WorldWideScience

Sample records for monocytogenes computer file

  1. Algorithms and file structures for computational geometry

    International Nuclear Information System (INIS)

    Hinrichs, K.; Nievergelt, J.

    1983-01-01

    Algorithms for solving geometric problems and file structures for storing large amounts of geometric data are of increasing importance in computer graphics and computer-aided design. As examples of recent progress in computational geometry, we explain plane-sweep algorithms, which solve various topological and geometric problems efficiently; and we present the grid file, an adaptable, symmetric multi-key file structure that provides efficient access to multi-dimensional data along any space dimension. (orig.)

  2. Small file aggregation in a parallel computing system

    Science.gov (United States)

    Faibish, Sorin; Bent, John M.; Tzelnic, Percy; Grider, Gary; Zhang, Jingwang

    2014-09-02

    Techniques are provided for small file aggregation in a parallel computing system. An exemplary method for storing a plurality of files generated by a plurality of processes in a parallel computing system comprises aggregating the plurality of files into a single aggregated file; and generating metadata for the single aggregated file. The metadata comprises an offset and a length of each of the plurality of files in the single aggregated file. The metadata can be used to unpack one or more of the files from the single aggregated file.

  3. Storing files in a parallel computing system using list-based index to identify replica files

    Science.gov (United States)

    Faibish, Sorin; Bent, John M.; Tzelnic, Percy; Zhang, Zhenhua; Grider, Gary

    2015-07-21

    Improved techniques are provided for storing files in a parallel computing system using a list-based index to identify file replicas. A file and at least one replica of the file are stored in one or more storage nodes of the parallel computing system. An index for the file comprises at least one list comprising a pointer to a storage location of the file and a storage location of the at least one replica of the file. The file comprises one or more of a complete file and one or more sub-files. The index may also comprise a checksum value for one or more of the file and the replica(s) of the file. The checksum value can be evaluated to validate the file and/or the file replica(s). A query can be processed using the list.

  4. RAMA: A file system for massively parallel computers

    Science.gov (United States)

    Miller, Ethan L.; Katz, Randy H.

    1993-01-01

    This paper describes a file system design for massively parallel computers which makes very efficient use of a few disks per processor. This overcomes the traditional I/O bottleneck of massively parallel machines by storing the data on disks within the high-speed interconnection network. In addition, the file system, called RAMA, requires little inter-node synchronization, removing another common bottleneck in parallel processor file systems. Support for a large tertiary storage system can easily be integrated in lo the file system; in fact, RAMA runs most efficiently when tertiary storage is used.

  5. A Computational Study of Amensalistic Control of Listeria monocytogenes by Lactococcus lactis under Nutrient Rich Conditions in a Chemostat Setting

    Directory of Open Access Journals (Sweden)

    Hassan Khassehkhan

    2016-09-01

    Full Text Available We study a previously introduced mathematical model of amensalistic control of the foodborne pathogen Listeria monocytogenes by the generally regarded as safe lactic acid bacteria Lactococcus lactis in a chemostat setting under nutrient rich growth conditions. The control agent produces lactic acids and thus affects pH in the environment such that it becomes detrimental to the pathogen while it is much more tolerant to these self-inflicted environmental changes itself. The mathematical model consists of five nonlinear ordinary differential equations for both bacterial species, the concentration of lactic acids, the pH and malate. The model is algebraically too involved to allow a comprehensive, rigorous qualitative analysis. Therefore, we conduct a computational study. Our results imply that depending on the growth characteristics of the medium in which the bacteria are cultured, the pathogen can survive in an intermediate flow regime but will be eradicated for slower flow rates and washed out for higher flow rates.

  6. WinSCP for Windows File Transfers | High-Performance Computing | NREL

    Science.gov (United States)

    WinSCP for Windows File Transfers WinSCP for Windows File Transfers WinSCP for can used to securely transfer files between your local computer running Microsoft Windows and a remote computer running Linux

  7. Documentation of CATHENA input files for the APOLLO computer

    International Nuclear Information System (INIS)

    1988-06-01

    Input files created for the VAX version of the CATHENA two-fluid code have been modified and documented for simulation on the AECB's APOLLO computer system. The input files describe the RD-14 thermalhydraulic loop, the RD-14 steam generator, the RD-12 steam generator blowdown test facility, the Stern Laboratories Cold Water Injection Facility (CWIT), and a CANDU 600 reactor. Sample CATHENA predictions are given and compared with experimental results where applicable. 24 refs

  8. NET: an inter-computer file transfer command

    International Nuclear Information System (INIS)

    Burris, R.D.

    1978-05-01

    The NET command was defined and supported in order to facilitate file transfer between computers. Among the goals of the implementation were greatest possible ease of use, maximum power (i.e., support of a diversity of equipment and operations), and protection of the operating system

  9. Storing files in a parallel computing system based on user-specified parser function

    Science.gov (United States)

    Faibish, Sorin; Bent, John M; Tzelnic, Percy; Grider, Gary; Manzanares, Adam; Torres, Aaron

    2014-10-21

    Techniques are provided for storing files in a parallel computing system based on a user-specified parser function. A plurality of files generated by a distributed application in a parallel computing system are stored by obtaining a parser from the distributed application for processing the plurality of files prior to storage; and storing one or more of the plurality of files in one or more storage nodes of the parallel computing system based on the processing by the parser. The plurality of files comprise one or more of a plurality of complete files and a plurality of sub-files. The parser can optionally store only those files that satisfy one or more semantic requirements of the parser. The parser can also extract metadata from one or more of the files and the extracted metadata can be stored with one or more of the plurality of files and used for searching for files.

  10. A software to report and file by personal computer

    International Nuclear Information System (INIS)

    Di Giandomenico, E.; Filippone, A.; Esposito, A.; Bonomo, L.

    1989-01-01

    During the past four years the authors have been gaining experince in reporting radiological examinations by personal computer. Today they describe the project of a new software which allows the reporting and filing of roentgenograms. This program was realized by a radiologist, using a well known data base management system: dBASE III. The program was shaped to fit the radiologist's needs: it helps to report, and allows to file, radiological data, with the diagnosic codes used by the American College of Radiology. In this paper the authors describe the data base structure and indicate the software functions which make its use possible. Thus, this paper is not aimed at advertising a new reporting program, but at demonstrating how the radiologist can himself manage some aspects of his work with the help of a personal computer

  11. 22 CFR 1429.21 - Computation of time for filing papers.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 2 2010-04-01 2010-04-01 true Computation of time for filing papers. 1429.21... MISCELLANEOUS AND GENERAL REQUIREMENTS General Requirements § 1429.21 Computation of time for filing papers. In... subchapter requires the filing of any paper, such document must be received by the Board or the officer or...

  12. Methods and apparatus for multi-resolution replication of files in a parallel computing system using semantic information

    Science.gov (United States)

    Faibish, Sorin; Bent, John M.; Tzelnic, Percy; Grider, Gary; Torres, Aaron

    2015-10-20

    Techniques are provided for storing files in a parallel computing system using different resolutions. A method is provided for storing at least one file generated by a distributed application in a parallel computing system. The file comprises one or more of a complete file and a sub-file. The method comprises the steps of obtaining semantic information related to the file; generating a plurality of replicas of the file with different resolutions based on the semantic information; and storing the file and the plurality of replicas of the file in one or more storage nodes of the parallel computing system. The different resolutions comprise, for example, a variable number of bits and/or a different sub-set of data elements from the file. A plurality of the sub-files can be merged to reproduce the file.

  13. File and metadata management for BESIII distributed computing

    International Nuclear Information System (INIS)

    Nicholson, C; Zheng, Y H; Lin, L; Deng, Z Y; Li, W D; Zhang, X M

    2012-01-01

    The BESIII experiment at the Institute of High Energy Physics (IHEP), Beijing, uses the high-luminosity BEPCII e + e − collider to study physics in the π-charm energy region around 3.7 GeV; BEPCII has produced the worlds largest samples of J/φ and φ’ events to date. An order of magnitude increase in the data sample size over the 2011-2012 data-taking period demanded a move from a very centralized to a distributed computing environment, as well as the development of an efficient file and metadata management system. While BESIII is on a smaller scale than some other HEP experiments, this poses particular challenges for its distributed computing and data management system. These constraints include limited resources and manpower, and low quality of network connections to IHEP. Drawing on the rich experience of the HEP community, a system has been developed which meets these constraints. The design and development of the BESIII distributed data management system, including its integration with other BESIII distributed computing components, such as job management, are presented here.

  14. Comparison of canal transportation and centering ability of hand Protaper files and rotary Protaper files by using micro computed tomography

    OpenAIRE

    Amit Gandhi; Taru Gandhi

    2011-01-01

    Introduction and objective: The aim of the present study was to compare root canal preparation with rotary ProTaper files and hand ProTaper files to find a better instrumentation technique for maintaining root canal geometry with the aid of computed tomography. Material and methods: Twenty curved root canals with at least 10 degree of curvature were divided into 2 groups of 10 teeth each. In group I the canals were prepared with hand ProTaper files and in group II the canals were prepared wit...

  15. Arranging and finding folders and files on your Windows 7 computer

    CERN Document Server

    Steps, Studio Visual

    2014-01-01

    If you have lots of documents on your desk, it may prove to be impossible to find the document you are looking for. In order to easily find certain documents, they are often stored in a filing cabinet and arranged in a logical order. The folders on your computer serve the same purpose. They do not just contain files; they can also contain other folders. You can create an unlimited number of folders, and each folder can contain any number of subfolders and files. You can use Windows Explorer, also called the folder window, to work with the files and folders on your computer. You can copy, delete, move, find, and sort files, among other things. Or you can transfer files and folders to a USB stick, an external hard drive, a CD, DVD or Blu-Ray disk. In this practical guide we will show you how to use the folder window, and help you arrange your own files.

  16. Methods and apparatus for capture and storage of semantic information with sub-files in a parallel computing system

    Science.gov (United States)

    Faibish, Sorin; Bent, John M; Tzelnic, Percy; Grider, Gary; Torres, Aaron

    2015-02-03

    Techniques are provided for storing files in a parallel computing system using sub-files with semantically meaningful boundaries. A method is provided for storing at least one file generated by a distributed application in a parallel computing system. The file comprises one or more of a complete file and a plurality of sub-files. The method comprises the steps of obtaining a user specification of semantic information related to the file; providing the semantic information as a data structure description to a data formatting library write function; and storing the semantic information related to the file with one or more of the sub-files in one or more storage nodes of the parallel computing system. The semantic information provides a description of data in the file. The sub-files can be replicated based on semantically meaningful boundaries.

  17. RRB / SSI Interface Checkwriting Integrated Computer Operation Extract File (CHICO)

    Data.gov (United States)

    Social Security Administration — This monthly file provides SSA with information about benefit payments made to railroad retirement beneficiaries. SSA uses this data to verify Supplemental Security...

  18. A technique for integrating remote minicomputers into a general computer's file system

    CERN Document Server

    Russell, R D

    1976-01-01

    This paper describes a simple technique for interfacing remote minicomputers used for real-time data acquisition into the file system of a central computer. Developed as part of the ORION system at CERN, this 'File Manager' subsystem enables a program in the minicomputer to access and manipulate files of any type as if they resided on a storage device attached to the minicomputer. Yet, completely transparent to the program, the files are accessed from disks on the central system via high-speed data links, with response times comparable to local storage devices. (6 refs).

  19. Informatics in Radiology (infoRAD): personal computer security: part 2. Software Configuration and file protection.

    Science.gov (United States)

    Caruso, Ronald D

    2004-01-01

    Proper configuration of software security settings and proper file management are necessary and important elements of safe computer use. Unfortunately, the configuration of software security options is often not user friendly. Safe file management requires the use of several utilities, most of which are already installed on the computer or available as freeware. Among these file operations are setting passwords, defragmentation, deletion, wiping, removal of personal information, and encryption. For example, Digital Imaging and Communications in Medicine medical images need to be anonymized, or "scrubbed," to remove patient identifying information in the header section prior to their use in a public educational or research environment. The choices made with respect to computer security may affect the convenience of the computing process. Ultimately, the degree of inconvenience accepted will depend on the sensitivity of the files and communications to be protected and the tolerance of the user. Copyright RSNA, 2004

  20. Processing of evaluated neutron data files in ENDF format on personal computers

    International Nuclear Information System (INIS)

    Vertes, P.

    1991-11-01

    A computer code package - FDMXPC - has been developed for processing evaluated data files in ENDF format. The earlier version of this package is supplemented with modules performing calculations using Reich-Moore and Adler-Adler resonance parameters. The processing of evaluated neutron data files by personal computers requires special programming considerations outlined in this report. The scope of the FDMXPC program system is demonstrated by means of numerical examples. (author). 5 refs, 4 figs, 4 tabs

  1. A digital imaging teaching file by using the internet, HTML and personal computers

    International Nuclear Information System (INIS)

    Chun, Tong Jin; Jeon, Eun Ju; Baek, Ho Gil; Kang, Eun Joo; Baik, Seung Kug; Choi, Han Yong; Kim, Bong Ki

    1996-01-01

    A film-based teaching file takes up space and the need to search through such a file places limits on the extent to which it is likely to be used. Furthermore it is not easy for doctors in a medium-sized hospital to experience a variety of cases, and so for these reasons we created an easy-to-use digital imaging teaching file with HTML(Hypertext Markup Language) and downloaded images via World Wide Web(WWW) services on the Internet. This was suitable for use by computer novices. We used WWW internet services as a resource for various images and three different IMB-PC compatible computers(386DX, 486DX-II, and Pentium) in downloading the images and in developing a digitalized teaching file. These computers were connected with the Internet through a high speed dial-up modem(28.8Kbps) and to navigate the Internet. Twinsock and Netscape were used. 3.0, Korean word processing software, was used to create HTML(Hypertext Markup Language) files and the downloaded images were linked to the HTML files. In this way, a digital imaging teaching file program was created. Access to a Web service via the Internet required a high speed computer(at least 486DX II with 8MB RAM) for comfortabel use; this also ensured that the quality of downloaded images was not degraded during downloading and that these were good enough to use as a teaching file. The time needed to retrieve the text and related images depends on the size of the file, the speed of the network, and the network traffic at the time of connection. For computer novices, a digital image teaching file using HTML is easy to use. Our method of creating a digital imaging teaching file by using Internet and HTML would be easy to create and radiologists with little computer experience who want to study various digital radiologic imaging cases would find it easy to use

  2. Globus File Transfer Services | High-Performance Computing | NREL

    Science.gov (United States)

    installed on the systems at both ends of the data transfer. The NREL endpoint is nrel#globus. Click Login on the Globus web site. On the login page select "Globus ID" as the login method and click Login to the Globus website. From the Manage Data drop down menu, select Transfer Files. Then click Get

  3. Cooperative storage of shared files in a parallel computing system with dynamic block size

    Science.gov (United States)

    Bent, John M.; Faibish, Sorin; Grider, Gary

    2015-11-10

    Improved techniques are provided for parallel writing of data to a shared object in a parallel computing system. A method is provided for storing data generated by a plurality of parallel processes to a shared object in a parallel computing system. The method is performed by at least one of the processes and comprises: dynamically determining a block size for storing the data; exchanging a determined amount of the data with at least one additional process to achieve a block of the data having the dynamically determined block size; and writing the block of the data having the dynamically determined block size to a file system. The determined block size comprises, e.g., a total amount of the data to be stored divided by the number of parallel processes. The file system comprises, for example, a log structured virtual parallel file system, such as a Parallel Log-Structured File System (PLFS).

  4. Computer Forensics Method in Analysis of Files Timestamps in Microsoft Windows Operating System and NTFS File System

    Directory of Open Access Journals (Sweden)

    Vesta Sergeevna Matveeva

    2013-02-01

    Full Text Available All existing file browsers displays 3 timestamps for every file in file system NTFS. Nowadays there are a lot of utilities that can manipulate temporal attributes to conceal the traces of file using. However every file in NTFS has 8 timestamps that are stored in file record and used in detecting the fact of attributes substitution. The authors suggest a method of revealing original timestamps after replacement and automated variant of it in case of a set of files.

  5. Survey on Security Issues in File Management in Cloud Computing Environment

    Science.gov (United States)

    Gupta, Udit

    2015-06-01

    Cloud computing has pervaded through every aspect of Information technology in past decade. It has become easier to process plethora of data, generated by various devices in real time, with the advent of cloud networks. The privacy of users data is maintained by data centers around the world and hence it has become feasible to operate on that data from lightweight portable devices. But with ease of processing comes the security aspect of the data. One such security aspect is secure file transfer either internally within cloud or externally from one cloud network to another. File management is central to cloud computing and it is paramount to address the security concerns which arise out of it. This survey paper aims to elucidate the various protocols which can be used for secure file transfer and analyze the ramifications of using each protocol.

  6. The image database management system of teaching file using personal computer

    International Nuclear Information System (INIS)

    Shin, M. J.; Kim, G. W.; Chun, T. J.; Ahn, W. H.; Baik, S. K.; Choi, H. Y.; Kim, B. G.

    1995-01-01

    For the systemic management and easy using of teaching file in radiology department, the authors tried to do the setup of a database management system of teaching file using personal computer. We used a personal computer (IBM PC compatible, 486DX2) including a image capture card(Window vision, Dooin Elect, Seoul, Korea) and video camera recorder (8mm, CCD-TR105, Sony, Tokyo, Japan) for the acquisition and storage of images. We developed the database program by using Foxpro for Window 2.6(Microsoft, Seattle, USA) executed in the Window 3.1 (Microsoft, Seattle, USA). Each datum consisted of hospital number, name, sex, age, examination date, keyword, radiologic examination modalities, final diagnosis, radiologic findings, references and representative images. The images were acquired and stored as bitmap format (8 bitmap, 540 X 390 ∼ 545 X 414, 256 gray scale) and displayed on the 17 inch-flat monitor(1024 X 768, Samtron, Seoul, Korea). Without special devices, the images acquisition and storage could be done on the reading viewbox, simply. The image quality on the computer's monitor was less than the one of original film on the viewbox, but generally the characteristics of each lesions could be differentiated. Easy retrieval of data was possible for the purpose of teaching file system. Without high cost appliances, we could consummate the image database system of teaching file using personal computer with relatively inexpensive method

  7. Transfer of numeric ASCII data files between Apple and IBM personal computers.

    Science.gov (United States)

    Allan, R W; Bermejo, R; Houben, D

    1986-01-01

    Listings for programs designed to transfer numeric ASCII data files between Apple and IBM personal computers are provided with accompanying descriptions of how the software operates. Details of the hardware used are also given. The programs may be easily adapted for transferring data between other microcomputers.

  8. Dimensional quality control of Ti-Ni dental file by optical coordinate metrology and computed tomography

    DEFF Research Database (Denmark)

    Yagüe-Fabra, J.A.; Tosello, Guido; Ontiveros, S.

    2014-01-01

    Endodontic dental files usually present complex 3D geometries, which make the complete measurement of the component very challenging with conventional micro metrology tools. Computed Tomography (CT) can represent a suitable alternative solution to micro metrology tools based on optical and tactile...... techniques. However, the establishment of CT systems traceability when measuring 3D complex geometries is still an open issue. In this work, to verify the quality of the CT dimensional measurements, the dental file has been measured both with a μCT system and an optical CMM (OCMM). The uncertainty...

  9. Listeria monocytogenes: diagnostic problems

    NARCIS (Netherlands)

    Beumer, R.R.; Hazeleger, W.C.

    2003-01-01

    The first isolation methods for the detection of Listeria spp. were generally based on the direct culture of samples on simple agar media, but isolation of the pathogenic Listeria monocytogenes was difficult. In time, new techniques were developed, based on a variety of selective and elective agents

  10. The occurrence, transmission, virulence and antibiotic resistance of Listeria monocytogenes in fish processing plant.

    Science.gov (United States)

    Skowron, Krzysztof; Kwiecińska-Piróg, Joanna; Grudlewska, Katarzyna; Świeca, Agnieszka; Paluszak, Zbigniew; Bauza-Kaszewska, Justyna; Wałecka-Zacharska, Ewa; Gospodarek-Komkowska, Eugenia

    2018-06-13

    The aim of this research was to investigate the occurrence of Listeria monocytogenes in fish and fish processing plant and to determine their transmission, virulence and antibiotic resistance. L. monocytogenes was isolated according to the ISO 11290-1. The identification of L. monocytogenes was confirmed by multiplex PCR method. Genetic similarity of L. monocytogenes strains was determined with the Pulsed-Filed Gene Electrophoresis (PFGE) method. The multiplex PCR was used for identification of L. monocytogenes serogroups and detection of selected virulence genes (actA, fbpA, hlyA, iap, inlA, inlB, mpl, plcA, plcB, prfA). The L. monocytogens isolates susceptibility to penicillin, ampicillin, meropenem, erythromycin, trimethoprim/sulfamethoxazole was evaluated with disc diffusion method according to EUCAST v. 7.1. The presence of 237 L. monocytogenes isolates (before genetic similarity assessment) in 614 examined samples was confirmed. After strain differentiation by PFGE techniques the presence of 161 genetically different strains were confirmed. The genetic similarity of the examined isolates suggested that the source of the L. monocytogenes strains were fishes originating from farms. All tested strains possessed all detected virulence genes. Among examined strains, the most (26, 38.6%) belonged to the group 1/2a-3a. The most of tested strains were resistant to erythromycin (47.1%) and trimethoprim/sulfamethoxazole (47.1%). Copyright © 2018. Published by Elsevier B.V.

  11. File management for experiment control parameters within a distributed function computer network

    International Nuclear Information System (INIS)

    Stubblefield, F.W.

    1976-10-01

    An attempt to design and implement a computer system for control of and data collection from a set of laboratory experiments reveals that many of the experiments in the set require an extensive collection of parameters for their control. The operation of the experiments can be greatly simplified if a means can be found for storing these parameters between experiments and automatically accessing them as they are required. A subsystem for managing files of such experiment control parameters is discussed. 3 figures

  12. Listeria monocytogenes Monographic Study

    Directory of Open Access Journals (Sweden)

    Emil Tirziu

    2010-05-01

    Full Text Available Listeria monocytogenes is a ubiquitous bacteria with a remarkable resistance in discordant condition which produce listeriosis, an infectious disease that affects multiple domestic and wild animals’ species, but also humans. Receptive to listeriosis are the majority of domestic or wild mammals and birds, in the last years being registered an increase of receptivity in humans. The concept of listeriosis in human pathology, a disease caused by eating or drinking contaminated food and water, appeared for the first time in 1981, during an outbreak in Canada with seven cases in adults and 34 cases of maternalfetal listeriosis. The alimentary origin of human listeriosis can be easily explained if considered some general characteristics of the bacteria. Thus, resistance in various conditions, especially at lower temperatures, justifies its dissemination and food contamination, particularly when is conserved by refrigeration. Also, L. monocytogenes has a significant presence in alimentary products. Some studies showed that 4% of the milk products, 29% of the meat products, 5% of the vegetable products and 26% of the products obtained from fishes and shell fishes are positive for L. monocytogenes, which allows us to say that battle against these bacteria is a war against microbial contamination.

  13. First Trimester Listeria monocytogenes Septicemia

    NARCIS (Netherlands)

    Goddijn, M.; Schipper, H. G.; Spanjaard, L.; Wolf, H.

    1997-01-01

    Background: Little is known about fetal outcome after Listeria monocytogenes septicemia in the first trimester of pregnancy.Case: A primigravida with L. monocytogenes septicemia at 9 weeks gestation was treated with amoxicillin. At 40 weeks gestation a healthy female infant was born.Conclusion: This

  14. Evaluation of clinical data in childhood asthma. Application of a computer file system

    International Nuclear Information System (INIS)

    Fife, D.; Twarog, F.J.; Geha, R.S.

    1983-01-01

    A computer file system was used in our pediatric allergy clinic to assess the value of chest roentgenograms and hemoglobin determinations used in the examination of patients and to correlate exposure to pets and forced hot air with the severity of asthma. Among 889 children with asthma, 20.7% had abnormal chest roentgenographic findings, excluding hyperinflation and peribronchial thickening, and 0.7% had abnormal hemoglobin values. Environmental exposure to pets or forced hot air was not associated with increased severity of asthma, as assessed by five measures of outcome: number of medications administered, requirement for corticosteroids, frequency of clinic visits, frequency of emergency room visits, and frequency of hospitalizations

  15. Building Parts Inventory Files Using the AppleWorks Data Base Subprogram and Apple IIe or GS Computers.

    Science.gov (United States)

    Schlenker, Richard M.

    This manual is a "how to" training device for building database files using the AppleWorks program with an Apple IIe or Apple IIGS Computer with Duodisk or two disk drives and an 80-column card. The manual provides step-by-step directions, and includes 25 figures depicting the computer screen at the various stages of the database file…

  16. CINDA 83 (1977-1983). The index to literature and computer files on microscopic neutron data

    International Nuclear Information System (INIS)

    1983-01-01

    CINDA, the Computer Index of Neutron Data, contains bibliographical references to measurements, calculations, reviews and evaluations of neutron cross-sections and other microscopic neutron data; it includes also index references to computer libraries of numerical neutron data exchanged between four regional neutron data centres. The present issue, CINDA 83, is an index to the literature on neutron data published after 1976. The basic volume, CINDA-A, together with the present issue, contains the full CINDA file as of 1 April 1983. A supplement to CINDA 83 is foreseen for fall 1983. Next year's issue, which is envisaged to be published in June 1984, will again cover all relevant literature that has appeared after 1976

  17. Trust in social computing. The case of peer-to-peer file sharing networks

    Directory of Open Access Journals (Sweden)

    Heng Xu

    2011-09-01

    Full Text Available Social computing and online communities are changing the fundamental way people share information and communicate with each other. Social computing focuses on how users may have more autonomy to express their ideas and participate in social exchanges in various ways, one of which may be peer-to-peer (P2P file sharing. Given the greater risk of opportunistic behavior by malicious or criminal communities in P2P networks, it is crucial to understand the factors that affect individual’s use of P2P file sharing software. In this paper, we develop and empirically test a research model that includes trust beliefs and perceived risks as two major antecedent beliefs to the usage intention. Six trust antecedents are assessed including knowledge-based trust, cognitive trust, and both organizational and peer-network factors of institutional trust. Our preliminary results show general support for the model and offer some important implications for software vendors in P2P sharing industry and regulatory bodies.

  18. Fødevarebetinget listeria monocytogenes endokarditis

    DEFF Research Database (Denmark)

    Frydland, Martin; Bundgaard, Henning; Moser, Claus

    2014-01-01

    Infection with Listeria monocytogenes is rare and mainly seen in immunosuppressed patients. Infection with L. monocytogenes has a mortality rate of 30%. We present a case report of L. monocytogenes bacteraemia and endocarditis in a 70-year-old man with several co-morbidities and following four...... major surgical procedures. This illustrates the findings and characteristics in one of the 16 patients who died in 2013 and 2014 this summer due to sausage-related L. monocytogenes infection....

  19. Comparison of canal transportation and centering ability of twisted files, Pathfile-ProTaper system, and stainless steel hand K-files by using computed tomography.

    Science.gov (United States)

    Gergi, Richard; Rjeily, Joe Abou; Sader, Joseph; Naaman, Alfred

    2010-05-01

    The purpose of this study was to compare canal transportation and centering ability of 2 rotary nickel-titanium (NiTi) systems (Twisted Files [TF] and Pathfile-ProTaper [PP]) with conventional stainless steel K-files. Ninety root canals with severe curvature and short radius were selected. Canals were divided randomly into 3 groups of 30 each. After preparation with TF, PP, and stainless steel files, the amount of transportation that occurred was assessed by using computed tomography. Three sections from apical, mid-root, and coronal levels of the canal were recorded. Amount of transportation and centering ability were assessed. The 3 groups were statistically compared with analysis of variance and Tukey honestly significant difference test. Less transportation and better centering ability occurred with TF rotary instruments (P < .0001). K-files showed the highest transportation followed by PP system. PP system showed significant transportation when compared with TF (P < .0001). The TF system was found to be the best for all variables measured in this study. Copyright (c) 2010 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

  20. Listeria monocytogenes endophthalmitis following keratoconjunctivitis.

    Science.gov (United States)

    Shoughy, Samir S; Tabbara, Khalid F

    2014-01-01

    Endophthalmitis due to endogenous or exogenous bacteria is a rare infection of the eye. We report a case of endophthalmitis following Listeria monocytogenes keratoconjunctivitis in a 27-year-old healthy white male presenting with hand motion visual acuity, right eye mucopurulent conjunctivitis, elevated intraocular pressure, and pigmented hypopyon 6 months post-keratectomy. The conjunctivitis was unresponsive to a 5-day course of topical tobramycin eye drops, and the patient developed keratitis with pain that progressed to endophthalmitis after 21 days. Diagnostic B-scan revealed vitreous exudates. Intraocular fluid specimen showed Gram-positive organisms and the aqueous culture grew penicillin-/aminoglycoside-sensitive L. monocytogenes. The patient was given intravitreal and systemic vancomycin and ceftazidime. The eye was unresponsive to intravenous penicillin and gentamicin; the anterior chamber progressively flattened and developed phthisis bulbi. L. monocytogenes keratoconjunctivitis may lead to bacterial endophthalmitis. Prompt culture and early antibiotic therapy are recommended.

  1. Modification to the Monte Carlo N-Particle (MCNP) Visual Editor (MCNPVised) to Read in Computer Aided Design (CAD) Files

    International Nuclear Information System (INIS)

    Randolph Schwarz; Leland L. Carter; Alysia Schwarz

    2005-01-01

    Monte Carlo N-Particle Transport Code (MCNP) is the code of choice for doing complex neutron/photon/electron transport calculations for the nuclear industry and research institutions. The Visual Editor for Monte Carlo N-Particle is internationally recognized as the best code for visually creating and graphically displaying input files for MCNP. The work performed in this grant was used to enhance the capabilities of the MCNP Visual Editor to allow it to read in both 2D and 3D Computer Aided Design (CAD) files, allowing the user to electronically generate a valid MCNP input geometry

  2. Conversion of Input Data between KENO and MCNP File Formats for Computer Criticality Assessments

    International Nuclear Information System (INIS)

    Schwarz, Randolph A.; Carter, Leland L.; Schwarz Alysia L.

    2006-01-01

    KENO is a Monte Carlo criticality code that is maintained by Oak Ridge National Laboratory (ORNL). KENO is included in the SCALE (Standardized Computer Analysis for Licensing Evaluation) package. KENO is often used because it was specifically designed for criticality calculations. Because KENO has convenient geometry input, including the treatment of lattice arrays of materials, it is frequently used for production calculations. Monte Carlo N-Particle (MCNP) is a Monte Carlo transport code maintained by Los Alamos National Laboratory (LANL). MCNP has a powerful 3D geometry package and an extensive cross section database. It is a general-purpose code and may be used for calculations involving shielding or medical facilities, for example, but can also be used for criticality calculations. MCNP is becoming increasingly more popular for performing production criticality calculations. Both codes have their own specific advantages. After a criticality calculation has been performed with one of the codes, it is often desirable (or may be a safety requirement) to repeat the calculation with the other code to compare the important parameters using a different geometry treatment and cross section database. This manual conversion of input files between the two codes is labor intensive. The industry needs the capability of converting geometry models between MCNP and KENO without a large investment in manpower. The proposed conversion package will aid the user in converting between the codes. It is not intended to be used as a ''black box''. The resulting input file will need to be carefully inspected by criticality safety personnel to verify the intent of the calculation is preserved in the conversion. The purpose of this package is to help the criticality specialist in the conversion process by converting the geometry, materials, and pertinent data cards

  3. Modification to the Monte N-Particle (MCNP) Visual Editor (MCNPVised) to read in Computer Aided Design (CAD) files

    International Nuclear Information System (INIS)

    Schwarz, Randy A.; Carter, Leeland L.

    2004-01-01

    Monte Carlo N-Particle Transport Code (MCNP) (Reference 1) is the code of choice for doing complex neutron/photon/electron transport calculations for the nuclear industry and research institutions. The Visual Editor for Monte Carlo N-Particle (References 2 to 11) is recognized internationally as the best code for visually creating and graphically displaying input files for MCNP. The work performed in this grant enhanced the capabilities of the MCNP Visual Editor to allow it to read in a 2D Computer Aided Design (CAD) file, allowing the user to modify and view the 2D CAD file and then electronically generate a valid MCNP input geometry with a user specified axial extent

  4. Listeria monocytogenes endophthalmitis following keratoconjunctivitis

    Directory of Open Access Journals (Sweden)

    Shoughy SS

    2014-01-01

    Full Text Available Samir S Shoughy,1 Khalid F Tabbara1–31The Eye Center and The Eye Foundation for Research in Ophthalmology, Riyadh, Saudi Arabia; 2Department of Ophthalmology, College of Medicine, King Saud University, Riyadh, Saudi Arabia; 3The Wilmer Ophthalmological Institute of The Johns Hopkins University School of Medicine, Baltimore, MD, USAAbstract: Endophthalmitis due to endogenous or exogenous bacteria is a rare infection of the eye. We report a case of endophthalmitis following Listeria monocytogenes keratoconjunctivitis in a 27-year-old healthy white male presenting with hand motion visual acuity, right eye mucopurulent conjunctivitis, elevated intraocular pressure, and pigmented hypopyon 6 months post-keratectomy. The conjunctivitis was unresponsive to a 5-day course of topical tobramycin eye drops, and the patient developed keratitis with pain that progressed to endophthalmitis after 21 days. Diagnostic B-scan revealed vitreous exudates. Intraocular fluid specimen showed Gram-positive organisms and the aqueous culture grew penicillin-/aminoglycoside-sensitive L. monocytogenes. The patient was given intravitreal and systemic vancomycin and ceftazidime. The eye was unresponsive to intravenous penicillin and gentamicin; the anterior chamber progressively flattened and developed phthisis bulbi. L. monocytogenes keratoconjunctivitis may lead to bacterial endophthalmitis. Prompt culture and early antibiotic therapy are recommended.Keywords: conjunctivitis, L. monocytogenes, endophthalmitis

  5. Geothermal-energy files in computer storage: sites, cities, and industries

    Energy Technology Data Exchange (ETDEWEB)

    O' Dea, P.L.

    1981-12-01

    The site, city, and industrial files are described. The data presented are from the hydrothermal site file containing about three thousand records which describe some of the principal physical features of hydrothermal resources in the United States. Data elements include: latitude, longitude, township, range, section, surface temperature, subsurface temperature, the field potential, and well depth for commercialization. (MHR)

  6. Evaluation of Single File Systems Reciproc, Oneshape, and WaveOne using Cone Beam Computed Tomography -An In Vitro Study.

    Science.gov (United States)

    Dhingra, Annil; Ruhal, Nidhi; Miglani, Anjali

    2015-04-01

    Successful endodontic therapy depends on many factor, one of the most important step in any root canal treatment is root canal preparation. In addition, respecting the original shape of the canal is of the same importance; otherwise, canal aberrations such as transportation will be created. The purpose of this study is to compare and evaluate Reciprocating WaveOne ,Reciproc and Rotary Oneshape Single File Instrumentation System On Cervical Dentin Thickness, Cross Sectional Area and Canal Transportation on First Mandibular Molar Using Cone Beam Computed Tomography. Sixty Mandibular First Molars extracted due to periodontal reason was collected from the Department of Oral and Maxillofacial. Teeth were prepared using one rotary and two reciprocating single file system. Teeth were divided into 3 groups 20 teeth in each group. Pre instrumentation and Post instrumentation scans was done and evaluated for three parameters Canal Transportation, Cervical Dentinal Thickness, Cross-sectional Area. Results were analysed statistically using ANOVA, Post-Hoc Tukey analysis. The change in cross-sectional area after filing showed significant difference at 0mm, 1mm, 2mm and 7mm (pfile system over a distance of 7 mm (starting from 0mm and then evaluation at 1mm, 2mm, 3mm, 5mm and 7mm), the results showed a significant difference among the file systems at various lengths (p= 0.014, 0.046, 0.004, 0.028, 0.005 & 0.029 respectively). Mean value of cervical dentinal removal is maximum at all the levels for oneshape and minimum for waveone showing the better quality of waveone and reciproc over oneshape file system. Significant difference was found at 9mm, 11mm and 12mm between all the three file systems (p<0.001,< 0.001, <0.001). It was concluded that reciprocating motion is better than rotary motion in all the three parameters Canal Transportation, Cross-sectional Area, Cervical Dentinal Thickness.

  7. Generation of Gaussian 09 Input Files for the Computation of 1H and 13C NMR Chemical Shifts of Structures from a Spartan’14 Conformational Search

    OpenAIRE

    sprotocols

    2014-01-01

    Authors: Spencer Reisbick & Patrick Willoughby ### Abstract This protocol describes an approach to preparing a series of Gaussian 09 computational input files for an ensemble of conformers generated in Spartan’14. The resulting input files are necessary for computing optimum geometries, relative conformer energies, and NMR shielding tensors using Gaussian. Using the conformational search feature within Spartan’14, an ensemble of conformational isomers was obtained. To convert the str...

  8. Computational system to create an entry file for replicating I-125 seeds simulating brachytherapy case studies using the MCNPX code

    Directory of Open Access Journals (Sweden)

    Leonardo da Silva Boia

    2014-03-01

    Full Text Available Purpose: A computational system was developed for this paper in the C++ programming language, to create a 125I radioactive seed entry file, based on the positioning of a virtual grid (template in voxel geometries, with the purpose of performing prostate cancer treatment simulations using the MCNPX code.Methods: The system is fed with information from the planning system with regard to each seed’s location and its depth, and an entry file is automatically created with all the cards (instructions for each seed regarding their cell blocks and surfaces spread out spatially in the 3D environment. The system provides with precision a reproduction of the clinical scenario for the MCNPX code’s simulation environment, thereby allowing the technique’s in-depth study.Results and Conclusion: The preliminary results from this study showed that the lateral penumbra of uniform scanning proton beams was less sensitive In order to validate the computational system, an entry file was created with 88 125I seeds that were inserted in the phantom’s MAX06 prostate region with initial activity determined for the seeds at the 0.27 mCi value. Isodose curves were obtained in all the prostate slices in 5 mm steps in the 7 to 10 cm interval, totaling 7 slices. Variance reduction techniques were applied in order to optimize computational time and the reduction of uncertainties such as photon and electron energy interruptions in 4 keV and forced collisions regarding cells of interest. Through the acquisition of isodose curves, the results obtained show that hot spots have values above 300 Gy, as anticipated in literature, stressing the importance of the sources’ correct positioning, in which the computational system developed provides, in order not to release excessive doses in adjacent risk organs. The 144 Gy prescription curve showed in the validation process that it covers perfectly a large percentage of the volume, at the same time that it demonstrates a large

  9. OK, Computer: File Sharing, the Music Industry, and Why We Need the Pirate Party

    Directory of Open Access Journals (Sweden)

    Adrian Cosstick

    2009-03-01

    Full Text Available The Pirate Party believes the state and big business are in the process of protecting stale and inefficient models of business for their own monetary benefit by limiting our right to share information. The Pirate Party suggests that they are achieving this goal through the amendment of intellectual property legislation. In the dawn of the digital era, the Pirate Party advocates that governments and multinational corporations are using intellectual property to: crack down on file sharing which limits the ability to share knowledge and information; increase the terms and length of copyright to raise profits; and build code into music files which limits their ability to be shared (Pirate Party, 2009. There are a number of ‘copyright industries’ that are affected by these issues, none more so than the music industry. Its relationship with file sharing is topical and makes an excellent case study to address the impact big business has had on intellectual property and the need for the Pirate Party’s legislative input. The essay will then examine the central issues raised by illegal file sharing. In particular, the future for record companies in an environment that increasingly demands flexibility, and whether the Pirate Party’s proposal is a viable solution to the music industry’s problems

  10. Comparative evaluation of effect of rotary and reciprocating single-file systems on pericervical dentin: A cone-beam computed tomography study.

    Science.gov (United States)

    Zinge, Priyanka Ramdas; Patil, Jayaprakash

    2017-01-01

    The aim of this study is to evaluate and compare the effect of one shape, Neolix rotary single-file systems and WaveOne, Reciproc reciprocating single-file systems on pericervical dentin (PCD) using cone-beam computed tomography (CBCT). A total of 40 freshly extracted mandibular premolars were collected and divided into two groups, namely, Group A - Rotary: A 1 - Neolix and A 2 - OneShape and Group B - Reciprocating: B 1 - WaveOne and B 2 - Reciproc. Preoperative scans of each were taken followed by conventional access cavity preparation and working length determination with 10-k file. Instrumentation of the canal was done according to the respective file system, and postinstrumentation CBCT scans of teeth were obtained. 90 μm thick slices were obtained 4 mm apical and coronal to the cementoenamel junction. The PCD thickness was calculated as the shortest distance from the canal outline to the closest adjacent root surface, which was measured in four surfaces, i.e., facial, lingual, mesial, and distal for all the groups in the two obtained scans. There was no significant difference found between rotary single-file systems and reciprocating single-file systems in their effect on PCD, but in Group B 2 , there was most significant loss of tooth structure in the mesial, lingual, and distal surface ( P file system removes more PCD as compared to other experimental groups, whereas Neolix single file system had the least effect on PCD.

  11. ERX: a software for editing files containing X-ray spectra to be used in exposure computational models

    International Nuclear Information System (INIS)

    Cabral, Manuela O.M.; Vieira, Jose W.; Silva, Alysson G.; Leal Neto, Viriato; Oliveira, Alex C.H.; Lima, Fernando R.A.

    2011-01-01

    Exposure Computational Models (ECMs) are utilities that simulate situations in which occurs irradiation in a given environment. An ECM is composed primarily by an anthropomorphic model (phantom), and a Monte Carlo code (MC). This paper presents a tutorial of the software Espectro de Raios-X (ERX). This software performs reading and numerical and graphical analysis of text files containing diagnostic X-ray spectra for use in algorithms of radioactive sources in the ECMs of a Grupo de Dosimetria Numerica. The ERX allows the user to select one among several X-ray spectrums in the energy range Diagnostic radiology X-Ray most commonly used in radiology clinics. In the current version of the ERX there are two types of input files: the contained in mspectra.dat file and the resulting of MC simulations in Geant4. The software allows the construction of charts of the Probability Density Function (PDF) and Cumulative Distribution Function (CDF) of a selected spectrum as well as the table with the values of these functions and the spectrum. In addition, the ERX allows the user to make comparative analysis between the PDF graphics of the two catalogs of spectra available, besides being can perform dosimetric evaluations with the selected spectrum. A software of this kind is an important computational tool for researchers in numerical dosimetry because of the diversity of Diagnostic radiology X-Ray machines, which implies in a mass of input data highly diverse. And because of this, the ERX provides independence to the group related to the data origin that is contained in the catalogs created, not being necessary to resort to others. (author)

  12. F2AC: A Lightweight, Fine-Grained, and Flexible Access Control Scheme for File Storage in Mobile Cloud Computing

    Directory of Open Access Journals (Sweden)

    Wei Ren

    2016-01-01

    Full Text Available Current file storage service models for cloud servers assume that users either belong to single layer with different privileges or cannot authorize privileges iteratively. Thus, the access control is not fine-grained and flexible. Besides, most access control methods at cloud servers mainly rely on computationally intensive cryptographic algorithms and, especially, may not be able to support highly dynamic ad hoc groups with addition and removal of group members. In this paper, we propose a scheme called F2AC, which is a lightweight, fine-grained, and flexible access control scheme for file storage in mobile cloud computing. F2AC can not only achieve iterative authorization, authentication with tailored policies, and access control for dynamically changing accessing groups, but also provide access privilege transition and revocation. A new access control model called directed tree with linked leaf model is proposed for further implementations in data structures and algorithms. The extensive analysis is given for justifying the soundness and completeness of F2AC.

  13. Micro computed tomography evaluation of the Self-adjusting file and ProTaper Universal system on curved mandibular molars.

    Science.gov (United States)

    Serefoglu, Burcu; Piskin, Beyser

    2017-09-26

    The aim of this investigation was to compare the cleaning and shaping efficiency of Self-adjusting file and Protaper, and to assess the correlation between root canal curvature and working time in mandibular molars using micro-computed tomography. Twenty extracted mandibular molars instrumented with Protaper and Self-adjusting file and the total working time was measured in mesial canals. The changes in canal volume, surface area and structure model index, transportation, uninstrumented area and the correlation between working-time and the curvature were analyzed. Although no statistically significant difference was observed between two systems in distal canals (p>0.05), a significantly higher amount of removed dentin volume and lower uninstrumented area were provided by Protaper in mesial canals (p<0.0001). A correlation between working-time and the canal-curvature was also observed in mesial canals for both groups (SAFr 2 =0.792, p<0.0004, PTUr 2 =0.9098, p<0.0001).

  14. Request queues for interactive clients in a shared file system of a parallel computing system

    Science.gov (United States)

    Bent, John M.; Faibish, Sorin

    2015-08-18

    Interactive requests are processed from users of log-in nodes. A metadata server node is provided for use in a file system shared by one or more interactive nodes and one or more batch nodes. The interactive nodes comprise interactive clients to execute interactive tasks and the batch nodes execute batch jobs for one or more batch clients. The metadata server node comprises a virtual machine monitor; an interactive client proxy to store metadata requests from the interactive clients in an interactive client queue; a batch client proxy to store metadata requests from the batch clients in a batch client queue; and a metadata server to store the metadata requests from the interactive client queue and the batch client queue in a metadata queue based on an allocation of resources by the virtual machine monitor. The metadata requests can be prioritized, for example, based on one or more of a predefined policy and predefined rules.

  15. A computer program for creating keyword indexes to textual data files

    Science.gov (United States)

    Moody, David W.

    1972-01-01

    A keyword-in-context (KWIC) or out-of-context (KWOC) index is a convenient means of organizing information. This keyword index program can be used to create either KWIC or KWOC indexes of bibliographic references or other types of information punched on. cards, typed on optical scanner sheets, or retrieved from various Department of Interior data bases using the Generalized Information Processing System (GIPSY). The index consists of a 'bibliographic' section and a keyword-section based on the permutation of. document titles, project titles, environmental impact statement titles, maps, etc. or lists of descriptors. The program can also create a back-of-the-book index to documents from a list of descriptors. By providing the user with a wide range of input and output options, the program provides the researcher, manager, or librarian with a means of-maintaining a list and index to documents in. a small library, reprint collection, or office file.

  16. Verification of data files of TREF-computer program; TREF-ohjelmiston ohjaustiedostojen soveltuvuustutkimus

    Energy Technology Data Exchange (ETDEWEB)

    Ruottu, S.; Halme, A.; Ruottu, A. [Einco Oy, Karhula (Finland)

    1996-12-01

    Originally the aim of Y43 project was to verify TREF data files for several different processes. However, it appeared that deficient or missing coordination between experimental and theoretical works made meaningful verifications impossible in some cases. Therefore verification calculations were focused on catalytic cracking reactor which was developed by Neste. The studied reactor consisted of prefluidisation and reaction zones. Verification calculations concentrated mainly on physical phenomena like vaporization near oil injection zone. The main steps of the cracking process can be described as follows oil (liquid) -> oil (gas) -> oil (catal) -> product (catal) + char (catal) -> product (gas). Catalytic nature of cracking reaction was accounted by defining the cracking pseudoreaction into catalyst phase. This simplified reaction model was valid only for vaporization zone. Applied fluid dynamic theory was based on the results of EINCO`s earlier LIEKKI-projects. (author)

  17. 78 FR 27939 - Draft Interagency Risk Assessment-Listeria monocytogenes

    Science.gov (United States)

    2013-05-13

    ... Listeria (L.) monocytogenes contamination of certain ready-to-eat (RTE) foods, for example cheese, deli... Scott, V.N., Survey of Listeria monocytogenes in ready-to-eat foods. Journal of Food Protection, 2003... monocytogenes in ready-to-eat processed meat and poultry collected in four FoodNet states in International...

  18. Occurrence of Listeria monocytogenes in smoked fish in Sokoto ...

    African Journals Online (AJOL)

    STORAGESEVER

    2008-09-03

    Sep 3, 2008 ... monocytogenes and other Listeria species are common contaminant of smoked fish, and this may pose serious public health implications. Key words: Smoked fish, Listeria monocytogenes, contamination, public health. INTRODUCTION ... L. monocytogenes belong to the recently emerging psychrotrophic ...

  19. Listeria monocytogenes infection in pregnancy and neonatal sepsis

    Directory of Open Access Journals (Sweden)

    Francesca Pascale

    2008-06-01

    Full Text Available Authors report a fatal neonatal sepsis caused by Listeria monocytogenes. While the diagnostic procedure aimed to identify the microrganism is described, it is emphasized the importance to recover Streptococcus agalactiae (GBS and L. monocytogenes by means of vaginal-rectal swab culture. The intrapartum screening for L. monocytogenes, by Polymerase Chain Reaction (PCR providing results in 75 minutes is also evaluated.

  20. Shaping ability of the conventional nickel-titanium and reciprocating nickel-titanium file systems: a comparative study using micro-computed tomography.

    Science.gov (United States)

    Hwang, Young-Hye; Bae, Kwang-Shik; Baek, Seung-Ho; Kum, Kee-Yeon; Lee, WooCheol; Shon, Won-Jun; Chang, Seok Woo

    2014-08-01

    This study used micro-computed tomographic imaging to compare the shaping ability of Mtwo (VDW, Munich, Germany), a conventional nickel-titanium file system, and Reciproc (VDW), a reciprocating file system morphologically similar to Mtwo. Root canal shaping was performed on the mesiobuccal and distobuccal canals of extracted maxillary molars. In the RR group (n = 15), Reciproc was used in a reciprocating motion (150° counterclockwise/30° clockwise, 300 rpm); in the MR group, Mtwo was used in a reciprocating motion (150° clockwise/30° counterclockwise, 300 rpm); and in the MC group, Mtwo was used in a continuous rotating motion (300 rpm). Micro-computed tomographic images taken before and after canal shaping were used to analyze canal volume change and the degree of transportation at the cervical, middle, and apical levels. The time required for canal shaping was recorded. Afterward, each file was analyzed using scanning electron microscopy. No statistically significant differences were found among the 3 groups in the time for canal shaping or canal volume change (P > .05). Transportation values of the RR and MR groups were not significantly different at any level. However, the transportation value of the MC group was significantly higher than both the RR and MR groups at the cervical and apical levels (P file deformation was observed for 1 file in group RR (1/15), 3 files in group MR (3/15), and 5 files in group MC (5/15). In terms of shaping ability, Mtwo used in a reciprocating motion was not significantly different from the Reciproc system. Copyright © 2014 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

  1. PCF File Format.

    Energy Technology Data Exchange (ETDEWEB)

    Thoreson, Gregory G [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)

    2017-08-01

    PCF files are binary files designed to contain gamma spectra and neutron count rates from radiation sensors. It is the native format for the GAmma Detector Response and Analysis Software (GADRAS) package [1]. It can contain multiple spectra and information about each spectrum such as energy calibration. This document outlines the format of the file that would allow one to write a computer program to parse and write such files.

  2. Prevalence and growth of Listeria monocytogenes in naturally contaminated seafood

    DEFF Research Database (Denmark)

    Jørgensen, Lasse Vigel; Huss, Hans Henrik

    1998-01-01

    Listeria monocytogenes contamination of seafood varies with product category. The highest prevalence was found in cold- smoked fish (34-60%), while the lowest was found in heat- treated and cured seafood (4-12%). The prevalence of L. monocytogenes differed greatly in cold-smoked salmon between...... production sites, ranging from monocytogenes. The organism showed moderate growth...... in naturally contaminated cold-smoked, and 'gravad', fish while the growth appeared faster in hot smoked fish. Thus L. monocytogenes is not under control in these products. Finally, the prevalence and growth of L. monocytogenes in naturally contaminated cold-smoked salmon are discussed in relation...

  3. Reciprocating vs Rotary Instrumentation in Pediatric Endodontics: Cone Beam Computed Tomographic Analysis of Deciduous Root Canals using Two Single-file Systems.

    Science.gov (United States)

    Prabhakar, Attiguppe R; Yavagal, Chandrashekar; Dixit, Kratika; Naik, Saraswathi V

    2016-01-01

    Primary root canals are considered to be most challenging due to their complex anatomy. "Wave one" and "one shape" are single-file systems with reciprocating and rotary motion respectively. The aim of this study was to evaluate and compare dentin thickness, centering ability, canal transportation, and instrumentation time of wave one and one shape files in primary root canals using a cone beam computed tomographic (CBCT) analysis. This is an experimental, in vitro study comparing the two groups. A total of 24 extracted human primary teeth with minimum 7 mm root length were included in the study. Cone beam computed tomographic images were taken before and after the instrumentation for each group. Dentin thickness, centering ability, canal transportation, and instrumentation times were evaluated for each group. A significant difference was found in instrumentation time and canal transportation measures between the two groups. Wave one showed less canal transportation as compared with one shape, and the mean instrumentation time of wave one was significantly less than one shape. Reciprocating single-file systems was found to be faster with much less procedural errors and can hence be recommended for shaping the root canals of primary teeth. How to cite this article: Prabhakar AR, Yavagal C, Dixit K, Naik SV. Reciprocating vs Rotary Instrumentation in Pediatric Endodontics: Cone Beam Computed Tomographic Analysis of Deciduous Root Canals using Two Single-File Systems. Int J Clin Pediatr Dent 2016;9(1):45-49.

  4. COMPUTING

    CERN Multimedia

    M. Kasemann

    CCRC’08 challenges and CSA08 During the February campaign of the Common Computing readiness challenges (CCRC’08), the CMS computing team had achieved very good results. The link between the detector site and the Tier0 was tested by gradually increasing the number of parallel transfer streams well beyond the target. Tests covered the global robustness at the Tier0, processing a massive number of very large files and with a high writing speed to tapes.  Other tests covered the links between the different Tiers of the distributed infrastructure and the pre-staging and reprocessing capacity of the Tier1’s: response time, data transfer rate and success rate for Tape to Buffer staging of files kept exclusively on Tape were measured. In all cases, coordination with the sites was efficient and no serious problem was found. These successful preparations prepared the ground for the second phase of the CCRC’08 campaign, in May. The Computing Software and Analysis challen...

  5. Effekt av ulike desinfeksjonsstrategier mot Listeria monocytogenes

    OpenAIRE

    Fossmo, Sabine

    2013-01-01

    Kontroll med bakterier som Listeria utgjør en stor utfordring for mange matprodusenter. Listeria monocytogenes er hovedsakelig et produksjonshygienisk problem, forbedret hygiene kan derfor være tiltak for å redusere overlevelse og smitteoverføring av bakterien i produksjonsmiljø. Hensikten med forsøkene i oppgaven var å undersøke effekten av ulike desinfeksjonsstrategier på drap av L. monocytogenes, både når bakteriene var i biofilm og i suspensjon. Dette inkluderte bruk av tradisjonelle desi...

  6. Cone-beam Computed Tomographic Assessment of Canal Centering Ability and Transportation after Preparation with Twisted File and Bio RaCe Instrumentation.

    Directory of Open Access Journals (Sweden)

    Kiamars Honardar

    2014-08-01

    Full Text Available Use of rotary Nickel-Titanium (NiTi instruments for endodontic preparation has introduced a new era in endodontic practice, but this issue has undergone dramatic modifications in order to achieve improved shaping abilities. Cone-beam computed tomography (CBCT has made it possible to accurately evaluate geometrical changes following canal preparation. This study was carried out to compare canal centering ability and transportation of Twisted File and BioRaCe rotary systems by means of cone-beam computed tomography.Thirty root canals from freshly extracted mandibular and maxillary teeth were selected. Teeth were mounted and scanned before and after preparation by CBCT at different apical levels. Specimens were divided into 2 groups of 15. In the first group Twisted File and in the second, BioRaCe was used for canal preparation. Canal transportation and centering ability after preparation were assessed by NNT Viewer and Photoshop CS4 software. Statistical analysis was performed using t-test and two-way ANOVA.All samples showed deviations from the original axes of the canals. No significant differences were detected between the two rotary NiTi instruments for canal centering ability in all sections. Regarding canal transportation however, a significant difference was seen in the BioRaCe group at 7.5mm from the apex.Under the conditions of this in vitro study, Twisted File and BioRaCe rotary NiTi files retained original canal geometry.

  7. Prevalence of Listeria monocytogenes in poultry meat

    Directory of Open Access Journals (Sweden)

    Mehmet ELMALI

    2015-01-01

    Full Text Available AbstractThe objectives of this study were i to isolate Listeria spp. and Listeria monocytogenes in broiler wing meat samples, ii to confirm the isolates by PCR, based on prs and hly A gene sequences, iii to determine the seasonal and monthly distribution of the isolates. A total of 120 broiler wing meat samples (60 packaged pieces wrapped using strech film in styrofoam plates and 60 unpackaged pieces bought from different markets in Hatay province were analysed. Listeria spp. was isolated from 57 (47.5% out of 120 samples. Fifty-four, out of 57 Listeria spp. isolates were identified as L. monocytogenes. L. monocytogenes was isolated from the samples collected during the spring, winter, summer, and autumn at the levels of 26.6%, 40%, 53.3%, 60%, respectively. In this study, the isolation rates were found to be the highest in autumn, while the isolation rates were found to be the lowest in spring. As a consequence, high prevalence of Listeria spp. and L. monocytogenes in poultry wing meat samples may pose a risk for human health. We consider that with obeying the rules of good hygiene practices (GHP, good manufacturing practices (GMP and HACCP can minimize the contamination with Listeria spp.

  8. Control options for Listeria monocytogenes in seafoods

    DEFF Research Database (Denmark)

    Huss, Hans Henrik; Jørgensen, Lasse Vigel; Vogel, Birte Fonnesbech

    2000-01-01

    At least three outbreaks of listeriosis associated with seafood have been reported. Listeria monocytogenes is widely distributed in the general environment including fresh water, coastal water and live fish from these areas. Contamination or recontamination of seafood may also take place during...

  9. Listeria monocytogenes : nog steeds een probleem?

    NARCIS (Netherlands)

    Beumer, R.R.

    2011-01-01

    Listeria monocytogenes is net als vele andere bacteriële voedselpathogenen al tientallen jaren bekend. De meeste grondstoffen voor voedingsmiddelen komen uit de akker- en tuinbouw, de veehouderij en de visserij. Besmetting vindt daar plaats met micro-organismen afkomstig uit grond, fecaliën, water,

  10. Evaluation of Single File Systems Reciproc, Oneshape, and WaveOne using Cone Beam Computed Tomography –An In Vitro Study

    Science.gov (United States)

    Dhingra, Annil; Miglani, Anjali

    2015-01-01

    Background Successful endodontic therapy depends on many factor, one of the most important step in any root canal treatment is root canal preparation. In addition, respecting the original shape of the canal is of the same importance; otherwise, canal aberrations such as transportation will be created. Aim The purpose of this study is to compare and evaluate Reciprocating WaveOne ,Reciproc and Rotary Oneshape Single File Instrumentation System On Cervical Dentin Thickness, Cross Sectional Area and Canal Transportation on First Mandibular Molar Using Cone Beam Computed Tomography. Materials and Methods Sixty Mandibular First Molars extracted due to periodontal reason was collected from the Department of Oral and Maxillofacial. Teeth were prepared using one rotary and two reciprocating single file system. Teeth were divided into 3 groups 20 teeth in each group. Pre instrumentation and Post instrumentation scans was done and evaluated for three parameters Canal Transportation, Cervical Dentinal Thickness, Cross-sectional Area. Results were analysed statistically using ANOVA, Post-Hoc Tukey analysis. Results The change in cross-sectional area after filing showed significant difference at 0mm, 1mm, 2mm and 7mm (pfile system over a distance of 7 mm (starting from 0mm and then evaluation at 1mm, 2mm, 3mm, 5mm and 7mm), the results showed a significant difference among the file systems at various lengths (p= 0.014, 0.046, 0.004, 0.028, 0.005 & 0.029 respectively). Mean value of cervical dentinal removal is maximum at all the levels for oneshape and minimum for waveone showing the better quality of waveone and reciproc over oneshape file system. Significant difference was found at 9mm, 11mm and 12mm between all the three file systems (p<0.001,< 0.001, <0.001). Conclusion It was concluded that reciprocating motion is better than rotary motion in all the three parameters Canal Transportation, Cross-sectional Area, Cervical Dentinal Thickness. PMID:26023639

  11. User's guide for the implementation of level one of the proposed American National Standard Specifications for an information interchange data descriptive file on control data 6000/7000 series computers

    CERN Document Server

    Wiley, R A

    1977-01-01

    User's guide for the implementation of level one of the proposed American National Standard Specifications for an information interchange data descriptive file on control data 6000/7000 series computers

  12. CHALLENGE TESTS WITH LISTERIA MONOCYTOGENES IN SALAMI: PRELIMINARY RESULTS

    Directory of Open Access Journals (Sweden)

    R. Mioni

    2013-02-01

    Full Text Available Challenge tests are the preferable methodology to study the behaviour of Listeria monocytogenes on ready to eat foods, according to Regulation (EC 2073/2005. Challenge testing using L. monocytogenes in seasoned salami from different food business operators showed, after seasoning of the product, a count reduction of the inoculated organisms without any further growth of the pathogen; however differences of L. monocytogenes behaviour could be observed according to different production protocols.

  13. Novel Cadmium Resistance Determinant in Listeria monocytogenes.

    Science.gov (United States)

    Parsons, Cameron; Lee, Sangmi; Jayeola, Victor; Kathariou, Sophia

    2017-03-01

    Listeria monocytogenes is a foodborne pathogen that can cause severe disease (listeriosis) in susceptible individuals. It is ubiquitous in the environment and often exhibits resistance to heavy metals. One of the determinants that enables Listeria to tolerate exposure to cadmium is the cadAC efflux system, with CadA being a P-type ATPase. Three different cadA genes (designated cadA1 to cadA3 ) were previously characterized in L. monocytogenes A novel putative cadmium resistance gene ( cadA4 ) was recently identified through whole-genome sequencing, but experimental confirmation for its involvement in cadmium resistance is lacking. In this study, we characterized cadA4 in L. monocytogenes strain F8027, a cadmium-resistant strain of serotype 4b. By screening a mariner-based transposon library of this strain, we identified a mutant with reduced tolerance to cadmium and that harbored a single transposon insertion in cadA4 The tolerance to cadmium was restored by genetic complementation with the cadmium resistance cassette ( cadA4C ), and enhanced cadmium tolerance was conferred to two unrelated cadmium-sensitive strains via heterologous complementation with cadA4C Cadmium exposure induced cadA4 expression, even at noninhibitory levels. Virulence assessments in the Galleria mellonella model suggested that a functional cadA4 suppressed virulence, potentially promoting commensal colonization of the insect larvae. Biofilm assays suggested that cadA4 inactivation reduced biofilm formation. These data not only confirm cadA4 as a novel cadmium resistance determinant in L. monocytogenes but also provide evidence for roles in virulence and biofilm formation. IMPORTANCE Listeria monocytogenes is an intracellular foodborne pathogen causing the disease listeriosis, which is responsible for numerous hospitalizations and deaths every year. Among the adaptations that enable the survival of Listeria in the environment are the abilities to persist in biofilms, grow in the cold, and

  14. Recombinant phage probes for Listeria monocytogenes

    Energy Technology Data Exchange (ETDEWEB)

    Carnazza, S; Gioffre, G; Felici, F; Guglielmino, S [Department of Microbiological, Genetic and Molecular Sciences, University of Messina, Messina (Italy)

    2007-10-03

    Monitoring of food and environmental samples for biological threats, such as Listeria monocytogenes, requires probes that specifically bind biological agents and ensure their immediate and efficient detection. There is a need for robust and inexpensive affinity probes as an alternative to antibodies. These probes may be recruited from random peptide libraries displayed on filamentous phage. In this study, we selected from two phage peptide libraries phage clones displaying peptides capable of specific and strong binding to the L. monocytogenes cell surface. The ability of isolated phage clones to interact specifically with L. monocytogenes was demonstrated using enzyme-linked immunosorbent assay (ELISA) and confirmed by co-precipitation assay. We also assessed the sensitivity of phage-bacteria binding by PCR on phage-captured Listeria cells, which could be detected at a concentration of 10{sup 4} cells ml{sup -1}. In addition, as proof-of-concept, we tested the possibility of immobilizing the affinity-selected phages to a putative biosensor surface. The quality of phage deposition was monitored by ELISA and fluorescent microscopy. Phage-bacterial binding was confirmed by high power optical phase contrast microscopy. Overall, the results of this work validate the concept of affinity-selected recombinant filamentous phages as probes for detecting and monitoring bacterial agents under any conditions that warrant their recognition, including in food products.

  15. Recombinant phage probes for Listeria monocytogenes

    Science.gov (United States)

    Carnazza, S.; Gioffrè, G.; Felici, F.; Guglielmino, S.

    2007-10-01

    Monitoring of food and environmental samples for biological threats, such as Listeria monocytogenes, requires probes that specifically bind biological agents and ensure their immediate and efficient detection. There is a need for robust and inexpensive affinity probes as an alternative to antibodies. These probes may be recruited from random peptide libraries displayed on filamentous phage. In this study, we selected from two phage peptide libraries phage clones displaying peptides capable of specific and strong binding to the L. monocytogenes cell surface. The ability of isolated phage clones to interact specifically with L. monocytogenes was demonstrated using enzyme-linked immunosorbent assay (ELISA) and confirmed by co-precipitation assay. We also assessed the sensitivity of phage-bacteria binding by PCR on phage-captured Listeria cells, which could be detected at a concentration of 104 cells ml-1. In addition, as proof-of-concept, we tested the possibility of immobilizing the affinity-selected phages to a putative biosensor surface. The quality of phage deposition was monitored by ELISA and fluorescent microscopy. Phage-bacterial binding was confirmed by high power optical phase contrast microscopy. Overall, the results of this work validate the concept of affinity-selected recombinant filamentous phages as probes for detecting and monitoring bacterial agents under any conditions that warrant their recognition, including in food products.

  16. Comparative Analysis of Canal Centering Ability of Different Single File Systems Using Cone Beam Computed Tomography- An In-Vitro Study

    Science.gov (United States)

    Agarwal, Jatin; Jain, Pradeep; Chandra, Anil

    2015-01-01

    Background The ability of an endodontic instrument to remain centered in the root canal system is one of the most important characteristic influencing the clinical performance of a particular file system. Thus, it is important to assess the canal centering ability of newly introduced single file systems before they can be considered a viable replacement of full-sequence rotary file systems. Aim The aim of the study was to compare the canal transportation, centering ability, and time taken for preparation of curved root canals after instrumentation with single file systems One Shape and Wave One, using cone-beam computed tomography (CBCT). Materials and Methods Sixty mesiobuccal canals of mandibular molars with an angle of curvature ranging from 20o to 35o were divided into three groups of 20 samples each: ProTaper PT (group I) – full-sequence rotary control group, OneShape OS (group II)- single file continuous rotation, WaveOne WO – single file reciprocal motion (group III). Pre instrumentation and post instrumentation three-dimensional CBCT images were obtained from root cross-sections at 3mm, 6mm and 9mm from the apex. Scanned images were then accessed to determine canal transportation and centering ability. The data collected were evaluated using one-way analysis of variance (ANOVA) with Tukey’s honestly significant difference test. Results It was observed that there were no differences in the magnitude of transportation between the rotary instruments (p >0.05) at both 3mm as well as 6mm from the apex. At 9 mm from the apex, Group I PT showed significantly higher mean canal transportation and lower centering ability (0.19±0.08 and 0.39±0.16), as compared to Group II OS (0.12±0.07 and 0.54±0.24) and Group III WO (0.13±0.06 and 0.55±0.18) while the differences between OS and WO were not statistically significant Conclusion It was concluded that there was minor difference between the tested groups. Single file systems demonstrated average canal

  17. Comparative Analysis of Canal Centering Ability of Different Single File Systems Using Cone Beam Computed Tomography- An In-Vitro Study.

    Science.gov (United States)

    Agarwal, Rolly S; Agarwal, Jatin; Jain, Pradeep; Chandra, Anil

    2015-05-01

    The ability of an endodontic instrument to remain centered in the root canal system is one of the most important characteristic influencing the clinical performance of a particular file system. Thus, it is important to assess the canal centering ability of newly introduced single file systems before they can be considered a viable replacement of full-sequence rotary file systems. The aim of the study was to compare the canal transportation, centering ability, and time taken for preparation of curved root canals after instrumentation with single file systems One Shape and Wave One, using cone-beam computed tomography (CBCT). Sixty mesiobuccal canals of mandibular molars with an angle of curvature ranging from 20(o) to 35(o) were divided into three groups of 20 samples each: ProTaper PT (group I) - full-sequence rotary control group, OneShape OS (group II)- single file continuous rotation, WaveOne WO - single file reciprocal motion (group III). Pre instrumentation and post instrumentation three-dimensional CBCT images were obtained from root cross-sections at 3mm, 6mm and 9mm from the apex. Scanned images were then accessed to determine canal transportation and centering ability. The data collected were evaluated using one-way analysis of variance (ANOVA) with Tukey's honestly significant difference test. It was observed that there were no differences in the magnitude of transportation between the rotary instruments (p >0.05) at both 3mm as well as 6mm from the apex. At 9 mm from the apex, Group I PT showed significantly higher mean canal transportation and lower centering ability (0.19±0.08 and 0.39±0.16), as compared to Group II OS (0.12±0.07 and 0.54±0.24) and Group III WO (0.13±0.06 and 0.55±0.18) while the differences between OS and WO were not statistically significant. It was concluded that there was minor difference between the tested groups. Single file systems demonstrated average canal transportation and centering ability comparable to full sequence

  18. Survival strategies of Listeria monocytogenes - roles of regulators and transporters

    NARCIS (Netherlands)

    Wemekamp-Kamphuis, H.H.

    2003-01-01

    Outbreaks of the food-borne pathogen Listeria monocytogenes are mainly associated with ready-to-eatfoods. Survival strategies of L. monocytogenes in relation to minimally processed foods were studied.

  19. Incidence and control of Listeria monocytogenes in foods in Denmark

    DEFF Research Database (Denmark)

    Nørrung, Birgit; Andersen, Jens Kirk; Schlundt, Jørgen

    1999-01-01

    The Danish regulatory policy on Listeria monocytogenes in foods is based on the principles of HACCP and was developed using a health risk assessment approach. The Danish policy focuses examinations and criteria for L. monocytogenes in ready-to-eat foods and is based on a combination of inspection...

  20. Listeria monocytogenes internalizes in Romaine Lettuce grown in greenhouse conditions

    Science.gov (United States)

    Listeria monocytogenes has been implicated in a number of outbreaks involving fresh produce, including an outbreak in 2016 resulting from contaminated packaged salads. The persistence and internalization potential of L. monocytogenes in romaine lettuce was evaluated, and the persistence of two L. mo...

  1. Occurrence of Listeria monocytogenes in smoked fish in Sokoto ...

    African Journals Online (AJOL)

    The present study was conducted to determine the prevalence of Listeria monocytogenes in smoked fish in Sokoto, Nigeria. A total of 115 different species of smoked fish from the various retail outlets and market places within the metropolis were analysed for the presence of L. monocytogenes using ISO culture method.

  2. Detection of Listeria Spp. and Listeria monocytogenes in vegetables ...

    African Journals Online (AJOL)

    This paper aimed to study the prevalence and antibiotic resistance pattern among Listeria monocytogenes in raw vegetables sourced from commercial farms and local farms in Terengganu. Thirteen types of vegetables investigated for the presence of L. monocytogenes using multiplex PCR and LAMP methods. Isolation of ...

  3. Genome sequences of Listeria monocytogenes strains with resistance to arsenic

    Science.gov (United States)

    Listeria monocytogenes frequently exhibits resistance to arsenic. We report here the draft genome sequences of eight genetically diverse arsenic-resistant L. monocytogenes strains from human listeriosis and food-associated environments. Availability of these genomes would help to elucidate the role ...

  4. Listeria monocytogenes growth limits and stress resistance mechanisms

    NARCIS (Netherlands)

    Veen, van der S.

    2008-01-01

    The food-borne pathogen Listeria monocytogenes is a Gram-positive facultative anaerobic rod, which is the causative agent of listeriosis. Due to the severity of the disease and the fact that its incidence is increasing in numerous European countries, L. monocytogenes is of great public health

  5. Resistance of Listeria monocytogenes biofilms to sanitizing agents

    Science.gov (United States)

    Listeria monocytogenes is notorious for its capacity to colonize the environment and equipment of food processing facilities and to persist in the processing plant ecosystem, sometimes for decades. Such persistence is mediated by multiple attributes of L. monocytogenes, including the pathogen’s capa...

  6. Effects of prebiotics on the infective potential of Listeria monocytogenes

    DEFF Research Database (Denmark)

    Ebersbach, Tine

    % xylooligosaccharides (XOS), galactooligosaccharides (GOS), inulin, apple pectin or polydextrose for three weeks before oral challenge with L. monocytogenes. XOS and GOS significantly improved resistance of guinea pigs to L. monocytogenes, while inulin and apple pectin decreased the resistance. No significant effect...

  7. Monitoring paneer for Listeria monocytogenes - A high risk food ...

    African Journals Online (AJOL)

    A multiplex polymerase chain reaction (PCR) assay was developed and applied to spiked and natural paneer samples to detect Listeria monocytogenes, a high risk food pathogen. The sensitivity of the assay on L. monocytogenes spiked paneer samples was 104 cells prior to enrichment, was improved to 103 cells after 4 h ...

  8. Evaluation of the Self-Adjusting File system (SAF) for the instrumentation of primary molar root canals: a micro-computed tomographic study.

    Science.gov (United States)

    Kaya, E; Elbay, M; Yiğit, D

    2017-06-01

    The Self-Adjusting File (SAF) system has been recommended for use in permanent teeth since it offers more conservative and effective root-canal preparation when compared to traditional rotary systems. However, no study had evaluated the usage of SAF in primary teeth. The aim of this study was to evaluate and compare the use of SAF, K file (manual instrumentation) and Profile (traditional rotary instrumentation) systems for primary-tooth root-canal preparation in terms of instrumentation time and amounts of dentin removed using micro-computed tomography (μCT) technology. Study Design: The study was conducted with 60 human primary mandibular second molar teeth divided into 3 groups according to instrumentation technique: Group I: SAF (n=20); Group II: K file (n=20); Group III; Profile (n=20). Teeth were embedded in acrylic blocks and scanned with a μCT scanner prior to instrumentation. All distal root canals were prepared up to size 30 for K file,.04/30 for Profile and 2 mm thickness, size 25 for SAF; instrumentation time was recorded for each tooth, and a second μCT scan was performed after instrumentation was complete. Amounts of dentin removed were measured using the three-dimensional images by calculating the difference in root-canal volume before and after preparation. Data was statistically analysed using the Kolmogorov-Smirnov and Kruskal-Wallis tests. Manual instrumentation (K file) resulted in significantly more dentin removal when compared to rotary instrumentation (Profile and SAF), while the SAF system generated significantly less dentin removal than both manual instrumentation (K file) and traditional rotary instrumentation (Profile) (psystems. Within the experimental conditions of the present study, the SAF seems as a useful system for root-canal instrumentation in primary molars because it removed less dentin than other systems, which is especially important for the relatively thin-walled canals of primary teeth, and because it involves less

  9. [Comparison of effectiveness and safety between Twisted File technique and ProTaper Universal rotary full sequence based on micro-computed tomography].

    Science.gov (United States)

    Chen, Xiao-bo; Chen, Chen; Liang, Yu-hong

    2016-02-18

    To evaluate the efficacy and security of two type of rotary nickel titanium system (Twisted File and ProTaper Universal) for root canal preparation based on micro-computed tomography(micro-CT). Twenty extracted molars (including 62 canals) were divided into two experimental groups and were respectively instrumented using Twisted File rotary nickel titanium system (TF) and ProTaper Universal rotary nickel titanium system (PU) to #25/0.08 following recommended protocol. Time for root canal instrumentation (accumulation of time for every single file) was recorded. The 0-3 mm root surface from apex was observed under an optical stereomicroscope at 25 × magnification. The presence of crack line was noted. The root canals were scanned with micro-CT before and after root canal preparation. Three-dimensional shape images of canals were reconstructed, calculated and evaluated. The amount of canal central transportation of the two groups was calculated and compared. The shorter preparation time [(0.53 ± 0.14) min] was observed in TF group, while the preparation time of PU group was (2.06 ± 0.39) min (Pvs. (0.097 ± 0.084) mm, P<0.05]. No instrument separation was observed in both the groups. Cracks were not found in both the groups either based in micro-CT images or observation under an optical stereomicroscope at 25 × magnification. Compared with ProTaper Universal, Twisted File took less time in root canal preparation and exhibited better shaping ability, and less canal transportation.

  10. Prevalence and location of Listeria monocytogenes in farmed rainbow trout.

    Science.gov (United States)

    Miettinen, Hanna; Wirtanen, Gun

    2005-10-15

    A total of 510 rainbow trout originating from fish farms in lakes and sea areas around Finland were studied for the presence of Listeria monocytogenes. Samples were studied as pools from five fish. Gill, viscera, and skin from the pooled samples were analysed separately. The individual samples were analysed later if the pooled sample was found to be Listeria positive. The prevalence of Listeria spp. and L. monocytogenes in pooled unprocessed fresh rainbow trout was on average 35.0% and 14.6%, respectively. On the other hand, the prevalence of Listeria spp. and L. monocytogenes in individual thawed fish was found to be 14.3% and 8.8%, respectively. These numbers tend to overestimate and underestimate the real situation because not all fish in pooled samples were necessarily contaminated and in some of the Listeria positive pooled samples all individual samples turned out to be Listeria free. The prevalence of L. monocytogenes varied greatly between different fish farms from zero to 100% in pooled samples and from zero to 75% according to individually studied fish samples. Some indications of the influence of weather conditions and seasonal variations that strongly affected the Listeria contamination of fish were also noticed. The location of Listeria spp. and L. monocytogenes in different parts of the fish differed with statistical significance in rainbow trout. Up to 95.6% of the L. monocytogenes and 84.5% of Listeria spp. positive samples were gill samples. Only 4.4% (2/45) of the L. monocytogenes positive samples were obtained from skin or viscera. Closer study at one fish farm revealed that there was only one L. monocytogenes ribotype present in the contaminated fish, although water and surfaces were heavily contaminated with six other L. monocytogenes ribotypes.

  11. Incorporation of Listeria monocytogenes strains in raw milk biofilms.

    Science.gov (United States)

    Weiler, Christiane; Ifland, Andrea; Naumann, Annette; Kleta, Sylvia; Noll, Matthias

    2013-02-01

    Biofilms develop successively on devices of milk production without sufficient cleaning and originate from the microbial community of raw milk. The established biofilm matrices enable incorporation of pathogens like Listeria monocytogenes, which can cause a continuous contamination of food processing plants. L. monocytogenes is frequently found in raw milk and non-pasteurized raw milk products and as part of a biofilm community in milk meters and bulk milk tanks. The aim of this study was to analyze whether different L. monocytogenes strains are interacting with the microbial community of raw milk in terms of biofilm formation in the same manner, and to identify at which stage of biofilm formation a selected L. monocytogenes strain settles best. Bacterial community structure and composition of biofilms were analyzed by a cloning and sequencing approach and terminal restriction fragment length polymorphism analysis (T-RFLP) based on the bacterial 16S rRNA gene. The chemical composition of biofilms was analyzed by Fourier transform infrared spectroscopy (FTIR), while settled L. monocytogenes cells were quantified by fluorescence in situ hybridization (FISH). Addition of individual L. monocytogenes strains to raw milk caused significant shifts in the biofilm biomass, in the chemical as well as in the bacterial community composition. Biofilm formation and attachment of L. monocytogenes cells were not serotype but strain specific. However, the added L. monocytogenes strains were not abundant since mainly members of the genera Citrobacter and Lactococcus dominated the bacterial biofilm community. Overall, added L. monocytogenes strains led to a highly competitive interaction with the raw milk community and triggered alterations in biofilm formation. Copyright © 2012 Elsevier B.V. All rights reserved.

  12. Listeria monocytogenes as a vector for anti-cancer therapies.

    LENUS (Irish Health Repository)

    Tangney, Mark

    2012-01-31

    The intracellular pathogen Listeria monocytogenes represents a promising therapeutic vector for the delivery of DNA, RNA or protein to cancer cells or to prime immune responses against tumour-specific antigens. A number of biological properties make L. monocytogenes a promising platform for development as a vector for either gene therapy or as an anti-cancer vaccine vector. L. monocytogenes is particularly efficient in mediating internalization into host cells. Once inside cells, the bacterium produces specific virulence factors which lyse the vaculolar membrane and allow escape into the cytoplasm. Once in the cytosol, L. monocytogenes is capable of actin-based motility and cell-to-cell spread without an extracellular phase. The cytoplasmic location of L. monocytogenes is significant as this potentiates entry of antigens into the MHC Class I antigen processing pathway leading to priming of specific CD8(+) T cell responses. The cytoplasmic location is also beneficial for the delivery of DNA (bactofection) by L. monocytogenes whilst cell-to-cell spread may facilitate access of the vector to cells throughout the tumour. Several preclinical studies have demonstrated the ability of L. monocytogenes for intracellular gene or protein delivery in vitro and in vivo, and this vector has also displayed safety and efficacy in clinical trial. Here, we review the features of the L. monocytogenes host-pathogen interaction that make this bacterium such an attractive candidate with which to induce appropriate therapeutic responses. We focus primarily upon work that has led to attenuation of the pathogen, demonstrated DNA, RNA or protein delivery to tumour cells as well as research that shows the efficacy of L. monocytogenes as a vector for tumour-specific vaccine delivery.

  13. Long term file migration. Part I: file reference patterns

    International Nuclear Information System (INIS)

    Smith, A.J.

    1978-08-01

    In most large computer installations, files are moved between on-line disk and mass storage (tape, integrated mass storage device) either automatically by the system or specifically at the direction of the user. This is the first of two papers which study the selection of algorithms for the automatic migration of files between mass storage and disk. The use of the text editor data sets at the Stanford Linear Accelerator Center (SLAC) computer installation is examined through the analysis of thirteen months of file reference data. Most files are used very few times. Of those that are used sufficiently frequently that their reference patterns may be examined, about a third show declining rates of reference during their lifetime; of the remainder, very few (about 5%) show correlated interreference intervals, and interreference intervals (in days) appear to be more skewed than would occur with the Bernoulli process. Thus, about two-thirds of all sufficiently active files appear to be referenced as a renewal process with a skewed interreference distribution. A large number of other file reference statistics (file lifetimes, interference distributions, moments, means, number of uses/file, file sizes, file rates of reference, etc.) are computed and presented. The results are applied in the following paper to the development and comparative evaluation of file migration algorithms. 17 figures, 13 tables

  14. Prevalence of Listeria monocytogenes in raw milk in North Lebanon

    International Nuclear Information System (INIS)

    Al Kassaa, I; El Omari, Kh.; Esmail, B.; Hamze, M; Saati, M.

    2016-01-01

    Listeriosis, although a zoonosis, is an invasive disease that can affect newborns, pregnant women and immunocompromised adults. Clinical manifestations can be expressedby febrile gastroenteritis, invasive forms including severe sepsis, meningitis, rhombencephalitis, prenatal infections and abortions. Species of Listeria bacteria are ubiquitous and adaptableto the environment in animal and plant foods. This study aimed to determine the prevalence of Listeria monocytogenes in 100 samples of fresh cow milk collected from different areas of North Lebanon. Listeria monocytogenes was detected by using the Grand VIDAS technique (Biomérieux France). The results obtained revealed the absence of Listeria monocytogenes inall analyzed samples. (Author)

  15. LACTIC FLORA-LISTERIA MONOCYTOGENES INTERACTION

    Directory of Open Access Journals (Sweden)

    S. Colombo

    2012-08-01

    Full Text Available The EC Regulation 2073/2005 (1 requires that food processors evaluate the capability of ready-to-use (RTE products to support the development of Listeria monocytogenes when their pH and aW values are favourable to the growth of this microorganism. It is renown that the lactic flora plays an important role in many different foods, both from a technological and a food safety standpoint. This study was aimed to observe the behaviour and the potential anti-Listeria effect of some natural lactic flora present in Italian liver patè crostini (chicken heart and liver, anchovies, onions, capers, starch, no added preservatives through the Combase Predictor – Max Growth Rate predictive software. The natural lactic flora of the crostini demonstrated a variable capability to inhibit the growth of Listeria monocytogenes which depends upon : the concentration of the lactic flora at the beginning of the shelf life period and the subsequent lag phase, the possible release of anti-Listeria substances, and the maximum growth rate.

  16. Silver as antibacterial towards Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Simone eBelluco

    2016-03-01

    Full Text Available Listeria monocytogenes is a serious foodborne pathogen that can contaminate food during processing and can grow during food shelf-life. New types of safe and effective food contact materials embedding antimicrobial agents, like silver, can play an important role in the food industry. The present work aimed at evaluating the in vitro growth kinetics of different strains of L. monocytogenes in the presence of silver, both in its ionic and nano form. The antimicrobial effect was determined by assaying the number of culturable bacterial cells, which formed colonies after incubation in the presence of silver nanoparticles (AgNPs or silver nitrate (AgNO3. Ionic release experiments were performed in parallel. A different reduction of bacterial viability between silver ionic and nano forms was observed, with a time delayed effect exerted by AgNPs. An association between antimicrobial activity and ions concentration was shown by both silver chemical forms, suggesting the major role of ions in the antimicrobial mode of action.

  17. REALIS: Postgenomic Analysis of Listeria Monocytogenes

    Directory of Open Access Journals (Sweden)

    The REALIS Consortium

    2006-04-01

    Full Text Available Listeria monocytogenes is a remarkably successful food-borne pathogen. It is capable a of surviving and proliferating under conditions that exist within the food chain, such as at low temperatures, high salt and low pH and b of colonizing animal host tissues after ingestion of contaminated food, causing opportunistic infections mainly, but not exclusively, in immunocompromised hosts. The ultimate goals of REALIS are two fold: Firstly, it aims to completely decipher all genes required for survival in and adaptation of Listeria monocytogenes to two very different environments, ie., the infected host and the external environment. Secondly, using genomics and postgenomic tools, REALIS seeks to precisely address fundamental questions regarding evolutionary relationships between pathogenic and non-pathogenic Listeria and to define qualities of particularly successful clonal pathovariants in causing disease. This project will provide both industry and health care managers with rational approaches to curbing food-borne contamination, minimising risks of infection and providing novel pharmacological approaches for halting the fulminant course of infection.

  18. RNAi screen reveals host cell kinases specifically involved in Listeria monocytogenes spread from cell to cell.

    Directory of Open Access Journals (Sweden)

    Ryan Chong

    Full Text Available Intracellular bacterial pathogens, such as Listeria monocytogenes and Rickettsia conorii display actin-based motility in the cytosol of infected cells and spread from cell to cell through the formation of membrane protrusions at the cell cortex. Whereas the mechanisms supporting cytosolic actin-based motility are fairly well understood, it is unclear whether specific host factors may be required for supporting the formation and resolution of membrane protrusions. To address this gap in knowledge, we have developed high-throughput fluorescence microscopy and computer-assisted image analysis procedures to quantify pathogen spread in human epithelial cells. We used the approach to screen a siRNA library covering the human kinome and identified 7 candidate kinases whose depletion led to severe spreading defects in cells infected with L. monocytogenes. We conducted systematic validation procedures with redundant silencing reagents and confirmed the involvement of the serine/threonine kinases, CSNK1A1 and CSNK2B. We conducted secondary assays showing that, in contrast with the situation observed in CSNK2B-depleted cells, L. monocytogenes formed wild-type cytosolic tails and displayed wild-type actin-based motility in the cytosol of CSNK1A1-depleted cells. Furthermore, we developed a protrusion formation assay and showed that the spreading defect observed in CSNK1A1-depleted cells correlated with the formation of protrusion that did not resolve into double-membrane vacuoles. Moreover, we developed sending and receiving cell-specific RNAi procedures and showed that CSNK1A was required in the sending cells, but was dispensable in the receiving cells, for protrusion resolution. Finally, we showed that the observed defects were specific to Listeria monocytogenes, as Rickettsia conorii displayed wild-type cell-to-cell spread in CSNK1A1- and CSNK2B-depleted cells. We conclude that, in addition to the specific host factors supporting cytosolic actin

  19. Growth inhibition of Listeria monocytogenes by a nonbacteriocinogenic Carnobacterium piscicola

    DEFF Research Database (Denmark)

    Nilsson, Lilian; Bech Hansen, T.; Garrido, P.

    2005-01-01

    Aims: This study elucidates the mechanisms by which a nonbacteriocinogenic Carnobacterium piscicola inhibits growth of Listeria monocytogenes. Methods and Results: Listeria monocytogenes was exposed to live cultures of a bacteriocin-negative variant of C. piscicola A9b in co-culture, in a diffusion...... chamber system, and to a cell-free supernatant. Suppression of maximum cell density (0-3.5 log units) of L. monocytogenes was proportional to initial levels of C. pisciola (10(3)-10(7) CFU ml(-1)). Cell-to-cell contact was not required to cause inhibition. The cell-free C. piscicola supernatant caused...... a decrease in L. monocytogenes maximum cell density, which was abolished by glucose addition but not by amino acid, vitamin or mineral addition. The fermentate also gave rise to a longer lag phase and a reduction in growth rate. These effects were independent of glucose and may have been caused by acetate...

  20. A micro-computed tomographic evaluation of dentinal microcrack alterations during root canal preparation using single-file Ni-Ti systems.

    Science.gov (United States)

    Li, Mei-Lin; Liao, Wei-Li; Cai, Hua-Xiong

    2018-01-01

    The aim of the present study was to evaluate the length of dentinal microcracks observed prior to and following root canal preparation with different single-file nickel-titanium (Ni-Ti) systems using micro-computed tomography (micro-CT) analysis. A total of 80 mesial roots of mandibular first molars presenting with type II Vertucci canal configurations were scanned at an isotropic resolution of 7.4 µm. The samples were randomly assigned into four groups (n=20 per group) according to the system used for root canal preparation, including the WaveOne (WO), OneShape (OS), Reciproc (RE) and control groups. A second micro-CT scan was conducted after the root canals were prepared with size 25 instruments. Pre- and postoperative cross-section images of the roots (n=237,760) were then screened to identify the lengths of the microcracks. The results indicated that the microcrack lengths were notably increased following root canal preparation (Pfiles. Among the single-file Ni-Ti systems, WO and RE were not observed to cause notable microcracks, while the OS system resulted in evident microcracks.

  1. LISTERIA MONOCYTOGENES RISK EVALUATION IN READY TO EAT DELI PRODUCTS

    Directory of Open Access Journals (Sweden)

    T Civera

    2013-02-01

    Full Text Available Listeria monocytogenes has become one of the major concerns for food safety. Its ability to survive and replicate at low temperature, pH and high salt concentration, makes the bacterium a threat, mostly for RTE products. For these reasons, the present research was aimed at detecting the ability of growth of L. monocytogenes in RTE products retrieved from one deli store. Samples were analysed for L. monocytogenes detection, then inoculated with the pathogen (105cell/ml and stored at refrigeration temperature for the duration of their shelf-life (15-60 days. In all the products L. monocytogenes was not detected before experimental contamination. The challenge test evidenced that experimentally inoculated L. monocytogenes was not able to multiply for the duration of the entire shelf-life. These results indicated that the tested products could be considered as foods which are not able to support the growth of L. monocytogenes, as indicated by E.C. Regulation 2073/05. However, in order to guarantee consumer’s safety, it needs to be emphasized the need of a correct application of the GMPs, required for lowering the risk of initial contamination.

  2. Behaviour of Listeria monocytogenes in packaged fresh mushrooms (Agaricus bisporus).

    Science.gov (United States)

    González-Fandos, E; Olarte, C; Giménez, M; Sanz, S; Simón, A

    2001-11-01

    The aim of this study was to evaluate the potential of Listeria monocytogenes to grow in mushrooms packaged in two different types of PVC films when stored at 4 degrees C and 10 degrees C. Mushrooms were packed in two polymeric films (perforated and nonperforated PVC) and stored at 4 degrees C and 10 degrees C. The carbon dioxide and oxygen content inside the packages, aerobic mesophiles, psychrotrophs, Pseudomonas spp., Listeria monocytogenes, faecal coliforms, Escherichia coli, anaerobic spores and major sensory factors were determined. The mushrooms packaged in nonperforated film and stored at 4 degrees C had the most desirable quality parameters (texture, development stage and absence of moulds). Listeria monocytogenes was able to grow at 4 degrees C and 10 degrees C in inoculated mushrooms packaged in perforated and nonperforated films between 1 and 2 log units during the first 48 h. After 10 d of storage, the populations of L. monocytogenes were higher in mushrooms packaged in nonperforated film and stored at 10 degrees C. MAP followed by storage at 4 degrees C or 10 degrees C extends the shelf life by maintaining an acceptable appearance, but allows the growth and survival of L. monocytogenes. According to this study additional hurdles must be studied in order to prevent the growth of L. monocytogenes.

  3. Listeria monocytogenes, a down-to-earth pathogen.

    Science.gov (United States)

    Vivant, Anne-Laure; Garmyn, Dominique; Piveteau, Pascal

    2013-01-01

    Listeria monocytogenes is the causative agent of the food-borne life threatening disease listeriosis. This pathogenic bacterium received much attention in the endeavor of deciphering the cellular mechanisms that underlie the onset of infection and its ability to adapt to the food processing environment. Although information is available on the presence of L. monocytogenes in many environmental niches including soil, water, plants, foodstuff and animals, understanding the ecology of L. monocytogenes in outdoor environments has received less attention. Soil is an environmental niche of pivotal importance in the transmission of this bacterium to plants and animals. Soil composition, microbial communities and macrofauna are extrinsic edaphic factors that direct the fate of L. monocytogenes in the soil environment. Moreover, farming practices may further affect its incidence. The genome of L. monocytogenes presents an extensive repertoire of genes encoding transport proteins and regulators, a characteristic of the genome of ubiquitous bacteria. Postgenomic analyses bring new insights in the process of soil adaptation. In the present paper focussing on soil, we review these extrinsic and intrinsic factors that drive environmental adaptation of L. monocytogenes.

  4. Biofilm Formation of Listeria monocytogenes on Various Surfaces

    Directory of Open Access Journals (Sweden)

    M Mahdavi

    2007-10-01

    Full Text Available Introduction & Objective: Listeria monocytogenes is considered as a ubiquitous foodborne pathogen which can lead to serious infections, especially in newborns, elderly, pregnant, and immunocompromised people. The organism has been isolated from many foods and may cause meningitis, septicemia and abortion in pregnant women. Also L. monocytogenes forms biofilms on many food contact surface materials and medical devices. Development of biofilms on many surfaces is a potential source of contamination of foods that may lead to spoilage or transmission of foodborne pathogens. Materials & Methods: Biofilm formation of L. monocytogenes (RITCC 1293 serotype 4a was investigated. Hydrophobicity of L. monocytogenes was measured by MATH method. Then biofilm formation of the organism was assessed at 2, 4, 8, 16 and 20 hours on stainless steel (type 304 no 2B, polyethylene and glass by drop plate method. Results: Results indicated that L. monocytogenes with 85% of hydrophobicity formed biofilm on each of three surfaces. Biofilm formation on stainless steel surfaces was significantly more than other surfaces (p<0.05. Conclusion: The ability of biofilm formation of L. monocytogenes on medical devices and food containers is very important as far as hygiene and disease outbreaks are concerned.

  5. Inhibition of sortase A by chalcone prevents Listeria monocytogenes infection.

    Science.gov (United States)

    Li, Hongen; Chen, Yutao; Zhang, Bing; Niu, Xiaodi; Song, Meng; Luo, Zhaoqing; Lu, Gejin; Liu, Bowen; Zhao, Xiaoran; Wang, Jianfeng; Deng, Xuming

    2016-04-15

    The critical role of sortase A in gram-positive bacterial pathogenicity makes this protein a good potential target for antimicrobial therapy. In this study, we report for the first time the crystal structure of Listeria monocytogenes sortase A and identify the active sites that mediate its transpeptidase activity. We also used a sortase A (SrtA) enzyme activity inhibition assay, simulation, and isothermal titration calorimetry analysis to discover that chalcone, an agent with little anti-L. monocytogenes activity, could significantly inhibit sortase A activity with an IC50 of 28.41 ± 5.34 μM by occupying the active site of SrtA. The addition of chalcone to a co-culture of L. monocytogenes and Caco-2 cells significantly inhibited bacterial entry into the cells and L. monocytogenes-mediated cytotoxicity. Additionally, chalcone treatment decreased the mortality of infected mice, the bacterial burden in target organs, and the pathological damage to L. monocytogenes-infected mice. In conclusion, these findings suggest that chalcone is a promising candidate for the development of treatment against L. monocytogenes infection. Copyright © 2016 Elsevier Inc. All rights reserved.

  6. A case of bovine raw milk contamination with Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Hunt Karen

    2012-07-01

    Full Text Available Abstract During routine sampling of bulk raw milk on a dairy farm, the pathogenic bacteria Listeria monocytogenes was found to be a contaminant, at numbers L. monocytogenes, indicating a possible case of excretion of the L. monocytogenes directly into the milk. Milk samples were collected from the individual cows and analysed, resulting in the identification of L. monocytogenes excretion (at 280 cfu/ml from one of the 4 mammary quarters of one dairy cow out of 180. When the infected cow was isolated from the herd, no L. monocytogenes was detected from the remaining herd. The pulsed-field gel electrophoresis pattern of the strain from the individual cow was indistinguishable from that originally isolated from the bulk milk. The infected cow did not show any clinical signs of disease, nor did the appearance of the milk have any physical abnormalities. Antibiotic treatment of the infected mammary quarter was found to be ineffective. This study shows that there can be risks associated with direct contamination of raw milk with L. monocytogenes.

  7. Prevalence of Listeria monocytogenes in European cheeses

    DEFF Research Database (Denmark)

    Martinez Rios, Veronica; Dalgaard, Paw

    2017-01-01

    , respectively, pasteurized or un-pasteurized milk. Data from a total of 130,604 samples were analysed. Mean prevalence for presence during 2005-2015 estimated from scientific literature (2.3% with confidence interval (CI): 1.4-3.8%) was more than three times higher than results from EFSA reports (0.7%; CI: 0.......05) for cheeses produced from pasteurized (0.9%; CI: 0.4-1.9%) or un-pasteurized (1.0%; CI: 0.4-2.2%) milk. For cheese samples reported by EFSA 0.2% CI: 0.1-0.4% had concentration of L. monocytogenes above the critical European limits of 100 cfu/g. In addition, this systematic review focused on groups...

  8. Sensitivity of Listeria monocytogenes to irradiation

    International Nuclear Information System (INIS)

    Tarjan, Veronika

    1990-01-01

    Irradiation of Listeria monocytogenes (L.m.) was carried out in culture media and pork meat paste at room temperature with 60 Co radiation source of 6.6 kGy h -1 dose rate. The employed doses were 0, 0.5, 1, 2, 3, 4 and 6 kGy. One strain out of 3 survived as high as 4 kGy irradiation. Radiation with 2 kGy resulted 7 log cycles reduction of cell count. After lower irradiation doses the L.m. count decreased in proportion to increasing doses. It has been concluded that L.m. compared with Gram-negative pathogens, are less sensitive to irradiation. (author) 6 refs.; 4 figs

  9. Listeria monocytogenes - Danger for health safety vegetable production.

    Science.gov (United States)

    Kljujev, Igor; Raicevic, Vera; Jovicic-Petrovic, Jelena; Vujovic, Bojana; Mirkovic, Milica; Rothballer, Michael

    2018-04-22

    The microbiologically contaminated vegetables represent a risk for consumers, especially vegetables without thermal processing. It is known that human pathogen bacteria, such as Listeria monocytogenes, could exist on fresh vegetables. The fresh vegetables could become Listeria-contaminated if they come in touch with contaminated soil, manure, irrigation water. The aim of this work was to investigate the presence of Listeria spp. and L. monocytogenes in different kind of vegetables grown in field and greenhouse condition as well as surface and endophytic colonization plant roots of different vegetables species by L. monocytogenes in laboratory conditions. The detection of Listeria spp. and L. monocytogenes in vegetable samples was done using ISO and PCR methods. The investigation of colonization vegetable roots and detection Listeria-cells inside plant root tissue was done using Fluorescence in situ hybridization (FISH) method in combination with confocal laser scanning microscopy (CLSM). The results showed that 25.58% vegetable samples were positive for Listeria spp. and only one sample (carrot) was positive for L. monocytogenes out of 43 samples in total collected from field and greenhouse. The strain L. monocytogenes EGD-E surface and endophytic colonized carrot root in highest degree while strain L. monocytogenes SV4B was the most represented at leafy vegetable plants, such at lettuce (1.68 × 10 6  cells/mm 3 absolutely dry root) and spinach (1.39 × 10 6  cells/mm 3 absolutely dry root) root surface. The cells of L. monocytogenes SV4B were visible as single cells in interior tissue of plant roots (celery and sweet corn roots) as well as in the interior of the plant root cell at sweet corn root. The cells of L. monocytogenes EGD-E bind to the surface of the plant root and they were less commonly found out on root hair. In the inner layers of the root, those bacterial cells were inhabited intercellular spaces mainly as single cells very close to the

  10. Diversity Assessment of Heat Resistance of Listeria monocytogenes Strains in a Continuous-Flow Heating System

    NARCIS (Netherlands)

    Veen, van der S.; Wagendorp, A.; Abee, T.; Wells-Bennik, M.H.J.

    2009-01-01

    Listeria monocytogenes is a foodborne pathogen that has the ability to survive relatively high temperatures compared with other nonsporulating foodborne pathogens. This study was performed to determine whether L. monocytogenes strains with relatively high heat resistances are adequately inactivated

  11. Meningoencefalite por Listeria monocytogenes em ovinos Meningoencephalitis in sheep caused by Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Daniel R. Rissi

    2010-01-01

    Full Text Available São descritos sete casos de doença neurológica em ovinos por Listeria monocytogenes no Rio Grande do Sul e Paraná entre 2000 e 2007. Foram afetados ovinos com idades entre 12-24 meses. Os casos ocorreram no verão e início da primavera e os índices gerais de morbidade e letalidade foram de 3,15% e 100%, respectivamente. Quando essa informação estava disponível, nenhum dos ovinos afetados era alimentado com silagem. Em três propriedades havia contato próximo dos ovinos afetados com outras espécies. A evolução do quadro clínico foi de 12 horas a três dias e os sinais clínicos foram caracterizados por decúbito (7/7, desvio da cabeça (4/7, incoordenação (3/7, depressão (3/7, andar em círculos (2/7, cegueira unilateral, emagrecimento progressivo, febre, midríase, movimentos de pedalagem, nistagmo lateral, opistótono, paralisia flácida dos membros pélvicos ou dos quatro membros, salivação excessiva e tremores (1/7 cada. Histologicamente observou-se encefalite com microabscessos, predominantemente unilateral com variáveis graus de gliose e alterações degenerativas como esferóides axonais e infiltração de células Gitter. As lesões se estendiam desde a medula oblonga até o mesencéfalo. Antígenos de Listeria monocytogenes foram detectados por imuno-histoquímica em seções de tronco encefálico de todos os ovinos afetados. O diagnóstico foi realizado com base nos achados epidemiológicos e clinico-patológicos, e confirmado pela imuno-histoquímica (IHQ utilizando anticorpo policlonal anti-L. monocytogenes.Seven cases of neurological disease in sheep caused by Listeria monocytogenes in Rio Grande do Sul and Paraná state, southern Brazil are described. The cases occurred between 2000 and 2007 and 12-24-month-old sheep were affected. Overall morbidity and lethality rates were 3.15% and 100%, respectively. Cases occurred in the summer and early spring. When this information was available, affected sheep had not been

  12. PASTEURISASI HIGH TEMPERATURE SHORT TIME (HTST) SUSU TERHADAP Listeria monocytogenes PADA PENYIMPANAN REFRIGERATOR

    OpenAIRE

    SABIL, SYAHRIANA

    2015-01-01

    2015 SYAHRIANA SABIL (I 111 11 273). Pasteurisasi High Temperature Short Time (HTST) Susu terhadap Listeria monocytogenes pada Penyimpanan Refrigerator. Dibimbing oleh RATMAWATI MALAKA dan FARIDA NUR YULIATI. Pasteurisasi High Temperature Short Time (HTST) merupakan proses pemanasan susu di bawah titik didih yang diharapkan dapat membunuh Listeria monocytogenes (L. monocytogenes) karena bersifat patogen dan mengakibatkan listeriosis yang merupakan penyakit zoonosis. Tu...

  13. Industrial disinfectants do not select for resistance in Listeria monocytogenes following long term exposure

    DEFF Research Database (Denmark)

    Kastbjerg, Vicky Gaedt; Gram, Lone

    2012-01-01

    or tolerance would evolve in L. monocytogenes under continued selection in three industrial disinfectants. L. monocytogenes EGD was exposed to Desinfect CL (hypochlorite) and Incimaxx DES (peracedic acid and hydrogen peroxide) for several hundred generations. This caused no increase in the minimal inhibitory......, and that the disinfectants are still efficient for controlling microorganisms such as L. monocytogenes....

  14. File sharing

    NARCIS (Netherlands)

    van Eijk, N.

    2011-01-01

    File sharing’ has become generally accepted on the Internet. Users share files for downloading music, films, games, software etc. In this note, we have a closer look at the definition of file sharing, the legal and policy-based context as well as enforcement issues. The economic and cultural

  15. Computed micro-tomographic evaluation of glide path with nickel-titanium rotary PathFile in maxillary first molars curved canals.

    Science.gov (United States)

    Pasqualini, Damiano; Bianchi, Caterina Chiara; Paolino, Davide Salvatore; Mancini, Lucia; Cemenasco, Andrea; Cantatore, Giuseppe; Castellucci, Arnaldo; Berutti, Elio

    2012-03-01

    X-ray computed micro-tomography scanning allows high-resolution 3-dimensional imaging of small objects. In this study, micro-CT scanning was used to compare the ability of manual and mechanical glide path to maintain the original root canal anatomy. Eight extracted upper first permanent molars were scanned at the TOMOLAB station at ELETTRA Synchrotron Light Laboratory in Trieste, Italy, with a microfocus cone-beam geometry system. A total of 2,400 projections on 360° have been acquired at 100 kV and 80 μA, with a focal spot size of 8 μm. Buccal root canals of each specimen (n = 16) were randomly assigned to PathFile (P) or stainless-steel K-file (K) to perform glide path at the full working length. Specimens were then microscanned at the apical level (A) and at the point of the maximum curvature level (C) for post-treatment analyses. Curvatures of root canals were classified as moderate (≤35°) or severe (≥40°). The ratio of diameter ratios (RDRs) and the ratio of cross-sectional areas (RAs) were assessed. For each level of analysis (A and C), 2 balanced 2-way factorial analyses of variance (P < .05) were performed to evaluate the significance of the instrument factor and of canal curvature factor as well as the interactions of the factors both with RDRs and RAs. Specimens in the K group had a mean curvature of 35.4° ± 11.5°; those in the P group had a curvature of 38° ± 9.9°. The instrument factor (P and K) was extremely significant (P < .001) for both the RDR and RA parameters, regardless of the point of analysis. Micro-CT scanning confirmed that NiTi rotary PathFile instruments preserve the original canal anatomy and cause less canal aberrations. Copyright © 2012 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

  16. Listeria monocytogenes in Fresh Produce: Outbreaks, Prevalence and Contamination Levels

    Directory of Open Access Journals (Sweden)

    Qi Zhu

    2017-03-01

    Full Text Available Listeria monocytogenes, a member of the genus Listeria, is widely distributed in agricultural environments, such as soil, manure and water. This organism is a recognized foodborne pathogenic bacterium that causes many diseases, from mild gastroenteritis to severe blood and/or central nervous system infections, as well as abortion in pregnant women. Generally, processed ready-to-eat and cold-stored meat and dairy products are considered high-risk foods for L. monocytogenes infections that cause human illness (listeriosis. However, recently, several listeriosis outbreaks have been linked to fresh produce contamination around the world. Additionally, many studies have detected L. monocytogenes in fresh produce samples and even in some minimally processed vegetables. Thus L. monocytogenes may contaminate fresh produce if present in the growing environment (soil and water. Prevention of biofilm formation is an important control measure to reduce the prevalence and survival of L. monocytogenes in growing environments and on fresh produce. This article specifically focuses on fresh produce–associated listeriosis outbreaks, prevalence in growing environments, contamination levels of fresh produce, and associated fresh produce safety challenges.

  17. Prebiotic Oligosaccharides Potentiate Host Protective Responses against L. Monocytogenes Infection

    Directory of Open Access Journals (Sweden)

    Poyin Chen

    2017-12-01

    Full Text Available Prebiotic oligosaccharides are used to modulate enteric pathogens and reduce pathogen shedding. The interactions with prebiotics that alter Listeria monocytogenes infection are not yet clearly delineated. L. monocytogenes cellular invasion requires a concerted manipulation of host epithelial cell membrane receptors to initiate internalization and infection often via receptor glycosylation. Bacterial interactions with host glycans are intimately involved in modulating cellular responses through signaling cascades at the membrane and in intracellular compartments. Characterizing the mechanisms underpinning these modulations is essential for predictive use of dietary prebiotics to diminish pathogen association. We demonstrated that human milk oligosaccharide (HMO pretreatment of colonic epithelial cells (Caco-2 led to a 50% decrease in Listeria association, while Biomos pretreatment increased host association by 150%. L. monocytogenes-induced gene expression changes due to oligosaccharide pretreatment revealed global alterations in host signaling pathways that resulted in differential subcellular localization of L. monocytogenes during early infection. Ultimately, HMO pretreatment led to bacterial clearance in Caco-2 cells via induction of the unfolded protein response and eIF2 signaling, while Biomos pretreatment resulted in the induction of host autophagy and L. monocytogenes vacuolar escape earlier in the infection progression. This study demonstrates the capacity of prebiotic oligosaccharides to minimize infection through induction of host-intrinsic protective responses.

  18. Low prevalence of Listeria monocytogenes in cull sows and pork.

    Science.gov (United States)

    Wesley, Irene V; Larsen, Steven; Hurd, H Scott; McKean, James D; Griffith, Ronald; Rivera, Fernando; Nannapaneni, Ramakrishna; Cox, Mandy; Johnson, Michael; Wagner, Dean; de Martino, Mary

    2008-03-01

    The goal of this study was to determine the prevalence of Listeria monocytogenes in sows slaughtered at a single Midwestern plant on two occasions (trial 1, n = 179 sows; trial 2, n = 160 sows). Fecal samples collected antemortem (trial 1) as well as animal tissues, and carcass swabs collected at the abattoir (trials 1 and 2) were analyzed. Eight isolates of L. monocytogenes were recovered from five samples that represented 0.18% of the total samples (n = 2,775). In trial 1, L. monocytogenes was detected in a tonsil sample (0.6%; 1 positive of 181 tonsils), in a carcass (0.6%; 1 positive of 179 carcasses), which was sampled prior to the organic rinse, and in two chopped meat block samples (1.2%; 2 positive of 165 samples). In trial 2, L. monocytogenes was only detected in a single chopped meat block sample (0.15%; 1 positive of 688 total samples). These data indicate the low prevalence of L. monocytogenes in the cull sow.

  19. Commensal microbes provide first line defense against Listeria monocytogenes infection

    Science.gov (United States)

    Littmann, Eric R.; Kim, Sohn G.; Morjaria, Sejal M.; Ling, Lilan; Gyaltshen, Yangtsho; Taur, Ying; Leiner, Ingrid M.

    2017-01-01

    Listeria monocytogenes is a foodborne pathogen that causes septicemia, meningitis and chorioamnionitis and is associated with high mortality. Immunocompetent humans and animals, however, can tolerate high doses of L. monocytogenes without developing systemic disease. The intestinal microbiota provides colonization resistance against many orally acquired pathogens, and antibiotic-mediated depletion of the microbiota reduces host resistance to infection. Here we show that a diverse microbiota markedly reduces Listeria monocytogenes colonization of the gut lumen and prevents systemic dissemination. Antibiotic administration to mice before low dose oral inoculation increases L. monocytogenes growth in the intestine. In immunodeficient or chemotherapy-treated mice, the intestinal microbiota provides nonredundant defense against lethal, disseminated infection. We have assembled a consortium of commensal bacteria belonging to the Clostridiales order, which exerts in vitro antilisterial activity and confers in vivo resistance upon transfer into germ free mice. Thus, we demonstrate a defensive role of the gut microbiota against Listeria monocytogenes infection and identify intestinal commensal species that, by enhancing resistance against this pathogen, represent potential probiotics. PMID:28588016

  20. Deciphering the landscape of host barriers to Listeria monocytogenes infection.

    Science.gov (United States)

    Zhang, Ting; Abel, Sören; Abel Zur Wiesch, Pia; Sasabe, Jumpei; Davis, Brigid M; Higgins, Darren E; Waldor, Matthew K

    2017-06-13

    Listeria monocytogenes is a common food-borne pathogen that can disseminate from the intestine and infect multiple organs. Here, we used sequence tag-based analysis of microbial populations (STAMP) to investigate L monocytogenes population dynamics during infection. We created a genetically barcoded library of murinized L monocytogenes and then used deep sequencing to track the pathogen's dissemination routes and quantify its founding population ( N b ) sizes in different organs. We found that the pathogen disseminates from the gastrointestinal tract to distal sites through multiple independent routes and that N b sizes vary greatly among tissues, indicative of diverse host barriers to infection. Unexpectedly, comparative analyses of sequence tags revealed that fecally excreted organisms are largely derived from the very small number of L. monocytogenes cells that colonize the gallbladder. Immune depletion studies suggest that distinct innate immune cells restrict the pathogen's capacity to establish replicative niches in the spleen and liver. Finally, studies in germ-free mice suggest that the microbiota plays a critical role in the development of the splenic, but not the hepatic, barriers that prevent L. monocytogenes from seeding these organs. Collectively, these observations illustrate the potency of the STAMP approach to decipher the impact of host factors on population dynamics of pathogens during infection.

  1. Portable File Format (PFF) specifications

    Energy Technology Data Exchange (ETDEWEB)

    Dolan, Daniel H. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)

    2015-02-01

    Created at Sandia National Laboratories, the Portable File Format (PFF) allows binary data transfer across computer platforms. Although this capability is supported by many other formats, PFF files are still in use at Sandia, particularly in pulsed power research. This report provides detailed PFF specifications for accessing data without relying on legacy code.

  2. CINDA 99, supplement 2 to CINDA 97 (1988-1999). The index to literature and computer files on microscopic neutron data

    International Nuclear Information System (INIS)

    1999-01-01

    CINDA, the Computer Index of Neutron Data, contains bibliographical references to measurements, calculations, reviews and evaluations of neutron cross-sections and other microscopic neutron data; it includes also index references to computer libraries of numerical neutron data available from four regional neutron data centres. The present issue, CINDA 99, is the second supplement to CINDA 97, the index to the literature on neutron data published after 1987. It supersedes the first supplement, CINDA 98. The complete CINDA file as of 1 June 1999 is contained in: the archival issue CINDA-A (5 volumes, 1990), CINDA 97 and the current issue CINDA 99. The compilation and publication of CINDA are the result of worldwide co-operation involving the following four data centres. Each centre is responsible for compiling the CINDA entries from the literature published in a defined geographical area given in brackets below: the USA National Nuclear Data Center at the Brookhaven National Laboratory, USA (United States of America and Canada); the Russian Nuclear Data Centre at the Fiziko-Energeticheskij Institut, Obninsk, Russian Federation (former USSR countries); the NEA Data Bank in Paris, France (European OECD member countries in Western Europe and Japan); and the IAEA Nuclear Data Section in Vienna, Austria (all other countries in Eastern Europe, Asia, Australia, Africa, Central and South America; also IAEA publications and translation journals). Besides the published CINDA books, up-to-date computer retrievals for specified CINDA information are currently available on request from the responsible CINDA centres, or via direct access to the on-line services as described in this publication

  3. Listeria monocytogenes: Overview and Targeting Advances

    Directory of Open Access Journals (Sweden)

    Mostafa F.N. Abushahba

    2016-04-01

    Full Text Available Listeria monocytogenes is a serious foodborne zoonotic pathogen capable of causing gastroenteritis and severe systemic infections such as septicemia, meningitis or abortion in the infected individuals what is called listeriosis. The bacterium is reported as the third leading cause of death among the foodborne pathogens preceded by nontyphoidal Salmonella spp. and Toxoplasma gondii. The power to tolerate a wide range of temperatures is considered the most prominent trait distinguishing it from the other foodborne pathogens. Within the infected host, the bacteria harbor inside macrophages and jump from cell to another without leaving the safeguarding milieu of the host's cells utilizing a set of genes including hly (listeriolysin O, plcA (phosphatidylinositol-specific phospholipase c, plcB (phosphatidylcholine-phospholipase C and actA (actin-assembly inducing protein. In addition to the health concerns associated with antibiotics, treatment failure likely occurs among listeriosis-infected persons especially with the inability of most antibiotics to access intracellular replicative niches and achieve the optimum therapeutic concentrations within the infected cells. Recently, one novel choice, peptide nucleic acid (PNA, has been emerged to target this bacterium as a model of targeting intracellular pathogens with anti-sense agents. PNA is a one of the DNA analogues which works via specific inhibition of bacterial gene expression.

  4. Prevalence and antimicrobial susceptibility of Listeria monocytogenes on chicken carcasses in Bandung, Indonesia.

    Science.gov (United States)

    Sugiri, Yoni Darmawan; Gölz, Greta; Meeyam, Tongkorn; Baumann, Maximilian P O; Kleer, Josef; Chaisowwong, Warangkhana; Alter, Thomas

    2014-08-01

    This study was conducted to determine the prevalence and quantify the number of Listeria monocytogenes in fresh chicken carcasses sold in traditional markets and supermarkets in Bandung, West Java, Indonesia, and to determine the antimicrobial resistance patterns of the isolated L. monocytogenes strains. The overall prevalence of L. monocytogenes in chicken carcasses was 15.8% (29/184). When comparing samples from traditional markets and supermarkets, no significant difference in the L. monocytogenes prevalence was detectable (15.2 versus 16.3%). Of the samples, 97.3% had L. monocytogenes counts study were grouped into the molecular serogroup IIb, comprising the serovars 1/2b, 3b, and 7.

  5. Behaviour of Listeria monocytogenes in artisanal raw milk Pecorino Umbro cheese: a microbiological challenge test

    Directory of Open Access Journals (Sweden)

    Roberta Ortenzi

    2015-09-01

    Full Text Available In the present study, a microbiological challenge test in artificially contaminated raw milk Pecorino Umbro cheese during cheese-making was carried out. Raw ewe milk was contaminated by a suspension of particular Listeria monocytogenes strains. The number of L. monocytogenes and L. monocytogenes dynamic growth were evaluated during cheese-making and storage. A significant decrease of the viable count of L. monocytogenes was observed during ripening and L. monocytogenes viable count was below the limit of quantification during storage. The results show that the product is unable to support the growth of the pathogen.

  6. Microbiological criteria for Listeria monocytogenes in foods under special consideration of risk assessment approaches

    DEFF Research Database (Denmark)

    Nørrung, Birgit

    2000-01-01

    This paper shortly summarizes data related to risk assessment of Listeria monocytogenes. From available data on risk assessment, it is concluded that the levels of L. monocytogenes consumed is an important factor affecting the incidence of listeriosis. Foods that do not support the growth of L....... monocytogenes are unlikely to be a source of listeriosis, whereas foods that support the growth to high levels, should be the target of risk management efforts. Based on current epidemiological information from several countries, a concentration of L. monocytogenes not exceeding 100/g of food at the time...... of L. monocytogenes in the food during prevailing storage and distribution conditions is needed....

  7. Early trigeminal nerve involvement in Listeria monocytogenes rhombencephalitis

    DEFF Research Database (Denmark)

    Karlsson, William K; Harboe, Zitta Barrella; Roed, Casper

    2017-01-01

    dysfunction on that side. In addition, we identified another 120 cases of Listeria rhombencephalitis following a systematic review. Cranial nerves VII, V, IX, and X, respectively, medulla oblongata, cerebellum and pons, were the most frequently involved brain structures. The present clinical and radiological...... findings corroborate earlier data from animal experiments, indicating that L. monocytogenes may be capable of retrograde intra-axonal migration along the cranial nerves. We suggest that in a subset of patients with rhombencephalitis L. monocytogenes enters the cerebellopontine angle through the trigeminal......Listeria monocytogenes is associated with rhombencephalitis. However, the exact mechanisms of brainstem invasion remains poorly understood. Here, we demonstrate clinical and radiological data suggesting that Listeria may invade the brainstem via the trigeminal nerve. Three females (41, 64 and 70...

  8. COMPARISON OF TWO METHODS FOR THE DETECTION OF LISTERIA MONOCYTOGENES

    Directory of Open Access Journals (Sweden)

    G. Tantillo

    2013-02-01

    Full Text Available The aim of this study was to compare the performance of the conventional methods for detection of Listeria monocytogenes in food using media Oxford and ALOA (Agar Listeria acc. to Ottaviani & Agosti in according to the ISO 11290-1 to a new chromogenic medium “CHROMagar Listeria” standardized in 2005 AFNOR ( CHR – 21/1-12/01. A total of 40 pre-packed ready-to-eat food samples were examined. Using two methods six samples were found positive for Listeria monocytogenes but the medium “CHROMagar Listeria” was more selective in comparison with the others. In conclusion this study has demonstrated that isolation medium able to target specifically the detection of L. monocytogenes such as “CHROMagar Listeria” is highly recommendable because of that detection time is significantly reduced and the analysis cost is less expensive.

  9. [Analysis of antibiotic susceptibility of foodborne Listeria monocytogenes in China].

    Science.gov (United States)

    Yang, Yang; Fu, Ping; Guo, Yunchang; Liu, Xiurmei

    2008-03-01

    To study the antibiotic susceptibility of foodborne Listeria monocytogenes in China. The susceptibilities of 476 strains of foodborne Listeria monocytogenes to antibiotics were determined in Broth Microdilution Susceptibility Testing in Clinical and Laboratory Standards Institute. The antibiotics of gentamicin, ampicillin, penicillin, tetracycline, doxycycline, imipenem, erythromycin, ciprofloxacin, levofloxacin, cephalothin, rifampin, vancomycin, chloramphenicol, Trimethoprim-sulfamethoxazole, ampicillin-sulbactam were used. The rates of antibiotic resistance in 467 is olates were 4.5%. Tetracycline resistance was most prevalent, accouting for 4.07% . The foods that the rates of antibiotic resistance were highest were vegetable (10%). Among 14 provinces, Jilin, Hubei and Hebei were the third top, the rate of which were 19.6% and 9.1% and 8%, respectively. It was suggested that antibiotic resistance exists in foodborne Listeria monocytogenes to a certain extent in China. It should pay more attention to the use of drugs in prevention and clinic treatment to reduce the antibiotic resistant strains.

  10. Inactivation of Listeria monocytogenes in milk by pulsed electric field.

    Science.gov (United States)

    Reina, L D; Jin, Z T; Zhang, Q H; Yousef, A E

    1998-09-01

    Pasteurized whole, 2%, and skim milk were inoculated with Listeria monocytogenes Scott A and treated with high-voltage pulsed electric field (PEF). The effects of milk composition (fat content) and PEF parameters (electric field strength, treatment time, and treatment temperature) on the inactivation of the bacterium were studied. No significant differences were observed in the inactivation of L. monocytogenes Scott A in three types of milk by PEF treatment. With treatment at 25 degrees C, 1- to 3-log reductions of L. monocytogenes were observed. PEF lethal effect was a function of field strength and treatment time. Higher field strength or longer treatment time resulted in a greater reduction of viable cells. A 4-log reduction of the bacterium was obtained by increasing the treatment temperature to 50 degrees C. Results indicate that the use of a high-voltage PEF is a promising technology for inactivation of foodborne pathogens.

  11. Role of Extracellular DNA during Biofilm Formation by Listeria monocytogenes

    DEFF Research Database (Denmark)

    Harmsen, Morten; Lappann, Martin; Knøchel, S

    2010-01-01

    (eDNA) may be the only central component of the biofilm matrix and that it is necessary for both initial attachment and early biofilm formation for 41 L. monocytogenes strains that were tested. DNase I treatment resulted in dispersal of biofilms, not only in microtiter tray assays but also in flow......Listeria monocytogenes is a food-borne pathogen that is capable of living in harsh environments. It is believed to do this by forming biofilms, which are surface-associated multicellular structures encased in a self-produced matrix. In this paper we show that in L. monocytogenes extracellular DNA...... cell biofilm assays. However, it was also demonstrated that in a culture without eDNA, neither Listeria genomic DNA nor salmon sperm DNA by itself could restore the capacity to adhere. A search for additional necessary components revealed that peptidoglycan (PG), specifically N-acetylglucosamine (NAG...

  12. Listeria spp., y L. monocytogenes EN LECHE CRUDA DE CABRA

    Directory of Open Access Journals (Sweden)

    Yolanda Albarracín C

    2008-08-01

    Full Text Available Objective. To test non-pasteurized goat’s milk from the village of ‘la Garita’, Northern Santander, for Listeria monocytogenes. Material and methods. 90 samples of non-pasteurized goat’s milk were obtained over a 4 month period; pH and temperature of each sample were measured. The INVIMA technique was used to isolate L. monocytogenes; the species was confirmed by PCR. Results. The study showed that eight goat milk providers of the zone neither had refrigeration nor pasteurized the milk. The prevalence of L. monocytogenes was 3%; 15% of the samples had other species of Listeria. The milk obtained from this zone contained the pathogen that may cause listeriosis in children less than 5 years of age, pregnant women, adults and immunologically compromised patients. Conclusions. This study shows the occurrence of this pathogen in goat’s milk and identified areas of risk for those people who drink goat’s milk.

  13. Review of Prosthetic Joint Infection from Listeria monocytogenes.

    Science.gov (United States)

    Bader, Gilbert; Al-Tarawneh, Mohammed; Myers, James

    2016-12-01

    Prosthetic joint infection from Listeria monocytogenes is rare. We decided to shed light on this illness and review the reported cases to better understand its characteristics. We conducted a comprehensive review of the English literature using PubMed. We also included one case that we had managed. We found 25 cases of prosthetic joint infection from L. monocytogenes reported individually and a retrospective study of 43 cases of joint and bone listerial infection, including 34 with prosthetic joint infection, conducted in France. We have described their clinical and para-clinical features and tried to elaborate on the pathophysiology, treatment, and prevention. Prosthetic joint infection from L. monocytogenes is mainly late. Systemic inflammation may be absent. Although rare, it must be suspected in patients at high risk for both prosthetic joint and listerial infections. In addition, those patients must be instructed on appropriate preventive measures.

  14. Listeria monocytogenes response regulators important for stress tolerance and pathogenesis

    DEFF Research Database (Denmark)

    Kallipolitis, B H; Ingmer, H

    2001-01-01

    Environmental sensing by two-component signal transduction systems is likely to play a role for growth and survival of Listeria monocytogenes both during transmission in food products and within a host organism. Two-component systems typically consist of a membrane-associated sensor histidine...... kinase and a gene regulatory protein, the response regulator (RR). We have identified seven putative RR genes in L. monocytogenes LO28 by PCR using degenerate oligonucleotide primers. By insertional inactivation we obtained data suggesting that three of the putative RRs contribute to the pathogenicity...... of L. monocytogenes in mice. Strikingly, the mutants that were attenuated in virulence also had a decreased ability to grow in the presence of various stress conditions potentially encountered in an infection process. Thus, our data point to a connection between the ability of the putative two...

  15. Animal models for oral transmission of Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Sarah E F D'Orazio

    2014-02-01

    Full Text Available Listeria monocytogenes has been recognized as a food borne pathogen in humans since the 1980s, but we still understand very little about oral transmission of L. monocytogenes or the host factors that determine susceptibility to gastrointestinal infection, due to the lack of an appropriate small animal model of oral listeriosis. Early feeding trials suggested that many animals were highly resistant to oral infection, and the more reproducible intravenous or intraperitoneal routes of inoculation soon came to be favored. There are a fair number of previously published studies using an oral infection route, but the work varies widely in terms of bacterial strain choice, the methods used for oral transmission, and various manipulations used to enhance infectivity. This mini review will summarize the published literature using oral routes of L. monocytogenes infection and will highlight recent technological advances that have made oral infection a more attractive model system.

  16. Download this PDF file

    African Journals Online (AJOL)

    User

    ABSTRACT. The antimicrobial susceptibility profile of L. monocytogenes and other Listeria species isolated from some ready-to-eat (RTE) foods sold in Kano metropolis, north-western Nigeria was carried out using disc-diffusion method. The results obtained showed that L. monocytogenes was moderately susceptible to all ...

  17. Listeria monocytogenes in retailed raw chicken meat in Turkey.

    Science.gov (United States)

    Siriken, Belgin; Ayaz, Naim Deniz; Erol, Irfan

    2014-01-01

    The objectives of this study were, to find the prevalence and antimicrobial resistance of L. monocytogenes from a total of 116 chicken meat samples including 50 carcasses and 66 meat parts marketed in Turkey between 2008 and 2009 using immunomagnetic separation (IMS) based cultivation technique, to detect the hlyA gene for the verification of the isolates by PCR, and to identify the genoserotypes of the L. monocytogenes isolates by multiplex PCR assay. In the study, 51 L. monocytogenes colonies were isolated from 34 (29.3%) chicken meat samples (eleven [22.0%] carcasses and 23 [34.8%] pieces of meat) by IMS based cultivation technique and confirmed by PCR. According to the multiplex PCR results, all the 51 isolates were identified as genoserotype IIa (1/2a or 3a). L. monocytogenes isolates were also tested for their susceptibility to eight antibiotic (gentamicin, vancomycin, chloramphenicol, streptomycin, tetracycline, ampicillin, penicillin G, erythromycin) agents using the disk diffusion method. 14 isolates (27.45%) were susceptible to all eight antimicrobials drugs tested and the remaining 37 isolates (72.54%) were resistant to gentamicin (one isolate, 1.96%), vancomycin (four isolates, 7.84%), penicillin G (six isolates, 11.76%), streptomycin (nine isolates, 17.64%; resistant or intermediate), tetracycline (seven isolates, 13.72%) and ampicillin (six isolates, 11.76%). This study showed that antimicrobial resistance is not highly prevalent in L. monocytogenes isolated from chicken carcasses and pieces of meat. The presence of L. monocytogenes in chicken samples suggests an importance of this pathogen in chicken.

  18. Aerosol studies with Listeria innocua and Listeria monocytogenes.

    Science.gov (United States)

    Zhang, Guodong; Ma, Li; Oyarzabal, Omar A; Doyle, Michael P

    2007-08-01

    Aerosol studies of Listeria monocytogenes in food processing plants have been limited by lack of a suitable surrogate microorganism. The objective of this study was to investigate the potential of using green fluorescent protein-labeled strains of Listeria innocua as a surrogate for L. monocytogenes for aerosol studies. These studies were conducted in a laboratory bioaerosol chamber and a pilot food-processing facility. Four strains of L. innocua and five strains of L. monocytogenes were used. In the laboratory chamber study, Listeria cells were released into the environment at two different cell numbers and under two airflow conditions. Trypticase soy agar (TSA) plates and oven-roasted breasts of chicken and turkey were placed in the chamber to monitor Listeria cell numbers deposited from aerosols. A similar experimental design was used in the pilot plant study; however, only L. innocua was used. Results showed that L. monocytogenes and L. innocua survived equally well on chicken and turkey breast meats and TSA plates. No-fan and continuous fan applications, which affected airflow, had no significant effect on settling rates of aerosolized L. monocytogenes and L. innocua in the bioaerosol chamber or L. innocua in the pilot plant study. Listeriae cell numbers in the air decreased rapidly during the first 1.5 h following release, with few to no listeriae detected in the air at 3 h. Aerosol particles with diameters of 1 and 2 microM correlated directly with the number of Listeria cells in the aerosol but not with particles that were 0.3, 0.5, and 5 microM in diameter. Results indicate that L. innocua can be used as a surrogate for L. monocytogenes in an aerosol study.

  19. Spontaneous Loss of Virulence in Natural Populations of Listeria monocytogenes.

    Science.gov (United States)

    Maury, Mylène M; Chenal-Francisque, Viviane; Bracq-Dieye, Hélène; Han, Lei; Leclercq, Alexandre; Vales, Guillaume; Moura, Alexandra; Gouin, Edith; Scortti, Mariela; Disson, Olivier; Vázquez-Boland, José A; Lecuit, Marc

    2017-11-01

    The pathogenesis of Listeria monocytogenes depends on the ability of this bacterium to escape from the phagosome of the host cells via the action of the pore-forming toxin listeriolysin O (LLO). Expression of the LLO-encoding gene ( hly ) requires the transcriptional activator PrfA, and both hly and prfA genes are essential for L. monocytogenes virulence. Here, we used the hemolytic activity of LLO as a phenotypic marker to screen for spontaneous virulence-attenuating mutations in L. monocytogenes Sixty nonhemolytic isolates were identified among a collection of 57,820 confirmed L. monocytogenes strains isolated from a variety of sources (0.1%). In most cases (56/60; 93.3%), the nonhemolytic phenotype resulted from nonsense, missense, or frameshift mutations in prfA Five strains carried hly mutations leading to a single amino acid substitution (G299V) or a premature stop codon causing strong virulence attenuation in mice. In one strain, both hly and gshF (encoding a glutathione synthase required for full PrfA activity) were missing due to genomic rearrangements likely caused by a transposable element. The PrfA/LLO loss-of-function (PrfA - /LLO - ) mutants belonged to phylogenetically diverse clades of L. monocytogenes , and most were identified among nonclinical strains (57/60). Consistent with the rare occurrence of loss-of-virulence mutations, we show that prfA and hly are under purifying selection. Although occurring at a low frequency, PrfA - /LLO - mutational events in L. monocytogenes lead to niche restriction and open an evolutionary path for obligate saprophytism in this facultative intracellular pathogen. Copyright © 2017 Maury et al.

  20. Listeria monocytogenes in poultry and poultry products: Epidemiological investigations in seven Danish abattoirs

    DEFF Research Database (Denmark)

    Ojeniyi, B.; Wegener, Henrik Caspar; Jensen, N.E.

    1996-01-01

    Listeria monocytogenes was isolated from 11/236 (4 . 7%) caecal samples from parent flocks, providing broilers to the abattoirs investigated. Caecal samples from 2078 broilers representing 90 randomly selected broiler flocks were negative for L. monocytogenes. A total of 3080 samples from seven...... abattoirs including poultry processing line samples, and final products were also examined for L. monocytogenes. Listeria monocytogenes was isolated in 0 . 3% to 18 . 7% of the samples collected in the different abattoirs. Epidemiological typing of 247 L. monocytogenes isolates, including serotyping, phage...... isolates of L. monocytogenes since only 120/247 (48 . 6%) isolates were typable by phage typing and 230/247 (93 . 1%) L. monocytogenes belonged to serotype 01 while 6/247 (2 . 4%) belonged to 04. The discovery of a few dominating clones in each abattoir might indicate an endemic occurrence of L...

  1. Variations in virulence between different electrophoretic types of Listeria monocytogenes

    DEFF Research Database (Denmark)

    Nørrung, Birgit; Andersen, Jens Kirk

    2000-01-01

    A total of 245 strains of Listeria monocytogenes, representing 33 different electrophoretic types (ETs), were examined quantitatively for haemolytic activity. No significant difference was observed in the mean haemolytic activity between different ETs. Eighty four out of 91 strains examined were...... compared with 3.64 among food isolates). The explanation for this may be that more virulent strains are more prone to cause human infection. It is, however, also possible that strains oft. monocytogenes may become more virulent while multiplying in a living organism compared with multiplying in foods....

  2. In-vitro Assessing the Shaping Ability of Three Nickel-Titanium Rotary Single File Systems by Cone Beam Computed Tomography

    Directory of Open Access Journals (Sweden)

    Ali Imad Al-Asadi

    2018-02-01

    Full Text Available Aim of the study was to evaluate the canal transportation and centering ability of three nickel-titanium single file rotary systems by cone beam computed tomography (CBCT. Materials and methods: Thirty permanent maxillary first molar with a range of mesiobuccal canals curvature from 20-30 degree were selected and assigned into three groups (n=10, according to the biomechanical preparation system used: Hyflex EDM (HF, Reciproc blue (RB and OneShape (OS. The sampled were scanned by CBCT after being mounted on customized acrylic base and then rescanned after the instrumentation. Slices from the axial section were taken from both exposures at 3 mm, 6 mm and 9 mm from the root apex corresponding to the apical, middle, and coronal third respectively. Data were statistically analyzed using Kurskal-Wallis and Mann-Whitney U tests at the 5% confidence level. Results: The results showed that there were no significant differences at the apical and coronal third and a significant difference at the middle third regarding canal transportation. However, there was a significant difference at the apical third and no significant difference at the middle and coronal third regarding centering ratio. Conclusion: It was concluded that the three single rotary systems reported a degree in canal transportation and centric ratio but the Hyflex EDM reported the least one.

  3. Canal transportation and centering ability of protaper and self-adjusting file system in long oval canals: An ex-vivo cone-beam computed tomography analysis.

    Science.gov (United States)

    Shah, Dipali Yogesh; Wadekar, Swati Ishwara; Dadpe, Ashwini Manish; Jadhav, Ganesh Ranganath; Choudhary, Lalit Jayant; Kalra, Dheeraj Deepak

    2017-01-01

    The purpose of this study was to compare and evaluate the shaping ability of ProTaper (PT) and Self-Adjusting File (SAF) system using cone-beam computed tomography (CBCT) to assess their performance in oval-shaped root canals. Sixty-two mandibular premolars with single oval canals were divided into two experimental groups ( n = 31) according to the systems used: Group I - PT and Group II - SAF. Canals were evaluated before and after instrumentation using CBCT to assess centering ratio and canal transportation at three levels. Data were statistically analyzed using one-way analysis of variance, post hoc Tukey's test, and t -test. The SAF showed better centering ability and lesser canal transportation than the PT only in the buccolingual plane at 6 and 9 mm levels. The shaping ability of the PT was best in the apical third in both the planes. The SAF had statistically significant better centering and lesser canal transportation in the buccolingual as compared to the mesiodistal plane at the middle and coronal levels. The SAF produced significantly less transportation and remained centered than the PT at the middle and coronal levels in the buccolingual plane of oval canals. In the mesiodistal plane, the performance of both the systems was parallel.

  4. Building a parallel file system simulator

    International Nuclear Information System (INIS)

    Molina-Estolano, E; Maltzahn, C; Brandt, S A; Bent, J

    2009-01-01

    Parallel file systems are gaining in popularity in high-end computing centers as well as commercial data centers. High-end computing systems are expected to scale exponentially and to pose new challenges to their storage scalability in terms of cost and power. To address these challenges scientists and file system designers will need a thorough understanding of the design space of parallel file systems. Yet there exist few systematic studies of parallel file system behavior at petabyte- and exabyte scale. An important reason is the significant cost of getting access to large-scale hardware to test parallel file systems. To contribute to this understanding we are building a parallel file system simulator that can simulate parallel file systems at very large scale. Our goal is to simulate petabyte-scale parallel file systems on a small cluster or even a single machine in reasonable time and fidelity. With this simulator, file system experts will be able to tune existing file systems for specific workloads, scientists and file system deployment engineers will be able to better communicate workload requirements, file system designers and researchers will be able to try out design alternatives and innovations at scale, and instructors will be able to study very large-scale parallel file system behavior in the class room. In this paper we describe our approach and provide preliminary results that are encouraging both in terms of fidelity and simulation scalability.

  5. Design and application of remote file management system

    International Nuclear Information System (INIS)

    Zhu Haijun; Liu Dekang; Shen liren

    2006-01-01

    File transfer protocol can help users transfer files between computers on internet. FTP can not fulfill the needs of users in special occasions, so it needs programmer define file transfer protocol himself based on users. The method or realization and application for user-defined file transfer protocol is introduced. (authors)

  6. Overlevingsstrategieën Listeria monocytogenes bij lage temperatuur

    NARCIS (Netherlands)

    Wemekamp-Kamphuis, H.H.; Abee, T.

    2004-01-01

    Listeria monocytogenes is an important food-borne pathogen that may cause severe infections in humans. Many outbreaks caused by this organism have been associated with ready-to-eat foods wich may have undergone some form of minimal processing, or have been contaminated after processing. Ready-to-eat

  7. Effect of Listeria monocytogenes inoculation, sodium acetate and ...

    African Journals Online (AJOL)

    Jane

    2011-08-08

    Aug 8, 2011 ... monocytogenes has been isolated from surface fresh waters and ... been reported that contamination of aquatic products with ..... In fish sausage treated with nisin, the peroxide value was lower in comparison with that of control (Raju et al., 2003). TBA assay is usually used as indicator for the assessment of.

  8. Listeria monocytogenes serotype prevalence and biodiversity in diverse food products.

    Science.gov (United States)

    Hadjilouka, Agni; Andritsos, Nikolaos D; Paramithiotis, Spiros; Mataragas, Marios; Drosinos, Eleftherios H

    2014-12-01

    The aim of this study was to assess serotype prevalence and biodiversity of Listeria monocytogenes strains isolated from diverse food products, i.e., minced pork, fruits, and vegetables. Three hundred twenty-six samples previously purchased from supermarkets and street markets within the Athens area were studied for L. monocytogenes prevalence. A total of 121 strains were isolated from the 36 samples that were positive for L. monocytogenes. Serotyping was performed with multiplex PCR, and biodiversity was assessed with random amplified polymorphic DNA (RAPD) PCR analysis using M13, UBC155, and HLWL85 as primers and with repetitive element palindromic (rep) PCR analysis using (GTG)5 as the primer. The majority (17 of 22) of the contaminated minced pork samples contained strains identified as serotype 1/2a, either alone or in combination with strains belonging to serotypes 1/2b, 4a, 4c, or 4ab. However, all L. monocytogenes isolates from fruits and vegetables belonged to serotype 4b. Rep-PCR provided better differentiation of the isolates than did RAPD PCR and resulted in discrimination of the isolates into a larger number of unique profiles. Complete differentiation was achieved only with the combination of these subtyping techniques.

  9. Listeria monocytogenes repellence by enzymatically modified PES surfaces

    NARCIS (Netherlands)

    Veen, van der S.; Nady, N.; Franssen, M.C.R.; Zuilhof, H.; Boom, R.M.; Abee, T.; Schroën, C.G.P.H.

    2015-01-01

    : The effect of enzyme-catalyzed modification of poly(ethersulfone) (PES) on the adhesion and biofilm formation of two Listeria monocytogenes strains is evaluated under static and dynamic flow conditions. PES has been modified with gallic acid, ferulic acid and 4-hydroxybenzoic acid. The surfaces

  10. LISTERIA MONOCYTOGENES IN THE CONTEXT OF THE NEW COMMUNITY REGULATIONS

    Directory of Open Access Journals (Sweden)

    A. Bragagnolo

    2008-02-01

    Full Text Available In recent years in the countries of the European Union have occurred profound and radical changes regarding the safety and hygiene of foodstuffs. The aim of this work is to highlight the significant changes made by the recent legislation in the control of Listeria monocytogenes.

  11. Incidence of Listeria monocytogenes and Other Bacteria in ...

    African Journals Online (AJOL)

    Prof. Ogunji

    Abstract. The involvement of Listeria monocytogenes in spontaneous abortion in Jos was investigated. One hundred blood and 100 placenta samples were collected from spontaneous abortion patients in Jos. The samples were inoculated first into Listeria enrichment broth. Incubation was at 37o C, followed by cold ...

  12. Influence of temperature on alkali stress adaptation in Listeria monocytogenes

    Science.gov (United States)

    Listeria monocytogenes cells may induce alkali stress adaptation when exposed to sublethal concentrations of alkaline cleaners and sanitizers that may be frequently used in the food processing environment. In the present study, the effect of temperature on the induction and the stability of such alk...

  13. Activity of daptomycin against Listeria monocytogenes isolates from cerebrospinal fluid

    NARCIS (Netherlands)

    Spanjaard, Lodewijk; Vandenbroucke-Grauls, Christina M. J. E.

    2008-01-01

    We tested the activity of daptomycin against 76 Listeria monocytogenes isolates from cerebrospinal fluid by broth dilution and Etest methods. For the broth dilution method, the MIC range was 1.0 to 8.0 and the MIC at which 90% of the isolates tested were inhibited (MIC(90)) was 4.0 mg/liter. For the

  14. Listeria monocytogenes response regulators important for stress tolerance and pathogenesis

    DEFF Research Database (Denmark)

    Kallipolitis, B. H.; Ingmer, H.

    2001-01-01

    of L. monocytogenes in mice. Strikingly, the mutants that were attenuated in virulence also had a decreased ability to grow in the presence of various stress conditions potentially encountered in an infection process. Thus, our data point to a connection between the ability of the putative two...

  15. Formation of biofilm by strains of Listeria monocytogenes isolated ...

    African Journals Online (AJOL)

    Quantification of biofilm formation by 40 Listeria monocytogenes strains from wara soft cheese and its processing environment was assessed on glass vials surfaces. Attachement to glass surface was quantified using a crystal violet binding assay. All the 40 strains produced biofilms after 48 and 72 h incubation at 37oC.

  16. Pathogenic potential of Listeria monocytogenes isolated from cattle ...

    African Journals Online (AJOL)

    Listeria monocytogenes is an opportunistic food-borne pathogen causing listeriosis especially among immune-compromised persons. Its high rate of morbidity and mortality has classed the organism among the top watch list in foods. It is known to produce several virulence factors which aid its survival in harsh conditions ...

  17. Carrier status for Listeria monocytogenes and other Listeria species ...

    African Journals Online (AJOL)

    Background: Listeria organisms are documented to be zoonotic; one of the sources of infection is the domestic fowl where it could occur as in apparent infection. The carriage of Listeria monocytogenes and other Listeria in indigenous birds has not been documented in Kenya. Objective: To establish whether healthy looking ...

  18. Incidence of Listeria monocytogenes and Other Bacteria in ...

    African Journals Online (AJOL)

    The involvement of Listeria monocytogenes in spontaneous abortion in Jos was investigated. One hundred blood and 100 placenta samples were collected from spontaneous abortion patients in Jos. The samples were inoculated first into Listeria enrichment broth. Incubation was at 37o C, followed by cold enrichment at ...

  19. Prevalence and antibiotic susceptibility of Listeria monocytogenes in ...

    African Journals Online (AJOL)

    One hundred and ninety two raw milk samples were collected from lactating cows identified in Fulani herds and small scale dairy farms within Sokoto metropolis in order to investigate the presence and determine the antibiotic susceptibility of Listeria monocytogenes in the milk. Selective culture and identification method ...

  20. Zebra: A striped network file system

    Science.gov (United States)

    Hartman, John H.; Ousterhout, John K.

    1992-01-01

    The design of Zebra, a striped network file system, is presented. Zebra applies ideas from log-structured file system (LFS) and RAID research to network file systems, resulting in a network file system that has scalable performance, uses its servers efficiently even when its applications are using small files, and provides high availability. Zebra stripes file data across multiple servers, so that the file transfer rate is not limited by the performance of a single server. High availability is achieved by maintaining parity information for the file system. If a server fails its contents can be reconstructed using the contents of the remaining servers and the parity information. Zebra differs from existing striped file systems in the way it stripes file data: Zebra does not stripe on a per-file basis; instead it stripes the stream of bytes written by each client. Clients write to the servers in units called stripe fragments, which are analogous to segments in an LFS. Stripe fragments contain file blocks that were written recently, without regard to which file they belong. This method of striping has numerous advantages over per-file striping, including increased server efficiency, efficient parity computation, and elimination of parity update.

  1. Prevalence of Listeria monocytogenes in poultry production in France.

    Science.gov (United States)

    Chemaly, Marianne; Toquin, Marie-Therese; Le Nôtre, Yolene; Fravalo, Philippe

    2008-10-01

    This study aimed to update and create a data set from laying hens and broilers regarding contamination by Listeria monocytogenes. Two hundred laying-hen flocks were sampled, with 88 flocks reared in cages and 112 reared on the floor. One hundred forty-five broiler flocks were sampled, with 85 conventional and 60 free-range flocks. A total of 774 and 725 samples were analyzed from laying hens and broilers, respectively. L. monocytogenes was detected in 31 of 200 flocks, yielding an estimated prevalence of 15.5% in laying-hen flocks. Among positive flocks, there appeared a significant (P = 0.004) difference between caged and floor-reared hens, with a higher detection in dust samples from floor-reared hens. In positive caged hen flocks, significant (P = 0.028) differences between dust and fecal samples appeared, with a higher detection in feces than in dust samples. In broiler flocks, L. monocytogenes was isolated in 46 of 145 flocks, yielding an estimated prevalence of 32% (28% in conventional flocks versus 37% in the free-range flocks). L. monocytogenes was isolated in samples taken from conventional flocks with a lower frequency than in free-range flocks (13 versus 18%, respectively). The serotyping of L. monocytogenes strains showed that the majority belonged to type 1/2a in laying-hen flocks (74.3%) and in broiler flocks (40.5%). A significant difference (P = 0.007) between laying hens and broilers was shown for serogroup 4 and for serovar 1/2b (P = 0.007); these serogroups were more prevalent in broilers (40%) than in laying hens (5.7%).

  2. Antimicrobial treatments to control Listeria monocytogenes in queso fresco.

    Science.gov (United States)

    Lourenço, António; Kamnetz, Mary B; Gadotti, Camila; Diez-Gonzalez, Francisco

    2017-06-01

    Queso fresco, is a Hispanic non-fermented cheese highly susceptible to contamination with L. monocytogenes. This research was aimed to determine the effect of GRAS antimicrobial ingredients to control L. monocytogenes. Antimicrobials included caprylic acid (CA), Nisaplin ® (N, 2.5% nisin), a mixture of sodium lactate and sodium diacetate (SL/SD), Lactococcus lactis sbp. lactis DPC 3147, monolaurin, and lactic acid (LA). Batches of queso fresco curds were inoculated with 10 4  CFU/g and stored at 4 °C for three weeks. During storage the count of L. monocytogenes reached 7 to 8 Log CFU/g in control samples. Most individual antimicrobial treatments resulted in less than 1 Log CFU/g reductions in final counts, with the exception of N (0.5 g/kg) and CA (2.9 g/kg) that caused more than 3 and 5 Log CFU/g differences with controls, respectively. Mixtures of ingredients were more effective in inhibiting L. monocytogenes growth, and treatments with N and CA consistently delivered 6 Log CFU/g less counts than controls. Supplementation of 12 g/kg LA to treatments with SL/SD (3%/0.22%) caused differences of more than 4 Log CFU/g in final Listeria populations. Samples treated with the binary mixtures of N and CA (0.5 and 0.7 g/kg, respectively) were evaluated in a consumer panel (n = 67). Panelists slightly preferred control and commercial over treated samples, but all samples were in average rated between "slightly liking" and "moderately liking." These experiments indicated that combined use of antimicrobial ingredients may be an effective way to control the population of Listeria monocytogenes in queso fresco. Copyright © 2016 Elsevier Ltd. All rights reserved.

  3. Validation of the ANSR(®) Listeria monocytogenes Method for Detection of Listeria monocytogenes in Selected Food and Environmental Samples.

    Science.gov (United States)

    Caballero, Oscar; Alles, Susan; Le, Quynh-Nhi; Gray, R Lucas; Hosking, Edan; Pinkava, Lisa; Norton, Paul; Tolan, Jerry; Mozola, Mark; Rice, Jennifer; Chen, Yi; Ryser, Elliot; Odumeru, Joseph

    2016-01-01

    Work was conducted to validate performance of the ANSR(®) for Listeria monocytogenes method in selected food and environmental matrixes. This DNA-based assay involves amplification of nucleic acid via an isothermal reaction based on nicking enzyme amplification technology. Following single-step sample enrichment for 16-24 h for most matrixes, the assay is completed in 40 min using only simple instrumentation. When 50 distinct strains of L. monocytogenes were tested for inclusivity, 48 produced positive results, the exceptions being two strains confirmed by PCR to lack the assay target gene. Forty-seven nontarget strains (30 species), including multiple non-monocytogenes Listeria species as well as non-Listeria, Gram-positive bacteria, were tested, and all generated negative ANSR assay results. Performance of the ANSR method was compared with that of the U.S. Department of Agriculture, Food Safety and Inspection Service Microbiology Laboratory Guidebook reference culture procedure for detection of L. monocytogenes in hot dogs, pasteurized liquid egg, and sponge samples taken from an inoculated stainless steel surface. In addition, ANSR performance was measured against the U.S. Food and Drug Administration Bacteriological Analytical Manual reference method for detection of L. monocytogenes in Mexican-style cheese, cantaloupe, sprout irrigation water, and guacamole. With the single exception of pasteurized liquid egg at 16 h, ANSR method performance as quantified by the number of positives obtained was not statistically different from that of the reference methods. Robustness trials demonstrated that deliberate introduction of small deviations to the normal assay parameters did not affect ANSR method performance. Results of accelerated stability testing conducted using two manufactured lots of reagents predicts stability at the specified storage temperature of 4°C of more than 1 year.

  4. Comparing ProFile Vortex to ProTaper Next for the efficacy of removal of root filling material: An ex vivo micro-computed tomography study

    Directory of Open Access Journals (Sweden)

    Emad AlShwaimi

    2018-01-01

    Conclusion: Our findings suggest that PV is as effective as PTN for removal of root canal filling material. Therefore, PV can be considered for use in endodontic retreatment, although more effective files or techniques are still required.

  5. Genotyping of Listeria monocytogenes isolates from poultry carcasses using high resolution melting (HRM) analysis.

    Science.gov (United States)

    Sakaridis, Ioannis; Ganopoulos, Ioannis; Madesis, Panagiotis; Tsaftaris, Athanasios; Argiriou, Anagnostis

    2014-01-02

    An outbreak situation of human listeriosis requires a fast and accurate protocol for typing Listeria monocytogenes . Existing techniques are either characterized by low discriminatory power or are laborious and require several days to give a final result. Polymerase chain reaction (PCR) coupled with high resolution melting (HRM) analysis was investigated in this study as an alternative tool for a rapid and precise genotyping of L. monocytogenes isolates. Fifty-five isolates of L. monocytogenes isolated from poultry carcasses and the environment of four slaughterhouses were typed by HRM analysis using two specific markers, internalin B and ssrA genes. The analysis of genotype confidence percentage of L. monocytogenes isolates produced by HRM analysis generated dendrograms with two major groups and several subgroups. Furthermore, the analysis of the HRM curves revealed that all L. monocytogenes isolates could easily be distinguished. In conclusion, HRM was proven to be a fast and powerful tool for genotyping isolates of L. monocytogenes .

  6. Restraining reactive oxygen species in Listeria monocytogenes promotes the apoptosis of glial cells.

    Science.gov (United States)

    Li, Sen; Li, Yixuan; Chen, Guowei; Zhang, Jingchen; Xu, Fei; Wu, Man

    2017-07-01

    Listeria monocytogenes is a facultative anaerobic foodborne pathogen that can traverse the blood-brain barrier and cause brain infection. L. monocytogenes infection induces host cell apoptosis in several cell types. In this study, we investigated the apoptosis of human glioma cell line U251 invaded by L. monocytogenes and evaluated the function of bacterial reactive oxygen species (ROS) during infection. Bacterial ROS level was reduced by carrying out treatment with N-acetyl cysteine (NAC) and diphenyleneiodonium chloride (DPI). After infection, the apoptosis of U251 cells was examined by flow cytometry assay and propidium iodide staining. DPI and NAC efficiently decreased ROS level in L. monocytogenes without affecting bacterial growth. Moreover, the apoptosis of glial cells was enhanced upon invasion of DPI- and NAC-pretreated L. monocytogenes. Results indicate that the apoptosis of glial cells can be induced by L. monocytogenes, and that the inhibition of bacterial ROS increases the apoptosis of host cells.

  7. Listeria monocytogenes serovar 4a is a possible evolutionary intermediate between L. monocytogenes serovars 1/2a and 4b and L. innocua.

    Science.gov (United States)

    Chen, Jianshun; Jiang, Lingli; Chen, Xueyan; Luo, Xiaokai; Chen, Yang; Yu, Ying; Tian, Guoming; Liu, Dongyou; Fang, Weihuan

    2009-03-01

    The genus Listeria consists of six closely related species and forms three phylogenetic groups: L. monocytogenes- L. innocua, L. ivanovii-L. seeligeri-L. welshimeri, and L. grayi. In this report, we attempted to examine the evolutionary relationship in the L. monocytogenes-L. innocua group by probing the nucleotide sequences of 23S rRNA and 16S rRNA, and the gene clusters lmo0029-lmo0042, ascBdapE, rplS-infC, and prs-ldh in L. monocytogenes serovars 1/2a, 4a, and 4b, and L. innocua. Additionally, we assessed the status of L. monocytogenes-specific inlA and inlB genes and 10 L. innocua-specific genes in these species/serovars, together with phenotypic characterization by using in vivo and in vitro procedures. The results indicate that L. monocytogenes serovar 4a strains are genetically similar to L. innocua in the lmo0035-lmo0042, ascB-dapE, and rplS-infC regions and also possess L. innocua-specific genes lin0372 and lin1073. Furthermore, both L. monocytogenes serovar 4a and L. innocua exhibit impaired intercellular spread ability and negligible pathogenicity in mouse model. On the other hand, despite resembling L. monocytogenes serovars 1/2a and 4b in having a nearly identical virulence gene cluster, and inlA and inlB genes, these serovar 4a strains differ from serovars 1/2a and 4b by harboring notably altered actA and plcB genes, displaying strong phospholipase activity and subdued in vivo and in vitro virulence. Thus, by possessing many genes common to L. monocytogenes serovars 1/2a and 4b, and sharing many similar gene deletions with L. innocua, L. monocytogenes serovar 4a represents a possible evolutionary intermediate between L. monocytogenes serovars 1/2a and 4b and L. innocua.

  8. L. monocytogenes in a cheese processing facility: Learning from contamination scenarios over three years of sampling.

    Science.gov (United States)

    Rückerl, I; Muhterem-Uyar, M; Muri-Klinger, S; Wagner, K-H; Wagner, M; Stessl, B

    2014-10-17

    The aim of this study was to analyze the changing patterns of Listeria monocytogenes contamination in a cheese processing facility manufacturing a wide range of ready-to-eat products. Characterization of L. monocytogenes isolates included genotyping by pulsed-field gel electrophoresis (PFGE) and multi-locus sequence typing (MLST). Disinfectant-susceptibility tests and the assessment of L. monocytogenes survival in fresh cheese were also conducted. During the sampling period between 2010 and 2013, a total of 1284 environmental samples were investigated. Overall occurrence rates of Listeria spp. and L. monocytogenes were 21.9% and 19.5%, respectively. Identical L. monocytogenes genotypes were found in the food processing environment (FPE), raw materials and in products. Interventions after the sampling events changed contamination scenarios substantially. The high diversity of globally, widely distributed L. monocytogenes genotypes was reduced by identifying the major sources of contamination. Although susceptible to a broad range of disinfectants and cleaners, one dominant L. monocytogenes sequence type (ST) 5 could not be eradicated from drains and floors. Significantly, intense humidity and steam could be observed in all rooms and water residues were visible on floors due to increased cleaning strategies. This could explain the high L. monocytogenes contamination of the FPE (drains, shoes and floors) throughout the study (15.8%). The outcome of a challenge experiment in fresh cheese showed that L. monocytogenes could survive after 14days of storage at insufficient cooling temperatures (8 and 16°C). All efforts to reduce L. monocytogenes environmental contamination eventually led to a transition from dynamic to stable contamination scenarios. Consequently, implementation of systematic environmental monitoring via in-house systems should either aim for total avoidance of FPE colonization, or emphasize a first reduction of L. monocytogenes to sites where

  9. Recombinant probiotic expressing Listeria adhesion protein attenuates Listeria monocytogenes virulence in vitro.

    Directory of Open Access Journals (Sweden)

    Ok Kyung Koo

    Full Text Available BACKGROUND: Listeria monocytogenes, an intracellular foodborne pathogen, infects immunocompromised hosts. The primary route of transmission is through contaminated food. In the gastrointestinal tract, it traverses the epithelial barrier through intracellular or paracellular routes. Strategies to prevent L. monocytogenes entry can potentially minimize infection in high-risk populations. Listeria adhesion protein (LAP aids L. monocytogenes in crossing epithelial barriers via the paracellular route. The use of recombinant probiotic bacteria expressing LAP would aid targeted clearance of Listeria from the gut and protect high-risk populations from infection. METHODOLOGY/PRINCIPAL FINDINGS: The objective was to investigate the ability of probiotic bacteria or LAP-expressing recombinant probiotic Lactobacillus paracasei (Lbp(LAP to prevent L. monocytogenes adhesion, invasion, and transwell-based transepithelial translocation in a Caco-2 cell culture model. Several wild type probiotic bacteria showed strong adhesion to Caco-2 cells but none effectively prevented L. monocytogenes infection. Pre-exposure to Lbp(LAP for 1, 4, 15, or 24 h significantly (P<0.05 reduced adhesion, invasion, and transepithelial translocation of L. monocytogenes in Caco-2 cells, whereas pre-exposure to parental Lb. paracasei had no significant effect. Similarly, Lbp(LAP pre-exposure reduced L. monocytogenes translocation by as much as 46% after 24 h. Lbp(LAP also prevented L. monocytogenes-mediated cell damage and compromise of tight junction integrity. Furthermore, Lbp(LAP cells reduced L. monocytogenes-mediated cell cytotoxicity by 99.8% after 1 h and 79% after 24 h. CONCLUSIONS/SIGNIFICANCE: Wild type probiotic bacteria were unable to prevent L. monocytogenes infection in vitro. In contrast, Lbp(LAP blocked adhesion, invasion, and translocation of L. monocytogenes by interacting with host cell receptor Hsp60, thereby protecting cells from infection. These data show promise

  10. Internalization of Listeria monocytogenes in cantaloupes during dump tank washing and hydrocooling.

    Science.gov (United States)

    Macarisin, Dumitru; Wooten, Anna; De Jesus, Antonio; Hur, Minji; Bae, Seonjae; Patel, Jitendra; Evans, Peter; Brown, Eric; Hammack, Thomas; Chen, Yi

    2017-09-18

    Recent listeriosis outbreaks and recalls associated with cantaloupes urge for studies to understand the mechanisms of cantaloupe contamination by Listeria monocytogenes. Postharvest practices such as washing and hydrocooling were suggested to facilitate the contamination of fresh fruits by human pathogens. This study assessed the potential of L. monocytogenes internalization into cantaloupes during dump tank washing and immersion-type hydrocooling in water contaminated with L. monocytogenes. The effect of cantaloupe cultivar, water temperature, and harvesting technique on L. monocytogenes internalization was also evaluated. Full slip (cantaloupe without any residual stem) Western and Eastern cultivar cantaloupes were pre-warmed to 42°C (to imitate peak-high field temperatures of freshly harvested cantaloupes) and then immersed in water at 6°C and 18°C containing 4 and 6logCFU/ml of L. monocytogenes. Clipped (cantaloupe with short stem residues obtained by clipping the stem at harvest) Western and Eastern cantaloupes were pre-warmed to 42°C and then immersed in water at 6°C containing 6logCFU/ml of L. monocytogenes. Additionally, full slip and clipped Western cantaloupes were equilibrated to 18°C and then immersed in water at 18°C containing 6logCFU/ml of L. monocytogenes (isothermal immersion without temperature differential). Water containing L. monocytogenes infiltrated both full slip and clipped cantaloupes through the stems/stem scars and was then distributed along the vascular system in hypodermal mesocarp reaching the calyx area of the fruit. The current study demonstrated that, under experimental conditions, L. monocytogenes can internalize into cantaloupes during immersion in water contaminated by L. monocytogenes, both in the presence and absence of temperature differential, and that temperature differential moderately enhanced the internalization of L. monocytogenes. The incidence and levels of L. monocytogenes internalized in the middle

  11. COMPUTING

    CERN Multimedia

    M. Kasemann

    Overview In autumn the main focus was to process and handle CRAFT data and to perform the Summer08 MC production. The operational aspects were well covered by regular Computing Shifts, experts on duty and Computing Run Coordination. At the Computing Resource Board (CRB) in October a model to account for service work at Tier 2s was approved. The computing resources for 2009 were reviewed for presentation at the C-RRB. The quarterly resource monitoring is continuing. Facilities/Infrastructure operations Operations during CRAFT data taking ran fine. This proved to be a very valuable experience for T0 workflows and operations. The transfers of custodial data to most T1s went smoothly. A first round of reprocessing started at the Tier-1 centers end of November; it will take about two weeks. The Computing Shifts procedure was tested full scale during this period and proved to be very efficient: 30 Computing Shifts Persons (CSP) and 10 Computing Resources Coordinators (CRC). The shift program for the shut down w...

  12. Lineage specific recombination rates and microevolution in Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Nightingale Kendra K

    2008-10-01

    Full Text Available Abstract Background The bacterium Listeria monocytogenes is a saprotroph as well as an opportunistic human foodborne pathogen, which has previously been shown to consist of at least two widespread lineages (termed lineages I and II and an uncommon lineage (lineage III. While some L. monocytogenes strains show evidence for considerable diversification by homologous recombination, our understanding of the contribution of recombination to L. monocytogenes evolution is still limited. We therefore used STRUCTURE and ClonalFrame, two programs that model the effect of recombination, to make inferences about the population structure and different aspects of the recombination process in L. monocytogenes. Analyses were performed using sequences for seven loci (including the house-keeping genes gap, prs, purM and ribC, the stress response gene sigB, and the virulence genes actA and inlA for 195 L. monocytogenes isolates. Results Sequence analyses with ClonalFrame and the Sawyer's test showed that recombination is more prevalent in lineage II than lineage I and is most frequent in two house-keeping genes (ribC and purM and the two virulence genes (actA and inlA. The relative occurrence of recombination versus point mutation is about six times higher in lineage II than in lineage I, which causes a higher genetic variability in lineage II. Unlike lineage I, lineage II represents a genetically heterogeneous population with a relatively high proportion (30% average of genetic material imported from external sources. Phylograms, constructed with correcting for recombination, as well as Tajima's D data suggest that both lineages I and II have suffered a population bottleneck. Conclusion Our study shows that evolutionary lineages within a single bacterial species can differ considerably in the relative contributions of recombination to genetic diversification. Accounting for recombination in phylogenetic studies is critical, and new evolutionary models that

  13. Presence of Listeria monocytogenes in Mediterranean-Style Dry Fermented Sausages

    Directory of Open Access Journals (Sweden)

    Domenico Meloni

    2015-03-01

    Full Text Available The morphological, physiological and epidemiological features of L. monocytogenes, together with the severity of human listeriosis infections, make L. monocytogenes of particular concern for manufacturers of cold-stored “ready to eat” (RTE foods. L. monocytogenes has been isolated from a wide variety of RTE foods and is responsible for several outbreaks associated with the consumption of RTE meat, poultry, dairy, fish and vegetable products. Although L. monocytogenes is among the most frequently-detected pathogens in dry fermented sausages, these products could be included in the category of RTE products in which the growth of L. monocytogenes is not favored and have rarely been implicated in listeriosis outbreaks. However, L. monocytogenes is highly difficult to control in fermented sausage processing environments due to its high tolerance to low pH and high salt concentration. In many Mediterranean-style dry fermented sausages, an empirical application of the hurdle technology often occurs and the frequent detection of L. monocytogenes in these products at the end of ripening highlights the need for food business operators to properly apply hurdle technology and to control the contamination routes of L. monocytogenes in the processing plants. In the following, through an up-to-date review of (personal and un- published data, the main aspects of the presence of L. monocytogenes in Mediterranean-style dry fermented sausages will be discussed.

  14. Presence of Listeria monocytogenes in Mediterranean-Style Dry Fermented Sausages.

    Science.gov (United States)

    Meloni, Domenico

    2015-03-12

    The morphological, physiological and epidemiological features of L. monocytogenes , together with the severity of human listeriosis infections, make L. monocytogenes of particular concern for manufacturers of cold-stored "ready to eat" (RTE) foods. L. monocytogenes has been isolated from a wide variety of RTE foods and is responsible for several outbreaks associated with the consumption of RTE meat, poultry, dairy, fish and vegetable products. Although L. monocytogenes is among the most frequently-detected pathogens in dry fermented sausages, these products could be included in the category of RTE products in which the growth of L. monocytogenes is not favored and have rarely been implicated in listeriosis outbreaks. However, L. monocytogenes is highly difficult to control in fermented sausage processing environments due to its high tolerance to low pH and high salt concentration. In many Mediterranean-style dry fermented sausages, an empirical application of the hurdle technology often occurs and the frequent detection of L. monocytogenes in these products at the end of ripening highlights the need for food business operators to properly apply hurdle technology and to control the contamination routes of L. monocytogenes in the processing plants. In the following, through an up-to-date review of (personal and un-) published data, the main aspects of the presence of L. monocytogenes in Mediterranean-style dry fermented sausages will be discussed.

  15. ACONC Files

    Data.gov (United States)

    U.S. Environmental Protection Agency — ACONC files containing simulated ozone and PM2.5 fields that were used to create the model difference plots shown in the journal article. This dataset is associated...

  16. XML Files

    Science.gov (United States)

    ... this page: https://medlineplus.gov/xml.html MedlinePlus XML Files To use the sharing features on this page, please enable JavaScript. MedlinePlus produces XML data sets that you are welcome to download ...

  17. 831 Files

    Data.gov (United States)

    Social Security Administration — SSA-831 file is a collection of initial and reconsideration adjudicative level DDS disability determinations. (A few hearing level cases are also present, but the...

  18. COMPUTING

    CERN Multimedia

    I. Fisk

    2011-01-01

    Introduction CMS distributed computing system performed well during the 2011 start-up. The events in 2011 have more pile-up and are more complex than last year; this results in longer reconstruction times and harder events to simulate. Significant increases in computing capacity were delivered in April for all computing tiers, and the utilisation and load is close to the planning predictions. All computing centre tiers performed their expected functionalities. Heavy-Ion Programme The CMS Heavy-Ion Programme had a very strong showing at the Quark Matter conference. A large number of analyses were shown. The dedicated heavy-ion reconstruction facility at the Vanderbilt Tier-2 is still involved in some commissioning activities, but is available for processing and analysis. Facilities and Infrastructure Operations Facility and Infrastructure operations have been active with operations and several important deployment tasks. Facilities participated in the testing and deployment of WMAgent and WorkQueue+Request...

  19. COMPUTING

    CERN Multimedia

    P. McBride

    The Computing Project is preparing for a busy year where the primary emphasis of the project moves towards steady operations. Following the very successful completion of Computing Software and Analysis challenge, CSA06, last fall, we have reorganized and established four groups in computing area: Commissioning, User Support, Facility/Infrastructure Operations and Data Operations. These groups work closely together with groups from the Offline Project in planning for data processing and operations. Monte Carlo production has continued since CSA06, with about 30M events produced each month to be used for HLT studies and physics validation. Monte Carlo production will continue throughout the year in the preparation of large samples for physics and detector studies ramping to 50 M events/month for CSA07. Commissioning of the full CMS computing system is a major goal for 2007. Site monitoring is an important commissioning component and work is ongoing to devise CMS specific tests to be included in Service Availa...

  20. COMPUTING

    CERN Multimedia

    M. Kasemann

    Overview During the past three months activities were focused on data operations, testing and re-enforcing shift and operational procedures for data production and transfer, MC production and on user support. Planning of the computing resources in view of the new LHC calendar in ongoing. Two new task forces were created for supporting the integration work: Site Commissioning, which develops tools helping distributed sites to monitor job and data workflows, and Analysis Support, collecting the user experience and feedback during analysis activities and developing tools to increase efficiency. The development plan for DMWM for 2009/2011 was developed at the beginning of the year, based on the requirements from the Physics, Computing and Offline groups (see Offline section). The Computing management meeting at FermiLab on February 19th and 20th was an excellent opportunity discussing the impact and for addressing issues and solutions to the main challenges facing CMS computing. The lack of manpower is particul...

  1. JNDC FP decay data file

    International Nuclear Information System (INIS)

    Yamamoto, Tohru; Akiyama, Masatsugu

    1981-02-01

    The decay data file for fission product nuclides (FP DECAY DATA FILE) has been prepared for summation calculation of the decay heat of fission products. The average energies released in β- and γ-transitions have been calculated with computer code PROFP. The calculated results and necessary information have been arranged in tabular form together with the estimated results for 470 nuclides of which decay data are not available experimentally. (author)

  2. Uncovering Listeria monocytogenes hypervirulence by harnessing its biodiversity

    Science.gov (United States)

    Charlier, Caroline; Touchon, Marie; Chenal-Francisque, Viviane; Leclercq, Alexandre; Criscuolo, Alexis; Gaultier, Charlotte; Roussel, Sophie; Brisabois, Anne; Disson, Olivier; Rocha, Eduardo P. C.; Brisse, Sylvain; Lecuit, Marc

    2016-01-01

    Microbial pathogenesis studies are typically performed with reference strains, thereby overlooking microbial intra-species virulence heterogeneity. Here we integrated human epidemiological and clinical data with bacterial population genomics to harness the biodiversity of the model foodborne pathogen Listeria monocytogenes and decipher the basis of its neural and placental tropisms. Taking advantage of the clonal structure of this bacterial species, we identify clones epidemiologically associated with either food or human central nervous system (CNS) and maternal-neonatal (MN) listeriosis. The latter are also most prevalent in patients without immunosuppressive comorbidities. Strikingly, CNS and MN clones are hypervirulent in a humanized mouse model of listeriosis. By integrating epidemiological data and comparative genomics, we uncovered multiple novel putative virulence factors and demonstrated experimentally the contribution of the first gene cluster mediating Listeria monocytogenes neural and placental tropisms. This study illustrates the exceptional power of harnessing microbial biodiversity to identify clinically relevant microbial virulence attributes. PMID:26829754

  3. Biosensor for the detection of Listeria monocytogenes: emerging trends

    KAUST Repository

    Soni, Dharmendra Kumar

    2018-05-23

    The early detection of Listeria monocytogenes (L. monocytogenes) and understanding the disease burden is of paramount interest. The failure to detect pathogenic bacteria in the food industry may have terrible consequences, and poses deleterious effects on human health. Therefore, integration of methods to detect and trace the route of pathogens along the entire food supply network might facilitate elucidation of the main contamination sources. Recent research interest has been oriented towards the development of rapid and affordable pathogen detection tools/techniques. An innovative and new approach like biosensors has been quite promising in revealing the foodborne pathogens. In spite of the existing knowledge, advanced research is still needed to substantiate the expeditious nature and sensitivity of biosensors for rapid and in situ analysis of foodborne pathogens. This review summarizes recent developments in optical, piezoelectric, cell-based, and electrochemical biosensors for Listeria sp. detection in clinical diagnostics, food analysis, and environmental monitoring, and also lists their drawbacks and advantages.

  4. Efficacy of Twisted File Adaptive, Reciproc and ProTaper Universal Retreatment instruments for root-canal-filling removal: A cone-beam computed tomography study.

    Science.gov (United States)

    Akbulut, Makbule Bilge; Akman, Melek; Terlemez, Arslan; Magat, Guldane; Sener, Sevgi; Shetty, Heeresh

    2016-01-01

    The aim of this study was to evaluate the efficacy of Twisted File (TF) Adaptive, Reciproc, and ProTaper Universal Retreatment (UR) System instruments for removing root-canal-filling. Sixty single rooted teeth were decoronated, instrumented and obturated. Preoperative CBCT scans were taken and the teeth were retreated with TF Adaptive, Reciproc, ProTaper UR, or hand files (n=15). Then, the teeth were rescanned, and the percentage volume of the residual root-canal-filling material was established. The total time for retreatment was recorded, and the data was statistically analyzed. The statistical ranking of the residual filling material volume was as follows: hand file=TF Adaptive>ProTaper UR=Reciproc. The ProTaper UR and Reciproc systems required shorter periods of time for retreatment. Root canal filling was more efficiently removed by using Reciproc and ProTaper UR instruments than TF Adaptive instruments and hand files. The TF Adaptive system was advantageous over hand files with regard to operating time.

  5. Mechanistic studies of the agmatine deiminase from Listeria monocytogenes.

    Science.gov (United States)

    Soares, Charles A; Knuckley, Bryan

    2016-06-01

    Listeria monocytogenes is a Gram-positive food-borne pathogen that is capable of living within extreme environments (i.e. low temperatures and pH). This ability to survive in such conditions may arise, at least in part, from agmatine catabolism via the agmatine deiminase system (AgDS). This catabolic pathway utilizes an agmatine deiminase (AgD) to hydrolyse agmatine into N-carbamoylputrescine (NCP), with concomitant release of ammonia, which increases the pH, thus mitigating the ill effects of the acidic environment. Given the potential significance of this pathway for cell survival, we set out to study the catalytic mechanism of the AgD encoded by L. monocytogenes In the present paper, we describe the catalytic mechanism employed by this enzyme based on pH profiles, pKa measurements of the active site cysteine and solvent isotope effects (SIE). In addition, we report inhibition of this enzyme by two novel AgD inhibitors, i.e. N-(4-aminobutyl)-2-fluoro-ethanimidamide (ABFA) and N-(4-aminobutyl)-2-chloro-ethanimidamide (ABCA). In contrast with other orthologues, L. monocytogenes AgD does not use the reverse protonation or substrate-assisted mechanism, which requires an active site cysteine with a high pKa and has been commonly seen in other members of the guanidinium-modifying enzyme (GME) superfamily. Instead, the L. monocytogenes AgD has a low pKa cysteine in the active site leading to an alternative mechanism of catalysis. This is the first time that this mechanism has been observed in the GME superfamily and is significant because it explains why previously developed mechanism-based inactivators of AgDs are ineffective against this orthologue. © 2016 The Author(s). published by Portland Press Limited on behalf of the Biochemical Society.

  6. Encefalitis del tallo cerebral y mielitis por Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Aracelly Castro

    2013-09-01

    Full Text Available La romboencefalitis por Listeria monocytogenes es una presentación poco común de la listeriosis del sistema nervioso central; sin embargo, es la presentación más común en personas inmunocompetentes. Aun más rara es la combinación de romboencefalitis con mielitis causada por L. monocytogenes; no obstante, en este artículo se reporta un caso de encefalitis del tallo y mielitis grave en un paciente sin compromiso del sistema inmunitario. Se presenta un paciente de 21 años de edad, sin deficiencias del sistema inmunitario, que consumió productos lácteos no pasteurizados y, posteriormente, presentó un cuadro de cefalea, vómito, deterioro de su estado general y, finalmente, alteración del estado de conciencia y muerte. Consultó al Instituto Neurológico de Colombia y se hizo diagnóstico de encefalitis del tallo y mielitis por L. monocytogenes. Se discuten las diferencias entre el caso presentado y los reportados en la literatura científica. Ante un paciente con signos de compromiso del tallo cerebral, de posible origen infeccioso, es prudente iniciar tratamiento antibiótico para L. monocytogenes y, en caso de poca respuesta, escalar rápidamente en dicho tratamiento. También lo es extender el estudio radiológico hacia la columna vertebral, con el fin de descartar compromiso de la médula espinal.   doi: http://dx.doi.org/10.7705/biomedica.v33i3.1482

  7. How Listeria monocytogenes organizes its surface for virulence

    Science.gov (United States)

    Carvalho, Filipe; Sousa, Sandra; Cabanes, Didier

    2014-01-01

    Listeria monocytogenes is a Gram-positive pathogen responsible for the manifestation of human listeriosis, an opportunistic foodborne disease with an associated high mortality rate. The key to the pathogenesis of listeriosis is the capacity of this bacterium to trigger its internalization by non-phagocytic cells and to survive and even replicate within phagocytes. The arsenal of virulence proteins deployed by L. monocytogenes to successfully promote the invasion and infection of host cells has been progressively unveiled over the past decades. A large majority of them is located at the cell envelope, which provides an interface for the establishment of close interactions between these bacterial factors and their host targets. Along the multistep pathways carrying these virulence proteins from the inner side of the cytoplasmic membrane to their cell envelope destination, a multiplicity of auxiliary proteins must act on the immature polypeptides to ensure that they not only maturate into fully functional effectors but also are placed or guided to their correct position in the bacterial surface. As the major scaffold for surface proteins, the cell wall and its metabolism are critical elements in listerial virulence. Conversely, the crucial physical support and protection provided by this structure make it an ideal target for the host immune system. Therefore, mechanisms involving fine modifications of cell envelope components are activated by L. monocytogenes to render it less recognizable by the innate immunity sensors or more resistant to the activity of antimicrobial effectors. This review provides a state-of-the-art compilation of the mechanisms used by L. monocytogenes to organize its surface for virulence, with special focus on those proteins that work “behind the frontline”, either supporting virulence effectors or ensuring the survival of the bacterium within its host. PMID:24809022

  8. COMPUTING

    CERN Multimedia

    I. Fisk

    2013-01-01

    Computing activity had ramped down after the completion of the reprocessing of the 2012 data and parked data, but is increasing with new simulation samples for analysis and upgrade studies. Much of the Computing effort is currently involved in activities to improve the computing system in preparation for 2015. Operations Office Since the beginning of 2013, the Computing Operations team successfully re-processed the 2012 data in record time, not only by using opportunistic resources like the San Diego Supercomputer Center which was accessible, to re-process the primary datasets HTMHT and MultiJet in Run2012D much earlier than planned. The Heavy-Ion data-taking period was successfully concluded in February collecting almost 500 T. Figure 3: Number of events per month (data) In LS1, our emphasis is to increase efficiency and flexibility of the infrastructure and operation. Computing Operations is working on separating disk and tape at the Tier-1 sites and the full implementation of the xrootd federation ...

  9. Assessment of Listeria sp. Interference Using a Molecular Assay To Detect Listeria monocytogenes in Food.

    Science.gov (United States)

    Zittermann, Sandra I; Stanghini, Brenda; See, Ryan Soo; Melano, Roberto G; Boleszczuk, Peter; Murphy, Allana; Maki, Anne; Mallo, Gustavo V

    2016-01-01

    Detection of Listeria monocytogenes in food is currently based on enrichment methods. When L. monocytogenes is present with other Listeria species in food, the species compete during the enrichment process. Overgrowth competition of the nonpathogenic Listeria species might result in false-negative results obtained with the current reference methods. This potential issue was noted when 50 food samples artificially spiked with L. monocytogenes were tested with a real-time PCR assay and Canada's current reference method, MFHPB-30. Eleven of the samples studied were from foods naturally contaminated with Listeria species other than those used for spiking. The real-time PCR assay detected L. monocytogenes in all 11 of these samples; however, only 6 of these samples were positive by the MFHPB-30 method. To determine whether L. monocytogenes detection can be affected by other species of the same genus due to competition, an L. monocytogenes strain and a Listeria innocua strain with a faster rate of growth in the enrichment broth were artificially coinoculated at different ratios into ground pork meat samples and cultured according to the MFHPB-30 method. L. monocytogenes was detected only by the MFHPB-30 method when L. monocytogenes/L. innocua ratios were 6.0 or higher. In contrast, using the same enrichments, the real-time PCR assay detected L. monocytogenes at ratios as low as 0.6. Taken together, these findings support the hypothesis that L. monocytogenes can be outcompeted by L. innocua during the MFHPB-30 enrichment phase. However, more reliable detection of L. monocytogenes in this situation can be achieved by a PCR-based method mainly because of its sensitivity.

  10. COMPUTING

    CERN Multimedia

    I. Fisk

    2010-01-01

    Introduction It has been a very active quarter in Computing with interesting progress in all areas. The activity level at the computing facilities, driven by both organised processing from data operations and user analysis, has been steadily increasing. The large-scale production of simulated events that has been progressing throughout the fall is wrapping-up and reprocessing with pile-up will continue. A large reprocessing of all the proton-proton data has just been released and another will follow shortly. The number of analysis jobs by users each day, that was already hitting the computing model expectations at the time of ICHEP, is now 33% higher. We are expecting a busy holiday break to ensure samples are ready in time for the winter conferences. Heavy Ion An activity that is still in progress is computing for the heavy-ion program. The heavy-ion events are collected without zero suppression, so the event size is much large at roughly 11 MB per event of RAW. The central collisions are more complex and...

  11. COMPUTING

    CERN Multimedia

    M. Kasemann P. McBride Edited by M-C. Sawley with contributions from: P. Kreuzer D. Bonacorsi S. Belforte F. Wuerthwein L. Bauerdick K. Lassila-Perini M-C. Sawley

    Introduction More than seventy CMS collaborators attended the Computing and Offline Workshop in San Diego, California, April 20-24th to discuss the state of readiness of software and computing for collisions. Focus and priority were given to preparations for data taking and providing room for ample dialog between groups involved in Commissioning, Data Operations, Analysis and MC Production. Throughout the workshop, aspects of software, operating procedures and issues addressing all parts of the computing model were discussed. Plans for the CMS participation in STEP’09, the combined scale testing for all four experiments due in June 2009, were refined. The article in CMS Times by Frank Wuerthwein gave a good recap of the highly collaborative atmosphere of the workshop. Many thanks to UCSD and to the organizers for taking care of this workshop, which resulted in a long list of action items and was definitely a success. A considerable amount of effort and care is invested in the estimate of the comput...

  12. File Type Identification of File Fragments using Longest Common Subsequence (LCS)

    Science.gov (United States)

    Rahmat, R. F.; Nicholas, F.; Purnamawati, S.; Sitompul, O. S.

    2017-01-01

    Computer forensic analyst is a person in charge of investigation and evidence tracking. In certain cases, the file needed to be presented as digital evidence was deleted. It is difficult to reconstruct the file, because it often lost its header and cannot be identified while being restored. Therefore, a method is required for identifying the file type of file fragments. In this research, we propose Longest Common Subsequences that consists of three steps, namely training, testing and validation, to identify the file type from file fragments. From all testing results we can conlude that our proposed method works well and achieves 92.91% of accuracy to identify the file type of file fragment for three data types.

  13. Diversity assessment of Listeria monocytogenes biofilm formation: Impact of growth condition, serotype and strain origin

    NARCIS (Netherlands)

    Kadam, S.R.; Besten, den H.M.W.; Veen, van der S.; Zwietering, M.H.; Moezelaar, R.; Abee, T.

    2013-01-01

    The foodborne pathogen Listeria monocytogenes has the ability to produce biofilms in food-processing environments and then contaminate food products, which is a major concern for food safety. The biofilm forming behavior of 143 L. monocytogenes strains was determined in four different media that

  14. A novel suicide plasmid for efficient gene mutation in Listeria monocytogenes

    Science.gov (United States)

    Although several plasmids have been used in Listeria monocytogenes for generating mutants by allelic exchange, construction of L. monocytogenes mutants has been inefficient due to lack of effective selection markers for first and second recombination events. To address this problem, we have develope...

  15. Environmental prevalence and persistence of Listeria monocytogenes in cold-smoked trout processing plants

    Science.gov (United States)

    The presence of Listeria monocytogenes on the surfaces of equipment and workers' hands during different production stages, as well as on fish skin and meat during processing and storage of cold-smoked trout, was investigated. Listeria monocytogenes was recovered from 10 (6.06%) of a total 165 cotto...

  16. Genome Sequences of Two Listeria monocytogenes Strains from Nectarines Associated with Listeriosis in 2014

    Science.gov (United States)

    Lu, Chunye; Marjanovic, Olivera; Kiang, David

    2017-01-01

    ABSTRACT Listeria monocytogenes is an important foodborne pathogen. Here, we present the annotated whole genome of Listeria monocytogenes strains F14M01297-C2 and F14M01297-C4, isolated from nectarines distributed by a packing facility in California during an investigation of listeriosis associated with stone fruit in 2014. PMID:28729255

  17. A dynamical systems approach to actin-based motility in Listeria monocytogenes

    Science.gov (United States)

    Hotton, S.

    2010-11-01

    A simple kinematic model for the trajectories of Listeria monocytogenes is generalized to a dynamical system rich enough to exhibit the resonant Hopf bifurcation structure of excitable media and simple enough to be studied geometrically. It is shown how L. monocytogenes trajectories and meandering spiral waves are organized by the same type of attracting set.

  18. A multiplex PCR for detection of Listeria monocytogenes and its lineages.

    Science.gov (United States)

    Rawool, Deepak B; Doijad, Swapnil P; Poharkar, Krupali V; Negi, Mamta; Kale, Satyajit B; Malik, S V S; Kurkure, Nitin V; Chakraborty, Trinad; Barbuddhe, Sukhadeo B

    2016-11-01

    A novel multiplex PCR assay was developed to identify genus Listeria, and discriminate Listeria monocytogenes and its major lineages (LI, LII, LIII). This assay is a rapid and inexpensive subtyping method for screening and characterization of L. monocytogenes. Copyright © 2016 Elsevier B.V. All rights reserved.

  19. Isolation and characterization of an atypical Listeria monocytogenes associated with a canine urinary tract infection

    Science.gov (United States)

    Listeria monocytogenes, a well-described cause of encephalitis and abortion in ruminants and of food-borne illness in humans, is rarely associated with disease in companion animals. A case of urinary tract infection associated with an atypical, weakly hemolytic L. monocytogenes strain is described i...

  20. COMPUTING

    CERN Multimedia

    P. McBride

    It has been a very active year for the computing project with strong contributions from members of the global community. The project has focused on site preparation and Monte Carlo production. The operations group has begun processing data from P5 as part of the global data commissioning. Improvements in transfer rates and site availability have been seen as computing sites across the globe prepare for large scale production and analysis as part of CSA07. Preparations for the upcoming Computing Software and Analysis Challenge CSA07 are progressing. Ian Fisk and Neil Geddes have been appointed as coordinators for the challenge. CSA07 will include production tests of the Tier-0 production system, reprocessing at the Tier-1 sites and Monte Carlo production at the Tier-2 sites. At the same time there will be a large analysis exercise at the Tier-2 centres. Pre-production simulation of the Monte Carlo events for the challenge is beginning. Scale tests of the Tier-0 will begin in mid-July and the challenge it...

  1. COMPUTING

    CERN Multimedia

    M. Kasemann

    Introduction During the past six months, Computing participated in the STEP09 exercise, had a major involvement in the October exercise and has been working with CMS sites on improving open issues relevant for data taking. At the same time operations for MC production, real data reconstruction and re-reconstructions and data transfers at large scales were performed. STEP09 was successfully conducted in June as a joint exercise with ATLAS and the other experiments. It gave good indication about the readiness of the WLCG infrastructure with the two major LHC experiments stressing the reading, writing and processing of physics data. The October Exercise, in contrast, was conducted as an all-CMS exercise, where Physics, Computing and Offline worked on a common plan to exercise all steps to efficiently access and analyze data. As one of the major results, the CMS Tier-2s demonstrated to be fully capable for performing data analysis. In recent weeks, efforts were devoted to CMS Computing readiness. All th...

  2. COMPUTING

    CERN Multimedia

    I. Fisk

    2011-01-01

    Introduction It has been a very active quarter in Computing with interesting progress in all areas. The activity level at the computing facilities, driven by both organised processing from data operations and user analysis, has been steadily increasing. The large-scale production of simulated events that has been progressing throughout the fall is wrapping-up and reprocessing with pile-up will continue. A large reprocessing of all the proton-proton data has just been released and another will follow shortly. The number of analysis jobs by users each day, that was already hitting the computing model expectations at the time of ICHEP, is now 33% higher. We are expecting a busy holiday break to ensure samples are ready in time for the winter conferences. Heavy Ion The Tier 0 infrastructure was able to repack and promptly reconstruct heavy-ion collision data. Two copies were made of the data at CERN using a large CASTOR disk pool, and the core physics sample was replicated ...

  3. COMPUTING

    CERN Multimedia

    I. Fisk

    2012-01-01

    Introduction Computing continued with a high level of activity over the winter in preparation for conferences and the start of the 2012 run. 2012 brings new challenges with a new energy, more complex events, and the need to make the best use of the available time before the Long Shutdown. We expect to be resource constrained on all tiers of the computing system in 2012 and are working to ensure the high-priority goals of CMS are not impacted. Heavy ions After a successful 2011 heavy-ion run, the programme is moving to analysis. During the run, the CAF resources were well used for prompt analysis. Since then in 2012 on average 200 job slots have been used continuously at Vanderbilt for analysis workflows. Operations Office As of 2012, the Computing Project emphasis has moved from commissioning to operation of the various systems. This is reflected in the new organisation structure where the Facilities and Data Operations tasks have been merged into a common Operations Office, which now covers everything ...

  4. COMPUTING

    CERN Multimedia

    I. Fisk

    2010-01-01

    Introduction The first data taking period of November produced a first scientific paper, and this is a very satisfactory step for Computing. It also gave the invaluable opportunity to learn and debrief from this first, intense period, and make the necessary adaptations. The alarm procedures between different groups (DAQ, Physics, T0 processing, Alignment/calibration, T1 and T2 communications) have been reinforced. A major effort has also been invested into remodeling and optimizing operator tasks in all activities in Computing, in parallel with the recruitment of new Cat A operators. The teams are being completed and by mid year the new tasks will have been assigned. CRB (Computing Resource Board) The Board met twice since last CMS week. In December it reviewed the experience of the November data-taking period and could measure the positive improvements made for the site readiness. It also reviewed the policy under which Tier-2 are associated with Physics Groups. Such associations are decided twice per ye...

  5. COMPUTING

    CERN Multimedia

    M. Kasemann

    Introduction More than seventy CMS collaborators attended the Computing and Offline Workshop in San Diego, California, April 20-24th to discuss the state of readiness of software and computing for collisions. Focus and priority were given to preparations for data taking and providing room for ample dialog between groups involved in Commissioning, Data Operations, Analysis and MC Production. Throughout the workshop, aspects of software, operating procedures and issues addressing all parts of the computing model were discussed. Plans for the CMS participation in STEP’09, the combined scale testing for all four experiments due in June 2009, were refined. The article in CMS Times by Frank Wuerthwein gave a good recap of the highly collaborative atmosphere of the workshop. Many thanks to UCSD and to the organizers for taking care of this workshop, which resulted in a long list of action items and was definitely a success. A considerable amount of effort and care is invested in the estimate of the co...

  6. Comparative experimental infection of Listeria monocytogenes and Listeria ivanovii in bovine trophoblasts.

    Science.gov (United States)

    Rocha, Cláudia E; Mol, Juliana P S; Garcia, Luize N N; Costa, Luciana F; Santos, Renato L; Paixão, Tatiane A

    2017-01-01

    Listeria monocytogenes is a Gram-positive, facultative intracellular and invasive bacterium that has tropism to the placenta, and causes fetal morbidity and mortality in several mammalian species. While infection with L. monocytogenes and L. ivanovii are known as important causes of abortion and reproductive failure in cattle, the pathogenesis of maternal-fetal listeriosis in this species is poorly known. This study used the bovine chorioallantoic membrane explant model to investigate the kinetics of L. monocytogenes, L. ivanovii, and L. innocua infections in bovine trophoblastic cells for up to 8 h post infection. L. monocytogenes and L. ivanovii were able to invade and multiply in trophoblastic cells without causing cell death or inducing expression of pro-inflammatory genes. Although L. innocua was unable to multiply in bovine trophoblastic cells, it induced transcription of the pro-inflammatory mediator CXCL6. This study demonstrated for the first time the susceptibility of bovine trophoblastic cells to L. monocytogenes and L. ivanovii infection.

  7. Survival of Bactericidal Antibiotic Treatment by a Persister Subpopulation of Listeria monocytogenes

    DEFF Research Database (Denmark)

    Knudsen, Gitte Maegaard; Ng, Yin; Gram, Lone

    2013-01-01

    Listeria monocytogenes can cause the serious infection listeriosis, which despite antibiotic treatment has a high mortality. Understanding the response of L. monocytogenes to antibiotic exposure is therefore important to ensure treatment success. Some bacteria survive antibiotic treatment...... by formation of persisters, which are a dormant antibiotic-tolerant subpopulation. The purpose of this study was to determine whether L. monocytogenes can form persisters and how bacterial physiology affects the number of persisters in the population. A stationary-phase culture of L. monocytogenes was adjusted...... that eradication of persisters is possible. Our study adds L. monocytogenes to the list of bacterial species capable of surviving bactericidal antibiotics in a dormant stage, and this persister phenomenon should be borne in mind when developing treatment regimens....

  8. Lactobacillus plantarum inhibits growth of Listeria monocytogenes in an in vitro continuous flow gut model, but promotes invasion of L. monocytogenes in the gut of gnotobiotic rats

    DEFF Research Database (Denmark)

    Bernbom, Nete; Licht, Tine Rask; Saadbye, Peter

    2006-01-01

    The ability of the pediocin AcH producing Lactobacillus plantarum DDEN 11007 and its non-producing plasmid-cured isogenic variant, DDEN 12305 to prevent the persistence and growth of Listeria monocytogenes EP2 in two gastrointestinal (GI) tract models was examined. In vitro studies conducted...... in a two-stage continuous flow system showed that L. plantarum DDEN 11007 inhibited L. monocytogenes EP2 under these conditions, while less effect was seen of the non-bacteriocin producing variant. The inhibitory effect was more pronounced at pH 5 than at pH 7. No effect on persistence of L. monocytogenes...... in the GI tract was seen in gnotobiotic rats colonized with either the pediocin AcH producing or the non-bacteriocin producing variant of L. plantarum when compared to rats inoculated with L. monocytogenes EP2 alone. Surprisingly, inoculation of the gnotobiotic animals with either of the L. plantarum...

  9. An analysis of file system and installation of the file management system for NOS operating system

    International Nuclear Information System (INIS)

    Lee, Young Jai; Park, Sun Hee; Hwang, In Ah; Kim, Hee Kyung

    1992-06-01

    In this technical report, we analyze NOS file structure for Cyber 170-875 and Cyber 960-31 computer system. We also describe functions, procedure and how-to-operate and how-to-use of VDS. VDS is used to manage large files effectively for Cyber computer system. The purpose of the VDS installation is to increase the virtual disk storage by utilizing magnetic tape, to assist the users of the computer system in managing their files, and to enhance the performance of KAERI Cyber computer system. (Author)

  10. COMPUTING

    CERN Multimedia

    2010-01-01

    Introduction Just two months after the “LHC First Physics” event of 30th March, the analysis of the O(200) million 7 TeV collision events in CMS accumulated during the first 60 days is well under way. The consistency of the CMS computing model has been confirmed during these first weeks of data taking. This model is based on a hierarchy of use-cases deployed between the different tiers and, in particular, the distribution of RECO data to T1s, who then serve data on request to T2s, along a topology known as “fat tree”. Indeed, during this period this model was further extended by almost full “mesh” commissioning, meaning that RECO data were shipped to T2s whenever possible, enabling additional physics analyses compared with the “fat tree” model. Computing activities at the CMS Analysis Facility (CAF) have been marked by a good time response for a load almost evenly shared between ALCA (Alignment and Calibration tasks - highest p...

  11. COMPUTING

    CERN Multimedia

    Contributions from I. Fisk

    2012-01-01

    Introduction The start of the 2012 run has been busy for Computing. We have reconstructed, archived, and served a larger sample of new data than in 2011, and we are in the process of producing an even larger new sample of simulations at 8 TeV. The running conditions and system performance are largely what was anticipated in the plan, thanks to the hard work and preparation of many people. Heavy ions Heavy Ions has been actively analysing data and preparing for conferences.  Operations Office Figure 6: Transfers from all sites in the last 90 days For ICHEP and the Upgrade efforts, we needed to produce and process record amounts of MC samples while supporting the very successful data-taking. This was a large burden, especially on the team members. Nevertheless the last three months were very successful and the total output was phenomenal, thanks to our dedicated site admins who keep the sites operational and the computing project members who spend countless hours nursing the...

  12. COMPUTING

    CERN Multimedia

    M. Kasemann

    Introduction A large fraction of the effort was focused during the last period into the preparation and monitoring of the February tests of Common VO Computing Readiness Challenge 08. CCRC08 is being run by the WLCG collaboration in two phases, between the centres and all experiments. The February test is dedicated to functionality tests, while the May challenge will consist of running at all centres and with full workflows. For this first period, a number of functionality checks of the computing power, data repositories and archives as well as network links are planned. This will help assess the reliability of the systems under a variety of loads, and identifying possible bottlenecks. Many tests are scheduled together with other VOs, allowing the full scale stress test. The data rates (writing, accessing and transfer¬ring) are being checked under a variety of loads and operating conditions, as well as the reliability and transfer rates of the links between Tier-0 and Tier-1s. In addition, the capa...

  13. COMPUTING

    CERN Multimedia

    Matthias Kasemann

    Overview The main focus during the summer was to handle data coming from the detector and to perform Monte Carlo production. The lessons learned during the CCRC and CSA08 challenges in May were addressed by dedicated PADA campaigns lead by the Integration team. Big improvements were achieved in the stability and reliability of the CMS Tier1 and Tier2 centres by regular and systematic follow-up of faults and errors with the help of the Savannah bug tracking system. In preparation for data taking the roles of a Computing Run Coordinator and regular computing shifts monitoring the services and infrastructure as well as interfacing to the data operations tasks are being defined. The shift plan until the end of 2008 is being put together. User support worked on documentation and organized several training sessions. The ECoM task force delivered the report on “Use Cases for Start-up of pp Data-Taking” with recommendations and a set of tests to be performed for trigger rates much higher than the ...

  14. COMPUTING

    CERN Multimedia

    P. MacBride

    The Computing Software and Analysis Challenge CSA07 has been the main focus of the Computing Project for the past few months. Activities began over the summer with the preparation of the Monte Carlo data sets for the challenge and tests of the new production system at the Tier-0 at CERN. The pre-challenge Monte Carlo production was done in several steps: physics generation, detector simulation, digitization, conversion to RAW format and the samples were run through the High Level Trigger (HLT). The data was then merged into three "Soups": Chowder (ALPGEN), Stew (Filtered Pythia) and Gumbo (Pythia). The challenge officially started when the first Chowder events were reconstructed on the Tier-0 on October 3rd. The data operations teams were very busy during the the challenge period. The MC production teams continued with signal production and processing while the Tier-0 and Tier-1 teams worked on splitting the Soups into Primary Data Sets (PDS), reconstruction and skimming. The storage sys...

  15. COMPUTING

    CERN Multimedia

    I. Fisk

    2013-01-01

    Computing operation has been lower as the Run 1 samples are completing and smaller samples for upgrades and preparations are ramping up. Much of the computing activity is focusing on preparations for Run 2 and improvements in data access and flexibility of using resources. Operations Office Data processing was slow in the second half of 2013 with only the legacy re-reconstruction pass of 2011 data being processed at the sites.   Figure 1: MC production and processing was more in demand with a peak of over 750 Million GEN-SIM events in a single month.   Figure 2: The transfer system worked reliably and efficiently and transferred on average close to 520 TB per week with peaks at close to 1.2 PB.   Figure 3: The volume of data moved between CMS sites in the last six months   The tape utilisation was a focus for the operation teams with frequent deletion campaigns from deprecated 7 TeV MC GEN-SIM samples to INVALID datasets, which could be cleaned up...

  16. COMPUTING

    CERN Multimedia

    I. Fisk

    2012-01-01

      Introduction Computing activity has been running at a sustained, high rate as we collect data at high luminosity, process simulation, and begin to process the parked data. The system is functional, though a number of improvements are planned during LS1. Many of the changes will impact users, we hope only in positive ways. We are trying to improve the distributed analysis tools as well as the ability to access more data samples more transparently.  Operations Office Figure 2: Number of events per month, for 2012 Since the June CMS Week, Computing Operations teams successfully completed data re-reconstruction passes and finished the CMSSW_53X MC campaign with over three billion events available in AOD format. Recorded data was successfully processed in parallel, exceeding 1.2 billion raw physics events per month for the first time in October 2012 due to the increase in data-parking rate. In parallel, large efforts were dedicated to WMAgent development and integrati...

  17. COMPUTING

    CERN Multimedia

    I. Fisk

    2011-01-01

    Introduction The Computing Team successfully completed the storage, initial processing, and distribution for analysis of proton-proton data in 2011. There are still a variety of activities ongoing to support winter conference activities and preparations for 2012. Heavy ions The heavy-ion run for 2011 started in early November and has already demonstrated good machine performance and success of some of the more advanced workflows planned for 2011. Data collection will continue until early December. Facilities and Infrastructure Operations Operational and deployment support for WMAgent and WorkQueue+Request Manager components, routinely used in production by Data Operations, are provided. The GlideInWMS and components installation are now deployed at CERN, which is added to the GlideInWMS factory placed in the US. There has been new operational collaboration between the CERN team and the UCSD GlideIn factory operators, covering each others time zones by monitoring/debugging pilot jobs sent from the facto...

  18. Patogénesis de Listeria monocytogenes, microorganismo zoonotico emergente

    Directory of Open Access Journals (Sweden)

    Kirvis Torres

    2005-05-01

    Full Text Available Listeria monocytogenes además de ser un paradigma para la investigación inmunológica se ha convertidoen sistema modelo apropiado para el análisis de los mecanismos moleculares del parasitismo intracelularde otras bacterias. Investigadores en el área de la inmunología se interesaron en este microorganismocuando se reconoció el riesgo que representaba para la salud pública y la seguridad en la industria dealimentos. Desde mediados de los años 80’s se ha investigado la biología molecular de los marcadores devirulencia de este microorganismo, la biología celular de las interacciones de los marcadores de virulenciacon los receptores de la célula hospedero, el citoesqueleto, las vías de transducción de señales y losmecanismos de inmunidad mediada por células del hospedero. El propósito de esta revisión es describiralgunas características taxonómicas y filogenéticas de Listeria monocytogenes , la incidencia humana yanimal de varios serotipos, la fisiopatología de la infección , modelos animales y de cultivo celular utilizadospara estudios de virulencia, las poblaciones de riesgo, manifestaciones clínicas de listeriosis humana yanimal, el tratamiento, la organización genética y evolución de los determinantes de virulencia, losmecanismos empleados para interactuar con la célula hospedera, y los mecanismos para escapar de losprocesos de muerte celular y pasar de una célula infectada a otra. La información recopilada resulta degran importancia para el personal de salud, industria, consumidores y población de riesgo; razón por lacual Listeria monocytogenes es un patógeno que representa una amenaza para la salud pública mundial.

  19. Control of Listeria monocytogenes in food production plants

    Directory of Open Access Journals (Sweden)

    Dimitrijević Mirjana

    2008-01-01

    Full Text Available L. monocytogenes has been established in different plants for the production of food, including dairy plants, abattoirs, plants for the processing of fish, as well as those for the production of ready-to-eat (RTE food and this fact is being considered as the primary mechanism of food contamination with this bacteria. There is also the factor of numerous and diverse contaminated production equipment, because it has certain parts that are inaccessible for the necessary cleaning and disinfection. The temperature, position, as well as the material of the work surface are also linked to the contamination of plants with this bacteria. Investigations carried out so far have helped toward the better understanding of the manner and time of contamination of food items in the course of the production process, but there are still unresolved problems, including most certainly the biggest one - the adherence of bacteria and the creation of a biofilm, when the bacteria is in that condition more resistant to so-called stress factors which are usually used in the food industry for the purpose of decontamination of the surfaces with which foods come into contact. The control of L. monocytogenes in food production plants is possible primarily by using an integrated programme, compatible with the systems Hazard Analysis Critical Control Point (HACCP and Good Hygiene Practice (GHP, necessary in the production of food that is safe for the consumer. Essentially, the control measures that can contribute to reducing the incidence of findings of L.monocytogenes in the finished product, as well as the reducing of the level of contamination with this bacteria are linked, on the one hand, with hygiene procedures in the production process, and, on the other, with the applied technological procedures.

  20. Combination of endolysins and high pressure to inactivate Listeria monocytogenes.

    Science.gov (United States)

    van Nassau, Tomas J; Lenz, Christian A; Scherzinger, Anna S; Vogel, Rudi F

    2017-12-01

    Outbreaks of listeriosis are often related to the consumption of low-processed ready-to-eat food products (e.g. soft cheeses or smoked fish) contaminated with Listeria monocytogenes. Traditional preservation techniques, such as heat treatment, cannot eliminate Listeria from these products without strongly affecting the quality of the foods. We therefore investigated the use of endolysin (PlyP40, Ply511, or PlyP825) in combination with high hydrostatic pressure processing to kill L. monocytogenes in buffer. The results demonstrated a more than additive effect when both treatments were combined. For example, whereas 0.16 μg/mL PlyP825 or 300 MPa (1 min, 30 °C) applied individually reduced the cell count by 0.2 and 0.3 log cfu, respectively, a combined treatment resulted in a reduction of 5.5 log cfu. Similar results were obtained for the other endolysins combined with high pressure processing. We also showed that the synergistic inactivation of cells by endolysin and HHP is possible at a pressure level of only 200 MPa (2 min, 30 °C). Thus, the application of endolysins did not only substantially increase the bactericidal effect of high pressure, but it also enabled the inactivation of bacterial cells at much lower pressure levels. This shows the potential of using such combined processes for the inactivation of L. monocytogenes and food preservation. Copyright © 2017 Elsevier Ltd. All rights reserved.

  1. Listeria monocytogenes HAZARD MANAGEMENT IN A TYPICAL PRODUCT: THE CIAUSCOLO

    Directory of Open Access Journals (Sweden)

    S Fisichella

    2013-02-01

    Full Text Available The aim of the present study is to investigate operative procedures that allow to minimize Listeria monocytogenes (L. m. hazard in the main traditional sausage of the internal areas of Marche (Italy: the Ciauscolo, that has received the quality trademark PGI. It is made from lean cuts of well mature pork that is finely minced, adding fat which give the salami his characteristic softness and flavour. It is characterized by having a very little maturing period that determine high aw levels and, for this peculiarity, it allows L. m development.

  2. Thermal resistance of Listeria monocytogenes in sausage meat.

    Science.gov (United States)

    Farber, J M; Hughes, A; Holley, R; Brown, B

    1989-01-01

    The heat resistance of a mixture of 10 different strains of Listeria monocytogenes inoculated into ground meat and ground meat plus cure was examined. D-values for ground meat ranged from 1.01 min at 62 degrees C to 13.18 min at 56 degrees C. The D-values obtained for ground meat plus cure were approximately 5-8 fold times higher than those for ground meat alone. These results imply that rare meats and possibly some cooked fermented meats may not be heated adequately to inactivate Listeria.

  3. [Listeria monocytogenes nosocomial infection in the maternity ward].

    Science.gov (United States)

    Jean, D; Croize, J; Hirtz, P; Legeais, C; Pelloux, I; Favier, M; Mallaret, M R; Le Noc, P; Rambaud, P

    1991-01-01

    Nosocomial infection with Listeria monocytogenes 4b occurred in January 1990 in a maternity hospital in Grenoble. The 3 patients involved were born within a 24 hour-interval. The premature newborn responsible for contamination was asymptomatic. Two other newborns without any perinatal infectious risk presented with meningitis, one on the 5th day of life in the maternity hospital, the other one on the 11th day while already at home. The 3 strains of Listeria had the same serovar and lysovar. Epidemiologic investigations led to suspect a contamination in the delivery room and during the care of the children. Strict respect of hygiene orders is imperative to avoid nosocomial infections.

  4. Carbon dioxide and nisin act synergistically on Listeria monocytogenes

    DEFF Research Database (Denmark)

    Nilsson, Lilian; Chen, Y.H.; Chikindas, M.L.

    2000-01-01

    This paper examines the synergistic action of carbon dioxide and nisin on Listeria monocytogenes Scott A wild-type and nisin-resistant (Nis(r)) cells grown in broth at 4 degrees C. Carbon dioxide extended the lag phase and decreased the specific growth rate of both strains, but to a greater degree...... for cultures in CO2. This synergism between nisin and CO2 was examined mechanistically by following the leakage of carboxyfluorescein (CF) from listerial liposomes. Carbon dioxide enhanced nisin-induced CF leakage, indicating that the synergistic action of CO2 and nisin occurs at the cytoplasmic membrane...

  5. JENDL special purpose file

    International Nuclear Information System (INIS)

    Nakagawa, Tsuneo

    1995-01-01

    In JENDL-3,2, the data on all the reactions having significant cross section over the neutron energy from 0.01 meV to 20 MeV are given for 340 nuclides. The object range of application extends widely, such as the neutron engineering, shield and others of fast reactors, thermal neutron reactors and nuclear fusion reactors. This is a general purpose data file. On the contrary to this, the file in which only the data required for a specific application field are collected is called special purpose file. The file for dosimetry is a typical special purpose file. The Nuclear Data Center, Japan Atomic Energy Research Institute, is making ten kinds of JENDL special purpose files. The files, of which the working groups of Sigma Committee are in charge, are listed. As to the format of the files, ENDF format is used similarly to JENDL-3,2. Dosimetry file, activation cross section file, (α, n) reaction data file, fusion file, actinoid file, high energy data file, photonuclear data file, PKA/KERMA file, gas production cross section file and decay data file are described on their contents, the course of development and their verification. Dosimetry file and gas production cross section file have been completed already. As for the others, the expected time of completion is shown. When these files are completed, they are opened to the public. (K.I.)

  6. COMPUTING

    CERN Multimedia

    M. Kasemann

    CMS relies on a well functioning, distributed computing infrastructure. The Site Availability Monitoring (SAM) and the Job Robot submission have been very instrumental for site commissioning in order to increase availability of more sites such that they are available to participate in CSA07 and are ready to be used for analysis. The commissioning process has been further developed, including "lessons learned" documentation via the CMS twiki. Recently the visualization, presentation and summarizing of SAM tests for sites has been redesigned, it is now developed by the central ARDA project of WLCG. Work to test the new gLite Workload Management System was performed; a 4 times increase in throughput with respect to LCG Resource Broker is observed. CMS has designed and launched a new-generation traffic load generator called "LoadTest" to commission and to keep exercised all data transfer routes in the CMS PhE-DEx topology. Since mid-February, a transfer volume of about 12 P...

  7. Listeria monocytogenes associated kerato-conjunctivitis in four horses in Norway.

    Science.gov (United States)

    Revold, Tobias; Abayneh, Takele; Brun-Hansen, Hege; Kleppe, Signe L; Ropstad, Ernst-Otto; Hellings, Robert A; Sørum, Henning

    2015-11-09

    Listeria monocytogenes has been reported to cause various infectious diseases in both humans and animals. More rarely, ocular infections have been reported. To our knowledge, only two cases of Listeria keratitis have been described in horses. We report kerato-conjunctivitis in four Norwegian horses associated with L. monocytogenes. Clinically, all cases were presented with recurrent unilateral kerato-conjunctivitis. L. monocytogenes bacteria were isolated from swab samples from all cases, and cytology carried out in 3 cases was indicative of L. monocytogenes infection. The present report describes the first known cases in which L. monocytogenes has been isolated from keratitic lesions in horses in Norway. A potential risk factor may be feeding of silage or haylage, but other sources of infection cannot be ruled out. The phenotypic features including antimicrobial susceptibility and serotype of the isolates are described. Laboratory detection of L. monocytogenes demands extra caution since only low numbers of bacteria were detected in the eye-swabs, probably due to the low volume of sample material and the intracellular niche of the bacterium. A general poor response to treatment in all these cases indicates that clinicians should pay extra attention to intensity and duration of treatment if L. monocytogenes is identified in connection with equine kerato-conjunctivitis.

  8. Listeria monocytogenes in Food-Processing Facilities, Food Contamination, and Human Listeriosis: The Brazilian Scenario.

    Science.gov (United States)

    Camargo, Anderson Carlos; Woodward, Joshua John; Call, Douglas Ruben; Nero, Luís Augusto

    2017-11-01

    Listeria monocytogenes is a foodborne pathogen that contaminates food-processing environments and persists within biofilms on equipment, utensils, floors, and drains, ultimately reaching final products by cross-contamination. This pathogen grows even under high salt conditions or refrigeration temperatures, remaining viable in various food products until the end of their shelf life. While the estimated incidence of listeriosis is lower than other enteric illnesses, infections caused by L. monocytogenes are more likely to lead to hospitalizations and fatalities. Despite the description of L. monocytogenes occurrence in Brazilian food-processing facilities and foods, there is a lack of consistent data regarding listeriosis cases and outbreaks directly associated with food consumption. Listeriosis requires rapid treatment with antibiotics and most drugs suitable for Gram-positive bacteria are effective against L. monocytogenes. Only a minority of clinical antibiotic-resistant L. monocytogenes strains have been described so far; whereas many strains recovered from food-processing facilities and foods exhibited resistance to antimicrobials not suitable against listeriosis. L. monocytogenes control in food industries is a challenge, demanding proper cleaning and application of sanitization procedures to eliminate this foodborne pathogen from the food-processing environment and ensure food safety. This review focuses on presenting the L. monocytogenes distribution in food-processing environment, food contamination, and control in the food industry, as well as the consequences of listeriosis to human health, providing a comparison of the current Brazilian situation with the international scenario.

  9. Prevalence and antimicrobial resistance of Listeria monocytogenes isolated in chicken slaughterhouses in Northern Greece.

    Science.gov (United States)

    Sakaridis, I; Soultos, N; Iossifidou, E; Papa, A; Ambrosiadis, I; Koidis, P

    2011-06-01

    This study was conducted to determine the prevalence and antimicrobial resistance of Listeria monocytogenes recovered from chicken carcasses in slaughterhouses in Northern Greece. A total of 100 poultry samples (300 carcasses) were examined for Listeria spp. The samples were neck skin taken from four different slaughterhouses in Northern Greece. Forty samples were also taken from the environment of the slaughterhouses. Identification of L. monocytogenes was carried out by PCR and fingerprinting of the isolates by random amplified polymorphic DNA. L. monocytogenes strains isolated from chicken carcasses and from the environment of the slaughterhouses were also examined for antibiotic resistance. Fifty-five isolates of L. monocytogenes were tested for susceptibility to 20 antibiotics using the disk diffusion method. Listeria spp. were present in 99 of the poultry samples tested (99%), and 38 yielded L monocytogenes (38%). L. monocytogenes was also isolated in 80% of samples from the environment of a certain slaughterhouse, while the other slaughterhouses were found to be contaminated only with Listeria spp. All isolates were resistant to nalidixic acid and oxolinic acid, the majority of them to clindamycin, and only a few to tetracycline and oxytetracycline, whereas they were found to be susceptible to all other antimicrobials. The results of this study demonstrate a high prevalence of L. monocytogenes contamination in chicken carcasses, and all isolates were found to be sensitive to the antimicrobials most commonly used to treat human listeriosis.

  10. Prevalence and characteristics of Listeria monocytogenes in bovine colostrum in Japan.

    Science.gov (United States)

    Hasegawa, Megumi; Iwabuchi, Eriko; Yamamoto, Shiori; Esaki, Hidetake; Kobayashi, Kazuhiko; Ito, Masahiko; Hirai, Katsuya

    2013-02-01

    This study was conducted to determine the prevalence and characteristics of Listeria monocytogenes in bovine colostrum in Japan. We collected bovine colostrum samples from 210 dams from 21 dairy farms in Hokkaido prefecture (Japan) between March and June 2009. L. monocytogenes was detected in samples from 6 (28.6%) of the 21 farms. Of the 210 samples, 16 (7.6%) were positive for L. monocytogenes. We recovered 80 L. monocytogenes isolates; 44 (55%) isolates were classified as serotype 1/2b and 36 (45%) were classified as serotype 4b. The isolates were susceptible to penicillin, ampicillin, amoxicillin, gentamicin, kanamycin, streptomycin, erythromycin, vancomycin, tetracycline, chloramphenicol, ciprofloxacin, and trimethoprim-sulfamethoxazole. Pulsed-field gel electrophoresis (PFGE) characterization of the 80 isolates revealed six PFGE types. Two PFGE types corresponded to human listeriosis cases. Most L. monocytogenes isolates possessed virulence-associated genes (actA, hly, iap, inlA, inlC, mpl, plcA, plcB, opuCA, prfA, and clpC). One PFGE type isolate possessed an epidemic clone II marker. Our findings suggest that isolates from bovine colostrum have the potential to cause human and animal listeriosis. This is the first study on the prevalence and characteristics of L. monocytogenes isolated from bovine colostrum obtained from dairy farms. Our results have important implications for improving public health and elucidating the epidemiology of L. monocytogenes in bovine colostrum.

  11. Relationship between Listeria monocytogenes and Listeria spp. in seafood processing plants.

    Science.gov (United States)

    Alali, Walid Q; Schaffner, Donald W

    2013-07-01

    The objective of this study was to evaluate the relationship between prevalence of Listeria monocytogenes as an outcome and Listeria spp. as an explanatory variable by food products, food contact surfaces, and nonfood contact surfaces in seafood processing plants by using peer-reviewed published data. Nine sets of prevalence data of L. monocytogenes and Listeria spp. were collected from published studies and used for the analyses. Based on our analysis, the relationship between L. monocytogenes prevalence and Listeria spp. prevalence in food products (incoming raw materials and finish products) was significant (P = 0.04) with (low) R² = 0.36. Furthermore, Listeria spp. were not a good indicator for L. monocytogenes when testing food contact surfaces (R² = 0.10). Listeria spp. were a good indicator for L. monocytogenes only on nonfood contact surfaces (R² = 0.90). On the other hand, the presence of Listeria spp. on food contact surfaces (R² = 0.002) and nonfood contact surfaces (R² = 0.03) was not a good indicator for L. monocytogenes presence in food products. In general, prevalence of Listeria spp. does not seem to be a good indicator for L. monocytogenes prevalence in seafood processing plants.

  12. Detection Of Alterations In Audio Files Using Spectrograph Analysis

    Directory of Open Access Journals (Sweden)

    Anandha Krishnan G

    2015-08-01

    Full Text Available The corresponding study was carried out to detect changes in audio file using spectrograph. An audio file format is a file format for storing digital audio data on a computer system. A sound spectrograph is a laboratory instrument that displays a graphical representation of the strengths of the various component frequencies of a sound as time passes. The objectives of the study were to find the changes in spectrograph of audio after altering them to compare altering changes with spectrograph of original files and to check for similarity and difference in mp3 and wav. Five different alterations were carried out on each audio file to analyze the differences between the original and the altered file. For altering the audio file MP3 or WAV by cutcopy the file was opened in Audacity. A different audio was then pasted to the audio file. This new file was analyzed to view the differences. By adjusting the necessary parameters the noise was reduced. The differences between the new file and the original file were analyzed. By adjusting the parameters from the dialog box the necessary changes were made. The edited audio file was opened in the software named spek where after analyzing a graph is obtained of that particular file which is saved for further analysis. The original audio graph received was combined with the edited audio file graph to see the alterations.

  13. Prevalence and contamination patterns of Listeria monocytogenes in catfish processing environment and fresh fillets.

    Science.gov (United States)

    Chen, Bang-Yuan; Pyla, Rajkumar; Kim, Tae-Jo; Silva, Juan L; Jung, Yean-Sung

    2010-08-01

    Catfish skins, intestines, fresh fillets, processing surfaces at different production stages, chiller water and non-food contact surfaces were sampled for Listeria monocytogenes and other Listeria species. Among 315 samples, prevalence of L. monocytogenes, Listeria innocua and a group of Listeria seeligeri-Listeria welshimeri-Listeria ivanovii was 21.6, 13.0 and 29.5%, respectively. No Listeria grayi was detected in this survey. While no L. monocytogenes strains were isolated from catfish skins and intestines, the strains were found with a frequency of 76.7% in chilled fresh catfish fillets and 43.3% in unchilled fillets. L. monocytogenes and Listeria spp. were also detected in fish contact surfaces such as deheading machine, trimming board, chiller water, conveyor belts at different stages, and fillet weighing table. Among L. monocytogenes, 1/2b (47.0%), 3b (16.0%) and 4c (14%) were the predominant serotypes isolated, whereas 4b, 4e, 1/2c and 1/2a were detected at much lower frequencies. Genotype analyses of L. monocytogenes isolates using serotyping, pulsed-field gel electrophoresis (PFGE) and enterobacterial repetitive intergenic consensus (ERIC)-PCR revealed that chiller water represented an important contamination source of L. monocytogenes in the chilled catfish fillets of two processing facilities, whereas fillet weighing table significantly contributed to the catfish fillet contamination of the third facility. This study suggests that L. monocytogenes contamination in the processed catfish fillets originates from the processing environment, rather than directly from catfish. Results from this study can aid the catfish industry to develop a plant-specific proper cleaning and sanitation procedure for equipment and the processing environment designed to specifically target L. monocytogenes contamination. Copyright 2010 Elsevier Ltd. All rights reserved.

  14. Morphological Change and Decreasing Transfer Rate of Biofilm-Featured Listeria monocytogenes EGDe.

    Science.gov (United States)

    Lee, Yuejia; Wang, Chinling

    2017-03-01

    Listeria monocytogenes , a lethal foodborne pathogen, has the ability to resist the hostile food processing environment and thus frequently contaminates ready-to-eat foods during processing. It is commonly accepted that the tendency of L. monocytogenes ' to generate biofilms on various surfaces enhances its resistance to the harshness of the food processing environment. However, the role of biofilm formation in the transferability of L. monocytogenes EGDe remains controversial. We examined the growth of Listeria biofilms on stainless steel surfaces and their effect on the transferability of L. monocytogenes EGDe. The experiments were a factorial 2 × 2 design with at least three biological replicates. Through scanning electron microscopy, a mature biofilm with intensive aggregates of cells was observed on the surface of stainless steel after 3 or 5 days of incubation, depending on the initial level of inoculation. During biofilm development, L. monocytogenes EGDe carried out binary fission vigorously before a mature biofilm was formed and subsequently changed its cellular morphology from rod shaped to sphere shaped. Furthermore, static biofilm, which was formed after 3 days of incubation at 25°C, significantly inhibited the transfer rate of L. monocytogenes EGDe from stainless steel blades to 15 bologna slices. During 7 days of storage at 4°C, however, bacterial growth rate was not significantly impacted by whether bacteria were transferred from biofilm and the initial concentrations of transferred bacteria on the slice. In conclusion, this study is the first to report a distinct change in morphology of L. monocytogenes EGDe at the late stage of biofilm formation. More importantly, once food is contaminated by L. monocytogenes EGDe, contamination proceeds independently of biofilm development and the initial level of contamination when food is stored at 4°C, even if contamination with L. monocytogenes EGDe was initially undetectable before storage.

  15. Remote file inquiry (RFI) system

    Science.gov (United States)

    1975-01-01

    System interrogates and maintains user-definable data files from remote terminals, using English-like, free-form query language easily learned by persons not proficient in computer programming. System operates in asynchronous mode, allowing any number of inquiries within limitation of available core to be active concurrently.

  16. Listeria monocytogenes contamination in dairy plants: evaluation of Listeria monocytogenes environmental contamination in two cheese-making plants using sheeps milk

    Directory of Open Access Journals (Sweden)

    Michela Ibba

    2013-09-01

    Full Text Available Listeria monocytogenes harbouring niches established in the processing plant support post-process contamination of dairy products made from pasteurised or thermised milk. The present study investigated L. monocytogenes environmental contamination in two sheep’s milk cheese-making plants. Persistence of contamination in the area at higher risk was also investigated. During a one-year survey 7 samplings were carried out in each dairy plant, along the production lines of Pecorino Romano and ricotta salata cheese. A total of 613 environmental samples collected from food contact and non-food contact surfaces were analysed according to ISO 11290-1:2005 standard method. Identification of the isolated strains was carried out by polymerase chain reaction. L. monocytogenes prevalence was 23.2% in dairy A and 13.1% in dairy B, respectively. The higher prevalence rate was found in the following areas: salting, products washing, packaging, ricotta salata storage and Pecorino Romano ripening rooms. L. monocytogenes was never found in the cheese-making area. The probability of observing samples positive for the presence of L. monocytogenes was asso- ciated with dairy plant, sampling area and the period of cheese-making (P<0.001. The greater persistence of contamination over time was observed in the washing, salting, and Pecorino Romano ripening areas. The control of persistent environmental contamination relies on the identification of L. monocytogenes niches within the processing environment and the prevention of harborage sites formation. The importance of strict cleaning and sanitising procedure in controlling L. monocytogenes environmental contamination is confirmed by the lower level of contamination observed after these procedures were correctly implemented.

  17. Prevalence and quantification of Listeria monocytogenes in chicken offal at the retail level in Malaysia.

    Science.gov (United States)

    Kuan, C H; Goh, S G; Loo, Y Y; Chang, W S; Lye, Y L; Puspanadan, S; Tang, J Y H; Nakaguchi, Y; Nishibuchi, M; Mahyudin, N A; Radu, S

    2013-06-01

    A total of 216 chicken offal samples (chicken liver = 72; chicken heart = 72; chicken gizzard = 72) from wet markets and hypermarkets in Selangor, Malaysia, were examined for the presence and density of Listeria monocytogenes by using a combination of the most probable number and PCR method. The prevalence of L. monocytogenes in 216 chicken offal samples examined was 26.39%, and among the positive samples, the chicken gizzard showed the highest percentage at 33.33% compared with chicken liver (25.00%) and chicken heart (20.83%). The microbial load of L. monocytogenes in chicken offal samples ranged from Malaysia.

  18. Flagellar motility is critical for Listeria monocytogenes biofilm formation.

    Science.gov (United States)

    Lemon, Katherine P; Higgins, Darren E; Kolter, Roberto

    2007-06-01

    The food-borne pathogen Listeria monocytogenes attaches to environmental surfaces and forms biofilms that can be a source of food contamination, yet little is known about the molecular mechanisms of its biofilm development. We observed that nonmotile mutants were defective in biofilm formation. To investigate how flagella might function during biofilm formation, we compared the wild type with flagellum-minus and paralyzed-flagellum mutants. Both nonmotile mutants were defective in biofilm development, presumably at an early stage, as they were also defective in attachment to glass during the first few hours of surface exposure. This attachment defect could be significantly overcome by providing exogenous movement toward the surface via centrifugation. However, this centrifugation did not restore mature biofilm formation. Our results indicate that it is flagellum-mediated motility that is critical for both initial surface attachment and subsequent biofilm formation. Also, any role for L. monocytogenes flagella as adhesins on abiotic surfaces appears to be either minimal or motility dependent under the conditions we examined.

  19. Enterocin CRL35 inhibits Listeria monocytogenes in a murine model.

    Science.gov (United States)

    Salvucci, Emiliano; Saavedra, Lucila; Hebert, Elvira Maria; Haro, Cecilia; Sesma, Fernando

    2012-01-01

    Listeria monocytogenes is a foodborne pathogen causative of opportunistic infections. Listeriosis is associated with severe infections in pregnant women causing abortion or neonatal listeriosis. An alternative to antibiotics are safe novel bacteriocins peptides such as enterocin CRL35 with strong antilisterial activity produced by Enterococcus mundtii CRL35. In the present paper, our goal is to study the effectiveness of this peptide and the producer strain in a murine model of pregnancy-associated listeriosis. A single dose of 5×10(9) colony-forming unit of L. monocytogenes FBUNT (Faculty of Biochemistry-University of Tucumán) resulted in translocation of pathogen to liver and spleen of BALB/c pregnant mice. The maximum level of Listeria was observed on day 3 postinfection. Interestingly, the intragastric administration of enterocin CRL35 significantly reduced the translocation of the pathogen to vital organs. On the other hand, the preadministration of E. mundtii CRL35 slightly inhibited this translocation. Listeria infection caused a significant increase in polymorphonuclear leukocytes at day 3 postinfection compared to the noninfected group. This value was reduced after the administration of enterocin CRL35. No significant changes were observed in either white blood cells or lymphocytes counts. Based on the data presented in the present work enterocin CRL35 would be a promising alternative for the prevention of Listeria infections.

  20. ASSESSMENT OF ACTION OF DISINFECTANTS AGAINST LISTERIA MONOCYTOGENES BIOFILMS

    Directory of Open Access Journals (Sweden)

    T. K. CABEÇA

    2008-12-01

    Full Text Available

    The purpose of this study was to assess the action of various disinfectants used in food industry against biofilm cells of Listeria monocytogenes formed on stainless steel surfaces during 24, 72 and 120 hours. Numbers of viable biofilm cells decreased after treatment with all the tested disinfectants (iodine, biguanide, quaternary ammonium compounds, peracetic acid and sodium hypochlorite. Sodium hypochlorite was the most effective disinfectant against the biofilm cells, while biguanide and iodine were the least. Scanning electron microscopy observations demonstrated attached cells on stainless steel surfaces after treatment with all the disinfectants. These observations showed that microorganisms were not completely removed from stainless steel surfaces after treatment with the disinfectants, however, the attachment did not means the viability of remaining cells. The biofilm age in hours (24, 72 and 120 had no apparent influence on resistance of microbiological cells to the disinfectants under study. In conclusion biofilm cells of L. monocytogenes can withstand disinfectants action.

  1. Identification of Listeria monocytogenes on Green Mussels and Cockle Shell

    Directory of Open Access Journals (Sweden)

    Winiati Puji Rahayu

    2017-02-01

    Full Text Available AbstractGreen mussel (Perna viridis and cockle shell (Anadara granosa are one of many sources of animal protein which is many cultivated in Indonesia because their price is relatively affordable. This study was conducted to identify the presence of Listeria monocytogenes in 27 samples of green mussels and 3 samples of cockle shells using real-time Polymerase Chain Reaction (real-time PCR and biochemical methods. The target gene for amplification in real-time PCR was an hlyA gene because this gene was a determinant of virulence genes that produce listeriolysin O. Primers used in this study were forward primer DG69 (GTG CCG GGT AAA AGA CCA TA and reverse primer DG74 (CGC CAC TGA GAT ACT AT and fluorescence signals indicator using SYBR Green I. The results of analysis using real-time PCR were negative Listeria monocytogenes in all samples, while using biochemical methods there was one of 30 samples contaminated by Listeria welshimeri.

  2. Research of Performance Linux Kernel File Systems

    Directory of Open Access Journals (Sweden)

    Andrey Vladimirovich Ostroukh

    2015-10-01

    Full Text Available The article describes the most common Linux Kernel File Systems. The research was carried out on a personal computer, the characteristics of which are written in the article. The study was performed on a typical workstation running GNU/Linux with below characteristics. On a personal computer for measuring the file performance, has been installed the necessary software. Based on the results, conclusions and proposed recommendations for use of file systems. Identified and recommended by the best ways to store data.

  3. Fast probabilistic file fingerprinting for big data.

    Science.gov (United States)

    Tretyakov, Konstantin; Laur, Sven; Smant, Geert; Vilo, Jaak; Prins, Pjotr

    2013-01-01

    Biological data acquisition is raising new challenges, both in data analysis and handling. Not only is it proving hard to analyze the data at the rate it is generated today, but simply reading and transferring data files can be prohibitively slow due to their size. This primarily concerns logistics within and between data centers, but is also important for workstation users in the analysis phase. Common usage patterns, such as comparing and transferring files, are proving computationally expensive and are tying down shared resources. We present an efficient method for calculating file uniqueness for large scientific data files, that takes less computational effort than existing techniques. This method, called Probabilistic Fast File Fingerprinting (PFFF), exploits the variation present in biological data and computes file fingerprints by sampling randomly from the file instead of reading it in full. Consequently, it has a flat performance characteristic, correlated with data variation rather than file size. We demonstrate that probabilistic fingerprinting can be as reliable as existing hashing techniques, with provably negligible risk of collisions. We measure the performance of the algorithm on a number of data storage and access technologies, identifying its strengths as well as limitations. Probabilistic fingerprinting may significantly reduce the use of computational resources when comparing very large files. Utilisation of probabilistic fingerprinting techniques can increase the speed of common file-related workflows, both in the data center and for workbench analysis. The implementation of the algorithm is available as an open-source tool named pfff, as a command-line tool as well as a C library. The tool can be downloaded from http://biit.cs.ut.ee/pfff.

  4. Viable but non-culturable Listeria monocytogenes on parsley leaves and absence of recovery to a culturable state.

    Science.gov (United States)

    Dreux, N; Albagnac, C; Federighi, M; Carlin, F; Morris, C E; Nguyen-the, C

    2007-10-01

    To investigate the presence of viable but non-culturable Listeria monocytogenes during survival on parsley leaves under low relative humidity (RH) and to evaluate the ability of L. monocytogenes to recover from VBNC to culturable state under satured humidity. Under low RH (47-69%) on parsley leaves, the initial number of L. monocytogenes populations counted on non selective media (10(9) L. monocytogenes per leaf on TSA) was reduced by 6 log10 scales in 15 days, whereas number of viable L. monocytogenes counted under the microscope was reduced by 3-4 log10 scales, indicating the presence of VBNC cells. This was demonstrated on three L. monocytogenes strains (EGDe, Bug 1995 and LmP60). Changing from low to 100% RH permitted an increase of the culturable counts of L. monocytogenes and this growth was observed only when residual culturable cells were present. Moreover, VBNC L. monocytogenes inoculated on parsley leaves did not become culturable after incubation under 100% RH. Dry conditions induced VBNC L. monocytogenes on parsley leaves but these VBNC were likely unable to recover culturability after transfer to satured humidity. Enumeration on culture media presumably under-estimates the number of viable L. monocytogenes on fresh produce after exposure to low RH.

  5. HUD GIS Boundary Files

    Data.gov (United States)

    Department of Housing and Urban Development — The HUD GIS Boundary Files are intended to supplement boundary files available from the U.S. Census Bureau. The files are for community planners interested in...

  6. Prevalence and quantification of Listeria monocytogenes in beef offal at retail level in Selangor, Malaysia

    Science.gov (United States)

    Kuan, Chee Hao; Wong, Woan Chwen; Pui, Chai Fung; Mahyudin, Nor Ainy; Tang, John Yew Huat; Nishibuchi, Mitsuaki; Radu, Son

    2013-01-01

    A total of 63 beef offal samples (beef liver = 16; beef lung = 14; beef intestine = 9; beef tripe = 15; beef spleen = 9) from three wet markets (A, B, and C) in Selangor, Malaysia were examined for the prevalence and microbial load of Listeria monocytogenes. A combination of the most probable number and polymerase chain reaction (MPN-PCR) method was employed in this study. It was found that L. monocytogenes detected in 33.33% of the beef offal samples. The prevalence of L. monocytogenes in beef offal purchased from wet markets A, B, and C were 22.73%, 37.50% and 41.18% respectively. The density of L. monocytogenes in all the samples ranged from 2,400 MPN/g. The findings in this study indicate that beef offal can be a potential vehicle of foodborne listeriosis. PMID:24688507

  7. Modeling the growth of Listeria monocytogenes in soft blue-white cheese

    DEFF Research Database (Denmark)

    Rosshaug, Per Sand; Detmer, Ann; Ingmer, Hanne

    2012-01-01

    The aim of this study was to develop a predictive model simulating growth over time of the pathogenic bacterium Listeria monocytogenes in a soft blue-white cheese. The physicochemical properties in a matrix such as cheese are essential controlling factors influencing the growth of L. monocytogenes....... We developed a predictive tertiary model of the bacterial growth of L. monocytogenes as a function of temperature, pH, NaCl, and lactic acid. We measured the variations over time of the physicochemical properties in the cheese. Our predictive model was developed based on broth data produced...... production and retail conditions showed that the number of L. monocytogenes cells increases 3 to 3.5 log within the shelf life of the cheese....

  8. Prevalence and quantification of Listeria monocytogenes in beef offal at retail level in Selangor, Malaysia.

    Science.gov (United States)

    Kuan, Chee Hao; Wong, Woan Chwen; Pui, Chai Fung; Mahyudin, Nor Ainy; Tang, John Yew Huat; Nishibuchi, Mitsuaki; Radu, Son

    2013-12-01

    A total of 63 beef offal samples (beef liver = 16; beef lung = 14; beef intestine = 9; beef tripe = 15; beef spleen = 9) from three wet markets (A, B, and C) in Selangor, Malaysia were examined for the prevalence and microbial load of Listeria monocytogenes. A combination of the most probable number and polymerase chain reaction (MPN-PCR) method was employed in this study. It was found that L. monocytogenes detected in 33.33% of the beef offal samples. The prevalence of L. monocytogenes in beef offal purchased from wet markets A, B, and C were 22.73%, 37.50% and 41.18% respectively. The density of L. monocytogenes in all the samples ranged from 2,400 MPN/g. The findings in this study indicate that beef offal can be a potential vehicle of foodborne listeriosis.

  9. Prevalence and quantification of Listeria monocytogenes in beef offal at retail level in Selangor, Malaysia

    Directory of Open Access Journals (Sweden)

    Chee Hao Kuan

    2013-12-01

    Full Text Available A total of 63 beef offal samples (beef liver = 16; beef lung = 14; beef intestine = 9; beef tripe = 15; beef spleen = 9 from three wet markets (A, B, and C in Selangor, Malaysia were examined for the prevalence and microbial load of Listeria monocytogenes. A combination of the most probable number and polymerase chain reaction (MPN-PCR method was employed in this study. It was found that L. monocytogenes detected in 33.33% of the beef offal samples. The prevalence of L. monocytogenes in beef offal purchased from wet markets A, B, and C were 22.73%, 37.50% and 41.18% respectively. The density of L. monocytogenes in all the samples ranged from 2,400 MPN/g. The findings in this study indicate that beef offal can be a potential vehicle of foodborne listeriosis.

  10. PRÉVALENCE DE LISTERIA MONOCYTOGENES DANS LE LAIT CRU DE VACHE AU LIBAN NORD

    Directory of Open Access Journals (Sweden)

    Imad al Kassaa

    2016-06-01

    Full Text Available Al Kassaa Imad, Khaled el Omari, Marwa Saati, Bachar Ismail and Monzer Hamze. 2016. Prevalence of Listeria monocytogenes in raw cow milk in north Lebanon. Lebanese Science Journal, 17(1: 39-45. Listeriosis, although a zoonosis, is an invasive disease that can affect newborns, pregnant women and immunocompromised adults. Clinical manifestations can be expressed by febrile gastroenteritis, invasive forms including severe sepsis, meningitis, rhombencephalitis, prenatal infections and abortions. Species of Listeria bacteria are ubiquitous and adaptable to the environment in animal and plant foods. This study aimed to determine the prevalence of Listeria monocytogenes in 100 samples of fresh cow milk collected from different areas of North Lebanon. Listeria monocytogenes was detected by using the Grand VIDAS technique (Biomérieux France. The results obtained revealed the absence of Listeria monocytogenes in all analyzed samples.

  11. Genotypic profile of Listeria monocytogenes isolated in refrigerated chickens in southern Rio Grande do Sul, Brazil

    Directory of Open Access Journals (Sweden)

    Karla Sequeira Mendonça

    2016-01-01

    Full Text Available ABSTRACT: Listeria monocytogenes is of notable concern to the food industry, due to its ubiquitous nature and ability to grow in adverse conditions. This study aimed to determine the genotypic profile of L. monocytogenes strains isolated from refrigerated chickens marketed in the southern part of Rio Grande do Sul, Brazil. The strains of L. monocytogenes isolated were characterized by serotyping and Pulsed Field Gel Electrophoresis (PFGE. Three different serotypes (1/2a, 1/2b and 4e were evaluated by PFGE, and the macrorestriction patterns utilizing enzymes AscI and ApaI, revealed five different pulsotypes. The presence of such varied genotypic profiles demonstrates the prevalence of L. monocytogenes contamination of chicken processing environments, which combined with ineffective cleaning procedures, allowing the survival, adaptation and proliferation of these pathogens, not only in the processing environment, but also in local grocery stores.

  12. Prevalence and contamination levels of listeria monocytogenes in ready-to-eat foods in Tokyo, Japan.

    Science.gov (United States)

    Shimojima, Yukako; Ida, Miki; Nakama, Akiko; Nishino, Yukari; Fukui, Rie; Kuroda, Sumiyo; Hirai, Akihiko; Kai, Akemi; Sadamasu, Kenji

    2016-08-01

    We surveyed prevalence and contamination levels of Listeria monocytogenes in ready-to-eat foods between 2000 and 2012 in Tokyo. L. monocytogenes was isolated from 52 (1.7%) out of 2,980 samples. Comparing the prevalence in the study period, 2.2% were positive in the former period (2000-2005) and 1.2% in the latter (2006-2012). Using the most probable number (MPN) technique, 32 samples were contaminated with fewer than 0.3 L. monocytogenes/g, 10 samples with 0.3-1.0/g and 4 samples with more than 1.0/g (the maximum was 2.3/g). The most common serovar was 1/2a, followed by 1/2b, 4b and 1/2c. We revealed that ready-to-eat foods in Tokyo were contaminated with L. monocytogenes, although the contamination levels were low.

  13. NATURAL ATYPICAL LISTERIA INNOCUA STRAINS WITH LISTERIA MONOCYTOGENES PATHOGENICITY ISLAND 1 GENES

    Science.gov (United States)

    The detection of the human foodborne pathogen, Listeria monocytogenes, in food, environmental samples and clinical specimens associated with cases of listeriosis, a rare but high mortality-rate disease, requires distinguishing the pathogen from other Listeria species. Speciation...

  14. Characteristics of the biologically active 35-kDa metalloprotease virulence factor from Listeria monocytogenes

    NARCIS (Netherlands)

    Coffey, A; van den Burg, B; Veltman, R; Abee, T

    Listeria monocytogenes, a facultative intracellular pathogen, synthesizes an extracellular protease which is responsible for the maturation of phosphatidylcholine phospholipase C (lecithinase), a virulence factor involved in cell-to-cell spread. This work describes the environmental parameters

  15. Listeriolysin S: A bacteriocin from epidemic Listeria monocytogenes strains that targets the gut microbiota.

    Science.gov (United States)

    Quereda, Juan J; Meza-Torres, Jazmín; Cossart, Pascale; Pizarro-Cerdá, Javier

    2017-07-04

    Listeria monocytogenes is a Gram-positive food-borne pathogen that in humans may traverse the intestinal, placental and blood/brain barriers, causing gastroenteritis, abortions and meningitis. Crossing of these barriers is dependent on the bacterial ability to enter host cells, and several L. monocytogenes surface and secreted virulence factors are known to facilitate entry and the intracellular lifecycle. The study of L. monocytogenes strains associated to human listeriosis epidemics has revealed the presence of novel virulence factors. One such factor is Listeriolysin S, a thiazole/oxazole modified microcin that displays bactericidal activity and modifies the host microbiota during infection. Our recent results therefore highlight the interaction of L. monocytogenes with gut microbes as a crucial step in epidemic listeriosis. In this article, we will discuss novel implications for this family of toxins in the pathogenesis of diverse medically relevant microorganisms.

  16. Inhibitory effect of liposome-entrapped lemongrass oil on the growth of Listeria monocytogenes in cheese.

    Science.gov (United States)

    Cui, H Y; Wu, J; Lin, L

    2016-08-01

    Listeria monocytogenes infection in dairy products is of mounting public concern. To inhibit bacterial growth, we engineered stimuli-responsive liposomes containing lemongrass oil for this study. The controlled release of liposome-entrapped lemongrass oil is triggered by listerolysin O, secreted by L. monocytogenes. We investigated the antibiotic activities of lemongrass oil liposomes against L. monocytogenes in cheese. We also assessed their possible effects on the quality of the cheese. Liposomes containing lemongrass oil (5.0mg/mL) presented the optimal polydispersity index (0.246), zeta-potential (-58.9mV) and entrapment efficiency (25.7%). The liposomes displayed satisfactory antibiotic activity against L. monocytogenes in cheese over the storage period at 4°C. We observed no effects on the physical and sensory properties of the cheese after the liposome treatment. Copyright © 2016 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  17. Evaluation of a monoclonal antibody able to detect live Listeria monocytogenes and Listeria innocua

    DEFF Research Database (Denmark)

    Sølve, Marianne; Boel, Jeppe; Nørrung, Birgit

    2000-01-01

    A monoclonal Listeria antibody, designated B4, was evaluated. The ability of the antibody to bind to viable bacteria belonging to Listeria spp, compared to bacteria of the same species killed by beat treatment, acid or base treatment, sanitizers, and irradiation was examined. The antibody was found...... to react with viable L. monocytogenes and L. innocua, but not with heat-killed (72 degrees C, 5 min) strains of these organisms. When L. monocytogenes and L. innocua were killed by methods other than heat treatment, it was ambiguous whether the antibody detected the organism or not. It was concluded...... that the B4 antibody has potential to be used in an immune capture step to capture live L, monocytogenes and L. innocua from foods prior to identification of L. monocytogenes by polymerase chain reaction (PCR)....

  18. Internalization of Listeria monocytogenes in cantaloupes during dump tank washing and hydrocooling

    Science.gov (United States)

    Recent listeriosis outbreaks and recalls associated with cantaloupes urge for studies to understand the mechanisms of cantaloupe contamination by Listeria monocytogenes. Postharvest practices such as washing and hydrocooling were suggested to facilitate the contamination of fresh fruits by human pat...

  19. A secure file manager for UNIX

    Energy Technology Data Exchange (ETDEWEB)

    DeVries, R.G.

    1990-12-31

    The development of a secure file management system for a UNIX-based computer facility with supercomputers and workstations is described. Specifically, UNIX in its usual form does not address: (1) Operation which would satisfy rigorous security requirements. (2) Online space management in an environment where total data demands would be many times the actual online capacity. (3) Making the file management system part of a computer network in which users of any computer in the local network could retrieve data generated on any other computer in the network. The characteristics of UNIX can be exploited to develop a portable, secure file manager which would operate on computer systems ranging from workstations to supercomputers. Implementation considerations making unusual use of UNIX features, rather than requiring extensive internal system changes, are described, and implementation using the Cray Research Inc. UNICOS operating system is outlined.

  20. Efficacy of ultraviolet light exposure against survival of Listeria monocytogenes on conveyor belts.

    Science.gov (United States)

    Morey, Amit; McKee, Shelly R; Dickson, James S; Singh, Manpreet

    2010-06-01

    Listeria monocytogenes has been repeatedly isolated from foods and food-processing facilities including food contact surfaces such as conveyor belts (CB). CBs are often difficult to clean and require rigorous sanitation programs for decontamination. Ultraviolet (UV) light has exhibited microbicidal properties on food contact surfaces and this study was conducted to determine the efficacy of UV against L. monocytogenes on CB made of different materials. A four-strain cocktail of L. monocytogenes (serotypes 3A, 4A, 4B, and 4C) was made to give a suspension of approximately 10(7) CFU/mL. CBs made from four different types of materials, (1) Ropanyl DM 8/2 A2 + 04 (belt 1), (2) Volta FRMW-3.0 (belt 2), (3) Volta FRMB-3.0 (belt 3), and (4) Ropanyl DM (belt 4), were inoculated with 1 mL of the four-strain cocktail (approximately 10(7) CFU/mL) of the bacterial suspension. CBs were treated with UV light (254 nm) for 1 and 3 sec at 5.53 and 5.95 mW/cm(2). Three replications of the experiments were conducted. Two-way analysis of variance of survival populations of L. monocytogenes showed that bacterial counts were significantly reduced (p belt types irrespective of UV light intensities and times of exposure. L. monocytogenes populations were reduced (p belts 1, 2, and 3 after exposure to 5.95 mW/cm(2) UV light intensity for 3 sec. L. monocytogenes-inoculated CBs that were exposed to 5.53 mW/cm(2) showed higher (p Belt 4 showed survival populations of L. monocytogenes ranging from 1.42 to 1.73 log(10) CFU/cm(2) after UV light treatment for 1 and 3 sec. UV light can be effectively used to reduce L. monocytogenes contamination on CBs.

  1. MicroRNA-146a Deficiency Protects against Listeria monocytogenes Infection by Modulating the Gut Microbiota

    Directory of Open Access Journals (Sweden)

    Chong-Tao Du

    2018-03-01

    Full Text Available The gut microbiota and microRNAs play important roles in the defense against infection. However, the role of miR-146a in L. monocytogenes infection and gut microbiota remains unclear. We tried to determine whether miR-146a controlled L. monocytogenes infection by regulating the gut microbiota. Wild-type and miR-146a-deficient mice or macrophages were used to characterize the impact of miR-146a on animal survival, cell death, bacterial clearance, and gut microbiota following L. monocytogenes challenge. We found that L. monocytogenes infection induced miR-146a expression both in vitro and in vivo. When compared to wild-type mice, miR-146a-deficient mice were more resistant to L. monocytogenes infection. MiR-146a deficiency in macrophages resulted in reduced invasion and intracellular survival of L. monocytogenes. High-throughput sequencing of 16S rRNA revealed that the gut microbiota composition differed between miR-146a-deficient and wild-type mice. Relative to wild-type mice, miR-146a-deficient mice had decreased levels of the Proteobacteria phylum, Prevotellaceae family, and Parasutterella genus, and significantly increased short-chain fatty acid producing bacteria, including the genera Alistipes, Blautia, Coprococcus_1, and Ruminococcus_1. Wild-type mice co-housed with miR-146a-deficient mice had increased resistance to L. monocytogenes, indicating that miR-146a deficiency guides the gut microbiota to alleviate infection. Together, these results suggest that miR-146a deficiency protects against L. monocytogenes infection by regulating the gut microbiota.

  2. Modeling and predicting the growth boundary of Listeria monocytogenes in lightly preserved seafood

    DEFF Research Database (Denmark)

    Mejlholm, Ole; Dalgaard, Paw

    2007-01-01

    The antimicrobial effect of diacetate and lactate against Listeria monocytogenes was evaluated in challenge tests with vacuum-packaged or modified atmosphere packaged (MAP) cold-smoked salmon, marinated salmon, cold-smoked Greenland halibut, marinated Greenland halibut, and gravad salmon. MAP col...... characteristics required to prevent the growth of L. monocytogenes, thereby making it possible to identify critical control points, and is useful for compliance with the new European Union regulation on ready-to-eat foods (EC 2073/2005)....

  3. An insight into the isolation, enumeration and molecular detection of Listeria monocytogenes in food

    Directory of Open Access Journals (Sweden)

    Jodi Woan-Fei Law

    2015-11-01

    Full Text Available Listeria monocytogenes, a foodborne pathogen that can cause listeriosis through the consumption of food contaminated with this pathogen. The ability of L. monocytogenes to survive in extreme conditions and cause food contaminations have become a major concern. Hence, routine microbiological food testing is necessary to prevent food contamination and outbreaks of foodborne illness. This review provides insight into the methods for cultural detection, enumeration and molecular identification of L. monocytogenes in various food samples. There are a number of enrichment and plating media that can be used for the isolation of L. monocytogenes from food samples. Enrichment media such as buffered Listeria Enrichment Broth (BLEB, Fraser broth and University of Vermont Medium (UVM Listeria enrichment broth are recommended by regulatory agencies such as FDA-BAM, USDA-FSIS and ISO. Many plating media are available for the isolation of L. monocytogenes, for instance, PALCAM, Oxford and other chromogenic media. Besides, reference methods like FDA-BAM, ISO 11290 method and USDA-FSIS method are usually applied for the cultural detection or enumeration of L. monocytogenes. MPN technique is applied for the enumeration of L. monocytogenes in the case of low level contamination. Molecular methods including polymerase chain reaction (PCR, multiplex polymerase chain reaction (mPCR, real-time/quantitative polymerase chain reaction (qPCR, nucleic acid sequence-based amplification (NASBA, loop-mediated isothermal amplification (LAMP, DNA microarray and Next Generation Sequencing (NGS technology for the detection and identification of L. monocytogenes are discussed in this review. Overall, molecular methods are rapid, sensitive, specific, time- and labour-saving. In future, there are chances for the development of new techniques for the detection and identification of foodborne with improved features.

  4. Incidence of Listeria monocytogenes and Listeria spp. in a small-scale mushroom production facility.

    Science.gov (United States)

    Viswanath, Prema; Murugesan, Latha; Knabel, Stephen J; Verghese, Bindhu; Chikthimmah, Naveen; Laborde, Luke F

    2013-04-01

    Listeria monocytogenes is a foodborne pathogen of significant concern to the agricultural and food processing industry because of its ability to grow and persist in cool and moist environments and its association with listeriosis, a disease with a very high mortality rate. Although there have been no listeriosis outbreaks attributed to fresh mushrooms in the United States, retail surveys and recalls are evidence that L. monocytogenes contamination of mushrooms (Agaricus bisporus) can occur. The objective of this study was to determine the prevalence of Listeria spp., including L. monocytogenes, in a small-scale mushroom production facility on the campus of the Pennsylvania State University in the United States. Of 184 samples taken from five production zones within the facility, 29 (15.8%) samples were positive for Listeria spp. Among the Listeria spp. isolates, L. innocua was most prevalent (10.3%) followed by L. welshimeri (3.3%), L. monocytogenes (1.6%), and L. grayi (0.5%). L. monocytogenes was recovered only from the phase I raw material composting area. Isolates of L. monocytogenes were confirmed and serotyped by multiplex PCR. The epidemiological relatedness of the three L. monocytogenes isolates to those serotypes or lineages frequently encountered in listeriosis infections was determined by multi-virulence-locus sequence typing using six virulence genes, namely, prfA, inlB, inlC, dal, clpP, and lisR. The phylogenetic positions of the three isolates in the dendrogram prepared with data from other isolates of L. monocytogenes showed that all isolates were grouped with serotype 4a, lineage IIIA. To date, this serotype has rarely been reported in foodborne disease outbreaks.

  5. The influence of Listeria monocytogenes cells on the primary immunologic response in irradiated mice

    International Nuclear Information System (INIS)

    Borowski, J.; Jokoniuk, P.

    1977-01-01

    The influence of killed Listeria monocytogenes cells on the primary immunologic response in mice irradiated with 300 or 500 R was studied. The immunologic response of the mice to sheep red blood cells used as antigen was assessed at the cellular level (by counting PFC) and humoral level. Injection of killed Listeria monocytogenes cells before irradiation of the mice diminished the immunosuppressive effect of roentgen radiation. Injection of the cells after irradiation accelerated regeneration of immunologic reactivity in the irradiated mice. (author)

  6. Occurrence and antimicrobial resistance patterns of Listeria monocytogenes isolated from vegetables

    OpenAIRE

    Byrne,Vanessa de Vasconcelos; Hofer,Ernesto; Vallim,Deyse Christina; Almeida,Rogeria Comastri de Castro

    2016-01-01

    Abstract Although the consumption of fresh and minimally processed vegetables is considered healthy, outbreaks related to the contamination of these products are frequently reported. Among the food-borne pathogens that contaminate vegetables is Listeria monocytogenes, a ubiquitous organism that exhibits the ability to survive and multiply at refrigerated temperatures. This study aimed to evaluate the occurrence of L. monocytogenes in vegetables as well as the antimicrobial resistance of isola...

  7. Phenotypic and Genotypic Characteristics of Listeria monocytogenes Isolated From Dairy and Meat Products

    OpenAIRE

    Bahador; Sadeghi Kalani; Valian; Irajian; Lotfollahi

    2015-01-01

    Background Listeria monocytogenes is a foodborne pathogen and a serious threat to the public health in the world. Consumption of traditional foods such as dairy and meat products can be a major reason for relative abundance and isolation of these bacteria. Objectives The purpose of this study was to determine the phenotypic and genotypic characteristics of L. monocytogenes strains isolated from dairy and meat products. ...

  8. Dual-species biofilm of Listeria monocytogenes and Escherichia coli on stainless steel surface.

    Science.gov (United States)

    de Grandi, Aline Zago; Pinto, Uelinton Manoel; Destro, Maria Teresa

    2018-04-12

    Listeria monocytogenes is a Gram-positive bacterium commonly associated with foodborne diseases. Due its ability to survive under adverse environmental conditions and to form biofilm, this bacterium is a major concern for the food industry, since it can compromise sanitation procedures and increase the risk of post-processing contamination. Little is known about the interaction between L. monocytogenes and Gram-negative bacteria on biofilm formation. Thus, in order to evaluate this interaction, Escherichia coli and L. monocytogenes were tested for their ability to form biofilms together or in monoculture. We also aimed to evaluate the ability of L. monocytogenes 1/2a and its isogenic mutant strain (ΔprfA ΔsigB) to form biofilm in the presence of E. coli. We assessed the importance of the virulence regulators, PrfA and σ B , in this process since they are involved in many aspects of L. monocytogenes pathogenicity. Biofilm formation was assessed using stainless steel AISI 304 #4 slides immersed into brain heart infusion broth, reconstituted powder milk and E. coli preconditioned medium at 25 °C. Our results indicated that a higher amount of biofilm was formed by the wild type strain of L. monocytogenes than by its isogenic mutant, indicating that prfA and sigB are important for biofilm development, especially maturation under our experimental conditions. The presence of E. coli or its metabolites in preconditioned medium did not influence biofilm formation by L. monocytogenes. Our results confirm the possibility of concomitant biofilm formation by L. monocytogenes and E. coli, two bacteria of major significance in the food industry.

  9. MicroRNA-146a Deficiency Protects against Listeria monocytogenes Infection by Modulating the Gut Microbiota.

    Science.gov (United States)

    Du, Chong-Tao; Gao, Wei; Ma, Ke; Yu, Shui-Xing; Li, Na; Yan, Shi-Qing; Zhou, Feng-Hua; Liu, Zhen-Zhen; Chen, Wei; Lei, Lian-Cheng; Yang, Yong-Jun; Han, Wen-Yu

    2018-03-26

    The gut microbiota and microRNAs play important roles in the defense against infection. However, the role of miR-146a in L. monocytogenes infection and gut microbiota remains unclear. We tried to determine whether miR-146a controlled L. monocytogenes infection by regulating the gut microbiota. Wild-type and miR-146a-deficient mice or macrophages were used to characterize the impact of miR-146a on animal survival, cell death, bacterial clearance, and gut microbiota following L. monocytogenes challenge. We found that L. monocytogenes infection induced miR-146a expression both in vitro and in vivo. When compared to wild-type mice, miR-146a-deficient mice were more resistant to L. monocytogenes infection. MiR-146a deficiency in macrophages resulted in reduced invasion and intracellular survival of L. monocytogenes . High-throughput sequencing of 16S rRNA revealed that the gut microbiota composition differed between miR-146a-deficient and wild-type mice. Relative to wild-type mice, miR-146a-deficient mice had decreased levels of the Proteobacteria phylum, Prevotellaceae family, and Parasutterella genus, and significantly increased short-chain fatty acid producing bacteria, including the genera Alistipes , Blautia , Coprococcus_1, and Ruminococcus_1 . Wild-type mice co-housed with miR-146a-deficient mice had increased resistance to L. monocytogenes , indicating that miR-146a deficiency guides the gut microbiota to alleviate infection. Together, these results suggest that miR-146a deficiency protects against L. monocytogenes infection by regulating the gut microbiota.

  10. Control of Listeria monocytogenes in turkey deli loaves using organic acids as formulation ingredients.

    Science.gov (United States)

    Lloyd, T; Alvarado, C Z; Brashears, M M; Thompson, L D; McKee, S R; Berrang, M

    2009-10-01

    The growth of Listeria monocytogenes in further-processed meat products has become a major concern and an important food safety issue. The meat and poultry industries have incorporated interventions such as organic acids in marinades to inhibit the growth of L. monocytogenes. In this study, organic acids were utilized in the raw product and as a postcook dip to determine their inhibitory effect on the growth of L. monocytogenes in turkey deli loaves. The turkey deli loaves were processed, cooked, cooled, inoculated with streptomycin-resistant L. monocytogenes, and then dipped. Treatments were potassium lactate (PL) in the raw product with sodium lactate (SL), sodium diacetate (SD) dip, PL with SL/PL/SD dip, SL with SL/SD dip, and SL with SL/PL/SD dip. There was also a positive (inoculated) and negative (noninoculated) control, which was dipped in distilled water. Days 0, 7, 14, 21, 28, 42, and 56 were sampled for L. monocytogenes. There were no differences (P>0.05) among the organic acid treatments in the turkey deli loaves at any time points; therefore, all of the treatments increased the lag phase of L. monocytogenes, extending the shelf-life of the product. However, there was a difference between the treatments and the positive control at d 7, 14, 21, 28, 42, and 56. The growth of L. monocytogenes increased immediately in the positive control, whereas the negative control appeared to have no growth. These organic acids can provide meat processors with a useful method for extending the lag phase of L. monocytogenes in ready-to-eat meat and poultry products.

  11. Distribution of the bacteria Listeria monocytogenes in the western part of the Sea of Okhotsk

    Science.gov (United States)

    Terekhova, V. E.; Sosnin, V. A.; Buzoleva, L. S.; Shakirov, R. B.

    2010-04-01

    The Amur River’s influence on the distribution of the opportunistic bacteria Listeria monocytogenes in the western part of the Sea of Okhotsk is discussed. The presence of Listeria in the seawater, sea ice, and sediments on the northeastern Sakhalin shelf and slope supports the idea of its connection with the Amur River discharge. The hypothesis of the allochtonic parentage of L. monocytogenes in the sea’s development is proved.

  12. Longitudinal monitoring of Listeria monocytogenes and Listeria phages in seafood processing environments in Thailand.

    Science.gov (United States)

    Vongkamjan, Kitiya; Benjakul, Soottawat; Kim Vu, Hue Thi; Vuddhakul, Varaporn

    2017-09-01

    Listeria monocytogenes is a foodborne pathogen commonly found in environments of seafood processing, thus presenting a challenge for eradication from seafood processing facilities. Monitoring the prevalence and subtype diversity of L. monocytogenes together with phages that are specific to Listeria spp. ("Listeria phages") will provide knowledge on the bacteria-phage ecology in food processing plants. In this work, a total of 595 samples were collected from raw material, finished seafood products and environmental samples from different sites of a seafood processing plant during 17 sampling visits in 1.5 years of study. L. monocytogenes and Listeria spp. (non-monocytogenes) were found in 22 (3.7%) and 43 (7.2%) samples, respectively, whereas 29 Listeria phages were isolated from 9 (1.5%) phage-positive samples. DNA fingerprint analysis of L. monocytogenes isolates revealed 11 Random Amplified Polymorphic DNA (RAPD) profiles, with two subtypes were frequently observed over time. Our data reveal a presence of Listeria phages within the same seafood processing environments where a diverse set of L. monocytogenes subtypes was also found. Although serotype 4b was observed at lower frequency, data indicate that isolates from this seafood processing plant belonged to both epidemiologically important serotypes 1/2a and 4b, which may suggest a potential public health risk. Phages (all showed a unique genome size of 65 ± 2 kb) were classified into 9 host range groups, representing both broad- and narrow-host range. While most L. monocytogenes isolates from this facility were susceptible to phages, five isolates showed resistance to 12-20 phages. Variations in phage host range among Listeria phages isolated from food processing plant may affect a presence of a diverse set of L. monocytogenes isolates derived from the same processing environment in Thailand. Copyright © 2017 Elsevier Ltd. All rights reserved.

  13. An insight into the isolation, enumeration, and molecular detection of Listeria monocytogenes in food

    Science.gov (United States)

    Law, Jodi Woan-Fei; Ab Mutalib, Nurul-Syakima; Chan, Kok-Gan; Lee, Learn-Han

    2015-01-01

    Listeria monocytogenes, a foodborne pathogen that can cause listeriosis through the consumption of food contaminated with this pathogen. The ability of L. monocytogenes to survive in extreme conditions and cause food contaminations have become a major concern. Hence, routine microbiological food testing is necessary to prevent food contamination and outbreaks of foodborne illness. This review provides insight into the methods for cultural detection, enumeration, and molecular identification of L. monocytogenes in various food samples. There are a number of enrichment and plating media that can be used for the isolation of L. monocytogenes from food samples. Enrichment media such as buffered Listeria enrichment broth, Fraser broth, and University of Vermont Medium (UVM) Listeria enrichment broth are recommended by regulatory agencies such as Food and Drug Administration-bacteriological and analytical method (FDA-BAM), US Department of Agriculture-Food and Safety (USDA-FSIS), and International Organization for Standardization (ISO). Many plating media are available for the isolation of L. monocytogenes, for instance, polymyxin acriflavin lithium-chloride ceftazidime aesculin mannitol, Oxford, and other chromogenic media. Besides, reference methods like FDA-BAM, ISO 11290 method, and USDA-FSIS method are usually applied for the cultural detection or enumeration of L. monocytogenes. most probable number technique is applied for the enumeration of L. monocytogenes in the case of low level contamination. Molecular methods including polymerase chain reaction, multiplex polymerase chain reaction, real-time/quantitative polymerase chain reaction, nucleic acid sequence-based amplification, loop-mediated isothermal amplification, DNA microarray, and next generation sequencing technology for the detection and identification of L. monocytogenes are discussed in this review. Overall, molecular methods are rapid, sensitive, specific, time- and labor-saving. In future, there are

  14. Schools (Students) Exchanging CAD/CAM Files over the Internet.

    Science.gov (United States)

    Mahoney, Gary S.; Smallwood, James E.

    This document discusses how students and schools can benefit from exchanging computer-aided design/computer-aided manufacturing (CAD/CAM) files over the Internet, explains how files are exchanged, and examines the problem of selected hardware/software incompatibility. Key terms associated with information search services are defined, and several…

  15. Parallel file system with metadata distributed across partitioned key-value store c

    Science.gov (United States)

    Bent, John M.; Faibish, Sorin; Grider, Gary; Torres, Aaron

    2017-09-19

    Improved techniques are provided for storing metadata associated with a plurality of sub-files associated with a single shared file in a parallel file system. The shared file is generated by a plurality of applications executing on a plurality of compute nodes. A compute node implements a Parallel Log Structured File System (PLFS) library to store at least one portion of the shared file generated by an application executing on the compute node and metadata for the at least one portion of the shared file on one or more object storage servers. The compute node is also configured to implement a partitioned data store for storing a partition of the metadata for the shared file, wherein the partitioned data store communicates with partitioned data stores on other compute nodes using a message passing interface. The partitioned data store can be implemented, for example, using Multidimensional Data Hashing Indexing Middleware (MDHIM).

  16. Molecular analysis of the iap gene of Listeria monocytogenes isolated from cheeses in Rio Grande do Sul, Brazil Análise molecular do gene iap de Listeria monocytogenes isoladas de queijos no Estado do Rio Grande do Sul, Brasil

    Directory of Open Access Journals (Sweden)

    Jozi Fagundes de Mello

    2008-03-01

    Full Text Available The polymorphic region sequences in the iap gene were analyzed in 25 strains of Listeria monocytogenes isolated from cheeses in the state of Rio Grande do Sul, and compared with reference strains. This investigation distinguished two clusters of L. monocytogenes: I (20 strains and II (5 strains.A seqüência da região polimórfica do gene iap foi analisada em 25 cepas de Listeria monocytogenes isoladas de queijo no Estado do Rio Grande do Sul e comparadas com cepas referências. Esta investigação distinguiu L. monocytogenes em dois grupos: I (20 cepas e II (5 cepas.

  17. Frequency of contamination Listeria monocytogenes of raw dried cured vacuum packed sausages

    Directory of Open Access Journals (Sweden)

    Hristo Daskalov

    2014-03-01

    Full Text Available The aim of this study was to collect actual data concerning the frequency of contamination with Listeria monocytogenes of some very popular in Bulgaria raw dried cured vacuum packed sausages, produced from October 2004 till May 2008. 148 vacuum-packed samples were taken from 9 different food business operators during all seasons of the year. The samples were analyzed according to USDA method for meat foods. Ten specimens were positive for presence of Listeria monocytogenes equal to 6,75% of all tested samples. In two other raw dried cured sausages L.welshimeri and L.innocua were found, but these species are not pathogenic for consumers. In the period before the official implementation of HACCP system (01.01.2006 in Bulgaria, 52 samples were examined and 5 Listeria monocytogenes isolates were found (~10%. 2,5 years after the HACCP implementation, 96 specimens from the same meat factories were tested and 5 Listeria monocytogenes isolates (5,2% were detected. Samples taken from lots, produced in winter time were contaminated with Listeria monocytogenes more often (7 of all 10 than specimens taken during other seasons. Data were discussed through the point of view of the effectiveness of hygienic practices and HACCP system application. Also, application of ‘microbiological criterion’ set in COMMISSION REGULATION (EC No 2073/2005 for ready-to-eat foods unable to support the growth of L. monocytogenes was considered.

  18. An outbreak of an unusual strain of Listeria monocytogenes infection in North-East Scotland

    Directory of Open Access Journals (Sweden)

    Emmanuel Okpo

    2015-11-01

    Full Text Available Summary: Listeria monocytogenes infection is an important cause of illness and hospitalization in vulnerable individuals. In the present study, we describe a community outbreak of Listeria monocytogenes in the North-East region of Scotland, which was epidemiologically, environmentally and microbiologically linked to a local meat product and ready-to-eat product manufacturer. Infected individuals were interviewed, and an environmental investigation was conducted. Clinical and environmental samples were tested by culture, and isolates were typed by fluorescent amplified fragment length polymorphism (fAFLP. Three cases of Listeria monocytogenes were linked geographically, had the same serotype (1/2a and were indistinguishable by fAFLP type XII.6. The human, food and environmental isolates were of the same serotype and were indistinguishable by molecular typing.This is the first community outbreak of L. monocytogenes reported in Scotland since the current outbreak surveillance was established in 1996. Epidemiological and laboratory evidence indicated poor hand hygiene, unhygienic practices and cross-contamination throughout the manufacturing process of ready-to-eat foods as a possible cause of the outbreak. More stringent control of commercial food establishments that provide ready-to-eat food and the need to advise specifically vulnerable groups, e.g., pregnant women, of the risk of L. monocytogenes in ready-to-eat food is urgently needed. Keywords: Listeria monocytogenes, Outbreak, Foodborne, Community acquired infection, Listeriosis

  19. Antimicrobial resistance of Listeria monocytogenes isolated from dairy-based food products.

    Science.gov (United States)

    Harakeh, Steve; Saleh, Imane; Zouhairi, Omar; Baydoun, Elias; Barbour, Elie; Alwan, Nisreen

    2009-06-15

    In this study Listeria monocytogenes (L. monocytogenes) was isolated from three traditionally consumed Lebanese dairy-based food products. One hundred and sixty four samples (45 samples of Baladi cheese, 36 samples of Shankleesh and 83 of Kishk) were collected from the Bekaa Valley in the Northeast region of Lebanon. Suspected Listeria colonies were selected and initially identified by using standard biochemical tests. Initial identification of the positive L. monocytogenes colonies was confirmed at the molecular level by Polymerase Chain Reaction (n=30) and the confirmed isolates were evaluated for their susceptibility to 10 commonly used antimicrobials. All of the 30 isolates were confirmed to be L. monocytogenes yielding a PCR product of approximately 660 base pairs (bp). L. monocytogenes was detected in 26.67%, 13.89% and 7.23% of the Baladi cheese, Shankleesh and Kishk samples, respectively. The highest resistance in L. monocytogenes isolates was noted against oxacillin (93.33%) followed by penicillin (90%). The results provide an indication of the contamination levels of dairy-based foods in Lebanon and highlight the emergence of multi-drug resistant Listeria in the environment.

  20. Prevalence and serotypes of Listeria monocytogenes contamination in Chinese beef processing plants.

    Science.gov (United States)

    Zhu, Lixian; Feng, Xiaohui; Zhang, Lihua; Zhu, Ruiliang; Luo, Xin

    2012-06-01

    The aim of this work was to study the epidemiology of Listeria spp., particularly Listeria monocytogenes, and to identify the serotypes present in contaminated samples from beef processing plants in China. A total of 439 samples were obtained from bovine feces, hides, and carcasses at three commercial processing plants. A standard protocol (ISO 11290-1) was followed to detect Listeria spp. and L. monocytogenes, and multiplex polymerase chain reaction was used to identify the various L. monocytogenes serotypes. The overall prevalences of Listeria spp. and L. monocytogenes were 65.6% and 26.4%, respectively, and the contamination was highest in the hide samples. The identified L. monocytogenes serotypes were 1/2c and 1/2a. The results of the current study indicate that Listeria spp. contamination is common in Chinese beef processing plants; specific measures should be taken to prevent and/or treat L. monocytogenes contamination of feces and hides in beef slaughter plants. Furthermore, because Listeria spp. contamination was found to be prevalent, it should, therefore, be studied further. The prevention of cases of sporadic listeriosis in China should also be addressed.

  1. Prevalence of Listeria monocytogenes in raw bovine milk and milk products from central highlands of Ethiopia.

    Science.gov (United States)

    Seyoum, Eyasu Tigabu; Woldetsadik, Daniel Asrat; Mekonen, Tesfu Kassa; Gezahegn, Haile Alemayehu; Gebreyes, Wondwossen Abebe

    2015-11-30

    Listeria monocytogenes is of major significance in human and veterinary medicine. Most human Listeria infections are foodborne and the association of contaminated milk and dairy produce consumption with human listeriosis is noteworthy. In Ethiopia, there is limited data regarding the prevalence of L. monocytogenes in raw bovine milk and dairy products. The aim of this study was, therefore, to determine the prevalence of L. monocytogenes in raw bovine milk and dairy produce. A total of 443 milk and milk product samples were microbiologically analyzed following methods recommended by the U.S. Food and Drug Administration Bacteriological Analytical Manual to isolate Listeria spp. The overall prevalence of Listeria spp. was 28.4% and specifically that of L. monocytogenes was 5.6%. Taking the prevalence of Listeria spp. into consideration, cheese was found to be highly contaminated at 60%, followed by pasteurized milk samples (40%), raw milk (18.9%) and yoghurt (5%). Considering the prevalence of Listeria monocytogenes only, raw milk had the lowest contamination while cheese had the highest, followed by pasteurized milk and yoghurt. Raw milk and milk products produced in urban and peri-urban areas of central Ethiopia were contaminated with pathogenic bacteria, L. monocytogenes. The detection of this pathogen in raw milk and milk products warrants an urgent regulatory mechanism to be put in place and also the potential role of milk processing plants in the contamination of dairy products should be investigated.

  2. Phenotypic and Genotypic Characteristics of Listeria monocytogenes Isolated From Dairy and Meat Products

    Directory of Open Access Journals (Sweden)

    Bahador

    2015-08-01

    Full Text Available Background Listeria monocytogenes is a foodborne pathogen and a serious threat to the public health in the world. Consumption of traditional foods such as dairy and meat products can be a major reason for relative abundance and isolation of these bacteria. Objectives The purpose of this study was to determine the phenotypic and genotypic characteristics of L. monocytogenes strains isolated from dairy and meat products. Materials and Methods A total of 317 dairy products and meat-processed samples were collected. Antibiotic susceptibility test was performed on each sample by the disk diffusion method (Kirby Bauer. Five reference loci were used for typing of L. monocytogenes strains by MLVA (Multiple Locus VNTR Analysis Technique. Results A total of 24 L. monocytogenes isolates were collected from the dairy and meat products. Resistance of isolated L. monocytogenes strains to penicillin G were 54.54% (from dairy products and 46.15% (from processed meat. Genetic relatedness of isolates were assessed by MLVA. Out of 13 different types, type 2 with 6 strains and type 3 with 4 strains, were the most common types. Conclusions MLVA analysis showed that samples obtained from different sources could have similar genetic profile. As a result, administration of penicillin in patients with listeriosis (especially pregnant women and antibiotic susceptibility test are recommended. The fast and accurate methods such as MLVA for tracking of pollution sources of L. monocytogenes are recommended during outbreaks.

  3. Listeria monocytogenes infection of HD11, chicken macrophage-like cells.

    Science.gov (United States)

    Jarvis, N A; Donaldson, J R; O'Bryan, C A; Ricke, S C; Crandall, P G

    2017-04-01

    Listeria monocytogenes can be carried by and infect poultry, although the clinical disease in birds is rare. Escape from macrophage phagocytosis is a key step in pathogenesis for L. monocytogenes. Therefore, we investigated the infection of the chicken macrophage-like cell line HD11 with 2 strains of L. monocytogenes EGD-e and Scott A. After infection, L. monocytogenes was quantified by spread plating and HD11 was quantified with trypan blue exclusion stain before enumeration. The standard macrophage killing protocols require washing the cell monolayers 3 times with PBS, which was found to negatively influence HD11 monolayers. Maximum bacterial densities within macrophages were not different between the 2 Listeria strains. HD11 required more than 11 h to effectively reduce intracellular L. monocytogenes Scott A, and Scott A was more susceptible to HD11 killing than EGD-e. It appears that Listeria infection initially causes attenuation of HD11 growth, and infected HD11 cells do not begin to lyse until at least 11 h post infection. These results suggest that there are subtle strain to strain differences in response to HD11 macrophage phagocytosis. The long lead-time required for HD11 to kill L. monocytogenes cells means that there is sufficient time available for chicken macrophages to circulate in the blood and transfer the intracellular Listeria to multiple tissues. © 2016 Poultry Science Association Inc.

  4. Factors associated with Listeria monocytogenes contamination of cold-smoked pork products produced in Latvia and Lithuania.

    OpenAIRE

    Berzins,-A; Horman,-A; Lunden,-J; Korkeala,-H

    2007-01-01

    A total of 312 samples of sliced, vacuum packaged, cold-smoked pork from 15 meat processing plants in Latvia and Lithuania, obtained over a 15-month period from 2003 until 2004, were analyzed for the presence of Listeria monocytogenes at the end of their shelf-life. Overall, 120 samples (38%) tested positive for L. monocytogenes. Despite the long storing period, the levels of L. monocytogenes in cold-smoked pork products were low. Manufacturing processes were studied at seven meat processing ...

  5. Spontaneous Bacterial Peritonitis Caused by Infection with Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Michael Vincent F. Tablang

    2008-11-01

    Full Text Available Spontaneous bacterial peritonitis is a severe and life-threatening complication in patients with ascites caused by advanced liver disease. The organisms most commonly involved are coliform bacteria and third-generation cephalosporins are the empiric antibiotics of choice. This is an uncommon case of spontaneous bacterial peritonitis caused by Listeria monocytogenes in a female patient with liver cirrhosis from autoimmune hepatitis. She did not improve with ceftriaxone and her course was complicated by hepatic encephalopathy, seizures and multi-organ failure. This case emphasizes that a high index of suspicion should be maintained for timely diagnosis and treatment. Listerial peritonitis should be suspected in patients with end-stage liver disease and inadequate response to conventional antibiotics within 48–72 h. Ampicillin/sulbactam should be initiated while awaiting results of ascitic fluid or blood culture.

  6. The Effect of Oxygen on Bile Resistance in Listeria monocytogenes

    Science.gov (United States)

    Wright, Morgan L; Pendarvis, Ken; Nanduri, Bindu; Edelmann, Mariola J; Jenkins, Haley N; Reddy, Joseph S; Wilson, Jessica G; Ding, Xuan; Broadway, Paul R; Ammari, Mais G; Paul, Oindrila; Roberts, Brandy; Donaldson, Janet R

    2016-01-01

    Listeria monocytogenes is a Gram-positive facultative anaerobe that is the causative agent of the disease listeriosis. The infectious ability of this bacterium is dependent upon resistance to stressors encountered within the gastrointestinal tract, including bile. Previous studies have indicated bile salt hydrolase activity increases under anaerobic conditions, suggesting anaerobic conditions influence stress responses. Therefore, the goal of this study was to determine if reduced oxygen availability increased bile resistance of L. monocytogenes. Four strains representing three serovars were evaluated for changes in viability and proteome expression following exposure to bile in aerobic or anaerobic conditions. Viability for F2365 (serovar 4b), EGD-e (serovar 1/2a), and 10403S (serovar 1/2a) increased following exposure to 10% porcine bile under anaerobic conditions (P 0.05) in bile resistance between aerobic and anaerobic conditions, indicating that oxygen availability does not influence resistance in this strain. The proteomic analysis indicated F2365 and EGD-e had an increased expression of proteins associated with cell envelope and membrane bioenergetics under anaerobic conditions, including thioredoxin-disulfide reductase and cell division proteins. Interestingly, HCC23 had an increase in several dehydrogenases following exposure to bile under aerobic conditions, suggesting that the NADH:NAD+ is altered and may impact bile resistance. Variations were observed in the expression of the cell shape proteins between strains, which corresponded to morphological differences observed by scanning electron microscopy. These data indicate that oxygen availability influences bile resistance. Further research is needed to decipher how these changes in metabolism impact pathogenicity in vivo and also the impact that this has on susceptibility of a host to listeriosis. PMID:27274623

  7. Listeria monocytogenes Meningitis in an Immunosuppressed Patient with Autoimmune Hepatitis and IgG4 Subclass Deficiency

    DEFF Research Database (Denmark)

    Gaini, Shahin

    2015-01-01

    A 51-year-old Caucasian woman with Listeria monocytogenes meningitis was treated and discharged after an uncomplicated course. Her medical history included immunosuppressive treatment with prednisolone and azathioprine for autoimmune hepatitis. A diagnostic work-up after the meningitis episode...... revealed that she had low levels of the IgG4 subclass. To our knowledge, this is the first case report describing a possible association between autoimmune hepatitis and the occurrence of Listeria monocytogenes meningitis, describing a possible association between Listeria monocytogenes meningitis...... and deficiency of the IgG4 subclass and finally describing a possible association between Listeria monocytogenes meningitis and immunosuppressive therapy with prednisolone and azathioprine....

  8. Symptomatic hydrocephalus in a newborn infected with listeria monocytogenes Hidrocefalia sintomática em um recém-nascido infectado com Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Analía L. Laciar

    2000-03-01

    Full Text Available Central nervous system infections caused by Listeria monocytogenes produce a wide range of clinical symptoms which include cerebral abscesses, meningitis and nonmeningitic parenchymal cerebritis. A case study is presented of early listeriosis with signs of meningitis accompanied with septicemia and complicated with severe hydrocephalus.As infecções do sistema nervoso central produzidas por Listeria monocytogenes provocam una grande variedade de sintomas clínicos que incluem abscessos cerebrais, meningites e cerebrites parenquimáticas não meningíticas. Apresenta-se um caso de listeriose precoce com sinais de meningite acompanhada de septicemia e agravado com hidrocefalia grave.

  9. Peregrine System | High-Performance Computing | NREL

    Science.gov (United States)

    classes of nodes that users access: Login Nodes Peregrine has four login nodes, each of which has Intel E5 /scratch file systems, the /mss file system is mounted on all login nodes. Compute Nodes Peregrine has 2592

  10. Provider of Services File

    Data.gov (United States)

    U.S. Department of Health & Human Services — The POS file consists of two data files, one for CLIA labs and one for 18 other provider types. The file names are CLIA and OTHER. If downloading the file, note it...

  11. PC Graphic file programing

    International Nuclear Information System (INIS)

    Yang, Jin Seok

    1993-04-01

    This book gives description of basic of graphic knowledge and understanding and realization of graphic file form. The first part deals with graphic with graphic data, store of graphic data and compress of data, programing language such as assembling, stack, compile and link of program and practice and debugging. The next part mentions graphic file form such as Mac paint file, GEM/IMG file, PCX file, GIF file, and TIFF file, consideration of hardware like mono screen driver and color screen driver in high speed, basic conception of dithering and conversion of formality.

  12. Methods and Algorithms for Detecting Objects in Video Files

    Directory of Open Access Journals (Sweden)

    Nguyen The Cuong

    2018-01-01

    Full Text Available Video files are files that store motion pictures and sounds like in real life. In today's world, the need for automated processing of information in video files is increasing. Automated processing of information has a wide range of application including office/home surveillance cameras, traffic control, sports applications, remote object detection, and others. In particular, detection and tracking of object movement in video file plays an important role. This article describes the methods of detecting objects in video files. Today, this problem in the field of computer vision is being studied worldwide.

  13. Efficacy of chlorine dioxide against Listeria monocytogenes in brine chilling solutions.

    Science.gov (United States)

    Valderrama, W B; Mills, E W; Cutter, C N

    2009-11-01

    Chilled brine solutions are used by the food industry to rapidly cool ready-to-eat meat products after cooking and before packaging. Chlorine dioxide (ClO(2)) was investigated as an antimicrobial additive to eliminate Listeria monocytogenes. Several experiments were performed using brine solutions made of sodium chloride (NaCl) and calcium chloride (CaCl(2)) inoculated with L. monocytogenes and/or treated with 3 ppm of ClO(2). First, 10 and 20% CaCl(2) and NaCl solutions (pH 7.0) were inoculated with a five-strain cocktail of L. monocytogenes to obtain approximately 7 log CFU/ml and incubated 8 h at 0 degrees C. The results demonstrated that L. monocytogenes survived in 10% CaCl(2), 10 and 20% NaCl, and pure water. L. monocytogenes levels were reduced approximately 1.2 log CFU/ml in 20% CaCl(2). Second, inoculated ( approximately 7 log CFU/ml) brine solutions (10 and 20% NaCl and 10% CaCl(2)) treated with 3 ppm of ClO(2) resulted in a approximately 4-log reduction of the pathogen within 90 s. The same was not observed in a solution of 20% CaCl(2); further investigation demonstrated that high levels of divalent cations interfere with the disinfectant. Spent brine solutions from hot dog and ham chilling were treated with ClO(2) at concentrations of 3 or 30 ppm. At these concentrations, ClO(2) did not reduce L. monocytogenes. Removal of divalent cations and organic material in brine solutions prior to disinfection with ClO(2) should be investigated to improve the efficacy of the compound against L. monocytogenes. The information from this study may be useful to processing establishments and researchers who are investigating antimicrobials in chilling brine solutions.

  14. Thermal Inactivation of Listeria monocytogenes and Salmonella during Water and Steam Blanching of Vegetables.

    Science.gov (United States)

    Ceylan, Erdogan; McMahon, Wendy; Garren, Donna M

    2017-09-01

    Thermal inactivation of Listeria monocytogenes and Salmonella was evaluated on peas, spinach, broccoli, potatoes, and carrots that were treated with hot water and steam. One gram-positive bacterium, L. monocytogenes, and one gram-negative bacterium, Salmonella, were selected as pertinent human pathogens for evaluation. Samples were inoculated with a composite of five strains each of L. monocytogenes and Salmonella to achieve approximately 10 8 to 10 9 CFU/g. Inoculated samples were treated with hot water at 85 and 87.8°C and with steam at 85 and 96.7°C for up to 3.5 min. A greater than 5-log reduction of L. monocytogenes and Salmonella was achieved on all products within 0.5 min by hot water blanching at 85 and 87.8°C. Steam blanching at 85°C reduced Salmonella populations by greater than 5 log on spinach and peas within 2 min and on carrots and broccoli within 3.5 min. Populations of Salmonella were reduced by more than 5 log within 1 min on carrot, spinach, and broccoli and within 2 min on peas by steam blanching at 96.7°C. Steam blanching at 85°C reduced L. monocytogenes populations by more than 5 log on carrots and spinach within 2 min and on broccoli and peas within 3.5 min. L. monocytogenes populations were reduced more than 5 log within 1 min on carrot, spinach, peas and broccoli by steam blanching at 96.7°C. Longer treatment times and higher temperatures were required for steam-blanched samples than for samples blanched with hot water. Results suggest that hot water and steam blanching practices commonly used by the frozen vegetable industry will achieve the desired 5-log lethality of L. monocytogenes and Salmonella and will enhance microbiological safety prior to freezing.

  15. Prevalence and Persistence of Listeria monocytogenes in Ready-to-Eat Tilapia Sashimi Processing Plants.

    Science.gov (United States)

    Chen, Bang-Yuan; Wang, Chung-Yi; Wang, Chia-Lan; Fan, Yang-Chi; Weng, I-Ting; Chou, Chung-Hsi

    2016-11-01

    A 2-year study was performed at two ready-to-eat tilapia sashimi processing plants (A and B) to identify possible routes of contamination with Listeria monocytogenes during processing. Samples were collected from the aquaculture environments, transportation tanks, processing plants, and final products. Seventy-nine L. monocytogenes isolates were found in the processing environments and final products; 3.96% (50 of 1,264 samples) and 3.86% (29 of 752 samples) of the samples from plants A and B, respectively, were positive for L. monocytogenes . No L. monocytogenes was detected in the aquaculture environments or transportation tanks. The predominant L. monocytogenes serotypes were 1/2b (55.70%) and 4b (37.97%); serotypes 3b and 4e were detected at much lower percentages. At both plants, most processing sections were contaminated with L. monocytogenes before the start of processing, which indicated that the cleaning and sanitizing methods did not achieve adequate pathogen removal. Eleven seropulsotypes were revealed by pulsed-field gel electrophoresis and serotyping. Analysis of seropulsotype distribution revealed that the contamination was disseminated by the processing work; the same seropulsotypes were repeatedly found along the work flow line and in the final products. Specific seropulsotypes were persistently found during different sampling periods, which suggests that the sanitation procedures or equipment used at these plants were inadequate. Plant staff should improve the sanitation procedures and equipment to reduce the risk of L. monocytogenes cross-contamination and ensure the safety of ready-to-eat tilapia products.

  16. Prevalence of Listeria monocytogenes in ready-to-eat seafood marketed in Thessaloniki (Northern Greece

    Directory of Open Access Journals (Sweden)

    N. Soultos

    2014-11-01

    Full Text Available Aim: In the current study, a contribution to the knowledge on the prevalence and level of contamination of Listeria monocytogenes in ready-to-eat (RTE seafood marketed in Thessaloniki (Northern Greece was provided; the serovar identity of the L. monocytogenes isolates was also determined. Materials and Methods: A total of 132 RTE seafood samples consisting of 74 smoked fish products, 18 salted fish products, 16 dried fish products, 9 raw marinated fish products, 10 cooked marinated cephalopods and 5 surimi crab stick products were analyzed. L. monocytogenes were isolated and enumerated based on ISO 11290-1/A1 and ISO 11290-2/A1 protocols, respectively, and identified using a multiplex polymerase chain reaction (PCR system utilizing genus and species specific primers. For the identification of serotypes a second multiplex PCR assay was used which clusters L. monocytogenes strains into four major serogroups. Results: Of the samples examined, 11 (8.3% proved positive for Listeria spp. with 8 (6.1% yielding L. monocytogenes. Only in one sample of smoked mackerel the level of L. monocytogenes exceeded the legal safety limit of 100 cfu/g set out in Commission Regulation (EC No. 1441/2007. Serotyping showed higher percentages of isolates belonging to PCR serogroup 3:1/2b, 3b, 7 (46.7% and serogroup 1:1/2a, 3a (40% followed by serogroup 4:4b, 4d, 4e (13.3%. Conclusion: This study demonstrated that L. monocytogenes can be isolated from processed RTE seafood products at retail in Thessaloniki (Northern Greece in low concentrations. However, the presence of this human pathogen in RTE seafood should not be overlooked, but it should be considered as having significance public health implications, particularly among the persons who are at greater risk. Therefore, RTE seafood should be produced under appropriate hygienic and technological conditions since the product does not undergo any treatment before consumption.

  17. Mechanism of Nisin, Pediocin 34, and Enterocin FH99 Resistance in Listeria monocytogenes.

    Science.gov (United States)

    Kaur, Gurpreet; Singh, Tejinder Pal; Malik, Ravinder Kumar; Bhardwaj, Arun

    2012-03-01

    Nisin-, pediocin 34-, and enterocin FH99-resistant variants of Listeria monocytogenes ATCC 53135 were developed. In an attempt to clarify the possible mechanisms underlying bacteriocin resistance in L. monocytogenes ATCC 53135, sensitivity of the resistant strains of L. monocytogenes ATCC 53135 to nisin, pediocin 34, and enterocin FH99 in the absence and presence of different divalent cations was assessed, and the results showed that the addition of divalent cations significantly reduced the inhibitory activity of nisin, pediocin 34, and enterocin FH99 against resistant variants of L. monocytogenes ATCC 53135. The addition of EDTA, however, restored this activity suggesting that the divalent cations seem to affect the initial electrostatic interaction between the positively charged bacteriocin and the negatively charged phospholipids of the membrane. Nisin-, pediocin 34-, and enterocin-resistant variants of L. monocytogenes ATCC 53135 were more resistant to lysozyme as compared to the wild-type strain both in the presence as well as absence of nisin, pediocin 34, and enterocin FH99. Ultra structural profiles of bacteriocin-sensitive L. monocytogenes and its bacteriocin-resistant counterparts revealed that the cells of wild-type strain of L. monocytogenes were maximally in pairs or short chains, whereas, its nisin-, pediocin 34-, and enterocin FH99-resistant variants tend to form aggregates. Results indicated that without a cell wall, the acquired nisin, pediocin 34, and enterocin FH99 resistance of the variants was lost. Although the bacteriocin-resistant variants appeared to lose their acquired resistance toward nisin, pediocin 34, and enterocin FH99, the protoplasts of the resistant variants appeared to be more resistant to bacteriocins than the protoplasts of their wild-type counterparts.

  18. Assessment of Listeria monocytogenes virulence in the Galleria mellonella insect larvae model.

    Science.gov (United States)

    Rakic Martinez, Mira; Wiedmann, Martin; Ferguson, Martine; Datta, Atin R

    2017-01-01

    Several animal models have been used to understand the molecular basis of the pathogenicity, infectious dose and strain to strain variation of Listeria monocytogenes. The greater wax worm Galleria mellonella, as an alternative model, provides some useful advantages not available with other models and has already been described as suitable for the virulence assessment of various pathogens including L. monocytogenes. The objectives of this study are: 1) confirming the usefulness of this model with a wide panel of Listeria spp. including non-pathogenic L. innocua, L. seeligeri, L. welshimeri and animal pathogen L. ivanovii; 2) assessment of virulence of several isogenic in-frame deletion mutants in virulence and stress related genes of L. monocytogenes and 3) virulence assessment of paired food and clinical isolates of L. monocytogenes from 14 major listeriosis outbreaks occurred worldwide between 1980 and 2015. Larvae injected with different concentrations of Listeria were incubated at 37°C and monitored over seven days for time needed to kill 50% of larvae (LT50) and to determine change of bacterial population in G. mellonella, 2 and 24 hours post-inoculation. Non-pathogenic members of Listeria and L. ivanovii showed significantly (P monocytogenes strains. Isogenic mutants of L. monocytogenes with the deletions in prfA, plcA, hly, actA and virR genes, also showed significantly (P monocytogenes strains related to non-invasive (gastroenteritis) outbreaks of listeriosis showed significantly (P < 0.05) lower virulence than isolates of the same serotype obtained from outbreaks with invasive symptoms. The difference, however, was dose and strain- dependent. No significant differences in virulence were observed among the serotype tested in this study.

  19. Listeria monocytogenes meningitis in the elderly: epidemiological, clinical and therapeutic findings.

    Science.gov (United States)

    Pagliano, Pasquale; Ascione, Tiziana; Boccia, Giovanni; De Caro, Francesco; Esposito, Silvano

    2016-06-01

    Listeria monocytogenes is a Gram-positive bacillus and facultative intracellular bacterium whose transmission occurs mainly through the consumption of contaminated food, L. monocytogenes invades the host cells using various protein and can escape to the human T-cell immune system by cell-to-cell spreading. If the infection is not controlled at the stage in which the bacterium is in the liver, for instance, due to a severe immunodepression, a secondary bacteraemia can be developed and L. monocytogenes reaches the preferred sites transgressing the blood-brain barrier or the placental barrier. Individuals with T-cell dysfunction, such as pregnant women, the elderly, and those receiving immunosuppressive therapy are at the highest risk of contracting the disease. Average life expectancy throughout developed countries has rapidly increased during the latter half of the 20th century and geriatric infectious diseases have become an increasingly important issue. L. monocytogenes meningitis in young previously healthy adults has been reported only in anecdotal observations. Differently, L. monocytogenes is the third most common cause of bacterial meningitis in the elderly population, after Streptococcus pneumoniae and Neisseria meningitidis. Patients with L. monocytogenes meningitis presented with signs and symptoms that were similar to those of the general population with community-acquired bacterial meningitis, but reported a longer prodromal phase. According to literature data, the prevalence of the classic triad of fever, neck stiffness, and altered mental status is 43%, and almost all patients present with at least 2 of the 4 classic symptoms of headache, fever, neck stiffness, and altered mental status. On the basis of our published data, in patients aged over 50 years, diagnosing L. monocytogenes meningitis was more challenging than pneumococcal meningitis, as demonstrated by the lower percentage of cases receiving a correct diagnosis within 48 hours from the onset

  20. Inhibitory Effect of Nisin on Listeria monocytogenes Inoculated into Surimi and Minced Meat

    Directory of Open Access Journals (Sweden)

    Masoud Rezaei

    2012-02-01

    Full Text Available Background & Objective: Listeria monocytogenes has already established as an important food born pathogen which induce listeriosis in human. Use of bacteriocins to provide food safety has been increased dramatically. Nisin has a wide spectrum inhibitory effect than the other bacteriocins and inhibits food-borne pathogens such as L. monocytogenes and many other Gram-positive spoilage microorganisms. The purpose of this study was to investigate the inhibitory effect of Nisin on population of Listeria monocytogenes and the role of changes in food components on the antilisterial properties of Nisin. Materials & Methods: The minced meat and surimi samples were inoculated by 1×104 cfu/g of L. monocytogenes. Then samples exposed to Nisin at the levels of 500 or 1000 IU/g were prepared. All treatments after packaging in plastic bags were kept for 12 days at refrigerator temperature. Samples were cultured on CHROMagarTM Listeria every 2 days and the number of listeria monocytogenes was counted. Results: two different concentrations of Nisin (500 or 1000 IU/g was not able to inhibit L. monocytogenes below the acceptable level for raw food (100 cells per g in minced meat and surimi of silver carp. But the number of bacteria reduces more in fish surimi as compared to the mince meal. Also, antilisterial activity of Nisin was reduced during the storage period. Conclusion: Inhibitory property of Nisin against L. monocytogenes in surimi significantly was higher than the minced (P<0.05. So it is possible the antilisterial properties of Nisin will increase by elimination of some enzymes during processing.

  1. Performance of Isfahan North Wastewater Treatment Plant in the Removal of Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    nahid Navijouy

    2013-08-01

    Full Text Available Listeria and in particular Listeria monocytogenes is considered a ubiquitous foodborne pathogen which can lead listeriosis in human and animals. Listeriosis can be serious and may cause meningitis, septicemia and abortion in pregnant women. Although wastewater or sludge may contaminate foods of plant origin, there are no data on occurrence of Listeria spp. in wastewater and sludge in Iran. The purpose of current investigation was to study the occurrence of Listeria spp. in various samples of wastewater and sludge in Isfahan North wastewater treatment plant. Influent, effluent, raw sludge and dried sludge samples were collected from Isfahan North municipal wastewater treatment plant. L. monocytogenes were enumerated by a three–tube most probable number (MPN assay using enrichment Fraser broth. A total of 65 various samples from five step in 13 visits were collected. The presence of Listeria spp. also was determined using USDA procedure. Then, phenotypically identified L. monocytogenes were further confirmed by Polymerase Chain Reaction amplification. L. monocytogenes isolated from 76.9%, 38.5%, 84.6%, 69.2% and 46.2% of influent, effluent, raw sludge, stabilized sludge and dried sludge respectively. The efficiency of wastewater treatment processes, digester tank and drying bed in removal L. monocytogenes were 69.6%, 64.7% and 73.4% respectively. All phenotypically identified L. monocytogenes were further confirmed by Polymerase Chain Reaction. The results of present study have shown that Listeriaspp. and L. monocytogenes in particular, were present in wastewater treatment plant effluents and sludge at high level. The bacteria may spread on agriculture land and contaminate foods of plant origin. This may cause a risk of spreading disease to human and animals.

  2. Listeria monocytogenes alters mast cell phenotype, mediator and osteopontin secretion in a listeriolysin-dependent manner.

    Directory of Open Access Journals (Sweden)

    Catherine E Jobbings

    Full Text Available Whilst mast cells participate in the immune defence against the intracellular bacterium Listeria monocytogenes, there is conflicting evidence regarding the ability of L. monocytogenes to infect mast cells. It is known that the pore-forming toxin listeriolysin (LLO is important for mast cell activation, degranulation and the release of pro-inflammatory cytokines. Mast cells, however, are a potential source of a wide range of cytokines, chemokines and other mediators including osteopontin, which contributes to the clearing of L. monocytogenes infections in vivo, although its source is unknown. We therefore aimed to resolve the controversy of mast cell infection by L. monocytogenes and investigated the extent of mediator release in response to the bacterium. In this paper we show that the infection of bone marrow-derived mast cells by L. monocytogenes is inefficient and LLO-independent. LLO, however, is required for calcium-independent mast cell degranulation as well as for the transient and selective downregulation of cell surface CD117 (c-kit on mast cells. We demonstrate that in addition to the key pro-inflammatory cytokines TNF-α and IL-6, mast cells release a wide range of other mediators in response to L. monocytogenes. Osteopontin, IL-2, IL-4, IL-13 and granulocyte macrophage colony-stimulating factor (GM-CSF, and chemokines including CCL2, CCL3, CCL4 and CCL5 are released in a MyD88-dependent manner. The wide range of mediators released by mast cells in response to L. monocytogenes may play an important role in the recruitment and activation of a variety of immune cells in vivo. The cocktail of mediators, however, is unlikely to skew the immune response to a particular effector response. We propose that mast cells provide a hitherto unreported source of osteopontin, and may provide an important role in co-ordinating the immune response during Listeria infection.

  3. NASA work unit system file maintenance manual

    Science.gov (United States)

    1972-01-01

    The NASA Work Unit System is a management information system for research tasks (i.e., work units) performed under NASA grants and contracts. It supplies profiles on research efforts and statistics on fund distribution. The file maintenance operator can add, delete and change records at a remote terminal or can submit punched cards to the computer room for batch update. The system is designed for file maintenance by a person with little or no knowledge of data processing techniques.

  4. Leucocins 4010 from Leuconostoc carnosum cause a matrix related decrease in intracellular pH of Listeria monocytogenes

    DEFF Research Database (Denmark)

    Fang, Weihuan; Budde, Birgitte Bjørn; Siegumfeldt, Henrik

    2006-01-01

    A mixed culture of single cells of Listeria monocytogenes and the bacteriocin producing Leuconostoc carnosum 4010 showed growth inhibition of L. monocytogenes, although the intracellular pH (pHi) of L. monocytogenes followed by fluorescence ratio imaging microscopy was not affected. Furthermore, L...

  5. Biocontrole de Listeria monocytogenes por Pediococcus acidilactici em couve minimamente processada Biocontrol of Listeria monocytogenes by Pediococcus acidilactici in fresh-cut kale

    Directory of Open Access Journals (Sweden)

    Wanessa Altimiras Costa

    2009-12-01

    Full Text Available Este estudo avaliou um sistema de biocontrole para inibição de Listeria monocytogenes em couve minimamente processada, objetivando sua segurança durante estocagem sob refrigeração e em condições de abuso de temperatura. O potencial inibitório de bactérias láticas tolerantes ao sal e psicrotróficas contaminantes naturais da couve e Lactobacillus plantarum, Lactobacillus delbrueckii ATCC 9649 e Lactobacillus casei CCT 1465 foram avaliadas contra L. monocytogenes. O isolado de couve identificado como P. acidilactici CCA3 inibiu L. monocytogenes a 10 e 15 °C em ágar MRS e foi selecionado como possível agente de biocontrole. O número de L. monocytogenes na couve minimamente processada aumentou 3,7 e 4,7 ciclos logarítmicos a 5 e 10 °C, respectivamente, após 20 dias de armazenamento e 4,6 ciclos logarítmicos após oito dias a 15 °C. Entretanto, quando 10(8 UFC.g-1 de P. acidilactici CCA3 foram inoculados no produto processado, o crescimento de L. monocytogenes reduziu 2,3 ciclos logarítmicos sob temperatura abusiva de 15 °C. A acidez titulável e as características sensoriais da couve não foram alteradas pela presença de CCA3 ao longo do período de vida útil. Estes resultados sugerem o potencial de aplicação dos bioconservantes na couve minimamente processada, que necessitam estar associados à refrigeração e sanitização para garantir segurança.This study evaluated a biological control system for the inhibition of Listeria monocytogenes in minimally processed kale focusing on its freshness under refrigeration and extreme temperatures. The inhibitory potential of salt and cold tolerant lactic bacteria from natural microflora of kale, Lactobacillus delbrueckii ATCC 9649, Lactobacillus plantarum, and Lactobacillus casei CCT 1465 strains were evaluated against L. monocytogenes. Pediococcus acidilactici CCA3 isolated from kale exhibited a large inhibition zone of L. monocytogenes at 10 and 15 °C in MRS agar and was

  6. Further computer appreciation

    CERN Document Server

    Fry, T F

    2014-01-01

    Further Computer Appreciation is a comprehensive cover of the principles and aspects in computer appreciation. The book starts by describing the development of computers from the first to the third computer generations, to the development of processors and storage systems, up to the present position of computers and future trends. The text tackles the basic elements, concepts and functions of digital computers, computer arithmetic, input media and devices, and computer output. The basic central processor functions, data storage and the organization of data by classification of computer files,

  7. Computerized index for teaching files

    International Nuclear Information System (INIS)

    Bramble, J.M.

    1989-01-01

    A computerized index can be used to retrieve cases from a teaching file that have radiographic findings similar to an unknown case. The probability that a user will review cases with a correct diagnosis was estimated with use of radiographic findings of arthritis in hand radiographs of 110 cases from a teaching file. The nearest-neighbor classification algorithm was used as a computer index to 110 cases of arthritis. Each case was treated as an unknown and inputted to the computer index. The accuracy of the computer index in retrieving cases with the same diagnosis (including rheumatoid arthritis, gout, psoriatic arthritis, inflammatory osteoarthritis, and pyrophosphate arthropathy) was measured. A Bayes classifier algorithm was also tested on the same database. Results are presented. The nearest-neighbor algorithm was 83%. By comparison, the estimated accuracy of the Bayes classifier algorithm was 78%. Conclusions: A computerized index to a teaching file based on the nearest-neighbor algorithm should allow the user to review cases with the correct diagnosis of an unknown case, by entering the findings of the unknown case

  8. Evaluation of DNA extraction methods for PCR-based detection of Listeria monocytogenes from vegetables.

    Science.gov (United States)

    Vojkovska, H; Kubikova, I; Kralik, P

    2015-03-01

    Epidemiological data indicate that raw vegetables are associated with outbreaks of Listeria monocytogenes. Therefore, there is a demand for the availability of rapid and sensitive methods, such as PCR assays, for the detection and accurate discrimination of L. monocytogenes. However, the efficiency of PCR methods can be negatively affected by inhibitory compounds commonly found in vegetable matrices that may cause false-negative results. Therefore, the sample processing and DNA isolation steps must be carefully evaluated prior to the introduction of such methods into routine practice. In this study, we compared the ability of three column-based and four magnetic bead-based commercial DNA isolation kits to extract DNA of the model micro-organism L. monocytogenes from raw vegetables. The DNA isolation efficiency of all isolation kits was determined using a triplex real-time qPCR assay designed to specifically detect L. monocytogenes. The kit with best performance, the PowerSoil(™) Microbial DNA Isolation Kit, is suitable for the extraction of amplifiable DNA from L. monocytogenes cells in vegetable with efficiencies ranging between 29.6 and 70.3%. Coupled with the triplex real-time qPCR assay, this DNA isolation kit is applicable to the samples with bacterial loads of 10(3) bacterial cells per gram of L. monocytogenes. Several recent outbreaks of Listeria monocytogenes have been associated with the consumption of fruits and vegetables. Real-time PCR assays allow fast detection and accurate quantification of microbes. However, the success of real-time PCR is dependent on the success with which template DNA can be extracted. The results of this study suggest that the PowerSoil(™) Microbial DNA Isolation Kit can be used for the extraction of amplifiable DNA from L. monocytogenes cells in vegetable with efficiencies ranging between 29.6 and 70.3%. This method is applicable to samples with bacterial loads of 10(3) bacterial cells per gram of L. monocytogenes. © 2014

  9. In vitro activity of naturally occurring peptides (defensins against Listeria monocytogenes Ação in vitro de peptídeos naturais (defensinas sobre Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Maria da Graça F. Nascimento

    1994-12-01

    Full Text Available Autoclaved distilled water samples were inoculated with L. monocytogenes strain V7 and strain VPH-1, and incubated aerobically, at 30 C for 48 hours. Each strain was tested individually, and growth curves were determined at 1, 2, 3, 4, 5, 21, 24, and 48 hours. The growth or survival of L. monocytogenes was similar for both strains, with survivors at 24 hour-incubation. The microbicidal activity of one synthetic cationic peptide (NP-2 was examined against L. monocytogenes strain V7, in a water system. Antibacterial activity of NP-2 (1, 5, and 10 g/ml was best expressed at 60 minute-incubation, with 10 g/ml of peptide, at 30 C.Amostras de água destilada, autoclavadas, foram inoculadas com L. monocytogenes cepa V7 e cepa VPH-1, e incubadas, aerobicamente, a 30ºC por 48 horas. Cada cepa foi testada individualmente, e determinou-se curvas de crescimento a 1, 2, 3, 4, 5, 21, 24, e 48 horas. O crescimento ou sobrevivência das duas cepas foi semelhante e encontrou-se sobreviventes em 24 horas de incubação. Examinou-se a atividade bactericida de um dos peptídeos catiônicos sintéticos (NP-2 contra L. monocytogenes cepa V7, em sistema aquoso. A atividade antibacteriana de NP-2 (1, 5, and 10µg/ml foi melhor aos 60 minutos de incubação, com 10µg/ml de peptídeo, a 30 C.

  10. Romer Labs RapidChek®Listeria monocytogenes Test System for the Detection of L. monocytogenes on Selected Foods and Environmental Surfaces.

    Science.gov (United States)

    Juck, Gregory; Gonzalez, Verapaz; Allen, Ann-Christine Olsson; Sutzko, Meredith; Seward, Kody; Muldoon, Mark T

    2018-04-27

    The Romer Labs RapidChek ® Listeria monocytogenes test system (Performance Tested Method ℠ 011805) was validated against the U.S. Department of Agriculture-Food Safety and Inspection Service Microbiology Laboratory Guidebook (USDA-FSIS/MLG), U.S. Food and Drug Association Bacteriological Analytical Manual (FDA/BAM), and AOAC Official Methods of Analysis ℠ (AOAC/OMA) cultural reference methods for the detection of L. monocytogenes on selected foods including hot dogs, frozen cooked breaded chicken, frozen cooked shrimp, cured ham, and ice cream, and environmental surfaces including stainless steel and plastic in an unpaired study design. The RapidChek method uses a proprietary enrichment media system, a 44-48 h enrichment at 30 ± 1°C, and detects L. monocytogenes on an immunochromatographic lateral flow device within 10 min. Different L. monocytogenes strains were used to spike each of the matrixes. Samples were confirmed based on the reference method confirmations and an alternate confirmation method. A total of 140 low-level spiked samples were tested by the RapidChek method after enrichment for 44-48 h in parallel with the cultural reference method. There were 88 RapidChek presumptive positives. One of the presumptive positives was not confirmed culturally. Additionally, one of the culturally confirmed samples did not exhibit a presumptive positive. No difference between the alternate confirmation method and reference confirmation method was observed. The respective cultural reference methods (USDA-FSIS/MLG, FDA/BAM, and AOAC/OMA) produced a total of 63 confirmed positive results. Nonspiked samples from all foods were reported as negative for L. monocytogenes by all methods. Probability of detection analysis demonstrated no significant differences in the number of positive samples detected by the RapidChek method and the respective cultural reference method.

  11. 9 CFR 430.4 - Control of Listeria monocytogenes in post-lethality exposed ready-to-eat products.

    Science.gov (United States)

    2010-01-01

    ... post-lethality exposed ready-to-eat products. 430.4 Section 430.4 Animals and Animal Products FOOD... Control of Listeria monocytogenes in post-lethality exposed ready-to-eat products. (a) Listeria... comes into direct contact with a food contact surface which is contaminated with L. monocytogenes. (b...

  12. Complete genome sequence of Listeria monocytogenes strain MR310, isolated from a pastured-flock poultry farm system

    Science.gov (United States)

    Investigation of Listeria monocytogenes transmission from environmental sources associated with pasture-raised chickens to poultry products is needed to determine ways to prevent potential foodborne illness. Here, we report the complete genome sequence of Listeria monocytogenes MR310, one of the iso...

  13. Directed evolution and targeted mutagenesis to murinize Listeria monocytogenes internalin A for enhanced infectivity in the murine oral infection model.

    LENUS (Irish Health Repository)

    Monk, Ian R

    2010-01-01

    Internalin A (InlA) is a critical virulence factor which mediates the initiation of Listeria monocytogenes infection by the oral route in permissive hosts. The interaction of InlA with the host cell ligand E-cadherin efficiently stimulates L. monocytogenes entry into human enterocytes, but has only a limited interaction with murine cells.

  14. Modelling and predicting the simultaneous growth of Listeria monocytogenes and spoilage micro-organisms in cold-smoked salmon

    DEFF Research Database (Denmark)

    Gimenez, B.; Dalgaard, Paw

    2004-01-01

    Aims: To evaluate and model the simultaneous growth of Listeria monocytogenes and spoilage micro-organisms in cold-smoked salmon.Methods and Results: Growth kinetics of L. monocytogenes, lactic acid bacteria (LAB), Enterobacteriaceae, enterococci and Photobacterium phosphoreum were determined...

  15. [Occurrence and typing of Listeria monocytogenes isolated from raw cow's milk collected on farms and from vending machines].

    Science.gov (United States)

    Gelbícová, T; Karpísková, R

    2012-04-01

    Evaluation of the incidence and characteristics of L. monocytogenes in samples of raw cow's milk collected on farms (bulk tank milk samples) and from vending machines. Detection of L. monocytogenes and enumeration were carried out according to EN/ISO 11290--1, 2. Strains were characterised by serotyping and macrorestriction analysis using pulsed-field gel electrophoresis. The presence of L. monocytogenes was detected in 3,2 % (11/346) of bulk tank milk samples and 1,8 % (4/219) samples of raw cow's milk from vending machines. Findings of L. monocytogenes in raw milk were sporadic. Only on one farm strains of L. monocytogenes were detected repeatedly. Thirteen strains of L. monocytogenes belonged to serotype 1/2a, two strains to serotype 1/2b and one to serotype 4b. Macrorestriction analysis revealed considerable heterogeinity of profiles, with nine different pulsotypes being detected. Pulsotype 711 was the most frequent. This pulsotype was found on three different farms. The incidence of L. monocytogenes in raw cow's milk is relatively low in the Czech Republic. The results confirmed that some clones of L. monocytogenes from raw milk are identical with food and human strains.

  16. Prevalence and methodologies for detection, characterization and subtyping of Listeria monocytogenes and L. ivanovii in foods and environmental sources

    Directory of Open Access Journals (Sweden)

    Jin-Qiang Chen

    2017-09-01

    Full Text Available Listeria monocytogenes, one of the most important foodborne pathogens, can cause listeriosis, a lethal disease for humans. L. ivanovii, which is closely related to L. monocytogenes, is also widely distributed in nature and infects mainly warm-blooded ruminants, causing economic loss. Thus, there are high priority needs for methodologies for rapid, specific, cost-effective and accurate detection, characterization and subtyping of L. monocytogenes and L. ivanovii in foods and environmental sources. In this review, we (A described L. monocytogenes and L. ivanovii, world-wide incidence of listeriosis, and prevalence of various L. monocytogenes strains in food and environmental sources; (B comprehensively reviewed different types of traditional and newly developed methodologies, including culture-based, antigen/antibody-based, LOOP-mediated isothermal amplification, matrix-assisted laser desorption ionization-time of flight-mass spectrometry, DNA microarray, and genomic sequencing for detection and characterization of L. monocytogenes in foods and environmental sources; (C comprehensively summarized different subtyping methodologies, including pulsed-field gel electrophoresis, multi-locus sequence typing, ribotyping, and phage-typing, and whole genomic sequencing etc. for subtyping of L. monocytogenes strains from food and environmental sources; and (D described the applications of these methodologies in detection and subtyping of L. monocytogenes in foods and food processing facilities.

  17. Determining If Phylogenetic Relatedness of Listeria Monocytogenes Isolates Corresponds to Persistence in Poultry Processing Plants Using Whole-Genome Sequencing

    Science.gov (United States)

    Introduction: Controlling Listeria monocytogenes on ready-to-eat meat and poultry products and in food processing facilities is challenging. Surveys have found that some L. monocytogenes types are more persistent in processing facilities than others, but the reason is unknown. It is possible persist...

  18. Self-contained chlorine dioxide generation and delivery pods for controlling Listeria monocytogenes in model floor drains.

    Science.gov (United States)

    Listeria monocytogenes is a foodborne pathogen that has been associated with poultry products. This organism is ubiquitous in nature and has been found to enter poultry further processing plants on incoming raw product. Once in the plant, L. monocytogenes can become a long term persistent colonize...

  19. Spatial and Temporal Factors Associated with an Increased Prevalence of Listeria monocytogenes in Spinach Fields in New York State

    Science.gov (United States)

    Weller, Daniel; Wiedmann, Martin

    2015-01-01

    While rain and irrigation events have been associated with an increased prevalence of foodborne pathogens in produce production environments, quantitative data are needed to determine the effects of various spatial and temporal factors on the risk of produce contamination following these events. This study was performed to quantify these effects and to determine the impact of rain and irrigation events on the detection frequency and diversity of Listeria species (including L. monocytogenes) and L. monocytogenes in produce fields. Two spinach fields, with high and low predicted risks of L. monocytogenes isolation, were sampled 24, 48, 72, and 144 to 192 h following irrigation and rain events. Predicted risk was a function of the field's proximity to water and roads. Factors were evaluated for their association with Listeria species and L. monocytogenes isolation by using generalized linear mixed models (GLMMs). In total, 1,492 (1,092 soil, 334 leaf, 14 fecal, and 52 water) samples were collected. According to the GLMM, the likelihood of Listeria species and L. monocytogenes isolation from soil samples was highest during the 24 h immediately following an event (odds ratios [ORs] of 7.7 and 25, respectively). Additionally, Listeria species and L. monocytogenes isolates associated with irrigation events showed significantly lower sigB allele type diversity than did isolates associated with precipitation events (P = monocytogenes contamination. Small changes in management practices (e.g., not irrigating fields before harvest) may therefore reduce the risk of L. monocytogenes contamination of fresh produce. PMID:26116668

  20. Inhibition of Listeria monocytogenes by piscicolin 126 in milk and Camembert cheese manufactured with a thermophilic starter.

    Science.gov (United States)

    Wan, J; Harmark, K; Davidson, B E; Hillier, A J; Gordon, J B; Wilcock, A; Hickey, M W; Coventry, M J

    1997-03-01

    The effect of bacteriocin, piscicolin 126, on the growth of Listeria monocytogenes and cheese starter bacteria was investigated in milk and in Camembert cheese manufactured from milk challenged with 10(2) cfu ml(-1) L. monocytogenes. In milk incubated at 30 degrees C, piscicolin 126 added in the range of 512-2,048 AU ml(-1) effectively inhibited growth of L. monocytogenes for more than 20 d when challenged with approximately 10(2) cfu ml(-1) L. monocytogenes. At higher challenge levels (10(4) and 10(6) cfu ml(-1)), piscicolin 126 reduced the viable count of L. monocytogenes by 4-5 log units immediately after addition of the bacteriocin; however, growth of Listeria occurred within 24 h. The minimum inhibitory concentration (MIC) of piscicolin 126 against lactic acid cheese starter bacteria was generally greater than 204,800 AU ml(-1) , and the viable count and acid production of these starter cultures in milk were not affected by the addition of 2,048 AU ml(-1) piscicolin 126. Camembert cheeses made from milk challenged with L. monocytogenes and with added piscicolin 126 showed a viable count of L. monocytogenes 3-4 log units lower than those without piscicolin 126. Inactivation of piscicolin 126 by proteolytic enzymes from cheese starter bacteria and mould together with the emergence of piscicolin 126-resistant isolates was responsible for the recovery of L. monocytogenes in the cheeses during ripening.

  1. Genes that are involved in high hydrostatic pressure treatments in a Listeria monocytogenes Scott A ctsR deletion mutant

    Science.gov (United States)

    Listeria monocytogenes is a food-borne pathogen of significant threat to public health. High Hydrostatic Pressure (HHP) treatment can be used to control L. monocytogenes in food. The CtsR (class three stress gene repressor) protein negatively regulates the expression of class III heat shock genes....

  2. Suppression of Listeria monocytogenes by the Native Micro-Flora in Teewurst Sausage

    Directory of Open Access Journals (Sweden)

    Michline Brice

    2013-10-01

    Full Text Available Modern consumers are interested in the use of non-chemical methods to control pathogens when heat sterilization is not an option. Such is the case with teewurst sausage, a raw spreadable sausage and a popular German commodity. Although Listeria was not found in teewurst, the optimal microbial growing conditions of teewurst coupled with the ubiquity of L. monocytogenes in nature, makes the possibility of contamination of products very possible. This pilot study was conducted to examine teewurst’s native micro-flora’s ability to suppress the outgrowth of L. monocytogenes at 10 °C using standard plate counts and PCR-DGGE. Traditional plating methods showed L. monocytogenes growth significantly decreased when in competition with the teewurst’s native micro-flora (p < 0.05. The native micro-flora of the teewurst suppressed the overall growth of L. monocytogenes by an average of two logs, under these conditions. Denaturing Gradient Gel Electrophoresis (DGGE amplicons with unique banding patterns were extracted from DGGE gel for identification. Brochothrix thermosphacta and Lactobacillus curvatus were identified as a part of the teewurst’s native micro-flora. Although the native micro-flora did not decrease L. monocytogenes to below limits of detection, it was enough of a decrease to warrant further investigation.

  3. Listeria monocytogenes Growth Kinetics in Milkshakes Made from Naturally and Artificially Contaminated Ice Cream

    Directory of Open Access Journals (Sweden)

    Joelle K. Salazar

    2018-01-01

    Full Text Available This study assessed the growth of Listeria monocytogenes in milkshakes made using the process-contaminated ice cream associated with a listeriosis outbreak in comparison to milkshakes made with artificially contaminated ice cream. For all temperatures, growth kinetics including growth rates, lag phases, maximum populations, and population increases were determined for the naturally and artificially derived contaminants at 5, 10, 15, and 25°C storage for 144 h. The artificially inoculated L. monocytogenes presented lower growth rates and shorter lag phases than the naturally contaminated populations at all temperatures except for 5°C, where the reverse was observed. At 25°C, lag phases of the naturally and artificially contaminated L. monocytogenes were 11.6 and 7.8 h, respectively. The highest increase in population was observed for the artificially inoculated pathogen at 15°C after 96 h (6.16 log CFU/mL of storage. Growth models for both contamination states in milkshakes were determined. In addition, this study evaluated the antimicrobial effectiveness of flavoring agents, including strawberry, chocolate and mint, on the growth of the pathogen in milkshakes during 10°C storage. All flavor additions resulted in decreased growth rates of L. monocytogenes for both contamination states. The addition of chocolate and mint flavoring also resulted in significantly longer lag phases for both contamination states. This study provides insight into the differences in growth between naturally and artificially contaminated L. monocytogenes in a food product.

  4. Effect of gamma-irradiation on the survival of Listeria monocytogenes and allergenicity of cherry tomatoes

    International Nuclear Information System (INIS)

    Todoriki, Setsuko; Bari, Latiful; Kitta, Kazumi; Ohba, Mika; Ito, Yasuhiro; Tsujimoto, Yuka; Kanamori, Norihito; Yano, Erika; Moriyama, Tatsuya; Kawamura, Yukio; Kawamoto, Shinichi

    2009-01-01

    The presence of Listeria monocytogenes in fresh produce is a growing concern because of the possibility of food-borne illness. Ionizing radiation is an effective non-thermal means of eliminating pathogenic bacteria in fresh produce; however, the effect of ionizing irradiation on the allergenic properties of the host commodities remains unknown. This study aimed (i) to determine the effective dose of gamma-irradiation in eliminating L. monocytogenes on whole cherry tomatoes and (ii) to evaluate the effect of gamma-irradiation on the allergenic properties of tomato proteins. Cherry tomatoes that were inoculated with a mixture of five L. monocytogenes strains were treated with gamma-rays from a 60 Co source. A 1.25 kGy dose of gamma-irradiation was found to be sufficient to eliminate L. monocytogenes on whole cherry tomatoes. The immunoblot profile of serum samples obtained from two patients with tomato allergy revealed that gamma-irradiation did not affect the allergenicity of tomato proteins for up to 7 days after irradiation when the tomatoes were stored at 20 deg. C. Additionally, the m-RNA levels of β-fructofuranosidase, polygalacturonase, pectin esterase, and superoxide dismutase, the main allergenic proteins in tomato, were not affected by the applied irradiation dose. Thus, this study demonstrated that a 1.25 kGy dose of gamma-irradiation effectively eliminates L. monocytogenes on cherry tomatoes without affecting the expression of allergenic proteins in the fruits.

  5. Gamma irradiation as a means to eliminate Listeria monocytogenes from frozen chicken meat

    International Nuclear Information System (INIS)

    Kamat, A.S.; Nair, M.P.

    1995-01-01

    Cells of Listeria monocytogenes ATCC 35152 were sensitive to gamma irradiation in phosphate buffer, pH 7.00 (D 10 , dose required for 10% survival—0.15 kGy) at 0–5°C. The cells showed higher radiation survival when irradiated under frozen condition, with a D 10 of 0.3 kGy. The protection offered by shrimp/chicken/kheema homogenates (100 g litre−1) was evidenced by even higher D 10 values (0.5 kGy) at both 0–5°C and cryogenic temperature. Boneless chicken meat samples were artificially inoculated with L monocytogenes ATCC 35152 cells at low (5 × 10 3 ) colony-forming unit (cfu) g −1 and high (5 × 10 6 cfu g −1 ) concentrations and irradiated at 1, 3, 4, 6 kGy doses under cryogenic conditions. The efficacy of the radiation process was evaluated by detecting L monocytogenes during storage at 2–4°C in the irradiated samples. These studies, when repeated with three other serotypes of L monocytogenes, clearly suggested the need for a dose of 3 kGy for elimination of 10 3 cfu cells of L monocytogenes g −1 from air-packed frozen chicken meat. (author)

  6. An ecological perspective of Listeria monocytogenes biofilms in food processing facilities.

    Science.gov (United States)

    Valderrama, Wladir B; Cutter, Catherine N

    2013-01-01

    Listeria monocytogenes can enter the food chain at virtually any point. However, food processing environments seem to be of particular importance. From an ecological point of view, food processing facilities are microbial habitats that are constantly disturbed by cleaning and sanitizing procedures. Although L. monocytogenes is considered ubiquitous in nature, it is important to recognize that not all L. monocytogenes strains appear to be equally distributed; the distribution of the organism seems to be related to certain habitats. Currently, no direct evidence exists that L. monocytogenes-associated biofilms have played a role in food contamination or foodborne outbreaks, likely because biofilm isolation and identification are not part of an outbreak investigation, or the definition of biofilm is unclear. Because L. monocytogenes is known to colonize surfaces, we suggest that contamination patterns may be studied in the context of how biofilm formation is influenced by the environment within food processing facilities. In this review, direct and indirect epidemiological and phenotypic evidence of lineage-related biofilm formation capacity to specific ecological niches will be discussed. A critical view on the development of the biofilm concept, focused on the practical implications, strengths, and weaknesses of the current definitions also is discussed. The idea that biofilm formation may be an alternative surrogate for microbial fitness is proposed. Furthermore, current research on the influence of environmental factors on biofilm formation is discussed.

  7. Antimicrobial activity of chitosan coatings and films against Listeria monocytogenes on black radish.

    Science.gov (United States)

    Jovanović, Gordana D; Klaus, Anita S; Nikšić, Miomir P

    2016-01-01

    The antibacterial activity of chitosan coatings prepared with acetic or lactic acid, as well as of composite chitosan-gelatin films prepared with essential oils, was evaluated in fresh shredded black radish samples inoculated with Listeria monocytogenes ATCC 19115 and L. monocytogenes ATCC 19112 during seven days of storage at 4°C. The chitosan coating prepared with acetic acid showed the most effective antibacterial activity. All tested formulations of chitosan films exhibited strong antimicrobial activity on the growth of L. monocytogenes on black radish, although a higher inhibition of pathogens was achieved at higher concentrations of chitosan. The antimicrobial effect of chitosan films was even more pronounced with the addition of essential oils. Chitosan-gelatin films with thyme essential oils showed the most effective antimicrobial activity. A reduction of 2.4log10CFU/g for L. monocytogenes ATCC 19115 and 2.1log10CFU/g for L. monocytogenes ATCC 19112 was achieved in the presence of 1% chitosan film containing 0.2% of thyme essential oil after 24h of storage. Copyright © 2016 Asociación Argentina de Microbiología. Publicado por Elsevier España, S.L.U. All rights reserved.

  8. Prevalence and serotype distribution of Listeria monocytogenes isolated from foods in Montevideo-Uruguay

    Directory of Open Access Journals (Sweden)

    Valeria Braga

    Full Text Available ABSTRACT The aim of this work was to study the prevalence of Listeria monocytogenes in foods obtained in retail shops and food industries located in Montevideo-Uruguay, and to identify the serogroups of the obtained isolates. Three-thousand one-hundred and seventy-five food samples (frozen, deli meats, ready-to-eat and cheese were analyzed. The obtained isolates were serogrouped by multiplex PCR and serotyped by conventional procedure. Genetic comparisons were performed using pulsed-field gel electrophoresis on a sub-set of isolates belonging to the same serotype successively recovered from the same establishment. L. monocytogenes was isolated from 11.2% of samples. The highest prevalence was observed in frozen foods (38%, followed by cheese (10%. 1/2b and 4b were the most frequently identified serotypes. In six of 236 analyzed establishments we successively recovered L. monocytogenes isolates belonging to the same serotype. Most of them corresponded to serotype 1/2b. Pulsed-field gel electrophoresis profiles suggest that at least 33% of L. monocytogenes 1/2b isolates are genetically related and that may remain viable for prolonged periods. The observed prevalence of L. monocytogenes was lower than reported in neighboring countries. Our findings highlight the role that frozen foods may play in the spread of this pathogen, and the relevance of serotypes 1/2b and 4b.

  9. Growth, viability and architecture of biofilms of Listeria monocytogenes formed on abiotic surfaces

    Directory of Open Access Journals (Sweden)

    Fernanda Barbosa dos Reis-Teixeira

    Full Text Available Abstract The pathogenic bacterium Listeria monocytogenes can persist in food processing plants for many years, even when appropriate hygienic measures are in place, with potential for contaminating ready-to-eat products and, its ability to form biofilms on abiotic surfaces certainly contributes for the environmental persistence. In this research, L. monocytogenes was grown in biofilms up 8 days attached to stainless steel and glass surfaces, contributing for advancing the knowledge on architecture of mature biofilms, since many literature studies carried out on this topic considered only early stages of cell adhesion. In this study, biofilm populations of two strains of L. monocytogenes (serotypes 1/2a and 4b on stainless steel coupons and glass were examined using regular fluorescence microscopy, confocal laser scanning microscopy and classic culture method. The biofilms formed were not very dense and microscopic observations revealed uneven biofilm structures, with presence of exopolymeric matrix surrounding single cells, small aggregates and microcolonies, in a honeycomb-like arrangement. Moreover, planktonic population of L. monocytogenes (present in broth media covering the abiotic surface remained stable throughout the incubation time, which indicates an efficient dispersal mechanism, since the culture medium was replaced daily. In conclusion, even if these strains of L. monocytogenes were not able to form thick multilayer biofilms, it was noticeable their high persistence on abiotic surfaces, reinforcing the need to focus on measures to avoid biofilm formation, instead of trying to eradicate mature biofilms.

  10. Characterization and antibiotic susceptibility of Listeria monocytogenes isolated from poultry and red meat in Morocco

    Directory of Open Access Journals (Sweden)

    Hayat Ennaji

    2008-09-01

    Full Text Available Hayat Ennaji1,2, Mohammed Timinouni2, My Mustapha Ennaji3, Mohammed Hassar1, Nozha Cohen11Laboratoire de Microbiologie et Hygiène des Aliments et de l’Environnement, Institut Pasteur du Maroc., Casablanca, Morocco; 2Laboratoire de Microbiologie et Biologie Moléculaire, Institut Pasteur du Maroc., Casablanca, Morocco; 3Laboratoire de Virologie et Hygiène and Microbiologie., Faculté des Sciences et Techniques - Mohammedia, Université Hassan II, Mohammedia, MoroccoAbstract: This study was carried out on 426 samples of raw meats collected from butcheries and supermarkets in Casablanca, Morocco. The samples were examined for the occurrence of Listeria species. Strains of Listeria monocytogenes were characterized by several biochemical tests and confirmed by polymerase chain reaction (PCR. β-hemolytic cultures and nonhemolytic isolates were tested for biochemical properties with the Listeria API test. Among the 43 Listeria species isolates; we identified 10 strains for L. monocytogenes (23.3%, 31 strains for L. innocua (72.1% and 2 strains for L. welshimeri (4.6%. Strains of L. monocytogenes were separated by multiplex PCR; two serogroups IIb and IVb were thus differentiated. Antibiotic susceptibility of L. monocytogenes to 21 antibiotics was determined by the disk diffusion method. All isolates were susceptible to a wide range of the tested antibiotics with the exception of nalidixic acid, colistine and cephalosporins second and third generation for which they were all resistant.Keywords: antibiotic susceptibility, Listeria monocytogenes, meat, PCR

  11. Age-Dependent Differences in Systemic and Cell-Autonomous Immunity to L. monocytogenes

    Directory of Open Access Journals (Sweden)

    Ashley M. Sherrid

    2013-01-01

    Full Text Available Host defense against infection can broadly be categorized into systemic immunity and cell-autonomous immunity. Systemic immunity is crucial for all multicellular organisms, increasing in importance with increasing cellular complexity of the host. The systemic immune response to Listeria monocytogenes has been studied extensively in murine models; however, the clinical applicability of these findings to the human newborn remains incompletely understood. Furthermore, the ability to control infection at the level of an individual cell, known as “cell-autonomous immunity,” appears most relevant following infection with L. monocytogenes; as the main target, the monocyte is centrally important to innate as well as adaptive systemic immunity to listeriosis. We thus suggest that the overall increased risk to suffer and die from L. monocytogenes infection in the newborn period is a direct consequence of age-dependent differences in cell-autonomous immunity of the monocyte to L. monocytogenes. We here review what is known about age-dependent differences in systemic innate and adaptive as well as cell-autonomous immunity to infection with Listeria monocytogenes.

  12. Efficacy of household washing treatments for the control of Listeria monocytogenes on salad vegetables.

    Science.gov (United States)

    Nastou, Aikaterini; Rhoades, Jonathan; Smirniotis, Petros; Makri, Ioanna; Kontominas, Michael; Likotrafiti, Eleni

    2012-10-15

    The efficacy of household decontamination methods at reducing Listeria monocytogenes on fresh lettuce (Lactuca sativa), cucumber (Cucumis sativus) and parsley (Petroselinum sativum) was studied. Inoculated vegetable pieces were immersed in washing solutions and surviving L. monocytogenes enumerated. Parameters investigated were storage temperature prior to washing, dipping water temperature, agitation, acetic acid concentration and immersion time. The results indicated that the storage temperature significantly affects the efficacy of dipping vegetables in water for the control of L. monocytogenes, as the reduction in count was greatest when products had been stored at cooler temperatures. Decontamination with acetic acid (up to 2.0% v/v) was shown to have some effect in most cases, but the highest observed decrease in count was 2.6 log cfu/g. Experiments investigating the effect of exposure time to acetic acid (0.5% and 1.0% v/v, up to 30 min immersion) indicated that immersing the vegetables for more than 10 min is of minimal benefit. The most significant factor affecting washing and decontamination efficacy was the vegetable itself: L. monocytogenes colonizing cucumber epidermis was far more resistant to removal by washing and to acid treatment than that on the leafy vegetables, and L. monocytogenes on parsley was the most susceptible. This shows that published decontamination experiments (often performed with lettuce) cannot necessarily be extrapolated to other vegetables. Copyright © 2012 Elsevier B.V. All rights reserved.

  13. Effect of pulmonary irradiation from inhaled 90Y on immunity to Listeria monocytogenes in mice

    International Nuclear Information System (INIS)

    Sanchez, A.; Lundgren, D.L.; McClellan, R.O.

    1976-01-01

    The immunological response of mice subjected to irradiation from particles deposited in the lungs and challenged with Listeria monocytogenes was investigated. Mice, exposed by inhalation to 90 Y (a beta-emitting radionuclide) in relatively insoluble fused aluminosilicate particles, were immunized with L. monocytogenes either before or after exposure. Two additional groups of mice were either immunized or irradiated only. A group of control mice received no irradiation or immunization. The beta radiation dose absorbed by the lungs of each mouse at time of challenge averaged 10,000 rads. Fourteen days after immunization, all mice were challenged with 2 LD 50 doses of L. monocytogenes via the respiratory route. Survival of all immunized mice either with or without exposure to 90 Y varied from 90 to 100% as compared to 10 to 20% for the mice irradiated only and for control mice through 14 days after challenge. Pulmonary clearance of inhaled L. monocytogenes during the first 4 hr after challenge was suppressed in the mice irradiated only but not in those immunized only, or in the immunized and irradiated groups, and control mice. There appeared to be a suppression of proliferation of L. monocytogenes in lungs and spleen in the immunized groups 72 hr after challenge, whereas the lungs and spleens of the mice irradiated only and the control mice had extensive bacterial invasion. It was concluded that the 10,000 rads of beta radiation absorbed by the lungs did not suppress the immune mechanisms of the immunized mice

  14. Suppression of Listeria monocytogenes by the Native Micro-Flora in Teewurst Sausage.

    Science.gov (United States)

    Austin-Watson, Clytrice; Grant, Ar'Quette; Brice, Michline

    2013-10-21

    Modern consumers are interested in the use of non-chemical methods to control pathogens when heat sterilization is not an option. Such is the case with teewurst sausage, a raw spreadable sausage and a popular German commodity. Although Listeria was not found in teewurst, the optimal microbial growing conditions of teewurst coupled with the ubiquity of L. monocytogenes in nature, makes the possibility of contamination of products very possible. This pilot study was conducted to examine teewurst's native micro-flora's ability to suppress the outgrowth of L. monocytogenes at 10 °C using standard plate counts and PCR-DGGE. Traditional plating methods showed L. monocytogenes growth significantly decreased when in competition with the teewurst's native micro-flora ( p flora of the teewurst suppressed the overall growth of L. monocytogenes by an average of two logs, under these conditions. Denaturing Gradient Gel Electrophoresis (DGGE) amplicons with unique banding patterns were extracted from DGGE gel for identification. Brochothrix thermosphacta and Lactobacillus curvatus were identified as a part of the teewurst's native micro-flora. Although the native micro-flora did not decrease L. monocytogenes to below limits of detection, it was enough of a decrease to warrant further investigation.

  15. Effect of gamma-irradiation on the survival of Listeria monocytogenes and allergenicity of cherry tomatoes

    Science.gov (United States)

    Todoriki, Setsuko; Bari, Latiful; Kitta, Kazumi; Ohba, Mika; Ito, Yasuhiro; Tsujimoto, Yuka; Kanamori, Norihito; Yano, Erika; Moriyama, Tatsuya; Kawamura, Yukio; Kawamoto, Shinichi

    2009-07-01

    The presence of Listeria monocytogenes in fresh produce is a growing concern because of the possibility of food-borne illness. Ionizing radiation is an effective non-thermal means of eliminating pathogenic bacteria in fresh produce; however, the effect of ionizing irradiation on the allergenic properties of the host commodities remains unknown. This study aimed (i) to determine the effective dose of gamma-irradiation in eliminating L. monocytogenes on whole cherry tomatoes and (ii) to evaluate the effect of gamma-irradiation on the allergenic properties of tomato proteins. Cherry tomatoes that were inoculated with a mixture of five L. monocytogenes strains were treated with gamma-rays from a 60Co source. A 1.25 kGy dose of gamma-irradiation was found to be sufficient to eliminate L. monocytogenes on whole cherry tomatoes. The immunoblot profile of serum samples obtained from two patients with tomato allergy revealed that gamma-irradiation did not affect the allergenicity of tomato proteins for up to 7 days after irradiation when the tomatoes were stored at 20 °C. Additionally, the m-RNA levels of β-fructofuranosidase, polygalacturonase, pectin esterase, and superoxide dismutase, the main allergenic proteins in tomato, were not affected by the applied irradiation dose. Thus, this study demonstrated that a 1.25 kGy dose of gamma-irradiation effectively eliminates L. monocytogenes on cherry tomatoes without affecting the expression of allergenic proteins in the fruits.

  16. An outbreak of an unusual strain of Listeria monocytogenes infection in North-East Scotland.

    Science.gov (United States)

    Okpo, Emmanuel; Leith, Jayne; Smith-Palmer, Alison; Bell, John; Parks, Duncan; Browning, Fiona; Byers, Lynn; Corrigan, Helen; Webster, Diana; Karcher, Anne M; Murray, Andrew; Storey, Tom

    2015-01-01

    Listeria monocytogenes infection is an important cause of illness and hospitalization in vulnerable individuals. In the present study, we describe a community outbreak of Listeria monocytogenes in the North-East region of Scotland, which was epidemiologically, environmentally and microbiologically linked to a local meat product and ready-to-eat product manufacturer. Infected individuals were interviewed, and an environmental investigation was conducted. Clinical and environmental samples were tested by culture, and isolates were typed by fluorescent amplified fragment length polymorphism (fAFLP). Three cases of Listeria monocytogenes were linked geographically, had the same serotype (1/2a) and were indistinguishable by fAFLP type XII.6. The human, food and environmental isolates were of the same serotype and were indistinguishable by molecular typing. This is the first community outbreak of L. monocytogenes reported in Scotland since the current outbreak surveillance was established in 1996. Epidemiological and laboratory evidence indicated poor hand hygiene, unhygienic practices and cross-contamination throughout the manufacturing process of ready-to-eat foods as a possible cause of the outbreak. More stringent control of commercial food establishments that provide ready-to-eat food and the need to advise specifically vulnerable groups, e.g., pregnant women, of the risk of L. monocytogenes in ready-to-eat food is urgently needed. Copyright © 2015 King Saud Bin Abdulaziz University for Health Sciences. Published by Elsevier Ltd. All rights reserved.

  17. Glycerol metabolism induces Listeria monocytogenes biofilm formation at the air-liquid interface.

    Science.gov (United States)

    Crespo Tapia, Natalia; den Besten, Heidy M W; Abee, Tjakko

    2018-05-20

    Listeria monocytogenes is a food-borne pathogen that can grow as a biofilm on surfaces. Biofilm formation in food-processing environments is a big concern for food safety, as it can cause product contamination through the food-processing line. Although motile aerobic bacteria have been described to form biofilms at the air-liquid interface of cell cultures, to our knowledge, this type of biofilm has not been described in L. monocytogenes before. In this study we report L. monocytogenes biofilm formation at the air-liquid interface of aerobically grown cultures, and that this phenotype is specifically induced when the media is supplemented with glycerol as a carbon and energy source. Planktonic growth, metabolic activity assays and HPLC measurements of glycerol consumption over time showed that glycerol utilization in L. monocytogenes is restricted to growth under aerobic conditions. Gene expression analysis showed that genes encoding the glycerol transporter GlpF, the glycerol kinase GlpK and the glycerol 3-phosphate dehydrogenase GlpD were upregulated in the presence of oxygen, and downregulated in absence of oxygen. Additionally, motility assays revealed the induction of aerotaxis in the presence of glycerol. Our results demonstrate that the formation of biofilms at the air-liquid interface is dependent on glycerol-induced aerotaxis towards the surface of the culture, where L. monocytogenes has access to higher concentrations of oxygen, and is therefore able to utilize this compound as a carbon source. Copyright © 2018 Elsevier B.V. All rights reserved.

  18. Adhesion to the host cell surface is sufficient to mediate Listeria monocytogenes entry into epithelial cells

    Science.gov (United States)

    Ortega, Fabian E.; Rengarajan, Michelle; Chavez, Natalie; Radhakrishnan, Prathima; Gloerich, Martijn; Bianchini, Julie; Siemers, Kathleen; Luckett, William S.; Lauer, Peter; Nelson, W. James; Theriot, Julie A.

    2017-01-01

    The intestinal epithelium is the first physiological barrier breached by the Gram-positive facultative pathogen Listeria monocytogenes during an in vivo infection. Listeria monocytogenes binds to the epithelial host cell receptor E-cadherin, which mediates a physical link between the bacterium and filamentous actin (F-actin). However, the importance of anchoring the bacterium to F-actin through E-cadherin for bacterial invasion has not been tested directly in epithelial cells. Here we demonstrate that depleting αE-catenin, which indirectly links E-cadherin to F-actin, did not decrease L. monocytogenes invasion of epithelial cells in tissue culture. Instead, invasion increased due to increased bacterial adhesion to epithelial monolayers with compromised cell–cell junctions. Furthermore, expression of a mutant E-cadherin lacking the intracellular domain was sufficient for efficient L. monocytogenes invasion of epithelial cells. Importantly, direct biotin-mediated binding of bacteria to surface lipids in the plasma membrane of host epithelial cells was sufficient for uptake. Our results indicate that the only requirement for L. monocytogenes invasion of epithelial cells is adhesion to the host cell surface, and that E-cadherin–mediated coupling of the bacterium to F-actin is not required. PMID:28877987

  19. Identification of a Peptide-Pheromone that Enhances Listeria monocytogenes Escape from Host Cell Vacuoles

    Science.gov (United States)

    Xayarath, Bobbi; Alonzo, Francis; Freitag, Nancy E.

    2015-01-01

    Listeria monocytogenes is a Gram-positive facultative intracellular bacterial pathogen that invades mammalian cells and escapes from membrane-bound vacuoles to replicate within the host cell cytosol. Gene products required for intracellular bacterial growth and bacterial spread to adjacent cells are regulated by a transcriptional activator known as PrfA. PrfA becomes activated following L. monocytogenes entry into host cells, however the signal that stimulates PrfA activation has not yet been defined. Here we provide evidence for L. monocytogenes secretion of a small peptide pheromone, pPplA, which enhances the escape of L. monocytogenes from host cell vacuoles and may facilitate PrfA activation. The pPplA pheromone is generated via the proteolytic processing of the PplA lipoprotein secretion signal peptide. While the PplA lipoprotein is dispensable for pathogenesis, bacteria lacking the pPplA pheromone are significantly attenuated for virulence in mice and have a reduced efficiency of bacterial escape from the vacuoles of nonprofessional phagocytic cells. Mutational activation of PrfA restores virulence and eliminates the need for pPplA-dependent signaling. Experimental evidence suggests that the pPplA peptide may help signal to L. monocytogenes its presence within the confines of the host cell vacuole, stimulating the expression of gene products that contribute to vacuole escape and facilitating PrfA activation to promote bacterial growth within the cytosol. PMID:25822753

  20. Listeria monocytogenes incidence changes and diversity in some Brazilian dairy industries and retail products.

    Science.gov (United States)

    Oxaran, Virginie; Lee, Sarah Hwa In; Chaul, Luíza Toubas; Corassin, Carlos Humberto; Barancelli, Giovana Verginia; Alves, Virgínia Farias; de Oliveira, Carlos Augusto Fernandes; Gram, Lone; De Martinis, Elaine Cristina Pereira

    2017-12-01

    Listeria monocytogenes can cause listeriosis, a severe foodborne disease. In Brazil, despite very few reported cases of listeriosis, the pathogen has been repeatedly isolated from dairies. This has led the government to implement specific legislation to reduce the hazard. Here, we determined the incidence of L. monocytogenes in five dairies and retail products in the Southeast and Midwest regions of Brazil over eight months. Of 437 samples, three samples (0.7%) from retail and only one sample (0.2%) from the dairies were positive for L. monocytogenes. Thus, the contamination rate was significantly reduced as compared to previous studies. MultiLocus Sequence Typing (MLST) was used to determine if contamination was caused by new or persistent clones leading to the first MLST profile of L. monocytogenes from the Brazilian dairy industry. The processing environment isolate is of concern being a sequence-type (ST) 2, belonging to the lineage I responsible for the majority of listeriosis outbreaks. Also, ST3 and ST8 found in commercialized cheese have previously been reported in outbreaks. Despite the lower incidence, dairy products still pose a potential health risk and the occurrence of L. monocytogenes in dairies and retail products emphasize the need for continuous surveillance of this pathogen in the Brazilian dairy industry. Copyright © 2017 Elsevier Ltd. All rights reserved.

  1. Effect of gamma-irradiation on the survival of Listeria monocytogenes and allergenicity of cherry tomatoes

    Energy Technology Data Exchange (ETDEWEB)

    Todoriki, Setsuko [National Food Research Institute, Tsukuba, Ibaraki 305-8642 (Japan)], E-mail: setsuko@affrc.go.jp; Bari, Latiful; Kitta, Kazumi; Ohba, Mika; Ito, Yasuhiro; Tsujimoto, Yuka [National Food Research Institute, Tsukuba, Ibaraki 305-8642 (Japan); Kanamori, Norihito [Japan International Research Center for Agricultural Science, Tsukuba, Ibaraki 305-8686 (Japan); Yano, Erika; Moriyama, Tatsuya; Kawamura, Yukio [School of Agriculture, Kinki University, Nara-city, Nara 631-8505 (Japan); Kawamoto, Shinichi [National Food Research Institute, Tsukuba, Ibaraki 305-8642 (Japan)

    2009-07-15

    The presence of Listeria monocytogenes in fresh produce is a growing concern because of the possibility of food-borne illness. Ionizing radiation is an effective non-thermal means of eliminating pathogenic bacteria in fresh produce; however, the effect of ionizing irradiation on the allergenic properties of the host commodities remains unknown. This study aimed (i) to determine the effective dose of gamma-irradiation in eliminating L. monocytogenes on whole cherry tomatoes and (ii) to evaluate the effect of gamma-irradiation on the allergenic properties of tomato proteins. Cherry tomatoes that were inoculated with a mixture of five L. monocytogenes strains were treated with gamma-rays from a {sup 60}Co source. A 1.25 kGy dose of gamma-irradiation was found to be sufficient to eliminate L. monocytogenes on whole cherry tomatoes. The immunoblot profile of serum samples obtained from two patients with tomato allergy revealed that gamma-irradiation did not affect the allergenicity of tomato proteins for up to 7 days after irradiation when the tomatoes were stored at 20 deg. C. Additionally, the m-RNA levels of {beta}-fructofuranosidase, polygalacturonase, pectin esterase, and superoxide dismutase, the main allergenic proteins in tomato, were not affected by the applied irradiation dose. Thus, this study demonstrated that a 1.25 kGy dose of gamma-irradiation effectively eliminates L. monocytogenes on cherry tomatoes without affecting the expression of allergenic proteins in the fruits.

  2. Growth, viability and architecture of biofilms of Listeria monocytogenes formed on abiotic surfaces.

    Science.gov (United States)

    Reis-Teixeira, Fernanda Barbosa Dos; Alves, Virgínia Farias; de Martinis, Elaine Cristina Pereira

    The pathogenic bacterium Listeria monocytogenes can persist in food processing plants for many years, even when appropriate hygienic measures are in place, with potential for contaminating ready-to-eat products and, its ability to form biofilms on abiotic surfaces certainly contributes for the environmental persistence. In this research, L. monocytogenes was grown in biofilms up 8 days attached to stainless steel and glass surfaces, contributing for advancing the knowledge on architecture of mature biofilms, since many literature studies carried out on this topic considered only early stages of cell adhesion. In this study, biofilm populations of two strains of L. monocytogenes (serotypes 1/2a and 4b) on stainless steel coupons and glass were examined using regular fluorescence microscopy, confocal laser scanning microscopy and classic culture method. The biofilms formed were not very dense and microscopic observations revealed uneven biofilm structures, with presence of exopolymeric matrix surrounding single cells, small aggregates and microcolonies, in a honeycomb-like arrangement. Moreover, planktonic population of L. monocytogenes (present in broth media covering the abiotic surface) remained stable throughout the incubation time, which indicates an efficient dispersal mechanism, since the culture medium was replaced daily. In conclusion, even if these strains of L. monocytogenes were not able to form thick multilayer biofilms, it was noticeable their high persistence on abiotic surfaces, reinforcing the need to focus on measures to avoid biofilm formation, instead of trying to eradicate mature biofilms. Copyright © 2017. Published by Elsevier Editora Ltda.

  3. Listeria monocytogenes Growth Kinetics in Milkshakes Made from Naturally and Artificially Contaminated Ice Cream.

    Science.gov (United States)

    Salazar, Joelle K; Bathija, Vriddi M; Carstens, Christina K; Narula, Sartaj S; Shazer, Arlette; Stewart, Diana; Tortorello, Mary Lou

    2018-01-01

    This study assessed the growth of Listeria monocytogenes in milkshakes made using the process-contaminated ice cream associated with a listeriosis outbreak in comparison to milkshakes made with artificially contaminated ice cream. For all temperatures, growth kinetics including growth rates, lag phases, maximum populations, and population increases were determined for the naturally and artificially derived contaminants at 5, 10, 15, and 25°C storage for 144 h. The artificially inoculated L. monocytogenes presented lower growth rates and shorter lag phases than the naturally contaminated populations at all temperatures except for 5°C, where the reverse was observed. At 25°C, lag phases of the naturally and artificially contaminated L. monocytogenes were 11.6 and 7.8 h, respectively. The highest increase in population was observed for the artificially inoculated pathogen at 15°C after 96 h (6.16 log CFU/mL) of storage. Growth models for both contamination states in milkshakes were determined. In addition, this study evaluated the antimicrobial effectiveness of flavoring agents, including strawberry, chocolate and mint, on the growth of the pathogen in milkshakes during 10°C storage. All flavor additions resulted in decreased growth rates of L. monocytogenes for both contamination states. The addition of chocolate and mint flavoring also resulted in significantly longer lag phases for both contamination states. This study provides insight into the differences in growth between naturally and artificially contaminated L. monocytogenes in a food product.

  4. Rapid detection of Listeria monocytogenes in milk using confocal micro-Raman spectroscopy and chemometric analysis.

    Science.gov (United States)

    Wang, Junping; Xie, Xinfang; Feng, Jinsong; Chen, Jessica C; Du, Xin-jun; Luo, Jiangzhao; Lu, Xiaonan; Wang, Shuo

    2015-07-02

    Listeria monocytogenes is a facultatively anaerobic, Gram-positive, rod-shape foodborne bacterium causing invasive infection, listeriosis, in susceptible populations. Rapid and high-throughput detection of this pathogen in dairy products is critical as milk and other dairy products have been implicated as food vehicles in several outbreaks. Here we evaluated confocal micro-Raman spectroscopy (785 nm laser) coupled with chemometric analysis to distinguish six closely related Listeria species, including L. monocytogenes, in both liquid media and milk. Raman spectra of different Listeria species and other bacteria (i.e., Staphylococcus aureus, Salmonella enterica and Escherichia coli) were collected to create two independent databases for detection in media and milk, respectively. Unsupervised chemometric models including principal component analysis and hierarchical cluster analysis were applied to differentiate L. monocytogenes from Listeria and other bacteria. To further evaluate the performance and reliability of unsupervised chemometric analyses, supervised chemometrics were performed, including two discriminant analyses (DA) and soft independent modeling of class analogies (SIMCA). By analyzing Raman spectra via two DA-based chemometric models, average identification accuracies of 97.78% and 98.33% for L. monocytogenes in media, and 95.28% and 96.11% in milk were obtained, respectively. SIMCA analysis also resulted in satisfied average classification accuracies (over 93% in both media and milk). This Raman spectroscopic-based detection of L. monocytogenes in media and milk can be finished within a few hours and requires no extensive sample preparation. Copyright © 2015 Elsevier B.V. All rights reserved.

  5. Growth characteristics of Listeria monocytogenes as affected by a native microflora in cooked ham under refrigerated and temperature abuse conditions.

    Science.gov (United States)

    Hwang, Cheng-An; Sheen, Shiowshuh

    2011-05-01

    This study examined the growth characteristics of Listeria monocytogenes as affected by a native microflora in cooked ham at refrigerated and abuse temperatures. A five-strain mixture of L. monocytogenes and a native microflora, consisting of Brochothrix spp., isolated from cooked meat were inoculated alone (monocultured) or co-inoculated (co-cultured) onto cooked ham slices. The growth characteristics, lag phase duration (LPD, h), growth rate (GR, log(10) cfu/h), and maximum population density (MPD, log(10) cfu/g), of L. monocytogenes and the native microflora in vacuum-packed ham slices stored at 4, 6, 8, 10, and 12 °C for up to 5 weeks were determined. At 4-12 °C, the LPDs of co-cultured L. monocytogenes were not significantly different from those of monocultured L. monocytogenes in ham, indicating the LPDs of L. monocytogenes at 4-12 °C were not influenced by the presence of the native microflora. At 4-8 °C, the GRs of co-cultured L. monocytogenes (0.0114-0.0130 log(10) cfu/h) were statistically but marginally lower than those of monocultured L. monocytogenes (0.0132-0.0145 log(10) cfu/h), indicating the GRs of L. monocytogenes at 4-8 °C were reduced by the presence of the native microflora. The GRs of L. monocytogenes were reduced by 8-7% with the presence of the native microflora at 4-8 °C, whereas there was less influence of the native microflora on the GRs of L. monocytogenes at 10 and 12 °C. The MPDs of L. monocytogenes at 4-8 °C were also reduced by the presence of the native microflora. Data from this study provide additional information regarding the growth suppression of L. monocytogenes by the native microflora for assessing the survival and growth of L. monocytogenes in ready-to-eat meat products. Published by Elsevier Ltd.

  6. The design and development of GRASS file reservation system

    International Nuclear Information System (INIS)

    Huang Qiulan; Zhu Suijiang; Cheng Yaodong; Chen Gang

    2010-01-01

    GFRS (GRASS File Reservation System) is designed to improve the file access performance of GRASS (Grid-enabled Advanced Storage System) which is a Hierarchical Storage Management (HSM) system developed at Computing Center, Institute of High Energy Physics. GRASS can provide massive storage management and data migration, but the data migration policy is simply based factors such as pool water level, the intervals for migration and so on, so it is short of precise control over files. As for that, we design GFRS to implement user-based file reservation which is to reserve and keep the required files on disks for High Energy physicists. CFRS can improve file access speed for users by avoiding migrating frequently accessed files to tapes. In this paper we first give a brief introduction of GRASS system and then detailed architecture and implementation of GFRS. Experiments results from GFRS have shown good performance and a simple analysis is made based on it. (authors)

  7. Decay data file based on the ENSDF file

    Energy Technology Data Exchange (ETDEWEB)

    Katakura, J. [Japan Atomic Energy Research Inst., Tokai, Ibaraki (Japan). Tokai Research Establishment

    1997-03-01

    A decay data file with the JENDL (Japanese Evaluated Nuclear Data Library) format based on the ENSDF (Evaluated Nuclear Structure Data File) file was produced as a tentative one of special purpose files of JENDL. The problem using the ENSDF file as primary source data of the JENDL decay data file is presented. (author)

  8. Local Outbreak of Listeria monocytogenes Serotype 4b Sequence Type 6 Due to Contaminated Meat Pâté.

    Science.gov (United States)

    Althaus, Denise; Jermini, Marco; Giannini, Petra; Martinetti, Gladys; Reinholz, Danuta; Nüesch-Inderbinen, Magdalena; Lehner, Angelika; Stephan, Roger

    2017-04-01

    In January and February 2016, five cases of confirmed and two cases of probable infection due to Listeria monocytogenes serotype 4b, sequence type (ST) 6 belonging to a single pulsed-field gel electrophoresis pulsotype pattern were registered in a region of southern Switzerland. L. monocytogenes was detected in blood samples (four cases) and pleural fluid (one case). Furthermore, L. monocytogenes 4b ST6 was detected in a stool sample of an asymptomatic person exposed to a common food. Forthwith, the food safety authority and a local gourmet meat producer reported L. monocytogenes contamination of meat pâté. Analysis of further food and environmental samples from the premises of the producer yielded isolates matching the clinical strains and confirmed the presence of L. monocytogenes 4b ST6 in the mincing machine as the cause of the food contamination.

  9. Sensitive enumeration of Listeria monocytogenes and other Listeria species in various naturally contaminated matrices using a membrane filtration method.

    Science.gov (United States)

    Barre, Léna; Brasseur, Emilie; Doux, Camille; Lombard, Bertrand; Besse, Nathalie Gnanou

    2015-06-01

    For the enumeration of Listeria monocytogenes (L. monocytogenes) in food, a sensitive enumeration method has been recently developed. This method is based on a membrane filtration of the food suspension followed by transfer of the filter on a selective medium to enumerate L. monocytogenes. An evaluation of this method was performed with several categories of foods naturally contaminated with L. monocytogenes. The results obtained with this technique were compared with those obtained from the modified reference EN ISO 11290-2 method for the enumeration of L. monocytogenes in food, and are found to provide more precise results. In most cases, the filtration method enabled to examine a greater quantity of food thus greatly improving the sensitivity of the enumeration. However, it was hardly applicable to some food categories because of filtration problems and background microbiota interference. Copyright © 2014 Elsevier Ltd. All rights reserved.

  10. Genetic characteristics of Japanese clinical Listeria monocytogenes isolates.

    Directory of Open Access Journals (Sweden)

    Satoko Miya

    Full Text Available Listeria monocytogenes causes foodborne illnesses through consumption of ready-to-eat foods. Although 135-201annual listeriosis cases have been estimated in Japan, the details regarding the clinical isolates such as infection source, virulence level, and other genetic characteristics, are not known. In order to uncover the trends of listeriosis in Japan and use the knowledge for prevention measures to be taken, the genetic characteristics of the past human clinical isolates needs to be elucidated. For this purpose, multilocus tandem-repeat sequence analysis (MLTSA and multi-virulence-locus sequence typing (MVLST were used in this study. The clinical isolates showed a variety of genetically distant genotypes, indicating they were from sporadic cases. However, the MVLST profiles of 7 clinical isolates were identical to those of epidemic clone (EC I isolates, which have caused several serious outbreaks in other countries, suggesting the possibility that they have strong virulence potential and originated from a single outbreak. Moreover, 6 Japanese food isolates shared their genotypes with ECI isolates, indicating that there may be risks for listeriosis outbreak in Japan. This is the first investigational study on genetic characteristics of Japanese listeriosis isolates. The listeriosis cases happened in the past are presumably sporadic, but it is still possible that some isolates with strong virulence potential have caused listeriosis outbreaks, and future listeriosis risks also exist.

  11. OrfX, a Nucleomodulin Required for Listeria monocytogenes Virulence

    Directory of Open Access Journals (Sweden)

    Andrzej Prokop

    2017-10-01

    Full Text Available Listeria monocytogenes is a bacterial pathogen causing severe foodborne infections in humans and animals. Listeria can enter into host cells and survive and multiply therein, due to an arsenal of virulence determinants encoded in different loci on the chromosome. Several key Listeria virulence genes are clustered in Listeria pathogenicity island 1. This important locus also contains orfX (lmo0206, a gene of unknown function. Here, we found that OrfX is a small, secreted protein whose expression is positively regulated by PrfA, the major transcriptional activator of Listeria virulence genes. We provide evidence that OrfX is a virulence factor that dampens the oxidative response of infected macrophages, which contributes to intracellular survival of bacteria. OrfX is targeted to the nucleus and interacts with the regulatory protein RybP. We show that in macrophages, the expression of OrfX decreases the level of RybP, which controls cellular infection. Collectively, these data reveal that Listeria targets RybP and evades macrophage oxidative stress for efficient infection. Altogether, OrfX is after LntA, the second virulence factor acting directly in the nucleus.

  12. UPIN Group File

    Data.gov (United States)

    U.S. Department of Health & Human Services — The Group Unique Physician Identifier Number (UPIN) File is the business entity file that contains the group practice UPIN and descriptive information. It does NOT...

  13. Listeria monocytogenes cross-contamination of cheese: risk throughout the food supply chain.

    Science.gov (United States)

    Sauders, B D; D'Amico, D J

    2016-10-01

    Listeria monocytogenes has been the most common microbial cause of cheese-related recalls in both the United States and Canada in recent years. Since L. monocytogenes is inactivated by pasteurization, the majority of these cases have been linked to environmental and cross-contamination of fresh-soft, soft-ripened, and semi-soft cheeses. Cross-contamination of foods with L. monocytogenes is a continuous risk throughout the food supply chain and presents unique challenges for subsequent illness and outbreak investigations. Reports on outbreaks of listeriosis attributed to cross-contamination downstream from primary processing help highlight the critical role of epidemiological investigation coupled with coordinated molecular subtyping and surveillance in the recognition and investigation of complex foodborne outbreaks. Despite their complexity, environmental sampling throughout the supply chain coupled with improved genotyping approaches and concomitant analysis of foodborne illness epidemiological exposure data are needed to help resolve these and similar cases more rapidly and with greater confidence.

  14. Microbial diversity and structure are drivers of the biological barrier effect against Listeria monocytogenes in soil.

    Science.gov (United States)

    Vivant, Anne-Laure; Garmyn, Dominique; Maron, Pierre-Alain; Nowak, Virginie; Piveteau, Pascal

    2013-01-01

    Understanding the ecology of pathogenic organisms is important in order to monitor their transmission in the environment and the related health hazards. We investigated the relationship between soil microbial diversity and the barrier effect against Listeria monocytogenes invasion. By using a dilution-to-extinction approach, we analysed the consequence of eroding microbial diversity on L. monocytogenes population dynamics under standardised conditions of abiotic parameters and microbial abundance in soil microcosms. We demonstrated that highly diverse soil microbial communities act as a biological barrier against L. monocytogenes invasion and that phylogenetic composition of the community also has to be considered. This suggests that erosion of diversity may have damaging effects regarding circulation of pathogenic microorganisms in the environment.

  15. The use of Listeria monocytogenes as a DNA delivery vector for cancer gene therapy.

    LENUS (Irish Health Repository)

    Tangney, Mark

    2012-01-31

    Listeria monocytogenes is an intracellular pathogen that lyses the phagosomal vacuole of infected cells, proliferates in the host cell cytoplasm and can actively enter adjacent cells. The pathogen is therefore well suited to exploitation as a vector for the delivery of DNA to target cells as the lifecycle favors cellular targeting with vector amplification and the potential for cell-to-cell spread. We have recently demonstrated DNA transfer by L. monocytogenes in growing tumors in murine models. Our approach exploited an ampicillin sensitive stain of L. monocytogenes which can be lysed through systemic administration of ampicillin to facilitate release of plasmid DNA for expression by infected mammalian cells. Here, we discuss the implications of this technology and the potential for future improvements of the system.

  16. Listeria monocytogenes incidence changes and diversity in some Brazilian dairy industries and retail products

    DEFF Research Database (Denmark)

    Oxaran, Virginie; In Lee, Sarah Hwa; Chaul, Luiza Toubas

    2017-01-01

    the incidence of L. monocytogenes in five dairies and retail products in the Southeast and Midwest regions of Brazil over eight months. Of 437 samples, three samples (0.7%) from retail and only one sample (0.2%) from the dairies were positive for L. monocytogenes. Thus, the contamination rate was significantly...... reduced as compared to previous studies. MultiLocus Sequence Typing (MLST) was used to determine if contamination was caused by new or persistent clones leading to the first MLST profile of L. monocytogenes from the Brazilian dairy industry. The processing environment isolate is of concern being...... a sequence-type (ST) 2, belonging to the lineage I responsible for the majority of listeriosis outbreaks. Also, ST3 and ST8 found in commercialized cheese have previously been reported in outbreaks. Despite the lower incidence, dairy products still pose a potential health risk and the occurrence of L...

  17. Prevalence of L. monocytogenes in environmental samples collected in dairy plants of Sassari Province, Italy

    Directory of Open Access Journals (Sweden)

    Giovanni Terrosu

    2015-09-01

    Full Text Available Listeria (L. monocytogenes is frequently isolated from food production environment and often persists in dairy plants despite vigorous sanitation regimes. In recent years several alert notifications were sent to Rapid Alert System for Food Products system as a consequence of Listeria monocytogenes contamination of ricotta cheese. After the alert of 2012, competent authority (Local Health Unit of Sassari Province organised an environmental monitoring plan with the partnership of the Institute for Experimental Veterinary Medicine of Sardinia to verify analysis of dairy plants own-check according to Regulation (EC N° 2073/05 and further modifications. In 2014 n. 665 processing areas samples of n. 50 dairy plants of Sassari Province were examined. UNI EN ISO 11290-1:2005 for detection of L. monocytogenes was used. Non-compliance in n. 5 diary plants are observed (n. 8 positive samples. Post-non-compliance environmental sanitisation was efficient and own-check plans included appropriate corrective actions.

  18. Use Carum copticum essential oil for controlling the Listeria monocytogenes growth in fish model system

    Directory of Open Access Journals (Sweden)

    Soghra Rabiey

    2014-01-01

    Full Text Available This study was conducted to evaluate the antibacterial effect of Carum copticum essential oil (Ajowan EO against Listeria monocytogenes in fish model system. Ajowan EO chemical composition was determined by gas chromatography/mass spectral analysis and the highest concentration of Carum copticum essential oil without any significant changes on sensory properties of kutum fish (Rutilus frisii kutum was assigned. Then the inhibitory effect of Ajowan EO at different concentrations in presence of salt and smoke component was tested on L. monocytogenes growth in fish peptone broth (FPB, kutum broth and cold smoked kutum broth at 4 ºC for 12 days. Ajowan EO completely decreased the number of L. monocytogenes in FPB after 12 days of storage, however, antimicrobial effect of EO significantly reduced in kutum and cold smoked kutum broth. Addition of 4% NaCl and smoke component improved the anti-listerial activity of Ajowan EO in all fish model broths.

  19. Triclosan-Induced Aminoglycoside-Tolerant Listeria monocytogenes Isolates Can Appear as Small-Colony Variants

    DEFF Research Database (Denmark)

    Kastbjerg, Vicky Gaedt; Hein-Kristensen, Line; Gram, Lone

    2014-01-01

    Exposure of the human food-borne pathogen Listeria monocytogenes to sublethal concentrations of triclosan can cause resistance to several aminoglycosides. Aminoglycoside-resistant isolates exhibit two colony morphologies: normal-size and pinpoint colonies. The purposes of the present study were...... to characterize the small colonies of L. monocytogenes and to determine if specific genetic changes could explain the triclosan-induced aminoglycoside resistance in both pinpoint and normal-size isolates. Isolates from the pinpoint colonies grew poorly under aerated conditions, but growth was restored by addition......I and that exposure to triclosan can cause resistance to antibiotics that enters the cell via active transport. Further studies are needed to elucidate if L. monocytogenes pinpoint isolates could have any clinical impact, e.g., in persistent infections....

  20. Effect of starter cultures on survival of Listeria monocytogenes in Čajna sausage

    Science.gov (United States)

    Bošković, M.; Tadić, V.; Đorđević, J.; Glišić, M.; Lakićević, B.; Dimitrijević, M.; Baltić, M. Ž.

    2017-09-01

    The aim of the study was to evaluate the survival of Listeria monocytogenes during the production of Čajna sausage with short maturation time. Sausage batter was inoculated with three different serotypes 4b and serotype 1/2a of L. monocytogenes. Control sausages were without any starter culture added; the second batch was inoculated with strains of Lactobacillus sakei, Staphylococcus carnosus and Staphylococcus xylosus, and the third batch was inoculated with strains of Debaryomyces hansenii, Lactobacillus sakei, Pediococcus acidilactici, Pediococcus pentosaceus, Staphylococcus carnosus and Staphylococcus xylosus. After 18 days of ripening, L. monocytogenes was not detected in any of the sausages, but during this fermentation and drying, the numbers of this pathogen was lower in the sausages inoculated with starter cultures.

  1. Changes in gene expression during adaptation of Listeria monocytogenes to the soil environment.

    Science.gov (United States)

    Piveteau, Pascal; Depret, Géraldine; Pivato, Barbara; Garmyn, Dominique; Hartmann, Alain

    2011-01-01

    Listeria monocytogenes is a ubiquitous opportunistic pathogen responsible for listeriosis. In order to study the processes underlying its ability to adapt to the soil environment, whole-genome arrays were used to analyse transcriptome modifications 15 minutes, 30 minutes and 18 h after inoculation of L. monocytogenes EGD-e in soil extracts. Growth was observed within the first day of incubation and large numbers were still detected in soil extract and soil microcosms one year after the start of the experiment. Major transcriptional reprofiling was observed. Nutrient acquisition mechanisms (phosphoenolpyruvate-dependent phosphotransferase systems and ABC transporters) and enzymes involved in catabolism of specific carbohydrates (β-glucosidases; chitinases) were prevalent. This is consistent with the overrepresentation of the CodY regulon that suggests that in a nutrient depleted environment, L. monocytogenes recruits its extensive repertoire of transporters to acquire a range of substrates for energy production.

  2. A putative ABC transporter is involved in negative regulation of biofilm formation by Listeria monocytogenes

    DEFF Research Database (Denmark)

    Zhu, Xinna; Long, Fei; Chen, Yonghui

    2008-01-01

    Listeria monocytogenes may persist for long periods in food processing environments. In some instances, this may be due to aggregation or biofilm formation. To investigate the mechanism controlling biofilm formation in the food-borne pathogen L. monocytogenes, we characterized LM-49, a mutant...... with enhanced ability of biofilm-formation generated via transposon Tn917 mutagenesis of L. monocytogenes 4b G. In this mutant, a Tn917 insertion has disrupted the coding region of the gene encoding a putative ATP binding cassette (ABC) transporter permease identical to Lmof2365_1771 (a putative ABC...... the same amount of biofilm biomass as the wild-type strain. Furthermore, transcription of the downstream lm.G_1770 was not influenced by the upstream Tn917 insertion, and the presence of Tn917 has no effect on biofilm formation. These results suggest that lm.G_1771 was solely responsible for the negative...

  3. Infectious Dose of Listeria monocytogenes in Outbreak Linked to Ice Cream, United States, 2015.

    Science.gov (United States)

    Pouillot, Régis; Klontz, Karl C; Chen, Yi; Burall, Laurel S; Macarisin, Dumitru; Doyle, Matthew; Bally, Kären M; Strain, Errol; Datta, Atin R; Hammack, Thomas S; Van Doren, Jane M

    2016-12-01

    The relationship between the number of ingested Listeria monocytogenes cells in food and the likelihood of developing listeriosis is not well understood. Data from an outbreak of listeriosis linked to milkshakes made from ice cream produced in 1 factory showed that contaminated products were distributed widely to the public without any reported cases, except for 4 cases of severe illness in persons who were highly susceptible. The ingestion of high doses of L. monocytogenes by these patients infected through milkshakes was unlikely if possible additional contamination associated with the preparation of the milkshake is ruled out. This outbreak illustrated that the vast majority of the population did not become ill after ingesting a low level of L. monocytogenes but raises the question of listeriosis cases in highly susceptible persons after distribution of low-level contaminated products that did not support the growth of this pathogen.

  4. Antibacterial activity of bacteriocin-like substance P34 on Listeria monocytogenes in chicken sausage

    Directory of Open Access Journals (Sweden)

    Voltaire Sant'Anna

    2013-12-01

    Full Text Available The antimicrobial activity of the bacteriocin-like substance (BLS P34 against Listeria monocytogenes was investigated in chicken sausage. The BLS was applied to chicken sausages (256 AU g-1 previously inoculated with a suspension of 10² cfu g-1 of L. monocytogenes. BLS P34 inhibited the indicator microorganism in situ in all incubation times for up to 10 days at 5 °C. The effectiveness of BLS P34 was increased when it was added in combination with nisin. The bacteriocin was also tested in natural eatable natural bovine wrapping (salty semi-dried tripe against the same indicator microorganism, also showing inhibitory capability in vitro. BLS P34 showed potential to control L. monocytogenes in refrigerated meat products.

  5. An Assessment of Different Genomic Approaches for Inferring Phylogeny of Listeria monocytogenes

    DEFF Research Database (Denmark)

    Henri, Clementine; Leekitcharoenphon, Pimlapas; Carleton, Heather A.

    2017-01-01

    Background/objectives: Whole genome sequencing (WGS) has proven to be a powerful subtyping tool for foodborne pathogenic bacteria like L. monocytogenes. The interests of genome-scale analysis for national surveillance, outbreak detection or source tracking has been largely documented. The genomic......MLPPST) or pan genome (wgMLPPST). Currently, there are little comparisons studies of these different analytical approaches. Our objective was to assess and compare different genomic methods that can be implemented in order to cluster isolates of L monocytogenes.Methods: The clustering methods were evaluated...... on a collection of 207 L. monocytogenes genomes of food origin representative of the genetic diversity of the Anses collection. The trees were then compared using robust statistical analyses.Results: The backward comparability between conventional typing methods and genomic methods revealed a near...

  6. Multi-level, automatic file management system using magnetic disk, mass storage system and magnetic tape

    International Nuclear Information System (INIS)

    Fujii, Minoru; Asai, Kiyoshi

    1979-12-01

    A simple, effective file management system using magnetic disk, mass storage system (MSS) and magnetic tape is described. Following are the concepts and techniques introduced in this file management system. (1) File distribution and continuity character of file references are closely approximated by memory retention function. A density function using the memory retention function is thus defined. (2) A method of computing the cost/benefit lines for magnetic disk, MSS and magnetic tape is presented. (3) A decision process of an optimal organization of file facilities incorporating file demands distribution to respective file devices, is presented. (4) A method of simple, practical, effective, automatic file management, incorporating multi-level file management, space management and file migration control, is proposed. (author)

  7. Novel Biocontrol Methods for Listeria monocytogenes Biofilms in Food Production Facilities

    Directory of Open Access Journals (Sweden)

    Jessica A. Gray

    2018-04-01

    Full Text Available High mortality and hospitalization rates have seen Listeria monocytogenes as a foodborne pathogen of public health importance for many years and of particular concern for high-risk population groups. Food manufactures face an ongoing challenge in preventing the entry of L. monocytogenes into food production environments (FPEs due to its ubiquitous nature. In addition to this, the capacity of L. monocytogenes strains to colonize FPEs can lead to repeated identification of L. monocytogenes in FPE surveillance. The contamination of food products requiring product recall presents large economic burden to industry and is further exacerbated by damage to the brand. Poor equipment design, facility layout, and worn or damaged equipment can result in Listeria hotspots and biofilms where traditional cleaning and disinfecting procedures may be inadequate. Novel biocontrol methods may offer FPEs effective means to help improve control of L. monocytogenes and decrease cross contamination of food. Bacteriophages have been used as a medical treatment for many years for their ability to infect and lyse specific bacteria. Endolysins, the hydrolytic enzymes of bacteriophages responsible for breaking the cell wall of Gram-positive bacteria, are being explored as a biocontrol method for food preservation and in nanotechnology and medical applications. Antibacterial proteins known as bacteriocins have been used as alternatives to antibiotics for biopreservation and food product shelf life extension. Essential oils are natural antimicrobials formed by plants and have been used as food additives and preservatives for many years and more recently as a method to prevent food spoilage by microorganisms. Competitive exclusion occurs naturally among bacteria in the environment. However, intentionally selecting and applying bacteria to effect competitive exclusion of food borne pathogens has potential as a biocontrol application. This review discusses these novel biocontrol

  8. Tolerance to quaternary ammonium compound disinfectants may enhance growth of Listeria monocytogenes in the food industry.

    Science.gov (United States)

    Møretrø, Trond; Schirmer, Bjørn C T; Heir, Even; Fagerlund, Annette; Hjemli, Pernille; Langsrud, Solveig

    2017-01-16

    The antibacterial effect of disinfectants is crucial for the control of Listeria monocytogenes in food processing environments. Tolerance of L. monocytogenes to sublethal levels of disinfectants based on quaternary ammonium compounds (QAC) is conferred by the resistance determinants qacH and bcrABC. The presence and distribution of these genes have been anticipated to have a role in the survival and growth of L. monocytogenes in food processing environments where QAC based disinfectants are in common use. In this study, a panel of 680 L. monocytogenes from nine Norwegian meat- and salmon processing plants were grouped into 36 MLVA profiles. The presence of qacH and bcrABC was determined in 101 isolates from the 26 most common MLVA profiles. Five MLVA profiles contained qacH and two contained bcrABC. Isolates with qacH and bcrABC showed increased tolerance to the QAC Benzalkonium chloride (BC), with minimal inhibitory concentrations (MICs) of 5-12, 10-13 and 100ppm). A sample with lower BC concentrations (14ppm of chain length C-12 and 2.7ppm of chain length C-14) inhibited growth of L. monocytogenes not containing bcrABC or qacH, compared to strains with these genes. The study has shown that L. monocytogenes harbouring the QAC resistance genes qacH and bcrABC are prevalent in the food industry and that residuals of QAC may be present in concentrations after sanitation in the industry that result in a growth advantage for bacteria with such resistance genes. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

  9. A Meta-analysis of the Rates of Listeria monocytogenes and Enterococcus in Febrile Infants.

    Science.gov (United States)

    Leazer, Rianna; Perkins, Amy M; Shomaker, Kyrie; Fine, Bryan

    2016-04-01

    A change in the epidemiology of pathogens causing serious bacterial infection (SBI) has been noted since original recommendations were made for the empirical antibiotic choices for young infants with fever. To assess the prevalence of SBI caused by Listeria monocytogenes and Enterococcus species. A literature search was conducted on keywords related to SBI, L. monocytogenes, and Enterococcus spp. infections. Eligible studies were those conducted in the United States and published between January 1998 and June 2014 focusing on SBI in infants≤90 days of age. The rates of urinary tract infection, bacteremia, and meningitis for each pathogen were recorded for each study. Meta-analysis was performed to calculate the prevalence for each pathogen in a random effects model with 0.5 continuity correction added to studies with zero events. Sixteen studies were included. A total of 20,703 blood cultures were included, with weighted prevalences for L. monocytogenes and Enterococcus spp. bacteremia of 0.03% and 0.09%, respectively. A total of 13,775 cerebrospinal fluid cultures were included with event rates (unweighted prevalences) for L. monocytogenes and Enterococcus spp. meningitis of 0.02% and 0.03%, respectively. A total of 18,283 urine cultures were included, with no cases of L. monocytogenes and a weighted prevalence for Enterococcus spp. urinary tract infection of 0.28%. There may have been reporting bias or incomplete retrieval or inadvertent exclusion of relevant studies. SBI caused by L. monocytogenes and Enterococcus spp. in febrile infants is rare, and therefore clinicians may consider a change in empirical antibiotic choices. Copyright © 2016 by the American Academy of Pediatrics.

  10. Faecal shedding and strain diversity of Listeria monocytogenes in healthy ruminants and swine in Northern Spain

    Directory of Open Access Journals (Sweden)

    Hurtado Ana

    2009-01-01

    Full Text Available Abstract Background Listeria monocytogenes is among the most important foodborne bacterial pathogens due to the high mortality rate and severity of the infection. L. monocytogenes is a ubiquitous organism occasionally present in the intestinal tract of various animal species and faecal shedding by asymptomatically infected livestock poses a risk for contamination of farm environments and raw food at the pre-harvest stages. The aim of this study was to determine the prevalence and strain diversity of L. monocytogenes in healthy ruminants and swine herds. Results Faecal samples from 30 animals per herd were collected from 343 herds (120 sheep, 124 beef cattle, 82 dairy cattle and 17 swine in the Basque Country and screened in pools by an automated enzyme-linked fluorescent immunoassay (VIDAS® to estimate the prevalence of positive herds. Positive samples were subcultured onto the selective and differential agar ALOA and biochemically confirmed. L. monocytogenes was isolated from 46.3% of dairy cattle, 30.6% beef cattle and 14.2% sheep herds, but not from swine. Within-herd prevalence investigated by individually analysing 197 sheep and 221 cattle detected 1.5% of faecal shedders in sheep and 21.3% in cattle. Serotyping of 114 isolates identified complex 4b as the most prevalent (84.2%, followed by 1/2a (13.2%, and PFGE analysis of 68 isolates showed a highly diverse L. monocytogenes population in ruminant herds. Conclusion These results suggested that cattle represent a potentially important reservoir for L. monocytogenes in the Basque Country, and highlighted the complexity of pathogen control at the farm level.

  11. Novel Biocontrol Methods for Listeria monocytogenes Biofilms in Food Production Facilities.

    Science.gov (United States)

    Gray, Jessica A; Chandry, P Scott; Kaur, Mandeep; Kocharunchitt, Chawalit; Bowman, John P; Fox, Edward M

    2018-01-01

    High mortality and hospitalization rates have seen Listeria monocytogenes as a foodborne pathogen of public health importance for many years and of particular concern for high-risk population groups. Food manufactures face an ongoing challenge in preventing the entry of L. monocytogenes into food production environments (FPEs) due to its ubiquitous nature. In addition to this, the capacity of L. monocytogenes strains to colonize FPEs can lead to repeated identification of L. monocytogenes in FPE surveillance. The contamination of food products requiring product recall presents large economic burden to industry and is further exacerbated by damage to the brand. Poor equipment design, facility layout, and worn or damaged equipment can result in Listeria hotspots and biofilms where traditional cleaning and disinfecting procedures may be inadequate. Novel biocontrol methods may offer FPEs effective means to help improve control of L. monocytogenes and decrease cross contamination of food. Bacteriophages have been used as a medical treatment for many years for their ability to infect and lyse specific bacteria. Endolysins, the hydrolytic enzymes of bacteriophages responsible for breaking the cell wall of Gram-positive bacteria, are being explored as a biocontrol method for food preservation and in nanotechnology and medical applications. Antibacterial proteins known as bacteriocins have been used as alternatives to antibiotics for biopreservation and food product shelf life extension. Essential oils are natural antimicrobials formed by plants and have been used as food additives and preservatives for many years and more recently as a method to prevent food spoilage by microorganisms. Competitive exclusion occurs naturally among bacteria in the environment. However, intentionally selecting and applying bacteria to effect competitive exclusion of food borne pathogens has potential as a biocontrol application. This review discusses these novel biocontrol methods and their

  12. Inhibition of Listeria monocytogenes by propionic acid-based ingredients in cured deli-style Turkey.

    Science.gov (United States)

    Glass, Kathleen A; McDonnell, Lindsey M; Von Tayson, Roxanne; Wanless, Brandon; Badvela, Mani

    2013-12-01

    Listeria monocytogenes growth can be controlled on ready-to-eat meats through the incorporation of antimicrobial ingredients into the formulation or by postlethality kill steps. However, alternate approaches are needed to provide options that reduce sodium content but maintain protection against pathogen growth in meats after slicing. The objective of this study was to determine the inhibition of L. monocytogenes by propionic acid-based ingredients in high-moisture, cured turkey stored at 4 or 7°C. Six formulations of sliced, cured (120 ppm of NaNO2 ), deli-style turkey were tested, including control without antimicrobials, 3.2% lactate-diacetate blend (LD), 0.4% of a liquid propionate-benzoate-containing ingredient, or 0.3, 0.4, and 0.5% of a liquid propionate-containing ingredient. Products were inoculated with 5 log CFU L. monocytogenes per 100-g package (3 log CFU/ml rinsate), vacuum-sealed, and stored at 4 or 7°C for up to 12 weeks; and populations were enumerated by plating on modified Oxford agar. As expected, the control without antimicrobials supported rapid growth, with >2 log average per ml rinsate increase within 4 weeks of storage at 4°C, whereas growth was observed at 6 weeks for the LD treatment. For both replicate trials, all treatments that contained liquid propionate or propionate-benzoate limited L. monocytogenes growth to an increase of 1-log increase) was observed in individual samples for all propionate-containing treatments at weeks 10, 11, and 12. As expected, L. monocytogenes grew more rapidly when products were stored at 7°C, but trends in relative inhibition were similar to those observed at 4°C. These results verify that propionate-based ingredients inhibit growth of L. monocytogenes on sliced, high-moisture, cured turkey and can be considered as an alternative to reduce sodium-based salts while maintaining food safety.

  13. Effect of citral and carvacrol on the susceptibility of Listeria monocytogenes and Listeria innocua to antibiotics.

    Science.gov (United States)

    Zanini, S F; Silva-Angulo, A B; Rosenthal, A; Rodrigo, D; Martínez, A

    2014-05-01

    The aim of this study was to evaluate the antibiotic susceptibility of Listeria innocua (L. innocua) and Listeria monocytogenes (L. monocytogenes) cells in the presence of citral and carvacrol at sublethal concentrations in an agar medium. The presence of terpenes in the L. monocytogenes and L. innocua culture medium provided a reduction in the minimal inhibitory concentration (MIC) of all the antibiotics tested. These effects were dependent on the concentration of terpenes present in the culture medium. The combination of citral and carvacrol potentiated antibiotic activity by reducing the MIC values of bacitracin and colistin from 32.0 and 128.0 μg ml⁻¹ to 1.0 and 2.0 μg ml⁻¹, respectively. Thus, both Listeria species became more susceptible to these drugs. In this way, the colistin and bacitracin resistance of L. monocytogenes and L. innocua was reversed in the presence of terpenes. Results obtained in this study show that the phytochemicals citral and carvacrol potentiate antibiotic activity, reducing the MIC values of cultured L. monocytogenes and L. innocua. Phytochemicals citral and carvacrol potentiate antibiotic activity of erythromycin, bacitracin and colistin by reducing the MIC values of cultured Listeria monocytogenes and Listeria innocua. This effect in reducing the MIC values of the antibiotics tested in both micro-organisms was increased when natural antimicrobials were combined. This finding indicated that the combination among terpenes and antibiotic may contribute in reducing the required dosage of antibiotics due to the possible effect of terpenes on permeation barrier of the micro-organism cell membrane. © 2014 The Society for Applied Microbiology.

  14. Novel Biocontrol Methods for Listeria monocytogenes Biofilms in Food Production Facilities

    Science.gov (United States)

    Gray, Jessica A.; Chandry, P. Scott; Kaur, Mandeep; Kocharunchitt, Chawalit; Bowman, John P.; Fox, Edward M.

    2018-01-01

    High mortality and hospitalization rates have seen Listeria monocytogenes as a foodborne pathogen of public health importance for many years and of particular concern for high-risk population groups. Food manufactures face an ongoing challenge in preventing the entry of L. monocytogenes into food production environments (FPEs) due to its ubiquitous nature. In addition to this, the capacity of L. monocytogenes strains to colonize FPEs can lead to repeated identification of L. monocytogenes in FPE surveillance. The contamination of food products requiring product recall presents large economic burden to industry and is further exacerbated by damage to the brand. Poor equipment design, facility layout, and worn or damaged equipment can result in Listeria hotspots and biofilms where traditional cleaning and disinfecting procedures may be inadequate. Novel biocontrol methods may offer FPEs effective means to help improve control of L. monocytogenes and decrease cross contamination of food. Bacteriophages have been used as a medical treatment for many years for their ability to infect and lyse specific bacteria. Endolysins, the hydrolytic enzymes of bacteriophages responsible for breaking the cell wall of Gram-positive bacteria, are being explored as a biocontrol method for food preservation and in nanotechnology and medical applications. Antibacterial proteins known as bacteriocins have been used as alternatives to antibiotics for biopreservation and food product shelf life extension. Essential oils are natural antimicrobials formed by plants and have been used as food additives and preservatives for many years and more recently as a method to prevent food spoilage by microorganisms. Competitive exclusion occurs naturally among bacteria in the environment. However, intentionally selecting and applying bacteria to effect competitive exclusion of food borne pathogens has potential as a biocontrol application. This review discusses these novel biocontrol methods and their

  15. A File Archival System

    Science.gov (United States)

    Fanselow, J. L.; Vavrus, J. L.

    1984-01-01

    ARCH, file archival system for DEC VAX, provides for easy offline storage and retrieval of arbitrary files on DEC VAX system. System designed to eliminate situations that tie up disk space and lead to confusion when different programers develop different versions of same programs and associated files.

  16. Text File Comparator

    Science.gov (United States)

    Kotler, R. S.

    1983-01-01

    File Comparator program IFCOMP, is text file comparator for IBM OS/VScompatable systems. IFCOMP accepts as input two text files and produces listing of differences in pseudo-update form. IFCOMP is very useful in monitoring changes made to software at the source code level.

  17. Listeria monocytogenes en alimentos: ¿son todos los aislamientos igual de virulentos? Foodborne Listeria monocytogenes: are all the isolates equally virulent?

    Directory of Open Access Journals (Sweden)

    V. López

    2006-12-01

    Full Text Available Listeria monocytogenes es un patógeno humano que se transmite a través de los alimentos y que causa infecciones graves, con una alta tasa de mortalidad. A pesar de la ubicuidad del microorganismo, la tasa real de la enfermedad es bastante baja y se asocia casi siempre a condiciones predisponentes. Tradicionalmente se consideraba que los aislamientos presentes en los alimentos y en el ambiente tenían la misma capacidad patogénica que los aislamientos de origen clínico. Pero el análisis de mutaciones en los genes de determinados factores de virulencia (internalina, hemolisina, fosfolipasas, proteína de superficie ActA y proteína reguladora PrfA, los estudios cuantitativos realizados con cultivos celulares y la genética de poblaciones, están replanteando la discusión sobre la variabilidad de la virulencia de L. monocytogenes. A pesar de todos estos avances, no existe un único marcador que permita comprobar la virulencia de los aislamientos naturales de esta especie. Probablemente en el futuro, la combinación de diferentes marcadores moleculares permitirá detectar los alimentos contaminados sólo por los clones virulentos de L. monocytogenes, con lo que se mejorará la prevención de la listeriosis humana transmitida por alimentos.Listeria monocytogenes is a foodborne human pathogen responsible for invasive infections presenting overall a high mortality. Despite the ubiquity of the microorganism, the actual disease rate is quite low and the disease is most often associated with an underlying predisposition. Foodborne and environmental isolates were traditionally considered of similar pathogenicity compared to clinical isolates. But the analysis of mutations in the genes encoding specific virulence factors (internalin, hemolysin, phospholipases, surface protein ActA and regulator protein PrfA, quantitative studies with cell cultures and population genetics have raised considerable concerns about virulence differences among L

  18. Listeria spp. e listeria monocytogenes na produção de salsichas tipo hot dog

    OpenAIRE

    Cesar, Alessandra Paro Rodrigues; Mesquita, Albenones José de; Prado, Cristiano Sales; Nunes, Iolanda Aparecida; Almeida Filho, Edivaldo Sampaio de

    2011-01-01

    v. 12, n. 2, p.339-352, abr./jun.2011. Listeria monocytogenes está amplamente distribuída no ambiente e tem sido isolada de alimentos associados a surtos de elevada letalidade, representando um risco para a saúde pública. Em alguns países, os produtos prontos para consumo, como embutidos cozidos, entre os quais as salsichas, estão associadas à listeriose humana. Considerando a relevância do tema e a necessidade de dados, analisou-se a ocorrência de Listeria spp. e L. monocytogenes na pr...

  19. Inhibition of Listeria monocytogenes by Lactobacillus bavaricus MN in beef systems at refrigeration temperatures.

    OpenAIRE

    Winkowski, K; Crandall, A D; Montville, T J

    1993-01-01

    The ability of Lactobacillus bavaricus, a meat isolate, to inhibit the growth of three Listeria monocytogenes strains was examined in three beef systems: beef cubes, beef cubes in gravy, and beef cubes in gravy containing glucose. The beef was minimally heat treated, inoculated with L. bavaricus at 10(5) or 10(3) CFU/g and L. monocytogenes at 10(2) CFU/g, vacuum sealed, and stored at 4 or 10 degrees C. The meat samples were monitored for microbial growth, pH, and bacteriocin production. The p...

  20. Effect of eugenol on growth and listeriolysin o production by Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Cristina Tostes Filgueiras

    2006-05-01

    Full Text Available The inhibitory effect of eugenol, a naturally occurring compound mainly present in the essential oil fraction of cloves, was studied on the growth and listeriolysin O (LLO production by Listeria monocytogenes. Potassium efflux from cells promoted by eugenol was also determined after 24 h incubation in phosphate buffered saline. Eugenol promoted a delay on the growth of L. monocytogenes at concentrations of 100, 300 and 500 µg mL-1and above 800 µg mL-1 the effect was bactericidal. Production of LLO by L. monocytogenes in the presence of eugenol was reduced 80-100%. An accumulation of external K+ was observed above 300 µg mL-1 of eugenol which indicated that the cell membrane was affected. The results showed the effectiveness of eugenol in controlling growth and LLO production of L. monocytogenes cells.O efeito inibitório do eugenol, o principal constituinte do óleo essencial de cravo, foi avaliado sobre o crescimento e produção de listeriolisina O (LLO por Listeria monocytogenes. O efluxo de íons potássio das células também foi determinado após 24 h de incubação em solução tampão, contendo eugenol. Concentrações de 100, 300 e 500 µg mL-1 de eugenol promoveram a inibição do crescimento de L. monocytogenes e, em concentrações acima de 800 µg mL-1, constatou-se um efeito bactericida. O crescimento de L. monocytogenes na presença de eugenol resultou na inibição de 80 a 100% da produção de LLO. O efluxo de K+ promovido pelo eugenol indicou que a membrana celular foi afetada. Estes resultados indicam a efetividade do eugenol para o controle do crescimento e da produção de LLO por L. monocytogenes.

  1. Effects of irradiation on bacterial load and Listeria monocytogenes in raw chicken

    International Nuclear Information System (INIS)

    Varabioff, Y.; Mitchell, G.E.; Nottingham, S.M.

    1992-01-01

    After irradiation of chickens to a dose of 2.5 kGy, the decrease in the standard plate count (SPC) was similar in air and in vacuum-packaged chickens. During storage at 4 degrees C for 15 d, the SPC increased progressively in both types of packaged chickens. At the end of the storage period, the SPC was higher in air-packaged chicken than in vacuum-packaged chickens. In irradiated chickens, Listeria monocytogenes was only recovered from the vacuum-packaged chickens after 7 d cold storage. In unirradiated chickens, L. monocytogenes proliferated similarly in both air- and vacuum-packaged chickens

  2. Desiccation of adhering and biofilm Listeria monocytogenes on stainless steel: Survival and transfer to salmon products

    DEFF Research Database (Denmark)

    Hansen, Lisbeth Truelstrup; Vogel, Birte Fonnesbech

    2011-01-01

    The foodborne bacterial pathogen, Listeria monocytogenes, commonly contaminates foods during processing, where the microorganisms are potentially subjected to low relative humidity (RH) conditions for extended periods of time. The objective of this study was to examine survival during desiccation...... (43% RH and 15°C) of biofilm L. monocytogenes N53-1 cells on stainless steel coupons and to assess subsequent transfer to salmon products. Formation of static biofilm (2days at 100% RH and 15°C) prior to desiccation for 23days significantly (P...

  3. The challenge of setting risk-based microbiological criteria for Listeria monocytogenes

    DEFF Research Database (Denmark)

    Andersen, Jens Kirk; Nørrung, Birgit

    2011-01-01

    After more than 20 years of work with discussing the setting of microbiological criteria for Listeria monocytogenes in foods, Codex Alimentarius on Food Hygiene has finalised a proposal that was recently adopted by the Codex Alimentarius Commission. The effort of developing procedures for making...... the microbiological criteria risk-based to the greatest extent possible has challenged scientists and managers during this long time period. Yet, the establishment of microbiological criteria for L. monocytogenes is still being discussed and several approaches are possible. Setting of microbiological criteria...

  4. How the study of Listeria monocytogenes has led to new concepts in biology.

    Science.gov (United States)

    Rolhion, Nathalie; Cossart, Pascale

    2017-06-01

    The opportunistic intracellular bacterial pathogen Listeria monocytogenes has in 30 years emerged as an exceptional bacterial model system in infection biology. Research on this bacterium has provided considerable insight into how pathogenic bacteria adapt to mammalian hosts, invade eukaryotic cells, move intracellularly, interfere with host cell functions and disseminate within tissues. It also contributed to unveil features of normal host cell pathways and unsuspected functions of previously known cellular proteins. This review provides an updated overview of our knowledge on this pathogen. In many examples, findings on L. monocytogenes provided the basis for new concepts in bacterial regulation, cell biology and infection processes.

  5. Sporadic case of listeriosis associated with the consumption of a Listeria monocytogenes-contaminated 'Camembert' cheese.

    Science.gov (United States)

    Gilot, P; Hermans, C; Yde, M; Gigi, J; Janssens, M; Genicot, A; André, P; Wauters, G

    1997-09-01

    Listeria monocytogenes is an intracellular gram-positive organism responsible for severe infections in both humans and animals. Whereas the food-borne transmission of listeriosis was demonstrated in several outbreaks, most cases of listeriosis occur sporadically and are rarely linked with consumption of contaminated foods. In this paper a case of septicaemia with L. monocytogenes in a 73-year-old immunocompromised man is described. Evidence for the association of this case of listeriosis with the consumption of a contaminated 'Camembert' cheese is provided by serotyping, esterase typing, DNA macrorestriction patterns analysis and level of virulence of the isolated strains for mice.

  6. Survival of Listeria monocytogenes in mozzarella cheese and ice cream exposed to gamma irradiation

    International Nuclear Information System (INIS)

    Hashisaka, A.E.; Weagant, S.D.; Dong, F.M.

    1989-01-01

    The survival of Listeria monocytogenes preinoculated into ice cream and mozzarella cheese prior to gamma-irradiation treatment was determined. Samples were maintained at -78 degrees C and exposed to targeted doses of 2, 4, 8, 16, and 32 kGy of gamma-irradiation. The calculated D10 values were 1.4 kGy for mozzarella cheese and 2.0 kGy for ice cream. The effective level of irradiation (12D) for inactivating L. monocytogenes was 16.8 kGy for mozzarella cheese and 24.4 kGy for ice cream

  7. Modeling the high pressure inactivation kinetics of Listeria monocytogenes on RTE cooked meat products

    DEFF Research Database (Denmark)

    Hereu, A.; Dalgaard, Paw; Garriga, M.

    2012-01-01

    High pressure (HP) inactivation curves of Listeria monocytogenes CTC1034 (ca. 107CFU/g) on sliced RTE cooked meat products (ham and mortadella) were obtained at pressures from 300 to 800MPa. A clear tail shape was observed at pressures above 450MPa and the log-linear with tail primary model...... provided the best fit to the HP-inactivation kinetics. The relationships between the primary kinetic parameters (log kmax and log Nres) and pressure treatments were described by a polynomial secondary model. To estimate HP-inactivation of L. monocytogenes in log (N/N0) over time, a one-step global fitting...

  8. Grammar-Based Specification and Parsing of Binary File Formats

    Directory of Open Access Journals (Sweden)

    William Underwood

    2012-03-01

    Full Text Available The capability to validate and view or play binary file formats, as well as to convert binary file formats to standard or current file formats, is critically important to the preservation of digital data and records. This paper describes the extension of context-free grammars from strings to binary files. Binary files are arrays of data types, such as long and short integers, floating-point numbers and pointers, as well as characters. The concept of an attribute grammar is extended to these context-free array grammars. This attribute grammar has been used to define a number of chunk-based and directory-based binary file formats. A parser generator has been used with some of these grammars to generate syntax checkers (recognizers for validating binary file formats. Among the potential benefits of an attribute grammar-based approach to specification and parsing of binary file formats is that attribute grammars not only support format validation, but support generation of error messages during validation of format, validation of semantic constraints, attribute value extraction (characterization, generation of viewers or players for file formats, and conversion to current or standard file formats. The significance of these results is that with these extensions to core computer science concepts, traditional parser/compiler technologies can potentially be used as a part of a general, cost effective curation strategy for binary file formats.

  9. 29 CFR 4000.28 - What if I send a computer disk?

    Science.gov (United States)

    2010-07-01

    ... 29 Labor 9 2010-07-01 2010-07-01 false What if I send a computer disk? 4000.28 Section 4000.28... I send a computer disk? (a) In general. We determine your filing or issuance date for a computer... paragraph (b) of this section. (1) Filings. For computer-disk filings, we may treat your submission as...

  10. A data compression algorithm for nuclear spectrum files

    International Nuclear Information System (INIS)

    Mika, J.F.; Martin, L.J.; Johnston, P.N.

    1990-01-01

    The total space occupied by computer files of spectra generated in nuclear spectroscopy systems can lead to problems of storage, and transmission time. An algorithm is presented which significantly reduces the space required to store nuclear spectra, without loss of any information content. Testing indicates that spectrum files can be routinely compressed by a factor of 5. (orig.)

  11. Purification of the bacteriocin bavaricin MN and characterization of its mode of action against Listeria monocytogenes Scott A cells and lipid vesicles.

    Science.gov (United States)

    Kaiser, A L; Montville, T J

    1996-12-01

    Bavaricin MN was purified from Lactobacillus sake culture supernatant 135-fold with a final yield of 11%. Sequence analysis revealed bavaricin MN to be a 42-amino-acid peptide having a molecular weight of 4,769 and a calculated pI of 10.0. Computer analysis indicated that the C-terminal region may form an alpha-helical structure with an amphipathic nature deemed important in the interaction of bacteriocins with biological membranes. Bavaricin MN rapidly depleted the membrane potential (delta p) of energized Listeria monocytogenes cells in a concentration-dependent fashion. At a bavaricin MN concentration of 9.0 micrograms/ml, the delta p decreased by 85%. Both the electrical potential (delta psi) and Z delta pH components of the delta p were depleted, and this depletion was not dependent on a threshold level of proton motive force. In addition to studying the effect of bavaricin MN on the delta p of vegetative cells, bavaricin MN-induced carboxyfluorescein (CF) efflux from L. monocytogenes-derived lipid vesicles was also characterized. Bavaricin MN-induced CF leakage was also concentration dependent with an optimum of pH 6.0. The rate of CF efflux was 63% greater in lipid vesicles in which a delta psi was generated compared with that in lipid vesicles in the absence of a delta psi.

  12. New orthopaedic implant management tool for computer-assisted planning, navigation, and simulation: from implant CAD files to a standardized XML-based implant database.

    Science.gov (United States)

    Sagbo, S; Blochaou, F; Langlotz, F; Vangenot, C; Nolte, L-P; Zheng, G

    2005-01-01

    Computer-Assisted Orthopaedic Surgery (CAOS) has made much progress over the last 10 years. Navigation systems have been recognized as important tools that help surgeons, and various such systems have been developed. A disadvantage of these systems is that they use non-standard formalisms and techniques. As a result, there are no standard concepts for implant and tool management or data formats to store information for use in 3D planning and navigation. We addressed these limitations and developed a practical and generic solution that offers benefits for surgeons, implant manufacturers, and CAS application developers. We developed a virtual implant database containing geometrical as well as calibration information for orthopedic implants and instruments, with a focus on trauma. This database has been successfully tested for various applications in the client/server mode. The implant information is not static, however, because manufacturers periodically revise their implants, resulting in the deletion of some implants and the introduction of new ones. Tracking these continuous changes and keeping CAS systems up to date is a tedious task if done manually. This leads to additional costs for system development, and some errors are inevitably generated due to the huge amount of information that has to be processed. To ease management with respect to implant life cycle, we developed a tool to assist end-users (surgeons, hospitals, CAS system providers, and implant manufacturers) in managing their implants. Our system can be used for pre-operative planning and intra-operative navigation, and also for any surgical simulation involving orthopedic implants. Currently, this tool allows addition of new implants, modification of existing ones, deletion of obsolete implants, export of a given implant, and also creation of backups. Our implant management system has been successfully tested in the laboratory with very promising results. It makes it possible to fill the current gap

  13. Securing the AliEn File Catalogue - Enforcing authorization with accountable file operations

    International Nuclear Information System (INIS)

    Schreiner, Steffen; Banerjee, Subho Sankar; Betev, Latchezar; Carminati, Federico; Vladimirovna Datskova, Olga; Furano, Fabrizio; Grigoras, Alina; Grigoras, Costin; Mendez Lorenzo, Patricia; Peters, Andreas Joachim; Saiz, Pablo; Bagnasco, Stefano; Zhu Jianlin

    2011-01-01

    The AliEn Grid Services, as operated by the ALICE Collaboration in its global physics analysis grid framework, is based on a central File Catalogue together with a distributed set of storage systems and the possibility to register links to external data resources. This paper describes several identified vulnerabilities in the AliEn File Catalogue access protocol regarding fraud and unauthorized file alteration and presents a more secure and revised design: a new mechanism, called LFN Booking Table, is introduced in order to keep track of access authorization in the transient state of files entering or leaving the File Catalogue. Due to a simplification of the original Access Envelope mechanism for xrootd-protocol-based storage systems, fundamental computational improvements of the mechanism were achieved as well as an up to 50% reduction of the credential's size. By extending the access protocol with signed status messages from the underlying storage system, the File Catalogue receives trusted information about a file's size and checksum and the protocol is no longer dependent on client trust. Altogether, the revised design complies with atomic and consistent transactions and allows for accountable, authentic, and traceable file operations. This paper describes these changes as part and beyond the development of AliEn version 2.19.

  14. Listeriolysin O Regulates the Expression of Optineurin, an Autophagy Adaptor That Inhibits the Growth of Listeria monocytogenes.

    Science.gov (United States)

    Puri, Madhu; La Pietra, Luigi; Mraheil, Mobarak Abu; Lucas, Rudolf; Chakraborty, Trinad; Pillich, Helena

    2017-09-05

    Autophagy, a well-established defense mechanism, enables the elimination of intracellular pathogens including Listeria monocytogenes . Host cell recognition results in ubiquitination of L . monocytogenes and interaction with autophagy adaptors p62/SQSTM1 and NDP52, which target bacteria to autophagosomes by binding to microtubule-associated protein 1 light chain 3 (LC3). Although studies have indicated that L . monocytogenes induces autophagy, the significance of this process in the infectious cycle and the mechanisms involved remain poorly understood. Here, we examined the role of the autophagy adaptor optineurin (OPTN), the phosphorylation of which by the TANK binding kinase 1 (TBK1) enhances its affinity for LC3 and promotes autophagosomal degradation, during L . monocytogenes infection. In LC3- and OPTN-depleted host cells, intracellular replicating L . monocytogenes increased, an effect not seen with a mutant lacking the pore-forming toxin listeriolysin O (LLO). LLO induced the production of OPTN. In host cells expressing an inactive TBK1, bacterial replication was also inhibited. Our studies have uncovered an OPTN-dependent pathway in which L . monocytogenes uses LLO to restrict bacterial growth. Hence, manipulation of autophagy by L . monocytogenes , either through induction or evasion, represents a key event in its intracellular life style and could lead to either cytosolic growth or persistence in intracellular vacuolar structures.

  15. Phloretin Attenuates Listeria monocytogenes Virulence Both In vitro and In vivo by Simultaneously Targeting Listeriolysin O and Sortase A.

    Science.gov (United States)

    Wang, Jianfeng; Liu, Bowen; Teng, Zihao; Zhou, Xuan; Wang, Xiyan; Zhang, Bing; Lu, Gejin; Niu, Xiaodi; Yang, Yongjun; Deng, Xuming

    2017-01-01

    The critical roles of sortase A (SrtA) and listeriolysin O (LLO) in Listeria monocytogenes pathogenicity render these two virulence factors as ideal targets for the development of anti-virulence agents against L. monocytogenes infection. Additionally, the structures of SrtA and LLO are highly conserved among the members of sortase enzyme family and cholesterol dependent toxin family. Here, phloretin, a natural polyphenolic compound derived from apples and pears that has little anti- L. monocytogenes activity, was identified to simultaneously inhibit LLO expression and neutralize SrtA catalytic activity. Phloretin neutralized SrtA activity by causing a conformational change in the protein's active pocket, which prevented engagement with its substrate. Treatment with phloretin simultaneously reduced L. monocytogenes invasion into host cells and blocked the escape of vacuole-entrapped L. monocytogenes into cytoplasm. Further, L. monocytogenes -infected mice that received phloretin showed lower mortality, decreased bacterial burden and reduced pathological injury. Our results demonstrate that phloretin is a promising anti-infective therapeutic for infections caused by L. monocytogenes due to its simultaneous targeting of SrtA and LLO, which may result in fewer side effects than those caused by other antibiotics.

  16. Effect of Listeria seeligeri or Listeria welshimeri on Listeria monocytogenes detection in and recovery from buffered Listeria enrichment broth.

    Science.gov (United States)

    Dailey, Rachel C; Welch, Lacinda J; Hitchins, Anthony D; Smiley, R Derike

    2015-04-01

    The presence of multiple species of Listeria in regulated food products is not uncommon and can complicate the recovery of Listeria monocytogenes particularly on a non-differentiating medium. The potential complications of Listeria seeligeri and Listeria welshimeri on the recovery of L. monocytogenes from inoculated food test samples using the U.S. Food and Drug Administration's (FDA) selective enrichment procedure was investigated. Post-enrichment enumeration, in the absence of food product, indicates that some L. seeligeri and L. monocytogenes pairings may have population differentials as great as 2.7 ± 0.1 logs with L. seeligeri being the predominant species. A similar observation was noted for L. welshimeri and L. monocytogenes pairings which resulted in population differentials as large as 3.7 ± 0.2 logs with L. welshimeri being the predominant species. Select strain pairings were used to inoculate guacamole, crab meat, broccoli, and cheese with subsequent recovery by the FDA Bacteriological Analytical Manual (BAM) method with 10 colonies per sample selected for confirmation. The presence of L. seeligeri had little effect on the recovery of L. monocytogenes. The presence of L. welshimeri resulted in the failure to recover L. monocytogenes in three out of the four food matrices. This work extends the observation that non-pathogenic species of Listeria can complicate the recovery of L. monocytogenes and that competition during selective enrichment is not limited to the presence of just Listeria innocua. Published by Elsevier Ltd.

  17. Effect of Listeria seeligeri or Listeria welshimeri on Listeria monocytogenes detection in and recovery from buffered Listeria enrichment broth☆

    Science.gov (United States)

    Dailey, Rachel C.; Welch, Lacinda J.; Hitchins, Anthony D.; Smiley, R. Derike

    2016-01-01

    The presence of multiple species of Listeria in regulated food products is not uncommon and can complicate the recovery of Listeria monocytogenes particularly on a non-differentiating medium. The potential complications of Listeria seeligeri and Listeria welshimeri on the recovery of L. monocytogenes from inoculated food test samples using the U.S. Food and Drug Administration's (FDA) selective enrichment procedure was investigated. Post-enrichment enumeration, in the absence of food product, indicates that some L. seeligeri and L. monocytogenes pairings may have population differentials as great as 2.7 ± 0.1 logs with L. seeligeri being the predominant species. A similar observation was noted for L. welshimeri and L. monocytogenes pairings which resulted in population differentials as large as 3.7 ± 0.2 logs with L. welshimeri being the predominant species. Select strain pairings were used to inoculate guacamole, crab meat, broccoli, and cheese with subsequent recovery by the FDA Bacteriological Analytical Manual (BAM) method with 10 colonies per sample selected for confirmation. The presence of L. seeligeri had little effect on the recovery of L. monocytogenes. The presence of L. welshimeri resulted in the failure to recover L. monocytogenes in three out of the four food matrices. This work extends the observation that non-pathogenic species of Listeria can complicate the recovery of L. monocytogenes and that competition during selective enrichment is not limited to the presence of just Listeria innocua. PMID:25475325

  18. ATLAS, an integrated structural analysis and design system. Volume 4: Random access file catalog

    Science.gov (United States)

    Gray, F. P., Jr. (Editor)

    1979-01-01

    A complete catalog is presented for the random access files used by the ATLAS integrated structural analysis and design system. ATLAS consists of several technical computation modules which output data matrices to corresponding random access file. A description of the matrices written on these files is contained herein.

  19. Pulsed-Field Gel Electrophoresis characterization of Listeria monocytogenes isolates from cheese manufacturing plants in São Paulo, Brazil.

    Science.gov (United States)

    Barancelli, Giovana V; Camargo, Tarsila M; Gagliardi, Natália G; Porto, Ernani; Souza, Roberto A; Campioni, Fabio; Falcão, Juliana P; Hofer, Ernesto; Cruz, Adriano G; Oliveira, Carlos A F

    2014-03-03

    This study aimed to evaluate the occurrence of Listeria monocytogenes in cheese and in the environment of three small-scale dairy plants (A, B, C) located in the Northern region state of São Paulo, Brazil, and to characterize the isolates using conventional serotyping and PFGE. A total of 393 samples were collected and analyzed from October 2008 to September 2009. From these, 136 came from dairy plant A, where only L. seeligeri was isolated. In dairy plant B, 136 samples were analyzed, and L. innocua, L. seeligeri and L. welshimeri were isolated together with L. monocytogenes. In dairy plant C, 121 samples were analyzed, and L. monocytogenes and L. innocua were isolated. Cheese from dairy plants B and C were contaminated with Listeria spp, with L. innocua being found in Minas frescal cheese from both dairy plants, and L. innocua and L. monocytogenes in Prato cheese from dairy plant C. A total of 85 L. monocytogenes isolates were classified in 3 serotypes: 1/2b, 1/2c, and 4b, with predominance of serotype 4b in both dairy plants. The 85 isolates found in the dairy plants were characterized by genomic macrorestriction using ApaI and AscI with Pulsed Field Gel Electrophoresis (PFGE). Macrorestriction yielded 30 different pulsotypes. The presence of indistinguishable profiles repeatedly isolated during a 12-month period indicated the persistence of L. monocytogenes in dairy plants B and C, which were more than 100 km away from each other. Brine used in dairy plant C contained more than one L. monocytogenes lineage. The routes of contamination were identified in plants B and C, and highlighted the importance of using molecular techniques and serotyping to track L. monocytogenes sources of contamination, distribution, and routes of contamination in dairy plants, and to develop improved control strategies for L. monocytogenes in dairy plants and dairy products. Copyright © 2013 Elsevier B.V. All rights reserved.

  20. Listeria monocytogenes and Listeria spp. contamination patterns in retail delicatessen establishments in three U.S. states.

    Science.gov (United States)

    Simmons, Courtenay; Stasiewicz, Matthew J; Wright, Emily; Warchocki, Steven; Roof, Sherry; Kause, Janell R; Bauer, Nathan; Ibrahim, Salam; Wiedmann, Martin; Oliver, Haley F

    2014-11-01

    Postprocessing contamination in processing plants has historically been a significant source of Listeria monocytogenes in ready-to-eat delicatessen meats, and therefore a major cause of human listeriosis cases and outbreaks. Recent risk assessments suggest that a majority of human listeriosis cases linked to consumption of contaminated deli meats may be due to L. monocytogenes contamination that occurs at the retail level. To better understand the ecology and transmission of Listeria spp. in retail delicatessens, food and nonfood contact surfaces were tested for L. monocytogenes and other Listeria spp. in a longitudinal study conducted in 30 retail delis in three U.S. states. In phase I of the study, seven sponge samples were collected monthly for 3 months in 15 delis (5 delis per state) prior to start of daily operation; in phase II, 28 food contact and nonfood contact sites were sampled in each of 30 delis during daily operation for 6 months. Among the 314 samples collected during phase I, 6.8% were positive for L. monocytogenes. Among 4,503 samples collected during phase II, 9.5% were positive for L. monocytogenes; 9 of 30 delis showed low L. monocytogenes prevalence (Listeria spp. isolates, including 184 Listeria innocua, 48 Listeria seeligeri, and 13 Listeria welshimeri were characterized. Pulsed-field gel electrophoresis (PFGE) was used to characterize 446 L. monocytogenes isolates. PFGE showed that for 12 of 30 delis, one or more PFGE types were isolated on at least three separate occasions, providing evidence for persistence of a given L. monocytogenes subtype in the delis. For some delis, PFGE patterns for isolates from nonfood contact surfaces were distinct from patterns for occasional food contact surface isolates, suggesting limited cross-contamination between these sites in some delis. This study provides longitudinal data on L. monocytogenes contamination patterns in retail delis, which should facilitate further development of control strategies in

  1. Various Ready-to-Eat Products from Retail Stores Linked to Occurrence of Diverse Listeria monocytogenes and Listeria spp. Isolates.

    Science.gov (United States)

    Vongkamjan, Kitiya; Fuangpaiboon, Janejira; Turner, Matthew P; Vuddhakul, Varaporn

    2016-02-01

    Listeriosis outbreaks have been associated with a variety of foods. This study investigated the prevalence and diversity of Listeria monocytogenes and Listeria spp. in ready-to-eat (RTE) products and evaluated the performance of a rapid detection method, the 3M molecular detection assay for L. monocytogenes (MDA-LM), for detection of L. monocytogenes. Assay results were compared with those obtained using the U.S. Food and Drug Administration standard culture method described in the Bacteriological Analytical Manual. Products (n = 200) were purchased from retail stores: 122 aquatic products, 22 products of animal origin, 18 vegetarian products, 15 deli meat products, 13 salad and vegetable products, 4 desserts, 2 egg-based products, and 4 other products. L. monocytogenes prevalence was comparable with both methods. Overall, 15 (7.5%) of 200 samples were positive for L. monocytogenes: 3% of aquatic products, 1.5% of products of animal origin, 1% of vegetarian products, and 2% of deli meat products. Compared with the standard culture method, the sensitivity, specificity, and the accuracy of the MDA-LM were 86.7% (95% confidence interval, 58.4 to 97.7%), 98.4% (95% confidence interval, 95.0 to 99.6%), and 97.5%, respectively. Using the culture-based method, 18 (9%) of 200 samples were positive for Listeria species other than L. monocytogenes. Listeria isolates from these samples were classified into nine allelic types (ATs). The majority of isolates were classified as ATs 58 and 74, which were identified as L. monocytogenes lineages I and IV, respectively. Listeria innocua and Listeria welshimeri also were represented by isolates of multiple ATs. The MDA-LM is a rapid and reliable technique for detecting L. monocytogenes in various RTE foods. Further study is needed to develop effective control strategies to reduce L. monocytogenes contamination in RTE foods.

  2. Fluxes of Ca2+ and K+ are required for the listeriolysin O-dependent internalization pathway of Listeria monocytogenes.

    Science.gov (United States)

    Vadia, Stephen; Seveau, Stephanie

    2014-03-01

    Listeria monocytogenes is responsible for the life-threatening food-borne disease listeriosis. This disease mainly affects elderly and immunocompromised individuals, causing bacteremia and meningoencephalitis. In pregnant women, L. monocytogenes infection leads to abortion and severe infection of the fetus or newborn. The L. monocytogenes intracellular life cycle is critical for pathogenesis. Previous studies have established that the major virulence factor of L. monocytogenes, the pore-forming toxin listeriolysin O (LLO), is sufficient to induce L. monocytogenes internalization into human epithelial cell lines. This internalization pathway strictly requires the formation of LLO pores in the plasma membrane and can be stimulated by the heterologous pore-forming toxin pneumolysin, suggesting that LLO acts nonspecifically by forming transmembrane pores. The present work tested the hypothesis that Ca2+ and K+ fluxes subsequent to perforation by LLO control L. monocytogenes internalization. We report that L. monocytogenes perforates the host cell plasma membrane in an LLO-dependent fashion at the early stage of invasion. In response to perforation, host cells undergo Ca2+ -dependent but K+ -independent resealing of their plasma membrane. In contrast to the plasma membrane resealing process, LLO-induced L. monocytogenes internalization requires both Ca2+ and K+ fluxes. Further linking ion fluxes to bacterial internalization, treating cells with a combination of Ca2+ and K+ ionophores but not with individual ionophores is sufficient to induce efficient internalization of large cargoes, such as 1-μm polystyrene beads and bacteria. We propose that LLO-induced L. monocytogenes internalization requires a Ca2+ - and K+ -dependent internalization pathway that is mechanistically distinct from the process of plasma membrane resealing.

  3. pcircle - A Suite of Scalable Parallel File System Tools

    Energy Technology Data Exchange (ETDEWEB)

    2015-10-01

    Most of the software related to file system are written for conventional local file system, they are serialized and can't take advantage of the benefit of a large scale parallel file system. "pcircle" software builds on top of ubiquitous MPI in cluster computing environment and "work-stealing" pattern to provide a scalable, high-performance suite of file system tools. In particular - it implemented parallel data copy and parallel data checksumming, with advanced features such as async progress report, checkpoint and restart, as well as integrity checking.

  4. MR-AFS: a global hierarchical file-system

    International Nuclear Information System (INIS)

    Reuter, H.

    2000-01-01

    The next generation of fusion experiments will use object-oriented technology creating the need for world wide sharing of an underlying hierarchical file-system. The Andrew file system (AFS) is a well known and widely spread global distributed file-system. Multiple-resident-AFS (MR-AFS) combines the features of AFS with hierarchical storage management systems. Files in MR-AFS therefore may be migrated on secondary storage, such as roboted tape libraries. MR-AFS is in use at IPP for the current experiments and data originating from super-computer applications. Experiences and scalability issues are discussed

  5. Network survivability performance (computer diskette)

    Science.gov (United States)

    1993-11-01

    File characteristics: Data file; 1 file. Physical description: 1 computer diskette; 3 1/2 in.; high density; 2.0MB. System requirements: Mac; Word. This technical report has been developed to address the survivability of telecommunications networks including services. It responds to the need for a common understanding of, and assessment techniques for network survivability, availability, integrity, and reliability. It provides a basis for designing and operating telecommunication networks to user expectations for network survivability.

  6. Stochastic modelling of Listeria monocytogenes single cell growth in cottage cheese with mesophilic lactic acid bacteria from aroma producing cultures

    DEFF Research Database (Denmark)

    Østergaard, Nina Bjerre; Christiansen, Lasse Engbo; Dalgaard, Paw

    2015-01-01

    . 2014. Modelling the effect of lactic acid bacteria from starter- and aroma culture on growth of Listeria monocytogenes in cottage cheese. International Journal of Food Microbiology. 188, 15-25]. Growth of L. monocytogenes single cells, using lag time distributions corresponding to three different......A stochastic model was developed for simultaneous growth of low numbers of Listeria monocytogenes and populations of lactic acid bacteria from the aroma producing cultures applied in cottage cheese. During more than two years, different batches of cottage cheese with aroma culture were analysed...

  7. Use of multi-locus sequencing typing as identification method for the food-borne pathogen Listeria monocytogenes: a review

    Directory of Open Access Journals (Sweden)

    Sonia Lamon

    2015-01-01

    Full Text Available Listeria monocytogenes is an ubiquitous, intracellular pathogen which has been implicated within the past decade as the causative organism in several outbreaks of foodborne diseases. In this review, a new approach to molecular typing primarily designed for global epidemiology has been described: multi-locus sequencing typing (MLST. This approach is novel, in that it uses data that allow the unambiguous characterization of bacterial strains via the Internet. Our aim is to present the currently available selection of references on L. monocytogenes MLST detection methods and to discuss its use as gold standard to L. monocytogenes subtyping method.

  8. Characteristics of file sharing and peer to peer networking | Opara ...

    African Journals Online (AJOL)

    Characteristics of file sharing and peer to peer networking. ... distributing or providing access to digitally stored information, such as computer programs, ... including in multicast systems, anonymous communications systems, and web caches.

  9. Efflux pump-mediated benzalkonium chloride resistance in Listeria monocytogenes isolated from retail food.

    Science.gov (United States)

    Jiang, Xiaobing; Yu, Tao; Liang, Yu; Ji, Shengdong; Guo, Xiaowei; Ma, Jianmin; Zhou, Lijun

    2016-01-18

    In this study, efflux pump-mediated benzalkonium chloride (BC) resistance, including plasmid-encoded (Qac protein family and BcrABC) and chromosome-borne efflux pumps, was investigated in Listeria monocytogenes from retail food in China. Among the 59 L. monocytogenes strains, 13 (22.0%) strains were resistant to BC. The PCR results showed that bcrABC was harbored by 2 of 13 BC resistant strains. However, none of the qac genes were detected among the 59 strains. The bcrABC was absent in both of the plasmid cured strains, indicating that this BC resistance determinant was plasmid-encoded in the two bcrABC-positive strains. In the presence of reserpine, most of the bcrABC-negative strains had decreases in the MICs of BC, suggesting the existence of other efflux pumps and their role in BC resistance. After exposed to reserpine, the reduction in BC MICs was observed in the two cured strains, indicating that efflux pumps located on chromosome was also involved in BC resistance. Our findings suggest that food products may act as reservoirs for BC resistant isolates of L. monocytogenes and plasmid- and chromosome-encoded efflux pumps could mediate the BC resistance of L. monocytogenes, which is especially relevant to the adaption of this organism in food-related environments with frequent BC use. Copyright © 2015 Elsevier B.V. All rights reserved.

  10. Enhanced biofilm formation in dual-species culture of Listeria monocytogenes and Ralstonia insidiosa

    Science.gov (United States)

    In the environment, many microorganisms coexist in communities as biofilms. The objective of this study was to investigate the interactions between Listeria monocytogenes and Ralstonia insidiosa in dual species biofilms. Biofilm development was measured using crystal violet in 96-well microtiter pla...

  11. New perspectives on the gastrointestinal mode of transmission in invasive Listeria monocytogenes infection

    Energy Technology Data Exchange (ETDEWEB)

    Schlech, W.F. III

    1984-01-01

    The route or mechanism of transmission of Listeria monocytogenes from its rural veterinary reservoir to newborn and older human populations has been obscure. Anecdotal reports of milk-borne infection from cows with Listeria mastitis have been published, but intensive investigations of small outbreaks of L. monocytogenes infections in humans have not supported a gastrointestinal mode of infection. Several recent studies, however, strongly suggest this possibility, and case-control studies of epidemic listeriosis in the Canadian Maritime provinces in 1981 documented an association between ingestion of uncooked vegetables and the development of illness (p = 0.02). In that study, coleslaw from a regional producer which was distributed throughout the Maritimes was considered to be the vehicle of transmission. Cabbage, the raw product in the production of coleslaw, was contaminated at a farm prior to arrival at the plant. Contamination occurred through fertilization with raw manure from a flock of sheep known to harbor L. monocytogenes. Therefore, an indirect link was established between Listeria monocytogenes infection of sheep on a cabbage farm and subsequent development of invasive listeriosis in humans. This study supports findings from other epidemiologic studies of human listeriosis and is consistent with results of investigations into the mode of transmission of natural and laboratory-acquired listeriosis in animals. 34 references.

  12. Metabolic responses of primary and transformed cells to intracellular Listeria monocytogenes.

    Directory of Open Access Journals (Sweden)

    Nadine Gillmaier

    Full Text Available The metabolic response of host cells, in particular of primary mammalian cells, to bacterial infections is poorly understood. Here, we compare the carbon metabolism of primary mouse macrophages and of established J774A.1 cells upon Listeria monocytogenes infection using (13C-labelled glucose or glutamine as carbon tracers. The (13C-profiles of protein-derived amino acids from labelled host cells and intracellular L. monocytogenes identified active metabolic pathways in the different cell types. In the primary cells, infection with live L. monocytogenes increased glycolytic activity and enhanced flux of pyruvate into the TCA cycle via pyruvate dehydrogenase and pyruvate carboxylase, while in J774A.1 cells the already high glycolytic and glutaminolytic activities hardly changed upon infection. The carbon metabolism of intracellular L. monocytogenes was similar in both host cells. Taken together, the data suggest that efficient listerial replication in the cytosol of the host cells mainly depends on the glycolytic activity of the hosts.

  13. Comparative genomics analyses revealed two virulent Listeria monocytogenes strains isolated from ready-to-eat food.

    Science.gov (United States)

    Lim, Shu Yong; Yap, Kien-Pong; Thong, Kwai Lin

    2016-01-01

    Listeria monocytogenes is an important foodborne pathogen that causes considerable morbidity in humans with high mortality rates. In this study, we have sequenced the genomes and performed comparative genomics analyses on two strains, LM115 and LM41, isolated from ready-to-eat food in Malaysia. The genome size of LM115 and LM41 was 2,959,041 and 2,963,111 bp, respectively. These two strains shared approximately 90% homologous genes. Comparative genomics and phylogenomic analyses revealed that LM115 and LM41 were more closely related to the reference strains F2365 and EGD-e, respectively. Our virulence profiling indicated a total of 31 virulence genes shared by both analysed strains. These shared genes included those that encode for internalins and L. monocytogenes pathogenicity island 1 (LIPI-1). Both the Malaysian L. monocytogenes strains also harboured several genes associated with stress tolerance to counter the adverse conditions. Seven antibiotic and efflux pump related genes which may confer resistance against lincomycin, erythromycin, fosfomycin, quinolone, tetracycline, and penicillin, and macrolides were identified in the genomes of both strains. Whole genome sequencing and comparative genomics analyses revealed two virulent L. monocytogenes strains isolated from ready-to-eat foods in Malaysia. The identification of strains with pathogenic, persistent, and antibiotic resistant potentials from minimally processed food warrant close attention from both healthcare and food industry.

  14. Growth potential of Listeria monocytogenes in sliced turkey bresaola packed in modified atmosphere

    Directory of Open Access Journals (Sweden)

    Elena Dalzini

    2014-02-01

    Full Text Available According to EC Regulation No 2073/2005, for food business operators that produce ready-to-eat (RTE product, it is crucial to be able to demonstrate if the product supports the growth of Listeria monocytogenes. The objective of the study was therefore to evaluate the behaviour of L. monocytogenes in sliced RTE turkey bresaola (made by cured turkey breast 4.5% NaCl, 1% sodium lactate, sodium nitrite 150 ppm and flavouring during the shelf life of the product, simulating a contamination during the slicing operation. Considering a shelf life of 90 days, as defined by manufacturer, the packages of sliced bresaola were stored at 5°C for 7 days and at 8°C for the remaining storage time (83 days. L. monocytogenes count decreased during storage test from 1.43/1.98 log cfu/g in the three batches tested to 1.03 log cfu/g in one batch and to undetectable levels in the other two batches. The results show that the investigated product is unable to support the growth of L. monocytogenes.

  15. The virulence regulator PrfA promotes biofilm formation by Listeria monocytogenes.

    Science.gov (United States)

    Lemon, Katherine P; Freitag, Nancy E; Kolter, Roberto

    2010-08-01

    Listeria monocytogenes is a food-borne facultative intracellular pathogen. It is widespread in the environment and has several distinct life-styles. The key transcriptional activator PrfA positively regulates L. monocytogenes virulence genes to mediate the transition from extracellular, flagellum-propelled cell to intracellular pathogen. Here we report the first evidence that PrfA also has a significant positive impact on extracellular biofilm formation. Mutants lacking prfA were defective in surface-adhered biofilm formation. The DeltaprfA mutant exhibited wild-type flagellar motility, and its biofilm defect occurred after initial surface adhesion. We also observed that mutations that led to the constitutive expression of PrfA-dependent virulence genes had a minimal impact on biofilm formation. Furthermore, biofilm development was enhanced in a mutant encoding a PrfA protein variant unable to fully transition from the extracellular form to the virulent, intracellular activity conformation. These results indicate that PrfA positively regulates biofilm formation and suggest that PrfA has a global role in modulating the life-style of L. monocytogenes. The requirement of PrfA for optimal biofilm formation may provide selective pressure to maintain this critical virulence regulator when L. monocytogenes is outside host cells in the environment.

  16. Listeria Spp. and Listeria Monocytogenes Contamination in Ready-To-Eat Sandwiches Collected from Vending Machines.

    Science.gov (United States)

    Cossu, Francesca; Spanu, Carlo; Deidda, Silvia; Mura, Erica; Casti, Daniele; Pala, Carlo; Lamon, Sonia; Spanu, Vincenzo; Ibba, Michela; Marrocu, Elena; Scarano, Christian; Piana, Andrea; De Santis, Enrico Pietro Luigi

    2016-04-19

    Ready-to-eat (RTE) food is characterised by a long shelf-life at refrigerated temperature and can be consumed as such, without any treatment. The aim of the work was to evaluate the presence of Listeria spp. and Listeria monocytogenes in RTEs collected from refrigerated vending machines placed in hospital environment and accessible to the hospitalised patients. In 4 different sampling, 55 RTEs were collected from vending machines of six hospitals located in different areas of Sardinia region. All the samples were characterised by similar manufacturing process, such as the use of modified atmosphere packaging and belonged to 5 different producers. Listeria spp. was not countable using the enumeration method in all of the analysed samples. Using the detection method, Listeria spp. was recovered from 9 sandwich samples. Interestingly, 3 of these samples (5.5%) made by the manufacturer, were positive for L. monocytogenes contamination. The risk related to the L. monocytogenes presence in RTEs proportionally increases when food is introduced in susceptible environments , such as hospitals and consumed by susceptible people . Although the RTEs analysed showed values that complied with the European microbiological criteria for foodstuffs, the availability of these products in a susceptible environment should be carefully checked. Therefore, in order to limit the possible exposition to L. monocytogenes , more information on the risk related to RTE consumption should be provided to the hospitalised patients.

  17. REAL-TIME PCR DETECTION OF LISTERIA MONOCYTOGENES IN FOOD SAMPLES OF ANIMAL ORIGIN

    Directory of Open Access Journals (Sweden)

    Jaroslav Pochop

    2013-02-01

    Full Text Available The aim of this study was to follow the contamination of food with Listeria monocytogenes by using Step One real time polymerase chain reaction (PCR. We used the PrepSEQ Rapid Spin Sample Preparation Kit for isolation of DNA and SensiFAST SYBR Hi-ROX Kit for the real-time PCR performance. In 24 samples of food of animal origin without incubation were detected strains of Listeria monocytogenes in 15 samples (swabs. Nine samples were negative. Our results indicated that the real-time PCR assay developed in this study could sensitively detect Listeria monocytogenes in food of animal origin without incubation. This could prevent infection caused by Listeria monocytogenes, and also could benefit food manufacturing companies by extending their product’s shelf-life as well as saving the cost of warehousing their food products while awaiting pathogen testing results. The rapid real-time PCR-based method performed very well compared to the conventional method. It is a fast, simple, specific and sensitive way to detect nucleic acids, which could be used in clinical diagnostic tests in the future.

  18. Listeria monocytogenes Identification in Food of Animal Origin Used with Real Time PCR

    Directory of Open Access Journals (Sweden)

    Jaroslav Pochop

    2013-10-01

    Full Text Available The aim of this study was to follow the contamination of food with Listeria monocytogenes by using Step One real time polymerase chain reaction (RT PCR. We used the PrepSEQ Rapid Spin Sample Preparation Kit for isolation of DNA and SensiFAST SYBR Hi-ROX Kit for the real-time PCR performance. In 20 samples of food of animal origin with incubation were detected strains of Listeria monocytogenes in 9 samples (swabs. Eleven samples were negative. Our results indicated that the real-time PCR assay developed in this study could sensitively detect Listeria monocytogenes in food of animal origin without incubation. This could prevent infection caused by Listeria monocytogenes, and also could benefit food manufacturing companies by extending their product’s shelf-life as well as saving the cost of warehousing their food products while awaiting pathogen testing results. The rapid real-time PCR-based method performed very well compared to the conventional method. It is a fast, simple, specific and sensitive way to detect nucleic acids, which could be used in clinical diagnostic tests in the future.

  19. Listeria spp. and Listeria monocytogenes contamination in ready-to-eat sandwiches collected from vending machines

    Directory of Open Access Journals (Sweden)

    Francesca Cossu

    2016-05-01

    Full Text Available Ready-to-eat (RTE food is characterised by a long shelf-life at refrigerated temperature and can be consumed as such, without any treatment. The aim of the work was to evaluate the presence of Listeria spp. and Listeria monocytogenes in RTEs collected from refrigerated vending machines placed in hospital environment and accessible to the hospitalised patients. In 4 different sampling, 55 RTEs were collected from vending machines of six hospitals located in different areas of Sardinia region. All the samples were characterised by similar manufacturing process, such as the use of modified atmosphere packaging and belonged to 5 different producers. Listeria spp. was not countable using the enumeration method in all of the analysed samples. Using the detection method, Listeria spp. was recovered from 9 sandwich samples. Interestingly, 3 of these samples (5.5% made by the manufacturer, were positive for L. monocytogenes contamination. The risk related to the L. monocytogenes presence in RTEs proportionally increases when food is introduced in susceptible environments, such as hospitals and consumed by susceptible people. Although the RTEs analysed showed values that complied with the European microbiological criteria for foodstuffs, the availability of these products in a susceptible environment should be carefully checked. Therefore, in order to limit the possible exposition to L. monocytogenes, more information on the risk related to RTE consumption should be provided to the hospitalised patients.

  20. Integrative genomic analysis identifies isoleucine and CodY as regulators of Listeria monocytogenes virulence.

    Directory of Open Access Journals (Sweden)

    Lior Lobel

    2012-09-01

    Full Text Available Intracellular bacterial pathogens are metabolically adapted to grow within mammalian cells. While these adaptations are fundamental to the ability to cause disease, we know little about the relationship between the pathogen's metabolism and virulence. Here we used an integrative Metabolic Analysis Tool that combines transcriptome data with genome-scale metabolic models to define the metabolic requirements of Listeria monocytogenes during infection. Twelve metabolic pathways were identified as differentially active during L. monocytogenes growth in macrophage cells. Intracellular replication requires de novo synthesis of histidine, arginine, purine, and branch chain amino acids (BCAAs, as well as catabolism of L-rhamnose and glycerol. The importance of each metabolic pathway during infection was confirmed by generation of gene knockout mutants in the respective pathways. Next, we investigated the association of these metabolic requirements in the regulation of L. monocytogenes virulence. Here we show that limiting BCAA concentrations, primarily isoleucine, results in robust induction of the master virulence activator gene, prfA, and the PrfA-regulated genes. This response was specific and required the nutrient responsive regulator CodY, which is known to bind isoleucine. Further analysis demonstrated that CodY is involved in prfA regulation, playing a role in prfA activation under limiting conditions of BCAAs. This study evidences an additional regulatory mechanism underlying L. monocytogenes virulence, placing CodY at the crossroads of metabolism and virulence.

  1. Visualization of gold and platinum nanoparticles interacting with Salmonella enteritidis and Listeria monocytogenes

    DEFF Research Database (Denmark)

    Sawosz, Ewa; Chwalibog, André; Szeliga, Jacek

    2010-01-01

    -Au and nano-Pt respectively), with Salmonella Enteritidis (Gram-negative) and Listeria monocytogenes (Gram-positive), to reveal possibilities of constructing bacteria-nanoparticle vehicles. Methods: Hydrocolloids of nano-Au or nano-Pt were added to two bacteria suspensions in the following order: nano...... as a vehicle to deliver nano-Pt to specific points in the body....

  2. Inactivation of Listeria monocytogenes by disinfectants and bacteriophages in suspension and stainless steel carrier tests

    NARCIS (Netherlands)

    Chaitiemwong, N.; Hazeleger, W.C.; Beumer, R.R.

    2014-01-01

    To simulate food contact surfaces with pits or cracks, stainless steel plates with grooves (depths between 0.2 and 5 mm) were constructed. These plates were artificially contaminated with Listeria monocytogenes in clean conditions, with organic soiling, or after 14 days of biofilm formation after

  3. Stevia rebaudiana Bertoni effect on the hemolytic potential of Listeria monocytogenes.

    Science.gov (United States)

    Sansano, S; Rivas, A; Pina-Pérez, M C; Martinez, A; Rodrigo, D

    2017-06-05

    The effect of Stevia rebaudiana Bertoni on the hemolytic potential of Listeria monocytogenes was studied by means of the assessment of the Listeriolysin O (LLO) production. The three factors under study, stevia concentration in the range [0-2.5] % (w/v), incubation temperature (10 and 37°C), and exposure time (0-65h) significantly affected (p≤0.05) the hemolytic activity of L. monocytogenes. Results showed that at the lower incubation temperature the hemolytic potential of the bacterium was significantly reduced, from 100% at 37°C to 8% at 10°C (after 65h of incubation) in unsupplemented substrate (0% stevia). Irrespective of the temperature, 10 or 37°C, supplementation of the medium with stevia at 2.5 % (w/v) reduced the bacterium's hemolytic activity by a maximum of 100%. Furthermore, the time of exposure to 2.5 % (w/v) stevia concentration was also a significant factor reducing the hemolytic capability of L. monocytogenes. The possibility of reducing the pathogenic potential of L. monocytogenes (hemolysis) by exposure to stevia should be confirmed in real food matrices, opening a research niche with a valuable future impact on food safety. Copyright © 2017 Elsevier B.V. All rights reserved.

  4. Prevalence and populations of Listeria monocytogenes in meat products retailed in Sao Paulo, Brazil.

    Science.gov (United States)

    Ristori, Christiane Asturiano; Rowlands, Ruth Estela Gravato; Martins, Cecília Geraldes; Barbosa, Maria Luisa; Yoshida, Júlia T U; Franco, Bernadette D G de Melo

    2014-12-01

    This study evaluated the prevalence of the populations and serotypes of Listeria monocytogenes in 552 refrigerated samples of ground beef, chicken leg, hot dog, and pork sausage collected in supermarkets in the city of Sao Paulo, SP, Brazil, between May 2008 and July 2009. The supermarkets were selected after stratification by geographical region and by random draw. Tests for presence and enumeration of L. monocytogenes were based on ISO 11290-1:1996/Amd.1:2004 and ISO 11290-2:1998 methods, respectively. Listeria spp. were detected in 469 (85.0%) of the studied meat products. The most frequently isolated species was L. innocua (64.1%), followed by L. monocytogenes (48.7%), L. welshimeri (13.4%), L. seeligeri (7.1%), L. ivanovii (0.2%), and L. grayi subspecies murrayi (0.2%). L. monocytogenes was detected in 269 (48.7%) samples, with highest prevalence in ground beef (59.4%) followed by chicken legs (58.0%), pork sausages (39.8%), and hot dogs (37.7%). The populations were Prevalence of serotypes varied according to the type of meat product. These data are relevant for estimating the risks of listeriosis associated with consumption of meat products in Sao Paulo, and for establishing science-based intervention strategies aimed at reducing these risks, especially for pregnant women and immunocompromised individuals.

  5. Prevalence of Listeria monocytogenes in the river receiving the effluent of municipal wastewater treatment plant

    Directory of Open Access Journals (Sweden)

    Atefeh Taherkhani

    2013-01-01

    Full Text Available Aims: The objective of this study was to evaluate the prevalence of Listeria spp. in the river water before and after discharge of the effluent of the municipal wastewater treatment plant (WWTP in Isfahan, Iran. Materials and Methods: A total of 66 samples were collected bi-weekly over 4 months from eleven discrete sampling locations in Zayandehrood River, Iran. Three sampling sites were located above the discharge point and five sites were located after the discharge point of WWTP. Samples were also collected from the influent and the effluent of WWTP. Listeria spp. were isolated using a selective enrichment procedure and a subculture onto polymyxin-acriflavine-lithium chloride-ceftazidime-esculin-mannitol Agar. All isolates were subjected to standard biochemical tests. Results: L. monocytogenes was isolated from influent (83%, effluent (50% and (18.5% river water. Listeria spp. was not found before the discharge point in river water. However, L. monocytogenes was isolated in samples collected from 200 m (33%, 500 m (33%, 2 km (16.5%, 5 km (16.5% and 10 km (16.5% downstream from the WWTP. Listeria innocua (9% and Listeria seeligeri (10% were the second most frequently isolated species. Conclusion: During the wastewater treatment, Listeria spp. is not removed completely. L. monocytogenes is widely distributed in the Zayandehrood river. L. monocytogenes released into surface water demonstrates a potential risk for public health. These results indicate the need for appropriate water management in order to reduce human and animal exposure to such pathogens.

  6. Isolation and detection of Listeria monocytogenes in poultry meat by standard culture methods and PCR

    Science.gov (United States)

    Kureljušić, J.; Rokvić, N.; Jezdimirović, N.; Kureljušić, B.; Pisinov, B.; Karabasil, N.

    2017-09-01

    Listeria is the genus of a bacteria found in soil and water and some animals, including poultry and cattle. It can be present in raw milk and food made from raw milk. It can also live in food processing plants and contaminate a variety of processed meats. Microscopically, Listeria species appear as small, Gram-positive rods, which are sometimes arranged in short chains. In direct smears, they can be coccoid, so they can be mistaken for streptococci. Longer cells can resemble corynebacteria. Flagella are produced at room temperature but not at 37°C. Haemolytic activity on blood agar has been used as a marker to distinguish Listeria monocytogenes among other Listeria species, but it is not an absolutely definitive criterion. Further biochemical characterization is necessary to distinguish between the different Listeria species. The objective of this study was to detect, isolate and identify Listeria monocytogenes from poultry meat. Within a period of six months from January to June 2017, a total of 15 samples were collected. Three samples were positive for the presence of Listeria monocytogenes. Biochemical and microbiological tests as well as PCR technique using specific primers were used to confirm L. Monocytogenes in the samples.

  7. Prevalence of Listeria monocytogenes in Retail Lightly Pickled Vegetables and Its Successful Control at Processing Plants.

    Science.gov (United States)

    Taguchi, Masumi; Kanki, Masashi; Yamaguchi, Yuko; Inamura, Hideichi; Koganei, Yosuke; Sano, Tetsuya; Nakamura, Hiromi; Asakura, Hiroshi

    2017-03-01

    Incidences of food poisoning traced to nonanimal food products have been increasingly reported. One of these was a recent large outbreak of Shiga toxin-producing Escherichia coli (STEC) O157 infection from the consumption of lightly pickled vegetables, indicating the necessity of imposing hygienic controls during manufacturing. However, little is known about the bacterial contamination levels in these minimally processed vegetables. Here we examined the prevalence of STEC, Salmonella spp., and Listeria monocytogenes in 100 lightly pickled vegetable products manufactured at 55 processing factories. Simultaneously, we also performed quantitative measurements of representative indicator bacteria (total viable counts, coliform counts, and β-glucuronidase-producing E. coli counts). STEC and Salmonella spp. were not detected in any of the samples; L. monocytogenes was detected in 12 samples manufactured at five of the factories. Microbiological surveillance at two factories (two surveys at factory A and three surveys at factory B) between June 2014 and January 2015 determined that the areas predominantly contaminated with L. monocytogenes included the refrigerators and packaging rooms. Genotyping provided further evidence that the contaminants found in these areas were linked to those found in the final products. Taken together, we demonstrated the prevalence of L. monocytogenes in lightly pickled vegetables sold at the retail level. Microbiological surveillance at the manufacturing factories further clarified the sources of the contamination in the retail products. These data indicate the necessity of implementing adequate monitoring programs to minimize health risks attributable to the consumption of these minimally processed vegetables.

  8. Extracting additional risk managers information from a risk assessment of Listeria monocytogenes in deli meats

    NARCIS (Netherlands)

    Pérez-Rodríguez, F.; Asselt, van E.D.; García-Gimeno, R.M.; Zurera, G.; Zwietering, M.H.

    2007-01-01

    The risk assessment study of Listeria monocytogenes in ready-to-eat foods conducted by the U.S. Food and Drug Administration is an example of an extensive quantitative microbiological risk assessment that could be used by risk analysts and other scientists to obtain information and by managers and

  9. Radiation sensitivities of Listeria monocytogenes isolated from chicken meat and their growth at refrigeration temperatures

    International Nuclear Information System (INIS)

    Harsojo; Banati, D.; Ito, H.

    1997-01-01

    Listeria monocytogenes were isolated in 5 lots, more than one cell in each 25-g sample of 10 lots of chicken meat, which was obtained from several different areas in Japan. From taxonomic study, the psychrotrophic type of 3 isolates grew well at 4°C on Trypticase soy agar slant, whereas 2 isolates grew poorly. Cells of all isolates were sensitive to γ-irradiation in phosphate buffer, and the D 10 values obtained were 0.16 to 0.18 kGy under aerobic irradiation conditions similar to the values of salmonellae. In the chicken meat sample, the D 10 value obtained was 0.42 kGy the same value as in phosphate buffer under anaerobic irradiation conditions, and the necessary dose for inactivation of L. monocytogenes was estimated to be 2 kGy in raw chicken meat below 10 -4 CFU (colony forming unit) per gram. In the storage study of chicken meat which was inoculated with about 3×10 3 CFU per gram of L. monocytogenes, the psychrotrophic type of the isolates grew quickly at 7 to 10°C storage. However, a dose of 1 kGy was also effective to suppress the growth of L. monocytogenes at refrigeration temperatures below 10°C

  10. Survival of Listeria monocytogenes on a conveyor belt material with or without antimicrobial additives

    NARCIS (Netherlands)

    Chaitiemwong, N.; Hazeleger, W.C.; Beumer, R.R.

    2010-01-01

    Survival of Listeria monocytogenes on a conveyor belt material with or without antimicrobial additives, in the absence or presence of food debris from meat, fish and vegetables and at temperatures of 10, 25 and 37 °C was investigated. The pathogen survived best at 10 °C, and better at 25 °C than at

  11. Biofilm formation by Listeria monocytogenes on stainless steel surface and biotransfer potential

    Directory of Open Access Journals (Sweden)

    Maíra Maciel Mattos de Oliveira

    2010-03-01

    Full Text Available An experimental model was proposed to study biofilm formation by Listeria monocytogenes ATCC 19117 on AISI 304 (#4 stainless steel surface and biotransfer potential during this process. In this model, biofilm formation was conducted on the surface of stainless steel coupons, set on a stainless steel base with 4 divisions, each one supporting 21 coupons. Trypic Soy Broth was used as bacterial growth substrate, with incubation at 37 ºC and stirring of 50 rpm. The number of adhered cells was determined after 3, 48, 96, 144, 192 and 240 hours of biofilm formation and biotransfer potential from 96 hours. Stainless steel coupons were submitted to Scanning Electron Microscopy (SEM after 3, 144 and 240 hours. Based on the number of adhered cells and SEM, it was observed that L. monocytogenes adhered rapidly to the stainless steel surface, with mature biofilm being formed after 240 hours. The biotransfer potential of bacterium to substrate occurred at all the stages analyzed. The rapid capacity of adhesion to surface, combined with biotransfer potential throughout the biofilm formation stages, make L. monocytogenes a potential risk to the food industry. Both the experimental model developed and the methodology used were efficient in the study of biofilm formation by L. monocytogenes on stainless steel surface and biotransfer potential.

  12. Biofilm formation by Listeria monocytogenes on stainless steel surface and biotransfer potential.

    Science.gov (United States)

    de Oliveira, Maíra Maciel Mattos; Brugnera, Danilo Florisvaldo; Alves, Eduardo; Piccoli, Roberta Hilsdorf

    2010-01-01

    An experimental model was proposed to study biofilm formation by Listeria monocytogenes ATCC 19117 on AISI 304 (#4) stainless steel surface and biotransfer potential during this process. In this model, biofilm formation was conducted on the surface of stainless steel coupons, set on a stainless steel base with 4 divisions, each one supporting 21 coupons. Trypic Soy Broth was used as bacterial growth substrate, with incubation at 37 °C and stirring of 50 rpm. The number of adhered cells was determined after 3, 48, 96, 144, 192 and 240 hours of biofilm formation and biotransfer potential from 96 hours. Stainless steel coupons were submitted to Scanning Electron Microscopy (SEM) after 3, 144 and 240 hours. Based on the number of adhered cells and SEM, it was observed that L. monocytogenes adhered rapidly to the stainless steel surface, with mature biofilm being formed after 240 hours. The biotransfer potential of bacterium to substrate occurred at all the stages analyzed. The rapid capacity of adhesion to surface, combined with biotransfer potential throughout the biofilm formation stages, make L. monocytogenes a potential risk to the food industry. Both the experimental model developed and the methodology used were efficient in the study of biofilm formation by L. monocytogenes on stainless steel surface and biotransfer potential.

  13. Combined action of S-carvone and mild heat treatment on Listeria monocytogenes Scott A

    NARCIS (Netherlands)

    Karatzas, A.K.; Bennik, M.H.J.; Smid, E.J.; Kets, E.P.W.

    2000-01-01

    The combined action of the plant-derived volatile, S-carvone, and mild heat treatment on the food-borne pathogen, Listeria monocytogenes, was evaluated. The viability of exponential phase cultures grown at 8 °C could be reduced by 1.3 log units after exposure to S-carvone (5 mmol 1-1) for 30 min at

  14. [Risk assessment of Listeria monocytogenes in deli meats and vegetable salads].

    Science.gov (United States)

    Tian, Jing; Liu, Xiu-mei

    2009-09-01

    To analysis risk from Listeria monocytogenes in deli meats and vegetable salads. Use Risk Ranger which is a software programme developed by the University of Hobart, Australia and answer 11 questions on affecting the risk from hazards in the specific foods by combining data from national foodborne diseases surveillance network and some references to make semi-quantitative risk assessment for the specific food. Relative risk from Listeria monocytogenes in deli meats and vegetable salads is 61 and 52, respectively. Incidence of listeriosis caused by deli meats-Listeria monocytogenes pairs and vegetable salads-Listeria monocytogenes pairs is 5.4 and 0.2 cases per million people, respectively. Risk from the former is 32 times than that from the latter. By changing the selection for some risk factors in the model, it was known that the risks from two food-hazard combinations could decrease 10 times, if taking necessary actions after processing. Deli meats is a kind of high risk food for listeriosis.

  15. Listeria monocytogenes meningitis: serotype distribution and patient characteristics in The Netherlands, 1976-95

    NARCIS (Netherlands)

    Aouaj, Y.; Spanjaard, L.; van Leeuwen, N.; Dankert, J.

    2002-01-01

    Two hundred and seven cases of listeria meningitis that occurred in The Netherlands over 20 years were reviewed to study associations between Listeria monocytogenes serotype, age, underlying disease, and outcome. The mean annual incidence per 100000 population was 0.12 in 1981-90, decreasing to 0.07

  16. Evaluation of Listeria monocytogenes survival and infectivity in non-traditional agricultural waters

    Science.gov (United States)

    Introduction: Listeria monocytogenes (Lm) is an enteric bacterium that can be found in environmental reservoirs. Restricted water availability for agriculture has increased interest in surface and reuse water sources which could potentially transmit Lm. Purpose: Persistence and infectivity of Lm re...

  17. A Dual Microscopy-Based Assay To Assess Listeria monocytogenes Cellular Entry and Vacuolar Escape.

    Science.gov (United States)

    Quereda, Juan J; Pizarro-Cerdá, Javier; Balestrino, Damien; Bobard, Alexandre; Danckaert, Anne; Aulner, Nathalie; Shorte, Spencer; Enninga, Jost; Cossart, Pascale

    2016-01-01

    Listeria monocytogenes is a Gram-positive bacterium and a facultative intracellular pathogen that invades mammalian cells, disrupts its internalization vacuole, and proliferates in the host cell cytoplasm. Here, we describe a novel image-based microscopy assay that allows discrimination between cellular entry and vacuolar escape, enabling high-content screening to identify factors specifically involved in these two steps. We first generated L. monocytogenes and Listeria innocua strains expressing a β-lactamase covalently attached to the bacterial cell wall. These strains were then incubated with HeLa cells containing the Förster resonance energy transfer (FRET) probe CCF4 in their cytoplasm. The CCF4 probe was cleaved by the bacterial surface β-lactamase only in cells inoculated with L. monocytogenes but not those inoculated with L. innocua, thereby demonstrating bacterial access to the host cytoplasm. Subsequently, we performed differential immunofluorescence staining to distinguish extracellular versus total bacterial populations in samples that were also analyzed by the FRET-based assay. With this two-step analysis, bacterial entry can be distinguished from vacuolar rupture in a single experiment. Our novel approach represents a powerful tool for identifying factors that determine the intracellular niche of L. monocytogenes. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  18. Thermal inactivation of Listeria monocytogenes and Salmonella spp. in sous-vide processed marinated chicken breast

    Science.gov (United States)

    The heat resistance of a cocktail of five Salmonella strains and five L. monocytogenes strains was determined in teriyaki-marinated chicken breasts. Inoculated meat, packaged in bags, were completely immersed in a circulating water bath and cooked to a final temperature of 55, 57.5 or 60C in one h...

  19. Antimicrobial resistance of Listeria monocytogenes and Listeria innocua from meat products and meat-processing environment.

    Science.gov (United States)

    Gómez, Diego; Azón, Ester; Marco, Noelia; Carramiñana, Juan J; Rota, Carmina; Ariño, Agustín; Yangüela, Javier

    2014-09-01

    A total of 336 Listeria isolates from ready-to-eat (RTE) meat products and meat-processing environments, consisting of 206 Listeria monocytogenes, and 130 Listeria innocua isolates, were characterized by disc diffusion assay and minimum inhibitory concentration (MIC) values for antimicrobial susceptibility against twenty antimicrobials. Resistance to one or two antimicrobials was observed in 71 L. monocytogenes isolates (34.5%), and 56 L. innocua isolates (43.1%). Multidrug resistance was identified in 24 Listeria isolates, 18 belonging to L. innocua (13.9%) and 6 to L. monocytogenes (2.9%). Oxacillin resistance was the most common resistance phenotype and was identified in 100% Listeria isolates. A medium prevalence of resistance to clindamycin (39.3% isolates) and low incidence of resistance to tetracycline (3.9% isolates) were also detected. Listeria isolates from RTE meat products displayed higher overall antimicrobial resistance (31.3%) than those from the environment (13.4%). All the strains assayed were sensitive to the preferred antibiotics used to treat listeriosis. Results showed that although antimicrobial resistance in L. monocytogenes still occurs at a low prevalence, L. innocua can form a reservoir of resistance genes which may transfer between bacterial species, including transference to organisms capable of causing disease in humans. Copyright © 2014 Elsevier Ltd. All rights reserved.

  20. Morphological change and decreasing transfer rate of biofilm-featured Listeria monocytogenes EGDe

    Science.gov (United States)

    Listeria monocytogenes, a lethal foodborne pathogen, has the ability to resist the hostile food-processing environment and, thus, frequently contaminates ready-to-eat foods during processing. It is commonly accepted that L. monocytogenes’ tendency to generate biofilms on various surfaces enhances it...

  1. Draft Genome Sequences of Historical Listeria monocytogenes from Human Listeriosis, 1933

    Science.gov (United States)

    We report here the draft genome sequences of two Listeria monocytogenes strains from some of the earliest reported cases of human listeriosis in North America. The strains were isolated in 1933 from patients in Massachusetts and Connecticut, USA, and belong to the widely disseminated hypervirulent c...

  2. A large outbreak of Listeria monocytogenes infection with short incubation period in a tertiary care hospital.

    Science.gov (United States)

    Johnsen, Bjørn Odd; Lingaas, Egil; Torfoss, Dag; Strøm, Erik H; Nordøy, Ingvild

    2010-12-01

    Listeria monocytogenes is a foodborne pathogen with a high mortality rate. We report a large, nosocomial outbreak of Listeria monocytogenes infection. Patients with L. monocytogenes isolated from a sterile site, or from faeces when diarrhoea and fever were present, were included. Clinical data were collected from the patient records. The incubation period was calculated as the time between exposure and start of symptoms. Seventeen patients (11 women, median age 64 years) were infected of whom 15 patients were at increased risk for listeriosis. Eleven patients received empiric antibiotic treatment, eight of them with cephalosporins. Three patients died with a resulting mortality rate of 18%. The source of the outbreak was a Camembert cheese made from pasteurised milk containing up to 360 million colony forming units per portion. The median incubation period was 3-4 days. The incubation period in this outbreak was significantly shorter than previously reported, a fact that may be due to the high number of ingested bacteria. Furthermore, food restrictions in hospitals seem warranted, as do treatment with antibiotics effective against L. monocytogenes in at-risk populations. Copyright © 2010 The British Infection Association. Published by Elsevier Ltd. All rights reserved.

  3. Modelling the growth of Listeria monocytogenes in fresh green coconut (Cocos nucifera L.) water.

    Science.gov (United States)

    Walter, Eduardo H M; Kabuki, Dirce Y; Esper, Luciana M R; Sant'Ana, Anderson S; Kuaye, Arnaldo Y

    2009-09-01

    The behaviour of Listeria monocytogenes in the fresh coconut water stored at 4 degrees C, 10 degrees C and 35 degrees C was studied. The coconut water was aseptically extracted from green coconuts (Cocos nucifera L.) and samples were inoculated in triplicate with a mixture of 5 strains of L. monocytogenes with a mean population of approximately 3 log(10) CFU/mL. The kinetic parameters of the bacteria were estimated from the Baranyi model, and compared with predictions of the Pathogen Modelling Program so as to predict its behaviour in the beverage. The results demonstrated that fresh green coconut water was a beverage propitious for the survival and growth of L. monocytogenes and that refrigeration at 10 degrees C or 4 degrees C retarded, but did not inhibit, growth of this bacterium. Temperature abuse at 35 degrees C considerably reduced the lagtimes. The study shows that L. monocytogenes growth in fresh green coconut water is controlled for several days by storage at low temperature, mainly at 4 degrees C. Thus, for risk population this product should only be drunk directly from the coconut or despite the sensorial alterations should be consumed pasteurized.

  4. Listeria monocytogenes Infection in Hairy Cell Leukemia: A Case Report and Literature Review

    Directory of Open Access Journals (Sweden)

    James C. Barton

    2018-01-01

    Full Text Available Listeria monocytogenes infections have been described in patients with diverse types of malignancy, especially leukemia. We report the case of a 65-year-old man with previously untreated hairy cell leukemia characterized by CD5 positivity and trisomy 12 (3% of blood lymphocytes who developed bacteremia due to L. monocytogenes serotype 1/2b. We summarize clinical features and treatment of this patient and five previously reported patients with hairy cell leukemia who also had L. monocytogenes infections. All six patients were men. Their mean age at infection diagnosis was 70 y. Three men had undergone splenectomy 4–11 y before they developed L. monocytogenes infection. The central nervous system was the primary site of infection in four men. Bacteremia alone occurred in two other men. At diagnosis of infection, one man was receiving antileukemia chemotherapy and another man was receiving treatment for Kaposi’s sarcoma. Two other patients had other comorbid conditions. All six men recovered from their infections.

  5. Effect of high pressure processing on reduction of Listeria monocytogenes in packaged Queso Fresco

    Science.gov (United States)

    The effect of high hydrostatic pressure processing (HPP) on the survival of a five-strain rifampicin-resistant cocktail of Listeria monocytogenes in Queso Fresco (QF) was evaluated as a post-packaging intervention. QF was made using pasteurized, homogenized milk, was starter-free and was not pressed...

  6. Modeling the effect of temperature on survival rate of Listeria monocytogenes in yogurt.

    Science.gov (United States)

    Szczawiński, J; Szczawińska, M E; Łobacz, A; Jackowska-Tracz, A

    2016-01-01

    The aim of the study was to (i) evaluate the behavior of Listeria monocytogenes in a commercially produced yogurt, (ii) determine the survival/inactivation rates of L. monocytogenes during cold storage of yogurt and (iii) to generate primary and secondary mathematical models to predict the behavior of these bacteria during storage at different temperatures. The samples of yogurt were inoculated with the mixture of three L. monocytogenes strains and stored at 3, 6, 9, 12 and 15°C for 16 days. The number of listeriae was determined after 0, 1, 2, 3, 5, 7, 9, 12, 14 and 16 days of storage. From each sample a series of decimal dilutions were prepared and plated onto ALOA agar (agar for Listeria according to Ottaviani and Agosti). It was found that applied temperature and storage time significantly influenced the survival rate of listeriae (pbacteria was found in the samples stored at 6°C (D-10 value = 243.9 h), whereas the highest reduction in the number of the bacteria was observed in the samples stored at 15°C (D-10 value = 87.0 h). The number of L. monocytogenes was correlated with the pH value of the samples (pyogurt stored under temperature range from 3 to 15°C, however, the polynomial model gave a better fit to the experimental data.

  7. Assessment of Listeria monocytogenes virulence in the Galleria mellonella insect larvae model.

    Directory of Open Access Journals (Sweden)

    Mira Rakic Martinez

    Full Text Available Several animal models have been used to understand the molecular basis of the pathogenicity, infectious dose and strain to strain variation of Listeria monocytogenes. The greater wax worm Galleria mellonella, as an alternative model, provides some useful advantages not available with other models and has already been described as suitable for the virulence assessment of various pathogens including L. monocytogenes. The objectives of this study are: 1 confirming the usefulness of this model with a wide panel of Listeria spp. including non-pathogenic L. innocua, L. seeligeri, L. welshimeri and animal pathogen L. ivanovii; 2 assessment of virulence of several isogenic in-frame deletion mutants in virulence and stress related genes of L. monocytogenes and 3 virulence assessment of paired food and clinical isolates of L. monocytogenes from 14 major listeriosis outbreaks occurred worldwide between 1980 and 2015. Larvae injected with different concentrations of Listeria were incubated at 37°C and monitored over seven days for time needed to kill 50% of larvae (LT50 and to determine change of bacterial population in G. mellonella, 2 and 24 hours post-inoculation. Non-pathogenic members of Listeria and L. ivanovii showed significantly (P < 0.05 higher LT50 (lower virulence than the wild type L. monocytogenes strains. Isogenic mutants of L. monocytogenes with the deletions in prfA, plcA, hly, actA and virR genes, also showed significantly (P < 0.05 higher LT50 than the wild type strain at the inoculum of 106CFU/larva. Food isolates had significantly (P < 0.05 lower virulence than the paired clinical isolates, at all three inoculum concentrations. L. monocytogenes strains related to non-invasive (gastroenteritis outbreaks of listeriosis showed significantly (P < 0.05 lower virulence than isolates of the same serotype obtained from outbreaks with invasive symptoms. The difference, however, was dose and strain- dependent. No significant differences in

  8. Solar irradiance limits the long-term survival of Listeria monocytogenes in seawater.

    Science.gov (United States)

    NicAogáin, K; Magill, D; O'Donoghue, B; Conneely, A; Bennett, C; O'Byrne, C P

    2018-03-01

    Seafood has often been implicated in outbreaks of food-borne illness caused by Listeria monocytogenes but the source of contamination is usually not known. In this study we investigated the possibility that this pathogen could survive in seawater for an extended time period. Freshly collected seawater samples were inoculated with 1 × 10 8  CFU per ml of L. monocytogenes EGD-e and survival was monitored by plate counting for up to 25 days. When incubated in the dark, either at ambient temperatures (4-14°C) or at 16°C, >10 4  CFU per ml survivors were present after 25 days. However, when the seawater cell suspensions were exposed to ambient light (solar irradiation) and temperatures, L. monocytogenes lost viability rapidly and no survivors could be detected after the 80 h time point. Both UV-A and visible light in the blue region of the spectrum (470 nm) were found to contribute to this effect. The stress inducible sigma factor σ B was found to play a role in survival of L. monocytogenes in seawater. Together these data demonstrate that solar irradiation is a critical determinant of L. monocytogenes survival in marine environments. The data further suggest the possibility of controlling this food-borne pathogen in food-processing environments using visible light. Listeria monocytogenes is a food-borne bacterial pathogen capable of causing the life-threatening infection, listeriosis. In seafood the route of contamination from the environment is often not well understood as this pathogen is not generally thought to survive well in seawater. Here we provide evidence that L. monocytogenes is capable of surviving for long periods of time in seawater when light is excluded. Sunlight is demonstrated to have a significant effect on the survival of this pathogen in seawater, and both visible (470 nm) and UV-A light are shown to contribute to this effect. © 2017 The Society for Applied Microbiology.

  9. LASIP-III, a generalized processor for standard interface files

    International Nuclear Information System (INIS)

    Bosler, G.E.; O'Dell, R.D.; Resnik, W.M.

    1976-03-01

    The LASIP-III code was developed for processing Version III standard interface data files which have been specified by the Committee on Computer Code Coordination. This processor performs two distinct tasks, namely, transforming free-field format, BCD data into well-defined binary files and providing for printing and punching data in the binary files. While LASIP-III is exported as a complete free-standing code package, techniques are described for easily separating the processor into two modules, viz., one for creating the binary files and one for printing the files. The two modules can be separated into free-standing codes or they can be incorporated into other codes. Also, the LASIP-III code can be easily expanded for processing additional files, and procedures are described for such an expansion. 2 figures, 8 tables

  10. CryptoCache: A Secure Sharable File Cache for Roaming Users

    DEFF Research Database (Denmark)

    Jensen, Christian D.

    2000-01-01

    . Conventional distributed file systems cache everything locally or not at all; there is no possibility to cache files on nearby nodes.In this paper we present the design of a secure cache system called CryptoCache that allows roaming users to cache files on untrusted file hosting servers. The system allows...... flexible sharing of cached files among unauthenticated users, i.e. unlike most distributed file systems CryptoCache does not require a global authentication framework.Files are encrypted when they are transferred over the network and while stored on untrusted servers. The system uses public key......Small mobile computers are now sufficiently powerful to run many applications, but storage capacity remains limited so working files cannot be cached or stored locally. Even if files can be stored locally, the mobile device is not powerful enough to act as server in collaborations with other users...

  11. Distributed Data Management and Distributed File Systems

    CERN Document Server

    Girone, Maria

    2015-01-01

    The LHC program has been successful in part due to the globally distributed computing resources used for collecting, serving, processing, and analyzing the large LHC datasets. The introduction of distributed computing early in the LHC program spawned the development of new technologies and techniques to synchronize information and data between physically separated computing centers. Two of the most challenges services are the distributed file systems and the distributed data management systems. In this paper I will discuss how we have evolved from local site services to more globally independent services in the areas of distributed file systems and data management and how these capabilities may continue to evolve into the future. I will address the design choices, the motivations, and the future evolution of the computing systems used for High Energy Physics.

  12. Utilizing HDF4 File Content Maps for the Cloud

    Science.gov (United States)

    Lee, Hyokyung Joe

    2016-01-01

    We demonstrate a prototype study that HDF4 file content map can be used for efficiently organizing data in cloud object storage system to facilitate cloud computing. This approach can be extended to any binary data formats and to any existing big data analytics solution powered by cloud computing because HDF4 file content map project started as long term preservation of NASA data that doesn't require HDF4 APIs to access data.

  13. BIBLIO: A Reprint File Management Algorithm

    Science.gov (United States)

    Zelnio, Robert N.; And Others

    1977-01-01

    The development of a simple computer algorithm designed for use by the individual educator or researcher in maintaining and searching reprint files is reported. Called BIBLIO, the system is inexpensive and easy to operate and maintain without sacrificing flexibility and utility. (LBH)

  14. An information retrieval system for research file data

    Science.gov (United States)

    Joan E. Lengel; John W. Koning

    1978-01-01

    Research file data have been successfully retrieved at the Forest Products Laboratory through a high-speed cross-referencing system involving the computer program FAMULUS as modified by the Madison Academic Computing Center at the University of Wisconsin. The method of data input, transfer to computer storage, system utilization, and effectiveness are discussed....

  15. GEODOC: the GRID document file, record structure and data element description

    Energy Technology Data Exchange (ETDEWEB)

    Trippe, T.; White, V.; Henderson, F.; Phillips, S.

    1975-11-06

    The purpose of this report is to describe the information structure of the GEODOC file. GEODOC is a computer based file which contains the descriptive cataloging and indexing information for all documents processed by the National Geothermal Information Resource Group. This file (along with other GRID files) is managed by DBMS, the Berkeley Data Base Management System. Input for the system is prepared using the IRATE Text Editing System with its extended (12 bit) character set, or punched cards.

  16. Genetic Separation of Listeria monocytogenes Causing Central Nervous System Infections in Animals

    Directory of Open Access Journals (Sweden)

    Lisandra Aguilar-Bultet

    2018-02-01

    Full Text Available Listeria monocytogenes is a foodborne pathogen that causes abortion, septicemia, gastroenteritis and central nervous system (CNS infections in ruminants and humans. L. monocytogenes strains mainly belong to two distinct phylogenetic groups, named lineages I and II. In general, clinical cases in humans and animals, in particular CNS infections, are caused by lineage I strains, while most of the environmental and food strains belong to lineage II. Little is known about why lineage I is more virulent than lineage II, even though various molecular factors and mechanisms associated with pathogenesis are known. In this study, we have used a variety of whole genome sequence analyses and comparative genomic tools in order to find characteristics that distinguish lineage I from lineage II strains and CNS infection strains from non-CNS strains. We analyzed 225 strains and identified single nucleotide variants between lineages I and II, as well as differences in the gene content. Using a novel approach based on Reads Per Kilobase per Million Mapped (RPKM, we identified 167 genes predominantly absent in lineage II but present in lineage I. These genes are mostly encoding for membrane-associated proteins. Additionally, we found 77 genes that are largely absent in the non-CNS associated strains, while 39 genes are especially lacking in our defined “non-clinical” group. Based on the RPKM analysis and the metadata linked to the L. monocytogenes strains, we identified 6 genes potentially associated with CNS cases, which include a transcriptional regulator, an ABC transporter and a non-coding RNA. Although there is not a clear separation between pathogenic and non-pathogenic strains based on phylogenetic lineages, the presence of the genes identified in our study reveals potential pathogenesis traits in ruminant L. monocytogenes strains. Ultimately, the differences that we have found in our study will help steer future studies in understanding the virulence

  17. Listeria spp. E Listeria monocytogenes NA PRODUÇÃO DE SALSICHAS TIPO HOT DOG

    Directory of Open Access Journals (Sweden)

    ALESSANDRA PARO RODRIGUES CESAR

    2011-06-01

    Full Text Available Listeria monocytogenes is widely distributed in the environment and it has been isolated from food that were associated to outbreaks of high lethality in many countries. Thus, this bacterium represents an important pathogen to the public health. Ready-to-eat products, likecooked stuffed food, within them, frankfurters, are associated to human listeriosis in many countries. Taking into consideration the importance of the subject and the need of more data about it, the occurrence of Listeria spp. and L. monocytogenes in industrial plants, in meat raw materials, in slurry and frankfurters was investigated.These samples were collected in two production plants with SIF (Federal Inspection Service; in one of them GMP, HACCP and SOP were implemented. The results of the 1 06 microbiological analysis were submitted to the program @Risk to obtain the risk analysis; the meanvalues results showed that 7 to 9% of the frankfurters in the market may have L. monocytogenes. The analysis indicated that 88 strains of L. monocytogenes were obtained from 1 06 samples; among them, 76 werecollected in the industrial plants that participate in the experiment, and 30 were collected in the market. In serological typification, 95% of these strains were classified as serotypes 4b, 1 /2a and 1 /2b. Besides the presence of the bacterium in frankfurthers consumed inBrazil and the risk factors associated to this pathogen, the situation concerns because of the lack of epidemiological data, absence of patterns and the deficient information given to the consumer, specially information related to the presence of L. monocytogenes, particularly important to the groups at risk, as well as information related to the importance of heating the product

  18. Visualization of gold and platinum nanoparticles interacting with Salmonella Enteritidis and Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Ewa Sawosz

    2010-08-01

    Full Text Available Ewa Sawosz1, André Chwalibog2, Jacek Szeliga3, Filip Sawosz2, Marta Grodzik1, Marlena Rupiewicz1, Tomasz Niemiec1, Katarzyna Kacprzyk11Division of Biotechnology and Biochemistry of Nutrition, Warsaw University of Life Sciences, Warsaw, Poland; 2Department of Basic Animal and Veterinary Sciences, University of Copenhagen, Copenhagen, Denmark; 3Division of Microbiology of Analytical Centre, Warsaw University of Life Sciences, Warsaw, PolandPurpose: Rapid development of nanotechnology has recently brought significant attention to the extraordinary biological features of nanomaterials. The objective of the present ­investigation was to evaluate morphological characteristics of the assembles of gold and platinum nanoparticles (nano-Au and nano-Pt respectively, with Salmonella Enteritidis (Gram-negative and Listeria monocytogenes (Gram-positive, to reveal possibilities of constructing bacteria-nanoparticle vehicles.Methods: Hydrocolloids of nano-Au or nano-Pt were added to two bacteria suspensions in the following order: nano-Au + Salmonella Enteritidis; nano-Au + Listeria monocytogenes; nano-Pt + Salmonella Enteritidis; nano-Pt + Listeria monocytogenes. Samples were inspected by transmission electron microscope.Results: Visualization of morphological interaction between nano-Au and Salmonella Enteritidis and Listeria monocytogenes, showed that nano-Au were aggregated within flagella or biofilm network and did not penetrate the bacterial cell. The analysis of morphological effects of interaction of nano-Pt with bacteria revealed that nano-Pt entered cells of Listeria monocytogenes and were removed from the cells. In the case of Salmonella Enteritidis, nano-Pt were seen inside bacteria cells, probably bound to DNA and partly left bacterial cells. After washing and centrifugation, some of the nano-Pt-DNA complexes were observed within Salmonella Enteritidis.Conclusion: The results indicate that the bacteria could be used as a vehicle to deliver nano

  19. Comparative genomics and transcriptomics of lineages I, II, and III strains of Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Hain Torsten

    2012-04-01

    Full Text Available Abstract Background Listeria monocytogenes is a food-borne pathogen that causes infections with a high-mortality rate and has served as an invaluable model for intracellular parasitism. Here, we report complete genome sequences for two L. monocytogenes strains belonging to serotype 4a (L99 and 4b (CLIP80459, and transcriptomes of representative strains from lineages I, II, and III, thereby permitting in-depth comparison of genome- and transcriptome -based data from three lineages of L. monocytogenes. Lineage III, represented by the 4a L99 genome is known to contain strains less virulent for humans. Results The genome analysis of the weakly pathogenic L99 serotype 4a provides extensive evidence of virulence gene decay, including loss of several important surface proteins. The 4b CLIP80459 genome, unlike the previously sequenced 4b F2365 genome harbours an intact inlB invasion gene. These lineage I strains are characterized by the lack of prophage genes, as they share only a single prophage locus with other L. monocytogenes genomes 1/2a EGD-e and 4a L99. Comparative transcriptome analysis during intracellular growth uncovered adaptive expression level differences in lineages I, II and III of Listeria, notable amongst which was a strong intracellular induction of flagellar genes in strain 4a L99 compared to the other lineages. Furthermore, extensive differences between strains are manifest at levels of metabolic flux control and phosphorylated sugar uptake. Intriguingly, prophage gene expression was found to be a hallmark of intracellular gene expression. Deletion mutants in the single shared prophage locus of lineage II strain EGD-e 1/2a, the lma operon, revealed severe attenuation of virulence in a murine infection model. Conclusion Comparative genomics and transcriptome analysis of L. monocytogenes strains from three lineages implicate prophage genes in intracellular adaptation and indicate that gene loss and decay may have led to the emergence

  20. Inactivation of Listeria monocytogenes in raw fruits by enterocin AS-48.

    Science.gov (United States)

    Molinos, Antonio Cobo; Abriouel, Hikmate; Ben Omar, Nabil; Lucas, Rosario; Valdivia, Eva; Gálvez, Antonio

    2008-12-01

    The purpose of this study was to determine the effect of enterocin AS-48 on Listeria monocytogenes CECT 4032 in fruits and fruit juice. Fruits were contaminated with a L. monocytogenes cell suspension, washed with enterocin AS-48 (25 microg/ml) or with sterile distilled water as control, and stored at different temperatures (-20, 6, 15, 22 degrees C). Washing treatments significantly inhibited or completely inactivated L. monocytogenes in strawberries, raspberries, and blackberries stored at 15 and 22 degrees C for up to 2 days and in blackberries and strawberries at 6 degrees C for up to 7 days. Washing treatments with enterocin AS-48 also reduced viable counts in sliced melon, watermelon, pear, and kiwi but did not avoid proliferation of survivors during storage at 15 and 22 degrees C. Added enterocin (25 microg/ml) completely inactivated L. monocytogenes in watermelon juice within 24 h. To enhance the antilisterial activity of treatments, enterocin AS-48 was tested in combination with other antimicrobial substances on sliced melon stored at 22 degrees C. The combinations of enterocin AS-48 and trisodium trimetaphosphate, sodium lactate, lactic acid, polyphosphoric acid, carvacrol, hydrocinnamic acid, p-hydroxybenzoic acid, n-propyl p-hydroxybenzoate, or 2-nitropropanol showed increased antilisterial activities compared with each antimicrobial tested separately. Washing treatments with enterocin AS-48 in combination with 12 mM carvacrol, as well as with 100 mM n-propyl p-hydroxybenzoate, avoided regrowth of Listeria during storage at 22 degrees C. Results from this study indicate that enterocin AS-48 alone or in combination with other preservatives could serve as an additional hurdle against L. monocytogenes in fruits and fruit juices.

  1. Effect of humidity and temperature on the survival of Listeria monocytogenes on surfaces.

    Science.gov (United States)

    Redfern, J; Verran, J

    2017-04-01

    Listeria monocytogenes is a pathogenic bacterium, with human disease and infection linked to dairy products, seafood, ready-to-eat meat and raw & undercooked meats. Stainless steel is the most common food preparation surface and therefore, it is important to understand how food storage conditions such as surface materials, temperature and relative humidity can affect survival of L. monocytogenes. In this study, survival of L. monocytogenes on stainless steel was investigated at three temperatures (4, 10 and 21°C), each approx. 11, 50 and 85% humidity. Results indicate that the lower the temperature, the more cells were recovered in all three humidity environments, while medium humidity enhances survival, irrespective of temperature. Lower humidity decreases recovery at all temperatures. These data support the guidance noted above that humidity control is important, and that lower humidity environments are less likely to support retention of viable L. monocytogenes on a stainless steel surface. Understanding survival of potential food-borne pathogens is essential for the safe production and preparation of food. While it has long been 'common knowledge' that relative humidity can affect the growth and survival of micro-organisms, this study systematically describes the survival of L. monocytogenes on stainless steel under varying humidity and temperatures for the first time. The outcomes from this paper will allow those involved with food manufacture and preparation to make informed judgement on environmental conditions relating to humidity control, which is lacking in the food standards guidelines. © 2017 The Society for Applied Microbiology.

  2. In vivo transcriptional profiling of Listeria monocytogenes and mutagenesis identify new virulence factors involved in infection.

    Directory of Open Access Journals (Sweden)

    Ana Camejo

    2009-05-01

    Full Text Available Listeria monocytogenes is a human intracellular pathogen able to colonize host tissues after ingestion of contaminated food, causing severe invasive infections. In order to gain a better understanding of the nature of host-pathogen interactions, we studied the L. monocytogenes genome expression during mouse infection. In the spleen of infected mice, approximately 20% of the Listeria genome is differentially expressed, essentially through gene activation, as compared to exponential growth in rich broth medium. Data presented here show that, during infection, Listeria is in an active multiplication phase, as revealed by the high expression of genes involved in replication, cell division and multiplication. In vivo bacterial growth requires increased expression of genes involved in adaptation of the bacterial metabolism and stress responses, in particular to oxidative stress. Listeria interaction with its host induces cell wall metabolism and surface expression of virulence factors. During infection, L. monocytogenes also activates subversion mechanisms of host defenses, including resistance to cationic peptides, peptidoglycan modifications and release of muramyl peptides. We show that the in vivo differential expression of the Listeria genome is coordinated by a complex regulatory network, with a central role for the PrfA-SigB interplay. In particular, L. monocytogenes up regulates in vivo the two major virulence regulators, PrfA and VirR, and their downstream effectors. Mutagenesis of in vivo induced genes allowed the identification of novel L. monocytogenes virulence factors, including an LPXTG surface protein, suggesting a role for S-layer glycoproteins and for cadmium efflux system in Listeria virulence.

  3. Genetic Separation of Listeria monocytogenes Causing Central Nervous System Infections in Animals

    Science.gov (United States)

    Aguilar-Bultet, Lisandra; Nicholson, Pamela; Rychener, Lorenz; Dreyer, Margaux; Gözel, Bulent; Origgi, Francesco C.; Oevermann, Anna; Frey, Joachim; Falquet, Laurent

    2018-01-01

    Listeria monocytogenes is a foodborne pathogen that causes abortion, septicemia, gastroenteritis and central nervous system (CNS) infections in ruminants and humans. L. monocytogenes strains mainly belong to two distinct phylogenetic groups, named lineages I and II. In general, clinical cases in humans and animals, in particular CNS infections, are caused by lineage I strains, while most of the environmental and food strains belong to lineage II. Little is known about why lineage I is more virulent than lineage II, even though various molecular factors and mechanisms associated with pathogenesis are known. In this study, we have used a variety of whole genome sequence analyses and comparative genomic tools in order to find characteristics that distinguish lineage I from lineage II strains and CNS infection strains from non-CNS strains. We analyzed 225 strains and identified single nucleotide variants between lineages I and II, as well as differences in the gene content. Using a novel approach based on Reads Per Kilobase per Million Mapped (RPKM), we identified 167 genes predominantly absent in lineage II but present in lineage I. These genes are mostly encoding for membrane-associated proteins. Additionally, we found 77 genes that are largely absent in the non-CNS associated strains, while 39 genes are especially lacking in our defined “non-clinical” group. Based on the RPKM analysis and the metadata linked to the L. monocytogenes strains, we identified 6 genes potentially associated with CNS cases, which include a transcriptional regulator, an ABC transporter and a non-coding RNA. Although there is not a clear separation between pathogenic and non-pathogenic strains based on phylogenetic lineages, the presence of the genes identified in our study reveals potential pathogenesis traits in ruminant L. monocytogenes strains. Ultimately, the differences that we have found in our study will help steer future studies in understanding the virulence mechanisms of the

  4. RAPID DNA EXTRACTION AND PCR VALIDATION FOR DIRECT DETECTION OF Listeria monocytogenes IN RAW MILK

    Directory of Open Access Journals (Sweden)

    Edith Burbano

    2006-05-01

    Full Text Available Objective. The aim of this study was to validate a method for detecting L. monocytogenes in raw milk.Materials and methods. The extraction procedure carried out using a chaotropic agent like NaI, toreduce fat in the sample to 0.2% w/v, which is the lowest limit for detection in the Gerber method, toavoid the polymerization. The raw milk samples were analyzed by using the traditional gold standardmethod for L. monocytogenes. Detection PCR was done on the specificity of primers that recognize theListeria genus by amplifying a specific fragment of about 938bp of the 16S rDNA. Several primer setswere use: L1 (CTCCATAAAGGTGACCCT, U1 (CAGCMGCCGCGGTAATWC, LF (CAAACGTTAACAACGCAGTAand LR (TCCAGAGTGATCGATGTTAA that recognize the hlyA gene of L. monocytogenes, amplifying a 750bpfragment. Results. The DNA of 39 strains evidenced high specificity of the technique since all the strainsof L. monocytogenes amplified the fragments 938bp and 750bp, specifically for genus and species,respectively. The detection limit of the PCR was 101 CFU/ml. T he PCR reproducibility showed a Kappa of0.85; the specificity and sensitivity of 100% were found, predictive positive and negative values were of100% respectively. Conclusions. These results demonstrate that is possible to detect of Listeria spp. byusing any of the three methods since they share the same sensitivity and specificity. One hundred percentof the predictive value for PCR (alternative method provides high reliability, and allows the detection ofthe positive samples. The extraction procedure combined with a PCR method can reduce in 15 days thetime of identification of L. monocytogenes in raw milk. This PCR technique could be adapted and validatedto be use for other types of food such as poultry, meat products and cheeses

  5. Multifaceted Activity of Listeriolysin O, the Cholesterol-Dependent Cytolysin of Listeria monocytogenes

    Science.gov (United States)

    2014-01-01

    The cholesterol-dependent cytolysins (CDCs) are a large family of pore-forming toxins that are produced by numerous Gram-positive bacterial pathogens. These toxins are released in the extracellular environment as water-soluble monomers or dimers that bind to cholesterol-rich membranes and assemble into large pore complexes. Depending upon their concentration, the nature of the host cell and membrane (cytoplasmic or intracellular) they target, the CDCs can elicit many different cellular responses. Among the CDCs, listeriolysin O (LLO), which is a major virulence factor of the facultative intracellular pathogen Listeria monocytogenes, is involved in several stages of the intracellular lifecycle of the bacterium and displays unique characteristics. It has long been known that following L. monocytogenes internalization into host cells, LLO disrupts the internalization vacuole, enabling the bacterium to replicate into the host cell cytosol. LLO is then used by cytosolic bacteria to spread from cell to cell, avoiding bacterial exposure to the extracellular environment. Although LLO is continuously produced during the intracellular lifecycle of L. monocytogenes, several processes limit its toxicity to ensure the survival of infected cells. It was previously thought that LLO activity was limited to mediating vacuolar escape during bacterial entry and cell to cell spreading. This concept has been challenged by compelling evidence suggesting that LLO secreted by extracellular L. monocytogenes perforates the host cell plasma membrane, triggering important host cell responses. This chapter provides an overview of the well-established intracellular activity of LLO and the multiple roles attributed to LLO secreted by extracellular L. monocytogenes. PMID:24798012

  6. Listeria monocytogenes endophthalmitis - case report and review of risk factors and treatment outcomes.

    Science.gov (United States)

    Bajor, Anna; Luhr, Anke; Brockmann, Dorothee; Suerbaum, Sebastian; Framme, Carsten; Sedlacek, Ludwig

    2016-07-16

    The majority of cases of endophthalmitis are caused by exogenous pathogens; only 5-10 % are of endogenous origin. One cause of these rare cases of endogenous endophthalmitis is Listeria monocytogenes. Twenty-six cases of endophthalmitis due to this pathogen have been published over the last twenty years. The aim of this review is to summarize the main risk factors and common clinical findings of endogenous endophthalmitis due to Listeria monocytogenes. We report on a 62-year-old female presenting with a sterile hypopyon iritis with secondary glaucoma and an underlying rheumatoid disease. In microbiological analysis we identified Listeria monocytogenes. Further we searched through all published cases for typical signs, risk factors, details of medical and surgical treatment and outcome of endogenous endophthalmitis due to this rare pathogen. Ocular symptoms in almost all of these published cases included pain, redness of the eye, and decreased vision. Main clinical features included elevated intraocular pressure and fibrinous anterior chamber reaction, as well as a dark hypopyon. While the infection is typically spread endogenously, neither an exogenous nor endogenous source of infection could be identified in most cases. Immunocompromised patients are at higher risk of being infected than immunocompetent patients. The clinical course of endophthalmitis caused by Listeria monocytogenes had different visual outcomes. In some cases, the infection led to enucleation, blindness, or strong visual loss, whereas most patients showed a tendency of visual improvement during therapy. Early diagnosis and treatment initiation are crucial factors in the outcome of endogenous endophthalmitis caused by Listeria monocytogenes. This possible differential diagnosis should be kept in mind while treating patients with presumable sterile hypopyon and anterior uveitis having a high intraocular pressure. A bacterial source should be considered with a prompt initiation of systemic

  7. Essential oils of thyme and Rosemary in the control of Listeria monocytogenes in raw beef

    Directory of Open Access Journals (Sweden)

    Maíra Maciel Mattos de Oliveira

    2013-12-01

    Full Text Available This study was developed in order to evaluate two alternatives for the control of Listeria monocytogenes in raw bovine meat pieces, both based on the use of Thymus vulgaris and Rosmarinus officinalis essential oils (EOs. The antilisterial activity of different concentrations of the EOs was tested in vitro using agar dilution and disk volatilization techniques. In addition, L. monocytogenes was inoculated in meat pieces, which were submerged in edible gelatin coatings containing 2% (v/v EOs or submitted to the vapor of EOs (0.74 μL.cm-3. L. monocytogenes was quantified after one, 48 and 96 hours of storage (7 °C. In the in vitro tests, the EO of T. vulgaris presented higher activity. The two options used (edible gelatin coating and vapor activity, in spite of exercising effects with differentiated behaviors, presented antibacterial activity against L. monocytogenes inoculated in raw bovine meat (p < 0.05. Greatest antibacterial activity were obtained in the experiment that used edible coatings containing EOs, at 48 hours of storage reductions in bacterial counts between 1.09 and 1.25 Log CFU.g-1 were obtained. In the vapor effect experiment, the EO of T. vulgaris caused the highest reduction in the population of bacteria inoculated in raw bovine meat (p < 0.05, 0.40 Log CFU.g-1 at 96 hours of storage. This study supplied important information regarding new and promising natural alternatives, based on the concept of active packaging, for the control of L. monocytogenes in the meat industry.

  8. Adding Data Management Services to Parallel File Systems

    Energy Technology Data Exchange (ETDEWEB)

    Brandt, Scott [Univ. of California, Santa Cruz, CA (United States)

    2015-03-04

    The objective of this project, called DAMASC for “Data Management in Scientific Computing”, is to coalesce data management with parallel file system management to present a declarative interface to scientists for managing, querying, and analyzing extremely large data sets efficiently and predictably. Managing extremely large data sets is a key challenge of exascale computing. The overhead, energy, and cost of moving massive volumes of data demand designs where computation is close to storage. In current architectures, compute/analysis clusters access data in a physically separate parallel file system and largely leave it scientist to reduce data movement. Over the past decades the high-end computing community has adopted middleware with multiple layers of abstractions and specialized file formats such as NetCDF-4 and HDF5. These abstractions provide a limited set of high-level data processing functions, but have inherent functionality and performance limitations: middleware that provides access to the highly structured contents of scientific data files stored in the (unstructured) file systems can only optimize to the extent that file system interfaces permit; the highly structured formats of these files often impedes native file system performance optimizations. We are developing Damasc, an enhanced high-performance file system with native rich data management services. Damasc will enable efficient queries and updates over files stored in their native byte-stream format while retaining the inherent performance of file system data storage via declarative queries and updates over views of underlying files. Damasc has four key benefits for the development of data-intensive scientific code: (1) applications can use important data-management services, such as declarative queries, views, and provenance tracking, that are currently available only within database systems; (2) the use of these services becomes easier, as they are provided within a familiar file

  9. Atlas(®) Listeria monocytogenes LmG2 Detection Assay Using Transcription Mediated Amplification to Detect Listeria monocytogenes in Selected Foods and Stainless Steel Surface.

    Science.gov (United States)

    Bres, Vanessa; Yang, Hua; Hsu, Ernie; Ren, Yan; Cheng, Ying; Wisniewski, Michele; Hanhan, Maesa; Zaslavsky, Polina; Noll, Nathan; Weaver, Brett; Campbell, Paul; Reshatoff, Michael; Becker, Michael

    2014-01-01

    The Atlas Listeria monocytogenes LmG2 Detection Assay, developed by Roka Bioscience Inc., was compared to a reference culture method for seven food types (hot dogs, cured ham, deli turkey, chicken salad, vanilla ice cream, frozen chocolate cream pie, and frozen cheese pizza) and one surface (stainless steel, grade 316). A 125 g portion of deli turkey was tested using a 1:4 food:media dilution ratio, and a 25 g portion for all other foods was tested using 1:9 food:media dilution ratio. The enrichment time and media for Roka's method was 24 to 28 h for 25 g food samples and environmental surfaces, and 44 to 48 h for 125 g at 35 ± 2°C in PALCAM broth containing 0.02 g/L nalidixic acid. Comparison of the Atlas Listeria monocytogenes LmG2 Detection Assay to the reference method required an unpaired approach. For each matrix, 20 samples inoculated at a fractional level and five samples inoculated at a high level with a different strain of Listeria monocytogenes were tested by each method. The Atlas Listeria monocytogenes LmG2 Detection Assay was compared to the Official Methods of Analysis of AOAC INTERNATIONAL 993.12 method for dairy products, the U.S. Department of Agriculture, Food Safety and Inspection Service, Microbiology Laboratory Guidebook 8.08 method for ready-to-eat meat and environmental samples, and the U.S. Food and Drug Administration Bacteriological Analytical Manual, Chapter 10 method for frozen foods. In the method developer studies, Roka's method, at 24 h (or 44 h for 125 g food samples), had 126 positives out of 200 total inoculated samples, compared to 102 positives for the reference methods at 48 h. In the independent laboratory studies, vanilla ice cream, deli turkey and stainless steel grade 316 were evaluated. Roka's method, at 24 h (or 44 h for 125 g food samples), had 64 positives out of 75 total inoculated samples compared to 54 positives for the reference methods at 48 h. The Atlas Listeria monocytogenes LmG2 Detection Assay detected all 50

  10. File access prediction using neural networks.

    Science.gov (United States)

    Patra, Prashanta Kumar; Sahu, Muktikanta; Mohapatra, Subasish; Samantray, Ronak Kumar

    2010-06-01

    One of the most vexing issues in design of a high-speed computer is the wide gap of access times between the memory and the disk. To solve this problem, static file access predictors have been used. In this paper, we propose dynamic file access predictors using neural networks to significantly improve upon the accuracy, success-per-reference, and effective-success-rate-per-reference by using neural-network-based file access predictor with proper tuning. In particular, we verified that the incorrect prediction has been reduced from 53.11% to 43.63% for the proposed neural network prediction method with a standard configuration than the recent popularity (RP) method. With manual tuning for each trace, we are able to improve upon the misprediction rate and effective-success-rate-per-reference using a standard configuration. Simulations on distributed file system (DFS) traces reveal that exact fit radial basis function (RBF) gives better prediction in high end system whereas multilayer perceptron (MLP) trained with Levenberg-Marquardt (LM) backpropagation outperforms in system having good computational capability. Probabilistic and competitive predictors are the most suitable for work stations having limited resources to deal with and the former predictor is more efficient than the latter for servers having maximum system calls. Finally, we conclude that MLP with LM backpropagation algorithm has better success rate of file prediction than those of simple perceptron, last successor, stable successor, and best k out of m predictors.

  11. Source Reference File

    Data.gov (United States)

    Social Security Administration — This file contains a national set of names and contact information for doctors, hospitals, clinics, and other facilities (known collectively as sources) from which...

  12. Patient Assessment File (PAF)

    Data.gov (United States)

    Department of Veterans Affairs — The Patient Assessment File (PAF) database compiles the results of the Patient Assessment Instrument (PAI) questionnaire filled out for intermediate care Veterans...

  13. RRB Earnings File (RRBERN)

    Data.gov (United States)

    Social Security Administration — RRBERN contains records for all beneficiaries on the RRB's PSSVES file who's SSNs are validated through the SVES processing. Validated output is processed through...

  14. Radiology Teaching Files on the Internet

    International Nuclear Information System (INIS)

    Lim, Eun Chung; Kim, Eun Kyung

    1996-01-01

    There is increasing attention about radiology teaching files on the Internet in the field of diagnostic radiology. The purpose of this study was to aid in the creation of new radiology teaching file by analysing the present radiology teaching file sites on the Internet with many aspects and evaluating images on those sites, using Macintosh II ci compute r, 28.8kbps TelePort Fax/Modem, Netscape Navigator 2.0 software. The results were as follow : 1. Analysis of radiology teaching file sites (1) Country distribution was the highest in USA (57.5%). (2) Average number of cases was 186 cases and radiology teaching file sites with search engine were 9 sites (22.5%). (3) At the method of case arrangement, anatomic area type and diagnosis type were found at the 10 sites (25%) each, question and answer type was found at the 9 sites (22.5%). (4) Radiology teaching file sites with oro-maxillofacial disorder were 9 sites (22.5%). (5) At the image format, GIF format was found at the 14 sites (35%), and JPEG format found at the 14 sites (35%). (6) Created year was the highest in 1995 (43.7%). (7) Continuing case upload was found at the 35 sites (87.5%). 2. Evaluation of images on the radiology teaching files (1) Average file size of GIF format (71 Kbyte) was greater than that of JPEG format (24 Kbyte). (P<0.001) (2) Image quality of GIF format was better than that of JPEG format. (P<0.001)

  15. Antimicrobial effect of blueberry (Vaccinium corymbosum L.) extracts against the growth of Listeria monocytogenes and Salmonella Enteritidis

    Science.gov (United States)

    We studied the antimicrobial effects of berry extracts obtained from four cultivars (Elliott, Darrow, Bluecrop and Duke) of blueberry (Vaccinium corymbosum L.) on the growth of Listeria monocytogenes and Salmonella Enteritidis. The minimal inhibitory concentration (MIC) and minimal bactericidal conc...

  16. Detection of Listeria monocytogenes in ready-to-eat food by Step One real-time polymerase chain reaction.

    Science.gov (United States)

    Pochop, Jaroslav; Kačániová, Miroslava; Hleba, Lukáš; Lopasovský, L'ubomír; Bobková, Alica; Zeleňáková, Lucia; Stričík, Michal

    2012-01-01

    The aim of this study was to follow contamination of ready-to-eat food with Listeria monocytogenes by using the Step One real time polymerase chain reaction (PCR). We used the PrepSEQ Rapid Spin Sample Preparation Kit for isolation of DNA and MicroSEQ® Listeria monocytogenes Detection Kit for the real-time PCR performance. In 30 samples of ready-to-eat milk and meat products without incubation we detected strains of Listeria monocytogenes in five samples (swabs). Internal positive control (IPC) was positive in all samples. Our results indicated that the real-time PCR assay developed in this study could sensitively detect Listeria monocytogenes in ready-to-eat food without incubation.

  17. Listeria monocytogenes presence during fermentation, drying and storage of Petrovská klobása sausage

    Science.gov (United States)

    Janković, V.; Mitrović, R.; Lakićević, B.; Velebit, B.; Baltić, T.

    2017-09-01

    The majority of human listeriosis cases appear to be caused by consumption of ready-to-eat (RTE) foods contaminated at the time of consumption with high levels of Listeria monocytogenes. Although strategies to prevent growth of L. monocytogenes in RTE products are critical for reducing the incidence of human listeriosis, this pathogen is highly difficult to control in fermented sausage processing environments due to its high tolerance to low pH and high salt concentration. The aims of the present study were to investigate the occurrence, presence and elimination of L. monocytogenes in Petrovská klobása sausage during processing, fermentation, drying and storage. L. monocytogenes, which was detected at the beginning of the production cycle, disappeared before day 30. The pathogen decline was much faster in those sausages which were dried in controlled, industrial conditions than in those dried applying the traditional, household technique.

  18. Elucidation of Listeria monocytogenes contamination routes in cold-smoked salmon processing plants detected by DNA-based typing methods

    DEFF Research Database (Denmark)

    Vogel, Birte Fonnesbech; Huss, Hans Henrik; Ojeniyi, B.

    2001-01-01

    and environment could not be excluded. Contamination of the product occurred in specific areas (the brining and slicing areas). In plant I, the same RAPD type (RAPD type 12) was found over a 4-year period, indicating that an established in-house flora persisted and was not eliminated by routine hygienic......, monocytogenes). A total of 429 strains of L. monocytogenes were subsequently compared by random amplified polymorphic DNA (RAPD) profiling, and 55 different RAPD types were found. The RAPD types detected on the products were identical to types found on the processing equipment and in the processing environment...... procedures. In plant II, where the prevalence of L, monocytogenes was much tower, no RAPD type persisted over long periods of time, and several different L, monocytogenes RAPD types were isolated. This indicates that persistent strains may be avoided by rigorous cleaning and sanitation; however, due...

  19. Listeria monocytogenes Meningitis in an Immunosuppressed Patient with Autoimmune Hepatitis and IgG4 Subclass Deficiency

    Directory of Open Access Journals (Sweden)

    Shahin Gaini

    2015-01-01

    Full Text Available A 51-year-old Caucasian woman with Listeria monocytogenes meningitis was treated and discharged after an uncomplicated course. Her medical history included immunosuppressive treatment with prednisolone and azathioprine for autoimmune hepatitis. A diagnostic work-up after the meningitis episode revealed that she had low levels of the IgG4 subclass. To our knowledge, this is the first case report describing a possible association between autoimmune hepatitis and the occurrence of Listeria monocytogenes meningitis, describing a possible association between Listeria monocytogenes meningitis and deficiency of the IgG4 subclass and finally describing a possible association between Listeria monocytogenes meningitis and immunosuppressive therapy with prednisolone and azathioprine.

  20. InlB-mediated Listeria monocytogenes internalization requires a balanced phospholipase D activity maintained through phospho-cofilin

    NARCIS (Netherlands)

    Han, Xuelin; Yu, Rentao; Ji, Lei; Zhen, Dongyu; Tao, Sha; Li, Shuai; Sun, Yansong; Huang, Liuyu; Feng, Zhe; Li, Xianping; Han, Gaige; Schmidt, Martina; Han, Li

    Internalization of Listeria monocytogenes into non-phagocytic cells is tightly controlled by host cell actin dynamics and cell membrane alterations. However, knowledge about the impact of phosphatidylcholine cleavage driven by host cell phospholipase D (PLD) on Listeria internalization into

  1. Evaluation of Listeria Monocytogenes Based Vaccines for HER-2/neu in Mouse Transgenic Models of Breast Cancer

    National Research Council Canada - National Science Library

    Singh, Reshma

    2006-01-01

    ...% of all breast cancers. Five Listeria monocytogenes vaccines have been made consisting of fragments of HER-2/neu that are capable of stopping the growth of transplantable tumors in wild type FVB/N mice and can cause...

  2. Genotypes Associated with Listeria monocytogenes Isolates Displaying Impaired or Enhanced Tolerances to Cold, Salt, Acid, or Desiccation Stress

    DEFF Research Database (Denmark)

    Hingston, Patricia A.; Chen, Jessica; Dhillon, Bhavjinder K

    2017-01-01

    elements. A whole genome single-nucleotide-variants phylogeny revealed sporadic distribution of tolerant isolates and closely related sensitive and tolerant isolates, highlighting that minor genetic differences can influence the stress tolerance of L. monocytogenes. Specifically, a number of cold......The human pathogen Listeria monocytogenes is a large concern in the food industry where its continuous detection in food products has caused a string of recalls in North America and Europe. Most recognized for its ability to grow in foods during refrigerated storage, L. monocytogenes can also...... tolerate several other food-related stresses with some strains possessing higher levels of tolerances than others. The objective of this study was to use a combination of phenotypic analyses and whole genome sequencing to elucidate potential relationships between L. monocytogenes genotypes and food...

  3. In vitro detection of pathogenic Listeria monocytogenes from food sources by conventional, molecular and cell culture method

    Directory of Open Access Journals (Sweden)

    J.A. Khan

    2013-09-01

    Full Text Available Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO. A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG; R: CCTCCAGAGTGATCGATGTT complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR. PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%, followed by fish meat (4.0%, and then beef (2.5%. Among various milk and milk products, curd (2.0% showed the highest prevalence, followed by raw milk (1.3%. The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 µL and 50 µL of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro resulted positive in twenty four

  4. Comparative Genomics Reveals the Diversity of Restriction-Modification Systems and DNA Methylation Sites in Listeria monocytogenes.

    Science.gov (United States)

    Chen, Poyin; den Bakker, Henk C; Korlach, Jonas; Kong, Nguyet; Storey, Dylan B; Paxinos, Ellen E; Ashby, Meredith; Clark, Tyson; Luong, Khai; Wiedmann, Martin; Weimer, Bart C

    2017-02-01

    Listeria monocytogenes is a bacterial pathogen that is found in a wide variety of anthropogenic and natural environments. Genome sequencing technologies are rapidly becoming a powerful tool in facilitating our understanding of how genotype, classification phenotypes, and virulence phenotypes interact to predict the health risks of individual bacterial isolates. Currently, 57 closed L. monocytogenes genomes are publicly available, representing three of the four phylogenetic lineages, and they suggest that L. monocytogenes has high genomic synteny. This study contributes an additional 15 closed L. monocytogenes genomes that were used to determine the associations between the genome and methylome with host invasion magnitude. In contrast to previous findings, large chromosomal inversions and rearrangements were detected in five isolates at the chromosome terminus and within rRNA genes, including a previously undescribed inversion within rRNA-encoding regions. Each isolate's epigenome contained highly diverse methyltransferase recognition sites, even within the same serotype and methylation pattern. Eleven strains contained a single chromosomally encoded methyltransferase, one strain contained two methylation systems (one system on a plasmid), and three strains exhibited no methylation, despite the occurrence of methyltransferase genes. In three isolates a new, unknown DNA modification was observed in addition to diverse methylation patterns, accompanied by a novel methylation system. Neither chromosome rearrangement nor strain-specific patterns of epigenome modification observed within virulence genes were correlated with serotype designation, clonal complex, or in vitro infectivity. These data suggest that genome diversity is larger than previously considered in L. monocytogenes and that as more genomes are sequenced, additional structure and methylation novelty will be observed in this organism. Listeria monocytogenes is the causative agent of listeriosis, a disease

  5. 76 FR 62092 - Filing Procedures

    Science.gov (United States)

    2011-10-06

    ... INTERNATIONAL TRADE COMMISSION Filing Procedures AGENCY: International Trade Commission. ACTION: Notice of issuance of Handbook on Filing Procedures. SUMMARY: The United States International Trade Commission (``Commission'') is issuing a Handbook on Filing Procedures to replace its Handbook on Electronic...

  6. Individual and combined efficacies of mild heat and ultraviolet-c radiation against Escherichia coli O157:H7, Salmonella enterica, and Listeria monocytogenes in coconut liquid endosperm.

    Science.gov (United States)

    Gabriel, Alonzo A; Ostonal, Jeffrey M; Cristobal, Jannelle O; Pagal, Gladess A; Armada, John Vincent E

    2018-07-20

    This study determined the inactivation kinetic parameters of selected pathogens in heat, ultraviolet-C and combined heat-UV-C treated coconut liquid endosperm. Separate cocktails of Escherichia coli O157:H7, Salmonella enterica serovars, and Listeria monocytogenes strains were inoculated into coconut liquid endosperm (pH 5.15, TSS 4.4 o Bx, TA 0.062% malic acid, extinction coefficient (ε) at 254 nm of 0.0154 cm -1 ) for inactivation studies. Result showed that all organisms generally exhibited a log-linear heat inactivation behavior (R 2 0.81-0.99). The E. coli O157:H7 cocktail (D 55  = 19.75 min, D 57  = 10.79 min, D 60  = 3.38 min, and D 63  = 0.46 min) was found to be significantly more resistant (P > 0.05) than the tested cocktail of L. monocytogenes (D 55  = 11.68 min, D 57  = 4.53 min, D 60  = 1.82 min and D 63  = 0.26 min) and S. enterica cocktail (D 55  = 3.08 min, D 57  = 2.60 min, D 60  = 0.89 min and D 63  = 0.25 min). Despite the differences in D T values, computed z values for L. monocytogenes cocktail (5.12 ± 0.43 °C) and E. coli O157:H7 cocktail (4.95 ± 0.12 °C) were not significantly different (P > 0.05), but were both significantly (P C). All test organisms also exhibited a generally log-linear UV-C inactivation behavior (R 2 0.90-0.99) with E. coli O157:H7 cocktail (D UV-C  = 25.26 mJ/cm 2 ) demonstrating greatest resistance to UV-C than S. enterica (D UV-C  = 24.65 mJ/cm 2 ) and L. monocytogenes (D UV-C  = 17.30 mJ/cm 2 ) cocktails. The D 55 values of each organism cocktail were used to calculate for the 3-log reduction heating process schedules, during which UV-C treatments were simultaneously applied. Lethal rates (F values) calculations in the combined processes revealed that within the 3-log reduction heating processes, co-exposure of UV-C resulted in 5.62 to 6.20 log reductions in the test organism populations. Heating

  7. Spatial and Temporal Factors Associated with an Increased Prevalence of Listeria monocytogenes in Spinach Fields in New York State.

    Science.gov (United States)

    Weller, Daniel; Wiedmann, Martin; Strawn, Laura K

    2015-09-01

    While rain and irrigation events have been associated with an increased prevalence of foodborne pathogens in produce production environments, quantitative data are needed to determine the effects of various spatial and temporal factors on the risk of produce contamination following these events. This study was performed to quantify these effects and to determine the impact of rain and irrigation events on the detection frequency and diversity of Listeria species (including L. monocytogenes) and L. monocytogenes in produce fields. Two spinach fields, with high and low predicted risks of L. monocytogenes isolation, were sampled 24, 48, 72, and 144 to 192 h following irrigation and rain events. Predicted risk was a function of the field's proximity to water and roads. Factors were evaluated for their association with Listeria species and L. monocytogenes isolation by using generalized linear mixed models (GLMMs). In total, 1,492 (1,092 soil, 334 leaf, 14 fecal, and 52 water) samples were collected. According to the GLMM, the likelihood of Listeria species and L. monocytogenes isolation from soil samples was highest during the 24 h immediately following an event (odds ratios [ORs] of 7.7 and 25, respectively). Additionally, Listeria species and L. monocytogenes isolates associated with irrigation events showed significantly lower sigB allele type diversity than did isolates associated with precipitation events (P = <0.001), suggesting that irrigation water may be a point source of L. monocytogenes contamination. Small changes in management practices (e.g., not irrigating fields before harvest) may therefore reduce the risk of L. monocytogenes contamination of fresh produce. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  8. Comparison of Listeria monocytogenes recoveries from spiked mung bean sprouts by the enrichment methods of three regulatory agencies.

    Science.gov (United States)

    Cauchon, Kaitlin E; Hitchins, Anthony D; Smiley, R Derike

    2017-09-01

    Three selective enrichment methods, the United States Food and Drug Administration's (FDA method), the United States Department of Agriculture Food Safety Inspection Service's (USDA method), and the EN ISO 11290-1 standard method, were assessed for their suitability for recovery of Listeria monocytogenes from spiked mung bean sprouts. Three parameters were evaluated; the enrichment L. monocytogenes population from singly-spiked sprouts, the enrichment L. monocytogenes population from doubly-spiked (L. monocytogenes and Listeria innocua) sprouts, and the population differential resulting from the enrichment of doubly-spiked sprouts. Considerable L. monocytogenes inter-strain variation was observed. The mean enrichment L. monocytogenes populations for singly-spiked sprouts were 6.1 ± 1.2, 4.9 ± 1.2, and 6.9 ± 2.3 log CFU/mL for the FDA, USDA, and EN ISO 11290-1 methods, respectively. The mean L. monocytogenes populations for doubly-spiked sprouts were 4.7 ± 1.1, 5.5 ± 1.3, and 4.6 ± 1.4 log CFU/mL for the FDA, USDA, and ISO 11290-1 enrichment methods, respectively. The corresponding mean population differentials were 2.8 ± 1.1, 3.3 ± 1.3, and 3.6 ± 1.4 Δlog CFU/mL for the same three enrichment methods, respectively. The presence of L. innocua and resident microorganisms on the sprouts negatively impacted final levels of L. monocytogenes with all three enrichment methods. Published by Elsevier Ltd.

  9. Estimation of Microbial Contamination of Food from Prevalence and Concentration Data: Application to Listeria monocytogenes in Fresh Vegetables▿

    Science.gov (United States)

    Crépet, Amélie; Albert, Isabelle; Dervin, Catherine; Carlin, Frédéric

    2007-01-01

    A normal distribution and a mixture model of two normal distributions in a Bayesian approach using prevalence and concentration data were used to establish the distribution of contamination of the food-borne pathogenic bacteria Listeria monocytogenes in unprocessed and minimally processed fresh vegetables. A total of 165 prevalence studies, including 15 studies with concentration data, were taken from the scientific literature and from technical reports and used for statistical analysis. The predicted mean of the normal distribution of the logarithms of viable L. monocytogenes per gram of fresh vegetables was −2.63 log viable L. monocytogenes organisms/g, and its standard deviation was 1.48 log viable L. monocytogenes organisms/g. These values were determined by considering one contaminated sample in prevalence studies in which samples are in fact negative. This deliberate overestimation is necessary to complete calculations. With the mixture model, the predicted mean of the distribution of the logarithm of viable L. monocytogenes per gram of fresh vegetables was −3.38 log viable L. monocytogenes organisms/g and its standard deviation was 1.46 log viable L. monocytogenes organisms/g. The probabilities of fresh unprocessed and minimally processed vegetables being contaminated with concentrations higher than 1, 2, and 3 log viable L. monocytogenes organisms/g were 1.44, 0.63, and 0.17%, respectively. Introducing a sensitivity rate of 80 or 95% in the mixture model had a small effect on the estimation of the contamination. In contrast, introducing a low sensitivity rate (40%) resulted in marked differences, especially for high percentiles. There was a significantly lower estimation of contamination in the papers and reports of 2000 to 2005 than in those of 1988 to 1999 and a lower estimation of contamination of leafy salads than that of sprouts and other vegetables. The interest of the mixture model for the estimation of microbial contamination is discussed. PMID

  10. Prevalence, enumeration and pheno- and genotypic characteristics of Listeria monocytogenes isolated from raw foods in South China

    Directory of Open Access Journals (Sweden)

    Moutong eChen

    2015-09-01

    Full Text Available Listeria monocytogenes is an important foodborne pathogen that can cause serious illness in immunocompromised individuals, pregnant women, the elderly, and newborns. The aim of this study was to: (i evaluate the prevalence and contamination level (most probable number, MPN of L. monocytogenes in 567 retail raw foods (fishery products, n=154; raw/fresh meat, n=123; frozen foods, n=110; edible fungi, n=108; vegetables, n=72 collected from South China and (ii to gain further knowledge on the phenotype and genotype distributions of this important foodborne pathogen. Approximately 22% of the samples were positive for L. monocytogenes. The contamination levels were between 0.3 and 10 MPN/g in 75.0%, between 10 and 100 MPN/g in 11.0% and less than 100 MPN/g in 14.0% of the countable samples. Five serogroups were identified among the177 foodborne L. monocytogenes isolates, with1/2a-3a (42.4% and1/2b-3b (26.0% serogroups being the most dominant. Serogroup I.1 and II.2 were only found in the edible mushrooms, while serogroup III was dominant in the fishery products, suggesting that specific serogroups of L. monocytogenes may have distinct ecological niches. Ten (5.6% L. monocytogenes isolates exhibited multidrug resistance. Genetic relatedness analysis revealed the absence of distinct associations between specific food types, antibiotic resistance, serogroups, and genetic diversity. The present study provided the first baseline data on the prevalence, contamination level, and characteristics of L. monocytogenes isolated from raw foods in South China. Some multidrug resistant strains belonged to the epidemiologically important serogroups (I.1 and II.1, implying a potential public health risk. In addition, these findings also provide basic information for the Chinese food safety associated authorities to draft appropriate standards to control L. monocytogenes contamination and improve microbiological safety of raw foods.

  11. Comparison of the Prevalences and Diversities of Listeria Species and Listeria monocytogenes in an Urban and a Rural Agricultural Watershed.

    Science.gov (United States)

    Stea, Emma C; Purdue, Laura M; Jamieson, Rob C; Yost, Chris K; Truelstrup Hansen, Lisbeth

    2015-06-01

    Foods and related processing environments are commonly contaminated with the pathogenic Listeria monocytogenes. To investigate potential environmental reservoirs of Listeria spp. and L. monocytogenes, surface water and point source pollution samples from an urban and a rural municipal water supply watershed in Nova Scotia, Canada, were examined over 18 months. Presumptive Listeria spp. were cultured from 72 and 35% of rural and urban water samples, respectively, with 24% of the positive samples containing two or three different Listeria spp. The L. innocua (56%) and L. welshimeri (43%) groups were predominant in the rural and urban watersheds, respectively. Analysis by the TaqMan assay showed a significantly (P monocytogenes of 62% versus 17% by the culture-based method. Both methods revealed higher prevalences in the rural watershed and during the fall and winter seasons. Elevated Escherichia coli (≥ 100 CFU/100 ml) levels were not associated with the pathogen regardless of the detection method. Isolation of Listeria spp. were associated with 70 times higher odds of isolating L. monocytogenes (odds ratio = 70; P monocytogenes isolates, followed by IVb (16.1%), IIb (15.8%), and IIc (0.4%). L. monocytogenes was detected in cow feces and raw sewage but not in septic tank samples. Pulsotyping of representative water (n = 54) and local human (n = 19) isolates suggested genetic similarities among some environmental and human L. monocytogenes isolates. In conclusion, temperate surface waters contain a diverse Listeria species population and could be a potential reservoir for L. monocytogenes, especially in rural agricultural watersheds. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  12. Real-time PCR detection of Listeria monocytogenes in infant formula and lettuce following macrophage-based isolation and enrichment.

    Science.gov (United States)

    Day, J B; Basavanna, U

    2015-01-01

    To develop a rapid detection procedure for Listeria monocytogenes in infant formula and lettuce using a macrophage-based enrichment protocol and real-time PCR. A macrophage cell culture system was employed for the isolation and enrichment of L. monocytogenes from infant formula and lettuce for subsequent identification using real-time PCR. Macrophage monolayers were exposed to infant formula and lettuce contaminated with a serial dilution series of L. monocytogenes. As few as approx. 10 CFU ml(-1) or g(-1) of L. monocytogenes were detected in infant formula and lettuce after 16 h postinfection by real-time PCR. Internal positive PCR controls were utilized to eliminate the possibility of false-negative results. Co-inoculation with Listeria innocua did not reduce the L. monocytogenes detection sensitivity. Intracellular L. monocytogenes could also be isolated on Listeria selective media from infected macrophage lysates for subsequent confirmation. The detection method is highly sensitive and specific for L. monocytogenes in infant formula and lettuce and establishes a rapid identification time of 20 and 48 h for presumptive and confirmatory identification, respectively. The method is a promising alternative to many currently used q-PCR detection methods which employ traditional selective media for enrichment of contaminated food samples. Macrophage enrichment of L. monocytogenes eliminates PCR inhibitory food elements and contaminating food microflora which produce cleaner samples that increase the rapidity and sensitivity of detection. Published 2014. This article is a U.S. Government work and is in the public domain in the USA.

  13. Virus Alert: Ten Steps to Safe Computing.

    Science.gov (United States)

    Gunter, Glenda A.

    1997-01-01

    Discusses computer viruses and explains how to detect them; discusses virus protection and the need to update antivirus software; and offers 10 safe computing tips, including scanning floppy disks and commercial software, how to safely download files from the Internet, avoiding pirated software copies, and backing up files. (LRW)

  14. Nuclear plant fire incident data file

    International Nuclear Information System (INIS)

    Sideris, A.G.; Hockenbury, R.W.; Yeater, M.L.; Vesely, W.E.

    1979-01-01

    A computerized nuclear plant fire incident data file was developed by American Nuclear Insurers and was further analyzed by Rensselaer Polytechnic Institute with technical and monetary support provided by the Nuclear Regulatory Commission. Data on 214 fires that occurred at nuclear facilities have been entered in the file. A computer program has been developed to sort the fire incidents according to various parameters. The parametric sorts that are presented in this article are significant since they are the most comprehensive statistics presently available on fires that have occurred at nuclear facilities

  15. Irrigation Is Significantly Associated with an Increased Prevalence of Listeria monocytogenes in Produce Production Environments in New York State.

    Science.gov (United States)

    Weller, Daniel; Wiedmann, Martin; Strawn, Laura K

    2015-06-01

    Environmental (i.e., meteorological and landscape) factors and management practices can affect the prevalence of foodborne pathogens in produce production environments. This study was conducted to determine the prevalence of Listeria monocytogenes, Listeria species (including L. monocytogenes), Salmonella, and Shiga toxin-producing Escherichia coli (STEC) in produce production environments and to identify environmental factors and management practices associated with their isolation. Ten produce farms in New York State were sampled during a 6-week period in 2010, and 124 georeferenced samples (80 terrestrial, 33 water, and 11 fecal) were collected. L. monocytogenes, Listeria spp., Salmonella, and STEC were detected in 16, 44, 4, and 5% of terrestrial samples, 30, 58, 12, and 3% of water samples, and 45, 45, 27, and 9% of fecal samples, respectively. Environmental factors and management practices were evaluated for their association with terrestrial samples positive for L. monocytogenes or other Listeria species by univariate logistic regression; analysis was not conducted for Salmonella or STEC because the number of samples positive for these pathogens was low. Although univariate analysis identified associations between isolation of L. monocytogenes or Listeria spp. from terrestrial samples and various water-related factors (e.g., proximity to wetlands and precipitation), multivariate analysis revealed that only irrigation within 3 days of sample collection was significantly associated with isolation of L. monocytogenes (odds ratio = 39) and Listeria spp. (odds ratio = 5) from terrestrial samples. These findings suggest that intervention at the irrigation level may reduce the risk of produce contamination.

  16. Enoyl-Acyl Carrier Protein Reductase I (FabI) Is Essential for the Intracellular Growth of Listeria monocytogenes

    Science.gov (United States)

    Ericson, Megan E.; Frank, Matthew W.

    2016-01-01

    Enoyl-acyl carrier protein reductase catalyzes the last step in each elongation cycle of type II bacterial fatty acid synthesis and is a key regulatory protein in bacterial fatty acid synthesis. Genes of the facultative intracellular pathogen Listeria monocytogenes encode two functional enoyl-acyl carrier protein isoforms based on their ability to complement the temperature-sensitive growth phenotype of Escherichia coli strain JP1111 [fabI(Ts)]. The FabI isoform was inactivated by the FabI selective inhibitor AFN-1252, but the FabK isoform was not affected by the drug, as expected. Inhibition of FabI by AFN-1252 decreased endogenous fatty acid synthesis by 80% and lowered the growth rate of L. monocytogenes in laboratory medium. Robust exogenous fatty acid incorporation was not detected in L. monocytogenes unless the pathway was partially inactivated by AFN-1252 treatment. However, supplementation with exogenous fatty acids did not restore normal growth in the presence of AFN-1252. FabI inactivation prevented the intracellular growth of L. monocytogenes, showing that neither FabK nor the incorporation of host cellular fatty acids was sufficient to support the intracellular growth of L. monocytogenes. Our results show that FabI is the primary enoyl-acyl carrier protein reductase of type II bacterial fatty acid synthesis and is essential for the intracellular growth of L. monocytogenes. PMID:27736774

  17. Effect of Filling Type and Heating Method on Prevalence of Listeria species and Listeria monocytogenes in Dumplings Produced in Poland.

    Science.gov (United States)

    Szymczak, Barbara; Dąbrowski, Waldemar

    2015-05-01

    The count of Listeria monocytogenes was determined, before and after heat treatment, in 200 samples of dumplings of 9 brands and with different types of stuffing. Analyses were conducted according to ISO 11290-1 standard and with real-time PCR method. The highest count of L. monocytogenes was found in meat dumplings (10(2) to 10(4) CFU/g), whereas products with white cheese-potato stuffing and vegetable-mushroom stuffing contained significantly less Listeria, 20 to 80 and 5 to 32 CFU/g, respectively. In cooled meat dumplings the extent of contamination depended significantly on the producer. In addition, a significant (P monocytogenes in meat dumplings. In contrast, the microwave heating applied for 2 min at 600 W only reduced the count of L. monocytogenes by 1 to 2 logs. Hence, the microwave heating failed to reduce the risk of infection with this pathogen below the level permissible in the EU regulation, especially in the most contaminated samples. In this case, the efficacy of microwave heating was significantly (P monocytogenes (rho = 0.626), then by meat content in the stuffing (0.476), and to the lowest extent--by the type of meat (0.415 to 0.425). However, no Listeria sp. and L. monocytogenes were isolated from cooked dumplings with fruits (strawberries or blueberries). © 2015 Institute of Food Technologists®

  18. Collection of Listeria monocytogenes Isolates from Milk, Dairy Products and Food Processing Environments in Slovakia for the Purposes of European Molecular Database

    OpenAIRE

    Kubicová Z.; Filipová M.; Jurovčíková J.; Cabanová L

    2017-01-01

    The molecular typing of Listeria monocytogenes isolates is an important tool for monitoring the spread of the strains in food chains, providing evidence for epidemiological investigations and for the detection of out-breaks. The demand of European typing data centralization, collection and sharing stimulated the generation of “EURL L. monocytogenes Database (EURL Lm DB)” in 2012 led by the European Union Reference Laboratory (EURL) for L. monocytogenes (ANSES Maisons-Alfort Laboratory for Foo...

  19. FHEO Filed Cases

    Data.gov (United States)

    Department of Housing and Urban Development — The dataset is a list of all the Title VIII fair housing cases filed by FHEO from 1/1/2007 - 12/31/2012 including the case number, case name, filing date, state and...

  20. Cleaning and Disinfection of Biofilms Composed of Listeria monocytogenes and Background Microbiota from Meat Processing Surfaces

    Science.gov (United States)

    Møretrø, Trond; Heir, Even; Briandet, Romain; Langsrud, Solveig

    2017-01-01

    ABSTRACT Surfaces of food processing premises are exposed to regular cleaning and disinfection (C&D) regimes, using biocides that are highly effective against bacteria growing as planktonic cells. However, bacteria growing in surface-associated communities (biofilms) are typically more tolerant toward C&D than their individual free-cell counterparts, and survival of pathogens such as Listeria monocytogenes may be affected by interspecies interactions within biofilms. In this study, Pseudomonas and Acinetobacter were the most frequently isolated genera surviving on conveyor belts subjected to C&D in meat processing plants. In the laboratory, Pseudomonas, Acinetobacter, and L. monocytogenes dominated the community, both in suspensions and in biofilms formed on conveyor belts, when cultures were inoculated with eleven-genus cocktails of representative bacterial strains from the identified background flora. When biofilms were exposed to daily C&D cycles mimicking treatments used in food industry, the levels of Acinetobacter and Pseudomonas mandelii diminished, and biofilms were instead dominated by Pseudomonas putida (65 to 76%), Pseudomonas fluorescens (11 to 15%) and L. monocytogenes (3 to 11%). The dominance of certain species after daily C&D correlated with high planktonic growth rates at 12°C and tolerance to C&D. In single-species biofilms, L. monocytogenes developed higher tolerance to C&D over time, for both the peracetic acid and quaternary ammonium disinfectants, indicating that a broad-spectrum mechanism was involved. Survival after C&D appeared to be a common property of L. monocytogenes strains, as persistent and sporadic subtypes showed equal survival rates in complex biofilms. Biofilms established preferentially in surface irregularities of conveyor belts, potentially constituting harborage sites for persistent contamination. IMPORTANCE In the food industry, efficient production hygiene is a key measure to avoid the accumulation of spoilage bacteria and