National Research Council Canada - National Science Library
Singh, Reshma
2006-01-01
...% of all breast cancers. Five Listeria monocytogenes vaccines have been made consisting of fragments of HER-2/neu that are capable of stopping the growth of transplantable tumors in wild type FVB/N mice and can cause...
Listeria monocytogenes as a vector for anti-cancer therapies.
LENUS (Irish Health Repository)
Tangney, Mark
2012-01-31
The intracellular pathogen Listeria monocytogenes represents a promising therapeutic vector for the delivery of DNA, RNA or protein to cancer cells or to prime immune responses against tumour-specific antigens. A number of biological properties make L. monocytogenes a promising platform for development as a vector for either gene therapy or as an anti-cancer vaccine vector. L. monocytogenes is particularly efficient in mediating internalization into host cells. Once inside cells, the bacterium produces specific virulence factors which lyse the vaculolar membrane and allow escape into the cytoplasm. Once in the cytosol, L. monocytogenes is capable of actin-based motility and cell-to-cell spread without an extracellular phase. The cytoplasmic location of L. monocytogenes is significant as this potentiates entry of antigens into the MHC Class I antigen processing pathway leading to priming of specific CD8(+) T cell responses. The cytoplasmic location is also beneficial for the delivery of DNA (bactofection) by L. monocytogenes whilst cell-to-cell spread may facilitate access of the vector to cells throughout the tumour. Several preclinical studies have demonstrated the ability of L. monocytogenes for intracellular gene or protein delivery in vitro and in vivo, and this vector has also displayed safety and efficacy in clinical trial. Here, we review the features of the L. monocytogenes host-pathogen interaction that make this bacterium such an attractive candidate with which to induce appropriate therapeutic responses. We focus primarily upon work that has led to attenuation of the pathogen, demonstrated DNA, RNA or protein delivery to tumour cells as well as research that shows the efficacy of L. monocytogenes as a vector for tumour-specific vaccine delivery.
Adenovirus-based vaccine against Listeria monocytogenes
DEFF Research Database (Denmark)
Jensen, Søren; Steffensen, Maria Abildgaard; Jensen, Benjamin Anderschou Holbech
2013-01-01
The use of replication-deficient adenoviruses as vehicles for transfer of foreign genes offers many advantages in a vaccine setting, eliciting strong cellular immune responses involving both CD8(+) and CD4(+) T cells. Further improving the immunogenicity, tethering of the inserted target Ag to MHC...... linked to Ii compared with vaccination with the unlinked vaccine. Studies using knockout mice demonstrated that CD8(+) T cells were largely responsible for this protection, which is mediated through perforin-dependent lysis of infected cells and IFN-γ production. Taking the concept a step further...
Antimicrobial resistance of Listeria monocytogenes isolated from dairy-based food products.
Harakeh, Steve; Saleh, Imane; Zouhairi, Omar; Baydoun, Elias; Barbour, Elie; Alwan, Nisreen
2009-06-15
In this study Listeria monocytogenes (L. monocytogenes) was isolated from three traditionally consumed Lebanese dairy-based food products. One hundred and sixty four samples (45 samples of Baladi cheese, 36 samples of Shankleesh and 83 of Kishk) were collected from the Bekaa Valley in the Northeast region of Lebanon. Suspected Listeria colonies were selected and initially identified by using standard biochemical tests. Initial identification of the positive L. monocytogenes colonies was confirmed at the molecular level by Polymerase Chain Reaction (n=30) and the confirmed isolates were evaluated for their susceptibility to 10 commonly used antimicrobials. All of the 30 isolates were confirmed to be L. monocytogenes yielding a PCR product of approximately 660 base pairs (bp). L. monocytogenes was detected in 26.67%, 13.89% and 7.23% of the Baladi cheese, Shankleesh and Kishk samples, respectively. The highest resistance in L. monocytogenes isolates was noted against oxacillin (93.33%) followed by penicillin (90%). The results provide an indication of the contamination levels of dairy-based foods in Lebanon and highlight the emergence of multi-drug resistant Listeria in the environment.
Shen, Hao; Slifka, Mark K.; Matloubian, Mehrdad; Jensen, Eric R.; Ahmed, Rafi; Miller, Jeff F.
1995-04-01
Listeria monocytogenes (LM) is a Gram-positive bacterium that is able to enter host cells, escape from the endocytic vesicle, multiply within the cytoplasm, and spread directly from cell to cell without encountering the extracellular milieu. The ability of LM to gain access to the host cell cytosol allows proteins secreted by the bacterium to efficiently enter the pathway for major histocompatibility complex class I antigen processing and presentation. We have established a genetic system for expression and secretion of foreign antigens by recombinant strains, based on stable site-specific integration of expression cassettes into the LM genome. The ability of LM recombinants to induce protective immunity against a heterologous pathogen was demonstrated with lymphocytic choriomeningitis virus (LCMV). LM strains expressing the entire LCMV nucleoprotein or an H-2L^d-restricted nucleoprotein epitope (aa 118-126) were constructed. Immunization of mice with LM vaccine strains conferred protection against challenge with virulent strains of LCMV that otherwise establish chronic infection in naive adult mice. In vivo depletion of CD8^+ T cells from vaccinated mice abrogated their ability to clear viral infection, showing that protective anti-viral immunity was due to CD8^+ T cells.
Directed antigen delivery as a vaccine strategy for an intracellular bacterial pathogen
Bouwer, H. G. Archie; Alberti-Segui, Christine; Montfort, Megan J.; Berkowitz, Nathan D.; Higgins, Darren E.
2006-03-01
We have developed a vaccine strategy for generating an attenuated strain of an intracellular bacterial pathogen that, after uptake by professional antigen-presenting cells, does not replicate intracellularly and is readily killed. However, after degradation of the vaccine strain within the phagolysosome, target antigens are released into the cytosol for endogenous processing and presentation for stimulation of CD8+ effector T cells. Applying this strategy to the model intracellular pathogen Listeria monocytogenes, we show that an intracellular replication-deficient vaccine strain is cleared rapidly in normal and immunocompromised animals, yet antigen-specific CD8+ effector T cells are stimulated after immunization. Furthermore, animals immunized with the intracellular replication-deficient vaccine strain are resistant to lethal challenge with a virulent WT strain of L. monocytogenes. These studies suggest a general strategy for developing safe and effective, attenuated intracellular replication-deficient vaccine strains for stimulation of protective immune responses against intracellular bacterial pathogens. CD8+ T cell | replication-deficient | Listeria monocytogenes
Vojkovska, H; Kubikova, I; Kralik, P
2015-03-01
Epidemiological data indicate that raw vegetables are associated with outbreaks of Listeria monocytogenes. Therefore, there is a demand for the availability of rapid and sensitive methods, such as PCR assays, for the detection and accurate discrimination of L. monocytogenes. However, the efficiency of PCR methods can be negatively affected by inhibitory compounds commonly found in vegetable matrices that may cause false-negative results. Therefore, the sample processing and DNA isolation steps must be carefully evaluated prior to the introduction of such methods into routine practice. In this study, we compared the ability of three column-based and four magnetic bead-based commercial DNA isolation kits to extract DNA of the model micro-organism L. monocytogenes from raw vegetables. The DNA isolation efficiency of all isolation kits was determined using a triplex real-time qPCR assay designed to specifically detect L. monocytogenes. The kit with best performance, the PowerSoil(™) Microbial DNA Isolation Kit, is suitable for the extraction of amplifiable DNA from L. monocytogenes cells in vegetable with efficiencies ranging between 29.6 and 70.3%. Coupled with the triplex real-time qPCR assay, this DNA isolation kit is applicable to the samples with bacterial loads of 10(3) bacterial cells per gram of L. monocytogenes. Several recent outbreaks of Listeria monocytogenes have been associated with the consumption of fruits and vegetables. Real-time PCR assays allow fast detection and accurate quantification of microbes. However, the success of real-time PCR is dependent on the success with which template DNA can be extracted. The results of this study suggest that the PowerSoil(™) Microbial DNA Isolation Kit can be used for the extraction of amplifiable DNA from L. monocytogenes cells in vegetable with efficiencies ranging between 29.6 and 70.3%. This method is applicable to samples with bacterial loads of 10(3) bacterial cells per gram of L. monocytogenes. © 2014
The challenge of setting risk-based microbiological criteria for Listeria monocytogenes
DEFF Research Database (Denmark)
Andersen, Jens Kirk; Nørrung, Birgit
2011-01-01
After more than 20 years of work with discussing the setting of microbiological criteria for Listeria monocytogenes in foods, Codex Alimentarius on Food Hygiene has finalised a proposal that was recently adopted by the Codex Alimentarius Commission. The effort of developing procedures for making...... the microbiological criteria risk-based to the greatest extent possible has challenged scientists and managers during this long time period. Yet, the establishment of microbiological criteria for L. monocytogenes is still being discussed and several approaches are possible. Setting of microbiological criteria...
Inhibition of Listeria monocytogenes by propionic acid-based ingredients in cured deli-style Turkey.
Glass, Kathleen A; McDonnell, Lindsey M; Von Tayson, Roxanne; Wanless, Brandon; Badvela, Mani
2013-12-01
Listeria monocytogenes growth can be controlled on ready-to-eat meats through the incorporation of antimicrobial ingredients into the formulation or by postlethality kill steps. However, alternate approaches are needed to provide options that reduce sodium content but maintain protection against pathogen growth in meats after slicing. The objective of this study was to determine the inhibition of L. monocytogenes by propionic acid-based ingredients in high-moisture, cured turkey stored at 4 or 7°C. Six formulations of sliced, cured (120 ppm of NaNO2 ), deli-style turkey were tested, including control without antimicrobials, 3.2% lactate-diacetate blend (LD), 0.4% of a liquid propionate-benzoate-containing ingredient, or 0.3, 0.4, and 0.5% of a liquid propionate-containing ingredient. Products were inoculated with 5 log CFU L. monocytogenes per 100-g package (3 log CFU/ml rinsate), vacuum-sealed, and stored at 4 or 7°C for up to 12 weeks; and populations were enumerated by plating on modified Oxford agar. As expected, the control without antimicrobials supported rapid growth, with >2 log average per ml rinsate increase within 4 weeks of storage at 4°C, whereas growth was observed at 6 weeks for the LD treatment. For both replicate trials, all treatments that contained liquid propionate or propionate-benzoate limited L. monocytogenes growth to an increase of 1-log increase) was observed in individual samples for all propionate-containing treatments at weeks 10, 11, and 12. As expected, L. monocytogenes grew more rapidly when products were stored at 7°C, but trends in relative inhibition were similar to those observed at 4°C. These results verify that propionate-based ingredients inhibit growth of L. monocytogenes on sliced, high-moisture, cured turkey and can be considered as an alternative to reduce sodium-based salts while maintaining food safety.
Jahn, Marie Louise; Steffensen, Maria Abildgaard; Christensen, Jan Pravsgaard; Thomsen, Allan Randrup
2018-05-11
Defining correlates of T cell mediated protection is important in order to accelerate the development of efficient T cell based vaccines conferring long-term immunity. Extensive studies have provided important insight regarding the characteristics and functional properties of the effector and memory CD8 T cells induced by viral vector based vaccines. However, long-term protection has been difficult to achieve with T cell inducing vaccines, and the determinants underlying this loss in protection over time are still not fully defined. In this study we analyzed different parameters of the CD8 T cell response as a function of time after vaccination with a human serotype 5 adenovector expressing the glycoprotein (GP) of LCMV tethered to the MHC class II-associated invariant chain. Using this vector we have previously found that CD8 T cells mediate protection from challenge with GP-expressing Listeria monocytogenes at 60 days post vaccination, but only little protection after further 60 days, and we now confirm this observation. A comparison of vaccine-primed CD8 T cells early and late after vaccination revealed a minor decline in the overall numbers of antigen specific memory CD8 T cells during this interval. More importantly, we also observed phenotypic changes over time with a distinct decline in the frequency and number of KLRG1 + CD8 T cells, and, notably, adoptive transfer studies confirmed that memory CD8 T cells expressing KLRG1 are central to protection from systemic L. monocytogenes infection. Together these findings imply that multiple factors including changes in memory T cell numbers and phenotypic composition over time influence the longevity of CD8 T-cell mediated protection. Copyright © 2018 Elsevier Ltd. All rights reserved.
A Dual Microscopy-Based Assay To Assess Listeria monocytogenes Cellular Entry and Vacuolar Escape.
Quereda, Juan J; Pizarro-Cerdá, Javier; Balestrino, Damien; Bobard, Alexandre; Danckaert, Anne; Aulner, Nathalie; Shorte, Spencer; Enninga, Jost; Cossart, Pascale
2016-01-01
Listeria monocytogenes is a Gram-positive bacterium and a facultative intracellular pathogen that invades mammalian cells, disrupts its internalization vacuole, and proliferates in the host cell cytoplasm. Here, we describe a novel image-based microscopy assay that allows discrimination between cellular entry and vacuolar escape, enabling high-content screening to identify factors specifically involved in these two steps. We first generated L. monocytogenes and Listeria innocua strains expressing a β-lactamase covalently attached to the bacterial cell wall. These strains were then incubated with HeLa cells containing the Förster resonance energy transfer (FRET) probe CCF4 in their cytoplasm. The CCF4 probe was cleaved by the bacterial surface β-lactamase only in cells inoculated with L. monocytogenes but not those inoculated with L. innocua, thereby demonstrating bacterial access to the host cytoplasm. Subsequently, we performed differential immunofluorescence staining to distinguish extracellular versus total bacterial populations in samples that were also analyzed by the FRET-based assay. With this two-step analysis, bacterial entry can be distinguished from vacuolar rupture in a single experiment. Our novel approach represents a powerful tool for identifying factors that determine the intracellular niche of L. monocytogenes. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Aarnisalo, Kaarina; Vihavainen, Elina; Rantala, Leila; Maijala, Riitta; Suihko, Maija-Liisa; Hielm, Sebastian; Tuominen, Pirkko; Ranta, Jukka; Raaska, Laura
2008-02-10
Microbial risk assessment provides a means of estimating consumer risks associated with food products. The methods can also be applied at the plant level. In this study results of microbiological analyses were used to develop a robust single plant level risk assessment. Furthermore, the prevalence and numbers of Listeria monocytogenes in marinated broiler legs in Finland were estimated. These estimates were based on information on the prevalence, numbers and genotypes of L. monocytogenes in 186 marinated broiler legs from 41 retail stores. The products were from three main Finnish producers, which produce 90% of all marinated broiler legs sold in Finland. The prevalence and numbers of L. monocytogenes were estimated by Monte Carlo simulation using WinBUGS, but the model is applicable to any software featuring standard probability distributions. The estimated mean annual number of L. monocytogenes-positive broiler legs sold in Finland was 7.2x10(6) with a 95% credible interval (CI) 6.7x10(6)-7.7x10(6). That would be 34%+/-1% of the marinated broiler legs sold in Finland. The mean number of L. monocytogenes in marinated broiler legs estimated at the sell-by-date was 2 CFU/g, with a 95% CI of 0-14 CFU/g. Producer-specific L. monocytogenes strains were recovered from the products throughout the year, which emphasizes the importance of characterizing the isolates and identifying strains that may cause problems as part of risk assessment studies. As the levels of L. monocytogenes were low, the risk of acquiring listeriosis from these products proved to be insignificant. Consequently there was no need for a thorough national level risk assessment. However, an approach using worst-case and average point estimates was applied to produce an example of single producer level risk assessment based on limited data. This assessment also indicated that the risk from these products was low. The risk-based approach presented in this work can provide estimation of public health risk
Qian, Yue; Zhang, Na; Jiang, Ping; Chen, Siyuan; Chu, Shujuan; Hamze, Firas; Wu, Yan; Luo, Qin; Feng, Aiping
2012-08-01
Listeria monocytogenes (LM), a Gram-positive facultative intracellular bacterium, can be used as an effective exogenous antigen expression vector in tumor-target therapy. But for successful clinical application, it is necessary to construct attenuated LM stain that is safe yet retains the potency of LM based on the full virulent pathogen. In this study, attenuated LM and recombinants of LM expressing melanoma inhibitory activity (MIA) were constructed successfully. The median lethal dose (LD(50)) and invasion efficiency of attenuated LM strains were detected. The recombinants were utilized for immunotherapy of animal model of B16F10 melanoma. The level of MIA mRNA expression in tumor tissue was detected by using real-time polymerase chain reaction (PCR) with specific sequence, meanwhile the anti-tumor immune response was assayed by flow cytometric analysis and enzyme-linked immunosorbent spot (ELISPOT) assay. The results showed the toxicity and invasiveness of attenuated LM were decreased as compared with LM, and attenuated LM expressing MIA, especially the double-genes attenuated LM recombinant, could significantly induce anti-tumor immune response and inhibit tumor growth. This study implicates attenuated LM may be a safer and more effective vector for immunotherapy of melanoma.
Day, J B; Basavanna, U
2015-01-01
To develop a rapid detection procedure for Listeria monocytogenes in infant formula and lettuce using a macrophage-based enrichment protocol and real-time PCR. A macrophage cell culture system was employed for the isolation and enrichment of L. monocytogenes from infant formula and lettuce for subsequent identification using real-time PCR. Macrophage monolayers were exposed to infant formula and lettuce contaminated with a serial dilution series of L. monocytogenes. As few as approx. 10 CFU ml(-1) or g(-1) of L. monocytogenes were detected in infant formula and lettuce after 16 h postinfection by real-time PCR. Internal positive PCR controls were utilized to eliminate the possibility of false-negative results. Co-inoculation with Listeria innocua did not reduce the L. monocytogenes detection sensitivity. Intracellular L. monocytogenes could also be isolated on Listeria selective media from infected macrophage lysates for subsequent confirmation. The detection method is highly sensitive and specific for L. monocytogenes in infant formula and lettuce and establishes a rapid identification time of 20 and 48 h for presumptive and confirmatory identification, respectively. The method is a promising alternative to many currently used q-PCR detection methods which employ traditional selective media for enrichment of contaminated food samples. Macrophage enrichment of L. monocytogenes eliminates PCR inhibitory food elements and contaminating food microflora which produce cleaner samples that increase the rapidity and sensitivity of detection. Published 2014. This article is a U.S. Government work and is in the public domain in the USA.
A dynamical systems approach to actin-based motility in Listeria monocytogenes
Hotton, S.
2010-11-01
A simple kinematic model for the trajectories of Listeria monocytogenes is generalized to a dynamical system rich enough to exhibit the resonant Hopf bifurcation structure of excitable media and simple enough to be studied geometrically. It is shown how L. monocytogenes trajectories and meandering spiral waves are organized by the same type of attracting set.
Zhang, Cathy X. Y.; Brooks, Brian W.; Huang, Hongsheng; Pagotto, Franco
2016-01-01
ABSTRACT The Gram-positive bacterium Listeria monocytogenes causes a significant percentage of the fatalities among foodborne illnesses in humans. Surface proteins specifically expressed in a wide range of L. monocytogenes serotypes under selective enrichment culture conditions could serve as potential biomarkers for detection and isolation of this pathogen via antibody-based methods. Our study aimed to identify such biomarkers. Interrogation of the L. monocytogenes serotype 4b strain F2365 genome identified 130 putative or known surface proteins. The homologues of four surface proteins, LMOf2365_0578, LMOf2365_0581, LMOf2365_0639, and LMOf2365_2117, were assessed as biomarkers due to the presence of conserved regions among strains of L. monocytogenes which are variable among other Listeria species. Rabbit polyclonal antibodies against the four recombinant proteins revealed the expression of only LMOf2365_0639 on the surface of serotype 4b strain LI0521 cells despite PCR detection of mRNA transcripts for all four proteins in the organism. Three of 35 monoclonal antibodies (MAbs) to LMOf2365_0639, MAbs M3643, M3644, and M3651, specifically recognized 42 (91.3%) of 46 L. monocytogenes lineage I and II isolates grown in nonselective brain heart infusion medium. While M3644 and M3651 reacted with 14 to 15 (82.4 to 88.2%) of 17 L. monocytogenes lineage I and II isolates, M3643 reacted with 22 (91.7%) of 24 lineage I, II, and III isolates grown in selective enrichment media (UVM1, modified Fraser, Palcam, and UVM2 media). The three MAbs exhibited only weak reactivities (the optical densities at 414 nm were close to the cutoff value) to some other Listeria species grown in selective enrichment media. Collectively, the data indicate the potential of LMOf2365_0639 as a surface biomarker of L. monocytogenes, with the aid of specific MAbs, for pathogen detection, identification, and isolation in clinical, environmental, and food samples. IMPORTANCE L. monocytogenes is
Listeria monocytogenes inhibition by defatted mustard meal-based edible films.
Lee, Hahn-Bit; Noh, Bong Soo; Min, Sea C
2012-02-01
An antimicrobial edible film was developed from defatted mustard meal (Sinapis alba) (DMM), a byproduct from the bio-fuel industry, without incorporating external antimicrobials and its antimicrobial activity against Listeria monocytogenes and physical properties were investigated. The DMM colloidal solution consisting of 184 g water, 14 g DMM, and 2g glycerol was homogenized and incubated at 37°C for 0.2, 0.5, 24 or 48 h to prepare a film-forming solution. The pH of a portion of the film-forming solution (pH 5.5) was adjusted to 2.0 or 4.0. Films were formed by drying the film-forming solutions at 23°C for 48 h. The film-forming solution incubated for 48 h inhibited L. monocytogenes in broth and on agar media. Antimicrobial effects of the film prepared from the 48 h-incubated solution increased with decrease in pH of the solution from 5.5 to 2.0. The film from the film forming solution incubated for 48 h (pH 2.0) initially inhibited more than 4.0 log CFU/g of L. monocytogenes inoculated on film-coated salmon. The film-coating retarded the growth of L. monocytogenes in smoked salmon at 5, 10, and 15°C and the antimicrobial effect during storage was more noticeable when the coating was applied before inoculation than when it was applied after inoculation. The tensile strength, percentage elongation, solubility in watercxu, and water vapor permeability of the anti microbial film were 2.44 ± 0.19 MPa, 6.40 ± 1.13%, 3.19 ± 0.90%, and 3.18 ± 0.63 gmm/kPa hm(2), respectively. The antimicrobial DMM films have demonstrated a potential to be applied to foods as wraps or coatings to control the growth of L. monocytogenes. Copyright © 2011 Elsevier B.V. All rights reserved.
Listeria monocytogenes: diagnostic problems
Beumer, R.R.; Hazeleger, W.C.
2003-01-01
The first isolation methods for the detection of Listeria spp. were generally based on the direct culture of samples on simple agar media, but isolation of the pathogenic Listeria monocytogenes was difficult. In time, new techniques were developed, based on a variety of selective and elective agents
Cloning and Expression of Listeria monocytogenes Listeriolysin O in Lactobacillus plantarum
Directory of Open Access Journals (Sweden)
Masoumeh Hayati
2017-11-01
Full Text Available Background: The protein listeriolysin O (LLO encoded by hly gene, is one of the most important virulence factors of Listeria monocytogenes. This highly potent immunogenic cholesterol binding toxin has hemolytic activity, responsible for phagosomal membrane disruption and bacterial escape to the cytoplasm and facilitating the stimulation of CD8+ T cells and Th1 response. Recently pathobiotechnological vaccination using probiotic bacteria have been proposed. One of these strategies is expression of LLO in non-pathogenic bacteria such as lactic acid bacteria as delivery strains. Objectives: Our aim in this study was cloning of hly gene in a Lactobacillus species via pNZ8110, an inducible expression vector which is specific for Lactococcus species. Materials and Methods: hly gene was amplified by PCR and cloned into pNZ8110 by restriction enzymes cutting and ligation method. After transformation and propagation in E. coli MC1061 intermediate host, it was successfully electrotransformed into Lactobacillus plantarum. Results: Gel electrophoresis of colony PCR, extracted plasmids and restriction analysis along with sequencing confirmed the transformation. After induction using supernatant of nisin producer Lactococcus lactis NZ9700 strain, Expression of LLO was confirmed by SDS PAGE and western blot. Conclusion: Here, we have employed a nonpathogenic probiotic strain; Lactobacillus plantarum for the first time to express hly gene of Listeria monocytogenes in order to propose a new vaccine candidate.
Fødevarebetinget listeria monocytogenes endokarditis
DEFF Research Database (Denmark)
Frydland, Martin; Bundgaard, Henning; Moser, Claus
2014-01-01
Infection with Listeria monocytogenes is rare and mainly seen in immunosuppressed patients. Infection with L. monocytogenes has a mortality rate of 30%. We present a case report of L. monocytogenes bacteraemia and endocarditis in a 70-year-old man with several co-morbidities and following four...... major surgical procedures. This illustrates the findings and characteristics in one of the 16 patients who died in 2013 and 2014 this summer due to sausage-related L. monocytogenes infection....
Incidence and control of Listeria monocytogenes in foods in Denmark
DEFF Research Database (Denmark)
Nørrung, Birgit; Andersen, Jens Kirk; Schlundt, Jørgen
1999-01-01
The Danish regulatory policy on Listeria monocytogenes in foods is based on the principles of HACCP and was developed using a health risk assessment approach. The Danish policy focuses examinations and criteria for L. monocytogenes in ready-to-eat foods and is based on a combination of inspection...
Incorporation of Listeria monocytogenes strains in raw milk biofilms.
Weiler, Christiane; Ifland, Andrea; Naumann, Annette; Kleta, Sylvia; Noll, Matthias
2013-02-01
Biofilms develop successively on devices of milk production without sufficient cleaning and originate from the microbial community of raw milk. The established biofilm matrices enable incorporation of pathogens like Listeria monocytogenes, which can cause a continuous contamination of food processing plants. L. monocytogenes is frequently found in raw milk and non-pasteurized raw milk products and as part of a biofilm community in milk meters and bulk milk tanks. The aim of this study was to analyze whether different L. monocytogenes strains are interacting with the microbial community of raw milk in terms of biofilm formation in the same manner, and to identify at which stage of biofilm formation a selected L. monocytogenes strain settles best. Bacterial community structure and composition of biofilms were analyzed by a cloning and sequencing approach and terminal restriction fragment length polymorphism analysis (T-RFLP) based on the bacterial 16S rRNA gene. The chemical composition of biofilms was analyzed by Fourier transform infrared spectroscopy (FTIR), while settled L. monocytogenes cells were quantified by fluorescence in situ hybridization (FISH). Addition of individual L. monocytogenes strains to raw milk caused significant shifts in the biofilm biomass, in the chemical as well as in the bacterial community composition. Biofilm formation and attachment of L. monocytogenes cells were not serotype but strain specific. However, the added L. monocytogenes strains were not abundant since mainly members of the genera Citrobacter and Lactococcus dominated the bacterial biofilm community. Overall, added L. monocytogenes strains led to a highly competitive interaction with the raw milk community and triggered alterations in biofilm formation. Copyright © 2012 Elsevier B.V. All rights reserved.
Listeria monocytogenes in retailed raw chicken meat in Turkey.
Siriken, Belgin; Ayaz, Naim Deniz; Erol, Irfan
2014-01-01
The objectives of this study were, to find the prevalence and antimicrobial resistance of L. monocytogenes from a total of 116 chicken meat samples including 50 carcasses and 66 meat parts marketed in Turkey between 2008 and 2009 using immunomagnetic separation (IMS) based cultivation technique, to detect the hlyA gene for the verification of the isolates by PCR, and to identify the genoserotypes of the L. monocytogenes isolates by multiplex PCR assay. In the study, 51 L. monocytogenes colonies were isolated from 34 (29.3%) chicken meat samples (eleven [22.0%] carcasses and 23 [34.8%] pieces of meat) by IMS based cultivation technique and confirmed by PCR. According to the multiplex PCR results, all the 51 isolates were identified as genoserotype IIa (1/2a or 3a). L. monocytogenes isolates were also tested for their susceptibility to eight antibiotic (gentamicin, vancomycin, chloramphenicol, streptomycin, tetracycline, ampicillin, penicillin G, erythromycin) agents using the disk diffusion method. 14 isolates (27.45%) were susceptible to all eight antimicrobials drugs tested and the remaining 37 isolates (72.54%) were resistant to gentamicin (one isolate, 1.96%), vancomycin (four isolates, 7.84%), penicillin G (six isolates, 11.76%), streptomycin (nine isolates, 17.64%; resistant or intermediate), tetracycline (seven isolates, 13.72%) and ampicillin (six isolates, 11.76%). This study showed that antimicrobial resistance is not highly prevalent in L. monocytogenes isolated from chicken carcasses and pieces of meat. The presence of L. monocytogenes in chicken samples suggests an importance of this pathogen in chicken.
Relationship between Listeria monocytogenes and Listeria spp. in seafood processing plants.
Alali, Walid Q; Schaffner, Donald W
2013-07-01
The objective of this study was to evaluate the relationship between prevalence of Listeria monocytogenes as an outcome and Listeria spp. as an explanatory variable by food products, food contact surfaces, and nonfood contact surfaces in seafood processing plants by using peer-reviewed published data. Nine sets of prevalence data of L. monocytogenes and Listeria spp. were collected from published studies and used for the analyses. Based on our analysis, the relationship between L. monocytogenes prevalence and Listeria spp. prevalence in food products (incoming raw materials and finish products) was significant (P = 0.04) with (low) R² = 0.36. Furthermore, Listeria spp. were not a good indicator for L. monocytogenes when testing food contact surfaces (R² = 0.10). Listeria spp. were a good indicator for L. monocytogenes only on nonfood contact surfaces (R² = 0.90). On the other hand, the presence of Listeria spp. on food contact surfaces (R² = 0.002) and nonfood contact surfaces (R² = 0.03) was not a good indicator for L. monocytogenes presence in food products. In general, prevalence of Listeria spp. does not seem to be a good indicator for L. monocytogenes prevalence in seafood processing plants.
Modeling the growth of Listeria monocytogenes in soft blue-white cheese
DEFF Research Database (Denmark)
Rosshaug, Per Sand; Detmer, Ann; Ingmer, Hanne
2012-01-01
The aim of this study was to develop a predictive model simulating growth over time of the pathogenic bacterium Listeria monocytogenes in a soft blue-white cheese. The physicochemical properties in a matrix such as cheese are essential controlling factors influencing the growth of L. monocytogenes....... We developed a predictive tertiary model of the bacterial growth of L. monocytogenes as a function of temperature, pH, NaCl, and lactic acid. We measured the variations over time of the physicochemical properties in the cheese. Our predictive model was developed based on broth data produced...... production and retail conditions showed that the number of L. monocytogenes cells increases 3 to 3.5 log within the shelf life of the cheese....
Caballero, Oscar; Alles, Susan; Le, Quynh-Nhi; Gray, R Lucas; Hosking, Edan; Pinkava, Lisa; Norton, Paul; Tolan, Jerry; Mozola, Mark; Rice, Jennifer; Chen, Yi; Ryser, Elliot; Odumeru, Joseph
2016-01-01
Work was conducted to validate performance of the ANSR(®) for Listeria monocytogenes method in selected food and environmental matrixes. This DNA-based assay involves amplification of nucleic acid via an isothermal reaction based on nicking enzyme amplification technology. Following single-step sample enrichment for 16-24 h for most matrixes, the assay is completed in 40 min using only simple instrumentation. When 50 distinct strains of L. monocytogenes were tested for inclusivity, 48 produced positive results, the exceptions being two strains confirmed by PCR to lack the assay target gene. Forty-seven nontarget strains (30 species), including multiple non-monocytogenes Listeria species as well as non-Listeria, Gram-positive bacteria, were tested, and all generated negative ANSR assay results. Performance of the ANSR method was compared with that of the U.S. Department of Agriculture, Food Safety and Inspection Service Microbiology Laboratory Guidebook reference culture procedure for detection of L. monocytogenes in hot dogs, pasteurized liquid egg, and sponge samples taken from an inoculated stainless steel surface. In addition, ANSR performance was measured against the U.S. Food and Drug Administration Bacteriological Analytical Manual reference method for detection of L. monocytogenes in Mexican-style cheese, cantaloupe, sprout irrigation water, and guacamole. With the single exception of pasteurized liquid egg at 16 h, ANSR method performance as quantified by the number of positives obtained was not statistically different from that of the reference methods. Robustness trials demonstrated that deliberate introduction of small deviations to the normal assay parameters did not affect ANSR method performance. Results of accelerated stability testing conducted using two manufactured lots of reagents predicts stability at the specified storage temperature of 4°C of more than 1 year.
Directory of Open Access Journals (Sweden)
Ok Kyung Koo
Full Text Available BACKGROUND: Listeria monocytogenes, an intracellular foodborne pathogen, infects immunocompromised hosts. The primary route of transmission is through contaminated food. In the gastrointestinal tract, it traverses the epithelial barrier through intracellular or paracellular routes. Strategies to prevent L. monocytogenes entry can potentially minimize infection in high-risk populations. Listeria adhesion protein (LAP aids L. monocytogenes in crossing epithelial barriers via the paracellular route. The use of recombinant probiotic bacteria expressing LAP would aid targeted clearance of Listeria from the gut and protect high-risk populations from infection. METHODOLOGY/PRINCIPAL FINDINGS: The objective was to investigate the ability of probiotic bacteria or LAP-expressing recombinant probiotic Lactobacillus paracasei (Lbp(LAP to prevent L. monocytogenes adhesion, invasion, and transwell-based transepithelial translocation in a Caco-2 cell culture model. Several wild type probiotic bacteria showed strong adhesion to Caco-2 cells but none effectively prevented L. monocytogenes infection. Pre-exposure to Lbp(LAP for 1, 4, 15, or 24 h significantly (P<0.05 reduced adhesion, invasion, and transepithelial translocation of L. monocytogenes in Caco-2 cells, whereas pre-exposure to parental Lb. paracasei had no significant effect. Similarly, Lbp(LAP pre-exposure reduced L. monocytogenes translocation by as much as 46% after 24 h. Lbp(LAP also prevented L. monocytogenes-mediated cell damage and compromise of tight junction integrity. Furthermore, Lbp(LAP cells reduced L. monocytogenes-mediated cell cytotoxicity by 99.8% after 1 h and 79% after 24 h. CONCLUSIONS/SIGNIFICANCE: Wild type probiotic bacteria were unable to prevent L. monocytogenes infection in vitro. In contrast, Lbp(LAP blocked adhesion, invasion, and translocation of L. monocytogenes by interacting with host cell receptor Hsp60, thereby protecting cells from infection. These data show promise
DEFF Research Database (Denmark)
Nørrung, Birgit
2000-01-01
This paper shortly summarizes data related to risk assessment of Listeria monocytogenes. From available data on risk assessment, it is concluded that the levels of L. monocytogenes consumed is an important factor affecting the incidence of listeriosis. Foods that do not support the growth of L....... monocytogenes are unlikely to be a source of listeriosis, whereas foods that support the growth to high levels, should be the target of risk management efforts. Based on current epidemiological information from several countries, a concentration of L. monocytogenes not exceeding 100/g of food at the time...... of L. monocytogenes in the food during prevailing storage and distribution conditions is needed....
Zittermann, Sandra I; Stanghini, Brenda; See, Ryan Soo; Melano, Roberto G; Boleszczuk, Peter; Murphy, Allana; Maki, Anne; Mallo, Gustavo V
2016-01-01
Detection of Listeria monocytogenes in food is currently based on enrichment methods. When L. monocytogenes is present with other Listeria species in food, the species compete during the enrichment process. Overgrowth competition of the nonpathogenic Listeria species might result in false-negative results obtained with the current reference methods. This potential issue was noted when 50 food samples artificially spiked with L. monocytogenes were tested with a real-time PCR assay and Canada's current reference method, MFHPB-30. Eleven of the samples studied were from foods naturally contaminated with Listeria species other than those used for spiking. The real-time PCR assay detected L. monocytogenes in all 11 of these samples; however, only 6 of these samples were positive by the MFHPB-30 method. To determine whether L. monocytogenes detection can be affected by other species of the same genus due to competition, an L. monocytogenes strain and a Listeria innocua strain with a faster rate of growth in the enrichment broth were artificially coinoculated at different ratios into ground pork meat samples and cultured according to the MFHPB-30 method. L. monocytogenes was detected only by the MFHPB-30 method when L. monocytogenes/L. innocua ratios were 6.0 or higher. In contrast, using the same enrichments, the real-time PCR assay detected L. monocytogenes at ratios as low as 0.6. Taken together, these findings support the hypothesis that L. monocytogenes can be outcompeted by L. innocua during the MFHPB-30 enrichment phase. However, more reliable detection of L. monocytogenes in this situation can be achieved by a PCR-based method mainly because of its sensitivity.
Vaccination of carp against SVCV with an oral DNA vaccine or an insect cells-based subunit vaccine.
Embregts, C W E; Rigaudeau, D; Tacchi, L; Pijlman, G P; Kampers, L; Veselý, T; Pokorová, D; Boudinot, P; Wiegertjes, G F; Forlenza, M
2018-03-19
We recently reported on a successful vaccine for carp against SVCV based on the intramuscular injection of a DNA plasmid encoding the SVCV glycoprotein (SVCV-G). This shows that the intramuscular (i.m.) route of vaccination is suitable to trigger protective responses against SVCV, and that the SVCV G-protein is a suitable vaccine antigen. Yet, despite the general success of DNA vaccines, especially against fish rhabdoviruses, their practical implementation still faces legislative as well as consumer's acceptance concerns. Furthermore, the i.m. route of plasmid administration is not easily combined with most of the current vaccination regimes largely based on intraperitoneal or immersion vaccination. For this reason, in the current study we evaluated possible alternatives to a DNA-based i.m. injectable vaccine using the SVCV-G protein as the vaccine antigen. To this end, we tested two parallel approaches: the first based on the optimization of an alginate encapsulation method for oral delivery of DNA and protein antigens; the second based on the baculovirus recombinant expression of transmembrane SVCV-G protein in insect cells, administered as whole-cell subunit vaccine through the oral and injection route. In addition, in the case of the oral DNA vaccine, we also investigated the potential benefits of the mucosal adjuvants Escherichia coli lymphotoxin subunit B (LTB). Despite the use of various vaccine types, doses, regimes, and administration routes, no protection was observed, contrary to the full protection obtained with our reference i.m. DNA vaccine. The limited protection observed under the various conditions used in this study, the nature of the host, of the pathogen, the type of vaccine and encapsulation method, will therefore be discussed in details to provide an outlook for future vaccination strategies against SVCV. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.
Prevalence of Listeria monocytogenes in poultry meat
Directory of Open Access Journals (Sweden)
Mehmet ELMALI
2015-01-01
Full Text Available AbstractThe objectives of this study were i to isolate Listeria spp. and Listeria monocytogenes in broiler wing meat samples, ii to confirm the isolates by PCR, based on prs and hly A gene sequences, iii to determine the seasonal and monthly distribution of the isolates. A total of 120 broiler wing meat samples (60 packaged pieces wrapped using strech film in styrofoam plates and 60 unpackaged pieces bought from different markets in Hatay province were analysed. Listeria spp. was isolated from 57 (47.5% out of 120 samples. Fifty-four, out of 57 Listeria spp. isolates were identified as L. monocytogenes. L. monocytogenes was isolated from the samples collected during the spring, winter, summer, and autumn at the levels of 26.6%, 40%, 53.3%, 60%, respectively. In this study, the isolation rates were found to be the highest in autumn, while the isolation rates were found to be the lowest in spring. As a consequence, high prevalence of Listeria spp. and L. monocytogenes in poultry wing meat samples may pose a risk for human health. We consider that with obeying the rules of good hygiene practices (GHP, good manufacturing practices (GMP and HACCP can minimize the contamination with Listeria spp.
Painter, Julia E.; Sales, Jessica M.; Pazol, Karen; Wingood, Gina M.; Windle, Michael; Orenstein, Walter A.; DiClemente, Ralph J.
2011-01-01
Background: School-based vaccination programs may provide an effective strategy to immunize adolescents against influenza. This study examined whether adolescent attitudes toward influenza vaccination mediated the relationship between receipt of a school-based influenza vaccination intervention and vaccine uptake. Methods: Participants were…
Directory of Open Access Journals (Sweden)
Daniel R. Rissi
2010-01-01
Full Text Available São descritos sete casos de doença neurológica em ovinos por Listeria monocytogenes no Rio Grande do Sul e Paraná entre 2000 e 2007. Foram afetados ovinos com idades entre 12-24 meses. Os casos ocorreram no verão e início da primavera e os índices gerais de morbidade e letalidade foram de 3,15% e 100%, respectivamente. Quando essa informação estava disponível, nenhum dos ovinos afetados era alimentado com silagem. Em três propriedades havia contato próximo dos ovinos afetados com outras espécies. A evolução do quadro clínico foi de 12 horas a três dias e os sinais clínicos foram caracterizados por decúbito (7/7, desvio da cabeça (4/7, incoordenação (3/7, depressão (3/7, andar em círculos (2/7, cegueira unilateral, emagrecimento progressivo, febre, midríase, movimentos de pedalagem, nistagmo lateral, opistótono, paralisia flácida dos membros pélvicos ou dos quatro membros, salivação excessiva e tremores (1/7 cada. Histologicamente observou-se encefalite com microabscessos, predominantemente unilateral com variáveis graus de gliose e alterações degenerativas como esferóides axonais e infiltração de células Gitter. As lesões se estendiam desde a medula oblonga até o mesencéfalo. Antígenos de Listeria monocytogenes foram detectados por imuno-histoquímica em seções de tronco encefálico de todos os ovinos afetados. O diagnóstico foi realizado com base nos achados epidemiológicos e clinico-patológicos, e confirmado pela imuno-histoquímica (IHQ utilizando anticorpo policlonal anti-L. monocytogenes.Seven cases of neurological disease in sheep caused by Listeria monocytogenes in Rio Grande do Sul and Paraná state, southern Brazil are described. The cases occurred between 2000 and 2007 and 12-24-month-old sheep were affected. Overall morbidity and lethality rates were 3.15% and 100%, respectively. Cases occurred in the summer and early spring. When this information was available, affected sheep had not been
First Trimester Listeria monocytogenes Septicemia
Goddijn, M.; Schipper, H. G.; Spanjaard, L.; Wolf, H.
1997-01-01
Background: Little is known about fetal outcome after Listeria monocytogenes septicemia in the first trimester of pregnancy.Case: A primigravida with L. monocytogenes septicemia at 9 weeks gestation was treated with amoxicillin. At 40 weeks gestation a healthy female infant was born.Conclusion: This
Algae-based oral recombinant vaccines
Specht, Elizabeth A.; Mayfield, Stephen P.
2014-01-01
Recombinant subunit vaccines are some of the safest and most effective vaccines available, but their high cost and the requirement of advanced medical infrastructure for administration make them impractical for many developing world diseases. Plant-based vaccines have shifted that paradigm by paving the way for recombinant vaccine production at agricultural scale using an edible host. However, enthusiasm for “molecular pharming” in food crops has waned in the last decade due to difficulty in developing transgenic crop plants and concerns of contaminating the food supply. Microalgae could be poised to become the next candidate in recombinant subunit vaccine production, as they present several advantages over terrestrial crop plant-based platforms including scalable and contained growth, rapid transformation, easily obtained stable cell lines, and consistent transgene expression levels. Algae have been shown to accumulate and properly fold several vaccine antigens, and efforts are underway to create recombinant algal fusion proteins that can enhance antigenicity for effective orally delivered vaccines. These approaches have the potential to revolutionize the way subunit vaccines are made and delivered – from costly parenteral administration of purified protein, to an inexpensive oral algae tablet with effective mucosal and systemic immune reactivity. PMID:24596570
Algae-based oral recombinant vaccines
Directory of Open Access Journals (Sweden)
Elizabeth A Specht
2014-02-01
Full Text Available Recombinant subunit vaccines are some of the safest and most effective vaccines available, but their high cost and the requirement of advanced medical infrastructure for administration make them impractical for many developing world diseases. Plant-based vaccines have shifted that paradigm by paving the way for recombinant vaccine production at agricultural scale using an edible host. However, enthusiasm for molecular pharming in food crops has waned in the last decade due to difficulty in developing transgenic crop plants and concerns of contaminating the food supply. Microalgae are poised to become the next candidate in recombinant subunit vaccine production, and they present several advantages over terrestrial crop plant-based platforms including scalable and contained growth, rapid transformation, easily obtained stable cell lines, and consistent transgene expression levels. Algae have been shown to accumulate and properly fold several vaccine antigens, and efforts are underway to create recombinant algal fusion proteins that can enhance antigenicity for effective orally-delivered vaccines. These approaches have the potential to revolutionize the way subunit vaccines are made and delivered – from costly parenteral administration of purified protein, to an inexpensive oral algae tablet with effective mucosal and system immune reactivity.
Listeria monocytogenes, a down-to-earth pathogen.
Vivant, Anne-Laure; Garmyn, Dominique; Piveteau, Pascal
2013-01-01
Listeria monocytogenes is the causative agent of the food-borne life threatening disease listeriosis. This pathogenic bacterium received much attention in the endeavor of deciphering the cellular mechanisms that underlie the onset of infection and its ability to adapt to the food processing environment. Although information is available on the presence of L. monocytogenes in many environmental niches including soil, water, plants, foodstuff and animals, understanding the ecology of L. monocytogenes in outdoor environments has received less attention. Soil is an environmental niche of pivotal importance in the transmission of this bacterium to plants and animals. Soil composition, microbial communities and macrofauna are extrinsic edaphic factors that direct the fate of L. monocytogenes in the soil environment. Moreover, farming practices may further affect its incidence. The genome of L. monocytogenes presents an extensive repertoire of genes encoding transport proteins and regulators, a characteristic of the genome of ubiquitous bacteria. Postgenomic analyses bring new insights in the process of soil adaptation. In the present paper focussing on soil, we review these extrinsic and intrinsic factors that drive environmental adaptation of L. monocytogenes.
Rational design of gene-based vaccines.
Barouch, Dan H
2006-01-01
Vaccine development has traditionally been an empirical discipline. Classical vaccine strategies include the development of attenuated organisms, whole killed organisms, and protein subunits, followed by empirical optimization and iterative improvements. While these strategies have been remarkably successful for a wide variety of viruses and bacteria, these approaches have proven more limited for pathogens that require cellular immune responses for their control. In this review, current strategies to develop and optimize gene-based vaccines are described, with an emphasis on novel approaches to improve plasmid DNA vaccines and recombinant adenovirus vector-based vaccines. Copyright 2006 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.
Deciphering the landscape of host barriers to Listeria monocytogenes infection.
Zhang, Ting; Abel, Sören; Abel Zur Wiesch, Pia; Sasabe, Jumpei; Davis, Brigid M; Higgins, Darren E; Waldor, Matthew K
2017-06-13
Listeria monocytogenes is a common food-borne pathogen that can disseminate from the intestine and infect multiple organs. Here, we used sequence tag-based analysis of microbial populations (STAMP) to investigate L monocytogenes population dynamics during infection. We created a genetically barcoded library of murinized L monocytogenes and then used deep sequencing to track the pathogen's dissemination routes and quantify its founding population ( N b ) sizes in different organs. We found that the pathogen disseminates from the gastrointestinal tract to distal sites through multiple independent routes and that N b sizes vary greatly among tissues, indicative of diverse host barriers to infection. Unexpectedly, comparative analyses of sequence tags revealed that fecally excreted organisms are largely derived from the very small number of L. monocytogenes cells that colonize the gallbladder. Immune depletion studies suggest that distinct innate immune cells restrict the pathogen's capacity to establish replicative niches in the spleen and liver. Finally, studies in germ-free mice suggest that the microbiota plays a critical role in the development of the splenic, but not the hepatic, barriers that prevent L. monocytogenes from seeding these organs. Collectively, these observations illustrate the potency of the STAMP approach to decipher the impact of host factors on population dynamics of pathogens during infection.
Cellular based cancer vaccines
DEFF Research Database (Denmark)
Hansen, M; Met, Ö; Svane, I M
2012-01-01
Cancer vaccines designed to re-calibrate the existing host-tumour interaction, tipping the balance from tumor acceptance towards tumor control holds huge potential to complement traditional cancer therapies. In general, limited success has been achieved with vaccines composed of tumor...... to transiently affect in vitro migration via autocrine receptor-mediated endocytosis of CCR7. In the current review, we discuss optimal design of DC maturation focused on pre-clinical as well as clinical results from standard and polarized dendritic cell based cancer vaccines....
Occurrence of Listeria monocytogenes in smoked fish in Sokoto ...
African Journals Online (AJOL)
STORAGESEVER
2008-09-03
Sep 3, 2008 ... monocytogenes and other Listeria species are common contaminant of smoked fish, and this may pose serious public health implications. Key words: Smoked fish, Listeria monocytogenes, contamination, public health. INTRODUCTION ... L. monocytogenes belong to the recently emerging psychrotrophic ...
Viral Vectors for Use in the Development of Biodefense Vaccines
2005-06-17
Shigella species Dengue Salmonella Filoviruses Listeria monocytogenes Ebola Campylobacter jejuni Marburg Yersinia entercolitica Viruses (Caliciviruses...Orthopoxvirus genus containing the monkey - J.S. Lee et al. / Advanced Drug Delivery Reviews 57 (2005) 1293–1314 1297 Approved for public release. Distribution...four monkeys vaccinated with V-LSGPC produced antibodies specific for LSV. After challenge, the four monkeys developed a febrile illness with low
Listeria monocytogenes infection in pregnancy and neonatal sepsis
Directory of Open Access Journals (Sweden)
Francesca Pascale
2008-06-01
Full Text Available Authors report a fatal neonatal sepsis caused by Listeria monocytogenes. While the diagnostic procedure aimed to identify the microrganism is described, it is emphasized the importance to recover Streptococcus agalactiae (GBS and L. monocytogenes by means of vaginal-rectal swab culture. The intrapartum screening for L. monocytogenes, by Polymerase Chain Reaction (PCR providing results in 75 minutes is also evaluated.
Listeria monocytogenes - Danger for health safety vegetable production.
Kljujev, Igor; Raicevic, Vera; Jovicic-Petrovic, Jelena; Vujovic, Bojana; Mirkovic, Milica; Rothballer, Michael
2018-04-22
The microbiologically contaminated vegetables represent a risk for consumers, especially vegetables without thermal processing. It is known that human pathogen bacteria, such as Listeria monocytogenes, could exist on fresh vegetables. The fresh vegetables could become Listeria-contaminated if they come in touch with contaminated soil, manure, irrigation water. The aim of this work was to investigate the presence of Listeria spp. and L. monocytogenes in different kind of vegetables grown in field and greenhouse condition as well as surface and endophytic colonization plant roots of different vegetables species by L. monocytogenes in laboratory conditions. The detection of Listeria spp. and L. monocytogenes in vegetable samples was done using ISO and PCR methods. The investigation of colonization vegetable roots and detection Listeria-cells inside plant root tissue was done using Fluorescence in situ hybridization (FISH) method in combination with confocal laser scanning microscopy (CLSM). The results showed that 25.58% vegetable samples were positive for Listeria spp. and only one sample (carrot) was positive for L. monocytogenes out of 43 samples in total collected from field and greenhouse. The strain L. monocytogenes EGD-E surface and endophytic colonized carrot root in highest degree while strain L. monocytogenes SV4B was the most represented at leafy vegetable plants, such at lettuce (1.68 × 10 6 cells/mm 3 absolutely dry root) and spinach (1.39 × 10 6 cells/mm 3 absolutely dry root) root surface. The cells of L. monocytogenes SV4B were visible as single cells in interior tissue of plant roots (celery and sweet corn roots) as well as in the interior of the plant root cell at sweet corn root. The cells of L. monocytogenes EGD-E bind to the surface of the plant root and they were less commonly found out on root hair. In the inner layers of the root, those bacterial cells were inhabited intercellular spaces mainly as single cells very close to the
Chen, Jianshun; Jiang, Lingli; Chen, Xueyan; Luo, Xiaokai; Chen, Yang; Yu, Ying; Tian, Guoming; Liu, Dongyou; Fang, Weihuan
2009-03-01
The genus Listeria consists of six closely related species and forms three phylogenetic groups: L. monocytogenes- L. innocua, L. ivanovii-L. seeligeri-L. welshimeri, and L. grayi. In this report, we attempted to examine the evolutionary relationship in the L. monocytogenes-L. innocua group by probing the nucleotide sequences of 23S rRNA and 16S rRNA, and the gene clusters lmo0029-lmo0042, ascBdapE, rplS-infC, and prs-ldh in L. monocytogenes serovars 1/2a, 4a, and 4b, and L. innocua. Additionally, we assessed the status of L. monocytogenes-specific inlA and inlB genes and 10 L. innocua-specific genes in these species/serovars, together with phenotypic characterization by using in vivo and in vitro procedures. The results indicate that L. monocytogenes serovar 4a strains are genetically similar to L. innocua in the lmo0035-lmo0042, ascB-dapE, and rplS-infC regions and also possess L. innocua-specific genes lin0372 and lin1073. Furthermore, both L. monocytogenes serovar 4a and L. innocua exhibit impaired intercellular spread ability and negligible pathogenicity in mouse model. On the other hand, despite resembling L. monocytogenes serovars 1/2a and 4b in having a nearly identical virulence gene cluster, and inlA and inlB genes, these serovar 4a strains differ from serovars 1/2a and 4b by harboring notably altered actA and plcB genes, displaying strong phospholipase activity and subdued in vivo and in vitro virulence. Thus, by possessing many genes common to L. monocytogenes serovars 1/2a and 4b, and sharing many similar gene deletions with L. innocua, L. monocytogenes serovar 4a represents a possible evolutionary intermediate between L. monocytogenes serovars 1/2a and 4b and L. innocua.
Directory of Open Access Journals (Sweden)
Samantha Sayers
2012-01-01
Full Text Available Vaccine adjuvants are compounds that enhance host immune responses to co-administered antigens in vaccines. Vaxjo is a web-based central database and analysis system that curates, stores, and analyzes vaccine adjuvants and their usages in vaccine development. Basic information of a vaccine adjuvant stored in Vaxjo includes adjuvant name, components, structure, appearance, storage, preparation, function, safety, and vaccines that use this adjuvant. Reliable references are curated and cited. Bioinformatics scripts are developed and used to link vaccine adjuvants to different adjuvanted vaccines stored in the general VIOLIN vaccine database. Presently, 103 vaccine adjuvants have been curated in Vaxjo. Among these adjuvants, 98 have been used in 384 vaccines stored in VIOLIN against over 81 pathogens, cancers, or allergies. All these vaccine adjuvants are categorized and analyzed based on adjuvant types, pathogens used, and vaccine types. As a use case study of vaccine adjuvants in infectious disease vaccines, the adjuvants used in Brucella vaccines are specifically analyzed. A user-friendly web query and visualization interface is developed for interactive vaccine adjuvant search. To support data exchange, the information of vaccine adjuvants is stored in the Vaccine Ontology (VO in the Web Ontology Language (OWL format.
Sayers, Samantha; Ulysse, Guerlain; Xiang, Zuoshuang; He, Yongqun
2012-01-01
Vaccine adjuvants are compounds that enhance host immune responses to co-administered antigens in vaccines. Vaxjo is a web-based central database and analysis system that curates, stores, and analyzes vaccine adjuvants and their usages in vaccine development. Basic information of a vaccine adjuvant stored in Vaxjo includes adjuvant name, components, structure, appearance, storage, preparation, function, safety, and vaccines that use this adjuvant. Reliable references are curated and cited. Bioinformatics scripts are developed and used to link vaccine adjuvants to different adjuvanted vaccines stored in the general VIOLIN vaccine database. Presently, 103 vaccine adjuvants have been curated in Vaxjo. Among these adjuvants, 98 have been used in 384 vaccines stored in VIOLIN against over 81 pathogens, cancers, or allergies. All these vaccine adjuvants are categorized and analyzed based on adjuvant types, pathogens used, and vaccine types. As a use case study of vaccine adjuvants in infectious disease vaccines, the adjuvants used in Brucella vaccines are specifically analyzed. A user-friendly web query and visualization interface is developed for interactive vaccine adjuvant search. To support data exchange, the information of vaccine adjuvants is stored in the Vaccine Ontology (VO) in the Web Ontology Language (OWL) format.
Biofilm Formation of Listeria monocytogenes on Various Surfaces
Directory of Open Access Journals (Sweden)
M Mahdavi
2007-10-01
Full Text Available Introduction & Objective: Listeria monocytogenes is considered as a ubiquitous foodborne pathogen which can lead to serious infections, especially in newborns, elderly, pregnant, and immunocompromised people. The organism has been isolated from many foods and may cause meningitis, septicemia and abortion in pregnant women. Also L. monocytogenes forms biofilms on many food contact surface materials and medical devices. Development of biofilms on many surfaces is a potential source of contamination of foods that may lead to spoilage or transmission of foodborne pathogens. Materials & Methods: Biofilm formation of L. monocytogenes (RITCC 1293 serotype 4a was investigated. Hydrophobicity of L. monocytogenes was measured by MATH method. Then biofilm formation of the organism was assessed at 2, 4, 8, 16 and 20 hours on stainless steel (type 304 no 2B, polyethylene and glass by drop plate method. Results: Results indicated that L. monocytogenes with 85% of hydrophobicity formed biofilm on each of three surfaces. Biofilm formation on stainless steel surfaces was significantly more than other surfaces (p<0.05. Conclusion: The ability of biofilm formation of L. monocytogenes on medical devices and food containers is very important as far as hygiene and disease outbreaks are concerned.
Development of a novel oral vaccine against Mycobacterium avium paratuberculosis and Johne disease
Johnston, C; Coffey, A; Sleator, RD
2010-01-01
Mycobacterium avium subsp. paratuberculosis (MAP) is the etiological agent of Johne disease, a granulomatous enteritis of cattle and other domesticated and wild ruminant species. Johne disease is prevalent worldwide and has a significant impact on the global agricultural economy. Current vaccines against Johne are insufficient in stemming its spread, and associated side-effects prevent their widespread use in control programs. Effective and safe vaccine strategies are needed. The main purpose of this paper is to propose and evaluate the development of a novel oral subunit-vaccine using a patho-biotechnological approach. This novel strategy, which harnesses patho-genetic elements from the intracellular pathogen Listeria monocytogenes, may provide a realistic route towards developing an effective next generation subunit vaccine against Johne disease and paratuberculosis. PMID:21326921
78 FR 27939 - Draft Interagency Risk Assessment-Listeria monocytogenes
2013-05-13
... Listeria (L.) monocytogenes contamination of certain ready-to-eat (RTE) foods, for example cheese, deli... Scott, V.N., Survey of Listeria monocytogenes in ready-to-eat foods. Journal of Food Protection, 2003... monocytogenes in ready-to-eat processed meat and poultry collected in four FoodNet states in International...
Presence of Listeria monocytogenes in Mediterranean-Style Dry Fermented Sausages
Directory of Open Access Journals (Sweden)
Domenico Meloni
2015-03-01
Full Text Available The morphological, physiological and epidemiological features of L. monocytogenes, together with the severity of human listeriosis infections, make L. monocytogenes of particular concern for manufacturers of cold-stored “ready to eat” (RTE foods. L. monocytogenes has been isolated from a wide variety of RTE foods and is responsible for several outbreaks associated with the consumption of RTE meat, poultry, dairy, fish and vegetable products. Although L. monocytogenes is among the most frequently-detected pathogens in dry fermented sausages, these products could be included in the category of RTE products in which the growth of L. monocytogenes is not favored and have rarely been implicated in listeriosis outbreaks. However, L. monocytogenes is highly difficult to control in fermented sausage processing environments due to its high tolerance to low pH and high salt concentration. In many Mediterranean-style dry fermented sausages, an empirical application of the hurdle technology often occurs and the frequent detection of L. monocytogenes in these products at the end of ripening highlights the need for food business operators to properly apply hurdle technology and to control the contamination routes of L. monocytogenes in the processing plants. In the following, through an up-to-date review of (personal and un- published data, the main aspects of the presence of L. monocytogenes in Mediterranean-style dry fermented sausages will be discussed.
Presence of Listeria monocytogenes in Mediterranean-Style Dry Fermented Sausages.
Meloni, Domenico
2015-03-12
The morphological, physiological and epidemiological features of L. monocytogenes , together with the severity of human listeriosis infections, make L. monocytogenes of particular concern for manufacturers of cold-stored "ready to eat" (RTE) foods. L. monocytogenes has been isolated from a wide variety of RTE foods and is responsible for several outbreaks associated with the consumption of RTE meat, poultry, dairy, fish and vegetable products. Although L. monocytogenes is among the most frequently-detected pathogens in dry fermented sausages, these products could be included in the category of RTE products in which the growth of L. monocytogenes is not favored and have rarely been implicated in listeriosis outbreaks. However, L. monocytogenes is highly difficult to control in fermented sausage processing environments due to its high tolerance to low pH and high salt concentration. In many Mediterranean-style dry fermented sausages, an empirical application of the hurdle technology often occurs and the frequent detection of L. monocytogenes in these products at the end of ripening highlights the need for food business operators to properly apply hurdle technology and to control the contamination routes of L. monocytogenes in the processing plants. In the following, through an up-to-date review of (personal and un-) published data, the main aspects of the presence of L. monocytogenes in Mediterranean-style dry fermented sausages will be discussed.
Directory of Open Access Journals (Sweden)
Jin-Qiang Chen
2017-09-01
Full Text Available Listeria monocytogenes, one of the most important foodborne pathogens, can cause listeriosis, a lethal disease for humans. L. ivanovii, which is closely related to L. monocytogenes, is also widely distributed in nature and infects mainly warm-blooded ruminants, causing economic loss. Thus, there are high priority needs for methodologies for rapid, specific, cost-effective and accurate detection, characterization and subtyping of L. monocytogenes and L. ivanovii in foods and environmental sources. In this review, we (A described L. monocytogenes and L. ivanovii, world-wide incidence of listeriosis, and prevalence of various L. monocytogenes strains in food and environmental sources; (B comprehensively reviewed different types of traditional and newly developed methodologies, including culture-based, antigen/antibody-based, LOOP-mediated isothermal amplification, matrix-assisted laser desorption ionization-time of flight-mass spectrometry, DNA microarray, and genomic sequencing for detection and characterization of L. monocytogenes in foods and environmental sources; (C comprehensively summarized different subtyping methodologies, including pulsed-field gel electrophoresis, multi-locus sequence typing, ribotyping, and phage-typing, and whole genomic sequencing etc. for subtyping of L. monocytogenes strains from food and environmental sources; and (D described the applications of these methodologies in detection and subtyping of L. monocytogenes in foods and food processing facilities.
Prevalence and growth of Listeria monocytogenes in naturally contaminated seafood
DEFF Research Database (Denmark)
Jørgensen, Lasse Vigel; Huss, Hans Henrik
1998-01-01
Listeria monocytogenes contamination of seafood varies with product category. The highest prevalence was found in cold- smoked fish (34-60%), while the lowest was found in heat- treated and cured seafood (4-12%). The prevalence of L. monocytogenes differed greatly in cold-smoked salmon between...... production sites, ranging from monocytogenes. The organism showed moderate growth...... in naturally contaminated cold-smoked, and 'gravad', fish while the growth appeared faster in hot smoked fish. Thus L. monocytogenes is not under control in these products. Finally, the prevalence and growth of L. monocytogenes in naturally contaminated cold-smoked salmon are discussed in relation...
Listeria monocytogenes endophthalmitis following keratoconjunctivitis
Directory of Open Access Journals (Sweden)
Shoughy SS
2014-01-01
Full Text Available Samir S Shoughy,1 Khalid F Tabbara1–31The Eye Center and The Eye Foundation for Research in Ophthalmology, Riyadh, Saudi Arabia; 2Department of Ophthalmology, College of Medicine, King Saud University, Riyadh, Saudi Arabia; 3The Wilmer Ophthalmological Institute of The Johns Hopkins University School of Medicine, Baltimore, MD, USAAbstract: Endophthalmitis due to endogenous or exogenous bacteria is a rare infection of the eye. We report a case of endophthalmitis following Listeria monocytogenes keratoconjunctivitis in a 27-year-old healthy white male presenting with hand motion visual acuity, right eye mucopurulent conjunctivitis, elevated intraocular pressure, and pigmented hypopyon 6 months post-keratectomy. The conjunctivitis was unresponsive to a 5-day course of topical tobramycin eye drops, and the patient developed keratitis with pain that progressed to endophthalmitis after 21 days. Diagnostic B-scan revealed vitreous exudates. Intraocular fluid specimen showed Gram-positive organisms and the aqueous culture grew penicillin-/aminoglycoside-sensitive L. monocytogenes. The patient was given intravitreal and systemic vancomycin and ceftazidime. The eye was unresponsive to intravenous penicillin and gentamicin; the anterior chamber progressively flattened and developed phthisis bulbi. L. monocytogenes keratoconjunctivitis may lead to bacterial endophthalmitis. Prompt culture and early antibiotic therapy are recommended.Keywords: conjunctivitis, L. monocytogenes, endophthalmitis
Surenaud, Mathieu; Lacabaratz, Christine; Zurawski, Gérard; Lévy, Yves; Lelièvre, Jean-Daniel
2017-10-01
Development of a safe, effective and globally affordable Human Immunodeficiency Virus strain 1 (HIV-1) vaccine offers the best hope for future control of the HIV-1 pandemic. However, with the exception of the recent RV144 trial, which elicited a modest level of protection against infection, no vaccine candidate has shown efficacy in preventing HIV-1 infection or in controlling virus replication in humans. There is also a great need for a successful immunotherapeutic vaccine since combination antiretroviral therapy (cART) does not eliminate the reservoir of HIV-infected cells. But to date, no vaccine candidate has proven to significantly alter the natural history of an individual with HIV-1 infection. Areas covered: For over 25 years, the ANRS (France Recherche Nord&Sud Sida-HIV hépatites) has been committed to an original program combining basic science and clinical research developing an epitope-based vaccine strategy to induce a multiepitopic cellular response against HIV-1. This review describes the evolution of concepts, based on strategies using HIV-1 lipopeptides towards the use of dendritic cell (DC) manipulation. Expert commentary: Understanding the crucial role of DCs in immune responses allowed moving from the non-specific administration of HIV-1 sequences with lipopeptides to DC-based vaccines. These DC-targeting strategies should improve HIV-1 vaccine efficacy.
Juck, Gregory; Gonzalez, Verapaz; Allen, Ann-Christine Olsson; Sutzko, Meredith; Seward, Kody; Muldoon, Mark T
2018-04-27
The Romer Labs RapidChek ® Listeria monocytogenes test system (Performance Tested Method ℠ 011805) was validated against the U.S. Department of Agriculture-Food Safety and Inspection Service Microbiology Laboratory Guidebook (USDA-FSIS/MLG), U.S. Food and Drug Association Bacteriological Analytical Manual (FDA/BAM), and AOAC Official Methods of Analysis ℠ (AOAC/OMA) cultural reference methods for the detection of L. monocytogenes on selected foods including hot dogs, frozen cooked breaded chicken, frozen cooked shrimp, cured ham, and ice cream, and environmental surfaces including stainless steel and plastic in an unpaired study design. The RapidChek method uses a proprietary enrichment media system, a 44-48 h enrichment at 30 ± 1°C, and detects L. monocytogenes on an immunochromatographic lateral flow device within 10 min. Different L. monocytogenes strains were used to spike each of the matrixes. Samples were confirmed based on the reference method confirmations and an alternate confirmation method. A total of 140 low-level spiked samples were tested by the RapidChek method after enrichment for 44-48 h in parallel with the cultural reference method. There were 88 RapidChek presumptive positives. One of the presumptive positives was not confirmed culturally. Additionally, one of the culturally confirmed samples did not exhibit a presumptive positive. No difference between the alternate confirmation method and reference confirmation method was observed. The respective cultural reference methods (USDA-FSIS/MLG, FDA/BAM, and AOAC/OMA) produced a total of 63 confirmed positive results. Nonspiked samples from all foods were reported as negative for L. monocytogenes by all methods. Probability of detection analysis demonstrated no significant differences in the number of positive samples detected by the RapidChek method and the respective cultural reference method.
2011-01-01
Background Vaccine literature indexing is poorly performed in PubMed due to limited hierarchy of Medical Subject Headings (MeSH) annotation in the vaccine field. Vaccine Ontology (VO) is a community-based biomedical ontology that represents various vaccines and their relations. SciMiner is an in-house literature mining system that supports literature indexing and gene name tagging. We hypothesize that application of VO in SciMiner will aid vaccine literature indexing and mining of vaccine-gene interaction networks. As a test case, we have examined vaccines for Brucella, the causative agent of brucellosis in humans and animals. Results The VO-based SciMiner (VO-SciMiner) was developed to incorporate a total of 67 Brucella vaccine terms. A set of rules for term expansion of VO terms were learned from training data, consisting of 90 biomedical articles related to Brucella vaccine terms. VO-SciMiner demonstrated high recall (91%) and precision (99%) from testing a separate set of 100 manually selected biomedical articles. VO-SciMiner indexing exhibited superior performance in retrieving Brucella vaccine-related papers over that obtained with MeSH-based PubMed literature search. For example, a VO-SciMiner search of "live attenuated Brucella vaccine" returned 922 hits as of April 20, 2011, while a PubMed search of the same query resulted in only 74 hits. Using the abstracts of 14,947 Brucella-related papers, VO-SciMiner identified 140 Brucella genes associated with Brucella vaccines. These genes included known protective antigens, virulence factors, and genes closely related to Brucella vaccines. These VO-interacting Brucella genes were significantly over-represented in biological functional categories, including metabolite transport and metabolism, replication and repair, cell wall biogenesis, intracellular trafficking and secretion, posttranslational modification, and chaperones. Furthermore, a comprehensive interaction network of Brucella vaccines and genes were
A novel Listeria monocytogenes-based DNA delivery system for cancer gene therapy.
LENUS (Irish Health Repository)
van Pijkeren, Jan Peter
2012-01-31
Bacteria-mediated transfer of plasmid DNA to mammalian cells (bactofection) has been shown to have significant potential as an approach to express heterologous proteins in various cell types. This is achieved through entry of the entire bacterium into cells, followed by release of plasmid DNA. In a murine model, we show that Listeria monocytogenes can invade and spread in tumors, and establish the use of Listeria to deliver genes to tumors in vivo. A novel approach to vector lysis and release of plasmid DNA through antibiotic administration was developed. Ampicillin administration facilitated both plasmid transfer and safety control of vector. To further improve on the gene delivery system, we selected a Listeria monocytogenes derivative that is more sensitive to ampicillin, and less pathogenic than the wild-type strain. Incorporation of a eukaryotic-transcribed lysin cassette in the plasmid further increased bacterial lysis. Successful gene delivery of firefly luciferase to growing tumors in murine models and to patient breast tumor samples ex vivo was achieved. The model described encompasses a three-phase treatment regimen, involving (1) intratumoral administration of vector followed by a period of vector spread, (2) systemic ampicillin administration to induce vector lysis and plasmid transfer, and (3) systemic administration of combined moxifloxacin and ampicillin to eliminate systemic vector. For the first time, our results reveal the potential of Listeria monocytogenes for in vivo gene delivery.
Uyttendaele, M; Busschaert, P; Valero, A; Geeraerd, A H; Vermeulen, A; Jacxsens, L; Goh, K K; De Loy, A; Van Impe, J F; Devlieghere, F
2009-07-31
Processed ready-to-eat (RTE) foods with a prolonged shelf-life under refrigeration are at risk products for listeriosis. This manuscript provides an overview of prevalence data (n=1974) and challenge tests (n=299) related to Listeria monocytogenes for three categories of RTE food i) mayonnaise-based deli-salads (1187 presence/absence tests and 182 challenge tests), ii) cooked meat products (639 presence/absence tests and 92 challenge tests), and iii) smoked fish (90 presence/absence tests and 25 challenge tests), based on data records obtained from various food business operators in Belgium in the frame of the validation and verification of their HACCP plans over the period 2005-2007. Overall, the prevalence of L. monocytogenes in these RTE foods in the present study was lower compared to former studies in Belgium. For mayonnaise-based deli-salads, in 80 out of 1187 samples (6.7%) the pathogen was detected in 25 g. L. monocytogenes positive samples were often associated with smoked fish deli-salads. Cooked meat products showed a 1.1% (n=639) prevalence of the pathogen. For both food categories, numbers per gram never exceeded 100 CFU. L. monocytogenes was detected in 27.8% (25/90) smoked fish samples, while 4/25 positive samples failed to comply to the 100 CFU/g limit set out in EU Regulation 2073/2005. Challenge testing showed growth potential in 18/182 (9.9%) deli-salads and 61/92 (66%) cooked meat products. Nevertheless, both for deli-salads and cooked meat products, appropriate product formulation and storage conditions based upon hurdle technology could guarantee no growth of L. monocytogenes throughout the shelf-life as specified by the food business operator. Challenge testing of smoked fish showed growth of L. monocytogenes in 12/25 samples stored for 3-4 weeks at 4 degrees C. Of 45 (non-inoculated) smoked fish samples (13 of which were initially positive in 25 g) which were subjected to shelf-life testing, numbers exceeded 100 CFU/g in only one sample
Directory of Open Access Journals (Sweden)
Paul Priyesh Vijayakumar
2017-03-01
Full Text Available Bacteriocin-producing (Bac+ lactic acid bacteria (LAB comprising selected strains of Lactobacillus curvatus, Lactococcus lactis, Pediococcus acidilactici, and Enterococcus faecium and thailandicus were examined for inhibition of Listeria monocytogenes during hotdog challenge studies. The Bac+ strains, or their cell-free supernatants (CFS, were grouped according to mode-of-action (MOA as determined from prior studies. Making a mixture of as many MOAs as possible is a practical way to obtain a potent natural antimicrobial mixture to address L. monocytogenes contamination of RTE meat products (i.e., hotdogs. The heat resistance of the bacteriocins allowed the use of pasteurization to eliminate residual producer cells for use as post-process surface application or their inclusion into hotdog meat emulsion during cooking. The use of Bac+ LAB comprising 3× MOAs directly as co-inoculants on hotdogs was not effective at inhibiting L. monocytogenes. However, the use of multiple MOA Bac+ CFS mixtures in a variety of trials demonstrated the effectiveness of this approach by showing a >2-log decrease of L. monocytogenes in treatment samples and 6–7 log difference vs. controls. These data suggest that surface application of multiple mode-of-action bacteriocin mixtures can provide for an Alternative 2, and possibly Alternative 1, process category as specified by USDA-FSIS for control of L. monocytogenes on RTE meat products.
Schrama, D; Helliwell, N; Neto, L; Faleiro, M L
2013-06-01
The aim of this study was to evaluate the effect of the acid and salt adaptation in a cheese-based medium on the virulence potential of Listeria monocytogenes strains isolated from cheese and dairy processing environment using the Galleria mellonella model. Four L. monocytogenes strains were exposed to a cheese-based medium in conditions of induction of an acid tolerance response and osmotolerance response (pH 5·5 and 3·5% w/v NaCl) and injected in G. mellonella insects. The survival of insects and the L. monocytogenes growth kinetics in insects were evaluated. The gene expression of hly, actA and inlA genes was determined by real-time PCR. The adapted cells of two dairy strains showed reduced insect mortality (P 0·05) was found between adapted and nonadapted cells. The gene expression results evidenced an overexpression of virulence genes in cheese-based medium, but not in simulated insect-induced conditions. Our results suggest that adaptation to low pH and salt in a cheese-based medium can affect the virulence of L. monocytogenes, but this effect is strain dependent. In this study, the impact of adaptation to low pH and salt in a cheese-based medium on L. monocytogenes virulence was tested using the Wax Moth G. mellonella model. This model allowed the differentiation of the virulence potential between the L. monocytogenes strains. The effect of adaptation on virulence is strain dependent. The G. mellonella model revealed to be a prompt method to test food-related factors on L. monocytogenes virulence. © 2013 The Society for Applied Microbiology.
The European Regulatory Environment of RNA-Based Vaccines.
Hinz, Thomas; Kallen, Kajo; Britten, Cedrik M; Flamion, Bruno; Granzer, Ulrich; Hoos, Axel; Huber, Christoph; Khleif, Samir; Kreiter, Sebastian; Rammensee, Hans-Georg; Sahin, Ugur; Singh-Jasuja, Harpreet; Türeci, Özlem; Kalinke, Ulrich
2017-01-01
A variety of different mRNA-based drugs are currently in development. This became possible, since major breakthroughs in RNA research during the last decades allowed impressive improvements of translation, stability and delivery of mRNA. This article focuses on antigen-encoding RNA-based vaccines that are either directed against tumors or pathogens. mRNA-encoded vaccines are developed both for preventive or therapeutic purposes. Most mRNA-based vaccines are directly administered to patients. Alternatively, primary autologous cells from cancer patients are modified ex vivo by the use of mRNA and then are adoptively transferred to patients. In the EU no regulatory guidelines presently exist that specifically address mRNA-based vaccines. The existing regulatory framework, however, clearly defines that mRNA-based vaccines in most cases have to be centrally approved. Interestingly, depending on whether RNA-based vaccines are directed against tumors or infectious disease, they are formally considered gene therapy products or not, respectively. Besides an overview on the current clinical use of mRNA vaccines in various therapeutic areas a detailed discussion of the current regulatory situation is provided and regulatory perspectives are discussed.
DEFF Research Database (Denmark)
Vogel, Birte Fonnesbech; Huss, Hans Henrik; Ojeniyi, B.
2001-01-01
and environment could not be excluded. Contamination of the product occurred in specific areas (the brining and slicing areas). In plant I, the same RAPD type (RAPD type 12) was found over a 4-year period, indicating that an established in-house flora persisted and was not eliminated by routine hygienic......, monocytogenes). A total of 429 strains of L. monocytogenes were subsequently compared by random amplified polymorphic DNA (RAPD) profiling, and 55 different RAPD types were found. The RAPD types detected on the products were identical to types found on the processing equipment and in the processing environment...... procedures. In plant II, where the prevalence of L, monocytogenes was much tower, no RAPD type persisted over long periods of time, and several different L, monocytogenes RAPD types were isolated. This indicates that persistent strains may be avoided by rigorous cleaning and sanitation; however, due...
Directory of Open Access Journals (Sweden)
Michela Ibba
2013-09-01
Full Text Available Listeria monocytogenes harbouring niches established in the processing plant support post-process contamination of dairy products made from pasteurised or thermised milk. The present study investigated L. monocytogenes environmental contamination in two sheep’s milk cheese-making plants. Persistence of contamination in the area at higher risk was also investigated. During a one-year survey 7 samplings were carried out in each dairy plant, along the production lines of Pecorino Romano and ricotta salata cheese. A total of 613 environmental samples collected from food contact and non-food contact surfaces were analysed according to ISO 11290-1:2005 standard method. Identification of the isolated strains was carried out by polymerase chain reaction. L. monocytogenes prevalence was 23.2% in dairy A and 13.1% in dairy B, respectively. The higher prevalence rate was found in the following areas: salting, products washing, packaging, ricotta salata storage and Pecorino Romano ripening rooms. L. monocytogenes was never found in the cheese-making area. The probability of observing samples positive for the presence of L. monocytogenes was asso- ciated with dairy plant, sampling area and the period of cheese-making (P<0.001. The greater persistence of contamination over time was observed in the washing, salting, and Pecorino Romano ripening areas. The control of persistent environmental contamination relies on the identification of L. monocytogenes niches within the processing environment and the prevention of harborage sites formation. The importance of strict cleaning and sanitising procedure in controlling L. monocytogenes environmental contamination is confirmed by the lower level of contamination observed after these procedures were correctly implemented.
Chikungunya Virus Vaccines: Viral Vector-Based Approaches.
Ramsauer, Katrin; Tangy, Frédéric
2016-12-15
In 2013, a major chikungunya virus (CHIKV) epidemic reached the Americas. In the past 2 years, >1.7 million people have been infected. In light of the current epidemic, with millions of people in North and South America at risk, efforts to rapidly develop effective vaccines have increased. Here, we focus on CHIKV vaccines that use viral-vector technologies. This group of vaccine candidates shares an ability to potently induce humoral and cellular immune responses by use of highly attenuated and safe vaccine backbones. So far, well-described vectors such as modified vaccinia virus Ankara, complex adenovirus, vesicular stomatitis virus, alphavirus-based chimeras, and measles vaccine Schwarz strain (MV/Schw) have been described as potential vaccines. We summarize here the recent data on these experimental vaccines, with a focus on the preclinical and clinical activities on the MV/Schw-based candidate, which is the first CHIKV-vectored vaccine that has completed a clinical trial. © The Author 2016. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail journals.permissions@oup.com.
Evaluation of a monoclonal antibody able to detect live Listeria monocytogenes and Listeria innocua
DEFF Research Database (Denmark)
Sølve, Marianne; Boel, Jeppe; Nørrung, Birgit
2000-01-01
A monoclonal Listeria antibody, designated B4, was evaluated. The ability of the antibody to bind to viable bacteria belonging to Listeria spp, compared to bacteria of the same species killed by beat treatment, acid or base treatment, sanitizers, and irradiation was examined. The antibody was found...... to react with viable L. monocytogenes and L. innocua, but not with heat-killed (72 degrees C, 5 min) strains of these organisms. When L. monocytogenes and L. innocua were killed by methods other than heat treatment, it was ambiguous whether the antibody detected the organism or not. It was concluded...... that the B4 antibody has potential to be used in an immune capture step to capture live L, monocytogenes and L. innocua from foods prior to identification of L. monocytogenes by polymerase chain reaction (PCR)....
Listeria monocytogenes endophthalmitis following keratoconjunctivitis.
Shoughy, Samir S; Tabbara, Khalid F
2014-01-01
Endophthalmitis due to endogenous or exogenous bacteria is a rare infection of the eye. We report a case of endophthalmitis following Listeria monocytogenes keratoconjunctivitis in a 27-year-old healthy white male presenting with hand motion visual acuity, right eye mucopurulent conjunctivitis, elevated intraocular pressure, and pigmented hypopyon 6 months post-keratectomy. The conjunctivitis was unresponsive to a 5-day course of topical tobramycin eye drops, and the patient developed keratitis with pain that progressed to endophthalmitis after 21 days. Diagnostic B-scan revealed vitreous exudates. Intraocular fluid specimen showed Gram-positive organisms and the aqueous culture grew penicillin-/aminoglycoside-sensitive L. monocytogenes. The patient was given intravitreal and systemic vancomycin and ceftazidime. The eye was unresponsive to intravenous penicillin and gentamicin; the anterior chamber progressively flattened and developed phthisis bulbi. L. monocytogenes keratoconjunctivitis may lead to bacterial endophthalmitis. Prompt culture and early antibiotic therapy are recommended.
Biofilm formation by Listeria monocytogenes on stainless steel surface and biotransfer potential
Directory of Open Access Journals (Sweden)
Maíra Maciel Mattos de Oliveira
2010-03-01
Full Text Available An experimental model was proposed to study biofilm formation by Listeria monocytogenes ATCC 19117 on AISI 304 (#4 stainless steel surface and biotransfer potential during this process. In this model, biofilm formation was conducted on the surface of stainless steel coupons, set on a stainless steel base with 4 divisions, each one supporting 21 coupons. Trypic Soy Broth was used as bacterial growth substrate, with incubation at 37 ºC and stirring of 50 rpm. The number of adhered cells was determined after 3, 48, 96, 144, 192 and 240 hours of biofilm formation and biotransfer potential from 96 hours. Stainless steel coupons were submitted to Scanning Electron Microscopy (SEM after 3, 144 and 240 hours. Based on the number of adhered cells and SEM, it was observed that L. monocytogenes adhered rapidly to the stainless steel surface, with mature biofilm being formed after 240 hours. The biotransfer potential of bacterium to substrate occurred at all the stages analyzed. The rapid capacity of adhesion to surface, combined with biotransfer potential throughout the biofilm formation stages, make L. monocytogenes a potential risk to the food industry. Both the experimental model developed and the methodology used were efficient in the study of biofilm formation by L. monocytogenes on stainless steel surface and biotransfer potential.
Biofilm formation by Listeria monocytogenes on stainless steel surface and biotransfer potential.
de Oliveira, Maíra Maciel Mattos; Brugnera, Danilo Florisvaldo; Alves, Eduardo; Piccoli, Roberta Hilsdorf
2010-01-01
An experimental model was proposed to study biofilm formation by Listeria monocytogenes ATCC 19117 on AISI 304 (#4) stainless steel surface and biotransfer potential during this process. In this model, biofilm formation was conducted on the surface of stainless steel coupons, set on a stainless steel base with 4 divisions, each one supporting 21 coupons. Trypic Soy Broth was used as bacterial growth substrate, with incubation at 37 °C and stirring of 50 rpm. The number of adhered cells was determined after 3, 48, 96, 144, 192 and 240 hours of biofilm formation and biotransfer potential from 96 hours. Stainless steel coupons were submitted to Scanning Electron Microscopy (SEM) after 3, 144 and 240 hours. Based on the number of adhered cells and SEM, it was observed that L. monocytogenes adhered rapidly to the stainless steel surface, with mature biofilm being formed after 240 hours. The biotransfer potential of bacterium to substrate occurred at all the stages analyzed. The rapid capacity of adhesion to surface, combined with biotransfer potential throughout the biofilm formation stages, make L. monocytogenes a potential risk to the food industry. Both the experimental model developed and the methodology used were efficient in the study of biofilm formation by L. monocytogenes on stainless steel surface and biotransfer potential.
An insight into the isolation, enumeration and molecular detection of Listeria monocytogenes in food
Directory of Open Access Journals (Sweden)
Jodi Woan-Fei Law
2015-11-01
Full Text Available Listeria monocytogenes, a foodborne pathogen that can cause listeriosis through the consumption of food contaminated with this pathogen. The ability of L. monocytogenes to survive in extreme conditions and cause food contaminations have become a major concern. Hence, routine microbiological food testing is necessary to prevent food contamination and outbreaks of foodborne illness. This review provides insight into the methods for cultural detection, enumeration and molecular identification of L. monocytogenes in various food samples. There are a number of enrichment and plating media that can be used for the isolation of L. monocytogenes from food samples. Enrichment media such as buffered Listeria Enrichment Broth (BLEB, Fraser broth and University of Vermont Medium (UVM Listeria enrichment broth are recommended by regulatory agencies such as FDA-BAM, USDA-FSIS and ISO. Many plating media are available for the isolation of L. monocytogenes, for instance, PALCAM, Oxford and other chromogenic media. Besides, reference methods like FDA-BAM, ISO 11290 method and USDA-FSIS method are usually applied for the cultural detection or enumeration of L. monocytogenes. MPN technique is applied for the enumeration of L. monocytogenes in the case of low level contamination. Molecular methods including polymerase chain reaction (PCR, multiplex polymerase chain reaction (mPCR, real-time/quantitative polymerase chain reaction (qPCR, nucleic acid sequence-based amplification (NASBA, loop-mediated isothermal amplification (LAMP, DNA microarray and Next Generation Sequencing (NGS technology for the detection and identification of L. monocytogenes are discussed in this review. Overall, molecular methods are rapid, sensitive, specific, time- and labour-saving. In future, there are chances for the development of new techniques for the detection and identification of foodborne with improved features.
Listeria monocytogenes Monographic Study
Directory of Open Access Journals (Sweden)
Emil Tirziu
2010-05-01
Full Text Available Listeria monocytogenes is a ubiquitous bacteria with a remarkable resistance in discordant condition which produce listeriosis, an infectious disease that affects multiple domestic and wild animals’ species, but also humans. Receptive to listeriosis are the majority of domestic or wild mammals and birds, in the last years being registered an increase of receptivity in humans. The concept of listeriosis in human pathology, a disease caused by eating or drinking contaminated food and water, appeared for the first time in 1981, during an outbreak in Canada with seven cases in adults and 34 cases of maternalfetal listeriosis. The alimentary origin of human listeriosis can be easily explained if considered some general characteristics of the bacteria. Thus, resistance in various conditions, especially at lower temperatures, justifies its dissemination and food contamination, particularly when is conserved by refrigeration. Also, L. monocytogenes has a significant presence in alimentary products. Some studies showed that 4% of the milk products, 29% of the meat products, 5% of the vegetable products and 26% of the products obtained from fishes and shell fishes are positive for L. monocytogenes, which allows us to say that battle against these bacteria is a war against microbial contamination.
Meloni, Domenico; Piras, Francesca; Mureddu, Anna; Fois, Federica; Consolati, Simonetta Gianna; Lamon, Sonia; Mazzette, Rina
2013-11-01
In a 3-year study (2008 to 2011) to estimate the prevalence and the contamination sources of Listeria monocytogenes in pork meat in Sardinia, Italy, 211 samples were collected from five Sardinian swine slaughterhouses: 171 samples from slaughtered pigs and 40 from the slaughterhouse environment. Fifty L. monocytogenes isolates were characterized by PCR-based serotyping, presence of virulence-associated genes, and pulsed-field gel electrophoresis restriction analysis. The overall prevalence of L. monocytogenes was 33% in swine carcasses, 7% in cecal material, 23% on meat contact surfaces, and 25% on noncontact surfaces. Only two serotypes were detected: 1/2c (78%) and 1/2a (22%). In all, based on the presence of virulence-associated genes, eight pathogenic profiles were detected. Only 42% of all isolates carried the full complement of virulence-associated genes and were allotted to profile 1. Six pulsed-field gel electrophoresis profiles persisted in the slaughterhouses; restriction profiles appeared to be specific to each plant.
Novel Cadmium Resistance Determinant in Listeria monocytogenes.
Parsons, Cameron; Lee, Sangmi; Jayeola, Victor; Kathariou, Sophia
2017-03-01
Listeria monocytogenes is a foodborne pathogen that can cause severe disease (listeriosis) in susceptible individuals. It is ubiquitous in the environment and often exhibits resistance to heavy metals. One of the determinants that enables Listeria to tolerate exposure to cadmium is the cadAC efflux system, with CadA being a P-type ATPase. Three different cadA genes (designated cadA1 to cadA3 ) were previously characterized in L. monocytogenes A novel putative cadmium resistance gene ( cadA4 ) was recently identified through whole-genome sequencing, but experimental confirmation for its involvement in cadmium resistance is lacking. In this study, we characterized cadA4 in L. monocytogenes strain F8027, a cadmium-resistant strain of serotype 4b. By screening a mariner-based transposon library of this strain, we identified a mutant with reduced tolerance to cadmium and that harbored a single transposon insertion in cadA4 The tolerance to cadmium was restored by genetic complementation with the cadmium resistance cassette ( cadA4C ), and enhanced cadmium tolerance was conferred to two unrelated cadmium-sensitive strains via heterologous complementation with cadA4C Cadmium exposure induced cadA4 expression, even at noninhibitory levels. Virulence assessments in the Galleria mellonella model suggested that a functional cadA4 suppressed virulence, potentially promoting commensal colonization of the insect larvae. Biofilm assays suggested that cadA4 inactivation reduced biofilm formation. These data not only confirm cadA4 as a novel cadmium resistance determinant in L. monocytogenes but also provide evidence for roles in virulence and biofilm formation. IMPORTANCE Listeria monocytogenes is an intracellular foodborne pathogen causing the disease listeriosis, which is responsible for numerous hospitalizations and deaths every year. Among the adaptations that enable the survival of Listeria in the environment are the abilities to persist in biofilms, grow in the cold, and
Kaslow, David C
2004-10-01
Vaccine development requires an amalgamation of disparate disciplines and has unique economic and regulatory drivers. Non-viral gene-based delivery systems, such as formulated plasmid DNA, are new and potentially disruptive technologies capable of providing 'cheaper, simpler, and more convenient-to-use' vaccines. Typically and somewhat ironically, disruptive technologies have poorer product performance, at least in the near-term, compared with the existing conventional technologies. Because successful product development requires that the product's performance must meet or exceed the efficacy threshold for a desired application, the appropriate selection of the initial product applications for a disruptive technology is critical for its successful evolution. In this regard, the near-term successes of gene-based vaccines will likely be for protection against bacterial toxins and acute viral and bacterial infections. Recent breakthroughs, however, herald increasing rather than languishing performance improvements in the efficacy of gene-based vaccines. Whether gene-based vaccines ultimately succeed in eliciting protective immunity in humans to persistent intracellular pathogens, such as HIV, malaria and tuberculosis, for which the conventional vaccine technologies have failed, remains to be determined. A success against any one of the persistent intracellular pathogens would be sufficient proof that gene-based vaccines represent a disruptive technology against which future vaccine technologies will be measured.
Listeria monocytogenes associated kerato-conjunctivitis in four horses in Norway.
Revold, Tobias; Abayneh, Takele; Brun-Hansen, Hege; Kleppe, Signe L; Ropstad, Ernst-Otto; Hellings, Robert A; Sørum, Henning
2015-11-09
Listeria monocytogenes has been reported to cause various infectious diseases in both humans and animals. More rarely, ocular infections have been reported. To our knowledge, only two cases of Listeria keratitis have been described in horses. We report kerato-conjunctivitis in four Norwegian horses associated with L. monocytogenes. Clinically, all cases were presented with recurrent unilateral kerato-conjunctivitis. L. monocytogenes bacteria were isolated from swab samples from all cases, and cytology carried out in 3 cases was indicative of L. monocytogenes infection. The present report describes the first known cases in which L. monocytogenes has been isolated from keratitic lesions in horses in Norway. A potential risk factor may be feeding of silage or haylage, but other sources of infection cannot be ruled out. The phenotypic features including antimicrobial susceptibility and serotype of the isolates are described. Laboratory detection of L. monocytogenes demands extra caution since only low numbers of bacteria were detected in the eye-swabs, probably due to the low volume of sample material and the intracellular niche of the bacterium. A general poor response to treatment in all these cases indicates that clinicians should pay extra attention to intensity and duration of treatment if L. monocytogenes is identified in connection with equine kerato-conjunctivitis.
Prevalence and location of Listeria monocytogenes in farmed rainbow trout.
Miettinen, Hanna; Wirtanen, Gun
2005-10-15
A total of 510 rainbow trout originating from fish farms in lakes and sea areas around Finland were studied for the presence of Listeria monocytogenes. Samples were studied as pools from five fish. Gill, viscera, and skin from the pooled samples were analysed separately. The individual samples were analysed later if the pooled sample was found to be Listeria positive. The prevalence of Listeria spp. and L. monocytogenes in pooled unprocessed fresh rainbow trout was on average 35.0% and 14.6%, respectively. On the other hand, the prevalence of Listeria spp. and L. monocytogenes in individual thawed fish was found to be 14.3% and 8.8%, respectively. These numbers tend to overestimate and underestimate the real situation because not all fish in pooled samples were necessarily contaminated and in some of the Listeria positive pooled samples all individual samples turned out to be Listeria free. The prevalence of L. monocytogenes varied greatly between different fish farms from zero to 100% in pooled samples and from zero to 75% according to individually studied fish samples. Some indications of the influence of weather conditions and seasonal variations that strongly affected the Listeria contamination of fish were also noticed. The location of Listeria spp. and L. monocytogenes in different parts of the fish differed with statistical significance in rainbow trout. Up to 95.6% of the L. monocytogenes and 84.5% of Listeria spp. positive samples were gill samples. Only 4.4% (2/45) of the L. monocytogenes positive samples were obtained from skin or viscera. Closer study at one fish farm revealed that there was only one L. monocytogenes ribotype present in the contaminated fish, although water and surfaces were heavily contaminated with six other L. monocytogenes ribotypes.
Law, Jodi Woan-Fei; Ab Mutalib, Nurul-Syakima; Chan, Kok-Gan; Lee, Learn-Han
2015-01-01
Listeria monocytogenes, a foodborne pathogen that can cause listeriosis through the consumption of food contaminated with this pathogen. The ability of L. monocytogenes to survive in extreme conditions and cause food contaminations have become a major concern. Hence, routine microbiological food testing is necessary to prevent food contamination and outbreaks of foodborne illness. This review provides insight into the methods for cultural detection, enumeration, and molecular identification of L. monocytogenes in various food samples. There are a number of enrichment and plating media that can be used for the isolation of L. monocytogenes from food samples. Enrichment media such as buffered Listeria enrichment broth, Fraser broth, and University of Vermont Medium (UVM) Listeria enrichment broth are recommended by regulatory agencies such as Food and Drug Administration-bacteriological and analytical method (FDA-BAM), US Department of Agriculture-Food and Safety (USDA-FSIS), and International Organization for Standardization (ISO). Many plating media are available for the isolation of L. monocytogenes, for instance, polymyxin acriflavin lithium-chloride ceftazidime aesculin mannitol, Oxford, and other chromogenic media. Besides, reference methods like FDA-BAM, ISO 11290 method, and USDA-FSIS method are usually applied for the cultural detection or enumeration of L. monocytogenes. most probable number technique is applied for the enumeration of L. monocytogenes in the case of low level contamination. Molecular methods including polymerase chain reaction, multiplex polymerase chain reaction, real-time/quantitative polymerase chain reaction, nucleic acid sequence-based amplification, loop-mediated isothermal amplification, DNA microarray, and next generation sequencing technology for the detection and identification of L. monocytogenes are discussed in this review. Overall, molecular methods are rapid, sensitive, specific, time- and labor-saving. In future, there are
A case of bovine raw milk contamination with Listeria monocytogenes
Directory of Open Access Journals (Sweden)
Hunt Karen
2012-07-01
Full Text Available Abstract During routine sampling of bulk raw milk on a dairy farm, the pathogenic bacteria Listeria monocytogenes was found to be a contaminant, at numbers L. monocytogenes, indicating a possible case of excretion of the L. monocytogenes directly into the milk. Milk samples were collected from the individual cows and analysed, resulting in the identification of L. monocytogenes excretion (at 280 cfu/ml from one of the 4 mammary quarters of one dairy cow out of 180. When the infected cow was isolated from the herd, no L. monocytogenes was detected from the remaining herd. The pulsed-field gel electrophoresis pattern of the strain from the individual cow was indistinguishable from that originally isolated from the bulk milk. The infected cow did not show any clinical signs of disease, nor did the appearance of the milk have any physical abnormalities. Antibiotic treatment of the infected mammary quarter was found to be ineffective. This study shows that there can be risks associated with direct contamination of raw milk with L. monocytogenes.
Inhibition of sortase A by chalcone prevents Listeria monocytogenes infection.
Li, Hongen; Chen, Yutao; Zhang, Bing; Niu, Xiaodi; Song, Meng; Luo, Zhaoqing; Lu, Gejin; Liu, Bowen; Zhao, Xiaoran; Wang, Jianfeng; Deng, Xuming
2016-04-15
The critical role of sortase A in gram-positive bacterial pathogenicity makes this protein a good potential target for antimicrobial therapy. In this study, we report for the first time the crystal structure of Listeria monocytogenes sortase A and identify the active sites that mediate its transpeptidase activity. We also used a sortase A (SrtA) enzyme activity inhibition assay, simulation, and isothermal titration calorimetry analysis to discover that chalcone, an agent with little anti-L. monocytogenes activity, could significantly inhibit sortase A activity with an IC50 of 28.41 ± 5.34 μM by occupying the active site of SrtA. The addition of chalcone to a co-culture of L. monocytogenes and Caco-2 cells significantly inhibited bacterial entry into the cells and L. monocytogenes-mediated cytotoxicity. Additionally, chalcone treatment decreased the mortality of infected mice, the bacterial burden in target organs, and the pathological damage to L. monocytogenes-infected mice. In conclusion, these findings suggest that chalcone is a promising candidate for the development of treatment against L. monocytogenes infection. Copyright © 2016 Elsevier Inc. All rights reserved.
Mechanistic studies of the agmatine deiminase from Listeria monocytogenes.
Soares, Charles A; Knuckley, Bryan
2016-06-01
Listeria monocytogenes is a Gram-positive food-borne pathogen that is capable of living within extreme environments (i.e. low temperatures and pH). This ability to survive in such conditions may arise, at least in part, from agmatine catabolism via the agmatine deiminase system (AgDS). This catabolic pathway utilizes an agmatine deiminase (AgD) to hydrolyse agmatine into N-carbamoylputrescine (NCP), with concomitant release of ammonia, which increases the pH, thus mitigating the ill effects of the acidic environment. Given the potential significance of this pathway for cell survival, we set out to study the catalytic mechanism of the AgD encoded by L. monocytogenes In the present paper, we describe the catalytic mechanism employed by this enzyme based on pH profiles, pKa measurements of the active site cysteine and solvent isotope effects (SIE). In addition, we report inhibition of this enzyme by two novel AgD inhibitors, i.e. N-(4-aminobutyl)-2-fluoro-ethanimidamide (ABFA) and N-(4-aminobutyl)-2-chloro-ethanimidamide (ABCA). In contrast with other orthologues, L. monocytogenes AgD does not use the reverse protonation or substrate-assisted mechanism, which requires an active site cysteine with a high pKa and has been commonly seen in other members of the guanidinium-modifying enzyme (GME) superfamily. Instead, the L. monocytogenes AgD has a low pKa cysteine in the active site leading to an alternative mechanism of catalysis. This is the first time that this mechanism has been observed in the GME superfamily and is significant because it explains why previously developed mechanism-based inactivators of AgDs are ineffective against this orthologue. © 2016 The Author(s). published by Portland Press Limited on behalf of the Biochemical Society.
CHALLENGE TESTS WITH LISTERIA MONOCYTOGENES IN SALAMI: PRELIMINARY RESULTS
Directory of Open Access Journals (Sweden)
R. Mioni
2013-02-01
Full Text Available Challenge tests are the preferable methodology to study the behaviour of Listeria monocytogenes on ready to eat foods, according to Regulation (EC 2073/2005. Challenge testing using L. monocytogenes in seasoned salami from different food business operators showed, after seasoning of the product, a count reduction of the inoculated organisms without any further growth of the pathogen; however differences of L. monocytogenes behaviour could be observed according to different production protocols.
Resistance of Listeria monocytogenes biofilms to sanitizing agents
Listeria monocytogenes is notorious for its capacity to colonize the environment and equipment of food processing facilities and to persist in the processing plant ecosystem, sometimes for decades. Such persistence is mediated by multiple attributes of L. monocytogenes, including the pathogen’s capa...
Ogilvie, Gina; Anderson, Maureen; Marra, Fawziah; McNeil, Shelly; Pielak, Karen; Dawar, Meena; McIvor, Marilyn; Ehlen, Thomas; Dobson, Simon; Money, Deborah; Patrick, David M; Naus, Monika
2010-05-04
Information on factors that influence parental decisions for actual human papillomavirus (HPV) vaccine receipt in publicly funded, school-based HPV vaccine programs for girls is limited. We report on the level of uptake of the first dose of the HPV vaccine, and determine parental factors associated with receipt of the HPV vaccine, in a publicly funded school-based HPV vaccine program in British Columbia, Canada. All parents of girls enrolled in grade 6 during the academic year of September 2008-June 2009 in the province of British Columbia were eligible to participate. Eligible households identified through the provincial public health information system were randomly selected and those who consented completed a validated survey exploring factors associated with HPV vaccine uptake. Bivariate and multivariate analyses were conducted to calculate adjusted odds ratios to identify the factors that were associated with parents' decision to vaccinate their daughter(s) against HPV. 2,025 parents agreed to complete the survey, and 65.1% (95% confidence interval [CI] 63.1-67.1) of parents in the survey reported that their daughters received the first dose of the HPV vaccine. In the same school-based vaccine program, 88.4% (95% CI 87.1-89.7) consented to the hepatitis B vaccine, and 86.5% (95% CI 85.1-87.9) consented to the meningococcal C vaccine. The main reasons for having a daughter receive the HPV vaccine were the effectiveness of the vaccine (47.9%), advice from a physician (8.7%), and concerns about daughter's health (8.4%). The main reasons for not having a daughter receive the HPV vaccine were concerns about HPV vaccine safety (29.2%), preference to wait until the daughter is older (15.6%), and not enough information to make an informed decision (12.6%). In multivariate analysis, overall attitudes to vaccines, the impact of the HPV vaccine on sexual practices, and childhood vaccine history were predictive of parents having a daughter receive the HPV vaccine in a
Directory of Open Access Journals (Sweden)
Gina Ogilvie
2010-05-01
Full Text Available BACKGROUND: Information on factors that influence parental decisions for actual human papillomavirus (HPV vaccine receipt in publicly funded, school-based HPV vaccine programs for girls is limited. We report on the level of uptake of the first dose of the HPV vaccine, and determine parental factors associated with receipt of the HPV vaccine, in a publicly funded school-based HPV vaccine program in British Columbia, Canada. METHODS AND FINDINGS: All parents of girls enrolled in grade 6 during the academic year of September 2008-June 2009 in the province of British Columbia were eligible to participate. Eligible households identified through the provincial public health information system were randomly selected and those who consented completed a validated survey exploring factors associated with HPV vaccine uptake. Bivariate and multivariate analyses were conducted to calculate adjusted odds ratios to identify the factors that were associated with parents' decision to vaccinate their daughter(s against HPV. 2,025 parents agreed to complete the survey, and 65.1% (95% confidence interval [CI] 63.1-67.1 of parents in the survey reported that their daughters received the first dose of the HPV vaccine. In the same school-based vaccine program, 88.4% (95% CI 87.1-89.7 consented to the hepatitis B vaccine, and 86.5% (95% CI 85.1-87.9 consented to the meningococcal C vaccine. The main reasons for having a daughter receive the HPV vaccine were the effectiveness of the vaccine (47.9%, advice from a physician (8.7%, and concerns about daughter's health (8.4%. The main reasons for not having a daughter receive the HPV vaccine were concerns about HPV vaccine safety (29.2%, preference to wait until the daughter is older (15.6%, and not enough information to make an informed decision (12.6%. In multivariate analysis, overall attitudes to vaccines, the impact of the HPV vaccine on sexual practices, and childhood vaccine history were predictive of parents having
Particle-based vaccines for HIV-1 infection.
Young, Kelly R; Ross, Ted M
2003-06-01
The use of live-attenuated viruses as vaccines has been successful for the control of viral infections. However, the development of an effective vaccine against the human immunodeficiency virus (HIV) has proven to be a challenge. HIV infects cells of the immune system and results in a severe immunodeficiency. In addition, the ability of the virus to adapt to immune pressure and the ability to reside in an integrated form in host cells present hurdles for vaccinologists to overcome. A particle-based vaccine strategy has promise for eliciting high titer, long-lived, immune responses to a diverse number of viral epitopes from different HIV antigens. Live-attenuated viruses are effective at generating both cellular and humoral immunity, however, a live-attenuated vaccine for HIV is problematic. The possibility of a live-attenuated vaccine to revert to a pathogenic form or recombine with a wild-type or defective virus in an infected individual is a drawback to this approach. Therefore, these vaccines are currently only being tested in non-human primate models. Live-attenuated vaccines are effective in stimulating immunity, however challenged animals rarely clear viral infection and the degree of attenuation directly correlates with the protection of animals from disease. Another particle-based vaccine approach for HIV involves the use of virus-like particles (VLPs). VLPs mimic the viral particle without causing an immunodeficiency disease. HIV-like particles (HIV-LP) are defined as self-assembling, non-replicating, nonpathogenic, genomeless particles that are similar in size and conformation to intact virions. A variety of VLPs for both HIV and SIV are currently in pre-clinical and clinical trials. This review focuses on the current knowledge regarding the immunogenicity and safety of particle-based vaccine strategies for HIV-1.
Vongkamjan, Kitiya; Fuangpaiboon, Janejira; Turner, Matthew P; Vuddhakul, Varaporn
2016-02-01
Listeriosis outbreaks have been associated with a variety of foods. This study investigated the prevalence and diversity of Listeria monocytogenes and Listeria spp. in ready-to-eat (RTE) products and evaluated the performance of a rapid detection method, the 3M molecular detection assay for L. monocytogenes (MDA-LM), for detection of L. monocytogenes. Assay results were compared with those obtained using the U.S. Food and Drug Administration standard culture method described in the Bacteriological Analytical Manual. Products (n = 200) were purchased from retail stores: 122 aquatic products, 22 products of animal origin, 18 vegetarian products, 15 deli meat products, 13 salad and vegetable products, 4 desserts, 2 egg-based products, and 4 other products. L. monocytogenes prevalence was comparable with both methods. Overall, 15 (7.5%) of 200 samples were positive for L. monocytogenes: 3% of aquatic products, 1.5% of products of animal origin, 1% of vegetarian products, and 2% of deli meat products. Compared with the standard culture method, the sensitivity, specificity, and the accuracy of the MDA-LM were 86.7% (95% confidence interval, 58.4 to 97.7%), 98.4% (95% confidence interval, 95.0 to 99.6%), and 97.5%, respectively. Using the culture-based method, 18 (9%) of 200 samples were positive for Listeria species other than L. monocytogenes. Listeria isolates from these samples were classified into nine allelic types (ATs). The majority of isolates were classified as ATs 58 and 74, which were identified as L. monocytogenes lineages I and IV, respectively. Listeria innocua and Listeria welshimeri also were represented by isolates of multiple ATs. The MDA-LM is a rapid and reliable technique for detecting L. monocytogenes in various RTE foods. Further study is needed to develop effective control strategies to reduce L. monocytogenes contamination in RTE foods.
LISTERIA MONOCYTOGENES RISK EVALUATION IN READY TO EAT DELI PRODUCTS
Directory of Open Access Journals (Sweden)
T Civera
2013-02-01
Full Text Available Listeria monocytogenes has become one of the major concerns for food safety. Its ability to survive and replicate at low temperature, pH and high salt concentration, makes the bacterium a threat, mostly for RTE products. For these reasons, the present research was aimed at detecting the ability of growth of L. monocytogenes in RTE products retrieved from one deli store. Samples were analysed for L. monocytogenes detection, then inoculated with the pathogen (105cell/ml and stored at refrigeration temperature for the duration of their shelf-life (15-60 days. In all the products L. monocytogenes was not detected before experimental contamination. The challenge test evidenced that experimentally inoculated L. monocytogenes was not able to multiply for the duration of the entire shelf-life. These results indicated that the tested products could be considered as foods which are not able to support the growth of L. monocytogenes, as indicated by E.C. Regulation 2073/05. However, in order to guarantee consumer’s safety, it needs to be emphasized the need of a correct application of the GMPs, required for lowering the risk of initial contamination.
Internalization of Listeria monocytogenes in cantaloupes during dump tank washing and hydrocooling.
Macarisin, Dumitru; Wooten, Anna; De Jesus, Antonio; Hur, Minji; Bae, Seonjae; Patel, Jitendra; Evans, Peter; Brown, Eric; Hammack, Thomas; Chen, Yi
2017-09-18
Recent listeriosis outbreaks and recalls associated with cantaloupes urge for studies to understand the mechanisms of cantaloupe contamination by Listeria monocytogenes. Postharvest practices such as washing and hydrocooling were suggested to facilitate the contamination of fresh fruits by human pathogens. This study assessed the potential of L. monocytogenes internalization into cantaloupes during dump tank washing and immersion-type hydrocooling in water contaminated with L. monocytogenes. The effect of cantaloupe cultivar, water temperature, and harvesting technique on L. monocytogenes internalization was also evaluated. Full slip (cantaloupe without any residual stem) Western and Eastern cultivar cantaloupes were pre-warmed to 42°C (to imitate peak-high field temperatures of freshly harvested cantaloupes) and then immersed in water at 6°C and 18°C containing 4 and 6logCFU/ml of L. monocytogenes. Clipped (cantaloupe with short stem residues obtained by clipping the stem at harvest) Western and Eastern cantaloupes were pre-warmed to 42°C and then immersed in water at 6°C containing 6logCFU/ml of L. monocytogenes. Additionally, full slip and clipped Western cantaloupes were equilibrated to 18°C and then immersed in water at 18°C containing 6logCFU/ml of L. monocytogenes (isothermal immersion without temperature differential). Water containing L. monocytogenes infiltrated both full slip and clipped cantaloupes through the stems/stem scars and was then distributed along the vascular system in hypodermal mesocarp reaching the calyx area of the fruit. The current study demonstrated that, under experimental conditions, L. monocytogenes can internalize into cantaloupes during immersion in water contaminated by L. monocytogenes, both in the presence and absence of temperature differential, and that temperature differential moderately enhanced the internalization of L. monocytogenes. The incidence and levels of L. monocytogenes internalized in the middle
Erdősi, Orsolya; Szakmár, Katalin; Reichart, Olivér; Szili, Zsuzsanna; László, Noémi; Székely Körmöczy, Péter; Laczay, Péter
2014-09-01
The incidence of outbreaks of foodborne listeriosis has indicated the need for a reliable and rapid detection of the microbe in different foodstuffs. A method combining redox potential measurement and real-time polymerase chain reaction (PCR) was developed to detect Listeria monocytogenes in artificially contaminated raw milk and soft cheese. Food samples of 25 g or 25 ml were homogenised in 225 ml of Listeria Enrichment Broth (LEB) with Oxford supplement, and the redox potential measurement technique was applied. For Listeria species the measuring time was maximum 34 h. The absence of L. monocytogenes could reliably be proven by the redox potential measurement method, but Listeria innocua and Bacillus subtilis could not be differentiated from L. monocytogenes on the basis of the redox curves. The presence of L. monocytogenes had to be confirmed by real-time PCR. The combination of these two methods proved to detect < 10 cfu/g of L. monocytogenes in a cost- and time-effective manner. This method can potentially be used as an alternative to the standard nutrient method for the rapid detection of L. monocytogenes in food.
REAL-TIME PCR DETECTION OF LISTERIA MONOCYTOGENES IN FOOD SAMPLES OF ANIMAL ORIGIN
Directory of Open Access Journals (Sweden)
Jaroslav Pochop
2013-02-01
Full Text Available The aim of this study was to follow the contamination of food with Listeria monocytogenes by using Step One real time polymerase chain reaction (PCR. We used the PrepSEQ Rapid Spin Sample Preparation Kit for isolation of DNA and SensiFAST SYBR Hi-ROX Kit for the real-time PCR performance. In 24 samples of food of animal origin without incubation were detected strains of Listeria monocytogenes in 15 samples (swabs. Nine samples were negative. Our results indicated that the real-time PCR assay developed in this study could sensitively detect Listeria monocytogenes in food of animal origin without incubation. This could prevent infection caused by Listeria monocytogenes, and also could benefit food manufacturing companies by extending their product’s shelf-life as well as saving the cost of warehousing their food products while awaiting pathogen testing results. The rapid real-time PCR-based method performed very well compared to the conventional method. It is a fast, simple, specific and sensitive way to detect nucleic acids, which could be used in clinical diagnostic tests in the future.
Listeria monocytogenes Identification in Food of Animal Origin Used with Real Time PCR
Directory of Open Access Journals (Sweden)
Jaroslav Pochop
2013-10-01
Full Text Available The aim of this study was to follow the contamination of food with Listeria monocytogenes by using Step One real time polymerase chain reaction (RT PCR. We used the PrepSEQ Rapid Spin Sample Preparation Kit for isolation of DNA and SensiFAST SYBR Hi-ROX Kit for the real-time PCR performance. In 20 samples of food of animal origin with incubation were detected strains of Listeria monocytogenes in 9 samples (swabs. Eleven samples were negative. Our results indicated that the real-time PCR assay developed in this study could sensitively detect Listeria monocytogenes in food of animal origin without incubation. This could prevent infection caused by Listeria monocytogenes, and also could benefit food manufacturing companies by extending their product’s shelf-life as well as saving the cost of warehousing their food products while awaiting pathogen testing results. The rapid real-time PCR-based method performed very well compared to the conventional method. It is a fast, simple, specific and sensitive way to detect nucleic acids, which could be used in clinical diagnostic tests in the future.
Listeria monocytogenes growth limits and stress resistance mechanisms
Veen, van der S.
2008-01-01
The food-borne pathogen Listeria monocytogenes is a Gram-positive facultative anaerobic rod, which is the causative agent of listeriosis. Due to the severity of the disease and the fact that its incidence is increasing in numerous European countries, L. monocytogenes is of great public health
Genetic Separation of Listeria monocytogenes Causing Central Nervous System Infections in Animals
Directory of Open Access Journals (Sweden)
Lisandra Aguilar-Bultet
2018-02-01
Full Text Available Listeria monocytogenes is a foodborne pathogen that causes abortion, septicemia, gastroenteritis and central nervous system (CNS infections in ruminants and humans. L. monocytogenes strains mainly belong to two distinct phylogenetic groups, named lineages I and II. In general, clinical cases in humans and animals, in particular CNS infections, are caused by lineage I strains, while most of the environmental and food strains belong to lineage II. Little is known about why lineage I is more virulent than lineage II, even though various molecular factors and mechanisms associated with pathogenesis are known. In this study, we have used a variety of whole genome sequence analyses and comparative genomic tools in order to find characteristics that distinguish lineage I from lineage II strains and CNS infection strains from non-CNS strains. We analyzed 225 strains and identified single nucleotide variants between lineages I and II, as well as differences in the gene content. Using a novel approach based on Reads Per Kilobase per Million Mapped (RPKM, we identified 167 genes predominantly absent in lineage II but present in lineage I. These genes are mostly encoding for membrane-associated proteins. Additionally, we found 77 genes that are largely absent in the non-CNS associated strains, while 39 genes are especially lacking in our defined “non-clinical” group. Based on the RPKM analysis and the metadata linked to the L. monocytogenes strains, we identified 6 genes potentially associated with CNS cases, which include a transcriptional regulator, an ABC transporter and a non-coding RNA. Although there is not a clear separation between pathogenic and non-pathogenic strains based on phylogenetic lineages, the presence of the genes identified in our study reveals potential pathogenesis traits in ruminant L. monocytogenes strains. Ultimately, the differences that we have found in our study will help steer future studies in understanding the virulence
Genetic Separation of Listeria monocytogenes Causing Central Nervous System Infections in Animals
Aguilar-Bultet, Lisandra; Nicholson, Pamela; Rychener, Lorenz; Dreyer, Margaux; Gözel, Bulent; Origgi, Francesco C.; Oevermann, Anna; Frey, Joachim; Falquet, Laurent
2018-01-01
Listeria monocytogenes is a foodborne pathogen that causes abortion, septicemia, gastroenteritis and central nervous system (CNS) infections in ruminants and humans. L. monocytogenes strains mainly belong to two distinct phylogenetic groups, named lineages I and II. In general, clinical cases in humans and animals, in particular CNS infections, are caused by lineage I strains, while most of the environmental and food strains belong to lineage II. Little is known about why lineage I is more virulent than lineage II, even though various molecular factors and mechanisms associated with pathogenesis are known. In this study, we have used a variety of whole genome sequence analyses and comparative genomic tools in order to find characteristics that distinguish lineage I from lineage II strains and CNS infection strains from non-CNS strains. We analyzed 225 strains and identified single nucleotide variants between lineages I and II, as well as differences in the gene content. Using a novel approach based on Reads Per Kilobase per Million Mapped (RPKM), we identified 167 genes predominantly absent in lineage II but present in lineage I. These genes are mostly encoding for membrane-associated proteins. Additionally, we found 77 genes that are largely absent in the non-CNS associated strains, while 39 genes are especially lacking in our defined “non-clinical” group. Based on the RPKM analysis and the metadata linked to the L. monocytogenes strains, we identified 6 genes potentially associated with CNS cases, which include a transcriptional regulator, an ABC transporter and a non-coding RNA. Although there is not a clear separation between pathogenic and non-pathogenic strains based on phylogenetic lineages, the presence of the genes identified in our study reveals potential pathogenesis traits in ruminant L. monocytogenes strains. Ultimately, the differences that we have found in our study will help steer future studies in understanding the virulence mechanisms of the
A history of adolescent school based vaccination in Australia.
Ward, Kirsten; Quinn, Helen; Menzies, Robert; McIntyre, Peter
2013-06-30
As adolescents have become an increasingly prominent target group for vaccination, school-based vaccination has emerged as an efficient and effective method of delivering nationally recommended vaccines to this often hard to reach group. School-based delivery of vaccines has occurred in Australia for over 80 years and has demonstrated advantages over primary care delivery for this part of the population. In the last decade school-based vaccination programs have become routine practice across all Australian states and territories. Using existing records and the recollection of experts we have compiled a history of school-based vaccination in Australia, primarily focusing on adolescents. This work is copyright. Apart from any use as permitted under the Copyright Act 1968, no part may be reproduced by any process without prior written permission from the Commonwealth. Requests and inquiries concerning reproduction and rights should be addressed to the Commonwealth Copyright Administration, Attorney General's Department, Robert Garran Offices, National Circuit, Barton ACT 2600 or posted at http://www.ag.gov.au/cca.
DEFF Research Database (Denmark)
Ojeniyi, B.; Wegener, Henrik Caspar; Jensen, N.E.
1996-01-01
Listeria monocytogenes was isolated from 11/236 (4 . 7%) caecal samples from parent flocks, providing broilers to the abattoirs investigated. Caecal samples from 2078 broilers representing 90 randomly selected broiler flocks were negative for L. monocytogenes. A total of 3080 samples from seven...... abattoirs including poultry processing line samples, and final products were also examined for L. monocytogenes. Listeria monocytogenes was isolated in 0 . 3% to 18 . 7% of the samples collected in the different abattoirs. Epidemiological typing of 247 L. monocytogenes isolates, including serotyping, phage...... isolates of L. monocytogenes since only 120/247 (48 . 6%) isolates were typable by phage typing and 230/247 (93 . 1%) L. monocytogenes belonged to serotype 01 while 6/247 (2 . 4%) belonged to 04. The discovery of a few dominating clones in each abattoir might indicate an endemic occurrence of L...
Aerosol studies with Listeria innocua and Listeria monocytogenes.
Zhang, Guodong; Ma, Li; Oyarzabal, Omar A; Doyle, Michael P
2007-08-01
Aerosol studies of Listeria monocytogenes in food processing plants have been limited by lack of a suitable surrogate microorganism. The objective of this study was to investigate the potential of using green fluorescent protein-labeled strains of Listeria innocua as a surrogate for L. monocytogenes for aerosol studies. These studies were conducted in a laboratory bioaerosol chamber and a pilot food-processing facility. Four strains of L. innocua and five strains of L. monocytogenes were used. In the laboratory chamber study, Listeria cells were released into the environment at two different cell numbers and under two airflow conditions. Trypticase soy agar (TSA) plates and oven-roasted breasts of chicken and turkey were placed in the chamber to monitor Listeria cell numbers deposited from aerosols. A similar experimental design was used in the pilot plant study; however, only L. innocua was used. Results showed that L. monocytogenes and L. innocua survived equally well on chicken and turkey breast meats and TSA plates. No-fan and continuous fan applications, which affected airflow, had no significant effect on settling rates of aerosolized L. monocytogenes and L. innocua in the bioaerosol chamber or L. innocua in the pilot plant study. Listeriae cell numbers in the air decreased rapidly during the first 1.5 h following release, with few to no listeriae detected in the air at 3 h. Aerosol particles with diameters of 1 and 2 microM correlated directly with the number of Listeria cells in the aerosol but not with particles that were 0.3, 0.5, and 5 microM in diameter. Results indicate that L. innocua can be used as a surrogate for L. monocytogenes in an aerosol study.
Low prevalence of Listeria monocytogenes in cull sows and pork.
Wesley, Irene V; Larsen, Steven; Hurd, H Scott; McKean, James D; Griffith, Ronald; Rivera, Fernando; Nannapaneni, Ramakrishna; Cox, Mandy; Johnson, Michael; Wagner, Dean; de Martino, Mary
2008-03-01
The goal of this study was to determine the prevalence of Listeria monocytogenes in sows slaughtered at a single Midwestern plant on two occasions (trial 1, n = 179 sows; trial 2, n = 160 sows). Fecal samples collected antemortem (trial 1) as well as animal tissues, and carcass swabs collected at the abattoir (trials 1 and 2) were analyzed. Eight isolates of L. monocytogenes were recovered from five samples that represented 0.18% of the total samples (n = 2,775). In trial 1, L. monocytogenes was detected in a tonsil sample (0.6%; 1 positive of 181 tonsils), in a carcass (0.6%; 1 positive of 179 carcasses), which was sampled prior to the organic rinse, and in two chopped meat block samples (1.2%; 2 positive of 165 samples). In trial 2, L. monocytogenes was only detected in a single chopped meat block sample (0.15%; 1 positive of 688 total samples). These data indicate the low prevalence of L. monocytogenes in the cull sow.
Prevalence and populations of Listeria monocytogenes in meat products retailed in Sao Paulo, Brazil.
Ristori, Christiane Asturiano; Rowlands, Ruth Estela Gravato; Martins, Cecília Geraldes; Barbosa, Maria Luisa; Yoshida, Júlia T U; Franco, Bernadette D G de Melo
2014-12-01
This study evaluated the prevalence of the populations and serotypes of Listeria monocytogenes in 552 refrigerated samples of ground beef, chicken leg, hot dog, and pork sausage collected in supermarkets in the city of Sao Paulo, SP, Brazil, between May 2008 and July 2009. The supermarkets were selected after stratification by geographical region and by random draw. Tests for presence and enumeration of L. monocytogenes were based on ISO 11290-1:1996/Amd.1:2004 and ISO 11290-2:1998 methods, respectively. Listeria spp. were detected in 469 (85.0%) of the studied meat products. The most frequently isolated species was L. innocua (64.1%), followed by L. monocytogenes (48.7%), L. welshimeri (13.4%), L. seeligeri (7.1%), L. ivanovii (0.2%), and L. grayi subspecies murrayi (0.2%). L. monocytogenes was detected in 269 (48.7%) samples, with highest prevalence in ground beef (59.4%) followed by chicken legs (58.0%), pork sausages (39.8%), and hot dogs (37.7%). The populations were Prevalence of serotypes varied according to the type of meat product. These data are relevant for estimating the risks of listeriosis associated with consumption of meat products in Sao Paulo, and for establishing science-based intervention strategies aimed at reducing these risks, especially for pregnant women and immunocompromised individuals.
New Kids on the Block: RNA-Based Influenza Virus Vaccines.
Scorza, Francesco Berlanda; Pardi, Norbert
2018-04-01
RNA-based immunization strategies have emerged as promising alternatives to conventional vaccine approaches. A substantial body of published work demonstrates that RNA vaccines can elicit potent, protective immune responses against various pathogens. Consonant with its huge impact on public health, influenza virus is one of the best studied targets of RNA vaccine research. Currently licensed influenza vaccines show variable levels of protection against seasonal influenza virus strains but are inadequate against drifted and pandemic viruses. In recent years, several types of RNA vaccines demonstrated efficacy against influenza virus infections in preclinical models. Additionally, comparative studies demonstrated the superiority of some RNA vaccines over the currently used inactivated influenza virus vaccines in animal models. Based on these promising preclinical results, clinical trials have been initiated and should provide valuable information about the translatability of the impressive preclinical data to humans. This review briefly describes RNA-based vaccination strategies, summarizes published preclinical and clinical data, highlights the roadblocks that need to be overcome for clinical applications, discusses the landscape of industrial development, and shares the authors' personal perspectives about the future of RNA-based influenza virus vaccines.
Wang, Junping; Xie, Xinfang; Feng, Jinsong; Chen, Jessica C; Du, Xin-jun; Luo, Jiangzhao; Lu, Xiaonan; Wang, Shuo
2015-07-02
Listeria monocytogenes is a facultatively anaerobic, Gram-positive, rod-shape foodborne bacterium causing invasive infection, listeriosis, in susceptible populations. Rapid and high-throughput detection of this pathogen in dairy products is critical as milk and other dairy products have been implicated as food vehicles in several outbreaks. Here we evaluated confocal micro-Raman spectroscopy (785 nm laser) coupled with chemometric analysis to distinguish six closely related Listeria species, including L. monocytogenes, in both liquid media and milk. Raman spectra of different Listeria species and other bacteria (i.e., Staphylococcus aureus, Salmonella enterica and Escherichia coli) were collected to create two independent databases for detection in media and milk, respectively. Unsupervised chemometric models including principal component analysis and hierarchical cluster analysis were applied to differentiate L. monocytogenes from Listeria and other bacteria. To further evaluate the performance and reliability of unsupervised chemometric analyses, supervised chemometrics were performed, including two discriminant analyses (DA) and soft independent modeling of class analogies (SIMCA). By analyzing Raman spectra via two DA-based chemometric models, average identification accuracies of 97.78% and 98.33% for L. monocytogenes in media, and 95.28% and 96.11% in milk were obtained, respectively. SIMCA analysis also resulted in satisfied average classification accuracies (over 93% in both media and milk). This Raman spectroscopic-based detection of L. monocytogenes in media and milk can be finished within a few hours and requires no extensive sample preparation. Copyright © 2015 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Wang Y
2017-01-01
Full Text Available Yi Wang,1 Hui Li,1,2 Yan Wang,1 Hua Li,1 Lijuan Luo,1 Jianguo Xu,1 Changyun Ye1 1State Key Laboratory of Infectious Disease Prevention and Control, National Institute for Communicable Disease Control and Prevention, Collaborative Innovation Center for Diagnosis and Treatment of Infectious Diseases, Chinese Center for Disease Control and Prevention, Changping, Beijing, 2Department of Microbiology, GuiZhou Medical University, Guiyang, Guizhou, People’s Republic of China Abstract: Listeria monocytogenes, one of most problematic foodborne pathogens, is responsible for listeriosis in both humans and animals and mainly transmitted through the food chain. In this report, we propose a simple, rapid, and nearly instrument-free molecular technique using multiple cross displacement amplification (MCDA label-based gold nanoparticles lateral flow biosensor (LFB for specific, sensitive, and visual detection of L. monocytogenes. The MCDA-LFB method was carried out at a constant temperature (61°C for only 20 min during the reaction stage, and then the amplification mixtures were directly detected by using LFB, eliminating the use of an electrophoresis instrument, special reagents, or amplicon analysis equipment. The whole procedure, from sample processing to result indicating, was finished within 1 h. The analytical specificity of MCDA-LFB method was successfully determined by distinguishing the target bacterium from other pathogens. The analytical sensitivity of the MCDA-LFB assay was 10 fg of genomic templates per reaction in pure culture, which was in complete accordance with MCDA by gel electrophoresis, real-time turbidity, and colorimetric indicator. The assay was also successfully applied to detecting L. monocytogenes in pork samples. Therefore, the rapidity, simplicity, and nearly equipment-free platform of the MCDA-LFB technique make it possible for food control, clinical diagnosis, and more. The proof-of-concept assay can be reconfigured to detect
Behaviour of Listeria monocytogenes in packaged fresh mushrooms (Agaricus bisporus).
González-Fandos, E; Olarte, C; Giménez, M; Sanz, S; Simón, A
2001-11-01
The aim of this study was to evaluate the potential of Listeria monocytogenes to grow in mushrooms packaged in two different types of PVC films when stored at 4 degrees C and 10 degrees C. Mushrooms were packed in two polymeric films (perforated and nonperforated PVC) and stored at 4 degrees C and 10 degrees C. The carbon dioxide and oxygen content inside the packages, aerobic mesophiles, psychrotrophs, Pseudomonas spp., Listeria monocytogenes, faecal coliforms, Escherichia coli, anaerobic spores and major sensory factors were determined. The mushrooms packaged in nonperforated film and stored at 4 degrees C had the most desirable quality parameters (texture, development stage and absence of moulds). Listeria monocytogenes was able to grow at 4 degrees C and 10 degrees C in inoculated mushrooms packaged in perforated and nonperforated films between 1 and 2 log units during the first 48 h. After 10 d of storage, the populations of L. monocytogenes were higher in mushrooms packaged in nonperforated film and stored at 10 degrees C. MAP followed by storage at 4 degrees C or 10 degrees C extends the shelf life by maintaining an acceptable appearance, but allows the growth and survival of L. monocytogenes. According to this study additional hurdles must be studied in order to prevent the growth of L. monocytogenes.
Animal vaccines based on orally presented yeast recombinants.
Shin, Min-Kyoung; Yoo, Han Sang
2013-09-13
In veterinary vaccinology, the oral route of administration is an attractive alternative compared to the commonly used parenteral route. Yeasts have a number of properties that make them potential live delivery systems for oral vaccination purposes such as their high expression levels, their GRAS status, adjuvant properties, and post-translational modification possibilities. Consequently, yeasts have been employed for the expression of heterologous genes and for the production of therapeutic proteins. Yeast-based vaccines are reviewed with regard to their ability to express and produce antigens from pathogens for veterinary use. Many of these vaccines have been shown to elicit protective immune responses following oral immunization in animals. Ultimately, yeast-based oral vaccines may offer a potential opportunity for the development of novel ideal vaccines in veterinary medicine. Copyright © 2013 Elsevier Ltd. All rights reserved.
Henriques, A R; Gama, L T; Fraqueza, M J
2017-02-02
Listeria monocytogenes isolates collected from final products and food contact surfaces of 10 ready-to-eat meat-based food products (RTEMP) producing industries were analyzed to relate their virulence-associated characteristics and genetic profiles with the hygiene assessment of those industries. Together with sample collection, an audit was performed to evaluate the implemented food safety management system and to investigate the specific audit requisites more associated to the occurrence of those L. monocytogenes serogroups frequently related with human disease. L. monocytogenes was present in 18% of the samples. The isolates (n=62) were serogrouped and detection of virulence-associated genes inlA, inlB, inlC and inlJ, and also plcA, hlyA, actA and iap was done by multiplex PCR. After this initial characterization, selected isolates (n=31) were submitted to antibiotic resistance testing by the disk diffusion method for the currently most used human and veterinary antibiotics and resistance was low. These isolates were also subtyped by pulsed-field gel electrophoresis. Genotyping and serogrouping of L. monocytogenes isolates revealed a genetically diverse population. Our data indicate that contamination of final products does not seem to be uniquely related to the sampled food surfaces. The occurrence of those L. monocytogenes serogroups more commonly associated with human disease in industries with a high hygienic audit classification could be the result of a previous identification of the pathogen, with an enforcement of the hygiene program without recognizing the real source of contamination. This reinforces the importance of a conjoined diagnosis using audit data and microbiological testing. Food safety management systems of those industries need improvement, particularly in cleaning and sanitizing operations, analytical control, preventive maintenance, personal hygiene and root cause analysis. Copyright © 2016. Published by Elsevier B.V.
Prevalence and characteristics of Listeria monocytogenes in bovine colostrum in Japan.
Hasegawa, Megumi; Iwabuchi, Eriko; Yamamoto, Shiori; Esaki, Hidetake; Kobayashi, Kazuhiko; Ito, Masahiko; Hirai, Katsuya
2013-02-01
This study was conducted to determine the prevalence and characteristics of Listeria monocytogenes in bovine colostrum in Japan. We collected bovine colostrum samples from 210 dams from 21 dairy farms in Hokkaido prefecture (Japan) between March and June 2009. L. monocytogenes was detected in samples from 6 (28.6%) of the 21 farms. Of the 210 samples, 16 (7.6%) were positive for L. monocytogenes. We recovered 80 L. monocytogenes isolates; 44 (55%) isolates were classified as serotype 1/2b and 36 (45%) were classified as serotype 4b. The isolates were susceptible to penicillin, ampicillin, amoxicillin, gentamicin, kanamycin, streptomycin, erythromycin, vancomycin, tetracycline, chloramphenicol, ciprofloxacin, and trimethoprim-sulfamethoxazole. Pulsed-field gel electrophoresis (PFGE) characterization of the 80 isolates revealed six PFGE types. Two PFGE types corresponded to human listeriosis cases. Most L. monocytogenes isolates possessed virulence-associated genes (actA, hly, iap, inlA, inlC, mpl, plcA, plcB, opuCA, prfA, and clpC). One PFGE type isolate possessed an epidemic clone II marker. Our findings suggest that isolates from bovine colostrum have the potential to cause human and animal listeriosis. This is the first study on the prevalence and characteristics of L. monocytogenes isolated from bovine colostrum obtained from dairy farms. Our results have important implications for improving public health and elucidating the epidemiology of L. monocytogenes in bovine colostrum.
Directory of Open Access Journals (Sweden)
U. B. Usman
2016-01-01
Full Text Available In this study, Listeria (L. monocytogenes isolated from milk and milk products in Kaduna, Nigeria, were subjected to a multiplex PCR assay to identify virulence-associated genes (such as prf A, inl A, hly A, act A, and iap. Of the 36 isolates, 9 (25% were positive for one or two virulence-associated genes. Based on the sample type, 6 (16.9% of the isolates that possessed virulence-associated genes were obtained from raw milk, 2 (3.2% from “Manshanu,” and 1 (2.8% from “Kindrimo.” Sequence and phylogenetic analysis based on the 16S rRNA revealed that Nigerian L. monocytogenes isolates (NGA 34A, NGA 35A, NGA 41A, and NGA 38A, when compared with reference L. monocytogenes, were grouped into two distinct clusters, A and B, with sequence (NGA 34A, NGA 35A, and NGA 41A phylogenetically closer to J1776; N1-011A; R2-502; J1816; and J2-031, whereas L. monocytogenes isolate (NGA 38A clustered with EDG; J1-220; J1926; J1817; and J2-1091. The separation of the Nigerian L. monocytogenes isolates into linage A (responsible for epidemic listeriosis and lineage B (responsible for sporadic cases of listeriosis is of public health concern and that local isolates might have potentials for human food borne listeriosis based on the virulence factors so far identified.
Wu, Shan; Zhang, Xiaofeng; Shuai, Jiangbing; Li, Ke; Yu, Huizhen; Jin, Chenchen
2016-07-04
To simplify the PNA-FISH (Peptide nucleic acid-fluorescence in situ hybridization) test, molecular beacon based PNA probe combined with fluorescence scanning detection technology was applied to replace the original microscope observation to detect Listeria monocytogenes The 5′ end and 3′ end of the L. monocytogenes specific PNA probes were labeled with the fluorescent group and the quenching group respectively, to form a molecular beacon based PNA probe. When PNA probe used for fluorescence scanning and N1 treatment as the control, the false positive rate was 11.4%, and the false negative rate was 0; when N2 treatment as the control, the false positive rate decreased to 4.3%, but the false negative rate rose to 18.6%. When beacon based PNA probe used for fluorescence scanning, taken N1 treatment as blank control, the false positive rate was 8.6%, and the false negative rate was 1.4%; taken N2 treatment as blank control, the false positive rate was 5.7%, and the false negative rate was 1.4%. Compared with PNA probe, molecular beacon based PNA probe can effectively reduce false positives and false negatives. The success rates of hybridization of the two PNA probes were 83.3% and 95.2% respectively; and the rates of the two beacon based PNA probes were 91.7% and 90.5% respectively, which indicated that labeling the both ends of the PNA probe dose not decrease the hybridization rate with the target bacteria. The combination of liquid phase PNA-FISH and fluorescence scanning method, can significantly improve the detection efficiency.
Møretrø, Trond; Schirmer, Bjørn C T; Heir, Even; Fagerlund, Annette; Hjemli, Pernille; Langsrud, Solveig
2017-01-16
The antibacterial effect of disinfectants is crucial for the control of Listeria monocytogenes in food processing environments. Tolerance of L. monocytogenes to sublethal levels of disinfectants based on quaternary ammonium compounds (QAC) is conferred by the resistance determinants qacH and bcrABC. The presence and distribution of these genes have been anticipated to have a role in the survival and growth of L. monocytogenes in food processing environments where QAC based disinfectants are in common use. In this study, a panel of 680 L. monocytogenes from nine Norwegian meat- and salmon processing plants were grouped into 36 MLVA profiles. The presence of qacH and bcrABC was determined in 101 isolates from the 26 most common MLVA profiles. Five MLVA profiles contained qacH and two contained bcrABC. Isolates with qacH and bcrABC showed increased tolerance to the QAC Benzalkonium chloride (BC), with minimal inhibitory concentrations (MICs) of 5-12, 10-13 and 100ppm). A sample with lower BC concentrations (14ppm of chain length C-12 and 2.7ppm of chain length C-14) inhibited growth of L. monocytogenes not containing bcrABC or qacH, compared to strains with these genes. The study has shown that L. monocytogenes harbouring the QAC resistance genes qacH and bcrABC are prevalent in the food industry and that residuals of QAC may be present in concentrations after sanitation in the industry that result in a growth advantage for bacteria with such resistance genes. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Wanessa Altimiras Costa
2009-12-01
Full Text Available Este estudo avaliou um sistema de biocontrole para inibição de Listeria monocytogenes em couve minimamente processada, objetivando sua segurança durante estocagem sob refrigeração e em condições de abuso de temperatura. O potencial inibitório de bactérias láticas tolerantes ao sal e psicrotróficas contaminantes naturais da couve e Lactobacillus plantarum, Lactobacillus delbrueckii ATCC 9649 e Lactobacillus casei CCT 1465 foram avaliadas contra L. monocytogenes. O isolado de couve identificado como P. acidilactici CCA3 inibiu L. monocytogenes a 10 e 15 °C em ágar MRS e foi selecionado como possível agente de biocontrole. O número de L. monocytogenes na couve minimamente processada aumentou 3,7 e 4,7 ciclos logarítmicos a 5 e 10 °C, respectivamente, após 20 dias de armazenamento e 4,6 ciclos logarítmicos após oito dias a 15 °C. Entretanto, quando 10(8 UFC.g-1 de P. acidilactici CCA3 foram inoculados no produto processado, o crescimento de L. monocytogenes reduziu 2,3 ciclos logarítmicos sob temperatura abusiva de 15 °C. A acidez titulável e as características sensoriais da couve não foram alteradas pela presença de CCA3 ao longo do período de vida útil. Estes resultados sugerem o potencial de aplicação dos bioconservantes na couve minimamente processada, que necessitam estar associados à refrigeração e sanitização para garantir segurança.This study evaluated a biological control system for the inhibition of Listeria monocytogenes in minimally processed kale focusing on its freshness under refrigeration and extreme temperatures. The inhibitory potential of salt and cold tolerant lactic bacteria from natural microflora of kale, Lactobacillus delbrueckii ATCC 9649, Lactobacillus plantarum, and Lactobacillus casei CCT 1465 strains were evaluated against L. monocytogenes. Pediococcus acidilactici CCA3 isolated from kale exhibited a large inhibition zone of L. monocytogenes at 10 and 15 °C in MRS agar and was
Listeria monocytogenes in Fresh Produce: Outbreaks, Prevalence and Contamination Levels
Directory of Open Access Journals (Sweden)
Qi Zhu
2017-03-01
Full Text Available Listeria monocytogenes, a member of the genus Listeria, is widely distributed in agricultural environments, such as soil, manure and water. This organism is a recognized foodborne pathogenic bacterium that causes many diseases, from mild gastroenteritis to severe blood and/or central nervous system infections, as well as abortion in pregnant women. Generally, processed ready-to-eat and cold-stored meat and dairy products are considered high-risk foods for L. monocytogenes infections that cause human illness (listeriosis. However, recently, several listeriosis outbreaks have been linked to fresh produce contamination around the world. Additionally, many studies have detected L. monocytogenes in fresh produce samples and even in some minimally processed vegetables. Thus L. monocytogenes may contaminate fresh produce if present in the growing environment (soil and water. Prevention of biofilm formation is an important control measure to reduce the prevalence and survival of L. monocytogenes in growing environments and on fresh produce. This article specifically focuses on fresh produce–associated listeriosis outbreaks, prevalence in growing environments, contamination levels of fresh produce, and associated fresh produce safety challenges.
Commensal microbes provide first line defense against Listeria monocytogenes infection
Littmann, Eric R.; Kim, Sohn G.; Morjaria, Sejal M.; Ling, Lilan; Gyaltshen, Yangtsho; Taur, Ying; Leiner, Ingrid M.
2017-01-01
Listeria monocytogenes is a foodborne pathogen that causes septicemia, meningitis and chorioamnionitis and is associated with high mortality. Immunocompetent humans and animals, however, can tolerate high doses of L. monocytogenes without developing systemic disease. The intestinal microbiota provides colonization resistance against many orally acquired pathogens, and antibiotic-mediated depletion of the microbiota reduces host resistance to infection. Here we show that a diverse microbiota markedly reduces Listeria monocytogenes colonization of the gut lumen and prevents systemic dissemination. Antibiotic administration to mice before low dose oral inoculation increases L. monocytogenes growth in the intestine. In immunodeficient or chemotherapy-treated mice, the intestinal microbiota provides nonredundant defense against lethal, disseminated infection. We have assembled a consortium of commensal bacteria belonging to the Clostridiales order, which exerts in vitro antilisterial activity and confers in vivo resistance upon transfer into germ free mice. Thus, we demonstrate a defensive role of the gut microbiota against Listeria monocytogenes infection and identify intestinal commensal species that, by enhancing resistance against this pathogen, represent potential probiotics. PMID:28588016
Listeria monocytogenes infection of HD11, chicken macrophage-like cells.
Jarvis, N A; Donaldson, J R; O'Bryan, C A; Ricke, S C; Crandall, P G
2017-04-01
Listeria monocytogenes can be carried by and infect poultry, although the clinical disease in birds is rare. Escape from macrophage phagocytosis is a key step in pathogenesis for L. monocytogenes. Therefore, we investigated the infection of the chicken macrophage-like cell line HD11 with 2 strains of L. monocytogenes EGD-e and Scott A. After infection, L. monocytogenes was quantified by spread plating and HD11 was quantified with trypan blue exclusion stain before enumeration. The standard macrophage killing protocols require washing the cell monolayers 3 times with PBS, which was found to negatively influence HD11 monolayers. Maximum bacterial densities within macrophages were not different between the 2 Listeria strains. HD11 required more than 11 h to effectively reduce intracellular L. monocytogenes Scott A, and Scott A was more susceptible to HD11 killing than EGD-e. It appears that Listeria infection initially causes attenuation of HD11 growth, and infected HD11 cells do not begin to lyse until at least 11 h post infection. These results suggest that there are subtle strain to strain differences in response to HD11 macrophage phagocytosis. The long lead-time required for HD11 to kill L. monocytogenes cells means that there is sufficient time available for chicken macrophages to circulate in the blood and transfer the intracellular Listeria to multiple tissues. © 2016 Poultry Science Association Inc.
Survival of Bactericidal Antibiotic Treatment by a Persister Subpopulation of Listeria monocytogenes
DEFF Research Database (Denmark)
Knudsen, Gitte Maegaard; Ng, Yin; Gram, Lone
2013-01-01
Listeria monocytogenes can cause the serious infection listeriosis, which despite antibiotic treatment has a high mortality. Understanding the response of L. monocytogenes to antibiotic exposure is therefore important to ensure treatment success. Some bacteria survive antibiotic treatment...... by formation of persisters, which are a dormant antibiotic-tolerant subpopulation. The purpose of this study was to determine whether L. monocytogenes can form persisters and how bacterial physiology affects the number of persisters in the population. A stationary-phase culture of L. monocytogenes was adjusted...... that eradication of persisters is possible. Our study adds L. monocytogenes to the list of bacterial species capable of surviving bactericidal antibiotics in a dormant stage, and this persister phenomenon should be borne in mind when developing treatment regimens....
Barre, Léna; Brasseur, Emilie; Doux, Camille; Lombard, Bertrand; Besse, Nathalie Gnanou
2015-06-01
For the enumeration of Listeria monocytogenes (L. monocytogenes) in food, a sensitive enumeration method has been recently developed. This method is based on a membrane filtration of the food suspension followed by transfer of the filter on a selective medium to enumerate L. monocytogenes. An evaluation of this method was performed with several categories of foods naturally contaminated with L. monocytogenes. The results obtained with this technique were compared with those obtained from the modified reference EN ISO 11290-2 method for the enumeration of L. monocytogenes in food, and are found to provide more precise results. In most cases, the filtration method enabled to examine a greater quantity of food thus greatly improving the sensitivity of the enumeration. However, it was hardly applicable to some food categories because of filtration problems and background microbiota interference. Copyright © 2014 Elsevier Ltd. All rights reserved.
Detection of Listeria Spp. and Listeria monocytogenes in vegetables ...
African Journals Online (AJOL)
This paper aimed to study the prevalence and antibiotic resistance pattern among Listeria monocytogenes in raw vegetables sourced from commercial farms and local farms in Terengganu. Thirteen types of vegetables investigated for the presence of L. monocytogenes using multiplex PCR and LAMP methods. Isolation of ...
Essential oils of thyme and Rosemary in the control of Listeria monocytogenes in raw beef
Directory of Open Access Journals (Sweden)
Maíra Maciel Mattos de Oliveira
2013-12-01
Full Text Available This study was developed in order to evaluate two alternatives for the control of Listeria monocytogenes in raw bovine meat pieces, both based on the use of Thymus vulgaris and Rosmarinus officinalis essential oils (EOs. The antilisterial activity of different concentrations of the EOs was tested in vitro using agar dilution and disk volatilization techniques. In addition, L. monocytogenes was inoculated in meat pieces, which were submerged in edible gelatin coatings containing 2% (v/v EOs or submitted to the vapor of EOs (0.74 μL.cm-3. L. monocytogenes was quantified after one, 48 and 96 hours of storage (7 °C. In the in vitro tests, the EO of T. vulgaris presented higher activity. The two options used (edible gelatin coating and vapor activity, in spite of exercising effects with differentiated behaviors, presented antibacterial activity against L. monocytogenes inoculated in raw bovine meat (p < 0.05. Greatest antibacterial activity were obtained in the experiment that used edible coatings containing EOs, at 48 hours of storage reductions in bacterial counts between 1.09 and 1.25 Log CFU.g-1 were obtained. In the vapor effect experiment, the EO of T. vulgaris caused the highest reduction in the population of bacteria inoculated in raw bovine meat (p < 0.05, 0.40 Log CFU.g-1 at 96 hours of storage. This study supplied important information regarding new and promising natural alternatives, based on the concept of active packaging, for the control of L. monocytogenes in the meat industry.
Early trigeminal nerve involvement in Listeria monocytogenes rhombencephalitis
DEFF Research Database (Denmark)
Karlsson, William K; Harboe, Zitta Barrella; Roed, Casper
2017-01-01
dysfunction on that side. In addition, we identified another 120 cases of Listeria rhombencephalitis following a systematic review. Cranial nerves VII, V, IX, and X, respectively, medulla oblongata, cerebellum and pons, were the most frequently involved brain structures. The present clinical and radiological...... findings corroborate earlier data from animal experiments, indicating that L. monocytogenes may be capable of retrograde intra-axonal migration along the cranial nerves. We suggest that in a subset of patients with rhombencephalitis L. monocytogenes enters the cerebellopontine angle through the trigeminal......Listeria monocytogenes is associated with rhombencephalitis. However, the exact mechanisms of brainstem invasion remains poorly understood. Here, we demonstrate clinical and radiological data suggesting that Listeria may invade the brainstem via the trigeminal nerve. Three females (41, 64 and 70...
Sugiri, Yoni Darmawan; Gölz, Greta; Meeyam, Tongkorn; Baumann, Maximilian P O; Kleer, Josef; Chaisowwong, Warangkhana; Alter, Thomas
2014-08-01
This study was conducted to determine the prevalence and quantify the number of Listeria monocytogenes in fresh chicken carcasses sold in traditional markets and supermarkets in Bandung, West Java, Indonesia, and to determine the antimicrobial resistance patterns of the isolated L. monocytogenes strains. The overall prevalence of L. monocytogenes in chicken carcasses was 15.8% (29/184). When comparing samples from traditional markets and supermarkets, no significant difference in the L. monocytogenes prevalence was detectable (15.2 versus 16.3%). Of the samples, 97.3% had L. monocytogenes counts study were grouped into the molecular serogroup IIb, comprising the serovars 1/2b, 3b, and 7.
Morphological Change and Decreasing Transfer Rate of Biofilm-Featured Listeria monocytogenes EGDe.
Lee, Yuejia; Wang, Chinling
2017-03-01
Listeria monocytogenes , a lethal foodborne pathogen, has the ability to resist the hostile food processing environment and thus frequently contaminates ready-to-eat foods during processing. It is commonly accepted that the tendency of L. monocytogenes ' to generate biofilms on various surfaces enhances its resistance to the harshness of the food processing environment. However, the role of biofilm formation in the transferability of L. monocytogenes EGDe remains controversial. We examined the growth of Listeria biofilms on stainless steel surfaces and their effect on the transferability of L. monocytogenes EGDe. The experiments were a factorial 2 × 2 design with at least three biological replicates. Through scanning electron microscopy, a mature biofilm with intensive aggregates of cells was observed on the surface of stainless steel after 3 or 5 days of incubation, depending on the initial level of inoculation. During biofilm development, L. monocytogenes EGDe carried out binary fission vigorously before a mature biofilm was formed and subsequently changed its cellular morphology from rod shaped to sphere shaped. Furthermore, static biofilm, which was formed after 3 days of incubation at 25°C, significantly inhibited the transfer rate of L. monocytogenes EGDe from stainless steel blades to 15 bologna slices. During 7 days of storage at 4°C, however, bacterial growth rate was not significantly impacted by whether bacteria were transferred from biofilm and the initial concentrations of transferred bacteria on the slice. In conclusion, this study is the first to report a distinct change in morphology of L. monocytogenes EGDe at the late stage of biofilm formation. More importantly, once food is contaminated by L. monocytogenes EGDe, contamination proceeds independently of biofilm development and the initial level of contamination when food is stored at 4°C, even if contamination with L. monocytogenes EGDe was initially undetectable before storage.
Listeria Monocytogenes Persistence in Ready-to-Eat Sausages and in Processing Plants.
Mureddu, Anna; Mazza, Roberta; Fois, Federica; Meloni, Domenico; Bacciu, Roberto; Piras, Francesca; Mazzette, Rina
2014-01-21
Listeria monocytogenes is of major concern in the fermented meat products and is able to persist in their processing environments. The aim of the present work was to evaluate the virulence profile and the persistence capacity of L. monocytogenes strains isolated in Sardinian fermented sausages processing plants. Food (ground meat, sausages at the end of acidification and ripening stage) and environmental samples (a total of n. 385), collected from 4 meat processing plants located in Sardinia (Italy), were examined to detect L. monocytogenes presence. All the L. monocytogenes isolates were identified by polymerase chain reaction (PCR) method. A subset of strains was also characterised by multiplex PCR-based serogrouping, using the lmo0737 , lmo1118 , ORF2819 and ORF2110 genes. Three different multiplex PCRs were used to obtain the virulence profiles by the rrn , hlyA , actA , prfA , inlA , inlB , iap , plcA , plcB and mpl marker genes. Furthermore, in vitro biofilm forming ability and resistance to disinfectants were carried out on microtiter plate. The overall prevalence was 31.5% in food, and 68.5% in environmental samples. The prevalent serotype resulted 1/2c (43%), followed by 1/2a (40%), 4b (8.6%), and 1/2b (8.6%). The amplification products of the virulence genes were found in all the isolates with the following prevalence: 77.1% hlyA ; 100% rrn ; 100% prfA ; 97.1% iap ; 65.7% inlB ; 88.6% inlA ; 100% plcA ; 100% plcB and 74.3% mpl . As for biofilm forming ability, 37.1% of the strains were positive and resulted weak producer, but all the isolates were sensible to disinfectants showing a reduction of L. monocytogenes growth after each incubation time. More appropriate technologies and application of measures of hygienic control should be implemented to prevent the L. monocytogenes growth and cross-contamination in salsiccia sarda processing plants.
Listeria monocytogenes persistence in ready-to-eat sausages and in processing plants
Directory of Open Access Journals (Sweden)
Anna Mureddu
2014-02-01
Full Text Available Listeria monocytogenes is of major concern in the fermented meat products and is able to persist in their processing environments. The aim of the present work was to evaluate the virulence profile and the persistence capacity of L. monocytogenes strains isolated in Sardinian fermented sausages processing plants. Food (ground meat, sausages at the end of acidification and ripening stage and environmental samples (a total of n. 385, collected from 4 meat processing plants located in Sardinia (Italy, were examined to detect L. monocytogenes presence. All the L. monocytogenes isolates were identified by polymerase chain reaction (PCR method. A subset of strains was also characterised by multiplex PCR-based serogrouping, using the lmo0737, lmo1118, ORF2819 and ORF2110 genes. Three different multiplex PCRs were used to obtain the virulence profiles by the rrn, hlyA, actA, prfA, inlA, inlB, iap, plcA, plcB and mpl marker genes. Furthermore, in vitro biofilm forming ability and resistance to disinfectants were carried out on microtiter plate. The overall prevalence was 31.5% in food, and 68.5% in environmental samples. The prevalent serotype resulted 1/2c (43%, followed by 1/2a (40%, 4b (8.6%, and 1/2b (8.6%. The amplification products of the virulence genes were found in all the isolates with the following prevalence: 77.1% hlyA; 100% rrn; 100% prfA; 97.1% iap; 65.7% inlB; 88.6% inlA; 100% plcA; 100% plcB and 74.3% mpl. As for biofilm forming ability, 37.1% of the strains were positive and resulted weak producer, but all the isolates were sensible to disinfectants showing a reduction of L. monocytogenes growth after each incubation time. More appropriate technologies and application of measures of hygienic control should be implemented to prevent the L. monocytogenes growth and crosscontamination in salsiccia sarda processing plants.
Weller, Daniel; Shiwakoti, Suvash; Bergholz, Peter; Grohn, Yrjo; Wiedmann, Martin
2015-01-01
Technological advancements, particularly in the field of geographic information systems (GIS), have made it possible to predict the likelihood of foodborne pathogen contamination in produce production environments using geospatial models. Yet, few studies have examined the validity and robustness of such models. This study was performed to test and refine the rules associated with a previously developed geospatial model that predicts the prevalence of Listeria monocytogenes in produce farms in New York State (NYS). Produce fields for each of four enrolled produce farms were categorized into areas of high or low predicted L. monocytogenes prevalence using rules based on a field's available water storage (AWS) and its proximity to water, impervious cover, and pastures. Drag swabs (n = 1,056) were collected from plots assigned to each risk category. Logistic regression, which tested the ability of each rule to accurately predict the prevalence of L. monocytogenes, validated the rules based on water and pasture. Samples collected near water (odds ratio [OR], 3.0) and pasture (OR, 2.9) showed a significantly increased likelihood of L. monocytogenes isolation compared to that for samples collected far from water and pasture. Generalized linear mixed models identified additional land cover factors associated with an increased likelihood of L. monocytogenes isolation, such as proximity to wetlands. These findings validated a subset of previously developed rules that predict L. monocytogenes prevalence in produce production environments. This suggests that GIS and geospatial models can be used to accurately predict L. monocytogenes prevalence on farms and can be used prospectively to minimize the risk of preharvest contamination of produce. PMID:26590280
Occurrence of Listeria monocytogenes in smoked fish in Sokoto ...
African Journals Online (AJOL)
The present study was conducted to determine the prevalence of Listeria monocytogenes in smoked fish in Sokoto, Nigeria. A total of 115 different species of smoked fish from the various retail outlets and market places within the metropolis were analysed for the presence of L. monocytogenes using ISO culture method.
A thermostable messenger RNA based vaccine against rabies.
Stitz, Lothar; Vogel, Annette; Schnee, Margit; Voss, Daniel; Rauch, Susanne; Mutzke, Thorsten; Ketterer, Thomas; Kramps, Thomas; Petsch, Benjamin
2017-12-01
Although effective rabies virus vaccines have been existing for decades, each year, rabies virus infections still cause around 50.000 fatalities worldwide. Most of these cases occur in developing countries, where these vaccines are not available. The reasons for this are the prohibitive high costs of cell culture or egg grown rabies virus vaccines and the lack of a functional cold chain in many regions in which rabies virus is endemic. Here, we describe the excellent temperature resistance of a non-replicating mRNA based rabies virus vaccine encoding the rabies virus glycoprotein (RABV-G). Prolonged storage of the vaccine from -80°C to up to +70°C for several months did not impact the protective capacity of the mRNA vaccine. Efficacy after storage was demonstrated by the induction of rabies specific virus neutralizing antibodies and protection in mice against lethal rabies infection. Moreover, storing the vaccine at oscillating temperatures between +4° and +56°C for 20 cycles in order to simulate interruptions of the cold chain during vaccine transport, did not affect the vaccine's immunogenicity and protective characteristics, indicating that maintenance of a cold chain is not essential for this vaccine.
Strengthening vaccination policies in Latin America: an evidence-based approach.
Tapia-Conyer, Roberto; Betancourt-Cravioto, Miguel; Saucedo-Martínez, Rodrigo; Motta-Murguía, Lourdes; Gallardo-Rincón, Héctor
2013-08-20
Despite many successes in the region, Latin American vaccination policies have significant shortcomings, and further work is needed to maintain progress and prepare for the introduction of newly available vaccines. In order to address the challenges facing Latin America, the Commission for the Future of Vaccines in Latin America (COFVAL) has made recommendations for strengthening evidence-based policy-making and reducing regional inequalities in immunisation. We have conducted a comprehensive literature review to assess the feasibility of these recommendations. Standardisation of performance indicators for disease burden, vaccine coverage, epidemiological surveillance and national health resourcing can ensure comparability of the data used to assess vaccination programmes, allowing deeper analysis of how best to provide services. Regional vaccination reference schemes, as used in Europe, can be used to develop best practice models for vaccine introduction and scheduling. Successful models exist for the continuous training of vaccination providers and decision-makers, with a new Latin American diploma aiming to contribute to the successful implementation of vaccination programmes. Permanent, independent vaccine advisory committees, based on the US Advisory Committee on Immunization Practices (ACIP), could facilitate the uptake of new vaccines and support evidence-based decision-making in the administration of national immunisation programmes. Innovative financing mechanisms for the purchase of new vaccines, such as advance market commitments and cost front-loading, have shown potential for improving vaccine coverage. A common regulatory framework for vaccine approval is needed to accelerate delivery and pool human, technological and scientific resources in the region. Finally, public-private partnerships between industry, government, academia and non-profit sectors could provide new investment to stimulate vaccine development in the region, reducing prices in the
Effekt av ulike desinfeksjonsstrategier mot Listeria monocytogenes
Fossmo, Sabine
2013-01-01
Kontroll med bakterier som Listeria utgjør en stor utfordring for mange matprodusenter. Listeria monocytogenes er hovedsakelig et produksjonshygienisk problem, forbedret hygiene kan derfor være tiltak for å redusere overlevelse og smitteoverføring av bakterien i produksjonsmiljø. Hensikten med forsøkene i oppgaven var å undersøke effekten av ulike desinfeksjonsstrategier på drap av L. monocytogenes, både når bakteriene var i biofilm og i suspensjon. Dette inkluderte bruk av tradisjonelle desi...
Day, J B; Basavanna, U
2015-04-01
Listeriosis, a disease contracted via the consumption of foods contaminated with pathogenic Listeria species, can produce severe symptoms and high mortality in susceptible people and animals. The development of molecular methods and immuno-based techniques for detection of pathogenic Listeria in foods has been challenging due to the presence of assay inhibiting food components. In this study, we utilize a macrophage cell culture system for the isolation and enrichment of Listeria monocytogenes and Listeria ivanovii from infant formula and leafy green vegetables for subsequent identification using the Luminex xMAP technique. Macrophage monolayers were exposed to infant formula, lettuce and celery contaminated with L. monocytogenes or L. ivanovii. Magnetic microspheres conjugated to Listeria specific antibody were used to capture Listeria from infected macrophages and then analyzed using the Bio-Plex 200 analyzer. As few as 10 CFU/mL or g of L. monocytogenes was detected in all foods tested. The detection limit for L. ivanovii was 10 CFU/mL in infant formula and 100 CFU/g in leafy greens. Microsphere bound Listeria obtained from infected macrophage lysates could also be isolated on selective media for subsequent confirmatory identification. This method presumptively identifies L. monocytogenes and L. ivanovii from infant formula, lettuce and celery in less than 28 h with confirmatory identifications completed in less than 48 h. Published by Elsevier Ltd.
Directory of Open Access Journals (Sweden)
N. Soultos
2014-11-01
Full Text Available Aim: In the current study, a contribution to the knowledge on the prevalence and level of contamination of Listeria monocytogenes in ready-to-eat (RTE seafood marketed in Thessaloniki (Northern Greece was provided; the serovar identity of the L. monocytogenes isolates was also determined. Materials and Methods: A total of 132 RTE seafood samples consisting of 74 smoked fish products, 18 salted fish products, 16 dried fish products, 9 raw marinated fish products, 10 cooked marinated cephalopods and 5 surimi crab stick products were analyzed. L. monocytogenes were isolated and enumerated based on ISO 11290-1/A1 and ISO 11290-2/A1 protocols, respectively, and identified using a multiplex polymerase chain reaction (PCR system utilizing genus and species specific primers. For the identification of serotypes a second multiplex PCR assay was used which clusters L. monocytogenes strains into four major serogroups. Results: Of the samples examined, 11 (8.3% proved positive for Listeria spp. with 8 (6.1% yielding L. monocytogenes. Only in one sample of smoked mackerel the level of L. monocytogenes exceeded the legal safety limit of 100 cfu/g set out in Commission Regulation (EC No. 1441/2007. Serotyping showed higher percentages of isolates belonging to PCR serogroup 3:1/2b, 3b, 7 (46.7% and serogroup 1:1/2a, 3a (40% followed by serogroup 4:4b, 4d, 4e (13.3%. Conclusion: This study demonstrated that L. monocytogenes can be isolated from processed RTE seafood products at retail in Thessaloniki (Northern Greece in low concentrations. However, the presence of this human pathogen in RTE seafood should not be overlooked, but it should be considered as having significance public health implications, particularly among the persons who are at greater risk. Therefore, RTE seafood should be produced under appropriate hygienic and technological conditions since the product does not undergo any treatment before consumption.
Monitoring paneer for Listeria monocytogenes - A high risk food ...
African Journals Online (AJOL)
A multiplex polymerase chain reaction (PCR) assay was developed and applied to spiked and natural paneer samples to detect Listeria monocytogenes, a high risk food pathogen. The sensitivity of the assay on L. monocytogenes spiked paneer samples was 104 cells prior to enrichment, was improved to 103 cells after 4 h ...
Genome sequences of Listeria monocytogenes strains with resistance to arsenic
Listeria monocytogenes frequently exhibits resistance to arsenic. We report here the draft genome sequences of eight genetically diverse arsenic-resistant L. monocytogenes strains from human listeriosis and food-associated environments. Availability of these genomes would help to elucidate the role ...
Effects of prebiotics on the infective potential of Listeria monocytogenes
DEFF Research Database (Denmark)
Ebersbach, Tine
% xylooligosaccharides (XOS), galactooligosaccharides (GOS), inulin, apple pectin or polydextrose for three weeks before oral challenge with L. monocytogenes. XOS and GOS significantly improved resistance of guinea pigs to L. monocytogenes, while inulin and apple pectin decreased the resistance. No significant effect...
Ericson, Megan E.; Frank, Matthew W.
2016-01-01
Enoyl-acyl carrier protein reductase catalyzes the last step in each elongation cycle of type II bacterial fatty acid synthesis and is a key regulatory protein in bacterial fatty acid synthesis. Genes of the facultative intracellular pathogen Listeria monocytogenes encode two functional enoyl-acyl carrier protein isoforms based on their ability to complement the temperature-sensitive growth phenotype of Escherichia coli strain JP1111 [fabI(Ts)]. The FabI isoform was inactivated by the FabI selective inhibitor AFN-1252, but the FabK isoform was not affected by the drug, as expected. Inhibition of FabI by AFN-1252 decreased endogenous fatty acid synthesis by 80% and lowered the growth rate of L. monocytogenes in laboratory medium. Robust exogenous fatty acid incorporation was not detected in L. monocytogenes unless the pathway was partially inactivated by AFN-1252 treatment. However, supplementation with exogenous fatty acids did not restore normal growth in the presence of AFN-1252. FabI inactivation prevented the intracellular growth of L. monocytogenes, showing that neither FabK nor the incorporation of host cellular fatty acids was sufficient to support the intracellular growth of L. monocytogenes. Our results show that FabI is the primary enoyl-acyl carrier protein reductase of type II bacterial fatty acid synthesis and is essential for the intracellular growth of L. monocytogenes. PMID:27736774
Restraining reactive oxygen species in Listeria monocytogenes promotes the apoptosis of glial cells.
Li, Sen; Li, Yixuan; Chen, Guowei; Zhang, Jingchen; Xu, Fei; Wu, Man
2017-07-01
Listeria monocytogenes is a facultative anaerobic foodborne pathogen that can traverse the blood-brain barrier and cause brain infection. L. monocytogenes infection induces host cell apoptosis in several cell types. In this study, we investigated the apoptosis of human glioma cell line U251 invaded by L. monocytogenes and evaluated the function of bacterial reactive oxygen species (ROS) during infection. Bacterial ROS level was reduced by carrying out treatment with N-acetyl cysteine (NAC) and diphenyleneiodonium chloride (DPI). After infection, the apoptosis of U251 cells was examined by flow cytometry assay and propidium iodide staining. DPI and NAC efficiently decreased ROS level in L. monocytogenes without affecting bacterial growth. Moreover, the apoptosis of glial cells was enhanced upon invasion of DPI- and NAC-pretreated L. monocytogenes. Results indicate that the apoptosis of glial cells can be induced by L. monocytogenes, and that the inhibition of bacterial ROS increases the apoptosis of host cells.
Listeria monocytogenes internalizes in Romaine Lettuce grown in greenhouse conditions
Listeria monocytogenes has been implicated in a number of outbreaks involving fresh produce, including an outbreak in 2016 resulting from contaminated packaged salads. The persistence and internalization potential of L. monocytogenes in romaine lettuce was evaluated, and the persistence of two L. mo...
Updates on the web-based VIOLIN vaccine database and analysis system.
He, Yongqun; Racz, Rebecca; Sayers, Samantha; Lin, Yu; Todd, Thomas; Hur, Junguk; Li, Xinna; Patel, Mukti; Zhao, Boyang; Chung, Monica; Ostrow, Joseph; Sylora, Andrew; Dungarani, Priya; Ulysse, Guerlain; Kochhar, Kanika; Vidri, Boris; Strait, Kelsey; Jourdian, George W; Xiang, Zuoshuang
2014-01-01
The integrative Vaccine Investigation and Online Information Network (VIOLIN) vaccine research database and analysis system (http://www.violinet.org) curates, stores, analyses and integrates various vaccine-associated research data. Since its first publication in NAR in 2008, significant updates have been made. Starting from 211 vaccines annotated at the end of 2007, VIOLIN now includes over 3240 vaccines for 192 infectious diseases and eight noninfectious diseases (e.g. cancers and allergies). Under the umbrella of VIOLIN, >10 relatively independent programs are developed. For example, Protegen stores over 800 protective antigens experimentally proven valid for vaccine development. VirmugenDB annotated over 200 'virmugens', a term coined by us to represent those virulence factor genes that can be mutated to generate successful live attenuated vaccines. Specific patterns were identified from the genes collected in Protegen and VirmugenDB. VIOLIN also includes Vaxign, the first web-based vaccine candidate prediction program based on reverse vaccinology. VIOLIN collects and analyzes different vaccine components including vaccine adjuvants (Vaxjo) and DNA vaccine plasmids (DNAVaxDB). VIOLIN includes licensed human vaccines (Huvax) and veterinary vaccines (Vevax). The Vaccine Ontology is applied to standardize and integrate various data in VIOLIN. VIOLIN also hosts the Ontology of Vaccine Adverse Events (OVAE) that logically represents adverse events associated with licensed human vaccines.
Prospects of HA-Based Universal Influenza Vaccine
Directory of Open Access Journals (Sweden)
Anwar M. Hashem
2015-01-01
Full Text Available Current influenza vaccines afford substantial protection in humans by inducing strain-specific neutralizing antibodies (Abs. Most of these Abs target highly variable immunodominant epitopes in the globular domain of the viral hemagglutinin (HA. Therefore, current vaccines may not be able to induce heterosubtypic immunity against the divergent influenza subtypes. The identification of broadly neutralizing Abs (BnAbs against influenza HA using recent technological advancements in antibody libraries, hybridoma, and isolation of single Ab-secreting plasma cells has increased the interest in developing a universal influenza vaccine as it could provide life-long protection. While these BnAbs can serve as a source for passive immunotherapy, their identification represents an important step towards the design of such a universal vaccine. This review describes the recent advances and approaches used in the development of universal influenza vaccine based on highly conserved HA regions identified by BnAbs.
Growth inhibition of Listeria monocytogenes by a nonbacteriocinogenic Carnobacterium piscicola
DEFF Research Database (Denmark)
Nilsson, Lilian; Bech Hansen, T.; Garrido, P.
2005-01-01
Aims: This study elucidates the mechanisms by which a nonbacteriocinogenic Carnobacterium piscicola inhibits growth of Listeria monocytogenes. Methods and Results: Listeria monocytogenes was exposed to live cultures of a bacteriocin-negative variant of C. piscicola A9b in co-culture, in a diffusion...... chamber system, and to a cell-free supernatant. Suppression of maximum cell density (0-3.5 log units) of L. monocytogenes was proportional to initial levels of C. pisciola (10(3)-10(7) CFU ml(-1)). Cell-to-cell contact was not required to cause inhibition. The cell-free C. piscicola supernatant caused...... a decrease in L. monocytogenes maximum cell density, which was abolished by glucose addition but not by amino acid, vitamin or mineral addition. The fermentate also gave rise to a longer lag phase and a reduction in growth rate. These effects were independent of glucose and may have been caused by acetate...
Prevalence and serotypes of Listeria monocytogenes contamination in Chinese beef processing plants.
Zhu, Lixian; Feng, Xiaohui; Zhang, Lihua; Zhu, Ruiliang; Luo, Xin
2012-06-01
The aim of this work was to study the epidemiology of Listeria spp., particularly Listeria monocytogenes, and to identify the serotypes present in contaminated samples from beef processing plants in China. A total of 439 samples were obtained from bovine feces, hides, and carcasses at three commercial processing plants. A standard protocol (ISO 11290-1) was followed to detect Listeria spp. and L. monocytogenes, and multiplex polymerase chain reaction was used to identify the various L. monocytogenes serotypes. The overall prevalences of Listeria spp. and L. monocytogenes were 65.6% and 26.4%, respectively, and the contamination was highest in the hide samples. The identified L. monocytogenes serotypes were 1/2c and 1/2a. The results of the current study indicate that Listeria spp. contamination is common in Chinese beef processing plants; specific measures should be taken to prevent and/or treat L. monocytogenes contamination of feces and hides in beef slaughter plants. Furthermore, because Listeria spp. contamination was found to be prevalent, it should, therefore, be studied further. The prevention of cases of sporadic listeriosis in China should also be addressed.
Weller, Daniel; Shiwakoti, Suvash; Bergholz, Peter; Grohn, Yrjo; Wiedmann, Martin; Strawn, Laura K
2016-02-01
Technological advancements, particularly in the field of geographic information systems (GIS), have made it possible to predict the likelihood of foodborne pathogen contamination in produce production environments using geospatial models. Yet, few studies have examined the validity and robustness of such models. This study was performed to test and refine the rules associated with a previously developed geospatial model that predicts the prevalence of Listeria monocytogenes in produce farms in New York State (NYS). Produce fields for each of four enrolled produce farms were categorized into areas of high or low predicted L. monocytogenes prevalence using rules based on a field's available water storage (AWS) and its proximity to water, impervious cover, and pastures. Drag swabs (n = 1,056) were collected from plots assigned to each risk category. Logistic regression, which tested the ability of each rule to accurately predict the prevalence of L. monocytogenes, validated the rules based on water and pasture. Samples collected near water (odds ratio [OR], 3.0) and pasture (OR, 2.9) showed a significantly increased likelihood of L. monocytogenes isolation compared to that for samples collected far from water and pasture. Generalized linear mixed models identified additional land cover factors associated with an increased likelihood of L. monocytogenes isolation, such as proximity to wetlands. These findings validated a subset of previously developed rules that predict L. monocytogenes prevalence in produce production environments. This suggests that GIS and geospatial models can be used to accurately predict L. monocytogenes prevalence on farms and can be used prospectively to minimize the risk of preharvest contamination of produce. Copyright © 2016, American Society for Microbiology. All Rights Reserved.
Survival strategies of Listeria monocytogenes - roles of regulators and transporters
Wemekamp-Kamphuis, H.H.
2003-01-01
Outbreaks of the food-borne pathogen Listeria monocytogenes are mainly associated with ready-to-eatfoods. Survival strategies of L. monocytogenes in relation to minimally processed foods were studied.
Oyarzún, Patricio; Kobe, Bostjan
2016-03-03
Novel vaccination approaches based on rational design of B- and T-cell epitopes - epitope-based vaccines - are making progress in the clinical trial pipeline. The epitope-focused recombinant protein-based malaria vaccine (termed RTS,S) is a next-generation approach that successfully reached phase-III trials, and will potentially become the first commercial vaccine against a human parasitic disease. Progress made on methods such as recombinant DNA technology, advanced cell-culture techniques, immunoinformatics and rational design of immunogens are driving the development of these novel concepts. Synthetic recombinant proteins comprising both B- and T-cell epitopes can be efficiently produced through modern biotechnology and bioprocessing methods, and can enable the induction of large repertoires of immune specificities. In particular, the inclusion of appropriate CD4+ T-cell epitopes is increasingly considered a key vaccine component to elicit robust immune responses, as suggested by results coming from HIV-1 clinical trials. In silico strategies for vaccine design are under active development to address genetic variation in pathogens and several broadly protective "universal" influenza and HIV-1 vaccines are currently at different stages of clinical trials. Other methods focus on improving population coverage in target populations by rationally considering specificity and prevalence of the HLA proteins, though a proof-of-concept in humans has not been demonstrated yet. Overall, we expect immunoinformatics and bioprocessing methods to become a central part of the next-generation epitope-based vaccine development and production process.
Ontology-Based Vaccine Adverse Event Representation and Analysis.
Xie, Jiangan; He, Yongqun
2017-01-01
Vaccine is the one of the greatest inventions of modern medicine that has contributed most to the relief of human misery and the exciting increase in life expectancy. In 1796, an English country physician, Edward Jenner, discovered that inoculating mankind with cowpox can protect them from smallpox (Riedel S, Edward Jenner and the history of smallpox and vaccination. Proceedings (Baylor University. Medical Center) 18(1):21, 2005). Based on the vaccination worldwide, we finally succeeded in the eradication of smallpox in 1977 (Henderson, Vaccine 29:D7-D9, 2011). Other disabling and lethal diseases, like poliomyelitis and measles, are targeted for eradication (Bonanni, Vaccine 17:S120-S125, 1999).Although vaccine development and administration are tremendously successful and cost-effective practices to human health, no vaccine is 100% safe for everyone because each person reacts to vaccinations differently given different genetic background and health conditions. Although all licensed vaccines are generally safe for the majority of people, vaccinees may still suffer adverse events (AEs) in reaction to various vaccines, some of which can be serious or even fatal (Haber et al., Drug Saf 32(4):309-323, 2009). Hence, the double-edged sword of vaccination remains a concern.To support integrative AE data collection and analysis, it is critical to adopt an AE normalization strategy. In the past decades, different controlled terminologies, including the Medical Dictionary for Regulatory Activities (MedDRA) (Brown EG, Wood L, Wood S, et al., Drug Saf 20(2):109-117, 1999), the Common Terminology Criteria for Adverse Events (CTCAE) (NCI, The Common Terminology Criteria for Adverse Events (CTCAE). Available from: http://evs.nci.nih.gov/ftp1/CTCAE/About.html . Access on 7 Oct 2015), and the World Health Organization (WHO) Adverse Reactions Terminology (WHO-ART) (WHO, The WHO Adverse Reaction Terminology - WHO-ART. Available from: https://www.umc-products.com/graphics/28010.pdf
Prevalence of Listeria monocytogenes in raw milk in North Lebanon
International Nuclear Information System (INIS)
Al Kassaa, I; El Omari, Kh.; Esmail, B.; Hamze, M; Saati, M.
2016-01-01
Listeriosis, although a zoonosis, is an invasive disease that can affect newborns, pregnant women and immunocompromised adults. Clinical manifestations can be expressedby febrile gastroenteritis, invasive forms including severe sepsis, meningitis, rhombencephalitis, prenatal infections and abortions. Species of Listeria bacteria are ubiquitous and adaptableto the environment in animal and plant foods. This study aimed to determine the prevalence of Listeria monocytogenes in 100 samples of fresh cow milk collected from different areas of North Lebanon. Listeria monocytogenes was detected by using the Grand VIDAS technique (Biomérieux France). The results obtained revealed the absence of Listeria monocytogenes inall analyzed samples. (Author)
Prebiotic Oligosaccharides Potentiate Host Protective Responses against L. Monocytogenes Infection
Directory of Open Access Journals (Sweden)
Poyin Chen
2017-12-01
Full Text Available Prebiotic oligosaccharides are used to modulate enteric pathogens and reduce pathogen shedding. The interactions with prebiotics that alter Listeria monocytogenes infection are not yet clearly delineated. L. monocytogenes cellular invasion requires a concerted manipulation of host epithelial cell membrane receptors to initiate internalization and infection often via receptor glycosylation. Bacterial interactions with host glycans are intimately involved in modulating cellular responses through signaling cascades at the membrane and in intracellular compartments. Characterizing the mechanisms underpinning these modulations is essential for predictive use of dietary prebiotics to diminish pathogen association. We demonstrated that human milk oligosaccharide (HMO pretreatment of colonic epithelial cells (Caco-2 led to a 50% decrease in Listeria association, while Biomos pretreatment increased host association by 150%. L. monocytogenes-induced gene expression changes due to oligosaccharide pretreatment revealed global alterations in host signaling pathways that resulted in differential subcellular localization of L. monocytogenes during early infection. Ultimately, HMO pretreatment led to bacterial clearance in Caco-2 cells via induction of the unfolded protein response and eIF2 signaling, while Biomos pretreatment resulted in the induction of host autophagy and L. monocytogenes vacuolar escape earlier in the infection progression. This study demonstrates the capacity of prebiotic oligosaccharides to minimize infection through induction of host-intrinsic protective responses.
Tolvanen, Riina; Lundén, Janne; Hörman, Ari; Korkeala, Hannu
2009-02-01
Ultrasonic cleaning of a conveyor belt was studied by building a pilot-scale conveyor with an ultrasonic cleaning bath. A piece of the stainless steel conveyor belt was contaminated with meat-based soil and Listeria monocytogenes strains (V1, V3, and B9) and incubated for 72 h to allow bacteria to attach to the conveyor belt surfaces. The effect of ultrasound with a potassium hydroxide-based cleaning detergent was determined by using the cleaning bath at 45 and 50 degrees C for 30 s with and without ultrasound. The detachment of L. monocytogenes from the conveyor belt caused by the ultrasonic treatment was significantly greater at 45 degrees C (independent samples t test, P conveyor belt is effective even with short treatment times.
Rocha, Cláudia E; Mol, Juliana P S; Garcia, Luize N N; Costa, Luciana F; Santos, Renato L; Paixão, Tatiane A
2017-01-01
Listeria monocytogenes is a Gram-positive, facultative intracellular and invasive bacterium that has tropism to the placenta, and causes fetal morbidity and mortality in several mammalian species. While infection with L. monocytogenes and L. ivanovii are known as important causes of abortion and reproductive failure in cattle, the pathogenesis of maternal-fetal listeriosis in this species is poorly known. This study used the bovine chorioallantoic membrane explant model to investigate the kinetics of L. monocytogenes, L. ivanovii, and L. innocua infections in bovine trophoblastic cells for up to 8 h post infection. L. monocytogenes and L. ivanovii were able to invade and multiply in trophoblastic cells without causing cell death or inducing expression of pro-inflammatory genes. Although L. innocua was unable to multiply in bovine trophoblastic cells, it induced transcription of the pro-inflammatory mediator CXCL6. This study demonstrated for the first time the susceptibility of bovine trophoblastic cells to L. monocytogenes and L. ivanovii infection.
Directory of Open Access Journals (Sweden)
Cronin Michael
2008-06-01
Full Text Available Abstract Background The foodborne, gram-positive pathogen, Listeria monocytogenes, is capable of causing lethal infections in compromised individuals. In the post genomic era of L. monocytogenes research, techniques are required to identify and validate genes involved in the pathogenicity and environmental biology of the organism. The aim here was to develop a widely applicable method to tag L. monocytogenes strains, with a particular emphasis on the development of multiple strain competitive index assays. Results We have constructed a new site-specific integrative vector, pIMC, based on pPL2, for the selection of L. monocytogenes from complex samples. The pIMC vector was further modified through the incorporation of IPTG inducible markers (antibiotic and phenotypic to produce a suite of four vectors which allowed the discrimination of multiple strains from a single sample. We were able to perform murine infection studies with up to four EGDe isolates within a single mouse and showed that the tags did not impact upon growth rate or virulence. The system also allowed the identification of subtle differences in virulence between strains of L. monocytogenes commonly used in laboratory studies. Conclusion This study has developed a competitive index assay that can be broadly applied to all L. monocytogenes strains. Improved statistical robustness of the data was observed, resulting in fewer mice being required for virulence assays. The competitive index assays provide a powerful method to analyse the virulence or fitness of L. monocytogenes in complex biological samples.
Parameter optimization toward optimal microneedle-based dermal vaccination.
van der Maaden, Koen; Varypataki, Eleni Maria; Yu, Huixin; Romeijn, Stefan; Jiskoot, Wim; Bouwstra, Joke
2014-11-20
Microneedle-based vaccination has several advantages over vaccination by using conventional hypodermic needles. Microneedles are used to deliver a drug into the skin in a minimally-invasive and potentially pain free manner. Besides, the skin is a potent immune organ that is highly suitable for vaccination. However, there are several factors that influence the penetration ability of the skin by microneedles and the immune responses upon microneedle-based immunization. In this study we assessed several different microneedle arrays for their ability to penetrate ex vivo human skin by using trypan blue and (fluorescently or radioactively labeled) ovalbumin. Next, these different microneedles and several factors, including the dose of ovalbumin, the effect of using an impact-insertion applicator, skin location of microneedle application, and the area of microneedle application, were tested in vivo in mice. The penetration ability and the dose of ovalbumin that is delivered into the skin were shown to be dependent on the use of an applicator and on the microneedle geometry and size of the array. Besides microneedle penetration, the above described factors influenced the immune responses upon microneedle-based vaccination in vivo. It was shown that the ovalbumin-specific antibody responses upon microneedle-based vaccination could be increased up to 12-fold when an impact-insertion applicator was used, up to 8-fold when microneedles were applied over a larger surface area, and up to 36-fold dependent on the location of microneedle application. Therefore, these influencing factors should be considered to optimize microneedle-based dermal immunization technologies. Copyright © 2014 Elsevier B.V. All rights reserved.
Skowron, Krzysztof; Kwiecińska-Piróg, Joanna; Grudlewska, Katarzyna; Świeca, Agnieszka; Paluszak, Zbigniew; Bauza-Kaszewska, Justyna; Wałecka-Zacharska, Ewa; Gospodarek-Komkowska, Eugenia
2018-06-13
The aim of this research was to investigate the occurrence of Listeria monocytogenes in fish and fish processing plant and to determine their transmission, virulence and antibiotic resistance. L. monocytogenes was isolated according to the ISO 11290-1. The identification of L. monocytogenes was confirmed by multiplex PCR method. Genetic similarity of L. monocytogenes strains was determined with the Pulsed-Filed Gene Electrophoresis (PFGE) method. The multiplex PCR was used for identification of L. monocytogenes serogroups and detection of selected virulence genes (actA, fbpA, hlyA, iap, inlA, inlB, mpl, plcA, plcB, prfA). The L. monocytogens isolates susceptibility to penicillin, ampicillin, meropenem, erythromycin, trimethoprim/sulfamethoxazole was evaluated with disc diffusion method according to EUCAST v. 7.1. The presence of 237 L. monocytogenes isolates (before genetic similarity assessment) in 614 examined samples was confirmed. After strain differentiation by PFGE techniques the presence of 161 genetically different strains were confirmed. The genetic similarity of the examined isolates suggested that the source of the L. monocytogenes strains were fishes originating from farms. All tested strains possessed all detected virulence genes. Among examined strains, the most (26, 38.6%) belonged to the group 1/2a-3a. The most of tested strains were resistant to erythromycin (47.1%) and trimethoprim/sulfamethoxazole (47.1%). Copyright © 2018. Published by Elsevier B.V.
Spontaneous Loss of Virulence in Natural Populations of Listeria monocytogenes.
Maury, Mylène M; Chenal-Francisque, Viviane; Bracq-Dieye, Hélène; Han, Lei; Leclercq, Alexandre; Vales, Guillaume; Moura, Alexandra; Gouin, Edith; Scortti, Mariela; Disson, Olivier; Vázquez-Boland, José A; Lecuit, Marc
2017-11-01
The pathogenesis of Listeria monocytogenes depends on the ability of this bacterium to escape from the phagosome of the host cells via the action of the pore-forming toxin listeriolysin O (LLO). Expression of the LLO-encoding gene ( hly ) requires the transcriptional activator PrfA, and both hly and prfA genes are essential for L. monocytogenes virulence. Here, we used the hemolytic activity of LLO as a phenotypic marker to screen for spontaneous virulence-attenuating mutations in L. monocytogenes Sixty nonhemolytic isolates were identified among a collection of 57,820 confirmed L. monocytogenes strains isolated from a variety of sources (0.1%). In most cases (56/60; 93.3%), the nonhemolytic phenotype resulted from nonsense, missense, or frameshift mutations in prfA Five strains carried hly mutations leading to a single amino acid substitution (G299V) or a premature stop codon causing strong virulence attenuation in mice. In one strain, both hly and gshF (encoding a glutathione synthase required for full PrfA activity) were missing due to genomic rearrangements likely caused by a transposable element. The PrfA/LLO loss-of-function (PrfA - /LLO - ) mutants belonged to phylogenetically diverse clades of L. monocytogenes , and most were identified among nonclinical strains (57/60). Consistent with the rare occurrence of loss-of-virulence mutations, we show that prfA and hly are under purifying selection. Although occurring at a low frequency, PrfA - /LLO - mutational events in L. monocytogenes lead to niche restriction and open an evolutionary path for obligate saprophytism in this facultative intracellular pathogen. Copyright © 2017 Maury et al.
Directory of Open Access Journals (Sweden)
Ryan Chong
Full Text Available Intracellular bacterial pathogens, such as Listeria monocytogenes and Rickettsia conorii display actin-based motility in the cytosol of infected cells and spread from cell to cell through the formation of membrane protrusions at the cell cortex. Whereas the mechanisms supporting cytosolic actin-based motility are fairly well understood, it is unclear whether specific host factors may be required for supporting the formation and resolution of membrane protrusions. To address this gap in knowledge, we have developed high-throughput fluorescence microscopy and computer-assisted image analysis procedures to quantify pathogen spread in human epithelial cells. We used the approach to screen a siRNA library covering the human kinome and identified 7 candidate kinases whose depletion led to severe spreading defects in cells infected with L. monocytogenes. We conducted systematic validation procedures with redundant silencing reagents and confirmed the involvement of the serine/threonine kinases, CSNK1A1 and CSNK2B. We conducted secondary assays showing that, in contrast with the situation observed in CSNK2B-depleted cells, L. monocytogenes formed wild-type cytosolic tails and displayed wild-type actin-based motility in the cytosol of CSNK1A1-depleted cells. Furthermore, we developed a protrusion formation assay and showed that the spreading defect observed in CSNK1A1-depleted cells correlated with the formation of protrusion that did not resolve into double-membrane vacuoles. Moreover, we developed sending and receiving cell-specific RNAi procedures and showed that CSNK1A was required in the sending cells, but was dispensable in the receiving cells, for protrusion resolution. Finally, we showed that the observed defects were specific to Listeria monocytogenes, as Rickettsia conorii displayed wild-type cell-to-cell spread in CSNK1A1- and CSNK2B-depleted cells. We conclude that, in addition to the specific host factors supporting cytosolic actin-based
Efficacy of chlorine dioxide against Listeria monocytogenes in brine chilling solutions.
Valderrama, W B; Mills, E W; Cutter, C N
2009-11-01
Chilled brine solutions are used by the food industry to rapidly cool ready-to-eat meat products after cooking and before packaging. Chlorine dioxide (ClO(2)) was investigated as an antimicrobial additive to eliminate Listeria monocytogenes. Several experiments were performed using brine solutions made of sodium chloride (NaCl) and calcium chloride (CaCl(2)) inoculated with L. monocytogenes and/or treated with 3 ppm of ClO(2). First, 10 and 20% CaCl(2) and NaCl solutions (pH 7.0) were inoculated with a five-strain cocktail of L. monocytogenes to obtain approximately 7 log CFU/ml and incubated 8 h at 0 degrees C. The results demonstrated that L. monocytogenes survived in 10% CaCl(2), 10 and 20% NaCl, and pure water. L. monocytogenes levels were reduced approximately 1.2 log CFU/ml in 20% CaCl(2). Second, inoculated ( approximately 7 log CFU/ml) brine solutions (10 and 20% NaCl and 10% CaCl(2)) treated with 3 ppm of ClO(2) resulted in a approximately 4-log reduction of the pathogen within 90 s. The same was not observed in a solution of 20% CaCl(2); further investigation demonstrated that high levels of divalent cations interfere with the disinfectant. Spent brine solutions from hot dog and ham chilling were treated with ClO(2) at concentrations of 3 or 30 ppm. At these concentrations, ClO(2) did not reduce L. monocytogenes. Removal of divalent cations and organic material in brine solutions prior to disinfection with ClO(2) should be investigated to improve the efficacy of the compound against L. monocytogenes. The information from this study may be useful to processing establishments and researchers who are investigating antimicrobials in chilling brine solutions.
Stea, Emma C; Purdue, Laura M; Jamieson, Rob C; Yost, Chris K; Truelstrup Hansen, Lisbeth
2015-06-01
Foods and related processing environments are commonly contaminated with the pathogenic Listeria monocytogenes. To investigate potential environmental reservoirs of Listeria spp. and L. monocytogenes, surface water and point source pollution samples from an urban and a rural municipal water supply watershed in Nova Scotia, Canada, were examined over 18 months. Presumptive Listeria spp. were cultured from 72 and 35% of rural and urban water samples, respectively, with 24% of the positive samples containing two or three different Listeria spp. The L. innocua (56%) and L. welshimeri (43%) groups were predominant in the rural and urban watersheds, respectively. Analysis by the TaqMan assay showed a significantly (P monocytogenes of 62% versus 17% by the culture-based method. Both methods revealed higher prevalences in the rural watershed and during the fall and winter seasons. Elevated Escherichia coli (≥ 100 CFU/100 ml) levels were not associated with the pathogen regardless of the detection method. Isolation of Listeria spp. were associated with 70 times higher odds of isolating L. monocytogenes (odds ratio = 70; P monocytogenes isolates, followed by IVb (16.1%), IIb (15.8%), and IIc (0.4%). L. monocytogenes was detected in cow feces and raw sewage but not in septic tank samples. Pulsotyping of representative water (n = 54) and local human (n = 19) isolates suggested genetic similarities among some environmental and human L. monocytogenes isolates. In conclusion, temperate surface waters contain a diverse Listeria species population and could be a potential reservoir for L. monocytogenes, especially in rural agricultural watersheds. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Review of Prosthetic Joint Infection from Listeria monocytogenes.
Bader, Gilbert; Al-Tarawneh, Mohammed; Myers, James
2016-12-01
Prosthetic joint infection from Listeria monocytogenes is rare. We decided to shed light on this illness and review the reported cases to better understand its characteristics. We conducted a comprehensive review of the English literature using PubMed. We also included one case that we had managed. We found 25 cases of prosthetic joint infection from L. monocytogenes reported individually and a retrospective study of 43 cases of joint and bone listerial infection, including 34 with prosthetic joint infection, conducted in France. We have described their clinical and para-clinical features and tried to elaborate on the pathophysiology, treatment, and prevention. Prosthetic joint infection from L. monocytogenes is mainly late. Systemic inflammation may be absent. Although rare, it must be suspected in patients at high risk for both prosthetic joint and listerial infections. In addition, those patients must be instructed on appropriate preventive measures.
Animal models for oral transmission of Listeria monocytogenes
Directory of Open Access Journals (Sweden)
Sarah E F D'Orazio
2014-02-01
Full Text Available Listeria monocytogenes has been recognized as a food borne pathogen in humans since the 1980s, but we still understand very little about oral transmission of L. monocytogenes or the host factors that determine susceptibility to gastrointestinal infection, due to the lack of an appropriate small animal model of oral listeriosis. Early feeding trials suggested that many animals were highly resistant to oral infection, and the more reproducible intravenous or intraperitoneal routes of inoculation soon came to be favored. There are a fair number of previously published studies using an oral infection route, but the work varies widely in terms of bacterial strain choice, the methods used for oral transmission, and various manipulations used to enhance infectivity. This mini review will summarize the published literature using oral routes of L. monocytogenes infection and will highlight recent technological advances that have made oral infection a more attractive model system.
Directory of Open Access Journals (Sweden)
Roberta Ortenzi
2015-09-01
Full Text Available In the present study, a microbiological challenge test in artificially contaminated raw milk Pecorino Umbro cheese during cheese-making was carried out. Raw ewe milk was contaminated by a suspension of particular Listeria monocytogenes strains. The number of L. monocytogenes and L. monocytogenes dynamic growth were evaluated during cheese-making and storage. A significant decrease of the viable count of L. monocytogenes was observed during ripening and L. monocytogenes viable count was below the limit of quantification during storage. The results show that the product is unable to support the growth of the pathogen.
Gianfranceschi, Monica Virginia; Rodriguez-Lazaro, David; Hernandez, Marta; González-García, Patricia; Comin, Damiano; Gattuso, Antonietta; Delibato, Elisabetta; Sonnessa, Michele; Pasquali, Frederique; Prencipe, Vincenza; Sreter-Lancz, Zuzsanna; Saiz-Abajo, María-José; Pérez-De-Juan, Javier; Butrón, Javier; Kozačinski, Lidija; Tomic, Danijela Horvatek; Zdolec, Nevijo; Johannessen, Gro S; Jakočiūnė, Džiuginta; Olsen, John Elmerdahl; De Santis, Paola; Lovari, Sarah; Bertasi, Barbara; Pavoni, Enrico; Paiusco, Antonella; De Cesare, Alessandra; Manfreda, Gerardo; De Medici, Dario
2014-08-01
The classical microbiological method for detection of Listeria monocytogenes requires around 7 days for final confirmation, and due to perishable nature of RTE food products, there is a clear need for an alternative methodology for detection of this pathogen. This study presents an international (at European level) ISO 16140-based validation trial of a non-proprietary real-time PCR-based methodology that can generate final results in the following day of the analysis. This methodology is based on an ISO compatible enrichment coupled to a bacterial DNA extraction and a consolidated real-time PCR assay. Twelve laboratories from six European countries participated in this trial, and soft cheese was selected as food model since it can represent a difficult matrix for the bacterial DNA extraction and real-time PCR amplification. The limit of detection observed was down to 10 CFU per 25 of sample, showing excellent concordance and accordance values between samples and laboratories (>75%). In addition, excellent values were obtained for relative accuracy, specificity and sensitivity (82.75%, 96.70% and 97.62%, respectively) when the results obtained for the real-time PCR-based methods were compared to those of the ISO 11290-1 standard method. An interesting observation was that the L. monocytogenes detection by the real-time PCR method was less affected in the presence of Listeria innocua in the contaminated samples, proving therefore to be more reliable than the reference method. The results of this international trial demonstrate that the evaluated real-time PCR-based method represents an excellent alterative to the ISO standard since it shows a higher performance as well as reduce the extent of the analytical process, and can be easily implemented routinely by the competent authorities and food industry laboratories. Copyright © 2014 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
V. López
2006-12-01
Full Text Available Listeria monocytogenes es un patógeno humano que se transmite a través de los alimentos y que causa infecciones graves, con una alta tasa de mortalidad. A pesar de la ubicuidad del microorganismo, la tasa real de la enfermedad es bastante baja y se asocia casi siempre a condiciones predisponentes. Tradicionalmente se consideraba que los aislamientos presentes en los alimentos y en el ambiente tenían la misma capacidad patogénica que los aislamientos de origen clínico. Pero el análisis de mutaciones en los genes de determinados factores de virulencia (internalina, hemolisina, fosfolipasas, proteína de superficie ActA y proteína reguladora PrfA, los estudios cuantitativos realizados con cultivos celulares y la genética de poblaciones, están replanteando la discusión sobre la variabilidad de la virulencia de L. monocytogenes. A pesar de todos estos avances, no existe un único marcador que permita comprobar la virulencia de los aislamientos naturales de esta especie. Probablemente en el futuro, la combinación de diferentes marcadores moleculares permitirá detectar los alimentos contaminados sólo por los clones virulentos de L. monocytogenes, con lo que se mejorará la prevención de la listeriosis humana transmitida por alimentos.Listeria monocytogenes is a foodborne human pathogen responsible for invasive infections presenting overall a high mortality. Despite the ubiquity of the microorganism, the actual disease rate is quite low and the disease is most often associated with an underlying predisposition. Foodborne and environmental isolates were traditionally considered of similar pathogenicity compared to clinical isolates. But the analysis of mutations in the genes encoding specific virulence factors (internalin, hemolysin, phospholipases, surface protein ActA and regulator protein PrfA, quantitative studies with cell cultures and population genetics have raised considerable concerns about virulence differences among L
An Internalin A Probe-Based Genosensor for Listeria monocytogenes Detection and Differentiation
Directory of Open Access Journals (Sweden)
Laura Bifulco
2013-01-01
Full Text Available Internalin A (InlA, a protein required for Listeria monocytogenes virulence, is encoded by the inlA gene, which is only found in pathogenic strains of this genus. One of the best ways to detect and confirm the pathogenicity of the strain is the detection of one of the virulence factors produced by the microorganism. This paper focuses on the design of an electrochemical genosensor used to detect the inlA gene in Listeria strains without labelling the target DNA. The electrochemical sensor was obtained by immobilising an inlA gene probe (single-stranded oligonucleotide on the surfaces of screen-printed gold electrodes (Au-SPEs by means of a mercaptan-activated self-assembled monolayer (SAM. The hybridisation reaction occurring on the electrode surface was electrochemically transduced by differential pulse voltammetry (DPV using methylene blue (MB as an indicator. The covalently immobilised single-stranded DNA was able to selectively hybridise to its complementary DNA sequences in solution to form double-stranded DNA on the gold surface. A significant decrease of the peak current of the voltammogram (DPV upon hybridisation of immobilised ssDNA was recorded. Whole DNA samples of L. monocytogenes strains could be discriminated from other nonpathogenic Listeria species DNA with the inlA gene DNA probe genosensor.
Sakaridis, Ioannis; Ganopoulos, Ioannis; Madesis, Panagiotis; Tsaftaris, Athanasios; Argiriou, Anagnostis
2014-01-02
An outbreak situation of human listeriosis requires a fast and accurate protocol for typing Listeria monocytogenes . Existing techniques are either characterized by low discriminatory power or are laborious and require several days to give a final result. Polymerase chain reaction (PCR) coupled with high resolution melting (HRM) analysis was investigated in this study as an alternative tool for a rapid and precise genotyping of L. monocytogenes isolates. Fifty-five isolates of L. monocytogenes isolated from poultry carcasses and the environment of four slaughterhouses were typed by HRM analysis using two specific markers, internalin B and ssrA genes. The analysis of genotype confidence percentage of L. monocytogenes isolates produced by HRM analysis generated dendrograms with two major groups and several subgroups. Furthermore, the analysis of the HRM curves revealed that all L. monocytogenes isolates could easily be distinguished. In conclusion, HRM was proven to be a fast and powerful tool for genotyping isolates of L. monocytogenes .
Directory of Open Access Journals (Sweden)
Callum J. Highmore
2018-04-01
Full Text Available The microbiological safety of fresh produce is monitored almost exclusively by culture-based detection methods. However, bacterial food-borne pathogens are known to enter a viable-but-nonculturable (VBNC state in response to environmental stresses such as chlorine, which is commonly used for fresh produce decontamination. Here, complete VBNC induction of green fluorescent protein-tagged Listeria monocytogenes and Salmonella enterica serovar Thompson was achieved by exposure to 12 and 3 ppm chlorine, respectively. The pathogens were subjected to chlorine washing following incubation on spinach leaves. Culture data revealed that total viable L. monocytogenes and Salmonella Thompson populations became VBNC by 50 and 100 ppm chlorine, respectively, while enumeration by direct viable counting found that chlorine caused a <1-log reduction in viability. The pathogenicity of chlorine-induced VBNC L. monocytogenes and Salmonella Thompson was assessed by using Caenorhabditis elegans. Ingestion of VBNC pathogens by C. elegans resulted in a significant life span reduction (P = 0.0064 and P < 0.0001, and no significant difference between the life span reductions caused by the VBNC and culturable L. monocytogenes treatments was observed. L. monocytogenes was visualized beyond the nematode intestinal lumen, indicating resuscitation and cell invasion. These data emphasize the risk that VBNC food-borne pathogens could pose to public health should they continue to go undetected.
Prevalence of Listeria monocytogenes in poultry production in France.
Chemaly, Marianne; Toquin, Marie-Therese; Le Nôtre, Yolene; Fravalo, Philippe
2008-10-01
This study aimed to update and create a data set from laying hens and broilers regarding contamination by Listeria monocytogenes. Two hundred laying-hen flocks were sampled, with 88 flocks reared in cages and 112 reared on the floor. One hundred forty-five broiler flocks were sampled, with 85 conventional and 60 free-range flocks. A total of 774 and 725 samples were analyzed from laying hens and broilers, respectively. L. monocytogenes was detected in 31 of 200 flocks, yielding an estimated prevalence of 15.5% in laying-hen flocks. Among positive flocks, there appeared a significant (P = 0.004) difference between caged and floor-reared hens, with a higher detection in dust samples from floor-reared hens. In positive caged hen flocks, significant (P = 0.028) differences between dust and fecal samples appeared, with a higher detection in feces than in dust samples. In broiler flocks, L. monocytogenes was isolated in 46 of 145 flocks, yielding an estimated prevalence of 32% (28% in conventional flocks versus 37% in the free-range flocks). L. monocytogenes was isolated in samples taken from conventional flocks with a lower frequency than in free-range flocks (13 versus 18%, respectively). The serotyping of L. monocytogenes strains showed that the majority belonged to type 1/2a in laying-hen flocks (74.3%) and in broiler flocks (40.5%). A significant difference (P = 0.007) between laying hens and broilers was shown for serogroup 4 and for serovar 1/2b (P = 0.007); these serogroups were more prevalent in broilers (40%) than in laying hens (5.7%).
SABIL, SYAHRIANA
2015-01-01
2015 SYAHRIANA SABIL (I 111 11 273). Pasteurisasi High Temperature Short Time (HTST) Susu terhadap Listeria monocytogenes pada Penyimpanan Refrigerator. Dibimbing oleh RATMAWATI MALAKA dan FARIDA NUR YULIATI. Pasteurisasi High Temperature Short Time (HTST) merupakan proses pemanasan susu di bawah titik didih yang diharapkan dapat membunuh Listeria monocytogenes (L. monocytogenes) karena bersifat patogen dan mengakibatkan listeriosis yang merupakan penyakit zoonosis. Tu...
Recombinant phage probes for Listeria monocytogenes
Carnazza, S.; Gioffrè, G.; Felici, F.; Guglielmino, S.
2007-10-01
Monitoring of food and environmental samples for biological threats, such as Listeria monocytogenes, requires probes that specifically bind biological agents and ensure their immediate and efficient detection. There is a need for robust and inexpensive affinity probes as an alternative to antibodies. These probes may be recruited from random peptide libraries displayed on filamentous phage. In this study, we selected from two phage peptide libraries phage clones displaying peptides capable of specific and strong binding to the L. monocytogenes cell surface. The ability of isolated phage clones to interact specifically with L. monocytogenes was demonstrated using enzyme-linked immunosorbent assay (ELISA) and confirmed by co-precipitation assay. We also assessed the sensitivity of phage-bacteria binding by PCR on phage-captured Listeria cells, which could be detected at a concentration of 104 cells ml-1. In addition, as proof-of-concept, we tested the possibility of immobilizing the affinity-selected phages to a putative biosensor surface. The quality of phage deposition was monitored by ELISA and fluorescent microscopy. Phage-bacterial binding was confirmed by high power optical phase contrast microscopy. Overall, the results of this work validate the concept of affinity-selected recombinant filamentous phages as probes for detecting and monitoring bacterial agents under any conditions that warrant their recognition, including in food products.
Content of web-based continuing medical education about HPV vaccination.
Kornides, Melanie L; Garrell, Jacob M; Gilkey, Melissa B
2017-08-16
Addressing low HPV vaccination coverage will require U.S. health care providers to improve their recommendation practices and vaccine delivery systems. Because readily available continuing medical education (CME) could be an important tool for supporting providers in this process, we sought to assess the content of web-based CME activities related to HPV vaccination. We conducted a content analysis of web-based CME activities about HPV vaccination available to U.S. primary care providers in May-September 2016. Using search engines, educational clearinghouses, and our professional networks, we identified 15 activities eligible for study inclusion. Through a process of open coding, we identified 45 commonly occurring messages in the CME activities, which we organized into five topic areas: delivering recommendations for HPV vaccination, addressing common parent concerns, implementing office-based strategies to increase HPV vaccination coverage, HPV epidemiology, and guidelines for HPV vaccine administration and safety. Using a standardized abstraction form, two coders then independently assessed which of the 45 messages each CME activity included. CME activities varied in the amount of content they delivered, with inclusion of the 45 messages ranging from 17% to 86%. Across activities, the most commonly included messages were related to guidelines for HPV vaccine administration and safety. For example, all activities (100%) specified that routine administration is recommended for ages 11 and 12. Most activities (73%) also noted that provider recommendations are highly influential. Fewer activities modeled examples of effective recommendations (47%), gave specific approaches to addressing common parent concerns (47%), or included guidance on office-based strategies to increase coverage (40%). Given that many existing CME activities lack substantive content on how to change provider practice, future activities should focus on the practical application of interpersonal
Dual-species biofilm of Listeria monocytogenes and Escherichia coli on stainless steel surface.
de Grandi, Aline Zago; Pinto, Uelinton Manoel; Destro, Maria Teresa
2018-04-12
Listeria monocytogenes is a Gram-positive bacterium commonly associated with foodborne diseases. Due its ability to survive under adverse environmental conditions and to form biofilm, this bacterium is a major concern for the food industry, since it can compromise sanitation procedures and increase the risk of post-processing contamination. Little is known about the interaction between L. monocytogenes and Gram-negative bacteria on biofilm formation. Thus, in order to evaluate this interaction, Escherichia coli and L. monocytogenes were tested for their ability to form biofilms together or in monoculture. We also aimed to evaluate the ability of L. monocytogenes 1/2a and its isogenic mutant strain (ΔprfA ΔsigB) to form biofilm in the presence of E. coli. We assessed the importance of the virulence regulators, PrfA and σ B , in this process since they are involved in many aspects of L. monocytogenes pathogenicity. Biofilm formation was assessed using stainless steel AISI 304 #4 slides immersed into brain heart infusion broth, reconstituted powder milk and E. coli preconditioned medium at 25 °C. Our results indicated that a higher amount of biofilm was formed by the wild type strain of L. monocytogenes than by its isogenic mutant, indicating that prfA and sigB are important for biofilm development, especially maturation under our experimental conditions. The presence of E. coli or its metabolites in preconditioned medium did not influence biofilm formation by L. monocytogenes. Our results confirm the possibility of concomitant biofilm formation by L. monocytogenes and E. coli, two bacteria of major significance in the food industry.
Biosensor for the detection of Listeria monocytogenes: emerging trends
Soni, Dharmendra Kumar
2018-05-23
The early detection of Listeria monocytogenes (L. monocytogenes) and understanding the disease burden is of paramount interest. The failure to detect pathogenic bacteria in the food industry may have terrible consequences, and poses deleterious effects on human health. Therefore, integration of methods to detect and trace the route of pathogens along the entire food supply network might facilitate elucidation of the main contamination sources. Recent research interest has been oriented towards the development of rapid and affordable pathogen detection tools/techniques. An innovative and new approach like biosensors has been quite promising in revealing the foodborne pathogens. In spite of the existing knowledge, advanced research is still needed to substantiate the expeditious nature and sensitivity of biosensors for rapid and in situ analysis of foodborne pathogens. This review summarizes recent developments in optical, piezoelectric, cell-based, and electrochemical biosensors for Listeria sp. detection in clinical diagnostics, food analysis, and environmental monitoring, and also lists their drawbacks and advantages.
McEgan, Rachel; Danyluk, Michelle D
2015-05-01
This study evaluated the efficacy of aqueous (aQUAT) and isopropyl alcohol-based quaternary ammonium (ipQUAT) sanitizers for reducing Salmonella spp., Escherichia coli O157:H7, or Listeria monocytogenes populations on peanut and pistachio shell pieces. Inoculated nutshells were mixed with QUAT sanitizers, water, or 70% ethanol and enumerated immediately or after incubation at 30 °C for 48 h. None of the treatments had any immediate effect on Salmonella or E. coli O157:H7 populations on the peanut or pistachio shells. L. monocytogenes populations declined immediately on the peanut and pistachio shells treated with aQUAT or ipQUAT. After incubation, Salmonella and E. coli O157:H7 populations increased significantly on the water- or aQUAT-treated peanut and pistachio shells. L. monocytogenes populations also increased significantly on the water- or aQUAT-treated peanut shells, but levels did not change on the water-treated pistachio shells and levels were just above the limit of detection on the aQUAT-treated pistachio shells. After treatment with ipQUAT and 48-h incubation, Salmonella and E. coli O157:H7 populations decreased to or below the limit of detection on both shell types; L. monocytogenes populations remained at or below the limit of detection on both shell types. Copyright © 2014 Elsevier Ltd. All rights reserved.
Dreux, N; Albagnac, C; Federighi, M; Carlin, F; Morris, C E; Nguyen-the, C
2007-10-01
To investigate the presence of viable but non-culturable Listeria monocytogenes during survival on parsley leaves under low relative humidity (RH) and to evaluate the ability of L. monocytogenes to recover from VBNC to culturable state under satured humidity. Under low RH (47-69%) on parsley leaves, the initial number of L. monocytogenes populations counted on non selective media (10(9) L. monocytogenes per leaf on TSA) was reduced by 6 log10 scales in 15 days, whereas number of viable L. monocytogenes counted under the microscope was reduced by 3-4 log10 scales, indicating the presence of VBNC cells. This was demonstrated on three L. monocytogenes strains (EGDe, Bug 1995 and LmP60). Changing from low to 100% RH permitted an increase of the culturable counts of L. monocytogenes and this growth was observed only when residual culturable cells were present. Moreover, VBNC L. monocytogenes inoculated on parsley leaves did not become culturable after incubation under 100% RH. Dry conditions induced VBNC L. monocytogenes on parsley leaves but these VBNC were likely unable to recover culturability after transfer to satured humidity. Enumeration on culture media presumably under-estimates the number of viable L. monocytogenes on fresh produce after exposure to low RH.
Age-Dependent Differences in Systemic and Cell-Autonomous Immunity to L. monocytogenes
Directory of Open Access Journals (Sweden)
Ashley M. Sherrid
2013-01-01
Full Text Available Host defense against infection can broadly be categorized into systemic immunity and cell-autonomous immunity. Systemic immunity is crucial for all multicellular organisms, increasing in importance with increasing cellular complexity of the host. The systemic immune response to Listeria monocytogenes has been studied extensively in murine models; however, the clinical applicability of these findings to the human newborn remains incompletely understood. Furthermore, the ability to control infection at the level of an individual cell, known as “cell-autonomous immunity,” appears most relevant following infection with L. monocytogenes; as the main target, the monocyte is centrally important to innate as well as adaptive systemic immunity to listeriosis. We thus suggest that the overall increased risk to suffer and die from L. monocytogenes infection in the newborn period is a direct consequence of age-dependent differences in cell-autonomous immunity of the monocyte to L. monocytogenes. We here review what is known about age-dependent differences in systemic innate and adaptive as well as cell-autonomous immunity to infection with Listeria monocytogenes.
A novel suicide plasmid for efficient gene mutation in Listeria monocytogenes
Although several plasmids have been used in Listeria monocytogenes for generating mutants by allelic exchange, construction of L. monocytogenes mutants has been inefficient due to lack of effective selection markers for first and second recombination events. To address this problem, we have develope...
Ultrasonic cleaning of conveyor belt materials using Listeria monocytogenes as a model organism.
Tolvanén, Riina; Lunden, Janne; Korkeala, Hannu; Wirtanen, Gun
2007-03-01
Persistent Listeria monocytogenes contamination of food industry equipment is a difficult problem to solve. Ultrasonic cleaning offers new possibilities for cleaning conveyors and other equipment that are not easy to clean. Ultrasonic cleaning was tested on three conveyor belt materials: polypropylene, acetal, and stainless steel (cold-rolled, AISI 304). Cleaning efficiency was tested at two temperatures (30 and 45 degrees C) and two cleaning times (30 and 60 s) with two cleaning detergents (KOH, and NaOH combined with KOH). Conveyor belt materials were soiled with milk-based soil and L. monocytogenes strains V1, V3, and B9, and then incubated for 72 h to attach bacteria to surfaces. Ultrasonic cleaning treatments reduced L. monocytogenes counts on stainless steel 4.61 to 5.90 log units; on acetal, 3.37 to 5.55 log units; and on polypropylene, 2.31 to 4.40 log units. The logarithmic reduction differences were statistically analyzed by analysis of variance using Statistical Package for the Social Sciences software. The logarithmic reduction was significantly greater in stainless steel than in plastic materials (P conveyor belt materials.
A small RNA controls expression of the chitinase ChiA in Listeria monocytogenes
DEFF Research Database (Denmark)
Nielsen, Jesper S; Larsen, Marianne Halberg; Lillebæk, Eva Maria Sternkopf
2011-01-01
role of LhrA in L. monocytogenes. To this end, we determined the effects of LhrA on global-wide gene expression. We observed that nearly 300 genes in L. monocytogenes are either positively or negatively affected by LhrA. Among these genes, we identified lmo0302 and chiA as direct targets of LhrA, thus...... establishing LhrA as a multiple target regulator. Lmo0302 encodes a hypothetical protein with no known function, whereas chiA encodes one of two chitinases present in L. monocytogenes. We show here that LhrA acts as a post-transcriptional regulator of lmo0302 and chiA by interfering with ribosome recruitment......, and we provide evidence that both LhrA and Hfq act to down-regulate the expression of lmo0302 and chiA. Furthermore, in vitro binding experiments show that Hfq stimulates the base pairing of LhrA to chiA mRNA. Finally, we demonstrate that LhrA has a negative effect on the chitinolytic activity of L...
De Vleeschauwer, Annebel; Qiu, Yu; Van Reeth, Kristien
2015-05-11
The human A/Port Chalmers/1/73 (H3N2) influenza virus strain, the supposed ancestor of European H3N2 swine influenza viruses (SIVs), was used in most commercial SIV vaccines in Europe until recently. If manufacturers want to update vaccine strains, they have to perform laborious intratracheal (IT) challenge experiments and demonstrate reduced virus titres in the lungs of vaccinated pigs. We aimed to examine (a) the ability of a Port Chalmers/73-based commercial vaccine to induce cross-protection against a contemporary European H3N2 SIV and serologic cross-reaction against H3N2 SIVs from Europe and North America and (b) the validity of intranasal (IN) challenge and virus titrations of nasal swabs as alternatives for IT challenge and titrations of lung tissue in vaccine potency tests. Pigs were vaccinated with Suvaxyn Flu(®) and challenged by the IT or IN route with sw/Gent/172/08. Post-vaccination sera were examined in haemagglutination-inhibition assays against vaccine and challenge strains and additional H3N2 SIVs from Europe and North America, including an H3N2 variant virus. Tissues of the respiratory tract and nasal swabs were collected 3 days post challenge (DPCh) and from 0-7 DPCh, respectively, and examined by virus titration. Two vaccinations consistently induced cross-reactive antibodies against European H3N2 SIVs from 1998-2012, but minimal or undetectable antibody titres against North American viruses. Challenge virus titres in the lungs, trachea and nasal mucosa of the vaccinated pigs were significantly reduced after both IT and IN challenge. Yet the reduction of virus titres and nasal shedding was greater after IT challenge. The Port Chalmers/73-based vaccine still offered protection against a European H3N2 SIV isolated 35 years later and with only 86.9% amino acid homology in its HA1, but it is unlikely to protect against H3N2 SIVs that are endemic in North America. We use our data to reflect on vaccine strain updates and on the vaccine potency test
Assessment of Listeria monocytogenes virulence in the Galleria mellonella insect larvae model.
Rakic Martinez, Mira; Wiedmann, Martin; Ferguson, Martine; Datta, Atin R
2017-01-01
Several animal models have been used to understand the molecular basis of the pathogenicity, infectious dose and strain to strain variation of Listeria monocytogenes. The greater wax worm Galleria mellonella, as an alternative model, provides some useful advantages not available with other models and has already been described as suitable for the virulence assessment of various pathogens including L. monocytogenes. The objectives of this study are: 1) confirming the usefulness of this model with a wide panel of Listeria spp. including non-pathogenic L. innocua, L. seeligeri, L. welshimeri and animal pathogen L. ivanovii; 2) assessment of virulence of several isogenic in-frame deletion mutants in virulence and stress related genes of L. monocytogenes and 3) virulence assessment of paired food and clinical isolates of L. monocytogenes from 14 major listeriosis outbreaks occurred worldwide between 1980 and 2015. Larvae injected with different concentrations of Listeria were incubated at 37°C and monitored over seven days for time needed to kill 50% of larvae (LT50) and to determine change of bacterial population in G. mellonella, 2 and 24 hours post-inoculation. Non-pathogenic members of Listeria and L. ivanovii showed significantly (P monocytogenes strains. Isogenic mutants of L. monocytogenes with the deletions in prfA, plcA, hly, actA and virR genes, also showed significantly (P monocytogenes strains related to non-invasive (gastroenteritis) outbreaks of listeriosis showed significantly (P < 0.05) lower virulence than isolates of the same serotype obtained from outbreaks with invasive symptoms. The difference, however, was dose and strain- dependent. No significant differences in virulence were observed among the serotype tested in this study.
DEFF Research Database (Denmark)
Bernbom, Nete; Licht, Tine Rask; Saadbye, Peter
2006-01-01
The ability of the pediocin AcH producing Lactobacillus plantarum DDEN 11007 and its non-producing plasmid-cured isogenic variant, DDEN 12305 to prevent the persistence and growth of Listeria monocytogenes EP2 in two gastrointestinal (GI) tract models was examined. In vitro studies conducted...... in a two-stage continuous flow system showed that L. plantarum DDEN 11007 inhibited L. monocytogenes EP2 under these conditions, while less effect was seen of the non-bacteriocin producing variant. The inhibitory effect was more pronounced at pH 5 than at pH 7. No effect on persistence of L. monocytogenes...... in the GI tract was seen in gnotobiotic rats colonized with either the pediocin AcH producing or the non-bacteriocin producing variant of L. plantarum when compared to rats inoculated with L. monocytogenes EP2 alone. Surprisingly, inoculation of the gnotobiotic animals with either of the L. plantarum...
Effect of eugenol on growth and listeriolysin o production by Listeria monocytogenes
Directory of Open Access Journals (Sweden)
Cristina Tostes Filgueiras
2006-05-01
Full Text Available The inhibitory effect of eugenol, a naturally occurring compound mainly present in the essential oil fraction of cloves, was studied on the growth and listeriolysin O (LLO production by Listeria monocytogenes. Potassium efflux from cells promoted by eugenol was also determined after 24 h incubation in phosphate buffered saline. Eugenol promoted a delay on the growth of L. monocytogenes at concentrations of 100, 300 and 500 µg mL-1and above 800 µg mL-1 the effect was bactericidal. Production of LLO by L. monocytogenes in the presence of eugenol was reduced 80-100%. An accumulation of external K+ was observed above 300 µg mL-1 of eugenol which indicated that the cell membrane was affected. The results showed the effectiveness of eugenol in controlling growth and LLO production of L. monocytogenes cells.O efeito inibitório do eugenol, o principal constituinte do óleo essencial de cravo, foi avaliado sobre o crescimento e produção de listeriolisina O (LLO por Listeria monocytogenes. O efluxo de íons potássio das células também foi determinado após 24 h de incubação em solução tampão, contendo eugenol. Concentrações de 100, 300 e 500 µg mL-1 de eugenol promoveram a inibição do crescimento de L. monocytogenes e, em concentrações acima de 800 µg mL-1, constatou-se um efeito bactericida. O crescimento de L. monocytogenes na presença de eugenol resultou na inibição de 80 a 100% da produção de LLO. O efluxo de K+ promovido pelo eugenol indicou que a membrana celular foi afetada. Estes resultados indicam a efetividade do eugenol para o controle do crescimento e da produção de LLO por L. monocytogenes.
Vesicular stomatitis virus-based vaccines protect nonhuman primates against Bundibugyo ebolavirus.
Directory of Open Access Journals (Sweden)
Chad E Mire
Full Text Available Ebola virus (EBOV causes severe and often fatal hemorrhagic fever in humans and nonhuman primates (NHPs. Currently, there are no licensed vaccines or therapeutics for human use. Recombinant vesicular stomatitis virus (rVSV-based vaccine vectors, which encode an EBOV glycoprotein in place of the VSV glycoprotein, have shown 100% efficacy against homologous Sudan ebolavirus (SEBOV or Zaire ebolavirus (ZEBOV challenge in NHPs. In addition, a single injection of a blend of three rVSV vectors completely protected NHPs against challenge with SEBOV, ZEBOV, the former Côte d'Ivoire ebolavirus, and Marburg virus. However, recent studies suggest that complete protection against the newly discovered Bundibugyo ebolavirus (BEBOV using several different heterologous filovirus vaccines is more difficult and presents a new challenge. As BEBOV caused nearly 50% mortality in a recent outbreak any filovirus vaccine advanced for human use must be able to protect against this new species. Here, we evaluated several different strategies against BEBOV using rVSV-based vaccines. Groups of cynomolgus macaques were vaccinated with a single injection of a homologous BEBOV vaccine, a single injection of a blended heterologous vaccine (SEBOV/ZEBOV, or a prime-boost using heterologous SEBOV and ZEBOV vectors. Animals were challenged with BEBOV 29-36 days after initial vaccination. Macaques vaccinated with the homologous BEBOV vaccine or the prime-boost showed no overt signs of illness and survived challenge. In contrast, animals vaccinated with the heterologous blended vaccine and unvaccinated control animals developed severe clinical symptoms consistent with BEBOV infection with 2 of 3 animals in each group succumbing. These data show that complete protection against BEBOV will likely require incorporation of BEBOV glycoprotein into the vaccine or employment of a prime-boost regimen. Fortunately, our results demonstrate that heterologous rVSV-based filovirus vaccine
Chen, Bang-Yuan; Pyla, Rajkumar; Kim, Tae-Jo; Silva, Juan L; Jung, Yean-Sung
2010-08-01
Catfish skins, intestines, fresh fillets, processing surfaces at different production stages, chiller water and non-food contact surfaces were sampled for Listeria monocytogenes and other Listeria species. Among 315 samples, prevalence of L. monocytogenes, Listeria innocua and a group of Listeria seeligeri-Listeria welshimeri-Listeria ivanovii was 21.6, 13.0 and 29.5%, respectively. No Listeria grayi was detected in this survey. While no L. monocytogenes strains were isolated from catfish skins and intestines, the strains were found with a frequency of 76.7% in chilled fresh catfish fillets and 43.3% in unchilled fillets. L. monocytogenes and Listeria spp. were also detected in fish contact surfaces such as deheading machine, trimming board, chiller water, conveyor belts at different stages, and fillet weighing table. Among L. monocytogenes, 1/2b (47.0%), 3b (16.0%) and 4c (14%) were the predominant serotypes isolated, whereas 4b, 4e, 1/2c and 1/2a were detected at much lower frequencies. Genotype analyses of L. monocytogenes isolates using serotyping, pulsed-field gel electrophoresis (PFGE) and enterobacterial repetitive intergenic consensus (ERIC)-PCR revealed that chiller water represented an important contamination source of L. monocytogenes in the chilled catfish fillets of two processing facilities, whereas fillet weighing table significantly contributed to the catfish fillet contamination of the third facility. This study suggests that L. monocytogenes contamination in the processed catfish fillets originates from the processing environment, rather than directly from catfish. Results from this study can aid the catfish industry to develop a plant-specific proper cleaning and sanitation procedure for equipment and the processing environment designed to specifically target L. monocytogenes contamination. Copyright 2010 Elsevier Ltd. All rights reserved.
Lefevere, Eva; Theeten, Heidi; Hens, Niel; De Smet, Frank; Top, Geert; Van Damme, Pierre
2015-09-22
School-based, free HPV vaccination for girls in the first year of secondary school was introduced in Flanders (Belgium) in 2010. Before that, non school-based, co-payment vaccination for girls aged 12-18 was in place. We compared vaccination coverage, age-specific coverage and socio-economic inequalities in coverage - 3 important parameters contributing to the effectiveness of the vaccination programs - under both vaccination systems. We used retrospective administrative data from different sources. Our sample consisted of all female members of the National Alliance of Christian Mutualities born in 1995, 1996, 1998 or 1999 (N=66,664). For each vaccination system we described the cumulative proportion HPV vaccination initiation and completion over time. We used life table analysis to calculate age-specific rates of HPV vaccination initiation and completion. Analyses were done separately for higher income and low income groups. Under non school-based, co-payment vaccination the proportions HPV vaccination initiation and completion slowly rose over time. By age 17, the proportion HPV vaccination initiation/completion was 0.75 (95% CI 0.74-076)/0.66 (95% CI 0.65-0.67). The median age at vaccination initiation/completion was 14.4 years (95% CI 14.4-14.5)/15.4 years (95% CI 15.3-15.4). Socio-economic inequalities in coverage widened over time and with age. Under school-based, free vaccination rates of HPV vaccination initiation were substantially higher. By age 14,the proportion HPV vaccination initiation/completion was 0.90 (95% CI 0.90-0.90)/0.87 (95% CI 0.87-0.88). The median age at vaccination initiation/completion was 12.7 years (95% CI 12.7-12.7)/13.3 years (95% CI 13.3-13.3). Socio-economic inequalities in coverage and in age-specific coverage were substantially smaller. Copyright © 2015. Published by Elsevier Ltd.
Ether lipid vesicle-based antigens impart protection against experimental listeriosis
Directory of Open Access Journals (Sweden)
Ansari MA
2012-06-01
Full Text Available Mairaj Ahmed Ansari,1 Swaleha Zubair,2 Saba Tufail,1 Ejaj Ahmad,1 Mohsin Raza Khan,1 Zainuddin Quadri,1 Mohammad Owais,11Interdisciplinary Biotechnology Unit, 2Women's College, Aligarh Muslim University, Aligarh, UP, IndiaBackground: Incidence of food-borne infections from Listeria monocytogenes, a parasite that has adapted intracellular residence to avoid antibody onslaught, has increased dramatically in the past few years. The apparent lack of an effective vaccine that is capable of evoking the desired cytotoxic T cell response to obliterate this intracellular pathogen has encouraged the investigation of alternate prophylactic strategies. It should also be noted that Archaebacteria (Archae lipid-based adjuvants enhance the efficacy of subunit vaccines. In the present study, the adjuvant properties of archaeosomes (liposomes prepared from total polar lipids of archaebacteria, Halobacterium salinarum combined with immunogenic culture supernatant antigens of L. monocytogenes have been exploited in designing a vaccine candidate against experimental listeriosis in murine model.Methods: Archaeosome-entrapped secretory protein antigens (SAgs of L. monocytogenes were evaluated for their immunological responses and tendency to deplete bacterial burden in BALB/c mice challenged with sublethal listerial infection. Various immunological studies involving cytokine profiling, lymphocyte proliferation assay, detection of various surface markers (by flowcytometric analysis, and antibody isotypes (by enzyme-linked immunosorbent assay were used for establishing the vaccine potential of archaeosome-entrapped secretory proteins.Results: Immunization schedule involving archaeosome-encapsulated SAgs resulted in upregulation of Th1 cytokine production along with boosted memory in BALB/c mice. It also showed protective effect by reducing listerial burden in various vital organs (liver and spleen of the infected mice. However, the soluble form of the antigens (SAgs
Efficacy of ultraviolet light exposure against survival of Listeria monocytogenes on conveyor belts.
Morey, Amit; McKee, Shelly R; Dickson, James S; Singh, Manpreet
2010-06-01
Listeria monocytogenes has been repeatedly isolated from foods and food-processing facilities including food contact surfaces such as conveyor belts (CB). CBs are often difficult to clean and require rigorous sanitation programs for decontamination. Ultraviolet (UV) light has exhibited microbicidal properties on food contact surfaces and this study was conducted to determine the efficacy of UV against L. monocytogenes on CB made of different materials. A four-strain cocktail of L. monocytogenes (serotypes 3A, 4A, 4B, and 4C) was made to give a suspension of approximately 10(7) CFU/mL. CBs made from four different types of materials, (1) Ropanyl DM 8/2 A2 + 04 (belt 1), (2) Volta FRMW-3.0 (belt 2), (3) Volta FRMB-3.0 (belt 3), and (4) Ropanyl DM (belt 4), were inoculated with 1 mL of the four-strain cocktail (approximately 10(7) CFU/mL) of the bacterial suspension. CBs were treated with UV light (254 nm) for 1 and 3 sec at 5.53 and 5.95 mW/cm(2). Three replications of the experiments were conducted. Two-way analysis of variance of survival populations of L. monocytogenes showed that bacterial counts were significantly reduced (p belt types irrespective of UV light intensities and times of exposure. L. monocytogenes populations were reduced (p belts 1, 2, and 3 after exposure to 5.95 mW/cm(2) UV light intensity for 3 sec. L. monocytogenes-inoculated CBs that were exposed to 5.53 mW/cm(2) showed higher (p Belt 4 showed survival populations of L. monocytogenes ranging from 1.42 to 1.73 log(10) CFU/cm(2) after UV light treatment for 1 and 3 sec. UV light can be effectively used to reduce L. monocytogenes contamination on CBs.
Chen, Jianshun; Chen, Qiaomiao; Jiang, Lingli; Cheng, Changyong; Bai, Fan; Wang, Jun; Mo, Fan; Fang, Weihuan
2010-03-31
Ecological, biochemical and genetic resemblance as well as clear differences of virulence between L. monocytogenes and L. innocua make this bacterial clade attractive as a model to examine evolution of pathogenicity. This study was attempted to examine the population structure of L. innocua and the microevolution in the L. innocua-L. monocytogenes clade via profiling of 37 internalin genes and multilocus sequence typing based on the sequences of 9 unlinked genes gyrB, sigB, dapE, hisJ, ribC, purM, gap, tuf and betL. L. innocua was genetically monophyletic compared to L. monocytogenes, and comprised four subgroups. Subgroups A and B correlated with internalin types 1 and 3 (except the strain 0063 belonging to subgroup C) and internalin types 2 and 4 respectively. The majority of L. innocua strains belonged to these two subgroups. Subgroup A harbored a whole set of L. monocytogenes-L. innocua common and L. innocua-specific internalin genes, and displayed higher recombination rates than those of subgroup B, including the relative frequency of occurrence of recombination versus mutation (rho/theta) and the relative effect of recombination versus point mutation (r/m). Subgroup A also exhibited a significantly smaller exterior/interior branch length ratio than expected under the coalescent model, suggesting a recent expansion of its population size. The phylogram based on the analysis with correction for recombination revealed that the time to the most recent common ancestor (TMRCA) of L. innocua subgroups A and B were similar. Additionally, subgroup D, which correlated with internalin type 5, branched off from the other three subgroups. All L. innocua strains lacked seventeen virulence genes found in L. monocytogenes (except for the subgroup D strain L43 harboring inlJ and two subgroup B strains bearing bsh) and were nonpathogenic to mice. L. innocua represents a young species descending from L. monocytogenes and comprises four subgroups: two major subgroups A and B
2010-01-01
Background Ecological, biochemical and genetic resemblance as well as clear differences of virulence between L. monocytogenes and L. innocua make this bacterial clade attractive as a model to examine evolution of pathogenicity. This study was attempted to examine the population structure of L. innocua and the microevolution in the L. innocua-L. monocytogenes clade via profiling of 37 internalin genes and multilocus sequence typing based on the sequences of 9 unlinked genes gyrB, sigB, dapE, hisJ, ribC, purM, gap, tuf and betL. Results L. innocua was genetically monophyletic compared to L. monocytogenes, and comprised four subgroups. Subgroups A and B correlated with internalin types 1 and 3 (except the strain 0063 belonging to subgroup C) and internalin types 2 and 4 respectively. The majority of L. innocua strains belonged to these two subgroups. Subgroup A harbored a whole set of L. monocytogenes-L. innocua common and L. innocua-specific internalin genes, and displayed higher recombination rates than those of subgroup B, including the relative frequency of occurrence of recombination versus mutation (ρ/θ) and the relative effect of recombination versus point mutation (r/m). Subgroup A also exhibited a significantly smaller exterior/interior branch length ratio than expected under the coalescent model, suggesting a recent expansion of its population size. The phylogram based on the analysis with correction for recombination revealed that the time to the most recent common ancestor (TMRCA) of L. innocua subgroups A and B were similar. Additionally, subgroup D, which correlated with internalin type 5, branched off from the other three subgroups. All L. innocua strains lacked seventeen virulence genes found in L. monocytogenes (except for the subgroup D strain L43 harboring inlJ and two subgroup B strains bearing bsh) and were nonpathogenic to mice. Conclusions L. innocua represents a young species descending from L. monocytogenes and comprises four subgroups: two
A multiplex PCR for detection of Listeria monocytogenes and its lineages.
Rawool, Deepak B; Doijad, Swapnil P; Poharkar, Krupali V; Negi, Mamta; Kale, Satyajit B; Malik, S V S; Kurkure, Nitin V; Chakraborty, Trinad; Barbuddhe, Sukhadeo B
2016-11-01
A novel multiplex PCR assay was developed to identify genus Listeria, and discriminate Listeria monocytogenes and its major lineages (LI, LII, LIII). This assay is a rapid and inexpensive subtyping method for screening and characterization of L. monocytogenes. Copyright © 2016 Elsevier B.V. All rights reserved.
DEFF Research Database (Denmark)
Kastbjerg, Vicky Gaedt; Gram, Lone
2012-01-01
or tolerance would evolve in L. monocytogenes under continued selection in three industrial disinfectants. L. monocytogenes EGD was exposed to Desinfect CL (hypochlorite) and Incimaxx DES (peracedic acid and hydrogen peroxide) for several hundred generations. This caused no increase in the minimal inhibitory......, and that the disinfectants are still efficient for controlling microorganisms such as L. monocytogenes....
Lloyd, T; Alvarado, C Z; Brashears, M M; Thompson, L D; McKee, S R; Berrang, M
2009-10-01
The growth of Listeria monocytogenes in further-processed meat products has become a major concern and an important food safety issue. The meat and poultry industries have incorporated interventions such as organic acids in marinades to inhibit the growth of L. monocytogenes. In this study, organic acids were utilized in the raw product and as a postcook dip to determine their inhibitory effect on the growth of L. monocytogenes in turkey deli loaves. The turkey deli loaves were processed, cooked, cooled, inoculated with streptomycin-resistant L. monocytogenes, and then dipped. Treatments were potassium lactate (PL) in the raw product with sodium lactate (SL), sodium diacetate (SD) dip, PL with SL/PL/SD dip, SL with SL/SD dip, and SL with SL/PL/SD dip. There was also a positive (inoculated) and negative (noninoculated) control, which was dipped in distilled water. Days 0, 7, 14, 21, 28, 42, and 56 were sampled for L. monocytogenes. There were no differences (P>0.05) among the organic acid treatments in the turkey deli loaves at any time points; therefore, all of the treatments increased the lag phase of L. monocytogenes, extending the shelf-life of the product. However, there was a difference between the treatments and the positive control at d 7, 14, 21, 28, 42, and 56. The growth of L. monocytogenes increased immediately in the positive control, whereas the negative control appeared to have no growth. These organic acids can provide meat processors with a useful method for extending the lag phase of L. monocytogenes in ready-to-eat meat and poultry products.
Rückerl, I; Muhterem-Uyar, M; Muri-Klinger, S; Wagner, K-H; Wagner, M; Stessl, B
2014-10-17
The aim of this study was to analyze the changing patterns of Listeria monocytogenes contamination in a cheese processing facility manufacturing a wide range of ready-to-eat products. Characterization of L. monocytogenes isolates included genotyping by pulsed-field gel electrophoresis (PFGE) and multi-locus sequence typing (MLST). Disinfectant-susceptibility tests and the assessment of L. monocytogenes survival in fresh cheese were also conducted. During the sampling period between 2010 and 2013, a total of 1284 environmental samples were investigated. Overall occurrence rates of Listeria spp. and L. monocytogenes were 21.9% and 19.5%, respectively. Identical L. monocytogenes genotypes were found in the food processing environment (FPE), raw materials and in products. Interventions after the sampling events changed contamination scenarios substantially. The high diversity of globally, widely distributed L. monocytogenes genotypes was reduced by identifying the major sources of contamination. Although susceptible to a broad range of disinfectants and cleaners, one dominant L. monocytogenes sequence type (ST) 5 could not be eradicated from drains and floors. Significantly, intense humidity and steam could be observed in all rooms and water residues were visible on floors due to increased cleaning strategies. This could explain the high L. monocytogenes contamination of the FPE (drains, shoes and floors) throughout the study (15.8%). The outcome of a challenge experiment in fresh cheese showed that L. monocytogenes could survive after 14days of storage at insufficient cooling temperatures (8 and 16°C). All efforts to reduce L. monocytogenes environmental contamination eventually led to a transition from dynamic to stable contamination scenarios. Consequently, implementation of systematic environmental monitoring via in-house systems should either aim for total avoidance of FPE colonization, or emphasize a first reduction of L. monocytogenes to sites where
Metabolic responses of primary and transformed cells to intracellular Listeria monocytogenes.
Directory of Open Access Journals (Sweden)
Nadine Gillmaier
Full Text Available The metabolic response of host cells, in particular of primary mammalian cells, to bacterial infections is poorly understood. Here, we compare the carbon metabolism of primary mouse macrophages and of established J774A.1 cells upon Listeria monocytogenes infection using (13C-labelled glucose or glutamine as carbon tracers. The (13C-profiles of protein-derived amino acids from labelled host cells and intracellular L. monocytogenes identified active metabolic pathways in the different cell types. In the primary cells, infection with live L. monocytogenes increased glycolytic activity and enhanced flux of pyruvate into the TCA cycle via pyruvate dehydrogenase and pyruvate carboxylase, while in J774A.1 cells the already high glycolytic and glutaminolytic activities hardly changed upon infection. The carbon metabolism of intracellular L. monocytogenes was similar in both host cells. Taken together, the data suggest that efficient listerial replication in the cytosol of the host cells mainly depends on the glycolytic activity of the hosts.
[Risk assessment of Listeria monocytogenes in deli meats and vegetable salads].
Tian, Jing; Liu, Xiu-mei
2009-09-01
To analysis risk from Listeria monocytogenes in deli meats and vegetable salads. Use Risk Ranger which is a software programme developed by the University of Hobart, Australia and answer 11 questions on affecting the risk from hazards in the specific foods by combining data from national foodborne diseases surveillance network and some references to make semi-quantitative risk assessment for the specific food. Relative risk from Listeria monocytogenes in deli meats and vegetable salads is 61 and 52, respectively. Incidence of listeriosis caused by deli meats-Listeria monocytogenes pairs and vegetable salads-Listeria monocytogenes pairs is 5.4 and 0.2 cases per million people, respectively. Risk from the former is 32 times than that from the latter. By changing the selection for some risk factors in the model, it was known that the risks from two food-hazard combinations could decrease 10 times, if taking necessary actions after processing. Deli meats is a kind of high risk food for listeriosis.
Lefevere, Eva; Theeten, Heidi; Hens, Niel; De Smet, Frank; Top, Geert; Van Damme, Pierre
2015-01-01
School-based, free HPV vaccination for girls in the first year of secondary school was introduced in Flanders (Belgium) in 2010. Before that, non school-based, co-payment vaccination for girls aged 12-18 was in place. We compared vaccination coverage, age-specific coverage and socio-economic inequalities in coverage -3 important parameters contributing to the effectiveness of the vaccination programs - under both vaccination systems. We used retrospective administrative data from different so...
Pagliano, Pasquale; Ascione, Tiziana; Boccia, Giovanni; De Caro, Francesco; Esposito, Silvano
2016-06-01
Listeria monocytogenes is a Gram-positive bacillus and facultative intracellular bacterium whose transmission occurs mainly through the consumption of contaminated food, L. monocytogenes invades the host cells using various protein and can escape to the human T-cell immune system by cell-to-cell spreading. If the infection is not controlled at the stage in which the bacterium is in the liver, for instance, due to a severe immunodepression, a secondary bacteraemia can be developed and L. monocytogenes reaches the preferred sites transgressing the blood-brain barrier or the placental barrier. Individuals with T-cell dysfunction, such as pregnant women, the elderly, and those receiving immunosuppressive therapy are at the highest risk of contracting the disease. Average life expectancy throughout developed countries has rapidly increased during the latter half of the 20th century and geriatric infectious diseases have become an increasingly important issue. L. monocytogenes meningitis in young previously healthy adults has been reported only in anecdotal observations. Differently, L. monocytogenes is the third most common cause of bacterial meningitis in the elderly population, after Streptococcus pneumoniae and Neisseria meningitidis. Patients with L. monocytogenes meningitis presented with signs and symptoms that were similar to those of the general population with community-acquired bacterial meningitis, but reported a longer prodromal phase. According to literature data, the prevalence of the classic triad of fever, neck stiffness, and altered mental status is 43%, and almost all patients present with at least 2 of the 4 classic symptoms of headache, fever, neck stiffness, and altered mental status. On the basis of our published data, in patients aged over 50 years, diagnosing L. monocytogenes meningitis was more challenging than pneumococcal meningitis, as demonstrated by the lower percentage of cases receiving a correct diagnosis within 48 hours from the onset
Renukaradhya, Gourapura J; Narasimhan, Balaji; Mallapragada, Surya K
2015-12-10
Vaccine development has had a huge impact on human health. However, there is a significant need to develop efficacious vaccines for several existing as well as emerging respiratory infectious diseases. Several challenges need to be overcome to develop efficacious vaccines with translational potential. This review focuses on two aspects to overcome some barriers - 1) the development of nanoparticle-based vaccines, and 2) the choice of suitable animal models for respiratory infectious diseases that will allow for translation. Nanoparticle-based vaccines, including subunit vaccines involving synthetic and/or natural polymeric adjuvants and carriers, as well as those based on virus-like particles offer several key advantages to help overcome the barriers to effective vaccine development. These include the ability to deliver combinations of antigens, target the vaccine formulation to specific immune cells, enable cross-protection against divergent strains, act as adjuvants or immunomodulators, allow for sustained release of antigen, enable single dose delivery, and potentially obviate the cold chain. While mouse models have provided several important insights into the mechanisms of infectious diseases, they are often a limiting step in translation of new vaccines to the clinic. An overview of different animal models involved in vaccine research for respiratory infections, with advantages and disadvantages of each model, is discussed. Taken together, advances in nanotechnology, combined with the right animal models for evaluating vaccine efficacy, has the potential to revolutionize vaccine development for respiratory infections. Copyright © 2015 Elsevier B.V. All rights reserved.
Recombinant phage probes for Listeria monocytogenes
Energy Technology Data Exchange (ETDEWEB)
Carnazza, S; Gioffre, G; Felici, F; Guglielmino, S [Department of Microbiological, Genetic and Molecular Sciences, University of Messina, Messina (Italy)
2007-10-03
Monitoring of food and environmental samples for biological threats, such as Listeria monocytogenes, requires probes that specifically bind biological agents and ensure their immediate and efficient detection. There is a need for robust and inexpensive affinity probes as an alternative to antibodies. These probes may be recruited from random peptide libraries displayed on filamentous phage. In this study, we selected from two phage peptide libraries phage clones displaying peptides capable of specific and strong binding to the L. monocytogenes cell surface. The ability of isolated phage clones to interact specifically with L. monocytogenes was demonstrated using enzyme-linked immunosorbent assay (ELISA) and confirmed by co-precipitation assay. We also assessed the sensitivity of phage-bacteria binding by PCR on phage-captured Listeria cells, which could be detected at a concentration of 10{sup 4} cells ml{sup -1}. In addition, as proof-of-concept, we tested the possibility of immobilizing the affinity-selected phages to a putative biosensor surface. The quality of phage deposition was monitored by ELISA and fluorescent microscopy. Phage-bacterial binding was confirmed by high power optical phase contrast microscopy. Overall, the results of this work validate the concept of affinity-selected recombinant filamentous phages as probes for detecting and monitoring bacterial agents under any conditions that warrant their recognition, including in food products.
Frequency of contamination Listeria monocytogenes of raw dried cured vacuum packed sausages
Directory of Open Access Journals (Sweden)
Hristo Daskalov
2014-03-01
Full Text Available The aim of this study was to collect actual data concerning the frequency of contamination with Listeria monocytogenes of some very popular in Bulgaria raw dried cured vacuum packed sausages, produced from October 2004 till May 2008. 148 vacuum-packed samples were taken from 9 different food business operators during all seasons of the year. The samples were analyzed according to USDA method for meat foods. Ten specimens were positive for presence of Listeria monocytogenes equal to 6,75% of all tested samples. In two other raw dried cured sausages L.welshimeri and L.innocua were found, but these species are not pathogenic for consumers. In the period before the official implementation of HACCP system (01.01.2006 in Bulgaria, 52 samples were examined and 5 Listeria monocytogenes isolates were found (~10%. 2,5 years after the HACCP implementation, 96 specimens from the same meat factories were tested and 5 Listeria monocytogenes isolates (5,2% were detected. Samples taken from lots, produced in winter time were contaminated with Listeria monocytogenes more often (7 of all 10 than specimens taken during other seasons. Data were discussed through the point of view of the effectiveness of hygienic practices and HACCP system application. Also, application of ‘microbiological criterion’ set in COMMISSION REGULATION (EC No 2073/2005 for ready-to-eat foods unable to support the growth of L. monocytogenes was considered.
Suppression of Listeria monocytogenes by the Native Micro-Flora in Teewurst Sausage.
Austin-Watson, Clytrice; Grant, Ar'Quette; Brice, Michline
2013-10-21
Modern consumers are interested in the use of non-chemical methods to control pathogens when heat sterilization is not an option. Such is the case with teewurst sausage, a raw spreadable sausage and a popular German commodity. Although Listeria was not found in teewurst, the optimal microbial growing conditions of teewurst coupled with the ubiquity of L. monocytogenes in nature, makes the possibility of contamination of products very possible. This pilot study was conducted to examine teewurst's native micro-flora's ability to suppress the outgrowth of L. monocytogenes at 10 °C using standard plate counts and PCR-DGGE. Traditional plating methods showed L. monocytogenes growth significantly decreased when in competition with the teewurst's native micro-flora ( p flora of the teewurst suppressed the overall growth of L. monocytogenes by an average of two logs, under these conditions. Denaturing Gradient Gel Electrophoresis (DGGE) amplicons with unique banding patterns were extracted from DGGE gel for identification. Brochothrix thermosphacta and Lactobacillus curvatus were identified as a part of the teewurst's native micro-flora. Although the native micro-flora did not decrease L. monocytogenes to below limits of detection, it was enough of a decrease to warrant further investigation.
Inhibitory Effect of Nisin on Listeria monocytogenes Inoculated into Surimi and Minced Meat
Directory of Open Access Journals (Sweden)
Masoud Rezaei
2012-02-01
Full Text Available Background & Objective: Listeria monocytogenes has already established as an important food born pathogen which induce listeriosis in human. Use of bacteriocins to provide food safety has been increased dramatically. Nisin has a wide spectrum inhibitory effect than the other bacteriocins and inhibits food-borne pathogens such as L. monocytogenes and many other Gram-positive spoilage microorganisms. The purpose of this study was to investigate the inhibitory effect of Nisin on population of Listeria monocytogenes and the role of changes in food components on the antilisterial properties of Nisin. Materials & Methods: The minced meat and surimi samples were inoculated by 1×104 cfu/g of L. monocytogenes. Then samples exposed to Nisin at the levels of 500 or 1000 IU/g were prepared. All treatments after packaging in plastic bags were kept for 12 days at refrigerator temperature. Samples were cultured on CHROMagarTM Listeria every 2 days and the number of listeria monocytogenes was counted. Results: two different concentrations of Nisin (500 or 1000 IU/g was not able to inhibit L. monocytogenes below the acceptable level for raw food (100 cells per g in minced meat and surimi of silver carp. But the number of bacteria reduces more in fish surimi as compared to the mince meal. Also, antilisterial activity of Nisin was reduced during the storage period. Conclusion: Inhibitory property of Nisin against L. monocytogenes in surimi significantly was higher than the minced (P<0.05. So it is possible the antilisterial properties of Nisin will increase by elimination of some enzymes during processing.
Rodríguez-López, Pedro; Saá-Ibusquiza, Paula; Mosquera-Fernández, Maruxa; López-Cabo, Marta
2015-08-03
In order to find out how real Listeria monocytogenes-carrying biofilms are in industrial settings, a total of 270 environmental samples belonging to work surfaces from fish (n = 123), meat (n = 75) and dairy industries (n = 72) were analysed in order to detect L. monocytogenes. 12 samples were positive for L. monocytogenes and a total of 18 different species were identified as accompanying microbiota in fish and meat industry. No L. monocytogenes was found in samples from dairy industry. Molecular characterisation combining results of AscI and ApaI macrorestriction PFGE assays yielded 7 different subtypes of L. monocytogenes sharing in 71.43% of cases the same serogroup (1/2a-3a). Results from dynamic numerical characterisation between L. monocytogenes monospecies biofilms on stainless steel (SS) using MATLAB-based tool BIOFILMDIVER demonstrated that except in isolate A1, in which a significant increase in the percentage of covered area (CA), average diffusion distance (ADD) and maximum diffusion distance (MDD) was observed after 120 h of culture, no significant differences were observed in the dynamics of the rest of the L. monocytogenes isolates. Quantitative dual-species biofilm association experiments performed on SS indicated that L. monocytogenes cell counts presented lower values in mixed-species cultures with certain species at 24 and 48 h compared with mono-species culture. However, they remained unaltered after 72 h except when co-cultured with Serratia fonticola which presented differences in all sampling times and was also the dominant species within the dual-species biofilm. When considering frequency of appearance of accompanying species, an ecological distribution was demonstrated as Escherichia coli appeared to be the most abundant in fish industry and Carnobacterium spp. in meat industry. Copyright © 2015 Elsevier B.V. All rights reserved.
Incidence of Listeria monocytogenes and Listeria spp. in a small-scale mushroom production facility.
Viswanath, Prema; Murugesan, Latha; Knabel, Stephen J; Verghese, Bindhu; Chikthimmah, Naveen; Laborde, Luke F
2013-04-01
Listeria monocytogenes is a foodborne pathogen of significant concern to the agricultural and food processing industry because of its ability to grow and persist in cool and moist environments and its association with listeriosis, a disease with a very high mortality rate. Although there have been no listeriosis outbreaks attributed to fresh mushrooms in the United States, retail surveys and recalls are evidence that L. monocytogenes contamination of mushrooms (Agaricus bisporus) can occur. The objective of this study was to determine the prevalence of Listeria spp., including L. monocytogenes, in a small-scale mushroom production facility on the campus of the Pennsylvania State University in the United States. Of 184 samples taken from five production zones within the facility, 29 (15.8%) samples were positive for Listeria spp. Among the Listeria spp. isolates, L. innocua was most prevalent (10.3%) followed by L. welshimeri (3.3%), L. monocytogenes (1.6%), and L. grayi (0.5%). L. monocytogenes was recovered only from the phase I raw material composting area. Isolates of L. monocytogenes were confirmed and serotyped by multiplex PCR. The epidemiological relatedness of the three L. monocytogenes isolates to those serotypes or lineages frequently encountered in listeriosis infections was determined by multi-virulence-locus sequence typing using six virulence genes, namely, prfA, inlB, inlC, dal, clpP, and lisR. The phylogenetic positions of the three isolates in the dendrogram prepared with data from other isolates of L. monocytogenes showed that all isolates were grouped with serotype 4a, lineage IIIA. To date, this serotype has rarely been reported in foodborne disease outbreaks.
An ecological perspective of Listeria monocytogenes biofilms in food processing facilities.
Valderrama, Wladir B; Cutter, Catherine N
2013-01-01
Listeria monocytogenes can enter the food chain at virtually any point. However, food processing environments seem to be of particular importance. From an ecological point of view, food processing facilities are microbial habitats that are constantly disturbed by cleaning and sanitizing procedures. Although L. monocytogenes is considered ubiquitous in nature, it is important to recognize that not all L. monocytogenes strains appear to be equally distributed; the distribution of the organism seems to be related to certain habitats. Currently, no direct evidence exists that L. monocytogenes-associated biofilms have played a role in food contamination or foodborne outbreaks, likely because biofilm isolation and identification are not part of an outbreak investigation, or the definition of biofilm is unclear. Because L. monocytogenes is known to colonize surfaces, we suggest that contamination patterns may be studied in the context of how biofilm formation is influenced by the environment within food processing facilities. In this review, direct and indirect epidemiological and phenotypic evidence of lineage-related biofilm formation capacity to specific ecological niches will be discussed. A critical view on the development of the biofilm concept, focused on the practical implications, strengths, and weaknesses of the current definitions also is discussed. The idea that biofilm formation may be an alternative surrogate for microbial fitness is proposed. Furthermore, current research on the influence of environmental factors on biofilm formation is discussed.
Antimicrobial treatments to control Listeria monocytogenes in queso fresco.
Lourenço, António; Kamnetz, Mary B; Gadotti, Camila; Diez-Gonzalez, Francisco
2017-06-01
Queso fresco, is a Hispanic non-fermented cheese highly susceptible to contamination with L. monocytogenes. This research was aimed to determine the effect of GRAS antimicrobial ingredients to control L. monocytogenes. Antimicrobials included caprylic acid (CA), Nisaplin ® (N, 2.5% nisin), a mixture of sodium lactate and sodium diacetate (SL/SD), Lactococcus lactis sbp. lactis DPC 3147, monolaurin, and lactic acid (LA). Batches of queso fresco curds were inoculated with 10 4 CFU/g and stored at 4 °C for three weeks. During storage the count of L. monocytogenes reached 7 to 8 Log CFU/g in control samples. Most individual antimicrobial treatments resulted in less than 1 Log CFU/g reductions in final counts, with the exception of N (0.5 g/kg) and CA (2.9 g/kg) that caused more than 3 and 5 Log CFU/g differences with controls, respectively. Mixtures of ingredients were more effective in inhibiting L. monocytogenes growth, and treatments with N and CA consistently delivered 6 Log CFU/g less counts than controls. Supplementation of 12 g/kg LA to treatments with SL/SD (3%/0.22%) caused differences of more than 4 Log CFU/g in final Listeria populations. Samples treated with the binary mixtures of N and CA (0.5 and 0.7 g/kg, respectively) were evaluated in a consumer panel (n = 67). Panelists slightly preferred control and commercial over treated samples, but all samples were in average rated between "slightly liking" and "moderately liking." These experiments indicated that combined use of antimicrobial ingredients may be an effective way to control the population of Listeria monocytogenes in queso fresco. Copyright © 2016 Elsevier Ltd. All rights reserved.
Gattuso, Antonietta; Gianfranceschi, Monica Virginia; Sonnessa, Michele; Delibato, Elisabetta; Marchesan, Massimo; Hernandez, Marta; De Medici, Dario; Rodriguez-Lazaro, David
2014-08-01
The aim of this study was to optimize a Real-Time PCR protocol for a rapid detection of Listeria monocytogenes in pork meat, using reduced volumes of primary selective enrichment broth and times of incubation to decrease the cost and time for analysis. Forty-five samples of pork meat were artificially contaminated with two different levels of L. monocytogenes (1-10 CFU per sample and 10-100 CFU per sample), homogenized in three different volumes of Half Fraser Broth (1:3; 1:5 and 1:10) and incubated at 30°C ± 1°C for 5h, 8h and 24h. The detection was conducted in parallel by Real-Time PCR and the ISO standard 11290-1 methods. L. monocytogenes was detected in all the samples after 24h by Real-Time PCR method, also using reduced volumes of Half Fraser Broth. This represents a clear advantage as the time to final detection and the inherent costs were significantly reduced compared to the ISO reference method. All samples artificially contaminated were correctly detected also after 8 of incubation at 30°C ± 1°C in Half Fraser Broth and 24h in Fraser Broth at 37°C ± 1°C using cultural method. Copyright © 2014 Elsevier B.V. All rights reserved.
DEFF Research Database (Denmark)
Mølbak, Kåre; Hansen, Niels Dalum; Valentiner-Branth, Palle
2016-01-01
to the DMA of suspected severe adverse reactions.We selected controls without reports of adverse reactions from the Danish vaccination registry and matched by year of vaccination, age of vaccination, and municipality, and obtained from the Danish National Patient Registry and The National Health Insurance...... vaccination programme has declined. The aim of the present study was to determine health care-seeking prior to the first HPV vaccination among females who suspected adverse reactions to HPV vaccine. Methods In this registry-based case-control study, we included as cases vaccinated females with reports...... Service Register the history of health care usage two years prior to the first vaccine. We analysed the data by logistic regression while adjusting for the matching variables. Results The study included 316 cases who received first HPV vaccine between 2006 and 2014. Age range of cases was 11 to 52 years...
Directory of Open Access Journals (Sweden)
Maria da Graça F. Nascimento
1994-12-01
Full Text Available Autoclaved distilled water samples were inoculated with L. monocytogenes strain V7 and strain VPH-1, and incubated aerobically, at 30 C for 48 hours. Each strain was tested individually, and growth curves were determined at 1, 2, 3, 4, 5, 21, 24, and 48 hours. The growth or survival of L. monocytogenes was similar for both strains, with survivors at 24 hour-incubation. The microbicidal activity of one synthetic cationic peptide (NP-2 was examined against L. monocytogenes strain V7, in a water system. Antibacterial activity of NP-2 (1, 5, and 10 g/ml was best expressed at 60 minute-incubation, with 10 g/ml of peptide, at 30 C.Amostras de água destilada, autoclavadas, foram inoculadas com L. monocytogenes cepa V7 e cepa VPH-1, e incubadas, aerobicamente, a 30ºC por 48 horas. Cada cepa foi testada individualmente, e determinou-se curvas de crescimento a 1, 2, 3, 4, 5, 21, 24, e 48 horas. O crescimento ou sobrevivência das duas cepas foi semelhante e encontrou-se sobreviventes em 24 horas de incubação. Examinou-se a atividade bactericida de um dos peptídeos catiônicos sintéticos (NP-2 contra L. monocytogenes cepa V7, em sistema aquoso. A atividade antibacteriana de NP-2 (1, 5, and 10µg/ml foi melhor aos 60 minutos de incubação, com 10µg/ml de peptídeo, a 30 C.
Chen, Bang-Yuan; Wang, Chung-Yi; Wang, Chia-Lan; Fan, Yang-Chi; Weng, I-Ting; Chou, Chung-Hsi
2016-11-01
A 2-year study was performed at two ready-to-eat tilapia sashimi processing plants (A and B) to identify possible routes of contamination with Listeria monocytogenes during processing. Samples were collected from the aquaculture environments, transportation tanks, processing plants, and final products. Seventy-nine L. monocytogenes isolates were found in the processing environments and final products; 3.96% (50 of 1,264 samples) and 3.86% (29 of 752 samples) of the samples from plants A and B, respectively, were positive for L. monocytogenes . No L. monocytogenes was detected in the aquaculture environments or transportation tanks. The predominant L. monocytogenes serotypes were 1/2b (55.70%) and 4b (37.97%); serotypes 3b and 4e were detected at much lower percentages. At both plants, most processing sections were contaminated with L. monocytogenes before the start of processing, which indicated that the cleaning and sanitizing methods did not achieve adequate pathogen removal. Eleven seropulsotypes were revealed by pulsed-field gel electrophoresis and serotyping. Analysis of seropulsotype distribution revealed that the contamination was disseminated by the processing work; the same seropulsotypes were repeatedly found along the work flow line and in the final products. Specific seropulsotypes were persistently found during different sampling periods, which suggests that the sanitation procedures or equipment used at these plants were inadequate. Plant staff should improve the sanitation procedures and equipment to reduce the risk of L. monocytogenes cross-contamination and ensure the safety of ready-to-eat tilapia products.
Sakaridis, I; Soultos, N; Iossifidou, E; Papa, A; Ambrosiadis, I; Koidis, P
2011-06-01
This study was conducted to determine the prevalence and antimicrobial resistance of Listeria monocytogenes recovered from chicken carcasses in slaughterhouses in Northern Greece. A total of 100 poultry samples (300 carcasses) were examined for Listeria spp. The samples were neck skin taken from four different slaughterhouses in Northern Greece. Forty samples were also taken from the environment of the slaughterhouses. Identification of L. monocytogenes was carried out by PCR and fingerprinting of the isolates by random amplified polymorphic DNA. L. monocytogenes strains isolated from chicken carcasses and from the environment of the slaughterhouses were also examined for antibiotic resistance. Fifty-five isolates of L. monocytogenes were tested for susceptibility to 20 antibiotics using the disk diffusion method. Listeria spp. were present in 99 of the poultry samples tested (99%), and 38 yielded L monocytogenes (38%). L. monocytogenes was also isolated in 80% of samples from the environment of a certain slaughterhouse, while the other slaughterhouses were found to be contaminated only with Listeria spp. All isolates were resistant to nalidixic acid and oxolinic acid, the majority of them to clindamycin, and only a few to tetracycline and oxytetracycline, whereas they were found to be susceptible to all other antimicrobials. The results of this study demonstrate a high prevalence of L. monocytogenes contamination in chicken carcasses, and all isolates were found to be sensitive to the antimicrobials most commonly used to treat human listeriosis.
Camargo, Anderson Carlos; Woodward, Joshua John; Call, Douglas Ruben; Nero, Luís Augusto
2017-11-01
Listeria monocytogenes is a foodborne pathogen that contaminates food-processing environments and persists within biofilms on equipment, utensils, floors, and drains, ultimately reaching final products by cross-contamination. This pathogen grows even under high salt conditions or refrigeration temperatures, remaining viable in various food products until the end of their shelf life. While the estimated incidence of listeriosis is lower than other enteric illnesses, infections caused by L. monocytogenes are more likely to lead to hospitalizations and fatalities. Despite the description of L. monocytogenes occurrence in Brazilian food-processing facilities and foods, there is a lack of consistent data regarding listeriosis cases and outbreaks directly associated with food consumption. Listeriosis requires rapid treatment with antibiotics and most drugs suitable for Gram-positive bacteria are effective against L. monocytogenes. Only a minority of clinical antibiotic-resistant L. monocytogenes strains have been described so far; whereas many strains recovered from food-processing facilities and foods exhibited resistance to antimicrobials not suitable against listeriosis. L. monocytogenes control in food industries is a challenge, demanding proper cleaning and application of sanitization procedures to eliminate this foodborne pathogen from the food-processing environment and ensure food safety. This review focuses on presenting the L. monocytogenes distribution in food-processing environment, food contamination, and control in the food industry, as well as the consequences of listeriosis to human health, providing a comparison of the current Brazilian situation with the international scenario.
Listeria monocytogenes response regulators important for stress tolerance and pathogenesis
DEFF Research Database (Denmark)
Kallipolitis, B H; Ingmer, H
2001-01-01
Environmental sensing by two-component signal transduction systems is likely to play a role for growth and survival of Listeria monocytogenes both during transmission in food products and within a host organism. Two-component systems typically consist of a membrane-associated sensor histidine...... kinase and a gene regulatory protein, the response regulator (RR). We have identified seven putative RR genes in L. monocytogenes LO28 by PCR using degenerate oligonucleotide primers. By insertional inactivation we obtained data suggesting that three of the putative RRs contribute to the pathogenicity...... of L. monocytogenes in mice. Strikingly, the mutants that were attenuated in virulence also had a decreased ability to grow in the presence of various stress conditions potentially encountered in an infection process. Thus, our data point to a connection between the ability of the putative two...
An Overview on the Field of Micro- and Nanotechnologies for Synthetic Peptide-Based Vaccines
Directory of Open Access Journals (Sweden)
Aiala Salvador
2011-01-01
Full Text Available The development of synthetic peptide-based vaccines has many advantages in comparison with vaccines based on live attenuated organisms, inactivated or killed organism, or toxins. Peptide-based vaccines cannot revert to a virulent form, allow a better conservation, and are produced more easily and safely. However, they generate a weaker immune response than other vaccines, and the inclusion of adjuvants and/or the use of vaccine delivery systems is almost always needed. Among vaccine delivery systems, micro- and nanoparticulated ones are attractive, because their particulate nature can increase cross-presentation of the peptide. In addition, they can be passively or actively targeted to antigen presenting cells. Furthermore, particulate adjuvants are able to directly activate innate immune system in vivo. Here, we summarize micro- and nanoparticulated vaccine delivery systems used in the field of synthetic peptide-based vaccines as well as strategies to increase their immunogenicity.
Mechanism of Nisin, Pediocin 34, and Enterocin FH99 Resistance in Listeria monocytogenes.
Kaur, Gurpreet; Singh, Tejinder Pal; Malik, Ravinder Kumar; Bhardwaj, Arun
2012-03-01
Nisin-, pediocin 34-, and enterocin FH99-resistant variants of Listeria monocytogenes ATCC 53135 were developed. In an attempt to clarify the possible mechanisms underlying bacteriocin resistance in L. monocytogenes ATCC 53135, sensitivity of the resistant strains of L. monocytogenes ATCC 53135 to nisin, pediocin 34, and enterocin FH99 in the absence and presence of different divalent cations was assessed, and the results showed that the addition of divalent cations significantly reduced the inhibitory activity of nisin, pediocin 34, and enterocin FH99 against resistant variants of L. monocytogenes ATCC 53135. The addition of EDTA, however, restored this activity suggesting that the divalent cations seem to affect the initial electrostatic interaction between the positively charged bacteriocin and the negatively charged phospholipids of the membrane. Nisin-, pediocin 34-, and enterocin-resistant variants of L. monocytogenes ATCC 53135 were more resistant to lysozyme as compared to the wild-type strain both in the presence as well as absence of nisin, pediocin 34, and enterocin FH99. Ultra structural profiles of bacteriocin-sensitive L. monocytogenes and its bacteriocin-resistant counterparts revealed that the cells of wild-type strain of L. monocytogenes were maximally in pairs or short chains, whereas, its nisin-, pediocin 34-, and enterocin FH99-resistant variants tend to form aggregates. Results indicated that without a cell wall, the acquired nisin, pediocin 34, and enterocin FH99 resistance of the variants was lost. Although the bacteriocin-resistant variants appeared to lose their acquired resistance toward nisin, pediocin 34, and enterocin FH99, the protoplasts of the resistant variants appeared to be more resistant to bacteriocins than the protoplasts of their wild-type counterparts.
Performance of Isfahan North Wastewater Treatment Plant in the Removal of Listeria monocytogenes
Directory of Open Access Journals (Sweden)
nahid Navijouy
2013-08-01
Full Text Available Listeria and in particular Listeria monocytogenes is considered a ubiquitous foodborne pathogen which can lead listeriosis in human and animals. Listeriosis can be serious and may cause meningitis, septicemia and abortion in pregnant women. Although wastewater or sludge may contaminate foods of plant origin, there are no data on occurrence of Listeria spp. in wastewater and sludge in Iran. The purpose of current investigation was to study the occurrence of Listeria spp. in various samples of wastewater and sludge in Isfahan North wastewater treatment plant. Influent, effluent, raw sludge and dried sludge samples were collected from Isfahan North municipal wastewater treatment plant. L. monocytogenes were enumerated by a three–tube most probable number (MPN assay using enrichment Fraser broth. A total of 65 various samples from five step in 13 visits were collected. The presence of Listeria spp. also was determined using USDA procedure. Then, phenotypically identified L. monocytogenes were further confirmed by Polymerase Chain Reaction amplification. L. monocytogenes isolated from 76.9%, 38.5%, 84.6%, 69.2% and 46.2% of influent, effluent, raw sludge, stabilized sludge and dried sludge respectively. The efficiency of wastewater treatment processes, digester tank and drying bed in removal L. monocytogenes were 69.6%, 64.7% and 73.4% respectively. All phenotypically identified L. monocytogenes were further confirmed by Polymerase Chain Reaction. The results of present study have shown that Listeriaspp. and L. monocytogenes in particular, were present in wastewater treatment plant effluents and sludge at high level. The bacteria may spread on agriculture land and contaminate foods of plant origin. This may cause a risk of spreading disease to human and animals.
Novel Biocontrol Methods for Listeria monocytogenes Biofilms in Food Production Facilities.
Gray, Jessica A; Chandry, P Scott; Kaur, Mandeep; Kocharunchitt, Chawalit; Bowman, John P; Fox, Edward M
2018-01-01
High mortality and hospitalization rates have seen Listeria monocytogenes as a foodborne pathogen of public health importance for many years and of particular concern for high-risk population groups. Food manufactures face an ongoing challenge in preventing the entry of L. monocytogenes into food production environments (FPEs) due to its ubiquitous nature. In addition to this, the capacity of L. monocytogenes strains to colonize FPEs can lead to repeated identification of L. monocytogenes in FPE surveillance. The contamination of food products requiring product recall presents large economic burden to industry and is further exacerbated by damage to the brand. Poor equipment design, facility layout, and worn or damaged equipment can result in Listeria hotspots and biofilms where traditional cleaning and disinfecting procedures may be inadequate. Novel biocontrol methods may offer FPEs effective means to help improve control of L. monocytogenes and decrease cross contamination of food. Bacteriophages have been used as a medical treatment for many years for their ability to infect and lyse specific bacteria. Endolysins, the hydrolytic enzymes of bacteriophages responsible for breaking the cell wall of Gram-positive bacteria, are being explored as a biocontrol method for food preservation and in nanotechnology and medical applications. Antibacterial proteins known as bacteriocins have been used as alternatives to antibiotics for biopreservation and food product shelf life extension. Essential oils are natural antimicrobials formed by plants and have been used as food additives and preservatives for many years and more recently as a method to prevent food spoilage by microorganisms. Competitive exclusion occurs naturally among bacteria in the environment. However, intentionally selecting and applying bacteria to effect competitive exclusion of food borne pathogens has potential as a biocontrol application. This review discusses these novel biocontrol methods and their
HPV vaccines: their pathology-based discovery, benefits, and adverse effects.
Nicol, Alcina F; de Andrade, Cecilia V; Russomano, Fabio B; Rodrigues, Luana S L; Oliveira, Nathalia S; Provance, David William; Nuovo, Gerard J
2015-12-01
The discovery of the human papillomavirus (HPV) vaccine illustrates the power of in situ-based pathologic analysis in better understanding and curing diseases. The 2 available HPV vaccines have markedly reduced the incidence of cervical intraepithelial neoplasias, genital warts, and cervical cancer throughout the world. Concerns about HPV vaccine safety have led some physicians, health care officials, and parents to refuse providing the recommended vaccination to the target population. The aims of the study were to discuss the discovery of HPV vaccine and review scientific data related to measurable outcomes from the use of HPV vaccines. The strong type-specific immunity against HPV in humans has been known for more than 25 years. Multiple studies confirm the positive risk benefit of HPV vaccination with minimal documented adverse effects. The most common adverse effect, injection site pain, occurred in about 10% of girls and was less than the rate reported for other vaccines. Use of HPV vaccine should be expanded into more diverse populations, mainly in low-resource settings. Copyright © 2015 Elsevier Inc. All rights reserved.
Vongkamjan, Kitiya; Benjakul, Soottawat; Kim Vu, Hue Thi; Vuddhakul, Varaporn
2017-09-01
Listeria monocytogenes is a foodborne pathogen commonly found in environments of seafood processing, thus presenting a challenge for eradication from seafood processing facilities. Monitoring the prevalence and subtype diversity of L. monocytogenes together with phages that are specific to Listeria spp. ("Listeria phages") will provide knowledge on the bacteria-phage ecology in food processing plants. In this work, a total of 595 samples were collected from raw material, finished seafood products and environmental samples from different sites of a seafood processing plant during 17 sampling visits in 1.5 years of study. L. monocytogenes and Listeria spp. (non-monocytogenes) were found in 22 (3.7%) and 43 (7.2%) samples, respectively, whereas 29 Listeria phages were isolated from 9 (1.5%) phage-positive samples. DNA fingerprint analysis of L. monocytogenes isolates revealed 11 Random Amplified Polymorphic DNA (RAPD) profiles, with two subtypes were frequently observed over time. Our data reveal a presence of Listeria phages within the same seafood processing environments where a diverse set of L. monocytogenes subtypes was also found. Although serotype 4b was observed at lower frequency, data indicate that isolates from this seafood processing plant belonged to both epidemiologically important serotypes 1/2a and 4b, which may suggest a potential public health risk. Phages (all showed a unique genome size of 65 ± 2 kb) were classified into 9 host range groups, representing both broad- and narrow-host range. While most L. monocytogenes isolates from this facility were susceptible to phages, five isolates showed resistance to 12-20 phages. Variations in phage host range among Listeria phages isolated from food processing plant may affect a presence of a diverse set of L. monocytogenes isolates derived from the same processing environment in Thailand. Copyright © 2017 Elsevier Ltd. All rights reserved.
Olaimat, Amin N; Holley, Richard A
2016-08-01
Ready-to-eat meats are considered foods at high risk to cause life-threatening Listeria monocytogenes infections. This study screened 5 L. monocytogenes strains for their ability to hydrolyze sinigrin (a glucosinolate in Oriental mustard), which formed allyl isothiocyanate (AITC) and reduced L. monocytogenes viability on inoculated vacuum-packed, cooked, cured roast chicken slices at 4 °C. Tests involved incorporation of 25-50 μl/g AITC directly or 100-250 mg/g Oriental mustard extract in 0.5% (w/v) κ-carrageenan/2% (w/v) chitosan-based coatings prepared using 1.5% malic or acetic acid. L. monocytogenes strains hydrolyzed 33.6%-48.4% pure sinigrin in MH broth by 21 d at 25 °C. Acidified κ-carrageenan/chitosan coatings containing 25-50 μl/g AITC or 100-250 mg/g mustard reduced the viability of L. monocytogenes and aerobic bacteria on cooked, cured roast chicken slices by 4.1 to >7.0 log10 CFU/g compared to uncoated chicken stored at 4 °C for 70 d. Coatings containing malic acid were significantly more antimicrobial than those with acetic acid. During storage for 70 d, acidified κ-carrageenan/chitosan coatings containing 25-50 μl/g AITC or 250 mg/g mustard extract reduced lactic acid bacteria (LAB) numbers 3.8 to 5.4 log10 CFU/g on chicken slices compared to uncoated samples. Acidified κ-carrageenan/chitosan-based coatings containing either AITC or Oriental mustard extract at the concentrations tested had the ability to control L. monocytogenes viability and delay growth of potential spoilage bacteria on refrigerated, vacuum-packed cured roast chicken. Copyright © 2016. Published by Elsevier Ltd.
Directory of Open Access Journals (Sweden)
Chong-Tao Du
2018-03-01
Full Text Available The gut microbiota and microRNAs play important roles in the defense against infection. However, the role of miR-146a in L. monocytogenes infection and gut microbiota remains unclear. We tried to determine whether miR-146a controlled L. monocytogenes infection by regulating the gut microbiota. Wild-type and miR-146a-deficient mice or macrophages were used to characterize the impact of miR-146a on animal survival, cell death, bacterial clearance, and gut microbiota following L. monocytogenes challenge. We found that L. monocytogenes infection induced miR-146a expression both in vitro and in vivo. When compared to wild-type mice, miR-146a-deficient mice were more resistant to L. monocytogenes infection. MiR-146a deficiency in macrophages resulted in reduced invasion and intracellular survival of L. monocytogenes. High-throughput sequencing of 16S rRNA revealed that the gut microbiota composition differed between miR-146a-deficient and wild-type mice. Relative to wild-type mice, miR-146a-deficient mice had decreased levels of the Proteobacteria phylum, Prevotellaceae family, and Parasutterella genus, and significantly increased short-chain fatty acid producing bacteria, including the genera Alistipes, Blautia, Coprococcus_1, and Ruminococcus_1. Wild-type mice co-housed with miR-146a-deficient mice had increased resistance to L. monocytogenes, indicating that miR-146a deficiency guides the gut microbiota to alleviate infection. Together, these results suggest that miR-146a deficiency protects against L. monocytogenes infection by regulating the gut microbiota.
Du, Chong-Tao; Gao, Wei; Ma, Ke; Yu, Shui-Xing; Li, Na; Yan, Shi-Qing; Zhou, Feng-Hua; Liu, Zhen-Zhen; Chen, Wei; Lei, Lian-Cheng; Yang, Yong-Jun; Han, Wen-Yu
2018-03-26
The gut microbiota and microRNAs play important roles in the defense against infection. However, the role of miR-146a in L. monocytogenes infection and gut microbiota remains unclear. We tried to determine whether miR-146a controlled L. monocytogenes infection by regulating the gut microbiota. Wild-type and miR-146a-deficient mice or macrophages were used to characterize the impact of miR-146a on animal survival, cell death, bacterial clearance, and gut microbiota following L. monocytogenes challenge. We found that L. monocytogenes infection induced miR-146a expression both in vitro and in vivo. When compared to wild-type mice, miR-146a-deficient mice were more resistant to L. monocytogenes infection. MiR-146a deficiency in macrophages resulted in reduced invasion and intracellular survival of L. monocytogenes . High-throughput sequencing of 16S rRNA revealed that the gut microbiota composition differed between miR-146a-deficient and wild-type mice. Relative to wild-type mice, miR-146a-deficient mice had decreased levels of the Proteobacteria phylum, Prevotellaceae family, and Parasutterella genus, and significantly increased short-chain fatty acid producing bacteria, including the genera Alistipes , Blautia , Coprococcus_1, and Ruminococcus_1 . Wild-type mice co-housed with miR-146a-deficient mice had increased resistance to L. monocytogenes , indicating that miR-146a deficiency guides the gut microbiota to alleviate infection. Together, these results suggest that miR-146a deficiency protects against L. monocytogenes infection by regulating the gut microbiota.
Listeria monocytogenes behaviour in presence of non-UV-irradiated titanium dioxide nanoparticles.
Directory of Open Access Journals (Sweden)
Maria Grazia Ammendolia
Full Text Available Listeria monocytogenes is the agent of listeriosis, a food-borne disease. It represents a serious problem for the food industry because of its environmental persistence mainly due to its ability to form biofilm on a variety of surfaces. Microrganisms attached on the surfaces are a potential source of contamination for environment and animals and humans. Titanium dioxide nanoparticles (TiO2 NPs are used in food industry in a variety of products and it was reported that daily exposure to these nanomaterials is very high. Anti-listerial activity of TiO2 NPs was investigated only with UV-irradiated nanomaterials, based on generation of reactive oxigen species (ROS with antibacterial effect after UV exposure. Since both Listeria monocytogenes and TiO2 NPs are veicolated with foods, this study explores the interaction between Listeria monocytogenes and non UV-irradiated TiO2 NPs, with special focus on biofilm formation and intestinal cell interaction. Scanning electron microscopy and quantitative measurements of biofilm mass indicate that NPs influence both production and structural architecture of listerial biofilm. Moreover, TiO2 NPs show to interfere with bacterial interaction to intestinal cells. Increased biofilm production due to TiO2 NPs exposure may favour bacterial survival in environment and its transmission to animal and human hosts.
Suppression of Listeria monocytogenes by the Native Micro-Flora in Teewurst Sausage
Directory of Open Access Journals (Sweden)
Michline Brice
2013-10-01
Full Text Available Modern consumers are interested in the use of non-chemical methods to control pathogens when heat sterilization is not an option. Such is the case with teewurst sausage, a raw spreadable sausage and a popular German commodity. Although Listeria was not found in teewurst, the optimal microbial growing conditions of teewurst coupled with the ubiquity of L. monocytogenes in nature, makes the possibility of contamination of products very possible. This pilot study was conducted to examine teewurst’s native micro-flora’s ability to suppress the outgrowth of L. monocytogenes at 10 °C using standard plate counts and PCR-DGGE. Traditional plating methods showed L. monocytogenes growth significantly decreased when in competition with the teewurst’s native micro-flora (p < 0.05. The native micro-flora of the teewurst suppressed the overall growth of L. monocytogenes by an average of two logs, under these conditions. Denaturing Gradient Gel Electrophoresis (DGGE amplicons with unique banding patterns were extracted from DGGE gel for identification. Brochothrix thermosphacta and Lactobacillus curvatus were identified as a part of the teewurst’s native micro-flora. Although the native micro-flora did not decrease L. monocytogenes to below limits of detection, it was enough of a decrease to warrant further investigation.
Chen, Yi; Allard, Emma; Wooten, Anna; Hur, Minji; Sheth, Ishani; Laasri, Anna; Hammack, Thomas S; Macarisin, Dumitru
2016-01-01
The recovery and growth potential of Listeria monocytogenes was evaluated in three flavors of milkshakes (vanilla, strawberry, and chocolate) that were prepared from naturally contaminated ice cream linked to a listeriosis outbreak in the U.S. in 2015, and were subsequently held at room temperature for 14 h. The average lag phase duration of L. monocytogenes was 9.05 h; the average generation time was 1.67 h; and the average population level increase per sample at 14 h was 1.14 log CFU/g. Milkshake flavors did not significantly affect these parameters. The average lag phase duration of L. monocytogenes in milkshakes with initial contamination levels ≤ 3 CFU/g (9.50 h) was significantly longer (P 3 CFU/g (8.60 h). The results highlight the value of using samples that are contaminated with very low levels of L. monocytogenes for recovery and growth evaluations. The behavior of L. monocytogenes populations in milkshakes prepared from naturally contaminated ice cream linked to the listeriosis outbreak should be taken into account when performing risk based analysis using this outbreak as a case study.
Directory of Open Access Journals (Sweden)
Wang Jun
2010-03-01
Full Text Available Abstract Background Ecological, biochemical and genetic resemblance as well as clear differences of virulence between L. monocytogenes and L. innocua make this bacterial clade attractive as a model to examine evolution of pathogenicity. This study was attempted to examine the population structure of L. innocua and the microevolution in the L. innocua-L. monocytogenes clade via profiling of 37 internalin genes and multilocus sequence typing based on the sequences of 9 unlinked genes gyrB, sigB, dapE, hisJ, ribC, purM, gap, tuf and betL. Results L. innocua was genetically monophyletic compared to L. monocytogenes, and comprised four subgroups. Subgroups A and B correlated with internalin types 1 and 3 (except the strain 0063 belonging to subgroup C and internalin types 2 and 4 respectively. The majority of L. innocua strains belonged to these two subgroups. Subgroup A harbored a whole set of L. monocytogenes-L. innocua common and L. innocua-specific internalin genes, and displayed higher recombination rates than those of subgroup B, including the relative frequency of occurrence of recombination versus mutation (ρ/θ and the relative effect of recombination versus point mutation (r/m. Subgroup A also exhibited a significantly smaller exterior/interior branch length ratio than expected under the coalescent model, suggesting a recent expansion of its population size. The phylogram based on the analysis with correction for recombination revealed that the time to the most recent common ancestor (TMRCA of L. innocua subgroups A and B were similar. Additionally, subgroup D, which correlated with internalin type 5, branched off from the other three subgroups. All L. innocua strains lacked seventeen virulence genes found in L. monocytogenes (except for the subgroup D strain L43 harboring inlJ and two subgroup B strains bearing bsh and were nonpathogenic to mice. Conclusions L. innocua represents a young species descending from L. monocytogenes and
Vaxvec: The first web-based recombinant vaccine vector database and its data analysis
Deng, Shunzhou; Martin, Carly; Patil, Rasika; Zhu, Felix; Zhao, Bin; Xiang, Zuoshuang; He, Yongqun
2015-01-01
A recombinant vector vaccine uses an attenuated virus, bacterium, or parasite as the carrier to express a heterologous antigen(s). Many recombinant vaccine vectors and related vaccines have been developed and extensively investigated. To compare and better understand recombinant vectors and vaccines, we have generated Vaxvec (http://www.violinet.org/vaxvec), the first web-based database that stores various recombinant vaccine vectors and those experimentally verified vaccines that use these vectors. Vaxvec has now included 59 vaccine vectors that have been used in 196 recombinant vector vaccines against 66 pathogens and cancers. These vectors are classified to 41 viral vectors, 15 bacterial vectors, 1 parasitic vector, and 1 fungal vector. The most commonly used viral vaccine vectors are double-stranded DNA viruses, including herpesviruses, adenoviruses, and poxviruses. For example, Vaxvec includes 63 poxvirus-based recombinant vaccines for over 20 pathogens and cancers. Vaxvec collects 30 recombinant vector influenza vaccines that use 17 recombinant vectors and were experimentally tested in 7 animal models. In addition, over 60 protective antigens used in recombinant vector vaccines are annotated and analyzed. User-friendly web-interfaces are available for querying various data in Vaxvec. To support data exchange, the information of vaccine vectors, vaccines, and related information is stored in the Vaccine Ontology (VO). Vaxvec is a timely and vital source of vaccine vector database and facilitates efficient vaccine vector research and development. PMID:26403370
Modeling the growth of Listeria monocytogenes in mold-ripened cheeses.
Lobacz, Adriana; Kowalik, Jaroslaw; Tarczynska, Anna
2013-06-01
This study presents possible applications of predictive microbiology to model the safety of mold-ripened cheeses with respect to bacteria of the species Listeria monocytogenes during (1) the ripening of Camembert cheese, (2) cold storage of Camembert cheese at temperatures ranging from 3 to 15°C, and (3) cold storage of blue cheese at temperatures ranging from 3 to 15°C. The primary models used in this study, such as the Baranyi model and modified Gompertz function, were fitted to growth curves. The Baranyi model yielded the most accurate goodness of fit and the growth rates generated by this model were used for secondary modeling (Ratkowsky simple square root and polynomial models). The polynomial model more accurately predicted the influence of temperature on the growth rate, reaching the adjusted coefficients of multiple determination 0.97 and 0.92 for Camembert and blue cheese, respectively. The observed growth rates of L. monocytogenes in mold-ripened cheeses were compared with simulations run with the Pathogen Modeling Program (PMP 7.0, USDA, Wyndmoor, PA) and ComBase Predictor (Institute of Food Research, Norwich, UK). However, the latter predictions proved to be consistently overestimated and contained a significant error level. In addition, a validation process using independent data generated in dairy products from the ComBase database (www.combase.cc) was performed. In conclusion, it was found that L. monocytogenes grows much faster in Camembert than in blue cheese. Both the Baranyi and Gompertz models described this phenomenon accurately, although the Baranyi model contained a smaller error. Secondary modeling and further validation of the generated models highlighted the issue of usability and applicability of predictive models in the food processing industry by elaborating models targeted at a specific product or a group of similar products. Copyright © 2013 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Efficient Vaccine Distribution Based on a Hybrid Compartmental Model.
Directory of Open Access Journals (Sweden)
Zhiwen Yu
Full Text Available To effectively and efficiently reduce the morbidity and mortality that may be caused by outbreaks of emerging infectious diseases, it is very important for public health agencies to make informed decisions for controlling the spread of the disease. Such decisions must incorporate various kinds of intervention strategies, such as vaccinations, school closures and border restrictions. Recently, researchers have paid increased attention to searching for effective vaccine distribution strategies for reducing the effects of pandemic outbreaks when resources are limited. Most of the existing research work has been focused on how to design an effective age-structured epidemic model and to select a suitable vaccine distribution strategy to prevent the propagation of an infectious virus. Models that evaluate age structure effects are common, but models that additionally evaluate geographical effects are less common. In this paper, we propose a new SEIR (susceptible-exposed-infectious šC recovered model, named the hybrid SEIR-V model (HSEIR-V, which considers not only the dynamics of infection prevalence in several age-specific host populations, but also seeks to characterize the dynamics by which a virus spreads in various geographic districts. Several vaccination strategies such as different kinds of vaccine coverage, different vaccine releasing times and different vaccine deployment methods are incorporated into the HSEIR-V compartmental model. We also design four hybrid vaccination distribution strategies (based on population size, contact pattern matrix, infection rate and infectious risk for controlling the spread of viral infections. Based on data from the 2009-2010 H1N1 influenza epidemic, we evaluate the effectiveness of our proposed HSEIR-V model and study the effects of different types of human behaviour in responding to epidemics.
Jadhav, Snehal; Sevior, Danielle; Bhave, Mrinal; Palombo, Enzo A
2014-01-31
Conventional methods used for primary detection of Listeria monocytogenes from foods and subsequent confirmation of presumptive positive samples involve prolonged incubation and biochemical testing which generally require four to five days to obtain a result. In the current study, a simple and rapid proteomics-based MALDI-TOF MS approach was developed to detect L. monocytogenes directly from selective enrichment broths. Milk samples spiked with single species and multiple species cultures were incubated in a selective enrichment broth for 24h, followed by an additional 6h secondary enrichment. As few as 1 colony-forming unit (cfu) of L. monocytogenes per mL of initial selective broth culture could be detected within 30h. On applying the same approach to solid foods previously implicated in listeriosis, namely chicken pâté, cantaloupe and Camembert cheese, detection was achieved within the same time interval at inoculation levels of 10cfu/mL. Unlike the routine application of MALDI-TOF MS for identification of bacteria from solid media, this study proposes a cost-effective and time-saving detection scheme for direct identification of L. monocytogenes from broth cultures.This article is part of a Special Issue entitled: Trends in Microbial Proteomics. Globally, foodborne diseases are major causes of illness and fatalities in humans. Hence, there is a continual need for reliable and rapid means for pathogen detection from food samples. Recent applications of MALDI-TOF MS for diagnostic microbiology focused on detection of microbes from clinical specimens. However, the current study has emphasized its use as a tool for detecting the major foodborne pathogen, Listeria monocytogenes, directly from selective enrichment broths. This proof-of-concept study proposes a detection scheme that is more rapid and simple compared to conventional methods of Listeria detection. Very low levels of the pathogen could be identified from different food samples post-enrichment in
Solar irradiance limits the long-term survival of Listeria monocytogenes in seawater.
NicAogáin, K; Magill, D; O'Donoghue, B; Conneely, A; Bennett, C; O'Byrne, C P
2018-03-01
Seafood has often been implicated in outbreaks of food-borne illness caused by Listeria monocytogenes but the source of contamination is usually not known. In this study we investigated the possibility that this pathogen could survive in seawater for an extended time period. Freshly collected seawater samples were inoculated with 1 × 10 8 CFU per ml of L. monocytogenes EGD-e and survival was monitored by plate counting for up to 25 days. When incubated in the dark, either at ambient temperatures (4-14°C) or at 16°C, >10 4 CFU per ml survivors were present after 25 days. However, when the seawater cell suspensions were exposed to ambient light (solar irradiation) and temperatures, L. monocytogenes lost viability rapidly and no survivors could be detected after the 80 h time point. Both UV-A and visible light in the blue region of the spectrum (470 nm) were found to contribute to this effect. The stress inducible sigma factor σ B was found to play a role in survival of L. monocytogenes in seawater. Together these data demonstrate that solar irradiation is a critical determinant of L. monocytogenes survival in marine environments. The data further suggest the possibility of controlling this food-borne pathogen in food-processing environments using visible light. Listeria monocytogenes is a food-borne bacterial pathogen capable of causing the life-threatening infection, listeriosis. In seafood the route of contamination from the environment is often not well understood as this pathogen is not generally thought to survive well in seawater. Here we provide evidence that L. monocytogenes is capable of surviving for long periods of time in seawater when light is excluded. Sunlight is demonstrated to have a significant effect on the survival of this pathogen in seawater, and both visible (470 nm) and UV-A light are shown to contribute to this effect. © 2017 The Society for Applied Microbiology.
Assessment of Listeria monocytogenes virulence in the Galleria mellonella insect larvae model.
Directory of Open Access Journals (Sweden)
Mira Rakic Martinez
Full Text Available Several animal models have been used to understand the molecular basis of the pathogenicity, infectious dose and strain to strain variation of Listeria monocytogenes. The greater wax worm Galleria mellonella, as an alternative model, provides some useful advantages not available with other models and has already been described as suitable for the virulence assessment of various pathogens including L. monocytogenes. The objectives of this study are: 1 confirming the usefulness of this model with a wide panel of Listeria spp. including non-pathogenic L. innocua, L. seeligeri, L. welshimeri and animal pathogen L. ivanovii; 2 assessment of virulence of several isogenic in-frame deletion mutants in virulence and stress related genes of L. monocytogenes and 3 virulence assessment of paired food and clinical isolates of L. monocytogenes from 14 major listeriosis outbreaks occurred worldwide between 1980 and 2015. Larvae injected with different concentrations of Listeria were incubated at 37°C and monitored over seven days for time needed to kill 50% of larvae (LT50 and to determine change of bacterial population in G. mellonella, 2 and 24 hours post-inoculation. Non-pathogenic members of Listeria and L. ivanovii showed significantly (P < 0.05 higher LT50 (lower virulence than the wild type L. monocytogenes strains. Isogenic mutants of L. monocytogenes with the deletions in prfA, plcA, hly, actA and virR genes, also showed significantly (P < 0.05 higher LT50 than the wild type strain at the inoculum of 106CFU/larva. Food isolates had significantly (P < 0.05 lower virulence than the paired clinical isolates, at all three inoculum concentrations. L. monocytogenes strains related to non-invasive (gastroenteritis outbreaks of listeriosis showed significantly (P < 0.05 lower virulence than isolates of the same serotype obtained from outbreaks with invasive symptoms. The difference, however, was dose and strain- dependent. No significant differences in
Listeria monocytogenes serotype prevalence and biodiversity in diverse food products.
Hadjilouka, Agni; Andritsos, Nikolaos D; Paramithiotis, Spiros; Mataragas, Marios; Drosinos, Eleftherios H
2014-12-01
The aim of this study was to assess serotype prevalence and biodiversity of Listeria monocytogenes strains isolated from diverse food products, i.e., minced pork, fruits, and vegetables. Three hundred twenty-six samples previously purchased from supermarkets and street markets within the Athens area were studied for L. monocytogenes prevalence. A total of 121 strains were isolated from the 36 samples that were positive for L. monocytogenes. Serotyping was performed with multiplex PCR, and biodiversity was assessed with random amplified polymorphic DNA (RAPD) PCR analysis using M13, UBC155, and HLWL85 as primers and with repetitive element palindromic (rep) PCR analysis using (GTG)5 as the primer. The majority (17 of 22) of the contaminated minced pork samples contained strains identified as serotype 1/2a, either alone or in combination with strains belonging to serotypes 1/2b, 4a, 4c, or 4ab. However, all L. monocytogenes isolates from fruits and vegetables belonged to serotype 4b. Rep-PCR provided better differentiation of the isolates than did RAPD PCR and resulted in discrimination of the isolates into a larger number of unique profiles. Complete differentiation was achieved only with the combination of these subtyping techniques.
COMPARISON OF TWO METHODS FOR THE DETECTION OF LISTERIA MONOCYTOGENES
Directory of Open Access Journals (Sweden)
G. Tantillo
2013-02-01
Full Text Available The aim of this study was to compare the performance of the conventional methods for detection of Listeria monocytogenes in food using media Oxford and ALOA (Agar Listeria acc. to Ottaviani & Agosti in according to the ISO 11290-1 to a new chromogenic medium “CHROMagar Listeria” standardized in 2005 AFNOR ( CHR – 21/1-12/01. A total of 40 pre-packed ready-to-eat food samples were examined. Using two methods six samples were found positive for Listeria monocytogenes but the medium “CHROMagar Listeria” was more selective in comparison with the others. In conclusion this study has demonstrated that isolation medium able to target specifically the detection of L. monocytogenes such as “CHROMagar Listeria” is highly recommendable because of that detection time is significantly reduced and the analysis cost is less expensive.
Role of Extracellular DNA during Biofilm Formation by Listeria monocytogenes
DEFF Research Database (Denmark)
Harmsen, Morten; Lappann, Martin; Knøchel, S
2010-01-01
(eDNA) may be the only central component of the biofilm matrix and that it is necessary for both initial attachment and early biofilm formation for 41 L. monocytogenes strains that were tested. DNase I treatment resulted in dispersal of biofilms, not only in microtiter tray assays but also in flow......Listeria monocytogenes is a food-borne pathogen that is capable of living in harsh environments. It is believed to do this by forming biofilms, which are surface-associated multicellular structures encased in a self-produced matrix. In this paper we show that in L. monocytogenes extracellular DNA...... cell biofilm assays. However, it was also demonstrated that in a culture without eDNA, neither Listeria genomic DNA nor salmon sperm DNA by itself could restore the capacity to adhere. A search for additional necessary components revealed that peptidoglycan (PG), specifically N-acetylglucosamine (NAG...
Directory of Open Access Journals (Sweden)
Bahador
2015-08-01
Full Text Available Background Listeria monocytogenes is a foodborne pathogen and a serious threat to the public health in the world. Consumption of traditional foods such as dairy and meat products can be a major reason for relative abundance and isolation of these bacteria. Objectives The purpose of this study was to determine the phenotypic and genotypic characteristics of L. monocytogenes strains isolated from dairy and meat products. Materials and Methods A total of 317 dairy products and meat-processed samples were collected. Antibiotic susceptibility test was performed on each sample by the disk diffusion method (Kirby Bauer. Five reference loci were used for typing of L. monocytogenes strains by MLVA (Multiple Locus VNTR Analysis Technique. Results A total of 24 L. monocytogenes isolates were collected from the dairy and meat products. Resistance of isolated L. monocytogenes strains to penicillin G were 54.54% (from dairy products and 46.15% (from processed meat. Genetic relatedness of isolates were assessed by MLVA. Out of 13 different types, type 2 with 6 strains and type 3 with 4 strains, were the most common types. Conclusions MLVA analysis showed that samples obtained from different sources could have similar genetic profile. As a result, administration of penicillin in patients with listeriosis (especially pregnant women and antibiotic susceptibility test are recommended. The fast and accurate methods such as MLVA for tracking of pollution sources of L. monocytogenes are recommended during outbreaks.
Jovanović, Gordana D; Klaus, Anita S; Nikšić, Miomir P
2016-01-01
The antibacterial activity of chitosan coatings prepared with acetic or lactic acid, as well as of composite chitosan-gelatin films prepared with essential oils, was evaluated in fresh shredded black radish samples inoculated with Listeria monocytogenes ATCC 19115 and L. monocytogenes ATCC 19112 during seven days of storage at 4°C. The chitosan coating prepared with acetic acid showed the most effective antibacterial activity. All tested formulations of chitosan films exhibited strong antimicrobial activity on the growth of L. monocytogenes on black radish, although a higher inhibition of pathogens was achieved at higher concentrations of chitosan. The antimicrobial effect of chitosan films was even more pronounced with the addition of essential oils. Chitosan-gelatin films with thyme essential oils showed the most effective antimicrobial activity. A reduction of 2.4log10CFU/g for L. monocytogenes ATCC 19115 and 2.1log10CFU/g for L. monocytogenes ATCC 19112 was achieved in the presence of 1% chitosan film containing 0.2% of thyme essential oil after 24h of storage. Copyright © 2016 Asociación Argentina de Microbiología. Publicado por Elsevier España, S.L.U. All rights reserved.
Lineage specific recombination rates and microevolution in Listeria monocytogenes
Directory of Open Access Journals (Sweden)
Nightingale Kendra K
2008-10-01
Full Text Available Abstract Background The bacterium Listeria monocytogenes is a saprotroph as well as an opportunistic human foodborne pathogen, which has previously been shown to consist of at least two widespread lineages (termed lineages I and II and an uncommon lineage (lineage III. While some L. monocytogenes strains show evidence for considerable diversification by homologous recombination, our understanding of the contribution of recombination to L. monocytogenes evolution is still limited. We therefore used STRUCTURE and ClonalFrame, two programs that model the effect of recombination, to make inferences about the population structure and different aspects of the recombination process in L. monocytogenes. Analyses were performed using sequences for seven loci (including the house-keeping genes gap, prs, purM and ribC, the stress response gene sigB, and the virulence genes actA and inlA for 195 L. monocytogenes isolates. Results Sequence analyses with ClonalFrame and the Sawyer's test showed that recombination is more prevalent in lineage II than lineage I and is most frequent in two house-keeping genes (ribC and purM and the two virulence genes (actA and inlA. The relative occurrence of recombination versus point mutation is about six times higher in lineage II than in lineage I, which causes a higher genetic variability in lineage II. Unlike lineage I, lineage II represents a genetically heterogeneous population with a relatively high proportion (30% average of genetic material imported from external sources. Phylograms, constructed with correcting for recombination, as well as Tajima's D data suggest that both lineages I and II have suffered a population bottleneck. Conclusion Our study shows that evolutionary lineages within a single bacterial species can differ considerably in the relative contributions of recombination to genetic diversification. Accounting for recombination in phylogenetic studies is critical, and new evolutionary models that
Oral Modeling of an Adenovirus-Based Quadrivalent Influenza Vaccine in Ferrets and Mice.
Scallan, Ciaran D; Lindbloom, Jonathan D; Tucker, Sean N
2016-06-01
Oral vaccines delivered as tablets offer a number of advantages over traditional parenteral-based vaccines including the ease of delivery, lack of needles, no need for trained medical personnel, and the ability to formulate into temperature-stable tablets. We have been evaluating an oral vaccine platform based on recombinant adenoviral vectors for the purpose of creating a prophylactic vaccine to prevent influenza, and have demonstrated vaccine efficacy in animal models and substantial immunogenicity in humans. These studies have evaluated monovalent vaccines to date. To protect against the major circulating A and B influenza strains, a multivalent influenza vaccine will be required. In this study, the immunogenicity of orally delivered monovalent, bivalent, trivalent, and quadrivalent vaccines was tested in ferrets and mice. The various vaccine combinations were tested by blending monovalent recombinant adenovirus vaccines, each expressing hemagglutinin from a single strain. Human tablet delivery was modeled in animals by oral gavage in mice and by endoscopic delivery in ferrets. We demonstrated minimal interference between the various vaccine vectors when used in combination and that the oral quadrivalent vaccine compared favorably to an approved trivalent inactivated vaccine. The quadrivalent vaccine presented here produced immune responses that we predict should be capable of providing protection against multiple influenza strains, and the platform should have applications to other multivalent vaccines. Vaxart, Inc.
Gelbícová, T; Karpísková, R
2012-04-01
Evaluation of the incidence and characteristics of L. monocytogenes in samples of raw cow's milk collected on farms (bulk tank milk samples) and from vending machines. Detection of L. monocytogenes and enumeration were carried out according to EN/ISO 11290--1, 2. Strains were characterised by serotyping and macrorestriction analysis using pulsed-field gel electrophoresis. The presence of L. monocytogenes was detected in 3,2 % (11/346) of bulk tank milk samples and 1,8 % (4/219) samples of raw cow's milk from vending machines. Findings of L. monocytogenes in raw milk were sporadic. Only on one farm strains of L. monocytogenes were detected repeatedly. Thirteen strains of L. monocytogenes belonged to serotype 1/2a, two strains to serotype 1/2b and one to serotype 4b. Macrorestriction analysis revealed considerable heterogeinity of profiles, with nine different pulsotypes being detected. Pulsotype 711 was the most frequent. This pulsotype was found on three different farms. The incidence of L. monocytogenes in raw cow's milk is relatively low in the Czech Republic. The results confirmed that some clones of L. monocytogenes from raw milk are identical with food and human strains.
Directory of Open Access Journals (Sweden)
J.A. Khan
2013-09-01
Full Text Available Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO. A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG; R: CCTCCAGAGTGATCGATGTT complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR. PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%, followed by fish meat (4.0%, and then beef (2.5%. Among various milk and milk products, curd (2.0% showed the highest prevalence, followed by raw milk (1.3%. The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 µL and 50 µL of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro resulted positive in twenty four
Inuwa, A; Lunt, A; Czuprynski, C; Miller, G; Rankin, S A
2017-10-19
Although frozen dairy desserts have a strong record of safety, recent outbreaks of foodborne disease linked to ice creams have brought new attention to this industry. There is concern that small-scale frozen dessert equipment may not comply with or be reviewed against published comprehensive design and construction sanitation specifications (National Sanitation Foundation or 3-A sanitary standards). Equipment sanitary design issues may result in reduced efficacy of cleaning and sanitation, thus increasing the likelihood of postprocess contamination with pathogenic bacteria. In this context, and given that Listeria monocytogenes outbreaks are of great concern for the frozen dessert industry, a complementary study was conducted to evaluate the fate of L. monocytogenes in ice cream mix on a stainless steel surface. Our results showed that L. monocytogenes survived for up to 6 weeks at room temperature and 9 weeks at 4°C in contaminated ice cream on a stainless steel surface. Furthermore, chlorine- and acid-based surface sanitizers had no detrimental effect on the L. monocytogenes when used at a concentration and contact time (1 min) recommended by the manufacturer; significant reduction in CFU required 5 to 20 min of contact time.
Robbins, Spring Chenoa Cooper; Bernard, Diana; McCaffery, Kirsten; Skinner, S Rachel
2010-09-01
To date, no published studies examine procedural factors of the school-based human papillomavirus (HPV) vaccination program from the perspective of those involved. This study examines the factors that were perceived to impact optimal vaccination experience. Schools across Sydney were selected to reflect a range of vaccination coverage at the school level and different school types to ensure a range of experiences. Semi-structured focus groups were conducted with girls; and one-on-one interviews were undertaken with parents, teachers and nurses until saturation of data in all emergent themes was reached. Focus groups and interviews explored participants' experiences in school-based HPV vaccination. Transcripts were analysed, letting themes emerge. Themes related to participants' experience of the organisational, logistical and procedural aspects of the vaccination program and their perceptions of an optimal process were organised into two categories: (1) preparation for the vaccination program and (2) vaccination day strategies. In (1), themes emerged regarding commitment to the process from those involved, planning time and space for vaccinations, communication within and between agencies, and flexibility. In (2), themes included vaccinating the most anxious girls first, facilitating peer support, use of distraction techniques, minimising waiting time girls, and support staff. A range of views exists on what constitutes an optimal school-based program. Several findings were identified that should be considered in the development of guidelines for implementing school-based programs. Future research should evaluate how different approaches to acquiring parental consent, and the use of anxiety and fear reduction strategies impact experience and uptake in the school-based setting.
Simmons, Courtenay; Stasiewicz, Matthew J; Wright, Emily; Warchocki, Steven; Roof, Sherry; Kause, Janell R; Bauer, Nathan; Ibrahim, Salam; Wiedmann, Martin; Oliver, Haley F
2014-11-01
Postprocessing contamination in processing plants has historically been a significant source of Listeria monocytogenes in ready-to-eat delicatessen meats, and therefore a major cause of human listeriosis cases and outbreaks. Recent risk assessments suggest that a majority of human listeriosis cases linked to consumption of contaminated deli meats may be due to L. monocytogenes contamination that occurs at the retail level. To better understand the ecology and transmission of Listeria spp. in retail delicatessens, food and nonfood contact surfaces were tested for L. monocytogenes and other Listeria spp. in a longitudinal study conducted in 30 retail delis in three U.S. states. In phase I of the study, seven sponge samples were collected monthly for 3 months in 15 delis (5 delis per state) prior to start of daily operation; in phase II, 28 food contact and nonfood contact sites were sampled in each of 30 delis during daily operation for 6 months. Among the 314 samples collected during phase I, 6.8% were positive for L. monocytogenes. Among 4,503 samples collected during phase II, 9.5% were positive for L. monocytogenes; 9 of 30 delis showed low L. monocytogenes prevalence (Listeria spp. isolates, including 184 Listeria innocua, 48 Listeria seeligeri, and 13 Listeria welshimeri were characterized. Pulsed-field gel electrophoresis (PFGE) was used to characterize 446 L. monocytogenes isolates. PFGE showed that for 12 of 30 delis, one or more PFGE types were isolated on at least three separate occasions, providing evidence for persistence of a given L. monocytogenes subtype in the delis. For some delis, PFGE patterns for isolates from nonfood contact surfaces were distinct from patterns for occasional food contact surface isolates, suggesting limited cross-contamination between these sites in some delis. This study provides longitudinal data on L. monocytogenes contamination patterns in retail delis, which should facilitate further development of control strategies in
Directory of Open Access Journals (Sweden)
Nilma Cintra Lea
2013-09-01
Full Text Available Background: In Brazil, listeriosis is not a notifiable disease; thus, the incidence of Brazilian cases remains unknown. Listeria monocytogenes is not always included in automated systems, and its detection depends on the high skill level of microbiology laboratory professionals. This paper describes the characteristics of L. monocytogenes isolates fortuitously obtained from an endocarditis case in Recife, PE, Brazil. Methods: Six bacterial isolates obtained from six blood cultures from a 28-year-old male bearing a prosthetic mitral heart valve were analyzed by PCR using primers specific of L. monocytogenes to confirm a presumptive identification, determine the serotype and presence of the virulence genes (inlA, inlB, inlC, inlJ, hly, plcA, actA, prfA in an attempt to determine the Listeria genotype by PCR-ribotyping. Results: The samples were identified as L. monocytogenes 4b. All investigated virulence genes were amplified by PCR, and the identity of the amplified segments was confirmed by sequencing. A deletion of 105 base pairs was detected in the actA gene. All of the samples generated the same PCR-ribotype pattern, clustered into a single ribotype, and were considered a single strain. Conclusion: L. monocytogenes infection should be considered in endocarditis differential diagnoses, especially among high-risk groups, due to its high pathogenicity and the environmental ubiquity.
LACTIC FLORA-LISTERIA MONOCYTOGENES INTERACTION
Directory of Open Access Journals (Sweden)
S. Colombo
2012-08-01
Full Text Available The EC Regulation 2073/2005 (1 requires that food processors evaluate the capability of ready-to-use (RTE products to support the development of Listeria monocytogenes when their pH and aW values are favourable to the growth of this microorganism. It is renown that the lactic flora plays an important role in many different foods, both from a technological and a food safety standpoint. This study was aimed to observe the behaviour and the potential anti-Listeria effect of some natural lactic flora present in Italian liver patè crostini (chicken heart and liver, anchovies, onions, capers, starch, no added preservatives through the Combase Predictor – Max Growth Rate predictive software. The natural lactic flora of the crostini demonstrated a variable capability to inhibit the growth of Listeria monocytogenes which depends upon : the concentration of the lactic flora at the beginning of the shelf life period and the subsequent lag phase, the possible release of anti-Listeria substances, and the maximum growth rate.
An outbreak of an unusual strain of Listeria monocytogenes infection in North-East Scotland
Directory of Open Access Journals (Sweden)
Emmanuel Okpo
2015-11-01
Full Text Available Summary: Listeria monocytogenes infection is an important cause of illness and hospitalization in vulnerable individuals. In the present study, we describe a community outbreak of Listeria monocytogenes in the North-East region of Scotland, which was epidemiologically, environmentally and microbiologically linked to a local meat product and ready-to-eat product manufacturer. Infected individuals were interviewed, and an environmental investigation was conducted. Clinical and environmental samples were tested by culture, and isolates were typed by fluorescent amplified fragment length polymorphism (fAFLP. Three cases of Listeria monocytogenes were linked geographically, had the same serotype (1/2a and were indistinguishable by fAFLP type XII.6. The human, food and environmental isolates were of the same serotype and were indistinguishable by molecular typing.This is the first community outbreak of L. monocytogenes reported in Scotland since the current outbreak surveillance was established in 1996. Epidemiological and laboratory evidence indicated poor hand hygiene, unhygienic practices and cross-contamination throughout the manufacturing process of ready-to-eat foods as a possible cause of the outbreak. More stringent control of commercial food establishments that provide ready-to-eat food and the need to advise specifically vulnerable groups, e.g., pregnant women, of the risk of L. monocytogenes in ready-to-eat food is urgently needed. Keywords: Listeria monocytogenes, Outbreak, Foodborne, Community acquired infection, Listeriosis
Clinical responses in patients with advanced colorectal cancer to a dendritic cell based vaccine
DEFF Research Database (Denmark)
Burgdorf, Stefan K; Fischer, Anders; Myschetzky, Peter S
2008-01-01
Patients with disseminated colorectal cancer have a poor prognosis. Preliminary studies have shown encouraging results from vaccines based on dendritic cells. The aim of this phase II study was to evaluate the effect of treating patients with advanced colorectal cancer with a cancer vaccine based...... with this DC-based cancer vaccine was safe and non-toxic. Stable disease was found in 24% (4/17) of the patients. The quality of life remained for most categories high and stable throughout the study period.......Patients with disseminated colorectal cancer have a poor prognosis. Preliminary studies have shown encouraging results from vaccines based on dendritic cells. The aim of this phase II study was to evaluate the effect of treating patients with advanced colorectal cancer with a cancer vaccine based......-testis antigens. Vaccines were biweekly administered intradermally with a total of 10 vaccines per patient. CT scans were performed and responses were graded according to the RECIST criteria. Quality of life was monitored with the SF-36 questionnaire. Toxicity and adverse events were graded according...
Inactivation of Listeria monocytogenes in milk by pulsed electric field.
Reina, L D; Jin, Z T; Zhang, Q H; Yousef, A E
1998-09-01
Pasteurized whole, 2%, and skim milk were inoculated with Listeria monocytogenes Scott A and treated with high-voltage pulsed electric field (PEF). The effects of milk composition (fat content) and PEF parameters (electric field strength, treatment time, and treatment temperature) on the inactivation of the bacterium were studied. No significant differences were observed in the inactivation of L. monocytogenes Scott A in three types of milk by PEF treatment. With treatment at 25 degrees C, 1- to 3-log reductions of L. monocytogenes were observed. PEF lethal effect was a function of field strength and treatment time. Higher field strength or longer treatment time resulted in a greater reduction of viable cells. A 4-log reduction of the bacterium was obtained by increasing the treatment temperature to 50 degrees C. Results indicate that the use of a high-voltage PEF is a promising technology for inactivation of foodborne pathogens.
Directory of Open Access Journals (Sweden)
Erica Tirloni
2017-12-01
Full Text Available Objective of the present study was to test the performances of a loop-mediated isothermal amplification (LAMP-based method for the detection of Listeria monocytogenes, with particular focus on the dairy products. The specificity of the method was evaluated on 42 different Listeria spp. strains from collections, food and environmental samples. 100% (32 of 32 of the L. monocytogenes strains were correctly recognised, and none of other 10 Listeria spp. strains was misidentified. The sensitivity was evaluated on four L. monocytogenes strains from different sources. The instrument was able to detect 10-400 CFU/mL. The ability to detect low initial numbers of L. monocytogenes (0.3- 0.7 Log CFU/g was also evaluated, in duplicate, in pasteurised milk (whole and skimmed and dairy samples (fresh ricotta, crescenza, mascarpone, mozzarella, cottage cheese, cream cheese, taleggio, gorgonzola. The analysis was performed after 18, 24 and 48 h of incubation, and was coupled with the count of L. monocytogenes in the broth. Microbial loads were insufficient to achieve a positive result after 18 and 24 h in most of the samples; after 48 h, all the products, except taleggio and one gorgonzola sample, were identified as positive; the sensitivity of the method when applied to contaminated dairy foods was about 5 Log CFU/g. The LAMP method tested can be considered a very useful tool, as it is a costeffective and easy-functioning method. The preliminary data obtained should be confirmed with a validation process taking into account different food typologies.
Novel Biocontrol Methods for Listeria monocytogenes Biofilms in Food Production Facilities
Directory of Open Access Journals (Sweden)
Jessica A. Gray
2018-04-01
Full Text Available High mortality and hospitalization rates have seen Listeria monocytogenes as a foodborne pathogen of public health importance for many years and of particular concern for high-risk population groups. Food manufactures face an ongoing challenge in preventing the entry of L. monocytogenes into food production environments (FPEs due to its ubiquitous nature. In addition to this, the capacity of L. monocytogenes strains to colonize FPEs can lead to repeated identification of L. monocytogenes in FPE surveillance. The contamination of food products requiring product recall presents large economic burden to industry and is further exacerbated by damage to the brand. Poor equipment design, facility layout, and worn or damaged equipment can result in Listeria hotspots and biofilms where traditional cleaning and disinfecting procedures may be inadequate. Novel biocontrol methods may offer FPEs effective means to help improve control of L. monocytogenes and decrease cross contamination of food. Bacteriophages have been used as a medical treatment for many years for their ability to infect and lyse specific bacteria. Endolysins, the hydrolytic enzymes of bacteriophages responsible for breaking the cell wall of Gram-positive bacteria, are being explored as a biocontrol method for food preservation and in nanotechnology and medical applications. Antibacterial proteins known as bacteriocins have been used as alternatives to antibiotics for biopreservation and food product shelf life extension. Essential oils are natural antimicrobials formed by plants and have been used as food additives and preservatives for many years and more recently as a method to prevent food spoilage by microorganisms. Competitive exclusion occurs naturally among bacteria in the environment. However, intentionally selecting and applying bacteria to effect competitive exclusion of food borne pathogens has potential as a biocontrol application. This review discusses these novel biocontrol
Novel Biocontrol Methods for Listeria monocytogenes Biofilms in Food Production Facilities
Gray, Jessica A.; Chandry, P. Scott; Kaur, Mandeep; Kocharunchitt, Chawalit; Bowman, John P.; Fox, Edward M.
2018-01-01
High mortality and hospitalization rates have seen Listeria monocytogenes as a foodborne pathogen of public health importance for many years and of particular concern for high-risk population groups. Food manufactures face an ongoing challenge in preventing the entry of L. monocytogenes into food production environments (FPEs) due to its ubiquitous nature. In addition to this, the capacity of L. monocytogenes strains to colonize FPEs can lead to repeated identification of L. monocytogenes in FPE surveillance. The contamination of food products requiring product recall presents large economic burden to industry and is further exacerbated by damage to the brand. Poor equipment design, facility layout, and worn or damaged equipment can result in Listeria hotspots and biofilms where traditional cleaning and disinfecting procedures may be inadequate. Novel biocontrol methods may offer FPEs effective means to help improve control of L. monocytogenes and decrease cross contamination of food. Bacteriophages have been used as a medical treatment for many years for their ability to infect and lyse specific bacteria. Endolysins, the hydrolytic enzymes of bacteriophages responsible for breaking the cell wall of Gram-positive bacteria, are being explored as a biocontrol method for food preservation and in nanotechnology and medical applications. Antibacterial proteins known as bacteriocins have been used as alternatives to antibiotics for biopreservation and food product shelf life extension. Essential oils are natural antimicrobials formed by plants and have been used as food additives and preservatives for many years and more recently as a method to prevent food spoilage by microorganisms. Competitive exclusion occurs naturally among bacteria in the environment. However, intentionally selecting and applying bacteria to effect competitive exclusion of food borne pathogens has potential as a biocontrol application. This review discusses these novel biocontrol methods and their
Trial watch: Naked and vectored DNA-based anticancer vaccines.
Bloy, Norma; Buqué, Aitziber; Aranda, Fernando; Castoldi, Francesca; Eggermont, Alexander; Cremer, Isabelle; Sautès-Fridman, Catherine; Fucikova, Jitka; Galon, Jérôme; Spisek, Radek; Tartour, Eric; Zitvogel, Laurence; Kroemer, Guido; Galluzzi, Lorenzo
2015-05-01
One type of anticancer vaccine relies on the administration of DNA constructs encoding one or multiple tumor-associated antigens (TAAs). The ultimate objective of these preparations, which can be naked or vectored by non-pathogenic viruses, bacteria or yeast cells, is to drive the synthesis of TAAs in the context of an immunostimulatory milieu, resulting in the (re-)elicitation of a tumor-targeting immune response. In spite of encouraging preclinical results, the clinical efficacy of DNA-based vaccines employed as standalone immunotherapeutic interventions in cancer patients appears to be limited. Thus, efforts are currently being devoted to the development of combinatorial regimens that allow DNA-based anticancer vaccines to elicit clinically relevant immune responses. Here, we discuss recent advances in the preclinical and clinical development of this therapeutic paradigm.
Listeria monocytogenes : nog steeds een probleem?
Beumer, R.R.
2011-01-01
Listeria monocytogenes is net als vele andere bacteriële voedselpathogenen al tientallen jaren bekend. De meeste grondstoffen voor voedingsmiddelen komen uit de akker- en tuinbouw, de veehouderij en de visserij. Besmetting vindt daar plaats met micro-organismen afkomstig uit grond, fecaliën, water,
Directory of Open Access Journals (Sweden)
Yi eChen
2016-05-01
Full Text Available The recovery and growth potential of Listeria monocytogenes was evaluated in three flavors of milkshakes (vanilla, strawberry, and chocolate that were prepared from naturally contaminated ice cream linked to a listeriosis outbreak in the U.S. in 2015, and were subsequently held at room temperature for 14 hours. The average lag phase duration of L. monocytogenes was 9.05 h; the average generation time was 1.67 h; and the average level increase per sample at 14 h was 1.15 log CFU/g. Milkshake flavors did not significantly affect these parameters. The average lag phase duration of L. monocytogenes in milkshakes with initial contamination levels ≤ 3 CFU/g (9.50 h was significantly longer (P 3 CFU/g (8.60 h. The results highlight the value of using samples that are contaminated with very low levels of L. monocytogenes for recovery and growth evaluations. The behavior of L. monocytogenes populations in milkshakes prepared from naturally contaminated ice cream linked to the listeriosis outbreak should be taken into account when performing risk based analysis using this outbreak as a case-study.
Tipping the Proteome with Gene-Based Vaccines: Weighing in on the Role of Nano materials
International Nuclear Information System (INIS)
Flores, K.J.; Craig, M.; Smith, J.J.; DeLong, R.K.; Wanekaya, A.; Dong, L.
2012-01-01
Since the first generation of DNA vaccines was introduced in 1988, remarkable improvements have been made to improve their efficacy and immunogenicity. Although human clinical trials have shown that delivery of DNA vaccines is well tolerated and safe, the potency of these vaccines in humans is somewhat less than optimal. The development of a gene-based vaccine that was effective enough to be approved for clinical use in humans would be one of, if not the most important, advance in vaccines to date. This paper highlights the literature relating to gene-based vaccines, specifically DNA vaccines, and suggests possible approaches to boost their performance. In addition, we explore the idea that combining RNA and nano materials may hold the key to successful gene-based vaccines for prevention and treatment of disease
Hwang, Cheng-An; Sheen, Shiowshuh
2011-05-01
This study examined the growth characteristics of Listeria monocytogenes as affected by a native microflora in cooked ham at refrigerated and abuse temperatures. A five-strain mixture of L. monocytogenes and a native microflora, consisting of Brochothrix spp., isolated from cooked meat were inoculated alone (monocultured) or co-inoculated (co-cultured) onto cooked ham slices. The growth characteristics, lag phase duration (LPD, h), growth rate (GR, log(10) cfu/h), and maximum population density (MPD, log(10) cfu/g), of L. monocytogenes and the native microflora in vacuum-packed ham slices stored at 4, 6, 8, 10, and 12 °C for up to 5 weeks were determined. At 4-12 °C, the LPDs of co-cultured L. monocytogenes were not significantly different from those of monocultured L. monocytogenes in ham, indicating the LPDs of L. monocytogenes at 4-12 °C were not influenced by the presence of the native microflora. At 4-8 °C, the GRs of co-cultured L. monocytogenes (0.0114-0.0130 log(10) cfu/h) were statistically but marginally lower than those of monocultured L. monocytogenes (0.0132-0.0145 log(10) cfu/h), indicating the GRs of L. monocytogenes at 4-8 °C were reduced by the presence of the native microflora. The GRs of L. monocytogenes were reduced by 8-7% with the presence of the native microflora at 4-8 °C, whereas there was less influence of the native microflora on the GRs of L. monocytogenes at 10 and 12 °C. The MPDs of L. monocytogenes at 4-8 °C were also reduced by the presence of the native microflora. Data from this study provide additional information regarding the growth suppression of L. monocytogenes by the native microflora for assessing the survival and growth of L. monocytogenes in ready-to-eat meat products. Published by Elsevier Ltd.
Gamma irradiation as a means to eliminate Listeria monocytogenes from frozen chicken meat
International Nuclear Information System (INIS)
Kamat, A.S.; Nair, M.P.
1995-01-01
Cells of Listeria monocytogenes ATCC 35152 were sensitive to gamma irradiation in phosphate buffer, pH 7.00 (D 10 , dose required for 10% survival—0.15 kGy) at 0–5°C. The cells showed higher radiation survival when irradiated under frozen condition, with a D 10 of 0.3 kGy. The protection offered by shrimp/chicken/kheema homogenates (100 g litre−1) was evidenced by even higher D 10 values (0.5 kGy) at both 0–5°C and cryogenic temperature. Boneless chicken meat samples were artificially inoculated with L monocytogenes ATCC 35152 cells at low (5 × 10 3 ) colony-forming unit (cfu) g −1 and high (5 × 10 6 cfu g −1 ) concentrations and irradiated at 1, 3, 4, 6 kGy doses under cryogenic conditions. The efficacy of the radiation process was evaluated by detecting L monocytogenes during storage at 2–4°C in the irradiated samples. These studies, when repeated with three other serotypes of L monocytogenes, clearly suggested the need for a dose of 3 kGy for elimination of 10 3 cfu cells of L monocytogenes g −1 from air-packed frozen chicken meat. (author)
Dendritic cell-based vaccination in cancer: therapeutic implications emerging from murine models
Directory of Open Access Journals (Sweden)
Soledad eMac Keon
2015-05-01
Full Text Available Dendritic cells (DCs play a pivotal role in the orchestration of immune responses, and are thus key targets in cancer vaccine design. Since the 2010 FDA approval of the first cancer DC-based vaccine (Sipuleucel T there has been a surge of interest in exploiting these cells as a therapeutic option for the treatment of tumors of diverse origin. In spite of the encouraging results obtained in the clinic, many elements of DC-based vaccination strategies need to be optimized. In this context, the use of experimental cancer models can help direct efforts towards an effective vaccine design. This paper reviews recent findings in murine models regarding the antitumoral mechanisms of DC-based vaccination, covering issues related to antigen sources, the use of adjuvants and maturing agents, and the role of DC subsets and their interaction in the initiation of antitumoral immune responses. The summary of such diverse aspects will highlight advantages and drawbacks in the use of murine models, and contribute to the design of successful DC-based translational approaches for cancer treatment.
Likelihood-based methods for evaluating principal surrogacy in augmented vaccine trials.
Liu, Wei; Zhang, Bo; Zhang, Hui; Zhang, Zhiwei
2017-04-01
There is growing interest in assessing immune biomarkers, which are quick to measure and potentially predictive of long-term efficacy, as surrogate endpoints in randomized, placebo-controlled vaccine trials. This can be done under a principal stratification approach, with principal strata defined using a subject's potential immune responses to vaccine and placebo (the latter may be assumed to be zero). In this context, principal surrogacy refers to the extent to which vaccine efficacy varies across principal strata. Because a placebo recipient's potential immune response to vaccine is unobserved in a standard vaccine trial, augmented vaccine trials have been proposed to produce the information needed to evaluate principal surrogacy. This article reviews existing methods based on an estimated likelihood and a pseudo-score (PS) and proposes two new methods based on a semiparametric likelihood (SL) and a pseudo-likelihood (PL), for analyzing augmented vaccine trials. Unlike the PS method, the SL method does not require a model for missingness, which can be advantageous when immune response data are missing by happenstance. The SL method is shown to be asymptotically efficient, and it performs similarly to the PS and PL methods in simulation experiments. The PL method appears to have a computational advantage over the PS and SL methods.
Active SMS-based influenza vaccine safety surveillance in Australian children.
Pillsbury, Alexis; Quinn, Helen; Cashman, Patrick; Leeb, Alan; Macartney, Kristine
2017-12-18
Australia's novel, active surveillance system, AusVaxSafety, monitors the post-market safety of vaccines in near real time. We analysed cumulative surveillance data for children aged 6 months to 4 years who received seasonal influenza vaccine in 2015 and/or 2016 to determine: adverse event following immunisation (AEFI) rates by vaccine brand, age and concomitant vaccine administration. Parent/carer reports of AEFI occurring within 3 days of their child receiving an influenza vaccine in sentinel immunisation clinics were solicited by Short Message Service (SMS) and/or email-based survey. Retrospective data from 2 years were combined to examine specific AEFI rates, particularly fever and medical attendance as a proxy for serious adverse events (SAE), with and without concomitant vaccine administration. As trivalent influenza vaccines (TIV) were funded in Australia's National Immunisation Program (NIP) in 2015 and quadrivalent (QIV) in 2016, respectively, we compared their safety profiles. 7402 children were included. Data were reported weekly through each vaccination season; no safety signals or excess of adverse events were detected. More children who received a concomitant vaccine had fever (7.5% versus 2.8%; p vaccine was associated with the highest increase in AEFI rates among children receiving a specified concomitant vaccine: 30.3% reported an AEFI compared with 7.3% who received an influenza vaccine alone (p safety profiles included low and expected AEFI rates (fever: 4.3% for TIV compared with 3.2% for QIV (p = .015); injection site reaction: 1.9% for TIV compared with 3.0% for QIV (p safety profile between brands. Active participant-reported data provided timely vaccine brand-specific safety information. Our surveillance system has particular utility in monitoring the safety of influenza vaccines, given that they may vary in composition annually. Copyright © 2017 Elsevier Ltd. All rights reserved.
Trivalent MDCK cell culture-derived influenza vaccine Optaflu (Novartis Vaccines).
Doroshenko, Alexander; Halperin, Scott A
2009-06-01
Annual influenza epidemics continue to have a considerable impact in both developed and developing countries. Vaccination remains the principal measure to prevent seasonal influenza and reduce associated morbidity and mortality. The WHO recommends using established mammalian cell culture lines as an alternative to egg-based substrates in the manufacture of influenza vaccine. In June 2007, the EMEA approved Optaflu, a Madin Darby canine kidney cell culture-derived influenza vaccine manufactured by Novartis Vaccines. This review examines the advantages and disadvantages of cell culture-based technology for influenza vaccine production, compares immunogenicity and safety data for Optaflu with that of currently marketed conventional egg-based influenza vaccines, and considers the prospects for wider use of cell culture-based influenza vaccines.
Directory of Open Access Journals (Sweden)
Anke M Mulder
Full Text Available BACKGROUND: Fundamental to vaccine development, manufacturing consistency, and product stability is an understanding of the vaccine structure-activity relationship. With the virus-like particle (VLP approach for recombinant vaccines gaining popularity, there is growing demand for tools that define their key characteristics. We assessed a suite of non-intrusive VLP epitope structure and function characterization tools by application to the Hepatitis B surface antigen (rHBsAg VLP-based vaccine. METHODOLOGY: The epitope-specific immune reactivity of rHBsAg epitopes to a given monoclonal antibody was monitored by surface plasmon resonance (SPR and quantitatively analyzed on rHBsAg VLPs in-solution or bound to adjuvant with a competitive enzyme-linked immunosorbent assay (ELISA. The structure of recombinant rHBsAg particles was examined by cryo transmission electron microscopy (cryoTEM and in-solution atomic force microscopy (AFM. PRINCIPAL FINDINGS: SPR and competitive ELISA determined relative antigenicity in solution, in real time, with rapid turn-around, and without the need of dissolving the particulate aluminum based adjuvant. These methods demonstrated the nature of the clinically relevant epitopes of HBsAg as being responsive to heat and/or redox treatment. In-solution AFM and cryoTEM determined vaccine particle size distribution, shape, and morphology. Redox-treated rHBsAg enabled 3D reconstruction from CryoTEM images--confirming the previously proposed octahedral structure and the established lipid-to-protein ratio of HBsAg particles. Results from these non-intrusive biophysical and immunochemical analyses coalesced into a comprehensive understanding of rHBsAg vaccine epitope structure and function that was important for assuring the desired epitope formation, determinants for vaccine potency, and particle stability during vaccine design, development, and manufacturing. SIGNIFICANCE: Together, the methods presented here comprise a novel
How Listeria monocytogenes organizes its surface for virulence
Carvalho, Filipe; Sousa, Sandra; Cabanes, Didier
2014-01-01
Listeria monocytogenes is a Gram-positive pathogen responsible for the manifestation of human listeriosis, an opportunistic foodborne disease with an associated high mortality rate. The key to the pathogenesis of listeriosis is the capacity of this bacterium to trigger its internalization by non-phagocytic cells and to survive and even replicate within phagocytes. The arsenal of virulence proteins deployed by L. monocytogenes to successfully promote the invasion and infection of host cells has been progressively unveiled over the past decades. A large majority of them is located at the cell envelope, which provides an interface for the establishment of close interactions between these bacterial factors and their host targets. Along the multistep pathways carrying these virulence proteins from the inner side of the cytoplasmic membrane to their cell envelope destination, a multiplicity of auxiliary proteins must act on the immature polypeptides to ensure that they not only maturate into fully functional effectors but also are placed or guided to their correct position in the bacterial surface. As the major scaffold for surface proteins, the cell wall and its metabolism are critical elements in listerial virulence. Conversely, the crucial physical support and protection provided by this structure make it an ideal target for the host immune system. Therefore, mechanisms involving fine modifications of cell envelope components are activated by L. monocytogenes to render it less recognizable by the innate immunity sensors or more resistant to the activity of antimicrobial effectors. This review provides a state-of-the-art compilation of the mechanisms used by L. monocytogenes to organize its surface for virulence, with special focus on those proteins that work “behind the frontline”, either supporting virulence effectors or ensuring the survival of the bacterium within its host. PMID:24809022
Nucleic acid-based vaccines targeting respiratory syncytial virus: Delivering the goods.
Smith, Trevor R F; Schultheis, Katherine; Broderick, Kate E
2017-11-02
Respiratory syncytial virus (RSV) is a massive medical burden on a global scale. Infants, children and the elderly represent the vulnerable populations. Currently there is no approved vaccine to protect against the disease. Vaccine development has been hindered by several factors including vaccine enhanced disease (VED) associated with formalin-inactivated RSV vaccines, inability of target populations to raise protective immune responses after vaccination or natural viral infection, and a lack of consensus concerning the most appropriate virus-associated target antigen. However, with recent advances in the molecular understanding of the virus, and design of highly characterized vaccines with enhanced immunogenicity there is new belief a RSV vaccine is possible. One promising approach is nucleic acid-based vaccinology. Both DNA and mRNA RSV vaccines are showing promising results in clinically relevant animal models, supporting their transition into humans. Here we will discuss this strategy to target RSV, and the ongoing studies to advance the nucleic acid vaccine platform as a viable option to protect vulnerable populations from this important disease.
Encefalitis del tallo cerebral y mielitis por Listeria monocytogenes
Directory of Open Access Journals (Sweden)
Aracelly Castro
2013-09-01
Full Text Available La romboencefalitis por Listeria monocytogenes es una presentación poco común de la listeriosis del sistema nervioso central; sin embargo, es la presentación más común en personas inmunocompetentes. Aun más rara es la combinación de romboencefalitis con mielitis causada por L. monocytogenes; no obstante, en este artículo se reporta un caso de encefalitis del tallo y mielitis grave en un paciente sin compromiso del sistema inmunitario. Se presenta un paciente de 21 años de edad, sin deficiencias del sistema inmunitario, que consumió productos lácteos no pasteurizados y, posteriormente, presentó un cuadro de cefalea, vómito, deterioro de su estado general y, finalmente, alteración del estado de conciencia y muerte. Consultó al Instituto Neurológico de Colombia y se hizo diagnóstico de encefalitis del tallo y mielitis por L. monocytogenes. Se discuten las diferencias entre el caso presentado y los reportados en la literatura científica. Ante un paciente con signos de compromiso del tallo cerebral, de posible origen infeccioso, es prudente iniciar tratamiento antibiótico para L. monocytogenes y, en caso de poca respuesta, escalar rápidamente en dicho tratamiento. También lo es extender el estudio radiológico hacia la columna vertebral, con el fin de descartar compromiso de la médula espinal. doi: http://dx.doi.org/10.7705/biomedica.v33i3.1482
Wan, J; Harmark, K; Davidson, B E; Hillier, A J; Gordon, J B; Wilcock, A; Hickey, M W; Coventry, M J
1997-03-01
The effect of bacteriocin, piscicolin 126, on the growth of Listeria monocytogenes and cheese starter bacteria was investigated in milk and in Camembert cheese manufactured from milk challenged with 10(2) cfu ml(-1) L. monocytogenes. In milk incubated at 30 degrees C, piscicolin 126 added in the range of 512-2,048 AU ml(-1) effectively inhibited growth of L. monocytogenes for more than 20 d when challenged with approximately 10(2) cfu ml(-1) L. monocytogenes. At higher challenge levels (10(4) and 10(6) cfu ml(-1)), piscicolin 126 reduced the viable count of L. monocytogenes by 4-5 log units immediately after addition of the bacteriocin; however, growth of Listeria occurred within 24 h. The minimum inhibitory concentration (MIC) of piscicolin 126 against lactic acid cheese starter bacteria was generally greater than 204,800 AU ml(-1) , and the viable count and acid production of these starter cultures in milk were not affected by the addition of 2,048 AU ml(-1) piscicolin 126. Camembert cheeses made from milk challenged with L. monocytogenes and with added piscicolin 126 showed a viable count of L. monocytogenes 3-4 log units lower than those without piscicolin 126. Inactivation of piscicolin 126 by proteolytic enzymes from cheese starter bacteria and mould together with the emergence of piscicolin 126-resistant isolates was responsible for the recovery of L. monocytogenes in the cheeses during ripening.
Directory of Open Access Journals (Sweden)
Hain Torsten
2012-04-01
Full Text Available Abstract Background Listeria monocytogenes is a food-borne pathogen that causes infections with a high-mortality rate and has served as an invaluable model for intracellular parasitism. Here, we report complete genome sequences for two L. monocytogenes strains belonging to serotype 4a (L99 and 4b (CLIP80459, and transcriptomes of representative strains from lineages I, II, and III, thereby permitting in-depth comparison of genome- and transcriptome -based data from three lineages of L. monocytogenes. Lineage III, represented by the 4a L99 genome is known to contain strains less virulent for humans. Results The genome analysis of the weakly pathogenic L99 serotype 4a provides extensive evidence of virulence gene decay, including loss of several important surface proteins. The 4b CLIP80459 genome, unlike the previously sequenced 4b F2365 genome harbours an intact inlB invasion gene. These lineage I strains are characterized by the lack of prophage genes, as they share only a single prophage locus with other L. monocytogenes genomes 1/2a EGD-e and 4a L99. Comparative transcriptome analysis during intracellular growth uncovered adaptive expression level differences in lineages I, II and III of Listeria, notable amongst which was a strong intracellular induction of flagellar genes in strain 4a L99 compared to the other lineages. Furthermore, extensive differences between strains are manifest at levels of metabolic flux control and phosphorylated sugar uptake. Intriguingly, prophage gene expression was found to be a hallmark of intracellular gene expression. Deletion mutants in the single shared prophage locus of lineage II strain EGD-e 1/2a, the lma operon, revealed severe attenuation of virulence in a murine infection model. Conclusion Comparative genomics and transcriptome analysis of L. monocytogenes strains from three lineages implicate prophage genes in intracellular adaptation and indicate that gene loss and decay may have led to the emergence
Occurrence and antimicrobial resistance patterns of Listeria monocytogenes isolated from vegetables
Byrne,Vanessa de Vasconcelos; Hofer,Ernesto; Vallim,Deyse Christina; Almeida,Rogeria Comastri de Castro
2016-01-01
Abstract Although the consumption of fresh and minimally processed vegetables is considered healthy, outbreaks related to the contamination of these products are frequently reported. Among the food-borne pathogens that contaminate vegetables is Listeria monocytogenes, a ubiquitous organism that exhibits the ability to survive and multiply at refrigerated temperatures. This study aimed to evaluate the occurrence of L. monocytogenes in vegetables as well as the antimicrobial resistance of isola...
Listeria monocytogenes Infection in Hairy Cell Leukemia: A Case Report and Literature Review
Directory of Open Access Journals (Sweden)
James C. Barton
2018-01-01
Full Text Available Listeria monocytogenes infections have been described in patients with diverse types of malignancy, especially leukemia. We report the case of a 65-year-old man with previously untreated hairy cell leukemia characterized by CD5 positivity and trisomy 12 (3% of blood lymphocytes who developed bacteremia due to L. monocytogenes serotype 1/2b. We summarize clinical features and treatment of this patient and five previously reported patients with hairy cell leukemia who also had L. monocytogenes infections. All six patients were men. Their mean age at infection diagnosis was 70 y. Three men had undergone splenectomy 4–11 y before they developed L. monocytogenes infection. The central nervous system was the primary site of infection in four men. Bacteremia alone occurred in two other men. At diagnosis of infection, one man was receiving antileukemia chemotherapy and another man was receiving treatment for Kaposi’s sarcoma. Two other patients had other comorbid conditions. All six men recovered from their infections.
Clarification of vaccines: An overview of filter based technology trends and best practices.
Besnard, Lise; Fabre, Virginie; Fettig, Michael; Gousseinov, Elina; Kawakami, Yasuhiro; Laroudie, Nicolas; Scanlan, Claire; Pattnaik, Priyabrata
2016-01-01
Vaccines are derived from a variety of sources including tissue extracts, bacterial cells, virus particles, recombinant mammalian, yeast and insect cell produced proteins and nucleic acids. The most common method of vaccine production is based on an initial fermentation process followed by purification. Production of vaccines is a complex process involving many different steps and processes. Selection of the appropriate purification method is critical to achieving desired purity of the final product. Clarification of vaccines is a critical step that strongly impacts product recovery and subsequent downstream purification. There are several technologies that can be applied for vaccine clarification. Selection of a harvesting method and equipment depends on the type of cells, product being harvested, and properties of the process fluids. These techniques include membrane filtration (microfiltration, tangential-flow filtration), centrifugation, and depth filtration (normal flow filtration). Historically vaccine harvest clarification was usually achieved by centrifugation followed by depth filtration. Recently membrane based technologies have gained prominence in vaccine clarification. The increasing use of single-use technologies in upstream processes necessitated a shift in harvest strategies. This review offers a comprehensive view on different membrane based technologies and their application in vaccine clarification, outlines the challenges involved and presents the current state of best practices in the clarification of vaccines. Copyright © 2015 Elsevier Inc. All rights reserved.
Glycerol metabolism induces Listeria monocytogenes biofilm formation at the air-liquid interface.
Crespo Tapia, Natalia; den Besten, Heidy M W; Abee, Tjakko
2018-05-20
Listeria monocytogenes is a food-borne pathogen that can grow as a biofilm on surfaces. Biofilm formation in food-processing environments is a big concern for food safety, as it can cause product contamination through the food-processing line. Although motile aerobic bacteria have been described to form biofilms at the air-liquid interface of cell cultures, to our knowledge, this type of biofilm has not been described in L. monocytogenes before. In this study we report L. monocytogenes biofilm formation at the air-liquid interface of aerobically grown cultures, and that this phenotype is specifically induced when the media is supplemented with glycerol as a carbon and energy source. Planktonic growth, metabolic activity assays and HPLC measurements of glycerol consumption over time showed that glycerol utilization in L. monocytogenes is restricted to growth under aerobic conditions. Gene expression analysis showed that genes encoding the glycerol transporter GlpF, the glycerol kinase GlpK and the glycerol 3-phosphate dehydrogenase GlpD were upregulated in the presence of oxygen, and downregulated in absence of oxygen. Additionally, motility assays revealed the induction of aerotaxis in the presence of glycerol. Our results demonstrate that the formation of biofilms at the air-liquid interface is dependent on glycerol-induced aerotaxis towards the surface of the culture, where L. monocytogenes has access to higher concentrations of oxygen, and is therefore able to utilize this compound as a carbon source. Copyright © 2018 Elsevier B.V. All rights reserved.
Ceylan, Erdogan; McMahon, Wendy; Garren, Donna M
2017-09-01
Thermal inactivation of Listeria monocytogenes and Salmonella was evaluated on peas, spinach, broccoli, potatoes, and carrots that were treated with hot water and steam. One gram-positive bacterium, L. monocytogenes, and one gram-negative bacterium, Salmonella, were selected as pertinent human pathogens for evaluation. Samples were inoculated with a composite of five strains each of L. monocytogenes and Salmonella to achieve approximately 10 8 to 10 9 CFU/g. Inoculated samples were treated with hot water at 85 and 87.8°C and with steam at 85 and 96.7°C for up to 3.5 min. A greater than 5-log reduction of L. monocytogenes and Salmonella was achieved on all products within 0.5 min by hot water blanching at 85 and 87.8°C. Steam blanching at 85°C reduced Salmonella populations by greater than 5 log on spinach and peas within 2 min and on carrots and broccoli within 3.5 min. Populations of Salmonella were reduced by more than 5 log within 1 min on carrot, spinach, and broccoli and within 2 min on peas by steam blanching at 96.7°C. Steam blanching at 85°C reduced L. monocytogenes populations by more than 5 log on carrots and spinach within 2 min and on broccoli and peas within 3.5 min. L. monocytogenes populations were reduced more than 5 log within 1 min on carrot, spinach, peas and broccoli by steam blanching at 96.7°C. Longer treatment times and higher temperatures were required for steam-blanched samples than for samples blanched with hot water. Results suggest that hot water and steam blanching practices commonly used by the frozen vegetable industry will achieve the desired 5-log lethality of L. monocytogenes and Salmonella and will enhance microbiological safety prior to freezing.
Listeria spp., y L. monocytogenes EN LECHE CRUDA DE CABRA
Directory of Open Access Journals (Sweden)
Yolanda Albarracín C
2008-08-01
Full Text Available Objective. To test non-pasteurized goat’s milk from the village of ‘la Garita’, Northern Santander, for Listeria monocytogenes. Material and methods. 90 samples of non-pasteurized goat’s milk were obtained over a 4 month period; pH and temperature of each sample were measured. The INVIMA technique was used to isolate L. monocytogenes; the species was confirmed by PCR. Results. The study showed that eight goat milk providers of the zone neither had refrigeration nor pasteurized the milk. The prevalence of L. monocytogenes was 3%; 15% of the samples had other species of Listeria. The milk obtained from this zone contained the pathogen that may cause listeriosis in children less than 5 years of age, pregnant women, adults and immunologically compromised patients. Conclusions. This study shows the occurrence of this pathogen in goat’s milk and identified areas of risk for those people who drink goat’s milk.
[Analysis of antibiotic susceptibility of foodborne Listeria monocytogenes in China].
Yang, Yang; Fu, Ping; Guo, Yunchang; Liu, Xiurmei
2008-03-01
To study the antibiotic susceptibility of foodborne Listeria monocytogenes in China. The susceptibilities of 476 strains of foodborne Listeria monocytogenes to antibiotics were determined in Broth Microdilution Susceptibility Testing in Clinical and Laboratory Standards Institute. The antibiotics of gentamicin, ampicillin, penicillin, tetracycline, doxycycline, imipenem, erythromycin, ciprofloxacin, levofloxacin, cephalothin, rifampin, vancomycin, chloramphenicol, Trimethoprim-sulfamethoxazole, ampicillin-sulbactam were used. The rates of antibiotic resistance in 467 is olates were 4.5%. Tetracycline resistance was most prevalent, accouting for 4.07% . The foods that the rates of antibiotic resistance were highest were vegetable (10%). Among 14 provinces, Jilin, Hubei and Hebei were the third top, the rate of which were 19.6% and 9.1% and 8%, respectively. It was suggested that antibiotic resistance exists in foodborne Listeria monocytogenes to a certain extent in China. It should pay more attention to the use of drugs in prevention and clinic treatment to reduce the antibiotic resistant strains.
Silver as antibacterial towards Listeria monocytogenes
Directory of Open Access Journals (Sweden)
Simone eBelluco
2016-03-01
Full Text Available Listeria monocytogenes is a serious foodborne pathogen that can contaminate food during processing and can grow during food shelf-life. New types of safe and effective food contact materials embedding antimicrobial agents, like silver, can play an important role in the food industry. The present work aimed at evaluating the in vitro growth kinetics of different strains of L. monocytogenes in the presence of silver, both in its ionic and nano form. The antimicrobial effect was determined by assaying the number of culturable bacterial cells, which formed colonies after incubation in the presence of silver nanoparticles (AgNPs or silver nitrate (AgNO3. Ionic release experiments were performed in parallel. A different reduction of bacterial viability between silver ionic and nano forms was observed, with a time delayed effect exerted by AgNPs. An association between antimicrobial activity and ions concentration was shown by both silver chemical forms, suggesting the major role of ions in the antimicrobial mode of action.
REALIS: Postgenomic Analysis of Listeria Monocytogenes
Directory of Open Access Journals (Sweden)
The REALIS Consortium
2006-04-01
Full Text Available Listeria monocytogenes is a remarkably successful food-borne pathogen. It is capable a of surviving and proliferating under conditions that exist within the food chain, such as at low temperatures, high salt and low pH and b of colonizing animal host tissues after ingestion of contaminated food, causing opportunistic infections mainly, but not exclusively, in immunocompromised hosts. The ultimate goals of REALIS are two fold: Firstly, it aims to completely decipher all genes required for survival in and adaptation of Listeria monocytogenes to two very different environments, ie., the infected host and the external environment. Secondly, using genomics and postgenomic tools, REALIS seeks to precisely address fundamental questions regarding evolutionary relationships between pathogenic and non-pathogenic Listeria and to define qualities of particularly successful clonal pathovariants in causing disease. This project will provide both industry and health care managers with rational approaches to curbing food-borne contamination, minimising risks of infection and providing novel pharmacological approaches for halting the fulminant course of infection.
Recombinant allergy vaccines based on allergen-derived B cell epitopes.
Valenta, Rudolf; Campana, Raffaela; Niederberger, Verena
2017-09-01
Immunoglobulin E (IgE)-associated allergy is the most common immunologically-mediated hypersensitivity disease. It affects more than 25% of the population. In IgE-sensitized subjects, allergen encounter can causes a variety of symptoms ranging from hayfever (allergic rhinoconjunctivitis) to asthma, skin inflammation, food allergy and severe life-threatening anaphylactic shock. Allergen-specific immunotherapy (AIT) is based on vaccination with the disease-causing allergens. AIT is an extremely effective, causative and disease-modifying treatment. However, administration of natural allergens can cause severe side effects and the quality of natural allergen extracts limits its application. Research in the field of molecular allergen characterization has allowed deciphering the molecular structures of the disease-causing allergens and it has become possible to engineer novel molecular allergy vaccines which precisely target the mechanisms of the allergic immune response and even appear suitable for prophylactic allergy vaccination. Here we discuss recombinant allergy vaccines which are based on allergen-derived B cell epitopes regarding their molecular and immunological properties and review the results obtained in clinical studies with this new type of allergy vaccines. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.
School-based influenza vaccination: parents' perspectives.
Directory of Open Access Journals (Sweden)
Candace Lind
Full Text Available School-age children are important drivers of annual influenza epidemics yet influenza vaccination coverage of this population is low despite universal publicly funded influenza vaccination in Alberta, Canada. Immunizing children at school may potentially increase vaccine uptake. As parents are a key stakeholder group for such a program, it is important to consider their concerns.We explored parents' perspectives on the acceptability of adding an annual influenza immunization to the immunization program that is currently delivered in Alberta schools, and obtained suggestions for structuring such a program.Forty-eight parents of children aged 5-18 years participated in 9 focus groups. Participants lived in urban areas of the Alberta Health Services Calgary Zone.Three major themes emerged: Advantages of school-based influenza vaccination (SBIV, Disadvantages of SBIV, and Implications for program design & delivery. Advantages were perceived to occur for different populations: children (e.g. emotional support, families (e.g. convenience, the community (e.g. benefits for school and multicultural communities, the health sector (e.g. reductions in costs due to burden of illness and to society at large (e.g. indirect conduit of information about health services, building structure for pandemic preparedness, building healthy lifestyles. Disadvantages, however, might also occur for children (e.g. older children less likely to be immunized, families (e.g. communication challenges, perceived loss of parental control over information, choices and decisions and the education sector (loss of instructional time. Nine second-level themes emerged within the major theme of Implications for program design & delivery: program goals/objectives, consent process, stakeholder consultation, age-appropriate program, education, communication, logistics, immunizing agent, and clinic process.Parents perceived advantages and disadvantages to delivering annual seasonal
Directory of Open Access Journals (Sweden)
Rossella Lelli
2011-09-01
Full Text Available È stato standardizzato e validato un dosaggio immunoenzimatico capture ELISA per l’identificazione di Listeria monocytogenes negli alimenti. Il dosaggio è stato messo a punto analizzando campioni di prodotti carnei, ittici e lattiero-caseari, pasta di semola e di farina di grano. Il metodo è risultato specifico al 100% per Listeria spp., con limite di rivelazione di 6,6 × 10(3 cfu/ml. Il metodo L. monocytogenes capture ELISA è stato confrontato con il metodo ufficiale ISO 11290-1:1996 per l’isolamento e l’identificazione di L. monocytogenes in matrici alimentari ottenendo un indice di concordanza significativo. Il dosaggio è stato validato in base alle indicazioni della norma ISO 16140:2003 relativamente ai metodi di analisi qualitativi. Il dosaggio è risultato accurato, specifico, sensibile, selettivo, riproducibile e rapido da eseguire, consentendo nello screening degli alimenti la riduzione di tempi e costi dell’indagine microbiologica.
Puri, Madhu; La Pietra, Luigi; Mraheil, Mobarak Abu; Lucas, Rudolf; Chakraborty, Trinad; Pillich, Helena
2017-09-05
Autophagy, a well-established defense mechanism, enables the elimination of intracellular pathogens including Listeria monocytogenes . Host cell recognition results in ubiquitination of L . monocytogenes and interaction with autophagy adaptors p62/SQSTM1 and NDP52, which target bacteria to autophagosomes by binding to microtubule-associated protein 1 light chain 3 (LC3). Although studies have indicated that L . monocytogenes induces autophagy, the significance of this process in the infectious cycle and the mechanisms involved remain poorly understood. Here, we examined the role of the autophagy adaptor optineurin (OPTN), the phosphorylation of which by the TANK binding kinase 1 (TBK1) enhances its affinity for LC3 and promotes autophagosomal degradation, during L . monocytogenes infection. In LC3- and OPTN-depleted host cells, intracellular replicating L . monocytogenes increased, an effect not seen with a mutant lacking the pore-forming toxin listeriolysin O (LLO). LLO induced the production of OPTN. In host cells expressing an inactive TBK1, bacterial replication was also inhibited. Our studies have uncovered an OPTN-dependent pathway in which L . monocytogenes uses LLO to restrict bacterial growth. Hence, manipulation of autophagy by L . monocytogenes , either through induction or evasion, represents a key event in its intracellular life style and could lead to either cytosolic growth or persistence in intracellular vacuolar structures.
Quereda, Juan J; Meza-Torres, Jazmín; Cossart, Pascale; Pizarro-Cerdá, Javier
2017-07-04
Listeria monocytogenes is a Gram-positive food-borne pathogen that in humans may traverse the intestinal, placental and blood/brain barriers, causing gastroenteritis, abortions and meningitis. Crossing of these barriers is dependent on the bacterial ability to enter host cells, and several L. monocytogenes surface and secreted virulence factors are known to facilitate entry and the intracellular lifecycle. The study of L. monocytogenes strains associated to human listeriosis epidemics has revealed the presence of novel virulence factors. One such factor is Listeriolysin S, a thiazole/oxazole modified microcin that displays bactericidal activity and modifies the host microbiota during infection. Our recent results therefore highlight the interaction of L. monocytogenes with gut microbes as a crucial step in epidemic listeriosis. In this article, we will discuss novel implications for this family of toxins in the pathogenesis of diverse medically relevant microorganisms.
PRÉVALENCE DE LISTERIA MONOCYTOGENES DANS LE LAIT CRU DE VACHE AU LIBAN NORD
Directory of Open Access Journals (Sweden)
Imad al Kassaa
2016-06-01
Full Text Available Al Kassaa Imad, Khaled el Omari, Marwa Saati, Bachar Ismail and Monzer Hamze. 2016. Prevalence of Listeria monocytogenes in raw cow milk in north Lebanon. Lebanese Science Journal, 17(1: 39-45. Listeriosis, although a zoonosis, is an invasive disease that can affect newborns, pregnant women and immunocompromised adults. Clinical manifestations can be expressed by febrile gastroenteritis, invasive forms including severe sepsis, meningitis, rhombencephalitis, prenatal infections and abortions. Species of Listeria bacteria are ubiquitous and adaptable to the environment in animal and plant foods. This study aimed to determine the prevalence of Listeria monocytogenes in 100 samples of fresh cow milk collected from different areas of North Lebanon. Listeria monocytogenes was detected by using the Grand VIDAS technique (Biomérieux France. The results obtained revealed the absence of Listeria monocytogenes in all analyzed samples.
Calderón-Gonzalez, Ricardo; Terán-Navarro, Héctor; Frande-Cabanes, Elisabet; Ferrández-Fernández, Eva; Freire, Javier; Penadés, Soledad; Marradi, Marco; García, Isabel; Gomez-Román, Javier; Yañez-Díaz, Sonsoles; Álvarez-Domínguez, Carmen
2016-01-01
Listeriosis is a fatal infection for fetuses and newborns with two clinical main morbidities in the neonatal period, meningitis and diffused cutaneous lesions. In this study, we vaccinated pregnant females with two gold glyconanoparticles (GNP) loaded with two peptides, listeriolysin peptide 91–99 (LLO91–99) or glyceraldehyde-3-phosphate dehydrogenase 1–22 peptide (GAPDH1–22). Neonates born to vaccinated mothers were free of bacteria and healthy, while non-vaccinated mice presented clear brain affections and cutaneous diminishment of melanocytes. Therefore, these nanoparticle vaccines are effective measures to offer pregnant mothers at high risk of listeriosis interesting therapies that cross the placenta. PMID:28335280
Directory of Open Access Journals (Sweden)
Ricardo Calderón-Gonzalez
2016-08-01
Full Text Available Listeriosis is a fatal infection for fetuses and newborns with two clinical main morbidities in the neonatal period, meningitis and diffused cutaneous lesions. In this study, we vaccinated pregnant females with two gold glyconanoparticles (GNP loaded with two peptides, listeriolysin peptide 91–99 (LLO91–99 or glyceraldehyde-3-phosphate dehydrogenase 1–22 peptide (GAPDH1–22. Neonates born to vaccinated mothers were free of bacteria and healthy, while non-vaccinated mice presented clear brain affections and cutaneous diminishment of melanocytes. Therefore, these nanoparticle vaccines are effective measures to offer pregnant mothers at high risk of listeriosis interesting therapies that cross the placenta.
The presence of Listeria monocytogenes on the surfaces of equipment and workers' hands during different production stages, as well as on fish skin and meat during processing and storage of cold-smoked trout, was investigated. Listeria monocytogenes was recovered from 10 (6.06%) of a total 165 cotto...
Directory of Open Access Journals (Sweden)
Shahin Gaini
2015-01-01
Full Text Available A 51-year-old Caucasian woman with Listeria monocytogenes meningitis was treated and discharged after an uncomplicated course. Her medical history included immunosuppressive treatment with prednisolone and azathioprine for autoimmune hepatitis. A diagnostic work-up after the meningitis episode revealed that she had low levels of the IgG4 subclass. To our knowledge, this is the first case report describing a possible association between autoimmune hepatitis and the occurrence of Listeria monocytogenes meningitis, describing a possible association between Listeria monocytogenes meningitis and deficiency of the IgG4 subclass and finally describing a possible association between Listeria monocytogenes meningitis and immunosuppressive therapy with prednisolone and azathioprine.
DEFF Research Database (Denmark)
Gaini, Shahin
2015-01-01
A 51-year-old Caucasian woman with Listeria monocytogenes meningitis was treated and discharged after an uncomplicated course. Her medical history included immunosuppressive treatment with prednisolone and azathioprine for autoimmune hepatitis. A diagnostic work-up after the meningitis episode...... revealed that she had low levels of the IgG4 subclass. To our knowledge, this is the first case report describing a possible association between autoimmune hepatitis and the occurrence of Listeria monocytogenes meningitis, describing a possible association between Listeria monocytogenes meningitis...... and deficiency of the IgG4 subclass and finally describing a possible association between Listeria monocytogenes meningitis and immunosuppressive therapy with prednisolone and azathioprine....
Inactivation of Listeria monocytogenes in raw fruits by enterocin AS-48.
Molinos, Antonio Cobo; Abriouel, Hikmate; Ben Omar, Nabil; Lucas, Rosario; Valdivia, Eva; Gálvez, Antonio
2008-12-01
The purpose of this study was to determine the effect of enterocin AS-48 on Listeria monocytogenes CECT 4032 in fruits and fruit juice. Fruits were contaminated with a L. monocytogenes cell suspension, washed with enterocin AS-48 (25 microg/ml) or with sterile distilled water as control, and stored at different temperatures (-20, 6, 15, 22 degrees C). Washing treatments significantly inhibited or completely inactivated L. monocytogenes in strawberries, raspberries, and blackberries stored at 15 and 22 degrees C for up to 2 days and in blackberries and strawberries at 6 degrees C for up to 7 days. Washing treatments with enterocin AS-48 also reduced viable counts in sliced melon, watermelon, pear, and kiwi but did not avoid proliferation of survivors during storage at 15 and 22 degrees C. Added enterocin (25 microg/ml) completely inactivated L. monocytogenes in watermelon juice within 24 h. To enhance the antilisterial activity of treatments, enterocin AS-48 was tested in combination with other antimicrobial substances on sliced melon stored at 22 degrees C. The combinations of enterocin AS-48 and trisodium trimetaphosphate, sodium lactate, lactic acid, polyphosphoric acid, carvacrol, hydrocinnamic acid, p-hydroxybenzoic acid, n-propyl p-hydroxybenzoate, or 2-nitropropanol showed increased antilisterial activities compared with each antimicrobial tested separately. Washing treatments with enterocin AS-48 in combination with 12 mM carvacrol, as well as with 100 mM n-propyl p-hydroxybenzoate, avoided regrowth of Listeria during storage at 22 degrees C. Results from this study indicate that enterocin AS-48 alone or in combination with other preservatives could serve as an additional hurdle against L. monocytogenes in fruits and fruit juices.
Enhanced protection against Ebola virus mediated by an improved adenovirus-based vaccine.
Richardson, Jason S; Yao, Michel K; Tran, Kaylie N; Croyle, Maria A; Strong, James E; Feldmann, Heinz; Kobinger, Gary P
2009-01-01
The Ebola virus is transmitted by direct contact with bodily fluids of infected individuals, eliciting death rates as high as 90% among infected humans. Currently, replication defective adenovirus-based Ebola vaccine is being studied in a phase I clinical trial. Another Ebola vaccine, based on an attenuated vesicular stomatitis virus has shown efficacy in post-exposure treatment of nonhuman primates to Ebola infection. In this report, we modified the common recombinant adenovirus serotype 5-based Ebola vaccine expressing the wild-type ZEBOV glycoprotein sequence from a CMV promoter (Ad-CMVZGP). The immune response elicited by this improved expression cassette vector (Ad-CAGoptZGP) and its ability to afford protection against lethal ZEBOV challenge in mice was compared to the standard Ad-CMVZGP vector. Ad-CMVZGP was previously shown to protect mice, guinea pigs and nonhuman primates from an otherwise lethal challenge of Zaire ebolavirus. The antigenic expression cassette of this vector was improved through codon optimization, inclusion of a consensus Kozak sequence and reconfiguration of a CAG promoter (Ad-CAGoptZGP). Expression of GP from Ad-CAGoptZGP was substantially higher than from Ad-CMVZGP. Ad-CAGoptZGP significantly improved T and B cell responses at doses 10 to 100-fold lower than that needed with Ad-CMVZGP. Additionally, Ad-CAGoptZGP afforded full protections in mice against lethal challenge at a dose 100 times lower than the dose required for Ad-CMVZGP. Finally, Ad-CAGoptZGP induced full protection to mice when given 30 minutes post-challenge. We describe an improved adenovirus-based Ebola vaccine capable of affording post-exposure protection against lethal challenge in mice. The molecular modifications of the new improved vaccine also translated in the induction of significantly enhanced immune responses and complete protection at a dose 100 times lower than with the previous generation adenovirus-based Ebola vaccine. Understanding and improving the
Enhanced protection against Ebola virus mediated by an improved adenovirus-based vaccine.
Directory of Open Access Journals (Sweden)
Jason S Richardson
Full Text Available BACKGROUND: The Ebola virus is transmitted by direct contact with bodily fluids of infected individuals, eliciting death rates as high as 90% among infected humans. Currently, replication defective adenovirus-based Ebola vaccine is being studied in a phase I clinical trial. Another Ebola vaccine, based on an attenuated vesicular stomatitis virus has shown efficacy in post-exposure treatment of nonhuman primates to Ebola infection. In this report, we modified the common recombinant adenovirus serotype 5-based Ebola vaccine expressing the wild-type ZEBOV glycoprotein sequence from a CMV promoter (Ad-CMVZGP. The immune response elicited by this improved expression cassette vector (Ad-CAGoptZGP and its ability to afford protection against lethal ZEBOV challenge in mice was compared to the standard Ad-CMVZGP vector. METHODOLOGY/PRINCIPAL FINDINGS: Ad-CMVZGP was previously shown to protect mice, guinea pigs and nonhuman primates from an otherwise lethal challenge of Zaire ebolavirus. The antigenic expression cassette of this vector was improved through codon optimization, inclusion of a consensus Kozak sequence and reconfiguration of a CAG promoter (Ad-CAGoptZGP. Expression of GP from Ad-CAGoptZGP was substantially higher than from Ad-CMVZGP. Ad-CAGoptZGP significantly improved T and B cell responses at doses 10 to 100-fold lower than that needed with Ad-CMVZGP. Additionally, Ad-CAGoptZGP afforded full protections in mice against lethal challenge at a dose 100 times lower than the dose required for Ad-CMVZGP. Finally, Ad-CAGoptZGP induced full protection to mice when given 30 minutes post-challenge. CONCLUSIONS/SIGNIFICANCE: We describe an improved adenovirus-based Ebola vaccine capable of affording post-exposure protection against lethal challenge in mice. The molecular modifications of the new improved vaccine also translated in the induction of significantly enhanced immune responses and complete protection at a dose 100 times lower than with the
Directory of Open Access Journals (Sweden)
Nilma Cintra Leal
2013-09-01
Full Text Available Background: In Brazil, listeriosis is not a notifiable disease; thus, the incidence of Brazilian cases remains unknown. Listeria monocytogenes is not always included in automated systems, and its detection depends on the high skill level of microbiology laboratory professionals. This paper describes the characteristics of L. monocytogenes isolates fortuitously obtained from an endocarditis case in Recife, PE, Brazil. Methods: Six bacterial isolates obtained from six blood cultures from a 28-year-old male bearing a prosthetic mitral heart valve were analyzed by PCR using primers specific of L. monocytogenes to confirm a presumptive identification, determine the serotype and presence of the virulence genes (inlA, inlB, inlC, inlJ, hly, plcA, actA, prfA in an attempt to determine the Listeria genotype by PCR-ribotyping. Results: The samples were identified as L. monocytogenes 4b. All investigated virulence genes were amplified by PCR, and the identity of the amplified segments was confirmed by sequencing. A deletion of 105 base pairs was detected in the actA gene. All of the samples generated the same PCR-ribotype pattern, clustered into a single ribotype, and were considered a single strain. Conclusion: L. monocytogenes infection should be considered in endocarditis differential diagnoses, especially among high-risk groups, due to its high pathogenicity and the environmental ubiquity.
Stevia rebaudiana Bertoni effect on the hemolytic potential of Listeria monocytogenes.
Sansano, S; Rivas, A; Pina-Pérez, M C; Martinez, A; Rodrigo, D
2017-06-05
The effect of Stevia rebaudiana Bertoni on the hemolytic potential of Listeria monocytogenes was studied by means of the assessment of the Listeriolysin O (LLO) production. The three factors under study, stevia concentration in the range [0-2.5] % (w/v), incubation temperature (10 and 37°C), and exposure time (0-65h) significantly affected (p≤0.05) the hemolytic activity of L. monocytogenes. Results showed that at the lower incubation temperature the hemolytic potential of the bacterium was significantly reduced, from 100% at 37°C to 8% at 10°C (after 65h of incubation) in unsupplemented substrate (0% stevia). Irrespective of the temperature, 10 or 37°C, supplementation of the medium with stevia at 2.5 % (w/v) reduced the bacterium's hemolytic activity by a maximum of 100%. Furthermore, the time of exposure to 2.5 % (w/v) stevia concentration was also a significant factor reducing the hemolytic capability of L. monocytogenes. The possibility of reducing the pathogenic potential of L. monocytogenes (hemolysis) by exposure to stevia should be confirmed in real food matrices, opening a research niche with a valuable future impact on food safety. Copyright © 2017 Elsevier B.V. All rights reserved.
The virulence regulator PrfA promotes biofilm formation by Listeria monocytogenes.
Lemon, Katherine P; Freitag, Nancy E; Kolter, Roberto
2010-08-01
Listeria monocytogenes is a food-borne facultative intracellular pathogen. It is widespread in the environment and has several distinct life-styles. The key transcriptional activator PrfA positively regulates L. monocytogenes virulence genes to mediate the transition from extracellular, flagellum-propelled cell to intracellular pathogen. Here we report the first evidence that PrfA also has a significant positive impact on extracellular biofilm formation. Mutants lacking prfA were defective in surface-adhered biofilm formation. The DeltaprfA mutant exhibited wild-type flagellar motility, and its biofilm defect occurred after initial surface adhesion. We also observed that mutations that led to the constitutive expression of PrfA-dependent virulence genes had a minimal impact on biofilm formation. Furthermore, biofilm development was enhanced in a mutant encoding a PrfA protein variant unable to fully transition from the extracellular form to the virulent, intracellular activity conformation. These results indicate that PrfA positively regulates biofilm formation and suggest that PrfA has a global role in modulating the life-style of L. monocytogenes. The requirement of PrfA for optimal biofilm formation may provide selective pressure to maintain this critical virulence regulator when L. monocytogenes is outside host cells in the environment.
Ndahetuye, Jean Baptiste; Koo, Ok Kyung; O'Bryan, Corliss A; Ricke, Steven C; Crandall, Philip G
2012-08-01
The study was conducted to evaluate the attachment of three lactic acid bacteria (LAB) strains and their combination in a cocktail, to stainless steel coupons from a deli slicer, and their ability to inhibit the attachment of Listeria monocytogenes. In a previous study, three LAB strains, Pediococcus acidilactici, Lactobacillus amylovorus, and Lactobacillus animalis, were isolated from ready-to-eat meat and exhibited antilisterial effect. In the study reported here, hydrophobicity tests were determined according to the method of microbial adhesion to solvent. The attachment of the cells was evaluated on stainless steel coupons from deli slicers. Extracellular carbohydrates were determined with a colorimetric method. Based on these tests, L. animalis exhibited the greatest hydrophobicity (26.3%), and its adherence increased sharply from 24 to 72 h, whereas L. amylovorus yielded the lowest hydrophobicity (3.86%) and was weakly adherent. Although P. acidilactici had moderate hydrophobicity (10.1%), it adhered strongly. The attached LAB strains produced significantly (P < 0.05) higher total carbohydrates than their planktonic counterparts did, which is an important characteristic for attachment. Three conditions were simulated to evaluate the ability of the LAB cocktail (10(8) CFU/ml) to competitively exclude L. monocytogenes (10(3) CFU/ml) on the surface of the coupons. The coupons were pretreated with the LAB cocktail for 24 h prior to the addition of L. monocytogenes, simultaneously treated with the LAB cocktail and L. monocytogenes, or pretreated with L. monocytogenes 24 h prior to the addition of the LAB cocktail. The LAB cocktail was able to reduce the attachment L. monocytogenes significantly (P < 0.05). The LAB cocktail indicated potential attachment on stainless steel and bacteriostatic activity toward L. monocytogenes attached on stainless steel, which indicates a possible role for LAB as a biosanitizer in the food industry.
Directory of Open Access Journals (Sweden)
Analía L. Laciar
2000-03-01
Full Text Available Central nervous system infections caused by Listeria monocytogenes produce a wide range of clinical symptoms which include cerebral abscesses, meningitis and nonmeningitic parenchymal cerebritis. A case study is presented of early listeriosis with signs of meningitis accompanied with septicemia and complicated with severe hydrocephalus.As infecções do sistema nervoso central produzidas por Listeria monocytogenes provocam una grande variedade de sintomas clínicos que incluem abscessos cerebrais, meningites e cerebrites parenquimáticas não meningíticas. Apresenta-se um caso de listeriose precoce com sinais de meningite acompanhada de septicemia e agravado com hidrocefalia grave.
Soni, Dharmendra Kumar; Singh, Durg Vijai; Dubey, Suresh Kumar
2015-09-01
Listeria monocytogenes, a life-threatening pathogen, poses severe risk during pregnancy, may cause abortion, fetal death or neonatal morbidity in terms of septicemia and meningitis. The present study aimed at characterizing L. monocytogenes isolated from pregnant women based on serotyping, antibiotic susceptibility, virulence genes, in vivo pathogenicity test and ERIC- and REP-PCR fingerprint analyses. The results revealed that out of 3700 human clinical samples, a total of 30 (0.81%) isolates [12 (0.80%) from placental bit (1500), 18 (0.81%) from vaginal swab (2200)] were positive for L. monocytogenes. All the isolates belonged to serogroup 4b, and were + ve for virulence genes tested i.e. inlA, inlC, inlJ, plcA, prfA, actA, hlyA, and iap. Based on the mice inoculation tests, 20 isolates showed 100% and 4 isolates 60% relative virulence while 6 isolates were non-pathogenic. Moreover, 2 and 10 isolates were resistant to ciprofloxacin and cefoxitin, respectively, while the rest susceptible to other antibiotics used in this study. ERIC- and REP-PCR collectively depicted that the isolates from placental bit and vaginal swab had distinct PCR fingerprints except a few isolates with identical patterns. This study demonstrates prevalence of pathogenic strains mostly resistant to cefoxitin and/or ciprofloxacin. The results indicate the importance of isolating and characterizing the pathogen from human clinical samples as the pre-requisite for accurate epidemiological investigations.
Locatelli, Aude; Lewis, Micah A.; Rothrock, Michael J.
2017-01-01
The occurrence of Listeria monocytogenes has been widely investigated in the poultry production chain from the processing plant to the final product. However, limited data are available on Listeria species, including Listeria monocytogenes, in the poultry farm environment. Therefore, fecal and soil samples from 37 pastured poultry flocks from 10 all-natural farms over 3 years were assessed to determine the prevalence and diversity of Listeria within these alternative poultry farm environments using standard cultural and molecular methods. Listeria species were isolated in 15% of poultry farm samples and included Listeria innocua (65.7%), L. monocytogenes (17.4%), and Listeria welshimeri (15.1%). Additional multiplex PCR serotyping showed group 1/2a-3a to be the most dominant L. monocytogenes serovar group. Based on these results, monoculture growth experiments were conducted on four Listeria soil isolates (three L. monocytogenes isolates representing the three recovered serovar groups and one L. innocua isolate) to determine if culture medium [tripticase soy broth (TSB) and University of Vermont modified Listeria enrichment broth (UVM)], inoculum concentration (102 or 105 CFU/ml), or incubation temperature (20, 30, and 42°C) differentially affected these Listeria species. Overall, very few significant growth differences were observed between the behavior of the three L. monocytogenes isolates (representing the three recovered serovar groups) under the growth conditions tested. Alternatively, at 30°C in UVM with the lower inoculum concentration, the L. innocua isolate had a significantly shorter lag phase than the L. monocytogenes isolates. In coculture growth studies under these same incubation conditions, the lag phase of L. innocua and L. monocytogenes was similar, but the final concentration of L. innocua was significantly higher than L. monocytogenes. However, cocultures in UVM for high inoculum concentration did not show preferential growth of L. innocua
Locatelli, Aude; Lewis, Micah A; Rothrock, Michael J
2017-01-01
The occurrence of Listeria monocytogenes has been widely investigated in the poultry production chain from the processing plant to the final product. However, limited data are available on Listeria species, including Listeria monocytogenes , in the poultry farm environment. Therefore, fecal and soil samples from 37 pastured poultry flocks from 10 all-natural farms over 3 years were assessed to determine the prevalence and diversity of Listeria within these alternative poultry farm environments using standard cultural and molecular methods. Listeria species were isolated in 15% of poultry farm samples and included Listeria innocua (65.7%), L. monocytogenes (17.4%), and Listeria welshimeri (15.1%). Additional multiplex PCR serotyping showed group 1/2a-3a to be the most dominant L. monocytogenes serovar group. Based on these results, monoculture growth experiments were conducted on four Listeria soil isolates (three L. monocytogenes isolates representing the three recovered serovar groups and one L. innocua isolate) to determine if culture medium [tripticase soy broth (TSB) and University of Vermont modified Listeria enrichment broth (UVM)], inoculum concentration (10 2 or 10 5 CFU/ml), or incubation temperature (20, 30, and 42°C) differentially affected these Listeria species. Overall, very few significant growth differences were observed between the behavior of the three L. monocytogenes isolates (representing the three recovered serovar groups) under the growth conditions tested. Alternatively, at 30°C in UVM with the lower inoculum concentration, the L. innocua isolate had a significantly shorter lag phase than the L. monocytogenes isolates. In coculture growth studies under these same incubation conditions, the lag phase of L. innocua and L. monocytogenes was similar, but the final concentration of L. innocua was significantly higher than L. monocytogenes . However, cocultures in UVM for high inoculum concentration did not show preferential growth of L
Wen, Yu-Wen; Wu, Hsin; Chang, Chee-Jen
2015-05-01
Vaccination can reduce the incidence and mortality of an infectious disease and thus increase the years of life and productivity for the entire society. But when determining the vaccination coverage rate, its economic burden is usually not taken into account. This article aimed to use a dynamic transmission modeling (DTM), which is based on a susceptible-infectious-recovered model and is a system of differential equations, to find the optimal vaccination coverage rate based on the economic burden of an infectious disease. Vaccination for pneumococcal diseases was used as an example to demonstrate the main purpose. 23-Valent pneumococcal polysaccharide vaccines (PPV23) and 13-valent pneumococcal conjugate vaccines (PCV13) have shown their cost-effectiveness in elderly and children, respectively. Scenarios analysis of PPV23 to elderly aged 65+ years and of PCV13 to children aged 0 to 4 years was applied to assess the optimal vaccination coverage rate based on the 5-year economic burden. Model parameters were derived from Taiwan's National Health Insurance Research Database, government data, and published literature. Various vaccination coverage rates, the vaccine efficacy, and all epidemiologic parameters were substituted into DTM, and all differential equations were solved in R Statistical Software. If the coverage rate of PPV23 for the elderly and of PCV13 for the children both reach 50%, the economic burden due to pneumococcal disease will be acceptable. This article provided an alternative perspective from the economic burden of diseases to obtain a vaccination coverage rate using the DTM. This will provide valuable information for vaccination policy decision makers. Copyright © 2015 International Society for Pharmacoeconomics and Outcomes Research (ISPOR). Published by Elsevier Inc. All rights reserved.
Koutsoumanis, Konstantinos; Pavlis, Athanasios; Nychas, George-John E.; Xanthiakos, Konstantinos
2010-01-01
A survey on the time-temperature conditions of pasteurized milk in Greece during transportation to retail, retail storage, and domestic storage and handling was performed. The data derived from the survey were described with appropriate probability distributions and introduced into a growth model of Listeria monocytogenes in pasteurized milk which was appropriately modified for taking into account strain variability. Based on the above components, a probabilistic model was applied to evaluate the growth of L. monocytogenes during the chill chain of pasteurized milk using a Monte Carlo simulation. The model predicted that, in 44.8% of the milk cartons released in the market, the pathogen will grow until the time of consumption. For these products the estimated mean total growth of L. monocytogenes during transportation, retail storage, and domestic storage was 0.93 log CFU, with 95th and 99th percentiles of 2.68 and 4.01 log CFU, respectively. Although based on EU regulation 2073/2005 pasteurized milk produced in Greece belongs to the category of products that do not allow the growth of L. monocytogenes due to a shelf life (defined by law) of 5 days, the above results show that this shelf life limit cannot prevent L. monocytogenes from growing under the current chill chain conditions. The predicted percentage of milk cartons—initially contaminated with 1 cell/1-liter carton—in which the pathogen exceeds the safety criterion of 100 cells/ml at the time of consumption was 0.14%. The probabilistic model was used for an importance analysis of the chill chain factors, using rank order correlation, while selected intervention and shelf life increase scenarios were evaluated. The results showed that simple interventions, such as excluding the door shelf from the domestic storage of pasteurized milk, can effectively reduce the growth of the pathogen. The door shelf was found to be the warmest position in domestic refrigerators, and it was most frequently used by the
Directory of Open Access Journals (Sweden)
Valeria Braga
Full Text Available ABSTRACT The aim of this work was to study the prevalence of Listeria monocytogenes in foods obtained in retail shops and food industries located in Montevideo-Uruguay, and to identify the serogroups of the obtained isolates. Three-thousand one-hundred and seventy-five food samples (frozen, deli meats, ready-to-eat and cheese were analyzed. The obtained isolates were serogrouped by multiplex PCR and serotyped by conventional procedure. Genetic comparisons were performed using pulsed-field gel electrophoresis on a sub-set of isolates belonging to the same serotype successively recovered from the same establishment. L. monocytogenes was isolated from 11.2% of samples. The highest prevalence was observed in frozen foods (38%, followed by cheese (10%. 1/2b and 4b were the most frequently identified serotypes. In six of 236 analyzed establishments we successively recovered L. monocytogenes isolates belonging to the same serotype. Most of them corresponded to serotype 1/2b. Pulsed-field gel electrophoresis profiles suggest that at least 33% of L. monocytogenes 1/2b isolates are genetically related and that may remain viable for prolonged periods. The observed prevalence of L. monocytogenes was lower than reported in neighboring countries. Our findings highlight the role that frozen foods may play in the spread of this pathogen, and the relevance of serotypes 1/2b and 4b.
Virus like particle-based vaccines against emerging infectious disease viruses.
Liu, Jinliang; Dai, Shiyu; Wang, Manli; Hu, Zhihong; Wang, Hualin; Deng, Fei
2016-08-01
Emerging infectious diseases are major threats to human health. Most severe viral disease outbreaks occur in developing regions where health conditions are poor. With increased international travel and business, the possibility of eventually transmitting infectious viruses between different countries is increasing. The most effective approach in preventing viral diseases is vaccination. However, vaccines are not currently available for numerous viral diseases. Virus-like particles (VLPs) are engineered vaccine candidates that have been studied for decades. VLPs are constructed by viral protein expression in various expression systems that promote the selfassembly of proteins into structures resembling virus particles. VLPs have antigenicity similar to that of the native virus, but are non-infectious as they lack key viral genetic material. VLP vaccines have attracted considerable research interest because they offer several advantages over traditional vaccines. Studies have shown that VLP vaccines can stimulate both humoral and cellular immune responses, which may offer effective antiviral protection. Here we review recent developments with VLP-based vaccines for several highly virulent emerging or re-emerging infectious diseases. The infectious agents discussed include RNA viruses from different virus families, such as the Arenaviridae, Bunyaviridae, Caliciviridae, Coronaviridae, Filoviridae, Flaviviridae, Orthomyxoviridae, Paramyxoviridae, and Togaviridae families.
Directory of Open Access Journals (Sweden)
Élen Silveira Nalério
2009-09-01
Full Text Available Listeria monocytogenes é uma bactéria patogênica que se tornou um grande desafio para as indústrias de alimentos, entre elas a de frangos, assim como para os órgãos de vigilância sanitária. Apesar da produção de frangos estar em expansão na região sul do Rio Grande do Sul, não há relatos sobre esse patógeno, dessa forma, objetivou-se avaliar a prevalência de L. monocytogenes e de seus sorotipos nos diversos segmentos dessa cadeia produtiva. Nos aviários isolou-se L. monocytogenes em 2,9% (1/35 das amostras de swabs cloacais, não se isolando o microrganismo em amostras provenientes das camas de aviários. No abatedouro, 11,7% (15/128 das amostras apresentaram contaminação por L. monocytogenes e nos frangos resfriados procedentes do comércio, a prevalência foi de 33,3% (15/45.Observou-se que 51,6% (16/31 das cepas de L. monocytogenes pertenciam ao sorotipo 1/2b; 22,5% (7/31 ao sorotipo 4e; 16,1% (5/31 ao sorotipo 1/2a; 6,4% (2/31 ao sorotipo 4b; e 3,2% (1/31 ao sorotipo 1/2c. Há disseminação de L. monocytogenes na cadeia produtiva de frangos da região sul do Rio Grande do Sul e a presença de sorotipos prevalentes em casos/surtos de listeriose traz preocupação à saúde pública.Listeria monocytogenes is a pathogenic bacterium which has become a huge challenge to the food industries, including the poultry industry, and to the health surveillance agencies. Although poultry production is in expansion in southern of Rio Grande do Sul, Brazil, there are not reports about this pathogen thus this study aimed at assessing the prevalence of L monocytogenes and its serotypes in the several segments of this productive chain. In the broilers flocks L. monocytogenes were isolated in 2.9% (1/35 from cloacal swabs samples. This microorganism was not isolated from broiler houses samples. In the abattoir, 11% of the samples presented L. monocytogenes contamination, and in the chilled chicken from retailers its prevalence was 33.3% (15
Aparecida de Oliveira, Maria; Abeid Ribeiro, Eliana Guimarães; Morato Bergamini, Alzira Maria; Pereira De Martinis, Elaine Cristina
2010-02-01
Modern lifestyle markedly changed eating habits worldwide, with an increasing demand for ready-to-eat foods, such as minimally processed fruits and leafy greens. Packaging and storage conditions of those products may favor the growth of psychrotrophic bacteria, including the pathogen Listeria monocytogenes. In this work, minimally processed leafy vegetables samples (n = 162) from retail market from Ribeirão Preto, São Paulo, Brazil, were tested for the presence or absence of Listeria spp. by the immunoassay Listeria Rapid Test, Oxoid. Two L. monocytogenes positive and six artificially contaminated samples of minimally processed leafy vegetables were evaluated by the Most Probable Number (MPN) with detection by classical culture method and also culture method combined with real-time PCR (RTi-PCR) for 16S rRNA genes of L. monocytogenes. Positive MPN enrichment tubes were analyzed by RTi-PCR with primers specific for L. monocytogenes using the commercial preparation ABSOLUTE QPCR SYBR Green Mix (ABgene, UK). Real-time PCR assay presented good exclusivity and inclusivity results and no statistical significant difference was found in comparison with the conventional culture method (p < 0.05). Moreover, RTi-PCR was fast and easy to perform, with MPN results obtained in ca. 48 h for RTi-PCR in comparison to 7 days for conventional method.
Loubet, Paul; Guerrisi, Caroline; Turbelin, Clément; Blondel, Béatrice; Launay, Odile; Bardou, Marc; Goffinet, François; Colizza, Vittoria; Hanslik, Thomas; Kernéis, Solen
2016-04-29
Pregnancy is a risk factor for severe influenza. However, data on influenza incidence during pregnancy are scarce. Likewise, no data are available on influenza vaccine coverage in France since national recommendation in 2012. We aimed to assess these points using a novel nationwide web-based surveillance system, G-GrippeNet. During the 2014/2015 influenza season, pregnant women living in metropolitan France were enrolled through a web platform (https://www.grippenet.fr/). Throughout the season, participants were asked to report, on a weekly basis, if they had experienced symptoms of influenza-like-illness (ILI). ILI episodes reported were used to calculate incidence density rates based on period of participation from each participant. Vaccination coverage was estimated after weighing on age and education level from national data on pregnant women. Factors associated with higher vaccination coverage were obtained through a logistic regression with Odds Ratio (OR) corrected with the Zhang and Yu method. A total of 153 women were enrolled. ILI incidence density rate was 1.8 per 100 person-week (95% CI, 1.5-2.1). This rate was higher in women older than 40 years (RR = 3.0, 95% CI [1.1-8.3], p = 0.03) and during first/second trimesters compared to third trimester (RR = 4.0, 95% CI [1.4-12.0], p = 0.01). Crude vaccination coverage was 39% (95% CI, 31-47) and weighted vaccination coverage was estimated at 26% (95% CI, 20-34). Health care provider recommendation for vaccination (corrected OR = 7.8; 95% CI [3.0-17.1]) and non-smoking status (cOR = 2.1; 95% CI [1.2-6.9]) were associated with higher vaccine uptake. This original web based longitudinal surveillance study design proved feasible in pregnant women population. First results are of interest and underline that public health policies should emphasize the vaccination promotion through health care providers. Copyright © 2016 Elsevier Ltd. All rights reserved.
Chen, Poyin; den Bakker, Henk C; Korlach, Jonas; Kong, Nguyet; Storey, Dylan B; Paxinos, Ellen E; Ashby, Meredith; Clark, Tyson; Luong, Khai; Wiedmann, Martin; Weimer, Bart C
2017-02-01
Listeria monocytogenes is a bacterial pathogen that is found in a wide variety of anthropogenic and natural environments. Genome sequencing technologies are rapidly becoming a powerful tool in facilitating our understanding of how genotype, classification phenotypes, and virulence phenotypes interact to predict the health risks of individual bacterial isolates. Currently, 57 closed L. monocytogenes genomes are publicly available, representing three of the four phylogenetic lineages, and they suggest that L. monocytogenes has high genomic synteny. This study contributes an additional 15 closed L. monocytogenes genomes that were used to determine the associations between the genome and methylome with host invasion magnitude. In contrast to previous findings, large chromosomal inversions and rearrangements were detected in five isolates at the chromosome terminus and within rRNA genes, including a previously undescribed inversion within rRNA-encoding regions. Each isolate's epigenome contained highly diverse methyltransferase recognition sites, even within the same serotype and methylation pattern. Eleven strains contained a single chromosomally encoded methyltransferase, one strain contained two methylation systems (one system on a plasmid), and three strains exhibited no methylation, despite the occurrence of methyltransferase genes. In three isolates a new, unknown DNA modification was observed in addition to diverse methylation patterns, accompanied by a novel methylation system. Neither chromosome rearrangement nor strain-specific patterns of epigenome modification observed within virulence genes were correlated with serotype designation, clonal complex, or in vitro infectivity. These data suggest that genome diversity is larger than previously considered in L. monocytogenes and that as more genomes are sequenced, additional structure and methylation novelty will be observed in this organism. Listeria monocytogenes is the causative agent of listeriosis, a disease
Bres, Vanessa; Yang, Hua; Hsu, Ernie; Ren, Yan; Cheng, Ying; Wisniewski, Michele; Hanhan, Maesa; Zaslavsky, Polina; Noll, Nathan; Weaver, Brett; Campbell, Paul; Reshatoff, Michael; Becker, Michael
2014-01-01
The Atlas Listeria monocytogenes LmG2 Detection Assay, developed by Roka Bioscience Inc., was compared to a reference culture method for seven food types (hot dogs, cured ham, deli turkey, chicken salad, vanilla ice cream, frozen chocolate cream pie, and frozen cheese pizza) and one surface (stainless steel, grade 316). A 125 g portion of deli turkey was tested using a 1:4 food:media dilution ratio, and a 25 g portion for all other foods was tested using 1:9 food:media dilution ratio. The enrichment time and media for Roka's method was 24 to 28 h for 25 g food samples and environmental surfaces, and 44 to 48 h for 125 g at 35 ± 2°C in PALCAM broth containing 0.02 g/L nalidixic acid. Comparison of the Atlas Listeria monocytogenes LmG2 Detection Assay to the reference method required an unpaired approach. For each matrix, 20 samples inoculated at a fractional level and five samples inoculated at a high level with a different strain of Listeria monocytogenes were tested by each method. The Atlas Listeria monocytogenes LmG2 Detection Assay was compared to the Official Methods of Analysis of AOAC INTERNATIONAL 993.12 method for dairy products, the U.S. Department of Agriculture, Food Safety and Inspection Service, Microbiology Laboratory Guidebook 8.08 method for ready-to-eat meat and environmental samples, and the U.S. Food and Drug Administration Bacteriological Analytical Manual, Chapter 10 method for frozen foods. In the method developer studies, Roka's method, at 24 h (or 44 h for 125 g food samples), had 126 positives out of 200 total inoculated samples, compared to 102 positives for the reference methods at 48 h. In the independent laboratory studies, vanilla ice cream, deli turkey and stainless steel grade 316 were evaluated. Roka's method, at 24 h (or 44 h for 125 g food samples), had 64 positives out of 75 total inoculated samples compared to 54 positives for the reference methods at 48 h. The Atlas Listeria monocytogenes LmG2 Detection Assay detected all 50
Directory of Open Access Journals (Sweden)
Paul D Cotter
Full Text Available Streptolysin S (SLS is a bacteriocin-like haemolytic and cytotoxic virulence factor that plays a key role in the virulence of Group A Streptococcus (GAS, the causative agent of pharyngitis, impetigo, necrotizing fasciitis and streptococcal toxic shock syndrome. Although it has long been thought that SLS and related peptides are produced by GAS and related streptococci only, there is evidence to suggest that a number of the most notorious Gram-positive pathogenic bacteria, including Listeria monocytogenes, Clostridium botulinum and Staphylococcus aureus, produce related peptides. The distribution of the L. monocytogenes cluster is particularly noteworthy in that it is found exclusively among a subset of lineage I strains; i.e., those responsible for the majority of outbreaks of listeriosis. Expression of these genes results in the production of a haemolytic and cytotoxic factor, designated Listeriolysin S, which contributes to virulence of the pathogen as assessed by murine- and human polymorphonuclear neutrophil-based studies. Thus, in the process of establishing the existence of an extended family of SLS-like modified virulence peptides (MVPs, the genetic basis for the enhanced virulence of a proportion of lineage I L. monocytogenes may have been revealed.
Schmitter, Sibylle; Fieseler, Lars; Klumpp, Jochen; Bertram, Ralph; Loessner, Martin J
2017-08-01
To enable specific and tightly controlled gene expression both in vitro and during the intracellular lifecycle of the pathogen Listeria monocytogenes, a TetR-dependent genetic induction system was developed. Highest concentration of cytoplasmic TetR and best repression of tetO-controlled genes was obtained by tetR expression from the synthetic promoter Pt 17 . Anhydrotetracycline (ATc) as inducer permitted concentration-dependent, fine-tuned expression of genes under control of the tetO operator and a suitable promoter. The actin-polymerizing ActA protein represents a major virulence factor of L. monocytogenes, required for actin-based motility and cell-to-cell spread in infected host cells. To be able to observe its spatial and temporal distribution on intracellular L. monocytogenes cells, conditional mutants featuring actA placed under TetR control were used to infect PtK2 epithelial cells. Following induction at different time intervals, the subsequent recruitment of actin by L. monocytogenes could be monitored. We found that cells displayed functional ActA after approximately 15 min, while formation of polarized actin tail was complete after 90-120 min. At this point, intracellular motility of the induced mutants was indistinguishable from wild-type bacteria. Interestingly, de novo ActA synthesis in intracellular Listeria also demonstrated the temporal, asymmetric redistribution of the membrane-anchored proteins from the lateral walls toward the cell poles. © 2017 John Wiley & Sons Ltd.
Plant-based anti-HIV-1 strategies: vaccine molecules and antiviral approaches.
Scotti, Nunzia; Buonaguro, Luigi; Tornesello, Maria Lina; Cardi, Teodoro; Buonaguro, Franco Maria
2010-08-01
The introduction of highly active antiretroviral therapy has drastically changed HIV infection from an acute, very deadly, to a chronic, long-lasting, mild disease. However, this requires continuous care management, which is difficult to implement worldwide, especially in developing countries. Sky-rocketing costs of HIV-positive subjects and the limited success of preventive recommendations mean that a vaccine is urgently needed, which could be the only effective strategy for the real control of the AIDS pandemic. To be effective, vaccination will need to be accessible, affordable and directed against multiple antigens. Plant-based vaccines, which are easy to produce and administer, and require no cold chain for their heat stability are, in principle, suited to such a strategy. More recently, it has been shown that even highly immunogenic, enveloped plant-based vaccines can be produced at a competitive and more efficient rate than conventional strategies. The high variability of HIV epitopes and the need to stimulate both humoral neutralizing antibodies and cellular immunity suggest the importance of using the plant system: it offers a wide range of possible strategies, from single-epitope to multicomponent vaccines, modulators of the immune response (adjuvants) and preventive molecules (microbicides), either alone or in association with plant-derived monoclonal antibodies, besides the potential use of the latter as therapeutic agents. Furthermore, plant-based anti-HIV strategies can be administered not only parenterally but also by the more convenient and safer oral route, which is a more suitable approach for possible mass vaccination.
Kuan, Chee Hao; Wong, Woan Chwen; Pui, Chai Fung; Mahyudin, Nor Ainy; Tang, John Yew Huat; Nishibuchi, Mitsuaki; Radu, Son
2013-12-01
A total of 63 beef offal samples (beef liver = 16; beef lung = 14; beef intestine = 9; beef tripe = 15; beef spleen = 9) from three wet markets (A, B, and C) in Selangor, Malaysia were examined for the prevalence and microbial load of Listeria monocytogenes. A combination of the most probable number and polymerase chain reaction (MPN-PCR) method was employed in this study. It was found that L. monocytogenes detected in 33.33% of the beef offal samples. The prevalence of L. monocytogenes in beef offal purchased from wet markets A, B, and C were 22.73%, 37.50% and 41.18% respectively. The density of L. monocytogenes in all the samples ranged from 2,400 MPN/g. The findings in this study indicate that beef offal can be a potential vehicle of foodborne listeriosis.
Variations in virulence between different electrophoretic types of Listeria monocytogenes
DEFF Research Database (Denmark)
Nørrung, Birgit; Andersen, Jens Kirk
2000-01-01
A total of 245 strains of Listeria monocytogenes, representing 33 different electrophoretic types (ETs), were examined quantitatively for haemolytic activity. No significant difference was observed in the mean haemolytic activity between different ETs. Eighty four out of 91 strains examined were...... compared with 3.64 among food isolates). The explanation for this may be that more virulent strains are more prone to cause human infection. It is, however, also possible that strains oft. monocytogenes may become more virulent while multiplying in a living organism compared with multiplying in foods....
Vadia, Stephen; Seveau, Stephanie
2014-03-01
Listeria monocytogenes is responsible for the life-threatening food-borne disease listeriosis. This disease mainly affects elderly and immunocompromised individuals, causing bacteremia and meningoencephalitis. In pregnant women, L. monocytogenes infection leads to abortion and severe infection of the fetus or newborn. The L. monocytogenes intracellular life cycle is critical for pathogenesis. Previous studies have established that the major virulence factor of L. monocytogenes, the pore-forming toxin listeriolysin O (LLO), is sufficient to induce L. monocytogenes internalization into human epithelial cell lines. This internalization pathway strictly requires the formation of LLO pores in the plasma membrane and can be stimulated by the heterologous pore-forming toxin pneumolysin, suggesting that LLO acts nonspecifically by forming transmembrane pores. The present work tested the hypothesis that Ca2+ and K+ fluxes subsequent to perforation by LLO control L. monocytogenes internalization. We report that L. monocytogenes perforates the host cell plasma membrane in an LLO-dependent fashion at the early stage of invasion. In response to perforation, host cells undergo Ca2+ -dependent but K+ -independent resealing of their plasma membrane. In contrast to the plasma membrane resealing process, LLO-induced L. monocytogenes internalization requires both Ca2+ and K+ fluxes. Further linking ion fluxes to bacterial internalization, treating cells with a combination of Ca2+ and K+ ionophores but not with individual ionophores is sufficient to induce efficient internalization of large cargoes, such as 1-μm polystyrene beads and bacteria. We propose that LLO-induced L. monocytogenes internalization requires a Ca2+ - and K+ -dependent internalization pathway that is mechanistically distinct from the process of plasma membrane resealing.
2014-01-01
The cholesterol-dependent cytolysins (CDCs) are a large family of pore-forming toxins that are produced by numerous Gram-positive bacterial pathogens. These toxins are released in the extracellular environment as water-soluble monomers or dimers that bind to cholesterol-rich membranes and assemble into large pore complexes. Depending upon their concentration, the nature of the host cell and membrane (cytoplasmic or intracellular) they target, the CDCs can elicit many different cellular responses. Among the CDCs, listeriolysin O (LLO), which is a major virulence factor of the facultative intracellular pathogen Listeria monocytogenes, is involved in several stages of the intracellular lifecycle of the bacterium and displays unique characteristics. It has long been known that following L. monocytogenes internalization into host cells, LLO disrupts the internalization vacuole, enabling the bacterium to replicate into the host cell cytosol. LLO is then used by cytosolic bacteria to spread from cell to cell, avoiding bacterial exposure to the extracellular environment. Although LLO is continuously produced during the intracellular lifecycle of L. monocytogenes, several processes limit its toxicity to ensure the survival of infected cells. It was previously thought that LLO activity was limited to mediating vacuolar escape during bacterial entry and cell to cell spreading. This concept has been challenged by compelling evidence suggesting that LLO secreted by extracellular L. monocytogenes perforates the host cell plasma membrane, triggering important host cell responses. This chapter provides an overview of the well-established intracellular activity of LLO and the multiple roles attributed to LLO secreted by extracellular L. monocytogenes. PMID:24798012
Chen, Jianshun; Chen, Qiaomiao; Jiang, Jianjun; Hu, Hongxia; Ye, Jiangbo; Fang, Weihuan
2010-01-01
Listeria monocytogenes, the causative organism of listeriosis, is primarily transmitted to humans through contaminated food. In this study, we examined 1275 batches of aquatic products imported from 29 countries and found that 36 batches from 8 countries were contaminated by Listeria (2.8%), with L. monocytogenes accounting for 2.6% (33/1275) and L. innocua for 0.2% (3/1275). Of the 23 selected L. monocytogenes isolates (from the 33 identified), 15 (65.2%) were of serovar 4b complex (4b, 4d, or 4e), three (13.0%) of 1/2a or 3a, four (17.4%) of 1/2b or 3b, and one (4.4%) of 1/2c or 3c. Notably, four of the 23 isolates belonged to epidemic clone I (ECI) and another four were associated with epidemic clone II (ECII), two highly clonal 4b clusters responsible for most of the documented listeriosis outbreaks. In the multilocus sequence typing scheme based on the concatenated genes gyrB-dapE-hisJ-sigB-ribC-purM-betL-gap-tuf, serovar 4b complex isolates from imported aquatic products exhibited significant genetic diversity. While the four ECI isolates were genetically related to those from Chinese diseased animals, both lacking one proline-rich repeat of ActA, the four ECII isolates were located between 1/2b or 3b strains. As the L. monocytogenes isolates from imported aquatic products possessed a nearly complete set of major infection-related genes, they demonstrated virulence potential in mouse model.
Miller, E. S.; Bates, R. A.; Koebel, D. A.; Fuchs, B. B.; Sonnenfeld, G.
1998-01-01
Exposure to different forms of psychological and physiological stress can elicit a host stress response, which alters normal parameters of neuroendocrine homeostasis. The present study evaluated the influence of the metabolic stressor 2-deoxy-D-glucose (2-DG; a glucose analog, which when administered to rodents, induces acute periods of metabolic stress) on the capacity of mice to resist infection with the facultative intracellular bacterial pathogen Listeria monocytogenes. Female BDF1 mice were injected with 2-DG (500 mg/kg b. wt.) once every 48 h prior to, concurrent with, or after the onset of a sublethal dose of virulent L. monocytogenes. Kinetics of bacterial growth in mice were not altered if 2-DG was applied concurrently or after the start of the infection. In contrast, mice exposed to 2-DG prior to infection demonstrated an enhanced resistance to the listeria challenge. The enhanced bacterial clearance in vivo could not be explained by 2-DG exerting a toxic effect on the listeria, based on the results of two experiments. First, 2-DG did not inhibit listeria replication in trypticase soy broth. Second, replication of L. monocytogenes was not inhibited in bone marrow-derived macrophage cultures exposed to 2-DG. Production of neopterin and lysozyme, indicators of macrophage activation, were enhanced following exposure to 2-DG, which correlated with the increased resistance to L. monocytogenes. These results support the contention that the host response to 2-DG-induced metabolic stress can influence the capacity of the immune system to resist infection by certain classes of microbial pathogens.
Dahiya, Shyam S; Saini, Mohini; Kumar, Pankaj; Gupta, Praveen K
2012-10-01
A replicon-based DNA vaccine encoding VP2 gene of canine parvovirus (CPV) was developed by cloning CPV-VP2 gene into a replicon-based DNA vaccine vector (pAlpha). The characteristics of a replicon-based DNA vaccine like, self-amplification of transcripts and induction of apoptosis were analyzed in transfected mammalian cells. When the pAlpha-CPV-VP2 was injected intradermal as DNA-launched replicon-based DNA vaccine in dogs, it induced CPV-specific humoral and cell mediated immune responses. The virus neutralization antibody and lymphocyte proliferative responses were higher than conventional CPV DNA vaccine and commercial CPV vaccine. These results indicated that DNA-launched replicon-based CPV DNA vaccine was effective in inducing both CPV-specific humoral and cellular immune responses and can be considered as effective alternative to conventional CPV DNA vaccine and commercial CPV vaccine. Crown Copyright © 2012. Published by Elsevier India Pvt Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Kang G
2006-01-01
Full Text Available Rotavirus, the most common cause of severe diarrhea and a leading cause of mortality in children, has been a priority target for vaccine development for the past several years. The first rotavirus vaccine licensed in the United States was withdrawn because of an association of the vaccine with intussusception. However, the need for a vaccine is greatest in the developing world, because the benefits of preventing deaths due to rotavirus disease are substantially greater than the risk of intussusception. Early vaccines were based on animal strains. More recently developed and licenced vaccines are either animal-human reassortants or are based on human strains. In India, two candidate vaccines are in the development process, but have not yet reached efficacy trials. Many challenges regarding vaccine efficacy and safety remain. In addition to completing clinical evaluations of vaccines in development in settings with the highest disease burden and virus diversity, there is also a need to consider alternative vaccine development strategies.
Growth potential of Listeria monocytogenes in sliced turkey bresaola packed in modified atmosphere
Directory of Open Access Journals (Sweden)
Elena Dalzini
2014-02-01
Full Text Available According to EC Regulation No 2073/2005, for food business operators that produce ready-to-eat (RTE product, it is crucial to be able to demonstrate if the product supports the growth of Listeria monocytogenes. The objective of the study was therefore to evaluate the behaviour of L. monocytogenes in sliced RTE turkey bresaola (made by cured turkey breast 4.5% NaCl, 1% sodium lactate, sodium nitrite 150 ppm and flavouring during the shelf life of the product, simulating a contamination during the slicing operation. Considering a shelf life of 90 days, as defined by manufacturer, the packages of sliced bresaola were stored at 5°C for 7 days and at 8°C for the remaining storage time (83 days. L. monocytogenes count decreased during storage test from 1.43/1.98 log cfu/g in the three batches tested to 1.03 log cfu/g in one batch and to undetectable levels in the other two batches. The results show that the investigated product is unable to support the growth of L. monocytogenes.
Nodulman, Jessica A.; Starling, Randall; Kong, Alberta S.; Buller, David B.; Wheeler, Cosette M.; Woodall, W. Gill
2015-01-01
Background: In several countries worldwide, school-based human papillomavirus (HPV) vaccination programs have been successful; however, little research has explored US stakeholders' acceptance toward school-based HPV vaccination programs. Methods: A total of 13 focus groups and 12 key informant interviews (N?=?117; 85% females; 66% racial/ethnic…
An Assessment of Different Genomic Approaches for Inferring Phylogeny of Listeria monocytogenes
DEFF Research Database (Denmark)
Henri, Clementine; Leekitcharoenphon, Pimlapas; Carleton, Heather A.
2017-01-01
Background/objectives: Whole genome sequencing (WGS) has proven to be a powerful subtyping tool for foodborne pathogenic bacteria like L. monocytogenes. The interests of genome-scale analysis for national surveillance, outbreak detection or source tracking has been largely documented. The genomic......MLPPST) or pan genome (wgMLPPST). Currently, there are little comparisons studies of these different analytical approaches. Our objective was to assess and compare different genomic methods that can be implemented in order to cluster isolates of L monocytogenes.Methods: The clustering methods were evaluated...... on a collection of 207 L. monocytogenes genomes of food origin representative of the genetic diversity of the Anses collection. The trees were then compared using robust statistical analyses.Results: The backward comparability between conventional typing methods and genomic methods revealed a near...
Impact of a website based educational program for increasing vaccination coverage among adolescents.
Esposito, Susanna; Bianchini, Sonia; Tagliabue, Claudia; Umbrello, Giulia; Madini, Barbara; Di Pietro, Giada; Principi, Nicola
2018-04-03
Data regarding the use of technology to improve adolescent knowledge on vaccines are scarce. The main aim of this study was to evaluate whether different web-based educational programmes for adolescents might increase their vaccination coverage. Overall, 917 unvaccinated adolescents (389 males, 42.4%; mean age ± standard deviation, 14.0 ± 2.2 years) were randomized 1:1:1 into the following groups: no intervention (n = 334), website educational program only (n = 281), or website plus face to face lesson (n = 302) groups. The use of the website plus the lesson significantly increased the overall knowledge of various aspects of vaccine-preventable disease and reduced the fear of vaccines (p education of adolescents while considering all of the vaccines recommended for this age group. Our results demonstrate the possibility of increasing vaccination coverage by using a website based educational program with tailored information. However, to be most effective, this program should be supplemented with face-to-face discussions of vaccines at school and at home. Thus, specific education should also include teachers and parents so that they will be prepared to discuss with adolescents what is true and false in the vaccination field.
Linares, María Belén; Garrido, María Dolores; Martins, Conceição; Patarata, Luis
2013-05-01
Chouriço de vinho is made from roughly minced (10 to 30 mm) pork and fat, seasoned with a marinade made from wine, salt, garlic, and other facultative seasonings used according to the recipe of each producer. The batter is maintained at 4 to 7 ºC for 24 to 48 h. It is then stuffed into natural thin pork gut, cold smoked and matured at a low temperature for 1 to 4 wk. The effect of garlic used in wine-based marinade and a starter culture of indigenous Lactobacillus sakei on the behavior of Listeria monocytogenes and Salmonella spp. in the processing of chouriço was investigated. The garlic (as powder and fresh juice) was found to contribute (P < 0.05) to the control of both pathogens in broth. Garlic dose, as tested within the usual limits used for seasoning, did not impact the reduction of pathogens. Garlic-wine-based marinade and a starter culture of indigenous L. sakei contribute to controlling L. monocytogenes and Salmonella spp. in the processing of chouriço. Their presence was responsible for the loss of viability of L. monocytogenes and Salmonella spp. following 5 d of drying, even sooner than situations where no garlic was used. The results of the present work show that the use of a wine-based marinade with garlic has an important role in ensuring the safety of the product. © 2013 Institute of Food Technologists®
Evaluation of peptide selection approaches for epitope‐based vaccine design
DEFF Research Database (Denmark)
Schubert, B.; Lund, Ole; Nielsen, Morten
2013-01-01
A major challenge in epitope-based vaccine (EV) design stems from the vast genomic variation of pathogens and the diversity of the host cellular immune system. Several computational approaches have been published to assist the selection of potential T cell epitopes for EV design. So far, no thoro......A major challenge in epitope-based vaccine (EV) design stems from the vast genomic variation of pathogens and the diversity of the host cellular immune system. Several computational approaches have been published to assist the selection of potential T cell epitopes for EV design. So far...... in terms of in silico measurements simulating important vaccine properties like the ability of inducing protection against a multivariant pathogen in a population; the predicted immunogenicity; pathogen, allele, and population coverage; as well as the conservation of selected epitopes. Additionally, we...... evaluate the use of human leukocyte antigen (HLA) supertypes with regards to their applicability for population-spanning vaccine design. The results showed that in terms of induced protection methods that simultaneously aim to optimize pathogen and HLA coverage significantly outperform methods focusing...
Immunotherapy for Alzheimer's disease: DNA- and protein-based epitope vaccines.
Davtyan, Hayk; Petrushina, Irina; Ghochikyan, Anahit
2014-01-01
Active immunotherapy for Alzheimer's disease (AD) is aimed to induce antibodies specific to amyloid-beta (Aβ) that are capable to reduce the level of Aβ in the CNS of Alzheimer's disease patients. First clinical trial AN-1792 that was based on vaccination with full-length Aβ42 showed that safe and effective AD vaccine should induce high titers of anti-Aβ antibodies without activation of harmful autoreactive T cells. Replacement of self-T cell epitope with foreign epitope, keeping self-B cell epitope intact, may allow to induce high titers of anti-Aβ antibodies while avoiding the activation of T cells specific to Aβ. Here we describe the protocols for evaluation of AD DNA- or multiple antigenic peptide (MAP)-based epitope vaccines composed of Aβ(1-11) B cell epitope fused to synthetic T cell epitope PADRE (Aβ(1-11)-PADRE). All protocols could be used for testing any epitope vaccine constructed in your lab and composed of other T cell epitopes using the appropriate peptides in tests for evaluation of humoral and cellular immune responses.
Directory of Open Access Journals (Sweden)
Catherine E Jobbings
Full Text Available Whilst mast cells participate in the immune defence against the intracellular bacterium Listeria monocytogenes, there is conflicting evidence regarding the ability of L. monocytogenes to infect mast cells. It is known that the pore-forming toxin listeriolysin (LLO is important for mast cell activation, degranulation and the release of pro-inflammatory cytokines. Mast cells, however, are a potential source of a wide range of cytokines, chemokines and other mediators including osteopontin, which contributes to the clearing of L. monocytogenes infections in vivo, although its source is unknown. We therefore aimed to resolve the controversy of mast cell infection by L. monocytogenes and investigated the extent of mediator release in response to the bacterium. In this paper we show that the infection of bone marrow-derived mast cells by L. monocytogenes is inefficient and LLO-independent. LLO, however, is required for calcium-independent mast cell degranulation as well as for the transient and selective downregulation of cell surface CD117 (c-kit on mast cells. We demonstrate that in addition to the key pro-inflammatory cytokines TNF-α and IL-6, mast cells release a wide range of other mediators in response to L. monocytogenes. Osteopontin, IL-2, IL-4, IL-13 and granulocyte macrophage colony-stimulating factor (GM-CSF, and chemokines including CCL2, CCL3, CCL4 and CCL5 are released in a MyD88-dependent manner. The wide range of mediators released by mast cells in response to L. monocytogenes may play an important role in the recruitment and activation of a variety of immune cells in vivo. The cocktail of mediators, however, is unlikely to skew the immune response to a particular effector response. We propose that mast cells provide a hitherto unreported source of osteopontin, and may provide an important role in co-ordinating the immune response during Listeria infection.
Control options for Listeria monocytogenes in seafoods
DEFF Research Database (Denmark)
Huss, Hans Henrik; Jørgensen, Lasse Vigel; Vogel, Birte Fonnesbech
2000-01-01
At least three outbreaks of listeriosis associated with seafood have been reported. Listeria monocytogenes is widely distributed in the general environment including fresh water, coastal water and live fish from these areas. Contamination or recontamination of seafood may also take place during...
Can dendritic cells improve whole cancer cell vaccines based on immunogenically killed cancer cells?
Cicchelero, Laetitia; Denies, Sofie; Devriendt, Bert; de Rooster, Hilde; Sanders, Niek N
2015-01-01
Immunogenic cell death (ICD) offers interesting opportunities in cancer cell (CC) vaccine manufacture, as it increases the immunogenicity of the dead CC. Furthermore, fusion of CCs with dendritic cells (DCs) is considered a superior method for generating whole CC vaccines. Therefore, in this work, we determined in naive mice whether immunogenically killed CCs per se (CC vaccine) elicit an antitumoral immune response different from the response observed when immunogenically killed CCs are associated with DCs through fusion (fusion vaccine) or through co-incubation (co-incubation vaccine). After tumor inoculation, the type of immune response in the prophylactically vaccinated mice differed between the groups. In more detail, fusion vaccines elicited a humoral anticancer response, whereas the co-incubation and CC vaccine mainly induced a cellular response. Despite these differences, all three approaches offered a prophylactic protection against tumor development in the murine mammary carcinoma model. In summary, it can be concluded that whole CC vaccines based on immunogenically killed CCs may not necessarily require association with DCs to elicit a protective anticancer immune response. If this finding can be endorsed in other cancer models, the manufacture of CC vaccines would greatly benefit from this new insight, as production of DC-based vaccines is laborious, time-consuming and expensive. PMID:26587315
Prevalence and contamination levels of listeria monocytogenes in ready-to-eat foods in Tokyo, Japan.
Shimojima, Yukako; Ida, Miki; Nakama, Akiko; Nishino, Yukari; Fukui, Rie; Kuroda, Sumiyo; Hirai, Akihiko; Kai, Akemi; Sadamasu, Kenji
2016-08-01
We surveyed prevalence and contamination levels of Listeria monocytogenes in ready-to-eat foods between 2000 and 2012 in Tokyo. L. monocytogenes was isolated from 52 (1.7%) out of 2,980 samples. Comparing the prevalence in the study period, 2.2% were positive in the former period (2000-2005) and 1.2% in the latter (2006-2012). Using the most probable number (MPN) technique, 32 samples were contaminated with fewer than 0.3 L. monocytogenes/g, 10 samples with 0.3-1.0/g and 4 samples with more than 1.0/g (the maximum was 2.3/g). The most common serovar was 1/2a, followed by 1/2b, 4b and 1/2c. We revealed that ready-to-eat foods in Tokyo were contaminated with L. monocytogenes, although the contamination levels were low.
Kuan, Chee Hao; Wong, Woan Chwen; Pui, Chai Fung; Mahyudin, Nor Ainy; Tang, John Yew Huat; Nishibuchi, Mitsuaki; Radu, Son
2013-01-01
A total of 63 beef offal samples (beef liver = 16; beef lung = 14; beef intestine = 9; beef tripe = 15; beef spleen = 9) from three wet markets (A, B, and C) in Selangor, Malaysia were examined for the prevalence and microbial load of Listeria monocytogenes. A combination of the most probable number and polymerase chain reaction (MPN-PCR) method was employed in this study. It was found that L. monocytogenes detected in 33.33% of the beef offal samples. The prevalence of L. monocytogenes in beef offal purchased from wet markets A, B, and C were 22.73%, 37.50% and 41.18% respectively. The density of L. monocytogenes in all the samples ranged from 2,400 MPN/g. The findings in this study indicate that beef offal can be a potential vehicle of foodborne listeriosis. PMID:24688507
Directory of Open Access Journals (Sweden)
Chee Hao Kuan
2013-12-01
Full Text Available A total of 63 beef offal samples (beef liver = 16; beef lung = 14; beef intestine = 9; beef tripe = 15; beef spleen = 9 from three wet markets (A, B, and C in Selangor, Malaysia were examined for the prevalence and microbial load of Listeria monocytogenes. A combination of the most probable number and polymerase chain reaction (MPN-PCR method was employed in this study. It was found that L. monocytogenes detected in 33.33% of the beef offal samples. The prevalence of L. monocytogenes in beef offal purchased from wet markets A, B, and C were 22.73%, 37.50% and 41.18% respectively. The density of L. monocytogenes in all the samples ranged from 2,400 MPN/g. The findings in this study indicate that beef offal can be a potential vehicle of foodborne listeriosis.
DEFF Research Database (Denmark)
Lauritsen, Klara Tølbøll; Vinther Heydenreich, Annette; Riber, Ulla
Arthritis in swine is frequently caused by Mycoplasma hyosynoviae (Mhs). For the development of an effective vaccine we investigated the immunogenic effect of three vaccine preparations with the ISCOM adjuvant Posintro™ from Nordic Vaccine. A: formalin fixed whole-cells Mhs (300 µg/dose) mixed...... with Posintro, B: Deoxycholate extracted lipoproteins from Mhs organisms (DOC-antigen, 300 μg/dose) in Posintro and C: DOC-antigen (50 μg/dose) in Posintro. Each vaccine-group contained three pigs. Vaccinations (i.m.) were performed at 12 and 15 weeks of age. The development of specific IgG and secretion...... of IFNγ were measured. Three weeks after the second vaccination, pigs were euthanised and autopsied. Vaccine B induced a high level of specific serum IgG in all pigs a week after boost. Vaccine C gave a variable response after boost, with two pigs seroconverting, while no response was seen by vaccine A...
Growth, viability and architecture of biofilms of Listeria monocytogenes formed on abiotic surfaces
Directory of Open Access Journals (Sweden)
Fernanda Barbosa dos Reis-Teixeira
Full Text Available Abstract The pathogenic bacterium Listeria monocytogenes can persist in food processing plants for many years, even when appropriate hygienic measures are in place, with potential for contaminating ready-to-eat products and, its ability to form biofilms on abiotic surfaces certainly contributes for the environmental persistence. In this research, L. monocytogenes was grown in biofilms up 8 days attached to stainless steel and glass surfaces, contributing for advancing the knowledge on architecture of mature biofilms, since many literature studies carried out on this topic considered only early stages of cell adhesion. In this study, biofilm populations of two strains of L. monocytogenes (serotypes 1/2a and 4b on stainless steel coupons and glass were examined using regular fluorescence microscopy, confocal laser scanning microscopy and classic culture method. The biofilms formed were not very dense and microscopic observations revealed uneven biofilm structures, with presence of exopolymeric matrix surrounding single cells, small aggregates and microcolonies, in a honeycomb-like arrangement. Moreover, planktonic population of L. monocytogenes (present in broth media covering the abiotic surface remained stable throughout the incubation time, which indicates an efficient dispersal mechanism, since the culture medium was replaced daily. In conclusion, even if these strains of L. monocytogenes were not able to form thick multilayer biofilms, it was noticeable their high persistence on abiotic surfaces, reinforcing the need to focus on measures to avoid biofilm formation, instead of trying to eradicate mature biofilms.
Growth, viability and architecture of biofilms of Listeria monocytogenes formed on abiotic surfaces.
Reis-Teixeira, Fernanda Barbosa Dos; Alves, Virgínia Farias; de Martinis, Elaine Cristina Pereira
The pathogenic bacterium Listeria monocytogenes can persist in food processing plants for many years, even when appropriate hygienic measures are in place, with potential for contaminating ready-to-eat products and, its ability to form biofilms on abiotic surfaces certainly contributes for the environmental persistence. In this research, L. monocytogenes was grown in biofilms up 8 days attached to stainless steel and glass surfaces, contributing for advancing the knowledge on architecture of mature biofilms, since many literature studies carried out on this topic considered only early stages of cell adhesion. In this study, biofilm populations of two strains of L. monocytogenes (serotypes 1/2a and 4b) on stainless steel coupons and glass were examined using regular fluorescence microscopy, confocal laser scanning microscopy and classic culture method. The biofilms formed were not very dense and microscopic observations revealed uneven biofilm structures, with presence of exopolymeric matrix surrounding single cells, small aggregates and microcolonies, in a honeycomb-like arrangement. Moreover, planktonic population of L. monocytogenes (present in broth media covering the abiotic surface) remained stable throughout the incubation time, which indicates an efficient dispersal mechanism, since the culture medium was replaced daily. In conclusion, even if these strains of L. monocytogenes were not able to form thick multilayer biofilms, it was noticeable their high persistence on abiotic surfaces, reinforcing the need to focus on measures to avoid biofilm formation, instead of trying to eradicate mature biofilms. Copyright © 2017. Published by Elsevier Editora Ltda.
Directory of Open Access Journals (Sweden)
Jozi Fagundes de Mello
2008-03-01
Full Text Available The polymorphic region sequences in the iap gene were analyzed in 25 strains of Listeria monocytogenes isolated from cheeses in the state of Rio Grande do Sul, and compared with reference strains. This investigation distinguished two clusters of L. monocytogenes: I (20 strains and II (5 strains.A seqüência da região polimórfica do gene iap foi analisada em 25 cepas de Listeria monocytogenes isoladas de queijo no Estado do Rio Grande do Sul e comparadas com cepas referências. Esta investigação distinguiu L. monocytogenes em dois grupos: I (20 cepas e II (5 cepas.
Basurto-Dávila, Ricardo; Meltzer, Martin I; Mills, Dora A; Beeler Asay, Garrett R; Cho, Bo-Hyun; Graitcer, Samuel B; Dube, Nancy L; Thompson, Mark G; Patel, Suchita A; Peasah, Samuel K; Ferdinands, Jill M; Gargiullo, Paul; Messonnier, Mark; Shay, David K
2017-12-01
To estimate the societal economic and health impacts of Maine's school-based influenza vaccination (SIV) program during the 2009 A(H1N1) influenza pandemic. Primary and secondary data covering the 2008-09 and 2009-10 influenza seasons. We estimated weekly monovalent influenza vaccine uptake in Maine and 15 other states, using difference-in-difference-in-differences analysis to assess the program's impact on immunization among six age groups. We also developed a health and economic Markov microsimulation model and conducted Monte Carlo sensitivity analysis. We used national survey data to estimate the impact of the SIV program on vaccine coverage. We used primary data and published studies to develop the microsimulation model. The program was associated with higher immunization among children and lower immunization among adults aged 18-49 years and 65 and older. The program prevented 4,600 influenza infections and generated $4.9 million in net economic benefits. Cost savings from lower adult vaccination accounted for 54 percent of the economic gain. Economic benefits were positive in 98 percent of Monte Carlo simulations. SIV may be a cost-beneficial approach to increase immunization during pandemics, but programs should be designed to prevent lower immunization among nontargeted groups. © Health Research and Educational Trust.
Wang, Jianfeng; Liu, Bowen; Teng, Zihao; Zhou, Xuan; Wang, Xiyan; Zhang, Bing; Lu, Gejin; Niu, Xiaodi; Yang, Yongjun; Deng, Xuming
2017-01-01
The critical roles of sortase A (SrtA) and listeriolysin O (LLO) in Listeria monocytogenes pathogenicity render these two virulence factors as ideal targets for the development of anti-virulence agents against L. monocytogenes infection. Additionally, the structures of SrtA and LLO are highly conserved among the members of sortase enzyme family and cholesterol dependent toxin family. Here, phloretin, a natural polyphenolic compound derived from apples and pears that has little anti- L. monocytogenes activity, was identified to simultaneously inhibit LLO expression and neutralize SrtA catalytic activity. Phloretin neutralized SrtA activity by causing a conformational change in the protein's active pocket, which prevented engagement with its substrate. Treatment with phloretin simultaneously reduced L. monocytogenes invasion into host cells and blocked the escape of vacuole-entrapped L. monocytogenes into cytoplasm. Further, L. monocytogenes -infected mice that received phloretin showed lower mortality, decreased bacterial burden and reduced pathological injury. Our results demonstrate that phloretin is a promising anti-infective therapeutic for infections caused by L. monocytogenes due to its simultaneous targeting of SrtA and LLO, which may result in fewer side effects than those caused by other antibiotics.
Veen, van der S.; Wagendorp, A.; Abee, T.; Wells-Bennik, M.H.J.
2009-01-01
Listeria monocytogenes is a foodborne pathogen that has the ability to survive relatively high temperatures compared with other nonsporulating foodborne pathogens. This study was performed to determine whether L. monocytogenes strains with relatively high heat resistances are adequately inactivated
Making evidence-based selections of influenza vaccines.
Childress, Billy-Clyde; Montney, Joshua D; Albro, Elise A
2014-01-01
Years ago, intramuscular influenza vaccines were the only option for those who wanted to arm themselves against the flu. Today there are alternatives, including intradermal injections and intranasal sprays. In order to select the right influenza vaccine for their patients, pharmacists, and other healthcare professionals must have a basic understanding of the immune system. Influenza vaccines elicit different levels of immune response involving innate and adaptive immunity, which are critical to fighting infection. For the 2013-2014 flu season, there were 13 different formulations of influenza vaccines on the market with vast differences in indications, contraindications, and effectiveness. The CDC does not recommend one vaccine over another, but recommends that all patients be vaccinated against the flu. Preventing the spread of influenza is no simple task; however, the most recent evidence on influenza vaccines and sufficient knowledge of the immune system will allow pharmacists and other healthcare providers to better advocate for vaccines, determine which are most appropriate, and ensure their proper administration.
Overney, Anaïs; Jacques-André-Coquin, Joséphine; Ng, Patricia; Carpentier, Brigitte; Guillier, Laurent; Firmesse, Olivier
2017-03-06
The ability of Listeria monocytogenes to adhere to and persist on surfaces for months or even years may be responsible for its transmission from contaminated surfaces to food products. Hence the necessity to find effective means to prevent the establishment of L. monocytogenes in food processing environments. The aim of this study was to assess, through a fractional experimental design, the environmental factors that could affect the survival of L. monocytogenes cells on surfaces to thereby prevent the persistence of this pathogen in conditions mimicking those encountered in food processing plants: culture with smoked salmon juice or meat exudate, use of two materials with different hygiene status, biofilm of L. monocytogenes in pure-culture or dual-culture with a Pseudomonas fluorescens strain, application of a drying step after cleaning and disinfection (C&D) and comparison of two strains of L. monocytogenes. Bacterial survival was assessed by culture, qPCR to quantify total cells, and propidium monoazide coupled with qPCR to quantify viable cells and highlight viable but non-culturable (VBNC) cells. Our results showed that failure to apply C&D causes cell persistence on surfaces. Moreover, the sanitation procedure leads only to a loss of culturability and appearance of VBNC populations. However, an additional daily drying step after C&D optimises the effectiveness of these procedures to reduce culturable populations. Our results reinforce the importance to use molecular tools to monitor viable pathogens in food processing plants to avoid underestimating the amounts of cells using only methods based on cell culture. Copyright © 2017 Elsevier B.V. All rights reserved.
Ontology-based literature mining of E. coli vaccine-associated gene interaction networks.
Hur, Junguk; Özgür, Arzucan; He, Yongqun
2017-03-14
Pathogenic Escherichia coli infections cause various diseases in humans and many animal species. However, with extensive E. coli vaccine research, we are still unable to fully protect ourselves against E. coli infections. To more rational development of effective and safe E. coli vaccine, it is important to better understand E. coli vaccine-associated gene interaction networks. In this study, we first extended the Vaccine Ontology (VO) to semantically represent various E. coli vaccines and genes used in the vaccine development. We also normalized E. coli gene names compiled from the annotations of various E. coli strains using a pan-genome-based annotation strategy. The Interaction Network Ontology (INO) includes a hierarchy of various interaction-related keywords useful for literature mining. Using VO, INO, and normalized E. coli gene names, we applied an ontology-based SciMiner literature mining strategy to mine all PubMed abstracts and retrieve E. coli vaccine-associated E. coli gene interactions. Four centrality metrics (i.e., degree, eigenvector, closeness, and betweenness) were calculated for identifying highly ranked genes and interaction types. Using vaccine-related PubMed abstracts, our study identified 11,350 sentences that contain 88 unique INO interactions types and 1,781 unique E. coli genes. Each sentence contained at least one interaction type and two unique E. coli genes. An E. coli gene interaction network of genes and INO interaction types was created. From this big network, a sub-network consisting of 5 E. coli vaccine genes, including carA, carB, fimH, fepA, and vat, and 62 other E. coli genes, and 25 INO interaction types was identified. While many interaction types represent direct interactions between two indicated genes, our study has also shown that many of these retrieved interaction types are indirect in that the two genes participated in the specified interaction process in a required but indirect process. Our centrality analysis of
A Meta-analysis of the Rates of Listeria monocytogenes and Enterococcus in Febrile Infants.
Leazer, Rianna; Perkins, Amy M; Shomaker, Kyrie; Fine, Bryan
2016-04-01
A change in the epidemiology of pathogens causing serious bacterial infection (SBI) has been noted since original recommendations were made for the empirical antibiotic choices for young infants with fever. To assess the prevalence of SBI caused by Listeria monocytogenes and Enterococcus species. A literature search was conducted on keywords related to SBI, L. monocytogenes, and Enterococcus spp. infections. Eligible studies were those conducted in the United States and published between January 1998 and June 2014 focusing on SBI in infants≤90 days of age. The rates of urinary tract infection, bacteremia, and meningitis for each pathogen were recorded for each study. Meta-analysis was performed to calculate the prevalence for each pathogen in a random effects model with 0.5 continuity correction added to studies with zero events. Sixteen studies were included. A total of 20,703 blood cultures were included, with weighted prevalences for L. monocytogenes and Enterococcus spp. bacteremia of 0.03% and 0.09%, respectively. A total of 13,775 cerebrospinal fluid cultures were included with event rates (unweighted prevalences) for L. monocytogenes and Enterococcus spp. meningitis of 0.02% and 0.03%, respectively. A total of 18,283 urine cultures were included, with no cases of L. monocytogenes and a weighted prevalence for Enterococcus spp. urinary tract infection of 0.28%. There may have been reporting bias or incomplete retrieval or inadvertent exclusion of relevant studies. SBI caused by L. monocytogenes and Enterococcus spp. in febrile infants is rare, and therefore clinicians may consider a change in empirical antibiotic choices. Copyright © 2016 by the American Academy of Pediatrics.
Henriques, A R; Cristino, J Melo; Fraqueza, M J
2017-04-01
Listeria monocytogenes isolates (n = 81) recovered from ready-to-eat meat-based food products (RTEMP) collected in industrial processing plants and retail establishments were genetically characterized for comparison with those from human clinical cases of listeriosis (n = 49). The aim was to assess RTEMP as a possible food source for human infection. L. monocytogenes was detected in 12.5% of the RTEMP samples, and in some cases, counts were above the European food safety criteria. All isolates were assessed by multiplex PCR for serogroup determination and detection of virulence-associated genes inlA, inlB, inlC, inlJ, plcA, hlyA, actA, and iap. Serogroups IIb and IVb dominated in RTEMP and human isolates, and all were positive for the assessed virulence genes. Antibiotic susceptibility testing by the disk diffusion method revealed a low level of resistance among the isolates. Pulsed-field gel electrophoresis (PFGE) of L. monocytogenes isolates, using restriction enzymes ApaI and AscI, revealed genetic variability and differentiated the isolates in five clusters. Although some pulsed-field gel electrophoresis profiles of particular RTEMP and human isolates seemed to be highly related, exhibiting more than 90% similarity, which suggests a possible common source, in most cases the strains were not genetically or temporally matched. The close genetic relatedness of RTEMP and human listeriosis strains stressed the importance of preventive measure implementation throughout the food chain.
Cauchon, Kaitlin E; Hitchins, Anthony D; Smiley, R Derike
2017-09-01
Three selective enrichment methods, the United States Food and Drug Administration's (FDA method), the United States Department of Agriculture Food Safety Inspection Service's (USDA method), and the EN ISO 11290-1 standard method, were assessed for their suitability for recovery of Listeria monocytogenes from spiked mung bean sprouts. Three parameters were evaluated; the enrichment L. monocytogenes population from singly-spiked sprouts, the enrichment L. monocytogenes population from doubly-spiked (L. monocytogenes and Listeria innocua) sprouts, and the population differential resulting from the enrichment of doubly-spiked sprouts. Considerable L. monocytogenes inter-strain variation was observed. The mean enrichment L. monocytogenes populations for singly-spiked sprouts were 6.1 ± 1.2, 4.9 ± 1.2, and 6.9 ± 2.3 log CFU/mL for the FDA, USDA, and EN ISO 11290-1 methods, respectively. The mean L. monocytogenes populations for doubly-spiked sprouts were 4.7 ± 1.1, 5.5 ± 1.3, and 4.6 ± 1.4 log CFU/mL for the FDA, USDA, and ISO 11290-1 enrichment methods, respectively. The corresponding mean population differentials were 2.8 ± 1.1, 3.3 ± 1.3, and 3.6 ± 1.4 Δlog CFU/mL for the same three enrichment methods, respectively. The presence of L. innocua and resident microorganisms on the sprouts negatively impacted final levels of L. monocytogenes with all three enrichment methods. Published by Elsevier Ltd.
Occurrence and antimicrobial resistance patterns of Listeria monocytogenes isolated from vegetables
Directory of Open Access Journals (Sweden)
Vanessa de Vasconcelos Byrne
2016-06-01
Full Text Available Abstract Although the consumption of fresh and minimally processed vegetables is considered healthy, outbreaks related to the contamination of these products are frequently reported. Among the food-borne pathogens that contaminate vegetables is Listeria monocytogenes, a ubiquitous organism that exhibits the ability to survive and multiply at refrigerated temperatures. This study aimed to evaluate the occurrence of L. monocytogenes in vegetables as well as the antimicrobial resistance of isolates. The results showed that 3.03% of samples were contaminated with L. monocytogenes, comprising 2.22% of raw vegetables and 5.56% of ready-to-eat vegetables. Multiplex PCR confirmed the virulence potential of the isolates. Antimicrobial resistance profiling showed that 50% of the isolates were susceptible to the antibiotics used. The resistance of one isolate to penicillin G, a commonly employed therapeutic agent, and the presence of serotype 4b, a serotype commonly associated with food-borne outbreaks, could be potential health hazards for consumers.
Tsiraki, Maria I; Yehia, Hany M; Elobeid, Tahra; Osaili, Tareq; Sakkas, Hercules; Savvaidis, Ioannis N
2018-02-01
The antimicrobial effect of citrus extract (at 1 mL/kg [C1] and 2 mL/kg [C2]) on naturally occurring microbiota and inoculated pathogens (E. coli O157:H7 and L. monocytogenes at ca. 6 log cfu/g) in the traditional Greek yogurt-based salad Tzatziki stored at 4, 10, or 21 °C, was examined. Lactic acid bacteria (LAB) were high (8.0-8.5 log cfu/g) and varied only minimally for both the control (untreated) and the citrus extract-treated salad samples, whereas the higher citrus extract concentration yielded the lowest yeast populations, irrespective of temperature, during the entire storage period. Populations of inoculated E. coli (6 log cfu/g) declined in both untreated and citrus extract-treated samples from day 0-70, 35, and 15 at 4, 10, and 21 °C, respectively. Citrus extract had a significant effect on the survival of the inoculated E. coli O157:H7, with reductions of 2.8-4.8 log cfu/g in the citrus extract-treated samples at the end of the storage period. Our data show that L. monocytogenes survived in both untreated and citrus extract-treated samples during the entire storage period, irrespective of the storage temperature. The higher concentration of citrus extract had a significant effect on the survival of L. monocytogenes in the treated samples, and reductions of 1.5-3.0 logs were noted on final day 70, 35 and 15 at 4, 10 and 21 °C, respectively. The results of our study demonstrated the potential of citrus extract as a natural compound that can control the growth of food-borne pathogenic bacteria, such as E. coli O157:H7 and L. monocytogenes in Tzatziki, a yogurt-based salad. Copyright © 2017 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Moutong eChen
2015-09-01
Full Text Available Listeria monocytogenes is an important foodborne pathogen that can cause serious illness in immunocompromised individuals, pregnant women, the elderly, and newborns. The aim of this study was to: (i evaluate the prevalence and contamination level (most probable number, MPN of L. monocytogenes in 567 retail raw foods (fishery products, n=154; raw/fresh meat, n=123; frozen foods, n=110; edible fungi, n=108; vegetables, n=72 collected from South China and (ii to gain further knowledge on the phenotype and genotype distributions of this important foodborne pathogen. Approximately 22% of the samples were positive for L. monocytogenes. The contamination levels were between 0.3 and 10 MPN/g in 75.0%, between 10 and 100 MPN/g in 11.0% and less than 100 MPN/g in 14.0% of the countable samples. Five serogroups were identified among the177 foodborne L. monocytogenes isolates, with1/2a-3a (42.4% and1/2b-3b (26.0% serogroups being the most dominant. Serogroup I.1 and II.2 were only found in the edible mushrooms, while serogroup III was dominant in the fishery products, suggesting that specific serogroups of L. monocytogenes may have distinct ecological niches. Ten (5.6% L. monocytogenes isolates exhibited multidrug resistance. Genetic relatedness analysis revealed the absence of distinct associations between specific food types, antibiotic resistance, serogroups, and genetic diversity. The present study provided the first baseline data on the prevalence, contamination level, and characteristics of L. monocytogenes isolated from raw foods in South China. Some multidrug resistant strains belonged to the epidemiologically important serogroups (I.1 and II.1, implying a potential public health risk. In addition, these findings also provide basic information for the Chinese food safety associated authorities to draft appropriate standards to control L. monocytogenes contamination and improve microbiological safety of raw foods.
Local Outbreak of Listeria monocytogenes Serotype 4b Sequence Type 6 Due to Contaminated Meat Pâté.
Althaus, Denise; Jermini, Marco; Giannini, Petra; Martinetti, Gladys; Reinholz, Danuta; Nüesch-Inderbinen, Magdalena; Lehner, Angelika; Stephan, Roger
2017-04-01
In January and February 2016, five cases of confirmed and two cases of probable infection due to Listeria monocytogenes serotype 4b, sequence type (ST) 6 belonging to a single pulsed-field gel electrophoresis pulsotype pattern were registered in a region of southern Switzerland. L. monocytogenes was detected in blood samples (four cases) and pleural fluid (one case). Furthermore, L. monocytogenes 4b ST6 was detected in a stool sample of an asymptomatic person exposed to a common food. Forthwith, the food safety authority and a local gourmet meat producer reported L. monocytogenes contamination of meat pâté. Analysis of further food and environmental samples from the premises of the producer yielded isolates matching the clinical strains and confirmed the presence of L. monocytogenes 4b ST6 in the mincing machine as the cause of the food contamination.
DEFF Research Database (Denmark)
Kastbjerg, Vicky Gaedt; Hein-Kristensen, Line; Gram, Lone
2014-01-01
Exposure of the human food-borne pathogen Listeria monocytogenes to sublethal concentrations of triclosan can cause resistance to several aminoglycosides. Aminoglycoside-resistant isolates exhibit two colony morphologies: normal-size and pinpoint colonies. The purposes of the present study were...... to characterize the small colonies of L. monocytogenes and to determine if specific genetic changes could explain the triclosan-induced aminoglycoside resistance in both pinpoint and normal-size isolates. Isolates from the pinpoint colonies grew poorly under aerated conditions, but growth was restored by addition......I and that exposure to triclosan can cause resistance to antibiotics that enters the cell via active transport. Further studies are needed to elucidate if L. monocytogenes pinpoint isolates could have any clinical impact, e.g., in persistent infections....
Effect of starter cultures on survival of Listeria monocytogenes in Čajna sausage
Bošković, M.; Tadić, V.; Đorđević, J.; Glišić, M.; Lakićević, B.; Dimitrijević, M.; Baltić, M. Ž.
2017-09-01
The aim of the study was to evaluate the survival of Listeria monocytogenes during the production of Čajna sausage with short maturation time. Sausage batter was inoculated with three different serotypes 4b and serotype 1/2a of L. monocytogenes. Control sausages were without any starter culture added; the second batch was inoculated with strains of Lactobacillus sakei, Staphylococcus carnosus and Staphylococcus xylosus, and the third batch was inoculated with strains of Debaryomyces hansenii, Lactobacillus sakei, Pediococcus acidilactici, Pediococcus pentosaceus, Staphylococcus carnosus and Staphylococcus xylosus. After 18 days of ripening, L. monocytogenes was not detected in any of the sausages, but during this fermentation and drying, the numbers of this pathogen was lower in the sausages inoculated with starter cultures.
Berzins,-A; Horman,-A; Lunden,-J; Korkeala,-H
2007-01-01
A total of 312 samples of sliced, vacuum packaged, cold-smoked pork from 15 meat processing plants in Latvia and Lithuania, obtained over a 15-month period from 2003 until 2004, were analyzed for the presence of Listeria monocytogenes at the end of their shelf-life. Overall, 120 samples (38%) tested positive for L. monocytogenes. Despite the long storing period, the levels of L. monocytogenes in cold-smoked pork products were low. Manufacturing processes were studied at seven meat processing ...
An outbreak of an unusual strain of Listeria monocytogenes infection in North-East Scotland.
Okpo, Emmanuel; Leith, Jayne; Smith-Palmer, Alison; Bell, John; Parks, Duncan; Browning, Fiona; Byers, Lynn; Corrigan, Helen; Webster, Diana; Karcher, Anne M; Murray, Andrew; Storey, Tom
2015-01-01
Listeria monocytogenes infection is an important cause of illness and hospitalization in vulnerable individuals. In the present study, we describe a community outbreak of Listeria monocytogenes in the North-East region of Scotland, which was epidemiologically, environmentally and microbiologically linked to a local meat product and ready-to-eat product manufacturer. Infected individuals were interviewed, and an environmental investigation was conducted. Clinical and environmental samples were tested by culture, and isolates were typed by fluorescent amplified fragment length polymorphism (fAFLP). Three cases of Listeria monocytogenes were linked geographically, had the same serotype (1/2a) and were indistinguishable by fAFLP type XII.6. The human, food and environmental isolates were of the same serotype and were indistinguishable by molecular typing. This is the first community outbreak of L. monocytogenes reported in Scotland since the current outbreak surveillance was established in 1996. Epidemiological and laboratory evidence indicated poor hand hygiene, unhygienic practices and cross-contamination throughout the manufacturing process of ready-to-eat foods as a possible cause of the outbreak. More stringent control of commercial food establishments that provide ready-to-eat food and the need to advise specifically vulnerable groups, e.g., pregnant women, of the risk of L. monocytogenes in ready-to-eat food is urgently needed. Copyright © 2015 King Saud Bin Abdulaziz University for Health Sciences. Published by Elsevier Ltd. All rights reserved.
Xayarath, Bobbi; Alonzo, Francis; Freitag, Nancy E.
2015-01-01
Listeria monocytogenes is a Gram-positive facultative intracellular bacterial pathogen that invades mammalian cells and escapes from membrane-bound vacuoles to replicate within the host cell cytosol. Gene products required for intracellular bacterial growth and bacterial spread to adjacent cells are regulated by a transcriptional activator known as PrfA. PrfA becomes activated following L. monocytogenes entry into host cells, however the signal that stimulates PrfA activation has not yet been defined. Here we provide evidence for L. monocytogenes secretion of a small peptide pheromone, pPplA, which enhances the escape of L. monocytogenes from host cell vacuoles and may facilitate PrfA activation. The pPplA pheromone is generated via the proteolytic processing of the PplA lipoprotein secretion signal peptide. While the PplA lipoprotein is dispensable for pathogenesis, bacteria lacking the pPplA pheromone are significantly attenuated for virulence in mice and have a reduced efficiency of bacterial escape from the vacuoles of nonprofessional phagocytic cells. Mutational activation of PrfA restores virulence and eliminates the need for pPplA-dependent signaling. Experimental evidence suggests that the pPplA peptide may help signal to L. monocytogenes its presence within the confines of the host cell vacuole, stimulating the expression of gene products that contribute to vacuole escape and facilitating PrfA activation to promote bacterial growth within the cytosol. PMID:25822753
Oxaran, Virginie; Lee, Sarah Hwa In; Chaul, Luíza Toubas; Corassin, Carlos Humberto; Barancelli, Giovana Verginia; Alves, Virgínia Farias; de Oliveira, Carlos Augusto Fernandes; Gram, Lone; De Martinis, Elaine Cristina Pereira
2017-12-01
Listeria monocytogenes can cause listeriosis, a severe foodborne disease. In Brazil, despite very few reported cases of listeriosis, the pathogen has been repeatedly isolated from dairies. This has led the government to implement specific legislation to reduce the hazard. Here, we determined the incidence of L. monocytogenes in five dairies and retail products in the Southeast and Midwest regions of Brazil over eight months. Of 437 samples, three samples (0.7%) from retail and only one sample (0.2%) from the dairies were positive for L. monocytogenes. Thus, the contamination rate was significantly reduced as compared to previous studies. MultiLocus Sequence Typing (MLST) was used to determine if contamination was caused by new or persistent clones leading to the first MLST profile of L. monocytogenes from the Brazilian dairy industry. The processing environment isolate is of concern being a sequence-type (ST) 2, belonging to the lineage I responsible for the majority of listeriosis outbreaks. Also, ST3 and ST8 found in commercialized cheese have previously been reported in outbreaks. Despite the lower incidence, dairy products still pose a potential health risk and the occurrence of L. monocytogenes in dairies and retail products emphasize the need for continuous surveillance of this pathogen in the Brazilian dairy industry. Copyright © 2017 Elsevier Ltd. All rights reserved.
Nastou, Aikaterini; Rhoades, Jonathan; Smirniotis, Petros; Makri, Ioanna; Kontominas, Michael; Likotrafiti, Eleni
2012-10-15
The efficacy of household decontamination methods at reducing Listeria monocytogenes on fresh lettuce (Lactuca sativa), cucumber (Cucumis sativus) and parsley (Petroselinum sativum) was studied. Inoculated vegetable pieces were immersed in washing solutions and surviving L. monocytogenes enumerated. Parameters investigated were storage temperature prior to washing, dipping water temperature, agitation, acetic acid concentration and immersion time. The results indicated that the storage temperature significantly affects the efficacy of dipping vegetables in water for the control of L. monocytogenes, as the reduction in count was greatest when products had been stored at cooler temperatures. Decontamination with acetic acid (up to 2.0% v/v) was shown to have some effect in most cases, but the highest observed decrease in count was 2.6 log cfu/g. Experiments investigating the effect of exposure time to acetic acid (0.5% and 1.0% v/v, up to 30 min immersion) indicated that immersing the vegetables for more than 10 min is of minimal benefit. The most significant factor affecting washing and decontamination efficacy was the vegetable itself: L. monocytogenes colonizing cucumber epidermis was far more resistant to removal by washing and to acid treatment than that on the leafy vegetables, and L. monocytogenes on parsley was the most susceptible. This shows that published decontamination experiments (often performed with lettuce) cannot necessarily be extrapolated to other vegetables. Copyright © 2012 Elsevier B.V. All rights reserved.
School-based human papillomavirus vaccination: An opportunity to ...
African Journals Online (AJOL)
School-based human papillomavirus vaccination: An opportunity to increase knowledge about cervical cancer and improve uptake of ... Poor knowledge about cervical cancer plays a role in limiting screening uptake. HPV ... Article Metrics.
Pochop, Jaroslav; Kačániová, Miroslava; Hleba, Lukáš; Lopasovský, L'ubomír; Bobková, Alica; Zeleňáková, Lucia; Stričík, Michal
2012-01-01
The aim of this study was to follow contamination of ready-to-eat food with Listeria monocytogenes by using the Step One real time polymerase chain reaction (PCR). We used the PrepSEQ Rapid Spin Sample Preparation Kit for isolation of DNA and MicroSEQ® Listeria monocytogenes Detection Kit for the real-time PCR performance. In 30 samples of ready-to-eat milk and meat products without incubation we detected strains of Listeria monocytogenes in five samples (swabs). Internal positive control (IPC) was positive in all samples. Our results indicated that the real-time PCR assay developed in this study could sensitively detect Listeria monocytogenes in ready-to-eat food without incubation.
Bacterial superglue enables easy development of efficient virus-like particle based vaccines
DEFF Research Database (Denmark)
Thrane, Susan; Janitzek, Christoph M; Matondo, Sungwa
2016-01-01
BACKGROUND: Virus-like particles (VLPs) represent a significant advance in the development of subunit vaccines, combining high safety and efficacy. Their particulate nature and dense repetitive subunit organization makes them ideal scaffolds for display of vaccine antigens. Traditional approaches...... for VLP-based antigen display require labor-intensive trial-and-error optimization, and often fail to generate dense antigen display. Here we utilize the split-intein (SpyTag/SpyCatcher) conjugation system to generate stable isopeptide bound antigen-VLP complexes by simply mixing of the antigen and VLP......). CONCLUSIONS: The spy-VLP system constitutes a versatile and rapid method to develop highly immunogenic VLP-based vaccines. Our data provide proof-of-concept for the technology's ability to present complex vaccine antigens to the immune system and elicit robust functional antibody responses as well...
Listeria monocytogenes presence during fermentation, drying and storage of Petrovská klobása sausage
Janković, V.; Mitrović, R.; Lakićević, B.; Velebit, B.; Baltić, T.
2017-09-01
The majority of human listeriosis cases appear to be caused by consumption of ready-to-eat (RTE) foods contaminated at the time of consumption with high levels of Listeria monocytogenes. Although strategies to prevent growth of L. monocytogenes in RTE products are critical for reducing the incidence of human listeriosis, this pathogen is highly difficult to control in fermented sausage processing environments due to its high tolerance to low pH and high salt concentration. The aims of the present study were to investigate the occurrence, presence and elimination of L. monocytogenes in Petrovská klobása sausage during processing, fermentation, drying and storage. L. monocytogenes, which was detected at the beginning of the production cycle, disappeared before day 30. The pathogen decline was much faster in those sausages which were dried in controlled, industrial conditions than in those dried applying the traditional, household technique.
Cui, H Y; Wu, J; Lin, L
2016-08-01
Listeria monocytogenes infection in dairy products is of mounting public concern. To inhibit bacterial growth, we engineered stimuli-responsive liposomes containing lemongrass oil for this study. The controlled release of liposome-entrapped lemongrass oil is triggered by listerolysin O, secreted by L. monocytogenes. We investigated the antibiotic activities of lemongrass oil liposomes against L. monocytogenes in cheese. We also assessed their possible effects on the quality of the cheese. Liposomes containing lemongrass oil (5.0mg/mL) presented the optimal polydispersity index (0.246), zeta-potential (-58.9mV) and entrapment efficiency (25.7%). The liposomes displayed satisfactory antibiotic activity against L. monocytogenes in cheese over the storage period at 4°C. We observed no effects on the physical and sensory properties of the cheese after the liposome treatment. Copyright © 2016 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Weller, Daniel; Wiedmann, Martin
2015-01-01
While rain and irrigation events have been associated with an increased prevalence of foodborne pathogens in produce production environments, quantitative data are needed to determine the effects of various spatial and temporal factors on the risk of produce contamination following these events. This study was performed to quantify these effects and to determine the impact of rain and irrigation events on the detection frequency and diversity of Listeria species (including L. monocytogenes) and L. monocytogenes in produce fields. Two spinach fields, with high and low predicted risks of L. monocytogenes isolation, were sampled 24, 48, 72, and 144 to 192 h following irrigation and rain events. Predicted risk was a function of the field's proximity to water and roads. Factors were evaluated for their association with Listeria species and L. monocytogenes isolation by using generalized linear mixed models (GLMMs). In total, 1,492 (1,092 soil, 334 leaf, 14 fecal, and 52 water) samples were collected. According to the GLMM, the likelihood of Listeria species and L. monocytogenes isolation from soil samples was highest during the 24 h immediately following an event (odds ratios [ORs] of 7.7 and 25, respectively). Additionally, Listeria species and L. monocytogenes isolates associated with irrigation events showed significantly lower sigB allele type diversity than did isolates associated with precipitation events (P = monocytogenes contamination. Small changes in management practices (e.g., not irrigating fields before harvest) may therefore reduce the risk of L. monocytogenes contamination of fresh produce. PMID:26116668
Side-by-side comparison of gene-based smallpox vaccine with MVA in nonhuman primates.
Golden, Joseph W; Josleyn, Matthew; Mucker, Eric M; Hung, Chien-Fu; Loudon, Peter T; Wu, T C; Hooper, Jay W
2012-01-01
Orthopoxviruses remain a threat as biological weapons and zoonoses. The licensed live-virus vaccine is associated with serious health risks, making its general usage unacceptable. Attenuated vaccines are being developed as alternatives, the most advanced of which is modified-vaccinia virus Ankara (MVA). We previously developed a gene-based vaccine, termed 4pox, which targets four orthopoxvirus antigens, A33, B5, A27 and L1. This vaccine protects mice and non-human primates from lethal orthopoxvirus disease. Here, we investigated the capacity of the molecular adjuvants GM-CSF and Escherichia coli heat-labile enterotoxin (LT) to enhance the efficacy of the 4pox gene-based vaccine. Both adjuvants significantly increased protective antibody responses in mice. We directly compared the 4pox plus LT vaccine against MVA in a monkeypox virus (MPXV) nonhuman primate (NHP) challenge model. NHPs were vaccinated twice with MVA by intramuscular injection or the 4pox/LT vaccine delivered using a disposable gene gun device. As a positive control, one NHP was vaccinated with ACAM2000. NHPs vaccinated with each vaccine developed anti-orthopoxvirus antibody responses, including those against the 4pox antigens. After MPXV intravenous challenge, all control NHPs developed severe disease, while the ACAM2000 vaccinated animal was well protected. All NHPs vaccinated with MVA were protected from lethality, but three of five developed severe disease and all animals shed virus. All five NHPs vaccinated with 4pox/LT survived and only one developed severe disease. None of the 4pox/LT-vaccinated animals shed virus. Our findings show, for the first time, that a subunit orthopoxvirus vaccine delivered by the same schedule can provide a degree of protection at least as high as that of MVA.
Side-by-side comparison of gene-based smallpox vaccine with MVA in nonhuman primates.
Directory of Open Access Journals (Sweden)
Joseph W Golden
Full Text Available Orthopoxviruses remain a threat as biological weapons and zoonoses. The licensed live-virus vaccine is associated with serious health risks, making its general usage unacceptable. Attenuated vaccines are being developed as alternatives, the most advanced of which is modified-vaccinia virus Ankara (MVA. We previously developed a gene-based vaccine, termed 4pox, which targets four orthopoxvirus antigens, A33, B5, A27 and L1. This vaccine protects mice and non-human primates from lethal orthopoxvirus disease. Here, we investigated the capacity of the molecular adjuvants GM-CSF and Escherichia coli heat-labile enterotoxin (LT to enhance the efficacy of the 4pox gene-based vaccine. Both adjuvants significantly increased protective antibody responses in mice. We directly compared the 4pox plus LT vaccine against MVA in a monkeypox virus (MPXV nonhuman primate (NHP challenge model. NHPs were vaccinated twice with MVA by intramuscular injection or the 4pox/LT vaccine delivered using a disposable gene gun device. As a positive control, one NHP was vaccinated with ACAM2000. NHPs vaccinated with each vaccine developed anti-orthopoxvirus antibody responses, including those against the 4pox antigens. After MPXV intravenous challenge, all control NHPs developed severe disease, while the ACAM2000 vaccinated animal was well protected. All NHPs vaccinated with MVA were protected from lethality, but three of five developed severe disease and all animals shed virus. All five NHPs vaccinated with 4pox/LT survived and only one developed severe disease. None of the 4pox/LT-vaccinated animals shed virus. Our findings show, for the first time, that a subunit orthopoxvirus vaccine delivered by the same schedule can provide a degree of protection at least as high as that of MVA.
Directory of Open Access Journals (Sweden)
Kåre Mølbak
Full Text Available Since 2013 the number of suspected adverse reactions to the quadrivalent human papillomavirus (HPV vaccine reported to the Danish Medicines Agency (DMA has increased. Due to the resulting public concerns about vaccine safety, the coverage of HPV vaccinations in the childhood vaccination programme has declined. The aim of the present study was to determine health care-seeking prior to the first HPV vaccination among females who suspected adverse reactions to HPV vaccine.In this registry-based case-control study, we included as cases vaccinated females with reports to the DMA of suspected severe adverse reactions. We selected controls without reports of adverse reactions from the Danish vaccination registry and matched by year of vaccination, age of vaccination, and municipality, and obtained from the Danish National Patient Registry and The National Health Insurance Service Register the history of health care usage two years prior to the first vaccine. We analysed the data by logistic regression while adjusting for the matching variables.The study included 316 cases who received first HPV vaccine between 2006 and 2014. Age range of cases was 11 to 52 years, with a peak at 12 years, corresponding to the recommended age at vaccination, and another peak at 19 to 28 years, corresponding to a catch-up programme targeting young women. Compared with 163,910 controls, cases had increased care-seeking in the two years before receiving the first HPV vaccine. A multivariable model showed higher use of telephone/email consultations (OR 1.9; 95% CI 1.2-3.2, physiotherapy (OR 2.1; 95% CI 1.6-2.8 and psychologist/psychiatrist (OR 1.9; 95% CI 1.3-2.7. Cases were more likely to have a diagnosis in the ICD-10 chapters of diseases of the digestive system (OR 1.6; 95% CI 1.0-2.4, of the musculoskeletal system (OR 1.6; 95% CI 1.1-2.2, symptoms or signs not classified elsewhere (OR 1.8; 95% CI 1.3-2.5 as well as injuries (OR 1.5; 95% CI 1.2-1.9.Before receiving the
Ethical and legal challenges of vaccines and vaccination: Reflections.
Jesani, Amar; Johari, Veena
2017-01-01
Vaccines and vaccination have emerged as key medical scientific tools for prevention of certain diseases. Documentation of the history of vaccination shows that the initial popular resistance to universal vaccination was based on false assumptions and eventually gave way to acceptance of vaccines and trust in their ability to save lives. The successes of the global eradication of smallpox, and now of polio, have only strengthened the premier position occupied by vaccines in disease prevention. However, the success of vaccines and public trust in their ability to eradicate disease are now under challenge, as increasing numbers of people refuse vaccination, questioning the effectiveness of vaccines and the need to vaccinate.
Kadam, S.R.; Besten, den H.M.W.; Veen, van der S.; Zwietering, M.H.; Moezelaar, R.; Abee, T.
2013-01-01
The foodborne pathogen Listeria monocytogenes has the ability to produce biofilms in food-processing environments and then contaminate food products, which is a major concern for food safety. The biofilm forming behavior of 143 L. monocytogenes strains was determined in four different media that
Listeria monocytogenes, a well-described cause of encephalitis and abortion in ruminants and of food-borne illness in humans, is rarely associated with disease in companion animals. A case of urinary tract infection associated with an atypical, weakly hemolytic L. monocytogenes strain is described i...
Kuan, C H; Goh, S G; Loo, Y Y; Chang, W S; Lye, Y L; Puspanadan, S; Tang, J Y H; Nakaguchi, Y; Nishibuchi, M; Mahyudin, N A; Radu, S
2013-06-01
A total of 216 chicken offal samples (chicken liver = 72; chicken heart = 72; chicken gizzard = 72) from wet markets and hypermarkets in Selangor, Malaysia, were examined for the presence and density of Listeria monocytogenes by using a combination of the most probable number and PCR method. The prevalence of L. monocytogenes in 216 chicken offal samples examined was 26.39%, and among the positive samples, the chicken gizzard showed the highest percentage at 33.33% compared with chicken liver (25.00%) and chicken heart (20.83%). The microbial load of L. monocytogenes in chicken offal samples ranged from Malaysia.
Effect of humidity and temperature on the survival of Listeria monocytogenes on surfaces.
Redfern, J; Verran, J
2017-04-01
Listeria monocytogenes is a pathogenic bacterium, with human disease and infection linked to dairy products, seafood, ready-to-eat meat and raw & undercooked meats. Stainless steel is the most common food preparation surface and therefore, it is important to understand how food storage conditions such as surface materials, temperature and relative humidity can affect survival of L. monocytogenes. In this study, survival of L. monocytogenes on stainless steel was investigated at three temperatures (4, 10 and 21°C), each approx. 11, 50 and 85% humidity. Results indicate that the lower the temperature, the more cells were recovered in all three humidity environments, while medium humidity enhances survival, irrespective of temperature. Lower humidity decreases recovery at all temperatures. These data support the guidance noted above that humidity control is important, and that lower humidity environments are less likely to support retention of viable L. monocytogenes on a stainless steel surface. Understanding survival of potential food-borne pathogens is essential for the safe production and preparation of food. While it has long been 'common knowledge' that relative humidity can affect the growth and survival of micro-organisms, this study systematically describes the survival of L. monocytogenes on stainless steel under varying humidity and temperatures for the first time. The outcomes from this paper will allow those involved with food manufacture and preparation to make informed judgement on environmental conditions relating to humidity control, which is lacking in the food standards guidelines. © 2017 The Society for Applied Microbiology.
Lu, Chunye; Marjanovic, Olivera; Kiang, David
2017-01-01
ABSTRACT Listeria monocytogenes is an important foodborne pathogen. Here, we present the annotated whole genome of Listeria monocytogenes strains F14M01297-C2 and F14M01297-C4, isolated from nectarines distributed by a packing facility in California during an investigation of listeriosis associated with stone fruit in 2014. PMID:28729255
Bahador; Sadeghi Kalani; Valian; Irajian; Lotfollahi
2015-01-01
Background Listeria monocytogenes is a foodborne pathogen and a serious threat to the public health in the world. Consumption of traditional foods such as dairy and meat products can be a major reason for relative abundance and isolation of these bacteria. Objectives The purpose of this study was to determine the phenotypic and genotypic characteristics of L. monocytogenes strains isolated from dairy and meat products. ...
Egg-Independent Influenza Vaccines and Vaccine Candidates
Directory of Open Access Journals (Sweden)
Ilaria Manini
2017-07-01
Full Text Available Vaccination remains the principal way to control seasonal infections and is the most effective method of reducing influenza-associated morbidity and mortality. Since the 1940s, the main method of producing influenza vaccines has been an egg-based production process. However, in the event of a pandemic, this method has a significant limitation, as the time lag from strain isolation to final dose formulation and validation is six months. Indeed, production in eggs is a relatively slow process and production yields are both unpredictable and highly variable from strain to strain. In particular, if the next influenza pandemic were to arise from an avian influenza virus, and thus reduce the egg-laying hen population, there would be a shortage of embryonated eggs available for vaccine manufacturing. Although the production of egg-derived vaccines will continue, new technological developments have generated a cell-culture-based influenza vaccine and other more recent platforms, such as synthetic influenza vaccines.
Immune complex-based vaccine for pig protection against parvovirus.
Roić, B; Cajavec, S; Ergotić, N; Lipej, Z; Madić, J; Lojkić, M; Pokrić, B
2006-02-01
generated by the IC containing the allogeneic antibodies were higher than that generated by the ICs containing the xenogeneic pig antibodies. It was similar to that generated by two-times higher content of the virus material administered by a commercially available vaccine. The IC-based vaccines belong to non-replicating, subunit vaccines, which are both ecologically convenient and the safest vaccines of all.
Seyoum, Eyasu Tigabu; Woldetsadik, Daniel Asrat; Mekonen, Tesfu Kassa; Gezahegn, Haile Alemayehu; Gebreyes, Wondwossen Abebe
2015-11-30
Listeria monocytogenes is of major significance in human and veterinary medicine. Most human Listeria infections are foodborne and the association of contaminated milk and dairy produce consumption with human listeriosis is noteworthy. In Ethiopia, there is limited data regarding the prevalence of L. monocytogenes in raw bovine milk and dairy products. The aim of this study was, therefore, to determine the prevalence of L. monocytogenes in raw bovine milk and dairy produce. A total of 443 milk and milk product samples were microbiologically analyzed following methods recommended by the U.S. Food and Drug Administration Bacteriological Analytical Manual to isolate Listeria spp. The overall prevalence of Listeria spp. was 28.4% and specifically that of L. monocytogenes was 5.6%. Taking the prevalence of Listeria spp. into consideration, cheese was found to be highly contaminated at 60%, followed by pasteurized milk samples (40%), raw milk (18.9%) and yoghurt (5%). Considering the prevalence of Listeria monocytogenes only, raw milk had the lowest contamination while cheese had the highest, followed by pasteurized milk and yoghurt. Raw milk and milk products produced in urban and peri-urban areas of central Ethiopia were contaminated with pathogenic bacteria, L. monocytogenes. The detection of this pathogen in raw milk and milk products warrants an urgent regulatory mechanism to be put in place and also the potential role of milk processing plants in the contamination of dairy products should be investigated.
Uppal, Kamaldeep K; Getty, Kelly J K; Boyle, Elizabeth A E; Harper, Nigel M; Lobaton-Sulabo, April Shayne S; Barry, Bruce
2012-01-01
The objective of our study was to determine effect of packaging method and storage time on reducing Listeria monocytogenes in shelf-stable meat snacks. Commercially available kippered beef steak strips and turkey tenders were dipped into a 5-strain L. monocytogenes cocktail, and dried at 23 °C until a water activity of 0.80 was achieved. Inoculated samples were packaged with 4 treatments: (1) vacuum, (2) nitrogen flushed with oxygen scavenger, (3) heat sealed with oxygen scavenger, and (4) heat sealed without oxygen scavenger. Samples were stored at 23 °C and evaluated for L. monocytogenes levels at 0, 24, 48, and 72 h. Initial levels (time 0) of L. monocytogenes were approximately 5.7 log CFU/cm² for steak and tenders. After 24 h of storage time, a 1 log CFU/cm² reduction of L. monocytogenes was observed for turkey tenders for all packaging treatments. After 48 h, turkey tenders showed >1 log CFU/cm² reduction of L. monocytogenes for all packaging treatments except for vacuum, where only 0.9 log CFU/cm² reduction was observed. After 72 h, reductions for all packaging treatments for turkey tenders ranged from 1.5 to 2.4 log CFU/cm². For kippered beef steak, there was no interaction between the packaging treatments and all storage times (P > 0.05) whereas, time was different (P packaging treatments and a 2.1 log CFU/ cm² L. monocytogenes reduction at 72 h of storage time. Processors of kippered beef steak and turkey tenders could use a combination of vacuum or nitrogen-flushing or heat sealed with an oxygen scavenger packaging methods and a holding time of 24 h prior to shipping to reduce potential L. monocytogenes numbers by ≥1 log. However, processors should be encouraged to hold packaged product a minimum of 72 h to enhance the margin of safety for L. monocytogenes control. © 2011 Institute of Food Technologists®
Barancelli, Giovana V; Camargo, Tarsila M; Gagliardi, Natália G; Porto, Ernani; Souza, Roberto A; Campioni, Fabio; Falcão, Juliana P; Hofer, Ernesto; Cruz, Adriano G; Oliveira, Carlos A F
2014-03-03
This study aimed to evaluate the occurrence of Listeria monocytogenes in cheese and in the environment of three small-scale dairy plants (A, B, C) located in the Northern region state of São Paulo, Brazil, and to characterize the isolates using conventional serotyping and PFGE. A total of 393 samples were collected and analyzed from October 2008 to September 2009. From these, 136 came from dairy plant A, where only L. seeligeri was isolated. In dairy plant B, 136 samples were analyzed, and L. innocua, L. seeligeri and L. welshimeri were isolated together with L. monocytogenes. In dairy plant C, 121 samples were analyzed, and L. monocytogenes and L. innocua were isolated. Cheese from dairy plants B and C were contaminated with Listeria spp, with L. innocua being found in Minas frescal cheese from both dairy plants, and L. innocua and L. monocytogenes in Prato cheese from dairy plant C. A total of 85 L. monocytogenes isolates were classified in 3 serotypes: 1/2b, 1/2c, and 4b, with predominance of serotype 4b in both dairy plants. The 85 isolates found in the dairy plants were characterized by genomic macrorestriction using ApaI and AscI with Pulsed Field Gel Electrophoresis (PFGE). Macrorestriction yielded 30 different pulsotypes. The presence of indistinguishable profiles repeatedly isolated during a 12-month period indicated the persistence of L. monocytogenes in dairy plants B and C, which were more than 100 km away from each other. Brine used in dairy plant C contained more than one L. monocytogenes lineage. The routes of contamination were identified in plants B and C, and highlighted the importance of using molecular techniques and serotyping to track L. monocytogenes sources of contamination, distribution, and routes of contamination in dairy plants, and to develop improved control strategies for L. monocytogenes in dairy plants and dairy products. Copyright © 2013 Elsevier B.V. All rights reserved.
Lianou, Alexandra; Sofos, John N
2007-09-01
Contamination of ready-to-eat products with Listeria monocytogenes may occur at several stages before consumption. Accessibility to the public and relatively limited control interventions at retail and food service establishments (compared with the processing sector of the food industry) and the lack of a specific regulatory framework increase the likelihood of introduction of this pathogen into some foods in these establishments. This review is a compilation of available information on the incidence and transmission of L. monocytogenes through ready-to-eat products at the retail and food service level. The potential transmission of L. monocytogenes within retail and food service operations has been indicated in epidemiological investigations and by survey data. Potential sources of the organism in these operations include the environment, food handlers, and incoming raw ingredients or processed products that have become contaminated after the lethality treatment at the manufacturing facility. L. monocytogenes may be present at retail and food service establishments in various ready-to-eat products, both prepackaged and those packaged in the store, and occasionally at high concentrations. This issue dictates the need for development and application of effective control measures, and potential control approaches are discussed here. Good manufacturing practices, appropriate cleaning, sanitation and hygiene programs, and temperature control required for prevention or inhibition of growth of the pathogen to high levels are critical for control of L. monocytogenes in the retail and food service sector. A comprehensive food safety system designed to be functional in retail and food service operations and based on the philosophy of hazard analysis and critical control point systems and a series of sound prerequisite programs can provide effective control of L. monocytogenes in these environments. However, competent delivery of food safety education and training to retail
Ortega, Fabian E.; Rengarajan, Michelle; Chavez, Natalie; Radhakrishnan, Prathima; Gloerich, Martijn; Bianchini, Julie; Siemers, Kathleen; Luckett, William S.; Lauer, Peter; Nelson, W. James; Theriot, Julie A.
2017-01-01
The intestinal epithelium is the first physiological barrier breached by the Gram-positive facultative pathogen Listeria monocytogenes during an in vivo infection. Listeria monocytogenes binds to the epithelial host cell receptor E-cadherin, which mediates a physical link between the bacterium and filamentous actin (F-actin). However, the importance of anchoring the bacterium to F-actin through E-cadherin for bacterial invasion has not been tested directly in epithelial cells. Here we demonstrate that depleting αE-catenin, which indirectly links E-cadherin to F-actin, did not decrease L. monocytogenes invasion of epithelial cells in tissue culture. Instead, invasion increased due to increased bacterial adhesion to epithelial monolayers with compromised cell–cell junctions. Furthermore, expression of a mutant E-cadherin lacking the intracellular domain was sufficient for efficient L. monocytogenes invasion of epithelial cells. Importantly, direct biotin-mediated binding of bacteria to surface lipids in the plasma membrane of host epithelial cells was sufficient for uptake. Our results indicate that the only requirement for L. monocytogenes invasion of epithelial cells is adhesion to the host cell surface, and that E-cadherin–mediated coupling of the bacterium to F-actin is not required. PMID:28877987
Bobbala, Sharan; Tamboli, Viral; McDowell, Arlene; Mitra, Ashim K; Hook, Sarah
2016-01-01
The need for multiple vaccinations to enhance the immunogenicity of subunit vaccines may be reduced by delivering the vaccine over an extended period of time. Here, we report two novel injectable pentablock copolymer based thermoresponsive hydrogels made of polyethyleneglycol-polycaprolactone-polylactide-polycaprolactone-polyethyleneglycol (PEG-PCL-PLA-PCL-PEG) with varying ratios of polycaprolactone (PCL) and polylactide (PLA), as single shot sustained release vaccines. Pentablock copolymer hydrogels were loaded with vaccine-encapsulated poly lactic-co-glycolic acid nanoparticles (PLGA-NP) or with the soluble vaccine components. Incorporation of PLGA-NP into the thermoresponsive hydrogels increased the complex viscosity of the gels, lowered the gelation temperature, and minimized the burst release of antigen and adjuvants. The two pentablock hydrogels stimulated both cellular and humoral responses. The addition of PLGA-NP to the hydrogels sustained immune responses for up to 49 days. The polymer with a higher ratio of PCL to PLA formed a more rigid gel, induced stronger immune responses, and stimulated effective anti-tumor responses in a prophylactic melanoma tumor model.
Wegwarth, O; Kurzenhäuser-Carstens, S; Gigerenzer, G
2014-03-10
Informed decision making requires transparent and evidence-based (=balanced) information on the potential benefit and harms of medical preventions. An analysis of German HPV vaccination leaflets revealed, however, that none met the standards of balanced risk communication. We surveyed a sample of 225 girl-parent pairs in a before-after design on the effects of balanced and unbalanced risk communication on participants' knowledge about cervical cancer and the HPV vaccination, their perceived risk, their intention to have the vaccine, and their actual vaccination decision. The balanced leaflet increased the number of participants who were correctly informed about cervical cancer and the HPV vaccine by 33 to 66 absolute percentage points. In contrast, the unbalanced leaflet decreased the number of participants who were correctly informed about these facts by 0 to 18 absolute percentage points. Whereas the actual uptake of the HPV vaccination 14 months after the initial study did not differ between the two groups (22% balanced leaflet vs. 23% unbalanced leaflet; p=.93, r=.01), the originally stated intention to have the vaccine reliably predicted the actual vaccination decision for the balanced leaflet group only (concordance between intention and actual uptake: 97% in the balanced leaflet group, rs=.92, p=.00; 60% in the unbalanced leaflet group, rs=.37, p=.08). In contrast to a unbalanced leaflet, a balanced leaflet increased people's knowledge of the HPV vaccination, improved perceived risk judgments, and led to an actual vaccination uptake, which first was robustly predicted by people's intention and second did not differ from the uptake in the unbalanced leaflet group. These findings suggest that balanced reporting about HPV vaccination increases informed decisions about whether to be vaccinated and does not undermine actual uptake. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.
Jadhav, Snehal; Gulati, Vandana; Fox, Edward M; Karpe, Avinash; Beale, David J; Sevior, Danielle; Bhave, Mrinal; Palombo, Enzo A
2015-06-02
Listeria monocytogenes is an important foodborne pathogen responsible for the sometimes fatal disease listeriosis. Public health concerns and stringent regulations associated with the presence of this pathogen in food and food processing environments underline the need for rapid and reliable detection and subtyping techniques. In the current study, the application of matrix assisted laser desorption/ionisation-time-of-flight mass spectrometry (MALDI-TOF MS) as a single identification and source-tracking tool for a collection of L. monocytogenes isolates, obtained predominantly from dairy sources within Australia, was explored. The isolates were cultured on different growth media and analysed using MALDI-TOF MS at two incubation times (24 and 48 h). Whilst reliable genus-level identification was achieved from most media, identification at the species level was found to be dependent on culture conditions. Successful speciation was highest for isolates cultured on the chromogenic Agar Listeria Ottaviani Agosti agar (ALOA, 91% of isolates) and non-selective horse blood agar (HBA, 89%) for 24h. Chemometric statistical analysis of the MALDI-TOF MS data enabled source-tracking of L. monocytogenes isolates obtained from four different dairy sources. Strain-level discrimination was also observed to be influenced by culture conditions. In addition, t-test/analysis of variance (ANOVA) was used to identify potential biomarker peaks that differentiated the isolates according to their source of isolation. Source-tracking using MALDI-TOF MS was compared and correlated with the gold standard pulsed-field gel electrophoresis (PFGE) technique. The discriminatory index and the congruence between both techniques were compared using the Simpsons Diversity Index and adjusted Rand and Wallace coefficients. Overall, MALDI-TOF MS based source-tracking (using data obtained by culturing the isolates on HBA) and PFGE demonstrated good congruence with a Wallace coefficient of 0.71 and
Comparison of Current Regulatory Status for Gene-Based Vaccines in the U.S., Europe and Japan
Directory of Open Access Journals (Sweden)
Yoshikazu Nakayama
2015-03-01
Full Text Available Gene-based vaccines as typified by plasmid DNA vaccines and recombinant viral-vectored vaccines are expected as promising solutions against infectious diseases for which no effective prophylactic vaccines exist such as HIV, dengue virus, Ebola virus and malaria, and for which more improved vaccines are needed such as tuberculosis and influenza virus. Although many preclinical and clinical trials have been conducted to date, no DNA vaccines or recombinant viral-vectored vaccines expressing heterologous antigens for human use have yet been licensed in the U.S., Europe or Japan. In this research, we describe the current regulatory context for gene-based prophylactic vaccines against infectious disease in the U.S., Europe, and Japan. We identify the important considerations, in particular, on the preclinical assessments that would allow these vaccines to proceed to clinical trials, and the differences on the regulatory pathway for the marketing authorization in each region.
Are Clade Specific HIV Vaccines a Necessity? An Analysis Based on Mathematical Models
Directory of Open Access Journals (Sweden)
Dobromir Dimitrov
2015-12-01
Full Text Available As HIV-1 envelope immune responses are critical to vaccine related protection, most candidate HIV vaccines entering efficacy trials are based upon a clade specific design. This need for clade specific vaccine prototypes markedly reduces the implementation of potentially effective HIV vaccines. We utilized a mathematical model to determine the effectiveness of immediate roll-out of a non-clade matched vaccine with reduced efficacy compared to constructing clade specific vaccines, which would take considerable time to manufacture and test in safety and efficacy trials. We simulated the HIV epidemic in San Francisco (SF and South Africa (SA and projected effectiveness of three vaccination strategies: i immediate intervention with a 20–40% vaccine efficacy (VE non-matched vaccine, ii delayed intervention by developing a 50% VE clade-specific vaccine, and iii immediate intervention with a non-matched vaccine replaced by a clade-specific vaccine when developed. Immediate vaccination with a non-clade matched vaccine, even with reduced efficacy, would prevent thousands of new infections in SF and millions in SA over 30 years. Vaccination with 50% VE delayed for five years needs six and 12 years in SA to break-even with immediate 20 and 30% VE vaccination, respectively, while not able to surpass the impact of immediate 40% VE vaccination over 30 years. Replacing a 30% VE with a 50% VE vaccine after 5 years reduces the HIV acquisition by 5% compared to delayed vaccination. The immediate use of an HIV vaccine with reduced VE in high risk communities appears desirable over a short time line but higher VE should be the pursued to achieve strong long-term impact. Our analysis illustrates the importance of developing surrogate markers (correlates of protection to allow bridging types of immunogenicity studies to support more rapid assessment of clade specific vaccines.
Directory of Open Access Journals (Sweden)
Joelle K. Salazar
2018-01-01
Full Text Available This study assessed the growth of Listeria monocytogenes in milkshakes made using the process-contaminated ice cream associated with a listeriosis outbreak in comparison to milkshakes made with artificially contaminated ice cream. For all temperatures, growth kinetics including growth rates, lag phases, maximum populations, and population increases were determined for the naturally and artificially derived contaminants at 5, 10, 15, and 25°C storage for 144 h. The artificially inoculated L. monocytogenes presented lower growth rates and shorter lag phases than the naturally contaminated populations at all temperatures except for 5°C, where the reverse was observed. At 25°C, lag phases of the naturally and artificially contaminated L. monocytogenes were 11.6 and 7.8 h, respectively. The highest increase in population was observed for the artificially inoculated pathogen at 15°C after 96 h (6.16 log CFU/mL of storage. Growth models for both contamination states in milkshakes were determined. In addition, this study evaluated the antimicrobial effectiveness of flavoring agents, including strawberry, chocolate and mint, on the growth of the pathogen in milkshakes during 10°C storage. All flavor additions resulted in decreased growth rates of L. monocytogenes for both contamination states. The addition of chocolate and mint flavoring also resulted in significantly longer lag phases for both contamination states. This study provides insight into the differences in growth between naturally and artificially contaminated L. monocytogenes in a food product.
Salazar, Joelle K; Bathija, Vriddi M; Carstens, Christina K; Narula, Sartaj S; Shazer, Arlette; Stewart, Diana; Tortorello, Mary Lou
2018-01-01
This study assessed the growth of Listeria monocytogenes in milkshakes made using the process-contaminated ice cream associated with a listeriosis outbreak in comparison to milkshakes made with artificially contaminated ice cream. For all temperatures, growth kinetics including growth rates, lag phases, maximum populations, and population increases were determined for the naturally and artificially derived contaminants at 5, 10, 15, and 25°C storage for 144 h. The artificially inoculated L. monocytogenes presented lower growth rates and shorter lag phases than the naturally contaminated populations at all temperatures except for 5°C, where the reverse was observed. At 25°C, lag phases of the naturally and artificially contaminated L. monocytogenes were 11.6 and 7.8 h, respectively. The highest increase in population was observed for the artificially inoculated pathogen at 15°C after 96 h (6.16 log CFU/mL) of storage. Growth models for both contamination states in milkshakes were determined. In addition, this study evaluated the antimicrobial effectiveness of flavoring agents, including strawberry, chocolate and mint, on the growth of the pathogen in milkshakes during 10°C storage. All flavor additions resulted in decreased growth rates of L. monocytogenes for both contamination states. The addition of chocolate and mint flavoring also resulted in significantly longer lag phases for both contamination states. This study provides insight into the differences in growth between naturally and artificially contaminated L. monocytogenes in a food product.
Monath, Thomas P; Seligman, Stephen J; Robertson, James S; Guy, Bruno; Hayes, Edward B; Condit, Richard C; Excler, Jean Louis; Mac, Lisa Marie; Carbery, Baevin; Chen, Robert T
2015-01-01
The Brighton Collaboration Viral Vector Vaccines Safety Working Group (V3SWG) was formed to evaluate the safety of live, recombinant viral vaccines incorporating genes from heterologous viruses inserted into the backbone of another virus (so-called "chimeric virus vaccines"). Many viral vector vaccines are in advanced clinical trials. The first such vaccine to be approved for marketing (to date in Australia, Thailand, Malaysia, and the Philippines) is a vaccine against the flavivirus, Japanese encephalitis (JE), which employs a licensed vaccine (yellow fever 17D) as a vector. In this vaccine, two envelope proteins (prM-E) of YF 17D virus were exchanged for the corresponding genes of JE virus, with additional attenuating mutations incorporated into the JE gene inserts. Similar vaccines have been constructed by inserting prM-E genes of dengue and West Nile into YF 17D virus and are in late stage clinical studies. The dengue vaccine is, however, more complex in that it requires a mixture of four live vectors each expressing one of the four dengue serotypes. This vaccine has been evaluated in multiple clinical trials. No significant safety concerns have been found. The Phase 3 trials met their endpoints in terms of overall reduction of confirmed dengue fever, and, most importantly a significant reduction in severe dengue and hospitalization due to dengue. However, based on results that have been published so far, efficacy in preventing serotype 2 infection is less than that for the other three serotypes. In the development of these chimeric vaccines, an important series of comparative studies of safety and efficacy were made using the parental YF 17D vaccine virus as a benchmark. In this paper, we use a standardized template describing the key characteristics of the novel flavivirus vaccine vectors, in comparison to the parental YF 17D vaccine. The template facilitates scientific discourse among key stakeholders by increasing the transparency and comparability of
Zika virus-like particle (VLP) based vaccine
Boigard, Hélène; Alimova, Alexandra; Martin, George R.; Katz, Al; Gottlieb, Paul
2017-01-01
The newly emerged mosquito-borne Zika virus poses a major public challenge due to its ability to cause significant birth defects and neurological disorders. The impact of sexual transmission is unclear but raises further concerns about virus dissemination. No specific treatment or vaccine is currently available, thus the development of a safe and effective vaccine is paramount. Here we describe a novel strategy to assemble Zika virus-like particles (VLPs) by co-expressing the structural (CprME) and non-structural (NS2B/NS3) proteins, and demonstrate their effectiveness as vaccines. VLPs are produced in a suspension culture of mammalian cells and self-assembled into particles closely resembling Zika viruses as shown by electron microscopy studies. We tested various VLP vaccines and compared them to analogous compositions of an inactivated Zika virus (In-ZIKV) used as a reference. VLP immunizations elicited high titers of antibodies, as did the In-ZIKV controls. However, in mice the VLP vaccine stimulated significantly higher virus neutralizing antibody titers than comparable formulations of the In-ZIKV vaccine. The serum neutralizing activity elicited by the VLP vaccine was enhanced using a higher VLP dose and with the addition of an adjuvant, reaching neutralizing titers greater than those detected in the serum of a patient who recovered from a Zika infection in Brazil in 2015. Discrepancies in neutralization levels between the VLP vaccine and the In-ZIKV suggest that chemical inactivation has deleterious effects on neutralizing epitopes within the E protein. This along with the inability of a VLP vaccine to cause infection makes it a preferable candidate for vaccine development. PMID:28481898
Mejlholm, Ole; Bøknæs, Niels; Dalgaard, Paw
2015-02-01
A new stochastic model for the simultaneous growth of Listeria monocytogenes and lactic acid bacteria (LAB) was developed and validated on data from naturally contaminated samples of cold-smoked Greenland halibut (CSGH) and cold-smoked salmon (CSS). During industrial processing these samples were added acetic and/or lactic acids. The stochastic model was developed from an existing deterministic model including the effect of 12 environmental parameters and microbial interaction (O. Mejlholm and P. Dalgaard, Food Microbiology, submitted for publication). Observed maximum population density (MPD) values of L. monocytogenes in naturally contaminated samples of CSGH and CSS were accurately predicted by the stochastic model based on measured variability in product characteristics and storage conditions. Results comparable to those from the stochastic model were obtained, when product characteristics of the least and most preserved sample of CSGH and CSS were used as input for the existing deterministic model. For both modelling approaches, it was shown that lag time and the effect of microbial interaction needs to be included to accurately predict MPD values of L. monocytogenes. Addition of organic acids to CSGH and CSS was confirmed as a suitable mitigation strategy against the risk of growth by L. monocytogenes as both types of products were in compliance with the EU regulation on ready-to-eat foods. Copyright © 2014 Elsevier Ltd. All rights reserved.
Parents' decision-making regarding vaccinating their children against influenza: A web-based survey.
Flood, Emuella M; Rousculp, Matthew D; Ryan, Kellie J; Beusterien, Kathleen M; Divino, Victoria M; Toback, Seth L; Sasané, Medha; Block, Stan L; Hall, Matthew C; Mahadevia, Parthiv J
2010-08-01
Despite the recommendation from the Centers for Disease Control and Prevention that children between the ages of 6 months and 18 years be vaccinated against influenza annually, vaccination rates remain suboptimal. This study was conducted to explore factors that influence parents' decisions regarding influenza vaccination for children aged 2 to 12 years, to quantify the relative importance of these factors, to identify an appropriate theoretical model for illustrating the relationships among these factors, and to characterize parents by their likelihood of vaccinating their children against influenza. A quantitative Web-based survey was administered to a sample of parents from an online panel representative of the US population. Parents were stratified based on self-reported rates of their personal influenza vaccination (every year, sometimes, or never) and the age of their child (2-4 years or 5-12 years). The results were examined by parents' likelihood of vaccinating their child in the next year (high, medium, or low). Participants were asked to rank their agreement with statements representing various beliefs and perceptions about influenza and influenza vaccine on a scale from 1 = strongly agree to 5 = strongly disagree. Parents who indicated that they vaccinate their child every year were asked to select the drivers of their decision to vaccinate; parents who indicated that they never vaccinate their child were asked to select the barriers affecting their decision not to vaccinate; and parents who responded that they sometimes vaccinate their child were asked to select both the drivers and barriers affecting their decision. Participants were then asked to rank the importance of each driver or barrier on a scale from 1 = a little important to 5 = extremely important. Mean agreement ratings were calculated for parents' beliefs and perceptions about influenza and influenza vaccine and were compared across likelihood subgroups. Mean importance ratings of the
Occurrence and antimicrobial resistance patterns of Listeria monocytogenes isolated from vegetables.
de Vasconcelos Byrne, Vanessa; Hofer, Ernesto; Vallim, Deyse Christina; de Castro Almeida, Rogeria Comastri
2016-01-01
Although the consumption of fresh and minimally processed vegetables is considered healthy, outbreaks related to the contamination of these products are frequently reported. Among the food-borne pathogens that contaminate vegetables is Listeria monocytogenes, a ubiquitous organism that exhibits the ability to survive and multiply at refrigerated temperatures. This study aimed to evaluate the occurrence of L. monocytogenes in vegetables as well as the antimicrobial resistance of isolates. The results showed that 3.03% of samples were contaminated with L. monocytogenes, comprising 2.22% of raw vegetables and 5.56% of ready-to-eat vegetables. Multiplex PCR confirmed the virulence potential of the isolates. Antimicrobial resistance profiling showed that 50% of the isolates were susceptible to the antibiotics used. The resistance of one isolate to penicillin G, a commonly employed therapeutic agent, and the presence of serotype 4b, a serotype commonly associated with food-borne outbreaks, could be potential health hazards for consumers. Copyright © 2016 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.
Fayol, L; Beizig, S; Le Monnier, A; Lacroze, V; Simeoni, U
2009-04-01
We report the case of a pregnant woman with listeriosis at 26 gestational weeks followed by premature labor at 30 gestational weeks. Bacterial meningitis was suspected in the neonate with ventriculitis on sonography, a high level of protein in the cerebrospinal fluid (CSF), and an identified specific bacterial genome of Listeria monocytogenes (PCR 16S rDNA and sequencing and specific amplification of L. monocytogenes hly gene) in CSF. Neonatal meningitis was complicated with cerebral venous sinus thrombosis and ventriculomegaly. Listeriosis during pregnancy can lead to severe complications in the neonate. Thus, listeriosis should be a diagnostic concern in febrile pregnant women at any stage of pregnancy. First-line treatment is based on high-dose amoxicillin (> or =6g/day) and must be used for at least 3 weeks for treatment of listeriosis during pregnancy. If the fetus survives, longer therapy until delivery can be discussed.
DEFF Research Database (Denmark)
Fang, Weihuan; Budde, Birgitte Bjørn; Siegumfeldt, Henrik
2006-01-01
A mixed culture of single cells of Listeria monocytogenes and the bacteriocin producing Leuconostoc carnosum 4010 showed growth inhibition of L. monocytogenes, although the intracellular pH (pHi) of L. monocytogenes followed by fluorescence ratio imaging microscopy was not affected. Furthermore, L...
Directory of Open Access Journals (Sweden)
Kast W Martin
2006-10-01
Full Text Available Abstract Incomplete Freund's adjuvant (IFA serves as a carrier for water-in-oil emulsion (W/O vaccines. The stability of such emulsions greatly affects vaccine safety and efficacy since continued presence of antigen depots at lymphoid organs releasing low-level antigens is known to stimulate a potent immune response and high-level systemic release of antigens can lead to tolerance. W/O emulsions for the purpose of clinical and laboratory peptide-based vaccinations have been prepared using the techniques of syringe extrusion, vortex or high-speed homogenization. There is no consensus in the field over which technique would be best to use and no immunological data are available that compare the three techniques. In this study, we compared the immune responses induced by a peptide-based vaccine prepared using vortex, syringe-extrusion and homogenization. The vaccination led to tumor rejection by mice vaccinated with the peptide-based vaccine prepared using all three techniques. The immunological data from the in vivo cytotoxicity assay showed a trend for lower responses and a higher variability and greater range in the immune responses induced by a vaccine that was emulsified by the vortex or homogenizer techniques as compared to the syringe-extrusion technique. There were statistically significant lower numbers of IFNγ-secreting cells induced when the mice were vaccinated with a peptide-based vaccine emulsion prepared using the vortex compared to the syringe-extrusion technique. At a suboptimal vaccine dose, the mice vaccinated with a peptide-based vaccine emulsion prepared using the vortex technique had the largest tumors compared to the syringe-extrusion or the homogenizer technique. In the setting of a busy pharmacy that prepares peptide-based vaccine emulsions for clinical studies, the vortex technique can still be used but we urge investigators to take special care in their choice of mixing vessels for the vortex technique as that can
Synthetic biology devices and circuits for RNA-based 'smart vaccines': a propositional review.
Andries, Oliwia; Kitada, Tasuku; Bodner, Katie; Sanders, Niek N; Weiss, Ron
2015-02-01
Nucleic acid vaccines have been gaining attention as an alternative to the standard attenuated pathogen or protein based vaccine. However, an unrealized advantage of using such DNA or RNA based vaccination modalities is the ability to program within these nucleic acids regulatory devices that would provide an immunologist with the power to control the production of antigens and adjuvants in a desirable manner by administering small molecule drugs as chemical triggers. Advances in synthetic biology have resulted in the creation of highly predictable and modular genetic parts and devices that can be composed into synthetic gene circuits with complex behaviors. With the recent advent of modified RNA gene delivery methods and developments in the RNA replicon platform, we foresee a future in which mammalian synthetic biologists will create genetic circuits encoded exclusively on RNA. Here, we review the current repertoire of devices used in RNA synthetic biology and propose how programmable 'smart vaccines' will revolutionize the field of RNA vaccination.
Listeria monocytogenes cross-contamination of cheese: risk throughout the food supply chain.
Sauders, B D; D'Amico, D J
2016-10-01
Listeria monocytogenes has been the most common microbial cause of cheese-related recalls in both the United States and Canada in recent years. Since L. monocytogenes is inactivated by pasteurization, the majority of these cases have been linked to environmental and cross-contamination of fresh-soft, soft-ripened, and semi-soft cheeses. Cross-contamination of foods with L. monocytogenes is a continuous risk throughout the food supply chain and presents unique challenges for subsequent illness and outbreak investigations. Reports on outbreaks of listeriosis attributed to cross-contamination downstream from primary processing help highlight the critical role of epidemiological investigation coupled with coordinated molecular subtyping and surveillance in the recognition and investigation of complex foodborne outbreaks. Despite their complexity, environmental sampling throughout the supply chain coupled with improved genotyping approaches and concomitant analysis of foodborne illness epidemiological exposure data are needed to help resolve these and similar cases more rapidly and with greater confidence.
La Vincente, S F; Mielnik, D; Jenkins, K; Bingwor, F; Volavola, L; Marshall, H; Druavesi, P; Russell, F M; Lokuge, K; Mulholland, E K
2015-12-18
In 2008 Fiji implemented a nationwide Human Papillomavirus (HPV) vaccine campaign targeting all girls aged 9-12 years through the existing school-based immunisation program. Parents of vaccine-eligible girls were asked to provide written consent for vaccination. The purpose of this study was to describe parents' knowledge, experiences and satisfaction with the campaign, the extent to which information needs for vaccine decision-making were met, and what factors were associated with vaccine consent. Following vaccine introduction, a cross-sectional telephone survey was conducted with parents of vaccine-eligible girls from randomly selected schools, stratified by educational district. Factors related to vaccine consent were explored using Generalised Estimating Equations. There were 560 vaccine-eligible girls attending the participating 19 schools at the time of the campaign. Among these, 313 parents could be contacted, with 293 agreeing to participate (93.6%). Almost 80% of participants reported having consented to HPV vaccination (230/293, 78.5%). Reported knowledge of cervical cancer and HPV prior to the campaign was very low. Most respondents reported that they were satisfied with their access to information to make an informed decision about HPV vaccination (196/293, 66.9%). and this was very strongly associated with provision of consent. Despite their young age, the vaccine-eligible girls were often involved in the discussion and decision-making. Most consenting parents were satisfied with the campaign and their decision to vaccinate, with almost 90% indicating they would consent to future HPV vaccination. However, negative media reports about the vaccine campaign created confusion and concern. Local health staff were cited as a trusted source of information to guide decision-making. Just over half of the participants who withheld consent cited vaccine safety fears as the primary reason (23/44, 52.3%). This is the first reported experience of HPV introduction
Directory of Open Access Journals (Sweden)
Karla Sequeira Mendonça
2016-01-01
Full Text Available ABSTRACT: Listeria monocytogenes is of notable concern to the food industry, due to its ubiquitous nature and ability to grow in adverse conditions. This study aimed to determine the genotypic profile of L. monocytogenes strains isolated from refrigerated chickens marketed in the southern part of Rio Grande do Sul, Brazil. The strains of L. monocytogenes isolated were characterized by serotyping and Pulsed Field Gel Electrophoresis (PFGE. Three different serotypes (1/2a, 1/2b and 4e were evaluated by PFGE, and the macrorestriction patterns utilizing enzymes AscI and ApaI, revealed five different pulsotypes. The presence of such varied genotypic profiles demonstrates the prevalence of L. monocytogenes contamination of chicken processing environments, which combined with ineffective cleaning procedures, allowing the survival, adaptation and proliferation of these pathogens, not only in the processing environment, but also in local grocery stores.
Energy Technology Data Exchange (ETDEWEB)
Schlech, W.F. III
1984-01-01
The route or mechanism of transmission of Listeria monocytogenes from its rural veterinary reservoir to newborn and older human populations has been obscure. Anecdotal reports of milk-borne infection from cows with Listeria mastitis have been published, but intensive investigations of small outbreaks of L. monocytogenes infections in humans have not supported a gastrointestinal mode of infection. Several recent studies, however, strongly suggest this possibility, and case-control studies of epidemic listeriosis in the Canadian Maritime provinces in 1981 documented an association between ingestion of uncooked vegetables and the development of illness (p = 0.02). In that study, coleslaw from a regional producer which was distributed throughout the Maritimes was considered to be the vehicle of transmission. Cabbage, the raw product in the production of coleslaw, was contaminated at a farm prior to arrival at the plant. Contamination occurred through fertilization with raw manure from a flock of sheep known to harbor L. monocytogenes. Therefore, an indirect link was established between Listeria monocytogenes infection of sheep on a cabbage farm and subsequent development of invasive listeriosis in humans. This study supports findings from other epidemiologic studies of human listeriosis and is consistent with results of investigations into the mode of transmission of natural and laboratory-acquired listeriosis in animals. 34 references.
The use of Listeria monocytogenes as a DNA delivery vector for cancer gene therapy.
LENUS (Irish Health Repository)
Tangney, Mark
2012-01-31
Listeria monocytogenes is an intracellular pathogen that lyses the phagosomal vacuole of infected cells, proliferates in the host cell cytoplasm and can actively enter adjacent cells. The pathogen is therefore well suited to exploitation as a vector for the delivery of DNA to target cells as the lifecycle favors cellular targeting with vector amplification and the potential for cell-to-cell spread. We have recently demonstrated DNA transfer by L. monocytogenes in growing tumors in murine models. Our approach exploited an ampicillin sensitive stain of L. monocytogenes which can be lysed through systemic administration of ampicillin to facilitate release of plasmid DNA for expression by infected mammalian cells. Here, we discuss the implications of this technology and the potential for future improvements of the system.
Directory of Open Access Journals (Sweden)
Voltaire Sant'Anna
2013-12-01
Full Text Available The antimicrobial activity of the bacteriocin-like substance (BLS P34 against Listeria monocytogenes was investigated in chicken sausage. The BLS was applied to chicken sausages (256 AU g-1 previously inoculated with a suspension of 10² cfu g-1 of L. monocytogenes. BLS P34 inhibited the indicator microorganism in situ in all incubation times for up to 10 days at 5 °C. The effectiveness of BLS P34 was increased when it was added in combination with nisin. The bacteriocin was also tested in natural eatable natural bovine wrapping (salty semi-dried tripe against the same indicator microorganism, also showing inhibitory capability in vitro. BLS P34 showed potential to control L. monocytogenes in refrigerated meat products.
Bioinformatics analysis of Brucella vaccines and vaccine targets using VIOLIN.
He, Yongqun; Xiang, Zuoshuang
2010-09-27
Brucella spp. are Gram-negative, facultative intracellular bacteria that cause brucellosis, one of the commonest zoonotic diseases found worldwide in humans and a variety of animal species. While several animal vaccines are available, there is no effective and safe vaccine for prevention of brucellosis in humans. VIOLIN (http://www.violinet.org) is a web-based vaccine database and analysis system that curates, stores, and analyzes published data of commercialized vaccines, and vaccines in clinical trials or in research. VIOLIN contains information for 454 vaccines or vaccine candidates for 73 pathogens. VIOLIN also contains many bioinformatics tools for vaccine data analysis, data integration, and vaccine target prediction. To demonstrate the applicability of VIOLIN for vaccine research, VIOLIN was used for bioinformatics analysis of existing Brucella vaccines and prediction of new Brucella vaccine targets. VIOLIN contains many literature mining programs (e.g., Vaxmesh) that provide in-depth analysis of Brucella vaccine literature. As a result of manual literature curation, VIOLIN contains information for 38 Brucella vaccines or vaccine candidates, 14 protective Brucella antigens, and 68 host response studies to Brucella vaccines from 97 peer-reviewed articles. These Brucella vaccines are classified in the Vaccine Ontology (VO) system and used for different ontological applications. The web-based VIOLIN vaccine target prediction program Vaxign was used to predict new Brucella vaccine targets. Vaxign identified 14 outer membrane proteins that are conserved in six virulent strains from B. abortus, B. melitensis, and B. suis that are pathogenic in humans. Of the 14 membrane proteins, two proteins (Omp2b and Omp31-1) are not present in B. ovis, a Brucella species that is not pathogenic in humans. Brucella vaccine data stored in VIOLIN were compared and analyzed using the VIOLIN query system. Bioinformatics curation and ontological representation of Brucella vaccines
Monath, Thomas P.; Seligman, Stephen J.; Robertson, James S.; Guy, Bruno; Hayes, Edward B.; Condit, Richard C.; Excler, Jean Louis; Mac, Lisa Marie; Carbery, Baevin; Chen, Robert T
2015-01-01
The Brighton Collaboration Viral Vector Vaccines Safety Working Group (V3SWG) was formed to evaluate the safety of live, recombinant viral vaccines incorporating genes from heterologous viruses inserted into the backbone of another virus (so-called “chimeric virus vaccines”). Many viral vector vaccines are in advanced clinical trials. The first such vaccine to be approved for marketing (to date in Australia, Thailand, Malaysia, and the Philippines) is a vaccine against the flavivirus Japanese encephalitis (JE), which employs a licensed vaccine (yellow fever 17D) as a vector. In this vaccine, two envelope proteins (prM-E) of YF 17D virus were replaced by the corresponding genes of JE virus, with additional attenuating mutations incorporated into the JE gene inserts. Similar vaccines have been constructed by inserting prM-E genes of dengue and West Nile into YF 17D virus and are in late stage clinical studies. The dengue vaccine is, however, more complex in that it requires a mixture of four live vectors each expressing one of the four dengue serotypes. This vaccine has been evaluated in multiple clinical trials. No significant safety concerns have been found. The Phase 3 trials met their endpoints in terms of overall reduction of confirmed dengue fever, and, most importantly a significant reduction in severe dengue and hospitalization due to dengue. However, based on results that have been published so far, efficacy in preventing serotype 2 infection is less than that for the other three serotypes. In the development of these chimeric vaccines, an important series of comparative studies of safety and efficacy were made using the parental YF 17D vaccine virus as a benchmark. In this paper, we use a standardized template describing the key characteristics of the novel flavivirus vaccine vectors, in comparison to the parental YF 17D vaccine. The template facilitates scientific discourse among key stakeholders by increasing the transparency and comparability of
Ottesen, Andrea; Ramachandran, Padmini; Reed, Elizabeth; White, James R; Hasan, Nur; Subramanian, Poorani; Ryan, Gina; Jarvis, Karen; Grim, Christopher; Daquiqan, Ninalynn; Hanes, Darcy; Allard, Marc; Colwell, Rita; Brown, Eric; Chen, Yi
2016-11-16
Microbiota that co-enrich during efforts to recover pathogens from foodborne outbreaks interfere with efficient detection and recovery. Here, dynamics of co-enriching microbiota during recovery of Listeria monocytogenes from naturally contaminated ice cream samples linked to an outbreak are described for three different initial enrichment formulations used by the Food and Drug Administration (FDA), the International Organization of Standardization (ISO), and the United States Department of Agriculture (USDA). Enrichment cultures were analyzed using DNA extraction and sequencing from samples taken every 4 h throughout 48 h of enrichment. Resphera Insight and CosmosID analysis tools were employed for high-resolution profiling of 16S rRNA amplicons and whole genome shotgun data, respectively. During enrichment, other bacterial taxa were identified, including Anoxybacillus, Geobacillus, Serratia, Pseudomonas, Erwinia, and Streptococcus spp. Surprisingly, incidence of L. monocytogenes was proportionally greater at hour 0 than when tested 4, 8, and 12 h later with all three enrichment schemes. The corresponding increase in Anoxybacillus and Geobacillus spp.indicated these taxa co-enriched in competition with L. monocytogenes during early enrichment hours. L. monocytogenes became dominant after 24 h in all three enrichments. DNA sequences obtained from shotgun metagenomic data of Listeria monocytogenes at 48 h were assembled to produce a consensus draft genome which appeared to have a similar tracking utility to pure culture isolates of L. monocytogenes. All three methods performed equally well for enrichment of Listeria monocytogenes. The observation of potential competitive exclusion of L. mono by Anoxybacillus and Geobacillus in early enrichment hours provided novel information that may be used to further optimize enrichment formulations. Application of Resphera Insight for high-resolution analysis of 16S amplicon sequences accurately identified L. monocytogenes
Weller, Daniel; Wiedmann, Martin; Strawn, Laura K
2015-09-01
While rain and irrigation events have been associated with an increased prevalence of foodborne pathogens in produce production environments, quantitative data are needed to determine the effects of various spatial and temporal factors on the risk of produce contamination following these events. This study was performed to quantify these effects and to determine the impact of rain and irrigation events on the detection frequency and diversity of Listeria species (including L. monocytogenes) and L. monocytogenes in produce fields. Two spinach fields, with high and low predicted risks of L. monocytogenes isolation, were sampled 24, 48, 72, and 144 to 192 h following irrigation and rain events. Predicted risk was a function of the field's proximity to water and roads. Factors were evaluated for their association with Listeria species and L. monocytogenes isolation by using generalized linear mixed models (GLMMs). In total, 1,492 (1,092 soil, 334 leaf, 14 fecal, and 52 water) samples were collected. According to the GLMM, the likelihood of Listeria species and L. monocytogenes isolation from soil samples was highest during the 24 h immediately following an event (odds ratios [ORs] of 7.7 and 25, respectively). Additionally, Listeria species and L. monocytogenes isolates associated with irrigation events showed significantly lower sigB allele type diversity than did isolates associated with precipitation events (P = <0.001), suggesting that irrigation water may be a point source of L. monocytogenes contamination. Small changes in management practices (e.g., not irrigating fields before harvest) may therefore reduce the risk of L. monocytogenes contamination of fresh produce. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Directory of Open Access Journals (Sweden)
Hurtado Ana
2009-01-01
Full Text Available Abstract Background Listeria monocytogenes is among the most important foodborne bacterial pathogens due to the high mortality rate and severity of the infection. L. monocytogenes is a ubiquitous organism occasionally present in the intestinal tract of various animal species and faecal shedding by asymptomatically infected livestock poses a risk for contamination of farm environments and raw food at the pre-harvest stages. The aim of this study was to determine the prevalence and strain diversity of L. monocytogenes in healthy ruminants and swine herds. Results Faecal samples from 30 animals per herd were collected from 343 herds (120 sheep, 124 beef cattle, 82 dairy cattle and 17 swine in the Basque Country and screened in pools by an automated enzyme-linked fluorescent immunoassay (VIDAS® to estimate the prevalence of positive herds. Positive samples were subcultured onto the selective and differential agar ALOA and biochemically confirmed. L. monocytogenes was isolated from 46.3% of dairy cattle, 30.6% beef cattle and 14.2% sheep herds, but not from swine. Within-herd prevalence investigated by individually analysing 197 sheep and 221 cattle detected 1.5% of faecal shedders in sheep and 21.3% in cattle. Serotyping of 114 isolates identified complex 4b as the most prevalent (84.2%, followed by 1/2a (13.2%, and PFGE analysis of 68 isolates showed a highly diverse L. monocytogenes population in ruminant herds. Conclusion These results suggested that cattle represent a potentially important reservoir for L. monocytogenes in the Basque Country, and highlighted the complexity of pathogen control at the farm level.
Zanini, S F; Silva-Angulo, A B; Rosenthal, A; Rodrigo, D; Martínez, A
2014-05-01
The aim of this study was to evaluate the antibiotic susceptibility of Listeria innocua (L. innocua) and Listeria monocytogenes (L. monocytogenes) cells in the presence of citral and carvacrol at sublethal concentrations in an agar medium. The presence of terpenes in the L. monocytogenes and L. innocua culture medium provided a reduction in the minimal inhibitory concentration (MIC) of all the antibiotics tested. These effects were dependent on the concentration of terpenes present in the culture medium. The combination of citral and carvacrol potentiated antibiotic activity by reducing the MIC values of bacitracin and colistin from 32.0 and 128.0 μg ml⁻¹ to 1.0 and 2.0 μg ml⁻¹, respectively. Thus, both Listeria species became more susceptible to these drugs. In this way, the colistin and bacitracin resistance of L. monocytogenes and L. innocua was reversed in the presence of terpenes. Results obtained in this study show that the phytochemicals citral and carvacrol potentiate antibiotic activity, reducing the MIC values of cultured L. monocytogenes and L. innocua. Phytochemicals citral and carvacrol potentiate antibiotic activity of erythromycin, bacitracin and colistin by reducing the MIC values of cultured Listeria monocytogenes and Listeria innocua. This effect in reducing the MIC values of the antibiotics tested in both micro-organisms was increased when natural antimicrobials were combined. This finding indicated that the combination among terpenes and antibiotic may contribute in reducing the required dosage of antibiotics due to the possible effect of terpenes on permeation barrier of the micro-organism cell membrane. © 2014 The Society for Applied Microbiology.
International Nuclear Information System (INIS)
Egerton, J.R.
2005-01-01
For vaccine production, recombinant antigens must be protective. Identifying protective antigens or candidate antigens is an essential precursor to vaccine development. Even when a protective antigen has been identified, cloning of its gene does not lead directly to vaccine development. The fimbrial protein of Dichelobacter nodosus, the agent of foot-rot in ruminants, was known to be protective. Recombinant vaccines against this infection are ineffective if expressed protein subunits are not assembled as mature fimbriae. Antigenic competition between different, but closely related, recombinant antigens limited the use of multivalent vaccines based on this technology. Recombinant antigens may need adjuvants to enhance response. DNA vaccines, potentiated with genes for different cytokines, may replace the need for aggressive adjuvants, and especially where cellular immunity is essential for protection. The expression of antigens from animal pathogens in plants and the demonstration of some immunity to a disease like rinderpest after ingestion of these, suggests an alternative approach to vaccination by injection. Research on disease pathogenesis and the identification of candidate antigens is specific to the disease agent. The definition of expression systems and the formulation of a vaccine for each disease must be followed by research to establish safety and efficacy. Where vaccines are based on unique gene sequences, the intellectual property is likely to be protected by patent. Organizations, licensed to produce recombinant vaccines, expect to recover their costs and to make a profit. The consequence is that genetically-derived vaccines are expensive. The capacity of vaccines to help animal owners of poorer countries depends not only on quality and cost but also on the veterinary infrastructure where they are used. Ensuring the existence of an effective animal health infrastructure in developing countries is as great a challenge for the developed world as
DEFF Research Database (Denmark)
Tamulevičius, Sigitas; Zakarienė, Gintarė; Novoslavskij, Aleksandr
2018-01-01
on selective agars and quantitative real-time PCR (qPCR) including staining with propidium monoazide (PMA). It was determined, that DLC:Ag film was the most efficient coating in the reduction of C. jejuni and L. monocytogenes numbers. Culture-based enumeration revealed that C. jejuni numbers were reduced......:Ag antimicrobial surface showed a reduced ability to grow on culture media, but maintained viability during the whole experiment. Nonetheless, DLC:Ag antimicrobial surface could be further considered for the reduction of cross-contamination risk from food preparation surfaces due to their contamination with C....... jejuni and L. monocytogenes in domestic and commercial kitchens or food establishments....
Modelling the growth of Listeria monocytogenes in fresh green coconut (Cocos nucifera L.) water.
Walter, Eduardo H M; Kabuki, Dirce Y; Esper, Luciana M R; Sant'Ana, Anderson S; Kuaye, Arnaldo Y
2009-09-01
The behaviour of Listeria monocytogenes in the fresh coconut water stored at 4 degrees C, 10 degrees C and 35 degrees C was studied. The coconut water was aseptically extracted from green coconuts (Cocos nucifera L.) and samples were inoculated in triplicate with a mixture of 5 strains of L. monocytogenes with a mean population of approximately 3 log(10) CFU/mL. The kinetic parameters of the bacteria were estimated from the Baranyi model, and compared with predictions of the Pathogen Modelling Program so as to predict its behaviour in the beverage. The results demonstrated that fresh green coconut water was a beverage propitious for the survival and growth of L. monocytogenes and that refrigeration at 10 degrees C or 4 degrees C retarded, but did not inhibit, growth of this bacterium. Temperature abuse at 35 degrees C considerably reduced the lagtimes. The study shows that L. monocytogenes growth in fresh green coconut water is controlled for several days by storage at low temperature, mainly at 4 degrees C. Thus, for risk population this product should only be drunk directly from the coconut or despite the sensorial alterations should be consumed pasteurized.
DEFF Research Database (Denmark)
Doyscher, Dominik; Fieseler, Lars; Dons, Lone Elisabet
2013-01-01
Despite its prominent role as an intracellular human pathogen, Listeria monocytogenes normally features a saprophytic lifestyle, and shares many environmental habitats with predatory protozoa. Earlier studies claimed that Acanthamoeba may act as environmental reservoirs for L.?monocytogenes, wher......Despite its prominent role as an intracellular human pathogen, Listeria monocytogenes normally features a saprophytic lifestyle, and shares many environmental habitats with predatory protozoa. Earlier studies claimed that Acanthamoeba may act as environmental reservoirs for L.......?monocytogenes, whereas others failed to confirm this hypothesis. Our findings support the latter and provide clear evidence that L.?monocytogenes is unable to persist in Acanthamoeba castellanii and A.?polyphaga. Instead, external Listeria cells are rapidly immobilized on the surface of Acanthamoeba trophozoites......-lapse microscopy revealed that shortly after the bacteria are collected, the amoeba can change direction of movement, phagocytose the backpack and continue to repeat the process. The phenomenon was also observed with avirulent L.?monocytogenes mutants, non-pathogenic Listeria, and other motile bacteria, indicating...
DEFF Research Database (Denmark)
Schmidt, Signe Tandrup; Foged, Camilla; Korsholm, Karen Smith
2016-01-01
be classified into delivery systems or immunostimulators. Liposomes are versatile delivery systems for antigens, and they can carefully be customized towards desired immune profiles by combining them with immunostimulators and optimizing their composition, physicochemical properties and antigen-loading mode......The development of subunit vaccines has become very attractive in recent years due to their superior safety profiles as compared to traditional vaccines based on live attenuated or whole inactivated pathogens, and there is an unmet medical need for improved vaccines and vaccines against pathogens...... of immunostimulators and antigens, respectively, into liposomes, and the choice of immunostimulator should ideally be based on knowledge regarding the specific PRR expression profile of the target APCs. Here, we review state-of-the-art formulation approaches employed for the inclusion of immunostimulators and subunit...
Verheyen, Davy; Bolívar, Araceli; Pérez-Rodríguez, Fernando; Baka, Maria; Skåra, Torstein; Van Impe, Jan F
2018-06-01
Traditionally, predictive growth models for food pathogens are developed based on experiments in broth media, resulting in models which do not incorporate the influence of food microstructure. The use of model systems with various microstructures is a promising concept to get more insight into the influence of food microstructure on microbial dynamics. By means of minimal variation of compositional and physicochemical factors, these model systems can be used to study the isolated effect of certain microstructural aspects on microbial growth, survival and inactivation. In this study, the isolated effect on microbial growth dynamics of Listeria monocytogenes of two food microstructural aspects and one aspect influenced by food microstructure were investigated, i.e., the nature of the food matrix, the presence of fat droplets, and microorganism growth morphology, respectively. To this extent, fish-based model systems with various microstructures were used, i.e., a liquid, a second more viscous liquid system containing xanthan gum, an emulsion, an aqueous gel, and a gelled emulsion. Growth experiments were conducted at 4 and 10 °C, both using homogeneous and surface inoculation (only for the gelled systems). Results regarding the influence of the growth morphology indicated that the lag phase of planktonic cells in the liquid system was similar to the lag phase of submerged colonies in the xanthan system. The lag phase of submerged colonies in each gelled system was considerably longer than the lag phase of surface colonies on these respective systems. The maximum specific growth rate of planktonic cells in the liquid system was significantly lower than for submerged colonies in the xanthan system at 10 °C, while no significant differences were observed at 4 °C. The maximum cell density was higher for submerged colonies than for surface colonies. The nature of the food matrix only exerted an influence on the maximum specific growth rate, which was
Balay, Danielle R; Dangeti, Ramana V; Kaur, Kamaljit; McMullen, Lynn M
2017-08-16
The aims of this study were to improve the method for purification of leucocin A to increase yield of peptide and to evaluate the efficacy of leucocin A and an analogue of leucocin A (leucocin N17L) to inhibit the growth of Listeria monocytogenes on wieners in the presence of spoilage organisms. Leucocin A was produced by Leuconostoc gelidum UAL187 and purified with a five-fold increase in yield; leucocin N17L was synthesized replacing asparagine at residue 17 with leucine. Five strains of L. monocytogenes associated with foodborne illness were used to assess bacteriocin efficacy in vitro and in situ. Minimum inhibitory concentrations could not be determined in broth; however, on agar the minimum inhibitory concentrations ranged from 11.7-62.5μM and 62.5->500μM for leucocin A and leucocin N17L, respectively. Leucocin N17L was less effective than the native bacteriocin at controlling the growth of L. monocytogenes. The inactivation profiles of L. monocytogenes in broth in the presence of leucocin A suggested each isolate had different levels of resistance to the bacteriocin as determined by the initial bactericidal effect. The formation of spontaneously resistance subpopulations were also observed for each strain of L. monocytogenes. In situ, wieners were inoculated with the spoilage organisms, Carnobacterium divergens and Brochothrix thermosphacta, followed by surface application of purified leucocin A, and inoculated with a cocktail of L. monocytogenes. Wieners were vacuum packaged and stored at 7°C for 16d. Leucocin A reduced the counts L. monocytogenes on wieners during storage, regardless of the presence of C. divergens. B. thermosphacta was unaffected by the presence of leucocin A on wieners over the duration of storage. This study suggests that leucocin A may be beneficial to industry as a surface application on wieners to help reduce L. monocytogenes counts due to post-processing contamination even in the presence of spoilage organisms. However, further
Meloni, Domenico; Galluzzo, Pietro; Mureddu, Anna; Piras, Francesca; Griffiths, Mansel; Mazzette, Rina
2009-02-15
The aims of the present study were: (a) to investigate the prevalence and the enumeration of Listeria monocytogenes in 200 samples of ready to eat (RTE) foods of animal and vegetal origin collected from different outlets and processing plants in Sardinia; (b) to characterize the isolates by phenotypical and molecular methods; (c) to analyze a subset of 42 L. monocytogenes by automated EcoRI ribotyping in order to predict the strain's potential virulence for humans. The strains were isolated from: smoked fish products, cooked marinated products, meat products and pre-packaged mixed vegetable salads. Of the samples tested, 22% were positive for Listeria spp. The prevalence of L. monocytogenes was 9.5%, while the level of L. monocytogenes in the positive samples was 93%), belonging to 17 different DuPont Identification Library Codes (DUP-IDs) clones. The Simpson's numerical index of discrimination was 0.911. Cluster analysis pointed out a high similarity among strains isolated from meat, fish, and vegetables of different origin. These results confirmed the existence of a widespread population of L. monocytogenes, characterized by highly related strains existing in different geographical areas. 65% of these strains belonged to lineage II (serotypes 1/2a and 1/2c), subtypes known to be associated with sporadic human listeriosis outbreaks. The remaining 35% of the isolates (serotypes 1/2b, 3b and 4b) were allocated to lineage I and belong to distinct clonal groups (DUP-ID 1038 and 1042), which again have been associated with several outbreaks of human listeriosis. Neither atypical profiles nor lineage III strains were found. EcoRI ribotyping was confirmed as a rapid and reliable method for L. monocytogenes typing, providing useful data for epidemiologic and clonality surveys of L. monocytogenes strains isolated from RTE foods.
Jamali, Hossein; Paydar, Mohammadjavad; Ismail, Salmah; Looi, Chung Yeng; Wong, Won Fen; Radmehr, Behrad; Abedini, Atefeh
2015-07-25
The aim of this study was to investigate the prevalence and characterization of Listeria species and Listeria monocytogenes isolated from raw fish and open-air fish market environments. Eight hundred and sixty two samples including raw fish and fish market environments (samples from workers' hands, workers' knives, containers and work surface) were collected from the open-air fish markets in the Northern region of Iran. Listeria spp. was isolated from 104/488 (21.3%) raw fish and 29/374 (7.8%) of samples from open-air fish market environment. The isolates of Listeria spp. included L. innocua (35.3%), L. monocytogenes (32.3%), L. seeligeri (18%), and L. ivanovii (14.3%). Of the 43 L. monocytogenes isolates, 31 (72.1%), 10 (23.3%) and 2 (4.7%) belonged to serovars 1/2a, 4b, and 1/2b, respectively. The inlA, inlB, inlC, inlJ, actA, hlyA, iap, plcA, and prfA virulence-associated genes were detected in almost all of the L. monocytogenes isolates. The Listeria spp. isolates showed high resistance against tetracycline (23.3%), penicillin G, and cephalothin (each 16.5%). Besides, we observed significant resistance level to tetracycline (27.9%), ampicillin (20.9%), cephalothin, penicillin G, and streptomycin (each 16.3%) in the L. monocytogenes isolates. All of the isolates were susceptible to cefotaxime, gentamicin, kanamycin, and pefloxacin. We found that tetM (25.6%), tetA (23.3%), ampC (14%), and penA (11.6%) were the most prevalent antibiotic resistance genes in the L. monocytogenes isolates. Recovery of potentially pathogenic L. monocytogenes from raw fish and environment of open-air fish market samples in this study is a convincing evidence for the zoonotic potential of listeriosis.
Liu, Xiaoji; Basu, Urmila; Miller, Petr; McMullen, Lynn M
2017-05-01
This study reports the gene expression and filamentation in Listeria monocytogenes 08-5923 following exposure to food preservatives sodium lactate (NaL) and sodium diacetate (SD). L. monocytogenes 08-5923 was challenged with a mixture of NaL/SD, NaL or sodium acetate at 37 °C in tryptic soy broth. In the initial study, L. monocytogenes 08-5923 was exposed to NaL/SD for 24 h. The transcriptome was investigated by RNA sequencing. A stress response network was discovered in L. monocytogenes 08-5923, which is mediated by genes encoding two-component systems (hisJ, lisK, OmpR family gene, resE) and RNA polymerase factors (sigC, sigH). NaL/SD resulted in the down-regulation of genes in glycolysis (pykA, eno, fbaA, pgm) and up-regulation of genes in DNA repair (radC), cell division (ftsE) and cell structure synthesis (flagella synthesis: flgK, fliF, fliD). Filamentation was monitored by flow cytometry. NaL/SD mixture resulted in filamentation in L. monocytogenes 08-5923. Longer exposure was required to induce filamentation in L. monocytogenes for SD (24 h) than for NaL (8 h) when cells were exposed to individual salt. The quantitative real time PCR analysis revealed the down-regulation of ftsE in filamented cells of Listeria exposed to NaL or sodium acetate. Copyright © 2016 Elsevier Ltd. All rights reserved.
Dailey, Rachel C; Welch, Lacinda J; Hitchins, Anthony D; Smiley, R Derike
2015-04-01
The presence of multiple species of Listeria in regulated food products is not uncommon and can complicate the recovery of Listeria monocytogenes particularly on a non-differentiating medium. The potential complications of Listeria seeligeri and Listeria welshimeri on the recovery of L. monocytogenes from inoculated food test samples using the U.S. Food and Drug Administration's (FDA) selective enrichment procedure was investigated. Post-enrichment enumeration, in the absence of food product, indicates that some L. seeligeri and L. monocytogenes pairings may have population differentials as great as 2.7 ± 0.1 logs with L. seeligeri being the predominant species. A similar observation was noted for L. welshimeri and L. monocytogenes pairings which resulted in population differentials as large as 3.7 ± 0.2 logs with L. welshimeri being the predominant species. Select strain pairings were used to inoculate guacamole, crab meat, broccoli, and cheese with subsequent recovery by the FDA Bacteriological Analytical Manual (BAM) method with 10 colonies per sample selected for confirmation. The presence of L. seeligeri had little effect on the recovery of L. monocytogenes. The presence of L. welshimeri resulted in the failure to recover L. monocytogenes in three out of the four food matrices. This work extends the observation that non-pathogenic species of Listeria can complicate the recovery of L. monocytogenes and that competition during selective enrichment is not limited to the presence of just Listeria innocua. Published by Elsevier Ltd.
Dailey, Rachel C.; Welch, Lacinda J.; Hitchins, Anthony D.; Smiley, R. Derike
2016-01-01
The presence of multiple species of Listeria in regulated food products is not uncommon and can complicate the recovery of Listeria monocytogenes particularly on a non-differentiating medium. The potential complications of Listeria seeligeri and Listeria welshimeri on the recovery of L. monocytogenes from inoculated food test samples using the U.S. Food and Drug Administration's (FDA) selective enrichment procedure was investigated. Post-enrichment enumeration, in the absence of food product, indicates that some L. seeligeri and L. monocytogenes pairings may have population differentials as great as 2.7 ± 0.1 logs with L. seeligeri being the predominant species. A similar observation was noted for L. welshimeri and L. monocytogenes pairings which resulted in population differentials as large as 3.7 ± 0.2 logs with L. welshimeri being the predominant species. Select strain pairings were used to inoculate guacamole, crab meat, broccoli, and cheese with subsequent recovery by the FDA Bacteriological Analytical Manual (BAM) method with 10 colonies per sample selected for confirmation. The presence of L. seeligeri had little effect on the recovery of L. monocytogenes. The presence of L. welshimeri resulted in the failure to recover L. monocytogenes in three out of the four food matrices. This work extends the observation that non-pathogenic species of Listeria can complicate the recovery of L. monocytogenes and that competition during selective enrichment is not limited to the presence of just Listeria innocua. PMID:25475325
Knudsen, Gitte M; Nielsen, Jesper Boye; Marvig, Rasmus L; Ng, Yin; Worning, Peder; Westh, Henrik; Gram, Lone
2017-08-01
Whole genome sequencing is increasing used in epidemiology, e.g. for tracing outbreaks of food-borne diseases. This requires in-depth understanding of pathogen emergence, persistence and genomic diversity along the food production chain including in food processing plants. We sequenced the genomes of 80 isolates of Listeria monocytogenes sampled from Danish food processing plants over a time-period of 20 years, and analysed the sequences together with 10 public available reference genomes to advance our understanding of interplant and intraplant genomic diversity of L. monocytogenes. Except for three persisting sequence types (ST) based on Multi Locus Sequence Typing being ST7, ST8 and ST121, long-term persistence of clonal groups was limited, and new clones were introduced continuously, potentially from raw materials. No particular gene could be linked to the persistence phenotype. Using time-based phylogenetic analyses of the persistent STs, we estimate the L. monocytogenes evolutionary rate to be 0.18-0.35 single nucleotide polymorphisms/year, suggesting that the persistent STs emerged approximately 100 years ago, which correlates with the onset of industrialization and globalization of the food market. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.
DEFF Research Database (Denmark)
Gimenez, B.; Dalgaard, Paw
2004-01-01
Aims: To evaluate and model the simultaneous growth of Listeria monocytogenes and spoilage micro-organisms in cold-smoked salmon.Methods and Results: Growth kinetics of L. monocytogenes, lactic acid bacteria (LAB), Enterobacteriaceae, enterococci and Photobacterium phosphoreum were determined...
Listeria monocytogenes repellence by enzymatically modified PES surfaces
Veen, van der S.; Nady, N.; Franssen, M.C.R.; Zuilhof, H.; Boom, R.M.; Abee, T.; Schroën, C.G.P.H.
2015-01-01
: The effect of enzyme-catalyzed modification of poly(ethersulfone) (PES) on the adhesion and biofilm formation of two Listeria monocytogenes strains is evaluated under static and dynamic flow conditions. PES has been modified with gallic acid, ferulic acid and 4-hydroxybenzoic acid. The surfaces
9 CFR 430.4 - Control of Listeria monocytogenes in post-lethality exposed ready-to-eat products.
2010-01-01
... post-lethality exposed ready-to-eat products. 430.4 Section 430.4 Animals and Animal Products FOOD... Control of Listeria monocytogenes in post-lethality exposed ready-to-eat products. (a) Listeria... comes into direct contact with a food contact surface which is contaminated with L. monocytogenes. (b...
Listeria monocytogenes is a foodborne pathogen that has been associated with poultry products. This organism is ubiquitous in nature and has been found to enter poultry further processing plants on incoming raw product. Once in the plant, L. monocytogenes can become a long term persistent colonize...
Directory of Open Access Journals (Sweden)
Roberto Degenhardt
2007-06-01
Full Text Available Dry sausages have been considered ready-to-eat products with low risk of causing listeriosis due to the hurdles created during the manufacturing process such as low pH and a w, high salt concentration and presence of lactic acid bacteria (LAB. However, several studies have detected survival of Listeria monocytogenes in these products and also shown that process parameters, LAB and L. monocytogenes strains directly influence the results. In this work, survival of the pathogen in sausages prepared with three different formulations (one standard formulation, one formulation added of Lactobacillus plantarum and one added of 2% sodium lactate, using the manufacturing process usually employed in Brazil, was evaluated. Naturally contaminated sausages presented a small increase in the counts of L. monocytogenes in the first days of the process, followed by a gradual decrease until the end of the process. In experimentally contaminated samples containing L. plantarum, the reduction of counts of L. monocytogenes during processing was considerable, but there wasn´t significant differences between the treatments.Salames têm sido considerados produtos prontos para o consumo com baixo risco de provocar listeriose devido aos obstáculos criados no processo de fabricação e suas características de pH e atividade água baixos, alta concentração de sal e presença de bactérias lácticas. Entretanto, a sobrevivência de Listeria monocytogenes nesta classe de produtos é verificada e estudos de processo visando à redução da contaminação por este patógeno, têm demonstrado que particularidades como variação dos parâmetros de processo, cepas de bactérias lácticas e de L. monocytogenes influenciam diretamente os resultados. Neste estudo três formulações foram avaliadas (uma padrão, uma com inoculação da cultura Lactobacillus plantarum e outra com adição 2% de lactato de sódio empregando parâmetros de processo comumente praticados no Brasil
Wachiralurpan, Sirirat; Sriyapai, Thayat; Areekit, Supatra; Sriyapai, Pichapak; Augkarawaritsawong, Suphitcha; Santiwatanakul, Somchai; Chansiri, Kosum
2018-04-01
ABSTRACT Listeria monocytogenes is a major foodborne pathogen of global health concern. Herein, the rapid diagnosis of L. monocytogenes has been achieved using loop-mediated isothermal amplification (LAMP) based on the phosphatidylcholine-phospholipase C gene (plcB). Colorimetric detection was then performed through the formation of DNA concatemers and a gold nanoparticle/DNA probe complex (GNP/DNA probe). The overall detection process was accomplished within approximately 1 h with no need for complicated equipment. The limits of detection for L. monocytogenes in the forms of purified genomic DNA and pure culture were 800 fg and 2.82 CFU mL-1, respectively. No cross reactions were observed from closely related bacteria species. The LAMP-GNP/DNA probe assay was applied to the detection of 200 raw chicken meat samples and compared to routine standard methods. The data revealed that the specificity, sensitivity and accuracy were 100%, 90.20% and 97.50%, respectively. The present assay was 100% in conformity with LAMP-agarose gel electrophoresis assay. Five samples that were negative by both assays appeared to have the pathogen at below the level of detection. The assay can be applied as a rapid direct screening method for L. monocytogenes.
Association of prior HPV vaccination with reduced preterm birth: A population based study.
Lawton, Beverley; Howe, Anna S; Turner, Nikki; Filoche, Sara; Slatter, Tania; Devenish, Celia; Hung, Noelyn Anne
2018-01-02
Emerging evidence suggests that HPV infection is associated with negative pregnancy outcomes such as preterm birth (PTB), and pre-eclampsia. We aimed to determine if prior HPV vaccination reduced adverse pregnancy outcomes. A New Zealand population-based retrospective study linking first pregnancy outcome data (2008-2014 n = 35,646) with prior quadrivalent HPV vaccination status. Primary outcomes were likelihood (odds ratios, ORs) of PTB, pre-eclampsia, and stillbirth. Exposure groups were based on HPV vaccination. Adjusted ORs were calculated for each outcome, controlling for mother's age at delivery, ethnicity, socioeconomic status, health board region at time of delivery, and body mass index and smoking status at time of registration with maternity care provider. Mother's mean age at delivery was 19 (SD 2.1) years. Of 34,994 the pregnancies included in the final study analyses 62.3% of women were unvaccinated, 11.0% vaccinated with one or two doses and 27.7% vaccinated with three doses prior to pregnancy. PTB (OR: 0.87; CI 0.78, 0.96)) was significantly lower for women who previously received the HPV vaccine. A dose response effect was found with each successive dose received decreasing the likelihood of PTB. No associations between the vaccinated and unvaccinated groups were shown for pre-eclampsia or stillbirth. Prior receipt of the quadrivalent HPV vaccine was associated with a significant reduction in PTB (13%); suggesting that HPV vaccination may be effective in reducing PTB. The potential global public health impact is considerable and there is urgency to undertake further research to replicate and explore these findings. Copyright © 2017 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Tian Ding
2017-05-01
Full Text Available This study firstly developed a multiplex real-time PCR (RT-PCR technique combined with a pre-enrichment step to simultaneously detect Staphylococcus aureus (S. aureus, Listeria monocytogenes (L. monocytogenes and Salmonella spp. in raw milk and the dairy farm environment (feces, soil, feed, water in one reaction. Brain heart infusion (BHI broth was selected for the enrichment step to increase the density of the target bacteria by using an incubation of 4 h before multiplex RT-PCR. The results showed that the detection limit of the multiplex real-time assay was approximately 102 CFU/mL for pure cultures and artificially contaminated milk without enrichment, while 12, 14, and 10 CFU/25 mL, respectively, for S. aureus, L. monocytogenes, and Salmonella spp. after pre-enrichment. The newly developed multiplex RT-PCR assay was applied to 46 dairy farm environmental samples and raw milk samples covering a wide variety of sample types. The results demonstrated that the multiplex RT-PCR assay coupled with the BHI enrichment broth was suitable for the simultaneous screening of S. aureus, L. monocytogenes, and Salmonella spp. in the pasture environment and in raw milk. The multiplex RT-PCR assay clearly and successfully shortened the total detection time and reduced labor compared to conventional culture-based methods for testing natural samples.
International Nuclear Information System (INIS)
Kwak, Heesun; Mustafa, Waleed; Speirs, Kendra; Abdool, Asha J.; Paterson, Yvonne; Isaacs, Stuart N.
2004-01-01
Recombinant poxviruses have shown promise as vaccine vectors. We hypothesized that improved cellular immune responses could be developed to a foreign antigen by incorporating it as part of the extracellular enveloped virion (EEV). We therefore constructed a recombinant vaccinia virus that replaced the cytoplasmic domain of the B5R protein with a test antigen, HIV-1 Gag. Mice immunized with the virus expressing Gag fused to B5R had significantly better primary CD4 T-cell responses than recombinant virus expressing HIV-Gag from the TK-locus. The CD8 T-cell responses were less different between the two groups. Importantly, although we saw differences in the immune response to the test antigen, the vaccinia virus-specific immune responses were similar with both constructs. When groups of vaccinated mice were challenged 30 days later with a recombinant Listeria monocytogenes that expresses HIV-Gag, mice inoculated with the virus that expresses the B5R-Gag fusion protein had lower colony counts of Listeria in the liver and spleen than mice vaccinated with the standard recombinant. Thus, vaccinia virus expressing foreign antigen incorporated into EEV may be a better vaccine strategy than standard recombinant vaccinia virus
Directory of Open Access Journals (Sweden)
Rafael C.R. Martinez
2005-03-01
Full Text Available Bacteriocin-producing Lactobacillus sakei 1 was cultivated in Brain-Heart Infusion broth (24 h at 25ºC. The culture supernatant was neutralized, filter sterilized and used to test the activity of bacteriocin against Listeria monocytogenes 1/2a, at 8ºC and 15ºC. Non-bacteriocinogenic Lactobacillus sakei ATCC 15521 was used as a negative control. L. monocytogenes 1/2a was inoculated in culture supernatant medium from L. sakei 1 and L. sakei ATCC 15521 and the listerial populations were determined after 0, 5 and 10 days. The bacteriocin production was quantified as arbitrary units per mL (AU/mL using agar antagonism test. Additionally, to investigate if L. monocytogenes virulence pattern could be changed after bactericion exposure, the ability of L. monocytogenes to cause haemolysis in sheep red blood cells was determined, before and after exposure to bacteriocin at 8ºC. In the presence of the antimicrobial peptide, at 8ºC, L. monocytogenes population decreased, but growth of resistant cells was observed. At 15ºC, there was no difference between test and control. Furthermore, the haemolytic activity of L. monocytogenes 1/2a was not altered by exposure to L. sakei 1 bacteriocin, which suggests no change in its virulence pattern.Lactobacillus sakei 1 produtor de bacteriocina foi cultivado em caldo Infusão Cérebro-Coração por 24h a 25ºC. O sobrenadante da cultura foi neutralizado, esterilizado por filtração e usado para testar a atividade da bacteriocina frente a Listeria monocytogenes 1/2a, a 8ºC e 15ºC. Lactobacillus sakei ATCC 15521 não bacteriocinogênico, foi utilizado como controle negativo. L. monocytogenes 1/2a foi inoculada no sobrenadante da cultura de L.sakei 1 e L. sakei ATCC 15521 e as populações listeriais foram determinadas após 0, 5 e 10 dias. A produção de bacteriocina foi quantificada como unidades arbitrárias por mL (UA/mL, utilizando-se o teste de antagonismo em ágar. Adicionalmente, para investigar se o padr
Modeling and predicting the growth boundary of Listeria monocytogenes in lightly preserved seafood
DEFF Research Database (Denmark)
Mejlholm, Ole; Dalgaard, Paw
2007-01-01
The antimicrobial effect of diacetate and lactate against Listeria monocytogenes was evaluated in challenge tests with vacuum-packaged or modified atmosphere packaged (MAP) cold-smoked salmon, marinated salmon, cold-smoked Greenland halibut, marinated Greenland halibut, and gravad salmon. MAP col...... characteristics required to prevent the growth of L. monocytogenes, thereby making it possible to identify critical control points, and is useful for compliance with the new European Union regulation on ready-to-eat foods (EC 2073/2005)....
Changes in gene expression during adaptation of Listeria monocytogenes to the soil environment.
Piveteau, Pascal; Depret, Géraldine; Pivato, Barbara; Garmyn, Dominique; Hartmann, Alain
2011-01-01
Listeria monocytogenes is a ubiquitous opportunistic pathogen responsible for listeriosis. In order to study the processes underlying its ability to adapt to the soil environment, whole-genome arrays were used to analyse transcriptome modifications 15 minutes, 30 minutes and 18 h after inoculation of L. monocytogenes EGD-e in soil extracts. Growth was observed within the first day of incubation and large numbers were still detected in soil extract and soil microcosms one year after the start of the experiment. Major transcriptional reprofiling was observed. Nutrient acquisition mechanisms (phosphoenolpyruvate-dependent phosphotransferase systems and ABC transporters) and enzymes involved in catabolism of specific carbohydrates (β-glucosidases; chitinases) were prevalent. This is consistent with the overrepresentation of the CodY regulon that suggests that in a nutrient depleted environment, L. monocytogenes recruits its extensive repertoire of transporters to acquire a range of substrates for energy production.
Directory of Open Access Journals (Sweden)
Ewa Sawosz
2010-08-01
Full Text Available Ewa Sawosz1, André Chwalibog2, Jacek Szeliga3, Filip Sawosz2, Marta Grodzik1, Marlena Rupiewicz1, Tomasz Niemiec1, Katarzyna Kacprzyk11Division of Biotechnology and Biochemistry of Nutrition, Warsaw University of Life Sciences, Warsaw, Poland; 2Department of Basic Animal and Veterinary Sciences, University of Copenhagen, Copenhagen, Denmark; 3Division of Microbiology of Analytical Centre, Warsaw University of Life Sciences, Warsaw, PolandPurpose: Rapid development of nanotechnology has recently brought significant attention to the extraordinary biological features of nanomaterials. The objective of the present investigation was to evaluate morphological characteristics of the assembles of gold and platinum nanoparticles (nano-Au and nano-Pt respectively, with Salmonella Enteritidis (Gram-negative and Listeria monocytogenes (Gram-positive, to reveal possibilities of constructing bacteria-nanoparticle vehicles.Methods: Hydrocolloids of nano-Au or nano-Pt were added to two bacteria suspensions in the following order: nano-Au + Salmonella Enteritidis; nano-Au + Listeria monocytogenes; nano-Pt + Salmonella Enteritidis; nano-Pt + Listeria monocytogenes. Samples were inspected by transmission electron microscope.Results: Visualization of morphological interaction between nano-Au and Salmonella Enteritidis and Listeria monocytogenes, showed that nano-Au were aggregated within flagella or biofilm network and did not penetrate the bacterial cell. The analysis of morphological effects of interaction of nano-Pt with bacteria revealed that nano-Pt entered cells of Listeria monocytogenes and were removed from the cells. In the case of Salmonella Enteritidis, nano-Pt were seen inside bacteria cells, probably bound to DNA and partly left bacterial cells. After washing and centrifugation, some of the nano-Pt-DNA complexes were observed within Salmonella Enteritidis.Conclusion: The results indicate that the bacteria could be used as a vehicle to deliver nano
Viral vector-based influenza vaccines
de Vries, Rory D.; Rimmelzwaan, Guus F.
2016-01-01
ABSTRACT Antigenic drift of seasonal influenza viruses and the occasional introduction of influenza viruses of novel subtypes into the human population complicate the timely production of effective vaccines that antigenically match the virus strains that cause epidemic or pandemic outbreaks. The development of game-changing vaccines that induce broadly protective immunity against a wide variety of influenza viruses is an unmet need, in which recombinant viral vectors may provide. Use of viral vectors allows the delivery of any influenza virus antigen, or derivative thereof, to the immune system, resulting in the optimal induction of virus-specific B- and T-cell responses against this antigen of choice. This systematic review discusses results obtained with vectored influenza virus vaccines and advantages and disadvantages of the currently available viral vectors. PMID:27455345
Repalust, Anja; Šević, Sandra; Rihtar, Stanko; Štulhofer, Aleksandar
2017-10-01
Considering that programmatic data suggest a recent rise in vaccine refusal in Croatia, this study, first of its kind in Southeast Europe, aimed to estimate the prevalence, and sociodemographic, and sociocultural determinants of childhood vaccine refusal and hesitancy (CVRH) intentions among Croatian adults. Multi-stage stratified population-based survey included 1000 individuals aged 18-88 years (M age = 47.7, SD = 17.8), of whom 51.7% were women. The outcome, a categorical indicator, distinguished among individuals who would approve vaccinating their children (vaccine accepting), those who would approve some but not all vaccines (vaccine hesitant), and those who would refuse vaccination (vaccine refusing). A sizeable minority of participants was characterized by childhood vaccine refusal (10.6%) and hesitancy intentions (19.5%). In a multivariate assessment controlling for parenthood, the odds of vaccine hesitancy were significantly increased by a younger age (AOR = 1.96-3.03, p Croatia. Following the social contagion model, future research should move beyond individual-level approach and take into account social interaction and social network effects.
Schoder, Dagmar; Melzner, Daniela; Schmalwieser, Alois; Zangana, Abdoulla; Winter, Petra; Wagner, Martin
2011-06-01
The aim of this study was to determine the transmission routs of Listeria spp. in dairy farms manufacturing fresh cheese made from ovine and caprine raw milk and to evaluate the impact of Listeria monocytogenes mastitis on raw milk contamination. Overall, 5,799 samples, including 835 environmental samples, 230 milk and milk product samples, and 4,734 aseptic half-udder foremilk samples were collected from 53 dairy farms in the dairy intensive area of Lower Austria. Farms were selected for the study because raw milk was processed to cheese that was sold directly to consumers. A total of 153 samples were positive for Listeria spp., yielding an overall prevalence of 2.6%; L. monocytogenes was found in 0.9% of the samples. Bulk tank milk, cheese, and half-udder samples were negative for Listeria spp. Because none of the sheep and goats tested positive from udder samples, L. monocytogenes mastitis was excluded as a significant source of raw milk contamination. L. monocytogenes was detected at 30.2% of all inspected farms. Swab samples from working boots and fecal samples had a significantly higher overall prevalence (P < 0.001) of L. monocytogenes (15.7 and 13.0%, respectively) than did swab samples from the milk processing environment (7.9%). A significant correlation was found between the prevalence of L. monocytogenes in the animal and in the milk processing environment and the silage feeding practices. Isolation of L. monocytogenes was three to seven times more likely from farms where silage was fed to animals throughout the year than from farms where silage was not fed to the animals.
Directory of Open Access Journals (Sweden)
Gusman Vera
2014-01-01
Full Text Available Listeria monocytogenes is pathogenic bacterium that can contaminate food products during and after processing. As ready-to-eat food does not undergo any treatment to ensure its safety before consumption, the risk of foodborne disease must be considered if this pathogen is present in the food. As diseases caused by contaminated food are an important public health problem today, the aim of this study was to determine the prevalence of Listeria monocytogenes in different ready-to-eat food products. In the seven-month period from June 1 to December 31, 2011, a total of 1 380 food samples were examined in the Division of Sanitary Bacteriology, Center for Microbiology, Institute of Public Health of Vojvodina in Novi Sad. A total of 912 samples were analyzed for the presence of Listeria monocytogenes according to ISO 11290-2. The identity of suspected Listeria monocytogenes was confirmed using the VITEK 2 Compact system (BioMerieux, France. Out of 912 samples, Listeria monocytogenes was detected in 18 (1.97%. Listeria monocytogenes was mostly found in cooked meals (in 6 samples out of 18, sandwiches (4 samples and frozen food, such as ice-cream and frozen vegetables (4 samples. It was also found in tofu bread spreads (2 samples, cream cheese (1 sample and cakes (1 sample. The presence of Listeria monocytogenes in some ready-to-eat food could present a public health hazard, particularly to the high-risk population group, because of the high mortality rate associated with listeriosis and the widespread nature of the organism. Monitoring of listeriosis is essential to prevent foodborne outbreaks, and in assessing human health risk in ready-to-eat foods.
Directory of Open Access Journals (Sweden)
Hayat Ennaji
2008-09-01
Full Text Available Hayat Ennaji1,2, Mohammed Timinouni2, My Mustapha Ennaji3, Mohammed Hassar1, Nozha Cohen11Laboratoire de Microbiologie et Hygiène des Aliments et de l’Environnement, Institut Pasteur du Maroc., Casablanca, Morocco; 2Laboratoire de Microbiologie et Biologie Moléculaire, Institut Pasteur du Maroc., Casablanca, Morocco; 3Laboratoire de Virologie et Hygiène and Microbiologie., Faculté des Sciences et Techniques - Mohammedia, Université Hassan II, Mohammedia, MoroccoAbstract: This study was carried out on 426 samples of raw meats collected from butcheries and supermarkets in Casablanca, Morocco. The samples were examined for the occurrence of Listeria species. Strains of Listeria monocytogenes were characterized by several biochemical tests and confirmed by polymerase chain reaction (PCR. β-hemolytic cultures and nonhemolytic isolates were tested for biochemical properties with the Listeria API test. Among the 43 Listeria species isolates; we identified 10 strains for L. monocytogenes (23.3%, 31 strains for L. innocua (72.1% and 2 strains for L. welshimeri (4.6%. Strains of L. monocytogenes were separated by multiplex PCR; two serogroups IIb and IVb were thus differentiated. Antibiotic susceptibility of L. monocytogenes to 21 antibiotics was determined by the disk diffusion method. All isolates were susceptible to a wide range of the tested antibiotics with the exception of nalidixic acid, colistine and cephalosporins second and third generation for which they were all resistant.Keywords: antibiotic susceptibility, Listeria monocytogenes, meat, PCR
International Nuclear Information System (INIS)
Todoriki, Setsuko; Bari, Latiful; Kitta, Kazumi; Ohba, Mika; Ito, Yasuhiro; Tsujimoto, Yuka; Kanamori, Norihito; Yano, Erika; Moriyama, Tatsuya; Kawamura, Yukio; Kawamoto, Shinichi
2009-01-01
The presence of Listeria monocytogenes in fresh produce is a growing concern because of the possibility of food-borne illness. Ionizing radiation is an effective non-thermal means of eliminating pathogenic bacteria in fresh produce; however, the effect of ionizing irradiation on the allergenic properties of the host commodities remains unknown. This study aimed (i) to determine the effective dose of gamma-irradiation in eliminating L. monocytogenes on whole cherry tomatoes and (ii) to evaluate the effect of gamma-irradiation on the allergenic properties of tomato proteins. Cherry tomatoes that were inoculated with a mixture of five L. monocytogenes strains were treated with gamma-rays from a 60 Co source. A 1.25 kGy dose of gamma-irradiation was found to be sufficient to eliminate L. monocytogenes on whole cherry tomatoes. The immunoblot profile of serum samples obtained from two patients with tomato allergy revealed that gamma-irradiation did not affect the allergenicity of tomato proteins for up to 7 days after irradiation when the tomatoes were stored at 20 deg. C. Additionally, the m-RNA levels of β-fructofuranosidase, polygalacturonase, pectin esterase, and superoxide dismutase, the main allergenic proteins in tomato, were not affected by the applied irradiation dose. Thus, this study demonstrated that a 1.25 kGy dose of gamma-irradiation effectively eliminates L. monocytogenes on cherry tomatoes without affecting the expression of allergenic proteins in the fruits.
Todoriki, Setsuko; Bari, Latiful; Kitta, Kazumi; Ohba, Mika; Ito, Yasuhiro; Tsujimoto, Yuka; Kanamori, Norihito; Yano, Erika; Moriyama, Tatsuya; Kawamura, Yukio; Kawamoto, Shinichi
2009-07-01
The presence of Listeria monocytogenes in fresh produce is a growing concern because of the possibility of food-borne illness. Ionizing radiation is an effective non-thermal means of eliminating pathogenic bacteria in fresh produce; however, the effect of ionizing irradiation on the allergenic properties of the host commodities remains unknown. This study aimed (i) to determine the effective dose of gamma-irradiation in eliminating L. monocytogenes on whole cherry tomatoes and (ii) to evaluate the effect of gamma-irradiation on the allergenic properties of tomato proteins. Cherry tomatoes that were inoculated with a mixture of five L. monocytogenes strains were treated with gamma-rays from a 60Co source. A 1.25 kGy dose of gamma-irradiation was found to be sufficient to eliminate L. monocytogenes on whole cherry tomatoes. The immunoblot profile of serum samples obtained from two patients with tomato allergy revealed that gamma-irradiation did not affect the allergenicity of tomato proteins for up to 7 days after irradiation when the tomatoes were stored at 20 °C. Additionally, the m-RNA levels of β-fructofuranosidase, polygalacturonase, pectin esterase, and superoxide dismutase, the main allergenic proteins in tomato, were not affected by the applied irradiation dose. Thus, this study demonstrated that a 1.25 kGy dose of gamma-irradiation effectively eliminates L. monocytogenes on cherry tomatoes without affecting the expression of allergenic proteins in the fruits.
Energy Technology Data Exchange (ETDEWEB)
Todoriki, Setsuko [National Food Research Institute, Tsukuba, Ibaraki 305-8642 (Japan)], E-mail: setsuko@affrc.go.jp; Bari, Latiful; Kitta, Kazumi; Ohba, Mika; Ito, Yasuhiro; Tsujimoto, Yuka [National Food Research Institute, Tsukuba, Ibaraki 305-8642 (Japan); Kanamori, Norihito [Japan International Research Center for Agricultural Science, Tsukuba, Ibaraki 305-8686 (Japan); Yano, Erika; Moriyama, Tatsuya; Kawamura, Yukio [School of Agriculture, Kinki University, Nara-city, Nara 631-8505 (Japan); Kawamoto, Shinichi [National Food Research Institute, Tsukuba, Ibaraki 305-8642 (Japan)
2009-07-15
The presence of Listeria monocytogenes in fresh produce is a growing concern because of the possibility of food-borne illness. Ionizing radiation is an effective non-thermal means of eliminating pathogenic bacteria in fresh produce; however, the effect of ionizing irradiation on the allergenic properties of the host commodities remains unknown. This study aimed (i) to determine the effective dose of gamma-irradiation in eliminating L. monocytogenes on whole cherry tomatoes and (ii) to evaluate the effect of gamma-irradiation on the allergenic properties of tomato proteins. Cherry tomatoes that were inoculated with a mixture of five L. monocytogenes strains were treated with gamma-rays from a {sup 60}Co source. A 1.25 kGy dose of gamma-irradiation was found to be sufficient to eliminate L. monocytogenes on whole cherry tomatoes. The immunoblot profile of serum samples obtained from two patients with tomato allergy revealed that gamma-irradiation did not affect the allergenicity of tomato proteins for up to 7 days after irradiation when the tomatoes were stored at 20 deg. C. Additionally, the m-RNA levels of {beta}-fructofuranosidase, polygalacturonase, pectin esterase, and superoxide dismutase, the main allergenic proteins in tomato, were not affected by the applied irradiation dose. Thus, this study demonstrated that a 1.25 kGy dose of gamma-irradiation effectively eliminates L. monocytogenes on cherry tomatoes without affecting the expression of allergenic proteins in the fruits.
Overlevingsstrategieën Listeria monocytogenes bij lage temperatuur
Wemekamp-Kamphuis, H.H.; Abee, T.
2004-01-01
Listeria monocytogenes is an important food-borne pathogen that may cause severe infections in humans. Many outbreaks caused by this organism have been associated with ready-to-eat foods wich may have undergone some form of minimal processing, or have been contaminated after processing. Ready-to-eat
Incidence of Listeria monocytogenes and Other Bacteria in ...
African Journals Online (AJOL)
Prof. Ogunji
Abstract. The involvement of Listeria monocytogenes in spontaneous abortion in Jos was investigated. One hundred blood and 100 placenta samples were collected from spontaneous abortion patients in Jos. The samples were inoculated first into Listeria enrichment broth. Incubation was at 37o C, followed by cold ...
Hingston, Patricia; Chen, Jessica; Dhillon, Bhavjinder K.; Laing, Chad; Bertelli, Claire; Gannon, Victor; Tasara, Taurai; Allen, Kevin; Brinkman, Fiona S. L.; Truelstrup Hansen, Lisbeth; Wang, Siyun
2017-01-01
The human pathogen Listeria monocytogenes is a large concern in the food industry where its continuous detection in food products has caused a string of recalls in North America and Europe. Most recognized for its ability to grow in foods during refrigerated storage, L. monocytogenes can also tolerate several other food-related stresses with some strains possessing higher levels of tolerances than others. The objective of this study was to use a combination of phenotypic analyses and whole genome sequencing to elucidate potential relationships between L. monocytogenes genotypes and food-related stress tolerance phenotypes. To accomplish this, 166 L. monocytogenes isolates were sequenced and evaluated for their ability to grow in cold (4°C), salt (6% NaCl, 25°C), and acid (pH 5, 25°C) stress conditions as well as survive desiccation (33% RH, 20°C). The results revealed that the stress tolerance of L. monocytogenes is associated with serotype, clonal complex (CC), full length inlA profiles, and the presence of a plasmid which was identified in 55% of isolates. Isolates with full length inlA exhibited significantly (p monocytogenes sequence types, a new inlA PMSC, and several connections between CCs and the presence/absence or variations of specific genetic elements. A whole genome single-nucleotide-variants phylogeny revealed sporadic distribution of tolerant isolates and closely related sensitive and tolerant isolates, highlighting that minor genetic differences can influence the stress tolerance of L. monocytogenes. Specifically, a number of cold and desiccation sensitive isolates contained PMSCs in σB regulator genes (rsbS, rsbU, rsbV). Collectively, the results suggest that knowing the sequence type of an isolate in addition to screening for the presence of full-length inlA and a plasmid, could help food processors and food agency investigators determine why certain isolates might be persisting in a food processing environment. Additionally, increased
Crépet, Amélie; Albert, Isabelle; Dervin, Catherine; Carlin, Frédéric
2007-01-01
A normal distribution and a mixture model of two normal distributions in a Bayesian approach using prevalence and concentration data were used to establish the distribution of contamination of the food-borne pathogenic bacteria Listeria monocytogenes in unprocessed and minimally processed fresh vegetables. A total of 165 prevalence studies, including 15 studies with concentration data, were taken from the scientific literature and from technical reports and used for statistical analysis. The predicted mean of the normal distribution of the logarithms of viable L. monocytogenes per gram of fresh vegetables was −2.63 log viable L. monocytogenes organisms/g, and its standard deviation was 1.48 log viable L. monocytogenes organisms/g. These values were determined by considering one contaminated sample in prevalence studies in which samples are in fact negative. This deliberate overestimation is necessary to complete calculations. With the mixture model, the predicted mean of the distribution of the logarithm of viable L. monocytogenes per gram of fresh vegetables was −3.38 log viable L. monocytogenes organisms/g and its standard deviation was 1.46 log viable L. monocytogenes organisms/g. The probabilities of fresh unprocessed and minimally processed vegetables being contaminated with concentrations higher than 1, 2, and 3 log viable L. monocytogenes organisms/g were 1.44, 0.63, and 0.17%, respectively. Introducing a sensitivity rate of 80 or 95% in the mixture model had a small effect on the estimation of the contamination. In contrast, introducing a low sensitivity rate (40%) resulted in marked differences, especially for high percentiles. There was a significantly lower estimation of contamination in the papers and reports of 2000 to 2005 than in those of 1988 to 1999 and a lower estimation of contamination of leafy salads than that of sprouts and other vegetables. The interest of the mixture model for the estimation of microbial contamination is discussed. PMID
Survival of Listeria monocytogenes in Soil Requires AgrA-Mediated Regulation.
Vivant, Anne-Laure; Garmyn, Dominique; Gal, Laurent; Hartmann, Alain; Piveteau, Pascal
2015-08-01
In a recent paper, we demonstrated that inactivation of the Agr system affects the patterns of survival of Listeria monocytogenes (A.-L. Vivant, D. Garmyn, L. Gal, and P. Piveteau, Front Cell Infect Microbiol 4:160, http://dx.doi.org/10.3389/fcimb.2014.00160). In this study, we investigated whether the Agr-mediated response is triggered during adaptation in soil, and we compared survival patterns in a set of 10 soils. The fate of the parental strain L. monocytogenes L9 (a rifampin-resistant mutant of L. monocytogenes EGD-e) and that of a ΔagrA deletion mutant were compared in a collection of 10 soil microcosms. The ΔagrA mutant displayed significantly reduced survival in these biotic soil microcosms, and differential transcriptome analyses showed large alterations of the transcriptome when AgrA was not functional, while the variations in the transcriptomes between the wild type and the ΔagrA deletion mutant were modest under abiotic conditions. Indeed, in biotic soil environments, 578 protein-coding genes and an extensive repertoire of noncoding RNAs (ncRNAs) were differentially transcribed. The transcription of genes coding for proteins involved in cell envelope and cellular processes, including the phosphotransferase system and ABC transporters, and proteins involved in resistance to antimicrobial peptides was affected. Under sterilized soil conditions, the differences were limited to 86 genes and 29 ncRNAs. These results suggest that the response regulator AgrA of the Agr communication system plays important roles during the saprophytic life of L. monocytogenes in soil. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Uncovering Listeria monocytogenes hypervirulence by harnessing its biodiversity
Charlier, Caroline; Touchon, Marie; Chenal-Francisque, Viviane; Leclercq, Alexandre; Criscuolo, Alexis; Gaultier, Charlotte; Roussel, Sophie; Brisabois, Anne; Disson, Olivier; Rocha, Eduardo P. C.; Brisse, Sylvain; Lecuit, Marc
2016-01-01
Microbial pathogenesis studies are typically performed with reference strains, thereby overlooking microbial intra-species virulence heterogeneity. Here we integrated human epidemiological and clinical data with bacterial population genomics to harness the biodiversity of the model foodborne pathogen Listeria monocytogenes and decipher the basis of its neural and placental tropisms. Taking advantage of the clonal structure of this bacterial species, we identify clones epidemiologically associated with either food or human central nervous system (CNS) and maternal-neonatal (MN) listeriosis. The latter are also most prevalent in patients without immunosuppressive comorbidities. Strikingly, CNS and MN clones are hypervirulent in a humanized mouse model of listeriosis. By integrating epidemiological data and comparative genomics, we uncovered multiple novel putative virulence factors and demonstrated experimentally the contribution of the first gene cluster mediating Listeria monocytogenes neural and placental tropisms. This study illustrates the exceptional power of harnessing microbial biodiversity to identify clinically relevant microbial virulence attributes. PMID:26829754
Directory of Open Access Journals (Sweden)
Paolo Pellegrino
Full Text Available OBJECTIVE: To evaluate epidemiological features of post vaccine acute disseminated encephalomyelitis (ADEM by considering data from different pharmacovigilance surveillance systems. METHODS: The Vaccine Adverse Event Reporting System (VAERS database and the EudraVigilance post-authorisation module (EVPM were searched to identify post vaccine ADEM cases. Epidemiological features including sex and related vaccines were analysed. RESULTS: We retrieved 205 and 236 ADEM cases from the EVPM and VAERS databases, respectively, of which 404 were considered for epidemiological analysis following verification and causality assessment. Half of the patients had less than 18 years and with a slight male predominance. The time interval from vaccination to ADEM onset was 2-30 days in 61% of the cases. Vaccine against seasonal flu and human papilloma virus vaccine were those most frequently associated with ADEM, accounting for almost 30% of the total cases. Mean number of reports per year between 2005 and 2012 in VAERS database was 40±21.7, decreasing after 2010 mainly because of a reduction of reports associated with human papilloma virus and Diphtheria, Pertussis, Tetanus, Polio and Haemophilus Influentiae type B vaccines. CONCLUSIONS: This study has a high epidemiological power as it is based on information on adverse events having occurred in over one billion people. It suffers from lack of rigorous case verification due to the weakness intrinsic to the surveillance databases used. At variance with previous reports on a prevalence of ADEM in childhood we demonstrate that it may occur at any age when post vaccination. This study also shows that the diminishing trend in post vaccine ADEM reporting related to Diphtheria, Pertussis, Tetanus, Polio and Haemophilus Influentiae type B and human papilloma virus vaccine groups is most likely not [corrected] due to a decline in vaccine coverage indicative of a reduced attention to this adverse drug reaction.
Depletion of proton motive force by nisin in Listeria monocytogenes cells.
Bruno, M E; Kaiser, A; Montville, T J
1992-07-01
The basal proton motive force (PMF) levels and the influence of the bacteriocin nisin on the PMF were determined in Listeria monocytogenes Scott A. In the absence of nisin, the interconversion of the pH gradient (Z delta pH) and the membrane potential (delta psi) led to the maintenance of a fairly constant PMF at -160 mV over the external pH range 5.5 to 7.0. The addition of nisin at concentrations of greater than or equal to 5 micrograms/ml completely dissipated PMF in cells at external pH values of 5.5 and 7.0. With 1 microgram of nisin per ml, delta pH was completely dissipated but delta psi decreased only slightly. The action of nisin on PMF in L. monocytogenes Scott A was both time and concentration dependent. Valinomycin depleted only delta pH, whereas nigericin and carbonyl cyanide m-chlorophenylhydrazone depleted only delta psi, under conditions in which nisin depleted both. Four other L. monocytogenes strains had basal PMF parameters similar to those of strain Scott A. Nisin (2.5 micrograms/ml) also completely dissipated PMF in these strains.
Jiang, Xiaobing; Yu, Tao; Liang, Yu; Ji, Shengdong; Guo, Xiaowei; Ma, Jianmin; Zhou, Lijun
2016-01-18
In this study, efflux pump-mediated benzalkonium chloride (BC) resistance, including plasmid-encoded (Qac protein family and BcrABC) and chromosome-borne efflux pumps, was investigated in Listeria monocytogenes from retail food in China. Among the 59 L. monocytogenes strains, 13 (22.0%) strains were resistant to BC. The PCR results showed that bcrABC was harbored by 2 of 13 BC resistant strains. However, none of the qac genes were detected among the 59 strains. The bcrABC was absent in both of the plasmid cured strains, indicating that this BC resistance determinant was plasmid-encoded in the two bcrABC-positive strains. In the presence of reserpine, most of the bcrABC-negative strains had decreases in the MICs of BC, suggesting the existence of other efflux pumps and their role in BC resistance. After exposed to reserpine, the reduction in BC MICs was observed in the two cured strains, indicating that efflux pumps located on chromosome was also involved in BC resistance. Our findings suggest that food products may act as reservoirs for BC resistant isolates of L. monocytogenes and plasmid- and chromosome-encoded efflux pumps could mediate the BC resistance of L. monocytogenes, which is especially relevant to the adaption of this organism in food-related environments with frequent BC use. Copyright © 2015 Elsevier B.V. All rights reserved.
Modeling the effect of temperature on survival rate of Listeria monocytogenes in yogurt.
Szczawiński, J; Szczawińska, M E; Łobacz, A; Jackowska-Tracz, A
2016-01-01
The aim of the study was to (i) evaluate the behavior of Listeria monocytogenes in a commercially produced yogurt, (ii) determine the survival/inactivation rates of L. monocytogenes during cold storage of yogurt and (iii) to generate primary and secondary mathematical models to predict the behavior of these bacteria during storage at different temperatures. The samples of yogurt were inoculated with the mixture of three L. monocytogenes strains and stored at 3, 6, 9, 12 and 15°C for 16 days. The number of listeriae was determined after 0, 1, 2, 3, 5, 7, 9, 12, 14 and 16 days of storage. From each sample a series of decimal dilutions were prepared and plated onto ALOA agar (agar for Listeria according to Ottaviani and Agosti). It was found that applied temperature and storage time significantly influenced the survival rate of listeriae (pbacteria was found in the samples stored at 6°C (D-10 value = 243.9 h), whereas the highest reduction in the number of the bacteria was observed in the samples stored at 15°C (D-10 value = 87.0 h). The number of L. monocytogenes was correlated with the pH value of the samples (pyogurt stored under temperature range from 3 to 15°C, however, the polynomial model gave a better fit to the experimental data.
A Novel Virus-Like Particle Based Vaccine Platform Displaying the Placental Malaria Antigen VAR2CSA.
Directory of Open Access Journals (Sweden)
Susan Thrane
Full Text Available Placental malaria caused by Plasmodium falciparum is a major cause of mortality and severe morbidity. Clinical testing of a soluble protein-based vaccine containing the parasite ligand, VAR2CSA, has been initiated. VAR2CSA binds to the human receptor chondroitin sulphate A (CSA and is responsible for sequestration of Plasmodium falciparum infected erythrocytes in the placenta. It is imperative that a vaccine against malaria in pregnancy, if administered to women before they become pregnant, can induce a strong and long lasting immune response. While most soluble protein-based vaccines have failed during clinical testing, virus-like particle (VLP based vaccines (e.g., the licensed human papillomavirus vaccines have demonstrated high efficacy, suggesting that the spatial assembly of the vaccine antigen is a critical parameter for inducing an optimal long-lasting protective immune response. We have developed a VLP vaccine display platform by identifying regions of the HPV16 L1 coat protein where a biotin acceptor site (AviTagTM can be inserted without compromising VLP-assembly. Subsequent biotinylation of Avi-L1 VLPs allow us to anchor monovalent streptavidin (mSA-fused proteins to the biotin, thereby obtaining a dense and repetitive VLP-display of the vaccine antigen. The mSA-VAR2CSA antigen was delivered on the Avi-L1 VLP platform and tested in C57BL/6 mice in comparison to two soluble protein-based vaccines consisting of naked VAR2CSA and mSA-VAR2CSA. The mSA-VAR2CSA Avi-L1 VLP and soluble mSA-VAR2CSA vaccines induced higher antibody titers than the soluble naked VAR2CSA vaccine after three immunizations. The VAR2CSA Avi-L1 VLP vaccine induced statistically significantly higher endpoint titres compared to the soluble mSA-VAR2CSA vaccine, after 1st and 2nd immunization; however, this difference was not statistically significant after 3rd immunization. Importantly, the VLP-VAR2CSA induced antibodies were functional in inhibiting the binding of
DEFF Research Database (Denmark)
Hingston, Patricia A.; Chen, Jessica; Dhillon, Bhavjinder K
2017-01-01
elements. A whole genome single-nucleotide-variants phylogeny revealed sporadic distribution of tolerant isolates and closely related sensitive and tolerant isolates, highlighting that minor genetic differences can influence the stress tolerance of L. monocytogenes. Specifically, a number of cold......The human pathogen Listeria monocytogenes is a large concern in the food industry where its continuous detection in food products has caused a string of recalls in North America and Europe. Most recognized for its ability to grow in foods during refrigerated storage, L. monocytogenes can also...... tolerate several other food-related stresses with some strains possessing higher levels of tolerances than others. The objective of this study was to use a combination of phenotypic analyses and whole genome sequencing to elucidate potential relationships between L. monocytogenes genotypes and food...
Learning from Successful School-based Vaccination Clinics during 2009 pH1N1
Klaiman, Tamar; O'Connell, Katherine; Stoto, Michael A.
2014-01-01
Background: The 2009 H1N1 vaccination campaign was the largest in US history. State health departments received vaccines from the federal government and sent them to local health departments (LHDs) who were responsible for getting vaccines to the public. Many LHD's used school-based clinics to ensure children were the first to receive limited…
Investigation of Listeria monocytogenes transmission from environmental sources associated with pasture-raised chickens to poultry products is needed to determine ways to prevent potential foodborne illness. Here, we report the complete genome sequence of Listeria monocytogenes MR310, one of the iso...
Argov, Tal; Rabinovich, Lev; Sigal, Nadejda; Herskovits, Anat A
2017-03-15
Construction of Listeria monocytogenes mutants by allelic exchange has been laborious and time-consuming due to lack of proficient selection markers for the final recombination event, that is, a marker conveying substance sensitivity to the bacteria bearing it, enabling the exclusion of merodiploids and selection for plasmid loss. In order to address this issue, we engineered a counterselection marker based on a mutated phenylalanyl-tRNA synthetase gene ( pheS* ). This mutation renders the phenylalanine-binding site of the enzyme more promiscuous and allows the binding of the toxic p -chloro-phenylalanine analog ( p -Cl-phe) as a substrate. When pheS* is introduced into L. monocytogenes and highly expressed under control of a constitutively active promoter, the bacteria become sensitive to p -Cl-phe supplemented in the medium. This enabled us to utilize pheS* as a negative selection marker and generate a novel, efficient suicide vector for allelic exchange in L. monocytogenes We used this vector to investigate the monocin genomic region in L. monocytogenes strain 10403S by constructing deletion mutants of the region. We have found this region to be active and to cause bacterial lysis upon mitomycin C treatment. The future applications of such an effective counterselection system, which does not require any background genomic alterations, are vast, as it can be modularly used in various selection systems (e.g., genetic screens). We expect this counterselection marker to be a valuable genetic tool in research on L. monocytogenes IMPORTANCE L. monocytogenes is an opportunistic intracellular pathogen and a widely studied model organism. An efficient counterselection marker is a long-standing need in Listeria research for improving the ability to design and perform various genetic manipulations and screening systems for different purposes. We report the construction and utilization of an efficient suicide vector for allelic exchange which can be conjugated, leaves no
Muc1 based breast cancer vaccines: role of post translational modifications
International Nuclear Information System (INIS)
Begum, M.; Khurshid, R.; Nagra, S.A.
2008-01-01
Vaccine development is one of the most promising fields in cancer research. After autologous transplantation, due to low tumour burden, patients are more likely to respond immunologically to a cancer vaccine. MUC1 with its adhesive and anti adhesive functions, immunostimulatory and immunosuppressive activities, is therefore a good candidate for breast cancer vaccine. A structure-based insight into the immunogenicity of natural MUC1 glyco forms, of its sub-domains, motifs and post translational modification like glycosylation and myriostoylation may aid the design of tumour vaccines. Primary sequences of human MUC1 were retrieved from the SWISSPROT data bank. Protein pattern search: The primary sequence of Human MUC1 was searched at PROSITE (a dictionary of protein sites and patterns) database. Our study observes that post-translational modifications play an important role in presenting MUC1 as a candidate for breast cancer vaccine. It is found that the phosphorylation and glycosylation of important functional motifs of MUC1 may take part in the production of cytokines that may provide immunization. (author)
Knobler, Stacey; Bok, Karin; Gellin, Bruce
2017-01-20
SMART Vaccines 2.0 software is being developed to support decision-making among multiple stakeholders in the process of prioritizing investments to optimize the outcomes of vaccine development and deployment. Vaccines and associated vaccination programs are one of the most successful and effective public health interventions to prevent communicable diseases and vaccine researchers are continually working towards expanding targets for communicable and non-communicable diseases through preventive and therapeutic modes. A growing body of evidence on emerging vaccine technologies, trends in disease burden, costs associated with vaccine development and deployment, and benefits derived from disease prevention through vaccination and a range of other factors can inform decision-making and investment in new and improved vaccines and targeted utilization of already existing vaccines. Recognizing that an array of inputs influences these decisions, the strategic multi-attribute ranking method for vaccines (SMART Vaccines 2.0) is in development as a web-based tool-modified from a U.S. Institute of Medicine Committee effort (IOM, 2015)-to highlight data needs and create transparency to facilitate dialogue and information-sharing among decision-makers and to optimize the investment of resources leading to improved health outcomes. Current development efforts of the SMART Vaccines 2.0 framework seek to generate a weighted recommendation on vaccine development or vaccination priorities based on population, disease, economic, and vaccine-specific data in combination with individual preference and weights of user-selected attributes incorporating valuations of health, economics, demographics, public concern, scientific and business, programmatic, and political considerations. Further development of the design and utility of the tool is being carried out by the National Vaccine Program Office of the Department of Health and Human Services and the Fogarty International Center of the
Heir, Even; Møretrø, Trond; Simensen, Andreas; Langsrud, Solveig
2018-06-20
Interactions and competition between resident bacteria in food processing environments could affect their ability to survive, grow and persist in microhabitats and niches in the food industry. In this study, the competitive ability of L. monocytogenes strains grown together in separate culture mixes with other L. monocytogenes (L. mono mix), L. innocua (Listeria mix), Gram-negative bacteria (Gram- mix) and with a multigenera mix (Listeria + Gram- mix) was investigated in biofilms on stainless steel and in suspensions at 12 °C. The mixed cultures included resident bacteria from processing surfaces in meat and salmon industry represented by L. monocytogenes (n = 6), L. innocua (n = 5) and Gram-negative bacteria (n = 6; Acinetobacter sp., Pseudomonas fragi, Pseudomonas fluorescens, Serratia liquefaciens, Stenotrophomonas maltophilia). Despite hampered in growth in mixed cultures, L. monocytogenes established in biofilms with counts at day nine between 7.3 and 9.0 log per coupon with the lowest counts in the Listeria + G- mix that was dominated by Pseudomonas. Specific L. innocua inhibited growth of L. monocytogenes strains differently; inhibition that was further enhanced by the background Gram-negative microbiota. In these multispecies and multibacteria cultures, the growth competitive effects lead to the dominance of a strong competitor L. monocytogenes strain that was only slightly inhibited by L. innocua and showed strong competitive abilities in mixed cultures with resident Gram-negative bacteria. The results indicates complex patterns of bacterial interactions and L. monocytogenes inhibition in the multibacteria cultures that only partially depend on cell contact and likely involve various antagonistic and bacterial tolerance mechanisms. The study indicates large variations among L. monocytogenes in their competitiveness under multibacterial culture conditions that should be considered in further studies towards understanding of L
Using magnetic resonance imaging to evaluate dendritic cell-based vaccination.
Directory of Open Access Journals (Sweden)
Peter M Ferguson
Full Text Available Cancer immunotherapy with antigen-loaded dendritic cell-based vaccines can induce clinical responses in some patients, but further optimization is required to unlock the full potential of this strategy in the clinic. Optimization is dependent on being able to monitor the cellular events that take place once the dendritic cells have been injected in vivo, and to establish whether antigen-specific immune responses to the tumour have been induced. Here we describe the use of magnetic resonance imaging (MRI as a simple, non-invasive approach to evaluate vaccine success. By loading the dendritic cells with highly magnetic iron nanoparticles it is possible to assess whether the injected cells drain to the lymph nodes. It is also possible to establish whether an antigen-specific response is initiated by assessing migration of successive rounds of antigen-loaded dendritic cells; in the face of a successfully primed cytotoxic response, the bulk of antigen-loaded cells are eradicated on-route to the node, whereas cells without antigen can reach the node unchecked. It is also possible to verify the induction of a vaccine-induced response by simply monitoring increases in draining lymph node size as a consequence of vaccine-induced lymphocyte trapping, which is an antigen-specific response that becomes more pronounced with repeated vaccination. Overall, these MRI techniques can provide useful early feedback on vaccination strategies, and could also be used in decision making to select responders from non-responders early in therapy.
Kollipara, Avinash; Wan, Charles; Rawlinson, Galit; Brumm, Jacqui; Nilsson, Karen; Polkinghorne, Adam; Beagley, Kenneth; Timms, Peter
2013-02-06
Chlamydia continues to be a major pathogen of koalas. The bacterium is associated with ocular, respiratory and urogenital tract infections and a vaccine is considered the best option to limit the decline of mainland koala populations. Over the last 20 years, efforts to develop a chlamydial vaccine in humans have focussed on the use of the chlamydial major outer membrane protein (MOMP). Potential problems with the use of MOMP-based vaccines relate to the wide range of genetic diversity in its four variable domains. In the present study, we evaluated the immune response of koalas vaccinated with a MOMP-based C. pecorum vaccine formulated with genetically and serologically diverse MOMPs. Animals immunised with individual MOMPs developed strong antibody and lymphocyte proliferation responses to both homologous as well as heterologous MOMP proteins. Importantly, we also showed that vaccine induced antibodies which effectively neutralised various heterologous strains of koala C. pecorum in an in vitro assay. Finally, we also demonstrated that the immune responses in monovalent as well as polyvalent MOMP vaccine groups were able to recognise whole chlamydial elementary bodies, illustrating the feasibility of developing an effective MOMP based C. pecorum vaccine that could protect against a range of strains. Crown Copyright © 2013. Published by Elsevier Ltd. All rights reserved.
RNA-Based Vaccines in Cancer Immunotherapy
Directory of Open Access Journals (Sweden)
Megan A. McNamara
2015-01-01
Full Text Available RNA vaccines traditionally consist of messenger RNA synthesized by in vitro transcription using a bacteriophage RNA polymerase and template DNA that encodes the antigen(s of interest. Once administered and internalized by host cells, the mRNA transcripts are translated directly in the cytoplasm and then the resulting antigens are presented to antigen presenting cells to stimulate an immune response. Alternatively, dendritic cells can be loaded with either tumor associated antigen mRNA or total tumor RNA and delivered to the host to elicit a specific immune response. In this review, we will explain why RNA vaccines represent an attractive platform for cancer immunotherapy, discuss modifications to RNA structure that have been developed to optimize mRNA vaccine stability and translational efficiency, and describe strategies for nonviral delivery of mRNA vaccines, highlighting key preclinical and clinical data related to cancer immunotherapy.
Jahan, M; Holley, R A
2016-04-01
Listeria monocytogenes is an important foodborne pathogen that can cause infection in children, pregnant women, the immunocompromised and the elderly. Antibiotic resistance in this species would represent a significant public health problem since the organism has a high fatality/case ratio and resistance may contribute to failure of therapeutic treatment. This study was designed to explore whether the in vitro transferability of antibiotic resistance from enterococci to Listeria spp. could occur. It was found that 2/8 Listeria strains were able to acquire tetracycline resistance from Enterococcus faecium. Listeria monocytogenes GLM-2 acquired the resistance determinant tet(M) and additional streptomycin resistance through in vitro mating with Ent. faecium S27 isolated from commercial fermented dry sausage. Similarly, Listeria innocua became more resistant to tetracycline, but the genetic basis for this change was not confirmed. It has been suggested that enterococci may transfer antibiotic resistance genes via transposons to Listeria spp., and this may explain, in part, the origin of their antibiotic resistance. Thus, the presence of enterococci in food should not be ignored since they may actively contribute to enhanced antibiotic resistance of L. monocytogenes and other pathogens. Acquisition of antibiotic resistance by pathogenic bacteria in the absence of antibiotic pressure represents an unquantified threat to human health. In the present work resistance to tetracycline and streptomycin were transferred by nonplasmid-based conjugation from Enterococcus faecium isolated from fermented sausage to Listeria monocytogenes and Listeria innocua. Thus, natural transfer of antibiotic resistance to Listeria strains may occur in the future which reinforces the concern about the safety of enterococcal strains present in foods. © 2016 The Society for Applied Microbiology.
Pathogenic potential of Listeria monocytogenes isolated from cattle ...
African Journals Online (AJOL)
Listeria monocytogenes is an opportunistic food-borne pathogen causing listeriosis especially among immune-compromised persons. Its high rate of morbidity and mortality has classed the organism among the top watch list in foods. It is known to produce several virulence factors which aid its survival in harsh conditions ...
Incidence of Listeria monocytogenes and Other Bacteria in ...
African Journals Online (AJOL)
The involvement of Listeria monocytogenes in spontaneous abortion in Jos was investigated. One hundred blood and 100 placenta samples were collected from spontaneous abortion patients in Jos. The samples were inoculated first into Listeria enrichment broth. Incubation was at 37o C, followed by cold enrichment at ...
Prevalence and antibiotic susceptibility of Listeria monocytogenes in ...
African Journals Online (AJOL)
One hundred and ninety two raw milk samples were collected from lactating cows identified in Fulani herds and small scale dairy farms within Sokoto metropolis in order to investigate the presence and determine the antibiotic susceptibility of Listeria monocytogenes in the milk. Selective culture and identification method ...
Listeria monocytogenes meningitis in the Netherlands, 1985-2014: A nationwide surveillance study.
Koopmans, Merel M; Bijlsma, Merijn W; Brouwer, Matthijs C; van de Beek, Diederik; van der Ende, Arie
2017-07-01
Listeria monocytogenes can cause sepsis and meningitis. We report national surveillance data on L. monocytogenes meningitis in the Netherlands, describing incidence changes, genetic epidemiology and fatality rate. We analyzed data from the Netherlands Reference Laboratory of Bacterial Meningitis for cases of L. monocytogenes meningitis. Strains were assessed by serotyping and bacterial population structure by multi-locus sequence typing. A total of 375 cases of Listeria meningitis were identified between 1985 and 2014. Peak incidence rates were observed in neonates (0.61 per 100,000 live births) and older adults (peak at 87 year; 0.53 cases per 100,000 population of the same age). Neonatal listerial meningitis decreased 17-fold from 1.95 per 100,000 live births between 1985 and 1989, to 0.11 per 100,000 live births between 2010 and 2014. Overall case fatality rate was 31%, in a multivariate analysis older age and concomitant bacteremia were associated with mortality (both p listeria meningitis has remained high. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.
Rychli, Kathrin; Grunert, Tom; Ciolacu, Luminita; Zaiser, Andreas; Razzazi-Fazeli, Ebrahim; Schmitz-Esser, Stephan; Ehling-Schulz, Monika; Wagner, Martin
2016-02-02
The foodborne pathogen Listeria monocytogenes, responsible for listeriosis a rare but severe infection disease, can survive in the food processing environment for month or even years. So-called persistent L. monocytogenes strains greatly increase the risk of (re)contamination of food products, and are therefore a great challenge for food safety. However, our understanding of the mechanism underlying persistence is still fragmented. In this study we compared the exoproteome of three persistent strains with the reference strain EGDe under mild stress conditions using 2D differential gel electrophoresis. Principal component analysis including all differentially abundant protein spots showed that the exoproteome of strain EGDe (sequence type (ST) 35) is distinct from that of the persistent strain R479a (ST8) and the two closely related ST121 strains 4423 and 6179. Phylogenetic analyses based on multilocus ST genes showed similar grouping of the strains. Comparing the exoproteome of strain EGDe and the three persistent strains resulted in identification of 22 differentially expressed protein spots corresponding to 16 proteins. Six proteins were significantly increased in the persistent L. monocytogenes exoproteomes, among them proteins involved in alkaline stress response (e.g. the membrane anchored lipoprotein Lmo2637 and the NADPH dehydrogenase NamA). In parallel the persistent strains showed increased survival under alkaline stress, which is often provided during cleaning and disinfection in the food processing environments. In addition, gene expression of the proteins linked to stress response (Lmo2637, NamA, Fhs and QoxA) was higher in the persistent strain not only at 37 °C but also at 10 °C. Invasion efficiency of EGDe was higher in intestinal epithelial Caco2 and macrophage-like THP1 cells compared to the persistent strains. Concurrently we found higher expression of proteins involved in virulence in EGDe e.g. the actin-assembly-inducing protein ActA and the
Lessons from pandemic influenza A(H1N1): the research-based vaccine industry's perspective.
Abelin, Atika; Colegate, Tony; Gardner, Stephen; Hehme, Norbert; Palache, Abraham
2011-02-01
As A(H1N1) influenza enters the post-pandemic phase, health authorities around the world are reviewing the response to the pandemic. To ensure this process enhances future preparations, it is essential that perspectives are included from all relevant stakeholders, including vaccine manufacturers. This paper outlines the contribution of R&D-based influenza vaccine producers to the pandemic response, and explores lessons that can be learned to improve future preparedness. The emergence of 2009 A(H1N1) influenza led to unprecedented collaboration between global health authorities, scientists and manufacturers, resulting in the most comprehensive pandemic response ever undertaken, with a number of vaccines approved for use three months after the pandemic declaration. This response was only possible because of the extensive preparations undertaken during the last decade. During this period, manufacturers greatly increased influenza vaccine production capacity, and estimates suggest a further doubling of capacity by 2014. Producers also introduced cell-culture technology, while adjuvant and whole virion technologies significantly reduced pandemic vaccine antigen content. This substantially increased pandemic vaccine production capacity, which in July 2009 WHO estimated reached 4.9 billion doses per annum. Manufacturers also worked with health authorities to establish risk management plans for robust vaccine surveillance during the pandemic. Individual producers pledged significant donations of vaccine doses and tiered-pricing approaches for developing country supply. Based on the pandemic experience, a number of improvements would strengthen future preparedness. Technical improvements to rapidly select optimal vaccine viruses, and processes to speed up vaccine standardization, could accelerate and extend vaccine availability. Establishing vaccine supply agreements beforehand would avoid the need for complex discussions during a period of intense time pressure. Enhancing
Vilaplana, Cristina; Gil, Olga; Cáceres, Neus; Pinto, Sergio; Díaz, Jorge; Cardona, Pere-Joan
2011-01-01
The prophylactic capacity of the RUTI® vaccine, based on fragmented cells of Mycobacterium tuberculosis, has been evaluated in respect to aerosol challenge with virulent bacilli. Subcutaneous vaccination significantly reduced viable bacterial counts in both lungs and spleens of C57Bl mice, when challenged 4 weeks after vaccination. RUTI® protected the spleen less than BCG. Following a 9 month vaccination-challenge interval, protection was observed for the lungs, but not for the spleen. Survival of infected guinea pigs was prolonged by vaccination given 5 weeks before challenge. Inoculations of RUTI® shortly after infection significantly reduced the viable bacterial counts in the lungs, when compared with infected control mice. Thus, vaccination by RUTI® has potential for both the prophylaxis and immunotherapy of tuberculosis.
Listeria spp. E Listeria monocytogenes NA PRODUÇÃO DE SALSICHAS TIPO HOT DOG
Directory of Open Access Journals (Sweden)
ALESSANDRA PARO RODRIGUES CESAR
2011-06-01
Full Text Available Listeria monocytogenes is widely distributed in the environment and it has been isolated from food that were associated to outbreaks of high lethality in many countries. Thus, this bacterium represents an important pathogen to the public health. Ready-to-eat products, likecooked stuffed food, within them, frankfurters, are associated to human listeriosis in many countries. Taking into consideration the importance of the subject and the need of more data about it, the occurrence of Listeria spp. and L. monocytogenes in industrial plants, in meat raw materials, in slurry and frankfurters was investigated.These samples were collected in two production plants with SIF (Federal Inspection Service; in one of them GMP, HACCP and SOP were implemented. The results of the 1 06 microbiological analysis were submitted to the program @Risk to obtain the risk analysis; the meanvalues results showed that 7 to 9% of the frankfurters in the market may have L. monocytogenes. The analysis indicated that 88 strains of L. monocytogenes were obtained from 1 06 samples; among them, 76 werecollected in the industrial plants that participate in the experiment, and 30 were collected in the market. In serological typification, 95% of these strains were classified as serotypes 4b, 1 /2a and 1 /2b. Besides the presence of the bacterium in frankfurthers consumed inBrazil and the risk factors associated to this pathogen, the situation concerns because of the lack of epidemiological data, absence of patterns and the deficient information given to the consumer, specially information related to the presence of L. monocytogenes, particularly important to the groups at risk, as well as information related to the importance of heating the product
Ophorst, Olga J. A. E.; Radosevic, Katarina; Klap, Jaco M.; Sijtsma, Jeroen; Gillissen, Gert; Mintardjo, Ratna; van Ooij, Mark J. M.; Holterman, Lennart; Companjen, Arjen; Goudsmit, Jaap; Havenga, Menzo J. E.
2007-01-01
Previously, we have shown the potency of recombinant Adenovirus serotype 35 viral vaccines (rAd35) to induce strong immune response against the circumsporozoite protein (CS) of the plasmodium parasite. To further optimize immunogenicity of Ad35-based malaria vaccines we formulated rAd35.CS vaccine
An Adenoviral Vector Based Vaccine for Rhodococcus equi.
Directory of Open Access Journals (Sweden)
Carla Giles
Full Text Available Rhodococcus equi is a respiratory pathogen which primarily infects foals and is endemic on farms around the world with 50% mortality and 80% morbidity in affected foals. Unless detected early and treated appropriately the disease can be fatal. Currently, there is no vaccine available to prevent this disease. For decades researchers have endeavoured to develop an effective vaccine to no avail. In this study a novel human adenoviral vector vaccine for R. equi was developed and tested in the mouse model. This vaccine generated a strong antibody and cytokine response and clearance of R. equi was demonstrated following challenge. These results show that this vaccine could potentially be developed further for use as a vaccine to prevent R. equi disease in foals.
Typhoid fever vaccination strategies.
Date, Kashmira A; Bentsi-Enchill, Adwoa; Marks, Florian; Fox, Kimberley
2015-06-19
Typhoid vaccination is an important component of typhoid fever prevention and control, and is recommended for public health programmatic use in both endemic and outbreak settings. We reviewed experiences with various vaccination strategies using the currently available typhoid vaccines (injectable Vi polysaccharide vaccine [ViPS], oral Ty21a vaccine, and injectable typhoid conjugate vaccine [TCV]). We assessed the rationale, acceptability, effectiveness, impact and implementation lessons of these strategies to inform effective typhoid vaccination strategies for the future. Vaccination strategies were categorized by vaccine disease control strategy (preemptive use for endemic disease or to prevent an outbreak, and reactive use for outbreak control) and vaccine delivery strategy (community-based routine, community-based campaign and school-based). Almost all public health typhoid vaccination programs used ViPS vaccine and have been in countries of Asia, with one example in the Pacific and one experience using the Ty21a vaccine in South America. All vaccination strategies were found to be acceptable, feasible and effective in the settings evaluated; evidence of impact, where available, was strongest in endemic settings and in the short- to medium-term. Vaccination was cost-effective in high-incidence but not low-incidence settings. Experience in disaster and outbreak settings remains limited. TCVs have recently become available and none are WHO-prequalified yet; no program experience with TCVs was found in published literature. Despite the demonstrated success of several typhoid vaccination strategies, typhoid vaccines remain underused. Implementation lessons should be applied to design optimal vaccination strategies using TCVs which have several anticipated advantages, such as potential for use in infant immunization programs and longer duration of protection, over the ViPS and Ty21a vaccines for typhoid prevention and control. Copyright © 2015. Published by
Silva, A; Genovés, S; Martorell, P; Zanini, S F; Rodrigo, D; Martinez, A
2015-09-01
The aim of this study was to evaluate the effect of two antimicrobial substances, carvacrol and citral, on Listeria monocytogenes and Listeria innocua cells, as well as possible virulence changes in injured cells, using Caenorhabditis elegans as a model test. The results indicated that the percentage of sublethal damage was higher in L. monocytogenes than in L. innocua. The results of the study carried out by using C. elegans indicated that C. elegans fed in a lawn of L. monocytogenes previously treated with carvacrol showed a loss in life span (p ≤ 0.05) as compared with L. monocytogenes treated with citral, Escherichia coli OP50 as a negative control, and treated and untreated L. innocua. Egg laying was also affected: worms fed in a lawn of treated and untreated L. monocytogenes laid fewer eggs than those fed in a lawn of treated and untreated L. innocua or fed with OP50 as a negative control. Worms fed in a lawn of treated and untreated L. innocua also laid fewer eggs than those fed with OP50 as a negative control. A phenotype named bag of worms and an undescribed new one, "vulva inflammation", were also observed. Copyright © 2015 Elsevier Ltd. All rights reserved.
Jia, Qingmei; Horwitz, Marcus A.
2018-01-01
higher standard of having efficacy ≥LVS in the demanding mouse model of tularemia. These latter include LVS with deletions in purMCD, sodBFt, capB or wzy; LVS ΔcapB that also overexpresses Type VI Secretion System (T6SS) proteins; FSC200 with a deletion in clpB; the single deletional purMCD mutant of F. tularensis SCHU S4, and a heterologous prime-boost vaccine comprising LVS ΔcapB and Listeria monocytogenes expressing T6SS proteins. PMID:29868510
Directory of Open Access Journals (Sweden)
Rahul Subramanian
2016-12-01
Full Text Available Despite the availability of vaccines, influenza remains a major public health challenge. A key reason is the virus capacity for immune escape: ongoing evolution allows the continual circulation of seasonal influenza, while novel influenza viruses invade the human population to cause a pandemic every few decades. Current vaccines have to be updated continually to keep up to date with this antigenic change, but emerging 'universal' vaccines-targeting more conserved components of the influenza virus-offer the potential to act across all influenza A strains and subtypes. Influenza vaccination programmes around the world are steadily increasing in their population coverage. In future, how might intensive, routine immunization with novel vaccines compare against similar mass programmes utilizing conventional vaccines? Specifically, how might novel and conventional vaccines compare, in terms of cumulative incidence and rates of antigenic evolution of seasonal influenza? What are their potential implications for the impact of pandemic emergence? Here we present a new mathematical model, capturing both transmission dynamics and antigenic evolution of influenza in a simple framework, to explore these questions. We find that, even when matched by per-dose efficacy, universal vaccines could dampen population-level transmission over several seasons to a greater extent than conventional vaccines. Moreover, by lowering opportunities for cross-protective immunity in the population, conventional vaccines could allow the increased spread of a novel pandemic strain. Conversely, universal vaccines could mitigate both seasonal and pandemic spread. However, where it is not possible to maintain annual, intensive vaccination coverage, the duration and breadth of immunity raised by universal vaccines are critical determinants of their performance relative to conventional vaccines. In future, conventional and novel vaccines are likely to play complementary roles in
Shrestha, Sourya; Chihota, Violet; White, Richard G; Grant, Alison D; Churchyard, Gavin J; Dowdy, David W
2017-12-15
Optimizing the use of new tools, such as vaccines, may play a crucial role in reaching global targets for tuberculosis (TB) control. Some of the most promising candidate vaccines target adults, although high-coverage mass vaccinations may be logistically more challenging among this population than among children. Vaccine-delivery strategies that target high-risk groups or settings might yield proportionally greater impact than do those that target the general population. We developed an individual-based TB transmission model representing a hypothetical population consisting of people who worked in South African gold mines or lived in associated labor-sending communities. We simulated the implementation of a postinfection adult vaccine with 60% efficacy and a mean effect duration of 10 years. We then compared the impact of a mine-targeted vaccination strategy, in which miners were vaccinated while in the mines, with that of a community-targeted strategy, in which random individuals within the labor-sending communities were vaccinated. Mine-targeted vaccination averted an estimated 0.37 TB cases per vaccine dose compared with 0.25 for community-targeted vaccination, for a relative efficacy of 1.46 (95% range, 1.13-1.91). The added benefit of mine-targeted vaccination primarily reflected the disproportionate demographic burden of TB among the population of adult males as a whole. As novel vaccines for TB are developed, venue-based vaccine delivery that targets high-risk demographic groups may improve both vaccine feasibility and the impact on transmission. © The Author(s) 2017. Published by Oxford University Press on behalf of the Johns Hopkins Bloomberg School of Public Health. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Peptide Vaccines for Leishmaniasis
Directory of Open Access Journals (Sweden)
Rory C. F. De Brito
2018-05-01
Full Text Available Due to an increase in the incidence of leishmaniases worldwide, the development of new strategies such as prophylactic vaccines to prevent infection and decrease the disease have become a high priority. Classic vaccines against leishmaniases were based on live or attenuated parasites or their subunits. Nevertheless, the use of whole parasite or their subunits for vaccine production has numerous disadvantages. Therefore, the use of Leishmania peptides to design more specific vaccines against leishmaniases seems promising. Moreover, peptides have several benefits in comparison with other kinds of antigens, for instance, good stability, absence of potentially damaging materials, antigen low complexity, and low-cost to scale up. By contrast, peptides are poor immunogenic alone, and they need to be delivered correctly. In this context, several approaches described in this review are useful to solve these drawbacks. Approaches, such as, peptides in combination with potent adjuvants, cellular vaccinations, adenovirus, polyepitopes, or DNA vaccines have been used to develop peptide-based vaccines. Recent advancements in peptide vaccine design, chimeric, or polypeptide vaccines and nanovaccines based on particles attached or formulated with antigenic components or peptides have been increasingly employed to drive a specific immune response. In this review, we briefly summarize the old, current, and future stands on peptide-based vaccines, describing the disadvantages and benefits associated with them. We also propose possible approaches to overcome the related weaknesses of synthetic vaccines and suggest future guidelines for their development.
Peptide Vaccines for Leishmaniasis.
De Brito, Rory C F; Cardoso, Jamille M De O; Reis, Levi E S; Vieira, Joao F; Mathias, Fernando A S; Roatt, Bruno M; Aguiar-Soares, Rodrigo Dian D O; Ruiz, Jeronimo C; Resende, Daniela de M; Reis, Alexandre B
2018-01-01
Due to an increase in the incidence of leishmaniases worldwide, the development of new strategies such as prophylactic vaccines to prevent infection and decrease the disease have become a high priority. Classic vaccines against leishmaniases were based on live or attenuated parasites or their subunits. Nevertheless, the use of whole parasite or their subunits for vaccine production has numerous disadvantages. Therefore, the use of Leishmania peptides to design more specific vaccines against leishmaniases seems promising. Moreover, peptides have several benefits in comparison with other kinds of antigens, for instance, good stability, absence of potentially damaging materials, antigen low complexity, and low-cost to scale up. By contrast, peptides are poor immunogenic alone, and they need to be delivered correctly. In this context, several approaches described in this review are useful to solve these drawbacks. Approaches, such as, peptides in combination with potent adjuvants, cellular vaccinations, adenovirus, polyepitopes, or DNA vaccines have been used to develop peptide-based vaccines. Recent advancements in peptide vaccine design, chimeric, or polypeptide vaccines and nanovaccines based on particles attached or formulated with antigenic components or peptides have been increasingly employed to drive a specific immune response. In this review, we briefly summarize the old, current, and future stands on peptide-based vaccines, describing the disadvantages and benefits associated with them. We also propose possible approaches to overcome the related weaknesses of synthetic vaccines and suggest future guidelines for their development.
Kureljušić, J.; Rokvić, N.; Jezdimirović, N.; Kureljušić, B.; Pisinov, B.; Karabasil, N.
2017-09-01
Listeria is the genus of a bacteria found in soil and water and some animals, including poultry and cattle. It can be present in raw milk and food made from raw milk. It can also live in food processing plants and contaminate a variety of processed meats. Microscopically, Listeria species appear as small, Gram-positive rods, which are sometimes arranged in short chains. In direct smears, they can be coccoid, so they can be mistaken for streptococci. Longer cells can resemble corynebacteria. Flagella are produced at room temperature but not at 37°C. Haemolytic activity on blood agar has been used as a marker to distinguish Listeria monocytogenes among other Listeria species, but it is not an absolutely definitive criterion. Further biochemical characterization is necessary to distinguish between the different Listeria species. The objective of this study was to detect, isolate and identify Listeria monocytogenes from poultry meat. Within a period of six months from January to June 2017, a total of 15 samples were collected. Three samples were positive for the presence of Listeria monocytogenes. Biochemical and microbiological tests as well as PCR technique using specific primers were used to confirm L. Monocytogenes in the samples.
Directory of Open Access Journals (Sweden)
Luisa Zanolli Moreno
2014-01-01
Full Text Available In the last decade, atypical Listeria monocytogenes and L. innocua strains have been detected in food and the environment. Because of mutations in the major virulence genes, these strains have different virulence intensities in eukaryotic cells. In this study, we performed phenotypic and genotypic characterization of atypical L. monocytogenes and L. innocua isolates obtained from swine slaughterhouses and meat markets. Forty strains were studied, including isolates of L. monocytogenes and L. innocua with low-hemolytic activity. The isolates were characterized using conventional phenotypic Listeria identification tests and by the detection and analysis of L. monocytogenes-specific genes. Analysis of 16S rRNA was used for the molecular identification of the Listeria species. The L. monocytogenes isolates were positive for all of the virulence genes studied. The atypical L. innocua strains were positive for hly, plcA, and inlC. Mutations in the InlC, InlB, InlA, PI-PLC, PC-PLC, and PrfA proteins were detected in the atypical isolates. Further in vitro and transcriptomic studies are being developed to confirm the role of these mutations in Listeria virulence.
Directory of Open Access Journals (Sweden)
Ninoska eCordero
2016-03-01
Full Text Available Listeria monocytogenes has become one of the principal foodborne pathogens worldwide. The capacity of this bacterium to grow at low temperatures has opened an interesting field of study in terms of the identification and classification of new strains of L. monocytogenes with different growth capacities at low temperatures. We determined the growth rate at 8 ºC of 110 strains of L. monocytogenes isolated from different food matrices. We identified a group of slow and fast strains according to their growth rate at 8 °C and performed a global transcriptomic assay in strains previously adapted to low temperature. We then identified shared and specific transcriptional mechanisms, metabolic and cellular processes of both groups; bacterial motility was the principal process capable of differentiating the adaptation capacity of L. monocytogenes strains with different ranges of tolerance to low temperatures. Strains belonging to the fast group were less motile, which may allow these strains to achieve a greater rate of proliferation at low temperature.
Effects of irradiation on bacterial load and Listeria monocytogenes in raw chicken
International Nuclear Information System (INIS)
Varabioff, Y.; Mitchell, G.E.; Nottingham, S.M.
1992-01-01
After irradiation of chickens to a dose of 2.5 kGy, the decrease in the standard plate count (SPC) was similar in air and in vacuum-packaged chickens. During storage at 4 degrees C for 15 d, the SPC increased progressively in both types of packaged chickens. At the end of the storage period, the SPC was higher in air-packaged chicken than in vacuum-packaged chickens. In irradiated chickens, Listeria monocytogenes was only recovered from the vacuum-packaged chickens after 7 d cold storage. In unirradiated chickens, L. monocytogenes proliferated similarly in both air- and vacuum-packaged chickens
Effect of pulmonary irradiation from inhaled 90Y on immunity to Listeria monocytogenes in mice
International Nuclear Information System (INIS)
Sanchez, A.; Lundgren, D.L.; McClellan, R.O.
1976-01-01
The immunological response of mice subjected to irradiation from particles deposited in the lungs and challenged with Listeria monocytogenes was investigated. Mice, exposed by inhalation to 90 Y (a beta-emitting radionuclide) in relatively insoluble fused aluminosilicate particles, were immunized with L. monocytogenes either before or after exposure. Two additional groups of mice were either immunized or irradiated only. A group of control mice received no irradiation or immunization. The beta radiation dose absorbed by the lungs of each mouse at time of challenge averaged 10,000 rads. Fourteen days after immunization, all mice were challenged with 2 LD 50 doses of L. monocytogenes via the respiratory route. Survival of all immunized mice either with or without exposure to 90 Y varied from 90 to 100% as compared to 10 to 20% for the mice irradiated only and for control mice through 14 days after challenge. Pulmonary clearance of inhaled L. monocytogenes during the first 4 hr after challenge was suppressed in the mice irradiated only but not in those immunized only, or in the immunized and irradiated groups, and control mice. There appeared to be a suppression of proliferation of L. monocytogenes in lungs and spleen in the immunized groups 72 hr after challenge, whereas the lungs and spleens of the mice irradiated only and the control mice had extensive bacterial invasion. It was concluded that the 10,000 rads of beta radiation absorbed by the lungs did not suppress the immune mechanisms of the immunized mice
Vivant, Anne-Laure; Garmyn, Dominique; Maron, Pierre-Alain; Nowak, Virginie; Piveteau, Pascal
2013-01-01
Understanding the ecology of pathogenic organisms is important in order to monitor their transmission in the environment and the related health hazards. We investigated the relationship between soil microbial diversity and the barrier effect against Listeria monocytogenes invasion. By using a dilution-to-extinction approach, we analysed the consequence of eroding microbial diversity on L. monocytogenes population dynamics under standardised conditions of abiotic parameters and microbial abundance in soil microcosms. We demonstrated that highly diverse soil microbial communities act as a biological barrier against L. monocytogenes invasion and that phylogenetic composition of the community also has to be considered. This suggests that erosion of diversity may have damaging effects regarding circulation of pathogenic microorganisms in the environment.
Enterocin CRL35 inhibits Listeria monocytogenes in a murine model.
Salvucci, Emiliano; Saavedra, Lucila; Hebert, Elvira Maria; Haro, Cecilia; Sesma, Fernando
2012-01-01
Listeria monocytogenes is a foodborne pathogen causative of opportunistic infections. Listeriosis is associated with severe infections in pregnant women causing abortion or neonatal listeriosis. An alternative to antibiotics are safe novel bacteriocins peptides such as enterocin CRL35 with strong antilisterial activity produced by Enterococcus mundtii CRL35. In the present paper, our goal is to study the effectiveness of this peptide and the producer strain in a murine model of pregnancy-associated listeriosis. A single dose of 5×10(9) colony-forming unit of L. monocytogenes FBUNT (Faculty of Biochemistry-University of Tucumán) resulted in translocation of pathogen to liver and spleen of BALB/c pregnant mice. The maximum level of Listeria was observed on day 3 postinfection. Interestingly, the intragastric administration of enterocin CRL35 significantly reduced the translocation of the pathogen to vital organs. On the other hand, the preadministration of E. mundtii CRL35 slightly inhibited this translocation. Listeria infection caused a significant increase in polymorphonuclear leukocytes at day 3 postinfection compared to the noninfected group. This value was reduced after the administration of enterocin CRL35. No significant changes were observed in either white blood cells or lymphocytes counts. Based on the data presented in the present work enterocin CRL35 would be a promising alternative for the prevention of Listeria infections.
Biofilm formation by Listeria monocytogenes on stainless steel surface and biotransfer potential
Oliveira,Maíra Maciel Mattos de; Brugnera,Danilo Florisvaldo; Alves,Eduardo; Piccoli,Roberta Hilsdorf
2010-01-01
An experimental model was proposed to study biofilm formation by Listeria monocytogenes ATCC 19117 on AISI 304 (#4) stainless steel surface and biotransfer potential during this process. In this model, biofilm formation was conducted on the surface of stainless steel coupons, set on a stainless steel base with 4 divisions, each one supporting 21 coupons. Trypic Soy Broth was used as bacterial growth substrate, with incubation at 37 ?C and stirring of 50 rpm. The number of adhered cells was de...
Designing Peptide-Based HIV Vaccine for Chinese
Fan, Xiaojuan
2014-01-01
CD4+ T cells are central to the induction and maintenance of CD8+ T cell and antibody-producing B cell responses, and the latter are essential for the protection against disease in subjects with HIV infection. How to elicit HIV-specific CD4+ T cell responses in a given population using vaccines is one of the major areas of current HIV vaccine research. To design vaccine that targets specifically Chinese, we assembled a database that is comprised of sequences from 821 Chinese HIV isolates and 46 human leukocyte antigen (HLA) DR alleles identified in Chinese population. We then predicted 20 potential HIV epitopes using bioinformatics approaches. The combination of these 20 epitopes has a theoretical coverage of 98.1% of the population for both the prevalent HIV genotypes and also Chinese HLA-DR types. We suggest that testing this vaccine experimentally will facilitate the development of a CD4+ T cell vaccine especially catered for Chinese. PMID:25136573
Sant'Ana, Anderson S; Igarashi, Maria Crystina; Landgraf, Mariza; Destro, Maria Teresa; Franco, Bernadette D G M
2012-04-02
Listeria monocytogenes is a foodborne pathogen of great concern due to the high fatality rates of listeriosis. The consumption of RTE vegetables has increased in Brazil over the last two decades, but little is known about the risks associated to the consumption of these products. This study evaluated the prevalence and counts of L. monocytogenes in 512 packages of ready-to-eat vegetables marketed in São Paulo. The isolates were characterized for their serotypes, ribotypes, positivity for virulence genes inlA, inlC and inlJ, resistance to chlorine, growth rate variability and capability to form biofilm on stainless steel (AISI 304, #4) coupons. L. monocytogenes was detected in 3.1% of the samples. Only five samples presented countable levels, with counts between 1.0×10(1) and 2.6×10(2)CFU/g. Isolates belonged to serotypes 1/2b or 4b and most were positive for genes inlC and inlJ. Ribotypable isolates were grouped into four groups: 1038 (69.4%), 19175 (11.3%), 19191 (17.7%) and 18604 (one isolate). Most isolates survived to exposure to 125 ppm of a chlorine-based disinfectant for 3 min. All isolates were capable to attach to the coupons, reaching counts above 4 log(10) CFU/cm(2) and the growth rate (μ) at 25°C of the majority of the isolates varied between 0.1 and 0.2 log OD/h, but for few strains the μ was as high as 0.26 log OD/h. Results of this survey indicate that RTE vegetables may be vehicles of L. monocytogenes strains with limited variation in serotype, ribotype and virulence factors but varying significantly in resistance to chlorine disinfectants, capability of forming biofilm and growth rate. Data obtained is of foremost importance to serve as baseline for the development of scientific-based policies to control the incidence of L. monocytogenes in RTE vegetables in Brazil. Copyright © 2012 Elsevier B.V. All rights reserved.
Ma, Ji-Hong; Yang, Fu-Ru; Yu, Hai; Zhou, Yan-Jun; Li, Guo-Xin; Huang, Meng; Wen, Feng; Tong, Guangzhi
2013-07-09
Vaccination is considered as the most effective preventive method to control influenza. The hallmark of influenza virus is the remarkable variability of its major surface glycoproteins, HA and NA, which allows the virus to evade existing anti-influenza immunity in the target population. So it is necessary to develop a novel vaccine to control animal influenza virus. Also we know that the ectodomain of influenza matrix protein 2 (M2e) is highly conserved in animal influenza A viruses, so a vaccine based on the M2e could avoid several drawbacks of the traditional vaccines. In this study we designed a novel tetra-branched multiple antigenic peptide (MAP) based vaccine, which was constructed by fusing four copies of M2e to one copy of foreign T helper (Th) cell epitope, and then investigated its immune responses. Our results show that the M2e-MAP induced strong M2e-specific IgG antibody,which responses following 2 doses immunization in the presence of Freunds' adjuvant. M2e-MAP vaccination limited viral replication substantially. Also it could attenuate histopathological damage in the lungs of challenged mice and counteracted weight loss. M2e-MAP-based vaccine protected immunized mice against the lethal challenge with PR8 virus. Based on these findings, M2e-MAP-based vaccine seemed to provide useful information for the research of M2e-based influenza vaccine. Also it show huge potential to study vaccines for other similarly viruses.
Making evidence-based selections of influenza vaccines
Childress, Billy-Clyde; Montney, Joshua D; Albro, Elise A
2014-01-01
Years ago, intramuscular influenza vaccines were the only option for those who wanted to arm themselves against the flu. Today there are alternatives, including intradermal injections and intranasal sprays. In order to select the right influenza vaccine for their patients, pharmacists, and other healthcare professionals must have a basic understanding of the immune system. Influenza vaccines elicit different levels of immune response involving innate and adaptive immunity, which are critical ...
Effect of School-based Human Papillomavirus (HPV) Vaccination on ...
African Journals Online (AJOL)
AJRH Managing Editor
assessed girls' knowledge of cervical cancer and HPV vaccine, and their acceptance of future vaccination of ... studies involve parents and young adults. The ... vaccine was delivered during the routine Child ... and attitudes about the vaccine.
Liu, Z; Meng, R; Zhao, X; Shi, C; Zhang, X; Zhang, Y; Guo, N
2016-12-01
Listeria monocytogenes (L. monocytogenes) is a Gram-positive bacterium that causes infections in humans. In this study, the effects of tea tree oil (TTO) at subinhibitory concentrations on L. monocytogenes growth and two important exotoxin proteins secreted by L. monocytogenes were researched. Treatment with half of minimal inhibitory concentration of TTO demonstrated very little or no reduction in numbers of viable ATCC 19115 cells. Listeriolysin O (LLO) and p60, were investigated. A listeriolysin assay was used to investigate the hemolytic activities of L. monocytogenes exposed to TTO, and the secretion of LLO and p60 was detected by immunoblot analysis. Additionally, real-time RT-PCR was used to analyse the influence of TTO on the transcription of LLO and p60 encoded genes hly and iap respectively. According to our experimental results, we propose that TTO could be used as a promising natural compound against L. monocytogenes and its virulence factors. This is the first report on the influence of subinhibitory concentrations of tea tree oil (TTO) on the secretion of listeriolysin O (LLO) and p60, the critical virulence factors involved in Listeria pathogenesis. The results showed that TTO at 0·25 mg ml -1 reduced the secretion of LLO and p60 to 10 and 34·9% respectively, in addtion, the transcription of hly and iap was reduced to 10 and 4·3% at 0·5 mg ml -1 respectively. We propose that TTO could be used as a promising antimicrobial compound and virulence inhibitor against L. monocytogenes. © 2016 The Society for Applied Microbiology.
Vaccination strategies for future influenza pandemics: a severity-based cost effectiveness analysis.
Kelso, Joel K; Halder, Nilimesh; Milne, George J
2013-02-11
A critical issue in planning pandemic influenza mitigation strategies is the delay between the arrival of the pandemic in a community and the availability of an effective vaccine. The likely scenario, born out in the 2009 pandemic, is that a newly emerged influenza pandemic will have spread to most parts of the world before a vaccine matched to the pandemic strain is produced. For a severe pandemic, additional rapidly activated intervention measures will be required if high mortality rates are to be avoided. A simulation modelling study was conducted to examine the effectiveness and cost effectiveness of plausible combinations of social distancing, antiviral and vaccination interventions, assuming a delay of 6-months between arrival of an influenza pandemic and first availability of a vaccine. Three different pandemic scenarios were examined; mild, moderate and extreme, based on estimates of transmissibility and pathogenicity of the 2009, 1957 and 1918 influenza pandemics respectively. A range of different durations of social distancing were examined, and the sensitivity of the results to variation in the vaccination delay, ranging from 2 to 6 months, was analysed. Vaccination-only strategies were not cost effective for any pandemic scenario, saving few lives and incurring substantial vaccination costs. Vaccination coupled with long duration social distancing, antiviral treatment and antiviral prophylaxis was cost effective for moderate pandemics and extreme pandemics, where it saved lives while simultaneously reducing the total pandemic cost. Combined social distancing and antiviral interventions without vaccination were significantly less effective, since without vaccination a resurgence in case numbers occurred as soon as social distancing interventions were relaxed. When social distancing interventions were continued until at least the start of the vaccination campaign, attack rates and total costs were significantly lower, and increased rates of vaccination
Hansen, Caitlin E; Okoloko, Edirin; Ogunbajo, Adedotun; North, Anna; Niccolai, Linda M
2017-09-01
Countries with high human papillomavirus (HPV) vaccination rates have achieved this success largely through school-based vaccination. Using school-based health centers (SBHCs) in the United States, where HPV vaccine remains underutilized, could improve uptake. In this mixed-methods study, we examined acceptability, facilitators, and barriers of HPV vaccination visits at SBHCs from the perspectives of adolescents and parents. We conducted qualitative interviews and structured surveys with adolescents and parents recruited from an urban, hospital-based clinic. Interviews with parents (N = 20) and adolescents (N = 20) were audio-recorded and transcribed for analysis using an iterative thematic approach. Quantitative measures for a survey administered to parents (N = 131) were derived from the qualitative findings. Survey results were analyzed by chi-square tests. Many participants expressed favorable opinions of HPV vaccination at SBHCs in qualitative interviews. Facilitators included convenience, ease of scheduling, and not missing work or school. However, barriers were noted including concerns about obtaining care outside the medical home, fragmentation of medical records, and negative perceptions about SBHCs. Quantitative findings revealed that a higher proportion of parents with experience using SBHCs were willing to use a middle school (59.5%) or high school (80.5%) SBHC for HPV vaccinations compared with those who had not used SBHCs (p HPV vaccination visits at SBHCs were acceptable, and SBHC users expressed more favorable attitudes. Barriers to HPV vaccination at SBHCs can be addressed through more education about SBHCs' role, and improvement of systems to coordinate care. © 2017, American School Health Association.
6-O-Branched Oligo-β-glucan-Based Antifungal Glycoconjugate Vaccines.
Liao, Guochao; Zhou, Zhifang; Liao, Jun; Zu, Luning; Wu, Qiuye; Guo, Zhongwu
2016-02-12
With the rapid growth in fungal infections and drug-resistant fungal strains, antifungal vaccines have become an especially attractive strategy to tackle this important health problem. β-Glucans, a class of extracellular carbohydrate antigens abundantly and consistently expressed on fungal cell surfaces, are intriguing epitopes for antifungal vaccine development. β-Glucans have a conserved β-1,3-glucan backbone with sporadic β-1,3- or β-1,6-linked short glucans as branches at the 6-O-positions, and the branches may play a critical role in their immunologic functions. To study the immunologic properties of branched β-glucans and develop β-glucan-based antifungal vaccines, three branched β-glucan oligosaccharides with 6-O-linked β-1,6-tetraglucose, β-1,3-diglucose, and β-1,3-tetraglucose branches on a β-1,3-nonaglucan backbone, which mimic the structural epitopes of natural β-glucans, were synthesized and coupled with keyhole limpet hemocyanin (KLH) to form novel synthetic conjugate vaccines. These glycoconjugates were proved to elicit strong IgG antibody responses in mice. It was also discovered that the number, size, and structure of branches linked to the β-glucan backbone had a significant impact on the immunologic property. Moreover, antibodies induced by the synthetic oligosaccharide-KLH conjugates were able to recognize and bind to natural β-glucans and fungal cells. Most importantly, these conjugates elicited effective protection against systemic Candida albicans infection in mice. Thus, branched oligo-β-glucans were identified as functional epitopes for antifungal vaccine design and the corresponding protein conjugates as promising antifungal vaccine candidates.
Mitchell, Gabriel
2017-01-01
Listeria monocytogenes causes listeriosis, a foodborne disease that poses serious risks to fetuses, newborns and immunocompromised adults. This intracellular bacterial pathogen proliferates in the host cytosol and exploits the host actin polymerization machinery to spread from cell-to-cell and disseminate in the host. Here, we report that during several days of infection in human hepatocytes or trophoblast cells, L. monocytogenes switches from this active motile lifestyle to a stage of persistence in vacuoles. Upon intercellular spread, bacteria gradually stopped producing the actin-nucleating protein ActA and became trapped in lysosome-like vacuoles termed Listeria-Containing Vacuoles (LisCVs). Subpopulations of bacteria resisted degradation in LisCVs and entered a slow/non-replicative state. During the subculture of host cells harboring LisCVs, bacteria showed a capacity to cycle between the vacuolar and the actin-based motility stages. When ActA was absent, such as in ΔactA mutants, vacuolar bacteria parasitized host cells in the so-called “viable but non-culturable” state (VBNC), preventing their detection by conventional colony counting methods. The exposure of infected cells to high doses of gentamicin did not trigger the formation of LisCVs, but selected for vacuolar and VBNC bacteria. Together, these results reveal the ability of L. monocytogenes to enter a persistent state in a subset of epithelial cells, which may favor the asymptomatic carriage of this pathogen, lengthen the incubation period of listeriosis, and promote bacterial survival during antibiotic therapy. PMID:29190284
School-based human papillomavirus vaccination: An opportunity to ...
African Journals Online (AJOL)
cational drive to improve knowledge and screening of mothers can be successful ... invited to sign consent and assent for the girl child to be vaccinated, and all mothers were .... view of the positive attitudes towards vaccines in general, vaccine.
DEFF Research Database (Denmark)
Burgdorf, Stefan; Claesson, Mogens; Nielsen, Hans
2009-01-01
Introduction. Immunotherapy based on dendritic cell vaccination has exciting perspectives for treatment of cancer. In order to clarify immunological mechanisms during vaccination it is essential with intensive monitoring of the responses. This may lead to optimization of treatment and prediction......-inflammatory cytokines in serum of patients who achieved stable disease following vaccination suggest the occurrence of vaccine-induced Th1 responses. Since Th1 responses seem to be essential in cancer immunotherapy this may indicate a therapeutic potential of the vaccine....... of responding patients. The aim of this study was to evaluate cytokine and biomarker responses in patients with colorectal cancer treated with a cancer vaccine based on dendritic cells pulsed with an allogeneic melanoma cell lysate. Material and methods. Plasma and serum samples were collected prior...
Directory of Open Access Journals (Sweden)
Romain Paillot
2016-11-01
Full Text Available Vaccination is highly effective to prevent, control, and limit the impact of equine influenza (EI, a major respiratory disease of horses. However, EI vaccines should contain relevant equine influenza virus (EIV strains for optimal protection. The OIE expert surveillance panel annually reviews EIV evolution and, since 2010, the use of Florida clade 1 and 2 sub-lineages representative vaccine strains is recommended. This report summarises the development process of a fully- updated recombinant canarypox-based EI vaccine in order to meet the last OIE recommendations, including the vaccine mode of action, production steps and schedule. The EI vaccine ProteqFlu contains 2 recombinant canarypox viruses expressing the haemagglutinin of the A/equine/Ohio/03 and A/equine/Richmond/1/07 isolates (Florida clade 1 and 2 sub-lineages, respectively. The updated EI vaccine was tested for efficacy against the representative Florida clade 2 EIV strain A/equine/Richmond/1/07 in the Welsh mountain pony model. Protective antibody response, clinical signs of disease and virus shedding were compared with unvaccinated control ponies. Significant protection was measured in vaccinated ponies, which supports the vaccine registration. The recombinant canarypox-based EI vaccine was the first fully updated EI vaccine available in the EU, which will help to minimise the increasing risk of vaccine breakdown due to constant EIV evolution through antigenic drift.
Chen, Jianshun; Fang, Chun; Zheng, Tianlun; Zhu, Ningyu; Bei, Yijiang; Fang, Weihuan
2012-02-01
The ability to survive and proliferate in acidic environments is a prerequisite for the infection of Listeria monocytogenes. The glutamate decarboxylase (GAD) system is responsible for acid resistance, and three GAD homologs have been identified in L. monocytogenes: gadD1, gadD2, and gadD3. To examine whether GAD genes are specific to lineage, serovar, or certain subpopulation, we performed a systematic investigation on the prevalence of GAD genes in 164 L. monocytogenes. In contrast to gadD2 and gadD3 conserved in all L. monocytogenes strains, gadD1 was identified in 36.6% (60/164) of L. monocytogenes strains, including all serovar 1/2c and 68.5% (37/54) of serovar 1/2a strains, as well as a small fraction of serovar 1/2b (3.4%, 1/29) and lineage III (13.8%, 4/29) strains. All serovar 4b and lineage IV strains lacked this gene. According to the ascB-dapE structure, L. monocytogenes strains were classified into four subpopulations, carrying inlC2DE, inlGC2DE, inlGHE, or no internalin cluster, respectively. All L. monocytogenes strains with inlGC2DE or inlGHE pattern harbored gadD1, whereas those bearing inlC2DE or no internalin cluster between ascB and dapE lacked gadD1. In addition, other five non-monocytogenes Listeria species lacking ascB-dapE internalin cluster were gadD1-negative. Overall, the presence of gadD1 is not fully dependent on lineages or serovars but correlates with ascB-dapE internalin profiles, suggesting gadD1 might have co-evolved with the ascB-dapE internalin cluster in the primitive L. monocytogenes before divergence of serovars.
Pricope-Ciolacu, Luminita; Nicolau, Anca Ioana; Wagner, Martin; Rychli, Kathrin
2013-08-16
Nearly all cases of human listeriosis have been associated with consumption of contaminated food, therefore the investigation of the virulence of Listeria (L.) monocytogenes after exposure to environmental conditions in food matrices is critical in order to understand and control its impact on public health. As milk and dairy products have been implicated in more than half of the listeriosis outbreaks, we investigated the in vitro virulence of L. monocytogenes incubated in different milk types at various storage conditions. Incubation in pasteurized milk at refrigeration conditions (4°C) revealed a higher invasion and intracellular proliferation of four different L. monocytogenes strains compared to raw milk using human intestinal epithelial Caco-2 cells. Furthermore the period of storage, which increased L. monocytogenes cell numbers, decreased in vitro virulence. However, L. monocytogenes stored for 3weeks at 4°C in milk are still able to invade and proliferate into the host cell. Interestingly abused storage temperatures (25°C and 30°C) for a short time period (2h) revealed an attenuated impact on the in vitro virulence of L. monocytogenes compared to the storage temperature of 4°C. Regarding the major milk compounds, the level of milk fat significantly affected the in vitro virulence of L. monocytogenes. Pre-incubation in milk with high fat content (3.6%) resulted in a lower invasion capability compared to milk with low fat content. In contrast casein and lactose did not influence the invasiveness of L. monocytogenes into the host cell. In conclusion our study shows that the milk environment and different storage conditions influence the in vitro virulence of L. monocytogenes, both of which have to be considered in the risk assessment of contaminated food. Copyright © 2013 Elsevier B.V. All rights reserved.