloride (BC) has been observed in many L. monocytogenes strains. However, the molecular determinants and mechanisms of BC tolerance of L. monocytogenes are still largely unknown. Here we describe Tn6188, a novel transposon in L. monocytogenes conferring tolerance to BC. Tn6188 is related to Tn554 from Staphylococcus (S.) aureus and other Tn554-like transposons such as Tn558, Tn559 and Tn5406 found in various Firmicutes. Tn6188 comprises 5117 bp, is integrated chromosomally within the radC gene and consists of three transposase genes (tnpABC) as well as genes encoding a putative transcriptional regulator and QacH, a small multidrug resistance protein family (SMR) transporter putatively associated with export of BC that shows high amino acid identity to Smr/QacC from S. aureus and to EmrE from Escherichia coli. We screened 91 L. monocytogenes strains for the presence of Tn6188 by PCR and found Tn6188 in 10 of the analyzed strains. These isolates were from food and food processing environments and predominantly from serovar 1/2a. L. monocytogenes strains harboring Tn6188 had significantly higher BC minimum inhibitory concentrations (MICs) (28.5 ± 4.7 mg/l) than strains without Tn6188 (14 ± 3.2 mg/l). Using quantitative reverse transcriptase PCR we could show a significant increase in qacH expression in the presence of BC. QacH deletion mutants were generated in two L. monocytogenes strains and growth analysis revealed that ΔqacH strains had lower BC MICs than wildtype strains. In conclusion, our results provide evidence that Tn6188 is responsible for BC tolerance in various L. monocytogenes

  1. The quorum sensing luxS gene is induced in Lactobacillus acidophilus NCFM in response to Listeria monocytogenes

    DEFF Research Database (Denmark)

    Moslehi Jenabian, Saloomeh; Vogensen, Finn Kvist; Jespersen, Lene

    2011-01-01

    The luxS gene involved in quorum sensing has been shown to control different behaviour of probiotic lactobacilli. In this study we investigated if luxS in Lactobacillus acidophilus NCFM was up-regulated in response to Listeria monocytogenes EGD-e. The two bacterial strains were grown in mono......- and co-culture and the growth of both bacteria and the transcriptional level of luxS in L. acidophilus cells were monitored. Contrary to L. acidophilus, the growth of L. monocytogenes was significantly affected by co-cultivation. Transcriptional analysis showed that the expression of luxS increased...... during exponential growth in L. acidophilus cells with the highest level in the late-exponential growth phase, decreasing in the stationary phase. Following co-cultivation with L. monocytogenes, the transcriptional level of luxS increased significantly in mid-exponential growing cells of L. acidophilus...

  2. Risk of Listeria monocytogenes contamination of raw ready-to-eat seafood products available at retail outlets in Japan.

    Science.gov (United States)

    Miya, Satoko; Takahashi, Hajime; Ishikawa, Tatsuya; Fujii, Tateo; Kimura, Bon

    2010-05-01

    Examination of Listeria monocytogenes prevalence among ready-to-eat foods in Japan revealed frequent (5.7 to 12.1%) contamination of minced tuna and fish roe products, and the isolates had the same virulence levels as clinical isolates in terms of invasion efficiency and infectivity in cell cultures and a murine infection model, respectively. Premature stop codons in inlA were infrequent (1 out of 39 isolates). Cell numbers of L. monocytogenes in minced tuna and salmon roe increased rapidly under inappropriate storage temperatures (from a most probable number [MPN] of 10(0) to 10(1)/g to an MPN of 10(3) to 10(4)/g over the course of 2 days at 10 degrees C). Thus, regulatory guidelines are needed for acceptable levels of L. monocytogenes in these foods.

  3. Risk of Listeria monocytogenes Contamination of Raw Ready-To-Eat Seafood Products Available at Retail Outlets in Japan▿

    Science.gov (United States)

    Miya, Satoko; Takahashi, Hajime; Ishikawa, Tatsuya; Fujii, Tateo; Kimura, Bon

    2010-01-01

    Examination of Listeria monocytogenes prevalence among ready-to-eat foods in Japan revealed frequent (5.7 to 12.1%) contamination of minced tuna and fish roe products, and the isolates had the same virulence levels as clinical isolates in terms of invasion efficiency and infectivity in cell cultures and a murine infection model, respectively. Premature stop codons in inlA were infrequent (1 out of 39 isolates). Cell numbers of L. monocytogenes in minced tuna and salmon roe increased rapidly under inappropriate storage temperatures (from a most probable number [MPN] of 100 to 101/g to an MPN of 103 to 104/g over the course of 2 days at 10°C). Thus, regulatory guidelines are needed for acceptable levels of L. monocytogenes in these foods. PMID:20348310

  4. Islam, Local Culture, and Japan-Indonesian Relations

    Directory of Open Access Journals (Sweden)

    Muhammad Nida' Fadlan

    2014-11-01

    Full Text Available Local culture is undoubtedly a very important aspect to every nation. Having an awareness of local culture, especially among the youth, plays a great role in shaping a society and a state. For one to have an appreciation of another country’s culture, however, can be an important starting point in breaking down barriers of misperceptions or misunderstandings, and in helping to build global relationships. In support of this idea, the Japanese Embassy in Jakarta this year offered a special program called the Japan-East Asia Network of Exchange for Students and Youth (JENESYS to strengthen the awareness of Japanese local culture among Muslim youth in Indonesia. In early 2014, the Japanese government, working in cooperation with PPIM (Center for the Study of Islam and Society at UIN Syarif Hidayatullah in Jakarta, invited a number of university students to visit Japan.Copyright (c 2014 by SDI. All right reserved.DOI: 10.15408/sdi.v21i2.1044

  5. The Relation of Culture and Musical Play: A Literature Review

    Science.gov (United States)

    Soccio, Alison

    2013-01-01

    Children express the cultures they bring into the classrooms through musical play. When children are left to their own devices they dance, create songs, and play instruments. Campbell emphasizes how children are immersed in musical activity throughout the entirety of their day; they use music for self-expression, to interact with others, and to…

  6. The Relation of Culture and Musical Play: A Literature Review

    Science.gov (United States)

    Soccio, Alison

    2013-01-01

    Children express the cultures they bring into the classrooms through musical play. When children are left to their own devices they dance, create songs, and play instruments. Campbell emphasizes how children are immersed in musical activity throughout the entirety of their day; they use music for self-expression, to interact with others, and to…

  7. Genotypes Associated with Listeria monocytogenes Isolates Displaying Impaired or Enhanced Tolerances to Cold, Salt, Acid, or Desiccation Stress

    Science.gov (United States)

    Hingston, Patricia; Chen, Jessica; Dhillon, Bhavjinder K.; Laing, Chad; Bertelli, Claire; Gannon, Victor; Tasara, Taurai; Allen, Kevin; Brinkman, Fiona S. L.; Truelstrup Hansen, Lisbeth; Wang, Siyun

    2017-01-01

    The human pathogen Listeria monocytogenes is a large concern in the food industry where its continuous detection in food products has caused a string of recalls in North America and Europe. Most recognized for its ability to grow in foods during refrigerated storage, L. monocytogenes can also tolerate several other food-related stresses with some strains possessing higher levels of tolerances than others. The objective of this study was to use a combination of phenotypic analyses and whole genome sequencing to elucidate potential relationships between L. monocytogenes genotypes and food-related stress tolerance phenotypes. To accomplish this, 166 L. monocytogenes isolates were sequenced and evaluated for their ability to grow in cold (4°C), salt (6% NaCl, 25°C), and acid (pH 5, 25°C) stress conditions as well as survive desiccation (33% RH, 20°C). The results revealed that the stress tolerance of L. monocytogenes is associated with serotype, clonal complex (CC), full length inlA profiles, and the presence of a plasmid which was identified in 55% of isolates. Isolates with full length inlA exhibited significantly (p elements. A whole genome single-nucleotide-variants phylogeny revealed sporadic distribution of tolerant isolates and closely related sensitive and tolerant isolates, highlighting that minor genetic differences can influence the stress tolerance of L. monocytogenes. Specifically, a number of cold and desiccation sensitive isolates contained PMSCs in σB regulator genes (rsbS, rsbU, rsbV). Collectively, the results suggest that knowing the sequence type of an isolate in addition to screening for the presence of full-length inlA and a plasmid, could help food processors and food agency investigators determine why certain isolates might be persisting in a food processing environment. Additionally, increased sequencing of L. monocytogenes isolates in combination with stress tolerance profiling, will enhance the ability to identify genetic elements

  8. Listeria monocytogenes meningoencephalitis: molecular methods for diagnosis and for monitoring the response to chemotherapy

    Directory of Open Access Journals (Sweden)

    Andrea Piana

    2005-03-01

    Full Text Available

    Background. Listeria monocytogenes is one of the most important human foodborne pathogens; it may be responsible for several disorders, like meningoencephalitis. Listerial isolation in cerebrospinal fluid (CSF is often difficult using microbiologic traditional assays. The aim of this study is to evaluate the reliability of molecular techniques as an alternative tool in order to identify Listeria monocytogenes meningitis and in particular, to evaluate a real-time PCR and a conventional PCR for the target hlyA gene.

    Methods. In 2000-2004, 145 patients, without T-cell immunodeficiency, affected by meningoencephalitis of unknown origin were admitted to the Infectious Diseases Institute of Sassari, Italy; a lumbar puncture was performed at the time of hospital admission. Two different PCR techniques, i.e. RT-PCR and a conventional PCR, were performed in order to detect CNS listerial infection, in conjunction with traditional microbiologic assays.

    Results. We identified fourteen patients affected by listerial meningitis using RT-PCR and conventional PCR. All but one of the CSF cultures were negative for L. monocytogenes. Molecular techniques were performed on the CSF samples collected during follow-up revealing that signal intensity decreased by 40%, 80% and 100% at day 15, 30 and 55 respectively, from the start of antibiotic treatment.

    Conclusions. Considering the seriousness of CNS involvement caused by L. monocytogenes infection, prompt diagnosis is necessary in order to rapidly start specific treatment. Conventional PCR and RT-PCR are rapid assays for L. monocytogenes diagnosis and they might be useful for monitoring the efficacy of antibiotic therapy

  9. Fluorescence amplified fragment length polymorphism compared to pulsed field gel electrophoresis for Listeria monocytogenes subtyping

    Directory of Open Access Journals (Sweden)

    Roussel Sophie

    2013-01-01

    Full Text Available Abstract Background Listeriosis is a severe infection which mainly affects pregnant women, neonates and immuno-compromised adults. ANSES’s Laboratory for Food safety has been the European Union Reference Laboratory (EURL for L. monocytogenes in the food chain since 2006. Pulsed Field Gel Electrophoresis (PFGE is routinely used in the EURL for the surveillance of L. monocytogenes isolated from foods, animals and the environment. One of the main EURL activities is to evaluate alternative molecular subtyping methods to PFGE, and integrate their use within the National Reference Laboratories (NRL network. Since 2008, the United Kingdom (UK-NRL for L. monocytogenes at the Health Protection Agency (HPA, London, has used fluorescent Amplified Fragment Length Polymorphism (fAFLP for the routine surveillance of L. monocytogenes isolated from human clinical cases, food and food processing environments in the UK. This study compares fAFLP with PFGE for subtyping L. monocytogenes. Results A panel of 109 L. monocytogenes isolates from either human cases of listeriosis, foods, food processing environments and animals were used for the comparative evaluation. Among these, 2 strains were tested from duplicate culture by both methods. The panel also included field isolates, isolates associated with outbreaks or sporadic cases and reference strains. The two strains tested in duplicate displayed the same fAFLP and PFGE types. Strains known to be epidemiologically associated with one another were found to have unique PFGE and fAFLP types. FAFLP and PFGE divided the strains into 76 and 82 distinct profiles, or types, respectively. The discriminatory index calculated was 0.993 and 0.996 for fAFLP and PFGE, respectively. Conclusions The discriminatory ability of fAFLP was similar to that of PFGE for the subtyping of L. monocytogenes isolates. As a less labour intensive technique fAFLP may be a better method to use than PFGE in investigating outbreaks of human

  10. Listeria monocytogenes en alimentos: ¿son todos los aislamientos igual de virulentos? Foodborne Listeria monocytogenes: are all the isolates equally virulent?

    Directory of Open Access Journals (Sweden)

    V. López

    2006-12-01

    Full Text Available Listeria monocytogenes es un patógeno humano que se transmite a través de los alimentos y que causa infecciones graves, con una alta tasa de mortalidad. A pesar de la ubicuidad del microorganismo, la tasa real de la enfermedad es bastante baja y se asocia casi siempre a condiciones predisponentes. Tradicionalmente se consideraba que los aislamientos presentes en los alimentos y en el ambiente tenían la misma capacidad patogénica que los aislamientos de origen clínico. Pero el análisis de mutaciones en los genes de determinados factores de virulencia (internalina, hemolisina, fosfolipasas, proteína de superficie ActA y proteína reguladora PrfA, los estudios cuantitativos realizados con cultivos celulares y la genética de poblaciones, están replanteando la discusión sobre la variabilidad de la virulencia de L. monocytogenes. A pesar de todos estos avances, no existe un único marcador que permita comprobar la virulencia de los aislamientos naturales de esta especie. Probablemente en el futuro, la combinación de diferentes marcadores moleculares permitirá detectar los alimentos contaminados sólo por los clones virulentos de L. monocytogenes, con lo que se mejorará la prevención de la listeriosis humana transmitida por alimentos.Listeria monocytogenes is a foodborne human pathogen responsible for invasive infections presenting overall a high mortality. Despite the ubiquity of the microorganism, the actual disease rate is quite low and the disease is most often associated with an underlying predisposition. Foodborne and environmental isolates were traditionally considered of similar pathogenicity compared to clinical isolates. But the analysis of mutations in the genes encoding specific virulence factors (internalin, hemolysin, phospholipases, surface protein ActA and regulator protein PrfA, quantitative studies with cell cultures and population genetics have raised considerable concerns about virulence differences among L

  11. Glycine betaine improves Listeria monocytogenes tolerance to desiccation on parsley leaves independent of the osmolyte transporters BetL, Gbu and OpuC.

    Science.gov (United States)

    Dreux, N; Albagnac, C; Sleator, R D; Hill, C; Carlin, F; Morris, C E; Nguyen-the, C

    2008-04-01

    To investigate the effect of glycine betaine (GB) on the survival of Listeria monocytogenes on leaf surfaces under low relative humidity (RH). The addition of GB (> or = 25 mmol l(-1)) improved the survival of L. monocytogenes under low RH on parsley leaves, thus suggesting that GB can improve the tolerance of L. monocytogenes to desiccation. Ten times less GB was needed to improve L. monocytogenes survival under low RH on nonbiological surfaces compared with parsley leaves, suggesting that, on the leaf surface, L. monocytogenes may have to compete for the available GB with autochthonous bacteria and/or the plant itself. Wild type and mutants carrying deletions in the three GB uptake systems, BetL, Gbu and OpuC, behaved similarly with and without added GB on parsley leaves (P > 0.05). In addition, preaccumulation of GB, triggered by osmotic stress prior to inoculation, failed to improve survival under low RH compared with osmotic stress without GB accumulation. Exogenous GB had a protective effect on L. monocytogenes cells from desiccation during survival on parsley leaves. This effect was independent of intracellular GB accumulation by the known uptake systems. Presence of GB could improve the survival of L. monocytogenes to desiccation on leaf surfaces and nonbiological surfaces.

  12. Control options for Listeria monocytogenes in seafoods

    DEFF Research Database (Denmark)

    Huss, Hans Henrik; Jørgensen, Lasse Vigel; Vogel, Birte Fonnesbech

    2000-01-01

    At least three outbreaks of listeriosis associated with seafood have been reported. Listeria monocytogenes is widely distributed in the general environment including fresh water, coastal water and live fish from these areas. Contamination or recontamination of seafood may also take place during...

  13. Listeria monocytogenes : nog steeds een probleem?

    NARCIS (Netherlands)

    Beumer, R.R.

    2011-01-01

    Listeria monocytogenes is net als vele andere bacteriële voedselpathogenen al tientallen jaren bekend. De meeste grondstoffen voor voedingsmiddelen komen uit de akker- en tuinbouw, de veehouderij en de visserij. Besmetting vindt daar plaats met micro-organismen afkomstig uit grond, fecaliën, water,

  14. Prevalence of Listeria monocytogenes in poultry meat

    Directory of Open Access Journals (Sweden)

    Mehmet ELMALI

    2015-01-01

    Full Text Available AbstractThe objectives of this study were i to isolate Listeria spp. and Listeria monocytogenes in broiler wing meat samples, ii to confirm the isolates by PCR, based on prs and hly A gene sequences, iii to determine the seasonal and monthly distribution of the isolates. A total of 120 broiler wing meat samples (60 packaged pieces wrapped using strech film in styrofoam plates and 60 unpackaged pieces bought from different markets in Hatay province were analysed. Listeria spp. was isolated from 57 (47.5% out of 120 samples. Fifty-four, out of 57 Listeria spp. isolates were identified as L. monocytogenes. L. monocytogenes was isolated from the samples collected during the spring, winter, summer, and autumn at the levels of 26.6%, 40%, 53.3%, 60%, respectively. In this study, the isolation rates were found to be the highest in autumn, while the isolation rates were found to be the lowest in spring. As a consequence, high prevalence of Listeria spp. and L. monocytogenes in poultry wing meat samples may pose a risk for human health. We consider that with obeying the rules of good hygiene practices (GHP, good manufacturing practices (GMP and HACCP can minimize the contamination with Listeria spp.

  15. Listeria monocytogenes : nog steeds een probleem?

    NARCIS (Netherlands)

    Beumer, R.R.

    2011-01-01

    Listeria monocytogenes is net als vele andere bacteriële voedselpathogenen al tientallen jaren bekend. De meeste grondstoffen voor voedingsmiddelen komen uit de akker- en tuinbouw, de veehouderij en de visserij. Besmetting vindt daar plaats met micro-organismen afkomstig uit grond, fecaliën, water,

  16. Eating behaviors and related cultural attitudes of African American men and women

    Directory of Open Access Journals (Sweden)

    Christina Oney

    2015-09-01

    Full Text Available Cultural groups often participate in traditions and activities surrounding food and eating, which contribute to group differences in maladaptive eating-related patterns and outcomes. This study explored the relationships between cultural attitudes and eating behaviors of young adult African American men and women. Endorsing a strong orientation on various dimensions of African American culture were related to less dieting, bulimic, and anorexic behaviors and attitudes. This study extended our knowledge of the ways in which cultural attitudes were related to the physical and mental health of African Americans and recognized the significance of individual differences within this group.

  17. Eating behaviors and related cultural attitudes of African American men and women

    Directory of Open Access Journals (Sweden)

    Christina Oney

    2015-09-01

    Full Text Available Cultural groups often participate in traditions and activities surrounding food and eating, which contribute to group differences in maladaptive eating-related patterns and outcomes. This study explored the relationships between cultural attitudes and eating behaviors of young adult African American men and women. Endorsing a strong orientation on various dimensions of African American culture were related to less dieting, bulimic, and anorexic behaviors and attitudes. This study extended our knowledge of the ways in which cultural attitudes were related to the physical and mental health of African Americans and recognized the significance of individual differences within this group.

  18. Spontaneous Bacterial Peritonitis Caused by Infection with Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Michael Vincent F. Tablang

    2008-11-01

    Full Text Available Spontaneous bacterial peritonitis is a severe and life-threatening complication in patients with ascites caused by advanced liver disease. The organisms most commonly involved are coliform bacteria and third-generation cephalosporins are the empiric antibiotics of choice. This is an uncommon case of spontaneous bacterial peritonitis caused by Listeria monocytogenes in a female patient with liver cirrhosis from autoimmune hepatitis. She did not improve with ceftriaxone and her course was complicated by hepatic encephalopathy, seizures and multi-organ failure. This case emphasizes that a high index of suspicion should be maintained for timely diagnosis and treatment. Listerial peritonitis should be suspected in patients with end-stage liver disease and inadequate response to conventional antibiotics within 48–72 h. Ampicillin/sulbactam should be initiated while awaiting results of ascitic fluid or blood culture.

  19. Infective endocarditis caused by Listeria monocytogenes forming a pseudotumor.

    Science.gov (United States)

    Uehara Yonekawa, Akiko; Iwasaka, Sho; Nakamura, Hisataka; Fukata, Mitsuhiro; Kadowaki, Masako; Uchida, Yujiro; Odashiro, Keita; Shimoda, Shinji; Shimono, Nobuyuki; Akashi, Koichi

    2014-01-01

    A 73-year-old woman with breast cancer and metastasis under chemotherapy suffered from fever, pleural effusion and pericardial effusion. Despite the administration of treatment with cefozopran and prednisolone, the patient's fever relapsed. An electrocardiogram identified a new complete atrioventricular block and an echocardiogram revealed vegetation with an unusual pseudotumoral mass in the right atrium. Blood cultures grew Listeria monocytogenes. The patient was eventually diagnosed with right-sided infective endocarditis, which improved following the six-week administration of ampicillin and gentamicin. Homemade yoghurt was suspected to be the cause of infection in this case. Listeria endocarditis is rare; however, physicians should pay more attention to preventing this fatal disease in immunocompromised patients.

  20. A test of the culture-performance related distress hypothesis among employees in a collectivistic culture

    Directory of Open Access Journals (Sweden)

    Pheko, M.M

    2013-06-01

    Full Text Available To test the notions that people from collectivist cultures may experience more intense Sensitivity Towards being the Target of Upward Comparison (STTUC responses the current study investigated the relationships between traditional gender role orientation and STTUC, and collectivistic cultural orientation and STTUC. Using a quantitative, cross-sectional survey approach, a convenient sample of 464 participants from various organizations in Botswana completed the questionnaire. The participants were mostly female (59.9%, in a dating relationship (67.9%, and between the ages of 20 and 57 (M = 32.69, SD = 7.43. In the main, the hypotheses were not supported as the correlation results indicated that neither collectivistic cultural orientation nor traditional gender role orientation were linked to STTUC experiences. Discussions center on the importance of reporting and suggesting theoretical justifications for the so called ‘”nonsignificant findings.” Implications of the empirical findings and the future research directions are also discussed.

  1. Food-related lifestyles: Cross-cultural validity and intra-cultural stability

    DEFF Research Database (Denmark)

    Scholderer, Joachim; Brunsø, Karen; Bredahl, Lone;

    samples from Denmark (N = 1209), France (N = 1000), Germany (N = 1000), Spain (N = 1000) and the U.K. (N = 1000) are tested for cross-cultural validity using multi-sample confirmatory factor analysis with structured means. Results indicate that the factorial structure is invariant, between countries...... in terms of factor pattern, factor loadings, factor covariances and factor variances. In the second factor part of the analysis, replication samples from France (N1 = 1000, N2 = 1000), Germany (N1 = 1000, N2 = 1042), and the UK (N1 = 1000, N2 = 1000) are examined for intra-cultural stability using the same...

  2. Listeria Spp. and Listeria Monocytogenes Contamination in Ready-To-Eat Sandwiches Collected from Vending Machines

    Science.gov (United States)

    Cossu, Francesca; Spanu, Carlo; Deidda, Silvia; Mura, Erica; Casti, Daniele; Pala, Carlo; Lamon, Sonia; Spanu, Vincenzo; Ibba, Michela; Marrocu, Elena; Piana, Andrea; De Santis, Enrico Pietro Luigi

    2016-01-01

    Ready-to-eat (RTE) food is characterised by a long shelf-life at refrigerated temperature and can be consumed as such, without any treatment. The aim of the work was to evaluate the presence of Listeria spp. and Listeria monocytogenes in RTEs collected from refrigerated vending machines placed in hospital environment and accessible to the hospitalised patients. In 4 different sampling, 55 RTEs were collected from vending machines of six hospitals located in different areas of Sardinia region. All the samples were characterised by similar manufacturing process, such as the use of modified atmosphere packaging and belonged to 5 different producers. Listeria spp. was not countable using the enumeration method in all of the analysed samples. Using the detection method, Listeria spp. was recovered from 9 sandwich samples. Interestingly, 3 of these samples (5.5%) made by the manufacturer, were positive for L. monocytogenes contamination. The risk related to the L. monocytogenes presence in RTEs proportionally increases when food is introduced in susceptible environments, such as hospitals and consumed by susceptible people. Although the RTEs analysed showed values that complied with the European microbiological criteria for foodstuffs, the availability of these products in a susceptible environment should be carefully checked. Therefore, in order to limit the possible exposition to L. monocytogenes, more information on the risk related to RTE consumption should be provided to the hospitalised patients. PMID:27800439

  3. Resistance or Disconnection? A Relational-Cultural Approach to Supervisee Anxiety and Nondisclosure

    Science.gov (United States)

    Abernethy, Catherine; Cook, Katrina

    2011-01-01

    Supervisee anxiety and resistance have long presented counselor supervisors with a dilemma in supporting the professional growth and client care of their supervisees. With a more contemporary and cultural perspective, relational-cultural theory (RCT) offers a relational approach for reframing supervisee anxiety and resistance of…

  4. Interaction between Food-borne Pathogens (Campylobacter jejuni, Salmonella Typhimurium and Listeria monocytogenes) and a Common Soil Flagellate (Cercomonas sp.)

    DEFF Research Database (Denmark)

    Bui, Thanh Xuan; Wolff, Anders; Madsen, Mogens

    2012-01-01

    Free-living protozoa may harbor, protect, and disperse bacteria, including those ingested and passed in viable form in feces. The flagellates are very important predators on bacteria in soil, but their role in the survival of food-borne pathogens associated with fruits and vegetables is not well...... understood. In this study, we investigated the interactions between a common soil flagellate, Cercomonas sp., and three different bacterial pathogens (Campylobacter jejuni, Salmonella Typhimurium, and Listeria monocytogenes). Rapid growth of flagellates was observed in co-culture with C. jejuni and S....... Typhimurium over the time course of 15 days. In contrast, the number of Cercomonas sp. cells decreased when grown with or without L. monocytogenes for 9 days of co-culture. Interestingly, we observed that C. jejuni and S. Typhimurium survived better when co-cultured with flagellates than when cultured alone...

  5. Educations of Vision - relational strategies in visual culture

    DEFF Research Database (Denmark)

    Illeris, Helene

    2004-01-01

    The article is divided into three parts. Through examples from twentieth century Scandinavian visual arts education the first part ?Epistemological inquiries? discusses how the historical and social construction of dominant modern strategies of vision has occurred. The second part ?Experimentalist...... redescriptions? employs poststructuralist and feminist thinking about visual culture in an attempt to explore alternative understandings of visual education. In the final part ?Educations of vision in late modernity? socialization and self creation are proposed as two different, but supplementary, educational...... functions which contemporary visual education inspired by epistemological and experimentalist approaches should aim to fulfill....

  6. Educations of Vision - relational strategies in visual culture

    DEFF Research Database (Denmark)

    Illeris, Helene

    2004-01-01

    The article is divided into three parts. Through examples from twentieth century Scandinavian visual arts education the first part ?Epistemological inquiries? discusses how the historical and social construction of dominant modern strategies of vision has occurred. The second part ?Experimentalist...... redescriptions? employs poststructuralist and feminist thinking about visual culture in an attempt to explore alternative understandings of visual education. In the final part ?Educations of vision in late modernity? socialization and self creation are proposed as two different, but supplementary, educational...... functions which contemporary visual education inspired by epistemological and experimentalist approaches should aim to fulfill....

  7. The Novel Multiple Inner Primers-Loop-Mediated Isothermal Amplification (MIP-LAMP) for Rapid Detection and Differentiation of Listeria monocytogenes.

    Science.gov (United States)

    Wang, Yi; Wang, Yan; Ma, Aijing; Li, Dongxun; Luo, Lijuan; Liu, Dongxin; Hu, Shoukui; Jin, Dong; Liu, Kai; Ye, Changyun

    2015-12-03

    Here, a novel model of loop-mediated isothermal amplification (LAMP), termed multiple inner primers-LAMP (MIP-LAMP), was devised and successfully applied to detect Listeria monocytogenes. A set of 10 specific MIP-LAMP primers, which recognized 14 different regions of target gene, was designed to target a sequence in the hlyA gene. The MIP-LAMP assay efficiently amplified the target element within 35 min at 63 °C and was evaluated for sensitivity and specificity. The templates were specially amplified in the presence of the genomic DNA from L. monocytogenes. The limit of detection (LoD) of MIP-LAMP assay was 62.5 fg/reaction using purified L. monocytogenes DNA. The LoD for DNA isolated from serial dilutions of L. monocytogenes cells in buffer and in milk corresponded to 2.4 CFU and 24 CFU, respectively. The amplified products were analyzed by real-time monitoring of changes in turbidity, and visualized by adding Loop Fluorescent Detection Reagent (FD), or as a ladder-like banding pattern on gel electrophoresis. A total of 48 pork samples were investigated for L. monocytogenes by the novel MIP-LAMP method, and the diagnostic accuracy was shown to be 100% when compared to the culture-biotechnical method. In conclusion, the MIP-LAMP methodology was demonstrated to be a reliable, sensitive and specific tool for rapid detection of L. monocytogenes strains.

  8. The Novel Multiple Inner Primers-Loop-Mediated Isothermal Amplification (MIP-LAMP for Rapid Detection and Differentiation of Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Yi Wang

    2015-12-01

    Full Text Available Here, a novel model of loop-mediated isothermal amplification (LAMP, termed multiple inner primers-LAMP (MIP-LAMP, was devised and successfully applied to detect Listeria monocytogenes. A set of 10 specific MIP-LAMP primers, which recognized 14 different regions of target gene, was designed to target a sequence in the hlyA gene. The MIP-LAMP assay efficiently amplified the target element within 35 min at 63 °C and was evaluated for sensitivity and specificity. The templates were specially amplified in the presence of the genomic DNA from L. monocytogenes. The limit of detection (LoD of MIP-LAMP assay was 62.5 fg/reaction using purified L. monocytogenes DNA. The LoD for DNA isolated from serial dilutions of L. monocytogenes cells in buffer and in milk corresponded to 2.4 CFU and 24 CFU, respectively. The amplified products were analyzed by real-time monitoring of changes in turbidity, and visualized by adding Loop Fluorescent Detection Reagent (FD, or as a ladder-like banding pattern on gel electrophoresis. A total of 48 pork samples were investigated for L. monocytogenes by the novel MIP-LAMP method, and the diagnostic accuracy was shown to be 100% when compared to the culture-biotechnical method. In conclusion, the MIP-LAMP methodology was demonstrated to be a reliable, sensitive and specific tool for rapid detection of L. monocytogenes strains.

  9. Cultural relations between Hungary and Albania during the period of Humanism and Renaissance

    Directory of Open Access Journals (Sweden)

    Muhamet Mala

    2016-07-01

    Full Text Available Cultural Hungarian-Albanian relations during the Middle Ages are characterized by a relatively poor intensity. Actually, relations between these two countries are more intense in the political field and especially through the partnership between Gjergj Kastrioti Skanderbeg and John Hunyadi. Regarding the origin, the Hungarian culture identity is rather distinct from the Albanian one. Lack of cultural contacts, among others, was conditioned also by the fact that these relations were held under war circumstances and their primary aim was the common defense from Ottoman attacks. Actually, the Albanian medieval culture remained a Mediterranean culture with elements of Byzantine influence in the continental and southern areas. Meanwhile, Hungary belonged to Central Europe, which, even though far away from Mediterranean cultural mainstream, sought to be influenced by this culture, namely by the Renaissance that emanated exactly in the Mediterranean region. It was Matthias Corvinus effort, regarding the cultural influence of the Mediterranean and Renaissance in Hungary but also the fact that Hungary possessed some of the most important towns of the Adriatic coast and particularly Ragusa. This city was the center where cultural relations between Albanian and Hungary started and became intensified in the religious, intellectual and human field.

  10. Cultural capital or relative risk aversion? Two mechanisms for educational inequality compared.

    Science.gov (United States)

    van de Werfhorst, Herman G; Hofstede, Saskia

    2007-09-01

    In this paper we empirically examined two explanatory mechanisms for educational inequality: cultural reproduction and relative risk aversion, using survey data taken from secondary school pupils in Amsterdam. Cultural reproduction theory seeks to explain class variations in schooling by cultural differences between social classes. Relative risk aversion theory argues that educational inequalities can be understood by between-class variation in the necessity of pursuing education at branching points in order to avoid downward mobility. We showed that class variations in early demonstrated ability are for a substantial part cultural: cultural capital - measured by parental involvement in highbrow culture - affected school performance at the primary and secondary level. However, relative risk aversion - operationalized by being concerned with downward mobility - strongly affects schooling ambitions, whereas cultural capital had no effect. Thus, we conclude that 'primary effects' of social origin on schooling outcomes are manifested through cultural capital and not through relative risk aversion (in addition to other potential sources of class variations such as genetics). Relative risk aversion, and not cultural capital, affects schooling ambitions, which is relevant for our understanding of secondary effects.

  11. Genotypes Associated with Listeria monocytogenes Isolates Displaying Impaired or Enhanced Tolerances to Cold, Salt, Acid, or Desiccation Stress

    DEFF Research Database (Denmark)

    Hingston, Patricia A.; Chen, Jessica; Dhillon, Bhavjinder K

    2017-01-01

    -related stress tolerance phenotypes. To accomplish this, 166 L. monocytogenes isolates were sequenced and evaluated for their ability to grow in cold (4°C), salt (6% NaCl, 25°C), and acid (pH 5, 25°C) stress conditions as well as survive desiccation (33% RH, 20°C). The results revealed that the stress tolerance...... tolerate several other food-related stresses with some strains possessing higher levels of tolerances than others. The objective of this study was to use a combination of phenotypic analyses and whole genome sequencing to elucidate potential relationships between L. monocytogenes genotypes and food...... of L. monocytogenes is associated with serotype, clonal complex (CC), full length inlA profiles, and the presence of a plasmid which was identified in 55% of isolates. Isolates with full length inlA exhibited significantly (p tolerance relative to those harboring a premature stop...

  12. Identification of Listeria monocytogenes on Green Mussels and Cockle Shell

    Directory of Open Access Journals (Sweden)

    Winiati Puji Rahayu

    2017-02-01

    Full Text Available AbstractGreen mussel (Perna viridis and cockle shell (Anadara granosa are one of many sources of animal protein which is many cultivated in Indonesia because their price is relatively affordable. This study was conducted to identify the presence of Listeria monocytogenes in 27 samples of green mussels and 3 samples of cockle shells using real-time Polymerase Chain Reaction (real-time PCR and biochemical methods. The target gene for amplification in real-time PCR was an hlyA gene because this gene was a determinant of virulence genes that produce listeriolysin O. Primers used in this study were forward primer DG69 (GTG CCG GGT AAA AGA CCA TA and reverse primer DG74 (CGC CAC TGA GAT ACT AT and fluorescence signals indicator using SYBR Green I. The results of analysis using real-time PCR were negative Listeria monocytogenes in all samples, while using biochemical methods there was one of 30 samples contaminated by Listeria welshimeri.

  13. Exploring the chicken embryo as a possible model for studying Listeria monocytogenes pathogenicity

    Directory of Open Access Journals (Sweden)

    Jonas eGripenland

    2014-12-01

    Full Text Available Listeria monocytogenes is a bacterial pathogen capable of causing severe infections in humans, often with fatal outcomes. Many different animal models exist to study L. monocytogenes pathogenicity, and we have investigated the chicken embryo as an infection model: What are the benefits and possible drawbacks? We have compared a defined wild-type strain with its isogenic strains lacking well-characterized virulence factors. Our results show that wild-type L. monocytogenes, already at a relatively low infection dose (~5 x 102 cfu, caused death of the chicken embryo within 36 hours, in contrast to strains lacking the main transcriptional activator of virulence, PrfA, or the cytolysin LLO. Surprisingly, strains lacking the major adhesins InlA and InlB caused similar mortality as the wild-type strain. In conclusion, our results suggest that the chicken embryo is a practical model to study L. monocytogenes infections, especially when analyzing alternative virulence pathways independent of the InlA and InlB adhesins. However, the route of infection might be different from a human infection. The chicken embryo model and other Listeria infection models are discussed.

  14. Efflux pump-mediated benzalkonium chloride resistance in Listeria monocytogenes isolated from retail food.

    Science.gov (United States)

    Jiang, Xiaobing; Yu, Tao; Liang, Yu; Ji, Shengdong; Guo, Xiaowei; Ma, Jianmin; Zhou, Lijun

    2016-01-18

    In this study, efflux pump-mediated benzalkonium chloride (BC) resistance, including plasmid-encoded (Qac protein family and BcrABC) and chromosome-borne efflux pumps, was investigated in Listeria monocytogenes from retail food in China. Among the 59 L. monocytogenes strains, 13 (22.0%) strains were resistant to BC. The PCR results showed that bcrABC was harbored by 2 of 13 BC resistant strains. However, none of the qac genes were detected among the 59 strains. The bcrABC was absent in both of the plasmid cured strains, indicating that this BC resistance determinant was plasmid-encoded in the two bcrABC-positive strains. In the presence of reserpine, most of the bcrABC-negative strains had decreases in the MICs of BC, suggesting the existence of other efflux pumps and their role in BC resistance. After exposed to reserpine, the reduction in BC MICs was observed in the two cured strains, indicating that efflux pumps located on chromosome was also involved in BC resistance. Our findings suggest that food products may act as reservoirs for BC resistant isolates of L. monocytogenes and plasmid- and chromosome-encoded efflux pumps could mediate the BC resistance of L. monocytogenes, which is especially relevant to the adaption of this organism in food-related environments with frequent BC use.

  15. The evolution and epidemiology of Listeria monocytogenes in Europe and the United States.

    Science.gov (United States)

    Lomonaco, Sara; Nucera, Daniele; Filipello, Virginia

    2015-10-01

    Listeria monocytogenes is an opportunistic food-borne pathogen responsible for listeriosis, a disease associated with high mortality rates. L. monocytogenes causes invasive syndromes and case-fatality can be as high as 30%, in specific high-risk population groups such as the elderly, immuno-compromised individuals, fetuses and newborns. Acquisition of the disease is mainly due to consumption of contaminated (predominantly ready-to-eat) food. We aimed to provide a state-of-the-art collection of different likely evolutionary models, based on recombination and positive selection, and the phylogenetic relationship between lineages of L. monocytogenes and between them and other Listeria species. We described the most recent findings in comparative pan-genomics, considering the core and accessory genome in relation to virulence and adaptation to different environments. Finally, this review illustrates L. monocytogenes epidemiology and transmission in humans, foods and animals, the surveillance systems of the European Union and United States and the application of molecular techniques as a core tool in epidemiological investigation. Copyright © 2015 Elsevier B.V. All rights reserved.

  16. The human P-glycoprotein transporter enhances the type I interferon response to Listeria monocytogenes infection.

    Science.gov (United States)

    Sigal, Nadejda; Kaplan Zeevi, Millie; Weinstein, Shiri; Peer, Dan; Herskovits, Anat A

    2015-06-01

    Human multidrug efflux transporters are known for their ability to extrude antibiotics and toxic compounds out of cells, yet accumulating data indicate they have additional functions in diverse physiological processes not related to drug efflux. Here, we show that the human multidrug transporter P-glycoprotein (P-gp) (also named MDR1 and ABCB1) is transcriptionally induced in the monocytic cell line THP-1 upon infection with the human intracellular bacterial pathogen Listeria monocytogenes. Notably, we found that P-gp is important for full activation of the type I interferon response elicited against L. monocytogenes bacteria. Both inhibition of P-gp function by verapamil and inhibition of its transcription using mRNA silencing led to a reduction in the magnitude of the type I response in infected cells. This function of P-gp was specific to type I interferon cytokines elicited against cytosolic replicating bacteria and was not observed in response to cyclic di-AMP (c-di-AMP), a molecule that was shown to be secreted by L. monocytogenes during infection and to trigger type I interferons. Moreover, P-gp was not involved in activation of other proinflammatory cytokines, such as those triggered by vacuolar-restricted L. monocytogenes or lipopolysaccharide (LPS). Taken together, these findings demonstrate a role for P-gp in proper development of an innate immune response against intracellular pathogens, highlighting the complexity in employing therapeutic strategies that involve inhibition of multidrug resistance (MDR) efflux pumps.

  17. Culture and religious beliefs in relation to reproductive health.

    Science.gov (United States)

    Arousell, Jonna; Carlbom, Aje

    2016-04-01

    An increasing number of contemporary research publications acknowledge the influence of religion and culture on sexual and reproductive behavior and health-care utilization. It is currently hypothesized that religious influences can partly explain disparities in sexual and reproductive health outcomes. In this paper, we will pay particular attention to Muslims in sexual and reproductive health care. This review reveals that knowledge about devout Muslims' own experience of sexual and reproductive health-care matters is limited, thus providing weak evidence for modeling of efficient practical guidelines for sexual and reproductive health care directed at Muslim patients. Successful outcomes in sexual and reproductive health of Muslims require both researchers and practitioners to acknowledge religious heterogeneity and variability, and individuals' possibilities to negotiate Islamic edicts. Failure to do so could lead to inadequate health-care provision and, in the worst case, to suboptimal encounters between migrants with Muslim background and the health-care providers in the receiving country.

  18. CHALLENGE TESTS WITH LISTERIA MONOCYTOGENES IN SALAMI: PRELIMINARY RESULTS

    Directory of Open Access Journals (Sweden)

    R. Mioni

    2013-02-01

    Full Text Available Challenge tests are the preferable methodology to study the behaviour of Listeria monocytogenes on ready to eat foods, according to Regulation (EC 2073/2005. Challenge testing using L. monocytogenes in seasoned salami from different food business operators showed, after seasoning of the product, a count reduction of the inoculated organisms without any further growth of the pathogen; however differences of L. monocytogenes behaviour could be observed according to different production protocols.

  19. Listeria spp. E Listeria monocytogenes NA PRODUÇÃO DE SALSICHAS TIPO HOT DOG

    Directory of Open Access Journals (Sweden)

    ALESSANDRA PARO RODRIGUES CESAR

    2011-06-01

    Full Text Available Listeria monocytogenes is widely distributed in the environment and it has been isolated from food that were associated to outbreaks of high lethality in many countries. Thus, this bacterium represents an important pathogen to the public health. Ready-to-eat products, likecooked stuffed food, within them, frankfurters, are associated to human listeriosis in many countries. Taking into consideration the importance of the subject and the need of more data about it, the occurrence of Listeria spp. and L. monocytogenes in industrial plants, in meat raw materials, in slurry and frankfurters was investigated.These samples were collected in two production plants with SIF (Federal Inspection Service; in one of them GMP, HACCP and SOP were implemented. The results of the 1 06 microbiological analysis were submitted to the program @Risk to obtain the risk analysis; the meanvalues results showed that 7 to 9% of the frankfurters in the market may have L. monocytogenes. The analysis indicated that 88 strains of L. monocytogenes were obtained from 1 06 samples; among them, 76 werecollected in the industrial plants that participate in the experiment, and 30 were collected in the market. In serological typification, 95% of these strains were classified as serotypes 4b, 1 /2a and 1 /2b. Besides the presence of the bacterium in frankfurthers consumed inBrazil and the risk factors associated to this pathogen, the situation concerns because of the lack of epidemiological data, absence of patterns and the deficient information given to the consumer, specially information related to the presence of L. monocytogenes, particularly important to the groups at risk, as well as information related to the importance of heating the product

  20. Determination of Listeria monocytogenes Growth during Mushroom Production and Distribution

    Directory of Open Access Journals (Sweden)

    Dara Leong

    2013-11-01

    Full Text Available In the EU, food is considered safe with regard to Listeria monocytogenes if its numbers do not exceed 100 CFU/g throughout the shelf-life of the food. Therefore, it is important to determine if a food supports growth of L. monocytogenes. Challenge studies to determine the ability of a food to support growth of L. monocytogenes are essential as predictive modelling often overestimates the growth ability of L. monocytogenes. The aim of this study was to determine if growth of L. monocytogenes was supported during the production and distribution of mushrooms. A three-strain mixture of L. monocytogenes was inoculated onto three independent batches of whole mushrooms, sliced mushrooms, mushroom casing and mushroom substrate at a concentration of about 100–1000 CFU/g. The batches were incubated at potential abuse temperatures, as a worst case scenario, and at intervals during storage L. monocytogenes numbers, % moisture and pH were determined. The results showed that the sliced and whole mushrooms had the ability to support growth, while mushroom casing allowed survival but did not support growth. Mushroom substrate showed a rich background microflora that grew on Listeria selective media and this hindered enumeration of L. monocytogenes. In the case of this study, Combase predictions were not always accurate, indicating that challenge studies may be a necessary part of growth determination of L. monocytogenes.

  1. Highly specific fiber optic immunosensor coupled with immunomagnetic separation for detection of low levels of Listeria monocytogenes and L. ivanovii

    Science.gov (United States)

    2012-01-01

    Background Immunomagnetic separation (IMS) and immunoassays are widely used for pathogen detection. However, novel technology platforms with highly selective antibodies are essential to improve detection sensitivity, specificity and performance. In this study, monoclonal antibodies (MAbs) against Internalin A (InlA) and p30 were generated and used on paramagnetic beads of varying diameters for concentration, as well as on fiber-optic sensor for detection. Results Anti-InlA MAb-2D12 (IgG2a subclass) was specific for Listeria monocytogenes and L. ivanovii, and p30-specific MAb-3F8 (IgM) was specific for the genus Listeria. At all bacterial concentrations (103–108 CFU/mL) tested in the IMS assay; the 1-μm diameter MyOne beads had significantly higher capture efficiency (P Listeria antibody (9 %). Furthermore, capture efficiency for MyOne-2D12 was highly specific for L. monocytogenes and L. ivanovii. Subsequently, we captured L. monocytogenes by MyOne-2D12 and MyOne-3F8 from hotdogs inoculated with mono- or co-cultures of L. monocytogenes and L. innocua (10–40 CFU/g), enriched for 18 h and detected by fiber-optic sensor and confirmed by plating, light-scattering, and qPCR assays. The detection limit for L. monocytogenes and L. ivanovii by the fiber-optic immunosensor was 3 × 102 CFU/mL using MAb-2D12 as capture and reporter antibody. Selective media plating, light-scattering, and qPCR assays confirmed the IMS and fiber-optic results. Conclusions IMS coupled with a fiber-optic sensor using anti-InlA MAb is highly specific for L. monocytogenes and L. ivanovii and enabled detection of these pathogens at low levels from buffer or food. PMID:23176167

  2. Comparison of different application strategies of divergicin M35 for inactivation of Listeria monocytogenes in cold-smoked wild salmon.

    Science.gov (United States)

    Tahiri, I; Desbiens, M; Kheadr, E; Lacroix, C; Fliss, I

    2009-12-01

    Cold-smoked salmon treated with divergicin M35-producing Carnobacterium divergens M35, C. divergens ATCC 35677 (a non-producer of bacteriocin), purified divergicin M35 or supernatants of C. divergens M35 culture in snow crab hepatopancreas (SCH) medium or MRS broth was challenged with Listeria monocytogenes (up to 10(3) CFU/g). Samples were stored at 4 degrees C for up to four weeks. L. monocytogenes, total bacterial and lactic acid bacterial counts were determined along with changes in total volatile base nitrogen (TVBN) and biogenic amine production as well as texture, color and odor. A 2.6 log CFU/g reduction in L. monocytogenes was obtained for up to 10 days of storage in samples treated with C. divergens M35. Purified divergicin M35 (50 microg/g), SCH supernatant or MRS supernatant brought reductions of 1 log CFU/g at the beginning of storage. However, the anti-listerial activity of the supernatants lasted for 15 days compared to 3 days for purified divergicin M35. Color and texture were affected little in samples containing C. divergens M35 compared to un-inoculated samples. TVBN and biogenic amine production, particularly tyramine, remained below the maximum acceptable level in fish appreciation. These results clearly show the potential of C. divergens M35 culture as well as divergicin M35 bio-ingredient for application to the inactivation of L. monocytogenes in ready-to-eat seafood.

  3. Algal culture studies related to a Closed Ecological Life Support System (CELSS)

    Science.gov (United States)

    Radmer, R.; Behrens, P.; Fernandez, E.; Ollinger, O.; Howell, C.; Venables, A.; Huggins, D.; Gladue, R.

    1984-01-01

    In many respects, algae would be the ideal plant component for a biologically based controlled life support system, since they are eminently suited to the closely coupled functions of atmosphere regeneration and food production. Scenedesmus obliquus and Spirulina platensis were grown in three continuous culture apparatuses. Culture vessels their operation and relative merits are described. Both light and nitrogen utilization efficiency are examined. Long term culture issues are detailed and a discussion of a plasmid search in Spirulina is included.

  4. Cultural influences on doing qualitative research in public relations in Mexico

    OpenAIRE

    Daymon, Christine; Hodges, Caroline E.M.

    2008-01-01

    Over the last decade in international public relations scholarship, there has been a significant growth in comparative research, offering illumination on the different practices, assumptions and expectations of those involved in public relations in both global and local contexts. The qualitative voice is increasingly heard because of its more nuanced insights on cultural difference. Yet there are significant challenges for researchers seeking to investigate public relations in cultures differ...

  5. Réseaux relationnels et éclectisme culturel Relational Networks and Cultural Omnivorousness

    Directory of Open Access Journals (Sweden)

    Fabien Granjon

    2005-01-01

    Full Text Available “Cultural omnivorousness” refers to the tendency to mix, in one’s cultural space, elements belonging to highbrow cultural forms with others which may be considered as popular or less legitimate. This article explores different patterns of cultural activities that mix differently ranked cultural elements, focusing on their relations to sociability. Drawing on examples from qualitative research, we show how cultural legitimacies can be produced by and worked out through the activities of groups and the ways in which cultural activities are combined and distributed, either in conversations — in talking — or in shared practices — in doing — according to the various groups that compose one’s relational network. Our hypothesis is that sociability and its different forms play an active role in the formation of omnivorous cultural tendencies and that, in return, the latter influence the differentiation of social frequentations. This article therefore concentrates on the architecture of relational practices and their peculiar forms when mobilising cultural contents that are heterogeneous in terms of their degree of legitimacy.

  6. Comments on "Some Relations Among Cultural Traditions, Nuptiality and Fertility".

    Science.gov (United States)

    Krotki, K J

    1991-01-01

    Facts employed in formulating Ansley Coale's interpretation of European historical demographic transition have largely been in the public domain for a long time. Coale's achievement, however, in bringing pertinent information together to form a theoretical framework is applauded, and is acknowledged as being an important contribution to the traditional use of demographic transition. Beyond this general interest and broad approval, the author critiques various points of Coale's thesis. First, he notes the need to be suspicious of high correlations found between mean age at 1st marriage and total fertility rate. Second, he is unsure of the role played by servants in explaining the comparatively later marriage age of western Europeans. Finally, the author considers marked fertility declines in China, Taiwan, and Korea. These declines run strongly counter to the traditional cultures of these countries. Moreover, the high life expectations at birth, strong episodic economic development in Taiwan and Korea, and serious autocratic government interference in China are atypical of experiences in most developing countries. Traditional family planning in these 3 countries was simply a facilitator of demographic transition. The experiences of China, Taiwan, Korea, and Bangladesh support the ineffectiveness of imposing programs from either within or outside of a country.

  7. Alteration of the phospho- or neutral lipid content and fatty acid composition in Listeria monocytogenes due to acid adaptation mechanisms for hydrochloric, acetic and lactic acids at pH 5.5 or benzoic acid at neutral pH.

    Science.gov (United States)

    Mastronicolis, Sofia K; Berberi, Anita; Diakogiannis, Ioannis; Petrova, Evanthia; Kiaki, Irene; Baltzi, Triantafillia; Xenikakis, Polydoros

    2010-10-01

    This study provides a first approach to observe the effects on Listeria monocytogenes of cellular exposure to acid stress at low or neutral pH, notably how phospho- or neutral lipids are involved in this mechanism, besides the fatty acid profile alteration. A thorough investigation of the composition of polar and neutral lipids from L. monocytogenes grown at pH 5.5 in presence of hydrochloric, acetic and lactic acids, or at neutral pH 7.3 in presence of benzoic acid, is described relative to cells grown in acid-free medium. The results showed that only low pH values enhance the antimicrobial activity of an acid. We suggest that, irrespective of pH, the acid adaptation response will lead to a similar alteration in fatty acid composition [decreasing the ratio of branched chain/saturated straight fatty acids of total lipids], mainly originating from the neutral lipid class of adapted cultures. Acid adaptation in L. monocytogenes was correlated with a decrease in total lipid phosphorus and, with the exception of cells adapted to benzoic acid, this change in the amount of phosphorus reflected a higher content of the neutral lipid class. Upon acetic or benzoic acid stress the lipid phosphorus proportion was analysed in the main phospholipids present: cardiolipin, phosphatidylglycerol, phosphoaminolipid and phosphatidylinositol. Interestingly only benzoic acid had a dramatic effect on the relative quantities of these four phospholipids.

  8. ON HEALTH PROTECTION AND HEALTH RELATED PHYSICAL CULTURE TRAININGS OF FIRST YEAR STUDENTS

    Directory of Open Access Journals (Sweden)

    V.G. Fotynyuk

    2017-01-01

    Full Text Available Purpose: to assess health protection and health related physical culture trainings of first year students. Material: in the research first year students (n=121; 86 boys and 35girls of age 16 - 19 years, participated. Results: components of students’ individual health were found. Situation with health related physical culture trainings, ensuring students’ sound health and optimal functional potentials of their organisms were determined. It was found that leading role shall be played by formation of health world vision values, knowledge about formation of practical skills in healthy life style. Motivation tendency for realization of intentions and practicing of health related physical culture trainings were found in students. Conclusions: the received results prove students’ tendency to pay insufficient attention to individual health. It was found that health related physical culture trainings require modern renewal of education’s content, forms and methods of physical education. The basis of such trainings shall be health related orientation.

  9. Counter cross-cultural priming and relative deprivation: The role of individualism-collectivism.

    NARCIS (Netherlands)

    Van den Bos, K.|info:eu-repo/dai/nl/145822923; van Veldhuizen, Tanja; Au, A.K.C.

    2015-01-01

    This paper uses cross-cultural comparisons and comparisons obtained by experimental manipulation to examine how cultural and contextual factors influence responses to personal and group relative deprivation. Two studies were conducted, one in an individualistic country (The Netherlands) and one in a

  10. Counter cross-cultural priming and relative deprivation: The role of individualism-collectivism.

    NARCIS (Netherlands)

    Van den Bos, K.; Van Veldhuizen, T. S.

    2015-01-01

    This paper uses cross-cultural comparisons and comparisons obtained by experimental manipulation to examine how cultural and contextual factors influence responses to personal and group relative deprivation. Two studies were conducted, one in an individualistic country (The Netherlands) and one in a

  11. Culture-Related Topic Selection in Small Talk Conversations across Germany and Japan

    DEFF Research Database (Denmark)

    Endrass, Birgit; Nakano, Yukiko; Lipi, Afia Akhter

    2011-01-01

    Small talk can be used in order to build a positive relationship towards a virtual character. However the choice of topics in a conversation can be dependent on social backgrounds such as culture. In this paper, we explore culture-related differences in small talk for the German and Japanese cult...

  12. Adenovirus-based vaccine against Listeria monocytogenes

    DEFF Research Database (Denmark)

    Jensen, Søren; Steffensen, Maria Abildgaard; Jensen, Benjamin Anderschou Holbech

    2013-01-01

    The use of replication-deficient adenoviruses as vehicles for transfer of foreign genes offers many advantages in a vaccine setting, eliciting strong cellular immune responses involving both CD8(+) and CD4(+) T cells. Further improving the immunogenicity, tethering of the inserted target Ag to MHC...... class II-associated invariant chain (Ii) greatly enhances both the presentation of most target Ags, as well as overall protection against viral infection, such as lymphocytic choriomeningitis virus (LCMV). The present study extends this vaccination concept to include protection against intracellular...... bacteria, using Listeria monocytogenes as a model organism. Protection in C57BL/6 mice against recombinant L. monocytogenes expressing an immunodominant epitope of the LCMV glycoprotein (GP33) was greatly accelerated, augmented, and prolonged following vaccination with an adenoviral vaccine encoding GP...

  13. A correlation between the virulence and the adhesion of Listeria monocytogenes to silicon nitride: an atomic force microscopy study.

    Science.gov (United States)

    Park, Bong-Jae; Haines, Travis; Abu-Lail, Nehal I

    2009-10-15

    Listeria monocytogenes is a facultative intracellular Gram-positive bacterium that is widely distributed in the environment. Despite being pathogenic at the species level, L. monocytogenes in fact comprises a diversity of strains from pathogenic ones that can result in disease and/or mortality to others that are relatively avirulent. The main goal of the current study was to answer the question on whether enhanced binding or attachment of L. monocytogenes to inert surfaces bears any relationship to pathogenicity in food-borne isolates. To answer this question, the nanoscale adhesion forces of eight L. monocytogenes strains that vary in their pathogenicity levels to a model surface of silicon nitride were quantified using atomic force microscopy. The strains used were the highly pathogenic (EGDe, 874, 1002, ATCC 19115), the intermediate pathogenic (ATCC 19112, ATCC 19118), and the non pathogenic (ATCC 15313 and HCC25). Our results indicate that the average nanoscale adhesion (in nN) and the 50% lethal dose (LD50) of strain virulence quantified in mice are logarithmically correlated according to: (nN)=-0.032ln(LD50)+1.040, r(2)=0.96. Such correlation indicates that nanoscale adhesion could potentially be used as a design criterion to distinguish between virulent and avirulent L. monocytogenes strains. Finally, stronger adhesion of virulent strains to inert surfaces modeled by silicon nitride might be a way for pathogenic strains to survive better in the environment and thus increase their likelihood of infecting animals or humans.

  14. Phylogenetic analysis of the Listeria monocytogenes based on sequencing of 16S rRNA and hlyA genes.

    Science.gov (United States)

    Soni, Dharmendra Kumar; Dubey, Suresh Kumar

    2014-12-01

    The discrimination between Listeria monocytogenes and Listeria species has been detected. The 16S rRNA and hlyA were PCR amplified with set of oligonucleotide primers with flank 1,500 and 456 bp fragments, respectively. Based on the differences in 16S rRNA and hlyA genes, a total 80 isolates from different environmental, food and clinical samples confirmed it to be L. monocytogenes. The 16S rRNA sequence similarity suggested that the isolates were similar to the previously reported ones from different habitats by others. The phylogenetic interrelationships of the genus Listeria were investigated by sequencing of 16S rRNA and hlyA gene. The 16S rRNA sequence indicated that genus Listeria is comprised of following closely related but distinct lines of descent, one is the L. monocytogenes species group (including L. innocua, L. ivanovii, L. seeligeri and L. welshimeri) and other, the species L. grayi, L. rocourtiae and L. fleischmannii. The phylogenetic tree based on hlyA gene sequence clearly differentiates between the L. monocytogenes, L. ivanovii and L. seeligeri. In the present study, we identified 80 isolates of L. monocytogenes originating from different clinical, food and environmental samples based on 16S rRNA and hlyA gene sequence similarity.

  15. Retrospective analysis of a listeria monocytogenes contamination episode in raw milk goat cheese using quantitative microbial risk assessment tools.

    Science.gov (United States)

    Delhalle, L; Ellouze, M; Yde, M; Clinquart, A; Daube, G; Korsak, N

    2012-12-01

    In 2005, the Belgian authorities reported a Listeria monocytogenes contamination episode in cheese made from raw goat's milk. The presence of an asymptomatic shedder goat in the herd caused this contamination. On the basis of data collected at the time of the episode, a retrospective study was performed using an exposure assessment model covering the production chain from the milking of goats up to delivery of cheese to the market. Predictive microbiology models were used to simulate the growth of L. monocytogenes during the cheese process in relation with temperature, pH, and water activity. The model showed significant growth of L. monocytogenes during chilling and storage of the milk collected the day before the cheese production (median increase of 2.2 log CFU/ml) and during the addition of starter and rennet to milk (median increase of 1.2 log CFU/ml). The L. monocytogenes concentration in the fresh unripened cheese was estimated to be 3.8 log CFU/g (median). This result is consistent with the number of L. monocytogenes in the fresh cheese (3.6 log CFU/g) reported during the cheese contamination episode. A variance-based method sensitivity analysis identified the most important factors impacting the cheese contamination, and a scenario analysis then evaluated several options for risk mitigation. Thus, by using quantitative microbial risk assessment tools, this study provides reliable information to identify and control critical steps in a local production chain of cheese made from raw goat's milk.

  16. Changing gender relations in Thailand: a historical and cultural analysis.

    Science.gov (United States)

    Tantiwiramanond, D

    1997-01-01

    In response to the stereotyping of Thai women in the media as either modern businesswomen or victims of male oppression, this article studies the changing gender roles and status of women in Thailand to identify the various roles played by Thai women and the ways these roles are linked to key cultural, economic, and political mechanisms in Thai society. After an introduction, the first section of the paper analyzes pre-modern Thai history from the mid-13th century with a look at the traditional social, political, and economic structure of feudal society to determine how women's status was affected by Thai Buddhism, absolute monarchy (the affect of the legal system on upper-class women), and matrifocal kinship (the effect of subsistence agriculture on lower-class women). This section also compares the historic status of upper- and lower-class Thai women. The second section of the article considers the effects of 1) the encroachment of Western colonialism in Southeast Asia during the period 1850-1925 and attendant criticisms of polygamy, 2) the post-1932 revolution that resulted in a constitutional monarchy, and 3) the post 1950s period of economic nationalism that has resulted in globalization. The article concludes that lower-class women have certain rights under the feudal system (before 1932) but were forced into certain roles by economic necessity and motherhood. Upper-class women enjoyed high status, but all women were victims of the Buddhist patriarchy and hierarchical systems. Western modernization caused a decline in polygamy and new opportunities for educated women but the status of Thai women has not changed substantially, and class-specific forms of female oppression continues unabated making lower-class women vulnerable to sexual exploitation.

  17. Chinese American immigrant parents' emotional expression in the family: Relations with parents' cultural orientations and children's emotion-related regulation.

    Science.gov (United States)

    Chen, Stephen H; Zhou, Qing; Main, Alexandra; Lee, Erica H

    2015-10-01

    The present study examined 2 measures of Chinese American immigrant parents' emotional expression in the family context: self-reported emotional expressivity and observed emotional expression during a parent-child interaction task. Path analyses were conducted to examine the concurrent associations between measures of emotional expression and (a) parents' American and Chinese cultural orientations in language proficiency, media use, and social affiliation domains, and (b) parents' and teachers' ratings of children's emotion-related regulation. Results suggested that cultural orientations were primarily associated with parents' self-reported expressivity (rather than observed emotional expression), such that higher American orientations were generally associated with higher expressivity. Although parents' self-reported expressivity was only related to their own reports of children's regulation, parents' observed emotional expression was related to both parents' and teachers' reports of children's regulation. These results suggest that self-reported expressivity and observed emotional expression reflect different constructs and have differential relations to parents' cultural orientations and children's regulation.

  18. Ikwerre Intergroup Relations and its Impact on Their Culture

    African Journals Online (AJOL)

    Nneka Umera-Okeke

    the Ikwerre relations with her Kalabari and Okrika coastal neighbours, as well as the. Etche, Eleme, Ekpeye ... Consequently, no human group, its level of development notwithstanding, can be said to be an island. .... tinned fish, real India cloth to Chief Uchendu Osi. ... Yet, there has been media war between the. Ikwerre- ...

  19. The quorum sensing luxS gene is induced in Lactobacillus acidophilus NCFM in response to Listeria monocytogenes

    DEFF Research Database (Denmark)

    Moslehi Jenabian, Saloomeh; Vogensen, Finn Kvist; Jespersen, Lene

    2011-01-01

    - and co-culture and the growth of both bacteria and the transcriptional level of luxS in L. acidophilus cells were monitored. Contrary to L. acidophilus, the growth of L. monocytogenes was significantly affected by co-cultivation. Transcriptional analysis showed that the expression of luxS increased...... EGD-e. The two bacterial strains were grown in mono- and co-culture and the growth of both bacteria and the transcriptional level of luxS in L. acidophilus cells were monitored. Contrary to L. acidophilus, the growth of L. monocytogenes was significantly affected by co-cultivation. Transcriptional...... during exponential growth in L. acidophilus cells with the highest level in the late-exponential growth phase, decreasing in the stationary phase. Following co-cultivation with L. monocytogenes, the transcriptional level of luxS increased significantly in mid-exponential growing cells of L. acidophilus...

  20. Social and cultural influences on tobacco-related health disparities among South Asians in the USA.

    Science.gov (United States)

    Mukherjea, Arnab; Morgan, Patricia A; Snowden, Lonnie R; Ling, Pamela M; Ivey, Susan L

    2012-07-01

    To explore and understand key cultural contexts of tobacco use among South Asian communities in the USA. Focus groups, with homogeneous compositions of gender, generational status and length of time in the USA, were conducted in two distinct South Asian ethnic enclaves. Focus group findings were triangulated with observational data regarding the availability of culturally specific tobacco from commercial ethnic outlets and cultural events. Respondents included 88 men and women of South Asian descent, aged 18-65 years, immigrant and native born, representing diversity of religion, socioeconomic status and region of origin, with the use of at least one culturally specific tobacco product in previous 24 months. A large number of culturally specific products were commonly used by community members. Knowledge of product-specific health risks was lacking or inaccurate. Many culturally specific tobacco products were considered to have beneficial properties. South Asian tobacco items were used to preserve cultural traditions and express ethnic identity in a new dominant culture. The social and cultural values ascribed to use helped distinguish community members from mainstream society and from other minority populations. Many cultural factors govern tobacco use among diverse global populations. Especially for migrants with a common regional origin, the role of ethnic identity may strongly influence culturally specific tobacco patterns. Qualitative inquiry helps elucidate such culturally framed behaviour in culturally diverse populations. These cultural contexts should be integrated into research and practice. Understanding multidimensional factors influencing non-traditional tobacco use is essential to ensure that comprehensive tobacco control strategies address tobacco-related disparities.

  1. Distinct Neurotoxicity Profile of Listeriolysin O from Listeria monocytogenes

    Science.gov (United States)

    Maurer, Jana; Hupp, Sabrina; Bischoff, Carolin; Foertsch, Christina; Mitchell, Timothy J.; Chakraborty, Trinad; Iliev, Asparouh I.

    2017-01-01

    Cholesterol-dependent cytolysins (CDCs) are protein toxins that originate from Gram-positive bacteria and contribute substantially to their pathogenicity. CDCs bind membrane cholesterol and build prepores and lytic pores. Some effects of the toxins are observed in non-lytic concentrations. Two pathogens, Streptococcus pneumoniae and Listeria monocytogenes, cause fatal bacterial meningitis, and both produce toxins of the CDC family—pneumolysin and listeriolysin O, respectively. It has been demonstrated that pneumolysin produces dendritic varicosities (dendrite swellings) and dendritic spine collapse in the mouse neocortex, followed by synaptic loss and astrocyte cell shape remodeling without elevated cell death. We utilized primary glial cultures and acute mouse brain slices to examine the neuropathological effects of listeriolysin O and to compare it to pneumolysin with identical hemolytic activity. In cultures, listeriolysin O permeabilized cells slower than pneumolysin did but still initiated non-lytic astrocytic cell shape changes, just as pneumolysin did. In an acute brain slice culture system, listeriolysin O produced dendritic varicosities in an NMDA-dependent manner but failed to cause dendritic spine collapse and cortical astrocyte reorganization. Thus, listeriolysin O demonstrated slower cell permeabilization and milder glial cell remodeling ability than did pneumolysin and lacked dendritic spine collapse capacity but exhibited equivalent dendritic pathology. PMID:28098781

  2. Distinct Neurotoxicity Profile of Listeriolysin O from Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Jana Maurer

    2017-01-01

    Full Text Available Cholesterol-dependent cytolysins (CDCs are protein toxins that originate from Gram-positive bacteria and contribute substantially to their pathogenicity. CDCs bind membrane cholesterol and build prepores and lytic pores. Some effects of the toxins are observed in non-lytic concentrations. Two pathogens, Streptococcus pneumoniae and Listeria monocytogenes, cause fatal bacterial meningitis, and both produce toxins of the CDC family—pneumolysin and listeriolysin O, respectively. It has been demonstrated that pneumolysin produces dendritic varicosities (dendrite swellings and dendritic spine collapse in the mouse neocortex, followed by synaptic loss and astrocyte cell shape remodeling without elevated cell death. We utilized primary glial cultures and acute mouse brain slices to examine the neuropathological effects of listeriolysin O and to compare it to pneumolysin with identical hemolytic activity. In cultures, listeriolysin O permeabilized cells slower than pneumolysin did but still initiated non-lytic astrocytic cell shape changes, just as pneumolysin did. In an acute brain slice culture system, listeriolysin O produced dendritic varicosities in an NMDA-dependent manner but failed to cause dendritic spine collapse and cortical astrocyte reorganization. Thus, listeriolysin O demonstrated slower cell permeabilization and milder glial cell remodeling ability than did pneumolysin and lacked dendritic spine collapse capacity but exhibited equivalent dendritic pathology.

  3. Recombinant phage probes for Listeria monocytogenes

    Energy Technology Data Exchange (ETDEWEB)

    Carnazza, S; Gioffre, G; Felici, F; Guglielmino, S [Department of Microbiological, Genetic and Molecular Sciences, University of Messina, Messina (Italy)

    2007-10-03

    Monitoring of food and environmental samples for biological threats, such as Listeria monocytogenes, requires probes that specifically bind biological agents and ensure their immediate and efficient detection. There is a need for robust and inexpensive affinity probes as an alternative to antibodies. These probes may be recruited from random peptide libraries displayed on filamentous phage. In this study, we selected from two phage peptide libraries phage clones displaying peptides capable of specific and strong binding to the L. monocytogenes cell surface. The ability of isolated phage clones to interact specifically with L. monocytogenes was demonstrated using enzyme-linked immunosorbent assay (ELISA) and confirmed by co-precipitation assay. We also assessed the sensitivity of phage-bacteria binding by PCR on phage-captured Listeria cells, which could be detected at a concentration of 10{sup 4} cells ml{sup -1}. In addition, as proof-of-concept, we tested the possibility of immobilizing the affinity-selected phages to a putative biosensor surface. The quality of phage deposition was monitored by ELISA and fluorescent microscopy. Phage-bacterial binding was confirmed by high power optical phase contrast microscopy. Overall, the results of this work validate the concept of affinity-selected recombinant filamentous phages as probes for detecting and monitoring bacterial agents under any conditions that warrant their recognition, including in food products.

  4. Recombinant phage probes for Listeria monocytogenes

    Science.gov (United States)

    Carnazza, S.; Gioffrè, G.; Felici, F.; Guglielmino, S.

    2007-10-01

    Monitoring of food and environmental samples for biological threats, such as Listeria monocytogenes, requires probes that specifically bind biological agents and ensure their immediate and efficient detection. There is a need for robust and inexpensive affinity probes as an alternative to antibodies. These probes may be recruited from random peptide libraries displayed on filamentous phage. In this study, we selected from two phage peptide libraries phage clones displaying peptides capable of specific and strong binding to the L. monocytogenes cell surface. The ability of isolated phage clones to interact specifically with L. monocytogenes was demonstrated using enzyme-linked immunosorbent assay (ELISA) and confirmed by co-precipitation assay. We also assessed the sensitivity of phage-bacteria binding by PCR on phage-captured Listeria cells, which could be detected at a concentration of 104 cells ml-1. In addition, as proof-of-concept, we tested the possibility of immobilizing the affinity-selected phages to a putative biosensor surface. The quality of phage deposition was monitored by ELISA and fluorescent microscopy. Phage-bacterial binding was confirmed by high power optical phase contrast microscopy. Overall, the results of this work validate the concept of affinity-selected recombinant filamentous phages as probes for detecting and monitoring bacterial agents under any conditions that warrant their recognition, including in food products.

  5. Identification of Surface Protein Biomarkers of Listeria monocytogenes via Bioinformatics and Antibody-Based Protein Detection Tools

    Science.gov (United States)

    Zhang, Cathy X. Y.; Brooks, Brian W.; Huang, Hongsheng; Pagotto, Franco

    2016-01-01

    ABSTRACT The Gram-positive bacterium Listeria monocytogenes causes a significant percentage of the fatalities among foodborne illnesses in humans. Surface proteins specifically expressed in a wide range of L. monocytogenes serotypes under selective enrichment culture conditions could serve as potential biomarkers for detection and isolation of this pathogen via antibody-based methods. Our study aimed to identify such biomarkers. Interrogation of the L. monocytogenes serotype 4b strain F2365 genome identified 130 putative or known surface proteins. The homologues of four surface proteins, LMOf2365_0578, LMOf2365_0581, LMOf2365_0639, and LMOf2365_2117, were assessed as biomarkers due to the presence of conserved regions among strains of L. monocytogenes which are variable among other Listeria species. Rabbit polyclonal antibodies against the four recombinant proteins revealed the expression of only LMOf2365_0639 on the surface of serotype 4b strain LI0521 cells despite PCR detection of mRNA transcripts for all four proteins in the organism. Three of 35 monoclonal antibodies (MAbs) to LMOf2365_0639, MAbs M3643, M3644, and M3651, specifically recognized 42 (91.3%) of 46 L. monocytogenes lineage I and II isolates grown in nonselective brain heart infusion medium. While M3644 and M3651 reacted with 14 to 15 (82.4 to 88.2%) of 17 L. monocytogenes lineage I and II isolates, M3643 reacted with 22 (91.7%) of 24 lineage I, II, and III isolates grown in selective enrichment media (UVM1, modified Fraser, Palcam, and UVM2 media). The three MAbs exhibited only weak reactivities (the optical densities at 414 nm were close to the cutoff value) to some other Listeria species grown in selective enrichment media. Collectively, the data indicate the potential of LMOf2365_0639 as a surface biomarker of L. monocytogenes, with the aid of specific MAbs, for pathogen detection, identification, and isolation in clinical, environmental, and food samples. IMPORTANCE L. monocytogenes is

  6. Cleaning and disinfection of biofilms composed of Listeria monocytogenes and background microbiota from meat processing surfaces.

    Science.gov (United States)

    Fagerlund, Annette; Møretrø, Trond; Heir, Even; Briandet, Romain; Langsrud, Solveig

    2017-06-30

    Surfaces of food processing premises are exposed to regular cleaning and disinfection (C&D) regimes, using biocides that are highly effective against bacteria growing as planktonic cells. However, bacteria growing in surface associated communities (biofilms) are typically more tolerant towards C&D than their individual free cells counterparts, and survival of pathogens such as Listeria monocytogenes may be affected by interspecies interactions within biofilms. In this study, Pseudomonas and Acinetobacter were the most frequently isolated genera surviving on conveyor belts subjected to C&D in meat processing plants. In the laboratory, Pseudomonas, Acinetobacter and L. monocytogenes dominated the community both in suspensions and in biofilms formed on conveyor belts, when cultures were inoculated with eleven-genera cocktails of representative bacterial strains from the identified background flora. When biofilms were exposed to daily C&D cycles, mimicking treatments used in food industry, the levels of Acinetobacter and Pseudomonas mandelii diminished, and biofilms were instead dominated by Pseudomonas putida (65-76%), Pseudomonas fluorescens (11-15%) and L. monocytogenes (3-11%). The dominance of certain species after daily C&D correlated with high planktonic growth rates at 12°C and tolerance to C&D. In single-species biofilms, L. monocytogenes developed higher tolerance to C&D over time, both for the peracetic acid and quaternary ammonium disinfectant, indicating that a broad-spectrum mechanism was involved. Survival after C&D appeared to be a common property of L. monocytogenes strains, as both persistent and sporadic subtypes showed equal survival in complex biofilms. Biofilms established preferentially in surface irregularities of conveyor belts, potentially constituting harborage sites for persistent contamination.IMPORTANCE In food industry, efficient production hygiene is a key measure to avoid accumulation of spoilage bacteria and eliminate pathogens

  7. Roles of a novel Crp/Fnr family transcription factor Lmo0753 in soil survival, biofilm production and surface attachment to fresh produce of Listeria monocytogenes.

    Directory of Open Access Journals (Sweden)

    Joelle K Salazar

    Full Text Available Listeria monocytogenes is a foodborne bacterial pathogen and the causative agent of an infectious disease, listeriosis. L. monocytogenes is ubiquitous in nature and has the ability to persist in food processing environments for extended periods of time by forming biofilms and resisting industrial sanitization. Human listeriosis outbreaks are commonly linked to contaminated dairy products, ready-to-eat meats, and in recent years, fresh produce such as lettuce and cantaloupes. We identified a putative Crp/Fnr family transcription factor Lmo0753 that is highly specific to human-associated genetic lineages of L. monocytogenes. Lmo0753 possesses two conserved functional domains similar to the major virulence regulator PrfA in L. monocytogenes. To determine if Lmo0753 is involved in environmental persistence-related mechanisms, we compared lmo0753 deletion mutants with respective wild type and complementation mutants of two fully sequenced L. monocytogenes genetic lineage II strains 10403S and EGDe for the relative ability of growth under different nutrient availability and temperatures, soil survival, biofilm productivity and attachment to select fresh produce surfaces including romaine lettuce leaves and cantaloupe rinds. Our results collectively suggested that Lmo0753 plays an important role in L. monocytogenes biofilm production and attachment to fresh produce, which may contribute to the environmental persistence and recent emergence of this pathogen in human listeriosis outbreaks linked to fresh produce.

  8. Cultural Interpretation of Archaeological Evidence Relating to Astronomy

    Science.gov (United States)

    Iwaniszewski, Stanisław

    The sky is a link between us and our remote ancestors. When we look at the sky, we are aware that our human ancestors were watching our sun, our moon, our planets, and our stars. Evidence of the peoples' different relations with the sky in the past, today, is found by historians and archaeologists. Archaeologists, who keep track of the earliest human history, infer the past lives of human societies from the physical remains of the past found in the soil. Archaeoastronomy holds that from the same archaeological record, we can get insights into the significance of celestial objects and events for the human life in the remote past.

  9. Growth differences and competition between Listeria monocytogenes strains determine their predominance on ham slices and lead to bias during selective enrichment with the ISO protocol.

    Science.gov (United States)

    Zilelidou, Evangelia; Manthou, Evanthia; Skandamis, Panagiotis

    2016-10-17

    Listeria monocytogenes strains are widespread in the environment where they live well mixed, often resulting in multiple strains contaminating a single food sample. The occurrence of different strains in the same food might trigger strain competition, contributing to uneven growth of strains in food and to bias during selective procedures. We tested the growth of seven L. monocytogenes strains (C5, 6179, ScottA, PL24, PL25, PL26, PL27) on ham slices and on nutrient-rich agar at 10°C, singly and in combinations. Strains were made resistant to different antibiotics for their selective enumeration. In addition, growth of single strains (axenic culture) and competition between strains in xenic cultures of two strains was evaluated in enrichment broth and on selective agar. According to ISO 11290-1:1996/Amd 1:2004 standard protocol for detection of L. monocytogenes, two enrichment steps both followed by streaking on ALOA were performed. Strain cultures were directly added in the enrichment broth or used to inoculate minced beef and sliced hams which were then mixed with enrichment broth. 180-360 colonies were used to determine the relative percentage of each strain recovered on plates per enrichment step. The data showed a significant impact of co-cultivation on the growth of six out of seven strains on ham and a bias towards certain strains during selective enrichment. Competition was manifested by: (i) cessation of growth for the outcompeted strain when the dominant strain reached stationary phase, (ii) reduction of growth rates or (iii) total suppression of growth (both on ham and in enrichment broth or ALOA). Outgrowth of strains by their competitors on ALOA resulted in limited to no recovery, with the outcompeting strain accounting for up to 100% of the total recovered colonies. The observed bias was associated with the enrichment conditions (i.e. food type added to the enrichment broth) and the strain-combination. The outcome of growth competition on food or

  10. 78 FR 23901 - Interagency Risk Assessment-Listeria monocytogenes

    Science.gov (United States)

    2013-04-23

    ... Food Safety and Inspection Service Interagency Risk Assessment--Listeria monocytogenes in Retail... risk assessment (QRA), ``Interagency Risk Assessment--Listeria monocytogenes in Retail Delicatessens... and on the FSIS Web site at http://www.fsis.usda.gov/PDF/Listeria-Transcript_062309.pdf ). II....

  11. Incidence and control of Listeria monocytogenes in foods in Denmark

    DEFF Research Database (Denmark)

    Nørrung, Birgit; Andersen, Jens Kirk; Schlundt, Jørgen

    1999-01-01

    The Danish regulatory policy on Listeria monocytogenes in foods is based on the principles of HACCP and was developed using a health risk assessment approach. The Danish policy focuses examinations and criteria for L. monocytogenes in ready-to-eat foods and is based on a combination of inspection...

  12. Resistance of Listeria monocytogenes biofilms to sanitizing agents

    Science.gov (United States)

    Listeria monocytogenes is notorious for its capacity to colonize the environment and equipment of food processing facilities and to persist in the processing plant ecosystem, sometimes for decades. Such persistence is mediated by multiple attributes of L. monocytogenes, including the pathogen’s capa...

  13. Application Progress of Recombinant Attenuated Listeria monocytogenes in Tumor Immunotherapy

    Institute of Scientific and Technical Information of China (English)

    Yin Xiaojiao; Bai Lin; Yang Xu

    2015-01-01

    Much progress of application of bacterial vaccine in treatment and prevention of tumor was acquired,which showed broad prospect in clinical study of animals and humans. Listeria monocytogenes( L. monocytogenes) was considered much important by virtue of its special characteristic of biology and immunology.L. monocytogenes was ingested by professional or part-time phagocytes,survived and proliferated in the phagocytes under synergism of toxic factor secreted by itself,meanwhile,the cellular and humoral immune response was induced. Antigenic gene of specific tumor was loaded in the attenuated L. monocytogenes,which can enhance immune response of host cells. Effective cell targeted to enter tumor tissue and acted on tumor cells to induce apoptosis of tumor cells. Tumor degenerated not easy to reappear. Therefore,recombinant attenuated L. monocytogenes was a safe and effective anti-cancer vaccine vector. Now the work of researchers mainly focuses on solving practical problem in clinical application. Biological characteristics of L. monocytogenes,feasibility and superiority of L. monocytogenes as targeted vaccine vector,problem and prospect of L. monocytogenes in clinical application of anti-tumor were reviewed in this paper.

  14. Listeria monocytogenes growth limits and stress resistance mechanisms

    NARCIS (Netherlands)

    Veen, van der S.

    2008-01-01

    The food-borne pathogen Listeria monocytogenes is a Gram-positive facultative anaerobic rod, which is the causative agent of listeriosis. Due to the severity of the disease and the fact that its incidence is increasing in numerous European countries, L. monocytogenes is of great public health concer

  15. Genome sequences of Listeria monocytogenes strains with resistance to arsenic

    Science.gov (United States)

    Listeria monocytogenes frequently exhibits resistance to arsenic. We report here the draft genome sequences of eight genetically diverse arsenic-resistant L. monocytogenes strains from human listeriosis and food-associated environments. Availability of these genomes would help to elucidate the role ...

  16. Listeria monocytogenes internalizes in Romaine Lettuce grown in greenhouse conditions

    Science.gov (United States)

    Listeria monocytogenes has been implicated in a number of outbreaks involving fresh produce, including an outbreak in 2016 resulting from contaminated packaged salads. The persistence and internalization potential of L. monocytogenes in romaine lettuce was evaluated, and the persistence of two L. mo...

  17. Making sense of (exceptional) causal relations. A cross-cultural and cross-linguistic study.

    Science.gov (United States)

    Le Guen, Olivier; Samland, Jana; Friedrich, Thomas; Hanus, Daniel; Brown, Penelope

    2015-01-01

    In order to make sense of the world, humans tend to see causation almost everywhere. Although most causal relations may seem straightforward, they are not always construed in the same way cross-culturally. In this study, we investigate concepts of "chance," "coincidence," or "randomness" that refer to assumed relations between intention, action, and outcome in situations, and we ask how people from different cultures make sense of such non-law-like connections. Based on a framework proposed by Alicke (2000), we administered a task that aims to be a neutral tool for investigating causal construals cross-culturally and cross-linguistically. Members of four different cultural groups, rural Mayan Yucatec and Tseltal speakers from Mexico and urban students from Mexico and Germany, were presented with a set of scenarios involving various types of causal and non-causal relations and were asked to explain the described events. Three links varied as to whether they were present or not in the scenarios: Intention-to-Action, Action-to-Outcome, and Intention-to-Outcome. Our results show that causality is recognized in all four cultural groups. However, how causality and especially non-law-like relations are interpreted depends on the type of links, the cultural background and the language used. In all three groups, Action-to-Outcome is the decisive link for recognizing causality. Despite the fact that the two Mayan groups share similar cultural backgrounds, they display different ideologies regarding concepts of non-law-like relations. The data suggests that the concept of "chance" is not universal, but seems to be an explanation that only some cultural groups draw on to make sense of specific situations. Of particular importance is the existence of linguistic concepts in each language that trigger ideas of causality in the responses from each cultural group.

  18. Making sense of (exceptional) causal relations. A cross-cultural and cross-linguistic study

    Science.gov (United States)

    Le Guen, Olivier; Samland, Jana; Friedrich, Thomas; Hanus, Daniel; Brown, Penelope

    2015-01-01

    In order to make sense of the world, humans tend to see causation almost everywhere. Although most causal relations may seem straightforward, they are not always construed in the same way cross-culturally. In this study, we investigate concepts of “chance,” “coincidence,” or “randomness” that refer to assumed relations between intention, action, and outcome in situations, and we ask how people from different cultures make sense of such non-law-like connections. Based on a framework proposed by Alicke (2000), we administered a task that aims to be a neutral tool for investigating causal construals cross-culturally and cross-linguistically. Members of four different cultural groups, rural Mayan Yucatec and Tseltal speakers from Mexico and urban students from Mexico and Germany, were presented with a set of scenarios involving various types of causal and non-causal relations and were asked to explain the described events. Three links varied as to whether they were present or not in the scenarios: Intention-to-Action, Action-to-Outcome, and Intention-to-Outcome. Our results show that causality is recognized in all four cultural groups. However, how causality and especially non-law-like relations are interpreted depends on the type of links, the cultural background and the language used. In all three groups, Action-to-Outcome is the decisive link for recognizing causality. Despite the fact that the two Mayan groups share similar cultural backgrounds, they display different ideologies regarding concepts of non-law-like relations. The data suggests that the concept of “chance” is not universal, but seems to be an explanation that only some cultural groups draw on to make sense of specific situations. Of particular importance is the existence of linguistic concepts in each language that trigger ideas of causality in the responses from each cultural group. PMID:26579028

  19. Listeria monocytogenes MDR transporters are involved in LTA synthesis and triggering of innate immunity during infection

    Science.gov (United States)

    Tadmor, Keren; Pozniak, Yair; Burg Golani, Tamar; Lobel, Lior; Brenner, Moran; Sigal, Nadejda; Herskovits, Anat A.

    2014-01-01

    Multi-drug resistance (MDR) transporters are known eponymously for their ability to confer resistance to various antimicrobial drugs. However, it is likely that this is not their primary function and that MDR transporters evolved originally to play additional roles in bacterial physiology. In Listeria monocytogenes a set of MDR transporters was identified to mediate activation of innate immune responses during mammalian cell infection. This phenotype was shown to be dependent on c-di-AMP secretion, but the physiological processes underlying this phenomenon were not completely resolved. Here we describe a genetic approach taken to screen for L. monocytogenes genes or physiological pathways involved in MDR transporter-dependent triggering of the type I interferon response. We found that disruption of L. monocytogenes lipoteichoic acid (LTA) synthesis results in enhanced triggering of type I interferon responses in infected macrophage cells yet does not impact bacterial intracellular growth. This innate immune response required the MDR transporters and could be recapitulated by exposing macrophage cells to culture supernatants derived from LTA mutant bacteria. Notably, we found that the MDR transporters themselves are required for full production of LTA, an observation that links MDR transporters to LTA synthesis for the first time. In light of our findings, we propose that the MDR transporters play a role in regulating LTA synthesis, possibly via c-di-AMP efflux, a physiological function in cell wall maintenance that triggers the host innate immune system. PMID:24611134

  20. Mechanism involved in phagocytosis and killing of Listeria monocytogenes by Acanthamoeba polyphaga.

    Science.gov (United States)

    Akya, Alisha; Pointon, Andrew; Thomas, Connor

    2009-10-01

    Intra-cellular pathogen, Listeria monocytogenes, is capable of invasion and survival within mammalian cells. However, Acanthamoeba polyphaga trophozoites phagocytose and rapidly degrade Listeria cells. In order to provide more information on amoeba phagocytosis and killing mechanisms, this study used several inhibitor agents known to affect the phagocytosis and killing of bacteria by eukaryotes. Amoebae were pre-treated with mannose, cytochalasin D, wortmannin, suramin, ammonium chloride, bafilomycin A and monensin followed by co-culture with bacteria. Phagocytosis and killing of bacterial cells by amoeba trophozoites was assessed using plate counting methods and microscopy. The data presented indicates that actin polymerisation and cytoskeletal rearrangement are involved in phagocytosis of L. monocytogenes cells by A. polyphaga trophozoites. Further, both phagosomal acidification and phagosome-lysosome fusion are involved in killing and degradation of L. monocytogenes cells by A. polyphaga. However, the mannose-binding protein receptor does not play an important role in uptake of bacteria by amoeba trophozoites. In conclusion, this data reveals the similar principles of molecular mechanisms used by different types of eukaryotes in uptake and killing of bacteria.

  1. Effects of CO2 on the resuscitation of Listeria monocytogenes injured by various bactericidal treatments.

    Science.gov (United States)

    Van Houteghem, Nancy; Devlieghere, Frank; Rajkovic, Andreja; Gómez, Sandra Maria Osés; Uyttendaele, Mieke; Debevere, Johan

    2008-03-31

    To assure the microbiological safety and quality of a food product, a combination of preservation hurdles is often used. Therefore, the effects of carbon dioxide at concentrations of 0, 20, 40 and 60% in modified atmospheres on the resuscitation of Listeria monocytogenes cells injured by mild bactericidal treatments during storage at 7 degrees C were examined. The bactericidal treatments were intense light pulses (ILP), chlorine dioxide (ClO(2)), lactic acid (LA) and heat. The results indicated additional bactericidal effects of CO(2) on cultures treated with LA, ClO(2) and ILP, with additional reductions in viable L. monocytogenes of 0.5-1.0 log cfu/ml. Lag phase duration was significantly different between the different treatments, with non-treated cells having the shortest lag phase, followed by that of heat, intense light pulses, lactic acid and finally ClO(2) treated cells. Maximum growth rate was also estimated and results showed a negative correlation with increasing CO(2) concentrations. A relationship was found between the amount of sub-lethally damaged cells after a mild inactivation treatment and the lag phase duration in the CO(2) environment. Current findings demonstrate the possibility that combining mild decontamination treatments and packaging in a CO(2) enriched environment could reduce the risk of L. monocytogenes infections in food due to an extension of the lag phase.

  2. Culturally related stress, hopelessness, and vulnerability to depressive symptoms and suicidal ideation in emerging adulthood.

    Science.gov (United States)

    Polanco-Roman, Lillian; Miranda, Regina

    2013-03-01

    Culturally related experiences are seldom considered in assessing risk for suicidal behavior among emerging adults, despite racial/ethnic differences in suicide attempts. The present study examined the impact of culturally related stressors on hopelessness, symptoms of depression, and suicidal ideation-well-known predictors of suicidal behavior-among emerging adults over time, and whether hopelessness would mediate the relation between culturally related stressors and both depression and ideation. An ethnically diverse sample of 143 emerging adults, ages 18 to 25, completed self-report measures of acculturative stress, perceived discrimination, and depressive symptoms at 1 time point, and self-report measures of ethnic identity, hopelessness, depressive symptoms, and suicidal ideation 2 to 3years later. Higher baseline acculturative stress and perceived discrimination predicted hopelessness, but not symptoms of depression, when entered simultaneously into a regression analysis. However, there was an indirect relation between these culturally related stressors and depressive symptoms through hopelessness. There was also a direct relation between acculturative stress at baseline and suicidal ideation at follow-up, and hopelessness mediated this relation. However, the indirect relations between culturally related stressors and depression and suicidal ideation through hopelessness were only present at low levels of ethnic identity, but not at average or high levels of ethnic identity. Acculturative stress and perceived discrimination may thus increase vulnerability to depression and suicidal ideation to the extent that they increase hopelessness, but a strong ethnic identity may buffer against this relation. This study highlights the need for incorporating culturally related experiences in assessing risk for suicidal ideation and behavior, particularly among emerging adults from diverse backgrounds. Copyright © 2012. Published by Elsevier Ltd.

  3. Deciphering the intracellular metabolism of Listeria monocytogenes by mutant screening and modelling

    Directory of Open Access Journals (Sweden)

    Dandekar Thomas

    2010-10-01

    Full Text Available Abstract Background The human pathogen Listeria monocytogenes resides and proliferates within the cytoplasm of epithelial cells. While the virulence factors essentially contributing to this step of the infection cycle are well characterized, the set of listerial genes contributing to intracellular replication remains to be defined on a genome-wide level. Results A comprehensive library of L. monocytogenes strain EGD knockout mutants was constructed upon insertion-duplication mutagenesis, and 1491 mutants were tested for their phenotypes in rich medium and in a Caco-2 cell culture assay. Following sequencing of the plasmid insertion site, 141 different genes required for invasion of and replication in Caco-2 cells were identified. Ten in-frame deletion mutants were constructed that confirmed the data. The genes with known functions are mainly involved in cellular processes including transport, in the intermediary metabolism of sugars, nucleotides and lipids, and in information pathways such as regulatory functions. No function could be ascribed to 18 genes, and a counterpart of eight genes is missing in the apathogenic species L. innocua. Mice infection studies revealed the in vivo requirement of IspE (Lmo0190 involved in mevalonate synthesis, and of the novel ABC transporter Lmo0135-0137 associated with cysteine transport. Based on the data of this genome-scale screening, an extreme pathway and elementary mode analysis was applied that demonstrates the critical role of glycerol and purine metabolism, of fucose utilization, and of the synthesis of glutathione, aspartate semialdehyde, serine and branched chain amino acids during intracellular replication of L. monocytogenes. Conclusion The combination of a genetic screening and a modelling approach revealed that a series of transporters help L. monocytogenes to overcome a putative lack of nutrients within cells, and that a high metabolic flexibility contributes to the intracellular replication of

  4. Genome-wide analyses reveal lineage specific contributions of positive selection and recombination to the evolution of Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Sun Qi

    2008-08-01

    Full Text Available Abstract Background The genus Listeria includes two closely related pathogenic and non-pathogenic species, L. monocytogenes and L. innocua. L. monocytogenes is an opportunistic human foodborne and animal pathogen that includes two common lineages. While lineage I is more commonly found among human listeriosis cases, lineage II appears to be overrepresented among isolates from foods and environmental sources. This study used the genome sequences for one L. innocua strain and four L. monocytogenes strains representing lineages I and II, to characterize the contributions of positive selection and recombination to the evolution of the L. innocua/L. monocytogenes core genome. Results Among the 2267 genes in the L. monocytogenes/L. innocua core genome, 1097 genes showed evidence for recombination and 36 genes showed evidence for positive selection. Positive selection was strongly associated with recombination. Specifically, 29 of the 36 genes under positive selection also showed evidence for recombination. Recombination was more common among isolates in lineage II than lineage I; this trend was confirmed by sequencing five genes in a larger isolate set. Positive selection was more abundant in the ancestral branch of lineage II (20 genes as compared to the ancestral branch of lineage I (9 genes. Additional genes under positive selection were identified in the branch separating the two species; for this branch, genes in the role category "Cell wall and membrane biogenesis" were significantly more likely to have evidence for positive selection. Positive selection of three genes was confirmed in a larger isolate set, which also revealed occurrence of multiple premature stop codons in one positively selected gene involved in flagellar motility (flaR. Conclusion While recombination and positive selection both contribute to evolution of L. monocytogenes, the relative contributions of these evolutionary forces seem to differ by L. monocytogenes lineages and

  5. Behavior of Escherichia coli O157:H7 and Listeria monocytogenes during fermentation and storage of camel yogurt.

    Science.gov (United States)

    Al-Nabulsi, Anas A; Olaimat, Amin N; Osaili, Tareq M; Ayyash, Mutamed M; Abushelaibi, Aisha; Jaradat, Ziad W; Shaker, Reyad; Al-Taani, Mahmoud; Holley, Richard A

    2016-03-01

    In addition to its nutritional and therapeutic properties, camel milk has the ability to suppress the growth of a wide range of foodborne pathogens, but there is a lack of information regarding the behavior of these pathogens in products such as yogurt produced from camel milk. The objective of the current study was to investigate the behavior of Listeria monocytogenes and Escherichia coli O157:H7 during manufacture and storage of camel yogurt. Camel milk inoculated with L. monocytogenes and E. coli O157:H7 was fermented at 43° C for 5h using freeze-dried lactic acid bacteria (LAB) starter cultures (Streptococcus thermophilus and Lactobacillus bulgaricus) and stored at 4 or 10 °C for 14 d. Camel milk inoculated with L. monocytogenes and E. coli O157:H7 without starter culture was also prepared. During fermentation, the numbers of L. monocytogenes and E. coli O157:H7 increased 0.3 and 1.6 log cfu/mL, respectively, in the presence of LAB, and by 0.3 and 2.7 log cfu/mL in the absence of LAB. During storage at 4 or 10 °C, L. monocytogenes increased 0.8 to 1.2 log cfu/mL by 14 d in camel milk without LAB, but in the presence of LAB, the numbers of L. monocytogenes were reduced by 1.2 to 1.7 log cfu/mL by 14 d. Further, E. coli O157:H7 numbers in camel milk were reduced by 3.4 to 3.5 log cfu/mL in the absence of LAB, but E. coli O157:H7 was not detected (6.3 log cfu/mL reduction) by 7d in camel yogurt made with LAB and stored at either temperature. Although camel milk contains high concentrations of natural antimicrobials, L. monocytogenes was able to tolerate these compounds in camel yogurt stored at refrigerator temperatures. Therefore, appropriate care should be taken during production of yogurt from camel milk to minimize the potential for postprocess contamination by this and other foodborne pathogens.

  6. Prevalence and biofilm-forming ability of Listeria monocytogenes in New Zealand mussel (Perna canaliculus) processing plants.

    Science.gov (United States)

    Cruz, Cristina D; Fletcher, Graham C

    2011-10-01

    Greenshell™ mussels are New Zealand's largest seafood export species. Some export markets require compliance with 'zero' tolerance legislation for Listeria monocytogenes in 25 g of product. Even though individually quick frozen (IQF) mussel products are labeled 'to be cooked', and are not classified as ready-to-eat, some markets still require them to comply with the strict policy. Three mussel processing plants were assessed for the pattern of L. monocytogenes contamination on raw material, environment, food contact surfaces, and in the final product. Cultures (n = 101) obtained from an industrial Listeria monitoring program from August 2007 to June 2009 were characterized by serotyping and pulsed field gel electrophoresis. Using the crystal violet method, isolates were assessed for their ability to form biofilms. This work confirmed the presence of L. monocytogenes in raw and processed product, and the importance of cross-contamination from external and internal environments. Processing plants had L. monocytogenes pulsotypes that were detected more than once over 6 months. No correlation was found between biofilm-forming ability and persistent isolates. Two pulsotypes (including a persistent one), were previously isolated in human cases of listeriosis in New Zealand, but none of the pulsotypes matched those involved in international outbreaks.

  7. Elongated cells of Listeria monocytogenes in biofilms in the presence of sucrose and bacteriocin-producing Leuconostoc mesenteroides A11

    Directory of Open Access Journals (Sweden)

    Regiane Priscilla Ratti

    2010-12-01

    Full Text Available Listeria monocytogenes is a foodborne pathogen which may survive in biofilms and persist in food processing plants. In this study, the ability of Leuconostoc mesenteroides (bac+ and bac- to inhibit biofilm formation by L. monocytogenes ATCC 19115 was studied with stainless steel coupons immersed in BHI broth and BHI broth plus sucrose in combination with the Lactic Acid Bacteria (LAB. Adhered cells were collected with swabs and enumerated on selective agars (Oxford for listeria and MRS for leuconostoc. Leuconostoc mesenteroides bac+ in co-culture with L. monocytogenes was effective to inhibit biofilm formation by listeria for up to 3 hours of incubation, but at 24 hours, biofilm was present in all conditions tested, as confirmed by observations of stainless steel coupons under Scanning Electron Microscopy (SEM. It was also observed that in the presence of L. mesenteroides bac+ in BHI plus sucrose, a high number of elongated cells of L. monocytogenes was present, which may indicate an adaptation response of the pathogen to stress conditions with important implications for food safety.

  8. Prevalence of Listeria monocytogenes in Idiazabal cheese Prevalencia de Listeria monocytogenes en queso Idiazabal

    Directory of Open Access Journals (Sweden)

    E. Arrese

    2012-12-01

    Full Text Available Introduction: Raw-milk cheese has been identified in risk assessment as a food of greater concern to public health due to listeriosis. Objective: To determine the prevalence and levels of Listeria monocytogenes in semi-hard Idiazabal cheese manufactured by different producers in the Basque Country at consumer level. Methodology: A total of 51 Idiazabal cheese samples were obtained from 10 separate retail establishments, chosen by stratified random sampling. Samples were tested using the official standard ISO procedure 11290-1 for detection and enumeration methods. Results and conclusion: All cheese samples tested negative for L. monocytogenes. However, 9.8% tested positive for Listeria spp., different from L. monocytogenes. Positive samples came from two brands, two were natural and three were smoked. The presence of Listeria spss. suggests that the cheese making process and the hygiene whether at milking or during cheese making could be insufficient.Introducción: Listeria monocytogenes se ha asociado a quesos elaborados a partir de leche cruda, lo que supone un importante riesgo de salud pública debido a la listeriosis. Objetivo: Estudiar la prevalencia y los niveles de L. monocytogenes en quesos Idiazabal semi-curados de distintos productores del País Vasco, a nivel de consumidor. Metodología: Se analizaron 51 muestras de queso Idiazabal procedentes de 10 establecimientos de venta al público; el muestreo fue aleatorio y estratificado. Los análisis se hicieron según el método de detección y de enumeración del procedimiento estandarizado ISO 11290-1. Resultados y conclusión: Todas las muestras dieron negativo para L. monocytogenes. Sin embargo, el 9,8% dio positivo para Listeria spp., distinta de L. monocytogenes. Las muestras positivas procedían de dos marcas, dos eran quesos naturales y tres ahumados. La presencia de Listeria spss. sugiere que el procesado del queso y la higiene durante el ordeño o durante la fabricación podr

  9. Atlas(®) Listeria monocytogenes LmG2 Detection Assay Using Transcription Mediated Amplification to Detect Listeria monocytogenes in Selected Foods and Stainless Steel Surface.

    Science.gov (United States)

    Bres, Vanessa; Yang, Hua; Hsu, Ernie; Ren, Yan; Cheng, Ying; Wisniewski, Michele; Hanhan, Maesa; Zaslavsky, Polina; Noll, Nathan; Weaver, Brett; Campbell, Paul; Reshatoff, Michael; Becker, Michael

    2014-01-01

    The Atlas Listeria monocytogenes LmG2 Detection Assay, developed by Roka Bioscience Inc., was compared to a reference culture method for seven food types (hot dogs, cured ham, deli turkey, chicken salad, vanilla ice cream, frozen chocolate cream pie, and frozen cheese pizza) and one surface (stainless steel, grade 316). A 125 g portion of deli turkey was tested using a 1:4 food:media dilution ratio, and a 25 g portion for all other foods was tested using 1:9 food:media dilution ratio. The enrichment time and media for Roka's method was 24 to 28 h for 25 g food samples and environmental surfaces, and 44 to 48 h for 125 g at 35 ± 2°C in PALCAM broth containing 0.02 g/L nalidixic acid. Comparison of the Atlas Listeria monocytogenes LmG2 Detection Assay to the reference method required an unpaired approach. For each matrix, 20 samples inoculated at a fractional level and five samples inoculated at a high level with a different strain of Listeria monocytogenes were tested by each method. The Atlas Listeria monocytogenes LmG2 Detection Assay was compared to the Official Methods of Analysis of AOAC INTERNATIONAL 993.12 method for dairy products, the U.S. Department of Agriculture, Food Safety and Inspection Service, Microbiology Laboratory Guidebook 8.08 method for ready-to-eat meat and environmental samples, and the U.S. Food and Drug Administration Bacteriological Analytical Manual, Chapter 10 method for frozen foods. In the method developer studies, Roka's method, at 24 h (or 44 h for 125 g food samples), had 126 positives out of 200 total inoculated samples, compared to 102 positives for the reference methods at 48 h. In the independent laboratory studies, vanilla ice cream, deli turkey and stainless steel grade 316 were evaluated. Roka's method, at 24 h (or 44 h for 125 g food samples), had 64 positives out of 75 total inoculated samples compared to 54 positives for the reference methods at 48 h. The Atlas Listeria monocytogenes LmG2 Detection Assay detected all 50

  10. pH and solute concentration of suspension media affect the outcome of high hydrostatic pressure treatment of Listeria monocytogenes.

    Science.gov (United States)

    Koseki, Shigenobu; Yamamoto, Kazutaka

    2006-09-01

    The effect of pH and solute concentration of suspension media on high hydrostatic pressure (HHP) induced inactivation of Listeria monocytogenes (approximate 10(8) CFU/ml) was investigated by the using treatment between 300 MPa and 600 MPa at 25 degrees C for 10 min. The suspension media used in this study represented different concentrations (0.1% to 10%) of buffered peptone water (BPW) with an adjusted pH of 4 to 7. An increase in the concentration of BPW resulted in a decreased HHP-induced inactivation of L. monocytogenes that was dependent on the pH of the medium. HHP-treatment at 300 MPa showed no bactericidal effect at neutral pH regardless of the BPW concentration. When the pH of BPW (0.1% to 5%) was reduced to 4, L. monocytogenes was completely inactivated (more than an 8 log cycle reduction) with a HHP-treatment of at least 300 MPa. HHP-treatment above 400 MPa completely inactivated L. monocytogenes in a relatively dilute BPW (0.1% and 1%) with an adjusted pH below 6. While only a 2 log cycle reduction was observed in 10% BPW at the pH ranging from 5 to 7 after treatment with 600 MPa, L. monocytogenes in 10% BPW at pH 4 was completely inactivated. Even though a significant bactericidal effect of HHP-treatment was not observed when applied with a low pressure such as 300 MPa or suspended in higher BPW at neutral pH, a reduction of the pH greatly affected the HHP-induced inactivation of L. monocytogenes. These results indicated that information concerning the pH of food or media would greatly assist an optimization of HHP-treatment for the inactivation of bacteria.

  11. The survival of Listeria monocytogenes during long term desiccation is facilitated by sodium chloride and organic material.

    Science.gov (United States)

    Vogel, Birte Fonnesbech; Hansen, Lisbeth Truelstrup; Mordhorst, Hanne; Gram, Lone

    2010-06-15

    One specific DNA-subtype, as determined by RAPD, of Listeria monocytogenes persisted in a fish slaughterhouse for years, even during months with no production where the plant was cleaned and kept dry. We hypothesised that tolerance to desiccation could be a factor in explaining the persistence of L. monocytogenes in food processing environments and the purpose of the present study was to determine ability of L. monocytogenes to survive desiccation on stainless steel under simulated food processing conditions. Viable counts of eight different L. monocytogenes strains exposed to different soils and relative humidities (RHs) during desiccation decreased significantly (pDesiccation in physiological peptone saline (PPS) reduced survivors by 3-5 log units whereas bacterial cells suspended in bacteriological growth substrates (tryptone soy broth with 1% glucose, TSB-glu) or PPS with 5% NaCl only were reduced by 1-3 log units. At RHs of 2, 43 and 75%, surfaces were visibly dry after 1, 3 and 5days of incubation, respectively. The lowest RH resulted in the most significant loss of viability, however, 10(3)-10(4)CFU/cm(2) remained viable regardless of the desiccation treatment (i.e., presence of TSB-glu and/or salt). At 75% RH, the bacterial counts remained almost constant when desiccated in TSB-glu. When bacteria were grown and desiccated (15 degrees C, 43% RH) in salmon or smoked salmon juice, survivors decreased slowly resulting in low numbers (10(2)-10(3)CFU/cm(2)) from all eight strains remaining viable after 3months. Whilst conditions during desiccation had a pronounced influence on inactivation kinetics and the number of survivors, persistent L. monocytogenes were not more tolerant to desiccation than presumed non-persistent isolates. Our study shows that the ability to survive for months during desiccated conditions may be a factor explaining the ability of L. monocytogenes to persist in food processing environments. Copyright 2010 Elsevier B.V. All rights reserved.

  12. Making sense of (exceptional causal relations. A cross-cultural and cross-linguistic study

    Directory of Open Access Journals (Sweden)

    Olivier eLe Guen

    2015-10-01

    Full Text Available In order to make sense of the world, humans tend to see causation almost everywhere. Although most causal relations may seem straightforward, they are not always construed in the same way cross-culturally. In this study, we investigate concepts of ‘chance’, ‘coincidence’ or ‘randomness’ that refer to assumed relations between intention, action, and outcome in situations, and we ask how people from different cultures make sense of such non-law-like connections. Based on a framework proposed by Alicke (2000, we administered a task that aims to be a neutral tool for investigating causal construals cross-culturally and cross-linguistically. Members of four different cultural groups, rural Mayan Yucatec and Tseltal speakers from Mexico and urban students from Mexico and Germany, were presented with a set of scenarios involving various types of causal and non-causal relations and were asked to explain the described events. Three links varied as to whether they were present or not in the scenarios: Intention to Action, Action to Outcome, and Intention to Outcome. Our results show that causality is recognized in all four cultural groups. However, how causality and especially non-law-like causality are interpreted depends on the type of links, the cultural background and the language used. In all three groups, Action to Outcome is the decisive link for recognizing causality. Despite the fact that the two Mayan groups share similar cultural backgrounds, they display different ideologies regarding concepts of non-law causality. The data suggests that the concept of ‘chance’ is not universal, but seems to be an explanation that only some cultural groups draw on to make sense of specific situations. Of particular importance is the existence of linguistic concepts in each language that trigger ideas of causality in the responses from each cultural group.

  13. Internalin profiling and multilocus sequence typing suggest four Listeria innocua subgroups with different evolutionary distances from Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Wang Jun

    2010-03-01

    Full Text Available Abstract Background Ecological, biochemical and genetic resemblance as well as clear differences of virulence between L. monocytogenes and L. innocua make this bacterial clade attractive as a model to examine evolution of pathogenicity. This study was attempted to examine the population structure of L. innocua and the microevolution in the L. innocua-L. monocytogenes clade via profiling of 37 internalin genes and multilocus sequence typing based on the sequences of 9 unlinked genes gyrB, sigB, dapE, hisJ, ribC, purM, gap, tuf and betL. Results L. innocua was genetically monophyletic compared to L. monocytogenes, and comprised four subgroups. Subgroups A and B correlated with internalin types 1 and 3 (except the strain 0063 belonging to subgroup C and internalin types 2 and 4 respectively. The majority of L. innocua strains belonged to these two subgroups. Subgroup A harbored a whole set of L. monocytogenes-L. innocua common and L. innocua-specific internalin genes, and displayed higher recombination rates than those of subgroup B, including the relative frequency of occurrence of recombination versus mutation (ρ/θ and the relative effect of recombination versus point mutation (r/m. Subgroup A also exhibited a significantly smaller exterior/interior branch length ratio than expected under the coalescent model, suggesting a recent expansion of its population size. The phylogram based on the analysis with correction for recombination revealed that the time to the most recent common ancestor (TMRCA of L. innocua subgroups A and B were similar. Additionally, subgroup D, which correlated with internalin type 5, branched off from the other three subgroups. All L. innocua strains lacked seventeen virulence genes found in L. monocytogenes (except for the subgroup D strain L43 harboring inlJ and two subgroup B strains bearing bsh and were nonpathogenic to mice. Conclusions L. innocua represents a young species descending from L. monocytogenes and

  14. Identification of Listeria monocytogenes on Green Mussels (Perna viridis) and Cockle Shell (Anadara granosa)

    OpenAIRE

    Winiati Puji Rahayu; Rini Riniati; Siti Nurjanah; Caecillia Chrismie Nurwitri

    2016-01-01

    Green mussel (Perna viridis) and cockle shell (Anadara granosa) are one of many sources of animalprotein which is many cultivated in Indonesia because their price is relatively affordable. This study wasconducted to identify the presence of Listeria monocytogenes in 27 samples of green mussels and 3 samplesof cockle shells using real-time Polymerase Chain Reaction (real-time PCR) and biochemical methods. Thetarget gene for amplification in real-time PCR was an hlyA gene because this gene was ...

  15. PEDAGIGOCAL TECHNIQUE OF BUILDING THE CULTURE OF INTERPERSONAL RELATIONS IN PRESCHOOL CHILDREN AT ART CLASSES

    Directory of Open Access Journals (Sweden)

    Svetlana Vyacheslavovna Kahnovich

    2013-10-01

    Full Text Available The article looks at the pedagogical technique of building the culture of interpersonal relations in preschool children at the local and modular level. Interpersonal relations are viewed as the module and art classes as the local level. The research is timely as it can assist in studying the problem of moral development of preschool children by building the culture of interpersonal relations by artistic education means. The study presents novelty concluding from the survey of scientific literature. The process of building the culture of interpersonal relations in children has not been properly studied by preschool pedagogy. The task of the present study is to elaborate a pedagogical technique to build the culture of interpersonal relations between children at art classes. The article discusses ‘technological’ criteria (term by G.K. Selevko and presents interactive principles of the pedagogical technique. Group activities alongside with individual ones were viewed as organizational forms of art classes. Building the culture of interpersonal relations in preschool children at art classes is closely connected with the development of their personality, a child’s  consciousness, their motivational and conceptual spheres during their gradual moral development at various levels - emotional (attitude, axiological level, psychic (intentional cognitive processes, activity (artistic and interpersonal literacy. Graphic (projective methods were used to analyze age dynamics of ethical and moral development. The conclusion describes a set of pedagogical conditions for efficient building of the culture of interpersonal relations in children at art classes.  Goal. To elaborate a pedagogical technique for building the culture of interpersonal relations in preschool children at art classes. The technique can be applied at local and modular level.Methods and Methodology. The pedagogical technique is aimed at building the culture of interpersonal relations

  16. Culturally sensitive health counseling to prevent lifestyle-related diseases in Japan.

    Science.gov (United States)

    Marutani, Miki; Miyazaki, Misako

    2010-09-01

    This study explored the methods that are used by public health nurses to provide culturally sensitive health counseling to elderly Japanese farmers in order to motivate them to adopt healthy behaviors. Fourteen elderly farmers (eight men and six women) from three rural communities underwent health counseling and then changed their habits to prevent lifestyle-related diseases. Qualitative and inductive analyses were conducted to determine the effects of the culturally sensitive counseling. Five methods for providing culturally sensitive counseling were identified: (i) showing an interest in, and respect for, the local culture; (ii) stimulating the participants' awareness of the health risks inherited in their local cultural practices through the use of familiar examples; (iii) accepting and understanding the participants' ambivalence about their local culture; (iv) connecting the reasons for the participants to change their lifestyle with their local culture; and (v) adjusting the health-promoting behaviors of the participants to fit their local culture. Public health nurses should consider the pride that elderly farmers have in their background and their resistance to change and use these factors to point out the discrepancies in their lifestyle and promote more quality-of-life-oriented and practical self-care behaviors.

  17. Adolescents’ willingness for intergenerational support: Relations to maternal expectations and mothers’ life satisfaction in 14 cultures

    OpenAIRE

    Mayer, Boris; Schwarz, Beate; Trommsdorff, Gisela

    2015-01-01

    How is adolescents’ willingness for intergenerational support affected by parents’ expectations and parenting behavior? Does youths’ willingness for intergenerational support in turn affect parents’ well-being? The current study addresses these questions from a cross-cultural perspective, using data from connected samples of mother-adolescent dyads (N = 4162) from 14 diverse cultural contexts as part of the “Value of Children and Intergenerational Relations Study” (Trommsdorff & Nauck, 2005)....

  18. Promotional Cultures: The Rise and Spread of Advertising, Public Relations, Marketing and Branding

    OpenAIRE

    Davis, Aeron

    2013-01-01

    In the twenty-first century, promotion is everywhere and everything has become promotable: everyday goods and organizations, people and ideas, cultures and futures. This engaging book looks at the rise of advertising, public relations, branding, marketing and lobbying, and explores where our promotional times have taken us.\\ud \\ud Promotional Cultures documents how the professions and practices of promotion have interacted with and reshaped so much in our world, from commodities, celebrities ...

  19. Survival and growth of Listeria monocytogenes on whole cantaloupes is dependent on site of contamination and storage temperature

    Science.gov (United States)

    Whole cantaloupes (Cucumis melo L), marketed as ‘Rocky Ford’, were implicated in a large multi-state outbreak of listeriosis in the United States in 2011; however, survival and growth of Listeria monocytogenes on whole cantaloupes remains relatively unexplored. The research presented here evaluated ...

  20. 31 CFR 585.212 - Prohibited transactions related to scientific and technical cooperation, cultural exchanges, and...

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false Prohibited transactions related to scientific and technical cooperation, cultural exchanges, and other official visits. 585.212 Section 585.212 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) OFFICE OF FOREIGN ASSETS CONTROL, DEPARTMENT OF THE...

  1. Belief, Knowledge and Understanding: How to Deal with the Relations between Different Cultural Perspectives in Classrooms

    Science.gov (United States)

    Moreira-dos-Santos, Frederik; El-Hani, Charbel N.

    2017-01-01

    This article discusses how to deal with the relations between different cultural perspectives in classrooms, based on a proposal for considering understanding and knowledge as goals of science education, inspired by Dewey's naturalistic humanism. It thus combines educational and philosophical interests. In educational terms, our concerns relate to…

  2. Using Relational-Cultural Theory to Conceptualize Couple Interventions in the Treatment of Sex Addiction

    Science.gov (United States)

    Vogel, Joanne E.

    2007-01-01

    Sex addictions have become an increasing concern since the growth of the sex industry, sex in advertising, and the ease of Internet access to sex. This article uses the foundational principles of Relational-Cultural Theory (RCT) to conceptualize sexual addiction and its relational impact. Particular attention is paid to the principles of…

  3. Cultural Differences in an Interorganizational Network: Shared Public Relations Firms among Japanese and American Companies.

    Science.gov (United States)

    Jang, Ha-Yong

    1997-01-01

    Investigates impact of national culture on interorganizational relationships among organizations. Matches 35 Japanese and American companies by their business types. Reveals that the network of shared public relations firms was loosely connected--American companies were more central. Indicates the network structure of shared public relations firms…

  4. Listeriolysin S, a novel peptide haemolysin associated with a subset of lineage I Listeria monocytogenes.

    Directory of Open Access Journals (Sweden)

    Paul D Cotter

    Full Text Available Streptolysin S (SLS is a bacteriocin-like haemolytic and cytotoxic virulence factor that plays a key role in the virulence of Group A Streptococcus (GAS, the causative agent of pharyngitis, impetigo, necrotizing fasciitis and streptococcal toxic shock syndrome. Although it has long been thought that SLS and related peptides are produced by GAS and related streptococci only, there is evidence to suggest that a number of the most notorious Gram-positive pathogenic bacteria, including Listeria monocytogenes, Clostridium botulinum and Staphylococcus aureus, produce related peptides. The distribution of the L. monocytogenes cluster is particularly noteworthy in that it is found exclusively among a subset of lineage I strains; i.e., those responsible for the majority of outbreaks of listeriosis. Expression of these genes results in the production of a haemolytic and cytotoxic factor, designated Listeriolysin S, which contributes to virulence of the pathogen as assessed by murine- and human polymorphonuclear neutrophil-based studies. Thus, in the process of establishing the existence of an extended family of SLS-like modified virulence peptides (MVPs, the genetic basis for the enhanced virulence of a proportion of lineage I L. monocytogenes may have been revealed.

  5. PATOGENESIS DE Listeria monocytogenes, MICROORGANISMO ZOONOTICO EMERGENTE.

    OpenAIRE

    Torres, Kirvis; Sierra, Sara; Potou, Raul; Carrascal, Ana; Mercado, Marcela

    2005-01-01

    Listeria monocytogenes además de ser un paradigma para la investigación inmunológica se ha convertido en sistema modelo apropiado para el análisis de los mecanismos moleculares del parasitismo intracelular de otras bacterias. Investigadores en el área de la inmunología se interesaron en este microorganismo cuando se reconoció el riesgo que representaba para la salud pública y la seguridad en la industria de alimentos. Desde mediados de los años 80’s se ha investigado la biología molecular de ...

  6. The influence of subminimal inhibitory concentrations of benzalkonium chloride on biofilm formation by Listeria monocytogenes.

    Science.gov (United States)

    Ortiz, Sagrario; López, Victoria; Martínez-Suárez, Joaquín V

    2014-10-17

    Disinfectants, such as benzalkonium chloride (BAC), are commonly used to control Listeria monocytogenes and other pathogens in food processing plants. Prior studies have demonstrated that the resistance to BAC of L. monocytogenes was associated with the prolonged survival of three strains of molecular serotype 1/2a in an Iberian pork processing plant. Because survival in such environments is related to biofilm formation, we hypothesised that the influence of BAC on the biofilm formation potential of L. monocytogenes might differ between BAC-resistant strains (BAC-R, MIC≥10mg/L) and BAC-sensitive strains (BAC-S, MIC≤2.5mg/L). To evaluate this possibility, three BAC-R strains and eight BAC-S strains, which represented all of the molecular serotype 1/2a strains detected in the sampled plant, were compared. Biofilm production was measured using the crystal violet staining method in 96-well microtitre plates. The BAC-R strains produced significantly (p<0.05) less biofilm than the BAC-S in the absence of BAC, independent of the rate of planktonic growth. In contrast, when the biofilm values were measured in the presence of BAC, one BAC-R strain (S10-1) was able to form biofilm at 5mg/L of BAC, which prevented biofilm formation among the rest of the strains. A genetic determinant of BAC resistance recently described in L. monocytogenes (Tn6188) was detected in S10-1. When a BAC-S strain and its spontaneous mutant BAC-R derivative were compared, resistance to BAC led to biofilm formation at 5mg/L of BAC and to a significant (p<0.05) stimulation of biofilm formation at 1.25mg/L of BAC, which significantly (p<0.05) reduced the biofilm level in the parent BAC-S strain. Our results suggest that the effect of subminimal inhibitory concentrations of BAC on biofilm production by L. monocytogenes might differ between strains with different MICs and even between resistant strains with similar MICs but different genetic determinants of BAC resistance. For BAC-R strains similar

  7. Influence of sublethal concentrations of common disinfectants on expression of virulence genes in Listeria monocytogenes

    DEFF Research Database (Denmark)

    Kastbjerg, Vicky Gaedt; Larsen, M. H.; Gram, Lone

    2010-01-01

    Listeria monocytogenes is a food-borne human pathogen that causes listeriosis, a relatively rare infection with a high fatality rate. The regulation of virulence gene expression is influenced by several environmental factors, and the aim of the present study was to determine how disinfectants used...... routinely in the food industry affect the expression of different virulence genes in L. monocytogenes when added at sublethal concentrations. An agar-based assay was developed to screen the effect of disinfectants on virulence gene promoter expression and was validated at the transcriptional level...... by Northern blot analysis. Eleven disinfectants representing four different groups of active components were evaluated in this study. Disinfectants with the same active ingredients had a similar effect on gene expression. Peroxy and chlorine compounds reduced the expression of the virulence genes...

  8. Incorporation of Listeria monocytogenes strains in raw milk biofilms.

    Science.gov (United States)

    Weiler, Christiane; Ifland, Andrea; Naumann, Annette; Kleta, Sylvia; Noll, Matthias

    2013-02-01

    Biofilms develop successively on devices of milk production without sufficient cleaning and originate from the microbial community of raw milk. The established biofilm matrices enable incorporation of pathogens like Listeria monocytogenes, which can cause a continuous contamination of food processing plants. L. monocytogenes is frequently found in raw milk and non-pasteurized raw milk products and as part of a biofilm community in milk meters and bulk milk tanks. The aim of this study was to analyze whether different L. monocytogenes strains are interacting with the microbial community of raw milk in terms of biofilm formation in the same manner, and to identify at which stage of biofilm formation a selected L. monocytogenes strain settles best. Bacterial community structure and composition of biofilms were analyzed by a cloning and sequencing approach and terminal restriction fragment length polymorphism analysis (T-RFLP) based on the bacterial 16S rRNA gene. The chemical composition of biofilms was analyzed by Fourier transform infrared spectroscopy (FTIR), while settled L. monocytogenes cells were quantified by fluorescence in situ hybridization (FISH). Addition of individual L. monocytogenes strains to raw milk caused significant shifts in the biofilm biomass, in the chemical as well as in the bacterial community composition. Biofilm formation and attachment of L. monocytogenes cells were not serotype but strain specific. However, the added L. monocytogenes strains were not abundant since mainly members of the genera Citrobacter and Lactococcus dominated the bacterial biofilm community. Overall, added L. monocytogenes strains led to a highly competitive interaction with the raw milk community and triggered alterations in biofilm formation.

  9. Listeria monocytogenes as a vector for anti-cancer therapies.

    LENUS (Irish Health Repository)

    Tangney, Mark

    2012-01-31

    The intracellular pathogen Listeria monocytogenes represents a promising therapeutic vector for the delivery of DNA, RNA or protein to cancer cells or to prime immune responses against tumour-specific antigens. A number of biological properties make L. monocytogenes a promising platform for development as a vector for either gene therapy or as an anti-cancer vaccine vector. L. monocytogenes is particularly efficient in mediating internalization into host cells. Once inside cells, the bacterium produces specific virulence factors which lyse the vaculolar membrane and allow escape into the cytoplasm. Once in the cytosol, L. monocytogenes is capable of actin-based motility and cell-to-cell spread without an extracellular phase. The cytoplasmic location of L. monocytogenes is significant as this potentiates entry of antigens into the MHC Class I antigen processing pathway leading to priming of specific CD8(+) T cell responses. The cytoplasmic location is also beneficial for the delivery of DNA (bactofection) by L. monocytogenes whilst cell-to-cell spread may facilitate access of the vector to cells throughout the tumour. Several preclinical studies have demonstrated the ability of L. monocytogenes for intracellular gene or protein delivery in vitro and in vivo, and this vector has also displayed safety and efficacy in clinical trial. Here, we review the features of the L. monocytogenes host-pathogen interaction that make this bacterium such an attractive candidate with which to induce appropriate therapeutic responses. We focus primarily upon work that has led to attenuation of the pathogen, demonstrated DNA, RNA or protein delivery to tumour cells as well as research that shows the efficacy of L. monocytogenes as a vector for tumour-specific vaccine delivery.

  10. Cellular and molecular investigations of the adhesion and mechanics of Listeria monocytogenes

    Science.gov (United States)

    Eskhan, Asma Omar

    Atomic force microscopy has been used to quantify the adherence and mechanical properties of an array of L. monocytogenes strains and their surface biopolymers. First, eight L. monocytogenes strains that represented the two major lineages of the species were compared for their adherence and mechanics at cellular and molecular levels. Our results indicated that strains of lineage' II were characterized by higher adhesion and Young's moduli, longer and more rigid surface biopolymers and lower specific and nonspecific forces when compared to lineage' I strains. Additionally, adherence and mechanical properties of eight L. monocytogenes epidemic and environmental strains were probed. Our results pointed to that environmental and epidemic strains representative of a given lineage were similar in their adherence and mechanical properties when investigated at a cellular level. However, when the molecular properties of the strains were considered, epidemic strains were characterized by higher specific and nonspecific forces, shorter, denser and more flexible biopolymers compared to environmental strains. Second, the role of environmental pH conditions of growth on the adhesion and mechanics of a pathogenic L. monocytogenes EGDe was investigated. Our results pointed to a transition in the adhesion energies for cells cultured at pH 7. In addition, when the types of molecular forces that govern the adhesion were quantified using Poisson statistical approach and using a new proposed method, specific hydrogen-bond energies dominated the bacterial adhesion process. Such a finding is instrumental to researchers designing methods to control bacterial adhesion. Similarly, bacterial cells underwent a transition in their mechanical properties. We have shown that cells cultured at pH 7 were the most rigid compared to those cultured in lower or higher pH conditions of growth. Due to transitions observed in adherence and mechanics when cells were cultured at pH 7, we hypothesized that

  11. Molecular analysis of dominant species in Listeria monocytogenes-positive biofilms in the drains of food processing facilities.

    Science.gov (United States)

    Liu, Yanlan; Zhang, Hongmei; Wu, Changli; Deng, Wenjia; Wang, Dong; Zhao, Guifen; Song, Jiankun; Jiang, Yan

    2016-04-01

    Listeria monocytogenes exhibits symbiotic codependence with the dominant commensal bacteria, which may help it avoid being removed or inactivated by disinfectants in local environments. In this study, we investigated L. monocytogenes-positive biofilms at food production facilities, and the dominant bacterial species of the biofilms were identified to determine the properties of the microbiological background. For this purpose, the ISO 11290 method was used for the detection and isolation of L. monocytogenes, and the species were further identified based on 16S rRNA and hly genes. 16S rRNA gene-based cloning, terminal restriction fragment length polymorphism, and denaturing gradient gel electrophoresis were combined to evaluate the dominant bacteria of the drain biofilms. Out of 100 drain samples, 8 were naturally contaminated with L. monocytogenes. Three molecular methods consistently showed that Pseudomonas psychrophila, Pseudomonas sp., and Klebsiella oxytoca were dominant species in 3Q, 5Q, and 6Q samples; Aeromonas hydrophila and Klebsiella sp. were significantly dominant in 1-2, 1-3, and 3-2 samples; A. hydrophila and K. oxytoca were dominant in the 2-3 sample; and A. hydrophila and Pseudomonas sp. were prominent in the 3-3 sample. Different biofilms from the same plant shared common bands, suggesting that similar bacteria can be found and can be dominant in different biofilms. This study provides a better understanding of the dominant compositions in these bacterial communities. Further studies to determine the mechanism of co-culture with L. monocytogenes will be of critical importance in predicting effective disinfection strategies.

  12. Microbial background flora in small-scale cheese production facilities does not inhibit growth and surface attachment of Listeria monocytogenes.

    Science.gov (United States)

    Schirmer, B C T; Heir, E; Møretrø, T; Skaar, I; Langsrud, S

    2013-10-01

    The background microbiota of 5 Norwegian small-scale cheese production sites was examined and the effect of the isolated strains on the growth and survival of Listeria monocytogenes was investigated. Samples were taken from the air, food contact surfaces (storage surfaces, cheese molds, and brine) and noncontact surfaces (floor, drains, and doors) and all isolates were identified by sequencing and morphology (mold). A total of 1,314 isolates were identified and found to belong to 55 bacterial genera, 1 species of yeast, and 6 species of mold. Lactococcus spp. (all of which were Lactococcus lactis), Staphylococcus spp., Microbacterium spp., and Psychrobacter sp. were isolated from all 5 sites and Rhodococcus spp. and Chryseobacterium spp. from 4 sites. Thirty-two genera were only found in 1 out of 5 facilities each. Great variations were observed in the microbial background flora both between the 5 producers, and also within the various production sites. The greatest diversity of bacteria was found in drains and on rubber seals of doors. The flora on cheese storage shelves and in salt brines was less varied. A total of 62 bacterial isolates and 1 yeast isolate were tested for antilisterial activity in an overlay assay and a spot-on-lawn assay, but none showed significant inhibitory effects. Listeria monocytogenes was also co-cultured on ceramic tiles with bacteria dominating in the cheese production plants: Lactococcus lactis, Pseudomonas putida, Staphylococcus equorum, Rhodococcus spp., or Psychrobacter spp. None of the tested isolates altered the survival of L. monocytogenes on ceramic tiles. The conclusion of the study was that no common background flora exists in cheese production environments. None of the tested isolates inhibited the growth of L. monocytogenes. Hence, this study does not support the hypothesis that the natural background flora in cheese production environments inhibits the growth or survival of L. monocytogenes.

  13. Elimination of Listeria monocytogenes in sausage meat by combination treatment: Radiation and radiation-resistant bacteriocins

    Science.gov (United States)

    Turgis, Mélanie; Stotz, Viviane; Dupont, Claude; Salmieri, Stéphane; Khan, Ruhul A.; Lacroix, Monique

    2012-08-01

    Two new bacteria were isolated from human feces and were designated MT 104 and MT 162. They were able to produce bacteriocins that are active against five strains of Listeria monocytogenes. Bacteriocins produced by these isolated strains had 100% and 82.35% residual activity when they were treated by gamma radiation at doses of 4 and 40 kGy, respectively. A reduction of 1.0, 1.5 and 3 log CFU/g of L. monocytogenes was observed in sausage meat when treated with bacteriocins from MT 104, MT 162, and nisin, respectively. For synergic effect, the D10 value in presence of the bacteriocins produced by MT 104 showed a 1.08 fold increased relative sensitivity of L. monocytogenes as compared to control after 5 days. The highest synergic effect was observed in presence of nisin which led to 1.61 fold increased relative sensitivity. Combined treatments with nisin and γ-irradiation showed a synergic antimicrobial effect in meat after 24 h and 5 days of storage. A synergic effect was observed only after 5 days at 4 °C for the bacteriocin from MT 104, as compared to the bacteriocin produced by MT 162 that had only an additive antimicrobial effect in all conditions.

  14. Habitus and Flow in Primary School Musical Practice: Relations between Family Musical Cultural Capital, Optimal Experience and Music Participation

    Science.gov (United States)

    Valenzuela, Rafael; Codina, Nuria

    2014-01-01

    Based on Bourdieu's idea that cultural capital is strongly related to family context, we describe the relations between family musical cultural capital and optimal experience during compulsory primary school musical practice. We analyse whether children from families with higher levels of musical cultural capital, and specifically with regard to…

  15. The relationship between relational models and individualism and collectivism: evidence from culturally diverse work groups.

    Science.gov (United States)

    Vodosek, Markus

    2009-04-01

    Relational models theory (Fiske, 1991 ) proposes that all thinking about social relationships is based on four elementary mental models: communal sharing, authority ranking, equality matching, and market pricing. Triandis and his colleagues (e.g., Triandis, Kurowski, & Gelfand, 1994 ) have suggested a relationship between the constructs of horizontal and vertical individualism and collectivism and Fiske's relational models. However, no previous research has examined this proposed relationship empirically. The objective of the current study was to test the association between the two frameworks in order to further our understanding of why members of culturally diverse groups may prefer different relational models in interactions with other group members. Findings from this study support a relationship between Triandis' constructs and Fiske's four relational models and uphold Fiske's ( 1991 ) claim that the use of the relational models is culturally dependent. As hypothesized, horizontal collectivism was associated with a preference for equality matching and communal sharing, vertical individualism was related to a preference for authority ranking, and vertical collectivism was related to a preference for authority ranking and communal sharing. However, contrary to expectations, horizontal individualism was not related to a preference for equality matching and market pricing, and vertical individualism was not associated with market pricing. By showing that there is a relationship between Triandis' and Fiske's frameworks, this study closes a gap in relational models theory, namely how culture relates to people's preferences for relational models. Thus, the findings from this study will enable future researchers to explain and predict what relational models are likely to be used in a certain cultural context.

  16. European food cultures: An exploratory analysis of food related preferences and behaviour in European regions

    DEFF Research Database (Denmark)

    Askegaard, Søren; Madsen, Tage Koed

    of homogeneity in the various national states was analyzed in order detect more or less regionalized countries in Europe in terms of food culture. 7. It was analyzed to what extent the other eleven clusters differ from Denmark, which alone represents a cluster. Sweden and to some extent the clustered British...... and its potential expansion, the relative importance of national boundaries must be expected to diminish whereas other boundaries will become more apparent. One type of boundaries of vital impo to international marketing is the cultural boundaries dividing Europe into regions with individual cultural...... background and different consumption patterns. 2. It follows from this that further insight in the food consumption patterns might be gained by considering Europe from a regional perspective rather than in more traditional terms of nation-states. 3. Food consumption patterns make up a cultural system, which...

  17. Cultural intelligence and work-related outcomes: A meta-analytic review

    DEFF Research Database (Denmark)

    Schlaegel, Christopher; Richter, Nicole Franziska; Taras, Vas

    2017-01-01

    -cultural work context. Tests of the relative incremental validity show that CQ and its dimensions explain desirable work outcomes beyond the effect of personality traits and emotional intelligence. The results of commonality analysis reveal the unique and shared contribution of CQ dimensions in explaining......Over the last 15 years the research on cultural intelligence (CQ) has grown to a point that a quantitative synthesis of the existing empirical evidence on the relationship between CQ and work-related outcomes is needed to provide a foundation for future research in this direction. Based on 110...

  18. LACTIC FLORA-LISTERIA MONOCYTOGENES INTERACTION

    Directory of Open Access Journals (Sweden)

    S. Colombo

    2012-08-01

    Full Text Available The EC Regulation 2073/2005 (1 requires that food processors evaluate the capability of ready-to-use (RTE products to support the development of Listeria monocytogenes when their pH and aW values are favourable to the growth of this microorganism. It is renown that the lactic flora plays an important role in many different foods, both from a technological and a food safety standpoint. This study was aimed to observe the behaviour and the potential anti-Listeria effect of some natural lactic flora present in Italian liver patè crostini (chicken heart and liver, anchovies, onions, capers, starch, no added preservatives through the Combase Predictor – Max Growth Rate predictive software. The natural lactic flora of the crostini demonstrated a variable capability to inhibit the growth of Listeria monocytogenes which depends upon : the concentration of the lactic flora at the beginning of the shelf life period and the subsequent lag phase, the possible release of anti-Listeria substances, and the maximum growth rate.

  19. An outbreak of febrile gastroenteritis associated with jellied pork contaminated with Listeria monocytogenes.

    Science.gov (United States)

    Pichler, Juliane; Much, Peter; Kasper, Sabine; Fretz, Rainer; Auer, Bettina; Kathan, Julia; Mann, Michaela; Huhulescu, Steliana; Ruppitsch, Werner; Pietzka, Ariane; Silberbauer, Karl; Neumann, Christian; Gschiel, Ernst; de Martin, Alfred; Schuetz, Angelika; Gindl, Josef; Neugschwandtner, Ernst; Allerberger, Franz

    2009-01-01

    In September 2008, the Austrian Agency for Health and Food Safety (AGES) learned of an outbreak of diarrheal illness that included a 71-year-old patient hospitalized for gastroenteritis with a blood culture positive for Listeria monocytogenes. Three stool specimens provided by seven of 19 persons attending a day trip to a foreign city, including a final break at an Austrian tavern, yielded L. monocytogenes. All isolates were of serovar 4b and had fingerprints indistinguishable from each other. A cohort study revealed that the outbreak of gastroenteritis occurred among 16 persons who had eaten dinner at the wine tavern on September 6. Of the 15 persons who ate from platters of mixed cold-cuts, 12 (80%) developed symptoms of febrile gastroenteritis within 24-48 h. The median age of those who became ill was 62 years. A 72-year-old patient recovered from gastroenteritis but was hospitalized with bacterial meningitis on day 19 after the dinner. The epidemiological investigation identified the consumption of mixed cold-cuts (including jellied pork) at the wine tavern as the most likely vehicle of the foodborne outbreak (P = 0.0015). This hypothesis was confirmed by microbiological investigation of jellied pork produced by the tavern owner on September 3. L. monocytogenes was isolated from leftover food in numbers of 3 x 10(3)-3 x 10(4) colony forming units/g and was indistinguishable from the clinical outbreak isolates. Symptoms reported by the 12 patients included unspecified fever (12x), diarrhea (9x), headache (5x), vomiting (4x), body aches (2x) and sore throat (1x). Active case finding identified one case of rhombencephalitis (female, age 48) among another group of four guests, among whom only the patient and her asymptomatic husband had eaten jellied pork on September 6. This is the first outbreak of L. monocytogenes-associated gastroenteritis reported in Austria. The occurrence of a secondary case of meningitis (diagnosed on day 19 after consumption of jellied

  20. Suitability of Lactococcus lactis subsp lactis ATCC 11454 as a protective culture for lightly preserved fish products

    DEFF Research Database (Denmark)

    Wessels, Stephen Wallace; Huss, Hans Henrik

    1996-01-01

    This study is part of strategy to control the human pathogen Listeria monocytogenes in lightly preserved fish products by using food-grade lactic acid bacteria. When the nisin-producing Lactococcus lactis subsp lactis ATCC 11454 was cultured in the same vessel as L-monocytogenes Scott A in brain...

  1. Bourdieu’s Cultural Capital in Relation to Food Choices: A Systematic Review of Cultural Capital Indicators and an Empirical Proof of Concept

    Science.gov (United States)

    Kamphuis, Carlijn B. M.; Jansen, Tessa; Mackenbach, Johan P.; van Lenthe, Frank J.

    2015-01-01

    Objective Unhealthy food choices follow a socioeconomic gradient that may partly be explained by one’s ‘cultural capital’, as defined by Bourdieu. We aim 1) to carry out a systematic review to identify existing quantitative measures of cultural capital, 2) to develop a questionnaire to measure cultural capital for food choices, and 3) to empirically test associations of socioeconomic position with cultural capital and food choices, and of cultural capital with food choices. Design We systematically searched large databases for the key-word ‘cultural capital’ in title or abstract. Indicators of objectivised cultural capital and family institutionalised cultural capital, as identified by the review, were translated to food choice relevant indicators. For incorporated cultural capital, we used existing questionnaires that measured the concepts underlying the variety of indicators as identified by the review, i.e. participation, skills, knowledge, values. The questionnaire was empirically tested in a postal survey completed by 2,953 adults participating in the GLOBE cohort study, The Netherlands, in 2011. Results The review yielded 113 studies that fulfilled our inclusion criteria. Several indicators of family institutionalised (e.g. parents’ education completed) and objectivised cultural capital (e.g. possession of books, art) were consistently used. Incorporated cultural capital was measured with a large variety of indicators (e.g. cultural participation, skills). Based on this, we developed a questionnaire to measure cultural capital in relation to food choices. An empirical test of the questionnaire showed acceptable overall internal consistency (Cronbach’s alpha of .654; 56 items), and positive associations between socioeconomic position and cultural capital, and between cultural capital and healthy food choices. Conclusions Cultural capital may be a promising determinant for (socioeconomic inequalities in) food choices. PMID:26244763

  2. Bourdieu's Cultural Capital in Relation to Food Choices: A Systematic Review of Cultural Capital Indicators and an Empirical Proof of Concept.

    Directory of Open Access Journals (Sweden)

    Carlijn B M Kamphuis

    Full Text Available Unhealthy food choices follow a socioeconomic gradient that may partly be explained by one's 'cultural capital', as defined by Bourdieu. We aim 1 to carry out a systematic review to identify existing quantitative measures of cultural capital, 2 to develop a questionnaire to measure cultural capital for food choices, and 3 to empirically test associations of socioeconomic position with cultural capital and food choices, and of cultural capital with food choices.We systematically searched large databases for the key-word 'cultural capital' in title or abstract. Indicators of objectivised cultural capital and family institutionalised cultural capital, as identified by the review, were translated to food choice relevant indicators. For incorporated cultural capital, we used existing questionnaires that measured the concepts underlying the variety of indicators as identified by the review, i.e. participation, skills, knowledge, values. The questionnaire was empirically tested in a postal survey completed by 2,953 adults participating in the GLOBE cohort study, The Netherlands, in 2011.The review yielded 113 studies that fulfilled our inclusion criteria. Several indicators of family institutionalised (e.g. parents' education completed and objectivised cultural capital (e.g. possession of books, art were consistently used. Incorporated cultural capital was measured with a large variety of indicators (e.g. cultural participation, skills. Based on this, we developed a questionnaire to measure cultural capital in relation to food choices. An empirical test of the questionnaire showed acceptable overall internal consistency (Cronbach's alpha of .654; 56 items, and positive associations between socioeconomic position and cultural capital, and between cultural capital and healthy food choices.Cultural capital may be a promising determinant for (socioeconomic inequalities in food choices.

  3. Occurrence and antimicrobial resistance patterns of Listeria monocytogenes isolated from vegetables

    Directory of Open Access Journals (Sweden)

    Vanessa de Vasconcelos Byrne

    2016-06-01

    Full Text Available Abstract Although the consumption of fresh and minimally processed vegetables is considered healthy, outbreaks related to the contamination of these products are frequently reported. Among the food-borne pathogens that contaminate vegetables is Listeria monocytogenes, a ubiquitous organism that exhibits the ability to survive and multiply at refrigerated temperatures. This study aimed to evaluate the occurrence of L. monocytogenes in vegetables as well as the antimicrobial resistance of isolates. The results showed that 3.03% of samples were contaminated with L. monocytogenes, comprising 2.22% of raw vegetables and 5.56% of ready-to-eat vegetables. Multiplex PCR confirmed the virulence potential of the isolates. Antimicrobial resistance profiling showed that 50% of the isolates were susceptible to the antibiotics used. The resistance of one isolate to penicillin G, a commonly employed therapeutic agent, and the presence of serotype 4b, a serotype commonly associated with food-borne outbreaks, could be potential health hazards for consumers.

  4. Single cell swimming dynamics of Listeria monocytogenes using a nanoporous microfluidic platform

    Energy Technology Data Exchange (ETDEWEB)

    Wright, Evan [University of Guelph, Canada; Neethirajan, Suresh [University of Guelph; Warriner, Keith [University of Guelph; Retterer, Scott T [ORNL; Srijanto, Bernadeta R [ORNL

    2014-01-01

    Listeria monocytogenes remains a significant foodborne pathogen due to its virulence and ability to become established in food processing facilities. The pathogen is characterized by its ability to grow over a wide temperature range and withstand a broad range of stresses. The following reports on the chemotaxis and motility of the L. monocytogenes when exposed to relatively small concentrations of acetic acid. Using the developed nanoporous microfluidic device to precisely modulate the cellular environment, we exposed the individual Listeria cells to acetic acid and, in real time and with high resolution, observed how the cells reacted to the change in their surroundings. Our results showed that concentrations of acetic acid below 10 mM had very little, if any, effect on the motility. However, when exposed to 100 mM acetic acid, the cells exhibited a sharp drop in velocity and displayed a more random pattern of motion. These results indicate that at appropriate concentrations, acetic acid has the ability to disable the flagellum of the cells, thus impairing their motility. This drop in motility has numerous effects on the cell; its main effects being the obstruction of the cell's ability to properly form biofilms and a reduction in the overall infectivity of the cells. Since these characteristics are especially useful in controlling the proliferation of L. monocytogenes, acetic acid shows potential for application in the food industry as an active compound in designing a food packaging environment and as an antimicrobial agent.

  5. Evaluation of the antibacterial activity of bergamot essential oils on different Listeria monocytogenes strains

    Directory of Open Access Journals (Sweden)

    Stefania M. Marotta

    2016-12-01

    Full Text Available Essential oils are aromatic and volatile substances extracted from plants and characterized by antimicrobial activity. The aim of the present study was to evaluate the antibacterial activity (agar disc-diffusion method of seven different bergamot essential oils (BEOs on eight Listeria monocytogenes strains. Minimal inhibitory concentration (MIC of most efficient BEOs was estimated. Extremely variable results for agar disc-diffusion method for L. monocytogenes strains were reported. One of the tested microorganisms resulted insensible to all the BEOs; 3 strains showed an inhibition from weak to null and the remaining 4 a variable susceptibility. Among the BEOs tested, one showed a strong activity against four pathogenic strains. Four BEOs revealed weak, moderate or null activity in all the 7 sensitive strains, while for two oils only a weak or no activity was reported. MIC values were 0.625 μL/mL for the most efficient BEO, 2.5 and 5 μL/mL for the other samples that showed moderate inhibition. Experiment results are significantly related to the strains tested (P<0.01, rather than the BEO employed (P>0.01. In conclusion, we can consider BEO as a natural technological hurdle for Listeria monocytogenes in combination with other preservation strategies. Finally, this study underlines the necessity to evaluate the antimicrobial activity of EOs on a significant strains number of the same bacteria.

  6. Evaluation of the Antibacterial Activity of Bergamot Essential Oils on Different Listeria Monocytogenes Strains.

    Science.gov (United States)

    Marotta, Stefania M; Giarratana, Filippo; Parco, Alessio; Neri, Domenico; Ziino, Graziella; Giuffrida, Alessandro; Panebianco, Antonio

    2016-09-20

    Essential oils are aromatic and volatile substances extracted from plants and characterized by antimicrobial activity. The aim of the present study was to evaluate the antibacterial activity (agar disc-diffusion method) of seven different bergamot essential oils (BEOs) on eight Listeria monocytogenes strains. Minimal inhibitory concentration (MIC) of most efficient BEOs was estimated. Extremely variable results for agar disc-diffusion method for L. monocytogenes strains were reported. One of the tested microorganisms resulted insensible to all the BEOs; 3 strains showed an inhibition from weak to null and the remaining 4 a variable susceptibility. Among the BEOs tested, one showed a strong activity against four pathogenic strains. Four BEOs revealed weak, moderate or null activity in all the 7 sensitive strains, while for two oils only a weak or no activity was reported. MIC values were 0.625 μL/mL for the most efficient BEO, 2.5 and 5 μL/mL for the other samples that showed moderate inhibition. Experiment results are significantly related to the strains tested (P0.01). In conclusion, we can consider BEO as a natural technological hurdle for Listeria monocytogenes in combination with other preservation strategies. Finally, this study underlines the necessity to evaluate the antimicrobial activity of EOs on a significant strains number of the same bacteria.

  7. Occurrence and antimicrobial resistance patterns of Listeria monocytogenes isolated from vegetables.

    Science.gov (United States)

    de Vasconcelos Byrne, Vanessa; Hofer, Ernesto; Vallim, Deyse Christina; de Castro Almeida, Rogeria Comastri

    2016-01-01

    Although the consumption of fresh and minimally processed vegetables is considered healthy, outbreaks related to the contamination of these products are frequently reported. Among the food-borne pathogens that contaminate vegetables is Listeria monocytogenes, a ubiquitous organism that exhibits the ability to survive and multiply at refrigerated temperatures. This study aimed to evaluate the occurrence of L. monocytogenes in vegetables as well as the antimicrobial resistance of isolates. The results showed that 3.03% of samples were contaminated with L. monocytogenes, comprising 2.22% of raw vegetables and 5.56% of ready-to-eat vegetables. Multiplex PCR confirmed the virulence potential of the isolates. Antimicrobial resistance profiling showed that 50% of the isolates were susceptible to the antibiotics used. The resistance of one isolate to penicillin G, a commonly employed therapeutic agent, and the presence of serotype 4b, a serotype commonly associated with food-borne outbreaks, could be potential health hazards for consumers. Copyright © 2016 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.

  8. Strategies for North American Missionaries' Relational Language-Culture Learning in the Japanese Context

    Science.gov (United States)

    Manabe-Kim, Rie

    2012-01-01

    This study focused on presenting the fieldwork findings derived from studying North-American missionaries' relational dynamics with the Japanese people, and the strategies that impacted their language-culture learning. This study also focused on applying the fieldwork findings towards the creation of a coaching model designed to help…

  9. Education-Related Factors in Cultural Intelligence Development: A Colombian Study

    Science.gov (United States)

    Robledo-Ardila, Cristina; Aguilar-Barrientos, Sara; Román-Calderón, Juan Pablo

    2016-01-01

    This article reports the results of a study inquiring about the role of education-related factors in the development of cultural intelligence. Five hundred fifty-seven students of a Colombian international business (IB) undergraduate program participated in the study. The psychometric properties of the measures were assessed by conducting…

  10. The Familial Socialization of Culturally Related Values in Mexican American Families

    Science.gov (United States)

    Knight, George P.; Berkel, Cady; Umana-Taylor, Adriana J.; Gonzales, Nancy A.; Ettekal, Idean; Jaconis, Maryanne; Boyd, Brenna M.

    2011-01-01

    Research has documented a relation between parents' ethnic socialization and youth's ethnic identity, yet there has been little research examining the transmission of cultural values from parents to their children through ethnic socialization and ethnic identity. This study examines a prospective model in which mothers' and fathers' Mexican…

  11. A Relational Cultural Approach to Working with Clients with Eating Disorders

    Science.gov (United States)

    Trepal, Heather C.; Boie, Ioana; Kress, Victoria E.

    2012-01-01

    The authors examine eating disorders through the conceptual framework of relational cultural theory (RCT). Taking into account the importance of relationships and connection, it is suggested that RCT may be a useful lens for conceptualizing and working with people who are experiencing eating disorders. Ways that RCT can be applied to enhance…

  12. A Relational Cultural Approach to Working with Clients with Eating Disorders

    Science.gov (United States)

    Trepal, Heather C.; Boie, Ioana; Kress, Victoria E.

    2012-01-01

    The authors examine eating disorders through the conceptual framework of relational cultural theory (RCT). Taking into account the importance of relationships and connection, it is suggested that RCT may be a useful lens for conceptualizing and working with people who are experiencing eating disorders. Ways that RCT can be applied to enhance…

  13. Human Relations: Assessing the Affect of Cultural Awareness Curriculum on Preservice Teachers

    Science.gov (United States)

    Olson, Seth; Reed, Kris; Schweinle, Amy

    2009-01-01

    Human relations training is intended to prepare teachers to be culturally sensitive to an increasingly diverse population. There is a growing trend in teacher education to train preservice teachers more effectively to meet the demands of multicultural society. However, limited research is available to guide the future design of human relations…

  14. Cross-cultural validity of the food-related lifestyles instrument (FRL) within Western Europe

    DEFF Research Database (Denmark)

    Scholderer, Joachim; Brunsø, Karen; Bredahl, Lone;

    2004-01-01

    The food-related lifestyle instrument (FRL) is tested for cross-cultural validity. In the first part of the analysis, consumer samples from Denmark (N = 1209), France (N = 1000), Germany (N = 1000), Spain (N = 1000), and the UK (N = 1000) are compared using multi-sample confirmatory factor analys...

  15. Vietnamese Americans' Attitudes toward Seeking Mental Health Services: Relation to Cultural Variables

    Science.gov (United States)

    Nguyen, Quang Charles X.; Anderson, Louis P.

    2005-01-01

    This study examined the relation between culturally based variables and attitudes toward seeking mental health services among a community sample of Vietnamese Americans (N = 148) with at least 8 years' residence in the United States (U.S.). Variables included Stigma, Traditional Beliefs about Mental Illness, Help-Seeking Preferences, Problem…

  16. Strategies for North American Missionaries' Relational Language-Culture Learning in the Japanese Context

    Science.gov (United States)

    Manabe-Kim, Rie

    2012-01-01

    This study focused on presenting the fieldwork findings derived from studying North-American missionaries' relational dynamics with the Japanese people, and the strategies that impacted their language-culture learning. This study also focused on applying the fieldwork findings towards the creation of a coaching model designed to help missionaries…

  17. Spontaneous Cultural Compatibility: Mazahua Students and Their Teachers Constructing Trusting Relations.

    Science.gov (United States)

    Paradise, Ruth

    1994-01-01

    Describes changes in school practices in a rural Mexican elementary school, presenting examples of social interactions that illustrate how the changes were constructed and the nature of the underlying cultural compatibility they expressed. Teacher-student relations became characterized by a tacitly recognized acceptance and respect of Mazahua…

  18. A Look inside the Listeria monocytogenes Biofilms Extracellular Matrix

    Directory of Open Access Journals (Sweden)

    Angelo Colagiorgi

    2016-07-01

    Full Text Available Listeria monocytogenes is a foodborne pathogen able to persist in food industry and is responsible for a severe illness called listeriosis. The ability of L. monocytogenes to persist in environments is due to its capacity to form biofilms that are a sessile community of microorganisms embedded in a self-produced matrix of extracellular polymeric substances (EPS’s. In this review, we summarized recent efforts performed in order to better characterize the polymeric substances that compose the extracellular matrix (ECM of L. monocytogenes biofilms. EPS extraction and analysis led to the identification of polysaccharides, proteins, extracellular DNA, and other molecules within the listerial ECM. All this knowledge will be useful for increasing food protection, suggesting effective strategies for the minimization of persistence of L. monocytogenes in food industry environments.

  19. FDA Bacteriological Analytical Manual, Chapter 10, 2003: Listeria monocytogenes

    Science.gov (United States)

    FDA Bacteriological Analytical Manual, Chapter 10 describes procedures for analysis of food samples and may be adapted for assessment of solid, particulate, aerosol, liquid and water samples containing Listeria monocytogenes.

  20. The Impact of Organizational Culture and Job Related Affective Well Being on Employees’ Conflict Resolution Styles

    Directory of Open Access Journals (Sweden)

    Nurdan Özarallı

    2015-06-01

    Full Text Available This study aims to investigate the impact of cooperative or competitive organizational culture and employees’ job related affective well being on their preferred conflict resolution styles. A total of 236 white collar employees in the private sector completed questionnaires on “Organizational Culture“, “Job Related Affective Well Being“and “Conflict Resolution Styles“. Results indicated that employees working in a cooperative organizational culture would choose problem solving, compromising and accomodating conflict resolution styles while those working in a competitive work environment would choose forcing and avoiding strategies. Results also showed that while positive job related affective well being is a major predictor o problem solving, compromising, accomodating and avoiding conflict resolution styles, negative job related affective well being significantly predicts forcing and avoiding strategies. Overall, the results draw attention to the preferred conflict resolution strategies assumed by Turkish employees, the role of the conflict environment as well as actors’ affective well being

  1. Cultural repertoires and food-related household technology within colonia households under conditions of material hardship

    OpenAIRE

    Dean Wesley R; Sharkey Joseph R; Johnson Cassandra M; John Julie

    2012-01-01

    Abstract Introduction Mexican-origin women in the U.S. living in colonias (new-destination Mexican-immigrant communities) along the Texas-Mexico border suffer from a high incidence of food insecurity and diet-related chronic disease. Understanding environmental factors that influence food-related behaviors among this population will be important to improving the well-being of colonia households. This article focuses on cultural repertoires that enable food choice and the everyday uses of tech...

  2. Caratterizzazione biomolecolare di listeria monocytogenes in suini regolarmente macellati

    OpenAIRE

    Santoro, Cristina

    2009-01-01

    Listeria monocytogenes è un batterio patogeno responsabile di una malattia potenzialmente molto grave per l’uomo. L’infezione avviene soprattutto tramite l’ingestione di alimenti di origine animale contaminati, e può propagarsi per via transplacentare al feto. Il potenziale patogeno di L. monocytogenes è dovuto soprattutto a caratteristici fattori di virulenza con i quali alcuni ceppi sono in grado di attaccare la cellula dell’organismo ospite potendo aderire, invadere, moltiplicare e prop...

  3. Reduced growth of Listeria monocytogenes in two model cheese microcosms is not associated with individual microbial strains.

    Science.gov (United States)

    Imran, Muhammad; Bré, Jean-Michel; Guéguen, Marielle; Vernoux, Jean-Paul; Desmasures, Nathalie

    2013-02-01

    Two model antilisterial microbial communities consisting of two yeasts, two Gram positive and two Gram negative bacteria, and originating from Livarot cheese smear were previously designed. They were used in the present study to analyse the impact of microbial population dynamics on growth of Listeria monocytogenes in cheese microcosm. Specific culture media and PCR primers were developed for simultaneous culture-dependent and real-time PCR quantification of strains belonging to Marinomonas sp., Paenibacillus sp., Staphylococcus equorum, Arthrobacter arilaitensis, Pseudomonas putida, Serratia liquefaciens, Candida natalensis, and Geotrichum candidum, in cheese microcosms. All strains were enumerated after 3, 5, 8 and 14 days at 15 °C. They established well at high counts in all cheese microcosms. Growth dynamics for all strains in presence of L. monocytogenes WSLC 1685 were compared to those of microbial communities obtained by omitting in turn one of the six members of the initial community. The growth of the microbial strains was neither markedly disturbed by Listeria presence nor by the removal of each strain in turn. Furthermore, these communities had a significant reducing effect on growth of L. monocytogenes independently of pH, as confirmed by mathematical modelling. A barrier effect was observed, that could be explained by specific competition for nutrients.

  4. [The current problems and cross-cultural perspectives of patient-doctor relation: an overview].

    Science.gov (United States)

    Koch, Eckhardt; Turgut, Tolga

    2004-01-01

    The success of the treatment in medicine, especially in psychiatry is based on the form and the strength of the patient-doctor relation. This complex and dynamic relation is changing in accordance with the social and technological development of the society. The context of the patient-doctor relation is determined by the present day culture as well as the traditional background. An overview of current patient-doctor relation and of problems that physicians and in particular psychiatrists meet is presented. Physicians have responsibilities in building patient-doctor relation. The ethical and legal aspects of these responsibilities are presented. The former paternalistic type of patient-doctor relation is evolving into a more equal and democratic relation. New problems are being encountered continuously in the changing process. Beside the of the process itself, the effects of progress in medical technology and communication systems on patient-doctor relation and the pressure, put from the insurance companies and/or authorities on physicians, which impair the trust between the physician and his patient, are making the process more difficult. The issues of compliance, sexual harassment and unique problems of patient-doctor relations in psychiatry are the other subtopics in the article. The cross-cultural aspects of patient-doctor relations and encountered clinical problems are discussed with case examples particularly about Turkish immigrants, who live in Germany. Suggestions for psychiatrists in Germany to work out the challenges facing them are presented in the conclusion.

  5. LISTERIA MONOCYTOGENES RISK EVALUATION IN READY TO EAT DELI PRODUCTS

    Directory of Open Access Journals (Sweden)

    T Civera

    2013-02-01

    Full Text Available Listeria monocytogenes has become one of the major concerns for food safety. Its ability to survive and replicate at low temperature, pH and high salt concentration, makes the bacterium a threat, mostly for RTE products. For these reasons, the present research was aimed at detecting the ability of growth of L. monocytogenes in RTE products retrieved from one deli store. Samples were analysed for L. monocytogenes detection, then inoculated with the pathogen (105cell/ml and stored at refrigeration temperature for the duration of their shelf-life (15-60 days. In all the products L. monocytogenes was not detected before experimental contamination. The challenge test evidenced that experimentally inoculated L. monocytogenes was not able to multiply for the duration of the entire shelf-life. These results indicated that the tested products could be considered as foods which are not able to support the growth of L. monocytogenes, as indicated by E.C. Regulation 2073/05. However, in order to guarantee consumer’s safety, it needs to be emphasized the need of a correct application of the GMPs, required for lowering the risk of initial contamination.

  6. Isolation and Identification of Listeria monocytogenes from Retail

    Directory of Open Access Journals (Sweden)

    A.D.I. Alsheikh

    2013-02-01

    Full Text Available Listeria species are widely distributed in environment and L. monocytogenes are the causal agent of Listeriosis, the disease that can be serious and fatal to human and animals. The objectives of this study were to detect, isolate and identify Listeria monocytogenes from retail broiler chicken ready to eat meat products in restaurants-Khartoum state, Sudan. A total of 250 retail broiler chicken ready to eat meat products were collected from restaurants in Khartoum State, 50 sample from frozen chicken burger, 50 sample from frozen chicken sausages, 50 sample from frozen chicken meat balls (kofta, 50 sample from chicken shawerma and 50 sample from chicken mortedella, Listeria spp. were isolated by the conventional International Organization for Standardization method and L. monocytogenes identified by biochemical test. The results showed that out of total 250 samples, 95 (38% were found to be contaminated with Listeria spp. the isolation rate was as follows: L. monocytogenes (13.6%, L. ivanovi (20.8%, L. grayi (1.6%, L. seeligeri (0.8% and L. welshimeri (1.2%. The results presented in this study indicate the contamination of retail broiler chicken ready to eat meat products with L. monocytogenes. This study reported the occurrence and distribution of L. monocytogenes and other Listeria species in retail meat products (frozen chicken burger, frozen chicken sausages, frozen chicken meat balls (kofta, chicken shawerma and chicken mortedella, purchased from restaurants in Khartoum state Sudan.

  7. Listeria monocytogenes, a down-to-earth pathogen.

    Science.gov (United States)

    Vivant, Anne-Laure; Garmyn, Dominique; Piveteau, Pascal

    2013-01-01

    Listeria monocytogenes is the causative agent of the food-borne life threatening disease listeriosis. This pathogenic bacterium received much attention in the endeavor of deciphering the cellular mechanisms that underlie the onset of infection and its ability to adapt to the food processing environment. Although information is available on the presence of L. monocytogenes in many environmental niches including soil, water, plants, foodstuff and animals, understanding the ecology of L. monocytogenes in outdoor environments has received less attention. Soil is an environmental niche of pivotal importance in the transmission of this bacterium to plants and animals. Soil composition, microbial communities and macrofauna are extrinsic edaphic factors that direct the fate of L. monocytogenes in the soil environment. Moreover, farming practices may further affect its incidence. The genome of L. monocytogenes presents an extensive repertoire of genes encoding transport proteins and regulators, a characteristic of the genome of ubiquitous bacteria. Postgenomic analyses bring new insights in the process of soil adaptation. In the present paper focussing on soil, we review these extrinsic and intrinsic factors that drive environmental adaptation of L. monocytogenes.

  8. Listeria monocytogenes a pathogen down-to-earth

    Directory of Open Access Journals (Sweden)

    Anne-Laure eVivant

    2013-11-01

    Full Text Available Listeria monocytogenes is the causative agent of the food-borne life threatening disease listeriosis. This pathogenic bacterium received much attention in the endeavour of deciphering the cellular mechanisms that underlie the onset of infection and its ability to adapt to the food processing environment. Although information is available on the presence of L. monocytogenes in many environmental niches including soil, water, plants, foodstuff and animals, understanding the ecology of L. monocytogenes in outdoor environments has received less attention. Soil is an environmental niche of pivotal importance in the transmission of this bacterium to plants and animals. Soil composition, microbial communities and macrofauna are extrinsic edaphic factors that direct the fate of L. monocytogenes in the soil environment. Moreover, farming practices may further affect its incidence. The genome of L. monocytogenes presents an extensive repertoire of genes encoding transport proteins and regulators, a characteristic of the genome of ubiquitous bacteria. Postgenomic analyses bring new insights in the process of soil adaptation. In the present paper focussing on soil, we review these extrinsic and intrinsic factors that drive environmental adaptation of L. monocytogenes.

  9. Use of antimicrobial films and edible coatings incorporating chemical and biological preservatives to control growth of Listeria monocytogenes on cold smoked salmon.

    Science.gov (United States)

    Neetoo, Hudaa; Mahomoodally, Fawzi

    2014-01-01

    The relatively high incidence of Listeria monocytogenes in cold smoked salmon (CSS) is of concern as it is a refrigerated processed food of extended durability (REPFED). The objectives of this study were to compare and optimize the antimicrobial effectiveness of films and coatings incorporating nisin (Nis) and sodium lactate (SL), sodium diacetate (SD), potassium sorbate (PS), and/or sodium benzoate (SB) in binary or ternary combinations on CSS. Surface treatments incorporating Nis (25000 IU/mL) in combination with PS (0.3%) and SB (0.1%) had the highest inhibitory activity, reducing the population of L. monocytogenes by a maximum of 3.3 log CFU/cm(2) (films) and 2.9 log CFU/cm(2) (coatings) relative to control samples after 10 days of storage at 21°C. During refrigerated storage, coatings were more effective in inhibiting growth of L. monocytogenes than their film counterparts. Cellulose-based coatings incorporating Nis, PS, and SB reduced the population of L. monocytogenes, and anaerobic and aerobic spoilage flora by a maximum of 4.2, 4.8, and 4.9 log CFU/cm(2), respectively, after 4 weeks of refrigerated storage. This study highlights the effectiveness of cellulose-based edible coatings incorporating generally regarded as safe (GRAS) natural and chemical antimicrobials to inhibit the development of L. monocytogenes and spoilage microflora thus enhancing the safety and quality of CSS.

  10. Use of Antimicrobial Films and Edible Coatings Incorporating Chemical and Biological Preservatives to Control Growth of Listeria monocytogenes on Cold Smoked Salmon

    Directory of Open Access Journals (Sweden)

    Hudaa Neetoo

    2014-01-01

    Full Text Available The relatively high incidence of Listeria monocytogenes in cold smoked salmon (CSS is of concern as it is a refrigerated processed food of extended durability (REPFED. The objectives of this study were to compare and optimize the antimicrobial effectiveness of films and coatings incorporating nisin (Nis and sodium lactate (SL, sodium diacetate (SD, potassium sorbate (PS, and/or sodium benzoate (SB in binary or ternary combinations on CSS. Surface treatments incorporating Nis (25000 IU/mL in combination with PS (0.3% and SB (0.1% had the highest inhibitory activity, reducing the population of L. monocytogenes by a maximum of 3.3 log CFU/cm2 (films and 2.9 log CFU/cm2 (coatings relative to control samples after 10 days of storage at 21°C. During refrigerated storage, coatings were more effective in inhibiting growth of L. monocytogenes than their film counterparts. Cellulose-based coatings incorporating Nis, PS, and SB reduced the population of L. monocytogenes, and anaerobic and aerobic spoilage flora by a maximum of 4.2, 4.8, and 4.9 log CFU/cm2, respectively, after 4 weeks of refrigerated storage. This study highlights the effectiveness of cellulose-based edible coatings incorporating generally regarded as safe (GRAS natural and chemical antimicrobials to inhibit the development of L. monocytogenes and spoilage microflora thus enhancing the safety and quality of CSS.

  11. The Management of Immigration Related Cultural Diversity In European Federated Entities The Case of Switzerland

    Directory of Open Access Journals (Sweden)

    Gianni d'Amato

    2015-11-01

    Full Text Available Switzerland is experiencing since the late 19th century immigration as economic necessity and cultural threat. The Bilateral Agreement with the EU (2002 changed fundamentally the setting, allowing free circulation for Europeans, but restricting access to third country nationals. With regard to migrant-related political fields, cantons use their autonomy to experiment with various approaches. Particularly the issue of language has become an indicator for measuring integration at the level of cantons and municipalities, strengthening in some areas of the country regional monolinguism. The cantons are also responsible for regulating the relationship between religious communities and the state. In particular recognition of new religious communities are dependent of the historical legacy, and how cantons want to regulate religious pluralism. Cultural promotion is primarily the duty of the cantons, but the Confederation supports the activities of the cantons. Cultural public sponsoring increasingly detects challenges as demographic change and societal pluralization, supporting artistic initiatives that reflect this transformation.

  12. Suicides of the Marginalised: Cultural Approaches to Suicide, Minorities and Relationality

    Directory of Open Access Journals (Sweden)

    Rob Cover

    2016-11-01

    Full Text Available Suicides among marginalised groups are one of the few occasions in which self-harm and suicide are framed as having cultural, social, environental, historical or structural causes. Suicidology, psychology and public discourse typically understand suicide causality to be grounded in individualised psychic pain and pathology, disavowing the social, cultural, environmental and linguistic contexts. However, public discourse on suicides of ‘marginalised’ groups such as asylum seekers, Indigenous persons and queer/LGBT youth are ‘authorised’ to be discussed from social perspectives, informing opportunities to re-think suicidality, identity and liveability. Building on recent critical challenges to dominant theories, this article examines some of the ways in which the suicides of marginalised groups are described in social terms, demonstrating how cultural approaches to relationality, aspiration, performativity and mobility can expand current thinking on suicide cause and prevention.

  13. Acting Bicultural versus Feeling Bicultural: Cultural Adaptation and School-Related Attitudes among U.S. Latina/o Youth

    Science.gov (United States)

    Acevedo-Polakovich, Ignacio D.; Quirk, Kelley M.; Cousineau, Jennifer R.; Saxena, Suchita R.; Gerhart, James I.

    2014-01-01

    This study examines whether incorporating a multidimensional perspective to the study of the relation between cultural adaptation and academic attitudes among Latinas/os in the United States can clarify this relation. Hypotheses about the relation between cultural adaptation and academic attitudes were examined using data provided by U.S. Latina/o…

  14. Relational mobility explains between- and within-culture differences in self-disclosure to close friends.

    Science.gov (United States)

    Schug, Joanna; Yuki, Masaki; Maddux, William

    2010-10-01

    In the current research, we tested a novel explanation for previously demonstrated findings that East Asians disclose less personal information to other people than do Westerners. We propose that both between- and within-culture differences in self-disclosure to close friends may be explained by the construct of relational mobility, the general degree to which individuals in a society have opportunities to form new relationships and terminate old ones. In Study 1, we found that cross-cultural differences (Japan vs. United States) in self-disclosure to a close friend were mediated by individuals' perceptions of relational mobility. In Study 2, two separate measures of relational mobility predicted self-disclosure within a single culture (Japan), and this relationship was mediated by the motivation to engage in self-disclosure to strengthen personal relationships. We conclude that societies and social contexts higher in relational mobility (in which relationships can be formed and dissolved relatively easily) produce stronger incentives for self-disclosure as a social-commitment device.

  15. The Agr communication system provides a benefit to the populations of Listeria monocytogenes in soil.

    Science.gov (United States)

    Vivant, Anne-Laure; Garmyn, Dominique; Gal, Laurent; Piveteau, Pascal

    2014-01-01

    In this study, we investigated whether the Agr communication system of the pathogenic bacterium Listeria monocytogenes was involved in adaptation and competitiveness in soil. Alteration of the ability to communicate, either by deletion of the gene coding the response regulator AgrA (response-negative mutant) or the signal pro-peptide AgrD (signal-negative mutant), did not affect population dynamics in soil that had been sterilized but survival was altered in biotic soil suggesting that the Agr system of L. monocytogenes was involved to face the complex soil biotic environment. This was confirmed by a set of co-incubation experiments. The fitness of the response-negative mutant was lower either in the presence or absence of the parental strain but the fitness of the signal-negative mutant depended on the strain with which it was co-incubated. The survival of the signal-negative mutant was higher when co-cultured with the parental strain than when co-cultured with the response-negative mutant. These results showed that the ability to respond to Agr communication provided a benefit to listerial cells to compete. These results might also indicate that in soil, the Agr system controls private goods rather than public goods.

  16. The frequency of Listeria monocytogenes strains recovered from clinical and non-clinical samples using phenotypic methods and confirmed by PCR

    Directory of Open Access Journals (Sweden)

    abazar pournajaf

    2013-09-01

    Full Text Available Background: Listeria monocytogenes is a facultative intracellular pathogen that causes listeriosis which has extensive clinical manifestations. Infections with L. monocytogenes are a serious threat to immunocompromised persons. The aim of this study was to determine the frequency of L. monocytogenes strains recovered from clinical and non-clinical samples using phenotypic methods and confirmed by PCR. Materials and Methods: In this study, 617 specimens were analyzed. All specimens were cultured in the specific PALCAM agar. Colonies were initially identified by routine biochemical tests. Finally, PCR assays using primers specific for inlA gene were performed. Results: In all, 46 (8.2% L. monocytogenes isolates were recovered from 617 specimens. Fourteen (8.2% strains, including 4 (7.5%, 2 (5.7%, 5 (14.2% and 3 (8.5% isolates were obtained from placental tissue, urine, vaginal and rectal swabs, respectively. In addition, 9 (7.4% strains of L. monocytogenes which were isolated from 107 different dairy products originated from cheese 5 (7.1%, cream 2 (10% and kashk 2 (11.7%, respectively. Among 11 (5.2% strains isolated from 210 different meat products, 5 (5.5%, 4 (7.2% and 2 (3% strains belonged to sausage, meat and poultry extracts, respectively. Finally, 12 (9.2% Listeria strains were recovered from 130 animal specimens that included 6 (10%, 4 (8% and 2 (10% strains from goat, sheep and cattle, respectively. Furthermore, all Listeria isolates (100% were found to be carriers of  inlA gene in PCR assay. Conclusion: The present study showed that the clinical and non-clinical specimens were contaminated with L. monocytogenes. So, it seems necessary to use a simple and standard technique such as PCR for rapid detection of this organism from various sources.

  17. Institutional comunication and cultural marketing: Peculiarities in museum communication within the framework of public relations

    Directory of Open Access Journals (Sweden)

    Camelia BURGHELE

    2011-01-01

    Full Text Available Cultural management theoreticians believe that the main target of museum communication is gaining knowledge on specific messages by as large a number of people as possible. Museum public relation practice – intensified and upgraded at the same time with the revolution of the new communication technologies – is both science and art which analyse certain tendences (in attitude, taste and informal of anticipating their consequences for implementing certain museum offer programs to appeal to the public.As an institution with a decisive role in guarding cultural heritage and in outlining cultural identity – as it keeps the necessary instruments for this, the specialists and also the motivation through its own purposes – the museum in its dynamic, modern, enhanced shape must provide an attractive cultural product to the public, based on a anthropological approach to cultural fact.Modern museum-ology is built upon the concept that museum is a story and modern museums stimulate to a high degree participative learning, generated by a productive dialogue.

  18. Parental influences on weight-related health behaviors in western and eastern cultures.

    Science.gov (United States)

    Niemeier, B S; Duan, Y P; Shang, B R; Yang, J

    2017-03-01

    Excessive bodyweight contributes to a myriad of risk factors for chronic diseases, and multiple reports have demonstrated that parents influence the development of their children's behaviors that contribute to bodyweight. However, studies that include considerations for cultural influences are limited, and methodology that considers direct reports from young adults and their parents across cultures does not exist. A sample of young adults (N = 327) and their parents in the U.S. and in China were recruited and completed a series of questionnaires in two cycles (2010 and 2014). With correlation and multiple regression analyses, parents' characteristics, behaviors, and parental authority styles were examined and compared to weight-related health behaviors and bodyweight of their young-adult children. Additionally, similarities and differences of parental influences between the two cultures were explored. Parents' body mass indexes (BMIs) and dietary behaviors were positively associated with those of their young adult children in the mixed-culture sample (P parental authority, the relationships between young adults' and their parents' BMIs were negative for U.S. participants and positive for Chinese participants (P parenting, the relationship between young adults' and their parents' dietary consumption behaviors was negative for U.S. participants and positive for Chinese participants (P parents' behaviors and parenting styles. Moreover, an interaction of parental characteristics and cultural norms is indicated. © 2017 John Wiley & Sons Ltd.

  19. A cross-cultural comparison of the coexistence and domain superiority of individuating and relating autonomy.

    Science.gov (United States)

    Yeh, Kuang-Hui; Bedford, Olwen; Yang, Yung-Jui

    2009-06-01

    The consensus definition of autonomy in the psychological literature emphasizes self-governance through free volition, not separation or independence from others. Since the concept of self may differ cross-culturally, several researchers have tried to incorporate types of self into the notion of autonomy; however, only the dual model of autonomy has been able to do this while retaining an emphasis on volition. The dual model describes two distinct forms of autonomy-individuating and relating-each with superior function in a specific domain of individual functioning. Individuating autonomy represents a volitional capacity to act against social constraints and offers a route to achieve an independent self-identity by expressing individualistic attributes and distinctions. Relating autonomy represents a volitional capacity to act by emphasizing the harmony of self-in-relation-to-others, the quality of interpersonal relationships, and self-transcendence. These two forms of autonomy have been shown to coexist at the individual level in a Taiwanese sample. This study takes the next step, with a cross-cultural test of the coexistence and domain superiority hypotheses of individuating and relating autonomy. Participants included 306 college students from Taiwan and 183 college students from the United States. Structural equation modelling by multigroup analyses confirmed the cross-cultural equivalence of the two-factor individuating autonomy and relating autonomy measurement model. Across both samples the two forms of autonomy were shown to be mutually inclusive and not exclusive or independent. The domain-superior function of each form of autonomy was also confirmed cross-culturally; each form of autonomy has a dominant, but not necessarily exclusive, domain of functioning. Specifically, individuating autonomy was more associated with intrapersonal than interpersonal domain dependent variables, while relating autonomy was more associated with interpersonal than

  20. Host range and in vitro lysis of Listeria monocytogenes seafood isolates by bacteriophages.

    Science.gov (United States)

    Arachchi, Geevika J Ganegama; Cruz, Cristina D; Dias-Wanigasekera, Beatrice M; McIntyre, Lynn; Billington, Craig; Hudson, Andrew; Flint, Steve H; Mutukumira, Anthony N

    2014-12-01

    Listeria-infecting bacteriophages (listeriaphages) can be used to control Listeria monocytogenes in the food industry. However, the sensitivity of many of seafood-borne Listeria strains to phages has not been reported. This research investigated the host ranges of three listeriaphages (FWLLm1, FWLLm3 and FWLLm5) by the formation of lytic zones and plaques on host lawns and in vitro lysis kinetics of listeriaphage FWLLm3. The study also predicted the phage titres required to lyse host cells. The host ranges of the phages were determined using 50 L. monocytogenes strains, of which 48 were isolated from the seafood industry and two from clinical cases. Of the 50 strains, 36 were tested at 25 and 30 ℃ and the remainder (14) at 15 and 25 ℃. Based on the formation of either discrete plaques or lytic zones (host kill zones), the host ranges of FWLLm1, FWLLm3 and FWLLm5 were about 87%, 81% and 87%, respectively, at 25 ℃. Six L. monocytogenes strains from the seafood environment were insensitive to all three phages, while the other seafood strains (42) were phage-sensitive. The adsorption rate constant (k value) of listeriaphage FWLLm3 was between 1.2 × 10(-9) and 1.6 × 10(-9 )ml/min across four host strains in tryptic soy broth at 25 ℃. The cultures (at 3-4 log colony-forming unit (CFU/ml) were completely lysed ( 8.7 log phage-forming units (PFU/ml) for 30 min. Re-growth of phage-infected cultures was not detected after 24 h. The effective empirical phage titre was similar to the calculated titre using a kinetic model. Results indicate the potential use of the three phages for controlling L. monocytogenes strains in seafood processing environments. © The Author(s) 2013 Reprints and permissions: sagepub.co.uk/journalsPermissions.nav.

  1. INFLUENCE OF GENDER RELATIONS ON THE CULTURE OF THE WORKERS AT THE COMPANY

    Directory of Open Access Journals (Sweden)

    Vladimir Yurevich Pripoten

    2015-11-01

    Full Text Available This article is devoted to a discover of gender relations of main managers of industrial companies and their subordinate groups. We have used a technique that is based on the effective head of the list as the «Сycle of control skills», that are identified to the major gender differences in management, based on the check of the possibility of a business and personal qualities of leaders, as we take to a consider the influence of gender on the culture of main control managers.Purpose. To study the influence of main relations on the culture of the workers, check and research a way for the companies to develop.Method and methodology of work. Expert survey, the use of methods of Clark L. Wilson «Сycle management skills», «The level of progress of the organizational culture», V. Snetkova.Results. The basic personal and business qualities of men and women leaders. The influence of gender on the culture of the staff of presented companies.Practical implications. Companies of all possible kinds and their specialization.

  2. The Use of Social Networking Sites in Job Related Activities: A Cross-cultural Comparison

    Directory of Open Access Journals (Sweden)

    Małgorzata Bartosik-Purgat

    2017-06-01

    Full Text Available Objective: The main objective of the paper is to identify the use of Social Networking Sites (SNSs in job related activities and indicate the interdependencies between these activities and age, gender, as well as education in culturally diversified markets (China, Poland, Turkey, the United States. Research Design & Methods: In the exploratory empirical study the authors used two research methods: PAPI (Paper and Pen Personal Interview and CAWI (Computer Assisted Web Interview. The empirical data were collected in 2016 and the total number of respondents from four culturally diversified countries was 1246. Findings: The analysis with the use of Kruskal-Wallis and Dunn post-hoc tests showed that the Turkish respondents most often use SNSs for job related activities, while it is the least often done by the studied Americans. Moreover, from among the studied factors (gender, age and education level that differentiate the SNSs usage for job related activities in a statistically significant way age is of greatest importance. Implications & Recommendations: The results of the research provide implications for the recruitment policy of multinational enterprises (MNEs. Since more and more enterprises use SNSs in order to look for new employees and advertise themselves as employers (employer branding, the identified interdependencies between the SNSs activities and the analysed factors can support firm attempts to develop the proper recruitment policy taking into account the cultural diversity of potential workers. Contribution & Value Added: There are not many studies in the literature which present the usage of SNSs for job related activities from the perspective of individual users in the cross-cultural approach. The majority of studies are related to the usage of SNSs by enterprises in the recruitment process.

  3. Legal and Ethical Issues Related to the Management of Cultural Heritage in Space

    Science.gov (United States)

    Walsh, Justin

    The recent discovery of water in darkened craters of the Moon's south pole is only the latest development drawing public and corporate interest to the possibilities of research and travel in outer space. Scientists pursuing fusion-generated power as a solution to global energy needs have also noted the relative abundance of Helium-3, an efficient fuel, on the Moon's surface, and there is the promise of other precious resources there as well. The implantation of colonies on the Moon or Mars, discussed for many decades as science fiction, therefore seems increasingly likely to happen. Some private companies and members of the public are even looking forward to the days when tourists will be able to travel for leisure beyond the earth's atmosphere. Most notably, the X Prize Foundation and Google are sponsoring a prize for the first private group to send an unmanned rover to the Moon as a way of advancing these agendas; 22 teams have registered for the competition, with some scheduled to launch by the end of 2010. Increased attention to outer space travel, exploration, and commercial exploitation has been paralleled by a rise in interest in the protection of cultural resources on Earth, such as ar-chaeological sites and historic monuments. Such sites and monuments already exist in outer space and on extraterrestrial planetary bodies. The Apollo 11 landing site, Tranquility Base, is only the most obvious example of a cultural site of outstanding significance in space. Satellites orbiting the earth -even defunct ones such as Vanguard 1, the oldest man-made object still in orbit, might be considered to have extraordinary historic and cultural value, too. As archae-ologists working on Earth have long recognized, once a site or object is damaged, it can never be perfectly restored to its original condition. Unfortunately, there are so far only a few vague guidelines, drafted in the 1960's and agreed upon by the international community, protecting mankind's cultural heritage

  4. Diversity and persistence of Listeria monocytogenes within the Gorgonzola PDO production chain and comparison with clinical isolates from the same area.

    Science.gov (United States)

    Filipello, Virginia; Gallina, Silvia; Amato, Ettore; Losio, Marina Nadia; Pontello, Mirella; Decastelli, Lucia; Lomonaco, Sara

    2017-03-20

    Listeria monocytogenes causes invasive syndromes with high fatality rates in specific population groups. Cheeses have been commonly implicated in outbreaks worldwide. Gorgonzola is a cheese only produced in Northwestern Italy (it is the third Italian cheese in terms of production and export) and L. monocytogenes is frequently isolated from the production chain. The aims of this study were to assess the distribution of L. monocytogenes Virulence Types (VTs) in isolates collected in Gorgonzola processing plants and to determine the presence of Epidemic Clones (ECs). Fifty-Six L. monocytogenes strains collected between 2004 and 2016 from cheese and environmental samples were subtyped with Multi-Virulence-Locus Sequence Typing (MVLST) and compared to previously typed strains. Most isolates (n=50) belonged to two new VTs (VT113 and VT114). The remaining isolates belonged to previously identified VTs: VT14-ECVIII (milk chocolate outbreak, 1994, USA) and VT80 (ricotta salata outbreak, 2012, USA). VT14, VT80 and VT113 were shared with isolates from apparently sporadic human cases in the same geographical area and temporal period (Piedmont and Lombardy, 2005-2016). The overall L. monocytogenes population appears to be homogeneous and may be characteristic of Gorgonzola production. Nevertheless, the detection in cheese and environmental samples of VTs observed in clinical isolates or outbreak related strains (VT80, VT14) contributed to better describe the current scenario and pointed out the need for increased surveillance.

  5. Plasmonic Enzyme-Linked Immunosorbent Assay Using Nanospherical Brushes as a Catalase Container for Colorimetric Detection of Ultralow Concentrations of Listeria monocytogenes.

    Science.gov (United States)

    Chen, Rui; Huang, Xiaolin; Xu, Hengyi; Xiong, Yonghua; Li, Yanbin

    2015-12-30

    Plasmonic enzyme-linked immunosorbent assay (pELISA) based on catalase (CAT)-mediated gold nanoparticle growth exhibits ultrahigh sensitivity for detecting disease-related biomarkers using sandwich formats. However, the limit of detection (LOD) of this strategy for Listeria monocytogenes is only around 10(3) CFU/mL, which considerably exceeds the amount of L. monocytogenes commonly present in food products (container" to increase enzyme loading for enhancing the detection signal. Under optimal conditions, the proposed pELISA exhibits good specificity and excellent sensitivity for L. monocytogenes with a LOD of 8 × 10(1) CFU/mL in 0.01 M phosphate-buffered saline, via a reaction that can be discriminated by the naked eye. The LOD obtained by this method was 2 and 5 orders of magnitude lower than that of conventional CAT-based pELISA and horseradish peroxidase (HRP)-based conventional ELISA, respectively. Coupled with large-volume immunomagnetic separation, the LOD for L. monocytogenes-spiked lettuce samples reached 8 × 10(1) CFU/g. The improved pELISA also exhibited a great potential in detecting a single cell of L. monocytogenes in 100 μL of solution.

  6. Potential Impact of the Resistance to Quaternary Ammonium Disinfectants on the Persistence of Listeria monocytogenes in Food Processing Environments

    Science.gov (United States)

    Martínez-Suárez, Joaquín V.; Ortiz, Sagrario; López-Alonso, Victoria

    2016-01-01

    The persistence of certain strains of Listeria monocytogenes, even after the food processing environment has been cleaned and disinfected, suggests that this may be related to phenomena that reduce the concentration of the disinfectants to subinhibitory levels. This includes (i) the existence of environmental niches or reservoirs that are difficult for disinfectants to reach, (ii) microorganisms that form biofilms and create microenvironments in which adequate concentrations of disinfectants cannot be attained, and (iii) the acquisition of resistance mechanisms in L. monocytogenes, including those that lead to a reduction in the intracellular concentration of the disinfectants. The only available data with regard to the resistance of L. monocytogenes to disinfectants applied in food production environments refer to genotypic resistance to quaternary ammonium compounds (QACs). Although there are several well-characterized efflux pumps that confer resistance to QACs, it is a low-level resistance that does not generate resistance to QACs at the concentrations applied in the food industry. However, dilution in the environment and biodegradation result in QAC concentration gradients. As a result, the microorganisms are frequently exposed to subinhibitory concentrations of QACs. Therefore, the low-level resistance to QACs in L. monocytogenes may contribute to its environmental adaptation and persistence. In fact, in certain cases, the relationship between low-level resistance and the environmental persistence of L. monocytogenes in different food production chains has been previously established. The resistant strains would have survival advantages in these environments over sensitive strains, such as the ability to form biofilms in the presence of increased biocide concentrations. PMID:27199964

  7. Virulence Phenotyping and Molecular Characterization of a Low-pathogenicity Isolate of Listeria monocytogenes from Cow's Milk

    Institute of Scientific and Technical Information of China (English)

    Ling-Li JIANG; Jing-Jing XU; Ning CHEN; Jiang-Bing SHUAI; Wei-Huan FANG

    2006-01-01

    A low-pathogenicity isolate of Listeria monocytogenes from cow's milk, as screened in mouse and chicken embryonated egg models, was examined for virulence-related phenotypic traits. Corresponding virulence genes (iap, prfA, plcA, hly, mpl, actA, plcB, InlA and InlB) were compared with L. monocytogenes reference strains 10403S and EGD to elucidate the possible molecular mechanisms of low virulence. Although L. monocytogenes H4 exhibited similar patterns to strain 10403S in terms of hemolytic activity, in vitro growth and invasiveness and even had higher adhesiveness, faster intracellular growth and higher phospholipase activity in vitro, it was substantially less virulent than the strain 10403S in mouse and chicken embryo models (50% lethal dose: 108.14 vs. 105.49 and 106.73 VS. 101.9, respectively). The genes prfA, plcA and mpl were homologous among L. monocytogenes strains H4, 10403S and EGD (>98%). Genes iap, hly, plcB,InlA and InlB of L. monocytogenes 10403S had higher homology to those of strain EGD (>98%) than isolate H4. The homology of the gene hly between strain 10403S and isolate H4 was 96.9% at the nucleotide level,but 98.7% at the amino acid level. The actA gene of isolate H4 had deletions of 105 nucleotides corresponding to 35 amino acid deletions falling within the proline-rich region. Taken together, this study presents some clues as to reduced virulence to mice and chicken embryos of the isolate H4 probably as a result of deletion mutations of actA.

  8. Cultural Dimension of International Relations During Interwar Period: International Institute for Intellectual Cooperation and the Scientific Study of International Relations

    Directory of Open Access Journals (Sweden)

    Anişoara Popa

    2014-12-01

    Full Text Available Our understanding of the past is highly influenced/leaded by the “lens” (readings, ideologies, etc. that have guided us through approaching realities of a specific period of time. In this article, we will discuss the cultural dimension of international relations characteristic for the interwar period , emphasizing , while tracing back on Romanian historiography, the aspects regarding the role that the International Institute of Intellectual Cooperation had in organizing the scientifically study of IR and the specific participation of Romania within this League of Nations‘ body activity.

  9. Exoproteome analysis reveals higher abundance of proteins linked to alkaline stress in persistent Listeria monocytogenes strains.

    Science.gov (United States)

    Rychli, Kathrin; Grunert, Tom; Ciolacu, Luminita; Zaiser, Andreas; Razzazi-Fazeli, Ebrahim; Schmitz-Esser, Stephan; Ehling-Schulz, Monika; Wagner, Martin

    2016-02-02

    The foodborne pathogen Listeria monocytogenes, responsible for listeriosis a rare but severe infection disease, can survive in the food processing environment for month or even years. So-called persistent L. monocytogenes strains greatly increase the risk of (re)contamination of food products, and are therefore a great challenge for food safety. However, our understanding of the mechanism underlying persistence is still fragmented. In this study we compared the exoproteome of three persistent strains with the reference strain EGDe under mild stress conditions using 2D differential gel electrophoresis. Principal component analysis including all differentially abundant protein spots showed that the exoproteome of strain EGDe (sequence type (ST) 35) is distinct from that of the persistent strain R479a (ST8) and the two closely related ST121 strains 4423 and 6179. Phylogenetic analyses based on multilocus ST genes showed similar grouping of the strains. Comparing the exoproteome of strain EGDe and the three persistent strains resulted in identification of 22 differentially expressed protein spots corresponding to 16 proteins. Six proteins were significantly increased in the persistent L. monocytogenes exoproteomes, among them proteins involved in alkaline stress response (e.g. the membrane anchored lipoprotein Lmo2637 and the NADPH dehydrogenase NamA). In parallel the persistent strains showed increased survival under alkaline stress, which is often provided during cleaning and disinfection in the food processing environments. In addition, gene expression of the proteins linked to stress response (Lmo2637, NamA, Fhs and QoxA) was higher in the persistent strain not only at 37 °C but also at 10 °C. Invasion efficiency of EGDe was higher in intestinal epithelial Caco2 and macrophage-like THP1 cells compared to the persistent strains. Concurrently we found higher expression of proteins involved in virulence in EGDe e.g. the actin-assembly-inducing protein ActA and the

  10. cultural

    Directory of Open Access Journals (Sweden)

    Irene Kreutz

    2006-01-01

    Full Text Available Es un estudio cualitativo que adoptó como referencial teorico-motodológico la antropología y la etnografía. Presenta las experiencias vivenciadas por mujeres de una comunidad en el proceso salud-enfermedad, con el objetivo de comprender los determinantes sócio-culturales e históricos de las prácticas de prevención y tratamiento adoptados por el grupo cultural por medio de la entrevista semi-estructurada. Los temas que emergieron fueron: la relación entre la alimentación y lo proceso salud-enfermedad, las relaciones con el sistema de salud oficial y el proceso salud-enfermedad y lo sobrenatural. Los dados revelaron que los moradores de la comunidad investigada tienen un modo particular de explicar sus procedimientos terapéuticos. Consideramos que es papel de los profesionales de la salud en sus prácticas, la adopción de abordajes o enfoques que consideren al individuo en su dimensión sócio-cultural e histórica, considerando la enorme diversidad cultural en nuestro país.

  11. Highly specific fiber optic immunosensor coupled with immunomagnetic separation for detection of low levels of Listeria monocytogenes and L. ivanovii

    Directory of Open Access Journals (Sweden)

    Mendonça Marcelo

    2012-11-01

    Full Text Available Abstract Background Immunomagnetic separation (IMS and immunoassays are widely used for pathogen detection. However, novel technology platforms with highly selective antibodies are essential to improve detection sensitivity, specificity and performance. In this study, monoclonal antibodies (MAbs against Internalin A (InlA and p30 were generated and used on paramagnetic beads of varying diameters for concentration, as well as on fiber-optic sensor for detection. Results Anti-InlA MAb-2D12 (IgG2a subclass was specific for Listeria monocytogenes and L. ivanovii, and p30-specific MAb-3F8 (IgM was specific for the genus Listeria. At all bacterial concentrations (103–108 CFU/mL tested in the IMS assay; the 1-μm diameter MyOne beads had significantly higher capture efficiency (P 5 CFU/mL was significantly higher (P Listeria antibody (9 %. Furthermore, capture efficiency for MyOne-2D12 was highly specific for L. monocytogenes and L. ivanovii. Subsequently, we captured L. monocytogenes by MyOne-2D12 and MyOne-3F8 from hotdogs inoculated with mono- or co-cultures of L. monocytogenes and L. innocua (10–40 CFU/g, enriched for 18 h and detected by fiber-optic sensor and confirmed by plating, light-scattering, and qPCR assays. The detection limit for L. monocytogenes and L. ivanovii by the fiber-optic immunosensor was 3 × 102 CFU/mL using MAb-2D12 as capture and reporter antibody. Selective media plating, light-scattering, and qPCR assays confirmed the IMS and fiber-optic results. Conclusions IMS coupled with a fiber-optic sensor using anti-InlA MAb is highly specific for L. monocytogenes and L. ivanovii and enabled detection of these pathogens at low levels from buffer or food.

  12. Identifying ingredients that delay outgrowth of Listeria monocytogenes in natural, organic, and clean-label ready-to-eat meat and poultry products.

    Science.gov (United States)

    McDonnell, Lindsey M; Glass, Kathleen A; Sindelar, Jeffrey J

    2013-08-01

    The objective of this study was to identify ingredients that inhibit Listeria monocytogenes in natural, organic, or clean-label ready-to-eat meat and poultry products. Fourteen ingredients were screened in uncured (no-nitrate-or-nitrite-added), traditional-cured (156 ppm of purified sodium nitrite), cultured (alternative cured, natural nitrate source, and Staphylococcus carnosus), or preconverted (alternative cured, natural nitrite source) turkey slurries. Slurries were cooked, cooled, inoculated to yield 3 log CFU/ml L. monocytogenes, stored at 4°C, and tested weekly for 4 weeks. Three antimicrobial ingredients, 1.5 % vinegar-lemon-cherry powder blend, 2.5 % buffered vinegar, and 3.0 % cultured sugar-vinegar blend, were incorporated into alternative-cured ham and uncured roast beef and deli-style turkey breast. Controls included all three meat products without antimicrobial ingredients and a traditional-cured ham with 2.8 % sodium lactate-diacetate. Cooked, sliced products were inoculated with 3 log CFU/g L. monocytogenes, vacuum packed, and stored at 4 or 7°C, for up to 12 weeks. For control products without antimicrobial agents stored at 4°C, a 2-log L. monocytogenes increase was observed at 2 weeks for ham and turkey and at 4 weeks for roast beef. Growth (>1-log increase) in the sodium lactate-diacetate was delayed until week 6. Compared with the control, the addition of either vinegar-lemon-cherry powder blend or buffered vinegar delayed L. monocytogenes growth for an additional 2 weeks, while the addition of cultured sugar-vinegar blend delayed growth for an additional 4 weeks for both ham and turkey. The greatest L. monocytogenes delay was observed in roast beef containing any of the three antimicrobial ingredients, with no growth detected through 12 weeks at 4°C for all the treatments. As expected, L. monocytogenes grew substantially faster in products stored at 7°C than at 4°C. These data suggest that antimicrobial ingredients from a natural source

  13. Culture and Language as Factors Related in the Process of Learning and Education

    OpenAIRE

    Irena Papa

    2015-01-01

    Communicative language teaching has become a familiar part of the landscape of language teaching in the last three or four decades. Teachers who perceive the objectives of teaching foreign languages associated with learning intercultural competence will be more inclined to make the process of teaching foreign languages more intercultural than teachers who perceive objectives as related to the acquisition of communicative competence. In this paper the relationship between culture and language ...

  14. [Trans-Cultural Prevention of Alcohol-Related Disorders in Elderly Immigrants].

    Science.gov (United States)

    Bermejo, I; Frank, F

    2015-09-01

    In migrants alcohol-related problems increase with increasing age. This group, in particular, is hardly reached by alcohol-specific care offers. Thus our project aimed at the identification of target group-specific barriers to health-care use by means of a cross-sectional study (n=435). Based on these results a trans-cultural concept for alcohol prevention among elderly migrants was developed and evaluated in a cluster-randomised controlled trial (n=176).

  15. Institutional comunication and cultural marketing: Peculiarities in museum communication within the framework of public relations

    OpenAIRE

    Camelia BURGHELE

    2011-01-01

    Cultural management theoreticians believe that the main target of museum communication is gaining knowledge on specific messages by as large a number of people as possible. Museum public relation practice – intensified and upgraded at the same time with the revolution of the new communication technologies – is both science and art which analyse certain tendences (in attitude, taste and informal) of anticipating their consequences for implementing certain museum offer programs to appeal to the...

  16. INTERNATIONAL STUDENTS’ ADJUSTMENT IN HIGHER EDUCATION: RELATION BETWEEN SOCIAL SUPPORT, SELF-EFFICACY, AND SOCIO-CULTURAL ADJUSTMENT

    Directory of Open Access Journals (Sweden)

    Yusliza Mohd.Yusoff

    2011-05-01

    Full Text Available This study was aimed at investigating the relationship between social support (Zimet et al., 1988, self-efficacy (Schwarzer & Jerusalem, 1995, and socio-cultural adjustment (Ward & Kennedy, 1999. The sample consisted of 185 international undergraduate students in one of the public higher education institutions in Malaysia. Multiple linear regression analysis was employed to test the hypotheses. The findings from this study indicated that support from friends and significant others is positively related to all dimensions of socio-cultural adjustment and support from family is positively related to cultural empathy. Self-efficacy is positively related to cultural empathy.

  17. Tracking of Listeria monocytogenes in meat establishment using Whole Genome Sequencing as a food safety management tool: A proof of concept.

    Science.gov (United States)

    Nastasijevic, Ivan; Milanov, Dubravka; Velebit, Branko; Djordjevic, Vesna; Swift, Craig; Painset, Anais; Lakicevic, Brankica

    2017-09-18

    and dispatch) originated from the slaughter line. Further, all eight L. monocytogenes isolates were confirmed to be biofilm producers on glass and stainless steel surfaces. The identification of the main entry routes of L. monocytogenes into meat establishments and tracking the routes for spread of the pathogen are of essential importance to define appropriate risk mitigation strategies for L. monocytogenes in meat production environment. The routine use of WGS for bacterial characterization, as a strong support of food safety management system in meat establishments, will require the cost-effective approach. It may encompass in-house sequencing when sequencing equipment is used for multiple applications (e.g. WGS of pathogens, starter cultures and spoilage organisms). Copyright © 2017 Elsevier B.V. All rights reserved.

  18. Predictive modeling for growth of non- and cold-adapted Listeria monocytogenes on fresh-cut cantaloupe at different storage temperatures.

    Science.gov (United States)

    Hong, Yoon-Ki; Yoon, Won Byong; Huang, Lihan; Yuk, Hyun-Gyun

    2014-06-01

    The aim of this study was to determine the growth kinetics of Listeria monocytogenes, with and without cold-adaption, on fresh-cut cantaloupe under different storage temperatures. Fresh-cut samples, spot inoculated with a 4-strain cocktail of L. monocytogenes (∼3.2 log CFU/g), were exposed to constant storage temperatures held at 10, 15, 20, 25, or 30 °C. All growth curves of L. monocytogenes were fitted to the Baranyi, modified Gompertz, and Huang models. Regardless of conditions under which cells grew, the time needed to reach 5 log CFU/g decreased with the elevated storage temperature. Experimental results showed that there were no significant differences (P > 0.05) in the maximum growth rate k (log CFU/g h(-1) ) and lag phase duration λ (h) between the cultures of L. monocytogenes with or without previous cold-adaption treatments. No distinct difference was observed in the growth pattern among 3 primary models at various storage temperatures. The growth curves of secondary modeling were fitted on an Arrhenius-type model for describing the relationship between k and temperature of the L. monocytogenes on fresh-cut cantaloupe from 10 to 30 °C. The root mean square error values of secondary models for non- and cold-adapted cells were 0.018, 0.021, and 0.024, and 0.039, 0.026, and 0.017 at the modified Gompertz, Baranyi, and Huang model, respectively, indicating that these 3 models presented the good statistical fit. This study may provide valuable information to predict the growth of L. monocytogenes on fresh-cut cantaloupes at different storage conditions. Listeriosis has occurred and increased along with the increased demand of fresh and fresh-cut fruits and vegetables. This study was conducted to predict the growth of non- and cold-adapted L. monocytogenes on fresh-cut cantaloupe at different temperature using mathematical model. These results can be helpful for risk assessments of L. monocytogenes in fresh-cut cantaloupe. This study provides valuable

  19. Protein markers for identification of Yersinia pestis and their variation related to culture

    Energy Technology Data Exchange (ETDEWEB)

    Wunschel, David S. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Engelmann, Heather E. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Victry, Kristin D. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Clowers, Brian H. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Sorensen, Christina M. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Valentine, Nancy B. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Mahoney Fahey, Christine M. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Wietsma, Thomas W. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Wahl, Karen L. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States)

    2013-12-11

    The detection of high consequence pathogens, such as Yersinia pestis, is well established in biodefense laboratories for bioterror situations. Laboratory protocols are well established using specified culture media and a growth temperature of 37 °C for expression of specific antigens. Direct detection of Y. pestis protein markers, without prior culture, depends on their expression. Unfortunately protein expression can be impacted by the culture medium which cannot be predicted ahead of time. Furthermore, higher biomass yields are obtained at the optimal growth temperature (i.e. 28 °C–30 °C) and therefore are more likely to be used for bulk production. Analysis of Y. pestis grown on several types of media at 30 °C showed that several protein markers were found to be differentially detected in different media. Analysis of the identified proteins against a comprehensive database provided an additional level of organism identification. Peptides corresponding to variable regions of some proteins could separate large groups of strains and aid in organism identification. This work illustrates the need to understand variability of protein expression for detection targets. The potential for relating expression changes of known proteins to specific media factors, even in nutrient rich and chemically complex culture medium, may provide the opportunity to draw forensic information from protein profiles.

  20. Refining the use of cancer-related cultural constructs with African Americans.

    Science.gov (United States)

    Sanders Thompson, Vetta L; Lewis, Tanisha; Williams, Sha-Lai

    2013-01-01

    An important step in using culture to increase colorectal cancer screening is the development and use of a reliable and valid measure. Measurement items that work well are defined as those that use clear and simple language, do not result in significant missing data, do not yield unexpected frequencies or patterns of association, and capture an important component of the underlying construct. The authors' work to develop such a measure includes cognitive response testing. This article describes 41 African American participants' reactions to and processing of items that have been used in the public health literature to assess cultural attitudes believed to be relevant to colorectal cancer screening. Participants were asked to verbalize thoughts, feelings, interpretations, and ideas that came to mind while examining or responding to 10 to 11 survey items. The results of cognitive response testing suggest negative reactions to items addressing the fatalism construct, concerns about appearing racist when responding to discrimination and mistrust items, and resistance to phrasing or terminology that conveys negative attitudes or frames of reference. When items were framed in a positive way, participants reported less frustration, confusion, and concern for how they would be perceived by others. The responses of older African Americans in this sample were consistent with research previously completed by Pasick et al.; participants questioned the relevance of items related to cultural constructs to health and cancer preventive behaviors. Recommendations for the assessment and use of cultural constructs and items assessing constructs are provided.

  1. Influence of flow direction and flow rate on the initial adhesion of seven Listeria monocytogenes strains to fine polished stainless steel

    DEFF Research Database (Denmark)

    Skovager, Anne; Whitehead, Kathryn; Siegumfeldt, Henrik

    2012-01-01

    (IAR) was studied. A method, including fluorescence microscopy and a flow perfusion system, was developed and used to examine the real-time initial cell adhesion of different L. monocytogenes species in situ to opaque surfaces under flow conditions. The results demonstrated that shear stress......The effects of flow direction and shear stress on the adhesion of different strains of Listeria monocytogenes to fine polished stainless steel under liquid flow conditions were investigated. Furthermore, the relationship between cell surface properties and cell size and the initial adhesion rate...... was the determining factor for the initial adhesion of L. monocytogenes under flow conditions. The flow direction in relation to the orientation of surface features (the scratches) could be disregarded. IARs were dependent on the shear stress and strain type. The strain EGDe, which had the lowest IAR, had the largest...

  2. A moveable feast: Contemporary relational food cultures emerging from local food networks.

    Science.gov (United States)

    O'Kane, Gabrielle

    2016-10-01

    Although the globalised food system delivers unparalleled food variety and quantity to most in the developed world it also disconnects consumers from where, how and by whom food is grown. This change in the food system has resulted in an acceptance of an anonymous and homogeneous food supply, which has contributed to over-consumption and the rise in diet-related diseases. 'Nutritionism' responds to this issue by maintaining that a 'healthy diet' can be achieved by consuming the correct balance of energy and nutrients, but with limited success. Yet, some food cultures can moderate the effects of the environmental drivers of increasing global obesity rates. This paper draws on this premise and presents an alternative eco-dietetic response, exploring people's meaning-making of food and food culture through local food networks. This research used narrative inquiry methodology and purposive sampling to gather stories through focus group conversations. Twenty people attended focus groups comprised of food procurers from one of three local food networks in the Canberra region: community gardens, a modified Community Supported Agriculture (CSA) and farmers' markets. The findings showed that those using local food networks enjoyed a 'contemporary relational food culture' that highlighted the importance of people, place and time, in their visceral experiences of food. The community gardeners made meaning of food through their connections to the earth and to others. The farmers' market and CSA food procurers valued the seasonal, local and ethical food produced by their beloved farmer(s). This paper provides qualitative evidence that local food networks enable people to enjoy multi-dimensional relationships to food. Further research is required to examine whether experiencing a contemporary relational food culture can lead to improved health outcomes for people and the planet.

  3. Parental acceptance of children’s intimate ethnic outgroup relations : The role of culture, status, and family reputation

    NARCIS (Netherlands)

    Munniksma, Anke; Flache, Andreas; Verkuyten, Maykel; Veenstra, René

    Research on adolescents' interethnic relations indicates that parents can resist their children's ethnic outgroup relations. However, there is little insight into the underlying reasons for this. The current study examines how cultural groups differ in parental acceptance of their children's

  4. Evaluation of bacteriocin-producing Lactobacillus sakei 1 against Listeria monocytogenes 1/2a growth and haemolytic activity Avaliação de Lactobacillus sakei 1 produtor de bacteriocina frente a Listeria monocytogenes 1/2a e sua atividade hemolítica

    Directory of Open Access Journals (Sweden)

    Rafael C.R. Martinez

    2005-03-01

    Full Text Available Bacteriocin-producing Lactobacillus sakei 1 was cultivated in Brain-Heart Infusion broth (24 h at 25ºC. The culture supernatant was neutralized, filter sterilized and used to test the activity of bacteriocin against Listeria monocytogenes 1/2a, at 8ºC and 15ºC. Non-bacteriocinogenic Lactobacillus sakei ATCC 15521 was used as a negative control. L. monocytogenes 1/2a was inoculated in culture supernatant medium from L. sakei 1 and L. sakei ATCC 15521 and the listerial populations were determined after 0, 5 and 10 days. The bacteriocin production was quantified as arbitrary units per mL (AU/mL using agar antagonism test. Additionally, to investigate if L. monocytogenes virulence pattern could be changed after bactericion exposure, the ability of L. monocytogenes to cause haemolysis in sheep red blood cells was determined, before and after exposure to bacteriocin at 8ºC. In the presence of the antimicrobial peptide, at 8ºC, L. monocytogenes population decreased, but growth of resistant cells was observed. At 15ºC, there was no difference between test and control. Furthermore, the haemolytic activity of L. monocytogenes 1/2a was not altered by exposure to L. sakei 1 bacteriocin, which suggests no change in its virulence pattern.Lactobacillus sakei 1 produtor de bacteriocina foi cultivado em caldo Infusão Cérebro-Coração por 24h a 25ºC. O sobrenadante da cultura foi neutralizado, esterilizado por filtração e usado para testar a atividade da bacteriocina frente a Listeria monocytogenes 1/2a, a 8ºC e 15ºC. Lactobacillus sakei ATCC 15521 não bacteriocinogênico, foi utilizado como controle negativo. L. monocytogenes 1/2a foi inoculada no sobrenadante da cultura de L.sakei 1 e L. sakei ATCC 15521 e as populações listeriais foram determinadas após 0, 5 e 10 dias. A produção de bacteriocina foi quantificada como unidades arbitrárias por mL (UA/mL, utilizando-se o teste de antagonismo em ágar. Adicionalmente, para investigar se o padr

  5. Listeria monocytogenes peritonitis in cirrhotic patients: first description in Brazil Peritonite bacteriana espontânea causada por Listeria monocytogenes em pacientes com cirrose: primeiro relato de caso no Brasil

    Directory of Open Access Journals (Sweden)

    Marcos Tadashi Kakitani Toyoshima

    2006-10-01

    Full Text Available Two cases of spontaneous bacterial peritonitis (SBP caused by Listeria monocytogenes in cirrhotic patients are reported. In one of the cases, the microorganism was isolated from pleural effusion and ascites. SBP is a serious and common complication of patients with ascites caused by hepatic cirrhosis and the culture of the ascitic fluid is an important tool for the diagnosis and for the more appropriate treatment. Although a third generation cephalosporin has usually been employed for empiric treatment of SBP, it does not provide adequate coverage against Listeria spp. In such cases the use of ampicillin (with or without sulbactam or sulfamethoxazole-trimethoprim is recommended. The last one is used for secondary prophylaxis, instead of norfloxacin. To summarize, Listeria monocytogenes infection is a rare cause of SBP, whose treatment should be specific for the bacteria.Foram relatados dois casos de peritonite bacteriana espontânea (PBE por Listeria monocytogenes em pacientes com cirrose. Em um dos casos isolamos também o agente no líquido pleural. A PBE é uma complicação comum e grave de pacientes com ascite por cirrose e a cultura do líquido ascítico é de grande importância para o diagnóstico e para o tratamento mais adequado. Embora uma cefalosporina de terceira geração seja geralmente utilizada para o tratamento empírico da PBE, ela não oferece cobertura adequada contra a Listeria spp. Nesses casos, recomenda-se o uso de ampicilina (com ou sem sulbactam ou sulfametoxazol-trimetoprim. Para a profilaxia secundária indica-se o uso deste último, ao invés da norfloxacina. Em resumo, a infecção por Listeria monocytogenes é uma causa rara de PBE e o tratamento específico deve ser administrado.

  6. Development of multiple cross displacement amplification label-based gold nanoparticles lateral flow biosensor for detection of Listeria monocytogenes

    Science.gov (United States)

    Wang, Yi; Li, Hui; Wang, Yan; Li, Hua; Luo, Lijuan; Xu, Jianguo; Ye, Changyun

    2017-01-01

    Listeria monocytogenes, one of most problematic foodborne pathogens, is responsible for listeriosis in both humans and animals and mainly transmitted through the food chain. In this report, we propose a simple, rapid, and nearly instrument-free molecular technique using multiple cross displacement amplification (MCDA) label-based gold nanoparticles lateral flow biosensor (LFB) for specific, sensitive, and visual detection of L. monocytogenes. The MCDA-LFB method was carried out at a constant temperature (61°C) for only 20 min during the reaction stage, and then the amplification mixtures were directly detected by using LFB, eliminating the use of an electrophoresis instrument, special reagents, or amplicon analysis equipment. The whole procedure, from sample processing to result indicating, was finished within 1 h. The analytical specificity of MCDA-LFB method was successfully determined by distinguishing the target bacterium from other pathogens. The analytical sensitivity of the MCDA-LFB assay was 10 fg of genomic templates per reaction in pure culture, which was in complete accordance with MCDA by gel electrophoresis, real-time turbidity, and colorimetric indicator. The assay was also successfully applied to detecting L. monocytogenes in pork samples. Therefore, the rapidity, simplicity, and nearly equipment-free platform of the MCDA-LFB technique make it possible for food control, clinical diagnosis, and more. The proof-of-concept assay can be reconfigured to detect various target sequences by redesigning the specific MCDA primers. PMID:28138243

  7. Listeria monocytogenes in Fresh Produce: Outbreaks, Prevalence and Contamination Levels

    Directory of Open Access Journals (Sweden)

    Qi Zhu

    2017-03-01

    Full Text Available Listeria monocytogenes, a member of the genus Listeria, is widely distributed in agricultural environments, such as soil, manure and water. This organism is a recognized foodborne pathogenic bacterium that causes many diseases, from mild gastroenteritis to severe blood and/or central nervous system infections, as well as abortion in pregnant women. Generally, processed ready-to-eat and cold-stored meat and dairy products are considered high-risk foods for L. monocytogenes infections that cause human illness (listeriosis. However, recently, several listeriosis outbreaks have been linked to fresh produce contamination around the world. Additionally, many studies have detected L. monocytogenes in fresh produce samples and even in some minimally processed vegetables. Thus L. monocytogenes may contaminate fresh produce if present in the growing environment (soil and water. Prevention of biofilm formation is an important control measure to reduce the prevalence and survival of L. monocytogenes in growing environments and on fresh produce. This article specifically focuses on fresh produce–associated listeriosis outbreaks, prevalence in growing environments, contamination levels of fresh produce, and associated fresh produce safety challenges.

  8. Listeria monocytogenes in Fresh Produce: Outbreaks, Prevalence and Contamination Levels

    Science.gov (United States)

    Zhu, Qi; Gooneratne, Ravi; Hussain, Malik Altaf

    2017-01-01

    Listeria monocytogenes, a member of the genus Listeria, is widely distributed in agricultural environments, such as soil, manure and water. This organism is a recognized foodborne pathogenic bacterium that causes many diseases, from mild gastroenteritis to severe blood and/or central nervous system infections, as well as abortion in pregnant women. Generally, processed ready-to-eat and cold-stored meat and dairy products are considered high-risk foods for L. monocytogenes infections that cause human illness (listeriosis). However, recently, several listeriosis outbreaks have been linked to fresh produce contamination around the world. Additionally, many studies have detected L. monocytogenes in fresh produce samples and even in some minimally processed vegetables. Thus L. monocytogenes may contaminate fresh produce if present in the growing environment (soil and water). Prevention of biofilm formation is an important control measure to reduce the prevalence and survival of L. monocytogenes in growing environments and on fresh produce. This article specifically focuses on fresh produce–associated listeriosis outbreaks, prevalence in growing environments, contamination levels of fresh produce, and associated fresh produce safety challenges. PMID:28282938

  9. Intention, Subjective Norms, and Cancer Screening in the Context of Relational Culture

    Science.gov (United States)

    Pasick, Rena J.; Barker, Judith C.; Otero-Sabogal, Regina; Burke, Nancy J.; Joseph, Galen; Guerra, Claudia

    2010-01-01

    Research targeting disparities in breast cancer detection has mainly utilized theories that do not account for social context and culture. Most mammography promotion studies have used a conceptual framework centered in the cognitive constructs of intention (commonly regarded as the most important determinant of screening behavior), self-efficacy, perceived benefit, perceived susceptibility, and/or subjective norms. The meaning and applicability of these constructs in diverse communities are unknown. The purpose of this study is to inductively explore the social context of Filipina and Latina women (the sociocultural forces that shape people’s day-to-day experiences and that directly and indirectly affect health and behavior) to better understand mammography screening behavior. One powerful aspect of social context that emerged from the findings was relational culture, the processes of interdependence and interconnectedness among individuals and groups and the prioritization of these connections above virtually all else. The authors examine the appropriateness of subjective norms and intentions in the context of relational culture and identify inconsistencies that suggest varied meanings from those intended by behavioral theorists. PMID:19805793

  10. Health-related quality of life of irritable bowel syndrome patients in different cultural settings

    Directory of Open Access Journals (Sweden)

    Johansson Saga

    2006-03-01

    Full Text Available Abstract Background Persons with Irritable bowel syndrome (IBS are seriously affected in their everyday life. The effect across different cultural settings of IBS on their quality of life has been little studied. The aim was to compare health-related quality of life (HRQOL of individuals suffering from IBS in two different cultural settings; Crete, Greece and Linköping, Sweden. Methods This study is a sex and age-matched case-control study, with n = 30 Cretan IBS cases and n = 90 Swedish IBS cases and a Swedish control group (n = 300 randomly selected from the general population. Health-related quality of life, measured by SF-36 and demographics, life style indicators and co-morbidity, was measured. Results Cretan IBS cases reported lower HRQOL on most dimensions of SF-36 in comparison to the Swedish IBS cases. Significant differences were found for the dimensions mental health (p Conclusion The results from this study tentatively support that the claim that similar individuals having the same disease, e.g. IBS, but living in different cultural environments could perceive their disease differently and that the disease might affect their everyday life and quality of life in a different way. The Cretan population, and especially women, are more seriously affected mentally by their disease than Swedish IBS cases. Coping with IBS in everyday life might be more problematic in the Cretan environment than in the Swedish setting.

  11. Hyperinvasiveness and increased intercellular spread of Listeria monocytogenes sequence type 1 are independent of listeriolysin S, internalin F and internalin J1.

    Science.gov (United States)

    Rupp, Sebastian; Bärtschi, Michelle; Frey, Joachim; Oevermann, Anna

    2017-07-01

    Listeria monocytogenes is a genetically heterogeneous species, which is divided into evolutionary lineages and clonal complexes (CCs). Not all L. monocytogenes isolates are equally likely to cause disease, with CC1, and in particular sequence type (ST) 1, being the most prevalent complex in human and ruminant infections and more specifically in neurolisteriosis. While the major factors that determine neurotropism are unknown, the L. monocytogenes CC1 strains harbour listeriolysin S (lls) and particular alleles of internalin (inl) F and inlJ, which are not present in CCs commonly isolated from food and the environment. The aim of this study was to analyse the role of these factors in cellular infection. A ST1 field strain (JF5203) from CC1 isolated from a bovine rhombencephalitis case was used to create deletion mutants. These were tested alongside the parental strain and EGD-e (CC9), in different culture models representing L. monocytogenes targets (neurons, microglia, placenta, intestine and macrophages). The phenotype was assessed by quantification of c.f.u. from cell lysates and immunofluorescence analysis. Compared to EGD-e, the ST1 strain JF5203 was hyperinvasive and exhibited increased intercellular spread. However, deletion of llsB, inlF or inlJ1, had no significant effect on infection or growth in the culture models tested. Our results underline the importance of using relevant clinical strains when investigating L. monocytogenes virulence. We show that despite the association with CC1, llsB, inlF and inlJ1 are not involved in the hyperinvasiveness and efficient intercellular spread of ST1 in various cell types.

  12. Sensitivity of PCR IS6110 in relation to culture and staining in Pott′s disease

    Directory of Open Access Journals (Sweden)

    Manoj Kumar

    2013-01-01

    Full Text Available Background: Rapid diagnosis is essential to decrease the morbidity and mortality of Pott′s disease. The bacteriological methods are time-consuming or insensitive. Polymerase chain reaction (PCR provides a rapid diagnostic tool and hope for early diagnosis of this disease. The aim of this study was to compare and assess of a rapid and effective method among diagnostic battery (Ziehl-Neelsen (ZN microscopy, BACTEC culture and PCR of Pott′s disease. Materials and Methods: Sixty-five specimens from clinico-radiological suspected cases of Pott′s disease were included in this study. They were processed for ZN microscopy, BACTEC culture, and PCR IS6110. The tests tool′s efficiency, positive agreement Kc (Kappa coefficient, and significance level (P value were calculated for correlation between PCR and performed tests. Results: The PCR sensitivity reached to 96% and 46.3% among positive and negative specimens on ZN microscopy. Further, 94% and 36.4% sensitivity were found among positive and negative specimens by BACTEC culture. The total 38 (58.5% specimens were detected either ZN microscopy or by BACTEC culture. Thus, the overall sensitivity and specificity of PCR were 95% and 74.1%. The kappa coefficient and P value, calculated for PCR against BACTEC culture and combined results of performed bacteriological tests were (Kc=0.60, (P<0.001 and (Kc=0.70, (P<0.001, respectively. Above statistical relations showed a fair agreement with significant differences. Conclusion: The PCR IS6110 may be useful in rapid detection of clinico-radiological suspected cases of Pott′s disease and those that are negative with bacteriological methods.

  13. Construction of deletion mutants in the phosphotransferase transport system and adenosine triphosphate-binding cassette transporters in Listeria monocytogenes and analysis of their growth under different stress conditions

    Directory of Open Access Journals (Sweden)

    Marina Ceruso

    2013-10-01

    Full Text Available Functional genomics approaches enable us to investigate the biochemical, cellular, and physiological properties of each gene product and are nowadays applied to enhance food safety by understanding microbial stress responses in food and host-pathogen interactions. Listeria monocytogenes is a food-borne pathogen that causes listeriosis and is difficult to eliminate this pathogen since it can survive under multiple stress conditions such as low pH and low temperature. Detailed studies are needed to determine its mode of action and to understand the mechanisms that protect the pathogen when it is subjected to stress. In this study, deletion mutants of phosphotransferase transport system genes (PTS and adenosine triphosphate(ATP-binding cassette transporters (ABC of Listeria monocytogenes F2365 were created using molecular techniques. These mutants and the wild-type were tested under different stress conditions, such as in solutions with different NaCl concentration, pH value and for nisin resistance. Results demonstrate that the behaviour of these deletion mutants is different from the wild type. In particular, deleted genes may be involved in L. monocytogenes resistance to nisin and to acid and salt concentrations. Functional genomics research on L. monocytogenes allows a better understanding of the genes related to stress responses and this knowledge may help in intervention strategies to control this food-borne pathogen. Furthermore, specific gene markers can be used to identify and subtype L. monocytogenes. Thus, future development of this study will focus on additional functional analyses of important stress response-related genes, as well as on methods for rapid and sensitive detection of L. monocytogenes such as using DNA microarrays.

  14. Crowdfunding and Cultural Industry: The new relations between production and consumption based on the culture of participation and collective funding

    Directory of Open Access Journals (Sweden)

    Vanessa Amália Dalpizol Valiati

    2013-04-01

    Full Text Available The configuration of a new standard of consumption and cultural production based on the participation of consumers through the Internet has become a feature of modern society (Jenkins, 2009; Shirky, 2011. Based on this premise, we intend to analyze the process of crowd funding, in which a mass of staff is united in the realization of cultural projects and to create a unique product, under the bias of the culturological theory. This work is also raising questions as to the timeliness of the concept of cultural industry in the face of new practices allowed by digital networks and a potential democratization, focusing the brazilian website Catarse.

  15. Development of multiple cross displacement amplification label-based gold nanoparticles lateral flow biosensor for detection of Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Wang Y

    2017-01-01

    Full Text Available Yi Wang,1 Hui Li,1,2 Yan Wang,1 Hua Li,1 Lijuan Luo,1 Jianguo Xu,1 Changyun Ye1 1State Key Laboratory of Infectious Disease Prevention and Control, National Institute for Communicable Disease Control and Prevention, Collaborative Innovation Center for Diagnosis and Treatment of Infectious Diseases, Chinese Center for Disease Control and Prevention, Changping, Beijing, 2Department of Microbiology, GuiZhou Medical University, Guiyang, Guizhou, People’s Republic of China Abstract: Listeria monocytogenes, one of most problematic foodborne pathogens, is responsible for listeriosis in both humans and animals and mainly transmitted through the food chain. In this report, we propose a simple, rapid, and nearly instrument-free molecular technique using multiple cross displacement amplification (MCDA label-based gold nanoparticles lateral flow biosensor (LFB for specific, sensitive, and visual detection of L. monocytogenes. The MCDA-LFB method was carried out at a constant temperature (61°C for only 20 min during the reaction stage, and then the amplification mixtures were directly detected by using LFB, eliminating the use of an electrophoresis instrument, special reagents, or amplicon analysis equipment. The whole procedure, from sample processing to result indicating, was finished within 1 h. The analytical specificity of MCDA-LFB method was successfully determined by distinguishing the target bacterium from other pathogens. The analytical sensitivity of the MCDA-LFB assay was 10 fg of genomic templates per reaction in pure culture, which was in complete accordance with MCDA by gel electrophoresis, real-time turbidity, and colorimetric indicator. The assay was also successfully applied to detecting L. monocytogenes in pork samples. Therefore, the rapidity, simplicity, and nearly equipment-free platform of the MCDA-LFB technique make it possible for food control, clinical diagnosis, and more. The proof-of-concept assay can be reconfigured to detect

  16. The overgrowth of Listeria monocytogenes by other Listeria spp. in food samples undergoing enrichment cultivation has a nutritional basis.

    Science.gov (United States)

    Besse, Nathalie Gnanou; Barre, Lena; Buhariwalla, Colin; Vignaud, Marie Léone; Khamissi, Elissa; Decourseulles, Emilie; Nirsimloo, Marjorie; Chelly, Minyar; Kalmokoff, Martin

    2010-01-01

    The isolation of Listeria monocytogenes from food is carried out using a double enrichment. In cases where multiple Listeria species are present within the original sample, L. monocytogenes can be overgrown during enrichment by other species of listeria present in the original sample. From a practical perspective, this can result in a false negative or complicate the ability of public health investigators to match food and clinical isolates. We have further investigated this phenomenon by analysing the growth kinetics of single species and pairs of different species over the ISO 11290-1 enrichment process. The overgrowth of a strain of L. monocytogenes by a strain of Listeria innocua resulted primarily from interactions which occurred in late exponential phase, where it was observed that growth of both strains stopped when the dominant strain reached stationary phase. In a second mixed culture, the dominant L. monocytogenes strain suppressed the exponential growth rate of the second Listeria welshimeri strain. Both findings suggest that the overgrowth could partially be explained in terms of a nutritional competition. Multi-factor analysis of Fraser broth constituents and growth temperatures using both stressed and non-stressed inoculants failed to identify any single factor in the ISO 11290-1 methodology which would contribute to the overgrowth phenomenon in our model system. Furthermore, species was not a significant factor in observed differences in growth parameters among a wider array of strains which had been stressed or not stressed prior to grown in Fraser broths, even though some strains had significantly faster growth rates than others. Limiting diffusion in Fraser broth through the addition of agar significantly reduced the extent of the overgrowth in experiments using mixtures of strains originally isolated from foods where overgrowth had been previously observed. Taken together, these findings support that the overgrowth phenomenon in most instances

  17. Controlling Listeria monocytogenes and Leuconostoc mesenteroides in Uncured Deli-style Turkey Breast Using a Clean Label Antimicrobial.

    Science.gov (United States)

    Weyker, Robert E; Glass, Kathleen A; Milkowski, Andrew L; Seman, Dennis L; Sindelar, Jeffrey J

    2016-03-01

    Interest in natural/organic meat products has resulted in the need to validate the effectiveness of clean label antimicrobials to increase safety and shelf life of these products. A Response Surface Methodology (RSM) was used to investigate the effects of varying levels of moisture, pH, and a commercial "clean-label" antimicrobial (cultured sugar-vinegar blend; CSVB) on the growth rate of Listeria monocytogenes and Leuconostoc mesenteroides in uncured turkey stored at 4 °C for 16 wk. Twenty treatment combinations of moisture (60% to 80%), pH (5.8 to 6.4), and CSVB (2.5% to 5.0%) were evaluated during phase I to develop growth curves for both microbe types, whereas the interactive effects of pH (5.8 to 6.4) and CSVB (0.0 to 4.75) were tested in 16 treatment combinations during Phase II at a single moisture level using L. monocytogenes only. CSVB inhibited L. monocytogenes growth in 14 of the 20 treatments tested in Phase I and in 12 of the 16 treatments in Phase II through 16 and 8 wk, respectively. In contrast, CSVB had little effect on L. mesenteroides, with growth inhibited in only 4 of 20 treatments in Phase I and was therefore not tested further in Phase II. Significant interactions of the RSM design coefficients yielded a predictive model for L. mesenteroides growth rate, but due to lack of growth, no growth rate model was developed for L. monocytogenes. CSVB was found to be an effective antilisteral antimicrobial, while having little effect on a spoilage microorganism.

  18. Reliable and Rapid Identification of Listeria monocytogenes and Listeria Species by Artificial Neural Network-Based Fourier Transform Infrared Spectroscopy†

    Science.gov (United States)

    Rebuffo, Cecilia A.; Schmitt, Jürgen; Wenning, Mareike; von Stetten, Felix; Scherer, Siegfried

    2006-01-01

    Differentiation of the species within the genus Listeria is important for the food industry but only a few reliable methods are available so far. While a number of studies have used Fourier transform infrared (FTIR) spectroscopy to identify bacteria, the extraction of complex pattern information from the infrared spectra remains difficult. Here, we apply artificial neural network technology (ANN), which is an advanced multivariate data-processing method of pattern analysis, to identify Listeria infrared spectra at the species level. A hierarchical classification system based on ANN analysis for Listeria FTIR spectra was created, based on a comprehensive reference spectral database including 243 well-defined reference strains of Listeria monocytogenes, L. innocua, L. ivanovii, L. seeligeri, and L. welshimeri. In parallel, a univariate FTIR identification model was developed. To evaluate the potentials of these models, a set of 277 isolates of diverse geographical origins, but not included in the reference database, were assembled and used as an independent external validation for species discrimination. Univariate FTIR analysis allowed the correct identification of 85.2% of all strains and of 93% of the L. monocytogenes strains. ANN-based analysis enhanced differentiation success to 96% for all Listeria species, including a success rate of 99.2% for correct L. monocytogenes identification. The identity of the 277-strain test set was also determined with the standard phenotypical API Listeria system. This kit was able to identify 88% of the test isolates and 93% of L. monocytogenes strains. These results demonstrate the high reliability and strong potential of ANN-based FTIR spectrum analysis for identification of the five Listeria species under investigation. Starting from a pure culture, this technique allows the cost-efficient and rapid identification of Listeria species within 25 h and is suitable for use in a routine food microbiological laboratory. PMID

  19. Perception of risk for Domoic Acid related health problems: A Cross-cultural study.

    Science.gov (United States)

    Roberts, Sparkle M; Grattan, Lynn M; Toben, Alexandra C; Ausherman, Christina; Trainer, Vera; Tracy, Kate; Morris, J Glenn

    2016-07-01

    Risk perception is a complex process that refers to the way people approach, think about and interpret risks in their environment. An important element of risk perception is that it is culturally situated. Since HAB's can present a health risk in many places around the world, looking at cultural parameters for understanding and interpreting risks are important. This study examined how two different groups of people perceive the potential health risks of low level exposure to domoic acid (DA) through razor clam consumption. The risk perceptions of Washington State, USA coastal dwelling Native American nations (NA) were compared to that of a community sample of recreational razor clam harvesters (CRH). Overall, the findings support the hypothesis that cultural and community specific contexts impact the perception of risk of a DA related illness. Specifically, the NA sample was distinguished by worrying more about ocean pollution, attributing DA risks to climate change, expressing concerns about the potential impact of DA on future generations, and feeling better informed than the CRH group. The CRH group were more likely to attribute the DA problem to anthropogenic or industrial causes; and view the risk of health problems as lower than that associated with smoking, high cholesterol, anxiety or depression, alcoholism, high blood pressure or obesity. The CRH group was also more likely to turn to the media for DA related information. Both groups trust the decisions of state and tribe health and natural resources officials and demonstrated a complex pattern of findings that involved gender. It was recommended that risk communication and outreach activities are designed to take into consideration factors that specifically apply to each cultural community.

  20. Identifying food-related life style segments by a cross-culturally valid scaling device

    DEFF Research Database (Denmark)

    Brunsø, Karen; Grunert, Klaus G.

    1994-01-01

    We present a new view of life style, based on a cognitive perspective, which makes life style specific to certain areas of consumption. The specific area of consumption studied here is food, resulting in a concept of food-related life style. An instrument is developed that can measure food-relate...... then applied the set of scales to a fourth country, Germany, based on a representative sample of 1000 respondents. The scales had, with a fe exceptions, moderately good reliabilities. A cluster ana-ly-sis led to the identification of 5 segments, which differed on all 23 scales.......We present a new view of life style, based on a cognitive perspective, which makes life style specific to certain areas of consumption. The specific area of consumption studied here is food, resulting in a concept of food-related life style. An instrument is developed that can measure food......-related life style in a cross-culturally valid way. To this end, we have col-lected a pool of 202 items, collected data in three countries, and have con-structed scales based on cross-culturally stable patterns. These scales have then been subjected to a number of tests of reliability and vali-dity. We have...

  1. Monolaurin and acetic acid inactivation of Listeria monocytogenes attached to stainless steel.

    Science.gov (United States)

    Oh, D H; Marshall, D L

    1996-03-01

    Individual and combined antimicrobial effects of monolaurin and acetic acid on Listeria monocytogenes planktonic cells or stainless-steel-adherent cells were determined in order to evaluate cell viability during a 25-min exposure period at 25 degrees C. A 10(7)-colony-forming units (CFU)/ml population of planktonic cells was completely inactivated by the synergistic combination of 1% acetic acid with 50 or 100 microg/ml of monolaurin within 25 or 20 min, respectively. Either compound alone caused partial but incomplete inactivation within the same time periods. A population of 10(5) CFU/cm2 of 1-day adherent cells on stainless steel was completely inactivated within 25 min, but with the highest concentrations of the combined chemicals, i.e., 1% acetic acid and 100 microg/ml of monolaurin. The combined chemical treatment again synergistically produced greater inhibition. A 10(6)-CFU/cm2 population of 7-day adherent cells was not completely inactivated within 25 min of exposure, although counts did decline. The results demonstrate increased resistance of attached L. monocytogenes to acetic acid and monolaurin and show that resistance increased with culture age. Combinations of organic acids and monolaurin might be considered as sanitizers of food contact surfaces, but activities of such combinations are likely to be less than other commonly used sanitizers.

  2. HISTOPATHOLOGICAL CHANGES IN THE LIVER OF MICE CHALLENGED WITH Listeria monocytogenes IN SIX ZONES OF NIGERIA

    Directory of Open Access Journals (Sweden)

    Enurah L U

    2013-11-01

    Full Text Available Fifty four strains of Listeria monocytogenes were isolated from fresh raw milk and abattoir effluent. Uniform distribution pattern of the isolates in the six zones of Nigeria viz Southwest, Southeast, Southsouth, Norhwest, Northeast and Northcentral is evidence that food contamination with this organism may be a source of foodborne outbreak s in Nigeria. Present study investigated the pathogenic nature of the strains. The pathogenic strains were isolated by culturing on 7% Sheep Blood Agar for evidence of haemolysis and were used to challenge thr ee out of four groups of laboratory bred mice for pathogenicity test. The Group 1 mice were given 1ml of sterile distilled water orally and served as control, groups 2, 3 and 4 with 1.6 x 10 5cfu/ml orally, subcutaneously and intraperitoneally respectively. Experimental animals were successfully observed up to six days for clinical signs and possible mortality. All the infected mice that died were subjected to post - mortem examination which showed change with liver abscess with congested gall bladder containing purulent bile. Histopathology sections of the liver showed hepatocyte necrosis with infiltration of degenerative neutrophils, lymphocytes and few plasma cells compared to control. The study confirmed the presence of pathogenic strains of L.monocytogenes in all zones of Nigeria and their presence in the food may pose serious health hazards

  3. Listeria monocytogenes protein fraction induces dendritic cells maturation and T helper 1 immune responses.

    Directory of Open Access Journals (Sweden)

    Azad Saei

    2014-02-01

    Full Text Available Fully mature dendritic cells (DCs play pivotal role in inducing immune responses and converting naïve T lymphocytes into functional Th1 cells. We aimed to evaluate Listeria Monocytogenes-derived protein fractions to induce DC maturation and stimulating T helper (Th1 immune responses.In the present study, we fractionated Listeria Monocytogenes-derived proteins by adding of ammonium sulfate in a stepwise manner. DCs were also generated from C57BL/6 mice bone marrow precursor cells. Then, the effects of protein fractions on bone marrow derived DC (BMDC maturation were evaluated. In addition, we assessed the capacity of activated DCs to induce cytokine production and proliferation of lymphocytes.Listeria-derived protein fractions induced fully mature DCs expressing high costimulatory molecules such as CD80, CD86 and CD40. DCs that were activated by selected F3 fraction had low capacity to uptake exogenous antigens while secreted high levels of Interleukine (IL-12. Moreover, lymphocytes cultured with activated BMDCs produced high amounts of IFN-γ and showed higher proliferation than control. Listeria derived protein fractions differently influenced DC maturation.In conclusion, Listeria protein activated-BMDCs can be used as a cell based vaccine to induce anti-tumor immune responses.

  4. Magnetic bead based immuno-detection of Listeria monocytogenes and Listeria ivanovii from infant formula and leafy green vegetables using the Bio-Plex suspension array system.

    Science.gov (United States)

    Day, J B; Basavanna, U

    2015-04-01

    Listeriosis, a disease contracted via the consumption of foods contaminated with pathogenic Listeria species, can produce severe symptoms and high mortality in susceptible people and animals. The development of molecular methods and immuno-based techniques for detection of pathogenic Listeria in foods has been challenging due to the presence of assay inhibiting food components. In this study, we utilize a macrophage cell culture system for the isolation and enrichment of Listeria monocytogenes and Listeria ivanovii from infant formula and leafy green vegetables for subsequent identification using the Luminex xMAP technique. Macrophage monolayers were exposed to infant formula, lettuce and celery contaminated with L. monocytogenes or L. ivanovii. Magnetic microspheres conjugated to Listeria specific antibody were used to capture Listeria from infected macrophages and then analyzed using the Bio-Plex 200 analyzer. As few as 10 CFU/mL or g of L. monocytogenes was detected in all foods tested. The detection limit for L. ivanovii was 10 CFU/mL in infant formula and 100 CFU/g in leafy greens. Microsphere bound Listeria obtained from infected macrophage lysates could also be isolated on selective media for subsequent confirmatory identification. This method presumptively identifies L. monocytogenes and L. ivanovii from infant formula, lettuce and celery in less than 28 h with confirmatory identifications completed in less than 48 h.

  5. Association between a case study of asymptomatic ovine listerial mastitis and the contamination of soft cheese and cheese processing environment with Listeria monocytogenes in Portugal.

    Science.gov (United States)

    Pintado, Cristina M B S; Grant, Kathie A; Halford-Maw, Robin; Hampton, Mike D; Ferreira, Maria A S S; McLauchlin, Jim

    2009-06-01

    For 5 months, the udders of milking ewes, raw ewe's milk, cheese, and the plant and environment of a cheese manufacturer in Portugal were investigated using standard methods for the presence of Listeria spp. An association between subclinical mastitis and Listeria monocytogenes in a single lactating sheep was investigated by visual inspection of udders for signs of inflammation, application of somatic cell counts, the California mastitis test, pH measurement to milk, and culture of L. monocytogenes and Staphylococcus spp. To track the routes of contamination by L. monocytogenes, 103 isolates were characterized by molecular serotyping and amplified fragment length polymorphism, and a selection was further tested by pulsed-field gel electrophoresis. This study provides molecular and epidemiological evidence tracking the persistence of a single L. monocytogenes strain causing a subclinical udder infection without obvious inflammation in a single ewe. This infection was the likely source of contamination of raw milk that was subsequently used to produce unpasteurised milk cheese and resulted in a single strain of this bacterium colonizing the processing environment and the final cheese product.

  6. Enterocin B3A-B3B produced by LAB collected from infant faeces: potential utilization in the food industry for Listeria monocytogenes biofilm management.

    Science.gov (United States)

    Al-Seraih, Alaa; Belguesmia, Yanath; Baah, John; Szunerits, Sabine; Boukherroub, Rabah; Drider, Djamel

    2017-02-01

    Enterococcus faecalis B3A-B3B produces the bacteriocin B3A-B3B with activity against Listeria monocytogenes, Staphylococcus aureus, methicillin-resistant Staphylococcus aureus (MRSA) and Clostridium perfringens, but apparently not against fungi or Gram-negative bacteria, except for Salmonella Newport. B3A-B3B enterocin has two different nucleotides but similar amino acid composition to the class IIb MR10A-MR10B enterocin. B3A-B3B consists of two peptides of predicted molecular mass of 5176.31 Da (B3A) and 5182.21 Da (B3B). Importantly, B3A-B3B impeded biofilm formation of the foodborne pathogen L. monocytogenes 162 grown on stainless steel. The antimicrobial treatment of stainless steel with nisin (1 or 16 mg ml(-1)) decreased the cell numbers by about 2 log CFU ml(-1), thereby impeding the biofilm formation by L. monocytogenes 162 or its nisin-resistant derivative strain L. monocytogenes 162R. Furthermore, the combination of nisin and B3A-B3B enterocin reduced the MIC required to inhibit this pathogen grown in planktonic or biofilm cultures.

  7. Listeria monocytogenes in renal transplant recipients Listeria monocytogenes em pacientes pós-transplante renal

    Directory of Open Access Journals (Sweden)

    Cristina Barroso HOFER

    1999-11-01

    Full Text Available Five cases of Listeria monocytogenes bacteriemia were observed from April to December 1985, among renal transplant recipients from the same hospital in São Paulo, Brazil. The patients were adults (mean age: 40.6 years, and the basic complain was fever, with no report of meningeal syndrome. Laboratory tests revealed the presence of two serovars, 1/2a and 4b, which were classified into three lysotypes. The four strains of serovar 4b showed the same antibiotype, with resistance to cefoxitin, clindamycin, oxacillin and penicillin.No período de abril a dezembro de 1985, foram observados cinco casos de listeriose em transplantados renais num mesmo hospital de São Paulo, SP. Os pacientes eram adultos (média de 40,6 anos tendo como queixa básica a febre. Laboratorialmente, em todos foram reconhecidos Listeria monocytogenes, caracterizada por dois sorovares 1/2a e 4b e três lisotipos distintos. As amostras do sorovar 4b apresentaram o mesmo antibiotipo: resistentes à cefoxitina, clindamicina, oxacilina e penicilina.

  8. Oxygen restriction increases the infective potential of Listeria monocytogenes in vitro in Caco-2 cells and in vivo in guinea pigs

    Directory of Open Access Journals (Sweden)

    Licht Tine

    2007-06-01

    Full Text Available Abstract Background Listeria monocytogenes has been implicated in several food borne outbreaks as well as sporadic cases of disease. Increased understanding of the biology of this organism is important in the prevention of food borne listeriosis. The infectivity of Listeria monocytogenes ScottA, cultivated with and without oxygen restriction, was compared in vitro and in vivo. Fluorescent protein labels were applied to allow certain identification of Listeria cells from untagged bacteria in in vivo samples, and to distinguish between cells grown under different conditions in mixed infection experiments. Results Infection of Caco-2 cells revealed that Listeria cultivated under oxygen-restricted conditions were approximately 100 fold more invasive than similar cultures grown without oxygen restriction. This was observed for exponentially growing bacteria, as well as for stationary-phase cultures. Oral dosage of guinea pigs with Listeria resulted in a significantly higher prevalence (p Listeria in fecal samples was observed after dosage with oxygen-restricted bacteria. These differences were seen after challenge with single Listeria cultures, as well as with a mixture of two cultures grown with and without oxygen restriction. Conclusion Our results show for the first time that the environmental conditions to which L. monocytogenes is exposed prior to ingestion are decisive for its in vivo infective potential in the gastrointestinal tract after passage of the gastric barrier. This is highly relevant for safety assessment of this organism in food.

  9. Listeria monocytogenes has a functional chitinolytic system and an active lytic polysaccharide monooxygenase

    DEFF Research Database (Denmark)

    Paspaliari, Dafni Katerina; Loose, Jennifer S. M.; Larsen, Marianne Halberg

    2015-01-01

    B) and a multi-modular lytic polysaccharide monooxygenase (LmLPMO10). These enzymes have been related to virulence and their role in chitin metabolism is poorly understood. It is thus of interest to functionally characterize the individual enzymes in order to shed light on their roles in vivo. Our results......Chitinases and chitin-active lytic polysaccharide monooxygenases (LPMOs) are most commonly associated with chitin metabolism, but are also reported as virulence factors in pathogenic bacteria. Listeria monocytogenes, a well-known virulent bacterium, possesses two chitinases (ChiA and Chi...

  10. Listeria spp., y L. monocytogenes EN LECHE CRUDA DE CABRA

    Directory of Open Access Journals (Sweden)

    Yolanda Albarracín C

    2008-08-01

    Full Text Available Objective. To test non-pasteurized goat’s milk from the village of ‘la Garita’, Northern Santander, for Listeria monocytogenes. Material and methods. 90 samples of non-pasteurized goat’s milk were obtained over a 4 month period; pH and temperature of each sample were measured. The INVIMA technique was used to isolate L. monocytogenes; the species was confirmed by PCR. Results. The study showed that eight goat milk providers of the zone neither had refrigeration nor pasteurized the milk. The prevalence of L. monocytogenes was 3%; 15% of the samples had other species of Listeria. The milk obtained from this zone contained the pathogen that may cause listeriosis in children less than 5 years of age, pregnant women, adults and immunologically compromised patients. Conclusions. This study shows the occurrence of this pathogen in goat’s milk and identified areas of risk for those people who drink goat’s milk.

  11. Animal models for oral transmission of Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Sarah E F D'Orazio

    2014-02-01

    Full Text Available Listeria monocytogenes has been recognized as a food borne pathogen in humans since the 1980s, but we still understand very little about oral transmission of L. monocytogenes or the host factors that determine susceptibility to gastrointestinal infection, due to the lack of an appropriate small animal model of oral listeriosis. Early feeding trials suggested that many animals were highly resistant to oral infection, and the more reproducible intravenous or intraperitoneal routes of inoculation soon came to be favored. There are a fair number of previously published studies using an oral infection route, but the work varies widely in terms of bacterial strain choice, the methods used for oral transmission, and various manipulations used to enhance infectivity. This mini review will summarize the published literature using oral routes of L. monocytogenes infection and will highlight recent technological advances that have made oral infection a more attractive model system.

  12. Listeria monocytogenes response regulators important for stress tolerance and pathogenesis

    DEFF Research Database (Denmark)

    Kallipolitis, B H; Ingmer, H

    2001-01-01

    Environmental sensing by two-component signal transduction systems is likely to play a role for growth and survival of Listeria monocytogenes both during transmission in food products and within a host organism. Two-component systems typically consist of a membrane-associated sensor histidine...... kinase and a gene regulatory protein, the response regulator (RR). We have identified seven putative RR genes in L. monocytogenes LO28 by PCR using degenerate oligonucleotide primers. By insertional inactivation we obtained data suggesting that three of the putative RRs contribute to the pathogenicity...... of L. monocytogenes in mice. Strikingly, the mutants that were attenuated in virulence also had a decreased ability to grow in the presence of various stress conditions potentially encountered in an infection process. Thus, our data point to a connection between the ability of the putative two...

  13. Case of Contamination by Listeria Monocytogenes in Mozzarella Cheese

    Science.gov (United States)

    Tolli, Rita; Bossù, Teresa; Rodas, Eda Maria Flores; Di Giamberardino, Fabiola; Di Sirio, Alessandro; Vita, Silvia; De Angelis, Veronica; Bilei, Stefano; Sonnessa, Michele; Gattuso, Antonietta; Lanni, Luigi

    2014-01-01

    Following a Listeria monocytogenes detection in a mozzarella cheese sampled at a dairy plant in Lazio Region, further investigations have been conducted both by the competent Authority and the food business operatordairy factory (as a part of dairy factory HACCP control). In total, 90 dairy products, 7 brine and 64 environmental samples have been tested. The prevalence of Listeria monocytogenes was 24.4% in mozzarella cheese, and 9.4% in environmental samples, while brines were all negatives. Forty-seven strains of L. monocytogenes have been isolated, all belonging to 4b/4e serotype. In 12 of these, the macrorestriction profile has been determined by means of pulsed field gel electrophoresis. The profiles obtained with AscI enzyme showed a 100% similarity while those obtained with ApaI a 96.78% similarity. These characteristics of the isolated strains jointly with the production process of mozzarella cheese has allowed to hypothesise an environmental contamination. PMID:27800317

  14. Comparative usefulness of inflammatory markers to indicate bacterial infection-analyzed according to blood culture results and related clinical factors.

    Science.gov (United States)

    Nishikawa, Hirokazu; Shirano, Michinori; Kasamatsu, Yu; Morimura, Ayumi; Iida, Ko; Kishi, Tomomi; Goto, Tetsushi; Okamoto, Saki; Ehara, Eiji

    2016-01-01

    To assess relationships of inflammatory markers and 2 related clinical factors with blood culture results, we retrospectively investigated inpatients' blood culture and blood chemistry findings that were recorded from January to December 2014 using electronic medical records and analyzed the data of 852 subjects (426 culture-positive and 426 culture-negative). Results suggested that the risk of positive blood culture statistically increased as inflammatory marker levels and the number of related factors increased. Concerning the effectiveness of inflammatory markers, when the outcome definition was also changed for C-reactive protein (CRP), the odds ratio had a similar value, whereas when the outcome definition of blood culture positivity was used for procalcitonin (PCT), the greatest effectiveness of that was detected. Therefore, the current results suggest that PCT is more useful than CRP as an auxiliary indication of bacterial infection.

  15. Expression of Folliculogenesis-Related Genes in Vitrified Human Ovarian Tissue after Two Weeks of In Vitro Culture

    Directory of Open Access Journals (Sweden)

    Zahra Shams Mofarahe

    2017-01-01

    Full Text Available Objective This study was designed to evaluate the effects of vitrification and in vitro culture of human ovarian tissue on the expression of oocytic and follicular cell-related genes. Materials and Methods In this experimental study, ovarian tissue samples were obtained from eight transsexual women. Samples were cut into small fragments and were then assigned to vitrified and non-vitrified groups. In each group, some tissue fragments were divided into un-cultured and cultured (in α-MEM medium for 2 weeks subgroups. The normality of follicles was assessed by morphological observation under a light microscope using hematoxylin and eosin (H&E staining. Expression levels of factor in the germ line alpha (FIGLA, KIT ligand (KL, growth differentiation factor 9 (GDF-9 and follicle stimulating hormone receptor (FSHR genes were quantified in both groups by real-time reverse transcriptase polymerase chain reaction (RT-PCR at the beginning and the end of culture. Results The percentage of normal follicles was similar between non-cultured vitrified and non-vitrified groups (P>0.05, however, cultured tissues had significantly fewer normal follicles than non-cultured tissues in both vitrified and non-vitrified groups (P<0.05. In both cultured groups the rate of primary and secondary follicles was significantly higher than non-cultured tissues (P<0.05. The expression of all examined genes was not significantly altered in both non-cultured groups. Whiles, in comparison with cultured tissues non-cultured tissues, the expression of FIGLA gene was significantly decreased, KL gene was not changed, GDF-9 and FSHR genes was significantly increased (P<0.05. Conclusion Human ovarian vitrification following in vitro culture has no impairing effects on follicle normality and development and expression of related-genes. However, in vitro culture condition has deleterious effects on normality of follicles.

  16. Keberadaan Bakteri Listeria monocytogenes pada Keju Gouda Produksi Lokal dan Impor (PRESENCE OF LISTERIA MONOCYTOGENES IN LOCAL AND IMPORTED GOUDA CHEESES)

    OpenAIRE

    Debby Fadhilah Pazra; Trioso Purnawarman; Denny Widaya Lukman

    2014-01-01

    Listeria monocytogenes is included in the foodborne pathogen, which has been associated with severaloutbreaks of human listeriosis especially in high risk groups. Listeria monocytogenes could be found inGouda cheeses because of poor hygienic and sanitation practices. In addition, this bacteria could surviveduring the making of cheese and cheese ripening process. The purpose of this study was to identify thepresence of L. monocytogenes in local and imported Gouda cheeses and how the safety lev...

  17. Diversity and distribution of Listeria monocytogenes in meat processing plants.

    Science.gov (United States)

    Martín, Belén; Perich, Adriana; Gómez, Diego; Yangüela, Javier; Rodríguez, Alicia; Garriga, Margarita; Aymerich, Teresa

    2014-12-01

    Listeria monocytogenes is a major concern for the meat processing industry because many listeriosis outbreaks have been linked to meat product consumption. The aim of this study was to elucidate L. monocytogenes diversity and distribution across different Spanish meat processing plants. L. monocytogenes isolates (N = 106) collected from food contact surfaces of meat processing plants and meat products were serotyped and then characterised by multilocus sequence typing (MLST). The isolates were serotyped as 1/2a (36.8%), 1/2c (34%), 1/2b (17.9%) and 4b (11.3%). MLST identified ST9 as the most predominant allelic profile (33% of isolates) followed by ST121 (16%), both of which were detected from several processing plants and meat products sampled in different years, suggesting that those STs are highly adapted to the meat processing environment. Food contact surfaces during processing were established as an important source of L. monocytogenes in meat products because the same STs were obtained in isolates recovered from surfaces and products. L. monocytogenes was recovered after cleaning and disinfection procedures in two processing plants, highlighting the importance of thorough cleaning and disinfection procedures. Epidemic clone (EC) marker ECI was identified in 8.5%, ECIII was identified in 2.8%, and ECV was identified in 7.5% of the 106 isolates. Furthermore, a selection of presumably unrelated ST9 isolates was analysed by multi-virulence-locus sequence typing (MVLST). Most ST9 isolates had the same virulence type (VT11), confirming the clonal origin of ST9 isolates; however, one ST9 isolate was assigned to a new VT (VT95). Consequently, MLST is a reliable tool for identification of contamination routes and niches in processing plants, and MVLST clearly differentiates EC strains, which both contribute to the improvement of L. monocytogenes control programs in the meat industry. Copyright © 2014 Elsevier Ltd. All rights reserved.

  18. Analytical bioconjugates, aptamers, enable specific quantitative detection of Listeria monocytogenes.

    Science.gov (United States)

    Lee, Sang-Hee; Ahn, Ji-Young; Lee, Kyeong-Ah; Um, Hyun-Ju; Sekhon, Simranjeet Singh; Sun Park, Tae; Min, Jiho; Kim, Yang-Hoon

    2015-06-15

    As a major human pathogen in the Listeria genus, Listeria monocytogenes causes the bacterial disease listeriosis, which is a serious infection caused by eating food contaminated with the bacteria. We have developed an aptamer-based sandwich assay (ABSA) platform that demonstrates a promising potential for use in pathogen detection using aptamers as analytical bioconjugates. The whole-bacteria SELEX (WB-SELEX) strategy was adopted to generate aptamers with high affinity and specificity against live L. monocytogenes. Of the 35 aptamer candidates tested, LMCA2 and LMCA26 reacted to L. monocytogenes with high binding, and were consequently chosen as sensing probes. The ABSA platform can significantly enhance the sensitivity by employing a very specific aptamer pair for the sandwich complex. The ABSA platform exhibited a linear response over a wide concentration range of L. monocytogenes from 20 to 2×10(6) CFU per mL and was closely correlated with the following relationship: y=9533.3x+1542.3 (R(2)=0.99). Our proposed ABSA platform also provided excellent specificity for the tests to distinguish L. monocytogenes from other Listeria species and other bacterial genera (3 Listeria spp., 4 Salmonella spp., 2 Vibrio spp., 3 Escherichia coli and 3 Shigella spp.). Improvements in the sensitivity and specificity have not only facilitated the reliable detection of L. monocytogenes at extremely low concentrations, but also allowed for the development of a 96-well plate-based routine assay platform for multivalent diagnostics. Copyright © 2015 Elsevier B.V. All rights reserved.

  19. Culture- and Immigration-Related Stress Faced by Chinese American Families with a Patient Having Schizophrenia.

    Science.gov (United States)

    Kung, Winnie W

    2016-07-01

    The impact of culture and immigration on the experience of Chinese American families with a member having schizophrenia is explored within the frameworks of family systems and stress and coping. This qualitative study was conducted within an intervention study of family psychoeducation using therapists' session notes from 103 family sessions and 13 relatives' group sessions from nine patients and 19 relatives. The high stigma attached to mental illness leading to social isolation, and families' devotion to caregiving exacerbated caregiver burden. Taboo against discussing dating and sexuality and the consideration of arranged marriages caused unique stress. The insecurity as immigrants and shortage of bilingual services were related to greater enmeshment within these families. Implications on research methodology and practice are discussed.

  20. A review of the incidence and transmission of Listeria monocytogenes in ready-to-eat products in retail and food service environments.

    Science.gov (United States)

    Lianou, Alexandra; Sofos, John N

    2007-09-01

    Contamination of ready-to-eat products with Listeria monocytogenes may occur at several stages before consumption. Accessibility to the public and relatively limited control interventions at retail and food service establishments (compared with the processing sector of the food industry) and the lack of a specific regulatory framework increase the likelihood of introduction of this pathogen into some foods in these establishments. This review is a compilation of available information on the incidence and transmission of L. monocytogenes through ready-to-eat products at the retail and food service level. The potential transmission of L. monocytogenes within retail and food service operations has been indicated in epidemiological investigations and by survey data. Potential sources of the organism in these operations include the environment, food handlers, and incoming raw ingredients or processed products that have become contaminated after the lethality treatment at the manufacturing facility. L. monocytogenes may be present at retail and food service establishments in various ready-to-eat products, both prepackaged and those packaged in the store, and occasionally at high concentrations. This issue dictates the need for development and application of effective control measures, and potential control approaches are discussed here. Good manufacturing practices, appropriate cleaning, sanitation and hygiene programs, and temperature control required for prevention or inhibition of growth of the pathogen to high levels are critical for control of L. monocytogenes in the retail and food service sector. A comprehensive food safety system designed to be functional in retail and food service operations and based on the philosophy of hazard analysis and critical control point systems and a series of sound prerequisite programs can provide effective control of L. monocytogenes in these environments. However, competent delivery of food safety education and training to retail

  1. Polyphasic characterization and genetic relatedness of low-virulence and virulent Listeria monocytogenes isolates

    Directory of Open Access Journals (Sweden)

    Roche Sylvie M

    2012-12-01

    Full Text Available Abstract Background Currently, food regulatory authorities consider all Listeria monocytogenes isolates as equally virulent. However, an increasing number of studies demonstrate extensive variations in virulence and pathogenicity of L. monocytogenes strains. Up to now, there is no comprehensive overview of the population genetic structure of L. monocytogenes taking into account virulence level. We have previously demonstrated that different low-virulence strains exhibit the same mutations in virulence genes suggesting that they could have common evolutionary pathways. New low-virulence strains were identified and assigned to phenotypic and genotypic Groups using cluster analysis. Pulsed-field gel electrophoresis, virulence gene sequencing and multi-locus sequence typing analyses were performed to study the genetic relatedness and the population structure between the studied low-virulence isolates and virulent strains. Results These methods showed that low-virulence strains are widely distributed in the two major lineages, but some are also clustered according to their genetic mutations. These analyses showed that low-virulence strains initially grouped according to their lineage, then to their serotypes and after which, they lost their virulence suggesting a relatively recent emergence. Conclusions Loss of virulence in lineage II strains was related to point mutation in a few virulence genes (prfA, inlA, inlB, plcA. These strains thus form a tightly clustered, monophyletic group with limited diversity. In contrast, low-virulence strains of lineage I were more dispersed among the virulence strains and the origin of their loss of virulence has not been identified yet, even if some strains exhibited different mutations in prfA or inlA.

  2. Listeria monocytogenes in Retail Delicatessens: An Interagency Risk Assessment-Risk Mitigations.

    Science.gov (United States)

    Gallagher, Daniel; Pouillot, Régis; Hoelzer, Karin; Tang, Jia; Dennis, Sherri B; Kause, Janell R

    2016-07-01

    Cross-contamination, improper holding temperatures, and insufficient sanitary practices are known retail practices that may lead to product contamination and growth of Listeria monocytogenes. However, the relative importance of control options to mitigate the risk of invasive listeriosis from ready-to-eat (RTE) products sliced or prepared at retail is not well understood. This study illustrates the utility of a quantitative risk assessment model described in a first article of this series (Pouillot, R., D. Gallagher, J. Tang, K. Hoelzer, J. Kause, and S. B. Dennis, J. Food Prot. 78:134-145, 2015) to evaluate the public health impact associated with changes in retail deli practices and interventions. Twenty-two mitigation scenarios were modeled and evaluated under six different baseline conditions. These scenarios were related to sanitation, worker behavior, use of growth inhibitors, cross-contamination, storage temperature control, and reduction of the level of L. monocytogenes on incoming RTE food products. The mean risk per serving of RTE products obtained under these scenarios was then compared with the risk estimated in the baseline condition. Some risk mitigations had a consistent impact on the predicted listeriosis risk in all baseline conditions (e.g. presence or absence of growth inhibitor), whereas others were greatly dependent on the initial baseline conditions or practices in the deli (e.g. preslicing of products). Overall, the control of the bacterial growth and the control of contamination at its source were major factors of listeriosis risk in these settings. Although control of cross-contamination and continued sanitation were also important, the decrease in the predicted risk was not amenable to a simple solution. Findings from these predictive scenario analyses are intended to encourage improvements to retail food safety practices and mitigation strategies to control L. monocytogenes in RTE foods more effectively and to demonstrate the utility of

  3. Social Mobilization and Reaffirmation of Democratic Participation : The Brotherhood as Expression of a New Relational Culture

    Directory of Open Access Journals (Sweden)

    Helen Crystine Corrêa Sanches

    2016-05-01

    Full Text Available Democracy represents a fundamental right for citizens. Democracy and citizen par- ticipation are developing and they complement each other, given that there is no demo- cracy without the active and conscious participation of citizens in the political process. This democratic participation occurs through tools that enable the practice of citizenship, and, among them, the social movements stand out. There is a direct relationship between the social movements and democracy: whilst the social movements exist only in demo- cratic systems, democracy requires the participation of civil society with the state. The social movements consist on a structured organization that has the purpose of uniting people to defend and promote rights, containing social identity and a particular way of thinking and acting collectively to achieve the common good and a new sort of life. The particularities of the social movements let one glimpse that the major expression of civic participation contributes to a cultural change in society, given that, with common goals, the differences are overcome, encouraging a relatedness which looks for ethics, sharing and fraternity. The understanding of fraternity in its various forms – historical, political, legal and ethical – contributes to a development in respect among people, acceptance of socio-economic and cultural differences, emphasizing the feeling of a group belonging. This way, this article aims to analyse social movements and its cooperation in building a new relational culture, more Humane, Fair And Fraternal.

  4. Water relations in culture media influence maturation of avocado somatic embryos.

    Science.gov (United States)

    Márquez-Martín, Belén; Sesmero, Rafael; Quesada, Miguel A; Pliego-Alfaro, Fernando; Sánchez-Romero, Carolina

    2011-11-15

    Application of transformation and other biotechnological tools in avocado (Persea americana Mill.) is hampered by difficulties in obtaining mature somatic embryos capable of germination at an acceptable rate. In this work, we evaluated the effect of different compounds affecting medium water relations on maturation of avocado somatic embryos. Culture media were characterized with respect to gel strength, water potential and osmotic potential. Improved production of mature somatic embryos was achieved with gelling agent concentrations higher than those considered standard. The osmotic agents such as sorbitol and PEG did not have positive effects on embryo maturation. The number of w-o mature somatic embryos per culture was positively correlated with medium gel strength. Gel strength was significantly affected by gelling agent type as well as by gelling agent and PEG concentration. Medium water potential was influenced by sorbitol concentration; incorporation of PEG to a culture medium did not affect medium water potential. The highest maturation results were achieved on a medium gelled with 10 gl(-1) agar. Moreover, these somatic embryos had improved germination rates. These results corroborate the role of water restriction as a key factor controlling maturation of somatic embryos.

  5. Error-related brain activity reveals self-centric motivation: culture matters.

    Science.gov (United States)

    Kitayama, Shinobu; Park, Jiyoung

    2014-02-01

    To secure the interest of the personal self (vs. social others) is considered a fundamental human motive, but the nature of the motivation to secure the self-interest is not well understood. To address this issue, we assessed electrocortical responses of European Americans and Asians as they performed a flanker task while instructed to earn as many reward points as possible either for the self or for their same-sex friend. For European Americans, error-related negativity (ERN)-an event-related-potential component contingent on error responses--was significantly greater in the self condition than in the friend condition. Moreover, post-error slowing--an index of cognitive control to reduce errors--was observed in the self condition but not in the friend condition. Neither of these self-centric effects was observed among Asians, consistent with prior cross-cultural behavioral evidence. Interdependent self-construal mediated the effect of culture on the ERN self-centric effect. Our findings provide the first evidence for a neural correlate of self-centric motivation, which becomes more salient outside of interdependent social relations.

  6. Cultural repertoires and food-related household technology within colonia households under conditions of material hardship

    Directory of Open Access Journals (Sweden)

    Dean Wesley R

    2012-05-01

    Full Text Available Abstract Introduction Mexican-origin women in the U.S. living in colonias (new-destination Mexican-immigrant communities along the Texas-Mexico border suffer from a high incidence of food insecurity and diet-related chronic disease. Understanding environmental factors that influence food-related behaviors among this population will be important to improving the well-being of colonia households. This article focuses on cultural repertoires that enable food choice and the everyday uses of technology in food-related practice by Mexican-immigrant women in colonia households under conditions of material hardship. Findings are presented within a conceptual framework informed by concepts drawn from sociological accounts of technology, food choice, culture, and material hardship. Methods Field notes were provided by teams of promotora-researchers (indigenous community health workers and public-health professionals trained as participant observers. They conducted observations on three separate occasions (two half-days during the week and one weekend day within eight family residences located in colonias near the towns of Alton and San Carlos, Texas. English observations were coded inductively and early observations stressed the importance of technology and material hardship in food-related behavior. These observations were further explored and coded using the qualitative data package Atlas.ti. Results Technology included kitchen implements used in standard and adapted configurations and household infrastructure. Residents employed tools across a range of food-related activities identified as forms of food acquisition, storage, preparation, serving, feeding and eating, cleaning, and waste processing. Material hardships included the quality, quantity, acceptability, and uncertainty dimensions of food insecurity, and insufficient consumption of housing, clothing and medical care. Cultural repertoires for coping with material hardship included reliance on

  7. Drive for leanness and health-related behavior within a social/cultural perspective.

    Science.gov (United States)

    Tod, David; Edwards, Christian; Hall, Gareth

    2013-09-01

    We examined relationships between drive for leanness and perceived media pressure to change appearance, internalization of an ideal physique, exercise frequency, and dieting. Men and women (N=353) completed the Drive for Leanness Scale, the Sociocultural Attitudes Toward Appearance Questionnaire-3, the Eating Attitudes Test-26, and a demographic inventory. Drive for leanness was significantly correlated with athletic internalization (.52), pressure to attain an ideal physique (.25), exercise frequency (.36), and dieting (.25). Structural equation modeling revealed a good fitting model (χ(2)=2.85, psocial/cultural theory helps enhance the understanding of the drive for leanness and its relationship with health-related behavior.

  8. Transferable tetracycline resistance in Listeria monocytogenes from food in Italy.

    Science.gov (United States)

    Pourshaban, Manoocheher; Ferrini, Anna Maria; Mannoni, Veruscka; Oliva, Brunello; Aureli, Paolo

    2002-07-01

    Mechanisms of tetracycline resistance were investigated in two recent Listeria monocytogenes isolates from food, with L. innocua 52P tet(r) as a control. Tetracycline resistance was transferred conjugatively from all three strains to L. ivanovii and from one isolate and the control to Enterococcus faecalis. Molecular analysis demonstrated a chromosomal location for the tet determinant, which was identified as tetM in all cases. These studies are the first to show that L. monocytogenes from food could be a source of tetracycline resistance genes able to spread to other micro-organisms.

  9. Variations in virulence between different electrophoretic types of Listeria monocytogenes

    DEFF Research Database (Denmark)

    Nørrung, Birgit; Andersen, Jens Kirk

    2000-01-01

    A total of 245 strains of Listeria monocytogenes, representing 33 different electrophoretic types (ETs), were examined quantitatively for haemolytic activity. No significant difference was observed in the mean haemolytic activity between different ETs. Eighty four out of 91 strains examined were...... compared with 3.64 among food isolates). The explanation for this may be that more virulent strains are more prone to cause human infection. It is, however, also possible that strains oft. monocytogenes may become more virulent while multiplying in a living organism compared with multiplying in foods....

  10. Nalaz bakterije Listeria monocytogenes u ribi i ribljim proizvodima

    OpenAIRE

    Rožman, Jelena; Njari, dr. sc. Bela; Kozačinski, dr. sc. Lidija

    2016-01-01

    Listerioza je bolest koja se prenosi hranom a bakterija Listeria monocytogenes je jedan od najznačajnijih javnozdravstvenih problema i uvjet prometa hrane u svijetu. Prije svega povezana je s konzumacijom gotovih proizvoda. U ovom radu je pretražena svježa riba (brancin) i riblji proizvodi (dimljena i marinirana riba, orada i brancin) na nalaz bakterije L. monocytogenes. Također, pretraženi su uzorci brisova uzeti s radnih površina i ruku djelatnika u pogonima prerade morske ribe. Bakterija L...

  11. Listeria monocytogenes response regulators important for stress tolerance and pathogenesis

    DEFF Research Database (Denmark)

    Kallipolitis, B H; Ingmer, H

    2001-01-01

    Environmental sensing by two-component signal transduction systems is likely to play a role for growth and survival of Listeria monocytogenes both during transmission in food products and within a host organism. Two-component systems typically consist of a membrane-associated sensor histidine...... of L. monocytogenes in mice. Strikingly, the mutants that were attenuated in virulence also had a decreased ability to grow in the presence of various stress conditions potentially encountered in an infection process. Thus, our data point to a connection between the ability of the putative two-component...

  12. Evolutionary relationships of outbreak-associated Listeria monocytogenes strains of serotypes 1/2a and 1/2b determined by whole genome sequencing

    Science.gov (United States)

    Listeria monocytogenes (Lm) is a bacterial pathogen that is almost exclusively transmitted by food. Although listeriosis is relatively rare (~1600 cases occur annually in the U.S.), ~20% of cases are fatal and outbreaks are not uncommon. Molecular subtyping differentiates Lm into four lineages (LI –...

  13. Bactericidal activities of health-promoting,food-derived powders against the foodborne pathogens Escherichia coli,listeria monocytogenes, salmonella enterica,and staphylococcus aureus

    Science.gov (United States)

    We evaluated the relative bactericidal activities of 10 presumed health-promoting food-based powders (nutraceuticals) and for comparison, several selected known components of such powders against the following foodborne pathogens: Escherichia coli O157:H7, Salmonella enterica, Listeria monocytogenes...

  14. Leadership, Peer Relationship, and Transformational Organizational Culture: A Relational Approach to a Taiwan College Music Faculty Sample

    Science.gov (United States)

    Ji, Chang-Ho C.; Chuang, Ching-Mien

    2012-01-01

    This paper explores how leadership and peer relation relate to the propensity of college music departments to develop transformational organizational culture. Our theory of relational leadership and peer relation has initially allowed us to formulate expectations for the affirmative impacts of professional and personal leadership and peer relation…

  15. In vitro culture of feline embryos increases stress-induced heat shock protein 70 and apoptotic related genes.

    Science.gov (United States)

    Sananmuang, Thanida; Phutikanit, Nawapen; Nguyen, Catherine; Manee-In, Sukanya; Techakumphu, Mongkol; Tharasanit, Theerawat

    2013-01-01

    Developmental competence and quality of in vitro produced embryos has been demonstrated to be lower than in vivo derived embryos. This study aimed specifically to determine the effects of in vitro culture of feline embryos using various culture densities on developmental competence and expression of stress- and apoptotic-related genes in terms of heat shock protein 70 (HSP70) and apoptotic-related (BAX and BCL-2) gene expressions. In experiment 1, we characterized the inducible form of a feline-specific HSP70 mRNA sequence, as it has not been previously reported. The primers for feline HSP70 mRNA were synthesized and tested on heat-treated cat fibroblasts. In experiment 2, feline embryos were cultured at different culture densities (embryo:culture volume; 1:1.25, 1:5 and 1:20). The developmental competence was determined along with HSP70, BAX and BCL-2 transcript abundances using quantitative RT-PCR. In vivo derived embryos were used as a control group. A partial cat HSP70 mRNA sequence (190 bp) was characterized and exhibited high nucleotide identity (93 to 96%) with other species. Cleaved embryos cultured at high density (1:1.25) developed to blastocysts at a lower rate than those generated from lower densities. Irrespective of the culture densities used, in vitro cultured blastocysts showed increased levels of HSP70 and BAX transcripts compared with in vivo counterparts. Blastocysts derived from the highest culture density (1:1.25) showed higher levels of upregulation of HSP70 and BAX transcripts than those cultured at lower culture densities (1:5 and 1:20). In conclusion, increased levels of pro-apoptotic (BAX) and stress-response (HSP70) transcripts correlated with developmental incompetence of embryos cultured at high embryonic density, indicating that stress accumulated during in vitro embryo culture affected the fate for embryo development and quality.

  16. An Organizational Culture Study of Missouri State University Faculty/Staff in Relation to the University's Public Affair Mission

    Science.gov (United States)

    Weaver, Marissa LeClaire

    2012-01-01

    The purpose of the study was to address a problem of practice of the public affairs mission through the perceptions of faculty and staff members at Missouri State University of the University's organizational culture. The design included a phenomenological study with a set of organizational culture procedural questions related to the perceptions…

  17. International legal cooperation of the Republic of Uzbekistan in the cultural and humanitarian spheres – important part of international relations

    Directory of Open Access Journals (Sweden)

    Nuriddin Mamajonov

    2015-12-01

    Full Text Available The article is devoted to the International legal cooperation of the Republic of Uzbekistan in the cultural and humanitarian spheres. Analysis of the influence of the cultural and humanitarian spheres in the international relations of the states, including Uzbekistan, was carried out in the article. Additionally, more and more growing role of the so-called “culture factor” in the international politics is discussed in it. The analysis is based on the legal base of the Republic of Uzbekistan, international legal documents, research works of domestic and foreign scholars in such areas as culture, education, science, tourism and medical science.

  18. Malaysian cultural differences in knowledge, attitudes and practices related to erectile dysfunction: focus group discussions.

    Science.gov (United States)

    Low, W Y; Wong, Y L; Zulkifli, S N; Tan, H M

    2002-12-01

    This qualitative study aimed to examine cultural differences in knowledge, attitudes and practices related to erectile dysfunction (ED) utilizing focus group discussion. Six focus groups consisting of 66 men, 45-70-y-old were conducted-two Malay groups (n=18), two Chinese groups (n=25) and two Indian groups (n=23). Participants were purposely recruited from the general public on a voluntary basis with informed consent. Transcripts were analyzed using qualitative data analysis software ATLASti. The Malay and Chinese traditional remedies for preventing or treating ED are commonly recognized among all races. Many have a negative perception of someone with ED. Malay and Chinese men tended to blame their wife for their problem and thought that the problem might lead to extra-marital affairs, unlike the Indian men who attributed their condition to fate. Malays would prefer traditional medicine for the problem. The Chinese felt they would be more comfortable with a male doctor whilst this is not so with the Malays or Indians. Almost all prefer the doctor to initiate discussion on sexual issues related to their medical condition. There is a need for doctors to consider cultural perspectives in a multicultural society as a lack of understanding of this often contributes to an inadequate consultation.

  19. Modeling the growth of Listeria monocytogenes on the surface of smear- or mold-ripened cheese.

    Science.gov (United States)

    Schvartzman, M Sol; Gonzalez-Barron, Ursula; Butler, Francis; Jordan, Kieran

    2014-01-01

    Surface-ripened cheeses are matured by means of manual or mechanical technologies posing a risk of cross-contamination, if any cheeses are contaminated with Listeria monocytogenes. In predictive microbiology, primary models are used to describe microbial responses, such as growth rate over time and secondary models explain how those responses change with environmental factors. In this way, primary models were used to assess the growth rate of L. monocytogenes during ripening of the cheeses and the secondary models to test how much the growth rate was affected by either the pH and/or the water activity (aw) of the cheeses. The two models combined can be used to predict outcomes. The purpose of these experiments was to test three primary (the modified Gompertz equation, the Baranyi and Roberts model, and the Logistic model) and three secondary (the Cardinal model, the Ratowski model, and the Presser model) mathematical models in order to define which combination of models would best predict the growth of L. monocytogenes on the surface of artificially contaminated surface-ripened cheeses. Growth on the surface of the cheese was assessed and modeled. The primary models were firstly fitted to the data and the effects of pH and aw on the growth rate (μmax) were incorporated and assessed one by one with the secondary models. The Logistic primary model by itself did not show a better fit of the data among the other primary models tested, but the inclusion of the Cardinal secondary model improved the final fit. The aw was not related to the growth of Listeria. This study suggests that surface-ripened cheese should be separately regulated within EU microbiological food legislation and results expressed as counts per surface area rather than per gram.

  20. Behaviour of Listeria monocytogenes during the manufacture and ripening of Manchego and Chihuahua Mexican cheeses.

    Science.gov (United States)

    Solano-López, C; Hernández-Sánchez, H

    2000-12-05

    The ability of Listeria monocytogenes to survive the Mexican Manchego and Chihuahua cheese-making processes and its persistence during the ripening stages of both cheeses was examined. Commercial pasteurized and homogenized whole milk was inoculated with Listeria monocytogenes (strain ATCC 19114) to a level between 2 x 10(6) and 9 x 10(6) CFU/ml. The milk was used to make Mexican Manchego and Chihuahua cheeses in a 25-l vat. Mexican Manchego cheese was ripened for 5 days and Chihuahua cheese for 6 weeks at 12 degrees C and 85% RH. Listeria present in the cheese was enumerated by diluting samples in sterile 0.1% peptone water and plating on Oxford agar. Duplicate samples were taken at each step of the manufacturing process. During the first week of ripening samples were taken daily from both cheeses. For Chihuahua cheese, samples were taken weekly after the first week of the ripening stage. During the manufacture of Mexican Manchego cheese, Listeria counts remained relatively constant at 10(6) CFU/ml, while with Chihuahua cheese there was a one log decrease in numbers (10(6) to 10(5) CFU/ml). After pressing both curds overnight, numbers of bacteria decreased in Mexican Manchego cheese to 8.2 x 10(5) but increased in Chihuahua cheese from 1.7 x 10(5) to 1.2 x 10(6) CFU/ml. During the ripening stage, counts of Listeria remained constant in both cheeses. However, since the Chihuahua cheese ripening stage is about 6 weeks, the number of bacteria decreased from 2 x 10(6) to 4 x 10(4) CFU/g. The results show that Listeria monocytogenes is able to survive the manufacture and ripening processes of both Mexican cheeses.

  1. Influence of Cultural Belief and Values on Secondary School Students' Understanding of Atmospheric Related Physics Concepts

    Science.gov (United States)

    Bello, Theodora Olufunke

    2015-01-01

    The study identified the different cultural concepts that secondary school students' believe in and determined the belief and idea of students about the cultural concepts. It also investigated students' source of information about the cultural concepts and determined the influence of these cultural believes on students' academic performance in…

  2. Searching for Conflict Related Missing Persons in Timor-Leste: Technical, Political and Cultural Considerations

    Directory of Open Access Journals (Sweden)

    Naomi Kinsella

    2013-03-01

    Full Text Available This paper outlines the context in which many thousands of people went missing in Timor-Leste between 1975 and 1999. The issues related to estimating the exact number of missing are discussed, followed by a review of the mechanisms implemented by the government and civil society since independence to attempt to examine and investigate the fate of missing persons. The paper then examines the technical details involved with searching for the missing which impact on the effectiveness of the different mechanisms. Further complexities related to scientific and religious/cultural beliefs when dealing with the missing are discussed. The paper concludes with providing suggestions for ways that the future search for the missing can realistically continue in light of other competing development priorities.

  3. Factors influencing resuscitation and growth of heat injured Listeria monocytogenes 13-249 in sous vide cooked beef.

    Science.gov (United States)

    Hansen, T B; Knøchel, S

    2001-01-22

    The growth of Listeria monocytogenes 13-249 in vacuum-packed, minced beef was investigated as a function of degree of heat injury (including no injury i.e. uncooked beef), growth phase (logarithmic and late stationary phase), pH (5.6 and 6.2), and storage temperature (3, 10 and 20 degrees C) during a storage period of 30 days. Late logarithmic and late stationary phase cultures of L. monocytogenes 13-249 showed similar growth in refrigerated, vacuum-packed, raw minced beef with a high pH (6.2). In normal pH (5.6) beef there was no growth at 3 degrees C while growth at 10 and 20 degrees C was only observed for logarithmic phase cultures. Heat injured late stationary phase cultures with 95-99.9% injured cells in the surviving population (as measured by differential plating on enriched vs. selective media after sous vide cooking) did not grow or repair sublethal injuries in sous vide cooked beef at 3 degrees C while repair and growth took place at 10 as well as at 20 degrees C. In logarithmic phase cultures heat injury occurred very rapidly and > or = 99.9% heat injury was observed in all trials in spite of much lower pasteurization values and fewer log10 reductions compared with late stationary phase cultures. Regardless of growth phase, all cultures where a high degree of heat injury (> or = 99.9%) was observed, did not subsequently grow in the beef product at 3 or 10 degrees C within 30 days. Growth of heat injured cultures preexposed to heat shock (46 degrees C, 30 min) or slowly rising temperatures (0.3 degrees C min(-1)) before heat injury was also investigated. Heat shocked or heat adapted cultures generally responded in the same manner as non-stressed cultures (no growth at 3 degrees C) except that a longer lag phase was observed in beef processed at slowly rising temperatures and in normal pH beef at 10 degrees C. Although processing at slowly rising temperatures may slightly increase the survival of L. monocytogenes 13-249 in cooked beef, there seem to be no

  4. Transcription factor σB plays an important role in the production of extracellular membrane-derived vesicles in Listeria monocytogenes.

    Directory of Open Access Journals (Sweden)

    Jung Hwa Lee

    Full Text Available Gram-negative bacteria produce extracellular outer membrane vesicles (OMVs that interact with host cells. Unlike Gram-negative bacteria, less is known about the production and role of extracellular membrane vesicles (MVs in Gram-positive bacteria. The food-borne pathogen Listeria monocytogenes can survive under extreme environmental and energy stress conditions and the transcription factor σ(B is involved in this survival ability. Here, we first determined the production of MVs from L. monocytogenes and evaluated whether general stress transcription factor σ(B affected production of MVs in L. monocytogenes. L. monocytogenes secreted MVs during in vitro broth culture. The wild-type strain actively produced MVs approximately nine times more and also produced more intact shapes of MVs than those of the isogenic ΔsigB mutant. A proteomic analysis showed that 130 and 89 MV proteins were identified in the wild-type and ΔsigB mutant strains, respectively. Wild-type strain-derived MVs contained proteins regulated by σ(B such as transporters (OpuCA and OpuCC, stress response (Kat, metabolism (LacD, translation (InfC, and cell division protein (FtsZ. Gene Ontology (GO enrichment analysis showed that wild-type-derived MV proteins corresponded to several GO terms, including response to stress (heat, acid, and bile resistance and extracellular polysaccharide biosynthetic process, but not the ΔsigB mutant. Internalin B (InlB was almost three times more contained in MVs derived from the wild-type strain than in MVs derived from the ΔsigB mutant. Taken together, these results suggest that σ(B plays a pivotal role in the production of MVs and protein profiles contained in MVs. L. monocytogenes MVs may contribute to host infection and survival ability under various stressful conditions.

  5. Influence of temperature on alkali stress adaptation in Listeria monocytogenes

    Science.gov (United States)

    Listeria monocytogenes cells may induce alkali stress adaptation when exposed to sublethal concentrations of alkaline cleaners and sanitizers that may be frequently used in the food processing environment. In the present study, the effect of temperature on the induction and the stability of such alk...

  6. Growth of Listeria monocytogenes in Salmon Roe - a kinetic analysis

    Science.gov (United States)

    The objective of this study was to investigate the growth kinetics of Listeria monocytogenes in unsalted and salted (3%) salmon roe. Growth curves, developed using inoculated samples incubated at constant temperatures between 5 and 30 degrees C, were analyzed by curve-fitting to the Huang and Baran...

  7. LISTERIA MONOCYTOGENES IN THE CONTEXT OF THE NEW COMMUNITY REGULATIONS

    Directory of Open Access Journals (Sweden)

    A. Bragagnolo

    2008-02-01

    Full Text Available In recent years in the countries of the European Union have occurred profound and radical changes regarding the safety and hygiene of foodstuffs. The aim of this work is to highlight the significant changes made by the recent legislation in the control of Listeria monocytogenes.

  8. Studies on the risk assessment of Listeria monocytogenes

    NARCIS (Netherlands)

    Notermans, S.; Dufrenne, J.; Teunis, P.; Chackraborty, T.

    1998-01-01

    Humans are frequently exposed to Listeria monocytogenes, and high numbers may be ingested during consumption of certain types of food. However, epidemiological investigations show that listeriosis is a rare disease. Risk assessment studies using an animal mouse model indicate that almost all L. mono

  9. Overlevingsstrategieën Listeria monocytogenes bij lage temperatuur

    NARCIS (Netherlands)

    Wemekamp-Kamphuis, H.H.; Abee, T.

    2004-01-01

    Listeria monocytogenes is an important food-borne pathogen that may cause severe infections in humans. Many outbreaks caused by this organism have been associated with ready-to-eat foods wich may have undergone some form of minimal processing, or have been contaminated after processing. Ready-to-eat

  10. Neonatal infection with Listeria monocytogenes: Rare, but serious

    NARCIS (Netherlands)

    Van Stuijvenberg, M.; Spanjaard, L.; Bergman, K.A.

    2006-01-01

    Between 1993 and 2003, three infants, two girls and a boy, were found to have an invasive infection with Listeria monocytogenes. They received intensive care including respiratory and circulatory support, antibiotics, and treatment of the neurological complications when possible. One of the girls

  11. Listeria monocytogenes and hemolytic Listeria innocua in poultry.

    Science.gov (United States)

    Milillo, S R; Stout, J C; Hanning, I B; Clement, A; Fortes, E D; den Bakker, H C; Wiedmann, M; Ricke, S C

    2012-09-01

    Listeria monocytogenes is a ubiquitous, saprophytic, Gram-positive bacterium and occasional food-borne pathogen, often associated with ready-to-eat meat products. Because of the increased consumer interest in organic, all natural, and free range poultry products, it is important to understand L. monocytogenes in the context of such systems. Pasture-reared poultry were surveyed over the course of two 8-wk rearing periods. Cecal, soil, and grass samples were collected for Listeria isolation and characterization. Seven of 399 cecal samples (or 1.75%) were Listeria-positive. All positive cecal samples were obtained from broilers sampled at 2 wk of age. Grass and soil samples were collected from the pasture both before and after introduction of the poultry. Environmental samples collected after introduction of poultry were significantly more likely to contain Listeria (P Listeria, sigB allelic typing, and hlyA PCR tests found that both L. monocytogenes and L. innocua, including hemolytic L. innocua, were recovered from the cecal and environmental (grass/soil) samples. The sigB allelic typing also revealed that (1) positive samples could be composed of 2 or more allelic types; (2) allelic types found in cecal samples could also be found in the environment; and (3) allelic types could persist through the 2 rearing periods. Our data indicate that both pasture-reared poultry and their environment can be contaminated with L. monocytogenes and hemolytic L. innocua.

  12. Presence of Listeria monocytogenes in silage products of Shahrekord city

    Directory of Open Access Journals (Sweden)

    Ali Sharifzadeh

    2015-06-01

    Full Text Available Objective: To investigate the presence of Listeria monocytogenes in the silage samples. Methods: Silage samples obtained from 150 different farms in Shahrekord city (Iran and after DNA extraction, all samples were analyzed by PCR technique using one pair of primers for presence of this pathogen. The amplified products were detected on 1.5% agarose gel electrophoresis. Results: Listeria monocytogenes was isolated in 4 (2% of the 150 samples. The detection of this bacterium from silage samples in Shahrekord city indicated that these products could create a serious risk in public health of animal and human. The findings showed that in positive silage samples for Listeria monocytogenes, the pH value was about five and it was due to bacterial activity in these products. Conclusions: The quality of silage and hygiene parameters and good herd health management play an important role in the microbiological quality of herd and farm. Considering the high specificity and sensitivity of the employed PCR technique, it is recommended to be useful technique for identification of Listeria monocytogenes.

  13. Listeria monocytogenes : the nature, public health aspects and ...

    African Journals Online (AJOL)

    Animal Production Research Advances ... New food borne infectious diseases have continued to emerge world over in the food industries. ... Its' public health importance cannot be over emphasized as L. monocytogenes causes huge economic ... It is therefore, suggested that proper control strategies, good quality control ...

  14. Quantifying strain variability in modeling growth of Listeria monocytogenes

    NARCIS (Netherlands)

    Aryani, D.; Besten, den H.M.W.; Hazeleger, W.C.; Zwietering, M.H.

    2015-01-01

    Prediction of microbial growth kinetics can differ from the actual behavior of the target microorganisms. In the present study, the impact of strain variability on maximum specific growth rate (µmax) (h- 1) was quantified using twenty Listeria monocytogenes strains. The µmax was determined as functi

  15. Genome sequesnce of lineage III Listeria monocytogenes strain HCC23

    Science.gov (United States)

    More than 98% of reported human listeriosis cases are caused by Listeria monocytogenes serotypes within lineages I and II. Serotypes within lineage III (4a and 4c) are commonly isolated from environmental and food specimens. We report the first complete genome sequence of a lineage III isolate, HCC2...

  16. Inhibition of Listeria monocytogenes by fatty acids and monoglycerides.

    Science.gov (United States)

    Wang, L L; Johnson, E A

    1992-02-01

    Fatty acids and monoglycerides were evaluated in brain heart infusion broth and in milk for antimicrobial activity against the Scott A strain of Listeria monocytogenes. C12:0, C18:3, and glyceryl monolaurate (monolaurin) had the strongest activity in brain heart infusion broth and were bactericidal at 10 to 20 micrograms/ml, whereas potassium (K)-conjugated linoleic acids and C18:2 were bactericidal at 50 to 200 micrograms/ml. C14:0, C16:0, C18:0, C18:1, glyceryl monomyristate, and glyceryl monopalmitate were not inhibitory at 200 micrograms/ml. The bactericidal activity in brain heart infusion broth was higher at pH 5 than at pH 6. In whole milk and skim milk, K-conjugated linoleic acid was bacteriostatic and prolonged the lag phase especially at 4 degrees C. Monolaurin inactivated L. monocytogenes in skim milk at 4 degrees C, but was less inhibitory at 23 degrees C. Monolaurin did not inhibit L. monocytogenes in whole milk because of the higher fat content. Other fatty acids tested were not effective in whole or skim milk. Our results suggest that K-conjugated linoleic acids or monolaurin could be used as an inhibitory agent against L. monocytogenes in dairy foods.

  17. The Continuous Challenge of Characterizing the Foodborne Pathogen Listeria monocytogenes.

    Science.gov (United States)

    Camargo, Anderson Carlos; Woodward, Joshua John; Nero, Luís Augusto

    2016-08-01

    Listeria monocytogenes is an important foodborne pathogen commonly isolated from food processing environments and food products. This organism can multiply at refrigeration temperatures, form biofilms on different materials and under various conditions, resist a range of environmental stresses, and contaminate food products by cross-contamination. L. monocytogenes is recognized as the causative agent of listeriosis, a serious disease that affects mainly individuals from high-risk groups, such as pregnant women, newborns, the elderly, and immunocompromised individuals. Listeriosis can be considered a disease that has emerged along with changing eating habits and large-scale industrial food processing. This disease causes losses of billions of dollars every year with recalls of contaminated foods and patient medical treatment expenses. In addition to the immune status of the host and the infecting dose, the virulence potential of each strain is crucial for the development of disease symptoms. While many isolates are naturally virulent, other isolates are avirulent and unable to cause disease; this may vary according to the presence of molecular determinants associated with virulence. In the last decade, the characterization of genetic profiles through the use of molecular methods has helped track and demonstrate the genetic diversity among L. monocytogenes isolates obtained from various sources. The purposes of this review were to summarize the main methods used for isolation, identification, and typing of L. monocytogenes and also describe its most relevant virulence characteristics.

  18. Overlevingsstrategieën Listeria monocytogenes bij lage temperatuur

    NARCIS (Netherlands)

    Wemekamp-Kamphuis, H.H.; Abee, T.

    2004-01-01

    Listeria monocytogenes is an important food-borne pathogen that may cause severe infections in humans. Many outbreaks caused by this organism have been associated with ready-to-eat foods wich may have undergone some form of minimal processing, or have been contaminated after processing. Ready-to-eat

  19. Whole genome sequence-based serogrouping of Listeria monocytogenes isolates.

    Science.gov (United States)

    Hyden, Patrick; Pietzka, Ariane; Lennkh, Anna; Murer, Andrea; Springer, Burkhard; Blaschitz, Marion; Indra, Alexander; Huhulescu, Steliana; Allerberger, Franz; Ruppitsch, Werner; Sensen, Christoph W

    2016-10-10

    Whole genome sequencing (WGS) is currently becoming the method of choice for characterization of Listeria monocytogenes isolates in national reference laboratories (NRLs). WGS is superior with regards to accuracy, resolution and analysis speed in comparison to several other methods including serotyping, PCR, pulsed field gel electrophoresis (PFGE), multilocus sequence typing (MLST), multilocus variable number tandem repeat analysis (MLVA), and multivirulence-locus sequence typing (MVLST), which have been used thus far for the characterization of bacterial isolates (and are still important tools in reference laboratories today) to control and prevent listeriosis, one of the major sources of foodborne diseases for humans. Backward compatibility of WGS to former methods can be maintained by extraction of the respective information from WGS data. Serotyping was the first subtyping method for L. monocytogenes capable of differentiating 12 serovars and national reference laboratories still perform serotyping and PCR-based serogrouping as a first level classification method for Listeria monocytogenes surveillance. Whole genome sequence based core genome MLST analysis of a L. monocytogenes collection comprising 172 isolates spanning all 12 serotypes was performed for serogroup determination. These isolates clustered according to their serotypes and it was possible to group them either into the IIa, IIc, IVb or IIb clusters, respectively, which were generated by minimum spanning tree (MST) and neighbor joining (NJ) tree data analysis, demonstrating the power of the new approach. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

  20. Influence of temperature on alkali stress adaptation in Listeria monocytogenes

    Science.gov (United States)

    Listeria monocytogenes cells may induce alkali stress adaptation when exposed to sublethal concentrations of alkaline cleaners and sanitizers that may be frequently used in the food processing environment. In the present study, the effect of temperature on the induction and the stability of such alk...

  1. Studies on the risk assessment of Listeria monocytogenes

    NARCIS (Netherlands)

    Notermans, S.; Dufrenne, J.; Teunis, P.; Chackraborty, T.

    1998-01-01

    Humans are frequently exposed to Listeria monocytogenes, and high numbers may be ingested during consumption of certain types of food. However, epidemiological investigations show that listeriosis is a rare disease. Risk assessment studies using an animal mouse model indicate that almost all L.

  2. Listeria monocytogenes following orthotopic liver transplantation: Central nervous system involvement and review of the literature

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    Listeria monocytogene is a well-recognized cause of bacteremia in immunocompromised individuals, including solid organ transplant recipients, but has been rarely reported following orthotopic liver transplantation. We describe a case of listeria meningitis that occurred within a week after liver transplantation. The patient developed a severe headache that mimicked tacrolimus encephalopathy, and was subsequently diagnosed with listeria meningitis by cerebrospinal fluid culture. The infection was successfully treated with three-week course of intravenous ampicillin. Recurrent hepatitis C followed and was successfully treated with interferon alfa and ribavirin. Fourteen cases of listeriosis after orthotopic liver transplantation have been reported in the English literature. Most reported cases were successfully treated with intravenous ampicillin. There were four cases of listeria meningitis, and the mortality of them was 50%.Early detection and treatment of listeria meningitis are the key to obtaining a better prognosis.

  3. Detection of viable and dead Listeria monocytogenes on gouda-like cheeses by real-time PCR.

    Science.gov (United States)

    Rudi, K; Naterstad, K; Drømtorp, S M; Holo, H

    2005-01-01

    Surface contamination by Listeria monocytogenes of gouda-like cheeses during processing represents a potential public health problem. The aim of this work was to develop novel real-time PCR diagnostics to detect the presence of viable, dead or viable but not culturable (VBNC) cells on gouda-like cheeses. We used ethidium monoazide bromide (EMA)-PCR for direct quantification of viable and dead cells, while semiquantitative detection of culturable cells below the PCR detection limit (c. 100 CFU g(-1)) was obtained by combining growth and real-time PCR. We were able to quantify the fraction of >0.5% viable cells in a background of dead cells by EMA-PCR, given that the viable cell concentration was above the PCR detection limit. The combined growth and real-time PCR complemented the EMA-PCR, and enabled semiquantitative detection of low levels of culturable cells (10 and 100 CFU g(-1)). The significance of this work is that we have developed a novel concept for detection of viable and potentially infectious L. monocytogenes.

  4. Designing and Using an Organisational Culture Inquiry Tool to Glimpse the Relational Nature of Leadership and Organisational Culture within a South Australian Primary School

    Science.gov (United States)

    Giles, David; Bills, Andrew

    2017-01-01

    This case study research found that the relational leadership and organisational culture at a public primary school situated in a high poverty location in South Australia was built upon the strength of the inter-relationships between the teachers, teachers and leadership, and between teachers and students. Supported by what we called "dynamic…

  5. No Superior and Inferior Culture -Cultural Relativity Theory%文化没有上下和优劣之分--文化相对论

    Institute of Scientific and Technical Information of China (English)

    肖璐娜

    2015-01-01

    With the increasingly frequent international communication and cooperation,people encounter a variety of difficulties in cross -cultural communication.Since most of people hold a sense of self -orientated ethnocentrism,it becomes difficult to communicate between people from contrasting culture.The paper analyzes the origin,characteristics and disadvantages of self-orientated ethnocentrism and cultural relativism.It studies the dynamics of anti -cultural relativism.We should hold the neutral,non -evaluation opinion about the existence of the relativity of culture,respecting and accepting each other.However, in the perspective of cross -cultural communication,cultural relativity is a double edged sword,which has only one side and defect,we should think critically.%随着越发频繁的国际交流与合作,人们在跨文化交流中遇到了各种各样的困难。由于绝大多数人对外国文化持有自民族中心主义,从而使不同文化背景的人们交流变得困难。本文关于自民族主义,文化相对论的由来、特征、缺点及关于反文化相对论动态进行了考察。我们应该持有文化是相对存在这样中立的,非评价的文化相对论观点,相互尊敬和接受。但是,从跨文化交流的视点来看,文化相对论却是一把双刃剑,存在一面性和缺陷,需要用批判的眼光再次思考认识。

  6. Tim-3 inhibits macrophage control of Listeria monocytogenes by inhibiting Nrf2

    Science.gov (United States)

    Wang, Zhiding; Sun, Dejun; Chen, Guojiang; Li, Ge; Dou, Shuaijie; Wang, Renxi; Xiao, He; Hou, Chunmei; Li, Yan; Feng, Jiannan; Shen, Beifen; Han, Gencheng

    2017-01-01

    T cell immunoglobulin mucin-3 (Tim-3) is an immune checkpoint inhibitor and its dysregulation has been related to T cell tolerance and many immune disorders, such as tumors and infection tolerance. However, the physiopathology roles of Tim-3 in innate immunity remain elusive. Here, we demonstrate that Tim-3 inhibits macrophage phagocytosis of L. monocytogenes by inhibiting the nuclear erythroid 2-related factor 2 (Nrf2) signaling pathway and increases bacterial burden. Tim-3 signaling promotes Nrf2 degradation by increasing its ubiquitination and, as a result, decreasing its nuclear translocation. CD36 and heme oxygenase-1 (HO-1), two downstream molecules in the Tim-3-Nrf2 signaling axis, are involved in the Tim-3- mediated immune evasion of L. monocytogenes both in vitro and in vivo. We here identified new mechanisms by which Tim-3 induces infection tolerance. By modulating the Tim-3 pathway, we demonstrate the feasibility of manipulating macrophage function as a potent tool for treating infectious diseases, such as Listeria infection. PMID:28205579

  7. Attached and planktonic Listeria monocytogenes global proteomic responses and associated influence of strain genetics and temperature.

    Science.gov (United States)

    Mata, Marcia M; da Silva, Wladimir P; Wilson, Richard; Lowe, Edwin; Bowman, John P

    2015-02-01

    Contamination of industrial and domestic food usage environments by the attachement of bacterial food-borne pathogen Listeria monocytogenes has public health and economic implications. Comprehensive proteomics experiments using label-free liquid chromatography/tandem mass spectrometry were used to compare the proteomes of two different L. monocytogenes strains (Siliken_1/2c and F2365_4b), which show very different capacities to attach to surfaces. Growth temperature and strain type were highly influential on the proteomes in both attached and planktonic cells. On the basis of the proteomic data, it is highly unlikely that specific surface proteins play a direct role in adherence to inanimate surfaces. Instead, strain-dependent responses related to cell envelope polymer biosynthesis and stress response regulation likely contribute to a different ability to attach and also to survive external stressors. Collectively, the divergent proteome-level responses observed define strain- and growth-temperature-dependent differences relevant to attachment efficacy, highlight relevant proteins involved in stress protection in attached cells, and suggest that strain differences and growth conditions are important in relation to environmental persistence.

  8. Differential Gene Expression of Three Gene Targets among Persistent and Nonpersistent Listeria monocytogenes Strains in the Presence or Absence of Benzethonium Chloride.

    Science.gov (United States)

    Mazza, Roberta; Mazzette, Rina; McAuliffe, Olivia; Jordan, Kieran; Fox, Edward M

    2015-08-01

    Persistence of Listeria monocytogenes strains in food processing environments remains relatively common but is difficult to control. Understanding the basis for such persistence represents an important step in the potential control or eradication of this pathogen from these environments. In this study, reverse transcription PCR was used to determine the relative and absolute expression of selected gene targets (pocR, eutJ, and qacH) among five persistent and four presumed nonpersistent L. monocytogenes strains. The quantification of these genes as markers for the persistent phenotype and the effect of benzethonium chloride (BZT) on their expression was investigated. Although no markers correlated with the ability of strains to persist in food processing facilities were found, expression of pocR was upregulated in three of the five persistent strains, in contrast to the four presumed nonpersistent strains, which showed down-regulation of this gene. These results provide further knowledge of the differential expression of genes of persistent and presumed nonpersistent strains of L. monocytogenes grown in the presence or absence of BZT and identifies upregulation of pocR as a potential response of persistent strains of L. monocytogenes to exposure to BZT.

  9. The effect of sodium reduction with and without potassium chloride on the survival of Listeria monocytogenes in Cheddar cheese.

    Science.gov (United States)

    Hystead, E; Diez-Gonzalez, F; Schoenfuss, T C

    2013-10-01

    Sodium chloride (NaCl) in cheese contributes to flavor and texture directly and by its effect on microbial and enzymatic activity. The salt-to-moisture ratio (S/M) is used to gauge if conditions for producing good-quality cheese have been met. Reductions in salt that deviate from the ideal S/M range could result in changing culture acidification profiles during cheese making. Lactococcus lactis ssp. lactis or Lc. lactis ssp. cremoris are both used as cultures in Cheddar cheese manufacture, but Lc. lactis ssp. lactis has a higher salt and pH tolerance than Lc. lactis ssp. cremoris. Both salt and pH are used to control growth and survival of Listeria monocytogenes and salts such as KCl are commonly used to replace the effects of NaCl in food when NaCl is reduced. The objectives of this project were to determine the effects of sodium reduction, KCl use, and the subspecies of Lc. lactis used on L. monocytogenes survival in stirred-curd Cheddar cheese. Cheese was manufactured with either Lc. lactis ssp. lactis or Lc. lactis ssp. cremoris. At the salting step, curd was divided and salted with a concentration targeted to produce a final cheese with 600 mg of sodium/100 g (control), 25% reduced sodium (450 mg of sodium/100 g; both with and without KCl), and low sodium (53% sodium reduction or 280 mg of sodium/100 g; both with and without KCl). Potassium chloride was added on a molar equivalent to the NaCl it replaced to maintain an equivalent S/M. Cheese was inoculated with a 5-strain cocktail of L. monocytogenes at different times during aging to simulate postprocessing contamination, and counts were monitored over 27 or 50 d, depending on incubation temperature (12 or 5 °C, respectively). In cheese inoculated with 4 log₁₀ cfu of L. monocytogenes/g 2 wk after manufacture, viable counts declined by more than 3 log₁₀ cfu/g in all treatments over 60 d. When inoculated with 5 log₁₀ cfu/g at 3mo of cheese age, L. monocytogenes counts in Cheddar cheese were also

  10. Bioconversion to raspberry ketone is achieved by several non-related plant cell cultures

    Directory of Open Access Journals (Sweden)

    Suvi Tuulikki Häkkinen

    2015-11-01

    Full Text Available Bioconversion, i.e. the use of biological systems to perform chemical changes in synthetic or natural compounds in mild conditions, is an attractive tool for the production of novel active or high-value compounds. Plant cells exhibit a vast biochemical potential, being able to transform a range of substances, including pharmaceutical ingredients and industrial by-products, via enzymatic processes. The use of plant cell cultures offers possibilities for contained and optimized production processes which can be applied in industrial scale. Raspberry ketone (4-(4-hydroxyphenylbutan-2-one is among the most interesting natural flavour compounds, due to its high demand and significant market value. The biosynthesis of this industrially relevant flavour compound is relatively well characterised, involving the condensation of 4-coumaryl-CoA and malonyl-CoA by Type III polyketide synthase to form a diketide, and the subsequent reduction catalysed by an NADPH-dependent reductase. Raspberry ketone has been successfully produced by bioconversion using different hosts and precursors to establish more efficient and economical processes. In this work, we studied the effect of overexpressed RiZS1 in tobacco on precursor bioconversion to raspberry ketone. In addition, various wild type plant cell cultures were studied for their capacity to carry out the bioconversion to raspberry ketone using either 4-hydroxybenzalacetone or betuligenol as a substrate. Apparently plant cells possess rather widely distributed reductase activity capable of performing the bioconversion to raspberry ketone using cheap and readily available precursors.

  11. [Home care in a culturally sensitive environment: perspectives of caregivers of Haitian elderly patients and relatives].

    Science.gov (United States)

    Ducharme, Francine; Paquet, Mario; Vissandjée, Bilkis; Carpentier, Normand; Lévesque, Louise; Trudeau, Denise

    2008-01-01

    In Canada, the care provided by families occurs in an increasingly multiethnic context. Against this backdrop, the present qualitative study aims to explore the needs/expectations and solutions not only of (female) natural caregivers of an elderly relative hailing from Haiti (presented in terms of tracking cases) but also of remunerated home care providers - all with a view to developing a culturally sensitive service offering. As such, this study works from a conceptual framework centring on the negotiation of a common area of agreement between the stakeholders involved (i.e., natural caregivers and home care providers). To this end, focus groups and individual interviews were conducted among 15 caregivers and 37 home care providers. The three recurrent themes emerging from the data analysis concern, in context, the needs/expectations and solutions surrounding the experience of service use, barriers to use, and the relationships between natural caregivers and home care providers. The statements of both groups evidenced a consistency of views and have thus provided a basis for developing some recommendations acceptable to all stakeholders from the perspective of making culturally-based adjustments to the service offering.

  12. Antimicrobial treatments to control Listeria monocytogenes in queso fresco.

    Science.gov (United States)

    Lourenço, António; Kamnetz, Mary B; Gadotti, Camila; Diez-Gonzalez, Francisco

    2017-06-01

    Queso fresco, is a Hispanic non-fermented cheese highly susceptible to contamination with L. monocytogenes. This research was aimed to determine the effect of GRAS antimicrobial ingredients to control L. monocytogenes. Antimicrobials included caprylic acid (CA), Nisaplin(®) (N, 2.5% nisin), a mixture of sodium lactate and sodium diacetate (SL/SD), Lactococcus lactis sbp. lactis DPC 3147, monolaurin, and lactic acid (LA). Batches of queso fresco curds were inoculated with 10(4) CFU/g and stored at 4 °C for three weeks. During storage the count of L. monocytogenes reached 7 to 8 Log CFU/g in control samples. Most individual antimicrobial treatments resulted in less than 1 Log CFU/g reductions in final counts, with the exception of N (0.5 g/kg) and CA (2.9 g/kg) that caused more than 3 and 5 Log CFU/g differences with controls, respectively. Mixtures of ingredients were more effective in inhibiting L. monocytogenes growth, and treatments with N and CA consistently delivered 6 Log CFU/g less counts than controls. Supplementation of 12 g/kg LA to treatments with SL/SD (3%/0.22%) caused differences of more than 4 Log CFU/g in final Listeria populations. Samples treated with the binary mixtures of N and CA (0.5 and 0.7 g/kg, respectively) were evaluated in a consumer panel (n = 67). Panelists slightly preferred control and commercial over treated samples, but all samples were in average rated between "slightly liking" and "moderately liking." These experiments indicated that combined use of antimicrobial ingredients may be an effective way to control the population of Listeria monocytogenes in queso fresco.

  13. Prevalence of Listeria monocytogenes in poultry production in France.

    Science.gov (United States)

    Chemaly, Marianne; Toquin, Marie-Therese; Le Nôtre, Yolene; Fravalo, Philippe

    2008-10-01

    This study aimed to update and create a data set from laying hens and broilers regarding contamination by Listeria monocytogenes. Two hundred laying-hen flocks were sampled, with 88 flocks reared in cages and 112 reared on the floor. One hundred forty-five broiler flocks were sampled, with 85 conventional and 60 free-range flocks. A total of 774 and 725 samples were analyzed from laying hens and broilers, respectively. L. monocytogenes was detected in 31 of 200 flocks, yielding an estimated prevalence of 15.5% in laying-hen flocks. Among positive flocks, there appeared a significant (P = 0.004) difference between caged and floor-reared hens, with a higher detection in dust samples from floor-reared hens. In positive caged hen flocks, significant (P = 0.028) differences between dust and fecal samples appeared, with a higher detection in feces than in dust samples. In broiler flocks, L. monocytogenes was isolated in 46 of 145 flocks, yielding an estimated prevalence of 32% (28% in conventional flocks versus 37% in the free-range flocks). L. monocytogenes was isolated in samples taken from conventional flocks with a lower frequency than in free-range flocks (13 versus 18%, respectively). The serotyping of L. monocytogenes strains showed that the majority belonged to type 1/2a in laying-hen flocks (74.3%) and in broiler flocks (40.5%). A significant difference (P = 0.007) between laying hens and broilers was shown for serogroup 4 and for serovar 1/2b (P = 0.007); these serogroups were more prevalent in broilers (40%) than in laying hens (5.7%).

  14. A Cross-cultural Examination of SNS Usage Intensity and Managing Interpersonal Relationships Online: The Role of Culture and the Autonomous-Related Self-Construal

    Directory of Open Access Journals (Sweden)

    Lee eSoon Li

    2016-04-01

    Full Text Available Perception of the autonomy and relatedness of the self may be influenced by one’s experiences and social expectations within a particular cultural setting. The present research examined the role of culture and the Autonomous-Related self-construal in predicting for different aspects of Social Networking Sites (SNS usage in three Asian countries, especially focusing on those aspects serving interpersonal goals. Participants in this cross-cultural study included 305 university students from Malaysia (n = 105, South Korea (n = 113, and China (n = 87. The study explored specific social and interpersonal behaviors on SNS, such as browsing the contacts’ profiles, checking for updates, and improving contact with SNS contacts, as well as the intensity of SNS use, hypothesizing that those with high intensity of use in the Asian context may be doing so to achieve the social goal of maintaining contact and keeping updated with friends. Two scales measuring activities on other users’ profiles and contact with friends’ profiles were developed and validated. As predicted, some cross-cultural differences were found. Koreans were more likely to use SNS to increase contact but tended to spend less time browsing contacts’ profiles than the Malaysians and Chinese. The intensity of SNS use differed between the countries as well, where Malaysians reported higher intensity than Koreans and Chinese. Consistent with study predictions, Koreans were found with the highest Autonomous-Related self-construal scores. The Autonomous-Related self-construal predicted SNS intensity. The findings suggest that cultural contexts, along with the way the self is construed in different cultures, may encourage different types of SNS usage. The authors discuss study implications and suggest future research directions.

  15. A Cross-Cultural Examination of SNS Usage Intensity and Managing Interpersonal Relationships Online: The Role of Culture and the Autonomous-Related Self-Construal.

    Science.gov (United States)

    Lee, Soon Li; Kim, Jung-Ae; Golden, Karen Jennifer; Kim, Jae-Hwi; Park, Miriam Sang-Ah

    2016-01-01

    Perception of the autonomy and relatedness of the self may be influenced by one's experiences and social expectations within a particular cultural setting. The present research examined the role of culture and the Autonomous-Related self-construal in predicting for different aspects of Social Networking Sites (SNS) usage in three Asian countries, especially focusing on those aspects serving interpersonal goals. Participants in this cross-cultural study included 305 university students from Malaysia (n = 105), South Korea (n = 113), and China (n = 87). The study explored specific social and interpersonal behaviors on SNS, such as browsing the contacts' profiles, checking for updates, and improving contact with SNS contacts, as well as the intensity of SNS use, hypothesizing that those with high intensity of use in the Asian context may be doing so to achieve the social goal of maintaining contact and keeping updated with friends. Two scales measuring activities on other users' profiles and contact with friends' profiles were developed and validated. As predicted, some cross-cultural differences were found. Koreans were more likely to use SNS to increase contact but tended to spend less time browsing contacts' profiles than the Malaysians and Chinese. The intensity of SNS use differed between the countries as well, where Malaysians reported higher intensity than Koreans and Chinese. Consistent with study predictions, Koreans were found with the highest Autonomous-Related self-construal scores. The Autonomous-Related self-construal predicted SNS intensity. The findings suggest that cultural contexts, along with the way the self is construed in different cultures, may encourage different types of SNS usage. The authors discuss study implications and suggest future research directions.

  16. Benzalkonium tolerance genes and outcome in Listeria monocytogenes meningitis.

    Science.gov (United States)

    Kremer, P H C; Lees, J A; Koopmans, M M; Ferwerda, B; Arends, A W M; Feller, M M; Schipper, K; Valls Seron, M; van der Ende, A; Brouwer, M C; van de Beek, D; Bentley, S D

    2017-04-01

    Listeria monocytogenes is a food-borne pathogen that can cause meningitis. The listerial genotype ST6 has been linked to increasing rates of unfavourable outcome over time. We investigated listerial genetic variation and the relation with clinical outcome in meningitis. We sequenced 96 isolates from adults with listerial meningitis included in two prospective nationwide cohort studies by whole genome sequencing, and evaluated associations between bacterial genetic variation and clinical outcome. We validated these results by screening listerial genotypes of 445 cerebrospinal fluid and blood isolates from patients over a 30-year period from the Dutch national surveillance cohort. We identified a bacteriophage, phiLMST6 co-occurring with a novel plasmid, pLMST6, in ST6 isolates to be associated with unfavourable outcome in patients (p 2.83e-05). The plasmid carries a benzalkonium chloride tolerance gene, emrC, conferring decreased susceptibility to disinfectants used in the food-processing industry. Isolates harbouring emrC were growth inhibited at higher levels of benzalkonium chloride (median 60 mg/L versus 15 mg/L; p <0.001), and had higher MICs for amoxicillin and gentamicin compared with isolates without emrC (both p <0.001). Transformation of pLMST6 into naive strains led to benzalkonium chloride tolerance and higher MICs for gentamicin. These results show that a novel plasmid, carrying the efflux transporter emrC, is associated with increased incidence of ST6 listerial meningitis in the Netherlands. Suggesting increased disease severity, our findings warrant consideration of disinfectants used in the food-processing industry that select for resistance mechanisms and may, inadvertently, lead to increased risk of poor disease outcome. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

  17. Acute Fetal Demise with First Trimester Maternal Infection Resulting from Listeria monocytogenes in a Nonhuman Primate Model

    Science.gov (United States)

    Wolfe, Bryce; Wiepz, Gregory J.; Schotzko, Michele; Bondarenko, Gennadiy I.; Durning, Maureen; Simmons, Heather A.; Mejia, Andres; Faith, Nancy G.; Sampene, Emmanuel; Suresh, Marulasiddappa; Kathariou, Sophia; Czuprynski, Charles J.

    2017-01-01

    ABSTRACT Infection with Listeria monocytogenes during pregnancy is associated with miscarriage, preterm birth, and neonatal complications, including sepsis and meningitis. While the risk of these conditions is thought to be greatest during the third trimester of pregnancy, the determinants of fetoplacental susceptibility to infection, the contribution of gestational age, and the in vivo progression of disease at the maternal-fetal interface are poorly understood. We developed a nonhuman primate model of listeriosis to better understand antecedents of adverse pregnancy outcomes in early pregnancy. Four pregnant cynomolgus macaques (Macaca fascicularis) received a single intragastric inoculation between days 36 and 46 of gestation with 107 CFU of an L. monocytogenes strain isolated from a previous cluster of human listeriosis cases that resulted in adverse pregnancy outcomes. Fecal shedding, maternal bacteremia, and fetal demise were consistently noted within 7 to 13 days. Biopsy specimens of maternal liver, spleen, and lymph node displayed variable inflammation and relatively low bacterial burden. In comparison, we observed greater bacterial burden in the decidua and placenta and the highest burden in fetal tissues. Histopathology indicated vasculitis, fibrinoid necrosis, and thrombosis of the decidual spiral arteries, acute chorioamnionitis and villitis in the placenta, and hematogenous infection of the fetus. Vascular pathology suggests early impact of L. monocytogenes infection on spiral arteries in the decidua, which we hypothesize precipitates subsequent placentitis and fetal demise. These results demonstrate that L. monocytogenes tropism for the maternal reproductive tract results in infection of the decidua, placenta, and the fetus itself during the first trimester of pregnancy. PMID:28223455

  18. Nisin resistance of Listeria monocytogenes is increased by exposure to salt stress and is mediated via LiaR.

    Science.gov (United States)

    Bergholz, Teresa M; Tang, Silin; Wiedmann, Martin; Boor, Kathryn J

    2013-09-01

    Growth of Listeria monocytogenes on refrigerated, ready-to-eat food is a significant food safety concern. Natural antimicrobials, such as nisin, can be used to control this pathogen on food, but little is known about how other food-related stresses may impact how the pathogen responds to these compounds. Prior work demonstrated that exposure of L. monocytogenes to salt stress at 7°C led to increased expression of genes involved in nisin resistance, including the response regulator liaR. We hypothesized that exposure to salt stress would increase subsequent resistance to nisin and that LiaR would contribute to increased nisin resistance. Isogenic deletion mutations in liaR were constructed in 7 strains of L. monocytogenes, and strains were exposed to 6% NaCl in brain heart infusion broth and then tested for resistance to nisin (2 mg/ml Nisaplin) at 7°C. For the wild-type strains, exposure to salt significantly increased subsequent nisin resistance (P nisin resistance of wild-type strains, ΔliaR strains were significantly more sensitive to nisin (P nisin. Transcript levels of LiaR-regulated genes were induced by salt stress, and lmo1746 and telA were found to contribute to LiaR-mediated salt-induced nisin resistance. These data suggest that environmental stresses similar to those on foods can influence the resistance of L. monocytogenes to antimicrobials such as nisin, and potential cross-protective effects should be considered when selecting and applying control measures for this pathogen on ready-to-eat foods.

  19. Shifts in indigenous culture relate to forest tree diversity: a case study from the Tsimane’, Bolivian Amazon

    Science.gov (United States)

    Guèze, Maximilien; Luz, Ana Catarina; Paneque-Gálvez, Jaime; Macía, Manuel J.; Orta-Martínez, Martí; Pino, Joan; Reyes-García, Victoria

    2015-01-01

    Understanding how indigenous peoples’ management practices relate to biological diversity requires addressing contemporary changes in indigenous peoples’ way of life. This study explores the association between cultural change among a Bolivian Amazonian indigenous group, the Tsimane’, and tree diversity in forests surrounding their villages. We interviewed 86 informants in six villages about their level of attachment to traditional Tsimane’ values, our proxy for cultural change. We estimated tree diversity (Fisher’s Alpha index) by inventorying trees in 48 0.1-ha plots in old-growth forests distributed in the territory of the same villages. We used multivariate models to assess the relation between cultural change and alpha tree diversity. Cultural change was associated with alpha tree diversity and the relation showed an inverted U-shape, thus suggesting that tree alpha diversity peaked in villages undergoing intermediate cultural change. Although the results do not allow for testing the direction of the relation, we propose that cultural change relates to tree diversity through the changes in practices and behaviors that affect the traditional ecological knowledge of Tsimane’ communities; further research is needed to determine the causality. Our results also find support in the intermediate disturbance hypothesis, and suggest that indigenous management can be seen as an intermediate form of anthropogenic disturbance affecting forest communities in a subtle, non-destructive way. PMID:26097240

  20. Shifts in indigenous culture relate to forest tree diversity: a case study from the Tsimane', Bolivian Amazon.

    Science.gov (United States)

    Guèze, Maximilien; Luz, Ana Catarina; Paneque-Gálvez, Jaime; Macía, Manuel J; Orta-Martínez, Martí; Pino, Joan; Reyes-García, Victoria

    2015-06-01

    Understanding how indigenous peoples' management practices relate to biological diversity requires addressing contemporary changes in indigenous peoples' way of life. This study explores the association between cultural change among a Bolivian Amazonian indigenous group, the Tsimane', and tree diversity in forests surrounding their villages. We interviewed 86 informants in six villages about their level of attachment to traditional Tsimane' values, our proxy for cultural change. We estimated tree diversity (Fisher's Alpha index) by inventorying trees in 48 0.1-ha plots in old-growth forests distributed in the territory of the same villages. We used multivariate models to assess the relation between cultural change and alpha tree diversity. Cultural change was associated with alpha tree diversity and the relation showed an inverted U-shape, thus suggesting that tree alpha diversity peaked in villages undergoing intermediate cultural change. Although the results do not allow for testing the direction of the relation, we propose that cultural change relates to tree diversity through the changes in practices and behaviors that affect the traditional ecological knowledge of Tsimane' communities; further research is needed to determine the causality. Our results also find support in the intermediate disturbance hypothesis, and suggest that indigenous management can be seen as an intermediate form of anthropogenic disturbance affecting forest communities in a subtle, non-destructive way.